Микроорганизмы corynebacterium sp., обладающие способностью продуцировать l-лизин, и способ продуцирования l-лизина с использованием этих микроорганизмов

Группа изобретений относится к области биотехнологии. Предложен L-лизин-продуцирующий микроорганизм рода Corynebacterium, где белок, содержащий аминокислотную последовательность SEQ ID NO: 1, является инактивированным. Предложен способ продуцирования L-лизина с использованием указанного микроорганизма. Группа изобретений позволяет повысить продукцию L-лизина при использовании указанного модифицированного микроорганизма по сравнению с исходным родительским микроорганизмом. 2 н. и 2 з.п. ф-лы, 5 табл., 8 пр.

 

[Область, к которой относится изобретение]

Настоящее изобретение относится к L-лизин-продуцирующему микроорганизму рода Corynebacterium и к способу продуцирования L-лизина с использованием такого микроорганизма.

[Предпосылки создания изобретения]

L-лизин, а именно, одна из незаменимых аминокислот, используется в кормах для животных, в фармацевтической и косметической промышленности и продуцируется посредством ферментации под действием микроорганизмов рода Corynebacterium или рода Escherichia.

Штамм рода Corynebacterium, а в частности, Corynebacterium glutamicum, представляет собой грам-положительный микроорганизм, который широко применяется для продуцирования L-аминокислоты. Для продуцирования L-лизина обычно применяются мишень-специфические подходы, такие как повышение уровня экспрессии генов, кодирующих ферменты, участвующие в биосинтезе L-лизина, в штамме рода Corynebacterium, или удаление генов, которые не являются необходимыми для биосинтеза L-лизина. Помимо этих методов был также применен метод удаления генов, которые не участвуют в биосинтезе L-лизина, или метод удаления генов, специфическая функция которых пока не известна.

В соответствии с этим, авторами настоящего изобретения были проведены крупномасштабные исследования для идентификации эффективных свойств, заключающихся в повышении уровня продуцирования лизина. В результате, авторами настоящего изобретения был проведен скрининг микроорганизма, продуцирующего высокую концентрацию L-лизина, посредством рандомизированной дизрупции эндогенных генов микроорганизма рода Corynebacterium, и было обнаружено, что если ген, функция которого пока еще не была описана, подвергается дизрупции в скринированном микроорганизме, то уровень продуцирования L-лизина этим микроорганизмом повышается, и на основе этих данных было создано настоящее изобретение.

Документы предшествующего уровня техники

(Патентный документ 1) KR 10-0838035 B1 (опубликованный 12 июня 2008).

[Раскрытие изобретения]

[Техническая проблема]

Целью настоящего изобретения является получение L-лизин-продуцирующего микроорганизма рода Corynebacterium.

Другой целью настоящего изобретения является способ продуцирования L-лизина с использованием этого микроорганизма.

[Решение технической проблемы]

Настоящее изобретение, разработанное для достижения вышеуказанных целей, относится к L-лизин-продуцирующему микроорганизму рода Corynebacterium, где белок, содержащий аминокислотную последовательность SEQ ID NO: 1, является инактивированным.

Настоящее изобретение также относится к способу продуцирования L-лизина, включающему стадии: культивирования микроорганизма согласно изобретению в среде и выделения L-лизина из микроорганизма или среды.

[Преимущественные эффекты]

Настоящее изобретение относится к рекомбинантному микроорганизму рода Corynebacterium, обладающему повышенной способностью продуцировать L-лизин, где указанный микроорганизм был получен путем инактивации белка, который содержит аминокислотную последовательность SEQ ID NO: 1, и функция которого неизвестна, в L-лизин-продуцирующем микроорганизме рода Corynebacterium. Рекомбинантный микроорганизм рода Corynebacterium может продуцировать L-лизин с высоким выходом, и таким образом он может быть использован в промышленности для продуцирования L-лизина.

[Способ осуществления изобретения]

Настоящее изобретение более подробно описано ниже.

В своем первом аспекте, настоящее изобретение относится к L-лизин-продуцирующему микроорганизму рода Corynebacterium, где белок, содержащий аминокислотную последовательность SEQ ID NO: 1, является инактивированным.

Белок, содержащий аминокислотную последовательность SEQ ID NO: 1, представляет собой белок, который является эндогенным в микроорганизме рода Corynebacterium, или гипотетический белок с неизвестной функцией. Белок, содержащий аминокислотную последовательность, которая по меньшей мере на 80%, в частности, по меньшей мере на 90%, более конкретно, по меньшей мере на 95%, а еще более конкретно, по меньшей мере на 97% гомологична аминокислотной последовательности SEQ ID NO: 1, может также входить в объем понятия «белок, содержащий аминокислотную последовательность SEQ ID NO: 1». Кроме того, очевидно, что белок, имеющий аминокислотную последовательность, содержащую делецию, модификацию, замену или делецию одной или нескольких аминокислот, также входит в объем настоящего изобретения, при условии, что этот белок будет иметь последовательность, гомологичную последовательности SEQ ID NO: 1, и будет обладать биологической активностью, в основном, аналогичной биологической активности белка, имеющего аминокислотную последовательность SEQ ID NO: 1, или подобной активностью.

