Создание диагностического набора для обнаружения вируса в хризантемы

Для обнаружения вируса В хризантемы у растений используют диагностический набор, содержащий поликлональные антитела к белку оболочки вируса В Chrysanthemum, конъюгат, меченый щелочной фосфатазой, фиксирующий буфер; экстракционный буфер, ECI-буфер и PNP-буфер. Белок оболочки вируса получают посредством амплификации очищенного гена этого белка с использованием смыслового праймера ATGCCTCCCAAACCGGCACCAGGTGAT и антисмыслового праймера TTTATAATGTCTTATTATTCGCAT. 2 н. и 13 з.п. ф-лы.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к праймерам, пригодным для обнаружения вируса В хризантемы (Chrysanthemum virus В) у растений.

Конкретнее данное изобретение относится к способу обнаружения вируса В хризантемы у растений с применением праймеров, пригодных для обнаружения вируса В хризантемы у растений.

Настоящее изобретение также относится к диагностическому набору, пригодному для обнаружения белка оболочки вируса В хризантемы у растений.

Предшествующий уровень техники

Хризантема является одним из важных срезаемых (срезочных) цветов во всем мире. Она занимает 3 место в мире среди срезаемых цветов. Обычно хризантему разводят вегетативно, и данная практика позволяет вирусу, однажды упрочившемуся в растении, сохраняться от поколения к поколению. Качество гермплазмы и сведение к минимуму инфекции вирусами различных культиваров, правильная диагностика и контроль за вирусными болезнями являются не только желательными, но также необходимыми для повышения качества растениеводческой продукции.

Вирус В хризантемы (CVB), карлавирус имеет узкий крут хозяев и распространен во всем мире, где бы ни росли хризантемы. Он заражает хризантему и около 10 других видов в 5 семействах двудольных (Brunt, A.A., Crabtree, К., Dallwitz, M.J., Gibbs, A.I, and Watson, L. (Edts) Viruses of Plants, CAB International, UK. Page No. 398-400). CVB широко распространен по всей стране. Во время тщательного изучения chrysanthemum cvs. было обнаружено, что все проверенные коммерческие источники (commercial stocks) заражены на от 40% до 95% (Verma, N.. Sharma, A., Ram, R., Hallan, V., Zaidi, A.A. and Garg, LD. (2003) Detection, identification and incidence of Chrysanthemum В carlavims in chrysanthemums in India. Crop Prof. 22, 425-429). В Гималайском Институте технологии биоресурсов были собраны культивары Palampur chrysanthemum из двадцати восьми географических районов. Двадцать восемь изолятов были клонированы, секвенированы, и последовательности были представлены в Genbank. Были разработаны различные праймерные пары (EMBL Nucleotide Sequence Accession Numbers: AJ566196, AJ566195, AJ609493, AJ609494, AJ609495, AJ609496, AJ609497, AJ609498, AJ609499, AJ609500) и успешно применялись для идентификации и характеристики индийских изолятов CVB. Это также показывает широкое распространение CVB в хризантеме, выращиваемой в различных частях страны.

Впервые о CVB было сообщено из Нидерландов как о члене группы карлавирусов (Noordam, D, 1952 Virusziekten by chrysant in Nedeland. With a summary: virus disease of Chrysanthemum morifolium in Netherlands. Tijaschrift over Plantenziekten. 58, 121-190). Обнаружено, что CVB инфекция приводит к потере качества цветов, умеренной пятнистой окраске листьев, просветлению жилок или комбинации этого (Hollings, M. and Stone. O.M. (1972) Chrysanthemum virus B CMI/AAB Descriptions of Plant viruses No. 110). Были также сообщены симптомы в диапазоне от мозаики, пороков развития и от небольшого до сильного некроза (Hakkart, F.A. and Matt, D.Z. (1974) Variation of Chrysanthemum virus B.J.Plant Path. 80, 97-103).

Традиционные способы диагностики растительных вирусов нуждаются в биологических пробах при помощи растения-индикатора, наблюдении симптомов, установлении круга хозяев и частичной морфологии и связях с переносчиком инфекции. Эти процессы поглощают время и требуют много труда. Однако развитие молекулярной биологии, биохимии и иммунологии ведет к созданию новых точных, быстрых и менее трудоемких способов обнаружения вирусов. Существуют различные диагностические методики, пригодные в области вирусной диагностики, подобные таким, как преципитационные тесты, агглютинационные тесты, тесты с применением флуоресцирующих антител, твердофазный иммуноферментный анализ, иммуносорбентный анализ, тканевой блоттинг-анализ, вестерн-блоттинг, гибридизация нуклеиновых кислот с образцами, мечеными изотопами и немечеными изотопами, и обнаружение на основе полимеразной цепной реакции.

