Аптамер для fgf2 и его применение

Авторы патента:


Аптамер для fgf2 и его применение
Аптамер для fgf2 и его применение
Аптамер для fgf2 и его применение
C12N15/115 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2686992:

РИБОМИК ИНК. (JP)

Изобретение относится к области биохимии. Описана группа изобретений, включающая в себя аптамер, связывающийся с FGF2; комплекс для связывания аптамера с FGF2; лекарственные средства для лечения или профилактики заболевания, сопровождаемого ангиогенезом; заболевания костей и суставов; боли; способ лечения или профилактики вышеперечисленных заболеваний, применение вышеуказанного аптамера или комплекса в получении лекарственного средства для лечения или профилактики вышеперечисленных заболеваний. В одном из вариантов аптамер содержит нуклеотидную последовательность, представленную формулой (1)

N1GGAN2ACUAGGGCN3UUAAN4GUN5ACCAGUGUN6 (формула 1)

Изобретение расширяет арсенал средств для связывания FGF2. 11 н. и 10 з.п. ф-лы, 3 ил., 9 табл., 7 пр.

 

Область техники

[0001]

Настоящее изобретение относится к аптамеру для FGF2, способу его применения и т.п.

Предшествующий уровень техники

[0002]

Основной фактор роста фибробластов (FGF2 или bFGF) является фактором роста, секретируемым различными клетками, в значительной степени, участвующим в клеточной пролиферации и дифференцировке на стадиях развития и демонстрирующим высокую экспрессию в течение восстановления тканей и в тканях злокачественных новообразований у взрослых.

[0003]

Хотя FGF2 человека имеет множество изоформ, лишь изоформа, имеющая наименьшую молекулярную массу, секретируется внеклеточно. Эта изоформа является белком массой приблизительно 18 кДа, состоящим из 154 аминокислот, не содержащим сахарную цепь и имеющим основную изоэлектрическую точку 9,4. Хотя функция высокомолекулярных изоформ (22, 22,5, 24, 34 кДа) FGF2 с разными открытыми рамками считывания не ясна, считают, что они имеют сигнал ядерной локализации и функцию в ядре.

[0004]

Известно, что белки семейства FGF человека включают 22 типа от FGF1 до FGF23 (FGF15 и FGF19 теперь объединены в FGF19, т.к. они являются одинаковыми молекулами). Посредством филогенетического анализа FGF2 классифицируют в подсемейство FGF1 вместе с FGF1. Гомология аминокислотной последовательности с FGF1 является самой высокой среди всех FGF, и ее значение составляет 55%. Рецептор FGF (FGFR) является рецепторной тирозинкиназой, и его классифицируют на 4 подтипа. Известно, что каждый из FGFR1-3 включает изоформы b и c. FGF2 связывается с FGFR1b, FGFR1c, FGFR2c и FGFR3c и FGFR4, таким образом, димеризуя эти рецепторы.

[0005]

Фибробласты мыши (клетки NIH-3T3) экспрессируют FGFR1 на поверхности клеточной мембраны. Известно, что FGFR1 активируется при связывании с FGF2 человека. Когда FGF2 связывается с FGFR1, путь киназы MAP (митоген-активируемой протеинкиназы), путь PIK3 (фосфатидилинозитол-3-киназы)/AKT1 (протеинкиназы B) и т.п. активируются посредством FRS2 (субстрата 2 рецептора фактора роста фибробластов), Grb2 (белка 2, связанного с рецептором фактора роста), SOS и, в конечном итоге, индуцируют экспрессию различных генов цитокинов и рецепторов, таких как VEGF (предшественник фактора роста эндотелия сосудов)-A, VEGF-C, HGF (фактор роста гепатоцитов), ангиопоэтин-2, VEGFR, PDGFR-α (рецептор-α фактора роста тромбоцитов бета) и т.п.

[0006]

FGF2 содержит гепарин-связывающую область и, подобно другим FGF, связывается с гепарином и гепарансульфатом. Как правило, считают, что FGF2, секретируемый клеткой, связан с гепарансульфатом внеклеточного матрикса, концентрирован и защищен от протеазы. Чтобы функционировать в качестве лиганда, FGF2 должен высвобождаться из внеклеточного матрикса, с которым он связан, в котором FGF-BP (FGF-связанный белок), как сообщают, участвует в стимуляции индукции FGFR.

[0007]

Известно, что FGF2 обладает сильным эффектом, способствующим росту, клеточной миграции, в отношении эндотелиальных клеток сосудов и, в значительной степени, участвует в ангиогенезе опухолевых тканей. Сообщают об особенно высокой концентрации FGF2 в сыворотке в опухоли с множеством кровеносных сосудов, например, злокачественной опухоли почки и т.п., и FGF2 присутствует в различных других опухолях, таких как рак предстательной железы, рак молочной железы, рак легких и т.п.

[0008]

Помимо FGF2, в ангиогенезе участвуют факторы, такие как FGF1, VEGF, ФНО (фактор некроза опухоли), PDGF, EGF (эпидермальный фактор роста), MMP (матричная металлопротеиназа), ангиогенин и т.п. Эти факторы секретируются из опухоли, ангиобластических клеток, поддерживающих клеток и т.п. и участвуют в ангиогенезе в качестве аутокринных или паракринных факторов роста. Однако FGF2 отличается от других факторов, т.к. он действует не только в отношении эндотелиальных клеток сосудов, но также и мезенхимальных клеток, окружающих эндотелиальные клетки, таких как гладкомышечная клетка и т.п. Другими словами, считают, что FGF2 стимулирует мезенхимальные клетки так, что они способствуют экспрессии PDGF, PDGFR, VEGF, HGF и т.п., и эти факторы напрямую повышают рост эндотелиальных клеток сосудов.

[0009]

К настоящему времени предпринято множество попыток разработать лекарственное средство, ингибирующее аномальный ангиогенез в опухолевой ткани для блокирования пути снабжения питательными веществами опухолевой ткани. Существует лекарственное средство, фактически используемое в клинических условиях, такое как гуманизированное моноклональное антитело против VEGF (авастин (зарегистрированная торговая марка)), разработанное Genentech, которое, как подтверждено, демонстрирует эффект в отношении рака толстого кишечника и немелкоклеточного рака легких. Однако до сих пор не разработано сильное противоопухолевое лекарственное средство. Многие из этих лекарственных средств направлены против VEGF и PDGF, и ожидают, что они будут блокировать начальные стадии аномального ангиогенеза, воздействуя на FGF2, функционирующего на более высоких стадиях каскада.

[0010]

Аномальный ангиогенез, помимо опухоли, вовлечен в такие заболевания, как хронические воспаления (например, пародонтоз, склеродермия, неоваскулярная глаукома, артрит и т.п.), псориаз, возрастная дегенерация желтого пятна и т.п.

[0011]

С другой стороны, предпринята попытка использовать сильное ангиогенное действие FGF2 для лечения окклюзирующих сосудистых нарушений и заживления ран. Фактически, препарат FGF2 человека (спрей FIBLAST (зарегистрированная торговая марка)) Kaken Pharmaceutical Co., Ltd. уже одобрен и продается в качестве лекарственного средства для стимуляции заживления ран.

[0012]

Хотя известно, что FGF2 обладает эффектом стимуляции остеогенеза, он также привлекает к себе внимание в качестве фактора, стимулирующего резорбцию кости, т.к. он участвует в разрушении сустава у пациентов с хроническим ревматоидным артритом. При хроническом ревматоидном артрите, отличающемся аутоиммунным артритом, количество остеокластов повышается для стимуляции резорбции кости, что, в свою очередь, приводит к прогрессированию разрушения кости.

FGF2 стимулирует мезенхимальные клетки так, что они способствуют экспрессии воспалительных цитокинов и факторов роста, таких как PDGF, PDGFR, VEGF, HGF и т.п., а также способствуют ангиогенезу и индуцируют разрушение кости. Выясняли, что FGF2 является ключевой молекулой, вовлеченной в серьезную патологию при хроническом ревматоидном артрите (непатентный документ 1).

[0013]

Остеопротегерин (OPG) является рецептором-ловушкой индуктора остеокластов, RANKL, и известно, что он является антагонистом RANK и супрессирует индукцию дифференцировки в остеокластах и их функцию (непатентный документ 2). Также известно, что OPG, продуцируемый синовиальными клетками, супрессируется при стимуляции FGF2 (непатентный документ 3). Кроме того, FGF2 способствует взаимодействию остеобластов и клеток-предшественников остеокластов посредством индукции высокой экспрессии RANKL остеобластами, в результате чего он стимулирует дифференцировку в остеокласт и активацию (непатентный документ 4).

Если можно будет контролировать функцию FGF2, то, в значительной степени, следует ожидать эффекта в виде терапевтического лекарственного средства в случае разрушения сустава посредством активации остеокласта. Фактически, известно, что прямое введение нейтрализующего антитела против FGF2 в сустав в модели AIA на крысах смягчает симптом. Однако, супрессирующий эффект в отношении его дебюта является небольшим, и, в частности, лечебный эффект посредством введения после дебюта не подтвержден (непатентный документ 5).

[0014]

В последние годы, внимание привлекает использование аптамеров РНК для лекарственных средств, диагностических реагентов и тестовых реагентов; некоторые аптамеры РНК уже находятся на стадии клинических исследований или практического применения. В декабре 2004 года первое в мире лекарственное средство на основе аптамера РНК, макуген, одобрено в США в качестве терапевтического лекарственного средства для возрастной дегенерации желтого пятна. Аптамер РНК относится к РНК, специфически связывающейся с веществом-мишенью, таким как белок, и которую можно получать с использованием способа SELEX (систематической эволюции лигандов экспоненциальным обогащением) (см. патентные документы 1-3). В способе SELEX РНК, специфически связывающаяся с веществом-мишенью, выбрана из совокупности РНК с приблизительно 1014 различными нуклеотидными последовательностями. Используемая структура РНК имеет случайную последовательность из приблизительно 40 остатков, фланкируемых последовательностями праймеров. Этой совокупности РНК позволяют собираться с веществом-мишенью, и только РНК, связавшуюся с веществом-мишенью, собирают с использованием фильтра и т.п. Собранную РНК амплифицируют посредством RT-ПЦР и используют ее в качестве матрицы для следующего раунда. Повторяя эту операцию приблизительно 10 раз, иногда можно получать аптамер РНК, специфически связывающийся с веществом-мишенью.

[0015]

В патентном документе 4 описывают аптамер, связывающийся с FGF2, получаемый указанным выше способом SELEX. Однако последовательности аптамеров отличаются от аптамеров, конкретно приведенных в настоящем описании. Кроме того, в этом документе не предлагают аптамеры, конкретно приведенные в настоящем описании.

[Список документов]

[Патентные документы]

[0016]

Патентный документ 1: WO 91/19813

Патентный документ 2: WO 94/08050

Патентный документ 3: WO 95/07364

Патентный документ 4: WO 2011/099576

[Непатентные документы]

[0017]

Непатентный документ 1: Manabe N. et al. Reumatology. 1999; 38; 714-720

Непатентный документ 2: Yasuda H. et al. Proc. Natl. Acad. Sci USA. 1998; 95; 3597-3602

Непатентный документ 3: Yano K. et al. J. Bone Miner Metab. 2001; 19; 365-372

Непатентный документ 4: Roccisana JL et al. J. Biol. Chem. 279: 10500-10507 (2004)

Непатентный документ 5: Yamashita A. et al. J. Immunol. 2002; 168; 450-457

[СУЩНОСТЬ ИЗОБРЕТЕНИЯ]

[Задачи, подлежащие решению посредством изобретения]

[0018]

Настоящее изобретение относится к получению аптамера для FGF2 и способу его применения, и т.п.

[Способы решения задач]

[0019]

Авторы настоящего изобретения осуществляли активные исследования для решения описываемой выше задачи и преуспели в получении аптамера хорошего качества для FGF2, что приводило к осуществлению настоящего изобретения.

[0020]

Таким образом, настоящее изобретение представляет собой следующее.

[1] Аптамер, связывающийся с FGF2, содержащий нуклеотидную последовательность, представленную следующей формулой (1) (где урацил, необязательно, представляет собой тимин) и являющуюся следующей (a) или (b):

N1GGAN2ACUAGGGCN3UUAAN4GUN5ACCAGUGUN6 (формула 1)

каждый из N1 и N6 независимо являются любым из от 0 до нескольких оснований,

N2, N3, N4 и N5 независимо являются любым основанием,

(a) аптамер, где в нуклеотидах, содержащихся в аптамере,

(i) 2'-положение рибозы каждого пиримидинового нуклеотида является атомом фтора,

(ii) 2'-положение рибозы каждого пуринового нуклеотида является гидроксигруппой;

(b) аптамер (a), где

(i) атом фтора в 2'-положении рибозы каждого пиримидинового нуклеотида является независимо незамещенным или замещенным атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксигруппы и метоксигруппы,

(ii) гидроксигруппа в 2'-положении рибозы каждого пуринового нуклеотида является независимо незамещенной или замещенной атомом или группой, выбранными из группы, состоящей из атома водорода, метоксигруппы и атома фтора.

[2] Аптамер по п. [1], где

N1 является G, GG, AG, C или пропуском,

N2 является A или U,

N3 является G, C или A,

N4 является G, C или U,

N5 является G или U, и

N6 является UUCN61 или AGUCN62, где N61 и N62 каждый независимо является любым из от 0 до нескольких оснований.

[3] Аптамер по п. [1] или [2], содержащий нуклеотидную последовательность, представленную следующей формулой (2) или (3):

GGGAAACUAGGGCGUUAACGUGACCAGUGUUUCN61 (формула 2)

N1GGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCN62 (формула 3).

[4] Аптамер по любому из пп. [1]-[3], содержащий нуклеотидную последовательность, представленную в SEQ ID NO: 2 или 7.

[5] Аптамер по любому из пп. [1]-[3], содержащий нуклеотидную последовательность, представленную в SEQ ID NO: 1, 3, 4, 5, 6, 8, 10 или 11.

[6] Аптамер по любому из пп. [1]-[5], где 1 или несколько нуклеотидов являются замещенными, делетированными, встроенными или добавленными, являющийся

(a) аптамером, где в нуклеотидах, содержащихся в аптамере,

(i) 2'-положение рибозы каждого пиримидинового нуклеотида является атомом фтора,

(ii) 2'-положение рибозы каждого пуринового нуклеотида является гидроксигруппой;

(b) аптамером по п. (a), где

(i) атом фтора в 2'-положении рибозы каждого пиримидинового нуклеотида является независимо незамещенным или замещенным атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксигруппы и метоксигруппы,

(ii) гидроксигруппа в 2'-положении рибозы каждого пуринового нуклеотида является независимо незамещенной или замещенной атомом или группой, выбранными из группы, состоящей из атома водорода, метоксигруппы и атома фтора.

[7] Аптамер по любому из пп. [1]-[6], имеющий длину не более 45 нуклеотидов.

[8] Аптамер по любому из пп. [1]-[7], ингибирующий связывание FGF2 и рецептора FGF.