В объем настоящего изобретения входит любая нуклеотидная последовательность, обладающая способностью кодировать белок, содержащий аминокислотную последовательность SEQ ID NO: 1. В частности, ген, кодирующий белок SEQ ID NO: 1, может иметь нуклеотидную последовательность SEQ ID NO: 2. Кроме того, в объем настоящего изобретения может также входить нуклеотидная последовательность, которая по меньшей мере на 80%, в частности, по меньшей мере на 90%, более конкретно на 95%, а еще более конкретно на 97% гомологична нуклеотидной последовательности SEQ ID NO: 2. Кроме того, в объем настоящего изобретения могут также входить варианты последовательности, кодирующие одну и ту же аминокислоту, что обусловлено вырожденностью генетического кода.

Используемый здесь термин «гомология» означает идентичность данной аминокислотной последовательности или нуклеотидной последовательности и может быть выражен в процентах. В описании изобретения, гомологичная последовательность, активность которой идентична или подобна активности аминокислотной последовательности или нуклеотидной последовательности, выражена термином «% гомологии».

Гомология аминокислотной последовательности или нуклеотидной последовательности может быть определен с использованием, например, алгоритма BLAST (см. Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)) или FASTA, Pearson (см. Methods Enzymol., 183, 63 (1990)). Программы, называемые BLASTN и BLASTX, были разработаны на основе этого алгоритма BLAST (см. http://www.ncbi.nlm.nih.gov).

Используемый здесь термин «инактивация» означает, что экспрессия эндогенного гена была снижена по сравнению с экспрессией родительского штамма, штамма до модификации или штамма дикого типа, либо этот ген не экспрессируется или не обладает активностью или обладает пониженной активностью даже при его экспрессии. В настоящем изобретении, инактивация может быть достигнута любым методом инактивации, известным специалистам. В настоящем изобретении, метод инактивации может быть осуществлен посредством введения по меньшей мере одной мутации, выбранной из группы, состоящей из инсерционной мутации, достигаемой посредством инсерции по меньшей мере одной пары оснований в ген; делеционной мутации, достигаемой посредством делеции по меньшей мере одной пары оснований в гене; и транзиционной или трансверсионной мутации пары оснований, достигаемой посредством введения в ген несмыслового кодона. Альтернативно, метод инактивации может быть осуществлен путем замены эндогенного промотора гена более слабым промотором или делеции всего гена или его части, но объем настоящего изобретения не ограничивается этим методом.

Методом дизрупции гена, применяемым в настоящем изобретении, может быть любой метод дизрупции гена, известный специалистам, и этот метод не имеет конкретных ограничений. Так, например, для индуцирования мутаций может быть применено излучение, такое как УФ-излучение, или химическое вещество, и из полученных мутантов может быть выбран штамм с дизрупцией гена-мишени. Кроме того, метод дизрупции гена может быть осуществлен, например, путем введения в микроорганизм нуклеотидной последовательности или вектора, содержащих нуклеотидную последовательность, гомологичную гену-мишени, и индуцирования гомологичной рекомбинации. Кроме того, введенная нуклеотидная последовательность или введенный вектор могут содержать маркер доминантного отбора.

Примерами вектора, который может быть использован для инактивации белка-мишени, являются природные или рекомбинантные плазмиды, космиды, вирусы и бактериофаги. Так, например, фаговым вектором или космидным вектором, используемым в настоящем изобретении, может быть pWE15, M13, λEMBL3, λEMBL4, λFIXII, λDASHII, λZAPII, λgt10, λgt11, Charon4A, Charon21A или т.п., а плазмидным вектором, используемым в настоящем изобретении, может быть вектор типа pDZ, типа pBR, типа pUC, типа pBluescriptII, типа pGEM, типа pTZ, типа pCL, типа pET или т.п. Вектор, который может быть использован в настоящем изобретении, не имеет конкретных ограничений и может представлять собой экспрессионный вектор, известный специалистам.

Введение вектора может быть легко осуществлено любым стандартным методом, известным специалистам. Вообще говоря, примерами такого метода являются метод CaCl2-преципитации, метод Анахана с повышенной эффективностью, где используется диметилсульфоксид (ДМСО) в качестве восстановителя, применяемого в методе CaCl2-преципитации; электропорация; метод преципитации фосфатом кальция; метод слияния протопластов; метод перемешивания с использованием волокон карбида кремния; метод трансформации, опосредуемый ПЭГ, сульфатом декстрана, липофектамином и сухим реагентом/супрессией и т.п.

Используемый здесь термин «трансформация» означает введение вектора, содержащего полинуклеотид, кодирующий белок-мишень, в клетку-хозяина, что приводит к экспрессии или к инактивации этого полипептида в клетке-хозяине. Полинуклеотид может включать ДНК и РНК, которые кодируют белок-мишень, или промотор, снижающий уровень экспрессии белка-мишени, или маркерный ген, способный инактивировать экспрессию белка-мишени и т.п. Полинуклеотид может быть введен в клетку-хозяина в любой форме, при условии, что он будет экспрессироваться в этой клетке.

В качестве родительского штамма, в котором белок, содержащий аминокислотную последовательность SEQ ID NO: 1, должен быть инактивирован, может быть использован любой микроорганизм без каких-либо ограничений, который обладает способностью продуцировать L-лизин. Примерами этого микроорганизма являются микроорганизмы, принадлежащие к роду Corynebacterium, к роду Brevibacterium, к роду Escherichia, к роду Enterbacter, к роду Erwinia, к роду Serratia и к роду Providencia. В частности, может быть использован микроорганизм рода Corynebacterium, а более конкретно, микроорганизм Corynebacterium glutamicum.