Для обнаружения CVB в Chrysanthemum morifolium успешно использовали иммунологические методики (Raizada, R.K., Srivastava, K.M., Chandra. G. and Singh, B.P. (1989) Comparative evaluation of sero-diagnostic methods for detection of Chrysanthemum virus В in chrysanthemum. Indian J. Exp.Biol. 27. 1094-1096). Для диагностики вируса В хризантемы были эффективно использованы серологические способы (Zaidi, A,A., Ram, R., Zaidi, S.N.H. and Mukherjee, D. (1990) Diagnosis of viruses in some ornamental plants with special reference to serological methods: New Developments. Indian Rev. Life Sci. 13,157-174).

Твердофазный иммуноферментный анализ (ELISA) и другой модифицированный вид ELISA широко используются для обнаружения CVB из Chrysanthemum morifolium (Venna, N-, Sharma, A., Ram, R., Hallan, V., Zaidi, A.A. and Garg, I.D. (2003) Detection, identification and incidence of Chrysanthemum В carlavirus in chrysanthemum in India. Crop Prot. 22, 425-429).

Он является высокоэффективным в обнаружении CVB в листьях. С применением DAS-ELISA статус вирусной болезни был проанализирован для 36 культиваров Chrysanthemum morifolium. Некоторые культивары также показали умеренную крапчатость листьев, просветление жилок или комбинацию этого (Hollings, M. and Stone, О.М. (1972) Chrysanthemum virus B CMI/AAB Descriptions of Plant viruses No. 110). Следовательно, важно иметь надежную и быструю методику для определения скрытой инфекции и для установления серологической взаимосвязи с изолятами вируса В хризантемы.

Подобно ELISA, иммуносорбционная электронная микроскопия (ISEM) также позволяет легко обнаружить CVB в листьях (Verma, N., Shanna, A.. Ram, R., Hallan, V., Zaidi, A.A. and Garg, I.D. L (2003) Detection, identification and incidence of Chrysanthemum В carlavirus in chrysanthemum In India. Crop Prot. 22, 425-429). Подобно ELISA, ISEM может обнаруживать CVB в листьях хризантем.

В течение последнего десятилетия для обнаружения вирусного генома у инфицированных растений используется ОТ-ПЦР с различной степенью модификации (Yamamoto, H., Kiguchi. T. and Ohya. T. (2001) 52nd Annual Report of the Society of Plant Protection of North Japan. 85-86). Была разработана частичная последовательность вируса В хризантем, и она составляла 3,4 кб (Levay, K.E. and Zavriev, S.K. (1991) Nucleotide sequence and gene organization of the 3'-terminal region of Chrysanthemumvirus В genomic RNA. J. Gen. Virol. 72(10), 2333-7). В IHBT, Palampur секвенировано приблизительно 5 кб генома CVB (EMBL Nucleotide Sequence Accession Numbers: AJ617281, AJ617282, AJ617287, AJ585240, AJ704627, AJ580956. AJ633542, AJ633540, and AJ633629). На основе секвенирования различных географических изолятов идентифицированы три биологических изолята, включая русский изолят, о котором сообщалось ранее, который напоминает один из трех изолятов.

Цели изобретения

Главной целью настоящего изобретения является обеспечение праймеров, пригодных для обнаружения вируса В хризантем у растений.

Другой целью настоящего изобретения является обеспечение способа для обнаружения вируса В хризантем у растений с применением разработанных праймеров, пригодных для обнаружения вируса кольцевой пятнистости Prunus necrotic у растений.

Следующей целью настоящего изобретения является обеспечение диагностического набора, пригодного для обнаружения белка оболочки вируса В хризантем у растений.

Краткое описание изобретения

Настоящее изобретение относится к способу для обнаружения вируса В хризантем у растений с применением разработанных праймеров

Последовательность ID 1; Смысловой праймер ATGCCTCCCAAACCGGCACCAGGTGAT

Последовательность ID 2: Антисмысловой праймер TTTATAATGTCTTATTATTCGCAT

Это также относится к диагностическому набору, пригодному для обнаружения белка оболочки вируса В хризантем у растений, содержащему:

a) поликлональные антитела к белку оболочки вируса В хризантем у растений;

b) конъюгат, меченый щелочной фосфатазой;

c) сенсибилизирующий буфер;

d) экстракционный буфер;

e) ECI буфер;

f) PNP буфер.