[9] Аптамер по любому из пп. [1]-[8], где по меньшей мере один нуклеотид является модифицированным.

[10] Комплекс, содержащий аптамер по любому из пп. [1]-[9] и функциональное вещество.

[11] Комплекс по п. [10], где функциональное вещество является аффинным веществом, веществом для мечения, ферментом, средством для доставки лекарственного средства или лекарственным средством.

[12] Лекарственное средство, содержащее аптамер по любому из пп. [1]-[9] или комплекс по пп. [10] или [11].

[13] Лекарственное средство для лечения или профилактики заболевания, сопровождаемого ангиогенезом, заболевания костей и суставов или боли, содержащее аптамер по любому из пп. [1]-[9] или комплекс по пп. [10] или [11].

[14] Способ лечения или профилактики заболевания, сопровождаемого ангиогенезом, заболевания костей и суставов или боли, включающий введение индивидууму эффективного количества аптамера по любому из пп. [1]-[9] или комплекса по пп. [10] или [11].

[15] Аптамер по любому из пп. [1]-[9] или комплекс по пп. [10] или [11] для применения в лечении или профилактике заболевания, сопровождаемого ангиогенезом, заболевания костей и суставов или боли.

[16] Применение аптамера по любому из пп. [1]-[9] или комплекса по пп. [10] или [11] в получении лекарственного средства для лечения или профилактики заболевания, сопровождаемого ангиогенезом, заболевания костей и суставов или боли.

[Эффект изобретения]

[0021]

Аптамер и комплекс по настоящему изобретению могут быть применимыми в качестве терапевтических или профилактических лекарственных средств, диагностических реагентов или реагентов для заболевания, сопровождаемого ангиогенезом, заболевания костей и суставов или боли. Аптамер и комплекс по настоящему изобретению также могут быть применимыми для очистки и концентрирования FGF2, мечения FGF2, а также детекции и количественного анализа FGF2.

[Краткое описание чертежей]

[0022]

Фиг. 1 является сенсограммой, на которой показано, что аптамеры, представленные аптамерами ID 1 и 2, связываются с FGF2 человека.

Фиг. 2 является сенсограммой, на которой показано, что аптамер, представленный аптамером ID 1, ингибирует связывание FGF2 человека и 4 рецепторов.

Фиг. 3 является сенсограммой, на которой показано, что аптамер, представленный аптамером ID 3, не связывается с FGF1 человека, EGF, NGF, VEGF.

[Описание вариантов осуществления]

[0023]

В одном из вариантов осуществления настоящее изобретение относится к аптамеру, связывающемуся с FGF2, содержащему нуклеотидную последовательность, представленную следующей формулой (1) (где урацил, необязательно, представляет собой тимин), и являющемуся следующим (a) или (b):

N1GGAN2ACUAGGGCN3UUAAN4GUN5ACCAGUGUN6 (формула 1)

каждый из N1 и N6 независимо является любым из от 0 до нескольких оснований,

N2, N3, N4 и N5 независимо являются любым основанием,

(a) аптамер, где в нуклеотидах, содержащихся в аптамере,

(i) 2'-положение рибозы каждого пиримидинового нуклеотида является атомом фтора,

(ii) 2'-положение рибозы каждого пуринового нуклеотида является гидроксигруппой;

(b) аптамер по п. (a), где

(i) атом фтора в 2'-положении рибозы каждого пиримидинового нуклеотида является независимо незамещенным или замещенным атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксигруппы и метоксигруппы,

(ii) гидроксигруппа в 2'-положении рибозы каждого пуринового нуклеотида является независимо незамещенной или замещенной атомом или группой, выбранными из группы, состоящей из атома водорода, метоксигруппы и атома фтора.

[0024]

Аптамер относится к молекуле нуклеиновой кислоты, имеющей связывающую активность в отношении конкретной молекулы-мишени. Аптамер может ингибировать активность конкретной молекулы-мишени посредством связывания с конкретной молекулой-мишенью. Аптамер по настоящему изобретению может являться РНК, ДНК, модифицированной нуклеиновой кислотой или их смесью. Аптамер по настоящему изобретению также может иметь линейную или кольцевую форму.

[0025]

Настоящее изобретение относится к аптамеру, имеющему связывающую активность в отношении FGF2. В одном из вариантов осуществления аптамер по настоящему изобретению может связываться с FGF2 для ингибирования активности FGF2. Т.е. аптамер по настоящему изобретению может иметь ингибиторную активность в отношении FGF2.

[0026]

Ингибиторная активность в отношении FGF2 означает способность к ингибированию в отношении любой активности, которую имеет FGF2. Например, FGF2 действует на клетку, экспрессирующую рецептор FGF, активируя передачу сигнала и индуцируя продукцию различных факторов роста клеток и их рецепторов. Таким образом, ингибиторная активность в отношении FGF2 может являться активностью для ингибирования внутриклеточной передачи сигнала через рецептор FGF. Т.к. экспрессия таких различных факторов роста клеток и их рецепторов приводит к стимуляции активности клеточной пролиферации и активности клеточной миграции, ингибиторная активность в отношении FGF2 означает ингибирование этих активностей.

Таким образом, если аптамер по настоящему изобретению связывается с FGF2 и ингибирует связывание FGF2 и рецептора FGF, можно ингибировать действие, ассоциированное с активацией внутриклеточного пути передачи сигнала через рецептор FGF, например, супрессию гибели клеток, клеточную пролиферацию, супрессию продукцию остеопротегерина (OPG) и т.п.

[0027]

FGF2 является белком, сильно экспрессирующимся на ранних стадиях развития и при дифференцировке, росте, регенерации, и, например, белком, имеющимся аминокислотную последовательность, представленную регистрационным номером EAX05222 или NP001997. FGF2 иногда также обозначают как bFGF (основной FGF), FGFB или HBGF-2. В настоящем изобретении FGF2 продуцируется в организме животного, или его также можно получать из культивируемых клеток, таких как клетки млекопитающих, например, мыши и т.п., клетки насекомых, Escherichia coli и т.п., или их также дополнительно можно получать посредством химического синтеза. При его получении из культивируемых клеток или с помощью химического синтеза вариант легко можно получать способом, известным в этой области. Термин "вариант" FGF2 означает белок или пептид, имеющий по меньшей мере одну активность из активностей, которые FGF2 имеет от природы, имеющий аминокислотную последовательность, являющуюся результатом замены, делеции, добавления и т.п. от одной до нескольких аминокислот в известной аминокислотной последовательности FGF2, или аминокислотную последовательность, состоящую из части известной аминокислотной последовательности FGF2. Если аминокислоту заменяют или добавляют, указанная аминокислота может являться природной аминокислотой или неприродной аминокислотой. В настоящем изобретении термин "FGF2" относится к его вариантам.

[0028]

Термин "рецептор FGF2" означает белок поверхности клетки, с которым связывается FGF2. В качестве рецептора FGF2 известны FGFR1b, FGFR1c, FGFR2c, FGFR3c и FGFR4. Рецептор FGF2, упоминаемый в настоящем описании, может являться белком, содержащим природную аминокислотную последовательность или ее вариант. В настоящем описании термин "вариант" рецептора FGF2 означает белок или пептид, где от одной до нескольких аминокислот в аминокислотной последовательности являются замещенными, делетированными, добавленными и т.п., или он имеет аминокислотную последовательность, состоящую из части известной аминокислотной последовательности рецептора FGF2, имеющего связывающую активность в отношении FGF2. В одном из вариантов осуществления настоящее изобретение относится к аптамеру, ингибирующему связывание FGF2 и рецептора FGF2.

[0029]

Аптамер по настоящему изобретению может проявлять ингибиторную активность в отношении FGF2, полученного из любых млекопитающих. Такие млекопитающие включают приматов (например, человека, обезьяну), грызунов (например, мышь, крысу и морскую свинку) и животных-компаньонов, домашних животных и рабочих животных (например, собаку, кошку, лошадь, крупный рогатый скот, козу, овцу, свинью).

[0030]

В одном из вариантов осуществления аптамер по настоящему изобретению может отличаться тем, что он может ингибировать активность FGF2, но не может ингибировать активность FGF1. Кроме того, в одном из вариантов осуществления аптамер по настоящему изобретению может отличаться тем, что он может ингибировать связывание FGF2 и рецептора FGF2, но не может ингибировать связывание FGF1 и рецептора FGF1. FGF1 является белком семейства FGF и наиболее похож на FGF2.

[0031]

В указанной выше формуле (1) каждый из N1 и N6 независимо является любым из от 0 до нескольких оснований, и N2, N3, N4 и N5 независимо являются любым основанием. В настоящем описании термин "основание" означает любое из аденина (A), гуанина (G), цитозина (C), урацила (U) или тимина (T), составляющих нуклеиновую кислоту.

Хотя количество оснований в N1 конкретно не ограничено, при условии, что аптамер, содержащий нуклеотидную последовательность, представленную формулой (1), связывается с FGF2, оно может составлять, например, от 0 до приблизительно 10, 0-9, 0-8, 0-7, 0-6, 0-5, 0-4, 0-3, 0-2 и т.п., предпочтительно - 0-2.

Аналогично, хотя количество оснований в N6 конкретно не ограничено, оно может составлять, например, от 0 до приблизительно 10, 0-9, 0-8, 0-7, 0-6, 0-5, 0-4, 0-3 и т.п., предпочтительно - 0-10, 3-9 или 5-8.

[0032]

В предпочтительном варианте осуществления в указанной выше формуле (1)

N1 является G, GG, AG, C или пропуском,

N2 является A или U,

N3 является G, C или A,

N4 является G, C или U,

N5 является G или U, и

N6 является UUCN61 или AGUCN62, где каждый из N61 и N62 независимо является любым из от 0 до нескольких оснований. В настоящем изобретении N1, являющийся "пропуском", означает, что N1 отсутствует в формуле (1), а именно N1 составляет 0 оснований.

Хотя количество оснований в N61 конкретно не ограничено, оно может составлять, например, от 0 до приблизительно 10, 0-7, 0-6, 0-5, 0-4 и т.п., предпочтительно - 0-5, 1-5 или 2-4.

Хотя количество оснований в N62 также конкретно не ограничено, оно может составлять, например, от 0 до приблизительно 10, 0-7, 0-5, 0-4, 0-3 и т.п., предпочтительно - 0-5, 0-4 или 0-3.

В другом предпочтительном варианте осуществления в указанной выше формуле (1)

N1 является G, GG, AG или пропуском,

N2 является A или U,

N3 является G или A,

N4 является C или U,

N5 является G или U

N6 является UUCN61 или AGUCN62, где N61 и N62 определены выше.

[0033]

В предпочтительном варианте осуществления аптамер по настоящему изобретению может содержать нуклеотидную последовательность, представленную следующей формулой (2) или (3):

GGGAAACUAGGGCGUUAACGUGACCAGUGUUUCN61 (формула 2)

N1GGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCN62 (формула 3)

где N1, N61 и N62 определены выше.

[0034]

В предпочтительном варианте осуществления аптамер по настоящему изобретению содержит нуклеотидную последовательность, представленную любой из SEQ ID NO: 1-12. Нуклеотидные последовательности, представленные в SEQ ID NO: 1-12, приведены ниже (где урацил, необязательно, представляет собой тимин) (далее в настоящем описании A, G, C и U указывают на то, что основание в нуклеотиде является аденином, гуанином, цитозином или урацилом, соответственно):

SEQ ID NO: 1:

GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCUCGA,

SEQ ID NO: 2:

GGGAAACUAGGGCGUUAACGUGACCAGUGUUUCUCGA,

SEQ ID NO: 3:

GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC,

SEQ ID NO: 4:

GGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCC,

SEQ ID NO: 5:

GGGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCCC,

SEQ ID NO: 6:

AGGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC,

SEQ ID NO: 7:

GGGAAACUAGGGCGUUAACGUGACCAGUGUUUCCC,

SEQ ID NO: 8:

CGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCG,

SEQ ID NO: 9:

CCGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCGG,

SEQ ID NO: 10:

GGGAUACUAGGGCGUUAACGUUACCAGUGUAGUCCC,

SEQ ID NO: 11:

GGGAUACUAGGGCCUUAAGGUUACCAGUGUAGUCCC,

SEQ ID NO: 12:

GGGAUACUAGGGCAUUUAUGUUACCAGUGUAGUCCC.

В одном предпочтительном варианте осуществления аптамер по настоящему изобретению содержит нуклеотидную последовательность, представленную в SEQ ID NO: 1, 3, 4, 5, 6, 8, 10 или 11.

В другом предпочтительном варианте осуществления аптамер по настоящему изобретению содержит нуклеотидную последовательность, представленную в SEQ ID NO: 2 или 7.

В другом предпочтительном варианте осуществления аптамер по настоящему изобретению содержит нуклеотидную последовательность представленную в SEQ ID NO: 1, 3, 4, 5 или 6.

[0035]

В одном из вариантов осуществления аптамер по настоящему изобретению в любой из указанных выше нуклеотидных последовательностях может содержать нуклеотидную последовательность, где 1 или несколько нуклеотидов являются замещенными, делетированными, встроенными или добавленными при условии, что аптамер все равно связывается с FGF2, и может являться

(a) аптамером, где в нуклеотидах, содержащихся в аптамере,

(i) 2'-положение рибозы каждого пиримидинового нуклеотида является атомом фтора,

(ii) 2'-положение рибозы каждого пуринового нуклеотида является гидроксигруппой;

(b) аптамером по п. (a), где

(i) атом фтора в 2'-положении рибозы каждого пиримидинового нуклеотида является независимо незамещенным или замещенным атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксигруппы и метоксигруппы,

(ii) гидроксигруппа в 2'-положении рибозы каждого пуринового нуклеотида является независимо незамещенной или замещенной атомом или группой, выбранными из группы, состоящей из атома водорода, метоксигруппы и атома фтора. Как применяют в настоящем описании, количество указанных выше нуклеотидов, замещенных, делетированных, встроенных или добавленных, конкретно не ограничено при условии, что аптамер все равно связывается с FGF2 даже после замены, делеции, инсерции или добавления. Оно может составлять, например, от 1 до приблизительно 10, предпочтительно - 1-6, более предпочтительно - 1-5, более предпочтительно - 1-4, более предпочтительно - 1-3, наиболее предпочтительно - 1 или 2. Хотя участок нуклеотида, подлежащий замене, делеции, инсерции или добавлению, конкретно не ограничен, при условии, что аптамер все равно связывается с FGF2 даже после замены, делеции, инсерции или добавления в участках, указанных как один тип нуклеотида в указанной выше формуле (1), (2) и (3), нуклеотиды являются замещенными, делетированными, встроенными или добавленными в 1-3, предпочтительно - 1 или 2, более предпочтительно - 1 участке. С другой стороны, если множество типов нуклеотидов может присутствовать в формулах (1), (2) и (3), замене, делеции, инсерции или добавлению можно подвергать большее количество нуклеотидов (например, от 1 до приблизительно 10, предпочтительно - 1-6, более предпочтительно - 1-5, более предпочтительно - 1-4).

