Способ дифференциации штаммов yersinia pestis средневекового биовара по филогенетической принадлежности методом пцр с электрофоретическим учетом результатов

Изобретение относится к биотехнологии и может быть использовано в научно-исследовательских учреждениях медицинского профиля и службах Роспотребнадзора. Сущность изобретения заключается в обеспечении быстрой и надежной дифференциации штаммов средневекового биовара от штаммов Y. pestis других биоваров и подвидов с последующим разделением штаммов средневекового биовара по их филогенетической принадлежности. Технический результат достигается способом дифференциации штаммов возбудителя чумы средневекового биовара с определением их филогенетической принадлежности методом ПНР с электрофоретическим учетом результатов, с использованием соответствующих праймеров SEQ ID NO:1-4 на ДНК мишени «(-183)2.med», «pCKF», «(-100)2.med1» и «(-73)2.med3» с последующей дифференциацией по размеру амплификатов в соответствии с таблицей. 1 табл., 4 пр.

 

Изобретение относится к области медицинской микробиологии, в частности, к внутривидовой дифференциации и молекулярному типированию штаммов возбудителя чумы, и может быть использовано в научно-исследовательских учреждениях медицинского профиля и службах Роспотребнадзора.

Высокопатогенная бактерия Yersinia pestis является возбудителем особо опасной инфекции - чумы, летальность при которой может составлять от 30 до 60%. Природные очаги чумы располагаются на территории всех континентов, за исключением Австралии и Антарктиды. На территории Российской Федерации и сопредельных государств расположено 45 природных очагов чумы, в том числе 11 очагов - в России. Быстрый рост торгово-экономических связей между странами, а также развитие туристической инфраструктуры обусловливают высокий риск распространения этой особо опасной инфекции. Все эти факты свидетельствуют об актуальности создания современных молекулярно-генетических методов диагностики штаммов Y. pestis.

Вид Y. pestis обладает сложной внутривидовой структурой и филогенетическим разнообразием. Он состоит из 5 подвидов (основной, кавказский, улегейский, гиссарский и алтайский), а также из 3-х биоваров, на которые подразделяется основой подвид. Штаммы основного подвида отличаются высокой вирулентностью и эпидемической значимостью. Они способны вызывать вспышки и эпидемии чумы, широко распространены в природных очагах чумы по всему миру. В природных очагах Российской Федерации и других стран СНГ наибольшее распространение получили штаммы возбудителя чумы средневекового биовара, которые циркулируют в 32 из 45 природных очагов чумы. Штаммы средневекового биовара также распространены в других странах Евразии, таких как Иран и Китай. Штаммы средневекового биовара - одна из наиболее молодых ветвей эволюции Y. pestis. Это высоковирулентные и эпидемически значимые штаммы. Несмотря на эволюционную молодость штаммы средневекового биовара Y. pestis обладают четко выраженной популяционной структурой. Все штаммы средневекового биовара относятся к филогенетической линии эволюции 2.MED. Ветвь 2.MED включает отдельные ветви -2.MED0, 2.MED1, 2.MED2 и 2.MED3, штаммы которых распространены в различных географических регионах.

Все штаммы Y. pestis средневекового биовара из очагов чумы в России, других странах СНГ и ближнего зарубежья относятся к филогенетической ветви 2.MED1. Исключение составляет популяция штаммов средневекового биовара из Центрально-Кавказского высокогорного очага чумы в Российской Федерации, которая относится к наиболее древней ветви эволюции этого биовара - 2.MED0. Штаммы двух других известных филогенетических ветвей 2.MED2 и 2.MED3 встречаются в природных очагах Китая, в том числе и на границе с Казахстаном и Киргизией, что делает вероятным риск заноса этих высоковирулентных штаммов на территорию стран СНГ, включая РФ. Ввиду этого актуальной является разработка способа определения принадлежности штаммов Y. pestis к средневековому биовару в целом (ветвь 2.MED) и к различным филогенетическим ветвям этого биовара: 2.MED0, 2.MED1, 2.MED2 и 2.MED3.

Метод ПЦР с электрофоретическим учетом результатов широко используется в молекулярном типировании штаммов Y. pestis. Для детекции бактерий рода Yersinia и определения патогенных для человека иерсиний разработан метод на основе ПЦР [Патент RU №2354700, опубликован 10.05.2009]. В основе этого изобретения лежит использование нуклеотидной последовательности участка гена ompF. При помощи этой ДНК мишени возможно разделение видов Y. pestis, Yersinia pseudotuberculosis и Yersinia enterocolitica. Однако этот способ не предназначен для внутривидового типирования штаммов возбудителя чумы и для дифференциации штаммов средневекового биовара.