Подробное описание изобретения

Специфическая последовательность CVB была обнаружена в экстракте тотальной РНК инфицированных растений с помощью транскрипции вирусной РНК в кДНК с последующей амплификацией с помощью полимеразной цепной реакции. Подобно ELISA и ISEM, ПЦР также легко позволяет обнаружить CVB в листьях.

Таким образом, DAS-ELISA, ISEM и ОТ-ПЦР являются подходящими методиками для обнаружения заражения хризантем CVB, ОТ-ПЦР и гибридизация нуклеиновых кислот являются чувствительными инструментами для обнаружения вируса, но они требуют тонкого инструментария, который также является дорогостоящим. До сих пор ELISA широко используется для обнаружения вирусного заражения хризантем и других растений, так как он является быстрым, удобным для выполнения, может применяться даже в полевых условиях и является эффективным по стоимости. Его можно использовать в форме диагностического набора.

Для разработки диагностического набора был амплифицирован ген белка оболочки CVB, представленный в данных EMBL (Vide Accession No. AJ871583), с применением специально разработанных праймеров, имеющих сайты рестрикционного фермента, совместимые для направленного и inframe (в рамке) клонирования в векторе pGex-2TK. Амплифицированный продукт был клонирован в вектор pGex 2TK посредством трансформации в компетентные клетки BL21.

Затем клонированный ген белка оболочки индуцировали в трансформированных клетках Е.Coli, выращенные в среде YT.

Условия экспрессии были стандартизированы в отношении концентрации IPTG, времени инкубации, условий роста и способа разрушения клеток. Для того чтобы получить максимальный выход экспрессированного рекомбинантного белка оболочки в растворимой форме, культуру индуцировали при 0,5 OD600 с помощью 0,25 мМ изопропил-p-D-тиогалактопиранозида (IPTG) в течение 3 часов при 25°С с разрушением клеток с помощью лизоцима (10 мг/мл) и ультразвука (пульс включен в течение 9,0 сек и пульс выключен в течение 4 сек).

Экспрессированный белок оболочки очищали до однородности с помощью аффинной хроматографии на глутатион-агарозе. Иммобилизация глутатиона на агарозном носителе позволяет получить высокоэффективный сорбент для аффинной хроматографии. Связавшиеся GST сшитые белки элюировали с помощью буфера, содержащего свободный глутатион.

Очищенные белковые препараты, полученные после аффинной хроматографии, использовали в качестве антигена для иммунизации кролика (Meenu Katoch. A.A.Zaidi and Raja Ram. 2002. Development of diagnostic kit for the detection of Bean yellow mosaic virus. Патентное дело № 76/NF/2002). Для получения гипериммунных сывороток к CVB использовали здоровых белых самцов новозеландских кроликов-альбиносов приблизительно шестимесячного возраста. Антиген (около 100 мкг на инъекцию) смешивали с неполным адъювантом Фрейнда (1:1) и вводили внутримышечно в бедренную мышцу кроликов. В течение одной недели были сделаны четыре инъекции. Через неделю после иммунизации кровь у животных собирали из маргинальной ушной вены. Кровь собирали в стеклянные пробирки и давали свернуться при комнатной температуре в течение одного часа. Потом стеклянные пробирки оставляли при 4°С в течение ночи. Сыворотку центрифугировали при 2000 об/мин в течение десяти минут при 4°С. Супернатант собирали и хранили при 4°С после добавления азида натрия до концентрации 0,2% (в/об).

Согласно настоящему изобретению праймеры, пригодные для обнаружения вируса В хризантем (CVB) у растений, содержащие следующие последовательности:

Последовательность ID. 1: Смысловой праймер ATGCCTCCCAAACCGGCACCAGGTGAT

Последовательность ID 2: Антисмысловой праймер TTTATAATGTCTTATTATTCGCAT

Настоящее изобретение также обеспечивает способ для обнаружения вируса В хризантем (CVB) у растений, включающий стадии:

а) обеспечения очищенного белка оболочки CVB с использованием разработанных праймеров

Последовательность ID 1: Смысловой праймер ATGCCTCCCAAACCGGCACCAGGTGAT

Последовательность ID 2: Антисмысловой праймер TTTATAATGTCTTATTATTCGCAT

b) получения поликлональных антител к белку оболочки CVB, полученному на стадии (а);

c) выполнения прямого антительного твердофазного иммуноферментного сандвич-анализа (DAS ELISA) для обнаружения CVB.

