Патенты автора Кощаев Андрей Георгиевич (RU)

Изобретение относится к области биотехнологии. Изобретение представляет собой способ идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах, включающий выделение ДНК из баранины (Ovis) и говядины (Bos) сорбционным методом, постановку одноэтапной полимеразной цепной реакции, проведение 45 циклов амплификации с детекцией в реальном времени с использованием специфичных для участка генома ДНК баранины (Ovis) и говядины (Bos) олигонуклеотидных праймеров, зондов, красителей, внутреннего контрольного образца в виде суспензии бактериофага и положительных контрольных образцов - содержащих фрагменты геномов ДНК баранины (Ovis) и говядины (Bos), измерение специфических сигналов и сигнала контролей и интерпретацию результатов, где дополнительно исследуют продовольственное сырье и пищевые продукты, содержащие ДНК баранины (Ovis) и говядины (Bos), проводят полимеразную цепную реакцию с флуоресцентной детекцией с применением термоциклера типа Rotor-Gene Q и измеряют накопление флуоресцентных сигналов по каналам соответствующих флуоресцентных красителей: JOE/Yellow для специфического сигнала для баранины (Ovis); ROX/Orange - для говядины (Bos) и Cy5/Red - для внутреннего контрольного образца, интерпретацию результатов проводят на основании наличия или отсутствия пересечения кривой флуоресценции с пороговой линией, если кривые накопления флуоресцентного сигнала выходят до 35 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 35 цикла, то результат реакции - отрицательный, при этом для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца - смесь содержащую фрагменты геномов баранины (Ovis), говядины (Bos) и бактериофага Т4 взятых в соотношении 1:1:1 со следующими нуклеотидными последовательностями:Ovis F GCCTCATCTCCCTCCAACAG прямой праймерOvis R CGGAAGCCTGTAATTACAGCTC обратный праймерOvis P R6G-CTCATGTCTGTCCTTTGGTGTTATGAATGC-BHQ1 зондBos F AACAGCATCATTCTACCCACTT прямой праймерBos R ACCTAAATTCCTATTCTAACACTG обратный праймерBos P ROX-ACGACTTACATACTCCACTGCACTCACG-BHQ2 зондT4F TACATATAAATCACGCAAAGCT4R TAGTATGGCTAATCTTATTGGT4P CY5 ACATTGGCACTGACCGAGTTC.Изобретение позволяет повысить точность идентификации видовой принадлежности говядины или баранины. 5 ил., 5 табл.

Изобретение относится к области биотехнологии. Для повышение точности диагностики тест-система для выявления РНК вируса болезни Шмалленберга у сельскохозяйственных животных включает буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящую из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов, специфичных для возбудителя вируса болезни Шмалленберга и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE; буфер для разведения РНК, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, согласно изобретению для внутреннего контрольного образца используют суспензию бактериофага MS2 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя вируса Шмалленберга и фрагмент генома бактериофага MS2, взятых в соотношении 1:1 со следующими нуклеотидными последовательностями: Изобретение позволяет повысить точность диагностики болезни Шмалленберга у сельскохозяйственных животных. 3 ил., 4 табл.

Изобретение относится к области биотехнологии. Описан способ выявления генома возбудителя коронавирусной инфекции у крупного рогатого скота. Способ включает в себя выделение РНК из биологического материала в виде экстракта фекалий или фрагментов органов брюшной полости сорбционным методом, синтез кДНК на матрице РНК путем постановки одноэтапной с добавлением внутреннего и положительного контрольных образцов мультиплексной реакции обратной транскрипции и полимеразной цепной реакции - с проведением 45 циклов амплификации с детекцией в реальном времени с использованием специфичных для участка генома вирусного возбудителя олигонуклеотидных праймеров флуоресцентно-меченного зонда. Фрагмент генома возбудителя короновирусной инфекции имеет следующие нуклеотидные последовательности: BCoVF 5'-GATCAAATTGCTAGT-3' - прямой праймер; BCoVR 5'-CAGTCTGCTTAGTTA-3' - обратный праймер; BCoVP 5'-FAM-GGATGCCACTAAGCCA-3'-BHQ1 – зонд. Изобретение расширяет арсенал способов диагностики короновирусной инфекции у крупного рогатого скота. 4 табл., 1 пр.

Изобретение относится к области биотехнологии. Описана тест-система для обнаружения генома возбудителя ротовируса типа А у сельскохозяйственных животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени. Тест-система включает в себя буфер для проведения полимеразной цепной реакции, смесь для ее проведения, состоящую из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов, специфичных для ротавируса А, смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE и обратной транскриптазы MMLV REVERSE TRANSCRIPTASE. Смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса RVA и фрагмент генома бактериофага MS2, содержит следующие нуклеотидные последовательности:RVF5 5'-ATTTCAGTTGATGAGACCA-3'; прямой праймер;RVR6 5'-CAATTCTAAGCGTGAGTCC-3' обратный праймер;зонд RVP FAM - 5'-AATATGACACCAGCGGTA-3' - BHQ1,MS2F, 5'-TGGCACTACCCCTCTCCGTATTCAC-3' - прямой праймер;MS2R, 5'-GTACGGGCGACCCCACGATGAC-3' - обратный праймер;зонд MS2P, Су5 5'-CACATCGATAGATCAAGGTGCCTACAAGC-3' BHQ2.Изобретение расширяет арсенал средств для обнаружения генома возбудителя ротовируса типа А у сельскохозяйственных животных. 4 табл., 1 пр.