Известна тест-система для экспресс-диагностики штаммов Y. pestis методом ПЦР с использованием мишеней, - участков генов cafl и pla в плазмидах чумного микроба [Тест-система для выявления ДНК Yersinia pestis методом ПЦР (Ген-Пест)]. Но эта тест-система не предусматривает внутривидовой дифференциации штаммов и выявления штаммов средневекового биовара.

Метод разделения штаммов Y. pestis основного и неосновных подвидов представлен в патенте RU №2425891, дата опубликования 10.08.2011. Описанный метод так же позволяет разделять близкородственные виды Y. pestis и Y. pseudotuberculosis, а также штаммы основного и неосновных подвидов возбудителя чумы. Однако это изобретение не предусматривает разделения штаммов основного подвида по их принадлежности к античному, средневековому и восточному биоварам возбудителя чумы.

Для разделения штаммов Y. pestis античного и средневекового биоваров известен метод, описанный в патенте RU №2496882 [опубликован 27.10.2013], основанный на использовании ПЦР с электрофоретическим учетом результатов. Этот метод обеспечивает разделение штаммов античного и средневекового биоваров возбудителя чумы, но он не предусматривает внутрибиоварной дифференциации штаммов средневекового биовара по филогенетической принадлежности.

Известен способ дифференциации типичных и атипичных штаммов средневекового биовара Y. pestis [Патент RU №2550257, опубликован 10.05.2015]. В изобретении излагается способ определения принадлежности типичных штаммов Y. pestis к средневековому биовару и дифференциации от них штаммов средневекового биовара филогенетической ветви 2.MED0, содержащих дополнительную плазмиду pCKF. Однако этот способ не предусматривает определения принадлежности штаммов к филогенетическим ветвям 2.MED1, 2.MED2 и 2.MED3 средневекового биовара.

Все вышеизложенное свидетельствует об актуальности разработки эффективного, быстрого и надежного способа определения принадлежности штаммов Y. pestis средневекового биовара к филогенетическим ветвям этого биовара.

Технический результат заключается в обеспечении быстрой и надежной дифференциации штаммов средневекового биовара от штаммов Y. pestis других биоваров и подвидов с последующим разделением штаммов средневекового биовара по их филогенетической принадлежности.

Технический результат достигается способом дифференциации штаммов возбудителя чумы средневекового биовара с определением их филогенетической принадлежности методом полимеразной цепной реакции с электрофоретическим учетом результатов, который предусматривает амплификацию ДНК мишеней (-183)2.Med, «pCKF», «(-100)2.med1» и «(-73)2.med3» в исследуемом материале, при этом олигонуклеотидные праймеры имеют следующие последовательности:

(-183)2.Med -S - CGTTGAGAAAGTCCAGCA

(-183)2.Med -As - GGCAGTGACCTCCAGAAA;

pCKF-S - TCCGTGCTCATTGGTTCG

pCKF-As - AGACTTGGCGAACGTGGT;

(-100)2.Med1-S - ATAGGTAATAGCGGCACTC

(-100)2.Med1-As - TGACTCCATTGAAGACGCT;

(-73)2.Med3-S - AGTAATGGGTTGTTCTGCC

(-73)2.Med3-As - CACCAGAAGCGAATGAAGC;

и дифференциацию штаммов средневекового биовара (за исключением линии 2.MED0) по образованию в ПЦР амплификатов размером 331 п. н. по мишени (-183)2.Med), и дальнейшее определение филогенетической принадлежности средневековых штаммов: ветви 2.MED1- по отсутствию амплификата по мишени (-100)2.Med1; ветви 2. MED2 - наличию амплификатов размером 235 п. н. по мишени (-73)2.Med3 и 100 п. н. по мишени (-100)2.Med1; ветви 2.MED3 - наличию амплификатов размером 162 п. н. по мишени (-73)2.Med3 и 100 п.н. по мишени (-100)2.Med1, 2.MED0 - по наличию амплификата размером 471 п.н. по мишени pCKF.

Выделение ДНК исследуемого штамма чумного микроба проводят по стандартной методике в соответствии с МУ 1.3.2569-09 «Организация работ лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности».

