Субъединичная вакцина против mycoplasma spp.

Изобретение относится к области биотехнологии, конкретно к получению субъединичных вакцин против Mycoplasma spp., и может быть использовано в медицине для профилактики инфекции Mycoplasma spp. Предложены вакцинные композиции на основе белка Mhp145 с SEQ ID NO: 11 в сочетании с фармацевтически приемлемым адъювантом, белком XylF с SEQ ID NO: 09 и/или фармацевтически приемлемой добавкой. Изобретение обеспечивает достижение сильных иммунных эффектов против Mycoplasma spp. 3 н. и 3 з.п. ф-лы, 4 ил., 9 табл., 3 пр.

 

Область техники, к которой относится изобретение

Это раскрытие относится к вакцине против Mycoplasma spp.; в частности, к субъединичной вакцине против Mycoplasma spp.

Уровень техники

Mycoplasma spp. является известной в настоящее время мельчайшей бактерией, способной к саморепликации вне клеток хозяина. Хотя энзоотическая пневмония свиней не должна вызывать смерть свиньи, она снижает эффективность кормления и вызывает замедление роста, воспаление и иммуносупрессию, а также делает свинью более восприимчивой к инфекции другими патогенами, что вследствие этого приводит к экономическому ущербу для производства.

На настоящий момент энзоотическую пневмонию свиней предотвращают тремя главными стратегиями, включая: введение лекарственного средства, контроль состояния окружающей среды и вакцинацию. Учитывая плохую предотвращающую эффективность антибиотиков от Mycoplasma hyopneumoniae, введение лекарственного средства может быть использовано только в целях лечения, и удовлетворение потребностей в профилактике представляет сложность. Кроме того, принимая во внимание то, что лекарственная зависимость может привести к более сильной инфекции, вызываемой посредством резистентных к лекарственным средствам бактерий, для введения лекарственного средства требуются меры предосторожности и существует множество ограничений.

Контроль состояния окружающей среды формирует основу профилактики инфекции Mycoplasma spp. Хорошая санитарная обработка и управление свиноводческими помещениями были бы полезными для снижения частоты инфекции. С другой стороны, профилактика могла бы быть более полноценной при вакцинации.

В обычных вакцинах в данной области используются неактивные/мертвые бактерии в качестве активного ингредиента. Однако стоимость обычных вакцин является слишком высокой из-за того, что Mycoplasma spp. являются прихотливыми бактериями и их трудно культивировать в лаборатории. Для того, чтобы снизить стоимость вакцин Mycoplasma spp., ученые непрерывно пытаются разработать вакцины различных типов, такие как: (1) аттенуированные вакцины, (2) векторные вакцины, (3) субъединичные вакцины и (4) ДНК вакцины. Среди них, субъединичные вакцины демонстрируют наибольшую эффективность из-за преимуществ в легкости производства и высокой безопасности.

К настоящему времени существует несколько потенциальных белков-кандидатов, которые могли бы быть использованы для вакцин M. hyopneumoniae; однако нет дополнительных сообщений, подтверждающих, что такие белки пригодны для вакцин M. hyopneumoniae.

Краткое описание изобретения

В свете вышеприведенного, одна из задач настоящего изобретения заключается в получении антигенов, пригодных для использования в вакцинах M. hyopneumoniae, с получением, посредством этого новых вакцин M. Hyopneumoniae, так, что стоимость профилактики может быть снижена.

Другая задача настоящего изобретения заключается в получении комбинации антигенов, которые пригодны для использования в вакцинах M. hyopneumoniae, с получением, посредством этого, субъединичных вакцин с лучшими характеристиками; вследствие этого будет иметь место большее количество вариантов для целей профилактики.

Для решения вышеуказанных задач, настоящее изобретение относится к рекомбинантному белку для получения вакцины для профилактики инфекции Mycoplasma spp., включающему аминокислотную последовательность SEQ ID NO: 08, SEQ ID NO: 09, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 или их комбинацию.

Настоящее изобретение также относится к вакцине для профилактики инфекции Mycoplasma spp., содержащей: активный ингредиент, содержащий белок PdhA, XylF, EutD, Mhp145, P78, P132, Mhp389 или их комбинацию; и фармацевтически приемлемый адъювант.

Предпочтительно указанный активный ингредиент имеет концентрацию от 50 до 3500 мкг/мл в расчете на общий объем указанной вакцины.

Предпочтительно, указанный активный ингредиент содержит по меньшей мере два белка, выбранных из группы, состоящей из PdhA, XylF, EutD, Mhp145, P78, P132 и Mhp389.

Предпочтительно, указанный активный ингредиент содержит PdhA и P78.

Предпочтительно, указанный активный ингредиент содержит XylF и Mhp145.

Предпочтительно, указанный фармацевтически приемлемый адъювант представляет собой полный адъювант Фрейнда, неполный адъювант Фрейнда, алюмогель, поверхностно-активное вещество, полианионный адъювант, пептид, масляную эмульсию или их комбинацию.

Предпочтительно, указанная вакцина дополнительно содержит фармацевтически приемлемую добавку.

Предпочтительно, указанная фармацевтически приемлемая добавка представляет собой растворитель, стабилизатор, разбавитель, консервант, антибактериальный агент, противогрибковый агент, изотонический агент, замедляющий абсорбцию агент или их комбинацию.

Настоящее изобретение дополнительно относится к вакцине для профилактики инфекции Mycoplasma spp., содержащей: активный ингредиент, содержащий аминокислотную последовательность SEQ ID NO: 08, SEQ ID NO: 09, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 или их комбинацию; и фармацевтически приемлемый адъювант.

Предпочтительно, указанный активный ингредиент имеет концентрацию от 50 до 3500 мкг/мл в расчете на общий объем указанной вакцины.

Предпочтительно, указанный активный ингредиент содержит по меньшей мере две аминокислотные последовательности, выбранные из группы, состоящей из SEQ ID NO: 08, SEQ ID NO: 09, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 и SEQ ID NO: 14.

Предпочтительно, указанный активный ингредиент содержит аминокислотные последовательности SEQ ID NO: и SEQ ID NO: 12.

Предпочтительно, указанный активный ингредиент содержит аминокислотные последовательности SEQ ID NO: 09 и SEQ ID NO: 11.

Предпочтительно, указанный фармацевтически приемлемый адъювант представляет собой полный адъювант Фрейнда, неполный адъювант Фрейнда, алюмогель, поверхностно-активное вещество, полианионный адъювант, пептид, масляную эмульсию или их комбинацию.

Предпочтительно, указанная вакцина дополнительно содержит фармацевтически приемлемую добавку.

Предпочтительно, указанная фармацевтически приемлемая добавка представляет собой растворитель, стабилизатор, разбавитель, консервант, антибактериальный агент, противогрибковый агент, изотонический агент, замедляющий абсорбцию агент или их комбинацию.

Настоящее изобретение также относится к экспрессионному вектору для профилактики инфекции Mycoplasma spp., содержащему: плазмиду; где указанная плазмида содержит: нуклеотидную последовательность, содержащую по меньшей мере одну последовательность, выбранную из группы, состоящей из SEQ ID NO: 01, SEQ ID NO: 02, SEQ ID NO: 03, SEQ ID NO: 04, SEQ ID NO: 05, SEQ ID NO: 06 и SEQ ID NO: 07; и регуляторный элемент.

Предпочтительно, указанный регуляторный элемент содержит промотор и сайт связывания рибосомы.

Предпочтительно, указанная плазмида представляет собой pET-MSY, pET-YjgD, pET-D или pET-SUMO.