Изобретение относится к области биотехнологии. Описана тест-система для обнаружения генома возбудителя коронавирусной инфекции у крупного рогатого скота при помощи мультиплексной полимеразной цепной реакции (ПЦР) с флуоресцентной детекцией в реальном времени. Тест–система включает буфер для проведения ПЦР, смесь для ее проведения, состоящая из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов, специфичных для коронавируса А и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE и обратной транскриптазы MMLV REVERSE TRANSCRIPTASE. Смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса BCoV и фрагмент генома бактериофага MS2 содержит следующие нуклеотидные последовательности: BCoVF 5'-GATCAAATTGCTAGT-3' - прямой праймер; BCoVR 5'-CAGTCTGCTTAGTTA-3' - обратный праймер; BCoVP 5'-FAM-GGATGCCACTAAGCCA-3' - BHQ1 – зонд; MS2F 5'-TGGCACTACCCCTCTCCGTATTCAC-3' - прямой праймер; MS2R, 5'-GTACGGGCGACCCCACGATGAC-3' - обратный праймер; MS2P Су5 5'-CACATCGATAGATCAAGGTGCCTACAAGC-3 BHQ' - зонд. Изобретение расширяет арсенал средств для обнаружения генома коронавирусной инфекции у крупного рогатого скота. 4 табл., 1 пр.

Изобретение относится к области биотехнологии и ветеринарной вирусологии. Предложен способ выявления генома возбудителя ротавируса типа А у сельскохозяйственных животных. Выделяют РНК из биологического материала от инфицированных животных сорбционным методом. Затем синтезируют кДНК на матрице РНК путем постановки одноэтапной с добавлением внутреннего положительного контроля мультиплексной реакции обратной транскрипции и полимеразной цепной реакции - с проведением 45 циклов амплификации с детекцией в реальном времени с использованием специфичных для участка генома ротавируса типа А олигонуклеотидных праймеров, флуоресцентно-меченного зонда и контрольных образцов. Затем измеряют накопление флуоресцентного сигнала по каналам соответствующих флуоресцентных красителей и интерпретируют результаты на основании наличия/отсутствия пересечения кривой флуоресценции с пороговой линией (Threshold). Для внутреннего контрольного образца используют суспензию бактериофага MS2, а для положительного контрольного образца - смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса RVA и фрагмент генома бактериофага MS2. Изобретение позволяет получить достоверную диагностику ротавирусной инфекции типа А у животных. 4 табл.

Изобретение относится к сельскому хозяйству, в частности к птицеводству, а конкретно к способу выращивания перепелов. Способ выращивания перепелов включает использование пробиотической добавки, состоящей из молочнокислых бактерий Lactobacillus agilis, которые культивируют в среде, включающей 45,0 г/л мелассы кормовой, состоящей из свекловичной и кукурузной меласс, взятых в соотношениях 1:1, К2НРО4 - 2,0 г/л и дрожжевого экстракта - 0,02 г/л, при 37°С в течение 24 ч до достижения титра Lactobacillus agilis не менее 1,0×1010 КОЕ/мл, которую выпаивают перепелам ежедневно в дозе 0,2-1,0 мл на голову. Предлагаемый способ выращивания перепелов обеспечивает повышение мясной продуктивности птицы. 2 табл., 5 ил.

Изобретение относится к биотехнологии и сельскому хозяйству, а конкретно к способу производства пробиотической добавки на основе молочнокислых бактерий для кормления перепелов. Способ производства пробиотической добавки включает культивирование микроорганизмов Lactobacillus salivarius в среде, состоящей из мелассы кормовой - 45,0 г, K2HPO4 - 2,0 г и дрожжевого экстракта - 0,02 г из расчета на 1 литр воды, при этом меласса кормовая состоит из свекловичной и кукурузной меласс, взятых в соотношении 1:1. Затем в полученную смесь добавляют микроорганизмы Lactobacillus salivarius с титром 1,0×105 КОЕ/мл и культивируют при температуре 37°С в течение 24 ч. Изобретение позволяет повысить мясную продуктивность птицы. 5 ил., 2 табл.

Изобретение относится к сельскому хозяйству, в частности к птицеводству. Способ кормления перепелов включает использование пробиотической добавки, состоящей из молочнокислых бактерий, при этом используют молочнокислые бактерии Lactobacillus salivarius, которые культивируют в среде, включающей 45,0 г/л мелассы кормовой, состоящей из свекловичной и кукурузной меласс, взятых в соотношениях 1:1, К2НРO4 - 2,0 г/л и дрожжевого экстракта - 0,02 г/л, при 37°С в течение 24 ч до достижения титра Lactobacillus salivarius не менее 1,0×1010 КОЕ/мл и выпаивают перепелам ежедневно в дозе 0,2-1,0 мл на голову. Предлагаемый способ выращивания перепелов обеспечивает повышения мясной продуктивности птицы. 2 табл., 5 ил.

Изобретение относится к биотехнологии и сельскому хозяйству. Предложен способ получения пробиотической добавки для перепелов, включающий культивирование микроорганизмов Lactobacillus agilis в среде, состоящей из мелассы кормовой - 45,0 г, К2НРО4 - 2,0 г и дрожжевого экстракта - 0,02 г из расчета на 1 л воды, причем меласса кормовая состоит из свекловичной и кукурузной меласс, взятых в соотношении 1:1, затем в полученную смесь добавляют микроорганизмы Lactobacillus agilis с титром не менее 1,0×105 КОЕ/мл и культивируют при температуре 37°С в течение 24 ч. Изобретение позволяет получить пробиотическую добавку на основе молочнокислых бактерий для кормления перепелов с целью повышения их мясной продуктивности. 5 ил., 2 табл., 1 пр.