[0036]

Длина аптамера по настоящему изобретению конкретно не ограничена, и, как правило, может составлять от приблизительно 10 до приблизительно 200 нуклеотидов, и может составлять, например, не менее приблизительно 20 нуклеотидов (например, не менее 25 нуклеотидов, не менее 30 нуклеотидов, не менее 31 нуклеотидов, не менее 32 нуклеотидов, не менее 33 нуклеотидов), предпочтительно - не менее 25 нуклеотидов, более предпочтительно - не менее 30 нуклеотидов, более предпочтительно - не менее 33 нуклеотидов. Кроме того, оно может составлять, например, не более приблизительно 100 нуклеотидов, как правило, не более приблизительно 80 нуклеотидов, предпочтительно - не более приблизительно 70 нуклеотидов, более предпочтительно - не более приблизительно 60 нуклеотидов, более предпочтительно - не более приблизительно 50 нуклеотидов, более предпочтительно - не более приблизительно 45 нуклеотидов (например, не более 44 нуклеотидов, не более 43 нуклеотидов, не более 42 нуклеотидов, не более 41 нуклеотидов, не более 40 нуклеотидов). Если общее количество нуклеотидов является меньшим, химический синтез и крупномасштабное производство будут более простыми, и есть значительно преимущество в терминах стоимости. Также считают, что химическая модификация является простой, стабильность в организме является высокой, и токсичность является низкой.

Таким образом, длина аптамера по настоящему изобретению, как правило, может составлять от приблизительно 10 до приблизительно 200 нуклеотидов, предпочтительно - 20-80 нуклеотидов, более предпочтительно - 25-60 нуклеотидов, более предпочтительно - 25-50 нуклеотидов, наиболее предпочтительно - 30-45 нуклеотидов.

[0037]

Аптамер по настоящему изобретению может являться конъюгатом, выбранным из группы, состоящей из конъюгата множества аптамеров, содержащего нуклеотидную последовательность, представленную указанной выше формулой (1) (аптамер (A)), конъюгата множества аптамеров, содержащего нуклеотидную последовательность, где 1 или несколько нуклеотидов являются замещенными, делетированными, встроенными или добавленными в нуклеотидной последовательности, представленной указанной выше формулой (1) (аптамер (B)), и конъюгата 1 или множества аптамеров (A) и 1 или множества аптамеров (B). Эти конъюгаты также могут связываться с FGF2.

В настоящем изобретении конъюгацию можно осуществлять посредством тандемного связывания. В конъюгации можно использовать линкер. В качестве линкера можно упомянуть нуклеотидные цепи (например, от 1 до приблизительно 20 нуклеотидов) и ненуклеотидные цепи (например, линкер -(CH2)n-, линкер -(CH2CH2O)n-, гексаэтиленгликолевый линкер, линкер TEG, пептид-содержащий линкер, линкер, содержащий связь -S-S-, линкер, содержащий связь -CONH-, линкер, содержащий связь -OPO3-). Множество, как указано для описываемого выше конъюгата из множества аптамеров, конкретно не ограничено, при условии, что оно составляет два или более, и множество может составлять, например, 2, 3 или 4.

[0038]

Каждый нуклеотид, содержащийся в аптамере по настоящему изобретению, является одинаковым или отличается и может являться нуклеотидом, содержащим гидроксильную группу в 2'-положении рибозы (например, рибозы пиримидинового нуклеотида, рибозы пуринового нуклеотида) (т.е. природного нуклеотида), или нуклеотидом, где гидроксильная группа является замещенной (модифицированной) с помощью любого атома или группы в 2'-положении рибозы (иногда обозначаемым в настоящем описании как "модифицированный нуклеотид").

[0039]

В качестве примеров любого такого атома или группы можно упомянуть нуклеотид, замещенный атомом водорода, атомом фтора или -O-алкильной группой (например, -O-Me-группой), -O-ацильной группой (например, -O-CHO-группой) или аминогруппой (например, -NH2-группой). В аптамере по настоящему изобретению по меньшей мере один тип (например, 1, 2, 3 или 4 типа) нуклеотида также может являться модифицированным нуклеотидом, содержащим гидроксильную группу или описываемый выше любой атом или группу, например, по меньшей мере два типа (например, 2, 3 или 4 типа) групп, выбранных из группы, состоящей из атома водорода, атома фтора, гидроксильной группы и-O-Me-группы, в 2'-положении рибозы.

[0040]

В аптамере по настоящему изобретению все пиримидиновые нуклеотиды могут являться нуклеотидами, где 2'-положение рибозы является атомом фтора или может являться одинаковым или отличаться, и нуклеотидами, где атом фтора является незамещенным или замещенным любым атомом или группой, указанной выше, предпочтительно - атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксильной группы и метоксигруппы. В частности, если в качестве способа получения аптамера по настоящему изобретению используют способ получения с использованием указанного ниже набора DuraScribeTM T7 Transcription Kit (производимого Epicentre), можно получать аптамер, где 2'-положение рибозы всех пиримидиновых нуклеотидов является фторсодержащим. Аптамер по настоящему изобретению, где атом фтора является замещенным другим указанным выше атомом или группой, можно получать указанным ниже способом.

[0041]

В аптамере по настоящему изобретению все пуриновые нуклеотиды могут являться нуклеотидами, где 2'-положение рибозы является атомом фтора или может являться одинаковым или отличаться, и нуклеотидами, где гидроксигруппа является незамещенной, или нуклеотидом, замещенным любым атомом или группой, указанными выше, предпочтительно - атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксильной группы и метоксигруппы в 2'-положении рибозы. Аптамер по настоящему изобретению, где гидроксильная группа является замещенной другим указанным выше атомом или группой, можно получать указанным ниже способом.

[0042]

В аптамере по настоящему изобретению, все пиримидиновые нуклеотиды могут являться нуклеотидами, где атом фтора в 2'-положении рибозы является замещенным любым из указанных выше атомов или групп, например, теми же атомами или группами, выбранными из группы, состоящей из атома водорода, гидроксигруппы и -O-Me-группы.

В аптамере по настоящему изобретению, кроме того, все пуриновые нуклеотиды могут являться нуклеотидами, где гидроксигруппа в 2'-положении рибозы является замещенной любым из указанных выше атомов или групп, например, теми же атомами или группами, выбранными из группы, состоящей из атома водорода, атома фтора и -O-Me-группой.

[0043]

В предпочтительном варианте осуществления, каждый пиримидиновый нуклеотид, содержащийся в аптамере по настоящему изобретению, является нуклеотидом, содержащим атом фтора в 2'-положении рибозы, и каждый пуриновый нуклеотид является нуклеотидом, имеющим гидроксигруппу в 2'-положении рибозы. В другом варианте осуществления указанный выше атом фтора в 2'-положении рибозы каждого пиримидинового нуклеотида независимо необязательно является замещенным атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксигруппы и метоксигруппы, и указанная выше гидроксигруппа в 2'-положении рибозы каждого пуринового нуклеотида необязательно независимо является замещенной атомом или группой, выбранными из группы, состоящей из атома водорода, метоксигруппы и атома фтора.

[0044]

В настоящем описании в описании того, как сахарные группы модифицируют в нуклеотидах, нуклеотиды, составляющие аптамер, считают РНК (т.е. сахарные группы считают рибозой). Однако это не означает, что ДНК исключают из составляющих аптамер нуклеотидов, и модификацию РНК, при необходимости, следует считать модификацией ДНК. Если нуклеотид, составляющий аптамер, является ДНК, например, замену гидроксильной группы в 2'-положении рибозы на X следует считать заменой атома водорода в 2'-положении дезоксирибозы на X.

Если в аптамере по настоящему изобретению урацил заменяют тимином, можно повышать FGF2-связывающую активность, ингибиторную активность в отношении FGF2 и рецептора FGF, стабильность, возможность доставки лекарственного средства и стабильность аптамера в крови и т.п.

[0045]

В аптамере по настоящему изобретению в 1 или нескольких, например, 1-2, 1-3, 1-4, 1-5 нуклеотидах фосфодиэфирную связи в нуклеотиде можно модифицировать или заменять любыми заместителями. Например, фосфодиэфирную связь можно заменять фосфотиоатной связью, фосфодитиоатной связью, алкилфосфонатной связью, фосфоамидатной связью и т.п. Например, в настоящем описании термин "нуклеотид замещают фосфотиоатной связью" означает, что группа фосфорной кислоты в участке связывания между смежными нуклеотидами является серосодержащей, т.е. фосфодиэфирную связь изменяют на фосфотиоатную связь.

[0046]

В аптамере по настоящему изобретению, один или несколько, например, 1-2, 1-3, 1-4, 1-5 нуклеотидов, можно заменять мостиковой нуклеиновой кислотой (BNA) или замкнутой нуклеиновой кислотой (ЗНК) для стабилизации аптамера и улучшения его активности. Как применяют в настоящем описании, термин "мостиковая нуклеиновая кислота" относится к нуклеиновой кислоте, имеющей структуру, где аффинность связывания с комплементарной последовательностью повышают посредством ограничения степени свободы нуклеиновой кислоты посредством внутримолекулярной перекрестной сшивки и достигают устойчивости к нуклеазе. Их неограничивающие примеры включают 2',4'-BNA (замкнутую нуклеиновую кислоту (ЗНК)), 2'-O,4'-C-этилен-мостиковую нуклеиновую кислоту (ENA) и т.п.

[0047]

Аптамер по настоящему изобретению является аптамером, связывающимся с FGF2, более предпочтительно - аптамером, который может связываться с FGF2 для ингибирования связывания FGF2 и рецептора FGF. То, ингибирует ли аптамер по настоящему изобретению связывание FGF2 и рецептора FGF, можно оценивать с использованием теста, например, способа поверхностного плазмонного резонанса в примере 1 и т.п.

[0048]

Аптамер по настоящему изобретению может являться аптамером, где остаток сахара (например, рибозу) каждого нуклеотида модифицируют для достижения FGF2-связывающей активности, стабильности, возможности доставки лекарственного средства и т.п. В качестве примеров модификации остатка сахара можно упомянуть замену атома кислорода в 2'-положении, 3'-положении и/или 4'-положении остатка сахара другим атомом и т.п. В качестве типа модификации можно упомянуть фторирование, O-алкилирование (например, O-метилирование, O-этилирование), O-арилирование, S-алкилирование (например, S-метилирование, S-этилирование), S-арилирование и аминирование (например, -NH2). Кроме того, их примеры включают 4'-SRNA, где кислород в 4'-положении заменяют серой, ЗНК (замкнутой нуклеиновой кислотой), где 2'-положение и 4'-положение перекрестно сшивают с помощью метилена, 3'-N-фосфоамидатную нуклеиновую кислоту, где гидроксильную группу в 3'-положение заменяют аминогруппой и т.п. Иногда аптамер по настоящему изобретению получают с использованием указанной модификации атома кислорода в 2'-положении рибозы пиримидинового нуклеотида благодаря способу его получения. Если в качестве способа получения аптамера по настоящему изобретению используют способ получения с использованием указанного ниже набора DuraScribeTM T7 Transcription Kit (производимого Epicentre), получают аптамер, где 2'-положение рибозы, предпочтительно, всех пиримидиновых нуклеотидов является фторсодержащим. Таким образом, можно получать различные варианты аптамеров, имеющих повышенную активность, даже если последовательность оснований является той же, используя такое изменение остатка сахара в полученном аптамере. Учитывая изложенное выше, аптамер по настоящему изобретению, предпочтительно, может являться аптамером, где остаток сахара по меньшей мере в одном нуклеотиде является модифицированным. Такие изменения в остатке сахара можно осуществлять способом, известным в этой области (см., например, Sproat et al., (1991) Nucl. Acid. Res. 19, 733-738; Cotton et al., (1991) Nucl. Acid. Res. 19, 2629-2635; Hobbs et al., (1973) 12 Biochemistry 5138-5145). Чтобы он был специфическим, аптамер, в котором гидроксильную группу в 2'-положении рибозы заменяют атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксильной группы и метоксигруппы, можно получать с использованием, в качестве основы, аптамера, в котором гидроксильную группу в 2'-положении рибозы всех пиримидиновых нуклеотидов заменяют группой фтора.

[0049]

Аптамер по настоящему изобретению также может содержать основание нуклеиновой кислоты (например, пурин или пиримидин), измененное (например, посредством химической замены) для повышения FGF2-связывающей активности, стабильности, возможности доставки лекарственного средства и т.п. В качестве примеров таких изменений можно упомянуть изменение пиримидина в 5-положении, изменение пурина в 6- и/или 8-положениях, изменение с использованием внециклического амина, замену 4-тиоуридином и замену 5-бром- или 5-йодурацилом. Фосфатную группу, содержащуюся в аптамере по настоящему изобретению, можно изменять для придания устойчивости к нуклеазе и гидролизу. Например, P(O)O-группу можно заменять P(O)S (тиоатом), P(S)S (дитиоатом), P(O)N(R)R' (амидатом), P(O)R, P(O)OR, CO или CH2 (формацеталем) или 3'-амином (-NH-CH2-CH2-) [где каждая единица R или R' независимо представляет собой H или замещенный или незамещенный алкил (например, метил, этил)].

Связывающая группа представляет собой, например, -O-, -N- или -S-, и нуклеотиды можно связывать со смежным нуклеотидом с помощью этих связывающих групп.

Изменения также могут включать такие изменения, как кэпирование на 3'- и 5'-конце.

[0050]

Изменение можно дополнительно осуществлять, добавляя на конец полиэтиленгликоль, аминокислоту, пептид, инвертированный dT, нуклеиновую кислоту, нуклеозиды, миристоил, литохолил-олеил, докозанил, лауроил, стеароил, пальмитоил, олеил, линолеоил, другие липиды, стероиды, холестерин, кофеин, витамины, красители, флуоресцентные вещества, противораковые средства, токсины, ферменты, радиоактивные вещества, биотин и т.п. См. такие изменения, например, в патентах США №№ 5660985 и 5756703.

[0051]

В частности, при осуществлении изменения посредством концевого добавления PEG, его молекулярная масса, в частности, не ограничена и предпочтительно составляет 1000-100000, более предпочтительно - 30000-90000. PEG может являться линейным или разветвленным на две или более цепей (разветвленный PEG).

Такой PEG конкретно не ограничен, и специалисты в этой области могут соответствующим образом выбирать и использовать коммерчески доступный или известный PEG (например, http://www.peg-drug.com/peg_product/branched.html). Конкретные предпочтительные примеры PEG, подлежащие использованию в отношении аптамера по настоящему изобретению, включают 2-разветвленный PEG типа GS, имеющий молекулярную массу 40000 (SUNBRIGHT GL2-400GS, производимый NOF CORPORATION), 2-разветвленный PEG типа TS, имеющий молекулярную массу 40000 (SUNBRIGHT GL2-400TS, производимый NOF CORPORATION), 4-разветвленный PEG типа TS, имеющий молекулярную массу 40000 (SUNBRIGHT GL4-400TS производимый NOF CORPORATION), 2-разветвленный PEG типа TS, имеющий молекулярную массу 80000 (SUNBRIGHT GL2-800TS, производимый NOF CORPORATION), 4-разветвленный PEG типа TS, имеющий молекулярную массу 80000 (SUNBRIGHT GL4-800TS, производимый NOF CORPORATION) и т.п.