В варианте осуществления настоящего изобретения полный белок оболочки CVB амплифицировали с применением разработанных праимеров, имеющих последовательность:

Последовательность ID 1: Смысловой праймер ATGCCTCCCAAACCGGCACCAGGTGAT

Последовательность ID 2: Антисмысловой праймер TTTATAATGTCTTATTATTCGCAT

В другом варианте осуществления настоящего изобретения полный белок оболочки CVB, содержащий последовательность ID, имеющую №

клонировали в pGEX-2TK с последующей трансформацией штамма E-coli BL 21.

Затем в варианте осуществления настоящего изобретения оптимальную экспрессию белка оболочки CVB индуцировали IPTG при концентрации 0,25-1 мМ при температуре около 25°С в течение 3,5-4 часов.

Кроме того, в варианте осуществления настоящего изобретения полученный белок оболочки CVB секвенировали известными способами секвенирования.

Еще в одном варианте осуществления настоящего изобретения очистку белка оболочки CVB выполняли известным способом.

В еще одном варианте осуществления изобретения три раза выполняли иммунизацию кроликов с очищенным белком оболочки CVB и полным адъювантом Фрейнда в отношении 1:1 с недельными интервалами.

В еще одном варианте осуществления настоящего изобретения иммунизацию проводили внутримышечно, подкожно или внутривенно.

В следующем варианте осуществления настоящего изобретения через 14-15 дней у кроликов собирали кровь, для того чтобы получить поликлональные антитела к белку оболочки CVB.

В следующем варианте осуществления настоящего изобретения поликлональные антитела к белку оболочки CVB очищали от сыворотки известными способами.

В следующем варианте осуществления настоящего изобретения титрационные микропланшеты сенсибилизировали поликлональными антителами, разведенными в сенсибилизирующем буфере в отношении от 1:500 до 1:1000 с последующей промывкой PBS-T 4-5 раз.

В следующем варианте осуществления настоящего изобретения тестируемые образцы приготавливали в титрационных микропланшетах вымачиванием зараженной листовой ткани растения с экстракционным буфером с последующим разбавлением от Ix - 1/150х исходного антигена.

В еще одном варианте осуществления настоящего изобретения титрационный микропланшет инкубировали в течение ночи приблизительно при 37°С с последующей отмывкой, чтобы позволить антигену покрыть стенки.

В следующем варианте осуществления настоящего изобретения добавляли конъюгат антител в буфере ECI в отношении от 1:500 до 1:1000 в течение 2 часов при приблизительно 37°С с последующей промывкой PBS-T.

В другом варианте осуществления настоящего изобретения в смесь добавляли около 100 мкл раствора р-нитрофенил фосфата (приблизительно 1 мг/мл) в буфере PNP.

В еще одном варианте осуществления настоящего изобретения реакцию останавливали добавлением около 50 мкл приблизительно 3М NaOH через 15-20 мин для получения продукта желтого цвета.

В следующем варианте осуществления настоящего изобретения цветной продукт является конъюгатом антигена и антитела.

Еще в одном варианте осуществления настоящего изобретения для обнаружения вируса В хризантем (CVB) оптическую плотность окрашенного продукта измеряли при 405 нм.

Настоящее изобретение также обеспечивает диагностический набор, пригодный для обнаружения белка оболочки вируса В хризантем (CVB), включающий:

a) поликлональные антитела к белку оболочки вируса В хризантем (CVB) у растений;

b) конъюгат, меченый щелочной фосфатазой;

c) сенсибилизирующий буфер;

d) экстракционный буфер;

e) буфер ECI;

f) буфер PNP.

Следующие примеры даны в качестве иллюстрации настоящего изобретения, и их не следует истолковывать как ограничивающие рамки настоящего изобретения.

Сведения, подтверждающие возможность осуществления изобретения

Пример 1

Обнаружение вируса В хризантем в хризантемах

Для того чтобы проверить активность набора, различные разновидности хризантем были протестированы методом DAS-ELISA. Образцы экстрагировали сходным образом, как описано в DAS-ELISA. Одновременно они также были протестированы с помощью стандартного (референс) набора BIORAD (США). Полученные антитела были протестированы на недавно открытых изолятах, включая изоляты, подобные русским изолятам, о которых сообщалось ранее, и было показано, что антитела эффективно обнаруживают все изоляты. Референс-набор слабо выявлял другие изоляты, тогда как антитела по изобретению позволяли надежно обнаружить протестированные изоляты. Результаты суммированы в таблице.

DAS-ELISA

1. Планшеты (Nunc Immuno TM plate, Denmark) сенсибилизировали 100 мкл поликлональных антител (разведенных 1:10,000) в сенсибилизирующем буфере и затем инкубировали в течение ночи при 4°С во влажной камере.