Изобретение относится к микробиологии и сельскому хозяйству и может быть использовано для получения пробиотической добавки с целью повышения мясной продуктивности перепелов. Предложенная питательная среда для культивирования лактобактерий состоит из мелассы кормовой, K2НРО4, дрожжевого экстракта и воды. При этом меласса кормовая состоит из свекловичной и кукурузной меласс, взятых в равных частях и микроорганизмов Lactobacillus agilis с титром не менее 1,0×105 КОЕ/мл при следующем соотношении исходных компонентов, г/л: меласса свекловичная 22-23, меласса кукурузная 22-23, K2НРO4 2,0, дрожжевой экстракт 0,02, микроорганизмы Lactobacillus agilis с титром не менее 1,0×105 КОЕ/мл 99-101, вода - остальное. Использование изобретения позволяет повысить титр молочнокислых культур lactobacillus agilis, в питательной среде. 2 табл., 5 ил.

Изобретение относится к микробиологии и сельскому хозяйству и может быть использовано для получения пробиотической добавки с целью повышения мясной продуктивности перепелов. Предложенная питательная среда для культивирования лактобактерий состоит из мелассы кормовой, K2НРО4, дрожжевого экстракта и воды. При этом меласса кормовая состоит из свекловичной и кукурузной меласс, взятых в равных частях и микроорганизмов Lactobacillus agilis с титром не менее 1,0×105 КОЕ/мл при следующем соотношении исходных компонентов, г/л: меласса свекловичная 22-23, меласса кукурузная 22-23, K2НРO4 2,0, дрожжевой экстракт 0,02, микроорганизмы Lactobacillus agilis с титром не менее 1,0×105 КОЕ/мл 99-101, вода - остальное. Использование изобретения позволяет повысить титр молочнокислых культур lactobacillus agilis, в питательной среде. 2 табл., 5 ил.

Изобретение относится к микробиологии и сельскому хозяйству и может быть использовано для получения пробиотической добавки с целью повышения мясной продуктивности перепелов. Предложенная питательная среда для культивирования лактобактерий состоит из мелассы кормовой, K2НРО4, дрожжевого экстракта и воды. При этом меласса кормовая состоит из свекловичной и кукурузной меласс, взятых в равных частях и микроорганизмов Lactobacillus agilis с титром не менее 1,0×105 КОЕ/мл при следующем соотношении исходных компонентов, г/л: меласса свекловичная 22-23, меласса кукурузная 22-23, K2НРO4 2,0, дрожжевой экстракт 0,02, микроорганизмы Lactobacillus agilis с титром не менее 1,0×105 КОЕ/мл 99-101, вода - остальное. Использование изобретения позволяет повысить титр молочнокислых культур lactobacillus agilis, в питательной среде. 2 табл., 5 ил.

Изобретение относится к биотехнологии, а именно к средствам диагностики вируса парагриппа 3 типа у животных. Предлагается тест-система для обнаружения генома возбудителя коронавирусной инфекции у животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени. Тест-система включает буфер для проведения полимеразной цепной реакции, праймеры и флуоресцентные зонды, специфичные для коронавируса А и для внутреннего контрольного образца, смесь ферментов из ДНК полимеразы с антителами, ингибирующими активность фермента, TAQ POLYMERASE и обратной транскриптазы MMLV REVERSE TRANSCRIPTASE, буфер для разведения РНК в виде деионизованной воды, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, для внутреннего контрольного образца - суспензию бактериофага MS2, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса BPI 3 и фрагмент генома бактериофага. Изобретение служит для расширения функциональных возможностей и получения достоверной диагностики. 5 табл., 1 пр.

Изобретение относится к ветеринарной микробиологии, в частности к лабораторной диагностике возбудителей инфекционных заболеваний, а именно к средствам диагностики инфекции у животных. Описан тест-система для выявления ДНК возбудителя лептоспироза (Leptospira spp.) у сельскохозяйственных животных, включающий буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящая из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов специфичные для возбудителя лептоспироза Leptospira spp. и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец. Для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл. Для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя лептоспироза (Leptospira spp. Lpts) и фрагмент генома бактериофага Т4, взятых в объемном соотношении 1:1. Технический результат - уменьшение трудозатрат, времени и расходного материала при проведении полимеразной цепной реакции. 2 ил., 4 табл., 1 пр.

Изобретение относится к фармацевтической промышленности, а именно к способу получения жидкого пробиотического препарата. Способ получения жидкого пробиотического препарата, включающий выбор культур микроорганизмов Lactobacillus acidophilus Scav. В-4625, Rhuminococcus albus Кr и Bacillus subtilis B-8130, подбор оптимальных питательных сред для их глубинного культивирования, смешивание полученных культуральных жидкостей, также на стадии смешивания в стерильных условиях в смесь культуральных жидкостей для обеспечения срока хранения биопрепарата до 28 суток и снижения контаминации условно-патогенной микрофлорой добавляют консервант в дозе 0,5 г/л; 1-2 г/л, в качестве которого используют нипагин. Вышеописанный способ позволяет исключить возможную контаминацию жидкого пробиотического препарата условно патогенной микрофлорой и обеспечить продолжительный срок хранения. 7 табл.

Изобретение относится к ветеринарной медицине и предназначено для лечения гепатозов у крупного рогатого скота. Коровам с интервалом в 5 дней курсом 45 дней по 10 мл парентерально вводят масляный раствор гепатопротектора, содержащего 0,03-0,06% диацетофенонилселинида, 0,09-0,18% бета-каротина, 5,5-6,0% фосфолипидов, и одновременно с кормом применяют по 150 г бентонита в течение 30 дней ежедневно, а затем по 100 г в течение 15 дней. Способ позволяет повысить результативность и сократить сроки лечения, а также увеличить сохранность и молочную продуктивность коров. 2 табл., 1 пр.