[0052]

В этом случае в аптамере по настоящему изобретению PEG можно напрямую добавлять в конец. Это является более предпочтительным, чем линкер, имеющий группу, связываемую с PEG и т.п., добавляемым на его конец, и PEG, добавляемым в аптамер по настоящему изобретению посредством линкера.

[0053]

Линкер для PEG и аптамер по настоящему изобретению конкретно не ограничен, и количество углеродных цепей, функциональную группу и т.п. можно соответствующим образом выбирать в соответствии с участком связывания, типом PEG и т.п. Примеры такого линкера включают линкер, имеющий аминогруппу. В частности, при добавлении на 5'-конец можно упомянуть линкер ssH (SAFC) или DMS(O)MT-AMINO-MODIFIER (GLEN RESEARCH) и при добавлении на 3'-конец можно упомянуть TFA Amino C-6 lcaa CPG (ChemGenes) и т.п. При выборе этого линкера, например, к PEG добавляют активную группу N-гидроксисукцинимида, и она реагирует с аминогруппой на стороне линкера, посредством чего аптамер по настоящему изобретению можно связывать с PEG посредством линкера.

[0054]

В качестве PEG и линкера предпочтительно можно использовать коммерчески доступные продукты. Специалисты в этой области могут соответствующим образом определять условия реакции и т.п., относящиеся к связыванию PEG, линкеру и аптамеру по настоящему изобретению.

[0055]

Аптамер по настоящему изобретению можно химически синтезировать, как представлено в настоящем описании, и способом, по существу, известным в этой области. Аптамер связывается с веществом-мишенью разнообразными способами связывания, такими как ионные связи, обусловленные отрицательным зарядом фосфатной группы, гидрофобные связи и водородные связи, обусловленные рибозой, и водородные связи и стэкинг-взаимодействия, обусловленные основаниями нуклеиновых кислот. В частности, ионные связи, обусловленные отрицательным зарядом фосфатной группы, присутствующие в том же количестве, что и входящие в состав нуклеотиды, являются сильными и осуществляют связывание с лизином и аргинином, присутствующим на положительно-заряженной поверхности белка. По этой причине можно заменять основания нуклеиновой кислоты, не вовлеченные в прямое взаимодействие с веществом-мишенью. В частности, т.к. область структуры "стебель" содержит уже образовавшиеся пары оснований и обращена к внутренней стороне двойной спиральной структуры, основания нуклеиновой кислоты вряд ли связываются непосредственно с веществом-мишенью. Таким образом, даже если пару оснований заменяют другой парой оснований, активность аптамера зачастую не повышается. В структурах, где не образуются пары оснований, таких как петлевые структуры, при условии, что основание нуклеиновой кислоты не участвует в прямом связывании с молекулой-мишенью, возможна замена оснований. Что касается модификаций 2'-положения рибозы, функциональная группа в 2'-положении рибозы в редких случаях взаимодействует непосредственно с молекулой-мишенью, но во многих случаях это не имеет никакого значения, и ее можно заменять другой модифицированной молекулой. Таким образом, если функциональная группа, участвующая в прямом связывании с молекулой-мишенью, не является замещенной или делетированной, аптамер часто сохраняет свою активность. Также важно, что общая трехмерная структура существенно не изменяется.

[0056]

Аптамер можно получать с использованием способа SELEX или его улучшенной версии (например, Ellington et al., (1990) Nature, 346, 818-822; Tuerk et al., (1990) Science, 249, 505-510). В способе SELEX концентрируют и выбирают аптамер, проявляющий больший потенциал связывания с веществом-мишенью, повышая количество раундов или используя конкурирующее вещество. Таким образом, корректируя количество раундов SELEX и/или изменяя условия конкуренции, в некоторых случаях можно получать аптамеры с различными силами связывания, аптамеры с различными способами связывания и аптамеры с одинаковой силой связывания или способом связывания, но с разными последовательностями оснований. Способ SELEX включает амплификацию посредством ПЦР; SELEX можно осуществлять с большим разнообразием, вызывая мутацию с использованием в нем ионов марганца и т.п.

[0057]

Аптамеры, полученные посредством SELEX, являются нуклеиновыми кислотами, проявляющими высокую аффинность к веществу-мишени, но это не означает связывание с активным центром вещества-мишени. Таким образом, аптамеры, полученные посредством SELEX, не обязательно действуют на функцию вещества-мишени. FGF2 является основным белком, и считают, что он позволяет нуклеиновым кислотам связываться с ним неспецифически. Аптамер, не связывающийся с активным центром, не влияет на активность вещества-мишени. Фактически, РНК, используемые для контроля, не ингибируют связывание FGF2 и рецептора FGF2.

[0058]

Используя выбранный таким образом активный аптамер, можно осуществлять оптимизированный SELEX для получения аптамера, обладающего более высокой активностью. В оптимизированном SELEX его снова осуществляют после получения матрицы, где аптамер с определенной последовательностью является частично рандомизированным, или матрицу дополняют от приблизительно 10 до 30% случайных последовательностей.

[0059]

Аптамер, полученный посредством SELEX, имеет длину приблизительно 80 нуклеотидов, и, фактически, его трудно получать в качестве фармацевтического средства. Таким образом, предпочтительно повторять попытки методом проб и ошибок для укорачивания аптамера до длины, делающей возможным простой химический синтез (например, приблизительно 60 нуклеотидов или менее, более предпочтительно - приблизительно 50 нуклеотидов или менее, наиболее предпочтительно - 45 нуклеотидов или менее, что делает возможным химический синтез).

В зависимости от дизайна праймеров для аптамера, полученного с помощью SELEX, изменяется простота последующей операции минимизации. Если дизайн праймеров неудачен, последующая разработка будет невозможна, даже если аптамер с активностью выбран с помощью SELEX.

[0060]

Аптамеры легко изменяют, т.к. они делают возможным химический синтез. В случае аптамеров, прогнозируя вторичную структуру с использованием программы MFOLD или прогнозируя стерическую структуру с помощью рентгеноструктурного анализа или ЯМР-анализа, можно, до некоторой степени, прогнозировать, какой нуклеотид можно заменять или подвергать делеции, и где осуществлять инсерцию нового нуклеотида. Предсказанный аптамер с новой последовательностью можно легко химически синтезировать и, используя существующую систему анализа, можно определять, сохраняет ли аптамер активность или нет.

[0061]

Если область, важную для связывания полученного аптамера с веществом-мишенью, идентифицируют посредством повторяющихся попыток методом проб и ошибок, как описано выше, активность во многих случаях остается неизменной, даже если новую последовательность добавляют на оба конца последовательности. Длина новой последовательности конкретно не ограничена.

[0062]

Как указано выше, модификации, подобные модификациям последовательности, делают возможными широкий диапазон дизайна или изменений.

[0063]

Как указано выше, аптамеры делают возможным широкий диапазон дизайна или изменений. Настоящее изобретение также относится к способу получения аптамера, делающего возможным широкий диапазон дизайна или изменений аптамера, содержащего конкретную последовательность (например, последовательность, соответствующую части, выбранной из областей "стебля", внутренних петлевых областей, областей "шпильки" и одноцепочечных областей: далее в настоящем описании сокращенно обозначаемых как фиксированная последовательность при необходимости).

[0064]

Например, способ получения такого аптамера включает получение аптамера, содержащего фиксированную последовательность с использованием одного типа молекулы нуклеиновой кислоты, состоящей из нуклеотидной последовательности, представленной следующим образом:

[0065]

Последовательность праймера (i)- (N)a-фиксированная последовательность- (N)b-последовательность праймера (ii)

[0066]

где (N)a представляет собой нуклеотидную цепь, состоящую из "a" единиц N; (N)b представляет собой нуклеотидную цепь, состоящую из "b" единиц N; каждая из единиц N, идентичных или разных, является нуклеотидом, выбранным из группы, состоящей из A, G, C, U и T (предпочтительно, A, G, C и U). Каждый из "a" и "b", идентичных или разных, может являться любым количеством и может составлять, например, от 1 до приблизительно 100, предпочтительно - от 1 до приблизительно 50, более предпочтительно - от 1 до приблизительно 30, еще более предпочтительно - от 1 до приблизительно 20 или от 1 до приблизительно 10], или может являться множеством типов молекул нуклеиновой кислоты (например, библиотекой молекул нуклеиновой кислоты, отличающихся по количеству a, b и т.д.) и парами праймеров, соответствующих последовательностям праймеров (i) и (ii), соответственно.

[0067]

В качестве аптамера по настоящему изобретению предпочтительным является аптамер по любому из следующих пп. (a'), (b') или (c'), связывающийся с FGF2 и ингибирующий связывание FGF2 и рецептора FGF:

(a') аптамер, содержащий нуклеотидную последовательность, представленную в любой из SEQ ID NO: 1-7 (или SEQ ID NO: 2 или 7 или любой из SEQ ID NO: 1 и 3-6) (где урацил может являться тимином), где в нуклеотидах, содержащихся в аптамере,

(i) 2'-положение рибозы каждого пиримидинового нуклеотида является атомом фтора,

(ii) 2'-положение рибозы каждого пуринового нуклеотида является гидроксигруппой;

(b') аптамер, содержащий нуклеотидную последовательность, где 1-5 (или 1-4 или 1-3) нуклеотидов являются замещенными, делетированными, встроенными или добавленными в нуклеотидную последовательность, представленную в любой из SEQ ID NO: 1-7 (или SEQ ID NO: 2 или 7, или любой из SEQ ID NO: 1 и 3-6) (где урацил может являться тимином), где в нуклеотиде, содержащемся в аптамере,

(i) 2'-положение рибозы каждого пиримидинового нуклеотида является атомом фтора,

(ii) 2'-положение рибозы каждого пуринового нуклеотида является гидроксигруппой; или

(c') аптамер, где в аптамере по п. (a') или (b')

(i) атом фтора в 2'-положении рибозы каждого пиримидинового нуклеотида является независимо незамещенным или замещенным атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксигруппы и метоксигруппы,

(ii) гидроксигруппа в 2'-положении рибозы каждого пуринового нуклеотида является независимо незамещенной или замещенной атомом или группой, выбранными из группы, состоящей из атома водорода, метоксигруппы и атома фтора, и,

из указанных выше аптамеров, дополнительно предпочтительным является аптамер, имеющий длину 30-45 нуклеотидов.

[0068]

Настоящее изобретение также относится к комплексу, содержащему аптамер по настоящему изобретению и связанному с ним функциональному веществу. Связь между аптамером и функциональным веществом в комплексе по настоящему изобретению может являться ковалентной связью или нековалентной связью. Комплекс по настоящему изобретению может являться комплексом, где связаны аптамер по настоящему изобретению и одно или несколько (например, 2 или 3) функциональных веществ одного типа или разных типов. Функциональное вещество конкретно не ограничено до той степени, пока оно придает аптамеру по настоящему изобретению конкретную функцию или способно изменять (например, улучшать) конкретную характеристику, которой может обладать аптамер по настоящему изобретению. В качестве примеров функционального вещества можно упомянуть белки, пептиды, аминокислоты, липиды, сахара, моносахариды, полинуклеотиды и нуклеотиды. В качестве примеров функционального вещества можно упомянуть аффинные вещества (например, биотин, стрептавидин, полинуклеотиды, обладающие аффинностью к комплементарной последовательности-мишени, антитела, глутатион-сефарозу, гистидин), вещества для мечения (например, флуоресцентные вещества, люминесцентные вещества, радиоактивные изотопы), ферменты (например, пероксидазу хрена, щелочную фосфатазу), средства для доставки лекарственных средств (например, липосому, микросферы, пептиды, полиэтиленгликоли), лекарственные средства (например, используемые в направленной терапии, такой как калихеамицин и дуокармицин; аналоги азотистого иприта, такие как циклофосфамид, мелфалан, ифосфамид или трофосфамид; этиленимины, такие как тиотепа; нитрозомочевины, такие как кармустин; алкилирующие средства, такие как темозоломид или дакарбазин; фолат-подобные метаболические антагонисты, такие как метотрексат или ралтитрексед; аналоги пурина, такие как тиогуанин, кладрибин или флударабин; аналоги пиримидина, такие как фторурацил, тегафур или гемцитабин; алкалоиды барвинка, такие как винбластин, винкристин или винорелбин и их аналоги; производные подофиллотоксина, такие как этопозид, таксаны, доцетаксел или паклитаксел; антрациклины, такие как доксорубицин, эпирубицин, идарубицин и митоксантрон и их аналоги; другие цитотоксические антибиотики, такие как блеомицин и митомицин; соединения платины, такие как цисплатин, карбоплатин и оксалиплатин; пентостатин, милтефозин, эстрамустин, топотекан, иринотекан и бикалутамид), и токсины (например, токсин рицин, лиатоксин и веротоксин). В некоторых случаях эти функциональные молекулы в конечном итоге удаляют. Кроме того, молекулы могут являться пептидами, которые могут распознаваться и расщепляться ферментами, такими как тромбин, матричная металлопротеиназа (MMP) и фактор X, и могут являться полинуклеотидами, которые могут расщепляться нуклеазами или рестрикционными эндонуклеазами.

[0069]

Аптамер или комплекс по настоящему изобретению можно использовать, например, в качестве лекарственного средства, диагностического реагента, тестового реагента или реагента. В частности, он применим в качестве лекарственного средства для лечения или профилактики заболеваний, сопровождаемых ангиогенезом, таких как возрастная дегенерация желтого пятна и т.п., заболеваний костей и суставов, таких как остеопороз, ревматоидный артрит, остеоартрит, перелом кости и т.п., или боли, или диагностического средства, тестового реагента или реагента.

[0070]

Лекарственное средство по настоящему изобретению может являться средством, составленным с использованием фармацевтически приемлемого носителя. В качестве примеров фармацевтически приемлемого носителя можно упомянуть эксципиенты, такие как сахароза, крахмал, маннит, сорбит, лактоза, глюкоза, целлюлоза, тальк, фосфат кальция и карбонат кальция; связывающие средства, такие как целлюлоза, метилцеллюлоза, гидроксипропилцеллюлоза, полипропилпирролидон, желатин, гуммиарабик, полиэтиленгликоль, сахароза и крахмал; разрыхлители, такие как крахмал, карбоксиметилцеллюлоза, гидроксипропилкрахмал, натрия крахмал гликолят, бикарбонат натрия, фосфат кальция и цитрат кальция; смазочные средства, такие как стеарат магния, аэросил, тальк и лаурилсульфат натрия; ароматизаторы, такие как лимонная кислота, ментол, глицирризинат аммония, глицин и апельсиновый порошок; консерванты, такие как бензоат натрия, гидросульфит натрия, метилпарабен и пропилпарабен; стабилизаторы, такие как лимонная кислота, цитрат натрия и уксусная кислота; суспендирующие средства, такие как метилцеллюлоза, поливинилпирролидон, и стеарат алюминия; диспергирующие средства, такие как поверхностно-активные вещества; дилюенты, такие как вода, физиологический раствор и апельсиновый сок; основные воски, такие как масло какао, полиэтиленгликоль и керосин; и т.п., но эти примеры не являются ограничивающими.

