Фармацевтическая композиция для лечения рака, содержащая микрорнк в качестве активного ингредиента

Изобретение относится к области медицины. Предложена фармацевтическая композиция для лечения рака, включающая одну или несколько миРНК, выбранных из группы, состоящей из miR-3670 и miR-8078, где miR-3670 включает двухцепочечную РНК, представленную нуклеотидными последовательностями SEQ ID NO: 35 и SEQ ID NO: 36, и miR-8078 включает двухцепочечную РНК, представленную нуклеотидными последовательностями SEQ ID NO: 65 и SEQ ID NO: 66. Изобретение обеспечивает ингибирование пролиферации и индуцирование апоптоза раковых клеток. 3 з.п. ф-лы, 8 ил., 3 табл., 9 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение касается противораковой фармацевтической композиции, содержащей двухцепочечную миРНК в качестве активного ингредиента. Более конкретно, настоящее изобретение касается противораковой фармацевтической композиции, содержащей в качестве фармацевтически активного ингредиента miR-3670, miR-8078 или miR-4477a, которые способны эффективно ингибировать пролиферацию раковых клеток или индуцировать апоптоз раковых клеток, вместе с фармацевтически приемлемым носителем.

УРОВЕНЬ ТЕХНИКИ

В качестве эффективных и традиционных способов лечения заболеваний, вызванных неконтролируемой регуляцией генов, в особенности заболеваний, именуемых раковыми заболеваниями, применялись методы удаления опухолей хирургическим путем. Однако, когда первичный рак дает метастазы в другие органы, хирургическое удаление становится невозможным и применяется противораковая химиотерапия. В качестве противораковых средств для химиотерапии в основном применялись низкомолекулярные соединения, синтезированные органическими или неорганическими методами. Такие противораковые препараты разрабатывались и применялись против раковых заболеваний в основном с тем, чтобы они эффективно воздействовали на белки, нарушающие сигнальные пути, путем гиперэкспрессии фосфорилирующих белков, входящих в сигнальные пути, тем самым ингибируя активность тех белков. Такая традиционная химиотерапия может вызывать много побочных эффектов, поскольку используемые противораковые препараты представляют собой искусственно синтезированные чужеродные вещества, которые воздействуют на и так уже гиперэкспрессированные белки.

Предпринимались различные подходы к разработке терапевтических препаратов для замены традиционных средств химиотерапии. Одним из таких подходов является использование маленькой или короткой интерферирующей РНК (в дальнейшем именуется киРНК, siRNA) (Iorns E., Lord C.J., Turner N. & Ashworth A. Utilizing RNA interference to enhance cancer drug discovery. Nat Rev Drug Discov 6, 556-68, 2007). киРНК представляет собой одноцепочечную РНК, состоящую из 16-27 нуклеотидов, которая служит одним из компонентов рибонуклеопротеидного комплекса, известного как комплекс РНК-индуцируемого сайленсинга (RISC) в клетках (Tomari Y. & Zamore P.D. Perspective: machines for RNAi. Genes Dev 19, 517-29, 2005; Chu C.Y. & Rana T.M. Potent RNAi by short RNA triggers. RNA 14, 1714-9, 2008; Mittal V. Improving the efficiency of RNA interference in mammals. Nat Rev Genet 5, 355-65, 2004; Reynolds A. et al. Rational siRNA design for RNA interference. Nat Biotechnol 22, 326-30, 2004). RISC функционирует как ножницы для расщепления матричной РНК (в дальнейшем именуется мРНК), тем самым ингибируя вырабатывание белка из мРНК. Содержащаяся в RISC киРНК может связываться с такой мРНК, последовательность которой комплементарна последовательности киРНК, с образованием двухцепочечной РНК, а RISC может действовать как ножницы для расщепления целевой мРНК с тем, чтобы мРНК больше не функционировала в качестве матрицы, которая многократно вырабатывает белок.

Противораковые препараты на основе киРНК, как описано выше, считаются продвинутыми в сравнении с низкомолекулярными противораковыми препаратами, так как они расщепляют мРНК еще до выработки белка и используют РНК и внутриклеточный путь RISC. Тем не менее, существует побочный эффект, который не может быть устранен даже по технологии киРНК (Jackson A.L. et al. Widespread siRNA "off-target" transcript silencing mediated by seed region sequence complementarity. RNA 12, 1179-87, 2006; Jackson A.L. et al. Position-specific chemical modification of siRNAs reduces "off-target" transcript silencing. RNA 12, 1197-205, 2006; Jackson, A.L. et al. Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechnol 21, 635-7, 2003; Nielsen C.B. et al. Determinants of targeting by endogenous and exogenous microRNAs and siRNAs. RNA 13, 1894-910, 2007; Peek A.S. & Behlke M.A. Design of active small interfering RNAs. Curr Opin Mol Ther 9, 110-8, 2007). Этот побочный эффект - явление, известное как сбой мишени. Как описано выше, киРНК действует, расщепляя мРНК, последовательность которой комплементарна последовательности киРНК. Однако киРНК также может связываться и расщеплять нецелевую мРНК, которая комплементарна не всей последовательности киРНК, а лишь части последовательности киРНК. Это явление известно как сбой мишени.

Для того, чтобы преодолеть описанный выше технический недостаток противораковых средств на основе киРНК, проводятся исследования по использованию микроРНК (в дальнейшем “миРНК”) в качестве терапевтических средств (Agostini M. & Knight R.A. miR-34: from bench to bedside. Oncotarget 5, 872-81, 2014; van Rooij E., Purcell A.L. & Levin A.A. Developing microRNA therapeutics. Circulation Research 110, 496-507, 2012; Burnett J.C. & Rossi J.J. RNA-based therapeutics: current progress and future prospects. Chem Biol 19, 60-71, 2012; Dangwal S. & Thum T. MicroRNA therapeutics in cardiovascular disease models. Annu Rev Pharmacol Toxicol 54, 185-203, 2014). миРНК представляет собой РНК, состоящую из 16-27 нуклеотидов, которая квалифицируется как РНК, не кодирующая белки, в отличие от матричной РНК (мРНК), которая транслируется в белок (Carthew R.W. & Sontheimer E.J. Origins and mechanisms of miRNAs and siRNAs. Cell 136, 642-55, 2009; MacFarlane L.-A. & Murphy P.R. MicroRNA: biogenesis, function and role in cancer. Current Genomics 11, 537-561, 2010; Bartel D.P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215-33, 2009). МикроРНК встречается в геноме высших животных и растительных клеток и, как известно, играет ключевую роль в регуляции метаболизма и функции клеток, включая образование, рост, дифференцировку и смерть клеток. К настоящему времени в геноме человека обнаружено около 2000 различных миРНК, причем функции значительной части этих миРНК пока еще не известны.

МикроРНК транскрибируется из генома в РНК под действием РНК-полимеразы, известной как Pol II, а исходная длина миРНК весьма разнообразна (Carthew R.W. & Sontheimer E.J. Origins and mechanisms of miRNAs and siRNAs. Cell 136, 642-55, 2009; Brodersen P. & Voinnet O. Revisiting the principles of microRNA target recognition and mode of action. Nat Rev Mol Cell Biol 10, 141-148, 2009). Это объясняется позиционным разнообразием миРНК в геноме. Оно возникает потому, что миРНК вырабатывается различными способами, включая тот, когда миРНК располагается в интроне (некодирующем участке мРНК) и транскрибируется в то же самое время, что и мРНК, и тот, когда миРНК располагается в межгенной области генома и транскрибируется индивидуально (Malone C.D. & Hannon G.J. Small RNAs as guardians of the genome. Cell 136, 656-68, 2009). миРНК, появившаяся на начальном этапе, как описано выше, известна как первичная микроРНК (miR). Первичная miR подвергается процессингу в miR-предшественник (предшественник миРНК или пре-miR), к примеру, под действием РНКазы, известной как внутриядерная Drosha (Bartel D.P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215-33, 2009). Пре-miR имеет структуру РНК-шпильки и состоит примерно из 70-80 нуклеотидов. В клеточном ядре пре-miR транспортируется из ядра в цитозоль белком экспортин и т.п. и подвергается дальнейшему процессингу в цитозоле другой РНКазой, известной как Dicer, при этом образуется двухцепочечная зрелая микроРНК (в дальнейшем miR при описании без определителя означает зрелую miR), состоящая из 16-27 нуклеотидов. Одна из нитей двухцепочечной РНК miR отделяется, активируется при связывании с рибонуклеопротеидным комплексом RISC и связывается с целевой мРНК в соответствии с последовательностью miR.

Как правило, в мРНК выделяются в основном три участка на основании того, участвуют они или нет в кодировании белка: кодирующая область, содержащая информацию по трансляции кодируемого белка, и области 5′-UTR (нетранслируемая область)

и 3′-UTR, которые не несут никакой информации по кодированию белка. В то время как киРНК, которая индуцирует расщепление целевой мРНК с комплементарной последовательностью, действует независимо от 5′-UTR, 3′-UTR и кодирующей области мРНК, miR связывается главным образом с 3′-UTR (Carthew R.W. & Sontheimer E.J. Origins and mechanisms of miRNAs and siRNAs. Cell 136, 642-55, 2009; Bartel D.P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215-33, 2009).

Наряду с различием в положении места связывания с мРНК, характерное отличие между киРНК и миРНК состоит в том, что киРНК связывается главным образом с мРНК, последовательность которой комплементарна всей последовательности siРНК, тогда как миРНК распознает целевую мРНК прежде всего через последовательность посадочного участка (seed region), располагающегося на 2-8 нуклеотидов от 5′-конца миРНК и имеющего ограниченную длину. Таким образом, даже если не вся последовательность миРНК полностью комплементарна последовательности мишени и содержит некомплементарную часть последовательности, некомплементарная часть последовательности не влияет на активность миРНК (Bartel D.P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215-33, 2009). Поскольку посадочный участок имеет длину в 6-8 нуклеотидов, то существует много таких различных мРНК, у которых 3′-UTR содержит последовательность, комплементарную посадочному участку, причем по этому участку можно одновременно контролировать несколько различных мРНК, используя всего одну миРНК. Эта особенность миРНК позволяет ей функционировать в качестве эффективного регулятора при управлении многими аспектами клеточной физиологии, включая деление, рост, дифференцировку и гибель клеток. Кроме того, функция миРНК в качестве регулятора дает преимущество в достижении эффективного противоракового действия. Это объясняется тем, что миРНК может одновременно ингибировать экспрессию целого ряда онкогенов, тогда как киРНК обычно ингибирует экспрессию лишь одного гена.

У многих мРНК область 3′-UTR содержит такую часть, с которой может связываться одна или несколько миРНК. По биоинформатическим расчетам известно, что около 30% всех мРНК регулируются миРНК.

То, что миРНК действует в качестве главного регулятора в сигнальных путях, видно из того, что миРНК играет важную роль в значительных заболеваниях, включая рак (MacFarlane L.-A. & Murphy P.R. MicroRNA: biogenesis, function and role in cancer. Current Genomics 11, 537-561, 2010; Malone C.D. & Hannon G.J. Small RNAs as guardians of the genome. Cell 136, 656-68, 2009; Nicoloso M.S., Spizzo R., Shimizu M., Rossi S. & Calin G.A. MicroRNAs - the micro steering wheel of tumour metastases. Nat Rev Cancer 9, 293-302, 2009; Landi D., Gemignani F. & Landi S. Role of variations within microRNA-binding sites in cancer. Mutagenesis 27, 205-10, 2012). Так, некоторые исследования показали, что профили экспрессии миРНК в раковых клетках сильно отличаются от профилей экспрессии миРНК в нормальных клетках. Кроме того, известно, что профили экспрессии миРНК сильно различаются в зависимости от тех первичных органов, в которых возник рак. В частности, при различных раковых заболеваниях, включая рак легких, рак печени, рак кожи и рак крови, проявляются характерные профили экспрессии миРНК в соответствии с первичными органами, указывая на то, что миРНК играет важную роль в биологии рака. В частности, известно, что уровень экспрессии миРНК в раковых клетках обычно ниже, чем уровень её экспрессии в нормальных клетках.

Исходя из тесной связи миРНК с раком, в последнее время предпринимались попытки использовать миРНК в качестве противораковых терапевтических средств. Так, миРНК под названием “miR-34a” проходит клинические испытания для проверки её способности ингибировать пролиферацию раковых клеток и индуцировать апоптоз раковых клеток (Wiggins J.F. et al. Development of a lung cancer therapeutic based on the tumor suppressor microRNA-34. Cancer Res 70, 5923-30, 2010; Bader A.G. et al. miR-34 Regulated Genes and Pathways as Targets for Therapeutic Intervention. Google Patents, 2009; Hermeking H. The miR-34 family in cancer and apoptosis. Cell Death Differ 17, 193-9, 2010; Chang T.C. et al. Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol Cell 26, 745-52, 2007).

Соответственно, авторы настоящего изобретения приложили значительные усилия для идентификации миРНК, обладающих лучшей способностью к ингибированию пролиферации раковых клеток и индуцированию апоптоза раковых клеток, чем miR-34a, которая проходит клинические испытания. В результате авторы настоящего изобретения идентифицировали miR-3670, miR-8078 и miR-4477a, которые обладают превосходной противораковой эффективностью, и обнаружили, что эти миРНК проявляют противораковые эффекты путем эффективного ингибирования экспрессии ряда генов, известных как онкогены, и тем самым совершили настоящее изобретение.

CУЩНОСТЬ ИЗОБРЕТЕНИЯ

Техническая проблема

Целью настоящего изобретения является идентификация миРНК, обладающей превосходной способностью к ингибированию пролиферации раковых клеток и индуцированию апоптоза раковых клеток, а также получение такой фармацевтической композиции для лечения рака, которая содержит миРНК в качестве активного ингредиента.

Техническое решение

Для достижения вышеуказанной цели настоящим изобретением предусмотрена композиция для лечения рака, которая содержит в качестве активного ингредиента одну или несколько миРНК, выбранных из группы, состоящей из miR-3670, miR-8078 и miR-4477a.

КРАТКОЕ ОПИСАНИЕ ФИГУР

На фиг. 1 представлены результаты измерения способности miR-34a, miR-100 и miR-125b ингибировать экспрессию белков. Для определения того, будет ли миРНК, использовавшаяся при построении библиотеки для скрининга, обладать активностью, из всей библиотеки скрининга были отобраны miR-34a, miR-100 и miR-125b, как обычно, и каждый 3′-UTRs из тех мРНК, которые подвергаются сайленсингу этими миРНК, вставляли в 3′-UTR экспрессирующих люциферазу векторов и измеряли их способность ингибировать экспрессию белка.

На фиг. 2 представлены результаты, полученные при обработке раковых клеток легких NCI-H460 библиотекой для скрининга, состоящей примерно из 1700 различных миРНК, количественном определении роста клеток с помощью реагента Resazurin и выражении результатов определения в виде относительных значений роста.

На фиг. 3 представлены результаты, полученные при отборе около 50 различных миРНК, проявляющих отличную эффективность на клетках линии NCI-H460, и измерении относительной способности к ингибированию роста раковых клеток у отобранных миРНК с помощью реагента WST-1.

На фиг. 4 представлены результаты, полученные при трансфекции каждой из miR-34a, miR-3670, miR-8078 и miR-4477a в клетки раковой линии легких, окрашивании клеток с помощью FITC-меченного Annexin V и анализе окрашенных клеток методом проточной цитометрии для определения апоптотического эффекта этих миРНК на клетки раковой линии легких.

На фиг. 5 представлены результаты, полученные при трансфекции каждой миРНК в клетки раковой линии легких, культивировании клеток на мягком агаре в течение 2 недель и измерении влияния миРНК на колониеобразующую способность клеток раковой линии легких.

На фиг. 6 представлены результаты, полученные при отборе целевых кандидатов с помощью программного обеспечения для прогнозирования мишеней миРНК и выражении апоптотической способности киРНК, нацеленных на отобранных кандидатов, в виде величины Z (Z-score).

На фиг. 7 представлены результаты кПЦР, полученные при анализе степени, в которой миРНК ингибирует экспрессию генов, приведенных на фиг. 6.

На фиг. 8 представлены результаты, полученные при клонировании 3′-UTR генов, приведенных на фиг. 6, в 3′-UTR люциферазы, и измерении степени, в которой миРНК ингибирует экспрессию белка люциферазы.

ОСУЩЕСТВЛЕНИЕ ИЗОБРЕТЕНИЯ

Если не указано иначе, все используемые здесь технические и научные термины имеют те же значения, которые обычно понимаются рядовыми специалистами в той области, к которой относится изобретение. Как правило, используемая здесь номенклатура хорошо известна и широко применяется в данной области.

В настоящем изобретении была предпринята попытка идентифицировать миРНК, обладающие лучшей эффективностью, чем miR-34a, которая, как известно, оказывает противораковое действие, и оценить противораковые эффекты идентифицированной миРНК.

В настоящем изобретении была синтезирована библиотека для скрининга, состоящая примерно из 1700 миРНК (табл. 1). Клетки NCI-H460 (линия раковых клеток легких) обрабатывали библиотекой для скрининга и измеряли способность этих миРНК ингибировать рост раковых клеток. При этом были идентифицированы miR-3670, miR-8078 и miR-4477a, которые проявляют лучшую эффективность, чем miR-34a, и имеют следующие нуклеотидные последовательности (табл. 3). Как оказалось, идентифицированные миРНК обладают отличным противораковым действием (фиг. 4-8).

Итак, настоящее изобретение направлено на фармацевтическую композицию для лечения рака, которая включает в качестве активного ингредиента одну или несколько миРНК, выбранных из группы, состоящей из miR-3670, miR-8078 и miR-4477a.

В настоящем изобретении miR-3670 может содержать в качестве активного ингредиента двухцепочечную РНК с нуклеотидными последовательностями SEQ ID NO: 35 и SEQ ID NO: 36 или SEQ ID NO: 35 и SEQ ID NO: 67.

В настоящем изобретении miR-4477a может содержать в качестве активного ингредиента двухцепочечную РНК с нуклеотидными последовательностями SEQ ID NO: 43 и SEQ ID NO: 44 или SEQ ID NO: 43 и SEQ ID NO: 68.

В настоящем изобретении miR-8078 может содержать в качестве активного ингредиента двухцепочечную РНК с нуклеотидными последовательностями SEQ ID NO: 65 и SEQ ID NO: 66 или SEQ ID NO: 65 и SEQ ID NO: 69.

Иными словами, матричная нить miR-3670 по настоящему изобретению может быть представлена SEQ ID NO: 35:

5′-AGAGCUCACAGCUGUCCUUCUCUA-3′ (MIMAT0018093, SEQ ID NO: 35).

Несмотря на то, что миРНК, которая активна in vivo, является одноцепочечной, она должна поступать в клетки в двухцепочечном виде вместе с нуклеотидной последовательностью такой же длины с тем, чтобы она связывалась с RISC. При этом антисмысловая последовательность, которая связывается с этой последовательностью, должна быть комплементарна активной последовательности. Комплементарная последовательность может быть идеальной комплементарной последовательностью или эндогенной последовательностью. Нуклеотиды, располагающиеся либо на 3′-конце каждой двухцепочечной последовательности, либо на 3′-конце одной нити, могут не связываться с нуклеотидами антисмысловой последовательности, и такие нуклеотиды известны как 3′-выступающие. Двухцепочечная последовательность может содержать 3′-выступающий конец.

Иными словами, идеальная комплементарная последовательность miR-3670 может быть представлена SEQ ID NO: 36:

5′-GAGAAGGACAGCUGUGAGCUCUUU-3′ (SEQ ID NO: 36).

А эндогенная комплементарная последовательность miR-3670 может быть представлена SEQ ID NO: 67:

5′-GACUGGUAUAGCUGCUUUUGGAGCCUCA-3′ (SEQ ID NO: 67).

Как описано выше в разделе «Уровень техники», главным фактором активности является посадочная последовательность, соответствующая 8-9 нуклеотидам, считая от второго нуклеотида активной последовательности миРНК. Длинная двухцепочечная последовательность, включающая посадочный участок, может использоваться для получения двухцепочечной РНК.

Аналогично miR-3670, активные последовательности miR-4477a и miR-8078 и комплементарные последовательности для формирования из них двухцепочечных последовательностей могут быть представлены следующими последовательностями. Эти двухцепочечные последовательности при образовании длинных двухцепочечных последовательностей могут содержать 3′-выступающий конец, как описано выше, а также могут содержать посадочный участок.

miR-4477a

5′-CUAUUAAGGACAUUUGUGAUUC-3′ (MIMAT0019004, SEQ ID NO: 43).

Идеальная комплементарная последовательность miR-4477a:

5′-AUCACAAAUGUCCUUAAUAGUU-3′ (SEQ ID NO: 44).

Эндогенная комплементарная последовательность miR-4477a:

5′-AUCACAAAUGUCCUUAAUGGCA-3′ (SEQ ID NO: 68).

miR-8078

5′-GGUCUAGGCCCGGUGAGAGACUC-3′ (MIMAT0031005, SEQ ID NO: 65).

Идеальная комплементарная последовательность miR-8078:

5′-GUCUCUCACCGGGCCUAGACCUU-3′ (SEQ ID NO: 66).

Эндогенная комплементарная последовательность miR-8078:

5′-CUCCACCGGGCUGACCGGCCUG-3′ (SEQ ID NO: 69).

В настоящем изобретении было обнаружено, что миРНК, идентифицированные при скрининге библиотеки, проявляют противораковые эффекты, контролируя те гены, которые вообще играют важную роль в индукции, появлении и росте раковых клеток. миРНК характеризуются тем, что одна миРНК может одновременно контролировать экспрессию целого ряда мРНК в одно и то же время. Такая особенность обнаруживалась и в настоящем изобретении, причем она полезна для разработки новых противораковых препаратов на основе олигонуклеотидов.

Было обнаружено, что miR-3670 по настоящему изобретению ингибирует экспрессию CBX4, NRAS, CASR, TXLNA, SNIP1, HNF1A, FZD4, TRIB1, ADMA19 и CKAP5, тогда как miR-8078 ингибирует экспрессию GREB1, HECTD3 и RIPK4, а miR-4477a ингибирует экспрессию STIL, KIF11, AKAP11 и FAM120A (фиг. 6).

Известно, что гены-мишени, которые ингибируются миРНК по настоящему изобретению, несут следующие функции.

Так, известно, что CBX4 (polycomb chromobox 4) участвует в ангиогенезе опухолей и стимуляции метастазирования опухолей, а NRAS играет важную роль в росте опухолей и делении клеток (Orouji E. et al. MAP Kinase pathway gene copy alterations in NRAS/BRAF wild-type advanced melanoma. Int J Cancer (2015); Zheng C. et al. MicroRNA-195 functions as a tumor suppressor by inhibiting CBX4 in hepatocellular carcinoma. Oncol Rep 33, 1115-22 (2015); Jiao H.K. et al. Prognostic significance of Cbx4 expression and its beneficial effect for transarterial chemoembolization in hepatocellular carcinoma. Cell Death Dis 6, e1689 (2015); Ohashi K. et al. Characteristics of lung cancers harboring NRAS mutations. Clin Cancer Res 19, 2584-91 (2013)).

Установлено, что CASR гиперэкспрессируется в опухолях и необходим для метастазирования опухолей, а TXLNA связан с ростом и метастазированием опухолей. Приведенные клинические результаты показали, что группа пациентов с высоким уровнем экспрессии TXLNA проявляет низкую выживаемость (Mashidori T., Shirataki H., Kamai T., Nakamura F. & Yoshida K. Increased alpha-taxilin protein expression is associated with the metastatic and invasive potential of renal cell cancer. Biomed Res 32, 103-10 (2011); Tennakoon S., Aggarwal A. & Kallay E. The calcium-sensing receptor and the hallmarks of cancer. Biochim Biophys Acta (2015); Ohtomo N. et al. Expression of alpha-taxilin in hepatocellular carcinoma correlates with growth activity and malignant potential of the tumor. Int J Oncol 37, 1417-23 (2010)).

SNIP1, известный как транскрипционный коактиватор, стимулирует экспрессию циклина D1, который необходим для роста и деления клеток. Известно, что группа пациентов с высоким уровнем экспрессии SNIP1 отличается плохим прогнозом. Кроме того, известно, что SNIP1 связывается с c-Myc, функционирующим в качестве главного регулятора пролиферации клеток, и при этом стимулирует рост опухолей (Li Q. et al. SNIP1: a new activator of HSE signaling pathway. Mol Cell Biochem 362, 1-6 (2012); Fujii M. et al. SNIP1 is a candidate modifier of the transcriptional activity of c-Myc on E box-dependent target genes. Mol Cell 24, 771-83 (2006); Roche K.C., Rocha S., Bracken C.P. & Perkins N.D. Regulation of ATR-dependent pathways by the FHA domain containing protein SNIP1. Oncogene 26, 4523-30 (2007); Jeon H.S. et al. High expression of SNIP1 correlates with poor prognosis in non-small cell lung cancer and SNIP1 interferes with the recruitment of HDAC1 to RB in vitro. Lung Cancer 82, 24-30 (2013); Liang X. et al. Hypoxia-inducible factor-1 alpha, in association with TWIST2 and SNIP1, is a critical prognostic factor in patients with tongue squamous cell carcinoma. Oral Oncol 47, 92-7 (2011)).

HNF1A и FZD4 являются компонентами сигнального пути Wnt, который глубоко вовлечен в росте опухолей и выживаемости. Сигнальные пути Wnt интенсивно изучались в биологии опухолей, и их значение широко известно. Известно, что TRIB1 играет роль в ингибировании роста, метастазирования и апоптоза опухолевых клеток и в регуляции сигнального пути MAPK, который является основным сигнальным путем роста опухолей (Pecina-Slaus N. et al. Wnt signaling transcription factors TCF-1 and LEF-1 are upregulated in malignant astrocytic brain tumors. Histol Histopathol 29, 1557-64 (2014); Ueno K. et al. Tumor suppressor microRNA-493 decreases cell motility and migration ability in human bladder cancer cells by downregulating RhoC and FZD4. Mol Cancer Ther 11, 244-53 (2012); Lin Z.Y. et al. MicroRNA-224 inhibits progression of human prostate cancer by downregulating TRIB1. Int J Cancer 135, 541-50 (2014); Soubeyrand S., Naing T., Martinuk A. & McPherson R. ERK1/2 regulates hepatocyte Trib1 in response to mitochondrial dysfunction. Biochim Biophys Acta 1833, 3405-14 (2013)).

ADAM19 - это белок, распределенный в клеточной мембране, который выполняет различные биологические функции, включая взаимодействия между клетками и взаимодействия между клетками и внеклеточным матриксом. Как известно в биологии опухолей, ADAM19 тесно связан с ростом и метастазированием опухолей. В настоящем изобретении посредством функционального скрининга генов было установлено, что ген CKAP5, который играет важную роль в выживании опухолей, контролируется миРНК. GREB1 связан с сигнальными путями в тканях или опухолях, реагирующих на гормоны, и гиперэкспрессируется в различных опухолевых клетках, стимулируя рост клеток (Zhang Q. et al. Role of microRNA-30c targeting ADAM19 in colorectal cancer. PLoS One 10, e0120698 (2015); Shan N., Shen L., Wang J., He D. & Duan C. MiR-153 inhibits migration and invasion of human non-small-cell lung cancer by targeting ADAM19. Biochem Biophys Res Commun 456, 385-91 (2015); Martens-de Kemp S.R. et al. Functional genetic screens identify genes essential for tumor cell survival in head and neck and lung cancer. Clin Cancer Res 19, 1994-2003 (2013); Rae J.M. et al. GREB1 is a novel androgen-regulated gene required for prostate cancer growth. Prostate 66, 886-94 (2006); Zhang L. et al. Development of transcriptomic biomarker signature in human saliva to detect lung cancer. Cell Mol Life Sci 69, 3341-50 (2012); Laviolette L.A., Hodgkinson K.M., Minhas N., Perez-Iratxeta C. & Vanderhyden B.C. 17beta-estradiol upregulates GREB1 and accelerates ovarian tumor progression in vivo. Int J Cancer 135, 1072-84 (2014)).

HECTD3 является убиквитин-лигазой E3, которая присоединяет полиубиквитин к каспазе-8, запускающей апоптоз, вызывая деградацию каспазы-8, тем самым ингибируя апоптоз опухолевых клеток. Также известно, что HECTD3 стабилизирует белок MALT1 и тем самым повышает устойчивость к противораковым препаратам группы цисплатина. RIPK4 представляет собой взаимодействующую с рецептором протеинкиназу 4, которая индуцирует накопление сигнального фактора роста клеток β-катенина и активирует сигнальный путь Wnt. Известно, что искусственное удаление RIPK4 может ингибировать рост опухолей на моделях рака у животных (Li Y. et al. The HECTD3 E3 ubiquitin ligase facilitates cancer cell survival by promoting K63-linked polyubiquitination of caspase-8. Cell Death Dis 4, e935 (2013); Li Y. et al. The HECTD3 E3 ubiquitin ligase suppresses cisplatin-induced apoptosis via stabilizing MALT1. Neoplasia 15, 39-48 (2013); Huang X. et al. Phosphorylation of Dishevelled by protein kinase RIPK4 regulates Wnt signaling. Science 339, 1441-5 (2013)).

Ген STIL, который является существенным фактором в переходе из фазы G2 в фазу M в клеточном цикле, сильно экспрессируется в различных клетках и необходим для роста и выживания опухолей. Известно, что KIF11 также необходим для роста и метастазирования опухолей, а ингибирование активности KIF11 может ингибировать рост опухолей (Erez A. et al. Sil overexpression in lung cancer characterizes tumors with increased mitotic activity. Oncogene 23, 5371-7 (2004); Erez A. et al. The SIL gene is essential for mitotic entry and survival of cancer cells. Cancer Res 67, 4022-7 (2007); Tang Y., Orth J.D., Xie T. & Mitchison T.J. Rapid induction of apoptosis during Kinesin-5 inhibitor-induced mitotic arrest in HL60 cells. Cancer Lett 310, 15-24 (2011); Venere M. et al. The mitotic kinesin KIF11 is a driver of invasion, proliferation, and self-renewal in glioblastoma. Sci Transl Med 7, 304ra143 (2015)).

AKAP11, который связывается с протеинкиназой A (PKA) и повышает активность PKA, также связывается с бета-GSK-3 и усиливает опосредованное PKA фосфорилирование GSK-3. Фосфорилированный бета-GSK-3 теряет свою активность, что является основным механизмом, который распознается клетками как сигнал стимуляции роста и индуцирует рост опухолей. Опухолевые клетки подвергаются различным стрессовым воздействиям, как-то кислотным условиям, условиям нехватки кислорода и т.п., поэтому они поддерживают механизм, при котором гибель опухолевых клеток ингибируется даже при таких тяжелых условиях. Например, известно, что FAM120A, являющийся РНК-связывающим белком, активирует киназы типа Src, ингибируя апоптоз клеток и повышая устойчивость к лекарственным средствам (Logue J.S. et al. AKAP220 protein organizes signaling elements that impact cell migration. J Biol Chem 286, 39269-81 (2011); Whiting J.L. et al. Protein kinase A opposes the phosphorylation-dependent recruitment of glycogen synthase kinase 3beta to A-kinase anchoring protein 220. J Biol Chem 290, 19445-57 (2015); Tanji C. et al. A-kinase anchoring protein AKAP220 binds to glycogen synthase kinase-3beta (GSK-3beta) and mediates protein kinase A-dependent inhibition of GSK-3beta. J Biol Chem 277, 36955-61 (2002); Tanaka M. et al. A novel RNA-binding protein, Ossa/C9orf10, regulates activity of Src kinases to protect cells from oxidative stress-induced apoptosis. Mol Cell Biol 29, 402-13 (2009); Bartolome R.A. et al. IL13 receptor alpha2 signaling requires a scaffold protein, FAM120A, to activate the FAK and PI3K pathways in colon cancer metastasis. Cancer Res 75, 2434-44 (2015)).

В настоящем изобретении было показано, что при снижении внутриклеточного содержания вышеописанных генов с помощью киРНК ингибируется рост клеток, как и при использовании miR-3670, miR4477a или miR-8078 (фиг. 6). Кроме того, результаты кПЦР показали, что при введении miR-3670, miR-4477a или miR-8078 в раковые клетки легких снижаются уровни экспрессии мРНК этих генов (фиг. 7). Кроме того, результаты определения люциферазы показали, что именно на эти вышеописанные гены непосредственно воздействует miR-3670, miR-4477a или miR-8078 (фиг. 8). Это говорит о том, что miR-3670, miR-4477a или miR-8078 прямо и одновременно ингибируют экспрессию различных генов, важных для роста и выживания опухолевых клеток, и тем самым индуцируют апоптоз опухолевых клеток.

В настоящем изобретении рак может представлять собой одно или несколько раковых заболеваний, выбранных из группы, состоящей из первичного рака типа рака легких, рака печени, рака желудка, колоректального рака, рака поджелудочной железы, рака желчного пузыря и желчных протоков, рака молочной железы, лейкемии, рака пищевода, неходжкинской лимфомы, рака щитовидной железы, рака шейки матки или рака кожи; метастатической карциномы, возникающей при метастазировании в другие органы из исходного места первичного рака; и неопластических заболеваний, вызванных аномально чрезмерным усилением деления клеток, но не ограничивается этим.

Последовательность миРНК, которая может применяться в качестве активного ингредиента фармацевтической композиции для лечения рака по настоящему изобретению, представляет собой последовательность, происходящую из генома человека, но это может быть и последовательность миРНК, полученная из генома других животных, не ограничивая происхождение миРНК геномом человека.

В настоящем изобретении миРНК может применяться в виде различных подобий миРНК, дающих биологически эквивалентный эффект. Например, можно использовать модифицированную миРНК, включающую последовательность миРНК, содержащую тот же посадочный участок. При этом можно уменьшить длину SEQ ID NO: 1 или SEQ ID NO: 2, а также можно использовать укороченную миРНК, состоящую из 15 нуклеотидов.

В настоящем изобретении аналоги миРНК могут частично содержать фосфоротиоатную структуру, в которой структура фосфатного остова РНК замещена другим элементом типа серы. Кроме того, можно использовать и такие, которые получены при полной или частичной замене РНК молекулой ДНК, ПНК (пептидной нуклеиновой кислоты) или LNA (блокированной нуклеиновой кислоты). Кроме того, можно использовать и такие, которые получены путем замещения 2′-гидроксильной группы сахара в РНК различными функциональными структурами. Такие модификации включают, без ограничения, метилирование, метоксилирование, фторирование и т.п.