Изобретение относится к ветеринарии, а именно к кормовым добавкам, обладающим гепатопротекторным и антитоксическим действием, предназначенным для снижения токсической нагрузки на организм птицы, а также улучшения функциональной активности печени. Кормовая добавка для сельскохозяйственной птицы, обладающая гепатопротекторным и антитоксическим действием, содержит бентонит, тиосульфат натрия, траву репешка обыкновенного и муку семян расторопши пятнистой при следующем соотношении компонентов, мас. %: тиосульфат натрия - 10,0-11,0; трава репешка обыкновенного - 8,0-9,0; мука семян расторопши пятнистой - 7,0-8,0; бентонит - остальное. Изобретение позволяет расширить ассортимент кормовых добавок для сельскохозяйственной птицы, а его применение обеспечит повышение сохранности и продуктивности птицы за счет гепатопротекторного и антитоксического действия. 3 табл., 2 пр.

Изобретение относится к области ветеринарной вирусологии, в частности к способу диагностики оспы овец и коз. Способ экспресс-диагностики вируса оспы коз и овец включает отбор проб патологического материала из очага инфекционного заболевания, экстракцию ДНК бактерий инфекционного заболевания из полученных проб, идентификацию видовой принадлежности возбудителя болезни методом полимеразной цепной реакции с флуоресцентным учетом результатов в режиме реального времени с применением термоциклера типа RotorGene на основании наличия/отсутствия пересечения кривой флуоресценции с пороговой линией. В качестве патологического материала используют пробы из очага инфекционного заболевания оспы, при этом отбор проб патологического материала осуществляют от всех животных, находящихся в очаге инфекционного заболевания, и проводят экспресс-диагностику полученного патологического материала в течение суток для выявления животных-носителей вируса оспы на начальной стадии инфицирования. Учет результатов полимеразной цепной реакции проводят по наличию или отсутствию пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией, если наблюдают рост специфического сигнала, то образец считают положительным - вирус оспы овец и коз присутствует, при этом значения контрольных образцов находятся в пределах нормы, если не наблюдают рост специфического сигнала, то образец считают отрицательным - вирус оспы овец и коз отсутствует и значения контрольных образцов также находятся в пределах нормы. Способ позволяет расширить функциональные возможности способа диагностики оспы овец и коз. 3 табл., 1 ил.

Изобретение относится к области ветеринарной вирусологии, в частности к способу экспресс-диагностики нодулярного дерматита крупного рогатого скота (КРС). Способ экспресс-диагностики вируса нодулярного дерматита КРС включает отбор проб патологического материала из очага инфекционного заболевания от всех животных, находящихся в очаге инфекционного заболевания, и проведение экспресс-диагностики полученного патологического материала в течение суток методом ПЦР с флуоресцентным учетом результатов в режиме реального времени с применением термоциклера типа RotorGene для выявления животных-носителей вируса нодулярного дерматита на начальной стадии инфицирования, при этом учет результатов ПЦР проводят по наличию или отсутствию пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией, если наблюдают рост специфического сигнала, то образец считают положительным - вирус нодулярного дерматита КРС присутствует, при этом значения контрольных образцов находятся в пределах нормы, если не наблюдают рост специфического сигнала, то образец считают отрицательным - вирус нодулярного дерматита крупного рогата скота отсутствует, и значения контрольных образцов также находятся в пределах нормы. 3 табл., 1 ил.

Изобретение относится к области ветеринарной вирусологии, в частности к тест-системе для обнаружения ДНК особо опасного возбудителя африканской чумы свиней (АЧС). Изобретение предназначено для повышения степени специфичности и чувствительности тест-системы, а также сокращения времени проведения диагностики при снижении вероятности технологических ошибок во время лабораторных манипуляциях. Тест-система для обнаружения ДНК вируса африканской чумы свиней с помощью полимеразной цепной реакции в режиме реального времени включает пластиковые флаконы и пробирки, термостабильный фермент Tag-полимеразу, буфер для постановки реакции, смесь четырех дезоксинуклеотидтрифосфатов, положительный контроль - рекомбинантную плазмиду, содержащую фрагмент гена vp72 вируса африканской чумы свиней, синтетические олигонуклеотидные праймеры и зонд. Используют синтетические олигонуклеотидные праймеры и флуоресцирующий зонд, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72 и имеющие следующий нуклеитидный состав: - прямой праймер, - обратный праймер, - флуоресцирующий зонд и взятые при соотношении 1:1:0,5, при этом BHQ1 - темновой гаситель флуоресценции присоединен к 3'-концевому нуклеотиду, а FAM - флуоресцентный краситель присоединен к нуклеотиду С, причем для постановки реакции используют 5-кратный буфер и в качестве отрицательного контроля используют дистиллированную воду. 1 табл., 9 ил.

Изобретение относится к ветеринарной вирусологии, а именно к средствам диагностики африканской чумы свиней (АЧС). Изобретение позволяет повысить точность обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени. Способ обнаружения ДНК вируса африканской чумы свиней методом полимеразной цепной реакции в режиме реального времени включает выделение ДНК с использованием контрольных образцов (контроль качества выделения вируса и контроль специфики реакции); амплификацию ДНК с использованием синтетических праймеров и флуоресцирующего зонда, включающую денатурацию при 95°С, циклирование: денатурация - отжиг - элонгация и оценку результата по кривым накопления флуоресцентного сигнала по каждому из заданных каналов. В качестве контроля качества выделения вируса используют рекомбинантную плазмиду с фрагментом гена vp72 вируса африканской чумы свиней. В качестве контроля специфики реакции используют рекомбинантную плазмиду с фрагментом гена здоровых тканей свиньи. Синтетические олигонуклеотидные праймеры и флуоресцирующий зонд, комплементарные консервативной области генома вируса африканской чумы свиней района гена vp72, взяты в соотношении 1:1:0,5 и имеют следующий нуклеотидный состав: SEQ NO 1:5'-CTG-CTC-ATG-GTA-TCA-ATC-3' - прямой праймер, SEQ NO 2:5'-GAT-ACC-ACA-AGA-TCG-CCG-3' - обратный праймер, SEQ NO 3:5'-FAM-CCA-CGG-GAG-GAA-TAC-CAA-CCC-AGT-G-BHQ1-3' - флуоресцирующий зонд, где BHQ1 означает присоединенный к 3'-концевому нуклеотиду темновой гаситель флуоресценции, a FAM - флуоресцентный краситель, присоединенный к нуклеотиду С. Амплификацию проводят при следующем режиме: денатурация при 95°С в течение 90 с, затем циклирование с детекцией, включающей денатурацию при 95°С в течение 15 с, отжиг - 60°С - 30 с и элонгацию - 72°С в течение 4 с. Цикл: денатурация - отжиг - элонгация повторяется 40 раз. Затем накопление флуоресцентного сигнала измеряют по каналам: FAM для специфического сигнала; HEX для сигнала внутреннего контроля; CY5 для сигнала экзогенного внутреннего контроля. Если кривые накопления флуоресцентного сигнала выходят до 36 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 36 цикла, то результат реакции - отрицательный. 1 табл., 9 ил.

