Способ прогнозирования развития метастазов у больных раком молочной железы

Изобретение относится к медицине и предназначено для прогнозирования развития метастазов у больных раком молочной железы (РМЖ) на основе анализа экспрессии генов MAGEA2, MAGEB1 и XAGE3. Проводят амплификацию в режиме реального времени в присутствии красителя EvaGreen Dye с использованием высокоспецифичных праймеров для генов MAGEA2, MAGEB1, XAGE3 и GAPDH, проводят анализ первичных данных с помощью программного продукта амплификатора, рассчитывают относительную экспрессию генетических локусов по формуле 2-ΔCt, вычисляют коэффициент экспрессии генов - KMAGEA2, КMAGEB1, КXAGE3 по формуле К=Ecancer/Enormal, где Ecancer - относительная экспрессия генов в опухолевой ткани, Enormal - относительная экспрессия генов нормальной ткани молочной железы, и при значениях КMAGEA2<0,6±0,2, КMAGEB1<1,0±0,3 и КХАGE3<1,0±0,8 прогнозируют отсутствие метастазов, а при значениях КMAGEA2>3,5±0,9, КMAGEB1>17,7±2,1 и КXAGE3>14,7±1,5 прогнозируют развитие метастазов. Способ позволяет осуществить прогноз развития метастазов при раке молочной железы. 1 табл., 2 пр.

 

Изобретение относится к медицине, а именно, к молекулярной биологии, онкологии, и касается способа прогнозирования развития метастазов у больных раком молочной железы (РМЖ) на основе анализа экспрессии генов MAGEA2, MAGEB1 и XAGE3.

В мире ежегодно регистрируют приблизительно 1 млн новых случаев рака молочной железы (РМЖ) (см. Водолажский Д.И., Кутилин Д.С., Могушкова Х.А., Ващенко Л.Н., Никитина В.П., Кит О.И. Транскрипционная активность раково-тестикулярных антигенов у больных раком молочной железы люминальных подтипов А и В // Современные проблемы науки и образования. - 2017. - №4. http://science-education.ru/ru/article/view?id=26492), гетерогенного заболевания, включающего в себя как наследственные, так и спорадические формы (см. Пржедецкий Ю.В., Водолажский Д.И., Шатова Ю.С., Комова Е.А., Двадненко К.В. BRCA-мутации у больных с клиническими признаками наследственного рака молочной железы в Южном федеральном округе // Злокачественные опухоли. - 2015. - №4-2, Т. 16. - С. 196-197.). Прогнозирование развития рецидивов и метастазирования РМЖ после первичного лечения представляет собой серьезную и нерешенную проблему (см. Ahmad A. Pathways to breast cancer recurrence. ISRN Oncol, 2013, pp. 1-16).

Раково-тестикулярные антигены (РТА, Cancer Testis Antigens (СТА)) человека, экспрессируются в опухолях различного гистологического происхождения, и практически не экспрессируются в нормальных тканях (за исключением в семенников и плаценты) (см. Водолажский Д.И., Кит О.И., Могушкова Х.А., Пушкин А.А., Тимошкина Н.Н. Раковые тестикулярные антигены в иммунотерапии злокачественных опухолей. Сибирский онкологический журнал. 2017;16(2):71-81. DOI: 10.21294/1814-4861-2017-16-2-71-81).

Для некоторых РТА в результате многочисленных исследований было выявлено их прогностическое значение, которое может быть использовано для уточняющей диагностики РМЖ (см. Matkovic В., Juretic A., Spagnoli G.C., Separovic V., Gamulin М., Separovic R., Saric N., Basic-Koretic M., Novosel I., Kruslin B. Expression of MAGE-A and NY-ESO-1 cancer/testis antigens in medullary breast cancer: retrospective immunohistochemical study. Croat Med J., 2011, no 2, pp. 171-177).

MAGEA2 (Melanoma-associated antigen 2) относится к семейству РТА MAGE-A. Экспрессия генов и антигенов семейства MAGE-A в опухолях исследована наиболее полно по сравнению со всеми остальными РТ-генами и РТ-антигенами. Их экспрессия как на уровне мРНК, так и на уровне белка была детектирована при гематологических заболеваниях, меланомах, плоскоклеточном раке головы и шеи, злокачественных новообразованиях гортани, пищевода, желудка, легких, яичника, мочевого пузыря и молочной железы.