2. Планшеты промывали пять раз PBS-T.

3. Антиген получали вымачиванием листовой ткани в экстракционном буфере 1 г/2 мл. Некоторые разведения были сделаны соответственно 1х-1/150х разведению первичного антигена, 100 мкл разведенного антигена добавляли в лунки микротитровального планшета согласно схеме и инкубировали при 37°С в течение двух часов во влажной камере для того, чтобы дать антигену покрыть стенки.

4. Были повторены стадии промывки, и конъюгат (разведенный 1:500) в буфере ЕС1 добавляли в лунки (100 мкл/лунку). Планшеты инкубировали в течение 2 часов при 37°С во влажной камере.

5. После промывания планшета PBST к лункам добавляли 100 мкл раствора (1 мг/мл) р-нитрофенил фосфата, в буфере PNP (10% раствор диэтаноламина, доведенный до рН 9,8 HCl).

6. После того, как появлялся соответствующий цвет (15-20 мин), реакцию останавливали добавлением 50 мкл 3М NaOH в каждую лунку.

7. Были также сделаны положительные и отрицательные контроли на том же самом планшете. Оптическую плотность измеряли при 405 нм с помощью мультиканального спектрофотометра (ридера). Реакция считалась положительной, если наблюдаемая оптическая плотность была выше чем 0,1, что было в три раза больше, чем в отрицательном контроле.

Набор реагировал хорошо с положительным образцом, тогда как в отрицательном контрольном образце - безрезультатно. Был выбран титр 1:10,000.

Сенсибилизирующий буфер: (0,05 М на литр): 1,59 мг карбоната натрия и 2,93 мг бикарбоната натрия, рН 9,6.

PBST буфер: 20 мМ фосфата натрия рН 7,4; 150 мМ NaCl и 0,05% (в/в) Tween 20.

Экстракционный буфер: 1,3 г сульфита натрия (безводного), 20 г поливинилпирролидона (PVP) MW24 - 40,000, 0,2 г азида натрия, 2,0 г порошкообразного яичного альбумина класса II и 20,0 г Tween-20 растворяли в 1000 мл на 1XPBST и доводили рН до значения 7,4.

ECI буфер; 2,0 г BSA, 20,0 г PVP 24-40,000 и 0,2 г азида натрия растворяли в 1000 мл IxPBST и доводили рН до значения 7,4.

PNP буфер: 0,1 г хлорида магния, 0,2 г азида натрия и 97 мл диэтаноламина растворяли в 800 мл дистиллированной воды и доводили до объема 1000 мл и до значения рН 9,8.

S.No Разновидности Набор по изобретению Референс-набор
1. Pink Gin +++ +
2. Funshine ++ +
3. Inga + +
4. Regol Time +++ +
5. Royal Mundial + +
6. Bronze Mundial + +
7. Otome Zakura + +
8. Tichmg Queen - -
9. Mundial ++ +
10. Shymal ++ +
11. Chandrama + +
12. White Stafour +++ +
13. Fish Tail + +
14. Pancho ++ +
15. Akita ++ +
16. White Prolific +++ +
17. Pink Casket +++ +
18. Dignity + +
19. Jyoti - -
20. Penny Lane + +
21. Jubilee ++ +
22. Vasantika ++ +
23. Nanako + +
24. Kundan + +
25. Himani +++ +
26. Birbal Sahni + +
27. Jaya + +
28. Flirt ++ +
29. Lilith - -
30. Sharad Shobha +++ +
31. Megani + +
32. Jayanti ++ +
33. Niharika ++ +
34. Snow Ball + +
35. Meghdoot - -
36. White Shoesmith ++ +
(-) - Отрицательная реакция,
(+++) - Сильная реакция,
(++) - Умеренная реакция,
(+) - Слабая реакция

Пример 2

Получение антисыворотки

Очищенный рекомбинантный белок оболочки использовали в качестве антигена для иммунизации кролика. Для получения гипериммунной сыворотки к CVB использовали здоровых белых самцов Новозеландских кроликов-альбиносов приблизительно шестимесячного возраста. Антиген (около 100 мкг на инъекцию) смешивали с адъювантом Фрейнда в отношении 1:1 и вводили внутримышечно и подкожно в бедренные мышцы кроликов. Первые две инъекции были сделаны вместе с полным адъювантом Фрейнда с интервалом в одну неделю. Подобным образом третью и четвертую инъекции давали вместе с неполным адъювантом Фрейнда (1:1) с интервалом в одну неделю. После двухнедельной иммунизации у животных отбирали кровь из маргинальной ушной вены. Кровь собирали в стеклянные пробирки и давали свернуться при комнатной температуре в течение часа. Потом стеклянную пробирку, содержащую свернувшуюся кровь, оставляли при 4°С в течение ночи. Сыворотку собирали, используя пастеровскую пипетку, и центрифугировали при 5000 об/мин в течение десяти минут при 2-6°С. Супернатант собирали и хранили при 4°С после добавления азида натрия до концентрации 0,2% (в/об). Чтобы собрать больше сыворотки, были сделаны повторные инъекции через 5, 12, 16 и 22 недели после первой инъекции. Для референса и серологического исследования использовали антисыворотку к CERV от BioRad, США.

