Штамм вируса для изготовления вакцинных препаратов против геморрагической лихорадки с почечным синдромом (варианты)

Изобретение относится к области биотехнологии. Изобретение представляет собой штамм ДОБ-СОЧИ/VERO (DOB-SOCHI/VERO) вируса Добрава/Белград (Dobrava-Belgrade orthohantavirus, семейство Hantaviridae, отряд Bunyavirales), депонированный под №1282 в Государственной коллекции вирусов (Институт вирусологии им. Д.И. Ивановского ФГБУ «НИЦЭМ им. Н.Ф. Гамалеи» Минздрава России), адаптированный к размножению в культуре клеток почек зеленой мартышки Vero, предназначенный для изготовления вакцинных препаратов для специфической профилактики геморрагической лихорадки с почечным синдромом, а также штамм XTH-P88/VERO (HTN-P88/VERO) вируса Хантаан (Hantaan orthohantavirus, семейство Hantaviridae, отряд Bunyavirales), депонированный под №1283 в Государственной коллекции вирусов (Институт вирусологии им. Д.И. Ивановского ФГБУ «НИЦЭМ им. Н.Ф. Гамалеи» Минздрава России), адаптированный к размножению в культуре клеток почек зеленой мартышки Vero, предназначенный для изготовления вакцинных препаратов для специфической профилактики геморрагической лихорадки с почечным синдромом. 2 н.п. ф-лы, 1 табл., 1 пр.

 

Изобретение относится к области вирусологии, в частности, к получению штаммов-продуцентов, предназначенных для вакцинопрофилактики вирусных инфекций, а именно хантавирусной инфекции - геморрагической лихорадки с почечным синдромом (ГЛПС). Возбудителями ГЛПС являются 4 вируса: ПУУМАЛА (ПУУ), ХАНТААН (ХТН), СЕУЛ (СЕУ) и ДОБРАВА/БЕЛГРАД (ДОБ), которые циркулируют среди диких мышевидных грызунов и могут заражать людей, вызывая у них тяжёлое заболевание. Наиболее тяжелое клиническое течение ГЛПС вызывают: геновариант вируса ДОБ – вирус СОЧИ (ДОБ-СОЧИ) и вирус ХТН с летальностью 14% и 6% соответственно. Образцы вирусов, полученные в результате выделения вирусологическими методами из крови больных ГЛПС и органов погибших от ГЛПС людей или инфицированных животных, называются штаммами выше перечисленных вирусов – возбудителей ГЛПС. После детального изучения молекулярно-биологических характеристик штаммы могут быть использованы для изготовления диагностических и вакцинных препаратов.

Известно, что трудности, связанные с разработкой вакцинных препаратов против хантавирусов – возбудителей ГЛПС обусловлены особенностями репродукции штаммов этих вирусов в чувствительных клеточных системах. Для них характерен довольно длительный цикл размножения, низкий уровень продукции и отсутствие цитопатогенного действия. В связи с этим основное затруднение состоит в адаптации штаммов к разрешенной для вакцинного производства перевиваемой культуре клеток Vero.

Задачей предлагаемого изобретения является разработка вакцинного препарата и способа производства вакцинного препарата для профилактики геморрагической лихорадки с почечным синдромом. Указанная задача решается при помощи получения впервые в мире штамма вируса ДОБ-СОЧИ, а также штамма вируса ХТН, способных к размножению в разрешенной для вакцинного производства перевиваемой культуре клеток Vero с накоплением вирусной массы в количествах, достаточных для изготовления вакцинных препаратов для специфической профилактики ГЛПС.

Описываемое изобретение включает в себя штамм ДОБ-СОЧИ/VERO (DOB-SOCHI/VERO) вируса Добрава/Белград (Dobrava-Belgrade orthohantavirus, семейство Hantaviridae, отряд Bunyavirales), депонированный под №1282 в Государственной коллекции вирусов (Институт вирусологии им. Д.И. Ивановского ФГБУ «НИЦЭМ им. Н. Ф. Гамалеи» Минздрава России), адаптированный к размножению в культуре клеток почек зелёной мартышки Vero, предназначенный для изготовления вакцинных препаратов для специфической профилактики геморрагической лихорадки с почечным синдромом, а также его производные.

Описываемое изобретение также включает в себя штамм ХТН-Р88/VERO (HTN-P88/VERO) вируса Хантаан (Hantaan orthohantavirus, семейство Hantaviridae, отряд Bunyavirales), депонированный под №1283 в Государственной коллекции вирусов (Институт вирусологии им. Д.И. Ивановского ФГБУ «НИЦЭМ им. Н. Ф. Гамалеи» Минздрава России), адаптированный к размножению в культуре клеток почек зелёной мартышки Vero, предназначенный для изготовления вакцинных препаратов для специфической профилактики геморрагической лихорадки с почечным синдромом, а также его производные.

В описании данного изобретения термины «включает» и «включающий» интерпретируются как означающие «включает, помимо всего прочего». Указанные термины не предназначены для того, чтобы их истолковывали как «состоит только из».

Если не определено отдельно, технические и научные термины в данной заявке имеют стандартные значения, общепринятые в научной и технической литературе.

Термин «антиген» обозначает любое вещество, которое организм субъекта рассматривает как чужеродное или потенциально опасное и против которого организм может индуцировать (запускать) иммунный ответ. Это могут быть компоненты инфекционного агента, такие как, например, фрагменты белков вируса или бактерии, а также инфекционные агенты, сохранившие, хотя бы частично, присущую им структуру.

Термин «производные» для штаммов вирусов, депонированных под номерами №1282 и №1283 в Государственной коллекции вирусов (Институт вирусологии им. Д.И. Ивановского ФГБУ «НИЦЭМ им. Н. Ф. Гамалеи» Минздрава России), обозначает вирусы, полученные из исходных вирусов, депонированных под номерами №1282 и №1283, имеющие схожие характеристики репликации, но отличающиеся в одной или нескольких областях генома. Под характеристиками репликации следует понимать способность и скорость размножения в культуре клеток почек зелёной мартышки Vero, а также способность к размножению в мышах линии Balb/c.

В предлагаемом изобретении описаны вакцинные штаммы ДОБ-СОЧИ/VERO и ХТН-Р88/VERO, способные к размножению в перевиваемой культуре клеток почек зелёной мартышки, линии Vero (ATCC CCL-81), и используемые для накопления вирусной массы с целью изготовления профилактической вакцины против ГЛПС.

Методика выделения вирусных штаммов.

Исходно штаммы Орлова/Сочи-09 и P-88/Хабаровск-89 были выделены в наиболее пермиссивной для размножения хантавирусов культуре клеток почек зелёной мартышки, линии Vero-E6 (ATCC CRL-13001): первый - из крови больной из Сочи, погибшей от ГЛПС в 2009 г., второй из крови больного ГЛПС из Хабаровска в 1989 г.