С точки зрения разработки методов уточняющей диагностики опухолевых заболеваний, наиболее интересными являются исследования, в которых была обнаружена корреляция между клиникопатологическими характеристиками и экспрессией генов или антигенов MAGE-A. Например, гены MAGE-A3, -А4 чаще экспрессируются в метастатической, чем в первичной меланоме кожи, экспрессия MAGE-А3 коррелирует с большей толщиной первичного очага, что является плохим прогностическим признаком (см. Brasseur F., Rimoldi D., Lienard D., Lethe В., Carrel S., Arienti F., Suter L., Vanwijck R., Bourlond A., Humblet Y., et al. Expression of MAGE genes in primary and metastatic cutaneous melanoma // Int J Cancer. - 1995. - 63. - №3. - P: 375-80.).

При инвазивном раке протоков молочной железы экспрессия антигенов MAGE-A прямо коррелировала с инвазией лимфатических сосудов, некрозом внутри опухоли. У пациентов с медуллярным РМЖ общая выживаемость была значительно ниже при экспрессии MAGE-A, MAGE-A1 или NY-ESO-1. В группе пациентов с MAGE-А11-негативными опухолями молочной железы общая выживаемость была выше, чем в группе с MAGE-A11-положительными опухолями. Для MAGEA10 не было обнаружено корреляции с выживаемостью. Экспрессия MAGEC1 также не имела прогностического значения (см. Lian Y., Sang М., Ding С, Zhou X., Fan X., Xu Y., Lu W., Shan B. Expressions of MAGE-A 10 and MAGE-A 11 in breast cancers and their prognostic significance: a retrospective clinical study // J Cancer Res Clin Oncol. - 2012. - 138. - №3. - P:519-27.).

XAGE3 (X Antigen Family Member 3) является членом подсемейства XAGE, принадлежащего к семейству GAGE. Гены GAGE экспрессируются в различных опухолях и в некоторых репродуктивных тканях. XAGE3 экспрессируется в плаценте, печени и селезенке плода.

Белок, кодируемый этим геном, имеет сходство в последовательности с других белков GAGE/PAGE. В метастатических опухолях гены семейства GAGE экспрессируются чаще (36-41%), чем в первичных опухолях (13-29%) (см. De Backer О., Arden K.С., Boretti М., Vantomme V., De Smet С, Czekay S.,Viars C.S., De Plaen E., Brasseur F., Chomez P., Van den Eynde В., Boon Т., van der Bruggen P. Characterization of the GAGE genes that are expressed in various human cancers and in normal testis // Cancer Res. - 1999. - 59. - №13. - P: 3157-65).

MAGEB1 (Melanoma Antigen Family B1) относится к семейству MAGEB, информация о прогностическом потенциале отсутсвует ( см. NCBI)/

Анализ патентных источников показал наличие следующих (близких по тематике данному) изобретений:

1. Патент RU №2623869 (опубл. 29.06.2017, Бюл. №19) «Способ прогнозирования безрецидивной выживаемости у больных раком молочной железы», основан на определении уровня экспрессии гена YKL-39 по технологии TaqMan с помощью метода Pfaffl относительно референсного гена GAPDH, причем в качестве калибратора используют нормальную ткань молочной железы.

2. Патент RU №2578462 (опубл. 27.03.2016, Бюл. №9) «Способ прогнозирования лимфогенного метастазирования при двухсторонней синхронной инвазивной карциноме неспецифического типа молочных желез», основан на гистологическом исследовании препаратов ткани новообразований, определении количества клеточных тубулярных структур в опухолевой ткани молочной железы на светооптическом уровне, причем проводят гистологическое исследование обеих молочных желез, при котором проводят гистологическую оценку инфильтративного компонента ткани новообразования, где подсчитывают количество разных типов структур (от 1 до 5), среди которых дополнительно учитывают альвеолярные, трабекулярные, солидные структуры и дискретные группы опухолевых клеток

3. Патент RU №2632115 (опубл. 02.10.2017, Бюл. №8) «Способ прогнозирования риска лимфогенного метастазирования при раке молочной железы на основе экспрессии гена белка YKL-39» (является аналогом Патент RU №2623869 (29.06.2017), п. №1).

4. Патент RU №2609199 (опубл. 30.01.2017, Бюл. №4) «Способ определения вероятности рецидивирования рака молочной железы», основан на измерении уровня экспрессии РНК-транскриптов KI67, CCND1, PTEN, NDRG1, TERT в биологическом образце, содержащем опухолевые клетки, относительно референсного значения.