Изобретение относится к области ветеринарии. Предложен способ профилактики африканской чумы свиней, включающий выявление животных с инфекционным заболеванием на начальной стадии развития, убой больных и дальнейшее обследование остальных животных. Остальных животных в очаге инфекционного заболевания африканской чумой свиней обследуют в течение суток методом полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени. Животных-носителей вируса и здоровых животных переводят в отдельные помещения и в их присутствии осуществляют санацию помещений озоно-воздушной смесью: в помещении с животными-носителями вируса - в течение месяца не менее 3-4 раз в неделю с концентрацией озона 4-6 г/м3 в течение 20-30 минут, в помещении со здоровыми животными - в течение не более двух недель 2-3 раза в неделю с концентрацией озона 3-4 г/м3 в течение 15-20 минут. Изобретение обеспечивает расширение функциональных возможностей способа профилактики африканской чумы свиней. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства кормопроизводству, в частности, к способу производства белково-витаминной кормовой добавки. Способ включает промывку семян гороха водопроводной водой в течение 4-8 мин. После чего промытые семена гороха замачивают анолитом с pH 3,0-10,5 и окислительно-восстановительным потенциалом 860-1580 мВ, концентрацией кислорода 7,2-17,0 мг/л и хлора 0,006-0,01 мг/л в течение 3,5-4,5-х часов, при соотношении семян к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой в течение 3-8 мин. Проращивание семян и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении при общей продолжительности проращивания 7-9 суток при естественном освещении. Осуществление способа позволяет получить белково-витаминную кормовую добавку высокого качества из семян гороха при ускорении технологического процесса проращивания семян и сокращении его продолжительности, а также получить белково-витаминную кормовую добавку для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства - кормопроизводству, в частности к способу получения витаминной кормовой добавки из люцерны. Способ включает замачивание семян в электроактивированной воде, проращивание и выгон проростков. В качестве исходных семян используют семена люцерны. Промывку семян люцерны осуществляют водопроводной водой в течение 4-8 мин, после чего промытые семена замачивают анолитом с рН 3,0-6,0 и окислительно-восстановительным потенциалом 970-1110 мВ, концентрацией кислорода 8,3-12,0 мг/л и хлора 0,006-0,01 мг/л в течение 3,5-4,5-х часов. Соотношении семян к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой в течение 3-8 мин, а проращивание семян осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 7-9 суток при естественном освещении. Использование изобретения позволит получить качественный корм из семян люцерны путем ускорения технологического процесса проращивания семян и сократить его продолжительность, а также получить витаминный корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства кормопроизводству, в частности к способу приготовления функциональной кормовой добавки из зерна люпина. Способ включает замачивание зерна люпина в анолите с pH 3,5-10,8 ед. и окислительно-восстановительным потенциалом 375-840 мВ, концентрацией кислорода 7,2-16,0 мг/л и хлора 0,003-0,007 мг/л. Соотношение зерна к анолиту соответственно составляет 1:2. Затем осуществляют проращивание зерна люпина в течение 7-9 суток при естественном освещении. Осуществление способа позволяет получить качественную функциональную кормовую добавку из зерна люпина при упрощении технологического процесса проращивания зерна и сокращении его продолжительности, а также получить зеленый витаминный корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл.

Изобретение относится к области сельского хозяйства кормопроизводству, в частности к способу производства белково-витаминной кормовой добавки. Способ включает промывку семян нута водопроводной водой в течение 4-8 мин. После чего промытые семена нута замачивают анолитом с pH 3,0-10,5 и окислительно-восстановительным потенциалом 860-1580 мВ, концентрацией кислорода 7,2-17,0 мг/л и хлора 0,006-0,01 мг/л в течение 3,5-4,5 часов, при соотношении семян к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой в течение 3-8 мин. Проращивание семян и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении при общей продолжительности проращивания 7-9 суток при естественном освещении. Осуществление способа позволяет получить белково-витаминную кормовую добавку из семян нута при ускорении технологического процесса проращивания семян и сокращении его продолжительности, а также получить белково-витаминную кормовую добавку для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, в частности к способу получения витаминной кормовой добавки из зерна чины. Способ включает замачивание зерна в электроактивированной воде, проращивание и выгон проростков. В качестве исходного зерна используют зерно чины, промывку зерна чины осуществляют водопроводной водой в течение 4-8 мин, после чего промытое зерно замачивают анолитом с pH 3,0-6,0 и окислительно-восстановительным потенциалом 970-1110 мВ, концентрацией кислорода 8,3-12,0 мг/л и хлора 0,006-0,01 мг/л в течение 3,5-4,5 часов, при соотношении зерна к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку зерна водопроводной водой в течение 3-8 мин. Проращивание зерна осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 7-9 суток при естественном освещении. Использование изобретения позволит получить витаминный корм из зерна чины путем ускорения технологического процесса проращивания зерна и сократить его продолжительность, а также получить витаминный корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства - кормопроизводству, в частности к способу производства функционального корма. Способ включает промывку зерна тритикале водопроводной водой в течение 4-8 мин. После чего промытое зерно замачивают в анолите с pH 2,4-8,0 ед. и окислительно-восстановительным потенциалом 230-810 мВ, концентрацией кислорода 6,0-14,8 мг/л, полученного путем контактной активации 6-10% раствора сульфата аммония, в течение 3,5-4,5 часов, при соотношении зерна к анолиту соответственно составляет 1:2. После этого удаляют анолит и осуществляют повторную промывку зерна водопроводной водой в течение 3-8 мин. Проращивание зерна и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 6-8 суток при естественном освещении. Осуществление способа позволяет получить качественный функциональный корм путем ускорения технологического процесса проращивания зерна и сократить его продолжительность, а также получить функциональный корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр., 2 табл.