Используемый здесь термин «микроорганизм, обладающий способностью продуцировать L-лизин» означает микроорганизм, полученный путем модификации, по существу, известного гена так, чтобы он приобретал способность продуцировать L-лизин. Так, например, микроорганизмом может быть микроорганизм, полученный посредством повышения уровня экспрессии одного или более генов, выбранных из группы, состоящей из генов, участвующих в биосинтезе L-лизина, включая aspB (ген, кодирующий аспартат-аминотрансферазу), lysC (ген, кодирующий аспартат-киназу), asd (ген, кодирующий аспартат-полульдегид-дегидрогеназу), dapA (ген, кодирующий дигидродипиколинат-синтазу), dapB (ген, кодирующий дигидродипиколинат-редуктазу) и lysA (ген, кодирующий диаминодипимелат-декарбоксилазу), которые являются эндогенными в микроорганизме рода Corynebacterium и участвуют в продуцировании L-аминокислот. Кроме того, микроорганизмом может быть микроорганизм, полученный путем обработки мутантного штамма, ауксотрофного по L-лейцину, N-метил-N′-нитро-N-нитрозогуанидином (NTG).

Во втором своем аспекте, настоящее изобретение относится к способу продуцирования L-лизина, включающему стадии: культивирования микроорганизма согласно изобретению в среде и выделения L-лизина из микроорганизма или среды.

Микроорганизм согласно изобретению является таким, как он описан выше.

В способе согласно изобретению, культивирование микроорганизма рода Corynebacterium может быть осуществлено в любых условиях культивирования и любым методом культивирования, известным специалистам.

Так, например, среда, которая может быть использована для культивирования микроорганизма рода Corynebacterium, описана в общем руководстве Американского Бактериологического Общества по применению бактериологических методов (Washington D.C., USA, 1981).

Источниками сахара, которые могут быть использованы в среде, являются сахара и углеводы, такие как глюкоза, сахароза, лактоза, фруктоза, мальтоза, крахмал или целлюлоза; масла и жиры, такие как соевое масло, подсолнечное масло, касторовое масло или кокосовое масло; жирные кислоты, такие как пальмитиновая кислота, стеариновая кислота или линолевая кислота; спирты, такие как глицерин или этанол; и органические кислоты, такие как уксусная кислота. Эти вещества могут быть использованы отдельно или в смеси, и не рассматриваются как ограничение объема изобретения.

Источниками азота, которые могут быть использованы, являются азот-содержащие органические соединения, такие как пептон, дрожжевой экстракт, мясной экстракт, солодовый экстракт, жидкий кукурузный экстракт, соевая мука и мочевина, или неорганические соединения, такие как сульфат аммония, хлорид аммония, фосфат аммония, карбонат аммония и нитрат аммония. Эти источники азота могут быть использованы отдельно или в смеси, и не рассматриваются как ограничение объема изобретения.

Источниками фосфора, которые могут быть использованы, являются дигидрофосфат калия или бифосфат калия или соответствующие соли натрия. Среда для культивирования может также содержать соли металлов, такие как сульфат магния или сульфат железа, которые необходимы для роста. И наконец, помимо вышеупомянутых веществ могут быть использованы вещества, необходимые для роста, такие как аминокислоты и витамины. Кроме того, в культуральную среду могут быть добавлены подходящие предшественники. Указанные вещества могут быть добавлены в культуру в процессе культивирования подходящим методом периодического или непрерывного культивирования.

pH культуральной среды можно регулировать подходящим методом с использованием основных соединений, таких как гидрокисид натрия, гидрокисид калия, аммиак или водный аммиак, или с использованием кислотных соединений, таких как фосфорная кислота или серная кислота. Пенообразование можно регулировать с использованием пеногасителей, таких как полигликолевые сложные эфиры жирной кислоты. Аэробные условия могут поддерживаться путем введения в культуру кислорода или кислород-содержащих газообразных смесей (например, воздуха). Температура культивирования обычно составляет от 20°C до 45°C, а в частности, от 25°C до 40°C. Культивирование может продолжаться до достижения нужного количества продуцируемого L-лизина. В частности, время культивирования составляет от 10 до 160 часов.

В способе согласно изобретению, культивирование может быть осуществлено непрерывным или периодическим способом или периодическим способом с подпиткой или периодическим способом с повторной подпиткой. Это культивирование может быть осуществлено любым методом, хорошо известным специалистам.

L-лизин может быть выделен и проанализирован с помощью анионообменной хроматографии с последующим проведением нингидринового теста. Кроме того, способ согласно изобретению включает стадию выделения L-лизина. Способ выделения L-лизина из микроорганизма или культуральной среды хорошо известен специалистам. Примерами способа, который может быть использован для выделения L-лизина, являются, но не ограничиваются ими, фильтрация, анионообменная хроматография, кристаллизация и ВЭЖХ.

Ниже представлено более подробное описание изобретения со ссылкой на примеры. Однако, следует отметить, что эти примеры приводятся лишь в иллюстративных целях и не должны рассматриваться как ограничение объема изобретения.

Примеры

Пример 1: Конструирование рандомизированной мутантной библиотеки с использованием транспозона

Для получения штамма, обладающего повышенной способностью продуцировать L-лизин, была сконструирована векторная библиотека следующим способом.