Клетки Vero-E6 выращивают на среде 2МЕМ с 5% телячьей сыворотки. В качестве поддерживающей рост клеток (после заражения) применяют ту же среду с 1% телячьей сыворотки. Для изоляции вируса в клетках Vero-E6 использовали цельную кровь, взятую в остром периоде болезни от больного ГЛПС. Через 10-12 дней культивирования при 37 °С заражённые клетки снимают со стекла для выявления вирусспецифического антигена, после чего ими заражают свежие клетки. Выявление вирусного антигена осуществляют с помощью непрямого метода флюоресцирующих антител (МФА). Для приготовления препаратов для исследования в МФА клетки снимают со стекла смесью 0,02% версена и 2,5% трипсина, готовят суспензию инфицированных клеток (450-550 тыс. кл/мл) и вносят её по 0,005 мл в лунки предметных стёкол для иммунофлюоресценции. После высушивания стёкла помещают на 20 минут в охлажденный ацетон для фиксации клеток и затем высушивают при комнатной температуре. На готовые препараты наносят соответственно референс сыворотки от больных ГЛПС с антителами к известным вирусам-возбудителям ГЛПС в разведениях, начиная с 1:64 и заканчивая разведением, соответствующим титру сыворотки, а также нормальную сыворотку, не содержащую антител к возбудителям ГЛПС, в разведениях с 1:16 до 1:64. Препараты помещают во влажную камеру и инкубируют при 37±1 °С в течение 30 мин (или при 6±2 °С в течение 18 час). После окончания экспозиции препараты 3-кратно отмывают физиологическим раствором (0,85% NaCl), промывают дистиллированной водой, высушивают и наносят на них ФИТЦ-конъюгат против иммуноглобулинов человека. Препараты помещают во влажную камеру и инкубируют при 37±1 0С в течение 30 мин. После чего их 3-х кратно промывают физиологическим раствором и 1-кратно дистиллированной водой, высушивают и исследуют с помощью люминесцентного микроскопа, используя водно-иммерсионный объектив х 65. Аналогичные процедуры исследования клеток на присутствие вирусспецифического антигена повторяют с той же периодичностью после каждого из 5-6 пассажей инфицированных клеток. В случае обнаружения специфического антигена в клетках проводят сбор культурального вируса, который затем помещают на хранение в дъюар с жидким азотом.

После выделения и закрепления в 10 пассажах в культуре клеток Vero-E6 штаммы подвергли адаптированию к размножению в культуре клеток линии Vero.

Методика адаптации штаммов заключается в следующем.

Для первичного заражения клеток Vero используют вируссодержащую суспензию клеток Vero-E6, инфицированных штаммами Орлова/Сочи-09 и P-88/Хабаровск-89 . Вирус (в ампулах или пробирках) извлекают из жидкого азота, оттаивают при комнатной температуре или в водяной бане (18±1) °С и разводят средой Игла МЕМ с двойным содержанием аминокислот и витаминов до концентрации, обеспечивающей множественность заражения 0,1-0,5 фокус образующих единиц (ФОЕ) на клетку. Культуру клеток Vero перед заражением дважды отмывают рабочим pacтвopoм Хенкса, после чего в 1 л роллерную бутыль с монослоем клеток вносят 15 мл инокулята вируса. Для адсорбции вируса на клетки, зараженные бутыли помещают в роллерную установку и инкубируют 1 час при температуре (37±I) °C. Пo истечении указанного времени в каждую бутыль вносят 100 мл поддерживающей среды Игла MEM с двойным содержанием аминокислот и витаминов (без добавления сыворотки крови плодов коров) и снова помещают в роллерную установку в термостатную комнату с температурой (37±I) °C. Сбор вируса осуществляют на 8-10 день с момента заражения клеток. Перед сбором вируса бутыли с зараженной культурой просматривают под микроскопом. Выбраковывают флаконы с признаками дегенерации клеток и бактериальной контаминацией. После удаления поддерживающей среды в зараженные флаконы вносят по 25-30 мл диспергента 0,02%-ный раствор версена, подогретого в термостате до температуры (36±1) °С. Поворачивая флакон, обмывают этим раствором весь монослой клеток, затем диспергент стерильно удаляют и обеззараживают автоклавированием. Культуру клеток оставляют при температуре (18±2) °С до тех пор, пока клетки не начнут отслаиваться от стекла. Отслоившиеся зараженные клетки ресуспендируют в минимальном объёме вируссодержащей культуральной жидкости, предварительно отобранной из флакона с зараженной культурой (15 мл на 1 литровый роллерный флакон). Клеточную взвесь из всех зараженных флаконов объединяют, 3-х кратно замораживают при температуре минус (70±1) °С, оттаивают при температуре (18±2) °С и стерильно разливают по (1,5±0,1) мл в криогенные пробирки, маркируют и хранят пpи температуре минус (70±2) °С. Аналогичные процедуры применяют при последующих пассажах, при этом, материалы каждого пассажа исследуют на содержание инфекционного вируса с помощью метода фокусобразующих единиц (ФОЕ). Монослой клеток Vero-E6, выращенных в 24-луночных панелях (фирма Costar), заражают 10-кратными разведениями вируссодержащей культуральной жидкости. После контакта с клетками при 37±1° С в течение 1 часа инокулят удаляют и вносят 0,6% метилцеллюлозное покрытие (800 мкл на лунку). После инкубации при 37±1° С в течение 6 - 8 суток, полужидкое покрытие удаляют, клетки однократно отмывают 0,85% раствором NaCl. Для фиксации монослоя клеток вносят в лунки панели по 400 мкл 96 % спирта и после 20 минутной экспозиции при комнатной температуре спирт удаляют, клетки 3-х кратно по 10 мин отмывают 0,85% раствором NaCl и вносят в каждую лунку по 200 мкл специфической анти-ХТН или анти-ДОБ сыворотки в дозе 16 - 32 ед. После контакта при 37±1 °С в течение 60 мин клетки 3-х кратно по 5 мин отмывают 0,85% раствором NaCl, вносят в лунки по 200 мкл меченные пероксидазой хрена белок «А». После контакта в течение 60 мин при 37±1° С или 18 час при 6±2° С клетки 3-х кратно по 10 мин отмывают 0,85% раствором NaCl и вносят индикатор пероксидазы хрена. В качестве субстрат-индикаторной системы применяют 0,05% диаминобензидин тетрахлорид с добавлением 0,02% NiCl2 и 0,01% Н2О2, после чего через 15-20 мин. проводят учёт опыта. Количество инфицированных колоний клеток в виде темно-серых пятен определяют визуально, и титр вируса выражают в виде lg ФОЕ в 1 мл вносимого для инфицирования клеток образца.

На уровне 7-го пассажа в клетках Vero штаммы Орлова/Сочи-09 и P-88/Хабаровск-89 очищают от клеточной ДНК путём обработки дезоксирибонуклеазой в концентрации 0,3 мкг/мл в оптимальных для этого фермента условиях. При этом, по данным метода молекулярной гибридизации, концентрация клеточной ДНК снижается до уровня менее 10 пг/мл. Далее вирус концентрируют осаждением при помощи 7,5 %-ного раствора ПЭГ-6000 при температуре (6±2) °С в течение (18±2) часов и очищают зональным центрифугированием (25.000 об/мин, 3,5 час, 5°С) в градиенте плотности сахарозы (5-20%) с последующей фильтрацией через мембранный фильтр с диаметром пор 0,22 мкм.

Полученными материалами штаммов Орлова/Сочи-09 и P-88/ Хабаровск-89 заражают культуру клеток Vero и пассируют в этой культуре до достижения стабильного размножения вирусов с титрами не менее 5,5 lg ФОЕ/мл.

Адаптированные к культуре клеток Vero вирусные штаммы Орлова/Сочи-09 и P-88/ Хабаровск-89 получили название вакцинных штаммов ДОБ-СОЧИ/VERO и ХТН-Р88/VERO.