В настоящем изобретении миРНК не ограничивается зрелой миРНК и двухцепочечной РНК происходящих из неё имитаций миРНК, а может применяться в виде предшественника миРНК. Предшественники миРНК также могут быть получены при замещении вышеописанной структуры фосфатного остова РНК, полной или частичной замене нуклеиновой кислоты РНК молекулой ДНК, ПНК или LNA либо модификации
2′-гидроксильной группы сахара в РНК.

В настоящем изобретении миРНК может применяться в виде предшественника миРНК или первичной миРНК (pri-miRNA), которые можно синтезировать химическим методом или доставить в клетки в виде плазмиды с тем, чтобы их экспрессировать.

Примеры способов доставки миРНК в клетки, культивируемые в культуральных чашках, которые можно использовать в настоящем изобретении, включают способ с использованием смеси миРНК и катионного липида, способ доставки миРНК в клетки при электрическом воздействии и способ с использованием вируса, но не ограничиваются этим.

Фармацевтическая композиция для лечения рака, включающая миРНК настоящего изобретения в качестве активного ингредиента, может дополнительно включать в себя фармацевтически приемлемый носитель и может быть составлена вместе с носителем.

В настоящем изобретении термин “фармацевтически приемлемый носитель” означает такой носитель или разбавитель, который не ухудшает биологическую активность и характеристики вводимого соединения без раздражения организма. В качестве фармацевтически приемлемого носителя в композиции, составленной в виде жидкого раствора, используется стерильный и биосовместимый носитель. Фармацевтически приемлемый носитель может представлять собой физиологический раствор, стерильную воду, раствор Рингера, забуференный физраствор, раствор альбумина для инъекций, раствор декстрозы, раствор мальтодекстрина, глицерин, этанол или смесь из двух или нескольких из них. Кроме того, композиции настоящего изобретения могут, при необходимости, содержать другие стандартные добавки, включая антиоксиданты, буферы и бактериостатические средства. Кроме того, композиции настоящего изобретения могут быть составлена в виде форм для инъекций типа водных растворов, суспензий или эмульсий с помощью разбавителей, диспергирующих средств, поверхностно-активных веществ, связующих и смазывающих веществ. Кроме того, композиции по настоящему изобретению могут быть составлены в виде пилюль, капсул, гранул или таблеток.

Композиции для профилактики или лечения рака, которые включают миРНК по настоящему изобретению и фармацевтически приемлемый носитель, могут применяться в виде любой лекарственной формы, содержащей её в качестве активного ингредиента, и могут быть приготовлены в виде пероральной или парентеральной формы. Фармацевтические формы настоящего изобретения включают формы, подходящие для перорального, ректального, назального, местного (включая буккальное и подъязычное), подкожного, вагинального или парентерального (включая внутримышечное, подкожное и внутривенное) введения, или же формы, подходящие для введения путем ингаляции или вдувания.

Примеры пероральных форм, содержащих композицию настоящего изобретения в качестве активного ингредиента, включают таблетки, пастилки, лепешки, водные или эмульгированные суспензии, порошки, гранулы, эмульсии, твердые или мягкие капсулы, сиропы или эликсиры. Такие формы, как таблетки или капсулы, могут включать в себя связующее вещество типа лактозы, сахарозы, сорбита, маннита, крахмала, амилопектина, целлюлозы или желатина, наполнитель типа дикальцийфосфата, разрыхлитель типа кукурузного крахмала или картофельного крахмала и смазывающее вещество типа стеарата магния, стеарата кальция, стеарилфумарата натрия или полиэтиленгликолевого воска. Формы типа капсул могут содержать, помимо вышеупомянутых веществ, жидкий носитель типа жирного (нелетучего) масла.

Парентеральные формы, содержащие композицию настоящего изобретения в качестве активного ингредиента, включают инъекционные формы для подкожных, внутривенных или внутримышечных инъекций, свечи или вдыхаемые через респираторные органы спреи типа аэрозолей. Формы для инъекций могут быть получены путем смешивания композиции настоящего изобретения со стабилизатором или буфером в воде с получением раствора или суспензии и внесения раствора или суспензии в ампулы или флаконы для получения стандартные дозовых форм. Формы типа свечей включают суппозитории или удерживающие клизмы, напр., содержащие стандартные основания свечей типа масла какао или другие глицериды. Для распыляемых форм типа аэрозолей можно использовать сжатый газ-вытеснитель для распыления диспергированного в воде концентрата или влажного порошка в сочетании с добавками.

ПРИМЕРЫ

Далее настоящее изобретение будет описано более подробно на примерах. Рядовым специалистам в данной области должно быть ясно, что эти примеры приводятся только в иллюстративных целях и не должны толковаться как ограничивающие объем настоящего изобретения.

Пример 1. Конструирование библиотеки миРНК для скрининга

Исходя из структуры типа стебель и петля у 21 варианта последовательностей миРНК человека, полученных из базы данных miRBase по миРНК (www.mirbase.org), синтезировали библиотеку для скрининга, состоящую примерно из 1700 различных миРНК, в виде последовательностей двухцепочечных миРНК методом твердофазного синтеза, который применяется при традиционном синтезе олигонуклеотидов. Каждую нить синтезированных миРНК очищали методом обратнофазовой хроматографии на смоле C18. Все синтезированные нити миРНК подвергали анализу методом масс-спектрометрии MALDI-TOF для определения того, что были синтезированы требуемые последовательности. Для получения двухцепочечных миРНК комплементарные нити нагревали в присутствии соли при 95°C в течение 2 минут, а затем медленно охлаждали для получения двойных нитей.