Сначала, с использованием Corynebacterium glutamicum KCCM11016P (этот микроорганизм был описан как KFCC10881 и был повторно депонирован группой специалистов Международного Депозитария в соответствии с Будапештским Договором под регистрационным номером No. KCCM11016P; Корейский патент No. 10-0159812) в качестве родительского штамма, плазмиды, полученные с использованием набора EZ-Tn5™ <R6Kγori/KAN-2>Tnp Transposome™ (Epicentre), были превращены в родительский штамм методом подачи электрических импульсов (Appl. Microbiol. Biotechnol. (1999) 52:541-545). Затем, этот штамм был распределен по планшету с комплексной средой, содержащей канамицин (25 мг/л) с получением приблизительно 20000 колоний.

Планшет с комплексной средой (pH 7,0):

10 г глюкозы, 10 г пептона, 5 г мясного экстракта, 5 г дрожжевого экстракта, 18,5 г бульона с экстрактом головного мозга и сердца, 2,5 г NaCl, 2 г мочевины, 91 г сорбита и 20 г агара (на литр дистиллированной воды).

Пример 2: Скрининг рандомизированной мутантной библиотеки с использованием транспозона

Каждую из приблизительно 20000 колоний, полученных в Примере 1, инокулировали в 300 мкл описанной ниже селективной среды и культивировали в 96-луночном планшете с глубокими лунками при 32°C и при 1000 об/мин приблизительно в течение 24 часов.

Селективная среда (pH 8,0):

10 г глюкозы, 5,5 г сульфата аммония, 1,2 г MgSO47H2O, 0,8 г KH2PO4, 16,4 г K2HPO4, 100 мкг биотина, 1000 мкг тиамина-HCl, 2000 мкг пантотената кальция и 2000 мкг никотинамида (на литр дистиллированной воды).

Для оценки количества L-лизина, продуцируемого в культуре, был применен метод на основе нингидринового теста (Moore, S., Stein, W. H., Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem.1948, 176, 367-388).

После завершения культивирования, 10 мкл супернатанта культуры подвергали реакции взаимодействия со 190 мкл реакционного раствора нингидрина при 65°C в течение 30 минут, а затем на спектрофотометре измеряли оптическую плотность на длине волны 570 нм. Исходя из результатов измерения, приблизительно 60 колоний, оптическая плотность которых превышала оптическую плотность штамма Corynebacterium glutamicum KCCM11016P, используемого в качестве контроля, отбирали как мутантные штаммы. Другие колонии имели оптическую плотность, подобную оптической плотности штамма Corynebacterium glutamicum KCCM11016P, используемого в качестве контроля, или имели более низкую оптическую плотность.

Приблизительно 60 штаммов, отобранных как описано выше, снова культивировали способом, описанным выше, а затем подвергали реакции взаимодействия с нингидрином. В результате было отобрано десять наилучших мутантных штаммов, обладающих повышенной способностью продуцировать L-лизин по сравнению со штаммом Corynebacterium glutamicum KCCM11016P, используемым в качестве родительского штамма.

Пример 3: Анализ на продуцирование L-лизина выбранными рандомизированными мутантными штаммами

Для конечного отбора штаммов из десяти мутантов, отобранных в примере 2, у которых способность продуцировать L-лизин репродуктивно увеличивалась, осуществляли культивирование в колбе с использованием описанной ниже среды. После завершения культивирования, концентрацию L-лизина в культуре анализировали с помощью ВЭЖХ. Концентрация L-лизина, продуцируемого каждым мутантным штаммом, представлена ниже в Таблице 1.

Среда для посева (pH 7,0):

20 г глюкозы, 10 г пептона, 5 г дрожжевого экстракта, 1,5 г мочевины, 4 г KH2PO4, 8 г K2HPO4, 0,5 г MgSO47H2O, 100 мкг биотина, 1000 мкг тиамина-HCl, 2000 мкг пантотената кальция и 2000 мкг никотинамида (на литр дистиллированной воды)

Среда для продуцирования (pH 7,0):

100 г глюкозы, 40 г (NH4)2SO4, 2,5 г соевого белка, 5 г твердого кукурузного экстракта, 3 г мочевины, 1 г KH2PO4, 0,5 г MgSO4•7H2O, 100 мкг биотина, 1000 мкг хлорида тиамина, 2000 мкг пантотената кальция, 3000 мкг никотинамида и 30 г CaCO3 (на литр дистиллированной воды).

Таблица 1: Концентрации L-лизина, продуцируемого 10 отобранными рандомизированными мутантными штаммами

Штаммы L-лизин (г/л)
Партия 1 Партия 2 Партия 3 Партия 4
Контроль KCCM11016P 42,9 42,5 42,4 42,6
1 KCCM11016P/mt-1 43,2 43,6 43,8 43,5
2 KCCM11016P/mt-2 43,0 43,1 43,4 43,2
3 KCCM11016P/mt-3 42,6 42,8 42,9 42,8
4 KCCM11016P/mt-4 43,1 42,8 42,9 42,9
5 KCCM11016P/mt-5 43,0 42,9 42,7 42,9
6 KCCM11016P/mt-6 41,0 41,7 41,6 41,4
7 KCCM11016P/mt-7 43,2 42,8 42,7 42,9
8 KCCM11016P/mt-8 53,2 53,1 53 53,1
9 KCCM11016P/mt-9 42,7 42,5 42 42,4
10 KCCM11016P/mt-10 48,9 48,2 48,5 48,5

Из 10 отобранных мутантных штаммов был наконец выбран KCCM11016P/mt-10 как штамм, обладающий значительно более высокой способностью продуцировать L-лизин.