Описанные изобретения используют более трудоемкие и сложные в анализе способы и алгоритмы расчета результатов, при этом обладающие меньшей чувствительностью и специфичностью (из-за выбранных генетических локусов), чем предлагаемый нами.

Изобретение «Способ прогнозирования развития метастазов у больных раком молочной железы» является новым, так как относительная экспрессия данных РТА-генов ранее не использовалась для заявленной в способе цели.

Техническим результатом заявляемого изобретения является создание нового, простого в исполнении, не дорогостоящего и более точного способа прогнозирования развития метастазов у больных раком молочной железы.

Технический результат достигается тем, что проводят амплификацию в режиме реального времени в присутствии красителя EvaGreen Dye с использованием высокоспецифичных праймеров для генов MAGEA2, MAGEB1, XAGE3 и GAPDH, проводят анализ первичных данных с помощью программного продукта амплификатора, рассчитывают относительную экспрессию генетических локусов по формуле 2-ΔCt, где Ct - медиана по трем повторам для целевого локуса и референсного GAPDH, величина ΔCt=Ct{ген мишень)-Ct(GAPDH), вычисляют коэффициент экспрессии генов - КMAGEA2, КMAGEB1, КXAGE3 по формуле К=Ecancer/Enormal, где Ecancer - относительная экспрессия генов в опухолевой ткани, Enormal - относительная экспрессия генов нормальной ткани молочной железы, и при значениях KMAGEA2<0,6±0,2, КMAGEB1<1,0±0,3 и КХАСЕ3<1,0±0,8 прогнозируют отсутствие метастазов, а при значениях КМАGЕА2>3,5±0,9, КMAGEB1>17,7±2,1 и КXAGE3>14,7±1,5 прогнозируют развитие метастазов.

Уровень экспрессии данных генов отличается у пациенток с метастазами и без метастазов: при значениях KMAGEA2<0,6±0,2, КMAGEB1<1,0±0,3 и КXAGE3<1,0±0,8 прогнозируют отсутствие метастазов (чувствительность 75%), а при значениях KMAGEA2>3,5±0,9, КMAGEB1>17,7±2,1 и КXAGE3>14,7±1,5 прогнозируют развитие метастазов (чувствительность 75%).

Заявленный способ включает следующие приемы: выделение тотальной РНК из тканевых проб с помощью метода гуанидин-тиоционат-фенол-хлороформной экстракции; определение относительной экспрессии генетических локусов методом ПЦР-РВ в присутствии красителя EvaGreen Dye и специфичных праймеров на матрице синтезированной кДНК; анализ первичных данных с помощью программного продукта амплификатора; расчет экспрессии гена на основании соотношения сигналов, продуцируемых ампликонами изучаемой и референсной последовательностей, и обработка данных на соответствие значениям коэффициентов экспрессии, характерным для групп пациенток с метастазами или без метастазов в лимфоузлы.

Заявляемый способ осуществляется следующим образом.

На первом этапе отбирают образцы тканей пациенток - опухолевые и условно здоровые, из операционного или биопсийного материала.

Образцы для транспортировки в лабораторию и хранения замораживают в жидком азоте.

Фрагменты ткани измельчают скальпелем и/или ножницами, дополнительно растирают в фарфоровых ступках в присутствии лизирующего раствора, содержащего 4 М гуанидин тиоцианат, 25 мМ цитрат натрия, 0,5% саркозил и 0,1 М 2-меркаптоэтанол.

Затем в лизат добавляют 1М цитрат Na рН 4,0, кислый фенол и смесь хлороформ/изоамиловый спирта, перемешивают на вортексе и охлаждают образцы при 0°С в течение 15 мин.

Дальнейшее выделение РНК из тканей проводят по методу по Р. Chomczynski & N. Sacchi (2006) (см. Chomczynski Р, Sacchi N. The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroforrn extraction: twenty-something years on. Nat Protoc. 2006; 1 (2):581-5).

Выделенная РНК обрабатывается ДНКазой. Перед проведением реакции обратной транскрипции для проверки качества выделенной РНК проводят электрофорез в 2% геле агарозы по методу Masek Т. et al. (2005). Также перед проведением реакции обратной транскрипции необходимо измерить концентрацию полученных препаратов РНК на флюориметре и нормолизовать ее до 2 нг/мкл.

Синтез кДНК можно проводить с использованием коммерческих наборов основанных на применении обратной транскриптазы M-MuLV Reverse Transcriptase и случайных праймеров (random hexamer).