Таблица 1. Последовательности миРНК

миРНК Последовательность 1 Последовательность 2
hsa-let-7a-1 UGAGGUAGUAGGUUGUAUAGUU CUAUACAAUCUACUGUCUUUC
hsa-let-7a-2 UGAGGUAGUAGGUUGUAUAGUU CUGUACAGCCUCCUAGCUUUCC
hsa-let-7b CUAUACAACCUACUGCCUUCCC UGAGGUAGUAGGUUGUGUGGUU
hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU CUGUACAACCUUCUAGCUUUCC
hsa-let-7d CUAUACGACCUGCUGCCUUUCU AGAGGUAGUAGGUUGCAUAGUU
hsa-let-7e CUAUACGGCCUCCUAGCUUUCC UGAGGUAGGAGGUUGUAUAGUU
hsa-let-7f-1 UGAGGUAGUAGAUUGUAUAGUU CUAUACAAUCUAUUGCCUUCCC
hsa-let-7f-2 UGAGGUAGUAGAUUGUAUAGUU CUAUACAGUCUACUGUCUUUCC
hsa-let-7g CUGUACAGGCCACUGCCUUGC UGAGGUAGUAGUUUGUACAGUU
hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU CUGCGCAAGCUACUGCCUUGCU
hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU ACAUACUUCUUUAUAUGCCCAU
hsa-miR-100 CAAGCUUGUAUCUAUAGGUAUG AACCCGUAGAUCCGAACUUGUG
hsa-miR-101 UACAGUACUGUGAUAACUGAA CAGUUAUCACAGUGCUGAUGCU
hsa-miR-103a AGCAGCAUUGUACAGGGCUAUGA AGCUUCUUUACAGUGCUGCCUUG
hsa-miR-103b UCAUAGCCCUGUACAAUGCUGCU CAGCAUUGUACAGGGCUAUGAUU
hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU ACGGAUGUUUGAGCAUGUGCUA
hsa-miR-106a CUGCAAUGUAAGCACUUCUUAC AAAAGUGCUUACAGUGCAGGUAG
hsa-miR-106b UAAAGUGCUGACAGUGCAGAU CCGCACUGUGGGUACUUGCUGC
hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA AUAGCCCUGUACAAUGCUGCUUU
hsa-miR-10a CAAAUUCGUAUCUAGGGGAAUA UACCCUGUAGAUCCGAAUUUGUG
hsa-miR-10b ACAGAUUCGAUUCUAGGGGAAU UACCCUGUAGAACCGAAUUUGUG
hsa-miR-1178 UUGCUCACUGUUCUUCCCUAG CAGGGUCAGCUGAGCAUG
hsa-miR-1179 AAGCAUUCUUUCAUUGGUUGG AACCAAUGAAAGAAUGCUUUU
hsa-miR-1180 UUUCCGGCUCGCGUGGGUGUGU GGACCCACCCGGCCGGGAAUA
hsa-miR-1181 CCGUCGCCGCCACCCGAGCCG GCUCGGGUGGCGGCGACGGUU
hsa-miR-1182 GAGGGUCUUGGGAGGGAUGUGAC CACAUCCCUCCCAAGACCCUCUU
hsa-miR-1183 CACUGUAGGUGAUGGUGAGAGUGGGCA CCCACUCUCACCAUCACCUACAGUGUU
hsa-miR-1184 CCUGCAGCGACUUGAUGGCUUCC AAGCCAUCAAGUCGCUGCAGGUU
hsa-miR-1185-1 AGAGGAUACCCUUUGUAUGUU AUAUACAGGGGGAGACUCUUAU
hsa-miR-1185-2 AGAGGAUACCCUUUGUAUGUU AUAUACAGGGGGAGACUCUCAU
hsa-miR-1193 GGGAUGGUAGACCGGUGACGUGC ACGUCACCGGUCUACCAUCCCUU
hsa-miR-1197 UAGGACACAUGGUCUACUUCU AAGUAGACCAUGUGUCCUAUU
hsa-miR-1199 CCUGAGCCCGGGCCGCGCAG UGCGGCCGGUGCUCAACCUGC
hsa-miR-1200 CUCCUGAGCCAUUCUGAGCCUC GGCUCAGAAUGGCUCAGGAGUU
hsa-miR-1202 GUGCCAGCUGCAGUGGGGGAG CCCCCACUGCAGCUGGCACUU
hsa-miR-1203 CCCGGAGCCAGGAUGCAGCUC GCUGCAUCCUGGCUCCGGGUU
hsa-miR-1204 UCGUGGCCUGGUCUCCAUUAU AAUGGAGACCAGGCCACGAUU
hsa-miR-1205 UCUGCAGGGUUUGCUUUGAG CAAAGCAAACCCUGCAGAUU
hsa-miR-1206 UGUUCAUGUAGAUGUUUAAGC UUAAACAUCUACAUGAACAUU
hsa-miR-1207 UGGCAGGGAGGCUGGGAGGGG UCAGCUGGCCCUCAUUUC
hsa-miR-1208 UCACUGUUCAGACAGGCGGA CGCCUGUCUGAACAGUGAUU
hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG AACGCCAUUAUCACACUAAAUA
hsa-miR-1224 CCCCACCUCCUCUCUCCUCAG GUGAGGACUCGGGAGGUGG
hsa-miR-1225 GUGGGUACGGCCCAGUGGGGGG UGAGCCCCUGUGCCGCCCCCAG
hsa-miR-1226 GUGAGGGCAUGCAGGCCUGGAUGGGG UCACCAGCCCUGUGUUCCCUAG
hsa-miR-1227 GUGGGGCCAGGCGGUGG CGUGCCACCCUUUUCCCCAG
hsa-miR-1228 GUGGGCGGGGGCAGGUGUGUG UCACACCUGCCUCGCCCCCC
hsa-miR-1229 GUGGGUAGGGUUUGGGGGAGAGCG CUCUCACCACUGCCCUCCCACAG
hsa-miR-1231 GUGUCUGGGCGGACAGCUGC AGCUGUCCGCCCAGACACUU
hsa-miR-1233 AGUGGGAGGCCAGGGCACGGCA UGAGCCCUGUCCUCCCGCAG
hsa-miR-1234 UCGGCCUGACCACCCACCCCAC GGGGUGGGUGGUCAGGCCGAUU
hsa-miR-1236 UGAGUGACAGGGGAAAUGGGGA CCUCUUCCCCUUGUCUCUCCAG
hsa-miR-1237 CGGGGGCGGGGCCGAAGCGCG UCCUUCUGCUCCGUCCCCCAG
hsa-miR-1238 CUUCCUCGUCUGUCUGCCCC GUGAGUGGGAGCCCCAGUGUGUG
hsa-miR-124 UAAGGCACGCGGUGAAUGCC CGUGUUCACAGCGGACCUUGAU
hsa-miR-1243 AACUGGAUCAAUUAUAGGAGUG CUCCUAUAAUUGAUCCAGUUUU
hsa-miR-1244 AAGUAGUUGGUUUGUAUGAGAUGGUU CCAUCUCAUACAAACCAACUACUUUU
hsa-miR-1245a AAGUGAUCUAAAGGCCUACAU GUAGGCCUUUAGAUCACUUUU
hsa-miR-1245b UCAGAUGAUCUAAAGGCCUAUA UAGGCCUUUAGAUCACUUAAA
hsa-miR-1246 AAUGGAUUUUUGGAGCAGG UGCUCCAAAAAUCCAUUUU
hsa-miR-1247 CCCCGGGAACGUCGAGACUGGAGC ACCCGUCCCGUUCGUCCCCGGA
hsa-miR-1248 ACCUUCUUGUAUAAGCACUGUGCUAAA UAGCACAGUGCUUAUACAAGAAGGUUU
hsa-miR-1249 ACGCCCUUCCCCCCCUUCUUCA AGGAGGGAGGAGAUGGGCCAAGUU
hsa-miR-1250 ACAUUUUCCAGCCCAUUCA ACGGUGCUGGAUGUGGCCUUU
hsa-miR-1251 CGCUUUGCUCAGCCAGUGUAG ACUCUAGCUGCCAAAGGCGCU
hsa-miR-1252 AGAAGGAAAUUGAAUUCAUUUA CAAAUGAGCUUAAUUUCCUUUU
hsa-miR-1253 AGAGAAGAAGAUCAGCCUGCA CAGGCUGAUCUUCUUCUCUUU
hsa-miR-1254 AGCCUGGAAGCUGGAGCCUGCAGU UGCAGGCUCCAGCUUCCAGGCUUU
hsa-miR-1255a AGGAUGAGCAAAGAAAGUAGAUU UCUACUUUCUUUGCUCAUCCUUU
hsa-miR-1255b AACCACUUUCUUUGCUCAUCCA CGGAUGAGCAAAGAAAGUGGUU
hsa-miR-1256 AGGCAUUGACUUCUCACUAGCU CUAGUGAGAAGUCAAUGCCUUU
hsa-miR-1257 AGUGAAUGAUGGGUUCUGACC UCAGAACCCAUCAUUCACUUU
hsa-miR-1258 AGUUAGGAUUAGGUCGUGGAA CCACGACCUAAUCCUAACUUU
hsa-miR-125a ACAGGUGAGGUUCUUGGGAGCC UCCCUGAGACCCUUUAACCUGUGA
hsa-miR-125b-1 UCCCUGAGACCCUAACUUGUGA ACGGGUUAGGCUCUUGGGAGCU
hsa-miR-125b-2 UCCCUGAGACCCUAACUUGUGA UCACAAGUCAGGCUCUUGGGAC
hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG CAUUAUUACUUUUGGUACGCG
hsa-miR-1260a AUCCCACCUCUGCCACCA GUGGCAGAGGUGGGAUUU
hsa-miR-1260b AUCCCACCACUGCCACCAU GGUGGCAGUGGUGGGAUUU
hsa-miR-1261 AUGGAUAAGGCUUUGGCUU GCCAAAGCCUUAUCCAUUU
hsa-miR-1262 AUGGGUGAAUUUGUAGAAGGAU CCUUCUACAAAUUCACCCAUUU
hsa-miR-1263 AUGGUACCCUGGCAUACUGAGU UCAGUAUGCCAGGGUACCAUUU
hsa-miR-1264 CAAGUCUUAUUUGAGCACCUGUU CAGGUGCUCAAAUAAGACUUGUU
hsa-miR-1265 CAGGAUGUGGUCAAGUGUUGUU CAACACUUGACCACAUCCUGUU
hsa-miR-1266 CCUCAGGGCUGUAGAACAGGGCU CCCUGUUCUAUGCCCUGAGGGA
hsa-miR-1267 CCUGUUGAAGUGUAAUCCCCA GGGAUUACACUUCAACAGGUU
hsa-miR-1268a CGGGCGUGGUGGUGGGGG CCCACCACCACGCCCGUU
hsa-miR-1268b CGGGCGUGGUGGUGGGGGUG CCCCCACCACCACGCCCGUU
hsa-miR-1269a CUGGACUGAGCCGUGCUACUGG AGUAGCACGGCUCAGUCCAGUU
hsa-miR-1269b CUGGACUGAGCCAUGCUACUGG AGUAGCAUGGCUCAGUCCAGUU
hsa-miR-127 UCGGAUCCGUCUGAGCUUGGCU CUGAAGCUCAGAGGGCUCUGAU
hsa-miR-1270 CUGGAGAUAUGGAAGAGCUGUGU ACAGCUCUUCCAUAUCUCCAGUU
hsa-miR-1271 AGUGCCUGCUAUGUGCCAGGCA CUUGGCACCUAGCAAGCACUCA
hsa-miR-1272 GAUGAUGAUGGCAGCAAAUUCUGAAA UCAGAAUUUGCUGCCAUCAUCAUCUU
hsa-miR-1273a GGGCGACAAAGCAAGACUCUUUCUU GAAAGAGUCUUGCUUUGUCGCCCUU
hsa-miR-1273c GGCGACAAAACGAGACCCUGUC CAGGGUCUCGUUUUGUCGCCUU
hsa-miR-1273d GAACCCAUGAGGUUGAGGCUGCAGU UGCAGCCUCAACCUCAUGGGUUCUU
hsa-miR-1273e UUGCUUGAACCCAGGAAGUGGA CACUUCCUGGGUUCAAGCAAUU
hsa-miR-1273f GGAGAUGGAGGUUGCAGUG CUGCAACCUCCAUCUCCUU
hsa-miR-1273g GGUGGUUGAGGCUGCAGUAAGU ACCACUGCACUCCAGCCUGAG
hsa-miR-1273h CUGGGAGGUCAAGGCUGCAGU CUGCAGACUCGACCUCCCAGGC
hsa-miR-1275 GUGGGGGAGAGGCUGUC CAGCCUCUCCCCCACUU
hsa-miR-1276 UAAAGAGCCCUGUGGAGACA UCUCCACAGGGCUCUUUAUU
hsa-miR-1277 UACGUAGAUAUAUAUGUAUUUU AAAUAUAUAUAUAUAUGUACGUAU
hsa-miR-1278 UAGUACUGUGCAUAUCAUCUAU AGAUGAUAUGCACAGUACUAUU
hsa-miR-1279 UCAUAUUGCUUCUUUCU AAAGAAGCAAUAUGAUU
hsa-miR-128-1 UCACAGUGAACCGGUCUCUUU CGGGGCCGUAGCACUGUCUGAGA
hsa-miR-128-2 UCACAGUGAACCGGUCUCUUU GGGGGCCGAUACACUGUACGAGA
hsa-miR-1281 UCGCCUCCUCCUCUCCC GAGAGGAGGAGGCGAUU
hsa-miR-1282 UCGUUUGCCUUUUUCUGCUU GCAGAAAAAGGCAAACGAUU
hsa-miR-1283 UCUACAAAGGAAAGCGCUUUCU AAAGCGCUUUCCUUUGUAGAUU
hsa-miR-1284 UCUAUACAGACCCUGGCUUUUC AAAGCCAGGGUCUGUAUAGAUU
hsa-miR-1285 UCUGGGCAACAAAGUGAGACCU GAUCUCACUUUGUUGCCCAGG
hsa-miR-1286 UGCAGGACCAAGAUGAGCCCU GGCUCAUCUUGGUCCUGCAUU
hsa-miR-1287 CUCUAGCCACAGAUGCAGUGAU UGCUGGAUCAGUGGUUCGAGUC
hsa-miR-1288 UGGACUGCCCUGAUCUGGAGA GCAGAUCAGGACUGUAACUCACC
hsa-miR-1289 UGGAGUCCAGGAAUCUGCAUUUU AAUGCAGAUUCCUGGACUCCAUU
hsa-miR-129-1 CUUUUUGCGGUCUGGGCUUGC AAGCCCUUACCCCAAAAAGUAU
hsa-miR-129-2 CUUUUUGCGGUCUGGGCUUGC AAGCCCUUACCCCAAAAAGCAU
hsa-miR-1290 UGGAUUUUUGGAUCAGGGA CCUGAUCCAAAAAUCCAUU
hsa-miR-1291 UGGCCCUGACUGAAGACCAGCAGU UGCUGGUCUUCAGUCAGGGCCAUU
hsa-miR-1292 UGGGAACGGGUUCCGGCAGACGCUG UCGCGCCCCGGCUCCCGUUC
hsa-miR-1293 UGGGUGGUCUGGAGAUUUGUGC ACAAAUCUCCAGACCACCCAUU
hsa-miR-1294 UGUGAGGUUGGCAUUGUUGUCU ACAACAAUGCCAACCUCACAUU
hsa-miR-1295a UUAGGCCGCAGAUCUGGGUGA ACCCAGAUCUGCGGCCUAAUU
hsa-miR-1295b AAUAGGCCACGGAUCUGGGCAA CACCCAGAUCUGCGGCCUAAU
hsa-miR-1296 UUAGGGCCCUGGCUCCAUCUCC GAGUGGGGCUUCGACCCUAACC
hsa-miR-1297 UUCAAGUAAUUCAGGUG CCUGAAUUACUUGAAUU
hsa-miR-1298 CAUCUGGGCAACUGACUGAAC UUCAUUCGGCUGUCCAGAUGUA
hsa-miR-1299 UUCUGGAAUUCUGUGUGAGGGA CCUCACACAGAAUUCCAGAAUU
hsa-miR-1301 CGCUCUAGGCACCGCAGCA UUGCAGCUGCCUGGGAGUGACUUC
hsa-miR-1302 UUGGGACAUACUUAUGCUAAA UAGCAUAAGUAUGUCCCAAUU
hsa-miR-1303 UUUAGAGACGGGGUCUUGCUCU AGCAAGACCCCGUCUCUAAAUU
hsa-miR-1304 UUUGAGGCUACAGUGAGAUGUG UCUCACUGUAGCCUCGAACCCC
hsa-miR-1305 UUUUCAACUCUAAUGGGAGAGA UCUCCCAUUAGAGUUGAAAAUU
hsa-miR-1306 CCACCUCCCCUGCAAACGUCCA ACGUUGGCUCUGGUGGUG
hsa-miR-1307 ACUCGGCGUGGCGUCGGUCGUG UCGACCGGACCUCGACCGGCU
hsa-miR-130a UUCACAUUGUGCUACUGUCUGC CAGUGCAAUGUUAAAAGGGCAU
hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU ACUCUUUCCCUGUUGCACUAC
hsa-miR-132 UAACAGUCUACAGCCAUGGUCG ACCGUGGCUUUCGAUUGUUACU
hsa-miR-1321 CAGGGAGGUGAAUGUGAU CACAUUCACCUCCCUGUU
hsa-miR-1322 GAUGAUGCUGCUGAUGCUG GCAUCAGCAGCAUCAUCUU
hsa-miR-1323 UCAAAACUGAGGGGCAUUUUCU AAAAUGCCCCUCAGUUUUGAUU
hsa-miR-1324 CCAGACAGAAUUCUAUGCACUUUC AAGUGCAUAGAAUUCUGUCUGGUU
hsa-miR-133a AGCUGGUAAAAUGGAACCAAAU UUUGGUCCCCUUCAACCAGCUG
hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA GCUGGUUGAAGGGGACCAAAUU
hsa-miR-134 UGUGACUGGUUGACCAGAGGGG CCUGUGGGCCACCUAGUCACCAA
hsa-miR-1343 CUCCUGGGGCCCGCACUCUCGC UGGGGAGCGGCCCCCGGGUGGG
hsa-miR-135a UAUAGGGAUUGGAGCCGUGGCG UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b AUGUAGGGCUAAAAGCCAUGGG UAUGGCUUUUCAUUCCUAUGUGA
hsa-miR-136 CAUCAUCGUCUCAAAUGAGUCU ACUCCAUUUGUUUUGAUGAUGGA
hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG ACGCGUAUUCUUAAGCAAUAAUU
hsa-miR-138-1 AGCUGGUGUUGUGAAUCAGGCCG GCUACUUCACAACACCAGGGCC
hsa-miR-138-2 AGCUGGUGUUGUGAAUCAGGCCG GCUAUUUCACGACACCAGGGUU
hsa-miR-139 UCUACAGUGCACGUGUCUCCAGU UGGAGACGCGGCCCUGUUGGAGU
hsa-miR-140 CAGUGGUUUUACCCUAUGGUAG UACCACAGGGUAGAACCACGG
hsa-miR-141 UAACACUGUCUGGUAAAGAUGG CAUCUUCCAGUACAGUGUUGGA
hsa-miR-142 CAUAAAGUAGAAAGCACUACU UGUAGUGUUUCCUACUUUAUGGA
hsa-miR-143 GGUGCAGUGCUGCAUCUCUGGU UGAGAUGAAGCACUGUAGCUC
hsa-miR-144 UACAGUAUAGAUGAUGUACU GGAUAUCAUCAUAUACUGUAAG
hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU GGAUUCCUGGAAAUACUGUUCU
hsa-miR-1468 CUCCGUUUGCCUGUUUCGCUG AGCAAAAUAAGCAAAUGGAAAA
hsa-miR-1469 CUCGGCGCGGGGCGCGGGCUCC AGCCCGCGCCCCGCGCCGAGUU
hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU CCUCUGAAAUUCAGUUCUUCAG
hsa-miR-146b UGCCCUGUGGACUCAGUUCUGG UGAGAACUGAAUUCCAUAGGCU
hsa-miR-1470 GCCCUCCGCCCGUGCACCCCG GGGUGCACGGGCGGAGGGCUU
hsa-miR-1471 GCCCGCGUGUGGAGCCAGGUGU ACCUGGCUCCACACGCGGGCUU
hsa-miR-147a GUGUGUGGAAAUGCUUCUGC AGAAGCAUUUCCACACACUU
hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA GCAGAAGCAUUUCCGCACACUU
hsa-miR-148a AAAGUUCUGAGACACUCCGACU UCAGUGCACUACAGAACUUUGU
hsa-miR-148b AAGUUCUGUUAUACACUCAGGC UCAGUGCAUCACAGAACUUUGU
hsa-miR-149 AGGGAGGGACGGGGGCUGUGC UCUGGCUCCGUGUCUUCACUCCC
hsa-miR-150 CUGGUACAGGCCUGGGGGACAG UCUCCCAACCCUUGUACCAGUG
hsa-miR-151a UCGAGGAGCUCACAGUCUAGU CUAGACUGAAGCUCCUUGAGG
hsa-miR-151b UCGAGGAGCUCACAGUCU ACUGUGAGCUCCUCGAUU
hsa-miR-152 AGGUUCUGUGAUACACUCCGACU UCAGUGCAUGACAGAACUUGG
hsa-miR-153 UCAUUUUUGUGAUGUUGCAGCU UUGCAUAGUCACAAAAGUGAUC
hsa-miR-1537 AGCUGUAAUUAGUCAGUUUUCU AAAACCGUCUAGUUACAGUUGU
hsa-miR-1538 CGGCCCGGGCUGCUGCUGUUCCU GAACAGCAGCAGCCCGGGCCGUU
hsa-miR-1539 UCCUGCGCGUCCCAGAUGCCC GCAUCUGGGACGCGCAGGAUU
hsa-miR-154 AAUCAUACACGGUUGACCUAUU UAGGUUAUCCGUGUUGCCUUCG
hsa-miR-155 CUCCUACAUAUUAGCAUUAACA UUAAUGCUAAUCGUGAUAGGGGU
hsa-miR-1587 UUGGGCUGGGCUGGGUUGGG CAACCCAGCCCAGCCCAAUU
hsa-miR-15a CAGGCCAUAUUGUGCUGCCUCA UAGCAGCACAUAAUGGUUUGUG
hsa-miR-15b CGAAUCAUUAUUUGCUGCUCUA UAGCAGCACAUCAUGGUUUACA
hsa-miR-16-1 UAGCAGCACGUAAAUAUUGGCG CCAGUAUUAACUGUGCUGCUGA
hsa-miR-16-2 UAGCAGCACGUAAAUAUUGGCG CCAAUAUUACUGUGCUGCUUUA
hsa-miR-17 ACUGCAGUGAAGGCACUUGUAG CAAAGUGCUUACAGUGCAGGUAG
hsa-miR-181a-1 AACAUUCAACGCUGUCGGUGAGU ACCAUCGACCGUUGAUUGUACC
hsa-miR-181a-2 AACAUUCAACGCUGUCGGUGAGU ACCACUGACCGUUGACUGUACC
hsa-miR-181b-1 AACAUUCAUUGCUGUCGGUGGGU CUCACUGAACAAUGAAUGCAA
hsa-miR-181b-2 AACAUUCAUUGCUGUCGGUGGGU CUCACUGAUCAAUGAAUGCA
hsa-miR-181c AACCAUCGACCGUUGAGUGGAC AACAUUCAACCUGUCGGUGAGU
hsa-miR-181d CCACCGGGGGAUGAAUGUCAC AACAUUCAUUGUUGUCGGUGGGU
hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU UGGUUCUAGACUUGCCAACUA
hsa-miR-1825 UCCAGUGCCCUCCUCUCC AGAGGAGGGCACUGGAUU
hsa-miR-1827 UGAGGCAGUAGAUUGAAU UCAAUCUACUGCCUCAUU
hsa-miR-183 UAUGGCACUGGUAGAAUUCACU GUGAAUUACCGAAGGGCCAUAA
hsa-miR-184 UGGACGGAGAACUGAUAAGGGU CCUUAUCAGUUCUCCGUCCAUU
hsa-miR-185 AGGGGCUGGCUUUCCUCUGGUC UGGAGAGAAAGGCAGUUCCUGA
hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCU GCCCAAAGGUGAAUUUUUUGGG
hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG GGCUACAACACAGGACCCGGGC
hsa-miR-188 CAUCCCUUGCAUGGUGGAGGG CUCCCACAUGCAGGGUUUGCA
hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG ACUGCCCUAAGUGCUCCUUCUGG
hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUAG UGCCCUAAAUGCCCCUUCUGGC
hsa-miR-1908 CGGCGGGGACGGCGAUUGGUC CCGGCCGCCGGCUCCGCCCCG
hsa-miR-1909 CGCAGGGGCCGGGUGCUCACCG UGAGUGCCGGUGCCUGCCCUG
hsa-miR-190a UGAUAUGUUUGAUAUAUUAGGU CUAUAUAUCAAACAUAUUCCU
hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU CCCAAUAUCAAACAUAUCAUU
hsa-miR-191 GCUGCGCUUGGAUUUCGUCCCC CAACGGAAUCCCAAAAGCAGCUG
hsa-miR-1910 CCAGUCCUGUGCCUGCCGCCU GAGGCAGAAGCAGGAUGACA
hsa-miR-1911 CACCAGGCAUUGUGGUCUCC UGAGUACCGCCAUGUCUGUUGGG
hsa-miR-1912 UACCCAGAGCAUGCAGUGUGAA CACACUGCAUGCUCUGGGUAUU
hsa-miR-1913 UCUGCCCCCUCCGCUGCUGCCA GCAGCAGCGGAGGGGGCAGAUU
hsa-miR-1914 CCCUGUGCCCGGCCCACUUCUG GGAGGGGUCCCGCACUGGGAGG
hsa-miR-1915 ACCUUGCCUUGCUGCCCGGGCC CCCCAGGGCGACGCGGCGGG
hsa-miR-192 CUGCCAAUUCCAUAGGUCACAG CUGACCUAUGAAUUGACAGCC
hsa-miR-193a UGGGUCUUUGCGGGCGAGAUGA AACUGGCCUACAAAGUCCCAGU
hsa-miR-193b CGGGGUUUUGAGGGCGAGAUGA AACUGGCCCUCAAAGUCCCGCU
hsa-miR-194 UGUAACAGCAACUCCAUGUGGA CCAGUGGGGCUGCUGUUAUCUG
hsa-miR-195 UAGCAGCACAGAAAUAUUGGC CCAAUAUUGGCUGUGCUGCUCC
hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG CGGCAACAAGAAACUGCCUGAG
hsa-miR-196b UCGACAGCACGACACUGCCUUC UAGGUAGUUUCCUGUUGUUGGG
hsa-miR-197 CGGGUAGAGAGGGCAGUGGGAGG UUCACCACCUUCUCCACCCAGC
hsa-miR-1972 UCAGGCCAGGCACAGUGGCUCA AGCCACUGUGCCUGGCCUGAUU
hsa-miR-1973 ACCGUGCAAAGGUAGCAUA UGCUACCUUUGCACGGUUU
hsa-miR-1976 CCUCCUGCCCUCCUUGCUGU AGCAAGGAGGGCAGGAGGUU
hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC ACCUAUCUCCCCUCUGGACCUU
hsa-miR-199a ACAGUAGUCUGCACAUUGGUUA CCCAGUGUUCAGACUACCUGUUC
hsa-miR-199b CCCAGUGUUUAGACUAUCUGUUC ACAGUAGUCUGCACAUUGGUUA
hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA AGUUUUGCAUAGUUGCACUACA
hsa-miR-19b-1 UGUGCAAAUCCAUGCAAAACUGA AGUUUUGCAGGUUUGCAUCCAGC
hsa-miR-19b-2 UGUGCAAAUCCAUGCAAAACUGA AGUUUUGCAGGUUUGCAUUUCA
hsa-miR-200a UAACACUGUCUGGUAACGAUGU CAUCUUACCGGACAGUGCUGGA
hsa-miR-200b CAUCUUACUGGGCAGCAUUGGA UAAUACUGCCUGGUAAUGAUGA
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA CGUCUUACCCAGCAGUGUUUGG
hsa-miR-202 UUCCUAUGCAUAUACUUCUUUG AGAGGUAUAGGGCAUGGGAA
hsa-miR-203a AGUGGUUCUUAACAGUUCAACAGUU GUGAAAUGUUUAGGACCACUAG
hsa-miR-203b UAGUGGUCCUAAACAUUUCACA UUGAACUGUUAAGAACCACUGGA
hsa-miR-204 GCUGGGAAGGCAAAGGGACGU UUCCCUUUGUCAUCCUAUGCCU
hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG GAUUUCAGUGGAGUGAAGUUC
hsa-miR-2052 UGUUUUGAUAACAGUAAUGU AUUACUGUUAUCAAAACAUU
hsa-miR-2053 GUGUUAAUUAAACCUCUAUUUAC AAAUAGAGGUUUAAUUAACACUU
hsa-miR-2054 CUGUAAUAUAAAUUUAAUUUAUU UAAAUUAAAUUUAUAUUACAGUU
hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG ACACACUUCCUUACAUUCCAUU
hsa-miR-208a AUAAGACGAGCAAAAAGCUUGU GAGCUUUUGGCCCGGGUUAUAC
hsa-miR-208b AAGCUUUUUGCUCGAAUUAUGU AUAAGACGAACAAAAGGUUUGU
hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG ACUGCAUUAUGAGCACUUAAAG
hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG ACUGUAGUAUGGGCACUUCCAG
hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA CAACACCAGUCGAUGGGCUGU
hsa-miR-210 AGCCCCUGCCCACCGCACACUG CUGUGCGUGUGACAGCGGCUGA
hsa-miR-211 GCAGGGACAGCAAAGGGGUGC UUCCCUUUGUCAUCCUUCGCCU
hsa-miR-2110 UUGGGGAAACGGCCGCUGAGUG CUCAGCGGCCGUUUCCCCAAUU
hsa-miR-2113 AUUUGUGCUUGGCUCUGUCAC GACAGAGCCAAGCACAAAUUU
hsa-miR-2114 UAGUCCCUUCCUUGAAGCGGUC CGAGCCUCAAGCAAGGGACUU
hsa-miR-2115 CAUCAGAAUUCAUGGAGGCUAG AGCUUCCAUGACUCCUGAUGGA
hsa-miR-2116 GGUUCUUAGCAUAGGAGGUCU CCUCCCAUGCCAAGAACUCCC
hsa-miR-2117 UGUUCUCUUUGCCAAGGACAG GUCCUUGGCAAAGAGAACAUU
hsa-miR-212 UAACAGUCUCCAGUCACGGCC ACCUUGGCUCUAGACUGCUUACU
hsa-miR-214 UGCCUGUCUACACUUGCUGUGC ACAGCAGGCACAGACAGGCAGU
hsa-miR-215 UCUGUCAUUUCUUUAGGCCAAUA AUGACCUAUGAAUUGACAGAC
hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA UCACAGUGGUCUCUGGGAUUAU
hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA ACACACUUACCCGUAGAGAUUCUA
hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA CAAUCAGUUCCUGAUGCAGUAUU
hsa-miR-218-1 UUGUGCUUGAUCUAACCAUGU AUGGUUCCGUCAAGCACCAUGG
hsa-miR-218-2 UUGUGCUUGAUCUAACCAUGU CAUGGUUCUGUCAAGCACCGCG
hsa-miR-219a-1 UGAUUGUCCAAACGCAAUUCU AGAGUUGAGUCUGGACGUCCCG
hsa-miR-219a-2 UGAUUGUCCAAACGCAAUUCU AGAAUUGUGGCUGGACAUCUGU
hsa-miR-219b AGAUGUCCAGCCACAAUUCUCG AGAAUUGCGUUUGGACAAUCAGU
hsa-miR-22 AGUUCUUCAGUGGCAAGCUUUA AAGCUGCCAGUUGAAGAACUGU
hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC ACCUGGCAUACAAUGUAGAUUU
hsa-miR-222 AGCUACAUCUGGCUACUGGGU CUCAGUAGCCAGUGUAGAUCCU
hsa-miR-223 CGUGUAUUUGACAAGCUGAGUU UGUCAGUUUGUCAAAUACCCCA
hsa-miR-224 AAAAUGGUGCCCUAGUGACUACA CAAGUCACUAGUGGUUCCGUU
hsa-miR-2276 GCCCUCUGUCACCUUGCAGACG UCUGCAAGUGUCAGAGGCGAGG
hsa-miR-2277 AGCGCGGGCUGAGCGCUGCCAGUC UGACAGCGCCCUGCCUGGCUC
hsa-miR-2278 GAGAGCAGUGUGUGUUGCCUGG AGGCAACACACACUGCUCUCUU
hsa-miR-2355 AUCCCCAGAUACAAUGGACAA AUUGUCCUUGCUGUUUGGAGAU
hsa-miR-2392 UAGGAUGGGGGUGAGAGGUG CCUCUCACCCCCAUCCUAUU
hsa-miR-23a AUCACAUUGCCAGGGAUUUCC GGGGUUCCUGGGGAUGGGAUUU
hsa-miR-23b AUCACAUUGCCAGGGAUUACC UGGGUUCCUGGCAUGCUGAUUU
hsa-miR-23c AUCACAUUGCCAGUGAUUACCC GUAAUCACUGGCAAUGUGAUUU
hsa-miR-24-1 UGGCUCAGUUCAGCAGGAACAG UGCCUACUGAGCUGAUAUCAGU
hsa-miR-24-2 UGGCUCAGUUCAGCAGGAACAG UGCCUACUGAGCUGAAACACAG
hsa-miR-2467 AGCAGAGGCAGAGAGGCUCAGG UGAGGCUCUGUUAGCCUUGGCUC
hsa-miR-25 AGGCGGAGACUUGGGCAAUUG CAUUGCACUUGUCUCGGUCUGA
hsa-miR-2681 GUUUUACCACCUCCAGGAGACU UAUCAUGGAGUUGGUAAAGCAC
hsa-miR-2682 CGCCUCUUCAGCGCUGUCUUCC CAGGCAGUGACUGUUCAGACGUC
hsa-miR-26a-1 UUCAAGUAAUCCAGGAUAGGCU CCUAUUCUUGGUUACUUGCACG
hsa-miR-26a-2 UUCAAGUAAUCCAGGAUAGGCU CCUAUUCUUGAUUACUUGUUUC
hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU CCUGUUCUCCAUUACUUGGCUC
hsa-miR-27a UUCACAGUGGCUAAGUUCCGC AGGGCUUAGCUGCUUGUGAGCA
hsa-miR-27b UUCACAGUGGCUAAGUUCUGC AGAGCUUAGCUGAUUGGUGAAC
hsa-miR-28 CACUAGAUUGUGAGCUCCUGGA AAGGAGCUCACAGUCUAUUGAG
hsa-miR-2861 GGGGCCUGGCGGUGGGCGG GCCCACCGCCAGGCCCCUU
hsa-miR-2909 GUUAGGGCCAACAUCUCUUGG AAGAGAUGUUGGCCCUAACUU
hsa-miR-296 GAGGGUUGGGUGGAGGCUCUCC AGGGCCCCCCCUCAAUCCUGU
hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG UGCACAUGCACACAUACAUUU
hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA GGAGAACCUCCCUGCUUCUGCUUU
hsa-miR-299 UGGUUUACCGUCCCACAUACAU UAUGUGGGAUGGUAAACCGCUU
hsa-miR-29a ACUGAUUUCUUUUGGUGUUCAG UAGCACCAUCUGAAAUCGGUUA
hsa-miR-29b-1 UAGCACCAUUUGAAAUCAGUGUU GCUGGUUUCAUAUGGUGGUUUAGA
hsa-miR-29b-2 UAGCACCAUUUGAAAUCAGUGUU CUGGUUUCACAUGGUGGCUUAG
hsa-miR-29c UGACCGAUUUCUCCUGGUGUUC UAGCACCAUUUGAAAUCGGUUA
hsa-miR-300 UAUACAAGGGCAGACUCUCUCU AGAGAGUCUGCCCUUGUAUAUU
hsa-miR-301a GCUCUGACUUUAUUGCACUACU CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC GCUCUGACGAGGUUGCACUACU
hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA ACUUAAACGUGGAUGUACUUGCU
hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG ACUUUAACAUGGAAGUGCUUUC
hsa-miR-302c UUUAACAUGGGGGUACCUGCUG UAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302d ACUUUAACAUGGAGGCACUUGC UAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-302e UAAGUGCUUCCAUGCUU GCAUGGAAGCACUUAUU
hsa-miR-302f UAAUUGCUUCCAUGUUU ACAUGGAAGCAAUUAUU
hsa-miR-3064 UUGCCACACUGCAACACCUUACA UCUGGCUGUUGUGGUGUGCAA
hsa-miR-3065 UCAGCACCAGGAUAUUGUUGGAG UCAACAAAAUCACUGAUGCUGGA
hsa-miR-3074 GAUAUCAGCUCAGUAGGCACCG GUUCCUGCUGAACUGAGCCAG
hsa-miR-30a CUUUCAGUCGGAUGUUUGCAGC UGUAAACAUCCUCGACUGGAAG
hsa-miR-30b UGUAAACAUCCUACACUCAGCU CUGGGAGGUGGAUGUUUACUUC
hsa-miR-30c-1 UGUAAACAUCCUACACUCUCAGC CUGGGAGAGGGUUGUUUACUCC
hsa-miR-30c-2 UGUAAACAUCCUACACUCUCAGC CUGGGAGAAGGCUGUUUACUCU
hsa-miR-30d UGUAAACAUCCCCGACUGGAAG CUUUCAGUCAGAUGUUUGCUGC
hsa-miR-30e UGUAAACAUCCUUGACUGGAAG CUUUCAGUCGGAUGUUUACAGC
hsa-miR-31 UGCUAUGCCAACAUAUUGCCAU AGGCAAGAUGCUGGCAUAGCU
hsa-miR-3115 AUAUGGGUUUACUAGUUGGU CAACUAGUAAACCCAUAUUU
hsa-miR-3116 UGCCUGGAACAUAGUAGGGACU UCCCUACUAUGUUCCAGGCAUU
hsa-miR-3117 AUAGGACUCAUAUAGUGCCAG AGACACUAUACGAGUCAUAU
hsa-miR-3118 UGUGACUGCAUUAUGAAAAUUCU AAUUUUCAUAAUGCAGUCACAUU
hsa-miR-3119 UGGCUUUUAACUUUGAUGGC CAUCAAAGUUAAAAGCCAUU
hsa-miR-3120 CCUGUCUGUGCCUGCUGUACA CACAGCAAGUGUAGACAGGCA
hsa-miR-3121 UCCUUUGCCUAUUCUAUUUAAG UAAAUAGAGUAGGCAAAGGACA
hsa-miR-3122 GUUGGGACAAGAGGACGGUCUU GACCGUCCUCUUGUCCCAACUU
hsa-miR-3123 CAGAGAAUUGUUUAAUC UUAAACAAUUCUCUGUU
hsa-miR-3124 UUCGCGGGCGAAGGCAAAGUC ACUUUCCUCACUCCCGUGAAGU
hsa-miR-3125 UAGAGGAAGCUGUGGAGAGA UCUCCACAGCUUCCUCUAUU
hsa-miR-3126 CAUCUGGCAUCCGUCACACAGA UGAGGGACAGAUGCCAGAAGCA
hsa-miR-3127 UCCCCUUCUGCAGGCCUGCUGG AUCAGGGCUUGUGGAAUGGGAAG
hsa-miR-3128 UCUGGCAAGUAAAAAACUCUCAU GAGAGUUUUUUACUUGCCAGAUU
hsa-miR-3129 GCAGUAGUGUAGAGAUUGGUUU AAACUAAUCUCUACACUGCUGC