Пример 4: Выявление причин повышенной способности продуцировать L-лизин конечным выбранным штаммом

В этом примере проводили эксперимент на конечном мутантном штамме, отобранном в Примере 3, в целях идентификации генов, подвергнутых дизрупции посредством рандомизированного встраивания транспозона.

Геномную ДНК экстрагировали из KCCM11016P/mt-10, гидролизовали, а затем лигировали, и продукт лигирования трансформировали в DH5α E. coli. Трансформированные клетки E. coli высевали на твердую среду LB, содержащую канамицин (25 мг/л). Двадцать трансформированных колоний отбирали, а затем получали плазмиды, содержащие часть неизвестного гена. Секвенирование осуществляли с использованием праймера 1 (SEQ ID NO: 3) и праймера 2 (SEQ ID NO: 4) из набора EZ-Tn5™ <R6Kγori/KAN-2>Tnp Transposome™. В результате, исходя из нуклеотидных последовательностей, имеющихся в NIH Genbank, можно видеть, что ген, содержащий нуклеотидную последовательность SEQ ID NO: 2, был инактивирован.

Праймер 1 (SEQ ID NO: 3): ACCTACAACAAAGCTCTCATCAACC;

Праймер 2 (SEQ ID NO: 4): CTACCCTGTGGAACACCTACATCT.

Пример 5: Конструирование вектора для дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2

Для конструированиея рекомбинантного вектора, способного разрушать ген, содержащий нуклеотидную последовательность SEQ ID NO: 2 (идентифицированную в Примере 4) в хромосоме штамма рода Corynebacterium, были синтезированы праймеры 3-6 в целях конструирования фрагмента для дизрупции гена, и эти праймеры представлены ниже в Таблице 2.

Таблица 2: Праймеры 3-6 для конструирования фрагмента в целях дизрупции гена

Ген Используемые праймеры Нуклеотидные последовательности
SEQ ID NO. Праймер 3 (SEQ ID NO: 5) GAATTCTACACGCAGTGCCGAAACTTC
Праймер 4 (SEQ ID NO: 6) TCGTATGTGCCTGGAATCACGAGACAGC
Праймер 5 (SEQ ID NO: 7) GATTCCAGGCACATACGACCAGGTCGCG
Праймер 6 (SEQ ID NO: 8) GCAGGTCGACTCACCAACACCATGACCACGCTT

Для делеции области ОРС были синтезированы праймер 3 (SEQ ID NO: 5), праймер 4 (SEQ ID NO: 6), праймер 5 (SEQ ID NO: 7) и праймер 6 (SEQ ID NO: 8) (Таблица 2) на основе SEQ ID NO: 2, так, чтобы эти праймеры имели сайт распознавания рестриктирующего фермента EcoRI у 5'-конца и сайт распознавания рестриктирующего фермента SalI у 3'-конца. С использованием этих синтезированных праймеров была проведена ПЦР [Sambrook et al, Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories] на хромосомной ДНК штамма Corynebacterium glutamicum ATCC 13032 дикого типа, используемой в качестве матрицы. В результате был получен фрагмент ДНК, содержащий вышерасположенную область в 500 п.о. и нижерасположенную область в 500 п.о., которые соответствуют гену нуклеотидной последовательности SEQ ID NO: 2, кодирующему белок. ПЦР проводили в следующих условиях: 30 циклов, каждый из которых состоит из денатурации при 95°C в течение 30 секунд, отжига при 56°C в течение 30 секунд и полимеризации при 72°C в течение 1 минуты, с последующей полимеризацией при 72°C в течение 7 минут. Вектор pDZ (Корейский патент No. 10-0924065), который не реплицировался в Corynebacterium glutamicum, и фрагмент, амплифицированный с помощью ПЦР, обрабатывали рестриктирующими ферментами EcoRI и SalI для введения в хромосому, а затем лигировали с использованием ДНК-лигазы. Продукт лигирования трансформировали в DH5α E. coli, который затем высевали на твердую среду LB, содержащую канамицин (25 мг/л).

Колонию, трансформированную плазмидой, имеющей нужный встроенный в нее ген, отбирали с помощью ПЦР, а затем плазмиду выделяли методом экстракции плазмид. Эта плазмида была обозначена «pDZ-ΔMT8EH».

Пример 6: Конструирование штамма посредством дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2 в Corynebacterium glutamicum KCCM11016P, и оценка способности сконструированного штамма продуцировать L-лизин

Рекомбинантную плазмиду pDZ-ΔMT8EH, сконструированную в Примере 5, трансформировали в штамм Corynebacterium glutamicum KCCM11016P, который представлял собой штамм, продуцирующий L-лизин, посредством гомологичной рекомбинации на хромосоме (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).

Затем, трансформированный штамм подвергали второй рекомбинации на планшете с твердой средой, содержащей 4% сахарозу. После завершения второй рекомбинации, дизрупцию гена SEQ ID NO: 2 на хромосоме трансформированного штамма Corynebacterium glutamicum подтверждали с помощью ПЦР с использованием праймера 3 и праймера 6. Этот рекомбинантный штамм был обозначен «Corynebacterium glutamicum KCCM11016P-MT8EH».