Нижеследующие примеры осуществления способа приведены в целях раскрытия характеристик настоящего изобретения и их не следует рассматривать как каким-либо образом ограничивающие объем изобретения.

Штаммы ДОБ-СОЧИ/VERO и ХТН-Р88/VERO исследовали на видовую специфичность (с использованием непрямого МФА с моновалентными антигенами и реакции нейтрализации) и специфическую активность (иммуногенность) на мышах Balb/c.

Методика определения вируснейтрализующих антител.

Для определения вируснейтрализующих антител исследуемые сыворотки в 2-х кратных разведениях смешивают с 50-100 ФОЕ каждого из взятых для идентификации вирусов ХТН и ДОБ и инкубируют при 6 ±2 °С в течение 18-20 часов. На монослой клеток Vero-E6, выращенных в 24 луночных панелях (Сostar), вносят по 0,2 мл вирус-сывороточной смеси и инкубируют при 37±1 °С в течение 1 часа. Затем добавляют метилцеллюлозное покрытие и через 6-7 дней инкубации при 37±1 °С полужидкое покрытие удаляют и монослой фиксируют 96° спиртом. Образовавшиеся в культуре клеток фокусы выявляют с помощью твёрдофазного иммуноферментного метода, используя специфические анти-ХТН и анти- ДОБ сыворотки и меченный пероксидазой хрена белок “А”. В качестве индикаторной системы применяют 0,05% диаминобензидин тетрахлорид с добавлением 0,02% NiCl2 и 0,01% Н2О2, после чего через 15-20 мин проводят учёт опыта. Титр вируснейтрализующих антител определяют по 80% подавлению числа фокусобразующих единиц (ФОЕ).

Методика определения специфической иммуногенной активности.

Предварительно из вируссодержащих жидкостей клеток Vero, инфицированных штаммами ДОБ-СОЧИ/VERO и ХТН-Р88/VERO, готовят инактивированные, концентрированные, очищенные и адсорбированные на гидроокиси алюминия препараты. Для иммунизации используют мышей линии Balb/c 9-10 недельного возраста, весом 18-20 г, которым вводят исследуемые препараты в объёме 0,5 мл внутримышечно трехкратно с 2-х недельным интервалом. В качестве контрольных используют мышей Balb/c, которым в те же сроки вводят только адсорбент - гидроокись алюминия. Через 2 недели после последней инъекции у животных берут из орбитальной вены кровь и готовят из неё сыворотку. В полученных сыворотках крови определяют титр вируснейтрализующих антител к вирусам ХТН и ДОБ, используя выше описанный метод определения вируснейтрализующих антител.

При исследовании штаммов ДОБ-СОЧИ/VERO и ХТН-Р88/VERO в перекрёстных опытах МФА и РН с прототипными штаммами вирусов ПУУ, ХТН, ДОБ, СЕУ подтверждена их видоспецифичность, а в опытах на мышах линии Balb/c - иммуногенная активность. Помимо результатов иммунологических исследований видоспецифичность штаммов подтверждена данными молекулярно-генетических исследований. Следовательно, по антигенным и молекулярно-биологическим свойствам штаммы ДОБ-СОЧИ/VERO и ХТН-Р88/VERO соответствуют естественно циркулирующим в природе прототипным штаммам вирусов ХТН и ДОБ.

Ниже представлены морфологические характеристики варианта № 1– штамм ДОБ-СОЧИ/VERO и варианта № 2 – штамм ХТН-Р88/VERO «Штамма вируса для изготовления вакцинных препаратов против геморрагической лихорадки с почечным синдромом».

Вирионы имеют округлую форму с размером в диаметре от 90 до 120 нм. Липидосодержащая оболочка имеет выступы – пепломеры, длиной до 10 нм, сформированные вирионными гликопротеинами; вирусные частицы морфологически однородны. Вирионы располагаются в цитоплазме клетки, наибольшее их скопление наблюдается в цитоплазмитической сети и везикулах аппарата Гольджи. Плавучие плотности вирусных частиц в растворах сахарозы и хлорида цезия составляют 1.16-1,17 и 1,2-1,21 г/мл соответственно. Хантавирусы инактивируются растворителями липидов и термообработкой при температуре 50°С; стабильны в нейтральной среде при значениях рН от 5,5 до 8. Вирион проникает в клетку, прикрепляясь к ее поверхности участками одного или обоих наружных белков (G1 и G2), с последующим эндоцитозом. Предполагается, что необходимым условием проникновения вируса в клетку является закисление эндосом, что приводит к изменению конформации G1:G2 гетеродимеров и способствует слиянию клеточной и вирусной мембран.

Далее представлены биотехнологические характеристики варианта № 1– штамм ДОБ-СОЧИ/VERO и варианта № 2 – штамм ХТН-Р88/VERO «Штамма вируса для изготовления вакцинных препаратов против геморрагической лихорадки с почечным синдромом».

Как известно, хантавирусы плохо размножаются даже в пермиссивных клеточных культурах. После заражения полученными в результате адаптации штаммами монослойной культуры клеток Vero получают от 3 до 5 сборов вируссодержащей биомассы со средним титром 5,5 lg ФОЕ/мл, что указывает на возможность их использования для вакцинопрофилактики ГЛПС. Заявленные штаммовые варианты, получив в результате адаптации к размножению в клетках Vero способность накапливаться в высоких титрах в культуральной жидкости, сохранили свои основные характеристики, включая их иммуногенность. Иммуногенные свойства штаммовых вариантов определяли в опытах на мышах линии Balb/c по образованию вирус нейтрализующих антител в ответ на введение внутримышечно 3-х кратно с 2-х недельным интервалом препаратов, приготовленных по схеме производства инактивированной цельновирионной вакцины, описанных в примерах 1 и 2. Методика определения вируснейтрализующих антител по подавлению фокус образующих единиц была приведена выше. Как видно из таблицы 1, заявленные штаммы обладают достаточно высокой иммуногенной активностью.

Таблица 1

Выявление нейтрализующих антител в сыворотках крови мышей Balb/c

Разведения штаммовых вариантов Титр нейтрализующих антител к штаммам
ДОБ-СОЧИ/VERO ХТН-Р88/VERO
Н/Р 136* 158
1/2 54 64
1/4 20 22,5
1/8 12,5 14
1/16 10 8,8
1/32 7,5 6
1/64 2,5 3,5
1/128 0 0

* - средний арифметический титр сыворотки (величина, обратная её разведению), обеспечивающий подавление 50% ФОЕ/мл

Ниже представлены молекулярно-генетические характеристики варианта № 1– штамм ДОБ-СОЧИ/VERO и варианта № 2 – штамм ХТН-Р88/VERO «Штамма вируса для изготовления вакцинных препаратов против геморрагической лихорадки с почечным синдромом».

Геном вирусов представляет собой сегментированную одноцепочечную негативную РНК. Три сегмента генома - большой (L), средний (M) и малый (S) - кодируют вирусную РНК-зависимую РНК-полимеразу RdRp, поверхностные гликопротеины G1 и G2 и нуклеокапсидный белок N, соответственно. Каждый из геномных сегментов имеет единственную функционирующую открытую рамку считывания (ОРС). Вирусные белки - RdRp, G1, G2 и N - имеют молекулярные массы 200, 72, 56 и 45 KДа соответственно. Все три сегмента хантавирусной РНК имеют на 3'-концах одну и ту же характерную короткую последовательность 3'-AUCAUCAUCUG-…-5', отличающую их от других буньявирусов.

