Гибридные белки и способы стимуляции роста растений, защиты растений и иммобилизации спор bacillus на растениях

Изобретение относится к области биохимии, в частности к способу стимулирования роста растений, включающему введение рекомбинантной бактерии группы Bacillus cereus, экспрессирующей гибридный белок в среде для роста растений, или применение рекомбинантной бактерии группы Bacillus cereus, экспрессирующей гибридный белок, к растению, семени растения или области, окружающей растение или семя растения, причем гибридный белок включает белок или пептид, стимулирующий рост растения, а также сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория. Также раскрыты семя растения и рекомбинантная бактерия группы Bacillus cereus для стимулирования роста растения, содержащие гибридный белок, включающий сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория. Изобретение также относится к гибридному белку для стимуляции роста растения. Изобретение позволяет эффективно стимулировать рост растений. 8 н. и 36 з.п. ф-лы, 2 ил., 31 табл., 39 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

[0001] Данная заявка заявляет приоритет по предварительной заявке США с серийным номером 61/799262, поданной 15 марта 2013 года, которая включена в данный документ в полном объеме посредством ссылки.

ОБЛАСТЬ ТЕХНИКИ

[0002] Данное изобретение, в целом, относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория, который транспортирует гибридный белок в экзоспорий представителя семейства Bacillus cereus. Данное изобретение также относится к рекомбинантным представителям семейства Bacillus cereus, которые экспрессируют такие гибридные белки, и препаратам, содержащим рекомбинантных представителей семейства Bacillus cereus, экспрессирующие гибридные белки. Дополнительно, изобретение относится к способам стимуляции роста растений, защиты растений от патогенов, а также повышения устойчивости к стрессу в растениях путем применения рекомбинантных представителей семейства Bacillus cereus или препаратов к растениям или средам для роста растений. Данное изобретение также относится к способам иммобилизации спор рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридный белок, на растениях или на растительных веществах.

УРОВЕНЬ ТЕХНИКИ

[0003] В области, окружающей корни растения, присутствует область, которая называется ризосферой. В ризосфере бактерии, грибы и другие организмы конкурируют за питательные вещества и за связывание с корневыми структурами растения. В ризосфере могут присутствовать как вредные, так и полезные бактерии и грибы. Все, включая бактерии, грибы и корневую систему растения, могут подвергаться влиянию активности пептидов, ферментов и других белков в ризосфере. Внесение в почву или обработка растений теми или иными из этих пептидов, ферментов или других белков оказывали бы положительные эффекты на целые популяции полезных почвенных бактерий и грибов, создали бы более здоровую общую почвенную среду для роста растений, улучшили бы рост растений, и обеспечили бы защиту растений от определенных бактериальных и грибковых патогенов. Однако предыдущие попытки внесения пептидов, ферментов и других белков в почву с целью вызвать такие положительные эффекты у растений были затруднены низкой выживаемостью ферментов, белков и пептидов в почве. Кроме того, широкое распространение протеаз, естественно присутствующих в почве, вызывает деградацию белков в почве. Среда вокруг корней растения (ризосфера) представляет собой уникальную смесь бактерий, грибов, питательных веществ, и корней, свойства которых отличаются от свойств чистой почвы. Симбиотические взаимоотношения между этими организмами представляют собой уникальные и могут быть улучшены с помощью экзогенных белков. Высокая концентрация грибов и бактерий в ризосфере вызывает еще большую деградацию белков в связи с аномально высоким уровнем протеаз и других элементов, вредных для белков, в почве. Кроме того, ферменты и другие белки, внесенные в почву, могут быстро рассеиваться от корней растения.

[0004] Таким образом, существует необходимость в данной области техники в способе эффективной доставки пептидов, ферментов и других белков в растения (например, в корневые системы растений) и продления периода времени, в течение которого такие молекулы остаются активными. Кроме того, существует необходимость в данной области техники в способе селективной транспортировки таких пептидов, ферментов и белков в ризосферу и в листья растений, и в особенности корни растений.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

[0005] Данное изобретение относится к гибридным белкам, содержащим по меньшей мере один белок или пептид, стимулирующий рост растения, по меньшей мере один белок или пептид, который повышает устойчивость к стрессу в растении, или по меньшей мере одно растение, связывающее белок или пептид. Белок или пептид, стимулирующий рост растения, включает пептидный гормон, пептид, не являющийся гормоном или фермент, участвующий в образовании или активации соединения, стимулирующего рост растения, гибридный белок также содержит сигнальную последовательность, белок экзоспория, или фрагмент белка экзоспория. Сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может представлять собой: (а) сигнальную последовательность, включающую аминокислотную последовательность, имеющую по меньшей мере около 43% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 54%; (б) сигнальную последовательность, содержащую аминокислоты 1-35 из SEQ ID №: 1; (в) сигнальную последовательность, содержащую аминокислоты 20-35 из SEQ ID №: 1; (г) сигнальную последовательность, включающую SEQ ID №: 1; (д) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 2; (е) сигнальную последовательность, содержащую аминокислоты 1-27 из SEQ ID №: 3; (ж) сигнальную последовательность, содержащую аминокислоты 12-27 из SEQ ID №: 3; (з) сигнальную последовательность, содержащую SEQ ID №: 3; (и) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 4; (к) сигнальную последовательность, содержащую аминокислоты 1-38 из SEQ ID №: 5; (л) сигнальную последовательность, содержащую аминокислоты 23-38 из SEQ ID №: 5; (м) сигнальную последовательность, включающую SEQ ID №: 5; (н) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 6; (о) сигнальную последовательность, содержащую аминокислоты 1-28 из SEQ ID №: 7; (п) сигнальную последовательность, содержащую аминокислоты 13-28 из SEQ ID №: 7; (р) сигнальную последовательность, содержащую SEQ ID №: 7; (с) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 8; (т) сигнальную последовательность, содержащую аминокислоты 1-24 из SEQ ID №: 9; (у) сигнальную последовательность, содержащую аминокислоты 9-24 из SEQ ID №: 9; (ф) сигнальную последовательность, содержащую SEQ ID №: 9; (х) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 10; (ц) сигнальную последовательность, содержащую аминокислоты 1-33 из SEQ ID №: 11; (ч) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 11; (ш) сигнальную последовательность, содержащую SEQ ID №: 11; (щ) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 12; (э) сигнальную последовательность, содержащую аминокислоты 1-33 из SEQ ID №: 13; (ю) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 13; (я) сигнальную последовательность, содержащую SEQ ID №: 13; (аа) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 14; (аб) сигнальную последовательность, содержащую аминокислоты 1-43 из SEQ ID №: 15; (ав) сигнальную последовательность, содержащую аминокислоты 28-43 из SEQ ID №: 15; (аг) сигнальную последовательность, содержащую SEQ ID №: 15; (ад) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 16; (ае) сигнальную последовательность, содержащую аминокислоты 1-27 из SEQ ID №: 17; (аж) сигнальную последовательность, содержащую аминокислоты 12-27 из SEQ ID №: 17; (аз) сигнальную последовательность, содержащую SEQ ID №: 17; (аи) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 18; (ак) сигнальную последовательность, содержащую аминокислоты 1-33 SEQ ID №: 19; (ал) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 19; (ам) сигнальную последовательность, содержащую SEQ ID №: 19; (ан) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 20; (ао) сигнальную последовательность, содержащую аминокислоты 1-33 SEQ ID №: 21; (aп) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 21; (ар) сигнальную последовательность, содержащую SEQ ID №: 21; (ас) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 22; (ат) сигнальную последовательность, содержащую аминокислоты 1-24 из SEQ ID №: 23; (ay) сигнальную последовательность, содержащую аминокислоты 9-24 из SEQ ID №: 23; (аф) сигнальную последовательность, содержащую SEQ ID №: 23; (ах) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 24; (ац) сигнальную последовательность, содержащую аминокислоты 1-24 из SEQ ID №: 25; (ач) сигнальную последовательность, содержащую аминокислоты 9-24 из SEQ ID №: 25; (аш) сигнальную последовательность, содержащую SEQ ID №: 25; (ащ) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 26; (аэ) сигнальную последовательность, содержащую аминокислоты 1-30 из SEQ ID №: 27; (аю) сигнальную последовательность, содержащую аминокислоты 15-30 из SEQ ID №: 27; (ая) сигнальную последовательность, содержащую SEQ ID №: 27; (ба) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 28; (бб) сигнальную последовательность, содержащую аминокислоты 1-33 SEQ ID №: 29; (бв) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 29; (бг) сигнальную последовательность, содержащую SEQ ID №: 29; (бд) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 30; (бе) сигнальную последовательность, содержащую аминокислоты 1-24 из SEQ ID №: 31; (бж) сигнальную последовательность, содержащую аминокислоты 9-24 из SEQ ID №: 31; (бз) сигнальную последовательность, содержащую SEQ ID №: 31; (би) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 32; (бк) сигнальную последовательность, содержащую аминокислоты 1-15 из SEQ ID №: 33; (бл) сигнальную последовательность, содержащую SEQ ID №: 33; (бм) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 34; (бн) сигнальную последовательность, содержащую аминокислоты 1-16 из SEQ ID №: 35; (бо) сигнальную последовательность, содержащую SEQ ID №: 35; (бп) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 36; (бр) сигнальную последовательность, содержащую аминокислоты 1-29 из SEQ ID №: 43; (бс) сигнальную последовательность, содержащую аминокислоты 14-29 из SEQ ID №: 43; (бт) сигнальную последовательность, содержащую SEQ ID №: 43; (бу) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 44; (бф) сигнальную последовательность, содержащую аминокислоты 1-35 из SEQ ID №: 45; (бх) сигнальную последовательность, содержащую аминокислоты 20-35 из SEQ ID №: 45; (бц) сигнальную последовательность, содержащую SEQ ID №: 45; (бч) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 46; (бш) сигнальную последовательность, содержащую аминокислоты 1-43 из SEQ ID №: 47; (бщ) сигнальную последовательность, содержащую аминокислоты 28-43 из SEQ ID №: 47; (бэ) сигнальную последовательность, содержащую SEQ ID №: 47; (бю) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 48; (бя) сигнальную последовательность, содержащую аминокислоты 1-32 из SEQ ID №: 49; (ва) сигнальную последовательность, содержащую аминокислоты 17-32 из SEQ ID №: 49; (вб) сигнальную последовательность, содержащую SEQ ID №: 49; (вв) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 50; (вг) сигнальную последовательность, содержащую аминокислоты 1-33 SEQ ID №: 51; (вд) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 51; (ве) сигнальную последовательность, содержащую SEQ ID №: 51; (вж) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 52; (вз) сигнальную последовательность, содержащую аминокислоты 1-33 SEQ ID №: 53; (ви) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 53; (вк) сигнальную последовательность, содержащую SEQ ID №: 53; (вл) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 54; (вм) сигнальную последовательность, содержащую аминокислоты 1-30 из SEQ ID №: 55; (вн) сигнальную последовательность, содержащую аминокислоты 15-30 из SEQ ID №: 55; (во) сигнальную последовательность, содержащую SEQ ID №: 55; (вп) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 56; (вр) сигнальную последовательность, содержащую аминокислоты 1-130 из SEQ ID №: 57; (вс) сигнальную последовательность, содержащую аминокислоты 115-130 из SEQ ID №: 57; (вт) сигнальную последовательность, содержащую SEQ ID №: 57; (ву) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 58; (вф) фрагмент белка экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 59; (вх) сигнальную последовательность, содержащую SEQ ID №: 60; (вц) сигнальную последовательность, содержащую SEQ ID №: 61; (вч) сигнальную последовательность, содержащую SEQ ID №: 62; (вш) сигнальную последовательность, содержащую SEQ ID №: 63; (вщ) сигнальную последовательность, содержащую SEQ ID №: 64; (вэ) сигнальную последовательность, содержащую SEQ ID №: 65; (вю) сигнальную последовательность, содержащую SEQ ID №: 66; (вя) сигнальную последовательность, содержащую SEQ ID №: 67; (га) сигнальную последовательность, содержащую SEQ ID №: 68; (гб) сигнальную последовательность, содержащую SEQ ID №: 69; (гв) сигнальную последовательность, содержащую SEQ ID №: 70; (гг) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 71; (гд) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 72; (ге) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 73; (гж) в белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 74; (гз) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 75; (ги) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 76; (гк) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 77; (гл) в белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 78; (гм) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 79; (гн) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 80; (го) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 81; (гп) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 82; (гр) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 83; (гс) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 84; (гт) сигнальную последовательность, содержащую аминокислоты 22-31 из SEQ ID №: 1; (гу) сигнальную последовательность, содержащую аминокислоты 22-33 из SEQ ID №: 1; (гф) сигнальную последовательность, содержащую аминокислоты 20-31 из SEQ ID №: 1; (гх) сигнальную последовательность, содержащую аминокислоты 14-23 из SEQ ID №: 3; (гц) сигнальную последовательность, содержащую аминокислоты 14-25 из SEQ ID №: 3; или (гч) сигнальную последовательность, включающую аминокислоты 12-23 из SEQ ID №: 3.

[0006] Данное изобретение также относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория и по меньшей мере один белок или пептид, защищающий растение от патогена. Сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может представлять собой: (а) сигнальную последовательность, состоящую из аминокислотной последовательности, состоящей из 16 аминокислот и имеющую по меньшей мере около 43% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 54%; (б) сигнальную последовательность, состоящую из аминокислот 1-35 из SEQ ID №: 1; (в) сигнальную последовательность, состоящую из аминокислот 20-35 в SEQ ID №: 1; (г) сигнальную последовательность, состоящую из SEQ ID №: 1; (д) сигнальную последовательность, содержащую SEQ ID №: 60; (е) сигнальную последовательность, содержащую аминокислоты 1-27 из SEQ ID №: 3; (ж) сигнальную последовательность, содержащую аминокислоты 12-27 из SEQ ID №: 3; (з) сигнальную последовательность, содержащую SEQ ID №: 3; (и) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 4; (к) сигнальную последовательность, содержащую аминокислоты 1-38 из SEQ ID №: 5; (л) сигнальную последовательность, содержащую аминокислоты 23-38 из SEQ ID №: 5; (м) сигнальную последовательность, содержащую SEQ ID №: 5; (н) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 6; (о) сигнальную последовательность, содержащую аминокислоты 1-28 из SEQ ID №: 7; (п) сигнальную последовательность, содержащую аминокислоты 13-28 из SEQ ID №: 7; (р) сигнальную последовательность, содержащую SEQ ID №: 7; (с) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 8; (т) сигнальную последовательность, содержащую аминокислоты 1-24 из SEQ ID №: 9; (у) в сигнальную последовательность, содержащую аминокислоты 9-24 из SEQ ID №: 9; (ф) сигнальную последовательность, содержащую SEQ ID №: 9; (х) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 10; (ц) сигнальную последовательность, содержащую аминокислоты 1-33 из SEQ ID №: 11; (ч) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 11; (ш) сигнальную последовательность, содержащую SEQ ID №: 11; (щ) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 12; (э) сигнальную последовательность, содержащую аминокислоты 1-33 из SEQ ID №: 13; (ю) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 13; (я) сигнальную последовательность, содержащую SEQ ID №: 13; (аа) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 14; (аб) сигнальную последовательность, содержащую аминокислоты 1-43 из SEQ ID №: 15; (ав) сигнальную последовательность, содержащую аминокислоты 28-43 из SEQ ID №: 15; (аг) сигнальную последовательность, содержащую SEQ ID №: 15; (ад) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 16; (ае) сигнальную последовательность, содержащую аминокислоты 1-27 из SEQ ID №: 17; (аж) сигнальную последовательность, содержащую аминокислоты 12-27 из SEQ ID №: 17; (аз) сигнальную последовательность, содержащую SEQ ID №: 17; (аи) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 18; (ак) сигнальную последовательность, содержащую аминокислоты 1-33 SEQ ID №: 19; (ал) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 19; (ам) сигнальную последовательность, содержащую SEQ ID №: 19; (ан) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 20; (ао) сигнальную последовательность, содержащую аминокислоты 1-33 SEQ ID №: 21; (aп) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 21; (ар) сигнальную последовательность, содержащую SEQ ID №: 21; (ас) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 22; (ат) сигнальную последовательность, содержащую аминокислоты 1-24 из SEQ ID №: 23; (ay) сигнальную последовательность, содержащую аминокислоты 9-24 из SEQ ID №: 23; (аф) сигнальную последовательность, содержащую SEQ ID №: 23; (ах) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 24; (ац) сигнальную последовательность, содержащую аминокислоты 1-24 из SEQ ID №: 25; (ач) сигнальную последовательность, содержащую аминокислоты 9-24 из SEQ ID №: 25; (аш) сигнальную последовательность, содержащую SEQ ID №: 25; (ащ) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 26; (аэ) сигнальную последовательность, содержащую аминокислоты 1-30 из SEQ ID №: 27; (аю) сигнальную последовательность, содержащую аминокислоты 15-30 из SEQ ID №: 27; (ая) сигнальную последовательность, содержащую SEQ ID №: 27; (ба) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 28; (бб) сигнальную последовательность, содержащую аминокислоты 1-33 SEQ ID №: 29; (бв) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 29; (бг) сигнальную последовательность, содержащую SEQ ID №: 29; (бд) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 30; (бе) сигнальную последовательность, содержащую аминокислоты 1-24 из SEQ ID №: 31; (бж) сигнальную последовательность, содержащую аминокислоты 9-24 из SEQ ID №: 31; (бз) сигнальную последовательность, содержащую SEQ ID №: 31; (би) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 32; (бк) сигнальную последовательность, содержащую аминокислоты 1-15 из SEQ ID №: 33; (бл) сигнальную последовательность, содержащую SEQ ID №: 33; (бм) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 34; (бн) сигнальную последовательность, содержащую аминокислоты 1-16 из SEQ ID №: 35; (бо) сигнальную последовательность, содержащую SEQ ID №: 35; (бп) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 36; (бр) сигнальную последовательность, содержащую аминокислоты 1-29 из SEQ ID №: 43; (бс) сигнальную последовательность, содержащую аминокислоты 14-29 из SEQ ID №: 43; (бт) сигнальную последовательность, содержащую SEQ ID №: 43; (бу) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 44; (бф) сигнальную последовательность, содержащую аминокислоты 1-35 из SEQ ID №: 45; (бх) к мишени последовательности, содержащей аминокислоты 20-35 из SEQ ID №: 45; (бц) сигнальную последовательность, содержащую SEQ ID №: 45; (бч) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 46; (бш) сигнальную последовательность, содержащую аминокислоты 1-43 из SEQ ID №: 47; (бщ) сигнальную последовательность, содержащую аминокислоты 28-43 из SEQ ID №: 47; (бэ) сигнальную последовательность, содержащую SEQ ID №: 47; (бю) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 48; (бя) сигнальную последовательность, содержащую аминокислоты 1-32 из SEQ ID №: 49; (ва) сигнальную последовательность, содержащую аминокислоты 17-32 из SEQ ID №: 49; (вб) сигнальную последовательность, содержащую SEQ ID №: 49; (вв) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 50; (вг) сигнальную последовательность, содержащую аминокислоты 1-33 SEQ ID №: 51; (вд) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 51; (ве) сигнальную последовательность, содержащую SEQ ID №: 51; (вж) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 52; (вз) сигнальную последовательность, содержащую аминокислоты 1-33 SEQ ID №: 53; (ви) сигнальную последовательность, содержащую аминокислоты 18-33 из SEQ ID №: 53; (вк) сигнальную последовательность, содержащую SEQ ID №: 53; (вл) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 54; (вм) сигнальную последовательность, содержащую аминокислоты 1-30 из SEQ ID №: 55; (вн) сигнальную последовательность, содержащую аминокислоты 15-30 из SEQ ID №: 55; (во) сигнальную последовательность, содержащую SEQ ID №: 55; (вп) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 56; (вр) сигнальную последовательность, содержащую аминокислоты 1-130 из SEQ ID №: 57; (вс) сигнальную последовательность, содержащую аминокислоты 115-130 из SEQ ID №: 57; (вт) сигнальную последовательность, содержащую SEQ ID №: 57; (ву) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 58; (вф) фрагмент белка экзоспория, состоящий из аминокислотной последовательности, имеющей по меньшей мере 85% идентичности с SEQ ID №: 59; (вх) сигнальную последовательность, содержащую SEQ ID №: 61; (вц) сигнальную последовательность, содержащую SEQ ID №: 62; (вч) сигнальную последовательность, содержащую SEQ ID №; 63; (вш) сигнальную последовательность, содержащую SEQ ID №: 64; (вщ) сигнальную последовательность, содержащую SEQ ID №: 65; (вэ) сигнальную последовательность, содержащую SEQ ID №: 66; (вю) сигнальную последовательность, содержащую SEQ ID №: 67; (вя) сигнальную последовательность, содержащую SEQ ID №: 68; (га) сигнальную последовательность, содержащую SEQ ID №: 69; (гб) сигнальную последовательность, содержащую SEQ ID №: 70; (гв) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 71; (ге) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 72; (гж) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 73; (гз) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 74; (ги) в белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 75; (гк) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 76; (гл) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 77; (гм) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 78; (гн) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 79; (го) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 80; (гп) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 81; (гр) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №; 82; (гс) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 83; (гт) белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с SEQ ID №: 84; (гу) сигнальную последовательность, состоящую из аминокислот 22-31 в SEQ ID №: 1; (гф) сигнальную последовательность, состоящую из аминокислот 22-33 в SEQ ID №: 1; (гх) сигнальную последовательность, состоящую из аминокислот 20-31 в SEQ ID №: 1; (гц) сигнальную последовательность, содержащую аминокислоты 14-23 из SEQ ID №: 3; (гч) сигнальную последовательность, содержащую аминокислоты 14-25 из SEQ ID №: 3; или (гш) сигнальную последовательность, содержащую аминокислоты 12-23 из SEQ ID №: 3.

[0007] Данное изобретение дополнительно относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория и по меньшей мере один белок или пептид, защищающий растение от патогена. Белок или пептид, защищающий растение от патогена, может включать гарпин, α-эластин, β-эластин, системин, фенилаланин аммиак-лиазу, элиситин, дефензин, криптогеин, белок флагеллин, пептид флагеллина, бактериоцин, лизоцим, пептид лизоцима, сидерофор, нерибосомальный активный пептид, кональбумин, альбумин, лактоферрин, пептид лактоферрина или TasA. В альтернативном варианте белок или пептид, защищающий растение от патогена, обладает инсектицидной активностью, антигельминтной активностью, подавляет хищничество насекомых или червей, или их комбинацию. В альтернативном варианте белок, защищающий растение от патогена, включает фермент. Сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может представлять собой любую из сигнальных последовательностей, белков экзоспория или фрагментов белка экзоспория, перечисленных ранее в параграфе [0005].

[0008] Данное изобретение также относится к гибридным белкам, содержащим по меньшей мере один целевой белок или пептид и белок экзоспория. Белок экзоспория может представлять собой белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с любой из SEQ ID №: 71,75, 80,81,82, 83 и 84.

[0009] Данное изобретение дополнительно относится к рекомбинантному представителю семейства Bacillus cereus, который экспрессирует любой из гибридных белков.