Полимеразную цепную реакцию осуществляют с применением вышеуказанных праймеров на мишени «(-183)2.med», «pCKF», «(-100)2.med1» и «(-73)2.med3». Олигонуклеотидные праймеры, используемые для амплификации в ПЦР с электрофоретическим учетом результатов хромосомных мишеней «(-183)2.med», «(-100)2.med1» и «(-73)2.med3», рассчитаны на основе нуклеотидных последовательностей этих участков у штаммов Y. pestis CO92, KIM, Antiqua, и Nepal516, представленных в базе данных NCBI GenBank, а праймеры на участок «pCKF» - на основе полученного нами полного сиквенса плазмиды размером 5,4 т.п.н штаммов 2.MED0 средневекового биовара из Центрально-Кавказского высокогорного очага чумы. С помощью рассчитанных праймеров в ПЦР проводят амплификацию участков «(-183)2.med», «pCKF», «(-100)2.med1» и «(-73)2.med3».

Полимеразную цепную реакцию с амплификацией участков «(-183)2.med», «pCKF», «(-100)2.med1» и «(-73)2.med3» проводят по следующей программе: 1 цикл 95°С в течение 5 мин, затем 35 циклов при 95°С 20 сек, 56°С 35 сек, 72°С 45 сек, затем 1 цикл 72°С 5 минут.

Определение принадлежности исследуемого штамма к средневековому биовару и его филогенетическим линиям ведется по комплексу результатов 4-х отдельных реакций ПЦР. Определение размеров получаемых в ПЦР амплификатов проводится на основе их сравнения с амплификатами типичных штаммов филогенетических ветвей средневекового биовара, а также с маркерами молекулярных масс.

Для типичных штаммов средневекового биовара характерно наличие ПЦР продукта по мишени (-183)2.med на уровне 331 п. н., а также отсутствие амплификата по мишени pCKF. Отсутствие ПЦР продукта на уровне 100 п. н. по мишени (-100)2.med1 и наличие амплификата размером 235 п. н. по мишени (-73)2.med3 свидетельствует о том, что штамм относится к линии 2.MED1. При наличии амплификата по мишени (-100)2.med1 и амплификата размером 235 п.н. по мишени (-73)2.med3 судят о принадлежности штамма к линии 2.MED2. И наконец, по наличию амплификата по мишени (-100)2.med1 в сочетании с образованием амплификата размером 162 п.н. при использовании мишени (-73)2.med3 штамм относят к линии 2.MED3. Для штаммов древней филогенетической линии 2.MED0 (атипичных штаммов) средневекового биовара) характерно наличие ПЦР продукта по мишени (-183)2.med размером 514 п. н. и присутствие продукта реакции по мишени pCKF.

Сущность изобретения поясняется примерами.

Пример 1. Дифференциация штамма Y. pestis средневекового биовара филогенетической ветви 2.MED1 (модельный эксперимент)

Выделение ДНК Y. pestis проводят стандартным методом с помощью лизирующего раствора на основе 6М гуанидинизотиоцианата с предварительным обеззараживанием культуры путем добавления мертиолята натрия до концентрации 1:10000 с последующим прогреванием при температуре 56°С в течение 30 мин. [МУ 1.3.2569-09].

Для ДНК мишени «(-183)2.med» полимеразную цепную реакцию проводят в объеме 25 мкл, реакционная смесь содержит: 1x буфер (10x ПЦР буфер - 2,5 мкл), MgCl2 - 2,0 ммоль, смесь dNTP - 0,3 ммоль, олигонуклеотидные праймеры - 12 пмоль, Taq DNA полимераза - 0,1 ед., исследуемая ДНК - 10 мкл. Для ДНК-мишеней «pCKF», «(-100)2.med1» и «(-73)2.med3» реакционная смесь аналогична для ДНК-мишени «(-183)2.med». В результате электрофореза получают следующие результаты. По мишени (- 183)2.med присутствует продукт на уровне 331 п. н., отсутствует продукт по мишени pCKF, отсутствует продукт по мишени (-100)2.med1. По мишени (- 73)2.med3 присутствует ПЦР продукт размером 235 п.н.. Следовательно, исследуемый штамм Y. pestis относится к филогенетической ветви 2.MED1 средневекового биовара.

Пример 2. Дифференциация штамма Y.pestis средневекового биовара филогенетической ветви 2.MED0

Исследование штамма Y. pestis проводят аналогично примеру №1. В ПЦР с использованием ДНК мишени (-183)2.med у исследуемого штамма Y. pestis образуется продукт реакции размером 514. По мишени pCKF наблюдается наличие ПЦР продукта размером 471 п. н. Также образуется амплификат по мишени (-100)2.med1 и амплификат размером 235 п.н. с использованием мишени (-73)2.med3. Следовательно, исследуемый штамм Y. pestis относится к филогенетической ветви 2.MED0 средневекового биовара.