Для анализа способности сконструированного штамма Corynebacterium glutamicum KCCM11016P-MT8EH продуцировать L-лизин, этот сконструированный штамм культивировали вместе с родительским штаммом Corynebacterium glutamicum KCCM11016P следующим образом.

Родительский штамм Corynebacterium glutamicum KCCM11016P и штамм Corynebacterium glutamicum KCCM11016P-MT8EH, сконструированный как описано в Примере 6, инокулировали в 250-миллилитровую колбу с угловой перегородкой, содержащую 25 мл нижеследующей среды для посева, и культивировали в шейкере при 200 об/мин при 30°C в течение 20 часов. Затем 1 мл каждой культуры для посева инокулировали в 250-миллилитровую колбу с угловой перегородкой, содержащую 24 мл нижеследующей среды для продуцирования, и культивировали в шейкере при 200 об/мин при 30°C в течение 72 часов. Состав среды для посева и состав среды для продуцирования представлены ниже.

Среда для посева (pH 7,0):

20 г глюкозы, 10 г пептона, 5 г дрожжевого экстракта, 1,5 г мочевины, 4 г KH2PO4, 8 г K2HPO4, 0,5 г MgSO47H2O, 100 мкг биотина, 1000 мкг тиамина-HCl, 2000 мкг пантотената кальция и 2000 мкг никотинамида (на литр дистиллированной воды).

Среда для продуцирования (pH 7,0):

100 г глюкозы, 40 г (NH4)2SO4, 2,5 г соевого белка, 5 г твердого кукурузного экстракта, 3 г мочевины, 1 г KH2PO4, 0,5 г MgSO4•7H2O, 100 мкг биотина, 1000 мкг тиамина-HCl, 2000 мкг пантотената кальция, 3000 мкг никотинамида и 30 г CaCO3 (на литр дистиллированной воды).

После завершения культивирования, количество продуцированного L-лизина определяли с помощью ВЭЖХ (Waters 2478), и концентрация проанализированного L-лизина представлена ниже в Таблице 3.

Таблица 3: Анализ на L-лизин-продуцирующую способность KCCM11016P-MT8EH, происходящего от KCCM11016P

Штаммы L-лизин (г/л)
Партия 1 Партия 2 Партия 3 Среднее
Контрольная группа KCCM11016P 41,2 41,7 41,8 41,6
Тест-группа KCCM11016P-MT8EH 54,9 55,2 54,5 54,9

Результаты, представленные выше в Таблице 3, показали, что в случае дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2 в Corynebacterium glutamicum KCCM11016P, который представляет собой L-лизин-продуцирующий штамм, способность рекомбинантного штамма продуцировать L-лизин повышалась в среднем на 32% по сравнению с родительским штаммом.

Таким образом, было обнаружено, что L-лизин-продуцирующая способность микроорганизма рода Corynebacterium может быть увеличена в результате дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2 в микроорганизме.

Исходя из вышеописанных результатов можно видеть, что инактивация гипотетического белка с неизвестной функцией посредством дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2 в L-лизин-продуцирующем штамме, была эффективной для повышения уровня продуцирования L-лизина этим штаммом. Штамм KCCM11016P-MT8EH был обозначен «CA01-2295» и депонирован Корейским Центром культур микроорганизмов (KCCM) в Международный депозитарий 15 мая 2015 под регистрационным номером KCCM11697P.

Пример 7: Конструирование штамма посредством дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2 в Corynebacterium glutamicum KCCM11347P, и оценка способности сконструированного штамма продуцировать L-лизин

Для того, чтобы подтвердить, что другие L-лизин-продуцирующие штаммы Corynebacterium glutamicum обладают таким же действием, как и штаммы, описанные выше, штамм, в котором ген, содержащий нуклеотидную последовательность SEQ ID NO: 2, был подвергнут дизрупции, конструировали из L-лизин-продуцирующего штамма Corynebacterium glutamicum KCCM11347P (этот микроорганизм был описан как KFCC10750 и был повторно депонирован группой специалистов Международного Депозитария в соответствии с Будапештским Договором под регистрационным номером No. KCCM11347P; Корейский патент No. 10-0073610) методом, аналогичным методу, описанному в Примере 6. Сконструированный штамм был обозначен «KCCM11347P-MT8EH».

Сконструированный штамм культивировали способом, описанным в Примере 6. После завершения культивирования, количество продуцированного L-лизина определяли с помощью ВЭЖХ (Waters 2478), и концентрация проанализированного L-лизина представлена ниже в Таблице 4.

Таблица 4: Анализ на L-лизин-продуцирующую способность KCCM11347P-MT8EH, происходящего от KCCM11347P

Штамм L-лизин (г/л)
Партия 1 Партия 2 Партия 3 Партия 4
Контрольная группа KCCM11347P 37,9 38,1 37,9 38,0
Тест-группа KCCM11347P-MT8EH 47,5 47,4 47,6 47,5

Результаты, представленные выше в Таблице 4, показали, что в случае дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2 в Corynebacterium glutamicum KCCM11347P, который представляет собой L-лизин-продуцирующий штамм, способность этого штамма продуцировать L-лизин повышалась в среднем на 25%.

Таким образом, аналогично результатам Примера 6, было показано, что L-лизин-продуцирующая способность микроорганизма рода Corynebacterium может быть увеличена в результате дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2 в микроорганизме.