[0010] Данное изобретение также относится к препаратам, включающим любого из рекомбинантных представителей семейства Bacillus cereus и сельскохозяйственно приемлемый носитель.

[0011] Данное изобретение также относится к способу стимуляции роста растений. Данный способ включает введение в среду для роста растений любого из рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридный белок, содержащий по меньшей мере один белок или пептид, стимулирующий рост растения, или любого препарата, содержащего рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридный белок, содержащий по меньшей мере один белок или пептид, стимулирующий рост растения. В альтернативном варианте данный способ включает применение к растению, семени растения или области, окружающей растение или семя растения, любого из рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридный белок, содержащий по меньшей мере один белок или пептид, стимулирующий рост растения, или любого препарата, содержащего рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридный белок, содержащий по меньшей мере один белок или пептид, стимулирующий рост растения. Белок или пептид, стимулирующий рост растения, физически прикреплен к экзоспорию рекомбинантного представителя семейства Bacillus.

[0012] Данное изобретение также относится к способу стимуляции роста растений. Этот способ включает введение рекомбинантного представителя семейства Bacillus cereus, экспрессирующего гибридный белок, в среду для роста растений или применение рекомбинантного представителя семейства Bacillus cereus, экспрессирующего гибридный белок, к растению, семени растений или области, окружающей растение или семя растения. Гибридный белок содержит по меньшей мере один белок или пептид, стимулирующий рост растения, сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория. Сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может представлять собой любой из перечисленных ранее в параграфе [0005]. Белок или пептид, стимулирующий рост растения, физически прикреплен к экзоспорию рекомбинантного представителя семейства Bacillus.

[0013] Данное изобретение дополнительно относится к способу защиты растений от патогена или усиления устойчивости к стрессу в растении. Данный способ включает введение в среду для роста растений любого из рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридный белок, содержащий по меньшей мере один белок или пептид, защищающий растение от патогена, или по меньшей мере один белок или пептид, усиливающий устойчивость к стрессу в растении, или любой из препаратов, содержащих любого из рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридный белок, содержащий по меньшей мере один белок или пептид, защищающий растение от патогена, или по меньшей мере один белок или пептид, усиливающий устойчивость к стрессу в растении. В альтернативном варианте данный способ включает применение к растению, семени растения или области, окружающей растение, любого из рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридный белок, содержащий по меньшей мере один белок или пептид, защищающий растение от патогена, или по меньшей мере один белок или пептид, который повышает устойчивость к стрессу в растении, или любого препарата, содержащего любого из рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридный белок, содержащий по меньшей мере один белок или пептид, защищающий растение от патогена, или по меньшей мере один белок или пептид повышающий устойчивость к стрессам в растении. Белок или пептид, защищающий растения из патогена, или белок или пептид, усиливающий устойчивость к стрессу в растении, физически прикреплен к экзоспорию рекомбинантного представителя семейства Bacillus cereus.

[0014] Данное изобретение также относится к способу иммобилизации спор рекомбинантного представителя семейства Bacillus cereus на растении. Данный способ включает введение в среду для роста растений любого из рекомбинантных представителей семейства Bacillus cereus, экспрессирующих по меньшей мере один белок или пептид, связывающийся с растением, или любого препарата, содержащего любого из рекомбинантных представителей семейства Bacillus cereus, экспрессирующих по меньшей мере один белок или пептид, связывающийся с растением. В альтернативном варианте данный способ включает применение к растению, семени растения или области, окружающей растение или семя растений, любого из рекомбинантных представителей семейства Bacillus cereus, экспрессирующих по меньшей мере один белок или пептид, связывающийся с растением, или любого из препаратов, содержащих любого из рекомбинантных представителей семейства Bacillus cereus, экспрессирующих по меньшей мере один белок или пептид, связывающийся с растением. Белок или пептид, связывающийся с растением, физически прикреплен к экзоспорию рекомбинантного представителя семейства Bacillus cereus.

[0015] Другие объекты и признаки будут отчасти очевидны и отчасти указаны в дальнейшем.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

[0016] ФИГ. 1 иллюстрирует выравнивание аминокислотной последовательности амино-концевого участка штамма BclA Bacillus anthracis Sterne с соответствующей областью различных белков экзоспория представителей семейства Bacillus cereus.

[0017] ФИГ. 2 иллюстрирует типичные результаты флуоресцентной микроскопии экспрессии гибридных белков, содержащих различные белки экзоспория, связанные с репортером mCherry, на экзоспории.

ОПРЕДЕЛЕНИЯ

[0018] В данном документе единственное число, «один», «данный» и «указанный» означает «по меньшей мере один» или «один или более», если не указано иное.

[0019] Термины «содержащий», «включающий» и «имеющий» подразумевают включение и означают, что могут быть дополнительные элементы, отличающиеся от перечисленных.

[0020] Термин «биологически активный пептид» означает любой пептид, который проявляет биологическую активность. «Биологически активные пептиды» могут быть получены, например, с помощью расщепления белка, пептида, пробелка или препробелка протеазой или пептидазой.

[0021] «Фермент, участвующий в образовании или активации соединения, стимулирующего рост растения» включает любой фермент, который катализирует любой этап пути биосинтеза соединения, которое стимулирует рост растения или изменяет структуру растения, или любой фермент, который катализирует переход неактивного или менее активного производного соединения, которое стимулирует рост растения или изменяет структуру растения, в активную или более активную форму соединения. Такие соединения, например, включают, но не ограничиваются ими, низкомолекулярные растительные гормоны, такие как ауксины и цитокинины, биологически активные пептиды и низкомолекулярные стимуляторы роста растения, которые синтезируются бактериями или грибами в ризосфере (например, 2,3-бутандиол).

[0022] В данном документе термин «гибридный белок» означает белок, имеющей полипептидную последовательность, которая содержит последовательности, полученные из двух или более отдельных белков. Гибридный белок может быть получен путем соединения молекулы нуклеиновой кислоты, которая кодирует весь первый полипептид, или его часть, с молекулой нуклеиновой кислоты, которая кодирует весь второй полипептид, или его часть, с целью создать последовательность нуклеиновой кислоты, при экспрессии которой образуется один полипептид, имеющий функциональные свойства, полученные от каждого из исходных белков.

[0023] Термин «иммобилизация споры рекомбинантного представителя семейства Bacillus cereus на растении» означает связывание споры представителя семейства Bacillus cereus с растением, например, с корнем растения или с надземной частью растения, такой как лист, стебель, цветок или плод, таким образом, что спора остается на корневой структуре растения или на его надземной части и не проникает в среду роста растения или в среду, окружающую надземные части растения.

[0024] «Среда для роста растений» включает любой материал, который способен поддерживать рост растения.

[0025] В данном документе «белок или пептид, усиливающий иммунную систему растения» включает любой белок или пептид, который оказывает благоприятное воздействие на иммунную систему растения.

[0026] В данном документе термин «белок или пептид, стимулирующий рост растения», включает любой белок или пептид, который увеличивает рост растения, подверженного воздействию этого белка или пептида.

[0027] В данном документе термин «белок или пептид, защищающий растение от патогена», включает любой белок или пептид, который делает растение, подверженное действию этого белка или пептида, менее восприимчивым к инфицированию патогеном.

[0028] В данном документе термин «белок или пептид, который повышает устойчивость к стрессу в растении», включает любой белок или пептид, который делает растение, подверженное действию этого белка или пептида, более устойчивым к стрессу.

[0029] Термин «белок или пептид, связывающийся с растением» означает любой пептид или белок, способный специфически или неспецифически связываться с любой частью растения (например, с корнем или с надземными частями растения, такими как листья, стебли, цветки или плоды) или с растительным материалом.

[0030] В данном документе термин «сигнальная последовательность» означает полипептидную последовательность, которая, являясь частью более длинного полипептида или белка, приводит к локализации более длинного полипептида или белка в определенном месте внутри клетки. Сигнальные последовательности, описанные в данном документе, приводят к расположению белков в эксзоспории представителя семейства Bacillus cereus.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

[0031] Данное изобретение относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория, или фрагмент белка экзоспория, который транспортирует гибридный белок в экзоспорий представителя семейства Bacillus cereus и: (а) по меньшей мере один белок или пептид, стимулирующий рост растения; (б) по меньшей мере один белок или пептид, защищающий растение от патогена; (в) по меньшей мере один белок или пептид, который повышает устойчивость растения к стрессу; или (г) по меньшей мере один белок или пептид, связывающийся с растением. При экспрессии в бактериях - представителях семейства Bacillus cereus, эти гибридные белки транспортируются в слой экзоспория в споре и физически ориентируются таким образом, что данный белок или пептид выводится на внешнюю сторону споры.

[0032] Эта система выведения на экзоспорий Bacillus (ВЭВ) может быть использована для внесения пептидов, ферментов и других белков в растения (например, в листья, фрукты, цветки, стебли или корни, или в среду для роста растений, такую как почва. Пептиды, ферменты, белки и внесенные таким способом в почву или другую среду для роста растений, сохраняют и проявляют активность в почве в течение длительных периодов времени. Внесение в почву или ризосферу растения бактерий - рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридные белки, описанные в данном документе, приводит к повышению полезного роста растения во многих различных почвенных условиях. Использование ВЭВ с целью создания этих ферментов позволяет им продолжать проявление положительных результатов на растение и ризосферу в течение первых месяцев жизни растения.

Сигнальные последовательности, белки экзоспория и фрагменты белков экзоспория

[0033] Для простоты ссылки SEQ ID №№ для пептидных и белковых последовательностей, указанных в данном документе, приведены ниже в таблице 1.

[0034] Bacillus представляет собой род палочковидных бактерий. Семейство бактерий Bacillus cereus включает виды Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis и Bacillus weihenstephensis. В стрессовых условиях окружающей среды бактерии семейства Bacillus cereus претерпевают споруляцию и образуют овальные эндоспоры, которые могут оставаться в состоянии покоя в течение длительных периодов времени. Наружный слой эндоспор известен как экзоспорий и содержит базальный слой, покрытый внешним ворсом из волоскоподобных выростов. Нити этого волоскоподобного ворса образованы преимущественно коллагеноподобным гликопротеином BclA, в то время как базальный слой состоит из нескольких различных белков. В экзоспорий также присутствует другой коллагеноподобный белок, BclB, который располагается на эндоспорах представителей семейства Bacillus cereus. Было показано, что BclA, основной компонент поверхностного ворса, прикреплен к экзоспорию с помощью амино-конца (N-конца), расположенного в базальном слое, и углеродного конца (С-конца), выходящего из споры наружу.

[0035] Ранее было обнаружено, что некоторые последовательности из N-концевых участков BclA и BclB могут быть использованы для транспортировки пептида или белка в экзоспорий эндоспор Bacillus cereus (см заявки на патент США №№2010/0233124 и 2011/0281316, и Thompson et al., Targeting of the BclA and BclB proteins to the Bacillus anthracis spore surface, Molecular Microbiology 70(2):421-34 (2008), каждая из которых включена в данное описание посредством ссылки). Было также установлено, что белок BetA/BAS3290 Bacillus anthracis локализируется в экзоспории.

[0036] В частности, было обнаружено, что аминокислот 20-35 BclA из штамма Bacillus anthracis Sterne достаточно для транспортировки в экзоспорий. На Фигуре 1 проиллюстрировано выравнивание последовательности аминокислот 1-41 из BclA (SEQ ID №: 1) с соответствующими N-концевыми участками нескольких других белков экзоспория из семейства Bacillus cereus и белков из семейства Bacillus cereus, имеющих сходные последовательности. Как видно из Фигуры 1, есть область высокой гомологии между всеми белками в области, соответствующей аминокислотам 20-41 из BclA. Тем не менее, в этих последовательностях аминокислоты, соответствующие аминокислотам 36-41 из BclA, содержит вторичную структуру и не представляют собой необходимыми для транспортировки гибридного белка в экзоспорий. Область консервативной сигнальной последовательности в BclA (аминокислоты 20-35 из SEQ ID №: 1) выделена жирным на Фигуре 1 и соответствует минимальной сигнальной последовательности, необходимой для транспортировки в экзоспорий. Более высоко консервативная область, охватывающая аминокислоты 25-35 из BclA в пределах сигнальной последовательности, подчеркнута в последовательностях на Фигуре 1 и представляет собой последовательность распознавания для ExsFA/BxpB/ExsFB и гомологов, которые направляют и прикрепляют описанные белки на поверхности экзоспория. Аминокислотные последовательности SEQ ID №№. 3, 5 и 7 на Фигуре 1 представляют собой аминокислоты 1-33 из штамма BetA/BAS3290 Bacillus anihracis Sterne, за метионином следуют аминокислоты 2-43 из штамма BAS4623 Bacillus anihracis Sterne, и аминокислоты 1-34 из штамма BclB Bacillus anihracis Sterne, соответственно. (Для BAS4623 было обнаружено, что замена присутствующего валина в положении 1 в нативном белке на метионин приводит к лучшей экспрессии.) Как можно увидеть из Фигуры 1, каждая из этих последовательностей содержит консервативную область, соответствующую аминокислотам 20-35 из BclA (SEQ ID №: 1; выделена жирным) и более высоко консервативную область, соответствующую аминокислотам 20-35 из BclA (подчеркнуто).

[0037] Дополнительные белки из представителей семейства Bacillus cereus также содержат консервативную сигнальную область. В частности, на Фигуре 1 SEQ ID №: 9 представляет собой аминокислоты 1-30 штамма BAS1882 Bacillus anihracis Sterne, SEQ ID №: 11 представляет собой аминокислоты 1-39 генетического продукта 2280 Bacillus weihenstephensis КВАВ4, SEQ ID №: 13 представляет собой аминокислоты 1-39 из генетического продукта 3572 Bacillus weihenstephensis КВАВ4, SEQ ID №: 15 представляет собой аминокислоты 1-49 из лидерного пептида экзоспория Bacillus cereus VD200, SEQ ID №: 17 представляет собой аминокислоты 1-33 из лидерного пептида экзоспория Bacillus cereus VD166, SEQ ID №: 19 представляет собой аминокислоты 1-39 из гипотетического белка IKG 04663 Bacillus cereus VD200, SEQ ID №: 21 представляет собой аминокислоты 1-39 из β-пропеллерного белка Bacillus weihenstephensis КВАВ4 YVTN, SEQ ID №; 23 представляет собой аминокислоты 1-30 из гипотетического белка bcerkbab4_2363 Bacillus weihenstephensis КВАВ4, SEQ ID №: 25 представляет собой аминокислоты 1-30 из гипотетического белка bcerkbab4_2131 Bacillus weihenstephensis КВАВ4, SEQ ID №: 27 представляет собой аминокислоты 1-36 из тройной коллагеновой спирали Bacillus weihenstephensis КВАВ4, SEQ ID №: 29 представляет собой аминокислоты 1-39 из гипотетического белка bmyco0001_21660 Bacillus mycoides 2048, SEQ ID №: 31 представляет собой аминокислоты 1-30 из гипотетического белка bmyc0001_22540 Bacillus mycoides 2048, SEQ ID №: 33 представляет собой аминокислоты 1-21 из гипотетического белка bmyc0001_21510 Bacillus mycoides 2048, SEQ ID №: 35 представляет собой аминокислоты 1-22 из белка тройной коллагеновой спирали Bacillus Thuringiensis 35646, SEQ ID №: 43 представляет собой аминокислоты 1-35 из гипотетического белка WP_69652 Bacillus cereus, SEQ ID №: 45 представляет собой аминокислоты 1-41 из лидера экзоспория WP016117717 Bacillus cereus, SEQ ID №: 47 представляет собой аминокислоты 1-49 из пептида WP002105192 экзоспория Bacillus cereus, SEQ ID №: 49 представляет собой аминокислоты 1-38 из гипотетического белка WP87353 Bacillus cereus, SEQ ID №: 51 представляет собой аминокислоты 1-39 из пептида 02112369 экзоспория Bacillus cereus, SEQ ID №: 53 представляет собой аминокислоты 1-39 из белка WP016099770 экзоспория Bacillus cereus, SEQ ID №: 55 представляет собой аминокислоты 1-36 из гипотетического белка YP006612525 Bacillus Thuringiensis и SEQ ID №: 57 представляет собой аминокислоты 1-136 из гипотетического белка TIGR03720 Bacillus mycoides. Как проиллюстировано на Фигуре 1, каждый из N-концевых областей этих белков содержит область, которая является консервативной с аминокислотами 20-35 из BclA (SEQ ID №: 1), и более высоко консервативную область, соответствующую аминокислотам 25-35 из BclA.

[0038] В гибридных белках по данному изобретению любая часть BclA которая включает аминокислоты 20-35, может быть использована в качестве сигнальной последовательности в данном изобретении. Кроме того, полноразмерные белки экзоспория или фрагменты белка экзоспория могут быть использованы для транспортировки гибридных белков в экзоспорий. Таким образом, полноразмерный BclA или фрагмент BclA, включающий аминокислоты 20-35, может быть использован для транспортировки в экзоспорий. Например, полноразмерный BclA (SEQ ID №: 2),или фрагмент BclA среднего размера, в котором отсутствует углеродный конец, такой как SEQ ID №: 59 (аминокислоты 1-196 из BclA), может быть использован для транспортировки гибридных белков в экзоспорий. Фрагменты среднего размера, такие как фрагмент SEQ ID №: 59, имеют меньшую вторичную структуру, чем полноразмерный BclA, и было установлено, что они пригодны для использования в качестве сигнальной последовательности. Сигнальная последовательность может также содержать намного более короткие части BclA, включающие аминокислоты 20-35, такие как SEQ ID №: 1 (аминокислоты 1-41 из BclA), аминокислоты 1-35 из SEQ ID №: 1, аминокислоты кислоты 20-35 из SEQ ID №: 1 или SEQ ID №: 60 (метиониновый остаток связан с аминокислотами 20-35 из BclA). Даже более короткие фрагменты BclA, включающие лишь некоторые из аминокислот 20-35, также обладают способностью к направлять гибридные белки в экзоспорий. Например, целевая последовательность может включать аминокислоты 22-31 из SEQ ID №: 1, аминокислоты 22-33 из SEQ ID №: 1 или аминокислоты 20-31 из SEQ ID №: 1.

[0039] В альтернативном варианте любая часть BetA/BAS3290, BAS4623, BclB, BAS1882, генетического продукта КВАВ4 2280, генетического продукта КВАВ4 3572, лидерного пептида экзоспория В. cereus VD200, лидерного пептида экзоспория В. cereus VD166, гипотетического белка IKG_04663 В. cereus VD200, β-пропеллерного белка YVTN В. weihenstephensis КВАВ4, гипотетического белка bcerkbab4_2363 В. weihenstephensis КВАВ4, гипотетического белка bcerkbab4_2131 В. weihenstephensis КВАВ4, тройной коллагеновой спирали В. weihenstephensis КВАВ4, гипотетического белка bmyco0001_21660 В. mycoides 2048, гипотетического белка bmyc0001_22540 В. mycoides 2048, гипотетического белка bmyc0001_21510В. mycoides 2048, белка тройной коллагеновой спирали В. thuringiensis 35646, гипотетического белка WP_69652 В. cereus, лидера WP016117717 экзоспория В. cereus, пептида WP002105192 экзоспория В. cereus, гипотетического белка WP87353 В. cereus, пептида 02112369 экзоспория В. cereus, белка WP016099770 экзоспория В. cereus, гипотетического белка YP006612525 В. thuringiensis или гипотетического белка TIGR03720 В. mycoides, который включает аминокислоты, соответствующие аминокислотам 20-35 из BclA, может служить сигнальной последовательностью. Как видно из рисунка 1, аминокислоты 12-27 из BetA/BAS3290, аминокислоты 23-38 из BAS4623, аминокислоты 13-28 из BclB, аминокислоты 9-24 из BAS1882, аминокислоты 18-33 генетического продукта КВАВ4 2280, аминокислоты 18-33 генетического продукта КВАВ4 3572, аминокислоты 28-43 лидерного пептида экзоспория В. cereus VD200, аминокислоты 12-27 лидерного пептида экзоспория В. cereus VD166, аминокислоты 18-33 гипотетического белка IKG_04663 В. cereus VD200, аминокислоты 18-33 β-пропеллерного белка В. weihenstephensis КВАВ4 YVTN, аминокислоты 9-24 гипотетического белка bcerkbab4_2363 В. weihenstephensis КВАВ4, аминокислоты 9-24 гипотетического белка bcerkbab4_2131 В. weihenstephensis КВАВ4, аминокислоты 15-30 тройной коллагеновой спирали В. weihenstephensis КВАВ4, аминокислоты 18-33 гипотетического белка bmyco0001_21660 В. mycoides 2048, аминокислоты 9-24 гипотетического белка bmyc0001_22540 В. mycoides 2048, аминокислоты 1-15 гипотетического белка bmyc0001_21510 В. mycoides 2048, аминокислоты 1-16 белка тройной коллагеновой спирали В. thuringiensis 35646, аминокислоты 14-29 гипотетического белка WP_69652 В. cereus, аминокислоты 20-35 лидера WP016117717 экзоспория В. cereus, аминокислоты 28-43 пептида WP002105192 экзоспория В. cereus, аминокислоты 17-32 гипотетического белка WP87353 В. cereus, аминокислоты 18-33 пептида 02112369 экзоспория В. cereus, аминокислоты 18-33 белка WP016099770 экзоспория В. cereus, аминокислоты 15-30 гипотетического белка YP006612525 В. thuringiensis и аминокислоты 115-130 гипотетического белка TIGR03720 В. mycoides соответствуют аминокислотам 20-35 из BclA. Таким образом, любая часть этих белков, которые включают вышеперечисленные соответствующие аминокислоты, может служить сигнальной последовательностью.

[0040] Кроме того, любая аминокислотная последовательность, содержащая аминокислоты 20-35 из BclA или любые из вышеперечисленных соответствующих аминокислот, может служить сигнальной последовательностью.

[0041] Таким образом, сигнальная последовательность может включать аминокислоты 1-35 из SEQ ID №: 1, аминокислоты 20-35 из SEQ ID №: 1, SEQ ID №: 1, SEQ ID №: 60, аминокислоты 22-31 из SEQ ID №: 1, аминокислоты 22-33 из SEQ ID №: 1, или аминокислоты 20-31 из SEQ ID №: 1. В альтернативном варианте сигнальная последовательность состоит из аминокислот 1-35 из SEQ ID №: 1, аминокислот 20-35 из SEQ ID №: 1, SEQ ID №: 1, или SEQ ID №: 60. В альтернативном варианте сигнальная последовательность может состоять из аминокислот 22-31 в SEQ ID №: 1, аминокислот 22-33 из SEQ ID №: 1, или аминокислот 20-31 из SEQ ID №: 1. В альтернативном варианте белок экзоспория может включать полноразмерный BclA (SEQ ID №: 2), или фрагмент белка экзоспория может включать фрагмент BclA среднего размера, в котором отсутствует углеродный конец, например, SEQ ID №: 59 (аминокислоты 1-196 из BclA). В альтернативном варианте фрагмент белка экзоспория может состоять из SEQ ID №: 59.