Подготовка образцов для сиквенирования включает: выделение тотальной РНК из лизата зараженных клеток Vero с помощью реагента Trizol (GibcoBRL), обратной транскрипции с использованием статистического гексануклеотида в качестве праймера, полимеразную цепную реакцию (ПЦР) в стандартных условиях с применением родоспецифических праймеров генома хантавирусов, комбинирование праймеров, комплементарных различным участкам малого и среднего сегментов генома, клонирование ПЦР-фрагмeнтов с использованием вeктора pCR 2.0 (TA cloning kit; Invitrogen). Для каждого из образцов были приготовлeны 3 клона, источником которых являлись различныe колонии. Сeквeнированиe проводили с использованиeм Sequenase version 2.0 (United States Biochemicals) в обоих направлeниях.

В результате были получены следующие сиквенсы:

1) S сегмент генома варианта № 1 – штамм ХТН-Р88/VERO - SEQ ID NO:1

ACTAGAATAACGATGGCAACTATGGAGGAATTGCAGAGGGAAATCAATGCCCACGAGGGTCAACTGGTGATAGCCAGGCAGAAGGTTAGGGATGCAGAAAAGCAGTATGAAAAGGATCCAGATGAGTTAAACAAGAGAGCATTGACAGATCGAGAGGGTGTTGCAGTATCCATCCAAGCAAAGGTTGATGAATTAAAGAGGCAACTGGCAGATCGGATCGCAACCGGGAAGAATCTTGGAAAGGAACAAGACCCAACAGGGGTAGAACCTGGAGATCATCTGAAAGAGAGATCAATGCTCAGTTATGGAAATGTTCTTGACTTAAACCACCTGGATATTGATGAGCCGACAGGACAGACAGCAGACTGGCTGAGCATTGTTGTCTATCTTACATCCTTTGTTGTCCCAATACTTCTGAAAGCTCTGTATATGTTAACAACAAGGGGGAGGCAGACCACCAAGGACAATAAGGGAACTCGGATTCGATTCAAGGATGATAGTTCCTTCGAGGATGTCAATGGCATCCGGAAGCCAAAACATCTATATGTGTCCTTGCCAAATGCACAGTCAAGTATGAAAGCAGAAGAGATTACACCTGGTAGATATAGAACAGCAATTTGTGGGCTTTATCCTGCACAAATTAAGGCAAGACAGATGATTAGTCCTGTCATGAGTGTGATCGGATTCCTGGCTCTGGCAAAAGATTGGAGTGACCGCATTGAGCAGTGGTTAAGTGAACCCTGTAAGCTTCTTCCAGACACAGCAGCAGTTAGCCTCCTTGGTGGTCCTGCTACCAACAGGGACTACCTACGGCAGCGGCAAGTGGCATTAGGCAATATGGAAACAAAAGAGTCTAAGGCTATACGCCAACATGCAGAGGCAGCAGGCTGTAGCATGATTGAGGACATTGAGTCACCATCCTCAATATGGGTGTTTGCTGGAGCACCAGACCGCTGTCCACCAACATGTCTTTTCATTGCAGGTATTGCTGAGCTTGGGGCATTTTTTTCCATCTTGCAGGACATGCGGAATACAATCATGGCATCCAAGACAGTTGGAACCTCTGAGGAGAAGCTGCGGAAGAAATCTTCATTCTATCAGTCTTATCTCAGGAGAACACAATCAATGGGAATACAACTGGATCAGAGGATAATTGTGCTCTTCATGGTAGCTTGGGGGAAAGAGGCAGTGGATAACTTCCACCTAGGAGATGATATGGATCCTGAGCTGCGAACACTAGCACAGAGCCTGATTGATGTTAAAGTGAAGGAAATTTCTAACCAAGAGCCTTTAAAATTGTAATCAGTGAATGTATAACCCTCATTATGTGATTATTATATACTACTGAATCATTATCAATCATATTTGCACTATTATTATCAGGGGAATCAGTATATCAGGGTAAGGGCACATTTATGGGTGGGAATCATTACTCAGAGGGTGGGTCAGTTAATCCGTTGTGGGTGGGTTTAGTTCCTGGCTGCCTTAAGTAGCCTTTTTTTGTATATATGGATGTAGATTTCATTTGATCCTTAAACTAATCATGCTCTCTTTCCTTTTCCTCCTGCTTTCTCTGCTTACTAACAACAACATTCTACCTCAACACAAAACTACCTCAACTAAACTACCTCATTAAATTGCTCCTTGA