Предпочтительно, указанная плазмида дополнительно содержит ген, кодирующий партнер слияния.

Предпочтительно, указанный партнер слияния представляет собой msyB E. coli, yjgD E. coli, белок D бактериофага лямбда или SUMO S. cerevisiae.

Предпочтительно, указанный экспрессионный вектор используется в системе экспрессии генов E. coli.

В целом, настоящее изобретение относится к антигенам, которые пригодны для использования в качестве активного ингредиента субъединичной вакцины M. hyopneumoniae, и к субъединичной вакцине M. hyopneumoniae, полученной с их использованием. Субъединичная вакцина по настоящему изобретению может быть не только эффективно использована в целях профилактики для снижения ее стоимости, раскрытие настоящего изобретения также демонстрирует, что “коктейльная” субъединичная вакцина (т.е. имеющая по меньшей мере два антигена в качестве активных ингредиентов) с использованием по меньшей мере двух антигенов по настоящему изобретению имеет улучшенную индукцию иммунного ответа.

Краткое описание чертежей

Фигура 1 демонстрирует результат двумерного электрофореза белков в геле, проведенного в 1ом примере данного изобретения.

Фигура 2 демонстрирует результат цветной реакции Вестерн-блота, проведенного в 1ом примере данного изобретения.

Фигура 3 демонстрирует результат электрофореза продуктов ПЦР, полученных во 2ом примере данного изобретения.

Фигура 4 демонстрирует записи стимуляционных экспериментов, проведенных в 3ем примере данного изобретения.

Описание ссылочных позиций на фигурах:

1 XylF (связывающий ксилозу липопротеин)

2 XylF (связывающий ксилозу липопротеин)

3 XylF (связывающий ксилозу липопротеин)

4 PdhA (E1-альфа субъединица пируватдегидрогеназы)

5 Mhp145 (периплазматический связывающий сахар белок)

6 EutD (фосфотрансацетилаза)

7 EutD (фосфотрансацетилаза)

8 Mhp389

9 P78 (липопротеин)

10 P132

Подробное описание изобретения

Одна из ключевых целей данного изобретения заключалась в обзоре потенциальных кандидатных антигенов, пригодных для субъединичных вакцин, с использованием двумерного электрофореза белков в геле наряду с технологией иммунологического скринирования, и в идентифицировании антигенов посредством масс-спектрометра. Затем, характеристики субъединичных вакцин по данному изобретению подтверждали экспериментами с моделями на животном.

Кратко, ход выполнения данного изобретения являлся следующим:

(1) Индуцирование иммунного ответа экспериментальных свиней инъецированием общепринятой вакциной M. hyopneumoniae и получением сыворотки, содержащей антитела кM. hyopneumoniae. (2) Получение тотального белка M. hyopneumoniae для двумерного электрофореза белков в геле. (3) Проведение гибридизации результата двумерного электрофореза белков в геле этапа (2) с использованием сыворотки этапа (1) в качестве 1ого антитела и затем сбор белков, являющихся позитивными (т.е. кандидатными антигенами) из геля после амплификации 2ым антителом и последующей процедуры визуализации. (4) Идентификация кандидатных антигенов, полученных в этапе (3). (5) Экспрессирование указанных кандидатных антигенов в больших количествах с использованием системы экспрессии генов E. coli. (6) Исследование эффективности субъединичных вакцин по данному изобретению в уменьшении патологических проявлений в легком экспериментами стимуляции свиньи и, посредством этого проверяя ценность указанных кандидатных антигенов при использовании в качестве активного ингредиента субъединичной вакцины.

Вакцина для профилактики инфекции Mycoplasma spp. по данному изобретению содержит активный ингредиент и фармацевтически приемлемый адъювант.

В одном варианте осуществления данного изобретения, указанный активный ингредиент может представлять собой PdhA, XylF, EutD, Mhp145, P78, P132 или Mhp389. В альтернативном варианте осуществления при условии, что антигенная детерминанта любого из вышеуказанных белков не нарушается, указанный активный ингредиент может представлять собой слитый белок любых двух из вышеуказанных белков. В другом альтернативном варианте осуществления указанный активный ингредиент содержит по меньшей мере два из вышеуказанных белков; то есть является так называемой “коктейльной” вакциной по данному изобретению.

В другом варианте осуществления данного изобретения указанный активный ингредиент может содержать аминокислотную последовательность SEQ ID NO: 08, SEQ ID NO: 09, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 или их комбинацию. В альтернативном варианте осуществления при условии, что антигенная детерминанта, образованная укладкой пептида указанной аминокислотной последовательности, не нарушается, указанный активный ингредиент может представлять собой слитый белок с по меньшей мере двумя указанными последовательностями. В другом альтернативном варианте осуществления указанный активный ингредиент содержит два или более белков, соответственно содержащих одну из вышеуказанных аминокислотных последовательностей; то есть является так называемой “коктейльной” вакциной по данному изобретению.

Указанный фармацевтически приемлемый адъювант используется для улучшения иммунного эффекта указанного активного ингредиента, стабилизируя указанный активный ингредиент и/или увеличивая безопасность вакцин. Указанный фармацевтически приемлемый адъювант по данному изобретению включает в себя, но не ограничен ими: полный адъювант Фрейнда, неполный адъювант Фрейнда, алюмогель, поверхностно-активное вещество, полианионный адъювант, пептид, масляную эмульсию или их комбинацию.

Вакцина по данному изобретению может иметь один или по меньшей мере два указанных активных ингредиента (т.е. коктейльная вакцина). В одном примере вакцины по данному изобретению указанный активный ингредиент имеет концентрацию от 50 до 3500 мкг/мл в расчете на общий объем указанной вакцины. В предпочтительном варианте осуществления данного изобретения, когда указанная вакцина содержит только один указанный активный ингредиент, указанный активный ингредиент имеет концентрацию от 50 до 500 мкг/мл в расчете на общий объем указанной вакцины. В альтернативном варианте осуществления данного изобретения, вакцина по данному изобретению содержит по меньшей мере один указанный активный ингредиент; где общая концентрация указанного активного ингредиента(ов), содержащаяся в указанной вакцине, составляет от 50 до 1000 мкг/мл, от 50 до 1500 мкг/мл, от 50 до 2000 мкг/мл, от 50 до 2500 мкг/мл, от 50 до 3000 мкг/мл или от 50 до 3500 мкг/мл в расчете на общий объем указанной вакцины.

Другой аспект данного изобретения заключается в предоставлении экспрессионного вектора для профилактики инфекции Mycoplasma spp. Конкретно, указанный экспрессионный вектор может быть использован для системы экспрессии генов E. coli. Тем не менее, не выходя за рамки основной идеи данного изобретения, рядовой специалист в данной области может модифицировать указанные векторы на основании данного открытия и сделать указанный вектор пригодным для другой системы экспрессии генов, что все еще будет находиться в рамках объема данного изобретения.

Указанный экспрессионный вектор содержит плазмиду. Указанная плазмида содержит: нуклеотидную последовательность, содержащую по меньшей мере одну последовательность, выбранную из группы, состоящей из SEQ ID NO: 01, SEQ ID NO: 02, SEQ ID NO: 03, SEQ ID NO: 04, SEQ ID NO: 05, SEQ ID NO: 06, SEQ ID NO: 07 и их комбинацию; и регуляторный элемент.

Указанный вектор используется в системе экспрессии генов E. coli и для продуцирования антигенов по данному изобретению посредством E. coli. Другими словами, указанная нуклеотидная последовательность может быть транслирована в амино последовательность антигена по данному изобретению посредством системы экспрессии генов E. coli, и затем аминокислотная последовательность может быть уложена в антиген по данному изобретению.