[0042] Сигнальная последовательность может также содержать аминокислоты 1-27 из SEQ ID №: 3, аминокислоты 12-27 из SEQ ID №: 3, или SEQ ID №: 3, или белок экзоспория может включать полноразмерный BetA/BAS3290 (SEQ ID №: 4). Кроме того, было обнаружено, что остаток метиониновый остаток, связанный с аминокислотами 12-27 из BetA/BAS3290, может быть использован в качестве сигнальной последовательности. Таким образом, сигнальная последовательность может включать SEQ ID №: 61. Сигнальная последовательность может также содержать аминокислоты 14-23 из SEQ ID №: 3, аминокислоты 14-25 из SEQ ID №: 3, или аминокислоты 12-23 из SEQ ID №: 3.

[0043] Сигнальная последовательность может также содержать аминокислоты 1-38 из SEQ ID №: 5, аминокислоты 23-38 из SEQ ID №: 5, или SEQ ID №: 5, или белок экзоспория может включать полноразмерный BAS4623 (SEQ ID №: 6).

[0044] В альтернативном варианте сигнальная последовательность может включать аминокислоты 1-28 из SEQ ID №: 7, аминокислоты 13-28 из SEQ ID №: 7 или SEQ ID №: 7, или белок экзоспория может включать полноразмерный BclB (SEQ ID №: 8).

[0045] Сигнальная последовательность может также содержать аминокислоты 1-24 из SEQ ID №: 9, аминокислоты 9-24 из SEQ ID №: 9 или SEQ ID №: 9 или белок экзоспория может включать полноразмерный BAS1882 (SEQ ID №: 10). Метиониновый остаток, связанный с аминокислотами 9-24 из BAS1882, также может быть использован в качестве сигнальной последовательности. Таким образом, сигнальная последовательность может включать SEQ ID №: 69.

[0046] Сигнальная последовательность может также содержать аминокислоты 1-33 из SEQ ID №: 11, аминокислоты 18-33 из SEQ ID №: 11, или SEQ ID №: 11, или белок экзоспория может включать полноразмерный генетический продукт В. weihenstephensis КВАВ4 2280 (SEQ ID №: 12). Метиониновый остаток, связанный с аминокислотами 18-33 генетического продукта В. weihenstephensis КВАВ4 2280, также может быть использован в качестве сигнальной последовательности. Таким образом, сигнальная последовательность может включать последовательность SEQ ID №: 62.

[0047] Сигнальная последовательность может также содержать аминокислоты 1-33 из SEQ ID №: 13, аминокислоты 18-33 из SEQ ID №: 13, или SEQ ID №: 13, или белок экзоспория может включать полноразмерный генетический продукт В. weihenstephensis КВАВ4 3572 (SEQ ID №: 14). Метиониновый остаток, связанный с аминокислотами 18-33 генетического продукта В. weihenstephensis КВАВ4 3572, также может быть использован в качестве сигнальной последовательности. Таким образом, сигнальная последовательность может включать SEQ ID №: 63.

[0048] В альтернативном варианте сигнальная последовательность может включать аминокислоты 1-43 из SEQ ID №: 15, аминокислоты 28-43 из SEQ ID №: 15, или SEQ ID №: 15, или белок экзоспория может включать полноразмерный лидерный пептид экзоспория В. cereus VD200 (SEQ ID №: 16).

[0049] Сигнальная последовательность может также содержать аминокислоты 1-27 из SEQ ID №: 17, аминокислоты 12-27 из SEQ ID №: 17, или SEQ ID №: 17, или белок экзоспория может включать полноразмерный лидерный пептид экзоспория В. cereus VD166 (SEQ ID №: 18). Метиониновый остаток, связанный с аминокислотами 12-27 лидерного пептида экзоспория В. cereus VD166, может быть также использован в качестве сигнальной последовательности. Таким образом, сигнальная последовательность может включать SEQ ID №: 64.

[0050] Сигнальная последовательность может также содержать аминокислоты 1-33 из SEQ ID №: 19, аминокислоты 18-33 из SEQ ID №: 19, или SEQ ID №: 19, или белок экзоспория может включать полноразмерный гипотетический белок IKG_04663 из В. cereus VD200 (SEQ ID №: 20).

[0051] В альтернативном варианте сигнальная последовательность содержит аминокислоты 1-33 из SEQ ID №: 21, аминокислоты 18-33 из SEQ ID №: 21, или SEQ ID №: 21, или белок экзоспория может включать полноразмерный β-пропеллерный белок из В. weihenstephensis КВАВ4 YVTN (SEQ ID №: 22). Метиониновый остаток, связанный с аминокислотами 18-33 β-пропеллерного белка из В. weihenstephensis КВАВ4 YVTN, также может быть использован в качестве сигнальной последовательности. Таким образом, сигнальная последовательность может включать SEQ ID №: 65.

[0052] Сигнальная последовательность может также содержать аминокислоты 1-24 из SEQ ID №: 23, аминокислоты 9-24 из SEQ ID №: 23, или SEQ ID №: 23, или белок экзоспория может включать полноразмерный гипотетический белок bcerkbab4_2363 из В. weihenstephensis КВАВ4 (SEQ ID №: 24). Метиониновый остаток, связанный с аминокислотами 9-24 гипотетического белка bcerkbab4_236 из В. weihenstephensis КВАВ4, также может быть использован в качестве сигнальной последовательности. Таким образом, сигнальная последовательность может включать SEQ ID №: 66.

[0053] Сигнальная последовательность содержит аминокислоты 1-24 из SEQ ID №: 25, аминокислоты 9-24 из SEQ ID №: 25, или SEQ ID №: 25, или белок экзоспория может включать полноразмерный гипотетический белок bcerkbab4_2131 из В. weihenstephensis КВАВ4 (SEQ ID №: 26). Метиониновый остаток, связанный с аминокислотами 9-24 гипотетического белка bcerkbab4_2131 из В. weihenstephensis КВАВ4, также может быть использован в качестве сигнальной последовательности. Таким образом, сигнальная последовательность может включать SEQ ID №: 67.

[0054] В альтернативном варианте сигнальная последовательность содержит аминокислоты 1-30 из SEQ ID №: 27, аминокислоты 15-30 из SEQ ID №: 27, или SEQ ID №: 27, или белок экзоспория может включать полноразмерную тройную коллагеновую спираль из В. weihenstephensis КВАВ4 (SEQ ID №: 28).

[0055] Сигнальная последовательность может также содержать аминокислоты 1-33 из SEQ ID №: 29, аминокислоты 18-33 из SEQ ID №: 29, или SEQ ID №: 29, или белок экзоспория может включать полноразмерный гипотетический белок bmyco0001_21660 из В. mycoides 2048 (SEQ ID №: 30).

[0056] Сигнальная последовательность может также содержать аминокислоты 1-24 из SEQ ID №: 31, аминокислоты 9-24 из SEQ ID №: 31, или SEQ ID №: 31, или белок экзоспория может включать полноразмерный гипотетический белок bmyc0001_22540 из В. mycoides 2048 (SEQ ID №: 32). Метиониновый остаток, связанный с аминокислотами 9-24 гипотетического белка bmyc0001_22540 из В. mycoides 2048, также может быть использован в качестве сигнальной последовательности. Таким образом, сигнальная последовательность может включать SEQ ID №: 68.

[0057] В альтернативном варианте сигнальная последовательность содержит аминокислоты 1-15 из SEQ ID №: 33, SEQ ID №: 33, или белок экзоспория содержит полноразмерный гипотетический белок bmyc0001_21510 из В. mycoides 2048 (SEQ ID №: 34).

[0058] Сигнальная последовательность может также содержать аминокислоты 1-16 из SEQ ID №: 35, SEQ ID №: 35, или белок экзоспория может включать полноразмерный белок тройной коллагеновой спирали из В. thuringiensis 35646 (SEQ ID №: 36).

[0059] Сигнальная последовательность может включать аминокислоты 1-29 из SEQ ID №: 43, аминокислоты 14-29 из SEQ ID №: 43, или SEQ ID №: 43, или белок экзоспория может включать полноразмерный гипотетический белок WP_69652 из В. cereus (SEQ ID №: 44).

[0060] В альтернативном варианте сигнальная последовательность может включать аминокислоты 1-35 из SEQ ID №: 45, аминокислоты 20-35 из SEQ ID №: 45, или SEQ ID №: 45, или белок экзоспория может включать полноразмерный лидер WP016117717 из В. cereus (SEQ ID №: 46). Метиониновый остаток, связанный с аминокислотами 20-35 лидера WP016117717 из экзоспория В. cereus, также может быть использован в качестве сигнальной последовательности. Таким образом, сигнальная последовательность может включать SEQ ID №: 70.

[0061] Сигнальная последовательность может включать аминокислоты 1-43 из SEQ ID №: 47, аминокислоты 28-43 из SEQ ID №: 47, или SEQ ID №: 47, или белок экзоспория может включать полноразмерный пептид WP002105192 из экзоспория В. cereus (SEQ ID №: 48).

[0062] Сигнальная последовательность может включать аминокислоты 1-32 из SEQ ID №: 49, аминокислоты 17-32 из SEQ ID №: 49, или SEQ ID №: 49, или белок экзоспория может включать полноразмерный гипотетический белок WP87353 из В. cereus (SEQ ID №: 50).

[0063] В альтернативном варианте сигнальная последовательность может включать аминокислоты 1-33 из SEQ ID №: 51, аминокислоты 18-33 из SEQ ID №: 51, или SEQ ID №: 51, или белок экзоспория может включать полноразмерный пептид 02112369 из экзоспория В. cereus (SEQ ID №: 52).

[0064] Сигнальная последовательность может включать аминокислоты 1-33 из SEQ ID №: 53, аминокислоты 18-33 из SEQ ID №: 53, или SEQ ID №: 53, или белок экзоспория может включать полноразмерный белок WP016099770 из экзоспория В. cereus (SEQ ID №: 54).

[0065] В альтернативном варианте сигнальная последовательность может включать аминокислоты 1-30 из SEQ ID №: 55, аминокислоты 15-30 из SEQ ID №: 55, или SEQ ID №: 55, или белок экзоспория может включать полноразмерный гипотетический белок YP006612525 из В. thuringiensis (SEQ ID №: 56).

[0066] Сигнальная последовательность может также содержать аминокислоты 1-130 из SEQ ID №: 57, аминокислоты 115-130 из SEQ ID №: 57, или SEQ ID №: 57, или белок экзоспория может включать полноразмерный гипотетический белок TIGR03720 из В. mycoides (SEQ ID №: 58).

[0067] Кроме того, как легко можно понять из выравнивания последовательностей на Фигуре 1, в то время как аминокислоты 20-35 из BclA являются консервативными, и аминокислоты 25-35 являются более консервативными, в этой области может возникать некоторый уровень вариации, не влияя на способность сигнальной последовательности транспортировать белок в экзоспорий. В Фигуре 1 перечислены проценты идентичности каждой из соответствующих аминокислот каждой последовательности с аминокислотами 20-35 из BclA («20-35% идентичности») и с аминокислотами 25-35 на BclA («25-35% идентичности»). Так, например, по сравнению с аминокислотами 20-35 из BclA, соответствующие аминокислоты из BetA/BAS3290 идентичны на около 81,3%, соответствующие аминокислоты из BAS4623 идентичны на около 50,0%, соответствующие аминокислоты из BclB идентичны на около 43,8%, соответствующие аминокислоты из BAS1882 идентичны на около 62,5%, соответствующие аминокислоты генетического продукта КВАВ4 2280 идентичны на около 81,3% и соответствующие аминокислоты генетического продукта КВАВ4 3572 идентичны на около 81,3%. Идентичности для остальных последовательностей этой области перечислены на Фигуре 1.

[0068] В отношении аминокислот 25-35 из BclA, соответствующие аминокислоты из BetA/BAS3290 идентичны на около 90,9%, соответствующие аминокислоты из BAS4623 идентичны на около 72,7%, соответствующие аминокислоты из BclB идентичны на около 54,5%, соответствующие аминокислоты из BAS1882 идентичны на около 72,7%, соответствующие аминокислоты генетического продукта КВАВ4 2280 идентичны на около 90,9% и соответствующие аминокислоты генетического продукта КВАВ4 3572 идентичны на около 81,8%. Идентичности для остальных последовательностей этой области перечислены на Фигуре 1.

[0069] Таким образом, сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 43% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 54%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 43% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 54%.

[0070] Сигнальная последовательность может также содержать аминокислотную последовательность, имеющую по меньшей мере около 50% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 63%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 50% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 63%.

[0071] Сигнальная последовательность может также содержать аминокислотную последовательность, имеющую по меньшей мере около 50% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 72%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 50% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 72%.

[0072] Сигнальная последовательность может также содержать аминокислотную последовательность, имеющую по меньшей мере около 56% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 63%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 56% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 63%.

[0073] В альтернативном варианте сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 62% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 72%. Сигнальная последовательность может также состоять из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 62% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 из SEQ ID №: 1 составляет по меньшей мере около 72%.

[0074] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере 68% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 81%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере 68% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 81%.

[0075] Сигнальная последовательность может также содержать аминокислотную последовательность, имеющую по меньшей мере около 75% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 72%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 75% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 из SEQ ID №: 1 составляет по меньшей мере около 72%.

[0076] Сигнальная последовательность может также содержать аминокислотную последовательность, имеющую по меньшей мере около 75% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 81%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 75% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 из SEQ ID №: 1 составляет по меньшей мере около 81%.

[0077] Сигнальная последовательность может также содержать аминокислотную последовательность, имеющую по меньшей мере около 81% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 81%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 81% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 81%.

[0078] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 81% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 90%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 81% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 90%.

[0079] Специалисту в данной области техники будет понятно, что варианты указанных последовательностей могут быть также использованы в качестве сигнальных последовательностей при условии, что данная сигнальная последовательность содержит аминокислоты 20-35 из BclA, соответствующие аминокислоты из BetA/BAS3290, BAS4263, BclB, BAS1882, генетического продукта КВАВ4 2280 или генетического продукта КВАВ 3572, или имеется последовательность, содержащая любую из вышеуказанных идентичностей с аминокислотами 20-35 и 25-35 из BclA.

[0080] Дополнительно было обнаружено, что некоторые белки представителей семейства Bacillus cereus, которые не имеют области, гомологичной к аминокислотам 25-35 из BclA, также могут быть использованы для транспортировки пептида или белка в экзоспорий представителя семейства Bacillus cereus. В частности, гибридные белки могут содержать белок экзоспория, содержащий SEQ ID №: 71 (В. mycoides InhA), белок экзоспория, содержащий SEQ ID №: 72 (В. anthracis Sterne BAS1141 (ExsY)), белок экзоспория, содержащий SEQ ID №: 73 (В. anthracis Sterne BAS1144 (BxpB/ExsFA)), белок экзоспория, содержащий SEQ ID №: 74 (В. anthracis Sterne BAS1145 (Coty)), белок экзоспория, содержащий SEQ ID №: 75 (В. anthracis Sterne BAS1140), белок экзоспория, содержащий SEQ ID №: 76 (В. anthracis H9401 ExsFB), белок экзоспория, содержащий SEQ ID №: 77 (В. thuringiensis HD74 InhAl), белок экзоспория, содержащий SEQ ID №: 78 (В. cereus ATCC 10876 ExsJ), белок экзоспория, содержащий SEQ ID №: 79 (В. cereus ExsH), белок экзоспория, содержащий SEQ ID №: 80 (В. anthracis Ames YjcA), белок экзоспория, содержащий SEQ ID №: 81 (В. anthracis YjcB), белок экзоспория, содержащий SEQ ID №: 82 (В. anihracis Sterne BclC), белок экзоспория, содержащий SEQ ID №: 83 (Bacillus thuringiensis к. т.п.97-27 кислой фосфатазы) или белок экзоспория, содержащий SEQ ID №: 84. (В. thuringiensis HD74 InhA2). Включение белка экзоспория, содержащего SEQ ID №: 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 или 84, в гибридные белки, описанные в данном документе, приведет к направлению в экзоспорий представителя семейства В. cereus.

[0081] Кроме того, белки экзоспория, имеющие высокую степень идентичности последовательности с любым из полноразмерных белков экзоспория, или фрагментов белка экзоспория, описанных выше, также могут быть использованы для транспортировки пептида или белка в экзоспорий представителя семейства Bacillus cereus. Таким образом, гибридный белок может включать белок экзоспория, включающий аминокислотную последовательность, имеющую по меньшей мере 85% идентичности с любой из SEQ ID №: 2, 4, 6, 8,10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 и 84. В альтернативном варианте гибридный белок может включать белок экзоспория, имеющий по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 98%, по меньшей мере 99% или 100% идентичности с любой из SEQ ID №: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 и 84.

[0082] В альтернативном варианте гибридный белок может включать фрагмент белка экзоспория, состоящий из аминокислотной последовательности, имеющей по меньшей мере 85% идентичности с SEQ ID №: 59. В альтернативном варианте гибридный белок может включать фрагмент белка экзоспория, состоящий из аминокислотной последовательности, имеющей по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 98%, по меньшей мере 99% или 100% идентичности с SEQ ID №: 59.

[0083] В любой из сигнальных последовательностей, белках экзоспория или фрагментах белка экзоспория, описанных в данном документе, сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может включать аминокислотную последовательность GXT на его углеродном конце, причем X представляет собой любую аминокислоту.

[0084] В любой из сигнальных последовательностей, белках экзоспория или фрагментах белка экзоспория, описанных в данном документе, сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может содержать аланиновый остаток в положении сигнальной последовательности, соответствующем аминокислоте 20 из SEQ ID №: 1.

Гибридные белки

[0085] Данное изобретение относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория, или фрагмент белка экзоспория, и по меньшей мере один белок или пептид, стимулирующий рост растения, причем белок или пептид, стимулирующий рост растения, включает пептидный гормон, негормональный пептид или фермент, участвующий в продуцировании или активации соединения, стимулирующего рост растения. Сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может представлять собой любую из сигнальных последовательностей, белков экзоспория или фрагментов белка экзоспория, описанных ранее в параграфе [0005].

[0086] Данное изобретение дополнительно относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория, или фрагмент белка экзоспория и по меньшей мере один белок или пептид, который повышает устойчивость к стрессу в растении. Сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может представлять собой любую из сигнальных последовательностей, белков экзоспория или фрагментов белка экзоспория, описанных ранее в параграфе [0005].

[0087] Кроме того, данное изобретение относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория и по меньшей мере один белок или пептид, связывающийся с растением. Сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может представлять собой любую из сигнальных последовательностей, белков экзоспория или фрагментов белка экзоспория, описанных ранее в параграфе [0005].

[0088] Данное изобретение также относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория, или фрагмент белка экзоспория и по меньшей мере один белок или пептид, защищающий растение от патогена. Сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может представлять собой любую из сигнальных последовательностей, белков экзоспория или фрагментов белка экзоспория, описанных ранее в параграфе [0006].

[0089] Данное изобретение дополнительно относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория, или фрагмент белка экзоспория и по меньшей мере один белок или пептид, защищающий растение от патогена. Белок или пептид, защищающий растение от патогена, включает гарпин, α-эластин, β-эластин, системин, фенилаланин аммиак-лиазу, элиситин, дефензин, криптогеин, белок флагеллин, пептид флагеллина, бактериоцин, лизоцим, пептид лизоцима, сидерофор, нерибосомальный активный пептид, кональбумин, альбумин, лактоферрин, пептид лактоферрина или TasA. В альтернативном варианте белок или пептид, защищающий растение от патогена, обладает инсектицидной активностью, антигельминтной активностью, подавляет хищничество насекомых или червей, или их комбинацию. В альтернативном варианте белок, защищающий растение от патогена, включает фермент.Сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может представлять собой любую из сигнальных последовательностей, белков экзоспория или фрагментов белка экзоспория, описанных ранее в параграфе [0005].

[0090] Гибридный белок может быть получен с использованием стандартных способов клонирования и молекулярной биологии, известных в данной области техники. Например, ген, кодирующий белок или пептид (например, ген, кодирующий белок или пептид, стимулирующий рост растения) может быть амплифицирован с помощью полимеразной цепной реакции (ПЦР) и лигирован с кодирующей ДНК для любой из сигнальных последовательностей, описанных выше, с целью сформировать молекулу ДНК, которая кодирует гибридный белок. Молекула ДНК кодирующая гибридный белок, может быть клонирована в виде любого подходящего вектора, например, плазмидного вектора. В подходящем варианте вектор содержит сайт множественного клонирования, в который может быть легко вставлена молекула ДНК, кодирующая гибридный белок. В подходящем варианте вектор также содержит селективный маркер, например, ген резистентности к антибиотику, таким образом, что трансформированные, трансфицированные или соединенные с вектором бактерии могут быть легко идентифицированы и выделены. В случае, когда вектор представляет собой плазмиду, в подходящем варианте плазмида также содержит точку начала репликации. В подходящем варианте ДНК, кодирующая гибридный белок, находится под контролем промотора споруляции, который будет вызывать экспрессию гибридного белка на экзоспорий эндоспоры представителя семейства В. cereus (например, нативный промотор BclA представителя семейства В. cereus). В альтернативном варианте ДНК, кодирующая гибридный белок, может быть интегрирована в хромосомную ДНК представителя семейства В. cereus.

[0091] Гибридный белок может также содержать дополнительные последовательности полипептидов, которые не являются частью сигнальной последовательности, белка экзоспория, фрагмента белка экзоспория или белка или пептида, стимулирующего рост растений, белка или пептида, защищающего растение от патогенов, белка или пептида который повышает устойчивость к стрессу в растении, или белка или пептида, который связывается с растением. Например, гибридный белок может включать метки или маркеры с целью облегчить очистку или визуализацию гибридного белка (например, полигистидиновую метку или флуоресцентный белок, такой как GFP или YFP) или визуализации спор рекомбинантных представителей семейства Bacillus cereus, экспрессирующих гибридный белок.

[0092] Экспрессия гибридных белков на экзоспорий с использованием сигнальных последовательностей, белков экзоспория и фрагментов белка экзоспория, описанных в данном документе, усиливается из-за отсутствия вторичной структуры в амино-конце этих последовательностей, что позволяет сохранить нативную структуру и активность гибридных белков. Правильность формы может быть дополнительно усилена включением короткого аминокислотного линкера между сигнальной последовательностью, белком экзоспория, фрагментом белка экзоспория и белком-партнером слияния.

[0093] Таким образом, любой из гибридных белков, описанных в данном документе, может включать аминокислотный линкер между сигнальной последовательностью, белком экзоспория или фрагментом белка экзоспория и белком или пептидом, стимулирующим рост растения, белком или пептидом, защищающим растение от патогена, белком или пептидом, повышающим устойчивость к стрессу в растении, или белком или пептидом, связывающимся с растением.

[0094] Линкер может включать полиаланиновый линкер или полиглициновый линкер. Также может быть использован линкер, содержащий смесь обоих - аланинового и глицинового остатков. Например, если сигнальная последовательность содержит SEQ ID №: 1, гибридный белок может иметь одну из следующих структур:

Линкер отсутствует: SEQ ID №: 1 - белок-партнер слияния

Аланиновый линкер: SEQ ID №: 1-An-белок-партнер слияния

Глициновый линкер: SEQ ID №: 1-Gn-белок-партнер слияния

Смесь аланинового и глицинового линкеров: SEQ ID №: 1-(А/G)n-белок-партнер слияния

где An, Gn, и (A/G) представляют собой аланины в любом количестве, глицины в любом количестве или смесь аланинов и глицинов в любом количестве, соответственно. Например, n может составлять от 1 до 25, и предпочтительно от 6 до 10. Если линкер содержит смесь аланиновых и глициновых остатков, может быть использована любая комбинация глицина и аланина. В приведенных выше структурах «белок-партнер слияния» представляет собой белок или пептид, стимулирующий рост растения, белок или пептид, защищающий растение от патогена, белок или пептид, повышающий устойчивость к стрессу в растении, или белок или пептид, связывающийся с растением.