Реакцию обратной транскрипции проводили при 37°С в течение 30 минут.

Анализируемые последовательности генетических локусов амплифицировали в 25 мкл ПЦР-смеси, содержащей 12 нг кДНК, 0,25 мМ dNTPs, 2,5 мМ MgCl2, 1х-ый ПЦР-буфер и 0,1 еа ДНК-полимеразы Thermus aquaticus, краситель EVA-Green и по 530 нМ прямого и обратного праймеров для референтного гена {GAPDH) или гена-мишени. Прямые и обратные праймеры были разработаны с использованием референсных последовательностей NCBI GenBank (см. таблица 1).

Количественную ПЦР-РВ амплификацию проводили на термоциклере в соответствии с инструкциями производителя по следующей программе. Первичная денатурация: t=95°C в течение 3 мин. 40 циклов: t=95°C в течение 10 с, t=58°C в течение 30 с, t=72°C в течение 15 с.

В одной постановке в качестве матрицы использовали одновременно кДНК опытной (опухоль) и контрольной (условно здоровая ткань) пробы для определения сигналов, продуцируемых амплификатами РТА-генов и референсного GAPDH, каждого в трех повторностях.

Относительная экспрессия генетических локусов вычислялась следующим образом:

- рассчитывали медиану Ct по трем повторам для целевого локуса и референсного GAPDH,

- далее рассчитывали величину ΔCt=Ct(ген мишень)-Ct(GAPDH)

- относительную экспрессию генетического локуса (Е) рассчитывали по формуле 2-ΔCt.

Вывод об изменении экспрессии гена делали, сравнивая показатели относительной экспрессии генетических локусов в опухолевой и условно здоровой ткани.

Для этого вычисляли медиану Е cancer опухолевых образцов и медиану Enormal контрольных (условно здоровая ткань) для каждого генетического локуса и рассчитывали соотношение относительной экспрессии генов в опухолевой ткани по отношению к нормальной ткани молочной железы:

К=Ecancer/Enormal.

Для доказательства прогностической ценности генов MAGEA2, MAGEB1 и XAGE3 приводим две выписки из историй болезни.

1) Больная К., 56 лет, госпитализирована в феврале 2016 г. в отделение опухолей костей, кожи, мягких тканей и молочной железы ООККМТМЖ №1 РНИОИ с верифицированным диагнозом рак правой молочной железы после пункционной биопсии опухоли, УЗИ молочных желез, маммографии.

Результаты молекулярно-генетического анализа образцов биопсии: КMAGЕА2=4,5; КMAGEB1=20,1 и КXAGE3=16,4 соответствуют прогностическим коэффициентам развития метастазов, что подтверждено результатами послеоперационного гистологического анализа - T2N3M0.

Больной было выполнено хирургическое вмешательство согласно стандарту лечения радикальная мастэктомия по Маддену с пластическим компонентом справа после секторальной резекции.

Морфологический анализ после операции: инфильтрирующий дольковый рак, гистологический анализ: метастазы рака в 9-ти подключичных, 17-ти подкрыльцовых и 7-и подлопаточных лимфатических узлах (T2N3M0).

После консультации специалистов (радиолога и химиотерапевта) показаны курсы АПХТ и адъювантная лучевая терапия.

Состояние при выписке: удовлетворительное, заживление раны первичным натяжением, послеоперационный период без осложнений.

2) Больная Д., 57 лет, госпитализирована в феврале 2016 г. в отделение опухолей костей, кожи, мягких тканей и молочной железы ООККМТМЖ №1 РНИОИ с верифицированным диагнозом рак правой молочной железы после пункционной биопсии опухоли, УЗИ молочных желез, маммографии.

Результаты молекулярно-генетического анализа образцов биопсии: KMAGEA2=0,4, КMAGEB1=0,6 и КXAGE3=0,2 соответствуют прогностическим коэффициентам отсутствия метастазов, что подтверждено результатами послеоперационного гистологического анализа - T2N0M0.

При осмотре в правой молочной железе в верхне-наружном квадранте пальпировалась плотная опухоль до 3 см, сосок ротирован в сторону опухоли. По результатам маммографии - рак правой молочной железы, по результатам УЗИ молочных желез также рак правой молочной железы.

Проведено хирургическое лечение - секторальная резекция правой молочной железы, радикальная мастэктомия справа с пластическим компонентом, обезболивающая терапия (кетонал), антибактериальная терапия (Азаран 2 г).