2) М сегмент генома варианта № 1 – штамм ХТН-Р88/VERO - SEQ ID NO:2

GAAAGCAGTCAATCAGCAACATGGGGATGTGGAAGTGGCTAGTAATAGCCAGTTTAGTAGGGCCTGTTTTGGCACTGCGAAATGTGTATGACATGAAAATTGAATGCCCCCACACAGTAAGTTTCGGAGAAAACAGTGTGATAGGGTATGTGGAGTTACCCCCTATGCCATTGGCTGACACAGCACAGATGGTGCCTGAGAGTTCTTGCAGCATGGATAATCATCAGTCAATAAACACTATAACAAAATACACTCAGGTAATCTGGAGAGGAAAGGCAGATCCGGGACAATCCAGTCAGAATTCATTCGAAACAGTGTCTACTGAAGTTGACTTGAAAGGAACATGTGTTTTAAAGCATAAGATGGTGGAAGAATCATACCGCAGCCGGAAGTCAATAACCTGTTATGACCTTTCTTGTAATAGTACTTATTGCAAGCCAACATTATATATGATTGTACCGATCCATGCATGTAATATGATGAAGAGCTGTCTAATTGCATTAGGGCCATACAGAGTGCAGGTAGTGTATGAGAGAACCTACTGTATGACAGGAGTCTTAATTGAAGGAAAATGTTTTGTCCCAGATCAAAGTGTTGTTAGCATTATTAAGCATGGGATCTTTGATATTGCAAGTGTTCATATTGTATGTTTCTTTGTTGCAATTAAGGGGAACACCTATAAACTCTTTGAACAGGTTAAGAAATCGTTTGAGTCAACTTGCAATGATACTGAGAATAAAGTACAGGGTTATTACATCTGTATTGTGGGAGGAAATTCTGCACCCATCTATGTCCCTACACTCGATGATTTCAGGTCCATGGAGGCATTTACAGGAATCTTTAAGTCACCGCATGGAGAAGACCATGACCTTGCTGGGGAGGAAATTGCTTCATACTCCATAGTTGGACCTGCAAATGCAAAAGTCCCTCATAGTGCAAGCTCAGACACACTAAGTTTAATTGCTTATTCAGGTATACCATCTTATTCTTCCCTGAGTATCTTGACAAGTTCAACAGATGCTAAGCATGTGTTTAGCCCTGGATTGTTCCCAAAGCTCAACCATACAAACTGTGATAAGAGTGCCATACCGCTTACATGGACTGGGATGATTGATTTACCTGGATACTATGAGGCCATACACCCTTGCACAGTTTTTTGTGTACTGTCAGGCCCTGGAGCTTCATGTGAAGCATTTTCTGAAGGTGGAATTTTCAACATAACTTCCCCCATGTGCTTAGTTTCAAAGCAAAATCGGTTCCGGCTAACAGAGCAGCAGGTGAACTTTGTGTGTCAAAGAGTAGACATGGACATTGTTGTGTACTGCAATGGGCAGCGGAAAGTAATATTAACAAAAACTTTAGTTATTGGGCAATGTATATATACTATAACAAGCTTGTTTTCACTACTACCTGGGGTAGCACATTCTATTGCTGTGGAACTATGTGTGCCTGGATTCCATGGCTGGGCTACAGCTGCTTTGCTTGTTACATACTGTTTTGGATGGGTCCTTATACCAGCTGTCACGTTTGTTATACTAACAGTCTTAAAGTTTGTTGCTAACATTTTTCACACAAGCAACCAAGAGAACAGGCTGAAATCAGTATTGAGAAAAATAAAAGAGGAGTTTGAAAAGACAAAGGGGTCAATGGTATGTGATGTTTGTAAGTATGAATGTGAAACCTATAAAGAATTAAAGGCACATGGGGTATCTTGCCCCCAATCTCAATGCCCTTACTGTTTTACTCATTGTGAGCCTACAGAGGCAGCATTTCAAGCCCACTATAAAGTATGCCAGGTAACTCACAGGTTCAGGGATGATCTTAAAAAGACTGTCACTCCTCAGAATTTCACACCAGGTTGTTATCGGACATTAAATTTATTTAGATACAAAAGTAGATGTTACATTTTCACAATGTGGGTATTCCTTCTCATTCTGGAATCTATACTGTGGGCTGCTAGTGCATCAGAAACACCGTTAGCTCCTGTTTGGAATGACAATGCCCATGGTGTTGGTTCTGTGCCCATGCACACAGATCTGGAGCTTGATTTTTCTCTGACATCCAGCTCTAAGTATACATACCGCAGGAAGCTAACAAACCCACTGGAAGAGGCACAATCAATTGATCTCCATATTGAAATAGAAGAGCAAACAATTGGTGTTGATGTGCACGCTCTAGGACATTGGTTTGATGGCCGTCTTAATCTTAAAACATCCTTTCACTGTTATGGTGCCTGTACAAAGTACGAGTACCCATGGCATACTGCAAAGTGTCACTATGAACGAGATTACCAATATGAGACAAGTTGGGGCTGTAATCCATCAGACTGCCCCGGGGTGGGTACAGGCTGCACAGCATGTGGGCTTTATCTTGACCAGTTAAAACCAGTTGGTAGTGCATATAAAATCATTACAATAAGATATAGTAGAAGAGTTTGTGTTCAGTTTGGAGAAGAAAACCTTTGTAAAATTATAGACATGAATGATTGCTTTGTATCTAGACATGTTAAAGTCTGTATTATTGGAACAGTTTCTAAGTTTTCACAAGGTGATACACTATTGTTTTTCGGGCCACTTGAAGGTGGTGGTTTGATATTTAAACACTGGTGTACATCTACATGTCAGTTTGGTGACCCAGGAGACATCATGAGCCCAAGGGACAAAGGTTTTTTATGCCCTGAGTTCCCAGGTAGTTTTAGAAAgAAATGTAATTTTGCTACTACTCCTATTTGTGAGTATGATGGAAATATGGTTTCGGGTTATAAAAAAGTGATGGCAACAATTGACTCTTTCCAATCCTTCAATACAAGCACTATGCACTTTACTGATGAGAGGATAGAATGGAAAGACCCTGATGGAATGTTGAGGGACCATATAAATATTTTAGTAACAAAGGATATTGATTTTGATAACCTTGGTGAAAACCCCTGTAAAATTGGCTTGCAGACATCTTCTATTGAAGGGGCATGGGGTTCTGGTGTAGGCTTTACACTTACATGCTTGGTATCATTAACAGAGTGTCCTACTTTTTTAACCTCCATTAAGGCCTGTGACAAAGCTATTTGTTATGGTGCAGAAAGTGTGAAATTAACGAGAGGACAAAATACAGTGAAGGTATCAGGGAAAGGTGGCCATAGTGGTTCAACTTTCAAATGTTGCCATGGGGAAGACTGTTCACAAATTGGGCTCCATGCTGCTGCACCCCACCTTGATAAAGTTAATGGGATCTCTGAAATAGAAAACAGTAAAGTATATGATGATGGAGCACCACAATGTGGTATAAAATGTTGGTTTGTCAAATCAGGGGAATGGATTTCAGGGATATTTAGTGGCAATTGGATTGTGCTCATTGTCCTCTGTGTGTTCTTACTATTTTCATTGGTCTTACTAAGCATCCTTTGCCCTGTCAGGAAGCATAAAAAATCATAGCTAGATGATGCTGTTATCAAGTTATTGTATATAGCTTTAACATATATACTAATTTTTATATTCCAGGACACTTTATCTAACACACTAAAAAAAATAGTAGCTTTCTAACCACAAAACTTAGATTTTTCTTCTGTATGATGTCTTAACATC

3) S сегмент генома варианта № 2 – штамм ДОБ-СОЧИ/VERO - SEQ ID NO:3

TAGTAGTATGCTCCCTAAAAAGCACTACACTAAAGATGGCAACATTGGAGGAACTCCAAAAGGAAATTAACAACCATGAAGGCCAACTGGTGATCGCCAGACAGAAGGTAAAGGATGCAGAAAAGCAATATGAGAAGGACCCTGATGACCTGAATAAAAGGGCATTAAGCGATCGGGAAAGTGTTGCACAGTCAATCCAAGGGAAAATTGATGAGTTGCGGAGACAGCTGGCTGACCGTGTGGCTGCAGGAAAAAATATTGGAAAAGAAAGGGATCCAACTGGACTAGACCCTGGTGATCATCTCAAAGAGAAGTCGATGCTCAGTTACGGGAATGTAATTGATCTTAATCACTTGGATATTGATGAACCAACAGGGCAAACTGCTGACTGGCTGAGCATTGTGGTCTATCTTACATCATTTGTGGTTCCAATACTTCTGAAGGCTCTTTACATGCTAACAACCAGAGGGAGACAAACTACTAAAGACAATAAAGGAATGAGGATTCGGTTCAAGGATGACAGTTCTTTTGAGGATGTGAACGGGATTCGAAAGCCAAAGCACCTGTTTCTGTCAATGCCCAATGCGCAATCCAGTATGAAAGCAGATGAGATCACACCAGGTCGATTCAGGACTGCAGTTTGTGGACTATATCCAGCTCAGGTTAAAGCAAGGAATTTGGTCAGTCCTGTAATGAGTGTGATTGGGTTTGTATCCCTTGCTAAAAACTGGACAGAGCGGGTTGAGGAATGGCTTGATCTCCCATGCAAGCTACTATCTGAGCCATCTCCCACGTCTTTGACTAAAGGCCCATCCACTAATCGTGACTACTTGAATCAAAGACAGGGGGCGCTTGCAAAAATGGAAACAAAGGAAGCTCAGGCTGTAAGGAAGCATGCCATAGATGCTGGTTGTAACCTTGTTGATCACATTGATTCACCATCATCAATTTGGGTCTTTGCAGGAGCACCTGATAGATGCCCCCCTACCTGCTTATTTGTTGCAGGCATGGCAGAGCTAGGTGCATTTTTTGCTGTCCTTCAAGATATGAGGAACACCATCATGGCATCGAAGACTATTGGGACATCAGAGGAGAAGTTGCGGAAGAAATCCTCTTTCTACCAGTCATATCTTAGAAGAACACAATCTATGGGAATACAACTGGATCAGCGTATTATTGTGCTTTTCATGGTGGACTGGGGTAAGGAAGCAGTTGACAGTTTCCATCTCGGTGATGACATGGACCCTGAGCTTCGAGGCCTGGCACAGGCACTGATTGATCAGAAAGTGAAGGAGATATCTAATCAGGAGCCGCTTAAGCTTTAAATGTATGTATTGCTTGTACCCCTGCTTTATGTAATCCCACATATGCTGCATTAATTGCTTGAACTGGAATTATTATCACTAGGGGATGGGTTGGGTGGGCCATTTATCCGTTATGTAATCTCAGGGTGGTTTAGGACGTCACCTTAAGTGACTATTTTTTGTATATATGGATGTAGATTTCAATTGATCTGTACTAACACCTTACTTCTTTCTTTTCCTTTCTTTACTAACAACAACTATCTACCGCAAAACAACAACACTACCTCAACAACTACTACCTCATTGATTTGCTTCCTGAATGTCTTTTTAGGGAGTCTACTACTA