Пример 3. Дифференциация штаммов Y. pestis средневекового биовара филогенетических ветвей 2.MED2 и 2.MED3.

Исследование штамма Y. pestis проводят аналогично примеру №1. В реакции ПЦР наблюдают наличие продукта размером 331 п.н. по мишени (-183)2.med и отсутствие продукта по мишени pCKF. Также образуется ПЦР продукт по мишени (-100)2.med1 размером 100 п.н. Образование ПЦР продукта размером 235 п.н. по мишени (- 73)2.med3 свидетельствует о принадлежности штамма к филогенетической ветви 2.MED2, а продукта размером 162 п.н. по этой мишени - к ветви 2.MED3.

Таким образом, заявленный способ дифференциации штаммов Y. pestis средневекового биовара с помощью полимеразной цепной реакции с электрофоретическим учетом результатов, основанный на выявлении наличия/отсутствия амплификатов по используемым ДНК мишеням и разницы в их размерах, обеспечивает проведение надежной и быстрой в исполнении дифференциации штаммов средневекового биовара по их филогенетической принадлежности.

Перечень последовательностей праймеров.

SEQ ID NO:1

(-183)2.Med -S – CGTTGAGAAAGTCCAGCA

(-183)2.Med -As – GGCAGTGACCTCCAGAAA;

SEQ ID NO:2

pCKF-S – TCCGTGCTCATTGGTTCG

pCKF-As – AGACTTGGCGAACGTGGT;

SEQ ID NO:3

(-100)2.Med1-S – ATAGGTAATAGCGGCACTC

(-100)2.Med1-As – TGACTCCATTGAAGACGCT;

SEQ ID NO:4

(-73)2.Med3-S – AGTAATGGGTTGTTCTGCC

(-73)2.Med3-As – CACCAGAAGCGAATGAAGC

Способ дифференциации штаммов Yersinia pestis средневекового биовара по филогенетической принадлежности, предусматривающий проведение ПЦР с электрофоретическим учетом результатов с использованием соответствующих праймеров SEQ ID NO: 1-4 на ДНК мишени «(-183)2.med», «pCKF», «(-100)2.med1» и «(-73)2.med3» с последующей дифференциацией по размеру амплификатов в соответствии с таблицей, где наличие амплификата ДНК мишени (-183)2.med размером 331 п. н. говорит о принадлежности к средневековому биовару популяции 2.MED (кроме 2.MED0); наличие амплификатов размером 471 п. н. ДНК мишени pCKF, 100 п. н. ДНК мишени (-100)2.med1 и 235 п. н. ДНК мишени (-73)2.med3 говорит о принадлежности к средневековому биовару популяции 2.MED0; отсутствие амплификата ДНК мишени (-100)2.med1 говорит о принадлежности к средневековому биовару популяции 2.MED1; наличие амплификатов размерами 100 п. н. ДНК мишени (-100)2.med1 и 235 п. н. ДНК мишени (-73)2.med3 говорит о принадлежности к средневековому биовару популяции 2.MED2; наличие амплификатов размерами 100 п. н. ДНК мишени (-100)2.med1 и 162 п. н. ДНК мишени (-73)2.med3 говорит о принадлежности к средневековому биовару популяции 2.MED3.



 

Похожие патенты:

Изобретение относится к области экспериментальной медицины и микробиологии и описывает способ определения наличия газовых сигнальных молекул в метаболитах микробиоты человека.

Изобретение относится к области медицины, в частности к молекулярной биологии и онкологии. Предложена тест-система для прогнозирования развития метастазов у больных раком желудка на основании определения числа копий HV2 мтДНК, содержащая высокоспецифичные праймеры для генов HV2 и В2М с концентрацией 1,8 мкМ каждого в водном растворе.

Предложенная группа изобретений относится к области биомедицины, в частности молекулярной и клинической онкологии. Предложен способ диагностики светлоклеточного почечно-клеточного рака (скПКР), при котором у обследуемых лиц берут образцы ткани почки, производят выделение и очистку ДНК из взятых образцов и производят методом МС-ПЦР анализ метилирования фрагментов ДНК с применением праймеров.

Изобретение относится к области ветеринарии, микробиологии и биотехнологии. Предложен способ выявления и количественной оценки содержания ДНК U.

Изобретение относится к области медицины, в частности к онкологии, и предназначено для прогнозирования безметастатической выживаемости у больных раком молочной железы.

Изобретение относится к биотехнологии. Предложена комбинация генов, конститутивно экспрессирующихся в здоровых и варикозно-измененных венах, которые могут быть использованы в дальнейших исследованиях по экспрессии генов в таких образцах.