Пример 8: Конструирование штамма посредством дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2 в Corynebacterium glutamicum CJ3P, и оценка способности сконструированного штамма продуцировать L-лизин

Для того, чтобы подтвердить, что другие L-лизин-продуцирующие штаммы Corynebacterium glutamicum обладают таким же действием, как и штаммы, описанные выше, штамм, в котором ген, содержащий нуклеотидную последовательность SEQ ID NO: 2, был подвергнут дизрупции, конструировали из L-лизин-продуцирующего штамма Corynebacterium glutamicum CJ3P (Binder et al. Genome Biology 2012, 13:R40), полученного путем введения трех мутаций [pyc(P458S), hom(V59A) и lysC(T311I)] в штамм дикого типа методом, аналогичным методу, описанному в Примере 6. Сконструированный штамм был обозначен «CJ3P-MT8EH».

Сконструированный штамм культивировали способом, описанным в Примере 6. После завершения культивирования, количество продуцированного L-лизина оценивали с помощью ВЭЖХ (Waters 2478), и концентрация проанализированного L-лизина указана ниже в Таблице 5.

Таблица 5: Продуцирование L-лизина штаммом CJ3P-MT8EH, происходящим от CJ3P

Штамм L-лизин (г/л)
Партия 1 Партия 2 Партия 3 Партия 4
Контрольная группа CJ3P 8,2 8,1 8,4 8,2
Тест-группа CJ3P-MT8EH 10,1 10,3 9,9 10,1

Исходя из результатов, представленных выше в Таблице 5, было обнаружено, что в случае дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2 в Corynebacterium glutamicum CJ3P, который представляет собой L-лизин-продуцирующий штамм, способность штамма продуцировать L-лизин повышалась в среднем на 23%.

Таким образом, аналогично результатам Примеров 6 и 7, было показано, что L-лизин-продуцирующая способность микроорганизма рода Corynebacterium может быть увеличена посредством дизрупции гена, содержащего нуклеотидную последовательность SEQ ID NO: 2 в микроорганизме.

Регистрационный номер

Название Депозитария: Корейский Центр культур микроорганизмов;

Регистрационный номер: KCCM11697P;

Дата депонирования: 15 мая, 2015.

Applicant's or agent's
file reference PP16-0105
International application No.

INDICATIONS RELATING TO DEPOSITED MICROORGANISM

OR OTHER BIOLOGICAL MATERIAL

(PCT Rule 13bis)

A. The indications made below relate to the deposited microorganism or other biological material referred to in the description
on page __13__________________________, line ______7________________________.
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet
Name of depositary institution
Korean Culture Center of Microorganisms
Address of depositary institution (including postal code and country)
Yurim Bldg, 45, Hongjenae 2ga-gil, Seodaemun-gu, Seoul, 120-861, Korea
Date of deposit
May 15, 2015
Accession Number
KCCM11697P
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e.g., "Accession Number of Deposit")
For receiving Office use only
This sheet was received with the international application
For International Bureau use only
This sheet was received by the International Bureau on:
Authorized officer Authorized officer

Form PCT/RO/134 (July1998; reprint January 2004)

1. L-лизин-продуцирующий микроорганизм рода Corynebacterium, где белок, содержащий аминокислотную последовательность SEQ ID NO: 1, является инактивированным.

2. L-лизин-продуцирующий микроорганизм по п. 1, где белок кодируется геном, имеющим нуклеотидную последовательность SEQ ID NO: 2.

3. L-лизин-продуцирующий микроорганизм по п. 1, где микроорганизм рода Corynebacterium представляет собой Corynebacterium glutamicum.

4. Способ продуцирования L-лизина, включающий стадии:

культивирования микроорганизма по любому из пп. 1-3 в среде и

выделения L-лизина из микроорганизма или среды.



 

Похожие патенты:

Группа изобретений относится к области биотехнологии. Предложен L-лизин-продуцирующий микроорганизм рода Corynebacterium, где активность белка, содержащего аминокислотную последовательность SEQ ID NO: 1, инактивирована.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Corynebacterium, модифицированный таким образом, что активность белка, вовлеченного в гидролиз клеточной стенки, инактивирована по сравнению с его эндогенной активностью.

Группа изобретений относится к области биотехнологии. Предложен вариант пируватдегидрогеназы, содержащий по меньшей мере одну аминокислотную замену в области аминокислот в положениях 190-205 или в области аминокислот в положениях 415-440 SEQ ID NO: 1.

Группа изобретений относится к области биотехнологии. Предложен полипептид, обладающий активностью репрессора глюконата, и полинуклеотид, кодирующий его.

Группа изобретений относится к области биотехнологии. Предложен способ получения L-валина путем ферментации микроорганизмов из рода Corynebacterium, содержащих в реплицируемой форме полинуклеотид с операторной активностью, последовательность которого по меньшей мере на 85% идентична последовательности от положения 1 до 121 согласно SEQ ID NO: 1, 2 или 3, с которым связывается активатор PrpR, и функционально ниже которого на 3’-конце находится второй полинуклеотид, характеризующийся промоторной активностью, а также гены ilvB и ilvN, и который регулирует транскрипцию генов ilvBN в зависимости от добавления активатора PrpR в среду, к которой после первой фазы (фазы роста), проходящей без индуктора, во второй фазе в качестве индуктора добавляют пропионат или 2-метилцитрат.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Corynebacterium, продуцирующий L-лизин, где оксалоацетат-декарбоксилаза с аминокислотной последовательностью SEQ ID NO: 1 инактивирована.