Очистка антитела (Отделение IgG от целой сыворотки):

А) Осаждением (преципитацией) сульфатом аммония:

1. Дистиллированную воду (9 мл) добавляли к 1 мл необработанной антисыворотки.

2. Медленно по каплям добавляли 10 мл нейтрализованного насыщенного сульфата аммония (Sigma) и инкубировали при непрерывном перемешивании.

3. После перемешивания оставляли при комнатной температуре в течение приблизительно 1 часа. Получающийся раствор должен иметь вид вязкий и мутный вследствие осаждения антител, т.е. IgG.

4. Раствор центрифугировали при 9000 g в течение 15 мин, и осадок промывали 2 мл разведенного (half-strength) PBS. Стадию промывки повторяли три раза, для того чтобы удалить следы сульфата аммония.

5. Окончательно осадок растворяли в 1 мл разведенного PBS.

6. OD измеряли при длине волны 280 нм.

7. Антитела разбавляли до конечной концентрации 1 мг/мл (показание OD 1,4=1 мг/мл).

8. Аликвоты 1 мл с 0,02% (в/об) азида натрия хранили при -20°С для дальнейшего использования.

PBS (100 мл): Na2HPO4·12H2O=5,8 gm; NaH2PO4·2H2O=1,0 gm; NaCl=8,76 gm.

В) Аффинной хроматографией:

1. Белок А - сефароза (Sigma) оставляли до набухания и помещали в колонку.

2. Колонку промывали уравновешивающим буфером.

3. Сыворотку разбавляли и пропускали через колонку с определенной скоростью.

4. Несвязанные белки отмывали PBS до исчезновения белка (по спектрофотометру).

5. Связавшийся белок (IgG) элюировали элюирующим буфером.

6. рН нейтрализовали Tris HCl.

7. Колонку восстанавливали промывкой либо уравновешивающими буфером, либо буфером для хранения. Затем сорбент хранили в буфере для хранения при 4°С.

8. Элюат диализировали трижды против PBS и хранили при -20°С до дальнейшего использования.

PBS (100 мл): Na2HPO4·12H2О=5,8 мг; NaH2PO4·2H2O=1,0 мг; NaCl=8,76 мг.

Уравновешивающий буфер (5Х): Tris - 0,05 М; NaCl - 0,15 М, рН 8,6.

Буфер для хранения: Na2HPO4 - 0,05 М; Thomersol - 0,05%, рН 6,0

Элюирующий буфер: CH3COONa - 0,5 М; NaCl - 0,15 М, рН 4,5

Получение коньюгата антитело фермент (со щелочной фосфатазой):

1. 1 мг щелочной фосфатазы (Sigma) растворяли в 2 мл очищенных антител.

2. Свежий глютеральдегид (25% сток, Merck) добавляли к раствору до конечной концентрации 0,05% и хорошо перемешивали.

3. Инкубировали при комнатной температуре в течение 4 час. Наблюдался слабый коричневый цвет.

4. Через 4 часа центрифугировали при 9000 g в течение 20 мин.

5. Осадок отмывали дважды с разведенным PBS и растворяли в 2 мл разведенного PBS.

6. Растворяли в том же буфере бычий сывороточный альбумин (BSA) до 5 мг/мл и азид натрия до 0,02% (в/об) для увеличения времени полужизни. Хранили при 4°С до дальнейшего использования.

Определение коньюгата щелочной фосфатазы

Активность коньюгата проверяли с помощью DAS-ELISA, как описано в примерах, приведенных в полном описании патента, используя известные положительные и отрицательные образцы, и также титровали.

Преимущества

Главными преимуществами настоящего изобретения являются:

1. Хризантема входит в число первых десяти срезаемых цветочных культур внутри страны, а также и в международном цветоводстве (Floriculture Trade). Так как на цветоводство сильно влияет CVB, который понижает качество цветов и урожай, для того чтобы создавать свободный от болезни материал для размножения и селекции здоровых растений применение местного диагностического набора является абсолютно необходимым, т.к. он помогает в управлении растительными вирусами.