В альтернативном варианте осуществления при условии, что функционирование системы экспрессии генов E. coli не блокировано и производство указанной нуклеотидной последовательности и укладка являющейся ее результатом аминокислотной последовательности не нарушены, указанная плазмида может содержать две или более указанных нуклеотидных последовательностей.

Указанный регуляторный элемент относится к элементу, требующемуся для инициирования транскрипции и трансляции в системе экспрессии. Указанный регуляторный элемент должен по меньшей мере содержать промотор и сайт связывания рибосомы. Предпочтительно указанный регуляторный элемент может дополнительно содержать: операторную, энхансерную последовательность или их комбинацию.

В предпочтительном варианте осуществления данного изобретения, указанная плазмида дополнительно содержит ген, кодирующий партнер слияния. Указанный партнер слияния включает в себя, но не ограничен ими msyB E. coli, yjgD E. coli, белок D бактериофага лямбда или SUMO S. cerevisiae. Указанный MsyB имеет высокое содержание кислотных аминокислот и должен способствовать улучшению растворимости белков, которые должны быть продуцированы.

Последующие примеры, излагают испытания и эксперименты данного изобретения для того, чтобы дополнительно объяснить признаки и преимущества данного изобретения. Необходимо отметить, что последующие примеры являются иллюстративными и не должны быть использованы для ограничения объема притязаний данного изобретения.

Пример 1: Скринирование на кандидатные антигены, пригодные для использования в качестве активного ингредиента субъединичной вакцины.

Приготовление сыворотки, содержащей антитело против свиного Mycoplasm spp.

В соответствии с исследованиями из свиньи может быть выделено семь Mycoplasm spp.: Mycoplasm hyopneumoniae, Mycoplasma hyorhinis, Mycoplasma hyosynoviae, Mycoplasma flocculare, Mycoplasma hyopharyngis, Mycoplasma sualvi, Mycoplasma bovigenitalium (Gourlay et al., 1978; Blank et al., 1996; Assuncao et al., 2005). Среди них, M. hyopneumoniae является главным патогеном энзоотической пневмонии свиней с уровнем заболеваемости от 25 до 93%. Вследствие этого в данном изобретении использовали M. hyopneumoniae (PRIT-5 strain) для иммунных протеомных исследований и в качестве источников генов, кодирующих антигены. Среду Фриза (Friis et al., 1975) использовали для культивирования M.hyopneumoniae. В соответствии со схемой эксперимента соответствующее количество антибиотика или агар 1,5% добавляли для формирования твердой среды.

Три SPF свиньи возрастом 4 недели были доставлены из Научно-исследовательского института сельскохозяйственной технологии и их кормили одинаковым кормом и держали при одинаковых окружающих условиях и условиях роста в свинарнике перед экспериментами.

После того, как свиней вскармливали до возраста 32 дня, 46 дней и 60 дней, свиньям вводили 2 мл вакцины Bayovac® MH-PRIT-5 (M. hyopneumoniae PRIT-5) посредством внутримышечной инъекции. Затем свиней непрерывно вскармливали до возраста 74 дня и отбирали кровь из их яремной вены. Отобранную кровь помещали в условия комнатной температуры на 1 час и хранили при 4°C. На следующий день отобранную кровь центрифугировали при 1107×g в течение 30 минут и супернатант удаляли для очистки пробирки и хранили при -20°C.

Двумерный белковый электрофорез в геле тотального белка Mycoplasm spp.

Набор для выделения белка ReadyPrepTM (тотальный белок) (Bio-Rad, CA, USA) использовали для выделения тотального белка Mycoplasm spp. Впоследствии концентрацию собранного белка определяли с использованием Bio-Rad RC DC Protein Assay Kit (CA, USA). Подробный протокол может быть взят из описания продукта или может быть модифицирован из хорошо известных протоколов в данной области.

Двумерный электрофорез белков в геле проводили в два этапа: изоэлектрическое фокусирование (ИЭФ) и электрофорез в геле в присутствии додецилсульфата натрия (ДСН-ПААГ-электрофорез). ИЭФ проводили для разделения белков в образце в зависимости от их изоэлектрической точки; ДСН-ПААГ-электрофорез проводили для разделения белков в соответствии с их молекулярной массой. См. фигуру 1, которая демонстрирует результат двумерного электрофореза белков в геле.

Гибридизация.

Сыворотку, полученную в этапе (1), использовали в качестве 1го антитела для гибридизирования с результатом двумерного электрофореза белков в геле в этапе (2). После того, как белки подвергали амплифицированию 2ым антителом и визуализации последующей процедурой визуализации, собирали белки, являвшиеся позитивными. Эти белки распознавались антителом к Mycoplasm spp. и вследствие этого могли быть пригодны в качестве кандидатных антигенов для активного ингредиента субъединичных вакцин.

Гибридизацию проводили посредством Вестерн-блотинга. Кратко, 2D гель после электрофореза переносили на PVDF мембрану. Затем мембрану инкубировали и гибридизировали последовательно с 1ым антителом (сыворотка, содержащая антитело к Mycoplasm spp.) и 2ым антителом (конъюгированные с AP анти-свиные IgG). Впоследствии проводили цветную реакцию с использованием раствора NBT/BCIP.

Результат цветной реакции Вестерн-блотинга показан на фигуре 2; где 10 белков, позитивных в иммуногибридизации с антителом к Mycoplasm spp., обозначали как кандидатные антигены для использования в качестве активных ингредиентов субъединичных вакцин.

Идентификация полученных кандидатных антигенов.

В соответствии с цветной реакцией Вестерн-блотинга гель, соответствующий позитивному положению на мембране, разрезали на микропептид и анализировали посредством масс-спектроскопии. Полученные данные масс-спектроскопии затем совмещали с аминокислотной последовательностью и базой данных белков для идентификации этих белков.

См. следующую таблицу 1, приведены указанные 10 белков, позитивных к иммуногибридизации с антителом к Mycoplasm spp.

Таблица 1:
10 белков, позитивных к иммуногибридизации с антителом к Mycoplasm spp. и их амино последовательность.
Кандидат Название SEQ ID NO
1 XylF (связывающий ксилозу липопротеин) SEQ ID NO: 09
2 XylF (связывающий ксилозу липопротеин) SEQ ID NO: 09
3 XylF (связывающий ксилозу липопротеин) SEQ ID NO: 09
4 PdhA (E1-альфа субъединица пируватдегидрогеназы) SEQ ID NO:
5 Mhp145 (периплазматический связывающий сахар белок) SEQ ID NO: 11
6 EutD (фосфотрансацетилаза) SEQ ID NO: 10
7 EutD (фосфотрансацетилаза) SEQ ID NO: 10
8 Mhp389 SEQ ID NO: 14
9 P78 (липопротеин) SEQ ID NO: 12
10 P132 SEQ ID NO: 13
*XylF и EutD имеют различные состояния заряда в клетках и вследствие этого становятся 3 и 2 позитивным положением на мембране.

Пример 2: Экспрессирование указанных кандидатных антигенов в большом количестве посредством системы экспрессии генов E. coli.

Escherichia coli JM109 использовали в качестве клеток хозяина для клонирования и Escherichia coli BL21 (DE3) использовали в качестве клеток хозяина для экспрессии белка. Клетки Escherichia coli культивировали в среде LB (Luria-Bertani; Difco, Michigan, USA). В соответствии с планом эксперимента соответствующее количество антибиотика или агар 1,5% добавляли для формирования твердой среды.

Амплификация генов, кодирующих кандидатные антигены.