hsa-miR-3130 GCUGCACCGGAGACUGGGUAA UACCCAGUCUCCGGUGCAGCC
hsa-miR-3131 UCGAGGACUGGUGGAAGGGCCUU GGCCCUUCCACCAGUCCUCGAUU
hsa-miR-3132 UGGGUAGAGAAGGAGCUCAGAGGA CUCUGAGCUCCUUCUCUACCCAUU
hsa-miR-3133 UAAAGAACUCUUAAAACCCAAU UGGGUUUUAAGAGUUCUUUAUU
hsa-miR-3134 UGAUGGAUAAAAGACUACAUAUU UAUGUAGUCUUUUAUCCAUCAUU
hsa-miR-3135a UGCCUAGGCUGAGACUGCAGUG CUGCAGUCUCAGCCUAGGCAUU
hsa-miR-3135b GGCUGGAGCGAGUGCAGUGGUG CCACUGCACUCGCUCCAGCCUU
hsa-miR-3136 CUGACUGAAUAGGUAGGGUCAUU UGGCCCAACCUAUUCAGUUAGU
hsa-miR-3137 UCUGUAGCCUGGGAGCAAUGGGGU CCCAUUGCUCCCAGGCUACAGAUU
hsa-miR-3138 UGUGGACAGUGAGGUAGAGGGAGU UCCCUCUACCUCACUGUCCACAUU
hsa-miR-3139 UAGGAGCUCAACAGAUGCCUGUU CAGGCAUCUGUUGAGCUCCUAUU
hsa-miR-3140 ACCUGAAUUACCAAAAGCUUU AGCUUUUGGGAAUUCAGGUAGU
hsa-miR-3141 GAGGGCGGGUGGAGGAGGA CUCCUCCACCCGCCCUCUU
hsa-miR-3142 AAGGCCUUUCUGAACCUUCAGA UGAAGGUUCAGAAAGGCCUUUU
hsa-miR-3143 AUAACAUUGUAAAGCGCUUCUUUCG AAAGAAGCGCUUUACAAUGUUAUUU
hsa-miR-3144 AUAUACCUGUUCGGUCUCUUUA AGGGGACCAAAGAGAUAUAUAG
hsa-miR-3145 AGAUAUUUUGAGUGUUUGGAAUUG AACUCCAAACACUCAAAACUCA
hsa-miR-3146 CAUGCUAGGAUAGAAAGAAUGG AUUCUUUCUAUCCUAGCAUGUU
hsa-miR-3147 GGUUGGGCAGUGAGGAGGGUGUGA ACACCCUCCUCACUGCCCAACCUU
hsa-miR-3148 UGGAAAAAACUGGUGUGUGCUU GCACACACCAGUUUUUUCCAUU
hsa-miR-3149 UUUGUAUGGAUAUGUGUGUGUAU ACACACACAUAUCCAUACAAAUU
hsa-miR-3150a CAACCUCGACGAUCUCCUCAGC CUGGGGAGAUCCUCGAGGUUGG
hsa-miR-3150b CAACCUCGAGGAUCUCCCCAGC UGAGGAGAUCGUCGAGGUUGG
hsa-miR-3151 GGUGGGGCAAUGGGAUCAGGU CCUGAUCCCACAGCCCACCU
hsa-miR-3152 AUUGCCUCUGUUCUAACACAAG UGUGUUAGAAUAGGGGCAAUAA
hsa-miR-3153 GGGGAAAGCGAGUAGGGACAUUU AUGUCCCUACUCGCUUUCCCCUU
hsa-miR-3154 CAGAAGGGGAGUUGGGAGCAGA UGCUCCCAACUCCCCUUCUGUU
hsa-miR-3155a CCAGGCUCUGCAGUGGGAACU UUCCCACUGCAGAGCCUGGUU
hsa-miR-3155b CCAGGCUCUGCAGUGGGA CCACUGCAGAGCCUGGUU
hsa-miR-3156 CUCCCACUUCCAGAUCUUUCU AAAGAUCUGGAAGUGGGAGACA
hsa-miR-3157 CUGCCCUAGUCUAGCUGAAGCU UUCAGCCAGGCUAGUGCAGUCU
hsa-miR-3158 AAGGGCUUCCUCUCUGCAGGAC CCUGCAGAGAGGAAGCCCUUC
hsa-miR-3159 UAGGAUUACAAGUGUCGGCCAC GGCCGACACUUGUAAUCCUAUU
hsa-miR-3160 AGAGCUGAGACUAGAAAGCCCA GGCUUUCUAGUCUCAGCUCUCC
hsa-miR-3161 CUGAUAAGAACAGAGGCCCAGAU CUGGGCCUCUGUUCUUAUCAGUU
hsa-miR-3162 UUAGGGAGUAGAAGGGUGGGGAG UCCCUACCCCUCCACUCCCCA
hsa-miR-3163 UAUAAAAUGAGGGCAGUAAGAC CUUACUGCCCUCAUUUUAUAUU
hsa-miR-3164 UGUGACUUUAAGGGAAAUGGCG CCAUUUCCCUUAAAGUCACAUU
hsa-miR-3165 AGGUGGAUGCAAUGUGACCUCA AGGUCACAUUGCAUCCACCUUU
hsa-miR-3166 CGCAGACAAUGCCUACUGGCCUA GGCCAGUAGGCAUUGUCUGCGUU
hsa-miR-3167 AGGAUUUCAGAAAUACUGGUGU ACCAGUAUUUCUGAAAUCCUUU
hsa-miR-3168 GAGUUCUACAGUCAGAC CUGACUGUAGAACUCUU
hsa-miR-3169 UAGGACUGUGCUUGGCACAUAG AUGUGCCAAGCACAGUCCUAUU
hsa-miR-3170 CUGGGGUUCUGAGACAGACAGU UGUCUGUCUCAGAACCCCAGUU
hsa-miR-3171 AGAUGUAUGGAAUCUGUAUAUAUC UAUAUACAGAUUCCAUACAUCUUU
hsa-miR-3173 AAAGGAGGAAAUAGGCAGGCCA UGCCCUGCCUGUUUUCUCCUUU
hsa-miR-3174 UAGUGAGUUAGAGAUGCAGAGCC CUCUGCAUCUCUAACUCACUAUU
hsa-miR-3175 CGGGGAGAGAACGCAGUGACGU GUCACUGCGUUCUCUCCCCGUU
hsa-miR-3176 ACUGGCCUGGGACUACCGG GGUAGUCCCAGGCCAGUUU
hsa-miR-3177 UGUGUACACACGUGCCAGGCGCU UGCACGGCACUGGGGACACGU
hsa-miR-3178 GGGGCGCGGCCGGAUCG AUCCGGCCGCGCCCCUU
hsa-miR-3179 AGAAGGGGUGAAAUUUAAACGU GUUUAAAUUUCACCCCUUCUUU
hsa-miR-3180 CUUCCAGACGCUCCGCCCCACGUCG UGGGGCGGAGCUUCCGGAGGCC
hsa-miR-3181 AUCGGGCCCUCGGCGCCGG GGCGCCGAGGGCCCGAUUU
hsa-miR-3182 GCUUCUGUAGUGUAGUC CUACACUACAGAAGCUU
hsa-miR-3183 GCCUCUCUCGGAGUCGCUCGGA CGAGCGACUCCGAGAGAGGCUU
hsa-miR-3184 AAAGUCUCGCUCUCUGCCCCUCA UGAGGGGCCUCAGACCGAGCUUUU
hsa-miR-3185 AGAAGAAGGCGGUCGGUCUGCGG GCAGACCGACCGCCUUCUUCUUU
hsa-miR-3186 CAGGCGUCUGUCUACGUGGCUU UCACGCGGAGAGAUGGCUUUG
hsa-miR-3187 UUGGCCAUGGGGCUGCGCGG CCUGGGCAGCGUGUGGCUGAAGG
hsa-miR-3188 AGAGGCUUUGUGCGGAUACGGGG CCGUAUCCGCACAAAGCCUCUUU
hsa-miR-3189 CCCUUGGGUCUGAUGGGGUAG UGCCCCAUCUGUGCCCUGGGUAGGA
hsa-miR-3190 UGUGGAAGGUAGACGGCCAGAGA UCUGGCCAGCUACGUCCCCA
hsa-miR-3191 CUCUCUGGCCGUCUACCUUCCA UGGGGACGUAGCUGGCCAGACAG
hsa-miR-3192 UCUGGGAGGUUGUAGCAGUGGAA CUCUGAUCGCCCUCUCAGCUC
hsa-miR-3193 UCCUGCGUAGGAUCUGAGGAGU UCCUCAGAUCCUACGCAGGAUU
hsa-miR-3194 AGCUCUGCUGCUCACUGGCAGU GGCCAGCCACCAGGAGGGCUG
hsa-miR-3195 CGCGCCGGGCCCGGGUU CCCGGGCCCGGCGCGUU
hsa-miR-3196 CGGGGCGGCAGGGGCCUC GGCCCCUGCCGCCCCGUU
hsa-miR-3197 GGAGGCGCAGGCUCGGAAAGGCG CCUUUCCGAGCCUGCGCCUCCUU
hsa-miR-3198 GUGGAGUCCUGGGGAAUGGAGA UCCAUUCCCCAGGACUCCACUU
hsa-miR-3199 AGGGACUGCCUUAGGAGAAAGUU CUUUCUCCUAAGGCAGUCCCUUU
hsa-miR-32 CAAUUUAGUGUGUGUGAUAUUU UAUUGCACAUUACUAAGUUGCA
hsa-miR-3200 CACCUUGCGCUACUCAGGUCUG AAUCUGAGAAGGCGCACAAGGU
hsa-miR-3201 GGGAUAUGAAGAAAAAU UUUUCUUCAUAUCCCUU
hsa-miR-3202 UGGAAGGGAGAAGAGCUUUAAU UAAAGCUCUUCUCCCUUCCAUU
hsa-miR-320a AAAAGCUGGGUUGAGAGGGCGA GCCCUCUCAACCCAGCUUUUUU
hsa-miR-320b AAAAGCUGGGUUGAGAGGGCAA GCCCUCUCAACCCAGCUUUUUU
hsa-miR-320c AAAAGCUGGGUUGAGAGGGU CCUCUCAACCCAGCUUUUUU
hsa-miR-320d AAAAGCUGGGUUGAGAGGA CUCUCAACCCAGCUUUUUU
hsa-miR-320e AAAGCUGGGUUGAGAAGG UUCUCAACCCAGCUUUUU
hsa-miR-323a AGGUGGUCCGUGGCGCGUUCGC CACAUUACACGGUCGACCUCU
hsa-miR-323b AGGUUGUCCGUGGUGAGUUCGCA CCCAAUACACGGUCGACCUCUU
hsa-miR-324 CGCAUCCCCUAGGGCAUUGGUGU ACUGCCCCAGGUGCUGCUGG
hsa-miR-325 CCUAGUAGGUGUCCAGUAAGUGU ACUUACUGGACACCUACUAGGUU
hsa-miR-326 CCUCUGGGCCCUUCCUCCAG GGAGGAAGGGCCCAGAGGUU
hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU GGGGGGGCAGGAGGGGCUCAGGG
hsa-miR-329 AACACACCUGGUUAACCUCUUU GAGGUUUUCUGGGUUUCUGUUUC
hsa-miR-330 GCAAAGCACACGGCCUGCAGAGA UCUCUGGGCCUGUGUCUUAGGC
hsa-miR-331 CUAGGUAUGGUCCCAGGGAUCC GCCCCUGGGCCUAUCCUAGAA
hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU UUUUUCAUUAUUGCUCCUGACC
hsa-miR-337 GAACGGCUUCAUACAGGAGUU CUCCUAUAUGAUGCCUUUCUUC
hsa-miR-338 UCCAGCAUCAGUGAUUUUGUUG AACAAUAUCCUGGUGCUGAGUG
hsa-miR-339 UGAGCGCCUCGACGACAGAGCCG UCCCUGUCCUCCAGGAGCUCACG
hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA CAAUGUUUCCACAGUGCAUCAC
hsa-miR-33b GUGCAUUGCUGUUGCAUUGC CAGUGCCUCGGCAGUGCAGCCC
hsa-miR-340 UCCGUCUCAGUUACUUUAUAGC UUAUAAAGCAAUGAGACUGAUU
hsa-miR-342 UCUCACACAGAAAUCGCACCCGU AGGGGUGCUAUCUGUGAUUGA
hsa-miR-345 GCCCUGAACGAGGGGUCUGGAG GCUGACUCCUAGUCCAGGGCUC
hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU AGGCAGGCAUGCGGGCAGACAUU
hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU CAAUCAGCAAGUAUACUGCCCU
hsa-miR-34b UAGGCAGUGUCAUUAGCUGAUUG CAAUCACUAACUCCACUGCCAU
hsa-miR-34c AAUCACUAACCACACGGCCAGG AGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-3529 AACAACAAAAUCACUAGUCUUCCA AGGUAGACUGGGAUUUGUUGUU
hsa-miR-3591 AAACACCAUUGUCACACUCCAC UUUAGUGUGAUAAUGGCGUUUGA
hsa-miR-3605 CCUCCGUGUUACCUGUCCUCUAG UGAGGAUGGAUAGCAAGGAAGCC
hsa-miR-3606 UUAGUGAAGGCUAUUUUAAUU AAAAUUUCUUUCACUACUUAG
hsa-miR-3607 ACUGUAAACGCUUUCUGAUG GCAUGUGAUGAAGCAAAUCAGU
hsa-miR-3609 CAAAGUGAUGAGUAAUACUGGCUG GCCAGUAUUACUCAUCACUUUGUU
hsa-miR-361 UCCCCCAGGUGUGAUUCUGAUUU UUAUCAGAAUCUCCAGGGGUAC
hsa-miR-3610 GAAUCGGAAAGGAGGCGCCG GCGCCUCCUUUCCGAUUCUU
hsa-miR-3611 UUGUGAAGAAAGAAAUUCUUA AGAAUUUCUUUCUUCACAAUU
hsa-miR-3612 AGGAGGCAUCUUGAGAAAUGGA CAUUUCUCAAGAUGCCUCCUUU
hsa-miR-3613 UGUUGUACUUUUUUUUUUGUUC ACAAAAAAAAAAGCCCAACCCUUC
hsa-miR-3614 CCACUUGGAUCUGAAGGCUGCCC UAGCCUUCAGAUCUUGGUGUUUU
hsa-miR-3615 UCUCUCGGCUCCUCGCGGCUC GCCGCGAGGAGCCGAGAGAUU
hsa-miR-3616 AUGAAGUGCACUCAUGAUAUGU CGAGGGCAUUUCAUGAUGCAGGC
hsa-miR-3617 CAUCAGCACCCUAUGUCCUUUCU AAAGACAUAGUUGCAAGAUGGG
hsa-miR-3618 UGUCUACAUUAAUGAAAAGAGC UCUUUUCAUUAAUGUAGACAUU
hsa-miR-3619 UCAGCAGGCAGGCUGGUGCAGC GGGACCAUCCUGCCUGCUGUGG
hsa-miR-362 AACACACCUAUUCAAGGAUUCA AAUCCUUGGAACCUAGGUGUGAGU
hsa-miR-3620 UCACCCUGCAUCCCGCACCCAG GUGGGCUGGGCUGGGCUGGGCC
hsa-miR-3621 CGCGGGUCGGGGUCUGCAGG UGCAGACCCCGACCCGCGUU
hsa-miR-3622a UCACCUGACCUCCCAUGCCUGU CAGGCACGGGAGCUCAGGUGAG
hsa-miR-3622b UCACCUGAGCUCCCGUGCCUG AGGCAUGGGAGGUCAGGUGA
hsa-miR-363 AAUUGCACGGUAUCCAUCUGUA CGGGUGGAUCACGAUGCAAUUU
hsa-miR-3646 AAAAUGAAAUGAGCCCAGCCCA GGCUGGGCUCAUUUCAUUUUUU
hsa-miR-3648 AGCCGCGGGGAUCGCCGAGGG CUCGGCGAUCCCCGCGGCUUU
hsa-miR-3649 AGGGACCUGAGUGUCUAAG UAGACACUCAGGUCCCUUU
hsa-miR-3650 AGGUGUGUCUGUAGAGUCC ACUCUACAGACACACCUUU
hsa-miR-3651 CAUAGCCCGGUCGCUGGUACAUGA AUGUACCAGCGACCGGGCUAUGUU
hsa-miR-3652 CGGCUGGAGGUGUGAGGA CUCACACCUCCAGCCGUU
hsa-miR-3653 CCUCCUGAUGAUUCUUCUUC CUAAGAAGUUGACUGAAG
hsa-miR-3654 GACUGGACAAGCUGAGGAA CCUCAGCUUGUCCAGUCUU
hsa-miR-3655 GCUUGUCGCUGCGGUGUUGCU CAACACCGCAGCGACAAGCUU
hsa-miR-3656 GGCGGGUGCGGGGGUGG ACCCCCGCACCCGCCUU
hsa-miR-3657 UGUGUCCCAUUAUUGGUGAUU UCACCAAUAAUGGGACACAUU
hsa-miR-3658 UUUAAGAAAACACCAUGGAGAU CUCCAUGGUGUUUUCUUAAAUU
hsa-miR-3659 UGAGUGUUGUCUACGAGGGCA CCCUCGUAGACAACACUCAUU
hsa-miR-365a UAAUGCCCCUAAAAAUCCUUAU AGGGACUUUUGGGGGCAGAUGUG
hsa-miR-365b UAAUGCCCCUAAAAAUCCUUAU AGGGACUUUCAGGGGCAGCUGU
hsa-miR-3660 ACUGACAGGAGAGCAUUUUGA AAAAUGCUCUCCUGUCAGUUU
hsa-miR-3661 UGACCUGGGACUCGGACAGCUG GCUGUCCGAGUCCCAGGUCAUU
hsa-miR-3662 GAAAAUGAUGAGUAGUGACUGAUG UCAGUCACUACUCAUCAUUUUCUU
hsa-miR-3663 UGAGCACCACACAGGCCGGGCGC GCUGGUCUGCGUGGUGCUCGG
hsa-miR-3664 UCUCAGGAGUAAAGACAGAGUU AACUCUGUCUUCACUCAUGAGU
hsa-miR-3665 AGCAGGUGCGGGGCGGCG CCGCCCCGCACCUGCUUU
hsa-miR-3666 CAGUGCAAGUGUAGAUGCCGA GGCAUCUACACUUGCACUGUU
hsa-miR-3667 ACCUUCCUCUCCAUGGGUCUUU AAAGACCCAUUGAGGAGAAGGU
hsa-miR-3668 AAUGUAGAGAUUGAUCAAAAU UUUGAUCAAUCUCUACAUUUU
hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA ACUGUUGCUAAUAUGCAACUCU
hsa-miR-3670 AGAGCUCACAGCUGUCCUUCUCUA GAGAAGGACAGCUGUGAGCUCUUU
hsa-miR-3671 AUCAAAUAAGGACUAGUCUGCA CAGACUAGUCCUUAUUUGAUUU
hsa-miR-3672 AUGAGACUCAUGUAAAACAUCUU GAUGUUUUACAUGAGUCUCAUUU
hsa-miR-3674 AUUGUAGAACCUAAGAUUGGCC CCAAUCUUAGGUUCUACAAUUU
hsa-miR-3675 CAUCUCUAAGGAACUCCCCCAA UAUGGGGCUUCUGUAGAGAUUUC
hsa-miR-3677 CAGUGGCCAGAGCCCUGCAGUG CUCGUGGGCUCUGGCCACGGCC
hsa-miR-3678 CUGCAGAGUUUGUACGGACCGG UCCGUACAAACUCUGCUGUG
hsa-miR-3679 CUUCCCCCCAGUAAUCUUCAUC UGAGGAUAUGGCAGGGAAGGGGA
hsa-miR-3680 GACUCACUCACAGGAUUGUGCA UUUUGCAUGACCCUGGGAGUAGG
hsa-miR-3681 UAGUGGAUGAUGCACUCUGUGC ACACAGUGCUUCAUCCACUACU
hsa-miR-3682 CUACUUCUACCUGUGUUAUCAU UGAUGAUACAGGUGGAGGUAG
hsa-miR-3683 UGCGACAUUGGAAGUAGUAUCA AUACUACUUCCAAUGUCGCAUU
hsa-miR-3684 UUAGACCUAGUACACGUCCUU GGACGUGUACUAGGUCUAAUU
hsa-miR-3685 UUUCCUACCCUACCUGAAGACU UCUUCAGGUAGGGUAGGAAAUU
hsa-miR-3686 AUCUGUAAGAGAAAGUAAAUGA AUUUACUUUCUCUUACAGAUUU
hsa-miR-3687 CCCGGACAGGCGUUCGUGCGACGU GUCGCACGAACGCCUGUCCGGGUU
hsa-miR-3688 UAUGGAAAGACUUUGCCACUCU AGUGGCAAAGUCUUUCCAUAU
hsa-miR-3689a CUGGGAGGUGUGAUAUCGUGGU UGUGAUAUCAUGGUUCCUGGGA
hsa-miR-3689b CUGGGAGGUGUGAUAUUGUGGU UGUGAUAUCAUGGUUCCUGGGA
hsa-miR-3689c CUGGGAGGUGUGAUAUUGUGGU CACAAUAUCACACCUCCCAGUU
hsa-miR-3689d GGGAGGUGUGAUCUCACACUCG AGUGUGAGAUCACACCUCCCUU
hsa-miR-3689e UGUGAUAUCAUGGUUCCUGGGA CCAGGAACCAUGAUAUCACAUU
hsa-miR-3689f UGUGAUAUCGUGCUUCCUGGGA CCAGGAAGCACGAUAUCACAUU
hsa-miR-369 AAUAAUACAUGGUUGAUCUUU AGAUCGACCGUGUUAUAUUCGC
hsa-miR-3690 ACCUGGACCCAGCGUAGACAAAG UUGUCUACGCUGGGUCCAGGUUU
hsa-miR-3691 AGUGGAUGAUGGAGACUCGGUAC ACCAAGUCUGCGUCAUCCUCUC
hsa-miR-3692 GUUCCACACUGACACUGCAGAAGU CCUGCUGGUCAGGAGUGGAUACUG
hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU CAGGUCACGUCUCUGCAGUUAC
hsa-miR-3713 GGUAUCCGUUUGGGGAUGGU CAUCCCCAAACGGAUACCUU
hsa-miR-3714 GAAGGCAGCAGUGCUCCCCUGU AGGGGAGCACUGCUGCCUUCUU
hsa-miR-371a ACUCAAACUGUGGGGGCACU AAGUGCCGCCAUCUUUUGAGUGU
hsa-miR-371b ACUCAAAAGAUGGCGGCACUUU AAGUGCCCCCACAGUUUGAGUGC
hsa-miR-372 CCUCAAAUGUGGAGCACUAUUCU AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU ACUCAAAAUGGGGGCGCUUUCC
hsa-miR-374a UUAUAAUACAACCUGAUAAGUG CUUAUCAGAUUGUAUUGUAAUU
hsa-miR-374b CUUAGCAGGUUGUAUUAUCAUU AUAUAAUACAACCUGCUAAGUG
hsa-miR-374c CACUUAGCAGGUUGUAUUAUAU AUAAUACAACCUGCUAAGUGCU
hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA ACGCGAGCCGAACGAACAAAUU
hsa-miR-376a-1 AUCAUAGAGGAAAAUCCACGU GUAGAUUCUCCUUCUAUGAGUA
hsa-miR-376a-2 AUCAUAGAGGAAAAUCCACGU GGUAGAUUUUCCUUCUAUGGU
hsa-miR-376b CGUGGAUAUUCCUUCUAUGUUU AUCAUAGAGGAAAAUCCAUGUU
hsa-miR-376c GGUGGAUAUUCCUUCUAUGUU AACAUAGAGGAAAUUCCACGU
hsa-miR-377 AGAGGUUGCCCUUGGUGAAUUC AUCACACAAAGGCAACUUUUGU
hsa-miR-378a CUCCUGACUCCAGGUCCUGUGU ACUGGACUUGGAGUCAGAAGGC
hsa-miR-378b ACUGGACUUGGAGGCAGAA CUGCCUCCAAGUCCAGUUU
hsa-miR-378c ACUGGACUUGGAGUCAGAAGAGUGG ACUCUUCUGACUCCAAGUCCAGUUU
hsa-miR-378d ACUGGACUUGGAGUCAGAAA UCUGACUCCAAGUCCAGUUU
hsa-miR-378e ACUGGACUUGGAGUCAGGA CUGACUCCAAGUCCAGUUU
hsa-miR-378f ACUGGACUUGGAGCCAGAAG UCUGGCUCCAAGUCCAGUUU
hsa-miR-378g ACUGGGCUUGGAGUCAGAAG UCUGACUCCAAGCCCAGUUU
hsa-miR-378h ACUGGACUUGGUGUCAGAUGG AUCUGACACCAAGUCCAGUUU
hsa-miR-378i ACUGGACUAGGAGUCAGAAGG UUCUGACUCCUAGUCCAGUUU
hsa-miR-378j ACUGGAUUUGGAGCCAGAA CUGGCUCCAAAUCCAGUUU
hsa-miR-379 UGGUAGACUAUGGAACGUAGG UAUGUAACAUGGUCCACUAACU
hsa-miR-380 UGGUUGACCAUAGAACAUGCGC UAUGUAAUAUGGUCCACAUCUU
hsa-miR-381 AGCGAGGUUGCCCUUUGUAUAU UAUACAAGGGCAAGCUCUCUGU
hsa-miR-382 AAUCAUUCACGGACAACACUU GAAGUUGUUCGUGGUGGAUUCG
hsa-miR-383 ACAGCACUGCCUGGUCAGA AGAUCAGAAGGUGAUUGUGGCU
hsa-miR-384 AUUCCUAGAAAUUGUUCAUA UGAACAAUUUCUAGGAAUUU
hsa-miR-3907 AGGUGCUCCAGGCUGGCUCACA UGAGCCAGCCUGGAGCACCUUU
hsa-miR-3908 GAGCAAUGUAGGUAGACUGUUU ACAGUCUACCUACAUUGCUCUU
hsa-miR-3909 UGUCCUCUAGGGCCUGCAGUCU ACUGCAGGCCCUAGAGGACAUU
hsa-miR-3910 AAAGGCAUAAAACCAAGACA UCUUGGUUUUAUGCCUUUUU
hsa-miR-3911 UGUGUGGAUCCUGGAGGAGGCA CCUCCUCCAGGAUCCACACAUU
hsa-miR-3912 UAACGCAUAAUAUGGACAUGU AUGUCCAUAUUAUGGGUUAGU
hsa-miR-3913 UUUGGGACUGAUCUUGAUGUCU AGACAUCAAGAUCAGUCCCAAA
hsa-miR-3914 AAGGAACCAGAAAAUGAGAAGU UUCUCAUUUUCUGGUUCCUUUU
hsa-miR-3915 UUGAGGAAAAGAUGGUCUUAUU UAAGACCAUCUUUUCCUCAAUU
hsa-miR-3916 AAGAGGAAGAAAUGGCUGGUUCUCAG GAGAACCAGCCAUUUCUUCCUCUUUU
hsa-miR-3917 GCUCGGACUGAGCAGGUGGG CACCUGCUCAGUCCGAGCUU
hsa-miR-3918 ACAGGGCCGCAGAUGGAGACU UCUCCAUCUGCGGCCCUGUUU
hsa-miR-3919 GCAGAGAACAAAGGACUCAGU UGAGUCCUUUGUUCUCUGCUU
hsa-miR-3920 ACUGAUUAUCUUAACUCUCUGA AGAGAGUUAAGAUAAUCAGUUU
hsa-miR-3921 UCUCUGAGUACCAUAUGCCUUGU AAGGCAUAUGGUACUCAGAGAUU
hsa-miR-3922 UCUGGCCUUGACUUGACUCUUU UCAAGGCCAGAGGUCCCACAGCA
hsa-miR-3923 AACUAGUAAUGUUGGAUUAGGG CUAAUCCAACAUUACUAGUUUU
hsa-miR-3924 AUAUGUAUAUGUGACUGCUACU UAGCAGUCACAUAUACAUAUUU
hsa-miR-3925 AAGAGAACUGAAAGUGGAGCCU ACUCCAGUUUUAGUUCUCUUG
hsa-miR-3926 UGGCCAAAAAGCAGGCAGAGA UCUGCCUGCUUUUUGGCCAUU
hsa-miR-3927 CAGGUAGAUAUUUGAUAGGCAU GCCUAUCACAUAUCUGCCUGU
hsa-miR-3928 UGAAGCUCUAAGGUUCCGCCUGC GGAGGAACCUUGGAGCUUCGGC
hsa-miR-3929 GAGGCUGAUGUGAGUAGACCACU UGGUCUACUCACAUCAGCCUCUU
hsa-miR-3934 UCAGGUGUGGAAACUGAGGCAG UGCUCAGGUUGCACAGCUGGGA
hsa-miR-3935 UGUAGAUACGAGCACCAGCCAC GGCUGGUGCUCGUAUCUACAUU
hsa-miR-3936 UAAGGGGUGUAUGGCAGAUGCA CAUCUGCCAUACACCCCUUAUU
hsa-miR-3937 ACAGGCGGCUGUAGCAAUGGGGG CCCAUUGCUACAGCCGCCUGUUU
hsa-miR-3938 AAUUCCCUUGUAGAUAACCCGG GGGUUAUCUACAAGGGAAUUUU
hsa-miR-3939 UACGCGCAGACCACAGGAUGUC CAUCCUGUGGUCUGCGCGUAUU
hsa-miR-3940 GUGGGUUGGGGCGGGCUCUG CAGCCCGGAUCCCAGCCCACUU
hsa-miR-3941 UUACACACAACUGAGGAUCAUA UGAUCCUCAGUUGUGUGUAAUU
hsa-miR-3942 AAGCAAUACUGUUACCUGAAAU UUUCAGAUAACAGUAUUACAU
hsa-miR-3943 UAGCCCCCAGGCUUCACUUGGCG CCAAGUGAAGCCUGGGGGCUAUU
hsa-miR-3944 UUCGGGCUGGCCUGCUGCUCCGG UGUGCAGCAGGCCAACCGAGA
hsa-miR-3945 AGGGCAUAGGAGAGGGUUGAUAU AUCAACCCUCUCCUAUGCCCUUU
hsa-miR-3960 GGCGGCGGCGGAGGCGGGGG CCCGCCUCCGCCGCCGCCUU
hsa-miR-3972 CUGCCAGCCCCGUUCCAGGGCA CCCUGGAACGGGGCUGGCAGUU
hsa-miR-3973 ACAAAGUACAGCAUUAGCCUUAG AAGGCUAAUGCUGUACUUUGUUU
hsa-miR-3974 AAAGGUCAUUGUAAGGUUAAUGC AUUAACCUUACAAUGACCUUUUU
hsa-miR-3975 UGAGGCUAAUGCACUACUUCAC GAAGUAGUGCAUUAGCCUCAUU
hsa-miR-3976 UAUAGAGAGCAGGAAGAUUAAUGU AUUAAUCUUCCUGCUCUCUAUAUU
hsa-miR-3977 GUGCUUCAUCGUAAUUAACCUUA AGGUUAAUUACGAUGAAGCACUU
hsa-miR-3978 GUGGAAAGCAUGCAUCCAGGGUGU ACCCUGGAUGCAUGCUUUCCACUU
hsa-miR-409 GAAUGUUGCUCGGUGAACCCCU AGGUUACCCGAGCAACUUUGCAU
hsa-miR-410 AGGUUGUCUGUGAUGAGUUCG AAUAUAACACAGAUGGCCUGU
hsa-miR-411 UAUGUAACACGGUCCACUAACC UAGUAGACCGUAUAGCGUACG
hsa-miR-412 UGGUCGACCAGUUGGAAAGUAAU ACUUCACCUGGUCCACUAGCCGU
hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC GCCCAAUUAAUGUCUGUUGAUUU
hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC CUUCUGACCCUAAGUCCAGUUU
hsa-miR-423 UGAGGGGCAGAGAGCGAGACUUU AGCUCGGUCUGAGGCCCCUCAGU
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA CAAAACGUGAGGCGCUGCUAU
hsa-miR-425 AUCGGGAAUGUCGUGUCCGCCC AAUGACACGAUCACUCCCGUUGA
hsa-miR-4251 CCUGAGAAAAGGGCCAA GGCCCUUUUCUCAGGUU
hsa-miR-4252 GGCCACUGAGUCAGCACCA GUGCUGACUCAGUGGCCUU
hsa-miR-4253 AGGGCAUGUCCAGGGGGU CCCCUGGACAUGCCCUUU
hsa-miR-4254 GCCUGGAGCUACUCCACCAUCUC GAUGGUGGAGUAGCUCCAGGCUU
hsa-miR-4255 CAGUGUUCAGAGAUGGA CAUCUCUGAACACUGUU
hsa-miR-4256 AUCUGACCUGAUGAAGGU CUUCAUCAGGUCAGAUUU
hsa-miR-4257 CCAGAGGUGGGGACUGAG CAGUCCCCACCUCUGGUU
hsa-miR-4258 CCCCGCCACCGCCUUGG AAGGCGGUGGCGGGGUU
hsa-miR-4259 CAGUUGGGUCUAGGGGUCAGGA CUGACCCCUAGACCCAACUGUU
hsa-miR-4260 CUUGGGGCAUGGAGUCCCA GGACUCCAUGCCCCAAGUU
hsa-miR-4261 AGGAAACAGGGACCCA GGUCCCUGUUUCCUUU
hsa-miR-4262 GACAUUCAGACUACCUG GGUAGUCUGAAUGUCUU
hsa-miR-4263 AUUCUAAGUGCCUUGGCC CCAAGGCACUUAGAAUUU
hsa-miR-4264 ACUCAGUCAUGGUCAUU UGACCAUGACUGAGUUU
hsa-miR-4265 CUGUGGGCUCAGCUCUGGG CAGAGCUGAGCCCACAGUU
hsa-miR-4266 CUAGGAGGCCUUGGCC CCAAGGCCUCCUAGUU
hsa-miR-4267 UCCAGCUCGGUGGCAC GCCACCGAGCUGGAUU
hsa-miR-4268 GGCUCCUCCUCUCAGGAUGUG CAUCCUGAGAGGAGGAGCCUU
hsa-miR-4269 GCAGGCACAGACAGCCCUGGC CAGGGCUGUCUGUGCCUGCUU
hsa-miR-4270 UCAGGGAGUCAGGGGAGGGC CCUCCCCUGACUCCCUGAUU
hsa-miR-4271 GGGGGAAGAAAAGGUGGGG CCACCUUUUCUUCCCCCUU
hsa-miR-4272 CAUUCAACUAGUGAUUGU AAUCACUAGUUGAAUGUU
hsa-miR-4273 GUGUUCUCUGAUGGACAG GUCCAUCAGAGAACACUU
hsa-miR-4274 CAGCAGUCCCUCCCCCUG GGGGGAGGGACUGCUGUU
hsa-miR-4275 CCAAUUACCACUUCUUU AGAAGUGGUAAUUGGUU
hsa-miR-4276 CUCAGUGACUCAUGUGC ACAUGAGUCACUGAGUU
hsa-miR-4277 GCAGUUCUGAGCACAGUACAC GUACUGUGCUCAGAACUGCUU
hsa-miR-4278 CUAGGGGGUUUGCCCUUG AGGGCAAACCCCCUAGUU
hsa-miR-4279 CUCUCCUCCCGGCUUC AGCCGGGAGGAGAGUU
hsa-miR-4280 GAGUGUAGUUCUGAGCAGAGC UCUGCUCAGAACUACACUCUU
hsa-miR-4281 GGGUCCCGGGGAGGGGGG CCCCUCCCCGGGACCCUU
hsa-miR-4282 UAAAAUUUGCAUCCAGGA CUGGAUGCAAAUUUUAUU
hsa-miR-4283 UGGGGCUCAGCGAGUUU ACUCGCUGAGCCCCAUU
hsa-miR-4284 GGGCUCACAUCACCCCAU GGGGUGAUGUGAGCCCUU
hsa-miR-4285 GCGGCGAGUCCGACUCAU GAGUCGGACUCGCCGCUU
hsa-miR-4286 ACCCCACUCCUGGUACC UACCAGGAGUGGGGUUU
hsa-miR-4287 UCUCCCUUGAGGGCACUUU AGUGCCCUCAAGGGAGAUU
hsa-miR-4288 UUGUCUGCUGAGUUUCC AAACUCAGCAGACAAUU
hsa-miR-4289 GCAUUGUGCAGGGCUAUCA AUAGCCCUGCACAAUGCUU
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU GGUUUUACCAGACAGUAUUAUU
hsa-miR-4290 UGCCCUCCUUUCUUCCCUC GGGAAGAAAGGAGGGCAUU
hsa-miR-4291 UUCAGCAGGAACAGCU CUGUUCCUGCUGAAUU
hsa-miR-4292 CCCCUGGGCCGGCCUUGG AAGGCCGGCCCAGGGGUU
hsa-miR-4293 CAGCCUGACAGGAACAG GUUCCUGUCAGGCUGUU
hsa-miR-4294 GGGAGUCUACAGCAGGG CUGCUGUAGACUCCCUU
hsa-miR-4295 CAGUGCAAUGUUUUCCUU GGAAAACAUUGCACUGUU
hsa-miR-4296 AUGUGGGCUCAGGCUCA AGCCUGAGCCCACAUUU
hsa-miR-4297 UGCCUUCCUGUCUGUG CAGACAGGAAGGCAUU
hsa-miR-4298 CUGGGACAGGAGGAGGAGGCAG GCCUCCUCCUCCUGUCCCAGUU
hsa-miR-4299 GCUGGUGACAUGAGAGGC CUCUCAUGUCACCAGCUU
hsa-miR-4300 UGGGAGCUGGACUACUUC AGUAGUCCAGCUCCCAUU
hsa-miR-4301 UCCCACUACUUCACUUGUGA ACAAGUGAAGUAGUGGGAUU
hsa-miR-4302 CCAGUGUGGCUCAGCGAG CGCUGAGCCACACUGGUU
hsa-miR-4303 UUCUGAGCUGAGGACAG GUCCUCAGCUCAGAAUU
hsa-miR-4304 CCGGCAUGUCCAGGGCA CCCUGGACAUGCCGGUU
hsa-miR-4305 CCUAGACACCUCCAGUUC ACUGGAGGUGUCUAGGUU
hsa-miR-4306 UGGAGAGAAAGGCAGUA CUGCCUUUCUCUCCAUU
hsa-miR-4307 AAUGUUUUUUCCUGUUUCC AAACAGGAAAAAACAUUUU
hsa-miR-4308 UCCCUGGAGUUUCUUCUU GAAGAAACUCCAGGGAUU
hsa-miR-4309 CUGGAGUCUAGGAUUCCA GAAUCCUAGACUCCAGUU
hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA CAGGUCGUCUUGCAGGGCUUCU
hsa-miR-4310 GCAGCAUUCAUGUCCC GACAUGAAUGCUGCUU
hsa-miR-4311 GAAAGAGAGCUGAGUGUG CACUCAGCUCUCUUUCUU
hsa-miR-4312 GGCCUUGUUCCUGUCCCCA GGGACAGGAACAAGGCCUU
hsa-miR-4313 AGCCCCCUGGCCCCAAACCC GUUUGGGGCCAGGGGGCUUU
hsa-miR-4314 CUCUGGGAAAUGGGACAG GUCCCAUUUCCCAGAGUU
hsa-miR-4315 CCGCUUUCUGAGCUGGAC CCAGCUCAGAAAGCGGUU
hsa-miR-4316 GGUGAGGCUAGCUGGUG CCAGCUAGCCUCACCUU
hsa-miR-4317 ACAUUGCCAGGGAGUUU ACUCCCUGGCAAUGUUU
hsa-miR-4318 CACUGUGGGUACAUGCU CAUGUACCCACAGUGUU
hsa-miR-4319 UCCCUGAGCAAAGCCAC GGCUUUGCUCAGGGAUU
hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG CUGGAUGGCUCCUCCAUGUCU
hsa-miR-4320 GGGAUUCUGUAGCUUCCU GAAGCUACAGAAUCCCUU
hsa-miR-4321 UUAGCGGUGGACCGCCCUGCG CAGGGCGGUCCACCGCUAAUU
hsa-miR-4322 CUGUGGGCUCAGCGCGUGGGG CCACGCGCUGAGCCCACAGUU
hsa-miR-4323 CAGCCCCACAGCCUCAGA UGAGGCUGUGGGGCUGUU
hsa-miR-4324 CCCUGAGACCCUAACCUUAA AAGGUUAGGGUCUCAGGGUU
hsa-miR-4325 UUGCACUUGUCUCAGUGA ACUGAGACAAGUGCAAUU
hsa-miR-4326 UGUUCCUCUGUCUCCCAGAC CUGGGAGACAGAGGAACAUU
hsa-miR-4327 GGCUUGCAUGGGGGACUGG AGUCCCCCAUGCAAGCCUU
hsa-miR-4328 CCAGUUUUCCCAGGAUU UCCUGGGAAAACUGGUU
hsa-miR-4329 CCUGAGACCCUAGUUCCAC GGAACUAGGGUCUCAGGUU
hsa-miR-433 UACGGUGAGCCUGUCAUUAUUC AUCAUGAUGGGCUCCUCGGUGU
hsa-miR-4330 CCUCAGAUCAGAGCCUUGC AAGGCUCUGAUCUGAGGUU
hsa-miR-4417 GGUGGGCUUCCCGGAGGG CUCCGGGAAGCCCACCUU
hsa-miR-4418 CACUGCAGGACUCAGCAG GCUGAGUCCUGCAGUGUU
hsa-miR-4419a UGAGGGAGGAGACUGCA CAGUCUCCUCCCUCAUU
hsa-miR-4419b GAGGCUGAAGGAAGAUGG AUCUUCCUUCAGCCUCUU
hsa-miR-4420 GUCACUGAUGUCUGUAGCUGAG CAGCUACAGACAUCAGUGACUU
hsa-miR-4421 ACCUGUCUGUGGAAAGGAGCUA GCUCCUUUCCACAGACAGGUUU
hsa-miR-4422 AAAAGCAUCAGGAAGUACCCA GGUACUUCCUGAUGCUUUUUU
hsa-miR-4423 AGUUGCCUUUUUGUUCCCAUGC AUAGGCACCAAAAAGCAACAA
hsa-miR-4424 AGAGUUAACUCAAAAUGGACUA GUCCAUUUUGAGUUAACUCUUU
hsa-miR-4425 UGUUGGGAUUCAGCAGGACCAU GGUCCUGCUGAAUCCCAACAUU