4) М сегмент генома варианта № 2 – штамм ДОБ-СОЧИ/VERO - SEQ ID NO:4

AGTAGTAGACACCGCAAGAAAGAGCAGTTAAATAACAGCATAATCATGTGGGGTTTACTATTGACAATGATTTTGATCGATTTCGGGGCAACCCTTAGGAATGTCTATGACATGAGGATAGAATGCCCACATTCTGTCAACTTCGGGGAAAGCAGTGTATCAGGGAAAGTGGAGCTACCACCAGTTCTACTTAGTGAGGTAGAGACGCTTGTCCCAGAAAGCTCTTGCAATATGGATAATCACCAATCAATGTCAATCATACAAAAAGTCACTCAACTAACTTGGAGAAAGAAGGCTGATAAAGCGCAGGCAGCAAAAGACTCATTTGAAATTACCTCAGGTGAAGTCAGCTTGAAAGGTACATGCACCTTAACACATAGAATGGTTGAGGACTCTCATAGGAATAGAAAGTCAATAATATGTTATGACCTATCCTGTAATTCAACCCATTGTAAACCAACAATGCACATGATAGTTCCCATTCACTCATGTAATATGATGAAGAGCTGCCTGGTAGGCCTTGGACCTTACCGCATCCAGGTTGTTTATGAAAGAACATACTGCACAACTGGTATCCTAACAGAAGGAAAATGCTTTGTCCCTGATCAGAGCATTGTGAATGTCATAAAAAATGGTGTGTTTGATATTGCCAGTGTTAGTATTGTTTGCTTCTTCGTGAGAGTGAAGGGTACAAATTACAATATAATGGCTAGCATCAAAACAGCTACATCAAATAATTGTAATGACACTGGCAATAAAGTGCAGGGGTATTATCTGTGTATTGTGGGTGGAAATTCTTCACCAGTGTATGTACCATCAACTACTGATTTCCGTTCAATGGAAGCACTTGCAAGTATGCTTAGAGCACCCCATGGTGAAGATCATGATTTAGCTGGAGAAGAAGTTGCAACATATTCAATTGCTGGTCAAGTTGAAGGTAAAGTCCCCCACACTGCAAGTACAGCAAACATGCTCCTCACTGCATTCTCAGGGGTTCCTAGCTATTCTTCACTCAGCGTCTTCACTGGCAGTCAGGATGGCCCTATTGTATATAGTCCTGGATTGTTTCCTAAACTGAACCAATCATCATGTGATAAGGTTGGGCTGCCTCTAATATGGGAAGGTTACATTGACTTGCCAGGTTACTATGAAACAGTACATCAGTGCAATGTTTTCTGTGTTCTTTCAGGCCCTGGAGCATCATGTGAGGCATTCTCAGAGGGTGGAATATTCAACATAACATCTCCAAACTGTATGGTCTCTAAACAAAATAGATTCCGGGCTGCTGAACAACAGGTTAACTTTGCATGCCAAAGGGTTGACCAGGACATTTTAATCTTCTGTAATGGTCAGAAGAAAACAATCCTGACAAAAACATTAGTCATTGGTCAATGTATCTACTCAATAACAAGTTTATTTTCAATCATGCCAGGTGTAGCACATTCAATTGCAATTGAATTATGTGTGCCAGGTTTCCATGGGTGGGCAACAGCTGCCCTCCTCACAACATTCTGCTTTGGTTGGGTATTAATCCCATCTATTACCTTGGCTGTACTTGTTGTCTTAAAGTTTTTTGCTGCAATCTTACACAATAGTTCCCAGGAAAACCGGTTCAAGCTCATCTTGAAAAAGATCAAGGAAGAGTTTGAAAAAACAAAGGGTTCAATGGTTTGTGAGGTATGCAAGTATGAGTGTGAGACAGGGAAGGAATTAAAAGCACATAATCTATCCTGCCCGCAATCACAGTGTCCCTATTGTTTCACACACTGTGAACCAACTGAGTCAGCATTTCAAGCTCATTATAAGGTGTGCCAGGTAACACATAGATTTAGAGATGATCTGAAAAAGACTATAACACCTCAATCTACTAGCCCTGGGTGTTACCGGACCTTGAACTTGTTCAGGTACAAAAGTAGGTGTTATATATTCACAGTGTGGGTAGTTCTCCTTGTTGTAGAGTCAGTGATGTGGGCAGCCAGTGCTTCAGAGACAGTATTAGAGCCCTCATGGAATGATAACGCACATGGAGTTGGTGTAGTGCCTATGCATACAGACTTGGAATTAGATTTTTCTCTCCCATCAAGCTCGAAGTATACGTATAAAAGAAAGCTAACGAGCCCTATAAATCAGGAACAATCTGTTGACCTACACATTGAGATAGAGAGCCAAGGAATTTCTACAAGTGTCCATGCTTTAGGCCATTGGTTTGATGGTAGGTTAAACCTAAAGACATCATTTCACTGTTACGGTGCCTGTACAAAGTATGAATACCCTTGGCATACTGCAAGATGTCACTTTGAAAGAGATTTTGAGTATGAGAATAGTTGGGGTTGTAATCCAGCTGACTGCCCTGGTATTGGTACAGGTTGTACAGCATGTGGCATCTATATCGACCAGTTGAAGCCTGTGGGCAGTGCATACAAGCTGATTACAGTCCGTTATAGCCGCAAAGTCTGTGTCCAGTTTGGAGAGGAAAACTTATGTAAAACTATTGACATGAATGACTGTTTTGTCACAAGGCATGTGAAAGTCTGTATTATTGGGACAGTCTCAAAATTCTCTCAAGGGGACACACTGGTATTTTTAGGTCCTATGGAGGGTGGAGGGCTAATATTTAAAGACTGGTGTACAAGCACATGTCAGTTTGGAGATCCAGGAGACATTATGAGTCCCAAGGATAAGGGATTTAGTTGTCCAGAATTCACTGGTCACTTCCGCAAAAAGTGCAACTTTGCAACGACACCTGTATGTGAATATGATGGGAATATGGTATCTGGATATAAGAAGGTCATGGCAACTATTGATTCTTTTCAAGCATTTAACACAAGTTCTATCCATTACACAGATGAGCGGATTGAATGGAAAGATCCAGATGGGATGTTGAAGGACCATCTTAATATATTGGTTACAAAAGATATTGATTTTGAAAACCTTGGAGACAATCCGTGTAAGGTGGGACTTCAGACTGTTTCCATTGAAGGTGCATGGGGTTCAGGGGTTGGGTTCACTTTAACATGCCAGGTTTCTTTAACTGAATGTTCTCGTTTCTTGACCTCAATCAAAGCTTGTGACAAGGCAATATGCTATGGCGCACAGAGTAGCACCCTCATTCGAGGACAAAATACAGTAAAAGTGTCTGGGAAGGGAGGACATAGTGGTTCATCCTTTAAGTGTTGCCATGGAACTGATTGCTCACAGCAAGGATTGCAAGCTAGTGCACCCCATCTTGACAAGATTAATGGTATTGTAGAACAAGAAAATGAAAAAGTTTATGACGATGGTGCACCACAGTGTGGTATTTCATGCTGGTTTGTGAAGTCTGGAGAATGGATTCAAGGTATCTTCAATGGGAATTGGATTGTAACTGTTGTCCTAATCTTTTTCTTCATCCTATCATTGATATTGCTCAGCATCTTTTGTCCAATTCGAAAGCATAAACGCTCCTAGCATGGAACTGTATATGGATTGATGCTGCTTGCTTGTTAATCTGCTTTTTTTAATAATGCCATTTTATACTTACTAACCTATATTTCTAAAAAAAATAGACTCTTTACTACTAGATTTCCTAGTCCTTTATTACGTGGGTATTTCTATATCTTGCGGAGCATACTACTA