[0095] В альтернативном варианте или в дополнение, линкер может включать сайт распознавания протеазой. Включение сайта распознавания протеазой позволяет целевое удаление под воздействием протеазы, которая распознает сайт распознавания протеазой, в белке или пептиде, стимулирующем рост растения, белке или пептиде, защищающем растение от патогена, белке или пептиде, повышающем устойчивость к стрессу в растении, или белке или пептиде, связывающемся с растением.

Белки и пептиды, стимулирующие рост растения

[0096] Как отмечено выше, данное изобретение относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория и по меньшей мере один белок или пептид, стимулирующий рост растения, причем белок или пептид, стимулирующий рост растения, включает пептидный гормон, негормональный пептид или фермент, участвующий в продуцировании или активации соединения, стимулирующего рост растения.

[0097] Например, если белок или пептид, стимулирующий рост растения, содержит пептидный гормон, этот пептидный гормон может включать фитосульфокин (например, фитосульфокин-α), clavata 3 (CLV3), системин, ZmlGF или SCR/SP11.

[0098] Если белок или пептид, стимулирующий рост растения, содержит негормональный пептид, этот негормональный пептид может включать RKN 16D10, Hg-Syv46, eNOD40 пептид, мелиттин, мастопаран, Mas7, RHPP, POLARIS или ингибитор трипсина Кунитца (ИТК).

[0099] Белок или пептид, стимулирующий рост растения, может включать фермент, участвующий в образовании или активации соединения, стимулирующего рост растения. Фермент, участвующий в образовании или активации соединения, стимулирующего рост растения, может представлять собой любой фермент, который катализирует любой этап пути биосинтеза соединения, которое стимулирует рост растения или изменяет структуру растения, или любой фермент, который катализирует переход неактивного или менее активного производного соединения, которое стимулирует рост растения или изменяет структуру растения, в активную или более активную форму соединения.

[00100] Соединение, которое стимулирует рост растения, может включать соединение, производимое бактериями или грибами в ризосфере, например, 2,3-бутандиол.

[00101] В альтернативном варианте соединение, которое стимулирует рост растения, может включать гормон роста растений, например, цитокинин или производное цитокинина, этилен, ауксин или производное ауксина, гибберелловую кислоту или ее производное гибберелловой кислоты, абсцизовую кислоту или производное абсцизовой кислоты, жасминовую кислоту или производное жасминовой кислоты.

[00102] Если соединение, стимулирующее рост растений, включает цитокинин или производную цитокинина, цитокинин или производное цитокинина может включать кинетин, цис-зеатин, транс-зеатин, 6-бензиламинопурин, дигидроксизеатин, N6-(D2-изопентенил) аденин, рибозилзеатин, N6-(D2-изопентенил) аденозин, 2-метилтио-цис-рибозилзеатин, цис-рибозилзеатин, транс-рибозилзеатин, 2-метилтио-транс-рибозилзеатин, рибозилзеатин-5-монофосфат, N6-метиламинопурин, N6-диметиламинопурин, 2'-дезоксизеатин рибозид, 4-гидрокси-3-метил-транс-2-бутениламинопурин, орто-тополин, мета-тополин, бензиладенин, орто-метилтополин, мета-метилтополин или их комбинацию.

[00103] Если соединение, стимулирующие рост растения, содержит ауксин или производное ауксина, ауксин или производное ауксина может включать активный ауксин, неактивный ауксин, конъюгированный ауксин, природный ауксин, синтетический ауксин или их комбинацию. Например, ауксин или производное ауксина может включать индол-3-ацетальдоксим, индол-3-ацетамид, индол-3-ацетонитрил, индол-3-этанол, индол-3-пируват, индол-3-ацетальдоксим, индол-3-масляную кислоту, фенилуксусную кислоту, 4-хлориндол-3-уксусную кислоту, ауксин, конъюгированный с глюкозой, или их комбинацию.

[00104] Фермент, участвующий в образовании или активации соединения, которое стимулирует рост растения, может включать ацетоинредуктазу, индол-3-ацетамидгидролазу, триптофанмонооксигеназу, ацетолактатсинтетазу, α-ацетолактатдекарбоксилазу, пируватдекарбоксилазу, диацетилредуктазу, бутандиолдегидрогеназу, аминотрансферазу, триптофандекарбоксилазу, аминоксидазу, индол-3-пируватдекарбоксилазу, индол-3-ацетальдегид-дегидрогеназу, триптофан боковой цепи-оксидазу, нитрилгидролазу, нитрилазу, пептидазу, протеазу, аденозинфосфат-изопентилтрансферазу, фосфатазу, аденозинкиназу, аденин-фосфорибозилтрансферазу, CYP735A, 5'-рибонуклеотид-фосфогидролазу, аденозин-нуклеозидазу, зеатин-цис-транс-изомеразу, зеатин-О-глюкозилтрансферазу, β-глюкозидазу, цис-гидроксилазу, ЦК-цис-гидроксилазу, ЦК-N-глюкозилтрансферазу, 2,5-рибонуклеотид-фосфогидролазу, аденозин-нуклеозидазу, пурин-нуклеозидфосфорилазу, зеатинредуктазу, гидроксиламинредуктазу, 2-оксоглутаратдиоксигеназу, гибберелловую-2В/3В-гидролазу, гиббереллин-3-оксидазу, гиббереллин-20-оксидазу, хитозиназу, хитиназу, β-1,3-глюканазу, β-1,4-глюканазу, β-1,6-глюканазу, аминоциклопропан-1-карбоновой кислоты-деаминазу или фермент, участвующий в продуцировании nod-факторов (например, NodA, nodB или NodI).

[00105] Если фермент включает протеазу или пептидазу, эта протеаза или пептидаза может представлять собой протеазу или пептидазу, которая расщепляет белки, пептиды, пробелки или препробелки для получения биологически активного пептида. Биологически активный пептид может представлять собой любой пептид, который проявляет биологическую активность.

[00106] Примеры биологически активных пептидов включают RKN 16D10 и RHPP.

[00107] Протеаза или пептидаза, которая расщепляет белки, пептиды, пробелки или препробелки для получения биологически активного пептида, может включать субтилизин, кислую протеазу, щелочную протеазу, протеиназу, эндопептидазу, экзопептидазу, термолизин, папаин, пепсин, трипсин, проназу, карбоксилазу, сериновую протеазу, глутаминовую протеазу, аспартатную протеазу, цистеиновую протеазу, треониновую протеазу или металлопротеазу.

[00108] Протеазы или пептидазы могут расщеплять белки в пище, богатой белком (например, соевый шрот или дрожжевой экстракт).

Белки и пептиды, которые защищают растения от патогенов

[00109] Данное изобретение относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория и по меньшей мере один белок или пептид, защищающий растение от патогена.

[00110] Белок или пептид, защищающий растение от патогена, может включать белок или пептид, который стимулирует иммунный ответ растения. Например, белок или пептид, который стимулирует иммунную реакцию растения, может включать белок или пептид, усиливающий иммунную систему растения. Белок или пептид, который усиливает иммунную систему растения, может представлять собой любой белок или пептид, который оказывает благоприятное воздействие на иммунную систему растения. Подходящие белки или пептиды, которые усиливают иммунную систему растения, включают гарпины, α-эластины, β-эластины, системины, фенилаланин аммиак-лиазу, элиситины, дефензины, криптогеины, белки флагеллины и пептиды флагеллина (например, flg22).

[00111] В альтернативном варианте белок или пептид, защищающий растение от патогена, может представлять собой белок или пептид, который обладает антибактериальной активностью, противогрибковой активностью, или обеими - антибактериальной и противогрибковой активностью. Примеры таких белков и пептидов включают бактериоцины, лизоцимы, пептиды лизоцима (например, LysM), сидерофоры, нерибосомальные активные пептиды, кональбумины, альбумины, лактоферрины, пептиды лактоферрина (например, LfcinB) и TasA.

[00112] Белок или пептид, защищающий растение от патогена, может также представлять собой белок или пептид, который обладает инсектицидной активностью, антигельминтной активностью, подавляет хищничество насекомых или червей, или обладает их комбинацией. Например, белок или пептид, защищающий растение от патогена, может включать инсектицидный бактериальный токсин (например, инсектицидный белок VIP), эндотоксин, Cry токсин (например, Cry токсин из Bacillus thuringiensis), белок или пептид ингибитор протеазы (например, ингибитор трипсина или стреловидный ингибитор протеазы), цистеиновую протеазу или хитиназу. Если Cry токсин представляет собой Cry токсин из Bacillus thuringiensis, Cry токсин может представлять собой белок Cry5В или белок Cry21A. Оба Cry5В и Cry21A обладают инсектицидной и нематоцидной активностью.

[00113] Белок, защищающий растение от патогена, может включать фермент. Подходящие ферменты включают протеазы и лактоназы. В протеазы и лактоназы могут быть специфичным для бактериальной сигнальной молекулы (например, бактериальную сигнальную молекулу гомосеринового лактона).

[00114] Если фермент представляет собой лактоназу, такая лактоназа может включать 1,4-лактоназу, 2-пирон-4,6-дикарбоксилат-лактоназу, 3-оксоадипат-енол-лактоназу, актиномицин-лактоназу, дезоксилимонат-А-кольцевую-лактоназу, глюконолактоназу, L-рамноно-1,4-лактоназу, лимонин-D-кольцевую-лактоназу, стероид-лактоназу, триацетат-лактоназу или ксилоно- 1,4-лактоназу.

[00115] Фермент также может представлять собой фермент, который является специфичным для клеточного компонента бактерий или грибов. Например, фермент может включать β-1,3-глюканазу, β-1,4-глюканазу, β-1,6-глюканазу, хитозиназу, хитиназу, хитозиназоподобный фермент, литиказу, пептидазу, протеиназу, протеазу (например, щелочную протеазу, кислую протеазу или нейтральную протеазу), мутанолизин, стафолисин или лизоцим.

[00116] Для любого из вышеуказанных гибридных белков, содержащих белок или пептид, защищающий растение от патогена, патоген может представлять собой бактериальный патоген или грибковый патоген. Например, патоген может включать протеобактерию α-класса, протеобактерию β-класса, протеобактерию γ-класса или их комбинацию. Конкретные бактериальные патогены включают Agrobacterium tumefaciens, Pantoea stewartii, Erwinia carotovora, Ralstonia solanacearum, Pseudomonas syringae, Pseudomonas aeruginosa, Xanthomonas campestris и их комбинации.