После того, как кандидатные антигены были идентифицированы, искали гены, кодирующие такие антигены в базе данных NCBI (National Center for Biotechnology Information). Специфичные праймеры, нацеленные на гены антигена были сконструированы соответствующим образом. Затем гены антигена амплифицировали с использованием специфичных праймеров и хромосомы M. hyopneumoniae PRIT-5 в качестве матрицы. Использованные специфичные праймеры приведены в последующей таблице 2.

Таблица 2:
Набор праймеров.
Кандидат Последовательности набора праймеров
PdhA PdhAF (SEQ ID NO: 15)
5'-GATATAGGATCCATGGACAAATTTCGCTATGTAAAGCCT G-3'
PdhAR (SEQ ID NO: 16)
5'-CAATATGTCGACTTATTTTACTCCTTTAAAAAATTCAAGCG CTTC-3'
XylF XylFF (SEQ ID NO: 17)
5'-GATATAGGATCCATGAATGGAATAAATTTCTTGGCTTAGGC TTAGTTTTTC-3'
XylFR (SEQ ID NO: 18)
5'-CAATATGTCGACTTAATTTTTATTAATATCGGTAATTAGTT TGTCTAAGC-3'
EutD EUTDF (SEQ ID NO: 19)
5'-GATATAGGATCCATGACATACCAAGAATATCTTCAAGCAA
G-3'
EUTDR (SEQ ID NO: 20)
5'-CAATATGTCGACCTATTTACCTTCTTCAAC
TTGTAGAGCGCT-3'
Mhp145 Mhp145F (SEQ ID NO: 21)
5'-GATATAGGATCCATAGCTTCAAGGTCGAA TACAACTGC-3'
Mhp145R (SEQ ID NO: 22)
5'-CAATATGTCGACTTAATTTACCTTTTGGAG TATCCCATTTTC-3'
P78 P78F (SEQ ID NO: 23)
5'-GATATAGGATCCTTATCCTATAAATTTAGG CGTTTTTTCC-3'
P78R (SEQ ID NO: 24)
5'-CAATATGTCGACTTATTTTGATTTAAAAGCAGGACCTAA AT-3'
P132 P132F (SEQ ID NO: 25)
5'-GATATAGGATCCATTGGACTAACAATTTTTGAGAAATCATT TAG-3'
P132R (SEQ ID NO: 26)
5'-CAATATGTCGACTTATTCCTAAATAGCCCC ATAAAGTG-3'
Mhp389 Mhp389F (SEQ ID NO: 27)
5'-GATATAGGATCCATGGACAAATTTTCACGA ACTGTTCT-3'
Mhp389R (SEQ ID NO: 28)
5'-CAATATGTCGACCTAGATTTTAAAGGATTTTTTTAATTCAA TAATATAATC-3'

Полимеразную цепную реакцию (ПЦР) проводили с наборами праймеров, приведенных в таблице 2 выше, для амплификации генов кандидатных антигенов. Амплифицированные гены затем использовали системе экспрессии генов E. coli. Условия ПЦР были следующими: 5 минут при 98°C (один цикл); 30 секунд при 94°C, 30 секунд при 55°C, X секунд при 68°C (35 циклов); 5 минут при 68°C (один цикл). Указанный X являлся временем элонгации для ДНК полимеразы и его устанавливали в зависимости от размера фрагмента, который должен быть амплифицирован. После ПЦР проводили электрофорез для проверки того, если продукты ПЦР содержали фрагменты ДНК ожидаемого размера. См. фигуру 3, которая демонстрирует результат электрофореза продуктов ПЦР; где трек 1 являлся геном eutD; трек 2 являлся pdhA; трек 3 являлся xylF; трек 4 являлся геном P78; трек 5 являлся геном P132; трек 6 являлся mhp145; трек 7 являлся mhp389.

Клонирование продуктов ПЦР.

Клонирование проводили с использованием набора для клонирования ПЦР CloneJET и лигационную смесь трансформировали в E. coli ECOSTM 9-5 (Yeastern, Taipei, Taiwan). Подробный протокол может быть получен из описания продукта или модифицирован из хорошо известного протокола в данной области.

После трансформации бактерии культивировали на твердой среде LB, содержащей ампициллин (100 мкг/мл) до формирования их колонии. Затем проводили ПЦР по колониям для скринирования штаммов с успешной трансформацией. Условия ПЦР были следующими: 5 минут при 95°C (один цикл); 30 секунд при 95°C, 30 секунд при 55°C, X секунд при 72°C (25 циклов); 7 минут при 72°C (один цикл). Указанный X являлся временем элонгации для ДНК полимеразы и был установлен в зависимости от размера фрагмента, который должен быть амплифицирован. Скорость элонгации Taq ДНК полимеразы (Genomics, Taipei, Taiwan) составляет 1 т.н./мин; вследствие этого, если Taq ДНК полимераза используется для амплифицирования фрагмента ДНК 1 т.о, указанный X будет установлен на 1 минуту.

Плазмиды из штаммов, для которых было подтверждено наличие вставки ДНК в рекомбинантной плазмиде, затем подвергали ДНК секвенированию (Total Solution Provider of Systems Biology and Chemoinformatics Ltd.). Плазмиды, содержащие eutD, pdhA, xylF, ген P78, ген P132, mhp145 и mhp389 были названы pJET-eutD, pJET-pdhA, pJET-xylF, pJET-P78, pJET-P132, pJET-mhp145, pJET-mhp389, соответственно.

Точечная мутация и клонирование генов антигена M. hyopneumoniae.

Перед амплифицированием кандидатных антигенов в системе экспрессии генов E. coli необходимо рассмотреть значение кодона в различных организмах. При этом, если ген содержит кодон, который будет неодинаково кодироваться в организме, из которого он происходит, и E. coli, ген должен быть модифицирован точечной мутацией.

Гены антигена M. hyopneumoniae, pdhA, xylF, P78 ген, ген P132, mhp145 и mhp389, содержат кодон TGA (eutD не имеет проблем со значением кодона подобно другими). Кодон TGA транслировался в триптофан в Mycoplasma spp., но транслировался как стоп-кодон в E. coli. Для того чтобы предотвратить невозможность продуцирования целого белка в системе экспрессии генов E. coli, сконструировали праймеры, нацеленные на сайт TGA, и проводили точечную мутацию, замещающую TGA на TGG с использованием полимеразной цепной реакции с перекрывающимися удлинениями. В результате, гены, которые должны быть экпрессированы в системе экспрессии генов E. coli, могут быть безошибочно транслированы в кандидатный антиген данного изобретения. Кроме того, сайты рестрикции BamHI гена P78, гена P132 и mhp389, были подвержены молчащей мутации для удобства клонирования.

Праймеры, использованные для точечной мутации, сконструировали, чтобы сайт точечной мутации был расположен в центральной части праймера и чтобы значение Tm было выше 78°C. Значение Tm праймеров для точечной мутации рассчитывали с использованием формулы, предоставленной Invitrogene Co.: Tm = 81,5 + 0,41 (%GC) - 675/N - % несоответствия; где %GC обозначает процентное содержание GC относительно общего количества нуклеотидов, содержащихся в рассматриваемом праймере; N обозначает длину рассматриваемого праймера; %несоответствие обозначает процентное содержание основания, которое должно подвергнуться мутации относительно общего содержания нуклеотидов, содержащихся в рассматриваемом праймере. Наборы праймеров, использованных для вышеуказанных генов, приведены в последующих таблицах 3-8.