hsa-miR-4426 GAAGAUGGACGUACUUU AGUACGUCCAUCUUCUU
hsa-miR-4427 UCUGAAUAGAGUCUGAAGAGU UCUUCAGACUCUAUUCAGAUU
hsa-miR-4428 CAAGGAGACGGGAACAUGGAGC UCCAUGUUCCCGUCUCCUUGUU
hsa-miR-4429 AAAAGCUGGGCUGAGAGGCG CCUCUCAGCCCAGCUUUUUU
hsa-miR-4430 AGGCUGGAGUGAGCGGAG CCGCUCACUCCAGCCUUU
hsa-miR-4431 GCGACUCUGAAAACUAGAAGGU CUUCUAGUUUUCAGAGUCGCUU
hsa-miR-4432 AAAGACUCUGCAAGAUGCCU GCAUCUUGCAGAGUCUUUUU
hsa-miR-4433a ACAGGAGUGGGGGUGGGACAU CGUCCCACCCCCCACUCCUGU
hsa-miR-4433b CAGGAGUGGGGGGUGGGACGU AUGUCCCACCCCCACUCCUGU
hsa-miR-4434 AGGAGAAGUAAAGUAGAA CUACUUUACUUCUCCUUU
hsa-miR-4435 AUGGCCAGAGCUCACACAGAGG UCUGUGUGAGCUCUGGCCAUUU
hsa-miR-4436a GCAGGACAGGCAGAAGUGGAU CCACUUCUGCCUGUCCUGCUU
hsa-miR-4436b GUCCACUUCUGCCUGCCCUGCC CAGGGCAGGAAGAAGUGGACAA
hsa-miR-4437 UGGGCUCAGGGUACAAAGGUU CCUUUGUACCCUGAGCCCAUU
hsa-miR-4438 CACAGGCUUAGAAAAGACAGU UGUCUUUUCUAAGCCUGUGUU
hsa-miR-4439 GUGACUGAUACCUUGGAGGCAU GCCUCCAAGGUAUCAGUCACUU
hsa-miR-4440 UGUCGUGGGGCUUGCUGGCUUG AGCCAGCAAGCCCCACGACAUU
hsa-miR-4441 ACAGGGAGGAGAUUGUA CAAUCUCCUCCCUGUUU
hsa-miR-4442 GCCGGACAAGAGGGAGG UCCCUCUUGUCCGGCUU
hsa-miR-4443 UUGGAGGCGUGGGUUUU AACCCACGCCUCCAAUU
hsa-miR-4444 CUCGAGUUGGAAGAGGCG CCUCUUCCAACUCGAGUU
hsa-miR-4445 AGAUUGUUUCUUUUGCCGUGCA CACGGCAAAAGAAACAAUCCA
hsa-miR-4446 AUUUCCCUGCCAUUCCCUUGGC CAGGGCUGGCAGUGACAUGGGU
hsa-miR-4447 GGUGGGGGCUGUUGUUU ACAACAGCCCCCACCUU
hsa-miR-4448 GGCUCCUUGGUCUAGGGGUA CCCCUAGACCAAGGAGCCUU
hsa-miR-4449 CGUCCCGGGGCUGCGCGAGGCA CCUCGCGCAGCCCCGGGACGUU
hsa-miR-4450 UGGGGAUUUGGAGAAGUGGUGA ACCACUUCUCCAAAUCCCCAUU
hsa-miR-4451 UGGUAGAGCUGAGGACA UCCUCAGCUCUACCAUU
hsa-miR-4452 UUGAAUUCUUGGCCUUAAGUGAU CACUUAAGGCCAAGAAUUCAAUU
hsa-miR-4453 GAGCUUGGUCUGUAGCGGUU CCGCUACAGACCAAGCUCUU
hsa-miR-4454 GGAUCCGAGUCACGGCACCA GUGCCGUGACUCGGAUCCUU
hsa-miR-4455 AGGGUGUGUGUGUUUUU AAACACACACACCCUUU
hsa-miR-4456 CCUGGUGGCUUCCUUUU AAGGAAGCCACCAGGUU
hsa-miR-4457 UCACAAGGUAUUGACUGGCGUA CGCCAGUCAAUACCUUGUGAUU
hsa-miR-4458 AGAGGUAGGUGUGGAAGAA CUUCCACACCUACCUCUUU
hsa-miR-4459 CCAGGAGGCGGAGGAGGUGGAG CCACCUCCUCCGCCUCCUGGUU
hsa-miR-4460 AUAGUGGUUGUGAAUUUACCUU GGUAAAUUCACAACCACUAUUU
hsa-miR-4461 GAUUGAGACUAGUAGGGCUAGGC CUAGCCCUACUAGUCUCAAUCUU
hsa-miR-4462 UGACACGGAGGGUGGCUUGGGAA CCCAAGCCACCCUCCGUGUCAUU
hsa-miR-4463 GAGACUGGGGUGGGGCC CCCCACCCCAGUCUCUU
hsa-miR-4464 AAGGUUUGGAUAGAUGCAAUA UUGCAUCUAUCCAAACCUUUU
hsa-miR-4465 CUCAAGUAGUCUGACCAGGGGA CCCUGGUCAGACUACUUGAGUU
hsa-miR-4466 GGGUGCGGGCCGGCGGGG CCGCCGGCCCGCACCCUU
hsa-miR-4467 UGGCGGCGGUAGUUAUGGGCUU GCCCAUAACUACCGCCGCCAUU
hsa-miR-4468 AGAGCAGAAGGAUGAGAU CUCAUCCUUCUGCUCUUU
hsa-miR-4469 GCUCCCUCUAGGGUCGCUCGGA CGAGCGACCCUAGAGGGAGCUU
hsa-miR-4470 UGGCAAACGUGGAAGCCGAGA UCGGCUUCCACGUUUGCCAUU
hsa-miR-4471 UGGGAACUUAGUAGAGGUUUAA AAACCUCUACUAAGUUCCCAUU
hsa-miR-4472 GGUGGGGGGUGUUGUUUU AACAACACCCCCCACCUU
hsa-miR-4473 CUAGUGCUCUCCGUUACAAGUA CUUGUAACGGAGAGCACUAGUU
hsa-miR-4474 UUGUGGCUGGUCAUGAGGCUAA UUAGUCUCAUGAUCAGACACA
hsa-miR-4475 CAAGGGACCAAGCAUUCAUUAU AAUGAAUGCUUGGUCCCUUGUU
hsa-miR-4476 CAGGAAGGAUUUAGGGACAGGC CUGUCCCUAAAUCCUUCCUGUU
hsa-miR-4477a CUAUUAAGGACAUUUGUGAUUC AUCACAAAUGUCCUUAAUAGUU
hsa-miR-4477b AUUAAGGACAUUUGUGAUUGAU CAAUCACAAAUGUCCUUAAUUU
hsa-miR-4478 GAGGCUGAGCUGAGGAG CCUCAGCUCAGCCUCUU
hsa-miR-4479 CGCGCGGCCGUGCUCGGAGCAG GCUCCGAGCACGGCCGCGCGUU
hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU GGGACAUCCUACAUAUGCAAUU
hsa-miR-4480 AGCCAAGUGGAAGUUACUUUA AAGUAACUUCCACUUGGCUUU
hsa-miR-4481 GGAGUGGGCUGGUGGUU CCACCAGCCCACUCCUU
hsa-miR-4482 UUUCUAUUUCUCAGUGGGGCUC AACCCAGUGGGCUAUGGAAAUG
hsa-miR-4483 GGGGUGGUCUGUUGUUG ACAACAGACCACCCCUU
hsa-miR-4484 AAAAGGCGGGAGAAGCCCCA GGGCUUCUCCCGCCUUUUUU
hsa-miR-4485 UAACGGCCGCGGUACCCUAA ACCGCCUGCCCAGUGA
hsa-miR-4486 GCUGGGCGAGGCUGGCA CCAGCCUCGCCCAGCUU
hsa-miR-4487 AGAGCUGGCUGAAGGGCAG GCCCUUCAGCCAGCUCUUU
hsa-miR-4488 AGGGGGCGGGCUCCGGCG CCGGAGCCCGCCCCCUUU
hsa-miR-4489 UGGGGCUAGUGAUGCAGGACG UCCUGCAUCACUAGCCCCAUU
hsa-miR-4490 UCUGGUAAGAGAUUUGGGCAUA UGCCCAAAUCUCUUACCAGAUU
hsa-miR-4491 AAUGUGGACUGGUGUGACCAAA UGGUCACACCAGUCCACAUUUU
hsa-miR-4492 GGGGCUGGGCGCGCGCC CGCGCGCCCAGCCCCUU
hsa-miR-4493 AGAAGGCCUUUCCAUCUCUGU AGAGAUGGAAAGGCCUUCUUU
hsa-miR-4494 CCAGACUGUGGCUGACCAGAGG UCUGGUCAGCCACAGUCUGGUU
hsa-miR-4495 AAUGUAAACAGGCUUUUUGCU CAAAAAGCCUGUUUACAUUUU
hsa-miR-4496 GAGGAAACUGAAGCUGAGAGGG CUCUCAGCUUCAGUUUCCUCUU
hsa-miR-4497 CUCCGGGACGGCUGGGC CCAGCCGUCCCGGAGUU
hsa-miR-4498 UGGGCUGGCAGGGCAAGUGCUG GCACUUGCCCUGCCAGCCCAUU
hsa-miR-4499 AAGACUGAGAGGAGGGA CCUCCUCUCAGUCUUUU
hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU CAGCUAACAAUACACUGCCAUU
hsa-miR-449b CAGCCACAACUACCCUGCCACU AGGCAGUGUAUUGUUAGCUGGC
hsa-miR-449c UAGGCAGUGUAUUGCUAGCGGCUGU UUGCUAGUUGCACUCCUCUCUGU
hsa-miR-4500 UGAGGUAGUAGUUUCUU GAAACUACUACCUCAUU
hsa-miR-4501 UAUGUGACCUCGGAUGAAUCA AUUCAUCCGAGGUCACAUAUU
hsa-miR-4502 GCUGAUGAUGAUGGUGCUGAAG UCAGCACCAUCAUCAUCAGCUU
hsa-miR-4503 UUUAAGCAGGAAAUAGAAUUUA AAUUCUAUUUCCUGCUUAAAUU
hsa-miR-4504 UGUGACAAUAGAGAUGAACAUG UGUUCAUCUCUAUUGUCACAUU
hsa-miR-4505 AGGCUGGGCUGGGACGGA CGUCCCAGCCCAGCCUUU
hsa-miR-4506 AAAUGGGUGGUCUGAGGCAA GCCUCAGACCACCCAUUUUU
hsa-miR-4507 CUGGGUUGGGCUGGGCUGGG CAGCCCAGCCCAACCCAGUU
hsa-miR-4508 GCGGGGCUGGGCGCGCG CGCGCCCAGCCCCGCUU
hsa-miR-4509 ACUAAAGGAUAUAGAAGGUUUU AACCUUCUAUAUCCUUUAGUUU
hsa-miR-450a-1 UUUUGCGAUGUGUUCCUAAUAU AUUGGGAACAUUUUGCAUGUAU
hsa-miR-450a-2 UUUUGCGAUGUGUUCCUAAUAU AUUGGGGACAUUUUGCAUUCAU
hsa-miR-450b UUUUGCAAUAUGUUCCUGAAUA UUGGGAUCAUUUUGCAUCCAUA
hsa-miR-4510 UGAGGGAGUAGGAUGUAUGGUU CCAUACAUCCUACUCCCUCAUU
hsa-miR-4511 GAAGAACUGUUGCAUUUGCCCU GGCAAAUGCAACAGUUCUUCUU
hsa-miR-4512 CAGGGCCUCACUGUAUCGCCCA GGCGAUACAGUGAGGCCCUGUU
hsa-miR-4513 AGACUGACGGCUGGAGGCCCAU GGGCCUCCAGCCGUCAGUCUUU
hsa-miR-4514 ACAGGCAGGAUUGGGGAA CCCCAAUCCUGCCUGUUU
hsa-miR-4515 AGGACUGGACUCCCGGCAGCCC GCUGCCGGGAGUCCAGUCCUUU
hsa-miR-4516 GGGAGAAGGGUCGGGGC CCCGACCCUUCUCCCUU
hsa-miR-4517 AAAUAUGAUGAAACUCACAGCUGAG CAGCUGUGAGUUUCAUCAUAUUUUU
hsa-miR-4518 GCUCAGGGAUGAUAACUGUGCUGAGA UCAGCACAGUUAUCAUCCCUGAGCUU
hsa-miR-4519 CAGCAGUGCGCAGGGCUG GCCCUGCGCACUGCUGUU
hsa-miR-451a AAACCGUUACCAUUACUGAGUU CUCAGUAAUGGUAACGGUUUUU
hsa-miR-451b UAGCAAGAGAACCAUUACCAUU UGGUAAUGGUUCUCUUGCUAUU
hsa-miR-452 AACUGUUUGCAGAGGAAACUGA CUCAUCUGCAAAGAAGUAAGUG
hsa-miR-4520-1 CCUGCGUGUUUUCUGUCCAA UUGGACAGAAAACACGCAGGAA
hsa-miR-4520-2 CCUGCGUGUUUUCUGUCCAA UUUGGACAGAAAACACGCAGGU
hsa-miR-4521 GCUAAGGAAGUCCUGUGCUCAG GAGCACAGGACUUCCUUAGCUU
hsa-miR-4522 UGACUCUGCCUGUAGGCCGGU CGGCCUACAGGCAGAGUCAUU
hsa-miR-4523 GACCGAGAGGGCCUCGGCUGU AGCCGAGGCCCUCUCGGUCUU
hsa-miR-4524a AUAGCAGCAUGAACCUGUCUCA UGAGACAGGCUUAUGCUGCUAU
hsa-miR-4524b AUAGCAGCAUAAGCCUGUCUC GAGACAGGUUCAUGCUGCUA
hsa-miR-4525 GGGGGGAUGUGCAUGCUGGUU CCAGCAUGCACAUCCCCCCUU
hsa-miR-4526 GCUGACAGCAGGGCUGGCCGCU CGGCCAGCCCUGCUGUCAGCUU
hsa-miR-4527 UGGUCUGCAAAGAGAUGACUGU AGUCAUCUCUUUGCAGACCAUU
hsa-miR-4528 UCAUUAUAUGUAUGAUCUGGAC CCAGAUCAUACAUAUAAUGAUU
hsa-miR-4529 AGGCCAUCAGCAGUCCAAUGAA AUUGGACUGCUGAUGGCCCGU
hsa-miR-4530 CCCAGCAGGACGGGAGCG CUCCCGUCCUGCUGGGUU
hsa-miR-4531 AUGGAGAAGGCUUCUGA AGAAGCCUUCUCCAUUU
hsa-miR-4532 CCCCGGGGAGCCCGGCG CCGGGCUCCCCGGGGUU
hsa-miR-4533 UGGAAGGAGGUUGCCGGACGCU CGUCCGGCAACCUCCUUCCAUU
hsa-miR-4534 GGAUGGAGGAGGGGUCU ACCCCUCCUCCAUCCUU
hsa-miR-4535 GUGGACCUGGCUGGGAC CCCAGCCAGGUCCACUU
hsa-miR-4536 UCGUGCAUAUAUCUACCACAU UGUGGUAGAUAUAUGCACGAU
hsa-miR-4537 UGAGCCGAGCUGAGCUUAGCUG GCUAAGCUCAGCUCGGCUCAUU
hsa-miR-4538 GAGCUUGGAUGAGCUGGGCUGA AGCCCAGCUCAUCCAAGCUCUU
hsa-miR-4539 GCUGAACUGGGCUGAGCUGGGC CCAGCUCAGCCCAGUUCAGCUU
hsa-miR-454 ACCCUAUCAAUAUUGUCUCUGC UAGUGCAAUAUUGCUUAUAGGGU
hsa-miR-4540 UUAGUCCUGCCUGUAGGUUUA AACCUACAGGCAGGACUAAUU
hsa-miR-455 GCAGUCCAUGGGCAUAUACAC UAUGUGCCUUUGGACUACAUCG
hsa-miR-4632 UGCCGCCCUCUCGCUGCUCUAG GAGGGCAGCGUGGGUGUGGCGGA
hsa-miR-4633 AUAUGCCUGGCUAGCUCCUC AGGAGCUAGCCAGGCAUAUGCA
hsa-miR-4634 CGGCGCGACCGGCCCGGGG CCGGGCCGGUCGCGCCGUU
hsa-miR-4635 UCUUGAAGUCAGAACCCGCAA GCGGGUUCUGACUUCAAGAUU
hsa-miR-4636 AACUCGUGUUCAAAGCCUUUAG AAAGGCUUUGAACACGAGUUUU
hsa-miR-4637 UACUAACUGCAGAUUCAAGUGA ACUUGAAUCUGCAGUUAGUAUU
hsa-miR-4638 CCUGGACACCGCUCAGCCGGCCG ACUCGGCUGCGGUGGACAAGU
hsa-miR-4639 UCACUCUCACCUUGCUUUGC UUGCUAAGUAGGCUGAGAUUGA
hsa-miR-4640 UGGGCCAGGGAGCAGCUGGUGGG CACCCCCUGUUUCCUGGCCCAC
hsa-miR-4641 UGCCCAUGCCAUACUUUUGCCUCA AGGCAAAAGUAUGGCAUGGGCAUU
hsa-miR-4642 AUGGCAUCGUCCCCUGGUGGCU CCACCAGGGGACGAUGCCAUUU
hsa-miR-4643 GACACAUGACCAUAAAUGCUAA AGCAUUUAUGGUCAUGUGUCUU
hsa-miR-4644 UGGAGAGAGAAAAGAGACAGAAG UCUGUCUCUUUUCUCUCUCCAUU
hsa-miR-4645 ACCAGGCAAGAAAUAUUGU AGACAGUAGUUCUUGCCUGGUU
hsa-miR-4646 AUUGUCCCUCUCCCUUCCCAG ACUGGGAAGAGGAGCUGAGGGA
hsa-miR-4647 GAAGAUGGUGCUGUGCUGAGGAA CCUCAGCACAGCACCAUCUUCUU
hsa-miR-4648 UGUGGGACUGCAAAUGGGAG CCCAUUUGCAGUCCCACAUU
hsa-miR-4649 UGGGCGAGGGGUGGGCUCUCAGAG UCUGAGGCCUGCCUCUCCCCA
hsa-miR-4650 AGGUAGAAUGAGGCCUGACAU UCAGGCCUCUUUCUACCUU
hsa-miR-4651 CGGGGUGGGUGAGGUCGGGC CCGACCUCACCCACCCCGUU
hsa-miR-4652 AGGGGACUGGUUAAUAGAACUA GUUCUGUUAACCCAUCCCCUCA
hsa-miR-4653 UCUCUGAGCAAGGCUUAACACC UGGAGUUAAGGGUUGCUUGGAGA
hsa-miR-4654 UGUGGGAUCUGGAGGCAUCUGG AGAUGCCUCCAGAUCCCACAUU
hsa-miR-4655 ACCCUCGUCAGGUCCCCGGGG CACCGGGGAUGGCAGAGGGUCG
hsa-miR-4656 UGGGCUGAGGGCAGGAGGCCUGU AGGCCUCCUGCCCUCAGCCCAUU
hsa-miR-4657 AAUGUGGAAGUGGUCUGAGGCAU GCCUCAGACCACUUCCACAUUUU
hsa-miR-4658 GUGAGUGUGGAUCCUGGAGGAAU UCCUCCAGGAUCCACACUCACUU
hsa-miR-4659a UUUCUUCUUAGACAUGGCAACG CUGCCAUGUCUAAGAAGAAAAC
hsa-miR-4659b UUUCUUCUUAGACAUGGCAGCU UUGCCAUGUCUAAGAAGAA
hsa-miR-466 AUACACAUACACGCAACACACAU GUGUGUUGCGUGUAUGUGUAUUU
hsa-miR-4660 UGCAGCUCUGGUGGAAAAUGGAG CCAUUUUCCACCAGAGCUGCAUU
hsa-miR-4661 AACUAGCUCUGUGGAUCCUGAC CAGGAUCCACAGAGCUAGUCCA
hsa-miR-4662a UUAGCCAAUUGUCCAUCUUUAG AAAGAUAGACAAUUGGCUAAAU
hsa-miR-4662b AAAGAUGGACAAUUGGCUAAAU UUAGCCAAUUGUCCAUCUUUUU
hsa-miR-4663 AGCUGAGCUCCAUGGACGUGCAGU UGCACGUCCAUGGAGCUCAGCUUU
hsa-miR-4664 CUUCCGGUCUGUGAGCCCCGUC UGGGGUGCCCACUCCGCAAGUU
hsa-miR-4665 CUCGGCCGCGGCGCGUAGCCCCCGCC CUGGGGGACGCGUGAGCGCGAGC
hsa-miR-4666a AUACAUGUCAGAUUGUAUGCC CAUACAAUCUGACAUGUAUUU
hsa-miR-4666b UUGCAUGUCAGAUUGUAAUUCCC GAAUUACAAUCUGACAUGCAAUU
hsa-miR-4667 ACUGGGGAGCAGAAGGAGAACC UCCCUCCUUCUGUCCCCACAG
hsa-miR-4668 AGGGAAAAAAAAAAGGAUUUGUC GAAAAUCCUUUUUGUUUUUCCAG
hsa-miR-4669 UGUGUCCGGGAAGUGGAGGAGG UCCUCCACUUCCCGGACACAUU
hsa-miR-4670 AAGCGACCAUGAUGUAACUUCA UGAAGUUACAUCAUGGUCGCUU
hsa-miR-4671 ACCGAAGACUGUGCGCUAAUCU UUAGUGCAUAGUCUUUGGUCU
hsa-miR-4672 UUACACAGCUGGACAGAGGCA CCUCUGUCCAGCUGUGUAAUU
hsa-miR-4673 UCCAGGCAGGAGCCGGACUGGA CAGUCCGGCUCCUGCCUGGAUU
hsa-miR-4674 CUGGGCUCGGGACGCGCGGCU CCGCGCGUCCCGAGCCCAGUU
hsa-miR-4675 GGGGCUGUGAUUGACCAGCAGG UGCUGGUCAAUCACAGCCCCUU
hsa-miR-4676 GAGCCAGUGGUGAGACAGUGA CACUGUUUCACCACUGGCUCUU
hsa-miR-4677 UUGUUCUUUGGUCUUUCAGCCA UCUGUGAGACCAAAGAACUACU
hsa-miR-4678 AAGGUAUUGUUCAGACUUAUGA AUAAGUCUGAACAAUACCUUUU
hsa-miR-4679 UCUGUGAUAGAGAUUCUUUGCU CAAAGAAUCUCUAUCACAGAUU
hsa-miR-4680 UCUGAAUUGUAAGAGUUGUUA AGAACUCUUGCAGUCUUAGAUGU
hsa-miR-4681 AACGGGAAUGCAGGCUGUAUCU AUACAGCCUGCAUUCCCGUUUU
hsa-miR-4682 UCUGAGUUCCUGGAGCCUGGUCU ACCAGGCUCCAGGAACUCAGAUU
hsa-miR-4683 UGGAGAUCCAGUGCUCGCCCGAU CGGGCGAGCACUGGAUCUCCAUU
hsa-miR-4684 CUCUCUACUGACUUGCAACAUA UGUUGCAAGUCGGUGGAGACGU
hsa-miR-4685 CCCAGGGCUUGGAGUGGGGCAAGGUU UCUCCCUUCCUGCCCUGGCUAG
hsa-miR-4686 UAUCUGCUGGGCUUUCUGGUGUU CACCAGAAAGCCCAGCAGAUAUU
hsa-miR-4687 UGGCUGUUGGAGGGGGCAGGC CAGCCCUCCUCCCGCACCCAAA
hsa-miR-4688 UAGGGGCAGCAGAGGACCUGGG CAGGUCCUCUGCUGCCCCUAUU
hsa-miR-4689 UUGAGGAGACAUGGUGGGGGCC CCCCCACCAUGUCUCCUCAAUU
hsa-miR-4690 GCAGCCCAGCUGAGGCCUCUG GAGCAGGCGAGGCUGGGCUGAA
hsa-miR-4691 GUCCUCCAGGCCAUGAGCUGCGG CCAGCCACGGACUGAGAGUGCAU
hsa-miR-4692 UCAGGCAGUGUGGGUAUCAGAU CUGAUACCCACACUGCCUGAUU
hsa-miR-4693 AUACUGUGAAUUUCACUGUCACA UGAGAGUGGAAUUCACAGUAUUU
hsa-miR-4694 AGGUGUUAUCCUAUCCAUUUGC CAAAUGGACAGGAUAACACCU
hsa-miR-4695 CAGGAGGCAGUGGGCGAGCAGG UGAUCUCACCGCUGCCUCCUUC
hsa-miR-4696 UGCAAGACGGAUACUGUCAUCU AUGACAGUAUCCGUCUUGCAUU
hsa-miR-4697 AGGGGGCGCAGUCACUGACGUG UGUCAGUGACUCCUGCCCCUUGGU
hsa-miR-4698 UCAAAAUGUAGAGGAAGACCCCA GGGUCUUCCUCUACAUUUUGAUU
hsa-miR-4699 AAUUUACUCUGCAAUCUUCUCC AGAAGAUUGCAGAGUAAGUUCC
hsa-miR-4700 CACAGGACUGACUCCUCACCCCAGUG UCUGGGGAUGAGGACAGUGUGU
hsa-miR-4701 UUGGCCACCACACCUACCCCUU AUGGGUGAUGGGUGUGGUGU
hsa-miR-4703 UGUAGUUGUAUUGUAUUGCCAC UAGCAAUACAGUACAAAUAUAGU
hsa-miR-4704 UCAGUCACAUAUCUAGUGUCUA GACACUAGGCAUGUGAGUGAUU
hsa-miR-4705 UCAAUCACUUGGUAAUUGCUGU AGCAAUUACCAAGUGAUUGAUU
hsa-miR-4706 AGCGGGGAGGAAGUGGGCGCUGCUU GCAGCGCCCACUUCCUCCCCGCUUU
hsa-miR-4707 AGCCCGCCCCAGCCGAGGUUCU GCCCCGGCGCGGGCGGGUUCUGG
hsa-miR-4708 AGAGAUGCCGCCUUGCUCCUU AGCAAGGCGGCAUCUCUCUGAU
hsa-miR-4709 ACAACAGUGACUUGCUCUCCAA UUGAAGAGGAGGUGCUCUGUAGC
hsa-miR-4710 GGGUGAGGGCAGGUGGUU CCACCUGCCCUCACCCUU
hsa-miR-4711 CGUGUCUUCUGGCUUGAU UGCAUCAGGCCAGAAGACAUGAG
hsa-miR-4712 AAUGAGAGACCUGUACUGUAU UCCAGUACAGGUCUCUCAUUUC
hsa-miR-4713 UUCUCCCACUACCAGGCUCCCA UGGGAUCCAGACAGUGGGAGAA
hsa-miR-4714 AACUCUGACCCCUUAGGUUGAU CCAACCUAGGUGGUCAGAGUUG
hsa-miR-4715 GUGCCACCUUAACUGCAGCCAAU AAGUUGGCUGCAGUUAAGGUGG
hsa-miR-4716 AAGGGGGAAGGAAACAUGGAGA UCCAUGUUUCCUUCCCCCUUCU
hsa-miR-4717 ACACAUGGGUGGCUGUGGCCU UAGGCCACAGCCACCCAUGUGU
hsa-miR-4718 AGCUGUACCUGAAACCAAGCA CUUGGUUUCAGGUACAGCUUU
hsa-miR-4719 UCACAAAUCUAUAAUAUGCAGG UGCAUAUUAUAGAUUUGUGAUU
hsa-miR-4720 UGCUUAAGUUGUACCAAGUAU CCUGGCAUAUUUGGUAUAACUU
hsa-miR-4721 UGAGGGCUCCAGGUGACGGUGG ACCGUCACCUGGAGCCCUCAUU
hsa-miR-4722 GGCAGGAGGGCUGUGCCAGGUUG ACCUGCCAGCACCUCCCUGCAG
hsa-miR-4723 UGGGGGAGCCAUGAGAUAAGAGCA CCCUCUCUGGCUCCUCCCCAAA
hsa-miR-4724 AACUGAACCAGGAGUGAGCUUCG GUACCUUCUGGUUCAGCUAGU
hsa-miR-4725 AGACCCUGCAGCCUUCCCACC UGGGGAAGGCGUCAGUGUCGGG
hsa-miR-4726 ACCCAGGUUCCCUCUGGCCGCA AGGGCCAGAGGAGCCUGGAGUGG
hsa-miR-4727 AUAGUGGGAAGCUGGCAGAUUC AUCUGCCAGCUUCCACAGUGG
hsa-miR-4728 CAUGCUGACCUCCCUCCUGCCCCAG UGGGAGGGGAGAGGCAGCAAGCA
hsa-miR-4729 UCAUUUAUCUGUUGGGAAGCUA GCUUCCCAACAGAUAAAUGAUU
hsa-miR-4730 CUGGCGGAGCCCAUUCCAUGCCA GCAUGGAAUGGGCUCCGCCAGUU
hsa-miR-4731 UGCUGGGGGCCACAUGAGUGUG CACACAAGUGGCCCCCAACACU
hsa-miR-4732 UGUAGAGCAGGGAGCAGGAAGCU GCCCUGACCUGUCCUGUUCUG
hsa-miR-4733 AAUCCCAAUGCUAGACCCGGUG CCACCAGGUCUAGCAUUGGGAU
hsa-miR-4734 GCUGCGGGCUGCGGUCAGGGCG CCCUGACCGCAGCCCGCAGCUU
hsa-miR-4735 CCUAAUUUGAACACCUUCGGUA AAAGGUGCUCAAAUUAGACAU
hsa-miR-4736 AGGCAGGUUAUCUGGGCUG GCCCAGAUAACCUGCCUUU
hsa-miR-4737 AUGCGAGGAUGCUGACAGUG CUGUCAGCAUCCUCGCAUUU
hsa-miR-4738 UGAAACUGGAGCGCCUGGAGGA ACCAGCGCGUUUUCAGUUUCAU
hsa-miR-4739 AAGGGAGGAGGAGCGGAGGGGCCCU GGCCCCUCCGCUCCUCCUCCCUUUU
hsa-miR-4740 GCCCGAGAGGAUCCGUCCCUGC AGGACUGAUCCUCUCGGGCAGG
hsa-miR-4741 CGGGCUGUCCGGAGGGGUCGGCU CCGACCCCUCCGGACAGCCCGUU
hsa-miR-4742 UCAGGCAAAGGGAUAUUUACAGA UCUGUAUUCUCCUUUGCCUGCAG
hsa-miR-4743 UUUCUGUCUUUUCUGGUCCAG UGGCCGGAUGGGACAGGAGGCAU
hsa-miR-4744 UCUAAAGACUAGACUUCGCUAUG UAGCGAAGUCUAGUCUUUAGAUU
hsa-miR-4745 UGAGUGGGGCUCCCGGGACGGCG UGGCCCGGCGACGUCUCACGGUC
hsa-miR-4746 AGCGGUGCUCCUGCGGGCCGA CCGGUCCCAGGAGAACCUGCAGA
hsa-miR-4747 AAGGCCCGGGCUUUCCUCCCAG AGGGAAGGAGGCUUGGUCUUAG
hsa-miR-4748 GAGGUUUGGGGAGGAUUUGCU CAAAUCCUCCCCAAACCUCUU
hsa-miR-4749 UGCGGGGACAGGCCAGGGCAUC CGCCCCUCCUGCCCCCACAG
hsa-miR-4750 CCUGACCCACCCCCUCCCGCAG CUCGGGCGGAGGUGGUUGAGUG
hsa-miR-4751 AGAGGACCCGUAGCUGCUAGAAGG UUCUAGCAGCUACGGGUCCUCUUU
hsa-miR-4752 UUGUGGAUCUCAAGGAUGUGCU CACAUCCUUGAGAUCCACAAUU
hsa-miR-4753 CAAGGCCAAAGGAAGAGAACAG UUCUCUUUCUUUAGCCUUGUGU
hsa-miR-4754 AUGCGGACCUGGGUUAGCGGAGU UCCGCUAACCCAGGUCCGCAUUU
hsa-miR-4755 UUUCCCUUCAGAGCCUGGCUUU AGCCAGGCUCUGAAGGGAAAGU
hsa-miR-4756 CCAGAGAUGGUUGCCUUCCUAU CAGGGAGGCGCUCACUCUCUGCU
hsa-miR-4757 CAUGACGUCACAGAGGCUUCGC AGGCCUCUGUGACGUCACGGUGU
hsa-miR-4758 GUGAGUGGGAGCCGGUGGGGCUG UGCCCCACCUGCUGACCACCCUC
hsa-miR-4759 UAGGACUAGAUGUUGGAAUUA AUUCCAACAUCUAGUCCUAUU
hsa-miR-4760 AAAUUCAUGUUCAAUCUAAACC UUUAGAUUGAACAUGAAGUUAG
hsa-miR-4761 ACAAGGUGUGCAUGCCUGACC GAGGGCAUGCGCACUUUGUCC
hsa-miR-4762 CCAAAUCUUGAUCAGAAGCCU CUUCUGAUCAAGAUUUGUGGUG
hsa-miR-4763 AGGCAGGGGCUGGUGCUGGGCGGG CGCCUGCCCAGCCCUCCUGCU
hsa-miR-4764 UUAACUCCUUUCACACCCAUGG UGGAUGUGGAAGGAGUUAUCU
hsa-miR-4765 UGAGUGAUUGAUAGCUAUGUUC ACAUAGCUAUCAAUCACUCAUU
hsa-miR-4766 UCUGAAAGAGCAGUUGGUGUU AUAGCAAUUGCUCUUUUGGAA
hsa-miR-4767 CGCGGGCGCUCCUGGCCGCCGCC CGGCGGCCAGGAGCGCCCGCGUU
hsa-miR-4768 CCAGGAGAUCCAGAGAGAAU AUUCUCUCUGGAUCCCAUGGAU
hsa-miR-4769 UCUGCCAUCCUCCCUCCCCUAC GGUGGGAUGGAGAGAAGGUAUGAG
hsa-miR-4770 UGAGAUGACACUGUAGCU CUACAGUGUCAUCUCAUU
hsa-miR-4771 AGCAGACUUGACCUACAAUUA AUUGUAGGUCAAGUCUGCUUU
hsa-miR-4772 CCUGCAACUUUGCCUGAUCAGA UGAUCAGGCAAAAUUGCAGACU
hsa-miR-4773 CAGAACAGGAGCAUAGAAAGGC CUUUCUAUGCUCCUGUUCUGUU
hsa-miR-4774 AUUGCCUAACAUGUGCCAGAA UCUGGUAUGUAGUAGGUAAUAA
hsa-miR-4775 UUAAUUUUUUGUUUCGGUCACU UGACCGAAACAAAAAAUUAAUU
hsa-miR-4776 GUGGACCAGGAUGGCAAGGGCU CUUGCCAUCCUGGUCCACUGCAU
hsa-miR-4777 UUCUAGAUGAGAGAUAUAUAUA AUACCUCAUCUAGAAUGCUGUA
hsa-miR-4778 UCUUCUUCCUUUGCAGAGUUGA AAUUCUGUAAAGGAAGAAGAGG
hsa-miR-4779 UAGGAGGGAAUAGUAAAAGCAG GCUUUUACUAUUCCCUCCUAUU
hsa-miR-4780 ACCCUUGAGCCUGAUCCCUAGC UAGGGAUCAGGCUCAAGGGUUU
hsa-miR-4781 UAGCGGGGAUUCCAAUAUUGG AAUGUUGGAAUCCUCGCUAGAG
hsa-miR-4782 UGAUUGUCUUCAUAUCUAGAAC UUCUGGAUAUGAAGACAAUCAA
hsa-miR-4783 CCCCGGUGUUGGGGCGCGUCUGC GGCGCGCCCAGCUCCCGGGCU
hsa-miR-4784 UGAGGAGAUGCUGGGACUGA AGUCCCAGCAUCUCCUCAUU
hsa-miR-4785 AGAGUCGGCGACGCCGCCAGC UGGCGGCGUCGCCGACUCUUU
hsa-miR-4786 UGAAGCCAGCUCUGGUCUGGGC UGAGACCAGGACUGGAUGCACC
hsa-miR-4787 GAUGCGCCGCCCACUGCCCCGCGC GCGGGGGUGGCGGCGGCAUCCC
hsa-miR-4788 UUACGGACCAGCUAAGGGAGGC CUCCCUUAGCUGGUCCGUAAUU
hsa-miR-4789 GUAUACACCUGAUAUGUGUAUG CACACAUAGCAGGUGUAUAUA
hsa-miR-4790 AUCGCUUUACCAUUCAUGUU UGAAUGGUAAAGCGAUGUCACA
hsa-miR-4791 UGGAUAUGAUGACUGAAA UCAGUCAUCAUAUCCAUU
hsa-miR-4792 CGGUGAGCGCUCGCUGGC CAGCGAGCGCUCACCGUU
hsa-miR-4793 ACAUCCUGCUCCACAGGGCAGAGG UCUGCACUGUGAGUUGGCUGGCU
hsa-miR-4794 UCUGGCUAUCUCACGAGACUGU AGUCUCGUGAGAUAGCCAGAUU
hsa-miR-4795 AGAAGUGGCUAAUAAUAUUGA AUAUUAUUAGCCACUUCUGGAU
hsa-miR-4796 UAAAGUGGCAGAGUAUAGACAC UGUCUAUACUCUGUCACUUUAC
hsa-miR-4797 GACAGAGUGCCACUUACUGAA UCUCAGUAAGUGGCACUCUGU
hsa-miR-4798 UUCGGUAUACUUUGUGAAUUGG AACUCACGAAGUAUACCGAAGU
hsa-miR-4799 AUCUAAAUGCAGCAUGCCAGUC ACUGGCAUGCUGCAUUUAUAUA
hsa-miR-4800 CAUCCGUCCGUCUGUCCAC AGUGGACCGAGGAAGGAAGGA
hsa-miR-4801 UACACAAGAAAACCAAGGCUCA AGCCUUGGUUUUCUUGUGUAUU
hsa-miR-4802 UAUGGAGGUUCUAGACCAUGUU UACAUGGAUGGAAACCUUCAAGC
hsa-miR-4803 UAACAUAAUAGUGUGGAUUGA AAUCCACACUAUUAUGUUAUU
hsa-miR-4804 UGCUUAACCUUGCCCUCGAAA UUGGACGGUAAGGUUAAGCAA
hsa-miR-483 UCACUCCUCUCCUCCCGUCUU AAGACGGGAGGAAAGAAGGGAG
hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU CGGGAGGGGACUGAGCCUGAUU
hsa-miR-485 AGAGGCUGGCCGUGAUGAAUUC GUCAUACACGGCUCUCCUCUCU
hsa-miR-486 CGGGGCAGCUCAGUACAGGAU UCCUGUACUGAGCUGCCCCGAG
hsa-miR-487a GUGGUUAUCCCUGCUGUGUUCG AAUCAUACAGGGACAUCCAGUU
hsa-miR-487b GUGGUUAUCCCUGUCCUGUUCG AAUCGUACAGGGUCAUCCACUU
hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC CCCAGAUAAUGGCACUCUCAA
hsa-miR-489 GUGACAUCACAUAUACGGCAGC GGUCGUAUGUGUGACGCCAUUU
hsa-miR-490 CCAUGGAUCUCCAGGUGGGU CAACCUGGAGGACUCCAUGCUG
hsa-miR-491 AGUGGGGAACCCUUCCAUGAGG CUUAUGCAAGAUUCCCUUCUAC
hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU GAAUCUUGUCCCGCAGGUCCUUU
hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG UUGUACAUGGUAGGCUUUCAUU
hsa-miR-494 AGGUUGUCCGUGUUGUCUUCUCU UGAAACAUACACGGGAAACCUC
hsa-miR-495 GAAGUUGCCCAUGUUAUUUUCG AAACAAACAUGGUGCACUUCUU
hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC GAUUGGCCAUGUAAUACUCAUU
hsa-miR-497 CAGCAGCACACUGUGGUUUGU CAAACCACACUGUGGUGUUAGA
hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC AAAACGCCCCCUGGCUUGAAAUU
hsa-miR-4999 UGCUGUAUUGUCAGGUAGUGA UCACUACCUGACAAUACAGU
hsa-miR-499a UUAAGACUUGCAGUGAUGUUU AACAUCACAGCAAGUCUGUGCU
hsa-miR-499b ACAGACUUGCUGUGAUGUUCA AACAUCACUGCAAGUCUUAACA
hsa-miR-5000 UCAGGACACUUCUGAACUUGGA CAGUUCAGAAGUGUUCCUGAGU
hsa-miR-5001 AGGGCUGGACUCAGCGGCGGAGCU UUCUGCCUCUGUCCAGGUCCUU
hsa-miR-5002 UGACUGCCUCACUGACCACUU AAUUUGGUUUCUGAGGCACUUAGU
hsa-miR-5003 UCACAACAACCUUGCAGGGUAGA UACUUUUCUAGGUUGUUGGGG
hsa-miR-5004 CUUGGAUUUUCCUGGGCCUCAG UGAGGACAGGGCAAAUUCACGA
hsa-miR-5006 UUGCCAGGGCAGGAGGUGGAA UUUCCCUUUCCAUCCUGGCAG
hsa-miR-5007 UAGAGUCUGGCUGAUAUGGUUU AUCAUAUGAACCAAACUCUAAU
hsa-miR-5008 UGAGGCCCUUGGGGCACAGUGG CCUGUGCUCCCAGGGCCUCGC
hsa-miR-5009 UCCUAAAUCUGAAAGUCCAAAA UUGGACUUUUUCAGAUUUGGGGAU
hsa-miR-500a AUGCACCUGGGCAAGGAUUCUG UAAUCCUUGCUACCUGGGUGAGA
hsa-miR-500b AAUCCUUGCUACCUGGGU GCACCCAGGCAAGGAUUCUG
hsa-miR-501 AAUGCACCCGGGCAAGGAUUCU AAUCCUUUGUCCCUGGGUGAGA
hsa-miR-5010 AGGGGGAUGGCAGAGCAAAAUU UUUUGUGUCUCCCAUUCCCCAG
hsa-miR-5011 UAUAUAUACAGCCAUGCACUC GUGCAUGGCUGUAUAUAUAACA
hsa-miR-502 AAUGCACCUGGGCAAGGAUUCA AUCCUUGCUAUCUGGGUGCUA
hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG GGGGUAUUGUUUCCGCUGCCAGG
hsa-miR-504 GGGAGUGCAGGGCAGGGUUUC AGACCCUGGUCUGCACUCUAUC
hsa-miR-5047 UUGCAGCUGCGGUUGUAAGGU CUUACAACCGCAGCUGCAAUU
hsa-miR-505 CGUCAACACUUGCUGGUUUCCU GGGAGCCAGGAAGUAUUGAUGU
hsa-miR-506 UAAGGCACCCUUCUGAGUAGA UAUUCAGGAAGGUGUUACUUAA
hsa-miR-507 UUUUGCACCUUUUGGAGUGAA CACUCCAAAAGGUGCAAAAUU
hsa-miR-508 UGAUUGUAGCCUUUUGGAGUAGA UACUCCAGAGGGCGUCACUCAUG
hsa-miR-5087 GGGUUUGUAGCUUUGCUGGCAUG UGCCAGCAAAGCUACAAACCCUU
hsa-miR-5088 UCCCUUCUUCCUGGGCCCUCA CAGGGCUCAGGGAUUGGAUGGAGG
hsa-miR-5089 GUGGGAUUUCUGAGUAGCAUC AUGCUACUCGGAAAUCCCACUGA