Полученные штаммы ДОБ-СОЧИ/VERO и ХТН-Р88/VERO при размножении в разрешенной для вакцинного производства культуре клеток Vero могут быть использованы для накопления вирусной массы при производстве инактивированной вакцины против ГЛПС.

Для лучшего понимания приведены следующие примеры.

№ 1– штамм ДОБ-СОЧИ/VERO и варианта № 2 – штамм ХТН-Р88/VERO

Пример 1

Вируссодержащую культуральную жидкость получают путем репродуцирования штамма ДОБ-СОЧИ/VERO вируса ДОБ в монослойной перевиваемой культуре клеток почек зеленой мартышки (Vero). Монослой клеток получают в роллерных бутылях объемом 1 л в среде Игла МЕМ с двойным набором витаминов и аминокислот и 5% сыворотки крови плодов коров. После заражения монослойных культур для поддержки вирусного размножения используется среда, не содержащая компонентов сыворотки крови. Сбор вируссодержащей жидкости начинают на 6 день. С одного монослоя клеток получают от 3 до 5 сборов вируссодержащей жидкости, Полученную вируссодержащую жидкость со средним титром 5,5 lg ФОЕ/мл осветляют с помощью ультрафильтрационных кассет (Мillipore) с молекулярным весом проходимых частиц 100 000 Дальтон и площадью 0,2м2 , инактивируют формалином в концентрации 1:4000 при 6 0С в течение 30 суток и концентрируют в 70 – 200 раз. Инактивированный концентрат очищают на колонке 2,6/70 с Сефарозой 6 Фаст Флоу со скоростью 7 мл/мин. Концентрация общего белка в очищенном концентрате составляет 100±50 мкг/мл. Очищенный инактивированный концентрат фильтруют через фильтр 0,22 мкм и используют для приготовления сорбированной на гидроокись алюминия моновалентной вакцины.

Пример 2

Вируссодержащую культруральную жидкость получают путем репродуцирования штамма ХТН-Р88/VERO вируса ХТН в монослойной перевиваемой культуре клеток почек зеленой мартышки (Vero). Монослой клеток получают в роллерных бутылях объемом 1 л в среде Игла МЕМ с двойным набором витаминов и аминокислот и 5% сыворотки крови плодов коров. После заражения монослойных культур для поддержки вирусного размножения используется среда, не содержащая компонентов сыворотки крови. Сбор вируссодержащей жидкости начинают на 6 день. С одного монослоя клеток получают от 3 до 5 сборов вируссодержащей ждикости, Полученную вируссодержащую жидкость со средним титром 5,5 lg ФОЕ/мл осветляют с помощью ультрафильтрационных кассет (Мillipore) с молекулярным весом проходимых частиц 100 000 Дальтон и площадью 0,2м2 , инактивируют формалином в концентрации 1:4000 при 60С в течение 30 суток и концентрируют в 70 – 200 раз. Инактивированный концентрат очищают на колонке 2,6/70 с Сефарозой 6 Фаст Флоу со скоростью 7 мл/мин. Концентрация общего белка в очищенном концентрате составляет 100±50 мкг/мл. Очищенный инактивированный концентрат фильтруют через фильтр 0,22 мкм и используют для приготовления сорбированной на гидроокись алюминия моновалентной вакцины.Вакцинные штаммы, приготовленные по описанному выше способу, содержат допустимые количества балластных компонентов, таких, как клеточный белок и дезоксирибонуклеиновая кислота, обладают иммуногенной активностью: сыворотки, полученные при 3-кратной иммунизации мышей Balb/c с интервалом 14 дней содержат антивирусные, в том числе вируснейтрализующие, антитела.

Штаммы ДОБ-СОЧИ/VERO и ХТН-Р88/VERO являются уникальными штаммами-продуцентами, которые могут быть применены для изготовления профилактических вакцин против вирусов ДОБ и ХТН.

В результате адаптации штаммов ДОБ-СОЧИ/VERO и ХТН-Р88/VERO к размножению в перевиваемой культуре клеток почек зелёной мартышки Vero впервые получена система вирус/клетка-хозяин, используемая как источник вирусной массы для изготовления инактивированной вакцины против ГЛПС.

Штаммы ДОБ-СОЧИ/VERO и ХТН-Р88/VERO антигенно идентичны циркулирующим в природе штаммам вирусов ДОБ и ХТН, и, вследствие этого, пригодны для изготовления вакцинных препаратов для специфической профилактики ГЛПС. Штаммы ДОБ-Сочи/VERO и ХТН-Р88/VERO не теряют своих антигенных и инфекционных свойств при хранении в течение двух лет (срок наблюдения) при температуре минус 70 0С.

Несмотря на то, что изобретение описано со ссылкой на раскрываемые варианты воплощения, для специалистов в данной области должно быть очевидно, что конкретные подробно описанные случаи приведены лишь в целях иллюстрирования настоящего изобретения, и их не следует рассматривать как каким-либо образом ограничивающие объем изобретения. Должно быть, понятно, что возможно осуществление различных модификаций без отступления от сути настоящего изобретения.

1. Штамм ДОБ-СОЧИ/VERO (DOB-SOCHI/VERO) вируса Добрава/Белград (Dobrava-Belgrade orthohantavirus, семейство Hantaviridae, отряд Bunyavirales), депонированный под №1282 в Государственной коллекции вирусов (Институт вирусологии им. Д.И. Ивановского ФГБУ «НИЦЭМ им. Н.Ф. Гамалеи» Минздрава России), адаптированный к размножению в культуре клеток почек зеленой мартышки Vero, предназначенный для изготовления вакцинных препаратов для специфической профилактики геморрагической лихорадки с почечным синдромом.