Таблица 3:
Наборы праймеров для точечной мутации pdhA.
Праймер Последовательность ДНК (5'-3')
PdhAF
SEQ ID NO: 29
GATATAGGATCCATGGACAAATTTCGCTATGTAAAGCCTG
PdhAM1
SEQ ID NO: 30
GCTAACAAAAGATGACTGGTTTGTCCCAGCTTTTCG
PdhAM2
SEQ ID NO: 31
CGAAAAGCTGGGACAAACCAGTCATCTTTTGTTAGC
PdhAM3
SEQ ID NO: 32
CTTGCAAATGCAATATTGGAATGGTAGCGAAAAAGG
PdhAM4
SEQ ID NO: 33
CCTTTTTCGCTACCATTCCAATATTGCATTTGCAAG
PdhAM5
SEQ ID NO: 34
CGAGGCGCTAAATATTGCAAGTATTTGGAAATGGCCAGTTGTTTTTTGCGTAAATAAC
PdhAM6
SEQ ID NO: 35
GTTATTTACGCAAAAAACAACTGGCCATTTCCAAATACTTGCAATATTTAGCGCCTCG
PdhAM7
SEQ ID NO: 36
GTTTTTTGCGTAAATAACAATCAATGGGCAATTTCAACCCCAAATAAATATG
PdhAM8
SEQ ID NO: 37
CATATTTATTTGGGGTTGAAATTGCCCATTGATTGTTATTTACGCAAAAAAC
PdhAM9
SEQ ID NO: 38
GTTGAGTTTGTAACTTGGCGTCAAGGTGTTCATACC
PdhAM10
SEQ ID NO: 39
GGTATGAACACCTTGACGCCAAGTTACAAACTCAAC
PdhAM11
SEQ ID NO: 40
GAGAACACGAAAAATGGGAACCAATGCACCGG
PdhAM12
SEQ ID NO: 41
CCGGTGCATTGGTTCCCATTTTTCGTGTTCTC
PdhAM13
SEQ ID NO: 42
CCGAAAAACAAAAAATTTGGGATGAAGCGCTTGCGATTG
PdhAM14
SEQ ID NO: 43
CAATCGCAAGCGCTTCATCCCAAATTTTTTGTTTTTCGG
PdhAR
SEQ ID NO: 44
CAATATGTCGACTTATTTTACTCCTTTAAAAAATTCAAGCGCTTC

Таблица 4:
Наборы праймеров для точечной мутации xylF.
Праймер Последовательность ДНК (5'-3')
XylFF
SEQ ID NO: 45
GATATAGGATCCATGAAATGGAATAAATTTCTTGGCTTAGGCTTAGTTTTTC
XylFM1
SEQ ID NO: 46
CATTTAACCAATCAAGTTGGGAGGCAATTCAACAACTTGG
XylFM2
SEQ ID NO: 47
CCAAGTTGTTGAATTGCCTCCCAACTTGATTGGTTAAATG
XylFM3
SEQ ID NO: 48
CTAATACCAACAAAAATGTTTGGGTACTTTCTGGTTTTCAACACG
XylFM4
SEQ ID NO: 49
CGTGTTGAAAACCAGAAAGTACCCAAACATTTTTGTTGGTATTAG
XylFM5
SEQ ID NO: 50
CGGTGATGCGATCACAAAATGGTTAAAAATCCCTGAAAATAAGC
XylFM6
SEQ ID NO: 51
GCTTATTTTCAGGGATTTTTAACCATTTTGTGATCGCATCACCG
XylFM7
SEQ ID NO: 52
TTATCATACTCGGAATTGACTGGACTGATACTGAAAATGTAATTC
XylFM8
SEQ ID NO: 53
GAATTACATTTTCAGTATCAGTCCAGTCAATTCCGAGTATGATAA
XylFM9
SEQ ID NO: 54
GAAGAAGCCGGATGGCTTGCAGGATATGC
XylFM10
SEQ ID NO: 55
GCATATCCTGCAAGCCATCCGGCTTCTTC
XylFM11
SEQ ID NO: 56
GGTTATCTAGCCGGAATTAAAGCTTGGAATCTAAAAAATTCTGATAAAAAAAC
XylFM12
SEQ ID NO: 57
GTTTTTTTATCAGAATTTTTTAGATTCCAAGCTTTAATTCCGGCTAGATAACC
XylFR
SEQ ID NO: 58
CAATATGTCGACTTAATTTTTATTAATATCGGTAATTAGTTTGTCTAAGC

Таблица 5:
Наборы праймеров для точечной мутации гена P78.
Праймер Последовательность ДНК (5'-3')
P78F
SEQ ID NO: 59
GATATAGGATCCTTATCCTATAAATTTAGGCGTTTTTTCC
P78M1
SEQ ID NO: 60
CAATTAATAAAGTTTTGTTTGGTTGGATGATTAATAAAGCACTTGCTGATCC
P78M2
SEQ ID NO: 61
GGATCAGCAAGTGCTTTATTAATCATCCAACCAAACAAAACTTTATTAATTG
P78M3
SEQ ID NO: 62
GATATTAAAGAAATTGAAAGAATCTGGAAAAAATATGTCTCCGATGATCAAGG
P78M4
SEQ ID NO: 63
CCTTGATCATCGGAGACATATTTTTTCCAGATTCTTTCAATTTCTTTAATATC
P78M5
SEQ ID NO: 64
GCCCTTTCAGGAGGCTCCACTGATTCGGCA
P78M6
SEQ ID NO: 65
TGCCGAATCAGTGGAGCCTCCTGAAAGGGC
P78M7
SEQ ID NO: 66
GCCGCAAAAGCTTTTGTTAAATGGCTTTTGACAGAAAAAATAGTCT
P78M8
SEQ ID NO: 67
AGACTATTTTTTCTGTCAAAAGCCATTTAACAAAAGCTTTTGCGGC
P78R
SEQ ID NO: 68
CAATATGTCGACTTATTTTGATTTAAAAGCAGGACCTAAAT

Таблица 6:
Наборы праймеров для точечной мутации гена P132.
Праймер Последовательность ДНК (5'-3')
P132F
SEQ ID NO: 69
GATATAGGATCCATTGGACTAACAATTTTTGAGAAATCATTTAG
P132M1
SEQ ID NO: 70
CTAACTTCTCTAAAAGGTTGGAAAGAAGAAGATGATTTTG
P132M2
SEQ ID NO: 71
CAAAATCATCTTCTTCTTTCCAACCTTTTAGAGAAGTTAG
P132M3
SEQ ID NO: 72
CTTTCTATTACTTTTGAACTCTGGGACCCAAATGGTAAATTAGTATC
P132M4
SEQ ID NO: 73
GATACTAATTTACCATTTGGGTCCCAGAGTTCAAAAGTAATAGAAAG
P132M5
SEQ ID NO: 74
CCCTGAAGGAGATTGGATAACTTTAGGGAG
P132M6
SEQ ID NO: 75
CTCCCTAAAGTTATCCAATCTCCTTCAGGG
P132M7
SEQ ID NO: 76
CTACCAGGAACTACCTGGGATTTCCATGTTGAAC
P132M8
SEQ ID NO: 77
GTTCAACATGGAAATCCCAGGTAGTTCCTGGTAG
P132M9
SEQ ID NO: 78
GGACAACTAATTTGGAGCCAGTTAGCTTCC
P132M10
SEQ ID NO: 79
GGAAGCTAACTGGCTCCAAATTAGTTGTCC
P132M11
SEQ ID NO: 80
GGAACAAAAAAGGAATGGATTCTTGTAGGATCTGG
P132M12
SEQ ID NO: 81
CCAGATCCTACAAGAATCCATTCCTTTTTTGTTCC
P132M13
SEQ ID NO: 82
CCAATACGCAAATATGGATAACCCGTCTAGGAAC
P132M14
SEQ ID NO: 83
GTTCCTAGACGGGTTATCCATATTTGCGTATTGG
P132M15
SEQ ID NO: 84
CCAAGGGGAAGTTCTCTGGACTACTATTAAATCCAAAC
P132M16
SEQ ID NO: 85
GTTTGGATTTAATAGTAGTCCAGAGAACTTCCCCTTGG
P132M17
SEQ ID NO: 86
CAAAAAACTTCACCTTTGGTGGATTGCTAATGATAGC
P132M18
SEQ ID NO: 87
GCTATCATTAGCAATCCACCAAAGGTGAAGTTTTTTG
P132R
SEQ ID NO: 88
CAATATGTCGACT TATTCCTAAATAGCCCCATAAAGTG