hsa-miR-509-1 UGAUUGGUACGUCUGUGGGUAG UACUGCAGACAGUGGCAAUCA
hsa-miR-509-3 UGAUUGGUACGUCUGUGGGUAG UACUGCAGACGUGGCAAUCAUG
hsa-miR-5090 CCGGGGCAGAUUGGUGUAGGGUG CCCUACACCAAUCUGCCCCGGUU
hsa-miR-5091 ACGGAGACGACAAGACUGUGCUG GCACAGUCUUGUCGUCUCCGUUU
hsa-miR-5092 AAUCCACGCUGAGCUUGGCAUC UGCCAAGCUCAGCGUGGAUUUU
hsa-miR-5093 AGGAAAUGAGGCUGGCUAGGAGC UCCUAGCCAGCCUCAUUUCCUUU
hsa-miR-5094 AAUCAGUGAAUGCCUUGAACCU GUUCAAGGCAUUCACUGAUUUU
hsa-miR-5095 UUACAGGCGUGAACCACCGCG CGGUGGUUCACGCCUGUAAUU
hsa-miR-5096 GUUUCACCAUGUUGGUCAGGC CUGACCAACAUGGUGAAACUU
hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC AUUGAAACCUCUAAGAGUGGA
hsa-miR-5100 UUCAGAUCCCAGCGGUGCCUCU AGGCACCGCUGGGAUCUGAAUU
hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA AAUGUGUAGCAAAAGACAGA
hsa-miR-512 AAGUGCUGUCAUAGCUGAGGUC CACUCAGCCUUGAGGGCACUUUC
hsa-miR-513a UAAAUUUCACCUUUCUGAGAAGG UUCACAGGGAGGUGUCAU
hsa-miR-513b AAAUGUCACCUUUUUGAGAGGA UUCACAAGGAGGUGUCAUUUAU
hsa-miR-513c UUCUCAAGGAGGUGUCGUUUAU UAAAUUUCACCUUUCUGAGAAGA
hsa-miR-514a AUUGACACUUCUGUGAGUAGA UACUCUGGAGAGUGACAAUCAUG
hsa-miR-514b AUUGACACCUCUGUGAGUGGA UUCUCAAGAGGGAGGCAAUCAU
hsa-miR-515 GAGUGCCUUCUUUUGGAGCGUU UUCUCCAAAAGAAAGCACUUUCUG
hsa-miR-516a UUCUCGAGGAAAGAAGCACUUUC UGCUUCCUUUCAGAGGGU
hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU UGCUUCCUUUCAGAGGGU
hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU CCUCUAGAUGGAAGCACUGUCU
hsa-miR-517b AUCGUGCAUCCCUUUAGAGUGU CCUCUAGAUGGAAGCACUGUCU
hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU CCUCUAGAUGGAAGCACUGUCU
hsa-miR-5186 AGAGAUUGGUAGAAAUCAGGU CUGAUUUCUACCAAUCUCUUU
hsa-miR-5187 ACUGAAUCCUCUUUUCCUCAG UGGGAUGAGGGAUUGAAGUGGA
hsa-miR-5188 AAUCGGACCCAUUUAAACCGGAG CCGGUUUAAAUGGGUCCGAUUUU
hsa-miR-5189 UCUGGGCACAGGCGGAUGGACAGG UGCCAACCGUCAGAGCCCAGA
hsa-miR-518a GAAAGCGCUUCCCUUUGCUGGA CUGCAAAGGGAAGCCCUUUC
hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU CUCUAAAGGGGAGCGCUUUGUU
hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU UCUCUGGAGGGAAGCACUUUCUG
hsa-miR-518d CUCUAGAGGGAAGCACUUUCUG CAAAGCGCUUCCCUUUGGAGC
hsa-miR-518e CUCUAGAGGGAAGCGCUUUCUG AAAGCGCUUCCCUUCAGAGUG
hsa-miR-518f CUCUAGAGGGAAGCACUUUCUC GAAAGCGCUUCUCUUUAGAGG
hsa-miR-5190 CCAGUGACUGAGCUGGAGCCA GCUCCAGCUCAGUCACUGGUU
hsa-miR-5191 AGGAUAGGAAGAAUGAAGUGCU CACUUCAUUCUUCCUAUCCUUU
hsa-miR-5192 AGGAGAGUGGAUUCCAGGUGGU CACCUGGAAUCCACUCUCCUUU
hsa-miR-5193 UCCUCCUCUACCUCAUCCCAGU UGGGAUGAGGUAGAGGAGGAUU
hsa-miR-5194 UGAGGGGUUUGGAAUGGGAUGG AUCCCAUUCCAAACCCCUCAUU
hsa-miR-5195 AACCCCUAAGGCAACUGGAUGG AUCCAGUUCUCUGAGGGGGCU
hsa-miR-5196 AGGGAAGGGGACGAGGGUUGGG UCAUCCUCGUCUCCCUCCCAG
hsa-miR-5197 AAGAAGAGACUGAGUCAUCGAAU CAAUGGCACAAACUCAUUCUUGA
hsa-miR-519a CUCUAGAGGGAAGCGCUUUCUG AAAGUGCAUCCUUUUAGAGUGU
hsa-miR-519b AAAGUGCAUCCUUUUAGAGGUU CUCUAGAGGGAAGCGCUUUCUG
hsa-miR-519c AAAGUGCAUCUUUUUAGAGGAU CUCUAGAGGGAAGCGCUUUCUG
hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG CCUCCAAAGGGAAGCGCUUUCUGUU
hsa-miR-519e UUCUCCAAAAGGGAGCACUUUC AAGUGCCUCCUUUUAGAGUGUU
hsa-miR-520a AAAGUGCUUCCCUUUGGACUGU CUCCAGAGGGAAGUACUUUCU
hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG CUCUAAAAGGAAGCACUUUUU
hsa-miR-520c CUCUAGAGGGAAGCACUUUCUG AAAGUGCUUCCUUUUAGAGGGU
hsa-miR-520d CUACAAAGGGAAGCCCUUUC AAAGUGCUUCUCUUUGGUGGGU
hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG CUCAAAAAGGAAGCACUUUUU
hsa-miR-520f CCUCUAAAGGGAAGCGCUUUCU AAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520g UCUAGAGGAAGCACUUUCUGUUU ACAAAGUGCUUCCCUUUAGAGUGU
hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU UCUAAAGGGAAGCACUUUGUUU
hsa-miR-521 AACGCACUUCCCUUUAGAGUGU ACUCUAAAGGGAAGUGCGUUUU
hsa-miR-522 CUCUAGAGGGAAGCGCUUUCUG AAAAUGGUUCCCUUUAGAGUGU
hsa-miR-523 CUCUAGAGGGAAGCGCUUUCUG GAACGCGCUUCCCUAUAGAGGGU
hsa-miR-524 GAAGGCGCUUCCCUUUGGAGU CUACAAAGGGAAGCACUUUCUC
hsa-miR-525 CUCCAGAGGGAUGCACUUUCU GAAGGCGCUUCCCUUUAGAGCG
hsa-miR-526a CUCUAGAGGGAAGCACUUUCUG GAAAGUGCUUCCCUCUAGAGUU
hsa-miR-526b GAAAGUGCUUCCUUUUAGAGGC CUCUUGAGGGAAGCACUUUCUGU
hsa-miR-527 CUGCAAAGGGAAGCCCUUUC AAGGGCUUCCCUUUGCAGUU
hsa-miR-532 CCUCCCACACCCAAGGCUUGCA CAUGCCUUGAGUGUAGGACCGU
hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU AUCAUACAAGGACAAUUUCUUU
hsa-miR-541 UGGUGGGCACAGAAUCUGGACU AAAGGAUUCUGCUGUCGGUCCCACU
hsa-miR-542 UGUGACAGAUUGAUAACUGAAA UCGGGGAUCAUCAUGUCACGAGA
hsa-miR-543 AAACAUUCGCGGUGCACUUCUU GAAGUGCACCGCGAAUGUUUUU
hsa-miR-544a AUUCUGCAUUUUUAGCAAGUUC ACUUGCUAAAAAUGCAGAAUUU
hsa-miR-544b ACCUGAGGUUGUGCAUUUCUAA AGAAAUGCACAACCUCAGGUUU
hsa-miR-545 UCAGUAAAUGUUUAUUAGAUGA UCAGCAAACAUUUAUUGUGUGC
hsa-miR-548a CAAAACUGGCAAUUACUUUUGC AAAAGUAAUUGCGAGUUUUACC
hsa-miR-548aa AAAAACCACAAUUACUUUUGCACCA GUGCAAAAGUAAUUGUGGUUUUUUU
hsa-miR-548ab AAAAGUAAUUGUGGAUUUUGCU CAAAAUCCACAAUUACUUUUUU
hsa-miR-548ac CAAAAACCGGCAAUUACUUUUG AAAGUAAUUGCCGGUUUUUGUU
hsa-miR-548ad AAAAGUAAUUGUGGUUUUUG GAAAACGACAAUGACUUUUGCA
hsa-miR-548ae CAAAAACUGCAAUUACUUUCA AAAAGUAAUUGUGGUUUUUG
hsa-miR-548ag AAAGGUAAUUGUGGUUUCUGC AGAAACCACAAUUACCUUUUU
hsa-miR-548ah CAAAAACUGCAGUUACUUUUGC AAAAGUGAUUGCAGUGUUUG
hsa-miR-548ai AAAGGUAAUUGCAGUUUUUCCC GAAAAACUGCAAUUACCUUUUU
hsa-miR-548aj UGCAAAAGUAAUUGCAGUUUUUG UAAAAACUGCAAUUACUUUUA
hsa-miR-548ak AAAAGUAACUGCGGUUUUUGA AAAAACCGCAGUUACUUUUUU
hsa-miR-548al AACGGCAAUGACUUUUGUACCA GUACAAAAGUCAUUGCCGUUUU
hsa-miR-548am AAAAGUAAUUGCGGUUUUUGCC CAAAAACUGCAGUUACUUUUGU
hsa-miR-548an AAAAGGCAUUGUGGUUUUUG AAAACCACAAUGCCUUUUUU
hsa-miR-548ao AGAAGUAACUACGGUUUUUGCA AAAGACCGUGACUACUUUUGCA
hsa-miR-548ap AAAAGUAAUUGCGGUCUUU AAAAACCACAAUUACUUUU
hsa-miR-548aq GAAAGUAAUUGCUGUUUUUGCC CAAAAACUGCAAUUACUUUUGC
hsa-miR-548ar AAAAGUAAUUGCAGUUUUUGC UAAAACUGCAGUUAUUUUUGC
hsa-miR-548as UAAAACCCACAAUUAUGUUUGU AAAAGUAAUUGCGGGUUUUGCC
hsa-miR-548at AAAAGUUAUUGCGGUUUUGGCU CAAAACCGCAGUAACUUUUGU
hsa-miR-548au UGGCAGUUACUUUUGCACCAG AAAAGUAAUUGCGGUUUUUGC
hsa-miR-548av AAAACUGCAGUUACUUUUGC AAAAGUACUUGCGGAUUU
hsa-miR-548aw GUGCAAAAGUCAUCACGGUU CCGUGAUGACUUUUGCACUU
hsa-miR-548ax AGAAGUAAUUGCGGUUUUGCCA GCAAAACCGCAAUUACUUCUUU
hsa-miR-548ay CAAAACCGCGAUUACUCUUGCA AAAAGUAAUUGUGGUUUUUGC
hsa-miR-548az AAAAACUGCAAUCACUUUUGC CAAAAGUGAUUGUGGUUUUUGC
hsa-miR-548b AAAAGUAAUUGUGGUUUUGGCC CAAGAACCUCAGUUGCUUUUGU
hsa-miR-548ba AAAGGUAACUGUGAUUUUUGCU CAAAAAUCACAGUUACCUUUUU
hsa-miR-548bb AAAAGUAACUAUGGUUUUUGCC CAAAAACCAUAGUUACUUUUGC
hsa-miR-548c AAAAGUAAUUGCGGUUUUUGCC CAAAAAUCUCAAUUACUUUUGC
hsa-miR-548d CAAAAACCACAGUUUCUUUUGC AAAAGUAAUUGUGGUUUUUGCC
hsa-miR-548e AAAAACUGAGACUACUUUUGCA CAAAAGCAAUCGCGGUUUUUGC
hsa-miR-548f AAAAACUGUAAUUACUUUU UGCAAAAGUAAUCACAGUUUUU
hsa-miR-548g UGCAAAAGUAAUUGCAGUUUUUG AAAACUGUAAUUACUUUUGUAC
hsa-miR-548h CAAAAACCGCAAUUACUUUUGCA AAAAGUAAUCGCGGUUUUUGUC
hsa-miR-548i AAAAGUAAUUGCGGAUUUUGCC CAAAAUCCGCAAUUACUUUUUU
hsa-miR-548j CAAAAACUGCAUUACUUUUGC AAAAGUAAUUGCGGUCUUUGGU
hsa-miR-548k AAAAGUACUUGCGGAUUUUGCU CAAAAUCCGCAAGUACUUUUUU
hsa-miR-548l AAAAGUAUUUGCGGGUUUUGUC CAAAACCCGCAAAUACUUUUUU
hsa-miR-548m CAAAGGUAUUUGUGGUUUUUG AAAACCACAAAUACCUUUGUU
hsa-miR-548n CAAAAGUAAUUGUGGAUUUUGU AAAAUCCACAAUUACUUUUGUU
hsa-miR-548o CCAAAACUGCAGUUACUUUUGC AAAAGUAAUUGCGGUUUUUGCC
hsa-miR-548p UAGCAAAAACUGCAGUUACUUU AGUAACUGCAGUUUUUGCUAUU
hsa-miR-548q GCUGGUGCAAAAGUAAUGGCGG GCCAUUACUUUUGCACCAGCUU
hsa-miR-548s AUGGCCAAAACUGCAGUUAUUUU AAUAACUGCAGUUUUGGCCAUUU
hsa-miR-548t AAAAACCACAAUUACUUUUGCACCA CAAAAGUGAUCGUGGUUUUUG
hsa-miR-548u CAAAGACUGCAAUUACUUUUGCG CAAAAGUAAUUGCAGUCUUUGUU
hsa-miR-548v AGCUACAGUUACUUUUGCACCA GUGCAAAAGUAACUGUAGCUUU
hsa-miR-548w AAAAGUAACUGCGGUUUUUGCCU GCAAAAACCGCAGUUACUUUUUU
hsa-miR-548x UGCAAAAGUAAUUGCAGUUUUUG UAAAAACUGCAAUUACUUUC
hsa-miR-548y AAAAGUAAUCACUGUUUUUGCC CAAAAACAGUGAUUACUUUUUU
hsa-miR-548z CAAAAACCGCAAUUACUUUUGCA CAAAAGUAAUUGCGGUUUUUGUU
hsa-miR-549a UGACAACUAUGGAUGAGCUCU AGCUCAUCCAUAGUUGUCAUU
hsa-miR-550a-1 UGUCUUACUCCCUCAGGCACAU AGUGCCUGAGGGAGUAAGAGCCC
hsa-miR-550a-3 UGUCUUACUCCCUCAGGCACAU AGUGCCUGAGGGAGUAAGAG
hsa-miR-550b UCUUACUCCCUCAGGCACUG AUGUGCCUGAGGGAGUAAGACA
hsa-miR-551a GCGACCCACUCUUGGUUUCCA GAAACCAAGAGUGGGUCGCUU
hsa-miR-551b GAAAUCAAGCGUGGGUGAGACC GCGACCCAUACUUGGUUUCAG
hsa-miR-552 GUUUAACCUUUUGCCUGUUGG AACAGGUGACUGGUUAGACAA
hsa-miR-553 AAAACGGUGAGAUUUUGUUUU AACAAAAUCUCACCGUUUUUU
hsa-miR-554 GCUAGUCCUGACUCAGCCAGU UGGCUGAGUCAGGACUAGCUU
hsa-miR-555 AGGGUAAGCUGAACCUCUGAU CAGAGGUUCAGCUUACCCUUU
hsa-miR-556 GAUGAGCUCAUUGUAAUAUGAG AUAUUACCAUUAGCUCAUCUUU
hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU ACAAGGCCCACCCGUGCAAACUU
hsa-miR-5571 GUCCUAGGAGGCUCCUCUG CAAUUCUCAAAGGAGCCUCCC
hsa-miR-5572 GUUGGGGUGCAGGGGUCUGCU CAGACCCCUGCACCCCAACUU
hsa-miR-5579 UAUGGUACUCCUUAAGCUAAC UUAGCUUAAGGAGUACCAGAUC
hsa-miR-558 UGAGCUGCUGUACCAAAAU UUUGGUACAGCAGCUCAUU
hsa-miR-5580 CACAUAUGAAGUGAGCCAGCAC UGCUGGCUCAUUUCAUAUGUGU
hsa-miR-5581 AGCCUUCCAGGAGAAAUGGAGA UUCCAUGCCUCCUAGAAGUUCC
hsa-miR-5582 UAAAACUUUAAGUGUGCCUAGG UAGGCACACUUAAAGUUAUAGC
hsa-miR-5583 GAAUAUGGGUAUAUUAGUUUGG AAACUAAUAUACCCAUAUUCUG
hsa-miR-5584 CAGGGAAAUGGGAAGAACUAGA UAGUUCUUCCCUUUGCCCAAUU
hsa-miR-5585 CUGAAUAGCUGGGACUACAGGU UGAAGUACCAGCUACUCGAGAG
hsa-miR-5586 UAUCCAGCUUGUUACUAUAUGC CAGAGUGACAAGCUGGUUAAAG
hsa-miR-5587 AUGGUCACCUCCGGGACU GCCCCGGGCAGUGUGAUCAUC
hsa-miR-5588 ACUGGCAUUAGUGGGACUUUU AAGUCCCACUAAUGCCAGC
hsa-miR-5589 GGCUGGGUGCUCUUGUGCAGU UGCACAUGGCAACCUAGCUCCCA
hsa-miR-559 UAAAGUAAAUAUGCACCAAAA UUGGUGCAUAUUUACUUUAUU
hsa-miR-5590 AAUAAAGUUCAUGUAUGGCAA UUGCCAUACAUAGACUUUAUU
hsa-miR-5591 UGGGAGCUAAGCUAUGGGUAU AUACCCAUAGCUUAGCUCCCA
hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU AUCAAGGAUCUUAAACUUUGCC
hsa-miR-562 AAAGUAGCUGUACCAUUUGC AAAUGGUACAGCUACUUUUU
hsa-miR-563 AGGUUGACAUACGUUUCCC GAAACGUAUGUCAACCUUU
hsa-miR-564 AGGCACGGUGUCAGCAGGC CUGCUGACACCGUGCCUUU
hsa-miR-566 GGGCGCCUGUGAUCCCAAC UGGGAUCACAGGCGCCCUU
hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC UCUGUCCUGGAAGAACAUACUUU
hsa-miR-568 AUGUAUAAAUGUAUACACAC GUGUAUACAUUUAUACAUUU
hsa-miR-5680 GAGAAAUGCUGGACUAAUCUGC AGAUUAGUCCAGCAUUUCUCUU
hsa-miR-5681a AGAAAGGGUGGCAAUACCUCUU GAGGUAUUGCCACCCUUUCUUU
hsa-miR-5681b AGGUAUUGCCACCCUUUCUAGU UAGAAAGGGUGGCAAUACCUUU
hsa-miR-5682 GUAGCACCUUGCAGGAUAAGGU CUUAUCCUGCAAGGUGCUACUU
hsa-miR-5683 UACAGAUGCAGAUUCUCUGACUUC AGUCAGAGAAUCUGCAUCUGUAUU
hsa-miR-5684 AACUCUAGCCUGAGCAACAG GUUGCUCAGGCUAGAGUUUU
hsa-miR-5685 ACAGCCCAGCAGUUAUCACGGG CGUGAUAACUGCUGGGCUGUUU
hsa-miR-5687 UUAGAACGUUUUAGGGUCAAAU UUGACCCUAAAACGUUCUAAUU
hsa-miR-5688 UAACAAACACCUGUAAAACAGC UGUUUUACAGGUGUUUGUUAUU
hsa-miR-5689 AGCAUACACCUGUAGUCCUAGA UAGGACUACAGGUGUAUGCUUU
hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU UUUCCAGGAUUCAUUAACUUU
hsa-miR-5690 UCAGCUACUACCUCUAUUAGG UAAUAGAGGUAGUAGCUGAUU
hsa-miR-5691 UUGCUCUGAGCUCCGAGAAAGC UUUCUCGGAGCUCAGAGCAAUU
hsa-miR-5692a CAAAUAAUACCACAGUGGGUGU ACCCACUGUGGUAUUAUUUGUU
hsa-miR-5692b AAUAAUAUCACAGUAGGUGU ACCUACUGUGAUAUUAUUUU
hsa-miR-5692c AAUAAUAUCACAGUAGGUGUAC ACACCUACUGUGAUAUUAUUUU
hsa-miR-5693 GCAGUGGCUCUGAAAUGAACUC GUUCAUUUCAGAGCCACUGCUU
hsa-miR-5694 CAGAUCAUGGGACUGUCUCAG GAGACAGUCCCAUGAUCUGUU
hsa-miR-5695 ACUCCAAGAAGAAUCUAGACAG GUCUAGAUUCUUCUUGGAGUUU
hsa-miR-5696 CUCAUUUAAGUAGUCUGAUGCC CAUCAGACUACUUAAAUGAGUU
hsa-miR-5697 UCAAGUAGUUUCAUGAUAAAGG UUUAUCAUGAAACUACUUGAUU
hsa-miR-5698 UGGGGGAGUGCAGUGAUUGUGG ACAAUCACUGCACUCCCCCAUU
hsa-miR-5699 UCCUGUCUUUCCUUGUUGGAGC UGCCCCAACAAGGAAGGACAAG
hsa-miR-570 CGAAAACAGCAAUUACCUUUGC AAAGGUAAUUGCAGUUUUUCCC
hsa-miR-5700 UAAUGCAUUAAAUUAUUGAAGG UUCAAUAAUUUAAUGCAUUAUU
hsa-miR-5701 UUAUUGUCACGUUCUGAUU UCAGAACGUGACAAUAAUU
hsa-miR-5702 UGAGUCAGCAACAUAUCCCAUG UGGGAUAUGUUGCUGACUCAUU
hsa-miR-5703 AGGAGAAGUCGGGAAGGU CUUCCCGACUUCUCCUUU
hsa-miR-5704 UUAGGCCAUCAUCCCAUUAUGC AUAAUGGGAUGAUGGCCUAAUU
hsa-miR-5705 UGUUUCGGGGCUCAUGGCCUGUG CAGGCCAUGAGCCCCGAAACAUU
hsa-miR-5706 UUCUGGAUAACAUGCUGAAGCU CUUCAGCAUGUUAUCCAGAAUU
hsa-miR-5707 ACGUUUGAAUGCUGUACAAGGC CUUGUACAGCAUUCAAACGUUU
hsa-miR-5708 AUGAGCGACUGUGCCUGACC UCAGGCACAGUCGCUCAUUU
hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG CACUCAGAUGGCCAACUCAUU
hsa-miR-572 GUCCGCUCGGCGGUGGCCCA GGCCACCGCCGAGCGGACUU
hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG GAUCAGUUACACAUCACUUCAGUU
hsa-miR-5739 GCGGAGAGAGAAUGGGGAGC UCCCCAUUCUCUCUCCGCUU
hsa-miR-574 UGAGUGUGUGUGUGUGAGUGUGU CACGCUCAUGCACACACCCACA
hsa-miR-575 GAGCCAGUUGGACAGGAGC UCCUGUCCAACUGGCUCUU
hsa-miR-576 AAGAUGUGGAAAAAUUGGAAUC AUUCUAAUUUCUCCACGUCUUU
hsa-miR-577 UAGAUAAAAUAUUGGUACCUG GGUACCAAUAUUUUAUCUAUU
hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU AAUCCUAGAGCACAAGAAGUU
hsa-miR-5787 GGGCUGGGGCGCGGGGAGGU CUCCCCGCGCCCCAGCCCUU
hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU UCGCGGUUUGUGCCAGAUGACG
hsa-miR-580 UAAUGAUUCAUCAGACUCAGAU UUGAGAAUGAUGAAUCAUUAGG
hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU UGAUCUAGAGAACACAAGAUU
hsa-miR-582 UUACAGUUGUUCAACCAGUUACU UAACUGGUUGAACAACUGAACC
hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC AAUGGGACCUUCCUCUUUGUU
hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG UCAGUUCCAGGCCAACCAGGCU
hsa-miR-585 UGGGCGUAUCUGUAUGCUA CUAGCACACAGAUACGCCCAGA
hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC ACCUAAAAAUACAAUGCAUAUU
hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC GACUCAUCACCUAUGGAAAUU
hsa-miR-588 UUGGCCACAAUGGGUUAGAAC UCUAACCCAUUGUGGCCAAUU
hsa-miR-589 UCAGAACAAAUGCCGGUUCCCAGA UGAGAACCACGUCUGCUCUGAG
hsa-miR-590 GAGCUUAUUCAUAAAAGUGCAG UAAUUUUAUGUAUAAGCUAGU
hsa-miR-591 AGACCAUGGGUUCUCAUUGU AAUGAGAACCCAUGGUCUUU
hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU AUCAUCGCAUAUUGACACAAUU
hsa-miR-593 UGUCUCUGCUGGGGUUUCU AGGCACCAGCCAGGCAUUGCUCAGC
hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU ACACACCACGGCACACUUCUU
hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG CGAGGAGCCGGGCAGGCUUUU
hsa-miR-597 UGGUUCUCUUGUGGCUCAAGCGU UGUGUCACUCGAUGACCACUGU
hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA GCGGUGAUCCCGAUGGUGUGAGC
hsa-miR-599 GUUGUGUCAGUUUAUCAAAC UUGAUAAACUGACACAACUU
hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC GCAAGGCUCUUGUCUGUAAGUUU
hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG CCUCCAACAAUCCUAGACCAUU
hsa-miR-602 GACACGGGCGACAGCUGCGGCCC GCCGCAGCUGUCGCCCGUGUCUU
hsa-miR-603 CACACACUGCAAUUACUUUUGC AAAAGUAAUUGCAGUGUGUGUU
hsa-miR-604 AGGCUGCGGAAUUCAGGAC CCUGAAUUCCGCAGCCUUU
hsa-miR-605 AGAAGGCACUAUGAGAUUUAGA UAAAUCCCAUGGUGCCUUCUCCU
hsa-miR-606 AAACUACUGAAAAUCAAAGAU CUUUGAUUUUCAGUAGUUUUU
hsa-miR-6068 CCUGCGAGUCUCCGGCGGUGG ACCGCCGGAGACUCGCAGGUU
hsa-miR-6069 GGGCUAGGGCCUGCUGCCCCC GGGCAGCAGGCCCUAGCCCUU
hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC UAUAGAUCUGGAUUUGAACUU
hsa-miR-6070 CCGGUUCCAGUCCCUGGAG CCAGGGACUGGAACCGGUU
hsa-miR-6071 UUCUGCUGCCGGCCAAGGC CUUGGCCGGCAGCAGAAUU
hsa-miR-6072 UCCUCAUCACACUGCACCUUAG AAGGUGCAGUGUGAUGAGGAUU
hsa-miR-6073 GGUAGUGAGUUAUCAGCUAC AGCUGAUAACUCACUACCUU
hsa-miR-6074 GAUAUUCAGAGGCUAGGUGG ACCUAGCCUCUGAAUAUCUU
hsa-miR-6075 ACGGCCCAGGCGGCAUUGGUG CCAAUGCCGCCUGGGCCGUUU
hsa-miR-6076 AGCAUGACAGAGGAGAGGUGG ACCUCUCCUCUGUCAUGCUUU
hsa-miR-6077 GGGAAGAGCUGUACGGCCUUC AGGCCGUACAGCUCUUCCCUU
hsa-miR-6078 CCGCCUGAGCUAGCUGUGG ACAGCUAGCUCAGGCGGUU
hsa-miR-6079 UUGGAAGCUUGGACCAACUAGCUG GCUAGUUGGUCCAAGCUUCCAAUU
hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU GGAGCUGUCCCAACACCACCCCUUU
hsa-miR-6080 UCUAGUGCGGGCGUUCCCG GGAACGCCCGCACUAGAUU
hsa-miR-6081 AGGAGCAGUGCCGGCCAAGGCGCC CGCCUUGGCCGGCACUGCUCCUUU
hsa-miR-6082 GAAUACGUCUGGUUGAUCC AUCAACCAGACGUAUUCUU
hsa-miR-6083 CUUAUAUCAGAGGCUGUGGG CACAGCCUCUGAUAUAAGUU
hsa-miR-6084 UUCCGCCAGUCGGUGGCCGG GGCCACCGACUGGCGGAAUU
hsa-miR-6085 AAGGGGCUGGGGGAGCACA UGCUCCCCCAGCCCCUUUU
hsa-miR-6086 GGAGGUUGGGAAGGGCAGAG CUGCCCUUCCCAACCUCCUU
hsa-miR-6087 UGAGGCGGGGGGGCGAGC UCGCCCCCCCGCCUCAUU
hsa-miR-6088 AGAGAUGAAGCGGGGGGGCG CCCCCCCGCUUCAUCUCUUU
hsa-miR-6089 GGAGGCCGGGGUGGGGCGGGGCGG GCCCCGCCCCACCCCGGCCUCCUU
hsa-miR-609 AGGGUGUUUCUCUCAUCUCU AGAUGAGAGAAACACCCUUU
hsa-miR-6090 GGGGAGCGAGGGGCGGGGC CCCGCCCCUCGCUCCCCUU
hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA CCAGCACACAUUUAGCUCAUU
hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC CAGACCCCGAGGGGUCCUCGCUU
hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU GGAGCUCAGAAGCCCUGCCCAGCUU
hsa-miR-6124 GGGAAAAGGAAGGGGGAGGA CUCCCCCUUCCUUUUCCCUU
hsa-miR-6125 GCGGAAGGCGGAGCGGCGGA CGCCGCUCCGCCUUCCGCUU
hsa-miR-6126 GUGAAGGCCCGGCGGAGA UCCGCCGGGCCUUCACUU
hsa-miR-6127 UGAGGGAGUGGGUGGGAGG UCCCACCCACUCCCUCAUU
hsa-miR-6128 ACUGGAAUUGGAGUCAAAA UUGACUCCAAUUCCAGUUU
hsa-miR-6129 UGAGGGAGUUGGGUGUAUA UACACCCAACUCCCUCAUU
hsa-miR-613 AGGAAUGUUCCUUCUUUGCC CAAAGAAGGAACAUUCCUUU
hsa-miR-6130 UGAGGGAGUGGAUUGUAUG UACAAUCCACUCCCUCAUU
hsa-miR-6131 GGCUGGUCAGAUGGGAGUG CUCCCAUCUGACCAGCCUU
hsa-miR-6132 AGCAGGGCUGGGGAUUGCA CAAUCCCCAGCCCUGCUUU
hsa-miR-6133 UGAGGGAGGAGGUUGGGUA CCCAACCUCCUCCCUCAUU
hsa-miR-6134 UGAGGUGGUAGGAUGUAGA UACAUCCUACCACCUCAUU
hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG ACCUGGCAAGAACAGGCGUUCUU
hsa-miR-615 GGGGGUCCCCGGUGCUCGGAUC UCCGAGCCUGGGUCUCCCUCUU
hsa-miR-616 ACUCAAAACCCUUCAGUGACUU AGUCAUUGGAGGGUUUGAGCAG
hsa-miR-6165 CAGCAGGAGGUGAGGGGAG CCCCUCACCUCCUGCUGUU
hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC CACCUUCAAAUGGGAAGUCUUU
hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU UCAGAAGGACAAGUAGAGUUUUU
hsa-miR-619 GCUGGGAUUACAGGCAUGAGCC GACCUGGACAUGUUUGUGCCCAGU
hsa-miR-620 AUGGAGAUAGAUAUAGAAAU UUCUAUAUCUAUCUCCAUUU
hsa-miR-621 GGCUAGCAACAGCGCUUACCU GUAAGCGCUGUUGCUAGCCUU
hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC UCCAACCUCAGCAGACUGUUU
hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU CCAACAGCCCCUGCAAGGGAUUU
hsa-miR-624 UAGUACCAGUACCUUGUGUUCA CACAAGGUAUUGGUAUUACCU
hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC GACUAUAGAACUUUCCCCCUCA
hsa-miR-626 AGCUGUCUGAAAAUGUCUU GACAUUUUCAGACAGCUUU
hsa-miR-627 UCUUUUCUUUGAGACUCACU GUGAGUCUCUAAGAAAAGAGGA
hsa-miR-628 UCUAGUAAGAGUGGCAGUCGA AUGCUGACAUAUUUACUAGAGG
hsa-miR-629 UGGGUUUACGUUGGGAGAACU GUUCUCCCAACGUAAGCCCAGC
hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU CUUCCCUGGUACAGAAUACUUU
hsa-miR-631 AGACCUGGCCCAGACCUCAGC UGAGGUCUGGGCCAGGUCUUU
hsa-miR-632 GUGUCUGCUUCCUGUGGGA CCACAGGAAGCAGACACUU
hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA UAUUGUGGUAGAUACUAUUAGUU
hsa-miR-634 AACCAGCACCCCAACUUUGGAC CCAAAGUUGGGGUGCUGGUUUU
hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC ACAUUGUUUCAGUGCCCAAGUUU
hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA CGGGCGGGACGAGCAAGCACAUU
hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU GCAGAGCCCGAAAGCCCCCAGUUU
hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU GCCGCCACCCGCCCGCGAUCCCUUU
hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU AGCGCUCGCAACCGCAGCGAUUU
hsa-miR-640 AUGAUCCAGGAACCUGCCUCU AGGCAGGUUCCUGGAUCAUUU
hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC GGUGACUCUAUCCUAUGUCUUUUU
hsa-miR-642a GUCCCUCUCCAAAUGUGUCUUG AGACACAUUUGGAGAGGGAACC
hsa-miR-642b GGUUCCCUCUCCAAAUGUGUCU AGACACAUUUGGAGAGGGACCC
hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG ACCUGAGCUAGCAUACAAGUUU
hsa-miR-644a AGUGUGGCUUUCUUAGAGC UCUAAGAAAGCCACACUUU
hsa-miR-645 UCUAGGCUGGUACUGCUGA AGCAGUACCAGCCUAGAUU
hsa-miR-646 AAGCAGCUGCCUCUGAGGC CUCAGAGGCAGCUGCUUUU
hsa-miR-647 GUGGCUGCACUCACUUCCUUC AGGAAGUGAGUGCAGCCACUU
hsa-miR-648 AAGUGUGCAGGGCACUGGU CAGUGCCCUGCACACUUUU
hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC CUCUUGAACAACACAGGUUUUU
hsa-miR-6499 AGCAGUGUUUGUUUUGCCCACA UCGGGCGCAAGAGCACUGCAGU
hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC CCUGAGAGCGCUGCCUCCUUU
hsa-miR-6500 ACACUUGUUGGGAUGACCUGC AGGAGCUAUCCACUCCAGGUGUCC
hsa-miR-6501 CCAGAGCAGCCUGCGGUAACAGU AGUUGCCAGGGCUGCCUUUGGU
hsa-miR-6502 AGCUCUAGAAAGAUUGUUGACC UAGACCAUCUUUCUAGAGUAU
hsa-miR-6503 GGGACUAGGAUGCAGACCUCC AGGUCUGCAUUCAAAUCCCCAGA
hsa-miR-6504 CAUUACAGCACAGCCAUUCU UCUGGCUGUGCUGUAAUGCAG
hsa-miR-6505 UGACUUCUACCUCUUCCAAAG UUGGAAUAGGGGAUAUCUCAGC
hsa-miR-6506 ACUGGGAUGUCACUGAAUAUGGU UCGUAUCAGAGAUUCCAGACAC
hsa-miR-6507 CAAAGUCCUUCCUAUUUUUCCC GAAGAAUAGGAGGGACUUUGU
hsa-miR-6508 UCUAGAAAUGCAUGACCCACC UGGGCCAUGCAUUUCUAGAACU
hsa-miR-6509 AUUAGGUAGUGGCAGUGGAAC UUCCACUGCCACUACCUAAUUU
hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG AAAGGAAAGUGUAUCCUAAAAG
hsa-miR-6510 CAGCAGGGGAGAGAGAGGAGUC CACCGACUCUGUCUCCUGCAG
hsa-miR-6511a CAGGCAGAAGUGGGGCUGACAGG CCUCACCAUCCCUUCUGCCUGC
hsa-miR-6511b CUGCAGGCAGAAGUGGGGCUGACA CCUCACCACCCCUUCUGCCUGCA
hsa-miR-6512 UACCAUUAGAAGAGCUGGAAGA UUCCAGCCCUUCUAAUGGUAGG
hsa-miR-6513 UUUGGGAUUGACGCCACAUGUCU UCAAGUGUCAUCUGUCCCUAG
hsa-miR-6514 CUGCCUGUUCUUCCACUCCAG UAUGGAGUGGACUUUCAGCUGGC
hsa-miR-6515 UCUCUUCAUCUACCCCCCAG UUGGAGGGUGUGGAAGACAUC
hsa-miR-6516 UUUGCAGUAACAGGUGUGAGCA AUCAUGUAUGAUACUGCAAACA
hsa-miR-652 AAUGGCGCCACUAGGGUUGUG CAACCCUAGGAGAGGGUGCCAUUCA
hsa-miR-653 GUGUUGAAACAAUCUCUACUG UUCACUGGAGUUUGUUUCAAUA
hsa-miR-654 UGGUGGGCCGCAGAACAUGUGC UAUGUCUGCUGACCAUCACCUU
hsa-miR-655 AGAGGUUAUCCGUGUUAUGUUC AUAAUACAUGGUUAACCUCUUU
hsa-miR-656 AGGUUGCCUGUGAGGUGUUCA AAUAUUAUACAGUCAACCUCU
hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG UAGAGAGGGUGAGAACCUGCCUU
hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU CAACGGACCUACUUCCCUCCGCCUU