[0071]

Препараты, подходящие для перорального введения, являются раствором, полученным посредством растворения эффективного количества лиганда в дилюенте, таком как вода, физиологический раствор или апельсиновый сок; капсулами, саше или таблетками, содержащими эффективное количество лиганда в твердой или гранулированной форме; суспензией, полученной посредством суспендирования эффективного количества активного ингредиента в подходящем дисперсанте; эмульсией, полученной посредством диспергирования и эмульгирования раствора эффективного количества активного ингредиента в подходящем дисперсанте, и т.п.

[0072]

Лекарственное средство по настоящему изобретению, по мере необходимости, можно покрывать способом, известным в этой области. в целях маскировки вкуса, растворения в кишечнике, замедленного высвобождения и т.п. В качестве примеров покрывающих средств, используемых для покрытия, используют гидроксипропилметилцеллюлозу, этилцеллюлозу, гидроксиметилцеллюлозу, гидроксипропилцеллюлозу, полиоксиэтиленгликоль, Tween 80, плюроник F68, ацетат-фталат целлюлозы, фталат гидроксипропилметилцеллюлозы, ацетат-сукцинат гидроксиметилцеллюлозы, эудражит (производимый Rohm, Germany, coполимер метакриловой кислоты/акриловой кислоты), красители (например, оксид железа (III), диоксид титана и т.п.) и т.п. Лекарственное средство может являться препаратом с быстрым высвобождением или препаратом с замедленным высвобождением. Примеры основ для препарата с замедленным высвобождением включают липосому, ателоколлаген, желатин, гидроксиапатит, PLGA и т.п.

[0073]

В качестве препаратов, подходящих для парентерального введения (например, внутривенного введения, подкожного введения, внутримышечного введения, местного введения, интраперитонеального введения, интраназального введения, легочного введения и т.п.), доступны водные и неводные изотонические стерильные инъецируемые жидкости, которые могут содержать антиоксидант, буферный раствор, бактериостатическое средство, средство придания изотоничности и т.п. Также можно упомянуть водные и неводные стерильные суспензии, которые могут содержать суспендирующее средство, солюбилизатор, загуститель, стабилизатор, антисептик и т.п. Препарат можно включать в контейнер, такой как ампула или сосуд в объеме единицы дозирования или в нескольких дробных дозах. Активный ингредиент и фармацевтически приемлемый носитель также можно подвергать лиофилизации и хранить в состоянии, которое можно растворять или суспендировать в подходящем стерильном наполнителе непосредственно перед использованием. В дополнение к инъекциям жидкостей, приемлемыми также являются ингалянты и мази. В случае ингалянта активный ингредиент в лиофилизированном состоянии микронизируют и вводят посредством ингаляции с использованием подходящего ингаляционного устройства. Ингалянт, при необходимости, можно составлять с использованием общепринятого поверхностно-активного вещества, масла, ароматизатора, циклодекстрина или его производного и т.п.

[0074]

В настоящем описании в качестве примеров поверхностно-активного вещества можно упомянуть олеиновую кислоту, лецитин, диолеат диэтиленгликоля, тетрагидрофурфурилолеат, этилолеат, изопропилмиристат, глицерилтриолеат, глицерилмонолаурат, глицерил моноолеат, глицерилмоностеарат, глицерилмонолизиноат, цетиловый спирт, стеариловый спирт, полиэтиленгликоль 400, хлорид цетилпиридиния, сорбитантриолеат (торговое название Span 85), сорбитанмоноолеат (торговое название Span 80), сорбитанмонолаурат (торговое название Span 20), полиоксиэтилен-касторовое масло (торговое название HCO-60), полиоксиэтилен (20)-сорбитанмонолаурат (торговое название Tween 20), полиоксиэтилен (20)-сорбитанмонооолеат (торговое название Tween 80), лецитин природного происхождения (торговое название Epiclon), простой эфир олеилполиоксиэтилена (2) (торговое название Brij 92), простой эфир стеарилполиоксиэтилена (2) (торговое название Brij 72), простой эфир лаурилполиоксиэтилена (4) (торговое название Brij 30), простой эфир олеилполиоксиэтилена (2) (торговое название Genapol 0-020), блок-сополимер оксиэтилена и оксипропилена (торговое название Synperonic) и т.п. Span, Tween, Epiclon, Brij, Genapol и Synperonic являются торговыми марками.

В качестве примеров масла можно упомянуть кукурузное масло, оливковое масло, хлопковое масло, подсолнечное масло и т.п. В случае мази подходящую фармацевтически приемлемую основу (желтый вазелин, белый вазелин, парафин, Plastibase, силикон, белую мазевую основу, пчелиный воск, лярд, растительные масла, гидрофильную мазь, гидрофильный вазелин, очищенный ланолин, гидролизованный ланолин, абсорбирующую воду мазь, гидрофильный Plastibase, полиэтиленгликолевую мазь и т.п.) смешивают с активным ингредиентом и используют в качестве препарата.

[0075]

Ингалянт можно получать общепринятым способом. В частности, ингалянт можно получать посредством измельчения в порошок или сжижения описываемого выше аптамера и комплекса по настоящему изобретению, его смешивания в ингаляционном пропелленте и/или носителе и наполнения им подходящего сосуда для ингаляции. Если описываемый выше аптамер и комплекс по настоящему изобретению является порошком, можно использовать общепринятый механический порошковый ингалятор; в случае жидкости можно использовать ингалятор, такой как небулайзер. В настоящем описании в качестве пропеллента можно широко использовать общеизвестный пропеллент; можно упомянуть соединения хлорфторуглеродной серии, такие как хлорфторуглерод-11, хлорфторуглерод-12, хлорфторуглерод-21, хлорфторуглерод-22, хлорфторуглерод-113, хлорфторуглерод-114, хлорфторуглерод-123, хлорфторуглерод-142c, хлорфторуглерод-134a, хлорфторуглерод-227, хлорфторуглерод-C318, и 1,1,1,2-тетрафторэтан, углеводороды, такие как пропан, изобутан и n-бутан, простые эфиры, такие как диэтиловый простой эфир, сжатые газы, такие как газообразный азот и диоксид углерода и т.п.

[0076]

Если лекарственное средство по настоящему изобретению используют в качестве лекарственного средства для профилактики или лечения указанных выше заболеваний, лекарственное средство по настоящему изобретению можно вводить напрямую в очаг повреждения или вводить другими указанными выше способами.

Т.к. аптамер по настоящему изобретению является одноцепочечной нуклеиновой кислотой, возможна детоксикация посредством введения нуклеотида, содержащего комплементарную последовательность, и существует высокая вероятность получения фармацевтического препарата с более высокой безопасностью, чем нейтрализующее антитело, которое сложно динамически контролировать после введения. Это чрезвычайно предпочтительный аспект в свете проблемы инфекций, вероятно возникающих в организме при лечении лекарственным средством и т.п., вызываемых длительным нахождением антитела в организме. В частности, если лекарственное средство по настоящему изобретению используют в качестве лекарственного средства для профилактики или лечения указанных выше заболеваний, с учетом тяжести заболевания и риска побочных эффектов очевидно, что лекарственное средство, имеющее более высокую безопасность, можно получать с использованием аптамера, делающего возможным простой контроль кинетики in vivo.

[0077]

Дозировку лекарственного средство по настоящему изобретению варьируют в зависимости от типа и активности активного ингредиента, тяжести заболевания, вида животного, являющегося субъектом введения, переносимости лекарственного средства субъектом введения, массы тела, возраста и т.п., и общепринятая дозировка с учетом количества активного ингредиента в сутки для взрослого может составлять от приблизительно 0,0001 до приблизительно 100 мг/кг, например, от приблизительно 0,0001 до приблизительно 10 мг/кг, предпочтительно - от приблизительно 0,005 до приблизительно 1 мг/кг.

[0078]

Кроме того, аптамер или комплекс по настоящему изобретению также можно использовать в качестве средства для доставки лекарственного средства, зонда для визуализации in vivo, зонда для измерения концентрации FGF2 в крови, зонда для окрашивания ткани, зонда для ELISA, лиганда для разделения и очистки FGF2.

[0079]

Настоящее изобретение также относится к твердофазному носителю, содержащему аптамер и комплекс по настоящему изобретению, иммобилизированный на нем. В качестве примеров твердофазного носителя можно упомянуть субстрат, смолу, планшет (например, многолуночный планшет), фильтр, картридж, колонку и пористый материал. Субстрат может являться субстратом, используемым в ДНК-чипах, белковых чипах и т.п.; например, можно упомянуть субстраты никель-PTFE (политетрафторэтилен), стеклянные субстраты, апатитовые субстраты, силиконовые субстраты, субстраты оксида алюминия и т.п., и субстраты, полученные посредством покрывания этих субстратов полимером и т.п. В качестве примеров смолы можно упомянуть агарозные частицы, частицы диоксида кремния, coполимер акриламида и N,N'-метиленбисакриламида, частицы перекрестно сшитого полистиролом дивинилбензола, частицы декстрана, перекрестно сшитого эпихлоргидрином, целлюлозные волокна, перекрестно сшитые полимеры арилдекстрана и N,N'-метиленбисакриламида, монодисперсные синтетические полимеры, монодисперсные гидрофильные полимеры, сефарозу, Toyopearl и т.п., а также включали смолы, полученные посредством связывания различных функциональных групп с этими смолами. Твердофазный носитель по настоящему изобретению может быть применим, например, в очистке, детекции и количественном анализе FGF2.

[0080]

Аптамер и комплекс по настоящему изобретению можно иммобилизовать на твердофазном носителе способом, известным в этой области. Например, можно упомянуть способ, посредством которого в аптамер или комплекс по настоящему изобретению встраивают аффинное вещество (например, описываемое выше) или заранее определенную функциональную группу, а затем иммобилизуют аптамер и комплекс на твердофазном носителе с помощью аффинного вещества или заранее определенной функциональной группы. Настоящее изобретение также относится к способу иммобилизации аптамера или комплекса по настоящему изобретению на твердофазном носителе и получаемому таким образом твердофазному носителю. Заранее определенная функциональная группа может являться функциональной группой, которую можно подвергать реакции присоединения; например, можно упомянуть аминогруппу, тиольную группу, гидроксильную группу и карбоксильную группу. Настоящее изобретение также относится к аптамеру, имеющему такую функциональную группу, встроенную в него.

[0081]

Настоящее изобретение также относится к способу очистки и концентрирования FGF2. В частности, способ очистки по настоящему изобретению позволяет отделять FGF2 от других белков семейства FGF. Способ очистки и концентрирования по настоящему изобретению может включать адсорбцию FGF2 на твердофазном носителе по настоящему изобретению и элюцию адсорбированного FGF2 с использованием элюента. Адсорбцию FGF2 на твердофазном носителе по настоящему изобретению можно осуществлять способом, известным в этой области. Например, FGF2-содержащий образец (например, культуру бактерий или клеток или супернатант культуры, кровь) вводят в твердофазный носитель по настоящему изобретению или содержащую его композицию. FGF2 можно элюировать с использованием элюента, такого как нейтральный раствор. Нейтральный элюент не ограничен и может иметь pH, например, от приблизительно 6 до приблизительно 9, предпочтительно - от приблизительно 6,5 до приблизительно 8,5, и более предпочтительно - от приблизительно 7 до приблизительно 8. Нейтральный раствор также может содержать, например, соль калия (например, KCl), соль магния (например, MgCl2), поверхностно-активное вещество (например, Tween 20, Triton, NP40) и глицерин.

Способ очистки и концентрирования по настоящему изобретению дополнительно может включать промывание твердофазного носителя с использованием промывочного раствора после адсорбции FGF2. Примеры промывочного раствора включают растворы, содержащие мочевину, хелатирующее средство (например, ЭДТА), Трис, кислоту, щелочь, транспортную РНК, ДНК, поверхностно-активные вещества, такие как Tween 20, соли, такие как NaCl, и т.п. Способ очистки и концентрирования по настоящему изобретению дополнительно может включать нагревание твердофазного носителя. Этот этап делает возможными восстановление и стерилизацию твердофазного носителя.

[0082]

Аптамер или комплекс по настоящему изобретению можно использовать в качестве детекторного зонда, в частности, детекторного зонда для FGF2. Способ мечения аптамера конкретно не ограничен, и применимым является, по существу, известный способ. Примеры такого способа включают мечение радиоактивным изотопом, мечение флуоресцентным красителем или флуоресцентным белком и т.п.

[0083]

Настоящее изобретение также относится к способу детекции и количественного анализа FGF2. В частности, настоящее изобретение позволяет определять и количественно анализировать FGF2 отдельно от других белков семейства. Способ детекции и количественного анализа по настоящему изобретению может включать измерение FGF2 с использованием аптамера по настоящему изобретению (например, с использованием комплекса и твердофазного носителя по настоящему изобретению). Способ детекции и количественного анализа FGF2 можно осуществлять аналогично иммунологическому способу, за исключением того, что вместо антитела используют аптамер по настоящему изобретению. Таким образом, используя аптамер по настоящему изобретению вместо антитела аналогично таким способам, как иммуноферментный анализ (EIA) (например, прямой конкурентный ELISA, непрямой конкурентный ELISA, сэндвич-ELISA), радиоиммунологический анализ (RIA), флуоресцентный иммунологический анализ (FIA), способ вестерн-блоттинг, способ иммуногистохимического окрашивания и способ сортинга клеток, можно осуществлять детекцию и количественный анализ. Эти способы могут быть применимы, например, в измерении содержания FGF2 в живых организмах или биологических образцах и в диагностике заболевания, ассоциированного с FGF2.

[0084]

Описания во всех публикациях, упомянутых в настоящем описании, включая патенты и описания патентных заявок, включены в настоящее описание в качестве ссылок в той степени, как если бы каждое из них было упомянуто конкретно.

[0085]

Примеры конкретных вариантов осуществления для практического осуществления настоящего изобретения представлены ниже. Примеры представлены исключительно в целях объяснения и не предназначены для ограничения объема настоящего изобретения.

[Примеры]

[0086]

Пример 1: Получение аптамеров РНК, специфически связывающихся с FGF2

В общепринятом способе SELEX использовали библиотеку приблизительно 30-40-мерных случайных последовательностей с добавлением приблизительно 20-мерных праймеров на оба конца. В этом случае полная длина полученного аптамера составляет приблизительно 80-100 мер, и после этого необходимым являлось укорачивание цепи. Однако укорачивание цепи не обязательно является простым, и зачастую активность коренным образом снижается. Таким образом, основываясь на способе Tailored-SELEX, разработанном NOXXON (Vater et al. Nucleic Acids Res. 31, 2003, el30; Jarosch et al. Nucleic Acids Res. 34, 2006, e86), осуществляли SELEX с использованием совокупности РНК с длиной приблизительно 30 мер, исключающей последовательность праймера.