Изобретение относится к области сельского хозяйства - кормопроизводству. Способ изготовления функционального корма включает промывку семян нута водопроводной водой в течение 4-8 мин. После чего промытые семена замачивают в анолите с рН 2,4-8,0 ед. и окислительно-восстановительным потенциалом 230-810 мВ, концентрацией кислорода 6,0-14,8 мг/л, полученном путем контактной активации 6-10%-ного раствора сульфата аммония, в течение 3,5-4,5-х часов, при соотношении семян к анолиту соответственно 1:2. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой в течение 3-8 мин. Проращивание семян и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 6-8 суток при естественном освещении. Осуществление изобретения позволяет получить корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах и ускорении технологического процесса проращивания семян. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, в частности к способу изготовления функционального корма. Способ включает замачивание зерна кукурузы в электроактивированной воде, проращивание и выгон проростков. В качестве зерна используют кукурузу, промывку зерна кукурузы осуществляют водопроводной водой в течение 4-8 мин. Промытое зерно замачивают анолитом с pH 2,4-8,0 ед. и окислительно-восстановительным потенциалом 230-810 мВ, концентрацией кислорода 6,0-14,8 мг/л, полученного путем контактной активации 6-10% раствора сульфата аммония, в течение 3,5-4,5 часов при соотношении зерна к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку зерна водопроводной водой в течение 3-8 мин, а проращивание зерна осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 6-8 суток при естественном освещении. Использование изобретения позволит получить функциональный корм путем ускорения технологического процесса проращивания зерна и сократить его продолжительность, а также получить корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства - кормопроизводству, в частности, к способу получения биологически активной кормовой добавки. Способ включает промывку зерна кукурузы водопроводной водой в течение 4-8 мин. После чего промытое зерно замачивают анолитом с рН 3,0-11,2 ед. и окислительно-восстановительным потенциалом 310-1100 мВ, концентрацией кислорода 7,2-16,0 мг/л и хлора 0,003-0,007 мг/л в течение 3,0-4,5-х часов, при соотношении зерна к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку зерна водопроводной водой в течение 3-8 мин. Проращивание зерна и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 7-9 суток при естественном освещении. Осуществление способа позволяет получить качественную биологически активную кормовую добавку при ускорении технологического процесса проращивания зерна и сокращении его продолжительности, а также получить биологический активный корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, в частности к кормопроизводству. Способ изготовления биологически активной кормовой добавки из зерна фасоли включает промывку зерна фасоли водопроводной водой в течение 4-8 мин. После чего промытое зерно замачивают анолитом с рН 3,0-11,2 ед. и окислительно-восстановительным потенциалом 310-1100 мВ, концентрацией кислорода 7,2-16,0 мг/л и хлора 0,003-0,007 мг/л в течение 3,0-4,5 часов, при соотношении зерна к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку зерна водопроводной водой в течение 3-8 мин. Проращивание зерна и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 7-9 суток при естественном освещении. Осуществление способа позволяет получить качественную биологически активную кормовую добавку путем ускорения технологического процесса проращивания зерна и сократить его продолжительность, а также получить биологический активный корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, в частности к способу приготовления белковой функциональной кормовой добавки из семян сои. Способ включает замачивание семян в электроактивированной воде, проращивание и выгон ростков. В качестве исходных семян использовали семена сои. В качестве электроактивированной воды использовали анолит с pH 3,5-10,8 ед. и окислительно-восстановительным потенциалом 375-840 мВ, концентрацией кислорода 7,2-16,0 мг/л и хлора 0,003-0,007 мг/л, полученный путем контактной активации, при соотношении семян и анолита соответственно 1:2 при общей продолжительности проращивания 7-9 суток при естественном освещении. Заявляемый способ позволяет получить качественную белковую функциональную кормовую добавку из семян сои путем упрощения технологического процесса проращивания семян и сократить его продолжительность, а также получить кормовую добавку для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, в частности к кормопроизводству. Способ приготовления белковой функциональной кормовой добавки из семян гороха включает замачивание семян гороха в анолите с рН 3,5-10,8 ед. и окислительно-восстановительным потенциалом 375-840 мВ, концентрацией кислорода 7,2-16,0 мг/л и хлора 0,003-0,007 мг/л. Анолит получают путем контактной активации. Соотношение семян к анолиту соответственно составляет 1:2. Затем осуществляют проращивание семян гороха в течение 7-9 суток при естественном освещении. Осуществление способа позволяет сократить продолжительность технологического процесса проращивания семян, а также получить кормовую добавку для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл.