Изобретение относится к области медицины, в частности к акушерству, и предназначено для прогнозирования преждевременных родов. Используя показатели концентрации общего количества внеклеточной ДНК (овДНК) и концентрации IL-8 в плазме периферической крови у беременных женщин на 22-36 неделях гестации, определяют переменную Р.

Изобретение относится к биотехнологии и может быть использовано в пищевой промышленности при идентификации осмотолерантных дрожжей Zygosaccharomyces rouxii. Способ включает предварительное обогащение дрожжей, осаждение их центрифугированием, выделение ДНК с проведением ПЦР в реальном времени, причем для амплификации используются праймеры: ZygRux-f GACGTGAACTCTTAACGGAG и ZygRux-r GAGAGCAGAACCCTCCC, а также Taqman зонд ZygRux-p FAM CGGAGGAGATTAAAAACAGCCGCGCA BHQ1, а логарифмическое повышение уровня флюоресценции в канале FAM свидетельствует о наличии штамма дрожжей рода Zygosaccharomyces rouxii.
Изобретение относится к области биотехнологии. Изобретение представляет собой способ определения степени раздражающего действия дезинфекционных средств на кожу человека, заключающийся в том, что культуру клеток Chang conjunctiva рассеивают на 96-луночную панель по 100 мкл в каждую лунку в концентрации 1×105 клеток/мл в питательной среде Игла-MEM с 10% эмбриональной телячьей сывороткой (ЭТС).

Изобретение относится к области биотехнологии. Предложен способ детекции полинуклеотида или полинуклеотидной последовательности в образце.

Изобретение относится к биотехнологии. Предложен способ быстрой и надежной детекции микобактерий туберкулеза генотипа Beijing В0-кластер. Поставленная задача достигается выявлением специфического для микобактерий туберкулеза генотипа Beijing В0-кластер участка ДНК (вставки элемента IS6110 в локусе генома Rv2664-Rv2665), амплифицированного методом ПЦР в формате реального времени. Анализ результатов проводится путем выявления продукта ПЦР в формате реального времени с использованием специфического флуоресцентного зонда. По каналу FAM регистрируется накопление продукта амплификации фрагмента ДНК, специфического для Beijing В0-кластер, по каналу HEX-фрагмента ДНК, специфического для штамма любого другого генотипа М. tuberculosis. При наличии в образце ДНК штамма Beijing В0-кластер, между 15-35 циклами ПЦР происходит экспоненциальный рост сигнала флуоресценции по каналу детекции FAM и при этом отсутствует сигнал флуоресценции по контрольному каналу детекции HEX. 3 ил., 2 пр.

Группа изобретений относится к медицине и касается иммобилизованного белкового материала, содержащего носитель и по меньшей мере один белок, иммобилизованный на носителе. Причем носитель содержит материал носителя, к которому присоединен аффинный матрикс, где указанный материал носителя выбран из группы, состоящей из стекла с контролируемой пористостью (CPG) и гибридного стекла с контролируемой пористостью (Hybrid CPG), и где по меньшей мере один белок содержит аффинный маркер и иммобилизован на носителе специфическим аффинным связыванием с аффинным матриксом, где аффинный маркер представляет собой полигистидиновую метку и где аффинный матрикс содержит хелатируемый ион металла. Группа изобретений также касается применения указанного носителя для иммобилизации белков; применения иммобилизованного белкового материала в качестве гетерогенного катализатора; способа катализа ферментативно катализируемой многостадийной или каскадной реакции, содержащей приведение иммобилизованного белкового материала в контакт по меньшей мере с одним субстратом. Группа изобретений обеспечивает улучшенную стабильность иммобилизованных белков. 10 н. и 14 з.п. ф-лы, 11 пр., 2 ил., 9 табл.

Изобретение относится к биотехнологии и может быть использовано в научно-исследовательских учреждениях медицинского профиля и службах Роспотребнадзора. Сущность изобретения заключается в обеспечении быстрой и надежной дифференциации штаммов средневекового биовара от штаммов Y. pestis других биоваров и подвидов с последующим разделением штаммов средневекового биовара по их филогенетической принадлежности. Технический результат достигается способом дифференциации штаммов возбудителя чумы средневекового биовара с определением их филогенетической принадлежности методом ПНР с электрофоретическим учетом результатов, с использованием соответствующих праймеров SEQ ID NO:1-4 на ДНК мишени «2.med», «pCKF», «2.med1» и «2.med3» с последующей дифференциацией по размеру амплификатов в соответствии с таблицей. 1 табл., 4 пр.

Наверх