2. Штамм XTH-P88/VERO (HTN-P88/VERO) вируса Хантаан (Hantaan orthohantavirus, семейство Hantaviridae, отряд Bunyavirales), депонированный под №1283 в Государственной коллекции вирусов (Институт вирусологии им. Д.И. Ивановского ФГБУ «НИЦЭМ им. Н. Ф. Гамалеи» Минздрава России), адаптированный к размножению в культуре клеток почек зеленой мартышки Vero, предназначенный для изготовления вакцинных препаратов для специфической профилактики геморрагической лихорадки с почечным синдромом.



 

Похожие патенты:

Изобретение относится к области биотехнологии. Изобретение представляет собой штамм вируса гриппа А/17/Сингапур/2016/3571 (H3N2), депонированный в Государственную коллекцию вирусов Института вирусологии им.

Изобретение относится к области биохимии, в частности к способу продуцирования вирусоподобной частицы (VLP) в растении, а также к способу индукции иммунного ответа к вирусу гриппа подтипа В или НЗ у субъекта и способу получения композиции для индукции иммунного ответа к вирусу гриппа подтипа В или Н3 у субъекта с его использованием.

Представленное изобретение относится к области вирусологии, в частности к рекомбинантным вирусам болезни Марека и их применению. Заявленное изобретение касается рекомбинантного вируса болезни Марека серотипа 1 (MDV1), включающего промотор из SEQ ID NO:5 и рекомбинантную последовательность нуклеотидов, кодирующую антигенный полипептид, которая находится под контролем указанного нуклеотида.

Изобретение относится к области ветеринарной вирусологии и биотехнологии. Разработана вакцина, содержащая авирулентный и очищенный антигенный материал из штамма вируса ящура А №2269/ВНИИЗЖ/2015.

Изобретение относится к биотехнологии. Описана MDCK клетка-продуцент белков вируса гриппа, содержащая лентивирусный плазмидный вектор pLenti6.3/TO/HA(H1N1)-M1-NA, содержащий гены гемагглютинина, нейраминидазы и M1 белка вируса гриппа (H1N1), представленный на фиг.

Изобретение относится к биохимии. Описан способ выделения и/или очистки гемоцианина, включающий a) обеспечение состава гемоцианина, полученного из морского моллюска, при этом указанный состав представляет собой сыворотку гемолимфы; b) уменьшение проводимости состава, который был обеспечен в п.

Изобретение относится к биотехнологии. Разработана кассета генов, несущая гены вируса гриппа субтипов А(Н1N1) и A(H3N2) и типа В - НА, M1 и NA, кодирующие белки вируса гриппа, предназначенная для последующего получения плазмидного вектора для трансдукции клеток млекопитающих, которые в дальнейшем использовались для создания клеток-продуцентов вирусоподобных частиц (ВПЧ) вируса гриппа.

Изобретение относится к биотехнологии. Разработаны лентивирусные векторы, несущие кассету генов белков вируса гриппа субтипов A(H1N1) и A(H3N2) и типа В, кодирующих последовательности белков вируса гриппа для трансдукции клеток млекопитающих.

Изобретение относится к биотехнологии. Предложен набор для обнаружения РНК вируса болезни Гамборо, где указанный набор включает олигонуклеотиды, имеющие следующие последовательности: SEQ ID NO:1, SEQ ID NO:2 и SEQ ID NO:3.

Представленное изобретение относится к области медицинской биотехнологии. Методом обратной генетики получен рекомбинантный штамм вируса гриппа A/PR8/HK-NS80E85A, который является аттенуированным, холодоадаптированным, температурочувствительным и экспрессирует фрагменты антигенов ESAT6 и Ag85A М.tuberculosis.

Настоящее изобретение относится к биотехнологии. Предложен иммортализованный альвеолярный макрофаг свиней (PAM) для репликации вируса PRRS. Данный PAM чувствителен к вирусу респираторного и репродуктивного синдрома свиней (PRRSV), экспрессирует Т-антиген SV40, причем ДНК, включающая Т-антиген SV40, интегрирована в клеточный геном с использованием транспозона, который не включает длинные концевые повторы (LTR) ретровирусной ДНК. Также предложена клеточная культура, способ получения иммортализованных PAM, способ репликации PRRSV и способ получения вакцины, включающей PRRSV. 5 н. и 7 з.п. ф-лы, 7 ил., 1 пр.

Изобретение относится к биотехнологии. Описано применение для лечения пациента с раком, экспрессирующим опухолеассоциированный антигенный белок MAGEA3, выделенной вирусной частицы Maraba MG1 и первого вируса. Частица содержит нуклеиновую кислоту, которая способна экспрессировать опухолеассоциированный антигенный белок MAGEA3. Указанный антигенный белок содержит аминокислотную последовательность, которая по меньшей мере на 70% идентична SEQ ID NO: 1, и включает по меньшей мере один опухолеассоциированный эпитоп MAGEA3, выбранный из группы, состоящей из: FLWGPRALV (SEQ ID NO: 27), KVAELVHFL (SEQ ID NO: 28), EGDCAPEEK (SEQ ID NO: 35), KKLLTQHFVQENYLEY (SEQ ID NO: 36) и RKVAELVHFLLLKYR (SEQ ID NO: 37). Антигенный белок способен индуцировать иммунный ответ у указанного пациента в гетерологичном прайм-буст формате. Указанный первый вирус представляет собой аденовирус, содержащий нуклеиновую кислоту, способную экспрессировать опухолеассоциированный антигенный белок MAGEA3. Указанный антигенный белок содержит аминокислотную последовательность, которая по меньшей мере на 70% идентична SEQ ID NO: 1, и включает по меньшей мере один опухолеассоциированный эпитоп MAGE A3, выбранный из группы, состоящей из: FLWGPRALV (SEQ ID NO: 27), KVAELVHFL (SEQ ID NO: 28), EGDCAPEEK (SEQ ID NO: 35), KKLLTQHFVQENYLEY (SEQ ID NO: 36) и RKVAELVHFLLLKYR (SEQ ID NO: 37). Описана онколитическая гетерологичная вирусная прайм-буст вакцина для лечения пациента с раком и применение выделенной вирусной частицы Maraba MG1 для индукции иммунного ответа у пациента в гетерологичном прайм-буст формате для онколитической вирусной терапии. Изобретение позволяет расширить арсенал средств, используемых для онколитической вирусной терапии. 3 н. и 30 з.п. ф-лы, 9 ил., 4 табл., 10 пр.

Изобретение относится к области биотехнологии. Изобретение представляет собой штамм ДОБ-СОЧИVERO вируса ДобраваБелград, депонированный под №1282 в Государственной коллекции вирусов, адаптированный к размножению в культуре клеток почек зеленой мартышки Vero, предназначенный для изготовления вакцинных препаратов для специфической профилактики геморрагической лихорадки с почечным синдромом, а также штамм XTH-P88VERO вируса Хантаан, депонированный под №1283 в Государственной коллекции вирусов, адаптированный к размножению в культуре клеток почек зеленой мартышки Vero, предназначенный для изготовления вакцинных препаратов для специфической профилактики геморрагической лихорадки с почечным синдромом. 2 н.п. ф-лы, 1 табл., 1 пр.

Наверх