Изобретение относится к области сельского хозяйства. Способ приготовления витаминного зеленого корма, включающий замачивание зерна ячменя в электроактивированной воде, проращивание и выгон проростков. Промывку зерна осуществляют водопроводной водой в течение 4-8 мин, после чего промытое зерно замачивают анолитом с рН 2,4-7,8 и окислительно-восстановительным потенциалом 260-720 мВ, концентрацией кислорода 6,3-12,5 мг/л, полученный путем контактной активации 6-10% раствора сульфата аммония в течение 3,5-4,5-х часов, после этого удаляют анолит и осуществляют повторную промывку зерна водопроводной водой. Проращивание зерна осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении. Заявляемый способ позволяет получить качественный витаминный зеленый корм. 2 табл.

Изобретение относится к области сельского хозяйства, в частности к способу производства функционального корма. Способ включает замачивание семян чины в электроактивированной воде, проращивание и выгон проростков. В качестве семян используют чину. Промывку семян чины осуществляют водопроводной водой в течение 4-8 мин, после чего промытые семена замачивают анолитом с pH 2,4-8,0 ед. и окислительно-восстановительным потенциалом 230-810 мВ, концентрацией кислорода 6,0-14,8 мг/л, полученного путем контактной активации 6-10% раствора сульфата аммония, в течение 3,5-4,5 ч при соотношении семян к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой в течение 3-8 мин. Проращивание семян осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 6-8 суток при естественном освещении. Использование изобретения позволит получить функциональный корм путем ускорения технологического процесса проращивания семян и сократить его продолжительность, а также получить корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства - кормопроизводству, в частности к способу производства витаминной кормовой добавки. Способ включает промывку зерна фасоли водопроводной водой в течение 4-8 мин. После чего промытое зерно замачивают анолитом с pH 3,0-10,5 и окислительно-восстановительным потенциалом 860-1580 мВ, концентрацией кислорода 7,2-17,0 мг/л и хлора 0,006-0,01 мг/л в течение 3,5-4,5-х часов, при соотношении зерна к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку зерна водопроводной водой в течение 3-8 мин. Проращивание зерна и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 7-9 суток при естественном освещении. Осуществление способа позволяет получить витаминную кормовую добавку из зерен фасоли при ускорении технологического процесса проращивания зерна и сократить его продолжительность, а также получить витаминную кормовую добавку для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства - кормопроизводству. Способ получения витаминного зеленого корма из зерна пшеницы включает промывку зерна пшеницы водопроводной водой в течение 4-8 мин. После чего промытое зерно замачивают анолитом с рН 2,4-7,8 ед. и окислительно-восстановительным потенциалом 260-720 мВ, концентрацией кислорода 6,3-12,5 мг/л, полученным путем контактной активации 6-10% раствора сульфата аммония в течение 3,5-4,5-х часов, при соотношении зерна к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку зерна водопроводной водой в течение 3-8 мин. Проращивание зерна и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 6-8 суток при естественном освещении. Осуществление изобретения позволяет получить витаминный зеленый корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах и ускорении технологического процесса проращивания семян. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, а именно к кормопроизводству. Способ приготовления белковой функциональной кормовой добавки из семян люцерны включает замачивание семян люцерны в анолите с pH 3,5-10,8 и окислительно-восстановительным потенциалом 375-840 мВ, концентрацией кислорода 7,2-16,0 мг/л и хлора 0,003-0,007 мг/л. Анолит получают путем контактной активации. Соотношение семян и анолита составляет 1:2 соответственно. После замачивания осуществляют проращивание семян люцерны в течение 7-9 суток при естественном освещении. Осуществление изобретения позволяет получить кормовую добавку для сельскохозяйственных животных и птиц с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах, позволяет сократить продолжительность процесса проращивания семян. 2 табл.