Таблица 7:
Наборы праймеров для точечной мутации mhp145.
Праймер Последовательность ДНК (5'-3')
Mhp145F
SEQ ID NO: 89
GATATAGG ATCCAT AGCTTCAAGGTCGAATACAACTGC
Mhp145M1
SEQ ID NO: 90
AATAATTGCAGAAAAAATTCTTAAAGATCAATGGAAAACAAGTAAATATTCTGATTTTTATTCACAAT
Mhp145M2
SEQ ID NO: 91
ATTGTGAATAAAAATCAGAATATTTACTTGTTTTCCATTGATCTTTAAGAATTTTTTCTGCAATTATT
Mhp145R
SEQ ID NO: 92
CAATATGTCGACTTA ATTTACCTTTTGGAGTATCCCATTTTC

Таблица 8:
Наборы праймеров для точечной мутации mhp389.
Праймер Последовательность ДНК (5'-3')
Mhp389F
SEQ ID NO: 93
GATATAGGATCCATGGACAAATTTTCACGAACTGTTCT
Mhp389M1
SEQ ID NO: 94
CAATAGTGACAATGGACCCCCCAAATGTTGGTCG
Mhp389M2
SEQ ID NO: 95
CGACCAACATTTGGGGGGTCCATTGTCACTATTG
Mhp389M3
SEQ ID NO: 96
GATAAAGGCGCATCATGGCTTGCGCTTGCACCAAC
Mhp389M4
SEQ ID NO: 97
GTTGGTGCAAGCGCAAGCCATGATGCGCCTTTATC
Mhp389M5
SEQ ID NO: 98
GGAAAACTTAAAGGTAAATGGACTTTTGGACTAACCTATTT
Mhp389M6
SEQ ID NO: 99
AAATAGGTTAGTCCAAAAGTCCATTTACCTTTAAGTTTTCC
Mhp389R
SEQ ID NO: 100
CAATATGTCGACCTAGATTTTAAAGGATTTTTTTAATTCAATAATATAATC

Способ точечной мутации кратко разъяснен ниже. Хромосому M. hyopneumoniae PRIT-5 использовали в качестве матрицы и ДНК фрагменты амплифицировали с использованием наборов праймеров, приведенных в таблицах 3-8 выше.

50 мкл реакционная смесь для ПЦР содержала буфер для ПЦР 1× GDP-HiFi, 200 мкМ смеси dATP, dTTP, dGTP и dCTP, 1 мкМ праймеров, 100 нг хромосомы M. hyopneumoniae PRIT-5 и 1 Ед ДНК полимеразы GDP-HiFi. Условия ПЦР были следующими: 5 минут при 98°C (один цикл); 30 секунд при 94°C, 30 секунд при 55°C, X секунд при 68°C (35 циклов); 5 минут при 68°C (один цикл). Указанный X являлся временем элонгации для ДНК полимеразы и был установлен в зависимости от размера фрагмента, который должен быть амплифицирован. Скорость элонгации ДНК полимеразы GDP-HIFI (GeneDirex, Las Vegas, USA) составляет 1 т.н./15 секунд; вследствие этого, если ДНК полимераза GDP-HIFI используется для амплифицирования фрагмента ДНК 1 т.н., указанный X будет составлять 15 секунд. После ПЦР проводили электрофорез для проверки того, если продукты ПЦР содержали фрагменты ДНК ожидаемого размера. Затем продукт ПЦР был рециркулирован с использованием набора системы для выделения из геля Gel-MTM.

Впоследствии продукт ПЦР использовали в качестве матрицы и амплифицировали с использованием наборов праймеров, приведенных в таблице 2 выше. Условия ПЦР были следующими: 2 минуты при 98°C (один цикл); 30 секунд при 94°C, 30 секунд при 55°C, X секунд при 68°C (35 циклов); 5 минут при 68°C (один цикл). Указанный X являлся временем элонгации для ДНК полимеразы и был установлен в зависимости от размера фрагмента, который должен быть амплифицирован. Скорость элонгации ДНК полимеразы GDP-HIFI (GeneDirex, Las Vegas, USA) составляет 1 т.н./15 секунд; вследствие этого, если ДНК полимераза GDP-HIFI используется для амплифицирования фрагмента ДНК 1 т.н., указанный X будет составлять 15 секунд. После вышеуказанного этапа амплификации может быть получена полноразмерная последовательность кандидатных генов антигена с точечной мутацией.

Затем продукт ПЦР выделяли с использованием набора системы очистки PCR-MTM (GeneMark, Taichung, Taiwan) и проводили его клонирование использованием набора для клонирования ПЦР CloneJET. Проводили ПЦР по колониям для подтверждения того, что штаммы после трансформации, содержали плазмиду, имеющую вставку ДНК, и затем плазмиды выделяли для ДНК секвенирования (Total Solution Provider of Systems Biology and Chemoinformatics Ltd.). Плазмиды, содержащие мутированные кандидатные гены антигена, были названы pJET-pdhAM, pJET-xylFM, pJET-P78M, pJET-P132M, pJET-mhp145M, pJET-mhp389M, соответственно.

В соответствии с результатом секвенирования ДНК последовательности кандидатных генов антигена после точечной мутации являлись такими, как показано в SEQ ID NO:01 (pdhA), SEQ ID NO:02 (xylF), SEQ ID NO:03 (eutD, был без точечной мутации), SEQ ID NO:04 (mhp145), SEQ ID NO:05 (ген P78), SEQ ID NO:06 (ген P132), SEQ ID NO:07 (mhp389).

Конструирование экспрессионных векторов для экспрессирования антигенов M. hyopneumoniae

В этой части экспериментов плазмиду pET-MSY использовали в качестве остова для конструирования экспрессионного вектора для экспрессирования антигена M. hyopneumoniae. pET-MSY является производной pET29a и имеет msyB E. coli. Вследствие этого, экспрессированный рекомбинантный антиген будет иметь партнера слияния MsyB. MsyB имеет большое содержание кислотных аминокислот и способен к увеличению растворимости экспрессированного белка.

После того, как pJET-eutD, pJET-pdhA, pJET-xylF, pJET-P78, pJET-P132, pJET-mhp145 и pJET-mhp389 были расщеплены BamHI и SalI, полученный фрагмент ДНК встраивали в pET-Msy, расщепленную предварительно с такими же рестрикционными ферментами, посредством лигазы. Затем pET-Msy с ДНК фрагментом трансформировали в E. coli ECOS 9-5. Проводили ПЦР по колониям для подтверждения штаммов после трансформации, содержащих плазмиду, имеющую вставку ДНК, и затем плазмиды выделяли из них для секвенирования ДНК (Total Solution Provider of Systems Biology and Chemoinformatics Ltd.). Плазмиды c подтвержденной корректной ДНК последовательностью были названы pET-MSYEutD, pET-MSYPdhA, pET-MSYXylF, pET-MSYP78, pET-MSYP132, pET-MSYMhp145 и pET-MSYMhp389, соответственно. Такие полученные плазмиды являлись примерами экспрессионных векторов для профилактики инфекции Mycoplasma spp. по данному изобретению.