Используемые ДНК-матрица и последовательности праймеров являются такими, как описано ниже.

ДНК-матрица:

5'-TCGAG-30N-TCCCTATAGTGAGTCGTATTAGCAGCTCCACAGGCTT-3' (SEQ ID NO: 13)

Прямой лигат:

5'-UAAUACGACUCACUAUA-3' (SEQ ID NO: 14)

Прямой праймер:

5'-AAGCCTGTGGAGCTGCTAATACGACTCACTATAGGGA-3' (SEQ ID NO: 15)

Прямой мостик:

5'-TCCCTATAGTGAGTCGTATTA-NH2-3' (SEQ ID NO: 16)

Обратный мостик:

5'-TCTTGTTCAGCTTAGTTCTCTCGAG-3' (SEQ ID NO: 17)

Обратный лигат:

5'-p-GAGAACTAAGCTGAACAAGA-NH2-3' (SEQ ID NO: 18)

[0087]

FGF2 человека (производимый Peprotech Inc.) использовали в качестве вещества-мишени. FGF2 иммобилизовали на агарозной смоле (NHS-активированной сефарозе, производимой GE Healthcare) посредством присоединения по аминогруппе. Присоединение по аминогруппе осуществляли по инструкциям GE Healthcare. Подтверждали степень иммобилизации, исследуя раствор FGF2 перед иммобилизацией и супернатант непосредственно после иммобилизации посредством электрофореза в ПААГ в присутствие SDS. В результате электрофореза в ПААГ в присутствие SDS в супернатанте не определяли полосу FGF2, что подтверждало, что присоединяли почти весь используемый FGF2. Приблизительно 290 пмоль FGF2 иммобилизовали на приблизительно 5 мкл смолы.

[0088]

РНК, используемую в первом раунде (30N-РНК), получали посредством получения двойной цепи химически синтезированной ДНК-матрицы с использованием прямого праймера и ее транскрипции с использованием набора DuraScribe (торговая марка) T7 Transcription Kit (производимого Epicentre). РНК, полученная этим способом, имеет замещенное фтором 2'-положение рибозы пиримидинового нуклеотида. После раунда 2 образуется двухцепочечная ДНК, и 3'-концевая последовательность праймера расщепляется ферментом рестрикции, после чего следует транскрипция.

[0089]

Совокупность РНК добавляли к смоле, на которой иммобилизовали FGF2, и смесь держали при комнатной температуре в течение 1 ч. Затем смолу промывали раствором A для удаления РНК, не связавшейся с FGF2. В настоящем описании раствор A является смешанным раствором 145 мМ хлорида натрия, 5,4 мМ хлорида калия, 1,8 мМ хлорида кальция, 0,8 мМ хлорида магния, 20 мМ Трис (pH 7,6) и 0,05% Tween 20. РНК, связавшуюся с FGF2, выделяли, добавляя элюент и инкубируя при 95°C в течение 10 мин. В качестве элюента использовали смесь 7 M мочевины, 3 мМ ЭДТА и 0,1 M Трис, полученную с pH 6,6. Выделенную РНК амплифицировали посредством RT-ПЦР, транскрибировали с помощью набора DuraScribe (торговая марка) T7 Transcription Kit и использовали в качестве совокупности для следующего раунда. Используя описываемое выше в качестве 1 раунда, осуществляли аналогичную операцию в течение 7 раундов. После завершения SELEX продукт ПЦР клонировали в вектор pGEM-T Easy (производимый Promega), который использовали для трансформации штамма DH5α Escherichia coli (производимого Toyobo). Плазмиду выделяли из отдельной колонии и исследовали последовательности оснований 97 клонов с помощью ДНК-секвенатора (3130xl Genetic Analyzer, производимого ABI).

[0090]

После 7 раундов SELEX исследовали последовательности. Из 89 клонов, 79 клонов являлись конвергентными, и их можно классифицировать на 11 типов. Оставшиеся 10 клонов представляли собой отдельные последовательности.

[0091]

Что касается конвергентных последовательностей, связывающую активность нуклеиновой кислоты, представленной в SEQ ID NO: 1 и 2, в отношении FGF2 оценивали способом поверхностного плазмонного резонанса. В дальнейшем, нуклеотидные последовательности, представленные в SEQ ID NO: 1 и 2, приведены как аптамер ID 1 и 2 вместе с модификацией 2'-положения рибозы. Круглыми скобками для каждого нуклеотида указаны модификации в 2'-положении рибозы, и F представляет собой атом фтора. В частности, c(F) представляет собой цитидин, где 2'-положение рибозы заменяют атомом фтора, и u(F) представляет собой уридин, где 2'-положение рибозы заменяют атомом фтора.

Начало каждой последовательности представляет собой 5'-конец, и конец представляет собой 3'-конец.

Аптамер ID 1:

GGGAU(F)AC(F)U(F)AGGGC(F)AU(F)U(F)AAU(F)GU(F)U(F)AC(F)C(F)AGU(F)GU(F)AGU(F)C(F)U(F)C(F)GA

Аптамер ID 2:GGGAAAC(F)U(F)AGGGC(F)GU(F)U(F)AAC(F)GU(F)GAC(F)C(F)AGU(F)GU(F)U(F)U(F)C(F)U(F)C(F)GA

[0092]

Для измерения использовали BIAcore2000, производимый BIAcore, и в качестве сенсорного чипа использовали CM4, реагирующий с аминогруппой. FGF2 человека разводили в растворе для иммобилизации (10 мМ ацетат натрия, pH 6) в концентрации 25-40 мкг/мл. Для реакции аминогруппы на стороне белка и карбоксильной группы на стороне чипа использовали этил-3-карбодиимид гидрохлорид и N-гидроксисукцинимид. После реакции осуществляли блокирование с помощью этаноламина-HCl. Количество иммобилизованного FGF2 устанавливали как 2500-4000 RU. Аптамер для аналита получали в количестве 0,15-0,5 мкМ. В качестве подвижного буфера использовали раствор A. В качестве раствора для регенерации использовали 2 M NaCl. FGF2 иммобилизовали на проточной кювете FC2 и вычитали результаты для FC1 для получения конечной сенсограммы.

[0093]

Измеряли связывание 2 последовательностей для нахождения исключительного связывания с FGF2. Сенсограмма, на которой показан статус связывания аптамера, представленного аптамером ID 1 и 2, и FGF2 человека, приведена на фиг. 1. Учитывая изложенное выше, показано, что эти нуклеиновые кислоты являются аптамерами, связывающимися с FGF2.

[0094]

Из 11 клонов, демонстрирующих конвергенцию, выбирали 10 клонов и, используя способ поверхностного плазмонного резонанса, исследовали, ингибируют ли они связывание FGF2 и рецептора FGF2. Для измерения использовали BIAcore2000, производимый BIAcore. Как указано в инструкциях BIAcore, протеин A (21181, производимый PIERCE) иммобилизовали на сенсорном чипе CM5. На нем иммобилизовали приблизительно по 1000 RU FGFR1α человека (IIIc), R2α (IIIc), R3 (IIIc), R4 (производимого R&D Systems), слитого с Fc-частью IgG (производимого R&D systems). В качестве аналита использовали смесь FGF2 (0,1 мкМ), гепарина (0,1 мкМ) (производимого Pfizer) и аптамера (0,15 мкМ). Перед тестированием ингибирования подтверждали, что смесь FGF2 и гепарина связывается с 4 типами рецепторов. В результате теста, аптамеры, представленные как аптамеры ID 1 и 2, демонстрировали сильную ингибиторную активность. Сенсограмма, на которой показано, что аптамер, представленный как аптамер ID 1, ингибирует связывание FGF2 и FGFR1α (IIIc), 2α (IIIc), 3(IIIc), 4, приведена на фиг. 2.

[0095]

Кроме того, определяли степень ингибирования в отношении каждого из 4 типов рецепторов. Определяли степень ингибирования, при этом максимальную степень связывания смеси FGF2 и гепарина принимали как 0 и степень связывания с буфером для инъекции в отдельности - как 100. В настоящем описании степень связывания означает значение RU для пика на сенсограмме. Вычисляли степень ингибирования. Аптамеры, представленные как аптамеры ID 1 и 2, демонстрировали высокое значение не менее 50% для любого рецептора. Степень ингибирования других аптамеров составляла не более 50%. Результаты представлены в таблице 1.

[0096]

Таблица 1

Степень ингибирования аптамеров, представленных как аптамеры ID 1 и 2, ингибирующих связывание FGF2 человека и рецептора FGF

Степень ингибирования (%)
FGFR1α (IIIc) FGFR2α (IIIc) FGFR3 (IIIc) FGFR4
Аптамер ID 1 89% 88% 80% 75%
Аптамер ID 2 89% 86% 75% 73%

[0097]

Пример 2: Укорачивание цепи аптамеров, представленных в SEQ ID NO: 1 и 2

Осуществляли укорачивание цепи аптамеров, представленных в SEQ ID NO: 1 и 2. Вторичную структуру РНК прогнозировали с использованием программы MFOLD (Zuker, Nucleic Acids Res. 31, 3406-3415, 2003) и осуществляли укорачивание цепи на основе структуры. Получали форму с укороченной цепью, получая ДНК целевой последовательности посредством химического синтеза и транскрибируя ее с использованием набора DuraScribe T7 Transcription Kit. Далее нуклеотидные последовательности (SEQ ID NO: 3 и 7) в фактически полученной форме с укороченной цепью представлены как аптамеры ID 3 и 7 вместе с модификацией 2'-положения рибозы.

[0098]

Аптамер ID 3: аптамер 36 нуклеотидов в длину, измененный относительно аптамера, представленного в SEQ ID NO: 1

GGGAU(F)AC(F)U(F)AGGGC(F)AU(F)U(F)AAU(F)GU(F)U(F)AC(F)C(F)AGU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 7: аптамер 35 нуклеотидов в длину, измененный относительно аптамера, представленного в SEQ ID NO: 2

GGGAAAC(F)U(F)AGGGC(F)GU(F)U(F)AAC(F)GU(F)GAC(F)C(F)AGU(F)GU(F)U(F)U(F)C(F)C(F)C(F)

[0099]

То, имеют ли эти нуклеиновые кислоты связывающую активность в отношении FGF2, исследовали способом поверхностного плазмонного резонанса, как в примере 1. Результаты представлены в таблице 2. Обнаруживали, что аптамеры, представленные как аптамеры ID 3 и 7, в значительной степени связываются с FGF2. Кроме того, то, имеют ли аптамеры ингибиторную активность в отношении связывания FGF2 и рецептора FGF2, исследовали способом поверхностного плазмонного резонанса аналогично примеру 1, обнаружив, что аптамеры, представленные как аптамеры ID 3 и 7, демонстрируют высокое ингибирование.

[0100]

Таблица 2

Степень ингибирования аптамеров, представленных как аптамеры ID 3 и 7, ингибирующих связывание FGF2 человека и рецептора FGF

FGFR1α (IIIc)
Аптамер ID 3 89%
Аптамер ID 7 85%

[0101]

Пример 3: Специфичность аптамера, представленного как аптамер ID 3

То, связывается ли аптамер FGF2, представленный как аптамер ID 3, с FGF1 из того же семейства FGF или некоторыми факторами роста EGF, β―NGF, VEGF, исследовали способом поверхностного плазмонного резонанса. Измерения осуществляли с использованием BIAcore 2000, производимого BIAcore. В качестве сенсорного чипа использовали чип SA с иммобилизованным на нем стрептавидином. С ним связывалось приблизительно 500 RU аптамера, представленного как аптамер ID 3, с добавлением биотина на 5'-конце. Аптамер с добавлением биотина получали посредством химического синтеза. В качестве белка, служащего лигандом, использовали FGF1, EGF, β―NGF, VEGF, производимый R&D. В качестве подвижного буфера использовали раствор A, используемый в примере 1, с добавлением хлорида натрия до конечной концентрации 0,3 M. В результате обнаруживали, что аптамер, представленный как аптамер ID 3, связывается с FGF2, но не связывается с другими белками. Сенсограмма приведена на фиг. 3.

Учитывая изложенное выше, обнаруживали, что аптамер, представленный как аптамер ID 3, специфически связывается с FGF2.

[0102]

Пример 4: Изменение и модификация аптамера с укороченной цепью

Для повышения FGF2-связывающей активности, стабильности, возможности доставки лекарственного средства и т.п. химически синтезировали нуклеиновые кислоты, представленные как аптамеры ID 3(1)-3(40), аптамеры ID 4 и 4(1)―4(4), аптамер ID 5 и аптамер ID 6, на основе аптамера, представленного в SEQ ID NO: 3. В настоящем описании аптамер, представленный как аптамер ID 4, является аптамером, представленным как аптамер ID 3(19), где один G(M) на 5'-конце и один C(M) на 3'-конце подвергали делеции. Аптамер, представленный как аптамер ID 5, является аптамером, представленным как аптамер ID 3(19), где один G(M) добавляли на 5'-конец и один C(M) добавляли на 3'-конец. Аптамер, представленный как аптамер ID 6, является аптамером, представленным как аптамер ID 3(19), где только A(M) добавляли на 5'-конец. Эти нуклеиновые кислоты получали посредством химического синтеза. То, ингибируют ли полученные аптамеры связывание FGF2 и рецептора FGF2, исследовали аналогично примеру 1. Как применяют в настоящем описании, концентрация аптамера, FGF2, гепарина составляла 0,1 мкМ. В результате эксперимента обнаруживали, что все измеряемые аптамеры сильно ингибировали связывание FGF2 и рецептора FGFR1α (IIIc). Результаты представлены в таблице 3.