Гистологические исследование: умеренно-дифференцированная аденокарцинома, метастазов нет.

Диагноз заключительный клинический рак правой молочной железы, cT2NxM0, pT2N0M0, ст. II А, состояние после хирургического лечения, кл. гр. 2.

Больная наблюдается по настоящее время без признаков рецидива и метастазов.

Предлагаемым способом было осуществлено прогнозирование метастазов у 25 пациенток с диагностированным раком молочной железы.

Заявляемый способ является экономически оправданным, осуществляется в условиях стандартной лаборатории молекулярной биологии, без использования специального дорогостоящего оборудования; обладает высокой чувствительностью и специфичностью, универсален, его осуществление возможно с операционными биоптатами, регистрацию результатов производят однократно в конце исследования, способ занимает менее 8 часов.

Способ прогнозирования развития метастазов у больных раком молочной железы, включающий выделение тотальной РНК из тканевых проб молочной железы с помощью метода гуанидин-тиоционат-фенол-хлороформной экстракции, получение кДНК с помощью реакции обратной транскрипции на матрице РНК, отличающийся тем, что проводят амплификацию в режиме реального времени в присутствии красителя EvaGreen Dye с использованием высокоспецифичных праймеров для генов MAGEA2, MAGEB1, XAGE3 и GAPDH, проводят анализ первичных данных с помощью программного продукта амплификатора, рассчитывают относительную экспрессию генетических локусов по формуле 2-ΔCt, где С1 - медиана по трем повторам для целевого локуса и референсного GAPDH, величина ΔCt=Ct(ген мишень)-Ct(GAPDH), вычисляют коэффициент экспрессии генов - КMAGEA2, КMAGEB1, КХАGE3 по формуле К=Ecancer/Enormal, где Ecancer - относительная экспрессия генов в опухолевой ткани, Enormal - относительная экспрессия генов нормальной ткани молочной железы, и при значениях КMAGЕА2<0,6±0,2, КMAGEB1<1,0±0,3 и КХАGE3<1,0±0,8 прогнозируют отсутствие метастазов, а при значениях КMAGEA2>3,5±0,9, КMAGEB1>17,7±2,1 и КMAGE3>14,7±1,5 прогнозируют развитие метастазов.



 

Похожие патенты:

Изобретение относится к медицине, а именно к хирургии, онкологии, и может быть использовано для дифференциальной диагностики кистозных неоплазий поджелудочной железы.

Группа изобретений относится к медицине, а именно к прогнозированию или мониторингу будущего или текущего ответа пациента, страдающего раком, на лечение агонистом TLR-9.

Изобретение относится к медицине и касается способа прогнозирования риска возникновения рака молочной железы или рака легких у женщины, которая не страдает раком, включающего определение уровня проэнкефалина или его фрагментов, состоящих по меньшей мере из 5 аминокислот, в общей воде организма, взятой у указанной женщины, и установление корреляции между указанным уровнем проэнкефалина (PENK) или его фрагментов и риском возникновения рака молочной железы или рака легких.

Предложенная группа изобретений относится к области медицины, в частности, к онкологии и молекулярной биологии. Предложены набор реагентов и планшет для определения риска возникновения рецидива онкологических заболеваний молочной железы, включающие праймеры и зонды, специфичные по отношению к генам-маркерам ELOVL5, IGFBP6, TXNDC9.

Настоящее изобретение относится к медицине, а именно к лабораторной диагностике, и может быть использовано для обнаружения злокачественной опухоли, экспрессирующей CAPRIN-1.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия рака у субъекта, включающий определение концентрации Hsp90α в образце плазмы субъекта.

Предложенная группа изобретений относится к области медицины. Предложены способ и набор для определения наличия рака у субъекта, включающий определение концентрации Hsp90α в образце плазмы субъекта.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, способные к специфическому связыванию с фолатным рецептором человека 1 (FOLR1).

Изобретение относится к биотехнологии. Изобретение касается способа диагностики миелоидных новообразований.

Настоящее изобретение относится к области биотехнологии, конкретно к оценке терапевтической эффективности химиотерапии с использованием противоопухолевого средства, и может быть использовано в медицине.

Изобретение относится к области медицины. Предложен способ определения маркеров наличия опухолевых Т-лимфобластов.

Изобретение относится к области медицины. Предложен способ определения маркеров наличия опухолевых Т-лимфобластов.