Экспрессия и выделение антигенов M. hyopneumoniae

Векторы для экспрессии антигена трансформировали в E. coli BL21 (DE3). Единичные колонии штаммов, являющихся результатом трансформации, инокулировали в жидкую среду LB, содержащую канамицин (рабочая концентрация: 30 мкг/мл). После культивирования в течение ночи 37°C, 180 об./мин. суспензию бактерий разбавляли в соотношении 1:100 и инокулировали снова в другую жидкую среду LB, содержащую канамицин (рабочая концентрация: 30 мкг/мл). Бактерии культивировали при 37°C, 180 об./мин. до OD600 вследствие этого достигая приблизительно от 0,6 до 0,8. Затем добавляли 0,1 мМ IPTG для индуцирования экспрессии. После индукции в течение 4 часов осадок собирали центрифугированием (10000×g, 10 минут, 4°C) и экспрессию проверяли посредством белкового электрофореза.

Впоследствии использовали аффинную хроматографию с иммобилизованными металлами (IMAC) для выделения белка посредством ковалентного связывания между His tag N-конца рекомбинантного белка и ионами никеля или ионами кобальта. Протокол выделения белка соответствовал описанию продукта QIAexpressionistTM (fourth edition, Qiagen). Осадок суспендировали в буфере для лизиса (50 мМ NaH2PO4, 300 мМ NaCl, 10 мМ имидазол, pH 8,0) и разрушали ультразвуковым гомогенизатором. После центрифугирования (8000×g, 15 минут) отбирали супернатант для введения в колонку с 1 мл смолы Ni-NTA. Рекомбинантные антигены должны были связаться на указанной смоле. Затем в колонку вводили 15 мл промывочного буфера (50 мМ NaH2PO4, 300 мМ NaCl, 20 мМ имидазол, pH 8,0) для промывки смолы, чтобы неспецифически связанные белки были удалены. В заключение, добавляли 20 мл элюирующего буфера (50 мМ NaH2PO4, 300 мМ NaCl, 250 мМ имидазол, pH 8,0) для вымывания рекомбинантных антигенов со смолы; в которой имидазол с высокой концентрацией может конкурировать за сайт связывания на смоле с рекомбинантными белками и посредством этого вызывая вымывание рекомбинантных белков. Результат выделения затем проверяли электрофорезом белков.

Кандидатные антигены данного изобретения, собранные посредством выделения, могут затем быть использованы для последующих иммунных испытаний для подтверждения возможности их использования в качестве активного ингредиента субъединичных вакцин против Mycoplasm spp.

Пример 3: Эксперименты иммунной стимуляции свиней кандидатными антигенами данного изобретения.

В этом примере кандидатные антигены данного изобретения использовали в качестве активного ингредиента для приготовления субъединичных вакцин и тестировали на их иммунные эффекты в живой свинье.

Приготовление вакцины

Один выделенный рекомбинантный антиген или несколько выделенных рекомбинантных антигенов смешивали с алюмогелем в качестве адъюванта для приготовления субъединичной вакцины или коктейльной субъединичной вакцины. Каждая доза приготовленной вакцины имела объем 2 мл, и содержание каждого вида антигена составляло 100 мкг.

В последующей таблице 9 приведены образцы, приготовленные в этом примере для экспериментов иммунной стимуляции.

Таблица 9:
Образцы вакцины, приготовленные в примере 3
Образец Активный ингредиент (Антиген)
1 PdhA
2 XylF
3 EutD
4 Mhp145
5 P78
6 P132
7 Mhp389
8 PdhA + P78
9 XylF + Mhp145

Эксперименты иммунной стимуляции свиней проводили с использованием Bayovac® MH-PRIT-5 (изготовлен с использованием M. hyopneumoniae PRIT-5, в качестве позитивной контрольной группы), субъединичных вакцин (образцы 1-7 данного изобретения) и коктейльных вакцин (образцы 8 и 9 данного изобретения).

33 свиньи SPF возрастом 4 недели доставляли из Научно-исследовательского института сельскохозяйственной технологии и кормили с одинаковыми кормом, окружающими условиями и условиями роста в свинарнике перед экспериментами.

После того, как свиней вскармливали до возраста 35 дней и 49 дней, свиньям вводили 2 мл вышеприведенной вакцины посредством внутримышечной инъекции.

Стимуляционные эксперименты

Вышеуказанных свиней, подвергаемых индуцированию иммунного ответа, стимулировали Mycoplasm spp. в возрасте 109 дней для подтверждения иммунного эффекта вышеуказанных вакцин.

Сначала легкое, отобранное у свиней, инфицированных Mycoplasm spp., измельчали в 20 мл среды Фриза и центрифугировали при 148,8×g в течение 10 минут. Супернатант удаляли для очистки пробирки и центрифугировали снова при 7870×g в течение 40 минут. Затем супернатант удаляли и осадок суспендировали в 6 мл среды Фриза для получения суспензии. Впоследствии суспензию фильтровали через мембраны 5 мкм и 0,45 мкм последовательно для получения растворов бактерий, требующихся для стимуляционных экспериментов.

Раствор бактерий (5 мл) вводили подвергнутым наркозу свиньям через их трахею. После 28 дней введения свиней умерщвляли и вскрывали для отбора их легкого. Иммунный эффект проверяли посредством наблюдения за легким и регистрировали в соответствии со следующими критериями: наблюдаемый патологический признак в любой из средних верхних долей и верхних долей любой стороны легкого оценивали как 10 баллов; наблюдаемый патологический признак в любой средней верхней доле и диафрагмальных долях любой стороны легкого, оценивали как 5 баллов. Общая оценка составляла 55 баллов. Запись результатов наблюдения представлена на фигуре 4.

По сравнению с результатами неинъецированных свиней семь кандидатных антигенов данного изобретения были способны обеспечивать иммунные эффекты, эквивалентные общепринятой вакцине (Bayovac® MH-PRIT-5). Если принимать во внимание более высокую безопасность субъединичных вакцин, то вакцины, содержащие кандидатные антигены данного изобретения, должны иметь большую ценность.

С другой стороны не являлось обычным использование двух или более антигенов, которые должны индуцировать иммунные эффекты в одной вакцине из-за того, что два или более антигенов могут не обеспечивать двойной иммунный эффект. В действительности имеет место более высокая вероятность того, что два или более антигенов будут препятствовать друг другу и в результате снижать иммунный эффект вакцины. В соответствии с результатом этого примера, образец 8 и образец 9 данного изобретения (т.е. коктейльная вакцина) неожиданно обеспечивали существенное возрастание иммунного эффекта. При этом субъединичные вакцины данного изобретения не только имеют высокую безопасность, но также предоставляют больший иммунный эффект, когда кандидатные антигены данного изобретения использованы в комбинации.

Рядовой специалист в данной области может легко понять любые возможные модификации на основании открытия данного изобретения без выхода за рамки основной идеи данного изобретения. Вследствие этого примеры выше не должны быть использованы для ограничения данного изобретения, но подразумевают охватывание любых возможных модификации в рамках основной идеи и объема данного изобретения в соответствии с приведенной далее формулой изобретения.

1. Композиция для профилактики инфекции Mycoplasma spp., содержащая:

эффективное количество активного ингредиента, содержащего белок Mhp145; и

фармацевтически приемлемый адъювант;

причем указанный Mhp145 имеет последовательность SEQ ID NO: 11.