[0103]

[Таблица 3-1]

Степень ингибирования аптамеров, ингибирующих связывание FGF2 и рецептора FGFR1α (IIIc) в присутствие гепарина

Степень ингибирования (%)
Аптамер ID 3(1) 84
Аптамер ID 3(2) 89
Аптамер ID 3(3) 87
Аптамер ID 3(4) 89
Аптамер ID 3(5) 87
Аптамер ID 3(6) 78
Аптамер ID 3(7) 89
Аптамер ID 3(8) 84
Аптамер ID 3(9) 89
Аптамер ID 3(10) 89
Аптамер ID 3(11) 88
Аптамер ID 3(12) 89
Аптамер ID 3(13) 88
Аптамер ID 3(14) 87
Аптамер ID 3(15) 86
Аптамер ID 3(16) 87
Аптамер ID 3(17) 88
Аптамер ID 3(18) 89
Аптамер ID 3(19) 93
Аптамер ID 3(20) 96
Аптамер ID 3(21) 97
Аптамер ID 3(22) 98
Аптамер ID 3(23) 91
Аптамер ID 3(24) 90
Аптамер ID 3(25) 90
Аптамер ID 3(26) 99
Аптамер ID 3(27) 99
Аптамер ID 3(28) 91
Аптамер ID 3(29) 91
Аптамер ID 3(30) 99

[0104]

[Таблица 3-2]

Степень ингибирования аптамеров, ингибирующих связывание FGF2 и рецептора FGFR1α (IIIc) в присутствие гепарина (продолжение)

Степень ингибирования (%)
Аптамер ID 3(31) 91
Аптамер ID 3(32) 91
Аптамер ID 3(33) 90
Аптамер ID 3(34) 91
Аптамер ID 3(35) 84
Аптамер ID 3(36) 98
Аптамер ID 3(37) 97
Аптамер ID 3(38) 97
Аптамер ID 3(39) 97
Аптамер ID 3(40) 97
Аптамер ID 4 95
Аптамер ID 4(1) 93
Аптамер ID 4(2) 94
Аптамер ID 4(3) 96
Аптамер ID 4(4) 96
Аптамер ID 5 94
Аптамер ID 6 93

[0105]

Учитывая изложенное выше, показано, что все аптамеры, представленные как указанные выше аптамеры ID, имеют высокую ингибиторную активность в отношении связывания FGF2 и рецептора FGF.

[0106]

Соответствующие последовательности представлены ниже. Заглавными буквами указана РНК, строчными буквами указана ДНК, и посредством idT указаны инвертированные dT. Круглыми скобками у каждого нуклеотида указана модификация в его 2'-положении, посредством F указан атом фтора, и посредством M указана O-метильная группа. Посредством s указана фосфотиоатная связь. Посредством C6 указан -(CH2)6-линкер, и посредством ssH указан линкер ssH (-CH2-CH2-O-CO-NH-(CH2)6-). PEG40TS2 является 2-разветвленным полиэтиленгликолем типа TS, имеющим молекулярную массу 40000 (SUNBRIGHT GL2-400TS, производимый NOF CORPORATION), PEG80TS4 является 4-разветвленным PEG типа TS, имеющим молекулярную массу 80000 (SUNBRIGHT GL4-800TS, производимый NOF CORPORATION), Y-NHS-40K является Y-образным PEG NHS Esyer (Y-NHS-40K, производимый JenKem Technology USA), имеющим молекулярную массу 40000, ME-100TS является PEG типа TS (SUNBRIGHT ME-100TS, производимый NOF CORPORATION), имеющим молекулярную массу 10000, и PTE-100CS является 4-разветвленным PEG типа CS (SUNBRIGHT PTE-100CS производимый NOF CORPORATION), имеющим молекулярную массу 10000. Каждая из нуклеотидных последовательностей аптамеров ID 3(1)-(40), не содержащие остаток линкера и модифицированный остаток, представленный в SEQ ID NO: 3, и аналогично, нуклеотидные последовательности аптамеров ID 4 и 4(1)-(4), аптамеров ID 5 и 6 представлены в SEQ ID NO: 4-6.

[0107]

Аптамер ID 3(1)

GGGAU(F)AC(F)U(F)AGGGC(F)A(M)U(F)U(F)A(M)A(M)U(F)G(M)U(F)U(F)AC(F)C(F)AGU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(2)

G(M)G(M)G(M)A(M)U(F)AC(F)U(F)AGGGC(F)AU(F)U(F)AAU(F)GU(F)U(F)AC(F)C(F)AGU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(3)

GGGAU(F)AC(F)U(F)AGG(M)GC(F)AU(F)U(F)AAU(F)GU(F)U(F)AC(F)C(F)AGU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(4)

GGGAU(F)AC(F)U(F)AG(M)GGC(F)AU(F)U(F)AAU(F)GU(F)U(F)AC(F)C(F)AGU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(5)

GGGAU(F)AC(F)U(F)A(M)GGGC(F)AU(F)U(F)AAU(F)GU(F)U(F)AC(F)C(F)AGU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(6)

GGGAU(F)AC(F)U(F)AGGGC(F)AU(F)U(F)AAU(F)GU(F)U(F)A(M)C(F)C(F)AGU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(7)

GGGAU(F)AC(F)U(F)AGGGC(F)AU(F)U(F)AAU(F)GU(F)U(F)AC(F)C(F)A(M)GU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(8)

G(M)G(M)G(M)A(M)U(F)AC(F)U(F)A(M)G(M)G(M)GC(F)A(M)U(F)U(F)A(M)A(M)U(F)G(M)U(F)U(F)A(M)C(F)C(F)A(M)GU(F)GU(F)AGU(F)C(F)C(F))C(F)-idT

Аптамер ID 3(9)

GGGAU(F)A(M)C(F)U(F)AGGGC(F)AU(F)U(F)AAU(F)GU(F)U(F)AC(F)C(F)AGU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(10)

GGGAU(F)AC(F)U(F)AGGGC(F)AU(F)U(F)AAU(F)GU(F)U(F)AC(F)C(F)AGU(F)GU(F)AG(M)U(F)C(F)C(F)C(F)

Аптамер ID 3(11)

GGGAU(F)AC(F)U(F)AGGGC(F)AU(F)U(F)AAU(F)GU(F)U(F)AC(F)C(F)AGU(F)GU(F)A(M)GU(F)C(F)C(F)C(F)

Аптамер ID 3(12)

G(M)G(M)G(M)A(M)U(F)AC(F)U(F)A(M)G(M)G(M)GC(F)A(M)U(F)U(F)A(M)A(M)U(F)G(M)U(F)U(F)A(M)C(F)C(F)A(M)GU(F)GU(F)AGU(M)C(M)C(M)C(M)-idT

Аптамер ID 3(13)

G(M)G(M)G(M)A(M)U(F)AC(F)U(F)A(M)G(M)G(M)GC(F)A(M)U(M)U(M)A(M)A(M)U(M)G(M)U(F)U(F)A(M)C(F)C(F)A(M)GU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(14)

G(M)G(M)G(M)A(M)U(F)AC(F)U(F)A(M)G(M)G(M)GC(F)A(M)U(F)U(F)A(M)A(M)U(F)G(M)U(F)U(M)A(M)C(F)C(F)A(M)GU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(15)

G(M)G(M)G(M)A(M)U(F)AC(F)U(F)A(M)G(M)G(M)GC(F)A(M)U(F)U(F)A(M)A(M)U(F)G(M)U(F)U(F)A(M)C(M)C(M)A(M)GU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(16)

G(M)G(M)G(M)A(M)U(F)AC(M)U(F)A(M)G(M)G(M)GC(F)A(M)U(F)U(F)A(M)A(M)U(F)G(M)U(F)U(F)A(M)C(F)C(F)A(M)GU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(17)

G(M)G(M)G(M)A(M)U(M)AC(F)U(F)A(M)G(M)G(M)GC(F)A(M)U(F)U(F)A(M)A(M)U(F)G(M)U(F)U(F)A(M)C(F)C(F)A(M)GU(F)GU(F)AGU(F)C(F)C(F)C(F)

Аптамер ID 3(18)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(19)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)-idT

Аптамер ID 3(20)

idT-G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(21)

GL2-400TS-C6-G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)-idT

Аптамер ID 3(22)

idT-G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)-C6-GL2-400TS

Аптамер ID 3(23)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)gC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(24)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)gU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(25)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)G(F)C(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(26)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)G(F)U(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(27)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)G(F)U(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(28)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)sGC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(29)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GsC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(30)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)sGU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(31)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GsU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(32)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)sGU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(33)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GsU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 3(34)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)G(F)C(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)G(F)U(F)G(F)U(F)A(M)G(M)U(M)C(M)C(M)C(M)-idT

Аптамер ID 3(35)

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)G(F)C(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)G(F)U(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)-idT

Аптамер ID 3(36)

GL4-800TS-C6-G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)-idT

Аптамер ID 3(37)

Y-NHS-40K-ssH-G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)-idT

Аптамер ID 3(38)

ME-100TS-C6-G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)-idT

Аптамер ID 3(39)

PTE-100CS-C6-G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)-idT

Аптамер ID 3(40)

GL2-400TS-ssH-G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)-idT

Аптамер ID 4: измененная форма аптамера, представленного как аптамер ID 3(19) и имеющего длину 34 нуклеотидов

G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)-idT

Аптамер ID 4(1)

G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)G(F)C(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)-idT

Аптамер ID 4(2)

G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)G(F)C(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)G(F)U(F)GU(F)A(M)G(M)U(M)C(M)C(M)-idT

Аптамер ID 4(3)

G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)G(F)C(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)sGU(F)A(M)G(M)U(M)C(M)C(M)-idT

Аптамер ID 4(4)

G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)G(F)C(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)G(F)U(F)GsU(F)A(M)G(M)U(M)C(M)C(M)-idT

Аптамер ID 5: измененная форма аптамера, представленного как аптамер ID 3(19) и имеющего длину 38 нуклеотидов

G(M)G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)C(M)-idT

Аптамер ID 6: измененная форма аптамера, представленного как аптамер ID 3(19) и имеющего длину 37 нуклеотидов

A(M)G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)-idT

[0108]

Пример 5: Оценка ингибиторной активности аптамера в отношении FGF2-зависимой клеточной пролиферации с использованием эндотелиальных клеток пупочной вены человека

Эндотелиальные клетки пупочной вены человека (HUVEC) высевали в 96-луночный плоскодонный планшет при 5×103 клеток на лунку и культивировали в течение ночи с использованием среды EGM-2 Bullet Kit для эндотелиальных клеток (CC-3162, производимых Lonza), содержащей 2% эмбриональную телячью сыворотку и факторы роста. Затем среду выбрасывали, клетки дважды промывали буфером PBS и добавляли смесь аптамера, представленного как аптамер ID 3(21), (5, 2,5, 1, 0,5 нМ) и FGF2 (конечная концентрация 0,5 нМ), растворенных в среде исключительно для эндотелиальных клеток, содержащей 2% эмбриональную телячью сыворотку. Через 72 часа исследовали количество жизнеспособных клеток с использованием набора Cell Counting Kit-8. Для измерения поглощения использовали спектрофотометр для чтения микропланшетов (450 нм). Один образец измеряли при n=3. В качестве положительного контроля использовали антитело mAb мыши против FGF2/основного FGF (Ab-3) (3H3) (производимое Calbiochem). Используя значение OD на лунку, полученное при добавлении FGF2 в отдельности и культуры клеток, культивируемой в течение 3 дней, в качестве ингибиторной активности 0%, и значение, полученное с помощью культуры без FGF2, культивируемой в течение 3 дней, в качестве ингибиторной активности 100%, вычисляли ингибиторную активность аптамера из значения OD на лунку, полученного при культивировании с добавлением смеси FGF2 и аптамера. В результате показано, что аптамер, представленный как аптамер ID 3(21), имеет высокую ингибиторную активность в отношении FGF2. Значение IC50 составляло приблизительно 1,0 нМ. Результаты представлены в таблице 4.

[0109]

[Таблица 4]

Супрессия роста клеток HUVEC аптамером, представленным как аптамер ID 3(21), с добавлением FGF2

Степень ингибирования (%)
- 100
FGF2 (500 пМ) 0
3H3 (25 нМ)+FGF2 (500 пМ) 100
3H3 (5 нМ)+FGF2 (500 пМ) 30
3H3 (1 нМ)+FGF2 (500 пМ) 8,5
Аптамер ID 3(21) (5 нМ)+FGF2 (500 пМ) 100
Аптамер ID 3(21) (2,5 нМ)+FGF2 (500 пМ) 86
Аптамер ID 3(21) (1 нМ)+FGF2 (500 пМ) 47
Аптамер ID 3(21) (0,5 нМ)+FGF2 (500 пМ) 0
Скремблированная последовательность (5 нМ)+FGF2 (500 пМ) 11

"-" означает отсутствие добавления FGF2.

[0110]

Учитывая изложенное выше, предполагали, что аптамер, представленный как аптамер ID 3(21), ингибирует ангиогенез.

[0111]

Активность различных аптамеров оценивали способом, аналогичным указанному выше, за исключением того, что 96-луночный плоскодонный планшет заменяли планшетом, покрытым коллагеном. Концентрация добавленного FGF2 составляла 0,58 нМ. Результаты представлены в таблице 5. В качестве РНК отрицательного контроля использовали последовательность макугена (зарегистрированная торговая марка) без добавления PEG, и с C6-модификацией 5'-конца и idT-модификацией 3'-конца.

[0112]

[Таблица 5]

Значение IC50 аптамера, супрессирующего рост клеток HUVEC при добавлении FGF2

Аптамер ID IC50 (нМ)
3(8) 27
3(12) 21
3(13) 15
3(14) 12
3(15) 14
3(16) 7,9
3(18) 2,6
3(23) 5,3
3(24) 7,3
3(25) 5,1
3(26) 3,0
3(27) 3,7
3(28) 4,0
3(29) 3,1
3(30) 3,3
3(31) 10
3(32) 4,0
3(33) 4,0
4 5,0
4(1) 3,8
4(2) 5,1
4(3) 4,6
4(4) 4,5
5 2,6
6 3,1
РНК отрицательного контроля >400

[0113]

Учитывая изложенное выше, предполагали, что аптамеры, представленные как указанные выше аптамеры ID, аналогично ингибируют ангиогенез.

[0114]

Пример 6: Оценка активности ингибирования аптамером FGF2-зависимой клеточной пролиферации с использованием эндотелиальных клеток пупочной вены человека-2

Способом, аналогичным таковому в примере 5, измеряли ингибиторную активность аптамеров, представленных как аптамеры ID 8-12. Результаты представлены в таблице 6.

Нуклеотидные последовательности аптамеров ID 8-12 представлены в SEQ ID NO: 8-12, соответственно.

[0115]

Аптамер ID 8

NH2-C(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)G(M)-idT

Аптамер ID 9

NH2-C(M)C(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)A(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)G(M)G(M)-idT

Аптамер ID 10

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)G(M)U(M)U(F)A(M)A(M)C(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 11

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)C(M)U(M)U(F)A(M)A(M)G(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

Аптамер ID 12

G(M)G(M)G(M)A(M)U(M)A(M)C(M)U(F)A(M)G(M)G(M)GC(M)A(M)U(M)U(F)U(M)A(M)U(M)G(M)U(F)U(M)A(M)C(M)C(M)A(M)GU(F)GU(F)A(M)G(M)U(M)C(M)C(M)C(M)

[0116]

[Таблица 6]

Значение IC50 аптамера, супрессирующего рост клеток HUVEC при добавлении FGF2

Аптамер ID IC50 (нМ)
Аптамер ID 8 5,6
Аптамер ID 9 3,7
Аптамер ID 10 4,9
Аптамер ID 11 13
Аптамер ID 12 2,3
Аптамер ID 3(19) 3,4

[0117]

Пример 7: Тестирование модели ангиогенеза мыши

Matrigel, содержащий 0,76% (конечная концентрация) цитрата натрия, (BD MatrigelTM), содержащий FGF-2 человека (производимый R&D), подкожно инъецировали мыши C57BL/6J (самке) возрастом 8 недель под анестезии. Через 7 дней выделяли Matrigel и оценивали уровень ангиогенеза с учетом уровня гемоглобина в Matrigel. Уровень гемоглобина количественно анализировали цианметгемоглобиновым способом с использованием набора Drabkin Reagent Kit. Аптамер растворяли в фосфатном буфере, содержащем 1 мМ хлорида магния, и вводили интраперитонеально один раз в сутки незамедлительно после подкожного введения Matrigel. Исследуемая группа представлена в таблице 7, и результаты представлены в таблице 8. Значительное ингибирование ангиогенеза наблюдали в группе, которой вводили 1 мг/кг аптамера. Учитывая сказанное выше, подтверждали, что аптамер по настоящему изобретению также демонстрирует сильную ингибиторную активность в отношении ангиогенеза в модели на животных.