Группа изобретений относится к биохимии. Предложена нуклеиновая кислота, кодирующая люциферазу или ее функциональный фрагмент и выбранная из группы, состоящей из нуклеиновой кислоты, кодирующей белок, характеризующийся аминокислотной последовательностью, представленной в SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 или 34, нуклеиновой кислоты, кодирующей белок, имеющий последовательность, которая по крайней мере на 65% идентична аминокислотной последовательности, представленной в SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 или 34, и нуклеиновой кислоты, кодирующей белок, в состав которого входит консенсусная последовательность SEQ ID NO: 35.

Предложенная группа изобретений относится к области медицины, в частности акушерству и медицинской генетике. Предложены способы определения источника анеуплоидных клеток по крови беременной женщины.

Предложенная группа изобретений относится к области медицины, в частности акушерству и медицинской генетике. Предложены способы определения источника анеуплоидных клеток по крови беременной женщины.

Изобретение относится к области генетики, молекулярной биологии и медицины. Предложен способ выявления соматических мутаций Q209P (с.

Изобретение относится к области генетики, молекулярной биологии и медицины. Предложен способ выявления соматических мутаций Q209P (с.

Изобретение относится к области генетики, молекулярной биологии и медицины. Предложен способ выявления соматических мутаций в генах BRAF, NRAS и KIT.

Изобретение относится к области генетики, молекулярной биологии и медицины. Предложен способ выявления соматических мутаций в генах BRAF, NRAS и KIT.

Изобретение относится к медицине, а именно к биотехнологии, и может быть использовано для оценки остеогенного потенциала мезенхимальных стромальных клеток. Способ включает оценку экспрессию генов BGLAP Osteocalcin, BMPR1A, ВМР1, IGF1, COL1A1,COL3A1, ALPL, RUNX2, SMAD2, SMAD4, VDR, FGF-2, IGFR1, SPP1 Osteopontin, TGFBR1 методом реал-тайм ПЦР.

Изобретение относится к биотехнологии. Изобретение представляет собой способ определения в гене галактозо-1-фосфатуридилтрансферазы человека мутации Q188R, rs35742686. Способ может быть использован при скрининге носительства моногенных заболеваний. Способ включает снятие кривых плавления с флуоресцентно-меченными аллель-специфичными олигонуклеотидными пробами. Используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченные аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченный гасителем флуоресценции, следующего нуклеотидного состава:GALT-s GGTCAGGAGGGAGTTGACTTGGGALT-as CCACAGTGCTGGCTCAGACTCAGCGALT-p1 CCACTGCCAGGTAAGG-FAMGALT-p2 CACTGCCGGGTAAGG-VICGALT-р3 BHQ1- GTGTCAGGGGCTCCAGTGG-P,где FAM означает флуоресцентный краситель FAM, VIC означает флуоресцентный краситель VIC, BHQ1 означает присоединенный к 5'-концевому нуклеотиду темновой гаситель флуоресценции. Относят образец к гомозиготе или гетерозиготе по данному аллелю по анализу форм кривых плавления ДНК, а именно по максимуму первой производной графиков флуоресценции. Предложенное изобретение позволяет более доступно проводить определение в гене галактозо-1-фосфатуридилтрансферазы человека мутации Q188R, rs35742686. 1 ил., 1 табл., 1 пр.

Изобретение относится к медицине и предназначено для прогнозирования развития метастазов у больных раком молочной железы на основе анализа экспрессии генов MAGEA2, MAGEB1 и XAGE3. Проводят амплификацию в режиме реального времени в присутствии красителя EvaGreen Dye с использованием высокоспецифичных праймеров для генов MAGEA2, MAGEB1, XAGE3 и GAPDH, проводят анализ первичных данных с помощью программного продукта амплификатора, рассчитывают относительную экспрессию генетических локусов по формуле 2-ΔCt, вычисляют коэффициент экспрессии генов - KMAGEA2, КMAGEB1, КXAGE3 по формуле КEcancerEnormal, где Ecancer - относительная экспрессия генов в опухолевой ткани, Enormal - относительная экспрессия генов нормальной ткани молочной железы, и при значениях КMAGEA2<0,6±0,2, КMAGEB1<1,0±0,3 и КХАGE3<1,0±0,8 прогнозируют отсутствие метастазов, а при значениях КMAGEA2>3,5±0,9, КMAGEB1>17,7±2,1 и КXAGE3>14,7±1,5 прогнозируют развитие метастазов. Способ позволяет осуществить прогноз развития метастазов при раке молочной железы. 1 табл., 2 пр.

Наверх