2. Набор, являющийся поликлональным по природе, может обнаружить все штаммы CVB.

3. Набор может обнаружить CVB в различных культиварах хризантем, давая более сильную реакцию по сравнению с референс-набором (таблица).

4. Все компоненты набора можно хранить при 4°С без какой-либо потери активности, тогда как некоторые компоненты референс-набора следует хранить при -20°С.

5. Очистка экспрессированного белка увеличивает чистоту и длительность поставки антигена.

6. Являясь местным, диагностический набор является также экономически эффективным.

7. Разработанный диагностический набор можно использовать для скрининга свободных от вируса культур тканей выращиваемых растений.

8. Разработанный диагностический набор можно использовать для понимания эпидемиологии болезни и прогнозирования болезни CVB.

9. Разработанный диагностический набор можно применять для контроля (мониторинга) вируса в переносчиках инфекции и сорняках.

10. CVB диагностический набор можно использовать при проведении растительного карантина, таким образом содействуя экспорту и импорту хризантем.

11. CVB диагностический набор можно использовать при выращивании источника Хризантем, свободного от вируса.

1. Диагностический набор, применимый для обнаружения вируса В Chrysanthemum (CVB), включающий:
(a) поликлональные антитела к белку оболочки вируса В Chrysanthemum (CVB) у растений, причем данный белок оболочки получают путем амплификации очищенного гена белка оболочки CVB с помощью заданных праймеров:
прямого праймера с последовательностью SEQ ID №1: ATGCCTCCCAAACCGGCACCAGGTGAT
и обратного праймера с последовательностью SEQ ID №2: TTTATAATGTCTTATTATTCGCAT;
(b) конъюгат антител, меченных щелочной фосфатазой;
(c) фиксирующий буфер;
(d) экстракционный буфер;
(e) буфер ECI;
(f) буфер PNP.

2. Способ обнаружения вируса В Chrysanthemum (CVB) у растений, включающий стадии:
(а) амплификации гена белка оболочки CVB с помощью заданных праймеров:
прямого праймера с последовательностью SEQ ID №1: ATGCCTCCCAAACCGGCACCAGGTGAT
и обратного праймера с последовательностью SEQ ID №2: TTTATAATGTCTTATTATTCGCAT, причем эти праймеры содержат сайты расщепления рестрикционными ферментами, пригодные для направленного клонирования в одной рамке считывания в векторе pGex-2ТК;
(b) клонирования амплифицированного гена белка оболочки из стадии (а) в вектор pGex-2TK путем трансформации компетентных клеток BL21 Е.coli;
(c) индуцирования трансформированных клеток Е.coli из стадии (b) в среде YT, способствующей оптимальной экспрессии для получения рекомбинантного белка оболочки в растворимой форме;
(d) очистки рекомбинантного белка оболочки из стадии (с) для получения очищенного белка оболочки CVB;
(e) получения поликлональных антител к очищенному белку оболочки CVB из стадии (d), причем данные поликлональные антитела получают путем иммунизации кроликов с использованием в качестве антигена очищенного белка оболочки CVB из стадии (d);
(f) получения конъюгата антител путем мечения поликлональных антител из стадии (е) щелочной фосфатазой;
(g) выполнения прямого антительного твердофазного иммуноферментного сэндвич-анализа (DAS ELISA) для обнаружения CVB с помощью поликлональных антител из стадии (е) и конъюгата антител из стадии (f).

3. Способ по п.2, в котором полный белок оболочки CVB подвергают амплификации из хризантем с помощью заданных праймеров: прямого праймера с последовательностью SEQ ID №1: ATGCCTCCCAAACCGGCACCAGGTGAT
и обратного праймера с последовательностью SEQ ID №2: TTTATAATGTCTTATTATTCGCAT.

4. Способ по п.2, в котором оптимальная экспрессия рекомбинантного белка оболочки CVB проверяется при концентрации IPTG 0,25-1 мМ при температуре 25°С в течение 3,5-4 часов.

5. Способ по п.2, в котором очистка рекомбинантного белка оболочки проводится методом осаждения сульфатом аммония или методом аффинной хроматографии, предпочтительно методом аффинной хроматографии.

6. Способ по п.2, в котором иммунизация кроликов проводится 4 раза с помощью очищенного белка оболочки из стадии 2(d) и полного адъюванта Фрейнда в соотношении 1:1 с интервалом в 1 неделю.

7. Способ по п.2, в котором иммунизация кроликов может проводиться внутримышечно, подкожно или внутривенно.