hsa-miR-659 AGGACCUUCCCUGAACCAAGGA CUUGGUUCAGGGAGGGUCCCCA
hsa-miR-660 ACCUCCUGUGUGCAUGGAUUA UACCCAUUGCAUAUCGGAGUUG
hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU GCGCAGGCCAGAGACCCAGGCAUU
hsa-miR-662 UCCCACGUUGUGGCCCAGCAG GCUGGGCCACAACGUGGGAUU
hsa-miR-663a AGGCGGGGCGCCGCGGGACCGC GGUCCCGCGGCGCCCCGCCUUU
hsa-miR-663b GGUGGCCCGGCCGUGCCUGAGG UCAGGCACGGCCGGGCCACCUU
hsa-miR-664a ACUGGCUAGGGAAAAUGAUUGGAU UAUUCAUUUAUCCCCAGCCUACA
hsa-miR-664b UUCAUUUGCCUCCCAGCCUACA UGGGCUAAGGGAGAUGAUUGGGUA
hsa-miR-665 ACCAGGAGGCUGAGGCCCCU GGGCCUCAGCCUCCUGGUUU
hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC UGCGCCUCGGGUGAGCAUG
hsa-miR-670 UUUCCUCAUAUUCAUUCAGGA GUCCCUGAGUGUAUGUGGUG
hsa-miR-671 UCCGGUUCUCAGGGCUCCACC AGGAAGCCCUGGAGGGGCUGGAG
hsa-miR-6715a CCAAACCAGUCGUGCCUGUGG ACAGGCACGACUGGUUUGGUU
hsa-miR-6715b CUCAAACCGGCUGUGCCUGUGG ACAGGCACGACUGGUUUGGCA
hsa-miR-6716 UGGGAAUGGGGGUAAGGGCC UCCGAACUCUCCAUUCCUCUGC
hsa-miR-6717 AGGCGAUGUGGGGAUGUAGAGA UCUACAUCCCCACAUCGCCUUU
hsa-miR-6718 UAGUGGUCAGAGGGCUUAUGA AUAAGCCCUCUGACCACUAUU
hsa-miR-6719 UCUGACAUCAGUGAUUCUCCUG GGAGAAUCACUGAUGUCAGAUU
hsa-miR-6720 UUCCAGCCCUGGUAGGCGCCGCG CGCGCCUGCAGGAACUGGUAGA
hsa-miR-6721 UGGGCAGGGGCUUAUUGUAGGAG CCUACAAUAAGCCCCUGCCCAUU
hsa-miR-6722 UGCAGGGGUCGGGUGGGCCAGG AGGCGCACCCGACCACAUGC
hsa-miR-6723 AUAGUCCGAGUAACGUCGGGGC CCCGACGUUACUCGGACUAUUU
hsa-miR-6724 CUGGGCCCGCGGCGGGCGUGGGG CCACGCCCGCCGCGGGCCCAGUU
hsa-miR-6726 CGGGAGCUGGGGUCUGCAGGU CUCGCCCUGUCUCCCGCUAG
hsa-miR-6727 UCCUGCCACCUCCUCCGCAG CUCGGGGCAGGCGGCUGGGAGCG
hsa-miR-6728 UCUCUGCUCUGCUCUCCCCAG UUGGGAUGGUAGGACCAGAGGGG
hsa-miR-6729 UCAUCCCCCUCGCCCUCUCAG UGGGCGAGGGCGGCUGAGCGGC
hsa-miR-6730 AGAAAGGUGGAGGGGUUGUCAGA CCUGACACCCCAUCUGCCCUCA
hsa-miR-6731 UGGGAGAGCAGGGUAUUGUGGA UCUAUUCCCCACUCUCCCCAG
hsa-miR-6732 UAGGGGGUGGCAGGCUGGCC UAACCCUGUCCUCUCCCUCCCAG
hsa-miR-6733 UCAGUGUCUGGAUUUCCUAG UGGGAAAGACAAACUCAGAGUU
hsa-miR-6734 CCCUUCCCUCACUCUUCUCUCAG UUGAGGGGAGAAUGAGGUGGAGA
hsa-miR-6735 AGGCCUGUGGCUCCUCCCUCAG CAGGGCAGAGGGCACAGGAAUCUGA
hsa-miR-6736 UCAGCUCCUCUCUACCCACAG CUGGGUGAGGGCAUCUGUGGU
hsa-miR-6737 UUGGGGUGGUCGGCCCUGGAG UCUGUGCUUCACCCCUACCCAG
hsa-miR-6738 CUUCUGCCUGCAUUCUACUCCCAG CGAGGGGUAGAAGAGCACAGGGG
hsa-miR-6739 AUUGUUCUGUCUUUCUCCCAG UGGGAAAGAGAAAGAACAAGUA
hsa-miR-6740 UGUCUUCUCUCCUCCCAAACAG AGUUUGGGAUGGAGAGAGGAGA
hsa-miR-6741 UCGGCUCUCUCCCUCACCCUAG GUGGGUGCUGGUGGGAGCCGUG
hsa-miR-6742 AGUGGGGUGGGACCCAGCUGUU ACCUGGGUUGUCCCCUCUAG
hsa-miR-6743 AAGGGGCAGGGACGGGUGGCCC AGCCGCUCUUCUCCCUGCCCACA
hsa-miR-6744 GGGCCUCUCUUGUCAUCCUGCAG UGGAUGACAGUGGAGGCCU
hsa-miR-6745 UGGGUGGAAGAAGGUCUGGUU CCAGACCUUCUUCCACCCAUU
hsa-miR-6746 CCGGGAGAAGGAGGUGGCCUGG CAGCCGCCGCCUGUCUCCACAG
hsa-miR-6747 UCCUGCCUUCCUCUGCACCAG AGGGGUGUGGAAAGAGGCAGAACA
hsa-miR-6748 UCCUGUCCCUGUCUCCUACAG UGUGGGUGGGAAGGACUGGAUU
hsa-miR-6749 UCGGGCCUGGGGUUGGGGGAGC CUCCUCCCCUGCCUGGCCCAG
hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG CUGUAUGCCCUCACCGCUCA
hsa-miR-6750 CAGGGAACAGCUGGGUGAGCUGCU GAACUCACCCUCUGCUCCCAG
hsa-miR-6751 UUGGGGGUGAGGUUGGUGUCUGG ACUGAGCCUCUCUCUCUCCAG
hsa-miR-6752 UCCCUGCCCCCAUACUCCCAG GGGGGGUGUGGAGCCAGGGGGC
hsa-miR-6753 UGGUCUGUCUCUGCCCUGGCAC CACCAGGGCAGAGCAGGGCUGA
hsa-miR-6754 UCUUCACCUGCCUCUGCCUGCA CCAGGGAGGCUGGUUUGGAGGA
hsa-miR-6755 UGUUGUCAUGUUUUUUCCCUAG UAGGGUAGACACUGACAACGUU
hsa-miR-6756 UCCCCUUCCUCCCUGCCCAG AGGGUGGGGCUGGAGGUGGGGCU
hsa-miR-6757 UAGGGAUGGGAGGCCAGGAUGA AACACUGGCCUUGCUAUCCCCA
hsa-miR-6758 ACUCAUUCUCCUCUGUCCAG UAGAGAGGGGAAGGAUGUGAUGU
hsa-miR-6759 UUGUGGGUGGGCAGAAGUCUGU UGACCUUUGCCUCUCCCCUCAG
hsa-miR-676 CUGUCCUAAGGUUGUUGAGUU UCUUCAACCUCAGGACUUGCA
hsa-miR-6760 CAGGGAGAAGGUGGAAGUGCAGA ACACUGUCCCCUUCUCCCCAG
hsa-miR-6761 UCUGAGAGAGCUCGAUGGCAG UCCUACGCUGCUCUCUCACUCC
hsa-miR-6762 CGGGGCCAUGGAGCAGCCUGUGU UGGCUGCUUCCCUUGGUCUCCAG
hsa-miR-6763 CUGGGGAGUGGCUGGGGAG CUCCCCGGCCUCUGCCCCCAG
hsa-miR-6764 UCUCUGGUCUUUCCUUGACAG UCCCAGGGUCUGGUCAGAGUUG
hsa-miR-6765 UCACCUGGCUGGCCCGCCCAG GUGAGGCGGGGCCAGGAGGGUGUGU
hsa-miR-6766 CGGGUGGGAGCAGAUCUUAUUGAG UGAUUGUCUUCCCCCACCCUCA
hsa-miR-6767 UCGCAGACAGGGACACAUGGAGA CCACGUGCUUCUCUUUCCGCAG
hsa-miR-6768 CAAAGGCCACAUUCUCCUGUGCAC CACACAGGAAAAGCGGGGCCCUG
hsa-miR-6769a GAGCCCCUCUCUGCUCUCCAG AGGUGGGUAUGGAGGAGCCCU
hsa-miR-6769b UGGUGGGUGGGGAGGAGAAGUGC CCCUCUCUGUCCCACCCAUAG
hsa-miR-6770 UGAGAAGGCACAGCUUGCACGUGA CUGGCGGCUGUGUCUUCACAG
hsa-miR-6771 CUCGGGAGGGCAUGGGCCAGGC CAAACCCCUGUCUACCCGCAG
hsa-miR-6772 UGGGUGUAGGCUGGAGCUGAGG UUGCUCCUGACUCUGUGCCCACA
hsa-miR-6773 ACUGUCACUUCUCUGCCCAUAG UUGGGCCCAGGAGUAAACAGGAU
hsa-miR-6774 ACUUGGGCAGGAGGGACCCUGUAUG UCGUGUCCCUCUUGUCCACAG
hsa-miR-6775 AGGCCCUGUCCUCUGCCCCAG UCGGGGCAUGGGGGAGGGAGGCUGG
hsa-miR-6776 UCUGGGUGCAGUGGGGGUU CAACCACCACUGUCUCUCCCCAG
hsa-miR-6777 UCCACUCUCCUGGCCCCCAG ACGGGGAGUCAGGCAGUGGUGGA
hsa-miR-6778 UGCCUCCCUGACAUUCCACAG AGUGGGAGGACAGGAGGCAGGU
hsa-miR-6779 AAGCCCUGUCUCCUCCCAUCU CUGGGAGGGGCUGGGUUUGGC
hsa-miR-6780a CUCCUCUGUUUUCUUUCCUAG UUGGGAGGGAAGACAGCUGGAGA
hsa-miR-6780b UCCCUUGUCUCCUUUCCCUAG UGGGGAAGGCUUGGCAGGGAAGA
hsa-miR-6781 CGGGCCGGAGGUCAAGGGCGU UGCCUCUUUUCCACGGCCUCAG
hsa-miR-6782 UAGGGGUGGGGGAAUUCAGGGGUGU CACCUUUGUGUCCCCAUCCUGCA
hsa-miR-6783 UUCCUGGGCUUCUCCUCUGUAG UAGGGGAAAAGUCCUGAUCCGG
hsa-miR-6784 UCUCACCCCAACUCUGCCCCAG GCCGGGGCUUUGGGUGAGGG
hsa-miR-6785 ACAUCGCCCCACCUUCCCCAG UGGGAGGGCGUGGAUGAUGGUG
hsa-miR-6786 UGACGCCCCUUCUGAUUCUGCCU GCGGUGGGGCCGGAGGGGCGU
hsa-miR-6787 UCUCAGCUGCUGCCCUCUCCAG UGGCGGGGGUAGAGCUGGCUGC
hsa-miR-6788 CUGGGAGAAGAGUGGUGAAGA UUCGCCACUUCCCUCCCUGCAG
hsa-miR-6789 CGGCGCCCGUGUCUCCUCCAG GUAGGGGCGUCCCGGGCGCGCGGG
hsa-miR-6790 GUGAGUGUGGAUUUGGCGGGGUU CGACCUCGGCGACCCCUCACU
hsa-miR-6791 CCCCUGGGGCUGGGCAGGCGGA UGCCUCCUUGGUCUCCGGCAG
hsa-miR-6792 CUCCUCCACAGCCCCUGCUCAU GUAAGCAGGGGCUCUGGGUGA
hsa-miR-6793 UGUGGGUUCUGGGUUGGGGUGA UCCCCAACCCCUGCCCGCAG
hsa-miR-6794 CAGGGGGACUGGGGGUGAGC CUCACUCUCAGUCCCUCCCU
hsa-miR-6795 UGGGGGGACAGGAUGAGAGGCUGU ACCCCUCGUUUCUUCCCCCAG
hsa-miR-6796 GAAGCUCUCCCCUCCCCGCAG UUGUGGGGUUGGAGAGCUGGCUG
hsa-miR-6797 UGCAUGACCCUUCCCUCCCCAC AGGAGGGAAGGGGCUGAGAACAGGA
hsa-miR-6798 CCAGGGGGAUGGGCGAGCUUGGG CUACCCCCCAUCCCCCUGUAG
hsa-miR-6799 GGGGAGGUGUGCAGGGCUGG UGCCCUGCAUGGUGUCCCCACAG
hsa-miR-6800 GUAGGUGACAGUCAGGGGCGG CACCUCUCCUGGCAUCGCCCC
hsa-miR-6801 UGGUCAGAGGCAGCAGGAAAUGA ACCCCUGCCACUCACUGGCC
hsa-miR-6802 UUCACCCCUCUCACCUAAGCAG CUAGGUGGGGGGCUUGAAGC
hsa-miR-6803 UCCCUCGCCUUCUCACCCUCAG CUGGGGGUGGGGGGCUGGGCGU
hsa-miR-6804 UGAGGGUGUCAGCAGGUGACG CGCACCUGCCUCUCACCCACAG
hsa-miR-6805 UUGCUCUGCUCCCCCGCCCCCAG UAGGGGGCGGCUUGUGGAGUGU
hsa-miR-6806 UGAAGCUCUGACAUUCCUGCAG UGUAGGCAUGAGGCAGGGCCCAGG
hsa-miR-6807 GUGAGCCAGUGGAAUGGAGAGG CACUGCAUUCCUGCUUGGCCCAG
hsa-miR-6808 CAGGCAGGGAGGUGGGACCAUG GUGUGACCACCGUUCCUGCAG
hsa-miR-6809 CUUCUCUUCUCUCCUUCCCAG UGGCAAGGAAAGAAGAGGAUCA
hsa-miR-6810 AUGGGGACAGGGAUCAGCAUGGC UCCCCUGCUCCCUUGUUCCCCAG
hsa-miR-6811 AGCCUGUGCUUGUCCCUGCAG AUGCAGGCCUGUGUACAGCACU
hsa-miR-6812 AUGGGGUGAGAUGGGGAGGAGCAGC CCGCUCUUCCCCUGACCCCAG
hsa-miR-6813 CAGGGGCUGGGGUUUCAGGUUCU AACCUUGGCCCCUCUCCCCAG
hsa-miR-6814 ACUCGCAUCCUUCCCUUGGCAG UCCCAAGGGUGAGAUGCUGCCA
hsa-miR-6815 UAGGUGGCGCCGGAGGAGUCAUU UGGCUUCUCUUGCACACCCAG
hsa-miR-6816 UGGGGCGGGGCAGGUCCCUGC GAAGGACCUGCACCUUCG
hsa-miR-6817 UCUGCCAUAGGAAGCUUGGAGUGG UCUCUCUGACUCCAUGGCA
hsa-miR-6818 UUGUGUGAGUACAGAGAGCAUC UUGUCUCUUGUUCCUCACACAG
hsa-miR-6819 UUGGGGUGGAGGGCCAAGGAGC AAGCCUCUGUCCCCACCCCAG
hsa-miR-6820 UGCGGCAGAGCUGGGGUCA UGUGACUUCUCCCCUGCCACAG
hsa-miR-6821 GUGCGUGGUGGCUCGAGGCGGGG UGACCUCUCCGCUCCGCACAG
hsa-miR-6822 AGGCUCUAACUGGCUUUCCCUGCA CAGGGAACCAGUUGGGGCUU
hsa-miR-6823 UCAGGGUUGGUAGGGGUUGCU UGAGCCUCUCCUUCCCUCCAG
hsa-miR-6824 GUAGGGGAGGUUGGGCCAGGGA UCUCUGGUCUUGCCACCCCAG
hsa-miR-6825 GCGCUGACCCGCCUUCUCCGCA UGGGGAGGUGUGGAGUCAGCAU
hsa-miR-6826 CUCCCCUCUCUUUCCUGUUCAG UCAAUAGGAAAGAGGUGGGACCU
hsa-miR-6827 UGGGAGCCAUGAGGGUCUGUGC ACCGUCUCUUCUGUUCCCCAG
hsa-miR-6828 AUCUGCUCUCUUGUUCCCAG AGGAAGCAAGAGAACCCUGUGG
hsa-miR-6829 UGGGCUGCUGAGAAGGGGCA UGCCUCCUCCGUGGCCUCAG
hsa-miR-6830 CCAAGGAAGGAGGCUGGACAUC UGUCUUUCUUCUCUCCCUUGCAG
hsa-miR-6831 UAGGUAGAGUGUGAGGAGGAGGUC UGACUAACUCCCACUCUACAG
hsa-miR-6832 AGUAGAGAGGAAAAGUUAGGGUC ACCCUUUUUCUCUUUCCCAG
hsa-miR-6833 UUUCUCUCUCCACUUCCUCAG GUGUGGAAGAUGGGAGGAGAAA
hsa-miR-6834 GUGAGGGACUGGGAUUUGUGG UAUGUCCCAUCCCUCCAUCA
hsa-miR-6835 AGGGGGUAGAAAGUGGCUGAAG AAAAGCACUUUUCUGUCUCCCAG
hsa-miR-6836 AUGCCUCCCCCGGCCCCGCAG CGCAGGGCCCUGGCGCAGGCAU
hsa-miR-6837 ACCAGGGCCAGCAGGGAAUGU CCUUCACUGUGACUCUGCUGCAG
hsa-miR-6838 AAGCAGCAGUGGCAAGACUCCU AAGUCCUGCUUCUGUUGCAG
hsa-miR-6839 UCUGGAUUGAAGAGACGACCCA UUGGGUUUUCUCUUCAAUCCAG
hsa-miR-6840 ACCCCCGGGCAAAGACCUGCAGAU GCCCAGGACUUUGUGCGGGGUG
hsa-miR-6841 UAGGGUACUCAGAGCAAGUUGU ACCUUGCAUCUGCAUCCCCAG
hsa-miR-6842 UGGGGGUGGUCUCUAGCCAAGG UUGGCUGGUCUCUGCUCCGCAG
hsa-miR-6843 AUGGUCUCCUGUUCUCUGCAG GCAGAGAACAGGAGACCAUUU
hsa-miR-6844 UUCUUUGUUUUUAAUUCACAG GUGAAUUAAAAACAAAGAAUU
hsa-miR-6845 CGGGGCCAGAGCAGAGAGC CCUCUCCUCCCUGUGCCCCAG
hsa-miR-6846 UGACCCCUUCUGUCUCCCUAG UGGGGGCUGGAUGGGGUAGAGU
hsa-miR-6847 GGCUCAUGUGUCUGUCCUCUUC ACAGAGGACAGUGGAGUGUGAGC
hsa-miR-6848 UGGGGGCUGGGAUGGGCCAUGGU GUGGUCUCUUGGCCCCCAG
hsa-miR-6849 ACCAGCCUGUGUCCACCUCCAG GAGUGGAUAGGGGAGUGUGUGGA
hsa-miR-6850 CCCGGCCGGAACGCCGCACU GUGCGGAACGCUGGCCGGGGCG
hsa-miR-6851 AGGAGGUGGUACUAGGGGCCAGC UGGCCCUUUGUACCCCUCCAG
hsa-miR-6852 CCCUGGGGUUCUGAGGACAUG UGUCCUCUGUUCCUCAG
hsa-miR-6853 AGCGUGGGAUGUCCAUGAAGUCAG UGUUCAUUGGAACCCUGCGCAG
hsa-miR-6854 UGCGUUUCUCCUCUUGAGCAG AAGCUCAGGUUUGAGAACUGCUGA
hsa-miR-6855 AGACUGACCUUCAACCCCACAG UUGGGGUUUGGGGUGCAGACAUUGC
hsa-miR-6856 UACAGCCCUGUGAUCUUUCCAG AAGAGAGGAGCAGUGGUGCUGUGG
hsa-miR-6857 UGACUGAGCUUCUCCCCACAG UUGGGGAUUGGGUCAGGCCAGU
hsa-miR-6858 CAGCCAGCCCCUGCUCACCCCU GUGAGGAGGGGCUGGCAGGGAC
hsa-miR-6859 UGACCCCCAUGUCGCCUCUGUAG GAGAGGAACAUGGGCUCAGGACA
hsa-miR-6860 ACUGGGCAGGGCUGUGGUGAGU UCACCACAGCCCUGCCCAGUUU
hsa-miR-6861 ACUGGGUAGGUGGGGCUCCAGG UGGACCUCUCCUCCCCAG
hsa-miR-6862 CCUCACCCAGCUCUCUGGCCCUCU CGGGCAUGCUGGGAGAGACUUU
hsa-miR-6863 UAGACGUGGUGAAGGAUUGAGUG CUCAAUCCUUCACCACGUCUAUU
hsa-miR-6864 UUGAAGGGACAAGUCAGAUAUGCC GUGAGACUUCUCUCCCUUCAG
hsa-miR-6865 ACACCCUCUUUCCCUACCGCC UAGGUGGCAGAGGAGGGACUUCA
hsa-miR-6866 GAUCCCUUUAUCUGUCCUCUAG UUAGAGGCUGGAAUAGAGAUUCU
hsa-miR-6867 UGUGUGUGUAGAGGAAGAAGGGA CUCUCCCUCUUUACCCACUAG
hsa-miR-6868 ACUGGCAGAACACUGAAGCAGC UUCCUUCUGUUGUCUGUGCAG
hsa-miR-6869 GUGAGUAGUGGCGCGCGGCGGC CGCCGCGCGCAUCGGCUCAGC
hsa-miR-6870 UGGGGGAGAUGGGGGUUGA GCUCAUCCCCAUCUCCUUUCAG
hsa-miR-6871 CAUGGGAGUUCGGGGUGGUUGC CAGCACCCUGUGGCUCCCACAG
hsa-miR-6872 CCCAUGCCUCCUGCCGCGGUC UCUCGCAUCAGGAGGCAAGG
hsa-miR-6873 UUCUCUCUGUCUUUCUCUCUCAG CAGAGGGAAUACAGAGGGCAAU
hsa-miR-6874 AUGGAGCUGGAACCAGAUCAGGC CAGUUCUGCUGUUCUGACUCUAG
hsa-miR-6875 UGAGGGACCCAGGACAGGAGA AUUCUUCCUGCCCUGGCUCCAU
hsa-miR-6876 AGCUGUCUGUGUUUUCCUUCUCAG CAGGAAGGAGACAGGCAGUUCA
hsa-miR-6877 CAGCCUCUGCCCUUGGCCUCC AGGGCCGAAGGGUGGAAGCUGC
hsa-miR-6878 CUGGCCUCUUCUUUCUCCUAG AGGGAGAAAGCUAGAAGCUGAAG
hsa-miR-6879 UGUCACCCGCUCCUUGCCCAG CAGGGCAGGGAAGGUGGGAGAG
hsa-miR-6880 UGGUGGAGGAAGAGGGCAGCUC CCGCCUUCUCUCCUCCCCCAG
hsa-miR-6881 AUCCUCUUUCGUCCUUCCCACU UGGGGUAAGGAUAGGAGGGUCA
hsa-miR-6882 UGCUGCCUCUCCUCUUGCCUGCAG UACAAGUCAGGAGCUGAAGCAG
hsa-miR-6883 UUCCCUAUCUCACUCUCCUCAG AGGGAGGGUGUGGUAUGGAUGU
hsa-miR-6884 CCCAUCACCUUUCCGUCUCCCCU AGAGGCUGAGAAGGUGAUGUUG
hsa-miR-6885 AGGGGGGCACUGCGCAAGCAAAGCC CUUUGCUUCCUGCUCCCCUAG
hsa-miR-6886 UGCCCUUCUCUCCUCCUGCCU CCCGCAGGUGAGAUGAGGGCU
hsa-miR-6887 UCCCCUCCACUUUCCUCCUAG UGGGGGGACAGAUGGAGAGGACA
hsa-miR-6888 AAGGAGAUGCUCAGGCAGAU AUCUGUCUCGAUUGUUUCCAG
hsa-miR-6889 UCGGGGAGUCUGGGGUCCGGAAU UCUGUGCCCCUACUUCCCAG
hsa-miR-6890 CCACUGCCUAUGCCCCACAG CAUGGGGUAGGGCAGAGUAGG
hsa-miR-6891 CCCUCAUCUUCCCCUCCUUUC UAAGGAGGGGGAUGAGGGG
hsa-miR-6892 GUAAGGGACCGGAGAGUAGGA UCCCUCUCCCACCCCUUGCAG
hsa-miR-6893 CCCUGCUGCCUUCACCUGCCAG CAGGCAGGUGUAGGGUGGAGC
hsa-miR-6894 UUGCCUGCCCUCUUCCUCCAG AGGAGGAUGGAGAGCUGGGCCAGA
hsa-miR-6895 CAGGGCCAGGCACAGAGUAAG UGUCUCUCGCCCUUGGCCUUAG
hsa-miR-7-1 UGGAAGACUAGUGAUUUUGUUGU CAACAAAUCACAGUCUGCCAUA
hsa-miR-7-2 UGGAAGACUAGUGAUUUUGUUGU CAACAAAUCCCAGUCUACCUAA
hsa-miR-708 CAACUAGACUGUGAGCUUCUAG AAGGAGCUUACAAUCUAGCUGGG
hsa-miR-7106 UGGGAGGAGGGGAUCUUGGG AGCUCCCUGAAUCCCUGUCCCAG
hsa-miR-7107 UCGGCCUGGGGAGGAGGAAGGG UGGUCUGUUCAUUCUCUCUUUUUGGCC
hsa-miR-7108 GUGUGGCCGGCAGGCGGGUGG ACCCGCCCGUCUCCCCACAG
hsa-miR-7109 CAAGCCUCUCCUGCCCUUCCAG CUGGGGGGAGGAGACCCUGCU
hsa-miR-711 GGGACCCAGGGAGAGACGUAAG UACGUCUCUCCCUGGGUCCCUU
hsa-miR-7110 UCUCUCUCCCACUUCCCUGCAG UGGGGGUGUGGGGAGAGAGAG
hsa-miR-7111 AUCCUCUCUUCCCUCCUCCCAG UGGGGGAGGAAGGACAGGCCAU
hsa-miR-7112 UGCAUCACAGCCUUUGGCCCUAG ACGGGCAGGGCAGUGCACCCUG
hsa-miR-7113 UCCAGGGAGACAGUGUGUGAG CCUCCCUGCCCGCCUCUCUGCAG
hsa-miR-7114 UGACCCACCCCUCUCCACCAG UCUGUGGAGUGGGGUGCCUGU
hsa-miR-7150 CUGGCAGGGGGAGAGGUA CCUCUCCCCCUGCCAGUU
hsa-miR-7151 GAUCCAUCUCUGCCUGUAUUGGC CUACAGGCUGGAAUGGGCUCA
hsa-miR-7152 UCUGGUCCUGGACAGGAGGC UUUCCUGUCCUCCAACCAGACC
hsa-miR-7153 CACCAUGGACGGUUUACC UGAGAACUGACAAAUGUGGUAGG
hsa-miR-7154 UUCAUGAACUGGGUCUAGCUUGG AGGAGGACAAGUUGUGGGAU
hsa-miR-7155 UGGCCCAAGACCUCAGACC UCUGGGGUCUUGGGCCAUC
hsa-miR-7156 CUGCAGCCACUUGGGGAACUGGU UUGUUCUCAAACUGGCUGUCAGA
hsa-miR-7157 UCUGUGCUACUGGAUGAAGAGU UCAGCAUUCAUUGGCACCAGAGA
hsa-miR-7158 GGCUCAAUCUCUGGUCCUGCAGCC CUGAACUAGAGAUUGGGCCCA
hsa-miR-7159 UUUCUAUGUUAGUUGGAAG UUCAACAAGGGUGUAGGAUGG
hsa-miR-7160 CAGGGCCCUGGCUUUAGCAGA UGCUGAGGUCCGGGCUGUGCC
hsa-miR-7161 UAAAGACUGUAGAGGCAACUGGU UAGAUCUUUGACUCUGGCAGUCUCCAGG
hsa-miR-7162 UCUGAGGUGGAACAGCAGC UGCUUCCUUUCUCAGCUG
hsa-miR-718 CUUCCGCCCCGCCGGGCGUCG ACGCCCGGCGGGGCGGAAGUU
hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA CUGUUGCCACUAACCUCAACCU
hsa-miR-7515 AGAAGGGAAGAUGGUGAC CACCAUCUUCCCUUCUUU
hsa-miR-758 UUUGUGACCUGGUCCACUAACC GAUGGUUGACCAGAGAGCACAC
hsa-miR-759 GCAGAGUGCAAACAAUUUUGAC CAAAAUUGUUUGCACUCUGCUU
hsa-miR-760 CGGCUCUGGGUCUGUGGGGA CCCACAGACCCAGAGCCGUU
hsa-miR-761 GCAGCAGGGUGAAACUGACACA UGUCAGUUUCACCCUGCUGCUU
hsa-miR-762 GGGGCUGGGGCCGGGGCCGAGC UCGGCCCCGGCCCCAGCCCCUU
hsa-miR-764 GCAGGUGCUCACUUGUCCUCCU GAGGACAAGUGAGCACCUGCUU
hsa-miR-7641 UUGAUCUCGGAAGCUAAGC UUAGCUUCCGAGAUCAAUU
hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG UCACCUUCCUUCUCCUCCAUU
hsa-miR-766 AGGAGGAAUUGGUGCUGGUCUU ACUCCAGCCCCACAGCCUCAGC
hsa-miR-767 UGCACCAUGGUUGUCUGAGCAUG UCUGCUCAUACCCCAUGGUUUCU
hsa-miR-769 CUGGGAUCUCCGGGGUCUUGGUU UGAGACCUCUGGGUUCUGAGCU
hsa-miR-770 UCCAGUACCACGUGUCAGGGCCA GCCCUGACACGUGGUACUGGAUU
hsa-miR-7702 CUUAGACUGCCAGACUCCCUGA AGGGAGUCUGGCAGUCUAAGUU
hsa-miR-7703 UUGCACUCUGGCCUUCUCCCAGG UGGGAGAAGGCCAGAGUGCAAUU
hsa-miR-7704 CGGGGUCGGCGGCGACGUG CGUCGCCGCCGACCCCGUU
hsa-miR-7705 AAUAGCUCAGAAUGUCAGUUCUG GAACUGACAUUCUGAGCUAUUUU
hsa-miR-7706 UGAAGCGCCUGUGCUCUGCCGAGA UCGGCAGAGCACAGGCGCUUCAUU
hsa-miR-7843 AUGAAGCCUUCUCUGCCUUACG GAGGGCAGAGCCAGCUUCCUGA
hsa-miR-7844 AAAACUAGGACUGUGUGGUGUA CACCACACAGUCCUAGUUUUUU
hsa-miR-7845 AAGGGACAGGGAGGGUCGUGG ACGACCCUCCCUGUCCCUUUU
hsa-miR-7846 CAGCGGAGCCUGGAGAGAAGG UUCUCUCCAGGCUCCGCUGUU
hsa-miR-7847 CGUGGAGGACGAGGAGGAGGC CUCCUCCUCGUCCUCCACGUU
hsa-miR-7848 CUACCCUCGGUCUGCUUACCACA UGGUAAGCAGACCGAGGGUAGUU
hsa-miR-7849 GACAAUUGUUGAUCUUGGGCCU GCCCAAGAUCAACAAUUGUCUU
hsa-miR-7850 GUUUGGACAUAGUGUGGCUGG AGCCACACUAUGUCCAAACUU
hsa-miR-7851 UACCUGGGAGACUGAGGUUGGA CAACCUCAGUCUCCCAGGUAUU
hsa-miR-7852 UAUGUAGUAGUCAAAGGCAUUU AUGCCUUUGACUACUACAUAUU
hsa-miR-7853 UCAAAUGCAGAUCCUGACUUC AGUCAGGAUCUGCAUUUGAUU
hsa-miR-7854 UGAGGUGACCGCAGAUGGGAA CCCAUCUGCGGUCACCUCAUU
hsa-miR-7855 UUGGUGAGGACCCCAAGCUCGG GAGCUUGGGGUCCUCACCAAUU
hsa-miR-7856 UUUUAAGGACACUGAGGGAUC UCCCUCAGUGUCCUUAAAAUU
hsa-miR-7973 UGUGACCCUAGAAUAAUUAC AAUUAUUCUAGGGUCACAUU
hsa-miR-7974 AGGCUGUGAUGCUCUCCUGAGCCC GCUCAGGAGAGCAUCACAGCCUUU
hsa-miR-7975 AUCCUAGUCACGGCACCA GUGCCGUGACUAGGAUUU
hsa-miR-7976 UGCCCUGAGACUUUUGCUC GCAAAAGUCUCAGGGCAUU
hsa-miR-7977 UUCCCAGCCAACGCACCA GUGCGUUGGCUGGGAAUU
hsa-miR-7978 UCUGGUGUAUAGCGUUGCUCA AGCAACGCUAUACACCAGAUU
hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU AAGGAUGAAUCUUUGUUACUGUU
hsa-miR-8052 CGGGACUGUAGAGGGCAUGAGC UCAUGCCCUCUACAGUCCCGUU
hsa-miR-8053 UGGCGAUUUUGGAACUCAAUGGCA CCAUUGAGUUCCAAAAUCGCCAUU
hsa-miR-8054 GAAAGUACAGAUCGGAUGGGU CCAUCCGAUCUGUACUUUCUU
hsa-miR-8055 CUUUGAGCACAUGAGCAGACGGA CGUCUGCUCAUGUGCUCAAAGUU
hsa-miR-8056 CGUGGAUUGUCUGGAUGCAU GCAUCCAGACAAUCCACGUU
hsa-miR-8057 GUGGCUCUGUAGUAAGAUGGA CAUCUUACUACAGAGCCACUU
hsa-miR-8058 CUGGACUUUGAUCUUGCCAUAA AUGGCAAGAUCAAAGUCCAGUU
hsa-miR-8059 GGGGAACUGUAGAUGAAAAGGC CUUUUCAUCUACAGUUCCCCUU
hsa-miR-8060 CCAUGAAGCAGUGGGUAGGAGGAC CCUCCUACCCACUGCUUCAUGGUU
hsa-miR-8061 CUUAGAUUAGAGGAUAUUGUU CAAUAUCCUCUAAUCUAAGUU
hsa-miR-8062 CAGUGAUUUGAGGAUUAUUGC AAUAAUCCUCAAAUCACUGUU
hsa-miR-8063 UCAAAAUCAGGAGUCGGGGCUU GCCCCGACUCCUGAUUUUGAUU
hsa-miR-8064 AGCACACUGAGCGAGCGGAC CCGCUCGCUCAGUGUGCUUU
hsa-miR-8065 UGUAGGAACAGUUGAAUUUUGGCU CCAAAAUUCAACUGUUCCUACAUU
hsa-miR-8066 CAAUGUGAUCUUUUGGAUGUA CAUCCAAAAGAUCACAUUGUU
hsa-miR-8067 CCUAGAAACUGUAAACUUAGUC CUAAGUUUACAGUUUCUAGGUU
hsa-miR-8068 UGUUUGUUGUAAGGAUCGUUGU AACGAUCCUUACAACAAACAUU
hsa-miR-8069 GGAUGGUUGGGGGCGGUCGGCGU GCCGACCGCCCCCAACCAUCCUU
hsa-miR-8070 AUGUGAUUGACGGCUGACUCCA GAGUCAGCCGUCAAUCACAUUU
hsa-miR-8071 CGGUGGACUGGAGUGGGUGG ACCCACUCCAGUCCACCGUU
hsa-miR-8072 GGCGGCGGGGAGGUAGGCAG GCCUACCUCCCCGCCGCCUU
hsa-miR-8073 ACCUGGCAGCAGGGAGCGUCGU GACGCUCCCUGCUGCCAGGUUU
hsa-miR-8074 CUAUGGCGAGACUGGCAUGUACUC GUACAUGCCAGUCUCGCCAUAGUU
hsa-miR-8075 UGCUGAUGGCAGAUGUCGGGUCUG GACCCGACAUCUGCCAUCAGCAUU
hsa-miR-8076 UAUAUGGACUUUUCUGAUACAAUG UUGUAUCAGAAAAGUCCAUAUAUU
hsa-miR-8077 GGCUGAGUGGGGUUCUGACUCC AGUCAGAACCCCACUCAGCCUU
hsa-miR-8078 GGUCUAGGCCCGGUGAGAGACUC GUCUCUCACCGGGCCUAGACCUU
hsa-miR-8079 CAGUGAUCGUCUCUGCUGGC CAGCAGAGACGAUCACUGUU
hsa-miR-8080 GAAGGACACUGGUGUCAACGGCU CCGUUGACACCAGUGUCCUUCUU
hsa-miR-8081 CUUGAGUCGUGCCUUUCUGAAUG UUCAGAAAGGCACGACUCAAGUU
hsa-miR-8082 UGAUGGAGCUGGGAAUACUCUG GAGUAUUCCCAGCUCCAUCAUU
hsa-miR-8083 CAGGACUUGACGGCUGCAACU UUGCAGCCGUCAAGUCCUGUU
hsa-miR-8084 GAAUACUAAGUAAAAAAUCAGUA CUGAUUUUUUACUUAGUAUUCUU
hsa-miR-8085 UGGGAGAGAGGACUGUGAGGC CUCACAGUCCUCUCUCCCAUU
hsa-miR-8086 UGCUAGUCUGGACUGAUAUGGU CAUAUCAGUCCAGACUAGCAUU
hsa-miR-8087 GAAGACUUCUUGGAUUACAGGGG CCUGUAAUCCAAGAAGUCUUCUU
hsa-miR-8088 CCUCGGUACUGGAAAGGGGUA CCCCUUUCCAGUACCGAGGUU
hsa-miR-8089 CCUGGGGACAGGGGAUUGGGGCAG GCCCCAAUCCCCUGUCCCCAGGUU
hsa-miR-8485 CACACACACACACACACGUAU ACGUGUGUGUGUGUGUGUGUU
hsa-miR-873 GCAGGAACUUGUGAGUCUCCU GGAGACUGAUGAGUUCCCGGGA
hsa-miR-874 CGGCCCCACGCACCAGGGUAAGA CUGCCCUGGCCCGAGGGACCGA
hsa-miR-875 UAUACCUCAGUUUUAUCAGGUG CCUGGAAACACUGAGGUUGUG
hsa-miR-876 UGGAUUUCUUUGUGAAUCACCA UGGUGGUUUACAAAGUAAUUCA
hsa-miR-877 UCCUCUUCUCCCUCCUCCCAG GUAGAGGAGAUGGCGCAGGG
hsa-miR-885 UCCAUUACACUACCCUGCCUCU AGGCAGCGGGGUGUAGUGGAUA
hsa-miR-887 CUUGGGAGCCCUGUUAGACUC GUGAACGGGCGCCAUCCCGAGG
hsa-miR-888 UACUCAAAAAGCUGUCAGUCA GACUGACACCUCUUUGGGUGAA
hsa-miR-889 AAUGGCUGUCCGUAGUAUGGUC UUAAUAUCGGACAACCAUUGU
hsa-miR-890 UACUUGGAAAGGCAUCAGUUG ACUGAUGCCUUUCCAAGUAUU
hsa-miR-891a AGUGGCACAUGUUUGUUGUGAG UGCAACGAACCUGAGCCACUGA
hsa-miR-891b UGCAACUUACCUGAGUCAUUGA AAUGACUCAGGUAAGUUGCAUU
hsa-miR-892a CACUGUGUCCUUUCUGCGUAG ACGCAGAAAGGACACAGUGUU
hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA UACCCAGAAAGGAGCCAGUGUU
hsa-miR-892c CACUGUUUCCUUUCUGAGUGGA UAUUCAGAAAGGUGCCAGUCA
hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA AUAAAGCUAGAUAACCGAAAGU
hsa-miR-920 GGGGAGCUGUGGAAGCAGUA CUGCUUCCACAGCUCCCCUU
hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC AUCCUGGUUCUGUCCCUCACUAGUU
hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC CGUAGUCCUAUUCUCUGCUGCUU
hsa-miR-924 AGAGUCUUGUGAUGUCUUGC AAGACAUCACAAGACUCUUU
hsa-miR-92a-1 UAUUGCACUUGUCCCGGCCUGU AGGUUGGGAUCGGUUGCAAUGCU
hsa-miR-92a-2 UAUUGCACUUGUCCCGGCCUGU GGGUGGGGAUUUGUUGCAUUAC
hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC AGGGACGGGACGCGGUGCAGUG
hsa-miR-93 ACUGCUGAGCUAGCACUUCCCG CAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC GAGAGGUCUCCCUGCGCACAUU
hsa-miR-934 UGUCUACUACUGGAGACACUGG AGUGUCUCCAGUAGUAGACAUU
hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC GGUAGCGGAAGCGGUAACUGGUU
hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG GCGAUUCCUCCCUCUACUGUUU
hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC GUGAGUCAGGGUGGGGCUGG
hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU UGGGUUCACCUUUAAGGGCAUU
hsa-miR-939 CCCUGGGCCUCUGCUCCCCAG UGGGGAGCUGAGGCUCUGGGGGUG
hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC GGAGCGGGGGCCCUGCCUUUU
hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC ACAUGUGCACACAGCCGGGUGUU
hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG CACAUGGCCGAAACAGAGAAGU
hsa-miR-943 CUGACUGUUGCCGUCCUCCAG GGAGGACGGCAACAGUCAGUU
hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG CAUCCGAUGUACAAUAAUUUUU
hsa-miR-95 UCAAUAAAUGUCUGUUGAAUU UUCAACGGGUAUUUAUUGAGCA
hsa-miR-9500 AAGGGAAGAUGGUGACCAC GGUCACCAUCUUCCCUUUU
hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU AAUCAUGUGCAGUGCCAAUAUG
hsa-miR-98 CUAUACAACUUACUACUUUCCC UGAGGUAGUAAGUUGUAUUGUU
hsa-miR-99a CAAGCUCGCUUCUAUGGGUCUG AACCCGUAGAUCCGAUCUUGUG
hsa-miR-99b CACCCGUAGAACCGACCUUGCG CAAGCUCGUGUCUGUGGGUCCG