[00117] Другие бактериальные и грибковые патогены включают Acarosporina microspora, Aceria guerreronis, Achlya conspicua, Achlya klebsiana, Achlysiella williamsi, Acholeplasmataceae, Acidovorax avenae, Acremonium strictum, Acrocalymma medicaginis, Acrodontium simplex, Acrophialophora fusispora, Acrosporium tingitaninum, Aecidium, Aecidium aechmantherae, Aecidium amaryllidis, Aecidium breyniae, Aecidium campanulastri, Aecidium cannabis, Aecidium cantensis, Aecidium caspicum, Aecidium foeniculi, Agrobacterium tumefaciens, Albonectria rigidiuscula, Albugo bliti, Albugo candida, Albugo ipomoeae-panduratae, Albugo laibachii, Albugo occidentalis, Albugo tragopogonis, Alternaria, Alternaria alternata, Alternaria brassicae, Alternaria brassicicola, Alternaria carthami, Alternaria cinerariae, Alternaria citri, Alternaria dauci, Alternaria dianthi, Alternaria dianthicola, Alternaria euphorbiicola, Alternaria helianthi, Alternaria helianthicola, Alternaria japonica, Alternaria leucanthemi, Alternaria limicola, Alternaria linicola, Alternaria mali, Alternaria padwickii, Alternaria panax, Alternaria radicina, Alternaria raphani, Alternaria saponariae, Alternaria senecionis, Alternaria solani, Alternaria tenuissima, Alternaria triticina, Alternaria zinniae, Amazonia, Amphobotrys ricini, Anguillosporella vermiformis, Anguina (род), Anguina agrostis, Anguina amsinckiae, Anguina australis, Anguina balsamophila, Anguina funesta, Anguina graminis, Anguina spermophaga, Anguina tritici, Anisogramma anomala, Anthostomella pullulans, Antrodia albida, Antrodia serialiformis, Antrodia serialis, Aphanomyces cladogamus, Aphanomyces cochlioides, Aphanomyces euteiches, Aphanomyces euteiches f. sp.pisi, Aphanomyces raphani, Aphelenchoides, Aphelenchoides arachidis, Aphelenchoides besseyi, Aphelenchoides fragariae, Aphelenchoides parietinus, Aphelenchoides ritzemabosi, Aphelenchus avenae, Apiognomonia errabunda, Apiognomonia veneta, Apiospora montagnei, Appendiculella, Armillaria, Armillaria affinis, Armillaria apalosclera, Armillaria camerunensis, Armillaria duplicate, Armillaria fellea, Armillaria fumosa, Armillaria fuscipes, Armillaria griseomellea, Armillaria heimii, Armillaria mellea, Armillaria melleorubens, Armillaria montagnei, Armillaria omnituens, Armillaria pallidula, Armillaria paulensis, Armillaria pelliculata, Armillaria procera, Armillaria puiggarii, Armillaria singular, Armillaria socialis, Armillaria solidipes, Armillaria tabescens, Armillaria tigrensis, Armillaria umbrinobrunnea, Armillaria viridiflava, Armillaria yungensis, Arthrocladiella, Arthuriomyces peckianus, Ascochyta asparagine, Ascochyta bohemica, Ascochyta caricae, Ascochyta doronici, Ascochyta fabae f. sp.lentis, Ascochyta graminea, Ascochyta hordei, Ascochyta humuli, Ascochyta pisi, Ascochyta prasadii, Ascochyta sorghi, Ascochyta spinaciae, Ascochyta tarda, Ascochyta tritici, Ascospora ruborum, Ashbya gossypii, Aspergillus aculeatus, Aspergillus fischerianus, Aspergillus niger, Asperisporium caricae, Asperisporium minutulum, Asteridiella, Asteridiella perseae, Asteroma caryae, Asteroma coryli, Asteroma inconspicuum, Athelia arachnoidea, Athelia rolfsii, Aurantiporus fissilis, Belonolaimus, Belonolaimus gracilis, Belonolaimus longicaudatus, Beniowskia sphaeroidea, Bionectria ochroleuca, Bipolaris, Bipolaris cactivora, Bipolaris cookie, Bipolaris incurvata, Bipolaris sacchari, Biscogniauxia capnodes var. capnodes, Biscogniauxia marginata, Biscogniauxia nummularia, Bjerkandera adusta, Blakeslea trispora, Blumeria graminis, Botryodiplodia oncidii, Botryodiplodia ulmicola, Botryosphaeria cocogena, Botryosphaeria corticola, Botryosphaeria disrupta, Botryosphaeria dothidea, Botryosphaeria marconii, Botryosphaeria obtuse, Botryosphaeria quercuum, Botryosphaeria rhodina, Botryosphaeria ribis, Botryosphaeria stevensii, Botryosporium pulchrum, Botryotinia, Botryotinia fuckeliana, Botrytis anthophila, Botrytis cinerea, Botrytis fabae, Bremia lactucae, Brenneria salicis, Briosia ampelophaga, Bulbomicrosphaera, Burkholderia andropogonis, Burkholderia caryophylli, Burkholderia glumae, Cadophora malorum, Caespitotheca, Calonectria indusiata, Calonectria kyotensis, Calonectria quinqueseptata, Calvatia versispora, Camarosporium pistaciae, Camarotella acrocomiae, Camarotella costaricensis, Candidatus Liberibacter, Capitorostrum cocoes, Capnodium footii, Capnodium mangiferum, Capnodium ramosum, Capnodium theae, Caulimoviridae, Cephaleuros virescens, Cephalosporium gramineum, Ceratobasidium cereal, Ceratobasidium cornigerum, Ceratobasidium noxium, Ceratobasidium ramicola, Ceratobasidium setariae, Ceratobasidium stevensii, Ceratocystis adiposa, Ceratocystis coerulescens, Ceratocystis fimbriata, Ceratocystis moniliformis, Ceratocystis paradoxa, Ceratocystis pilifera, Ceratocystis pluriannulata, Ceratorhiza hydrophila, Ceratospermopsis, Cercoseptoria ocellata, Cercospora, Cercospora angreci, Cercospora apii, Cercospora apii f. sp. clerodendri, Cercospora apiicola, Cercospora arachidicola, Cercospora asparagi, Cercospora atrofiliformis, Cercospora beticola, Cercospora brachypus, Cercospora brassicicola, Cercospora brunkii, Cercospora cannabis, Cercospora cantuariensis, Cercospora capsici, Cercospora carotae, Cercospora corylina, Cercospora fragariae, Cercospora fuchsiae, Cercospora fusca, Cercospora fusimaculans, Cercospora gerberae, Cercospora halstedii, Cercospora handelii, Cercospora hayi, Cercospora hydrangea, Cercospora kikuchii, Cercospora lentis, Cercospora liquidambaris, Cercospora longipes, Cercospora longissima, Cercospora mamaonis, Cercospora mangiferae, Cercospora medicaginis, Cercospora melongenae, Cercospora minima, Cercospora minuta, Cercospora nicotianae, Cercospora odontoglossi, Cercospora papaya, Cercospora penniseti, Cercospora pisa-sativae, Cercospora platanicola, Cercospora puderii, Cercospora pulcherrima, Cercospora rhapidicola, Cercospora rosicola, Cercospora rubrotincta, Cercospora sojina, Cercospora solani, Cercospora solani-tuberosi, Cercospora sorghi, Cercospora theae, Cercospora tuberculans, Cercospora vexans, Cercospora vicosae, Cercospora zeae-maydis, Cercospora zebrina, Cercospora zonata, Cercosporella rubi, Cereal cyst nematode, Ceriporia spissa, Ceriporia xylostromatoides, Cerrena unicolor, Ceuthospora lauri, Choanephora, Choanephora cucurbitarum, Choanephora infundibulifera, Chondrostereum purpureum, Chrysomyxa ledi var. rhododendri, Chrysomyxa ledicola, Chrysomyxa piperiana, Chrysomyxa roanensis, Cladosporium, Cladosporium arthropodii, Cladosporium caryigenum, Cladosporium cladosporioides, Cladosporium cladosporioides f. sp.pisicola, Cladosporium cucumerinum, Cladosporium herbarum, Cladosporium musae, Cladosporium oncobae, Clavibacter michiganensis, Claviceps fusiformis, Claviceps purpurea, Claviceps sorghi, Claviceps zizaniae, Climacodon pulcherrimus, Climacodon septentrionalis, Clitocybe parasitica, Clonostachys rosea f. rosea, Clypeoporthe iliau, Cochliobolus, Cochliobolus carbonum, Cochliobolus cymbopogonis, Cochliobolus hawaiiensis, Cochliobolus heterostrophus, Cochliobolus lunatus, Cochliobolus miyabeanus, Cochliobolus ravenelii, Cochliobolus sativus, Cochliobolus setariae, Cochliobolus spicifer, Cochliobolus stenospilus, Cochliobolus tuberculatus, Cochliobolus victoriae, Coleosporium helianthi, Coleosporium ipomoeae, Coleosporium madiae, Coleosporium pacificum, Coleosporium tussilaginis, Colletotrichum acutatum, Colletotrichum arachidis, Colletotrichum capsici, Colletotrichum cereale, Colletotrichum crassipes, Colletotrichum dematium, Colletotrichum dematium f. spinaciae, Colletotrichum derridis, Colletotrichum destructivum, Colletotrichum fragariae, Colletotrichum gossypii, Colletotrichum higginsianum, Colletotrichum kahawae, Colletotrichum lindemuthianum, Colletotrichum lini, Colletotrichum mangenotii, Colletotrichum musae, Colletotrichum nigrum, Colletotrichum orbiculare, Colletotrichum pisi, Colletotrichum sublineolum, Colletotrichum trichellum, Colletotrichum trifolii, Colletotrichum truncatum, Coniella castaneicola, Coniella diplodiella, Coniella fragariae, Coniothecium chomatosporum, Coniothyrium celtidis-australis, Coniothyrium henriquesii, Coniothyrium rosarum, Coniothyrium wernsdorffiae, Coprinopsis psychromorbida, Cordana johnstonii, Cordana musae, Coriolopsis floccose, Coriolopsis gallica, Corticium invisum, Corticium penicillatum, Corticium theae, Coryneopsis rubi, Corynespora cassiicola, Coryneum rhododendri, Crinipellis sarmentosa, Cronartium ribicola, Cryphonectriaceae, Cryptocline cyclaminis, Cryptomeliola, Cryptoporus volvatus, Cryptosporella umbrina, Cryptosporiopsis tarraconensis, Cryptosporium minimum, Curvularia caricae-papayae, Curvularia penniseti, Curvularia senegalensis, Curvularia trifolii, Cylindrocarpon candidum, Cylindrocarpon ianthothele var. ianthothele, Cylindrocarpon magnusianum, Cylindrocarpon musae, Cylindrocladiella camelliae, Cylindrocladiella parva, Cylindrocladium clavatum, Cylindrocladium lanceolatum, Cylindrocladium peruvianum, Cylindrocladium pteridis, Cylindrosporium cannabinum, Cylindrosporium juglandis, Cylindrosporium rubi, Cymadothea trifolii, Cytospora, Cytospora palmarum, Cytospora personata, Cytospora platani, Cytospora sacchari, Cytospora sacculus, Cytospora terebinthi, Cytosporina ludibunda, Dactuliophora elongata, Daedaleopsis confragosa, Dasineura urticae, Datronia scutellata, Davidiella carinthiaca, Davidiella dianthi, Davidiella tassiana, Deightoniella papuana, Deightoniella torulosa, Dendrophoma marconii, Dendrophora erumpens, Denticularia mangiferae, Dermea pseudotsugae, Diaporthaceae, Diaporthe, Diaporthe arctii, Diaporthe citri, Diaporthe dulcamarae, Diaporthe eres, Diaporthe helianthi, Diaporthe lagunensis, Diaporthe lokoyae, Diaporthe melonis, Diaporthe orthoceras, Diaporthe perniciosa, Diaporthe phaseolorum, Diaporthe phaseolorum var. caulivora, Diaporthe phaseolorum var. phaseolorum, Diaporthe phaseolorum var. sojae, Diaporthe rudis, Diaporthe tanakae, Diaporthe toxica, Dibotryon morbosum, Dicarpella dryina, Didymella bryoniae, Didymella fabae, Didymella lycopersici, Didymosphaeria arachidicola, Didymosphaeria taiwanensis, Dilophospora alopecuri, Dimeriella sacchari, Diplocarpon earlianum, Diplocarpon mali, Diplocarpon mespili, Diplocarpon rosae, Diplodia laelio-cattleyae, Diplodia manihoti, Diplodia paraphysaria, Diplodia theae-sinensis, Discosia artocreas, Guignardia fulvida, Discostroma corticola, Distocercospora, Distocercospora livistonae, Ditylenchus, Ditylenchus africanus, Ditylenchus angustus, Ditylenchus destructor, Ditylenchus dipsaci, Dolichodorus heterocephalus, Dothideomycetes, Dothiorella aromatic, Dothiorella dominicana, Dothiorella gregaria, Dothiorella ulmi, Drechslera avenacea, Drechslera campanulata, Drechslera dematioidea, Drechslera gigantea, Drechslera glycines, Drechslera musae-sapientium, Drechslera teres f. maculate, Drechslera wirreganensis, Durandiella pseudotsugae, Eballistra lineata, Eballistra oryzae, Eballistraceae, Echinodontium tinctorium, Ectendomeliola, ampelina, australis, batatas, brasiliensis, fawcettii, leucospila, mangiferae, piri, randii, rosarum, sacchari, theae, veneta, Endomeliola, Endothia radicalis, Endothiella gyrosa, Entoleuca mammata, Entorrhizomycetes, Entyloma ageratinae, Entyloma dahlia, Entyloma ellisii, Epicoccum nigrum, Ergot, Erwinia, Erwinia chrysanthemi, Erwinia psidii, Erysiphaceae, Erysiphales, Erysiphe, Erysiphe alphitoides, Erysiphe betae, Erysiphe brunneopunctata, Erysiphe cichoracearum, Erysiphe cruciferarum, Erysiphe flexuosa, Erysiphe graminis f. sp. avenae, Erysiphe graminis f. sp.tritici, Erysiphe heraclei, Erysiphe pisi, Eutypella parasitica, Eutypella scoparia, Exobasidium burtii, Exobasidium reticulatum, Exobasidium vaccina var. japonicum, Exobasidium vaccinii-uliginosi, Exobasidium vexans, Exophiala,Flavescence , Fomes fasciatus, Fomes , Fomes meliae, Fomitopsis cajanderi, Fomitopsis palustris, Fomitopsis rosea, Fomitopsis spraguei, Fomitopsis supina, Forma specialis, Frommeella tormentillae, Fusarium, Fusarium affine, Fusarium arthrosporioides, Fusarium circinatum, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium incarnatum, Fusarium solani, Fusarium merismoides, Fusarium oxysporum f. sp.albedinis, Fusarium oxysporum f. sp.asparagi, Fusarium oxysporum f. sp.batatas, Fusarium oxysporum f. sp.betae, Fusarium oxysporum f. sp.cannabis, Fusarium oxysporum f. sp.citri, Fusarium oxysporum f. sp. coffea, Fusarium oxysporum f. sp.cubense, Fusarium oxysporum f. sp.cyclaminis, Fusarium oxysporum f. sp.dianthi, Fusarium oxysporum f. sp.lentis, Fusarium oxysporum f. sp.lini, Fusarium oxysporum f. sp.lycopersici, Fusarium oxysporum f. sp.medicaginis, Fusarium oxysporum f. sp.pisi, Fusarium oxysporum f. sp.radicis-lycopersici, Fusarium pallidoroseum, Fusarium proliferatum, Fusarium redolens, Fusarium sacchari, Fusarium solani f. sp.pisi, Fusarium sporotrichioides, Fusarium subglutinans, Fusarium sulphureum, Fuscoporia torulosa, Fusicladium pisicola, Fusicoccum aesculi, Fusicoccum amygdali, Gaeumannomyces graminis var tritici, Gaeumannomyces graminis var. avenae, Gaeumannomyces graminis var. graminis, Galactomyces candidum, Ganoderma brownii, Ganoderma lobatum, Ganoderma orbiforme, Ganoderma philippii, Ganoderma tornatum, Ganoderma zonatum, Geastrumia polystigmatis, Georgefischeriaceae, Georgefischeriales, Geosmithia morbida, Geotrichum, Geotrichum candidum, Geotrichum candidum var. citri-aurantii, Geotrichum klebahnii, Gibberella, Gibberella acuminata, Gibberella avenacea, Gibberella baccata, Gibberella cyanogena, Gibberella fujikuroi, Gibberella fujikuroi var. subglutinans, Gibberella intricans, Gibberella pulicaris, Gibberella stilboides, Gibberella xylarioides, Gibberella zeae, Gibellina cerealis, Gilbertella persicaria, Gjaerumiaceae, Gliocladium vermoeseni, Globodera pallida, Globodera rostochiensis, Globodera tabacum, Gloeocercospora sorghi, Gloeocystidiellum porosum, Gloeophyllum mexicanum, Gloeophyllum trabeum, Gloeoporus dichrous, Gloeosporium cattleyae, Gloeosporium theae-sinensis, Glomerella cingulate, Glomerella glycines, Glomerella graminicola, Glomerella tucumanensis, Gnomonia caryae, Gnomonia comari, Gnomonia dispora, Gnomonia iliau, Gnomonia leptostyla, Gnomonia nerviseda, Gnomonia rubi, Golovinomyces cichoracearum var. latisporus, Granulobasidium vellereum, Graphiola phoenicis, Graphium rigidum, Graphium rubrum, Graphyllium pentamerum, Grovesinia pyramidalis, Guignardia bidwellii f. muscadinii, Guignardia camelliae, Guignardia citricarpa, Guignardia mangiferae, Guignardia musae, Guignardia philoprina, Gummosis, Gymnoconia nitens, Gymnopus dryophilus, Gymnosporangium clavipes, Gymnosporangium sabinae, Gymnosporangium globosum, Gymnosporangium juniperi-virginianae, Gymnosporangium kernianum, Gymnosporangium nelsonii, Gymnosporangium yamadae, Haematonectria haematococca, Hansenula subpelliculosa, Hapalosphaeria deformans, Haplobasidion musae, Haustorium, Helicobasidium compactum, Helicobasidium longisporum, Helicobasidium purpureum, Helicoma muelleri, Helicotylenchus, Helicotylenchus dihystera, Helicotylenchus multicinctus, Helminthosporium cookei, Helminthosporium papulosum, Helminthosporium solani, Helotiales, Hemicriconemoides kanayaensis, Hemicriconemoides mangiferae, Hemicycliophora arenaria, Hemlock woolly adelgid, Hendersonia creberrima, Hendersonia theicola, Hericium coralloides, Heterobasidion annosum, Heterodera, Heterodera amygdali, Heterodera arenaria, Heterodera aucklandica, Heterodera avenae, Heterodera bergeniae, Heterodera bifenestra, Heterodera cacti, Heterodera cajani, Heterodera canadensis, Heterodera cardiolata, Heterodera carotae, Heterodera ciceri, Heterodera cruciferae, Heterodera delvii, Heterodera elachista, Heterodera filipjevi, Heterodera gambiensis, Heterodera goettingiana, Heterodera hordecalis, Heterodera humuli, Heterodera latipons, Heterodera medicaginis, Heterodera oryzae, Heterodera oryzicola, Heterodera rosii, Heterodera sacchari, Heterodera schachtii, Heterodera tabacum, Heterodera trifolii, Heteroderidae, Hexagonia hydnoides, Hirschmanniella oryzae, Hoplalaimus galeatus, Hoplolaimidae, Hoplolaimus columbus, Hoplolaimus indicus, Hoplolaimus magnistylus, Hoplolaimus pararobustus, Hoplolaimus seinhorsti, Hoplolaimus uniformis, Huanglongbing, Hyaloperonospora, Hyaloperonospora arabidopsidis, Hyaloperonospora brassicae, Hyaloperonospora parasitica, Hymenula afftnis, Hyphodermella corrugata, Hyphodontia aspera, Hyphodontia sambuci, Hypochnus, Hypoxylon tinctor, Idriella lunata, Inonotus arizonicus, Inonotus cuticularis, Inonotus dryophilus, Inonotus hispidus, Inonotus ludovicianus, Inonotus munzii, Inonotus tamaricis, Irenopsis, Irpex destruens, Irpex lacteus, Isariopsis clavispora, Johncouchia mangiferae, Kabatiella caulivora, Kabatiella lini, Karnal bunt, Khuskia oryzae, Kretzschmaria deusta, Kretzschmaria zonata, Kuehneola uredinis, Kutilakesa pironii, Labrella coryli, Laeticorticium roseum, Laetiporus baudonii, Lagenocystis radicicola, Laricifomes officinalis, Lasiodiplodia theobromae, Leandria momordicae, Leifsonia xyli xyli, Lentinus tigrinus, Lenzites betulina, Lenzites elegans, Lepteutypa cupressi, Leptodontidium elatius var. elatius, Leptographium microsporum, Leptosphaeria acuta, Leptosphaeria cannabina, Leptosphaeria coniothyrium, Leptosphaeria libanotis, Leptosphaeria lindquistii, Leptosphaeria maculans, Leptosphaeria musarum, Leptosphaeria pratensis, Leptosphaeria sacchari, Leptosphaeria woroninii, Leptosphaerulina crassiasca, Leptosphaerulina trifolii, Leptothyrium nervisedum, Leptotrochila medicaginis, Leucocytospora leucostoma, Leucostoma auerswaldii, Leucostoma kunzei, Leucostoma persoonii, Leveillula compositarum f. helianthi, Leveillula leguminosarum f. lentis, Leveillula taurica, Ligniera pilorum, Limacinula tenuis, Linochora graminis, Longidorus africanus, Longidorus maximus, Longidorus sylphus, Lopharia crassa, Lophodermium, Lophodermium aucupariae, Lophodermium schweinitzii, Lophodermium seditiosum, Macrophoma mangiferae, Macrophoma theicola, Macrophomina phaseolina, Macrosporium cocos, Magnaporthe, Magnaporthe grisea, Magnaporthe salvinii, Mamianiella coryli, Marasmiellus cocophilus, Marasmiellus inoderma, Marasmiellus scandens, Marasmiellus stenophyllus, Marasmius crinisequi, Marasmius sacchari, Marasmius semiustus, Marasmius stenophyllus, Marasmius tenuissimus, Massarina walkeri, Mauginiella scaettae, Melampsora, Melampsora lini var. lini, Melampsora medusae, Melampsora occidentalis, Melanconis carthusiana, Melanconium juglandinum, Meliola, Meliola mangiferae, Meliolaceae, Meloidogyne acronea, Meloidogyne arenaria, Meloidogyne artiellia, Meloidogyne brevicauda, Meloidogyne chitwoodi, Meloidogyne enterolobii, Meloidogyne fruglia, Meloidogyne gajuscus, Meloidogyne incognita, Meloidogyne javanica, Meloidogyne naasi, Meloidogyne partityla, Meloidogyne thamesi, Meripilus giganteus, Merlinius brevidens, Meruliopsis ambigua, Mesocriconema xenoplax, Microascus brevicaulis, Microbotryum violaceum, Microdochium bolleyi, Microdochium dimerum, Microdochium panattonianum, Microdochium phragmitis, Microsphaera, Microsphaera coryli, Microsphaera diffusa, Microsphaera ellisii, Microsphaera euphorbiae, Microsphaera hommae, Microsphaera penicillata, Microsphaera penicillata var. vaccinii, Microsphaera vaccinii, Microsphaera verruculosa, Microstroma juglandis, Moesziomyces bullatus, Monilinia azaleae, Monilinia fructicola, Monilinia fructigena, Monilinia laxa, Monilinia mali, Moniliophthora perniciosa, Moniliophthora roreri, Monilochaetes infuscans, Monochaetia coryli, Monochaetia mali, Monographella albescens, Monographella cucumerina, Monographella nivalis var. neglecta, Monographella nivalis var. nivalis, Mononegavirales, Monosporascus cannonballus, Monosporascus eutypoides, Monostichella coryli, Mucor circinelloides, Mucor hiemalis, Mucor hiemalis f. silvaticus, Mucor mucedo, Mucor paronychius, Mucor piriformis, Mucor racemosus, Mycena citricolor, Mycena maculate, Mycocentrospora acerina, Mycoleptodiscus terrestris, Mycosphaerella angulata, Mycosphaerella arachidis, Mycosphaerella areola, Mycosphaerella berkeleyi, Mycosphaerella bolleana, Mycosphaerella brassicicola, Mycosphaerella caricae, Mycosphaerella caryigena, Mycosphaerella cerasella, Mycosphaerella citri, Mycosphaerella coffeicola, Mycosphaerella confusa, Mycosphaerella cruenta, Mycosphaerella dendroides, Mycosphaerella eumusae, Mycosphaerella fragariae, Mycosphaerella gossypina, Mycosphaerella graminicola, Mycosphaerella henningsii, Mycosphaerella horii, Mycosphaerella juglandis, Mycosphaerella lageniformis, Mycosphaerella linicola, Mycosphaerella louisianae, Mycosphaerella musae, Mycosphaerella musicola, Mycosphaerella palmicola, Mycosphaerella pinodes, Mycosphaerella pistaciarum, Mycosphaerella pistacina, Mycosphaerella platanifolia, Mycosphaerella polymorpha, Mycosphaerella pomi, Mycosphaerella punctiformis, Mycosphaerella pyri, Didymella rabiei, Mycosphaerella recutita, Mycosphaerella rosicola, Mycosphaerella rubi, Mycosphaerella stigmina-platani, Mycosphaerella striatiformans, Mycovellosiella concors, Mycovellosiella fulva, Mycovellosiella koepkei, Mycovellosiella vaginae, Myriogenospora aciculispora, Myrothecium roridum, Myrothecium verrucaria, Nacobbus aberrans, Nacobbus dorsalis, Naevala perexigua, Naohidemyces vaccinii, Nectria, Nectria cinnabarina, Nectria coccinea, Nectria ditissima, ectria foliicola, Nectria mammoidea var. rubi, Nectria mauritiicola, Nectria peziza, Nectria pseudotrichia, Nectria radicicola, Nectria ramulariae, Nectriella pironii, Nemania diffusa, Nemania serpens var. serpens, Nematospora coryli, Neocosmospora vasinfecta, Neodeightonia phoenicum, Neoerysiphe, Neofabraea malicorticis, Neofabraea perennans, Neofusicoccum mangiferae, Neonectria galligena, Oidiopsis gossypii, Oidium (род), Oidium arachidis, Oidium caricae-papayae, Oidium indicum, Oidium mangiferae, Oidium manihotis, Oidium tingitaninum, Olpidium brassicae, Omphalia tralucida, Oncobasidium theobromae, Onnia tomentosa, Ophiobolus anguillides, Ophiobolus cannabinus, Ophioirenina, Ophiostoma ulmi, Ophiostoma wageneri, Ovulariopsis papayae, Ovulinia azaleae, Ovulitis azaleae, Oxyporus corticola, Oxyporus latemarginatus, Oxyporus populinus, Oxyporus similis, Ozonium texanum var. parasiticum, Paecilomyces fulvus, Paralongidorus maximus, Paratrichodorus christiei, Paratrichodorus minor, Paratylenchus curvitatus, Paratylenchus elachistus, Paratylenchus hamatus, Paratylenchus macrophallus, Paratylenchus microdorus, Paratylenchus projectus, Paratylenchus tenuicaudatus, Pathovar, Pauahia, Peach latent mosaic viroid, Pectobacterium carotovorum, Peltaster fructicola, Penicillium aurantiogriseum, Penicillium digitatum, Penicillium expansum, Penicillium funiculosum, Penicillium glabrum, Penicillium italicum, Penicillium purpurogenum, Penicillium ulaiense, Peniophora, Peniophora albobadia, Peniophora cinerea, Peniophora quercina, Peniophora sacrata, Perenniporia fraxinea, Perenniporia fraxinophila, Perenniporia medulla-panis, Perenniporia subacida, Periconia circinata, Periconiella cocoes, Peridermium californicum, Peronosclerospora miscanthi, Peronosclerospora sacchari, Peronosclerospora sorghi, Peronospora, Peronospora anemones, Peronospora antirrhini, Peronospora arborescens, Peronospora conglomerata, Peronospora destructor, Peronospora dianthi, Peronospora dianthicola, Peronospora farinosa, Peronospora farinosa f. sp. betae, Peronospora hyoscyami f. sp. tabacina, Peronospora manshurica, Peronospora potentillae, Peronospora sparsa, Peronospora trifoliorum, Peronospora valerianellae, Peronospora viciae, Pestalosphaeriaconcentrica, Pestalotia longiseta, Pestalotia longisetula, Pestalotia rhododendri, Pestalotiopsis, Pestalotiopsis adusta, Pestalotiopsis arachidis, Pestalotiopsis disseminata, Pestalotiopsis guepini, Pestalotiopsis leprogena, Pestalotiopsis longiseta, Pestalotiopsis mangiferae, Pestalotiopsis palmarum, Pestalotiopsis sydowiana, Pestalotiopsis theae, Pestalotiopsis versicolor, Phacidiopycnis padwickii, Phacidium infestans, Phaeochoropsis mucosa, Phaeocytostroma iliau, Phaeocytostroma sacchari, Phaeoisariopsis bataticola, Phaeolus schweinitzii, Phaeoramularia angolensis, Phaeoramularia dissiliens, Phaeoramularia heterospora, Phaeoramularia manihotis, Phaeoseptoria musae, Phaeosphaerella mangiferae, Phaeosphaerella theae, Phaeosphaeria avenaria f. sp.avenaria, Phaeosphaeria avenaria f. sp.triticae, Phaeosphaeria herpotrichoides, Phaeosphaeria microscopica, Phaeosphaeria nodorum, Phaeosphaeriopsis obtusispora, Phaeotrichoconis crotalariae, Phakopsora gossypii, Phakopsora pachyrhizi, Phanerochaete allantospora, Phanerochaete arizonica, Phanerochaete avellanea, Phanerochaete burtii, Phanerochaete carnosa, Phanerochaete chrysorhizon, Phanerochaete radicata, Phanerochaete salmonicolor, Phanerochaete tuberculata, Phanerochaete velutina, Phellinus ferreus, Phellinus gilvus, Phellinus igniarius, Phellinus pini, Phellinus pomaceus, Phellinus weirii, Phialophora asteris, Phialophora cinerescens, Phialophora gregata, Phialophora tracheiphila, Phloeospora multimaculans, Pholiota variicystis, Phoma, Phoma caricae-papayae, Phoma clematidina, Phoma costaricensis, Phoma cucurbitacearum, Phoma destructiva, Phoma draconis, Phoma eupyrena, Phoma exigua, Phoma exigua var. exigua, Phoma exigua var. foveata, Phoma exigua var. linicola, Phoma glomerata, Phoma glycinicola, Phoma herbarum, Phoma insidiosa, Phoma medicaginis, Phoma microspora, Phoma nebulosa, Phoma oncidii-sphacelati, Phoma pinodella, Phoma scabra, Phoma sclerotioides, Phoma strasseri, Phoma tracheiphila, Phomopsis arnoldiae, Phomopsis asparagi, Phomopsis asparagicola, Phomopsis azadirachtae, Phomopsis cannabina, Phomopsis caricae-papayae, Phomopsis coffeae, Phomopsis elaeagni, Phomopsis ganjae, Phomopsis javanica, Phomopsis lokoyae, Phomopsis mangiferae, Phomopsis obscurans, Phomopsis perseae, Phomopsis prunorum, Phomopsis scabra, Phomopsis sclerotioides, Phomopsis tanakae, Phomopsis theae, Photoassimilate, Phragmidium, Phragmidium mucronatum, Phragmidium rosae-pimpinellifoliae, Phragmidium rubi-idaei, Phragmidium violaceum, Phyllachora cannabis, Phyllachora graminis var. graminis, Phyllachora gratissima, Phyllachora musicola, Phyllachora pomigena, Phyllachora sacchari, Phyllactinia, Phyllactinia angulata, Phyllactinia guttata, Phyllody, Phyllosticta, Phyllosticta alliariaefoliae, Phyllosticta anacardiacearum, Phyllosticta arachidis-hypogaeae, Phyllosticta batatas, Phyllosticta capitalensis, Phyllosticta caricae-papayae, Phyllosticta carpogena, Phyllosticta circumscissa, Phyllosticta coffeicola, Phyllosticta concentrica, Phyllosticta coryli, Phyllosticta cucurbitacearum, Phyllosticta cyclaminella, Phyllosticta erratica, Phyllosticta hawaiiensis, Phyllosticta lentisci, Phyllosticta manihotis, Phyllosticta micropuncta, Phyllosticta mortonii, Phyllosticta nicotianae, Phyllosticta palmetto, Phyllosticta penicillariae, Phyllosticta perseae, Phyllosticta platani, Phyllosticta pseudocapsici, Phyllosticta sojaecola, Phyllosticta solitaria, Phyllosticta theae, Phyllosticta theicola, Phymatotrichopsis omnivora, Physalospora abdita, Physalospora disrupta, Physalospora perseae, Physarum cinereum, Physoderma alfalfae, Physoderma leproides, Physoderma trifolii, Physopella ampelopsidis, Phytophthora, Phytophthora alni, Phytophthora boehmeriae, Phytophthora cactorum, Phytophthora cajani, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, Phytophthora erythroseptica, Phytophthora fragariae, Phytophthora fragariae var. rubi, Phytophthora gallica, Phytophthora hibernalis, Phytophthora infestans, Phytophthora inflata, Phytophthora iranica, Phytophthora katsurae, Phytophthora kernoviae, Phytophthora lateralis, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora megasperma, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora plurivora, Phytophthora ramorum, Phytophthora sojae, Phytophthora syringae, Phytophthora tentaculata, Phytoplasma, Pichia membranifaciens, Pichia subpelliculosa, Pileolaria terebinthi, Pilidiella quercicola, Plasmodiophora brassicae, Plasmopara, Plasmopara halstedii, Plasmopara helianthi f. helianthi, Plasmopara lactucae-radicis, Plasmopara nivea, Plasmopara obducens, Plasmopara penniseti, Plasmopara pygmaea, Plasmopara viticola, Platychora ulmi, Plenodomus destruens, Plenodomus meliloti, Pleochaeta, Pleosphaerulina sojicola, Pleospora alfalfae, Pleospora betae, Pleospora herbarum, Pleospora lycopersici, Pleospora tarda, Pleospora theae, Pleurotus dryinus, Podosphaera, Podosphaera clandestina var. clandestine, Podosphaera fusca, Podosphaera leucotricha, Podosphaera macularis, Podosphaera pannosa, Podosphaera tridactyla, Podosphaera tridactyla var. tridactyla, Podosphaera xanthii, Polymyxa graminis, Polyscytalum pustulans, Polystigma fulvum, Poria hypobrunnea, Postia tephroleuca, Potato cyst nematode, Pratylenchus alleni, Pratylenchus brachyurus, Pratylenchus coffeae, Pratylenchus crenatus, Pratylenchus dulscus, Pratylenchus fallax, Pratylenchus flakkensis, Pratylenchus goodeyi, Pratylenchus hexincisus, Pratylenchus loosi, Pratylenchus minutus, Pratylenchus mulchandi, Pratylenchus musicola, Pratylenchus neglectus, Pratylenchus penetrans, Pratylenchus pratensis, Pratylenchus reniformia, Pratylenchus scribneri, Pratylenchus thornei, Pratylenchus vulnus, Pratylenchus zeae, Pseudocercospora, Pseudocercospora arecacearum, Pseudocercospora cannabina, Pseudocercospora fuligena, Pseudocercospora gunnerae, Pseudocercospora kaki, Pseudocercospora mali, Pseudocercospora pandoreae, Pseudocercospora puderi, Pseudocercospora purpurea, Pseudocercospora rhapisicola, Pseudocercospora subsessilis, Pseudocercospora theae, Pseudocercospora vitis, Pseudocercosporella capsellae, Pseudocochliobolus eragrostidis, Pseudoepicoccum cocos, Pseudomonas amygdali, Pseudomonas asplenii, Pseudomonas avellanae, Pseudomonas caricapapayae, Pseudomonas cichorii, Pseudomonas coronafaciens, Pseudomonas corrugate, Pseudomonas ficuserectae, Pseudomonas flavescens, Pseudomonas fuscovaginae, Pseudomonas helianthi, Pseudomonas marginalis, Pseudomonas meliae, Pseudomonas oryzihabitans, Pseudomonas palleroniana, Pseudomonas papaveris, Pseudomonas salomonii, Pseudomonas savastanoi, Pseudomonas syringae, Pseudomonas tomato, Pseudomonas tremae, Pseudomonas turbinellae, Pseudomonas viridiflava, Pseudoperonospora cannabina, Pseudoperonospora cubensis, Pseudoperonospora humuli, Pseudopezicula tetraspora, Pseudopezicula tracheiphila, Pseudopeziza jonesii, Pseudopeziza medicaginis, Pseudopeziza trifolii, Pseudoseptoria donacis, Puccinia, Puccinia angustata, Puccinia arachidis, Puccinia aristidae, Puccinia asparagi, Puccinia cacabata, Puccinia campanulae, Puccinia carthami, Puccinia coronate, Puccinia coronata var. hordei, Puccinia dioicae, Puccinia erianthi, Puccinia extensicola var. hieraciata, Puccinia helianthi, Puccinia hordei, Puccinia jaceae var. solstitialis, Puccinia kuehnii, Puccinia mariae-wilsoniae, Puccinia melanocephala, Puccinia menthae, Puccinia pelargonii-zonalis, Puccinia pittieriana, Puccinia poarum, Puccinia psidii, Puccinia purpurea, Puccinia recondita, Puccinia schedonnardii, Puccinia sessilis, Puccinia striiformis f. sp.hordei, Puccinia striiformis var. striiformis, Puccinia subnitens, Puccinia substriata var. indica, Puccinia verruca, Puccinia xanthii, Pucciniaceae, Pucciniastrum, Pucciniastrum americanum, Pucciniastrum arcticum, Pucciniastrum coryli, Pucciniastrum epilobii, Pucciniastrum hydrangeae, Punctodera chalcoensis, Pycnoporus cinnabarinus, Pycnoporus sanguineus, Pycnostysanus azaleae, Pyrenochaeta lycopersici, Pyrenochaeta terrestris, Pyrenopeziza brassicae, Pyrenophora, Pyrenophora avenae, Pyrenophora chaetomioides, Pyrenophora graminea, Pyrenophora seminiperda, Pyrenophora teres, Pyrenophora teres f. maculata, Pyrenophora teres f. teres, Pyrenophora tritici-repentis, Pythiaceae, Pythiales, Pythium, Pythium acanthicum, Pythium aphanidermatum, Pythium aristosporum, Pythium arrhenomanes, Pythium buismaniae, Pythium debaryanum, Pythium deliense, Pythium dissotocum, Pythium graminicola, Pythium heterothallicum, Pythium hypogynum, Pythium irregulare, Pythium iwayamae, Pythium mastophorum, Pythium middletonii, Pythium myriotylum, Pythium okanoganense, Pythium paddicum, Pythium paroecandrum, Pythium perniciosum, Pythium rostratum, Pythium scleroteichum, Pythium spinosum, Pythium splendens, Pythium sulcatum, Pythium sylvaticum, Pythium tardicrescens, Pythium tracheiphilum, Pythium ultimum, Pythium ultimum var. ultimum, Pythium vexans, Pythium violae, Pythium volutum, Quinisulcius acutus, Quinisulcius capitatus, Radopholous similis, Radopholus similis, Ralstonia solanacearum, Ramichloridium musae, Ramularia, Ramularia beticola, Ramularia brunnea, Ramularia coryli, Ramularia cyclaminicola, Ramularia macrospora, Ramularia menthicola, Ramularia necator, Ramularia primulae, Ramularia spinaciae, Ramularia subtilis, Ramularia tenella, Ramulispora sorghi, Ramulispora sorghicola, Resinicium bicolor, Rhabdocline pseudotsugae, Rhabdocline weirii Rhabdoviridae, Rhinocladium corticola, Rhizoctonia, Rhizoctonia leguminicola, Rhizoctonia rubi, Rhizoctonia solani, Rhizomorpha subcorticalis, Rhizophydium graminis, Rhizopus arrhizus, Rhizopus circinans, Rhizopus microsporus var. microspores, Rhizopus oryzae, Rhodococcus fascians, Rhynchosporium, Rhynchosporium secalis, Rhytidhysteron rufulum, Rhytisma acerinum, Rhytisma vitis, Rigidoporus lineatus, Rigidoporus microporus, Rigidoporus ulmarius, Rigidoporus vinctus, Rosellinia arcuata, Rosellinia bunodes, Rosellinia necatrix, Rosellinia pepo, Rosellinia subiculata, Rotylenchulus, Rotylenchulus parvus, Rotylenchulus reniformis, Rotylenchus brachyurus, Rotylenchus robustus, Saccharicola taiwanensis, Saccharomyces florentinus, Saccharomyces kluyveri, Sarocladium oryzae, Sawadaea, Sawadaea tulasnei, Schiffnerula cannabis, Schizoparme straminea, Schizophyllum commune, Schizopora flavipora, Schizothyrium pomi, Scleroderris canker, Sclerophthora macrospora, Sclerophthora rayssiae, Sclerospora graminicola, Sclerospora mischanthi, Sclerotinia borealis, Sclerotinia minor, Sclerotinia ricini, Sclerotinia sclerotiorum, Sclerotinia spermophila, Sclerotinia trifoliorum, Sclerotium, Sclerotium cinnamomi, Sclerotium delphinii, Scutellonema brachyurum, Scutellonema cavenessi, Scytinostroma galactinum, Seimatosporium mariae, Seimatosporium rhododendri, Selenophoma linicola, Septobasidium, Septobasidium bogoriense, Septobasidium pilosum, Septobasidium pseudopedicellatum, Septobasidium theae, Septocyta ruborum, Septogloeum potentillae, Septoria, Septoria aciculosa, Septoria ampelina, Septoria azalea, Septoria bataticola, Septoria campanulae, Septoria cannabis, Septoria caryae, Septoria citri, Septoria cucurbitacearum, Septoria darrowii, Septoria dianthi, Septoria eumusae, Septoria fragariae, Septoria fragariaecola, Septoria glycines, Septoria helianthi, Septoria humuli, Septoria hydrangeae, Septoria lactucae, Septoria liquidambaris, Septoria lycopersici, Septoria lycopersici var. malagutii, Septoria menthae, Septoria ostryae, Septoria passerinii, Septoria pisi, Septoria pistaciae, Septoria platanifolia, Septoria rhododendri, Septoria secalis, Septoria selenophomoides, Setosphaeria rostrata, Setosphaeria turcica, Sirosporium diffusum, Sparassis, Sphaceloma, Sphaceloma arachidis, Sphaceloma coryli, Sphaceloma menthae, Sphaceloma perseae, Sphaceloma poinsettiae, Sphaceloma pyrinum, Sphaceloma randii, Sphaceloma sacchari, Sphaceloma theae, Sphacelotheca reiliana, Sphaerella platanifolia, Sphaeropsis tumefaciens, Sphaerotheca, Sphaerotheca castagnei, Sphaerotheca fuliginea, Sphaerulina oryzina, Sphaerulina rehmiana, Sphaerulina rubi, Sphenospora kevorkianii, Spiniger meineckellus, Spiroplasma, Spongipellis unicolor, Sporisorium cruentum, Sporisorium ehrenbergi, Sporisorium scitamineum, Sporisorium sorghi, Sporonema phacidioides, Stagonospora avenae f. sp.triticae, Stagonospora meliloti, Stagonospora recedens, Stagonospora sacchari, Stagonospora tainanensis, Steccherinum ochraceum, Stegocintractia junci, Stegophora ulmea, Stemphylium alfalfa, Stemphylium bolickii, Stemphylium cannabinum, Stemphylium globuliferum, Stemphylium lycopersici, Stemphylium sarciniforme, Stemphylium solani, Stemphylium vesicarium, Stenella anthuriicola, Stereum, Stereum hirsutum, Stereum rameale, Stereum sanguinolentum, Stigmatomycosis, Stigmella platani-racemosae, Stigmina carpophila, Stigmina liquidambaris, Stigmina palmivora, Stigmina platani, Stigmina platani-racemosae, Subanguina radicicola, Subanguina wevelli, Sydowia polyspora, Sydowiella depressula, Sydowiellaceae, Synchytrium endobioticum, Synchytrium fragariae, Synchytrium liquidambaris, Taiwanofungus camphoratus, Tapesia acuformis, Tapesia yallundae, Taphrina aurea, Taphrina bullata, Taphrina caerulescens, Taphrina coryli, Taphrina deformans, Taphrina entomospora, Taphrina johansonii, Taphrina potentillae, Taphrina ulmi, Taphrina wiesneri, Thanatephorus cucumeris, Thielaviopsis, Thielaviopsis basicola, Thyrostroma compactum, Tilletia barclayana, Tilletia caries, Tilletia controversa, Tilletia laevis, Tilletia tritici, Tilletia walkeri, Tilletiariaceae, Tobacco necrosis virus, Togniniaceae, Trachysphaera fructigena, Trametes gibbosa, Trametes hirsute, Trametes nivosa, Trametes pubescens, Tranzschelia discolor f. sp.persica, Tranzschelia pruni-spinosae var. discolor, Trichaptum biforme, Trichoderma harzianum, Trichoderma koningii, Trichoderma viride, Trichothecium roseum, Tripospermum acerinum, Truncatella, Truncatella laurocerasi, Tubercularia lateritia, Tubercularia ulmea, Tubeufia pezizula, Tunstallia aculeata, Tylenchorhynchus, Tylenchorhynchus brevilineatus, Tylenchorhynchus claytoni, Tylenchorhynchus dubius, Tylenchorhynchus maximus, Tylenchorhynchus nudus, Tylenchorhynchus phaseoli, Tylenchorhynchus vulgaris, Tylenchorhynchus zeae, Tylenchulus semipenetrans, Typhula idahoensis, Typhula incarnate, Typhula ishikariensis, Typhula ishikariensis var. canadensis, Typhula variabilis, Typhulochaeta, Tyromyces calkinsii, Tyromyces chioneus, Tyromyces galactinus, Ulocladium atrum, Ulocladium consortiale, Uncinula, Uncinula macrospora, Uncinula necator, Uredo behnickiana, Uredo kriegeriana, Uredo musae, Uredo nigropuncta, Uredo rangelii, Urocystis, Urocystis agropyri, Urocystis brassicae, Urocystis occulta, Uromyces, Uromyces apiosporus, Uromyces beticola, Uromyces ciceris-arietini, Uromyces dianthi, Uromyces euphorbiae, Uromyces graminis, Uromyces inconspicuus, Uromyces lineolatus subsp.nearcticus, Uromyces medicaginis, Uromyces musae, Uromyces oblongus, Uromyces pisi-sativi, Uromyces proeminens var. poinsettiae, Uromyces trifolii-repentis var. fallens, Uromyces viciae-fabae var. viciae-fabae, Urophlyctis leproides, Urophlyctis trifolii, Urophora cardui, Ustilaginales, Ustilaginoidea virens, Ustilaginomycetes, Ustilago, Ustilago avenae, Ustilago hordei, Ustilago maydis, Ustilago nigra, Ustilago nuda, Ustilago scitaminea, Ustilago tritici, Valsa abietis, Valsa ambiens, Valsa auerswaldii, Valsa ceratosperma, Valsa kunzei, Valsa nivea, Valsa sordida, Valsaria insitiva, Venturia carpophila, Venturia inaequalis, Venturia pirina, Venturia pyrina, Veronaea musae, Verticillium, Verticillium albo-atrum, Verticillium albo-atrum var. menthae, Verticillium dahliae, Verticillium longisporum, Verticillium theobromae, Villosiclava virens, Virescence, Waitea circinata, Wuestneiopsis Georgiana, Xanthomonas ampelina, Xanthomonas axonopodis, Xanthomonas campestris, Xanthomonas campestris pv. campestris, Xanthomonas oryzae, Xeromphalina fraxinophila, Xiphinema americanum, Xiphinema bakeri, Xiphinema brevicolle, Xiphinema diversicaudatum, Xiphinema insigne, Xiphinema rivesi, Xiphinema vuittenezi, Xylaria mali, Xylaria polymorpha, Xylella fastidiosa, Xylophilus, Xylophilus ampelinus, Zopfia rhizophila, Zygosaccharomyces bailii и Zygosaccharomyces florentinus.