8. Способ по п.2, в котором поликлональные антитела к белку оболочки CVB очищают из сыворотки крови центрифугированием.

9. Способ по п.2, в котором при выполнении прямого антительного твердофазного иммуноферментного сэндвич-анализа (DAS ELISA) микротитровальные планшеты покрывают поликлональными антителами при разведении их фиксирующим буфером в пределах от 1:500 до 1:1000 с последующей отмывкой 4-5 раз с помощью PBS-T.

10. Способ по п.9, в котором для фиксации антигена в лунках микротитровальные планшеты инкубируют при 4°С в течение ночи или при 37°С в течение 2 ч с последующей отмывкой.

11. Способ по п.9, в котором для получения смеси в лунки добавляют конъюгат антител из стадии 2(f) в буфере ECI в разведении от 1:500 до 1:1000 примерно на 2 ч при 37°С с последующей отмывкой с помощью PBS-T.

12. Способ по п.9, в котором в смесь по п.11 добавляют 100 мкл раствора n-нитрофенилфосфата 1 мг/мл в буфере PNP.

13. Способ по п.9, в котором реакцию через 15-20 мин останавливают добавлением 50 мкл 3М NaOH для получения продукта желтого цвета.

14. Способ по п.13, в котором полученный окрашенный продукт представляет n-нитрофенол, образовавшийся при реакции фермента щелочной фосфатазы с n-нитрофенилфосфатом.

15. Способ по п.13, в котором для обнаружения вируса В Chrysanthemum (CVB) измеряют поглощение окрашенного продукта при 405 нм.



 

Похожие патенты:

Изобретение относится к медицине, касается диагностики в области венерологии и может быть использовано для диагностики и профилактики транзиторной и персистирующей латентной папилломавирусной инфекции.
Изобретение относится к области медицины, в частности к лабораторным исследованиям, и может быть использовано при выборе тактики лечения тонзиллитов. .
Изобретение относится к медицине и может использоваться для экспресс-определения тяжести состояния больного ожоговой болезнью. .

Изобретение относится к медицине и касается применения соединений полианилина в качестве сорбента для удаления вирусов, белков невирусной природы и в качестве матрицы для получения иммуносорбента и может быть использовано в диагностических целях, для дезактивации и удаления вирусов из окружающей среды.
Изобретение относится к ветеринарии, а именно к диагностике вирусных заболеваний крупного рогатого скота. .
Изобретение относится к медицине, а именно к лабораторной диагностике туляремии у людей, и касается дифференциации инфекционного и поствакцинального антительного ответа при туляремии у человека.
Изобретение относится к способам лабораторной диагностики микоплазмозов и может быть использовано в ветеринарной медицине. .
Изобретение относится к ветеринарной микробиологии. .
Изобретение относится к ветеринарной микробиологии и биотехнологии и может быть использовано при разработке средств специфической диагностики эшерихиозов. .

Изобретение относится к области медицины и касается новых мутаций, комбинаций мутаций или мутационных профилей генов обратной транскриптазы ВИЧ-1 и/или протеазы, коррелирующих с фенотипической резистентностью к лекарственным средствам против ВИЧ.
Изобретение относится к области медицины, медицинской токсикологии, микробиологии, биологии. .

Изобретение относится к микробиологии и экологии, в частности к способам моделирования симбиоза (биоценоза) возбудителя чумы с сапрофитными микроорганизмами и последующего выявления клеток Yersinia pestis в этом симбиозе.

Изобретение относится к области медицины и биотехнологии и касается способа анализа активности in vitro для ДНК-полимеразы вируса гепатита В (НВV) человека, который предусматривает использование в качестве 5'-олигонуклеотида в ПЦР-амплификации ДНК-полимеразы НВV из пробы олигонуклеотида, в который был встроен промотор SP6-вирусной полимеразы, прямую транскрипцию и трансляцию ПЦР-продуктов в присутствии радиоактивно меченого агента и измерение праймирования ДНК-полимеразы НВV.

Изобретение относится к биотехнологии, вирусологии и иммунологии и может быть использовано для создания вакцины против вируса классической свиной лихорадки (CSFV). .

Изобретение относится к области медицины, в частности, описаны системы и способы, которые могут быть использованы для тестирования донорских материалов крови или плазмы в целях обнаружения конкретных донорских проб, инфицированных вирусом.

Изобретение относится к медицине и предлагает вакцину, содержащую иммуноген вируса козьего артрита-энцефалита (CAEV) и фармацевтически приемлемый носитель. .

Создание диагностического набора для обнаружения вируса в хризантемы

Наверх