Изобретение относится к области сельского хозяйства - кормопроизводству, в частности к способам производства витаминной кормовой добавки. Способ производства витаминной кормовой добавки включает промывку зерна овса водопроводной водой в течение 4-8 мин. После чего промытое зерно замачивают анолитом с рН 3,0-10,5 и окислительно-восстановительным потенциалом 860-1580 мВ, концентрацией кислорода 7,2-17,0 мг/л и хлора 0,006-0,01 мг/л в течение 3,5-4,5-х часов, при соотношении зерна к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку зерна водопроводной водой в течение 3-8 мин. Проращивание зерна и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 7-9 суток, при естественном освещении. Осуществление способа позволяет получить витаминную кормовую добавку из зерна овса при ускорении технологического процесса проращивания зерна и сокращении его продолжительности, а также получить витаминную кормовую добавку для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, в частности к способу производства витаминной кормовой добавки. Способ включает промывку, замачивание зерна в электроактивированной воде, проращивание и выгон проростков. Промывку зерна пшеницы осуществляют водопроводной водой в течение 4-8 мин, после чего промытое зерно замачивают анолитом с рН 3,0-10,5 и окислительно-восстановительным потенциалом 860-1580 мВ, концентрацией кислорода 7,2-17,0 мг/л и хлора 0,006-0,01 мг/л в течение 3,5-4,5 ч при соотношении зерна и анолита 1:2. После этого удаляют анолит и осуществляют повторную промывку зерна водопроводной водой в течение 3-8 мин. Проращивание зерна осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 7-9 суток при естественном освещении. Использование изобретения позволит получить качественную кормовую добавку путем ускорения технологического процесса проращивания зерна и сократить его продолжительность, а также получить кормовую добавку для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, в частности к кормопроизводству. Способ получения белково-витаминного зеленого корма включает промывку семян амаранта водопроводной водой в течение 4-8 мин. После чего промытые семена замачивают анолитом с pH 2,4-7,8 и окислительно-восстановительным потенциалом 260-720 мВ, концентрацией кислорода 6,0-12,8 мг/л, полученного путем контактной активации 6-10% раствора сульфата аммония, в течение 3,5-4,5-х часов, при соотношении семян анолита 1:2. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой в течение 3-8 мин. Проращивание семян и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 6-8 суток при естественном освещении. Осуществление изобретения позволяет получить белково-витаминный зеленый корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах и ускорении технологического процесса проращивания семян. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства кормопроизводству, в частности, к способам производства белково-витаминной кормовой добавки. Способ производства белково-витаминной кормовой добавки включает промывку семян амаранта водопроводной водой в течение 4-8 мин. После чего промытые семена амаранта замачивают анолитом с рН 3,0-10,5 и окислительно-восстановительным потенциалом 860-1580 мВ, концентрацией кислорода 7,2-17,0 мг/л и хлора 0,006-0,01 мг/л в течение 3,5-4,5 часов, при соотношении семян к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой в течение 3-8 мин. Проращивание семян и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 7-9 суток при естественном освещении. Осуществление изобретения позволяет получить белково-витаминную кормовую добавку для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах и ускорении технологического процесса проращивания семян. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, в частности к кормопроизводству. Способ получения белково-витаминного зеленого корма включает промывку семян люцерны водопроводной водой в течение 4-8 мин. После этого промытое семя замачивают анолитом с pH 2,4-7,8 и окислительно-восстановительным потенциалом 260-720 мВ, концентрацией кислорода 6,0-12,8 мг/л, полученного путем контактной активации 6-10%-ного раствора сульфата аммония, в течение 3,5-4,5-х часов, при соотношении семян к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой в течение 3-8 мин. Проращивание семян и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 6-8 суток при естественном освещении. Осуществление способа позволяет получить качественный белково-витаминный зеленый корм при ускорении технологического процесса проращивания семян и сократить его продолжительность, а также получить белково-витаминный зеленый корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, в частности к кормопроизводству. Способ приготовления функциональной кормовой добавки из зерна тритикале включает замачивание зерна тритикале в анолите с рН 3,5-10,8 ед. и окислительно-восстановительным потенциалом 375-840 мВ, концентрацией кислорода 7,2-16,0 мг/л и хлора 0,003-0,007 мг/л. Анолит получают путем контактной активации. Соотношение зерна и анолита соответственно составляет 1:2. Затем осуществляют проращивание зерна тритикале в течение 7-9 суток при естественном освещении. Осуществление способа позволяет сократить продолжительность технологического процесса проращивания зерна, а также получить кормовую добавку для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл.

Изобретение относится к области сельского хозяйства - кормопроизводству, в частности к способу производства функционального корма. Способ производства функционального корма включает промывку семян сои водопроводной водой в течение 4-8 мин. После чего промытые семена замачивают в анолите с рН 2,4-8,0 ед. и окислительно-восстановительным потенциалом 230-810 мВ, концентрацией кислорода 6,0-14,8 мг/л, полученного путем контактной активации 6-10% раствора сульфата аммония, в течение 3,5-4,5-х часов, при соотношении семян к анолиту соответственно составляет 1:2. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой в течение 3-8 мин. Проращивание семян и выгон проростков осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 6-8 суток при естественном освещении. Осуществление способа позволяет получить качественный функциональный корм путем ускорения технологического процесса проращивания семян и сократить его продолжительность, а также получить функциональный корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства, в частности к способу производства белковой биологически активной кормовой добавки. Способ включает замачивание семян в электроактивированной воде, проращивание и выгон проростков. В качестве исходных семян используют семена гороха. Промывку семян гороха осуществляют водопроводной водой в течение 4-8 мин, после чего промытые семена замачивают анолитом с pH 3,0-11,2 ед. и окислительно-восстановительным потенциалом 840-1100 мВ, концентрацией кислорода 7,2-16,0 мг/л и хлора 0,003-0,007 мг/л в течение 3,0-4,5 часов, при соотношении семян к анолиту 1:2. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой в течение 3-8 мин. Проращивание семян осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении, при общей продолжительности проращивания 7-9 суток при естественном освещении. Заявляемый способ позволяет получить качественную белковую биологически активную кормовую добавку путем ускорения технологического процесса проращивания семян и сократить его продолжительность, а также получить белковый биологический активный корм для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл., 1 пр.

Изобретение относится к области сельского хозяйства. Способ получения витаминного зеленого корма, включающий замачивание семян рыжика в электроактивированной воде, проращивание и выгон проростков. Промывку семян осуществляют водопроводной водой в течение 4-8 мин, после чего промытое семя замачивают анолитом с рН 2,4-7,8 и окислительно-восстановительным потенциалом 260-720 мВ, концентрацией кислорода 6,0-12,8 мг/л, полученного путем контактной активации 6-10% раствора сульфата аммония, в течение 3,5-4,5 ч. После этого удаляют анолит и осуществляют повторную промывку семян водопроводной водой. Проращивание семян осуществляют в тонком слое без использования субстрата воздушно-оросительным методом при периодическом ворошении. Способ позволяет получить качественный зеленый корм. 2 табл., 2 пр.

Изобретение относится к области сельского хозяйства, в частности к кормопроизводству. Способ приготовления белковой функциональной кормовой добавки включает замачивание семян нута в анолите с рН 3,5-10,8 ед. и окислительно-восстановительным потенциалом 375-840 мВ, концентрацией кислорода 7,2-16,0 мг/л и хлора 0,003-0,007 мг/л. Анолит получают путем контактной активации. Соотношение семян к анолиту соответственно составляет 1:2. Затем осуществляют проращивание семян нута в течение 7-9 суток при естественном освещении. Осуществление способа позволяет получить качественную белковую функциональную кормовую добавку из семян нута при упрощении технологического процесса проращивания семян и сокращении его продолжительности, а также получить белковую функциональную кормовую добавку для сельскохозяйственных животных и птицы с рекомендуемыми биохимическими и микробиологическими показателями качества при низких материальных и трудозатратах. 2 табл.

 


Наверх