[00118] Патогенные насекомые и черви включают Acalymma, Acyrthosiphon pisum, Spodoptera exempta, африканизированную пчелу, Agromyzidae, Agrotis munda, Agrotis porphyricollis, Aleurocanthus woglumi, Aleyrodes proletella, Alphitobius diaperinus, Altica chalybea, Anasa tristis, Anguina tritici, Anisoplia austriaca, Anthonomus pomorum, Anthonomus signatus, Aonidiella aurantii, Apamea apamiformis, Apamea niveivenosa, Aphelenchoides spp., тлю, Aphis gossypii, яблонную пестрокрылку, аргентинского муравья, Euxoa auxiliaris, Arotrophora arcuatalis, Asterolecanium coffeae, Athous haemorrhoidalis, Aulacophora, Chortoicetes terminifera Bactericera cockerelli, Bactrocera, Bactrocera correcta, Bagrada hilaris, Knulliana cincta, карадрину, Belonolaimus spp., свекловичную тлю, Blepharidopterus chlorionis, Agrotis infusa, хлопкового долгоносика, Bradysia similigibbosa, стручкового капустного комарика, Brevicoryne brassicae, коричневую саранчу, клопа мраморного щитника, бурую рисовую цикадку, Bursephelenchus spp., капустную совку, купустную гусеницу, Callosobruchus maculatus, Dermolepida albohirtum, морковную муху, овсяную нематоду, Cecidomyiidae, Ceratitis capitata, Ceratitis rosa, пьявицу красногрудую, Chlorops pumilionis, Anoplophora chinensis, Coccus viridis, яблонную плодожорку, кофейного жука, коллорадского жука, хрущака малого мучного, Crambus, полосатого огуречного жука, Curculio писит, Curculio occidentis, личинок моли, Cyclocephala borealis, совку-ипсилон, пальмового короеда, Delia spp., Delia antiqua, Delia floralis, Delia radicum, пустынную саранчу, Diabrotica, Diabrotica balteata, Diabrotica speciosa, капустную моль, Diaphania indica, Diaphania nitidalis, Diaphorina citri, Diaprepes abbreviatus, Diatraea saccharalis, Melanoplus differentialis, Ditylenchus spp., Dociostaurus maroccanus, Drosophila suzukii, Dryocosmus kuriphilus, Earias perhuegeli, Epicauta vittata, Epilachna varivestis, Erionota thrax, Eriosomatinae, Euleia heraclei, Eumetopina flavipes, Eupoecilia ambiguella, огневку кукурузную, Eurydema oleracea, Eurygaster integriceps, щитника красноногого, Frankliniella tritici, Galleria mellonella, Euxoa nigricans, Homalodisca vitripennis, тепличную белокрылку, Gryllotalpa orientalis, Gryllus pennsylvanicus, непарного шелкопряда, Helicoverpa armigera, Helicoverpa gelotopoeon, Helicoverpa punctigera, Helicoverpa zea, Heliothis virescens, Henosepilachna vigintioctopunctata, гессенскую муху, Heterodera spp., Jacobiasca formosana, хруща японского, кожееда зернового, Lampides boeticus, листового минера, Lepidiota consobrina, Lepidosaphes beckii, Lepidosaphes ulmi, Leptoglossus zonatus, Leptopterna dolabrata, малую восковую моль, Leucoptera (моль), Leucoptera caffeina, бурую плодовую моль, Lissorhoptrus oryzophilus, длиннохвостого шкипера, Lygus, Lygus hesperus, Maconellicoccus hirsutus, Macrodactylus subspinosus, Macrosiphum euphorbiae, долгоносика амбарного кукурузного, Manduca sexta, Mayetiola hordei, Mealybug, Meloidogyne spp., Megacopta cribraria, Metcalfa pruinosa, молей, луковую моль, Myzus persicae, Naccobus spp., Nezara viridula, походного шелкопряда дубового, маслинную муху, Ophiomyia simplex, Opisina arenosella, Opomyza, Opomyza florum, Opomyzidae, Oscinella frit, Ostrinia furnacalis, Oxycarenus hyalinipennis, Paracoccus marginatus, Papilio demodocus, Paratachardina pseudolobata, Pentatomoidea, Phthorimaea operculella, Phyllophaga, Phylloxera, Phylloxeridae, Phylloxeroidea, Pieris brassicae, хлопковую моль, Planococcus citri, Platynota idaeusalis, Plum curculio, Pratylenchus spp., Prionus californicus, Pseudococcus viburni, Pyralis farinalis, красного огненного муравья, красную саранчу, корневых нематод Pratylenchus, корневых галлообразующих фитонематод, Radopholus spp., Rotylenchulus spp., Rhagoletis cerasi, Rhagoletis indifferens, Rhagoletis mendax, Rhopalosiphum maidis, Rhyacionia frustrana, Rhynchophorus ferrugineus, Rhynchophorus palmarum, Rhyzopertha, рисовую моль, рисового клопа щитника, ячменную тлю, калифорнийскую щитовку, щитовок, Schistocerca americana, Sciaridae, Scirtothrips dorsalis, Scutelleridae, Scutiphora pedicellata, пшеничную нематоду, змеевидного листового минера, табачную белокрылку, Sipha flava, малого ульевого жука, огневку кукурузную юго-западную, соевую тлю, Spodoptera cilium, Spodoptera litura, пятнистого огуречного жука, Melittia cucurbitae, стеблевых нематод, Stenotus binotatus, Strauzia longipennis, блошку полосатую, клопа вредную черепашку, Physomerus grossipes, клопа-слепняка, трипсы, Thrips angusticeps, Thrips palmi, Toxoptera citricida, Trichodorus spp., Trioza erytreae, совку озимую, Tuta absoluta, Tylenchulus spp., кожееда домового, Virachola isocrates, личинок восковых молей, западного кукурузного жука, западного цветочного трипса, пшеничного комарика, долгоносика амбарного обыкновенного, белокрылок, зимнюю пяденицу и Xiphenema spp.

[00119] Например, патогенное насекомое или червь может представлять собой совку, совку-ипсилон, кукурузного мотылька, совку травяную, гусеницу озимой совки, хрущика японского, огневку Elasmopalpus lignosellus, долгоносика кукурузного, личинку мухи ростковой, лугового мотылька, огневку кукурузную стеблевую, жука-блошку одиннадцатиточечную, южного картофельного проволочника, совку Papaipema nebris, жука-носорога сахарного тростника, личинку хруща, совку ни, хлопкового долгоносика, совку Spodoptera ornithogalli, пьявицу красногрудую, клопа-черепашку пшеничную североамериканскую, тлю, совку малую, коровку Epilachna varivestis, совку Chrysodeixis includens, Dectes texanus или их комбинацию.

Белки и пептиды, которые повышают устойчивость к стрессу в растениях

[00120] Данное изобретение также относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория и по меньшей мере один белок или пептид, усиливающий устойчивость к стрессу в растении.

[00121] Например, белок или пептид, который повышает устойчивость к стрессу в растении, включает фермент, вызывающий деградацию соединений, связанных со стрессом. Соединения, связанные со стрессом, включают, но не ограничиваются этим, аминоциклопропан-1-карбоновую кислоту (АЦК), активные формы кислорода, оксид азота, оксилипины, и фенольные соединения. Конкретные активные формы кислорода включают гидроксил, перекись водорода, кислород и супероксид. Фермент, вызывающий деградацию соединений, связанных со стрессом, может включать супероксиддисмутазы, оксидазу, каталазу, в деаминазу аминоциклопропан-1-карбоновой кислоты, пероксидазу, антиоксидантное фермент, или антиоксидантный пептид.

[00122] Белок или пептид, который повышает устойчивость к стрессу в растении, может также содержать белок или пептид, защищающий растение от воздействия окружающей среды. Экологический стресс может включать, например, засуху, наводнение, высокие температуры, заморозки, засаливание, тяжелые металлы, низкое значение рН, высокое значение рН или их комбинацию. Например, белок или пептид, защищающий растение от воздействия окружающей среды, могут содержит белок, индуцирующий формирование микрокристаллов льда, пролиназу, фенилаланин-аммиак-лиазу, изохоризмат-синтазу, изохоризмат-пируват-лиазу или холиндегидрогеназу.

Белки и пептиды, связывающиеся с растением

[00123] Изобретение также относится к гибридным белкам, содержащим сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория и по меньшей один белок или пептид, связывающийся с растением. Белок или пептид, связывающийся с растением, может представлять собой любой белок или пептид, способный специфически или неспецифически связываться с любой частью растения (например, с корнем или с надземной частью растения, такой как лист, стебель, цветок или плод) или с растительным материалом. Так, например, белок или пептид, связывающийся с растением, может представлять собой белок или пептид, связывающийся с корнем, или белок, или пептид, связывающийся с листом.

[00124] Подходящие белки или пептиды, связывающиеся с растением, включают адгезины, флагеллины (например, рикфлагелин), омптины, лектины, экспансины, структурные белки биопленки (например, TasA или YuaB), белки пилуса, белки Curlus, интимины, инвазины, агглютинины и нефимбриальные белки.

Другие гибридные белки

[00125] Данное изобретение дополнительно относится к гибридным белкам, содержащим по меньшей мере один целевой белок или пептид, и белок экзоспория, содержащий белок экзоспория, содержащий аминокислотную последовательность, имеющую, по меньшей мере 85% идентичности с любой из SEQ ID №№: 71, 75, 80, 81, 82, 83, и 84. В альтернативном варианте белок экзоспория может включать аминокислотную последовательность, имеющую по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 98%, по меньшей мере 99% или по меньшей мере 100% идентичности с любой из SEQ ID №№: 71, 75, 80, 81, 82, 83, и 84.

[00126] Целевой белок или пептид, может включать любой белок или пептид. Например, целевой белок или пептид может включать любой из белков или пептидов, описанных в данном документе. Например, целевой белок или пептид может включать любой из описанных в данном документе белков или пептидов, стимулирующих рост растения, любой из описанных в данном документе белков или пептидов, которые защищают растение от патогена, любой из описанных в данном документе белков или пептидов, которые повышает устойчивость к стрессу в растении, или любой из описанных в данном документе белков или пептидов, связывающихся с растением.