Группа изобретений относится к области биотехнологии. Предложен модифицированный полипептид, обладающий активностью сигма-фактора А РНК-полимеразы, где по меньшей мере одна аминокислота, выбранная из группы, состоящей из аминокислот в следующих положениях полипептида, имеющего аминокислотную последовательность, изложенную в SEQ ID NO: 2, заменена, и аминокислотная замена представляет собой по меньшей мере одну из следующих аминокислотных замен: 136G, 254N, 268S, 281S, 381R, 429R, 447H, 451I, 455V, 479R, 483R, 488T и 491R.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Corynebacterium, продуцирующий L-лизин, с улучшенной экспрессией полинуклеотида, кодирующего ген NCgl0862 Corynebacterium glutamicum.
Изобретение относится к области биохимии и биотехнологии, в частности к продуцирующему L-лизин микроорганизму рода Corynebacterium. Указанный микроорганизм отличается тем, что в нем инактивирован по меньшей мере один секреторный белок, выбранный из группы, состоящей из аминокислотных последовательностей SEQ ID NOs: 1, 7 и 13.

Предложены коринеформный микроорганизм с улучшенной способностью продуцировать L-лизин и способ получения L-лизина с использованием указанного микроорганизма. Указанный коринеформный микроорганизм представляет собой Corynebacterium glutamicum, в котором инактивирован белок-инициатор формирования перегородки, где указанный белок-инициатор формирования перегородки представляет собой филаментный чувствительный к температуре белок В (FtsB).

Группа изобретений относится к области биотехнологии. Предложен L-лизин-продуцирующий микроорганизм рода Corynebacterium, где активность белка, содержащего аминокислотную последовательность SEQ ID NO: 1, инактивирована.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Corynebacterium, модифицированный таким образом, что активность белка, вовлеченного в гидролиз клеточной стенки, инактивирована по сравнению с его эндогенной активностью.

Группа изобретений относится к области биотехнологии. Предложен вариант пируватдегидрогеназы, содержащий по меньшей мере одну аминокислотную замену в области аминокислот в положениях 190-205 или в области аминокислот в положениях 415-440 SEQ ID NO: 1.

Группа изобретений относится к области биотехнологии. Предложен полипептид, обладающий активностью репрессора глюконата, и полинуклеотид, кодирующий его.

Группа изобретений относится к области биотехнологии. Предложен способ получения L-валина путем ферментации микроорганизмов из рода Corynebacterium, содержащих в реплицируемой форме полинуклеотид с операторной активностью, последовательность которого по меньшей мере на 85% идентична последовательности от положения 1 до 121 согласно SEQ ID NO: 1, 2 или 3, с которым связывается активатор PrpR, и функционально ниже которого на 3’-конце находится второй полинуклеотид, характеризующийся промоторной активностью, а также гены ilvB и ilvN, и который регулирует транскрипцию генов ilvBN в зависимости от добавления активатора PrpR в среду, к которой после первой фазы (фазы роста), проходящей без индуктора, во второй фазе в качестве индуктора добавляют пропионат или 2-метилцитрат.

Группа изобретений относится к микроорганизму для продуцирования диамина, а также способу получения диамина с использованием указанного микроорганизма. В предложенном микроорганизме активность белка, имеющего аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 6, SEQ ID NO: 22 и SEQ ID NO: 24, или белка, обладающего диамин-экспортирующей активностью и имеющего аминокислотную последовательность, имеющую гомологию последовательности с SEQ ID NO: 6, SEQ ID NO: 22 или SEQ ID NO: 24, составляющую по меньшей мере 95%, введена или повышена по сравнению с эндогенной активностью.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Corynebacterium, обладающий способностью продуцировать L-аргинин, с усиленной активностью аргининового оперона и орнитин-карбамоилтрансферазы.

Изобретение относится к области биотехнологии и биохимии, в частности к L-арабинозоизомеразе, обладающей увеличенной активностью превращения D-галактозы в D-тагатозу по сравнению с арабинозоизомеразой, содержащей замещение лейцина в положении 469 пролином, или арабинозоизомеразой дикого типа.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Corynebacterium, продуцирующий L-лизин, где оксалоацетат-декарбоксилаза с аминокислотной последовательностью SEQ ID NO: 1 инактивирована.

Группа изобретений относится к микроорганизму рода Corynebacterium, обладающему повышенной путресцин-продуцирующей способностью, и способу получения путресцина с его использованием.

Группа изобретений относится к области биотехнологии. Предложен L-лизин-продуцирующий микроорганизм рода Corynebacterium, где активность белка, содержащего аминокислотную последовательность SEQ ID NO: 1, инактивирована.

Группа изобретений относится к области биотехнологии. Предложен L-лизин-продуцирующий микроорганизм рода Corynebacterium, где белок, содержащий аминокислотную последовательность SEQ ID NO: 1, является инактивированным. Предложен способ продуцирования L-лизина с использованием указанного микроорганизма. Группа изобретений позволяет повысить продукцию L-лизина при использовании указанного модифицированного микроорганизма по сравнению с исходным родительским микроорганизмом. 2 н. и 2 з.п. ф-лы, 5 табл., 8 пр.

Наверх