Пример 2. Измерение активности образцов из библиотеки миРНК

Для того, чтобы определить, будут ли активными двухцепочечные миРНК, синтезированные в Примере 1, из библиотеки, состоящей примерно из 1700 различных миРНК, были отобраны miR-34a, miR-100 и miR-125b. Выбранные миРНК были отобраны потому, что имеется много исследований по целевым мРНК, функции и экспрессия которых должны контролироваться, а также по участкам, связывающимся с 3′-UTR мРНК. Участки 3′-UTR каждой из мРНК Bcl2, mTOR и Lin28b, экспрессия которых контролируется каждым из miR-34a, miR-100 и miR-125b, вставляли в 3′-UTR вектора люциферазы светлячков, получая при этом вектор, соответствующий каждой из миРНК. Каждый вектор и контрольный miR либо miR-34a, miR-100 или miR-125b, соответствующие каждому вектору, подвергали совместной трансфекции в клетки HEK-293T с помощью Lipofectamine 2000 (Lipofectamine 2000, Invitrogen), который является реагентом для внутриклеточной доставки олигонуклеотидов (в тройных повторах), и культивировали клетки в условиях 37°C и 5% (об/об) CO2 в течение 24 часов. Для определения активности синтезированных миРНК измеряли активность люциферазы на люминометре (Thermo Scientific) (фиг.1).

Пример 3. Скрининг для идентификации тех микроРНК, которые ингибируют пролиферацию раковых клеток легких

Вносили по ~3000-10000 клеток NCI-H460 в лунки 96-луночных планшетов и культивировали в условиях 37°C и 5% (об/об) CO2 в течение 24 часов, а затем эти клетки подвергали трансфекции каждой из миРНК, выбранных из библиотеки миРНК, при конечной концентрации 100 нМ, с помощью реагента RNAiMAX (Invitrogen). Поскольку трансфекцию каждой миРНК повторяли три раза, то готовили по три 96-луночных планшета на каждую миРНК. Далее клетки культивировали 24 часа в тех же условиях, что описаны выше, а затем измеряли значения флуоресценции, полученные при добавлении реагента Resazurin (Promega), на флуориметре (Tecan). Для сравнительной оценки способности миРНК ингибировать рост клеток рассчитывали среднее значение и стандартное отклонение из 96 значений, измеренных для 96-луночного планшета, а затем рассчитывали кратность стандартного отклонения (Z-score) измеряемой величины для каждой лунки (по каждой миРНК) от среднего значения по следующему уравнению:

где xi - значение, измеренное в данной лунке, μ - среднее из измеренных значений по всем лункам планшета, а σ - стандартное отклонение. Кратность стандартного отклонения zi для данной лунки есть среднее из значений, полученных для трех планшетов, причем сначала отбирали миРНК-кандидаты, проявляющие значения zi менее -2 (фиг. 2 и табл. 2).

Таблица 2. Последовательности первых отобранных миРНК

SEQ ID NO: 1 hsa-miR-23c 1-я нить AUCACAUUGCCAGUGAUUACCC
SEQ ID NO: 2 hsa-miR-23c 2-я нить GUAAUCACUGGCAAUGUGAUUU
SEQ ID NO: 3 hsa-miR-219b 1-я нить AGAUGUCCAGCCACAAUUCUCG
SEQ ID NO: 4 hsa-miR-219b 2-я нить AGAAUUGCGUUUGGACAAUCAGU
SEQ ID NO: 5 hsa-miR-378c 1-я нить ACUGGACUUGGAGUCAGAAGAGUGG
SEQ ID NO: 6 hsa-miR-378c 2-я нить ACUCUUCUGACUCCAAGUCCAGUUU
SEQ ID NO: 7 hsa-miR-548aa 1-я нить AAAAACCACAAUUACUUUUGCACCA
SEQ ID NO: 8 hsa-miR-548aa 2-я нить GUGCAAAAGUAAUUGUGGUUUUUUU
SEQ ID NO: 9 hsa-miR-548u 1-я нить CAAAGACUGCAAUUACUUUUGCG
SEQ ID NO: 10 hsa-miR-548u 2-я нить CAAAAGUAAUUGCAGUCUUUGUU
SEQ ID NO: 11 hsa-miR-571 1-я нить UGAGUUGGCCAUCUGAGUGAG
SEQ ID NO: 12 hsa-miR-571 2-я нить CACUCAGAUGGCCAACUCAUU
SEQ ID NO: 13 hsa-miR-641 1-я нить AAAGACAUAGGAUAGAGUCACCUC
SEQ ID NO: 14 hsa-miR-641 2-я нить GGUGACUCUAUCCUAUGUCUUUUU
SEQ ID NO: 15 hsa-miR-1244 1-я нить AAGUAGUUGGUUUGUAUGAGAUGGUU
SEQ ID NO: 16 hsa-miR-1244 2-я нить CCAUCUCAUACAAACCAACUACUUUU
SEQ ID NO: 17 hsa-miR-1248 1-я нить ACCUUCUUGUAUAAGCACUGUGCUAAA
SEQ ID NO: 18 hsa-miR-1248 2-я нить UAGCACAGUGCUUAUACAAGAAGGUUU
SEQ ID NO: 19 hsa-miR-1298 1-я нить CAUCUGGGCAACUGACUGAAC
SEQ ID NO: 20 hsa-miR-1298 2-я нить UUCAUUCGGCUGUCCAGAUGUA
SEQ ID NO: 21 hsa-miR-2392 1-я нить UAGGAUGGGGGUGAGAGGUG
SEQ ID NO: 22 hsa-miR-2392 2-я нить CCUCUCACCCCCAUCCUAUU
SEQ ID NO: 23 hsa-miR-3119 1-я нить UGGCUUUUAACUUUGAUGGC
SEQ ID NO: 24 hsa-miR-3119 2-я нить CAUCAAAGUUAAAAGCCAUU
SEQ ID NO: 25 hsa-miR-3164 1-я нить UGUGACUUUAAGGGAAAUGGCG
SEQ ID NO: 26 hsa-miR-3164 2-я нить CCAUUUCCCUUAAAGUCACAUU
SEQ ID NO: 27 hsa-miR-3188 1-я нить AGAGGCUUUGUGCGGAUACGGGG
SEQ ID NO: 28 hsa-miR-3188 2-я нить CCGUAUCCGCACAAAGCCUCUUU
SEQ ID NO: 29 hsa-miR-3609 1-я нить CAAAGUGAUGAGUAAUACUGGCUG
SEQ ID NO: 30 hsa-miR-3609 2-я нить GCCAGUAUUACUCAUCACUUUGUU
SEQ ID NO: 31 hsa-miR-3612 1-я нить AGGAGGCAUCUUGAGAAAUGGA
SEQ ID NO: 32 hsa-miR-3612 2-я нить CAUUUCUCAAGAUGCCUCCUUU
SEQ ID NO: 33 hsa-miR-3662 1-я нить GAAAAUGAUGAGUAGUGACUGAUG
SEQ ID NO: 34 hsa-miR-3662 2-я нить UCAGUCACUACUCAUCAUUUUCUU
SEQ ID NO: 35 hsa-miR-3670 1-я нить AGAGCUCACAGCUGUCCUUCUCUA
SEQ ID NO: 36 hsa-miR-3670 2-я нить GAGAAGGACAGCUGUGAGCUCUUU
SEQ ID NO: 37 hsa-miR-3943 1-я нить UAGCCCCCAGGCUUCACUUGGCG
SEQ ID NO: 38 hsa-miR-3943 2-я нить CCAAGUGAAGCCUGGGGGCUAUU
SEQ ID NO: 39 hsa-miR-4424 1-я нить AGAGUUAACUCAAAAUGGACUA
SEQ ID NO: 40 hsa-miR-4424 2-я нить GUCCAUUUUGAGUUAACUCUUU
SEQ ID NO: 41 hsa-miR-4461 1-я нить GAUUGAGACUAGUAGGGCUAGGC
SEQ ID NO: 42 hsa-miR-4461 2-я нить CUAGCCCUACUAGUCUCAAUCUU
SEQ ID NO: 43 hsa-miR-4477a 1-я нить CUAUUAAGGACAUUUGUGAUUC
SEQ ID NO: 44 hsa-miR-4477a 2-я нить AUCACAAAUGUCCUUAAUAGUU
SEQ ID NO: 45 hsa-miR-4477b 1-я нить AUUAAGGACAUUUGUGAUUGAU
SEQ ID NO: 46 hsa-miR-4477b 2-я нить CAAUCACAAAUGUCCUUAAUUU
SEQ ID NO: 47 hsa-miR-4765 1-я нить UGAGUGAUUGAUAGCUAUGUUC
SEQ ID NO: 48 hsa-miR-4765 2-я нить ACAUAGCUAUCAAUCACUCAUU
SEQ ID NO: 49 hsa-miR-4773 1-я нить CAGAACAGGAGCAUAGAAAGGC
SEQ ID NO: 50 hsa-miR-4773 2-я нить CUUUCUAUGCUCCUGUUCUGUU
SEQ ID NO: 51 hsa-miR-4776 1-я нить GUGGACCAGGAUGGCAAGGGCU
SEQ ID NO: 52 hsa-miR-4776 2-я нить CUUGCCAUCCUGGUCCACUGCAU
SEQ ID NO: 53 hsa-miR-4999 1-я нить UGCUGUAUUGUCAGGUAGUGA
SEQ ID NO: 54 hsa-miR-4999 2-я нить UCACUACCUGACAAUACAGU
SEQ ID NO: 55 hsa-miR-5096 1-я нить GUUUCACCAUGUUGGUCAGGC
SEQ ID NO: 56 hsa-miR-5096 2-я нить CUGACCAACAUGGUGAAACUU
SEQ ID NO: 57 hsa-miR-5697 1-я нить UCAAGUAGUUUCAUGAUAAAGG
SEQ ID NO: 58 hsa-miR-5697 2-я нить UUUAUCAUGAAACUACUUGAUU
SEQ ID NO: 59 hsa-miR-5705 1-я нить UGUUUCGGGGCUCAUGGCCUGUG
SEQ ID NO: 60 hsa-miR-5705 2-я нить CAGGCCAUGAGCCCCGAAACAUU
SEQ ID NO: 61 hsa-miR-5707 1-я нить ACGUUUGAAUGCUGUACAAGGC
SEQ ID NO: 62 hsa-miR-5707 2-я нить CUUGUACAGCAUUCAAACGUUU
SEQ ID NO: 63 hsa-miR-8053 1-я нить UGGCGAUUUUGGAACUCAAUGGCA
SEQ ID NO: 64 hsa-miR-8053 2-я нить CCAUUGAGUUCCAAAAUCGCCAUU
SEQ ID NO: 65 hsa-miR-8078 1-я нить GGUCUAGGCCCGGUGAGAGACUC
SEQ ID NO: 66 hsa-miR-8078 2-я нить GUCUCUCACCGGGCCUAGACCUU

Пример 4. Второй скрининг для идентификации тех миРНК, которые ингибируют пролиферацию раковых клеток легких

Используя около 50 миРНК-кандидатов, полученных при первом скрининге, проводили второй скрининг с повышенной точностью измерения. Эксперимент проводили в тех же условиях, что и первый скрининг, за исключением того, что вместо реагента Resazurin для измерения потенциала пролиферации клеток использовали реагент WST-1 (Roche). WST-1 обладает преимуществом перед ресазурином в том, что можно более точно количественно измерить интенсивность сигналов. Значения, полученные при измерении способности каждой миРНК ингибировать пролиферацию клеток, выражали в виде относительных значений по сравнению с контролем, а результаты представлены на фиг. 3. В качестве положительного контроля использовали miR-34a.

Пример 5. Анализ способности индуцировать апоптоз клеток

Метод, используемый при скрининге, заключается в измерении относительного ингибирования пролиферации клеток путем количественного измерения количества клеток. Механизмы ингибирования пролиферации клеток включают снижение скорости деления клеток и индуцирование апоптоза. Для анализа механизма, по которому миРНК, выявленные в настоящем изобретении, ингибируют пролиферацию клеток, анализировали степень апоптоза методом активируемой флуоресценцией сортировки клеток (FACS). В частности, в 6-луночные планшеты вносили клетки и трансфицировали в них миРНК с помощью реагента RNAiMAX, а затем культивировали клетки в тех же условиях, что описаны выше, в течение 48 часов. Далее клетки обрабатывали FITC-меченым Annexin V и анализировали на активируемом флуоресценцией сортировщике клеток (FACS) (фиг. 4). Результаты анализа показали, что клетки, обработанные каждой из miR-3670, miR-4477a и miR-8078, в основном погибли. Это говорит о том, что эффект ингибирования роста опухолевых клеток миРНК, идентифицированными при скрининге, является результатом индукции апоптоза (табл. 3).

Таблица 3. Последовательности окончательно отобранных миРНК

SEQ ID NO: 35 hsa-miR-3670 1-я нить AGAGCUCACAGCUGUCCUUCUCUA
SEQ ID NO: 36 hsa-miR-3670 2-я нить GAGAAGGACAGCUGUGAGCUCUUU
SEQ ID NO: 67 miR-3670-IC IC GACUGGUAUAGCUGCUUUUGGAGCCUCA
SEQ ID NO: 43 hsa-miR-4477a 1-я нить CUAUUAAGGACAUUUGUGAUUC
SEQ ID NO: 44 hsa-miR-4477a 2-я нить AUCACAAAUGUCCUUAAUAGUU
SEQ ID NO: 68 miR-4477a-IC IC AUCACAAAUGUCCUUAAUGGCA
SEQ ID NO: 65 hsa-miR-8078 1-я нить GGUCUAGGCCCGGUGAGAGACUC
SEQ ID NO: 66 hsa-miR-8078 2-я нить GUCUCUCACCGGGCCUAGACCUU
SEQ ID NO: 69 miR-8078-IC IC CUCCACCGGGCUGACCGGCCUG

Пример 6. Ингибирование миРНК роста опухолевых клеток на мягком агаре

При культивировании опухолевых клеток на мягком агаре можно определить характеристики опухолевых клеток. Нормальные клетки требуют подложки типа культуральной чашки для роста, тогда как опухолевые клетки отличаются тем, что растут даже в такой среде, как мягкий агар, который не имеет физически сильной опоры. Используя эту характерную для опухолей особенность, исследовали колониеобразующую способность клеток на мягком агаре. Раковые клетки легких NCI-H460 обрабатывали контрольной miRNA и каждой из miR-34a, miR-8078, miR-3670, miR-4477a и miR-4765 и культивировали в течение 24 часов. Затем клетки смешивали с мягким агаром и культивировали в 6-луночных планшетах в течение 2 недель. Клетки окрашивали кристаллическим фиолетовым и измеряли количество колоний в каждой группе (фиг. 5). При этом видно, что клетки, обработанные miR-8078 или miR-3670, почти или совсем не образовывали колоний, а клетки, обработанные miR-4477a, проявляли колониеобразующую способность, равную примерно 30% от контрольной группы.

Пример 7. Измерение ингибирующего эффекта миРНК на пролиферацию клеток после нокдауна целевой мРНК

мРНК мишени, экспрессия которой контролируется миРНК, имеет последовательность, комплементарную части последовательности миРНК. Для ингибирования мРНК особенно важна последовательность посадочного участка миРНК, так как последовательность посадочного участка связывается с мРНК, содержащей комплементарную ей последовательность, и ингибирует экспрессию гена. Однако, поскольку последовательность посадочного участка сравнительно короткая (8-9 нуклеотидов), то мРНК, которые являются мишенями миРНК, можно предсказать с помощью компьютерной программы. Однако известно, что даже при использовании компьютерных программ лишь некоторые из предсказанных мишеней являются существенными. Чтобы преодолеть этот недостаток, уменьшали внутриклеточное содержание генов-мишеней, предсказанных программой, с помощью киРНК, а затем определяли, будет ли ингибироваться рост клеток, тем самым отбирая целевые гены. Для прогнозирования целевых мРНК, которые должны быть мишенями миРНК, использовали программу TargetScan, которая обычно применяется в данной области для прогнозирования мишеней, и отобрали около 600 различных генов, которые были предсказаны как мишени miR-3670, miR-4477a или miR-8078. Для каждого из отобранных генов синтезировали 3 различных киРНК и проводили эксперимент таким же образом, как описано в примере 3, используя синтезированные киРНК. В частности, в 96-луночные планшеты вносили клетки, обрабатывали их каждой из киРНК, а затем культивировали в течение 48 часов, после чего измеряли пролиферационную способность клеток с помощью ресазурина. Таким же образом, как описано в примере 3, рассчитывали Z-показатели каждого гена из средних значений, измеренных для всех 1800 образцов (около 600 генов × три разных киРНК). Результаты представлены на фиг. 6.

Пример 8. Анализ мРНК, являющихся мишенями миРНК

миРНК действуют, ингибируя образование белка из мРНК и вызывая деградацию большинства мРНК-мишеней. Итак, в клетки трансфицируют миРНК и методом кПЦР анализируют внутриклеточное содержание тех мРНК, которые должны быть мишенями миРНК, определяя, будет ли уменьшаться их содержание, тем самым определяя, будет ли данная мРНК мишенью этой миРНК. Для того, чтобы определить, будет ли при введении в клетки миРНК существенно снижаться внутриклеточное содержание генов-мишеней, обнаруженных в примере 7, каждую из miR-3670, miR-4477a и miR-8078 трансфицировали в раковые клетки легких, которые затем культивировали в течение 48 часов, после чего из каждых клеток экстрагировали РНК и количественно измеряли содержание РНК в клетках (фиг. 7). При этом видно, что содержание тех мРНК, которые были предсказаны как мишени miR-3670, miR-4477a или miR-8078, значительно снижалось.

Пример 9. Исследование мРНК-мишеней люциферазным методом

миРНК связывается с 3′-UTR (нетранслируемой областью) мРНК-мишени и ингибирует образование белка из данной мРНК. Поэтому для прямого измерения взаимосвязи между миРНК и целевой мРНК обычно применяется люциферазный метод. По программе TargetScan была получена последовательность 3′-UTR, содержащая последовательность, связывающую миРНК. Для конструирования вектора последовательность 3′-UTR клонировали в 3'-UTR люциферазы светлячков, как описано выше в Примере 2. Полученный вектор и миРНК подвергали совместной трансфекции в эмбриональные клетки почек человека (HEK) и измеряли уровень экспрессии люциферазы вектора. Для коррекции на эффективность трансфекции также подвергали трансфекции люциферазу морской фиалки. После совместной трансфекции миРНК, люциферазы светлячков и люциферазы морской фиалки клетки культивировали в течение 48 часов, а затем измеряли люциферазную активность клеток на люминометре (фиг. 9). При этом видно, что целевая мРНК контролируется непосредственно соответствующей миРНК.

Промышленная применимость

Как описано выше, фармацевтическая композиция для лечения рака по настоящему изобретению содержит в качестве активного ингредиента одну или несколько миРНК, выбранных из группы, состоящей из miR-3670, miR-4477a и miR-8078. Фармацевтическая композиция настоящего изобретения проявляет лучшие противораковые эффекты по сравнению с miR-34a, которая в настоящее время проходит клинические испытания для определения пригодности в качестве противоракового средства, и другими фармацевтическими композициями для лечения рака, содержащими другие миРНК в качестве активных ингредиентов. Таким образом, фармацевтическая композиция настоящего изобретения может широко применяться в качестве противораковой композиции.

Хотя настоящее изобретение было подробно описано на конкретных примерах, однако специалистам в данной области должно быть ясно, что это описание приводится только для предпочтительного воплощения и не ограничивает объем настоящего изобретения. Таким образом, существенный объем настоящего изобретения будет определяться прилагаемой формулой изобретения и её эквивалентами.

1. Фармацевтическая композиция для лечения рака, которая включает в качестве активного ингредиента одну или несколько миРНК, выбранных из группы, состоящей из miR-3670 и miR-8078, где miR-3670 включает двухцепочечную РНК, представленную нуклеотидными последовательностями SEQ ID NO: 35 и SEQ ID NO: 36, и miR-8078 включает двухцепочечную РНК, представленную нуклеотидными последовательностями SEQ ID NO: 65 и SEQ ID NO: 66.

2. Фармацевтическая композиция по п. 1, где миРНК индуцирует апоптоз раковых клеток при лечении рака.

3. Фармацевтическая композиция по п. 1, где рак представляет собой одно или несколько раковых заболеваний, выбранных из группы, состоящей из первичного рака типа рака легких, рака печени, рака желудка, колоректального рака, рака поджелудочной железы, рака желчного пузыря и желчных протоков, рака молочной железы, лейкемии, рака пищевода, неходжкинской лимфомы, рака щитовидной железы, рака шейки матки или рака кожи, метастатической карциномы, возникающей при метастазировании в другие органы из исходного места первичного рака, и неопластических заболеваний, вызванных аномально чрезмерным усилением деления клеток.

4. Фармацевтическая композиция по любому из пп. 1-3, где миРНК представляет собой миметик миРНК, где миметик миРНК выбран из группы, состоящей из миРНК, частично включающей фосфоротиоатную структуру, в которой фосфат каркасной структуры РНК замещен другим элементом, таким как сера, и миРНК, в которой 2’-гидроксильная группа сахара РНК замещена различными функциональными структурами, такими как метилирование, метоксилирование или фторирование.



 

Похожие патенты:

Изобретение относится к медицине, а именно к пульмонологии, и касается лечения состояния, поддающегося облегчению путем ингибирования активности лейкотриен-А4-гидролазы у пациента-человека.

Изобретение относится к А-секотритерпеноидам общей формулы I. Технический результат: получены новые А-секотритерпеноиды, проявляющие цитотоксическую активность в отношении опухолевых клеток линий НСТ 116 (колоректальная карцинома), MS (меланома), RD ТЕ32 (рабдомиосаркома).

Настоящее изобретение относится к применению конъюгата антитело-лекарственное средство (ADC) формулы II для лечения солидных опухолей человека, экспрессирующих HER2, где солидная опухоль человека, экспрессирующая HER2, представляет собой рак эндометрия, в частности серозную карциному эндометрия (USC).

Изобретение относится к области генной инженерии, конкретно к получению рекомбинантных полипептидов аденовируса, и может быть использовано в медицине для увеличения эффективности терапевтического лечения солидной опухоли, экспрессирующей десмоглеин 2 (DSG2).

Изобретение относится к области биотехнологии, конкретно к получению вариантов дизинтегрина, и может быть использовано в медицине для лечения связанного с интегрином заболевания, выбранного из возрастной макулярной дегенерации, диабетической ретинопатии, роговичных неоваскуляризирующих заболеваний, индуцированной ишемией неоваскуляризированной ретинопатии, высокой миопии, ретинопатии недоношенных, метастатической меланомы, метастатического рака предстательной железы, метастатического рака молочной железы, колоректального рака, рака печени, рака яичников, рака шейки матки, рака поджелудочной железы, немелкоклеточного рака легких и мультиформной глиобластомы.

Изобретение относится к медицине, а именно к онкологии. После предварительного ангиографического исследования и выявления «целевых» сосудов, кровоснабжающих опухоль, на первом этапе лечения проводят суперселективную внутриартериальную химиотерапию, максимально насыщая зону опухоли химиопрепаратом.

Группа изобретений относится к медицине и касается способа ингибирования метастатической опухоли, ассоциированной с васкулогенной мимикрией, включающего введение субъекту, нуждающемуся в этом, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли.

Группа изобретений относится к области фармацевтики. Первое изобретение представляет собой конъюгат лиганд-цитотоксическое лекарственное средство со структурной формулой .Также группа изобретений включает способ получения указанного конъюгата, содержащего его фармацевтическую композицию, применение указанного конъюгата или композиции для получения лекарственного препарата для лечения рака, способ модулирования рецептора in vitro и способ лечения рака.

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для лечения ранней стадии рака со сверхэкспрессией/амплификацией HER-2/neu. Для этого пациенту после завершения одного года адъювантной терапии трастузумабом вводят нератиниб.

Настоящее изобретение относится к иммунологии. Предложен химерный антигенный рецептор (CAR), который содержит дисиалоганглиозид (GD2)-связывающий домен.

Изобретение относится к области молекулярной генетики, биотехнологии и медицины. Предложен рекомбинантный вектор для создания плазмидных генетических конструкций, обладающих повышенной длительностью экспрессии целевых генов, содержащий гексамер модифицированного S/MAR элемента из человеческого гена IFNβ и сниженное до 13 число CpG динуклеотидов, нуклеотидная последовательность которого представлена в SEQ ID NO 1.

Настоящее изобретение относится к генной инженерии. Предложен способ in vitro модификации генома в представляющем интерес геномном локусе в нечеловеческой плюрипотентной клетке млекопитающего, включающий внесение в клетку компонентов системы CRISPR/Cas9 в комбинации с крупным направляющим вектором (LTVEC), который составляет по меньшей мере 10 т.п.о.

Изобретение относится к области биотехнологии, конкретно к химерным антигенным рецепторам (CAR), и может быть использовано в медицине для лечения заболевания плазматических клеток, которые характеризуются экспрессией антигена созревания B-клеток (BCMA) и рецептора трансмембранного активатора, модулятора кальция и активатора лиганда циклофилина (TACI).

Изобретение относится к области медицины и предназначено для лечения спинальной мышечной атрофии (СМА). Способ включает введение посредством болюсной инъекции в интратекальное пространство субъекта, являющегося человеком, антисмыслового соединения, содержащего антисмысловой олигонуклеотид, состоящий из 18 связанных нуклеозидов, где каждая межнуклеозидная связь олигонуклеотида представляет собой фосфоротиоатную связь, где каждый нуклеозид олигонуклеотида представляет собой 2'-МОЭ нуклеозид и где введение антисмыслового соединения усиливает включение экзона 7 в SMN2 мРНК транскриптах у субъекта, являющегося человеком.

Изобретение относится к биотехнологии. Описан вектор на основе аденоассоциированного вируса (AAV) для доставки субъекту гетерологичной последовательности нуклеиновой кислоты, содержащей капсидный белок VP1, который содержит одну или несколько замен лизина, где одна замена лизина представляет K137R.

Изобретение относится к области медицины. Предложено применение ингибитора EGFR в лечении немелкоклеточного рака легкого, вызванного мутировавшим NRAS, где ингибитор EGFR вводят в комбинации с ингибитором МЕК и мутация NRAS выбрана из Е63К, G12V и G12R или роста копийности гена NRAS.

Группа изобретений относится к медицине, в частности к применению флагеллина Roseburia, и/или полинуклеотидной последовательности, кодирующей указанный флагеллин Roseburia, и/или вектора, содержащего указанную полинуклеотидную последовательность, и/или клетки-хозяина, включающей бактерии, содержащей указанный вектор, и/или клетки-хозяина, включающей бактерии, содержащей указанную полинуклеотидную последовательность, для снижения воспаления у индивидуума.
Изобретение относится к области медицины. Предложен способ регенерации нервных волокон кровеносных сосудов генным стимулированием ангиогенеза.

Изобретение относится к фармацевтической промышленности, а именно к способу уменьшения продуцирующих внеклеточный матрикс клеток в легких или подавления увеличения продуцирующих внеклеточный матрикс клеток в легких (варианты) и к композиции для уменьшения продуцирующих внеклеточный матрикс клеток в легких или подавления увеличения продуцирующих внеклеточный матрикс клеток в легких.

Группа изобретений относится к медицине и касается средства для лечения состояний клеток различных органов и тканей, а также собственно органов и тканей человека, связанных с уменьшением экспрессии гена PROK 2 и/или уменьшением количества белка прокинетицина 2, на основе генно-терапевтических субстанций с геном PROK 2, представляющего собой, по крайней мере, одну генно-терапевтическую субстанцию, выбранную из группы генно-терапевтических субстанций, каждая из которых представляет генетическую конструкцию на основе векторной плазмиды, включающей кДНК гена PROK2, с кодирующей последовательностью белка прокинетицина 2.

Изобретение относится к области медицины и предназначено для лечения спинальной мышечной атрофии (СМА). Способ включает введение посредством болюсной инъекции в интратекальное пространство субъекта, являющегося человеком, антисмыслового соединения, содержащего антисмысловой олигонуклеотид, состоящий из 18 связанных нуклеозидов, где каждая межнуклеозидная связь олигонуклеотида представляет собой фосфоротиоатную связь, где каждый нуклеозид олигонуклеотида представляет собой 2'-МОЭ нуклеозид и где введение антисмыслового соединения усиливает включение экзона 7 в SMN2 мРНК транскриптах у субъекта, являющегося человеком.

Изобретение относится к области медицины. Предложена фармацевтическая композиция для лечения рака, включающая одну или несколько миРНК, выбранных из группы, состоящей из miR-3670 и miR-8078, где miR-3670 включает двухцепочечную РНК, представленную нуклеотидными последовательностями SEQ ID NO: 35 и SEQ ID NO: 36, и miR-8078 включает двухцепочечную РНК, представленную нуклеотидными последовательностями SEQ ID NO: 65 и SEQ ID NO: 66. Изобретение обеспечивает ингибирование пролиферации и индуцирование апоптоза раковых клеток. 3 з.п. ф-лы, 8 ил., 3 табл., 9 пр.

Наверх