[00127] Таким образом, когда целевой белок или пептид включает белок или пептид, стимулирующий рост растения, белок или пептид, стимулирующий рост растения, может включать пептидный гормон, негормональный пептид или фермент, участвующий в образовании или активации соединения, стимулирующего рост растения. В альтернативном варианте белок или пептид, стимулирующий рост растения, может включать любой из ферментов, разрушающих или модифицирующих бактериальный, грибковый или растительный источник питательных веществ, которые описаны ниже.

Рекомбинантные представители семейства Bacillus cereus, которые экспрессируют гибридные белки

[00128] Данное изобретение также относится к рекомбинантному представителю семейства Bacillus cereus, который экспрессирует гибридный белок. Гибридный белок может представлять собой любой из гибридных белков, описанных выше.

[00129] Рекомбинантный представитель семейства Bacillus cereus может дополнительно экспрессировать два или более любых из гибридных белков, описанных выше. Например, рекомбинантный представитель семейства Bacillus cereus может дополнительно экспрессировать по меньшей мере один гибридный белок, который содержит белок или пептид, связывающийся с растением, вместе с по меньшей мере одним гибридным белком, содержащим белок или пептид, стимулирующий рост растения, по меньшей мере одним гибридным белком, содержащим белок или пептид, защищающий растение от патогена, или по меньшей мере одним белком или пептидом, повышающим устойчивость к стрессу в растении.

[00130] Рекомбинантный представитель семейства Bacillus cereus может включать Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis или их комбинацию. Например, рекомбинантный представитель семейства Bacillus cereus может включать Bacillus cereus, Bacillus thuringiensis, Bacillus pseudomycoides или Bacillus mycoides. В частности, рекомбинантный представитель семейства Bacillus cereus может включать Bacillus thuringiensis или Bacillus mycoides.

[00131] С целью создать рекомбинантного представителя семейства Bacillus cereus, экспрессирующего гибридный белок, любой представитель семейства Bacillus cereus может быть конъюгирован, трансдуцирован или трансформирован вектором, кодирующим гибридный белок, с использованием стандартных способов, известных в данной области техники (например, путем электропорации). После этого бактерии могут быть подвергнуты скринингу для идентификации трансформантов любым способом, известным в данной области техники. Например, если вектор включает ген устойчивости к антибиотику, бактерии могут быть подвергнуты скринингу на устойчивость к антибиотикам. В альтернативном варианте ДНК, кодирующая гибридный белок, может быть интегрирована в хромосомную ДНК хозяина представителя семейства В. cereus. Рекомбинантный представитель семейства Bacillus cereus может быть подвержен условиям, которые вызывают споруляцию. Подходящие условия для индуцирования споруляции известны в данной области техники. Например, рекомбинантный представитель семейства Bacillus cereus может быть высеян на чашки с агаром и инкубирован при температуре около 30°С в течение нескольких дней (например, 3 суток).

[00132] Также соответствующим образом могут быть использованы инактивированные штаммы, нетоксичные штаммы, или генетически модифицированные штаммы любого из вышеперечисленных видов. Например, может быть использован Bacillus thuringiensis, в котором отсутствует токсин Cry. В альтернативном варианте или в дополнение, после получения спор рекомбинантного представителя В. cereus, экспрессирующих гибридный белок, они могут быть инактивированы, чтобы предотвратить дальнейшее прорастание во время использования. Может быть использован любой способ инактивации бактериальных спор, который известен в данной области техники. Подходящие способы включают, без ограничения, термообработку, гамма-облучение, рентгеновское облучение, УФ-А облучение, УФ-Б облучение, химическая обработка (например, обработка глютаровым альдегидом, формальдегидом, перекисью водорода, уксусной кислотой, отбеливателем или их комбинацией) или их комбинацией. В альтернативном варианте могут быть использованы споры, полученные из штаммов нетоксигенных штаммов или генетически или физически инактивированных штаммов.

Рекомбинантные представители семейства Bacillus cereus, обладающие эффектом стимуляции роста растений и/или другими полезными свойствами.

[00133] Многие штаммы представителей семейства Bacillus cereus обладают полезные свойствами. Например, некоторые штаммы обладают эффектом стимуляции роста растений. В таких штаммах может быть экспрессирован любой из гибридных белков, описанных в данном документе.

[00134] Например, рекомбинантный представитель семейства Bacillus cereus может включать штамм бактерий, стимулирующий рост растения.

[00135] Штамм бактерий, стимулирующий рост растения, может включать штамм бактерий, который продуцирует инсектицидный токсин (например, токсин Cry), продуцирует фунгицидное соединение (например, β-1,3-глуканазу, хитозиназу, лутиказу, или их комбинацию), продуцирует нематоцидное соединение (например, токсин Cry), продуцирует бактерицидное соединение, является устойчивым к одному или более антибиотикам, содержит одну или более самостоятельно реплицирующихся плазмид, прикрепляется к корням растений, колонизирует корни растений, формирует биопленки, растворяет питательные вещества, секретирует органические кислоты, или их комбинацию.

[00136] Например, если рекомбинантный представитель семейства Bacillus cereus включает штамм бактерий, стимулирующий рост растения, такой штамм бактерий, стимулирующий рост растения, может включать Bacillus mycoides ВТ 155 (NRRL №В-50921), Bacillus mycoides ЕЕ118 (NRRL № B-50918), Bacillus mycoides EE141 (NRRL № B-50916), Bacillus mycoides BT46-3 (NRRL № B-50922), представителя семейства Bacillus cereus EE 128 (NRRL № B-50917), Bacillus thuringiensis BT013A (NRRL № B-50924) или представителя семейства Bacillus cereus EE349 (NRRL № B-50928). Каждый из этих штаммов был помещен на хранение Службой сельскохозяйственных исследований (ССИ) Министерства сельского хозяйства США (МСХСША) по адресу 1815 North University Street, Peoria, Illinois 61604 U.S.A., 10 марта 2014 года, и идентифицируются по номеру NRRL (Northern Regional Research Laboratory), указанному в скобках.

[00137] Эти штаммы, стимулирующие рост растения, были выделены из ризосфер различных активно растущих растений и были идентифицированы по их последовательности 16S рРНК (указанной в данном документе как SEQ ID №№: 104-110) и с помощью биохимических анализов. Данные штаммы были идентифицированы по меньшей мере до рода с помощью общих биохимических методов и морфологических показателей. Биохимические тесты для подтверждения грам-положительных штаммов, таких как Bacillus, включали выращивание на среде PEA и питательном агаре, микроскопические исследования, выращивание на среде, содержащей 5% и 7,5% NaCl, выращивание при рН 5 и рН 9, выращивание при 42°С и 50°С, способность продуцировать кислоту при ферментации с целлобиозой, лактозой, глицерином, глюкозой, сахарозой, d-маннитом и крахмалом; продуцирование флуоресцентных пигментов; гидролиз желатина; восстановление нитратов; продуцирование каталазы, гидролиз крахмала; оксидативная реакция, продуцирование уреазы и подвижность. Идентификация этих штаммов и демонстрация их стимулирующих эффектов на рост растений описаны далее в примерах, приведенных ниже.

[00138] Например, рекомбинантный представитель семейства Bacillus cereus, включающий штамм бактерий, стимулирующий рост растения, может включать Bacillus mycoides ВТ155, Bacillus mycoides EE141 или Bacillus thuringiensis BT013A. Рекомбинантный представитель семейства Bacillus cereus может экспрессировать любой из гибридных белков, описанных в данном документе, например, гибридный белок, содержащий сигнальную последовательность из SEQ ID №: 60 и негормональный пептидный (например, ингибитор трипсина Кунитца (ИКТ)), фермент участвующий в образовании или активации соединения, индуцирующего рост растений (например, хитозиназа), белок или пептид, связывающийся с растением (например, TasA); белок или пептид, защищающий растение от патогенов (например, TasA), или фермент, который разрушает или изменяет бактериальные, грибковые или растительные источники питательных веществ (например, фосфатазы, такие как PhoA или фитазы, или эндоглюканазы).

Промоторы

[00139] В любом из рекомбинантных представителей семейства Bacillus cereus, описанных в данном документе, гибридный белок может экспрессироваться под контролем промотора, который является родным для сигнальной последовательности белка экзоспория или фрагмента белка экзоспория гибридного белка. Например, если гибридный белок содержит сигнальную последовательность, полученную из В. anthracis Sterne BclA (например, аминокислот 20-35 из SEQ ID №: 1, аминокислот 1-35 из SEQ ID №: 1, SEQ ID №: 1 или SEQ ID №: 60) или если гибридный белок содержит полноразмерный BclA (SEQ ID №: 2) или фрагмент полноразмерного BclA (например, SEQ ID №: 59), гибридный белок может экспрессироваться под контролем промотора, который, как правило, связан с геном BclA в геноме В. anthracis Sterne (например, промотор SEQ ID №: 85).

[00140] В альтернативном варианте гибридный белок может экспрессироваться под контролем сильного промотора споруляции. В некоторых случаях промотор, который является нативным для сигнальной последовательности, белок экзоспория или фрагмент белка экзоспория будет представлять собой сильный промотор споруляции. В других случаях промотор, который является нативным для сигнальной последовательности, белок экзоспория или фрагмент белка экзоспория не будет представлять собой сильный промотор споруляции. В последнем случае может быть предпочтительным заменить нативный промотор на сильный промотор споруляции. Экспрессия гибридного белка под контролем сильного промотора споруляции обеспечивает повышенную экспрессию гибридного белка на экзоспорий представителя семейства Bacillus cereus.

[00141] Сильный промотор споруляции может включать одну или более промоторную последовательность сигма-К, специфическую для полимеразы споруляции.

[00142] Подходящие сильные промоторы споруляции для применения в экспрессировании гибридных белков в представителе семейства Bacillus cereus, включают следующие, перечисленные в таблице 2 ниже:

[00143] В промоторных последовательностях, перечисленных в Таблице 2 выше, положения промоторных последовательностей сигма-К, специфических для полимеразы споруляции, обозначаются жирным шрифтом и подчеркнутым текстом. Промотор CrylA (В. thuringiensis HD-73; SEQ ID №: 90) имеет в общей сложности четыре последовательности сигма-К, две из которых перекрываются друг другом, как показано двойным подчеркиванием в таблице 2.

[00144] Предпочтительные сильные промоторы споруляции для использования в экспрессии гибридных белков в представителях семейства Bacillus cereus включают промотор BetA (В. anthracis Sterne; SEQ ID №: 86), промотор BclA (В. anthracis Sterne; SEQ ID №: 85), промоторы оперонов 1 и 2 кластера BclA гликозилтрансферазы (В. anthracis Sterne; SEQ ID №№: 101 и 102), и промотор β-пропеллерного белка YVTN (В. weihenstephensis КВАВ 4; SEQ ID №: 89).

[00145] В любом из рекомбинантных представителей семейства Bacillus cereus, описанных в данном документе, гибридный белок может экспрессироваться под контролем промотора споруляции, содержащего последовательность нуклеиновой кислоты, имеющую по меньшей мере 80%, по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 98%, по меньшей мере 99% или 100% идентичности с последовательностью нуклеиновой кислоты любой из SEQ ID №: 85-103.

[00146] Если промотор споруляции содержит последовательность нуклеиновой кислоты, имеющую по меньшей мере 80%, по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 98% или по меньшей мере 99% идентичности с последовательностью нуклеиновой кислоты любой из SEQ ID №№№: 85-103, промоторная последовательность или последовательности сигма-К, специфические для полимеразы споруляции, предпочтительно имеют 100% идентичности с соответствующими нуклеотидами из SEQ ID №: 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102 или 103. Например, как показано в Таблице 2 выше, промотор BclA В. anthracis Sterne (SEQ ID №: 85) содержит промоторные последовательности сигма-К, специфические для полимеразы споруляции, на нуклеотидах 24-32, 35-43 и 129-137. Таким образом, если промотор споруляции включает последовательность, имеющую по меньшей мере 90% идентичности с последовательностью нуклеиновой кислоты SEQ ID №: 85, предпочтительно, чтобы нуклеотиды промотора споруляции, соответствующие нуклеотидам 24-32, 35-43 и 129-137 из SEQ ID №: 85 имели 100% идентичности с нуклеотидами 24-32, 35-43 и 129-137 в SEQ ID №: 85.

Препараты

[00147] Данное изобретение также относится к препаратам, содержащим любой из рекомбинантных представителей семейства Bacillus cereus, описанных в предыдущем разделе, и сельскохозяйственно приемлемый носитель.

[00148] Сельскохозяйственно приемлемый носитель может представлять собой любой носитель, приемлемый для использования в сельском хозяйстве. Например, подходящие сельскохозяйственно приемлемые носители включают, но не ограничиваются этим, диспергирующие вещества, сурфактанты, примеси, воду, загустители, противослеживающиеся агенты, противоосадочные вещества, компостирующие препараты, гранулированные подкормки, диатомиты, масла, красители, стабилизаторы, консерванты, полимеры, пленки или их комбинации.

[00149] Добавка может представлять собой масло, камедь, смолу, глину, полиоксиэтиленгликоль, терпен, вязкую органику, сложный эфир жирной кислоты, сульфатированный спирт, алкилсульфонат, нефтяной сульфонат, сульфат спирта, алкил бутан diamate натрия, полиэфир тиобутандиоата натрия, производное бензол-ацетонитрила, белковый материал (молочный продукт, пшеничную муку, соевую муку, кровь, альбумин, желатин или их комбинацию) или их комбинацию.

[00150] Загуститель может включать длинную цепь алкилсульфоната полиэтиленгликоля, полиоксиэтиленолеат или их комбинацию.

[00151] Сурфактант может включать тяжелое нефтяное масло, тяжелый нефтяной дистиллят, сложный эфир полиола жирной кислоты, полиэтоксилированный эфир жирной кислоты, арилалкил полиоксиэтиленгликоля, алкиламин ацетат, алкиларилсульфонат, многоатомный спирт, алкилфосфат или их комбинацию.

[00152] Противодействующее слипанию вещество включает соль натрия, карбонат кальция, диатомит или их комбинацию. Например, соль натрия может включать монометил-нафталинсульфонат натриевую соль, диметил- нафталинсульфонат натриевую соль, сульфит натрия, сульфат натрия или их комбинацию.

[00153] Подходящие сельскохозяйственно приемлемые носители включают вермикулит, древесный уголь, отходы сатурационного пресса сахарного завода, рисовую шелуху, карбоксиметилцеллюлозу, торф, перлит, мелкий песок, карбонат кальция, муку, квасцы, крахмал, тальк, поливинилпирролидон или их комбинацию.

[00154] Препарат может включать препарат для покрытия семян, жидкий препарат, применяемый для растений или для растительных ростовых сред, или твердый препарат, применяемый для растений или для растительных ростовых сред.

[00155] Например, композиция для покрытия семян может включать раствор на водной или масляной основе, применяемый для семян, или порошок или гранулированный препарат, применяемый для семян. В альтернативном варианте композиция для покрытия семян может включать порошок или гранулированный препарат, применяемый для семян.

[00156] Жидкий препарат, применяемый для растений или для растительных ростовых сред, может включать концентрированный препарат или препарат, готовый для использования.

[00157] Твердый препарат, применяемый для растений или для растительных ростовых сред, может включать гранулированный препарат или порошковое вещество.

[00158] Любой из указанных выше препаратов также может включать агрохимикат, например, удобрение, материал микроэлементов удобрения, инсектицид, гербицид, фунгицид, моллюскоцид, альгицид, вещество, улучшающее рост растений, бактериальный инокулянт, грибковый инокулянт или их комбинацию.

[00159] Удобрение может включать жидкое удобрение.

[00160] Удобрение может включать сульфат аммония, нитрат аммония, сульфат-нитрат аммония, хлорид аммония, бисульфат аммония, полисульфид аммония, тиосульфат аммония, водный раствор аммиака, безводный аммиак, полифосфат аммония, сульфат алюминия, нитрат кальция, известково-аммиачную селитру, сульфат кальция, обожженный магнезит, кальцитовый известняк, оксид кальция, нитрат кальция, доломитовый известняк, гашеную известь, карбонат кальция, диаммонийфосфат, моноаммонийфосфат, нитрат магния, сульфат магния, нитрат калия, хлорид калия, сульфат калия-магния, сульфат калия, нитраты натрия, магнезиальный известняк, оксид магния, мочевину, карбамидоформальдегидные смолы, мочевино-аммониевый нитрат, покрытую серой мочевину, мочевину с полимерным покрытием, изобутилиден димочевину, K2SO4-2MgSO4, каинит, сильвинит, кизерит, эпсомскую соль, элементарную серу, мергель, измельченные устричные раковины, рыбную муку, жмыхи, рыбный тук, кровяную муку, фосфорит, суперфосфат, шлак, костную муку, древесную золу, навоз, гуано летучих мышей, торф, компост, зеленый песок, муку из семян хлопчатника, муку из перьев, муку из крабов, рыбную эмульсию, гуминовую кислоту или их комбинацию.

[00161] Материал микроэлементного удобрения может включать борную кислоту, борат, борную фритту, сульфат меди, медную фритту, хелат меди, декагидрат тетрабората натрия, сульфат железа, оксид железа, сульфат железа-аммония, железную фритту, хелат железа, сульфат марганца, оксид марганца, хелат марганца, хлорид марганца, марганцевую фритту, молибдат натрия, молибденовую кислоту, сульфат цинка, оксид цинка, карбонат цинка, цинковую фритту, фосфат цинка, хелат цинка или их комбинацию.

[00162] Инсектицид может включать органофосфат, карбамат, пиретроид, акарицид, алкил-фталат, борную кислоту, борат, фторид, серу, мочевину, замещенную ароматическим галоидом, углеводород сложного эфира, инсектицид на биологической основе или их комбинацию.

[00163] Гербицид может включать соединение хлорфенокси, нитрофенольное соединение, соединение нитрокрезола, соединение дипиридила, ацетамид, алифатическую кислоту, анилид, бензамид, бензойную кислоту, производное бензойной кислоты, анисовую кислоту, производное анисовой кислоты, бензонитрил, бензотиадиазинона диоксид, тиокарбамат, карбамат, карбанилат, хлорпиридинил, производное циклогексенона, производное динитроаминобензола, соединение фтор-динитро-толуидин, изоксазолидинон, никотиновую кислоту, изопропиламин, производные изопропиламина, оксадиазолинон, фосфат, фталат, соединение пиколиновой кислоты, триазин, триазол, урацил, производное мочевины, эндотал, хлорат натрия или их комбинацию.

[00164] Фунгицид может включать замещенный бензол, тиокарбамат, этилен-бис-дитиокарбамат, тиофталид амид, соединение меди, ртутьорганическое соединение, оловоорганическое соединение, соединение кадмия, анилазин, беномил, циклогексамид, додин, этридиазол, ипродион, металаксил, тиамимефон, трифорин или их комбинацию.

[00165] Грибковый инокулянт может включать грибковый инокулянт из семейства Glomeraceae, грибковый инокулянт из семейства Claroidoglomeraceae, грибковый инокулянт из семейства Gigasporaceae, грибковый инокулянт из семейства Acaulosporaceae, грибковый инокулянт из семейства Sacculosporaceae, грибковый инокулянт из семейства Entrophosporaceae, грибковый инокулянт из семейства Pacidsporaceae, грибковый инокулянт из семейства Diversisporaceae, грибковый инокулянт из семейства Paraglomeraceae, грибковый инокулянт из семейства Archaeosporaceae, грибковый инокулянт из семейства Geosiphonaceae, грибковый инокулянт из семейства Ambisporaceae, грибковый инокулянт из семейства Scutellosporaceae, грибковый инокулянт из семейства Dentiscultataceae, грибковый инокулянт из семейства Racocetraceae, грибковый инокулянт из типа Basidiomycota, грибковый инокулянт из типа Ascomycota, грибковый инокулянт из типа Zygomycota или их комбинацию.

[00166] Бактериальный инокулянт может включать бактериальный инокулянт из рода Rhizobium, бактериальный инокулянт из рода Bradyrhizobium, бактериальный инокулянт из рода Mesorhizobium, бактериальный инокулянт из рода Azorhizobium, бактериальный инокулянт из рода Allorhizobium, бактериальный инокулянт из рода Sinorhizobium, бактериальный инокулянт из рода Kluyvera, бактериальный инокулянт из рода Azotobacter, бактериальный инокулянт из рода Pseudomonas, бактериальный инокулянт из рода Azospirillium, бактериальный инокулянт из рода Bacillus, бактериальный инокулянт из рода Streptomyces, бактериальный инокулянт из рода PaeniBacillus, бактериальный инокулянт из рода Paracoccus, бактериальный инокулянт из рода Enterobacter, бактериальный инокулянт из рода Alcaligenes, бактериальный инокулянт из рода Mycobacterium, бактериальный инокулянт из рода Trichoderma, бактериальный инокулянт из рода Gliocladium, бактериальный инокулянт из рода Glomus, бактериальный инокулянт из рода Klebsiella или их комбинацию.

[00167] Бактериальный инокулянт может включать штамм бактерий, стимулирующий рост растения. Штамм бактерий, стимулирующий рост растений, может включать штамм бактерий, который продуцирует инсектицидный токсин (например, токсин Cry), продуцирует фунгицидное соединение (например, β-1,3-глюканаза, хитозиназа, литиказа или их комбинация), продуцирует нематоцидное соединение (например, токсин Cry), продуцирует бактерицидное соединение, является устойчивым к одному или более антибиотикам, содержит одну или более самостоятельно реплицирующихся плазмид, прикрепляется к корням растений, колонизирует корни растений, формирует биопленки, растворяет питательные вещества, секретирует органические кислоты, или их комбинации.

[00168] Например, бактериальный инокулянт может включать Bacillus aryabhattai САР53 (NRRL № В-50819), Bacillus aryabhattai CAP56 (NRRL № B-50817), Bacillus flexus BT054 (NRRL № B-50816), Paracoccus kondratievae NC35 (NRRL № B-50820), Bacillus mycoides BT155 (NRRL № B-50921), Enterobacter клоаки CAP12 (NRRL № B-50822), Bacillus nealsonii BOBA57 (NRRL № NRRL B-50821), Bacillus mycoides EE118 (NRRL № B-50918), Bacillus subtilis EE148 (NRRL № B-50927), Alcaligenes faecalis EE107 (NRRL № B-50920), Bacillus mycoides EE141 (NRRL № B-50916), Bacillus mycoides BT46-3 (NRRL № B-50922), представителя семейства Bacillus cereus EE128 (NRRL № B-50917), Bacillus Thuringiensis BT013A (NRRL № B-50924), PaeniBacillus massiliensis BT23 (NRRL № B-50923), представителя семейства Bacillus cereus EE349 (NRRL № B-50928), Bacillus subtilis EE218 (NRRL № B-50926), Bacillus megaterium EE281 (NRRL № B-50925), или их комбинации. Каждый из этих штаммов был помещен на хранение Центром сельскохозяйственных исследований (ЦСИ) Министерства сельского хозяйства США (МСХСША) по адресу: 1815 North University Street, Peoria, Illinois 61604 U.S.A., 11 марта 2013 года (Bacillus aryabhattai CAP53, Bacillus aryabhattai CAP56, Bacillus flexus BT054, Paracoccus kondratievae NC35, Enterobacter cloacae CAP12, и Bacillus nealsonii BOBA57) или 10 марта 2014 года (Bacillus mycoides BT155, Bacillus mycoides EE118, Bacillus subtilis EE148, Alcaligenes faecalis EE107, Bacillus mycoides EE141, Bacillus mycoides BT46-3, представитель семейства Bacillus cereus ЕЕ128, Bacillus thuringiensis ВТ013А, PaeniBacillus massiliensis BT23, представитель семейства Bacillus cereus EE349, Bacillus subtilis EE218, и Bacillus megaterium EE281), и идентифицируется по номерам NRRL, указанным в скобках.