[0118]

[Таблица 7]

Исследуемая группа

Исследуемая группа FGF-2 (мкг) Доза аптамера (мг/кг) Путь введения Частота введения Количество животных
(мышей)
1 Контрольная группа 0 0 Интраперитонеальный Раз в сутки 3
2 Группа, которой вводили растворитель 1 0 Интраперитонеальный Раз в сутки 3
3 Группа, которой вводили низкую дозу аптамера ID 3(22) 1 0,1 Интраперитонеальный Раз в сутки 3
4 Группа, которой вводили высокую дозу аптамера ID 3(22) 1 1 Интраперитонеальный Раз в сутки 3

[0119]

[Таблица 8]

Результаты тестирования модели ангиогенеза мыши

Контрольная группа Количество гемоглобина (мг/мл)
1 Группа, которой вводили растворитель 0,19
2 Группа, которой вводили низкую дозу аптамера ID 3(22) 2,2
3 Группа, которой вводили высокую дозу аптамера ID 3(22) 1,3
4 Контрольная группа 0,29

[0120]

Настоящая заявка основана на патентной заявке № 2014-60966 (дата подачи: 24 марта 2014 года), поданной в Японии, содержание которой включено в настоящее описание в полном объеме.

[Промышленная применимость]

[0121]

Аптамер или комплекс по настоящему изобретению могут быть применимыми в качестве лекарственного средства, или диагностического средства или реагента для заболеваний, таких как заболевание, сопровождаемое ангиогенезом, заболевание костей и суставов, боль и т.п. Аптамер и комплекс по настоящему изобретению также могут быть применимыми для очистки и концентрирования FGF2, мечения FGF2, а также детекции и количественного анализа FGF2.

1. Аптамер, связывающийся с FGF2, содержащий нуклеотидную последовательность, представленную следующей формулой (1) (где урацил может быть замещен на тимин), и представляющий собой (a) или (b):

N1GGAN2ACUAGGGCN3UUAAN4GUN5ACCAGUGUN6 (формула 1),

каждый из N1 и N6 независимо является любым из от 0 до 10 оснований,

N2, N3, N4 и N5 независимо являются любым основанием,

(a) аптамер, где в нуклеотидах, содержащихся в аптамере,

(i) 2'-положение рибозы каждого пиримидинового нуклеотида является атомом фтора,

(ii) 2'-положение рибозы каждого пуринового нуклеотида является гидроксигруппой;

(b) аптамер по п. (a), где

(i) атом фтора в 2'-положении рибозы каждого пиримидинового нуклеотида является независимо незамещенным или замещенным атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксигруппы и метоксигруппы,

(ii) гидроксигруппа в 2'-положении рибозы каждого пуринового нуклеотида является независимо незамещенной или замещенной атомом или группой, выбранными из группы, состоящей из атома водорода, метоксигруппы и атома фтора.

2. Аптамер по п. 1, где

N1 является G, GG, AG, C или пропуском,

N2 является A или U,

N3 является G, C или A,

N4 является G, C или U,

N5 является G или U, и

N6 является UUCN61 или AGUCN62, где каждый из N61 и N62 независимо является любым из от 0 до 10 оснований.

3. Аптамер по п. 1 или 2, содержащий нуклеотидную последовательность, представленную следующей формулой (2) или (3):

GGGAAACUAGGGCGUUAACGUGACCAGUGUUUCN61 (формула 2),

N1GGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCN62 (формула 3).

4. Аптамер по любому из пп. 1-3, содержащий нуклеотидную последовательность, представленную в SEQ ID NO: 2 или 7.

5. Аптамер по любому из пп. 1-3, содержащий нуклеотидную последовательность, представленную в SEQ ID NO: 1, 3, 4, 5, 6, 8, 10 или 11.

6. Аптамер по любому из пп. 1-5, где от 1 до 10 нуклеотидов являются замещенными, делетированными, встроенными или добавленными, являющийся

(a) аптамером, где в нуклеотидах, содержащихся в аптамере,

(i) 2'-положение рибозы каждого пиримидинового нуклеотида является атомом фтора,

(ii) 2'-положение рибозы каждого пуринового нуклеотида является гидроксигруппой;

(b) аптамером по п. (a), где

(i) атом фтора в 2'-положении рибозы каждого пиримидинового нуклеотида является независимо незамещенным или замещенным атомом или группой, выбранными из группы, состоящей из атома водорода, гидроксигруппы и метоксигруппы,

(ii) гидроксигруппа в 2'-положении рибозы каждого пуринового нуклеотида является независимо незамещенной или замещенной атомом или группой, выбранными из группы, состоящей из атома водорода, метоксигруппы и атома фтора.

7. Аптамер по любому из пп. 1-6, имеющий длину не более 45 нуклеотидов.

8. Аптамер по любому из пп. 1-7, ингибирующий связывание FGF2 и рецептора FGF.

9. Комплекс для связывания аптамера с FGF2, содержащий аптамер по любому из пп. 1-8 и функциональное вещество, где функциональное вещество является аффинным веществом, веществом для мечения, ферментом, средством для доставки лекарственного средства или лекарственным средством.

10. Лекарственное средство для лечения или профилактики заболевания, сопровождаемого ангиогенезом, содержащее аптамер по любому из пп. 1-8 или комплекс по п. 9.

11. Лекарственное средство для лечения или профилактики заболевания костей и суставов, содержащее аптамер по любому из пп. 1-8 или комплекс по п. 9.

12. Лекарственное средство для лечения или профилактики боли, содержащее аптамер по любому из пп. 1-8 или комплекс по п. 9.

13. Способ лечения или профилактики заболевания, сопровождаемого ангиогенезом, включающий введение индивидууму эффективного количества аптамера по любому из пп. 1-8 или комплекс по п. 9.

14. Способ лечения или профилактики заболевания костей и суставов, включающий введение субъекту эффективного количества аптамера по любому из пп. 1-8 или комплекса по п. 9.

15. Способ лечения или профилактики боли, включающий введение субъекту эффективного количества аптамера по любому из пп. 1-8 или комплекса по п. 9.

16. Аптамер по любому из пп. 1-8 или комплекс по п. 9 для применения в лечении или профилактике заболевания, сопровождаемого ангиогенезом.

17. Аптамер по любому из пп. 1-8 или комплекс по п. 9 для применения для лечения или профилактики заболевания костей и суставов.

18. Аптамер по любому из пп. 1-8 или комплекс по п. 9 для применения для лечения или профилактики боли.

19. Применение аптамера по любому из пп. 1-8 или комплекса по п. 9 в получении лекарственного средства для лечения или профилактики заболевания, сопровождаемого ангиогенезом.

20. Применение аптамера по любому из пп. 1-8 или комплекса по п. 9 для получения лекарственного средства для лечения или профилактики заболевания костей и суставов.

21. Применение аптамера по любому из пп. 1-8 или комплекса по п. 9 для получения лекарственного средства для лечения или профилактики боли.



 

Похожие патенты:

Изобретение относится к биотехнологии и представляет собой антитела, которые связывают белок программируемой гибели клеток 1 человека (PD-1). Данные антитела могут быть полезны для лечения рака в одиночку и в сочетании с химиотерапией и другими средствами лечения рака.

Изобретение относится к области биотехнологии. Представлен рекомбинантный штамм бактерии Streptococcus pyogenes М39 «Гуров», полученный путем трансформации штамма Streptococcus pyogenes «Гуров» плазмидой pT7ErmEMM, полученной на основе вектора p7ermB путем встраивания по сайтам HindIII и EcoRI фрагмента гена emm.

Изобретение относится к области биохимии, в частности к способу борьбы с повреждением растений хлопковой совкой, а также к способу борьбы с насекомым хлопковая совка, предусматривающим предоставление инсектицидного белка Cry1Da указанной хлопковой совке.

Настоящее изобретение относится к генной инженерии. Предложен способ in vitro модификации генома в представляющем интерес геномном локусе в нечеловеческой плюрипотентной клетке млекопитающего, включающий внесение в клетку компонентов системы CRISPR/Cas9 в комбинации с крупным направляющим вектором (LTVEC), который составляет по меньшей мере 10 т.п.о.

Изобретение относится к области биохимии, в частности к белку, способному усиливать устойчивость растения к вертициллезному вилту, а также молекуле нуклеиновой кислоты, его кодирующей.

Изобретение относится к области медицины и предназначено для лечения спинальной мышечной атрофии (СМА). Способ включает введение посредством болюсной инъекции в интратекальное пространство субъекта, являющегося человеком, антисмыслового соединения, содержащего антисмысловой олигонуклеотид, состоящий из 18 связанных нуклеозидов, где каждая межнуклеозидная связь олигонуклеотида представляет собой фосфоротиоатную связь, где каждый нуклеозид олигонуклеотида представляет собой 2'-МОЭ нуклеозид и где введение антисмыслового соединения усиливает включение экзона 7 в SMN2 мРНК транскриптах у субъекта, являющегося человеком.

Изобретение относится к биотехнологии. Предложена система для экспрессии Fab-фрагментов антител, состоящая из рекомбинантных плазмидных ДНК Ab-HCh-HIS/pPICZ_α_A и Ab-LCh-LAMBDA/pPICZα_A.

Изобретение относится к области биохимии, в частности к генетически модифицированной мыши для получения антитела, причем антитело содержит первую тяжелую цепь иммуноглобулина, содержащую первый вариабельный домен тяжелой цепи иммуноглобулина человека, кодируемый вариабельной областью тяжелой цепи иммуноглобулина человека, содержащей VH2-26, VH3-21, VH3-64 или их соматически гипермутированный вариант.

Изобретение относится к области биохимии, в частности к способу продуцирования вирусоподобной частицы (VLP) в растении, а также к способу индукции иммунного ответа к вирусу гриппа подтипа В или НЗ у субъекта и способу получения композиции для индукции иммунного ответа к вирусу гриппа подтипа В или Н3 у субъекта с его использованием.

Изобретение относится к области биотехнологии, в частности к трансформированной клетке для экспрессии цис-пренилтрансферазы и рецептора Nogo-B, полученной посредством введения в клетку кодирующего гена, кодирующего цис-пренилтрансферазу, и гена, кодирующего рецептор Nogo-B.

Изобретение относится к области медицины и предназначено для лечения спинальной мышечной атрофии (СМА). Способ включает введение посредством болюсной инъекции в интратекальное пространство субъекта, являющегося человеком, антисмыслового соединения, содержащего антисмысловой олигонуклеотид, состоящий из 18 связанных нуклеозидов, где каждая межнуклеозидная связь олигонуклеотида представляет собой фосфоротиоатную связь, где каждый нуклеозид олигонуклеотида представляет собой 2'-МОЭ нуклеозид и где введение антисмыслового соединения усиливает включение экзона 7 в SMN2 мРНК транскриптах у субъекта, являющегося человеком.

Изобретение относится к области биотехнологии, конкретно к антителам и их антиген-связывающим фрагментам, сконструированным для связывания трансформирующего фактора роста-β (TGFβ1, TGFβ2 и TGFβ3), что может быть использовано в медицине.

Изобретение относится к области биотехнологии. Раскрывается заполняющий компонент аденоассоциированного вируса, состоящий из нуклеиновой кислоты длиной от 3300 до 4200 нуклеотидов.

Изобретение относится к области биохимии и молекулярной биологии. Предложено применение молекулы нуклеиновой кислоты, способной к связыванию с SDF-1 и блокированию взаимодействия между SDF-1 и рецептором SDF-1 CXCR7.

Изобретение относится к биохимии. Описано двухцепочечное средство для РНКи для ингибирования экспрессии транстиретина (TTR), содержащее смысловую цепь, комплементарную антисмысловой цепи, где указанная антисмысловая цепь содержит последовательность, комплементарный нуклеотидам 504-526 гена транстиретина (TTR) (SEQ ID NO:1), где смысловая цепь имеет длину 21 нуклеотид, а антисмысловая цепь имеет длину 23 нуклеотида.

Изобретение относится к области биотехнологии, конкретно к способам для идентификации связывающих полипептидов (например, антител или их антигенсвязывающих фрагментов), которые специфически связываются с антигеном клеточной поверхности, что может быть использовано в медицине.

Изобретение относится к области молекулярной биологии и биотехнологии и представляет собой биологически активный белковый препарат, обладающий специфической активностью папаин-подобных цистеиновых протеиназ, характеризующийся тем, что представляет собой аминокислотную последовательность, выбранную из SEQ ID NO:2-4, экспрессирующийся в растворимой форме.

Данное изобретение относится к области биотехнологии и иммунологии. Предложена нуклеотидная композиция для получения гетеродимерной конструкции Fc, имеющей замены в CH3 доменах, обеспечивающие повышение температуры плавления.

Данное изобретение относится к биотехнологии. Предложен олигонуклеотид для обеспечения пропуска двух или более экзонов пре-мРНК дистрофина.

Настоящее изобретение относится к области биотехнологии, конкретно к полипептидному биомаркеру эффективности применения ингибитора FGFR при лечении рака мочевого пузыря и рака легких, что может быть использовано в медицине.

Изобретение относится к области биотехнологии, в частности к трансформированной клетке для экспрессии цис-пренилтрансферазы и рецептора Nogo-B, полученной посредством введения в клетку кодирующего гена, кодирующего цис-пренилтрансферазу, и гена, кодирующего рецептор Nogo-B.

Изобретение относится к области биохимии. Описана группа изобретений, включающая в себя аптамер, связывающийся с FGF2; комплекс для связывания аптамера с FGF2; лекарственные средства для лечения или профилактики заболевания, сопровождаемого ангиогенезом; заболевания костей и суставов; боли; способ лечения или профилактики вышеперечисленных заболеваний, применение вышеуказанного аптамера или комплекса в получении лекарственного средства для лечения или профилактики вышеперечисленных заболеваний. В одном из вариантов аптамер содержит нуклеотидную последовательность, представленную формулой N1GGAN2ACUAGGGCN3UUAAN4GUN5ACCAGUGUN6 Изобретение расширяет арсенал средств для связывания FGF2. 11 н. и 10 з.п. ф-лы, 3 ил., 9 табл., 7 пр.

Наверх