2. Композиция для профилактики инфекции Mycoplasma spp., содержащая:

эффективное количество активного ингредиента, содержащего Mhp145 и XylF; и

фармацевтически приемлемый адъювант;

причем указанный Mhp145 имеет последовательность SEQ ID NO: 11; указанный XylF имеет последовательность SEQ ID NO: 09.

3. Композиция по п. 1 или 2, где указанный активный ингредиент имеет концентрацию от 50 до 3500 мкг/мл в расчете на общий объем указанной композиции.

4. Композиция по п. 1 или 2, где указанный фармацевтически приемлемый адъювант представляет собой полный адъювант Фрейнда, неполный адъювант Фрейнда, алюмогель, поверхностно-активное вещество, полианионный адъювант, пептид, масляную эмульсию или их комбинацию.

5. Композиция для профилактики инфекции Mycoplasma spp., содержащая:

эффективное количество активного ингредиента, содержащего белок Mhp145;

фармацевтически приемлемый адъювант; и

фармацевтически приемлемую добавку;

причем указанный Mhp145 имеет последовательность SEQ ID NO: 11.

6. Композиция по п. 5, где указанная фармацевтически приемлемая добавка представляет собой растворитель, стабилизатор, разбавитель, консервант, антибактериальный агент, противогрибковый агент, изотонический агент, замедляющий абсорбцию агент или их комбинацию.



 

Похожие патенты:

Предложен способ получения рекомбинантного экзопротеина А P. aeruginosa (rEPA).

Изобретение относится к области биотехнологии, конкретно к получению слитых белков, ингибирующих пролиферацию раковых клеток, что может быть использовано в медицине.

Настоящее изобретение относится к иммунологии. Предложено выделенное человеческое моноклональное антитело и его антигенсвязывающий фрагмент, которые связываются с MASP-2 человека.

Настоящее изобретение относится к иммунологии. Предложено выделенное антитело к PD-L1 и его антигенсвязывающий фрагмент, охарактеризованные аминокислотными последовательностями гипервариабельных участков (HVR) в составе вариабельных областей тяжелой цепи и легкой цепи.

Изобретение относится к области биотехнологии и иммунологии. Описаны моноклональные антитела и их фрагменты, которые являются перекрестно реактивными с множеством кладов вируса гриппа, включая представителей как группы 1, так и группы 2.
Изобретение относится к области биохимии и биотехнологии, в частности к способу получения активной фармацевтической субстанции рекомбинантного бисметионилгистона Н1.3.

Представлены выделенный пищевой белок, нуклеиновая кислота, кодирующая такой белок, вектор экспрессии, содержащий последовательность нуклеиновой кислоты, клетка-хозяин и способ получения такого белка.

Настоящее изобретение относится к биохимии, в частности к выделенному пептиду, обладающему способностью к индукции цитостатических Т-лимфоцитов (CTL) в присутствии антигенпрезентирующих клеток (APC), несущих HLA-A*0201 или HLA-A*2402 антиген.

Изобретение относится к области биотехнологии, конкретно к полипептидам для лечения или предотвращения аллергий на аллергены пыльцы трав Ph1P1, пыльцы березы Betv1 и клеща домашней пыли Derp2, что может быть использовано в медицине.

Изобретение относится к биотехнологии и медицине, а именно к способу выделения рекомбинантного белка, содержащего в своем составе последовательности миелопептидов и представленного последовательностью SEQ ID NO:1.

Изобретение относится к области биотехнологии, конкретно к разработке химерных молекул внешнего поверхностного белка А (OspA), и может быть использовано в медицине. Разработанный химерный полипептид с SEQ ID NO: 173, а также композиции и комбинированные вакцины, которые его содержат, способны вызывать специфический иммунный ответ против бактерий рода Borrelia.

Предложен способ получения рекомбинантного экзопротеина А P. aeruginosa (rEPA).

Изобретение относится к биотехнологии и биофармакологии. Предложен способ получения рекомбинантного пептидогликан-ассоциированного липопротеина (PAL) Legionella pneumophila.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к выделенному полипептиду, вызывающему образование нейтрализующих антител к токсинам Clostridium difficile.

Группа изобретений относится к молекулярной биологии, биотехнологии, медицине и может быть использована для осуществления профилактики и лечения туберкулеза. Предложены гибридные белки для индукции специфичного иммунного ответа против Mycobacterium tuberculosis, включающие белки Ag85B, Tb10.4 M.tuberculosis, фрагменты флагеллина FliC S.Typhimurium, соединенные гибкими мостиками, кодирующие полинуклеотиды, генетические конструкции для экспрессии полинуклеотидов, рекомбинантные клетки и варианты вакцины для профилактики или лечения туберкулеза на основе описанного гибридного белка, потребитель разработанной вакцины - человек либо животное.

Группа изобретений относится к области биотехнологии. Экспрессируемый альфа-токсин и кодирующая его молекула нуклеиновой кислоты представляют собой делеционный мутеин, который по сравнению со зрелым альфа-токсином штамма 13 Clostridium perfringens лишен, по меньшей мере, девяти последовательных аминокислотных остатков, включая His68, но сохраняет при этом значительную антигенность токсина и может быть использован в качестве вакцины против Clostridium perfringens.

Изобретение относится к области генной и белковой инженерии и представляет собой рекомбинантную плазмидную ДНК pER-TA1GyrA-AcSer, предназначенную для одновременного биосинтеза двух белков - гибридного полипептида, содержащего аминокислотную последовательность тимозина α1 человека и интеина, и фермента E.

Изобретение относится к области генной и белковой инженерии и представляет собой рекомбинантную плазмидную ДНК pER-TB4GyrA-AcSer, предназначенную для одновременного биосинтеза двух белков - гибридного полипептида, содержащего аминокислотную последовательность тимозина β4 человека и интеин, и фермента E.

Изобретение относится к биотехнологии и касается способа производства препарата «Мобилан (M-VM3)». Изобретение оптимизирует стадии производства, повышая его рентабельность, делая оптимальным соотношение время производства/количество полученного препарата/количество средств, затраченных на производство.

Изобретение относится к областям биологии и генетической инженерии. Предложен выделенный пептид для терапевтических целей, содержащий последовательность, по меньшей мере, на 95% идентичную SEQ ID NO:4 (GG00444), или его фрагмент или вариант, способные связываться со слизью кишечника человека, а также содержащая его ворсинчатая структура, пищевой продукт, фармацевтическая композиция, полинуклеотид, экспрессионный вектор, клетка-хозяин, кластер генов, антитело, способ лечения и способ скрининга пробиотических бактериальных штаммов.

Изобретение относится к области биотехнологии, конкретно к разработке химерных молекул внешнего поверхностного белка А (OspA), и может быть использовано в медицине. Разработанный химерный полипептид с SEQ ID NO: 173, а также композиции и комбинированные вакцины, которые его содержат, способны вызывать специфический иммунный ответ против бактерий рода Borrelia.

Изобретение относится к области биотехнологии, конкретно к получению субъединичных вакцин против Mycoplasma spp., и может быть использовано в медицине для профилактики инфекции Mycoplasma spp. Предложены вакцинные композиции на основе белка Mhp145 с SEQ ID NO: 11 в сочетании с фармацевтически приемлемым адъювантом, белком XylF с SEQ ID NO: 09 иили фармацевтически приемлемой добавкой. Изобретение обеспечивает достижение сильных иммунных эффектов против Mycoplasma spp. 3 н. и 3 з.п. ф-лы, 4 ил., 9 табл., 3 пр.

Наверх