[00169] Эти штаммы, стимулирующие рост растения, были выделены из ризосфер различных активно растущих растений и были идентифицированы по их последовательности 16S рРНК (указанной в данном документе как SEQ ID №№: 104-121) и с помощью биохимических анализов. Данные штаммы были идентифицированы по меньшей мере до рода с помощью общих биохимических методов и морфологических показателей. Биохимические тесты для подтверждения грам-отрицательных штаммов, таких как Paracoccus kondratievae, Alcaligenes faecalis и Enterobacter cloacae, включали выращивание на среде MacConkey и питательном агаре, микроскопические исследования, выращивание на среде, содержащей 5% и 7,5% NaCl, выращивание при рН 5 и рН 9, выращивание при 42°С и 50°С, способность продуцировать кислоту при ферментации с целлобиозой, лактозой, глицерином, глюкозой, сахарозой, d-маннитом и крахмалом; продуцирование флуоресцентных пигментов; гидролиз желатина; восстановление нитратов; продуцирование каталазы, гидролиз крахмала; оксидативная реакция, продуцирование уреазы и подвижность. Аналогичным образом биохимические тесты для подтверждения грам-положительных штаммов, таких как Bacillus и Paenibacillus, включали выращивание на среде PEA и питательном агаре, микроскопические исследования, выращивание на среде, содержащей 5% и 7,5% NaCl, выращивание при рН 5 и рН 9, выращивание при 42°С и 50°С, способность продуцировать кислоту при ферментации с целлобиозой, лактозой, глицерином, глюкозой, сахарозой, d-маннитом и крахмалом; продуцирование флуоресцентных пигментов; гидролиз желатина; восстановление нитратов; продуцирование каталазы, гидролиз крахмала; оксидативная реакция, продуцирование уреазы и подвижность. Идентификация этих штаммов и демонстрация их стимулирующих эффектов на рост растений описаны далее в примерах, приведенных ниже.

[00170] Например, препарат может включать штамм бактерий, стимулирующий рост растения, включающий Paracoccus kondratievae NC35, Bacillus aryabhattai CAP53 или Bacillus megaterium EE281, причем данный препарат дополнительно содержит любой из рекомбинантных представителей семейства Bacillus cereus, описанных в данном документе, в том числе любой из описанных в данном документе штаммов рекомбинантных представителей семейства Bacillus cereus, стимулирующих рост растений (например, рекомбинантный Bacillus mycoides ВТ155, Bacillus mycoides EE141 или Bacillus thuringiensis BT013A). Штамм рекомбинантного представителя семейства Bacillus cereus, стимулирующий рост растения, может экспрессировать любой из гибридных белков, описанных в данном документе, например, гибридный белок, содержащий сигнальную последовательность SEQ ID №: 60 и негормональный пептид (например, ингибитор трипсина Кунитца (ИТК)), фермент, участвующий в продуцировании или активации соединения, стимулирующего рост растений (например, хитозиназы), белок или пептид, связывающийся с растением (например, TasA); белок или пептид, защищающий растение от патогенов (например, TasA), или фермент, который разрушает или изменяет бактериальные, грибковые или растительные источники питательных веществ (например, фосфатазы, такие как PhoA или фитазы, или эндоглюканазы).

Способы стимуляции роста растений

[00171] Данное изобретение также относится к способам стимуляции роста растений. Способ стимуляции роста растений включает введение в среду для роста растений любого из рекомбинантных представителей семейства Bacillus cereus, которые обсуждались выше, или любого из препаратов, которые обсуждались выше. В альтернативном варианте любой из рекомбинантных представителей семейства Bacillus cereus, которые обсуждались выше, или любой из препаратов, которые обсуждались выше, могут быть применены к растению, семени растения или области, окружающей растение или семя растений. В таких способах белок или пептид, стимулирующий рост растения, физически прикреплен к экзоспорию рекомбинантного представителя семейства Bacillus.

[00172] В альтернативном варианте способ стимуляции роста растений включает введение рекомбинантного представителя семейства Bacillus cereus, экспрессирующего гибридный белок, в среду для роста растений, или применение рекомбинантного представителя семейства Bacillus cereus, экспрессирующего гибридный белок, к растению, семени растения или области, окружающей растение или семя растения. Гибридный белок содержит по меньшей мере один белок или пептид, стимулирующий рост растения, и сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория. Белок или пептид, стимулирующий рост растения, физически прикреплен к экзоспорию рекомбинантного представителя семейства Bacillus. Сигнальная последовательность, белок экзоспория или фрагмент белка экзоспория может представлять собой любую из сигнальных последовательностей, белков экзоспория или фрагментов белка экзоспория, перечисленных ранее в параграфе [0005].

[00173] Сигнальная последовательность может дополнительно состоять из 16 аминокислот и иметь по меньшей мере около 43% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 54%. В альтернативном варианте сигнальная последовательность может состоять из аминокислот 1-35 из SEQ ID №: 1, аминокислот 20-35 из SEQ ID №: 1; SEQ ID №: 1 или SEQ ID №: 60.

[00174] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 50% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 63%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 50% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 63%.

[00175] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 50% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 72%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 50% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 72%.

[00176] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 56% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 63%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 56% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 63%.

[00177] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 62% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 72%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 62% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 из SEQ ID №: 1 составляет по меньшей мере около 72%.

[00178] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 68% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 81%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 68% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 81%.

[00179] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 75% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 72%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 75% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 из SEQ ID №: 1 составляет по меньшей мере около 72%.

[00180] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 75% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 81%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 75% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 из SEQ ID №: 1 составляет по меньшей мере около 81%.

[00181] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 81% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с. аминокислотами 25-35 составляет по меньшей мере около 81%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 81% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 81%.

[00182] Сигнальная последовательность может включать аминокислотную последовательность, имеющую по меньшей мере около 81% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 90%. В альтернативном варианте сигнальная последовательность состоит из аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере около 81% идентичности с аминокислотами 20-35 из SEQ ID №: 1, причем идентичность с аминокислотами 25-35 составляет по меньшей мере около 90%.

[00183] В альтернативном варианте белок экзоспория или фрагмент белка экзоспория может включать аминокислотную последовательность, имеющую по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 98%, по меньшей мере 99% или 100% идентичности с любой из SEQ ID №№: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44,46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 и 84.

[00184] Белок, стимулирующий рост растения, может включать фермент. Например, фермент может включать фермент, который разрушает или изменяет бактериальный, грибковый или растительный источник питательных веществ. Такие ферменты включают целлюлазы, липазы, оксидазы, лигнин протеазы, гликозид гидролазы, фосфатазы, нитрогеназы, нуклеазы, амидазы, нитрат редуктазы, нитрит редуктазы, амилазы, аммиак оксидазы, лигниназы, глюкозидазы, фосфолипазы, фитазы, пектиназы, глюканазы, сульфатазы, уреазы, ксиланазы и сидерофоры. При введении в среду для роста растений или применении на растение, семенах или области, окружающей растение или семя растений, гибридные белки, содержащие ферменты, которые разрушают или изменяют бактериальный, грибковый или растительный источник питательных веществ, могут помочь в обработке питательных веществ в непосредственной близости от растения и привести к повышенному поглощению питательных веществ растением или полезных бактериями или грибками в непосредственной близости от растения.

[00185] Подходящие целлюлазы включают эндоцеллюлазы (например, эндоглюканазу, такую как эндоглюканаза Bacillus subtilis, эндоглюканаза Bacillus thuringiensis, эндоглюканаза Bacillus cereus или эндоглюканаза Bacillus clausii), экзоглюканазы (например, экзоглюканазу Trichoderma reesei), и β-глюкозидазы (например, β-глюкозидазу Bacillus subtilis, β-глюкозидазу Bacillus thuringiensis, β-глюкозидазу Bacillus cereus или β-глюкозидазу Bacillus clausii).

[00186] Липаза может включать липазу Bacillus subtilis, липазу Bacillus thuringiensis, липазу Bacillus cereus или липазу Bacillus clausii.

[00187] Подходящие лигнин оксидазы включают лигнин пероксидазы, лакказы, глиоксал оксидазы, лигниназы и марганец пероксидазы.

[00188] Протеаза может включать субтилизин, кислую протеазу, щелочную протеазу, протеиназу, пептидазу, эндопептидазу, экзопептидазу, термолизин, папаин, пепсин, трипсин, проназу, карбоксилазу, сериновую протеазу, глутаминовую протеазу, аспартатную протеазу, цистеиновую протеазу, треониновую протеазу или металлопротеазу.

[00189] Фосфатаза может включать фосфорную моноэфир-гидролазу, фосфомоноэстеразу, (например, PhoA4), фосфорную диэфир-гидролазу, фосфодиэстеразу, трифосфорную моноэфир-гидролазу, фосфорил ангидрид-гидролазу, пирофосфатазу, фитазу, (например, фитазу Bacillus subtilis ЕЕ148 или фитазу Bacillus thuringiensis ВТ013А), триметафосфатазу или трифосфатазу.

[00190] Нитрогеназа может включать нитрогеназу из Nif семейства (например, NifBDEHKNXV PaeniBacillus massiliensis).

[00191] В любом из описанных выше способов стимуляции роста растений растения, выращиваемые в среде для роста растений, содержащей рекомбинантного представителя семейства Bacillus cereus, проявляют усиленный рост по сравнению с ростом растений в идентичной среде для роста растений, не содержащей рекомбинантного представителя семейства Bacillus cereus.

[00192] В любом из описанных выше способов стимуляции роста растений рекомбинантный представитель семейства Bacillus cereus может включать любой из описанных выше рекомбинантных штаммов бактерий, стимулирующих рост растений.

[00193] В любом из описанных выше способов стимуляции роста растений гибридный белок может экспрессироваться под контролем любого из промоторов, описанных ранее.

Способы зашиты растения от патогена

[00194] Данное изобретение также относится к способам защиты растения от патогена. Такие способы включают введение любого из рекомбинантных представителей семейства Bacillus cereus, описанных выше, или любого из препаратов, описанных выше, в среду для роста растений. В альтернативном варианте такие способы включают применение любого из рекомбинантных представителей семейства Bacillus cereus, описанных выше, или любого из препаратов, описанных выше, к растению, к семени растения или к области, окружающей растение или семя растения. В этих способах белок или пептид, защищающий растение от патогена, физически прикреплен к экзоспорию рекомбинантного представителя семейства Bacillus cereus.

[00195] Растения, выращиваемые в среде для роста растений, содержащей рекомбинантного представителя семейства Bacillus cereus, менее восприимчивы к инфицированию патогеном по сравнению с растениями, выращиваемыми в идентичной среде для роста растений, не содержащей рекомбинантного представителя семейства Bacillus cereus. Снижение чувствительности к патогену может являться результатом стимуляции иммунной системы растения белком или пептидом, защищающим растение от патогена, или может являться результатом прямого или косвенного воздействия белка или пептида, защищающего растение от патогена, на патоген.

Способы повышения устойчивости к стрессу в растении

[00196] Данное изобретение также относится к способам повышения устойчивости к стрессу в растении. Такие способы включают введение любого из рекомбинантных представителей семейства Bacillus cereus, описанных выше, или любого из препаратов, описанных выше в среде для роста растений. В альтернативном варианте такие способы включают применение любого из рекомбинантных представителей семейства Bacillus cereus, описанных выше, или любого из препаратов, описанных выше, к растению, к семени растения или к области, окружающей растение или семя растения. В этих способах белок или пептид, который повышает устойчивость к стрессу в растении, физически прикреплен к экзоспорию рекомбинантного представителя семейства Bacillus cereus.

[00197] Растения, выращиваемые в среде для роста растений, содержащей рекомбинантного представителя семейства Bacillus cereus, менее восприимчивы к стрессу по сравнению с растениями, выращиваемыми в идентичной среде для роста растений, не содержащей рекомбинантного представителя семейства Bacillus cereus.

Способы иммобилизации спор рекомбинантного представителя семейства Bacillus cereus на растении

[00198] Данное изобретение также относится к способам иммобилизации споры рекомбинантного представителя семейства Bacillus cereus на растении. Эти способы включают введение любого из рекомбинантных представителей семейства Bacillus cereus, описанных выше, или любого из препаратов, описанных выше, в среду для роста растений. В альтернативном варианте такие способы включают применение любого из рекомбинантных представителей семейства Bacillus cereus, описанных выше, или любого из препаратов, описанных выше, к растению, к семени растения или к области, окружающей растение или семя растения. Белок или пептид, связывающийся с растением, физически прикреплен к экзоспорию рекомбинантного представителя семейства Bacillus.

[00199] Эти способы позволяют споре представителя семейства Bacillus cereus связываться с растением таким образом, что спора остается на растении. Например, эти способы позволяют споре представителя семейства Bacillus cereus связываться с корнем растения или с надземной частью растения (например, листья, стебли, плоды или цветы) таким образом, что спора остается на корневой структуре растения или на его надземной части и не проникает в среду роста растения или в среду, окружающую надземные части растения.

[00200] В любом из способов иммобилизации спор рекомбинантного представителя семейства Bacillus cereus на растении белок или пептид, связывающийся с растением, может избирательно воздействовать и удерживать представителя семейства Bacillus cereus на растительной структуре или субструктуре (например, на корнях растения или субструктуре корней растения или на воздушной части растения или субструктуре воздушной части растения).

Среда роста растений

[00201] В любом из описанных выше способов среда для роста растений представляет собой материал, который способен поддерживать рост растений. Среда роста растений может включать почву, воду, водную среду, песок, гравий, полисахарид, мульчу, компост, торф, солому, древесину, глину, соевую муку, дрожжевой экстракт или их комбинацию. Например, среда для роста растений включает почву, компост, торф или их комбинацию.

[00202] Среда роста растений необязательно может быть с добавлением субстрата для фермента. Например, субстрат может включать триптофан, аденозинмонофосфат, аденозиндифосфат, аденозинтрифосфат (например, аденозин-3-трифосфат), индол, триметафосфат, ферродоксин, ацетоин, диацетил, пируват, ацетолактат, пектин, целлюлозу, метилцеллюлозу, крахмал, хитин, пектин, белоковую муку, производное целлюлозы, фосфат, ацетоин, хитозан, неактивное производное индол-3-уксусной кислоты, неактивное производное гибберелловой кислоты, ксилан, холин, производное холина, пролин, полипролин, пролин-содержащую муку, пролинсодержащий белок, фенилаланин, хоризмат, арабиноксилан, жир, воск, масло, фитиновую кислоту, лигнин, гуминовую кислоту, холин, производное холина или их комбинацию.

Способы применения

[00203] В любом из описанных выше способов рекомбинантный представитель семейства Bacillus cereus или препарат может быть введен в среду роста растения или применен к растению, семени растения или области, окружающей растение или семя растения.

[00204] Например, способ может включать покрытие семян рекомбинантным представителем семейства Bacillus cereus или препаратом, содержащим рекомбинантного представителя семейства Bacillus cereus, до посадки.

[00205] В альтернативном варианте способ может включать применение рекомбинантного представителя семейства Bacillus cereus или препарата к воздушной части растения, например, к листьям, стеблям, плодам или цветам. Например, рекомбинантный представитель семейства Bacillus cereus или препарат может быть распылен, нанесен щеткой, инфильтрирован или иным способом применен к листьям или другим воздушным частям растения.

[00206] Способ может включать введение рекомбинантного представителя семейства Bacillus cereus в среду для роста растений путем применения жидкого или твердого препарата, содержащего рекомбинантного представителя семейства Bacillus cereus к среде (например, почве, компосту, торфу или их комбинации).

[00207] Препарат может быть применен к среде для роста растений до, одновременно с или после посадки семян, саженцев, черенков, луковиц или растений в среду для роста растений.

Дополнительное применение агрохимикатов

[00208] Любой из описанных выше способов может дополнительно включать введение по меньшей мере одного агрохимиката в среду для роста растений или применения по меньшей мере одного агрохимиката на растения или семена. Агрохимикат может представлять собой любой из перечисленных выше, предназначенных для включения в препараты, или любую их комбинацию.

Растения

[00209] Вышеуказанные способы могут быть осуществлены на различных растениях. Например, растения могут относиться к двудольным, однодольным или голосеменным.

[00210] Например, если растение относится к двудольным, двудольные могут быть выбраны из группы, состоящей из фасоли, гороха, томатов, перца, кабачков, люцерны, миндаля, аниса, яблока, абрикоса, артишока, арракачи, авокадо, земляных бобов, свеклы, бергамота, черного перца, акации черной, ежевики, черники, апельсина горького, бок чой, бразильского ореха, хлебного дерева, брокколи, бобов, брюссельской капусты, гречки, капусты, рыжика, китайской капусты, какао, дыни, тмина, артишока испанского, рожкового дерева, моркови, ореха кешью, маниоки, клещевины обыкновенной, цветной капусты, сельдерея корневого, сельдерей салатного, вишни, каштана, нута, цикория, перца чили, хризантемы, корицы, цитрона, клементина, гвоздики, клевера, кофе, гуру, рапса, кукурузы, хлопка, хлопчатника, коровьего гороха, крамбе, клюквы, кресс-салата, огурца, смородины, кремовой яблони, кассии пучковатой, чины клубненосной, баклажана, цикория-эндивия, укропа, пажитника, риса, фундука, льна, герань, крыжовника, тыквы, винограда, грейпфрута, гуавы, конопли, хны, хмеля, конских бобов, хрена, индиго, жасмина, топинамбура, джута, капусты кормовой, капка, кенафа, кольраби, кумквата, лаванды, лимона, чечевицы, леспедецы, салата-латука, лайма настоящего, солодки, личи, мушмула, люпин, ореха макадамии, булава, мандарин, кормовой, манго, мушмулы японской, дыни, мяты, шелковицы, горчицы, нектарина, масличного нуга, мускатного ореха, бамии, маслины, опиумного мака, апельсина, папайи, пастернака, гороха, персика, арахиса, груши, ореха пекана, хурмы, голубиного гороха, фисташкового ореха, подорожника, сливы, граната, грейпфрута, мака, картофеля, сладкого картофеля, чернослива, тыквы, квебрахо, айвы, деревьев из рода Cinchona, лебеды, редиса, рами, рапса, малины, нанду, ревня, розы, фикуса каучуконосного, брюквы, сафлора, эспарцета, козлобородника, саподиллы, мандарина уншиу, козлеца испанского, кунжута, масляного дерева, сои, шпината, кабачка, клубники, сахарной свеклы, сахарного тростника, подсолнечника, сладкого перца, танжерина, чая, теффа, табака, помидора, трилистника, тунга, репы, растения рода Urena, вики, грецкого ореха, арбуза, мате, сурепки, пастушей сумки, кресс-салата, ярутки, иллициума настоящего, лавра, лавра благородного, кассии, джамболана, укропа, тамаринда, мяты перечной, орегана, розмарина, шалфея, сметанного яблока, щитолистника, калофилла, момордики харантской, лумбанга, инокарпуса съедобного, базилика, черники облиствленной, гибискуса, пассифлоры, златолиста каймито, сассафрасы, кактуса, зверобоя, вербейника, боярышника, кориандра, карри, киви, тимьяна, цукини, уллюки, джикамы, гидрофиллума, стрихноса колючего, момбина желтого, карамболя, амаранта, васаби, японского перца, желтой сливы, настурции клубненосной, Toona sinensis, новозеландского шпината, тетрагонии, угу, пижмы, песчанка, момбина пурпурного, малайского яблока, акмеллы осота огородного, китайского картофеля, смирнии европейской, гулявника лекарственного, смолевки, агата, дерева кассия, чертополоха, кровохлебки, антильскогой крыжовника, солянки, солероса, щавля, птеридиса мечевидного, капусты листовой, примулы, первоцвет, портулака, спорыша, терпентинного дерева, пизонии белой, дикого бетеля, западноафриканского переца, эриодиктиона клейкого, эстрагона, петрушки, кервеля, сурепки весенней, бедренца камнеломкового, липпии сладкой, белокопытника, сисо, водяного перца, периллы, паркии красивой, оки, кампонга, китайской селеры, лимонного базилика, тайского базилика, водяной мимозы, кокорыша, кордилины южной, моринги, мирабилиса, страусника обыкновенного, лимнофилы ароматной, лимнохариса желтого, любистка, клоповника, маки, бутылочной тыквы, лобия, водяного шпината, пазника стержнекорневого, хаттюнии сердцевидной, окинавского шпината, глинуса лядвенцевидного, галинсоги мелкоцветковой, синеголовника пахучего, рукколы, артишока испанского, циклантеры съедобной, петрушки японской, чипиля, критмума морского, кратоксилума красивого, иван-чая, кокцинии индийской, бодяка огородного, крамбе приморской, чхайи, кионы, горчицы эфиопской, мари гигантской, мари цельнолистной, epazole, мари белой, центеллы перьевидной, петушиного гребня, каперсника, брокколи рапини, пекинской капусты, курчаволистной горчицы, савойской капусты, кай-лан, листовой горчицы, базеллы белой, мангольда, алтея лекарственного, вьющейся акации, канатника Теофраста, паприки, биксы аннатовой, мяты курчавой, чабера, майорана, тмина, ромашки, мелиссы, душистого переца, черника, черимойи, морошки, терносливы, питайи, дуриана, бузины, фейхоа, джекфрута, ююбы, физалиса, мангостана, рамбутана, красной смородины, черной смородины, гаультерии шаллон, фрукта угли фрукты, фасоли адзуки, черной фасоли, коровьего гороха, вьющейся фасоли, фасоли обыкновенной, фасоли зеленой, фасоли лимской, фасоли золотистой, фасоли многоцветковой, фасоли пинто, фасоли огненно-красной, стручкового гороха, спаржевой капусты, крапивы, радиккьо, редьки японской, редьки белой, поручейника сахарного, японского горчичного шпината, брокколини, редьки черной, лопуха, конских бобов, итальянской брокколи, боба индийского, люпина, стеркулии, боба бархатного, боба крылатого, боба бататового, акации безжилковой, вернонии, акации песчаной, акации Муррея, акации колючей, акации иволистой, акации жилистой, чиа, бука, свечного дерева, арбуза кормового, меликокки, ореха Майя, монгонго, ирвингию, райского ореха и чемпедака.

[00211] В альтернативном варианте двудольные могут относиться к семействам, выбранным из группы, состоящей из Acanthaceae (акант), Aceraceae (клен), Achariaceae, Achatocarpaceae (ачатокарпус), Actinidiaceae (киви), Adoxaceae (адокса), Aextoxicaceae, Aizoaceae (фига готтентотская), Akaniaceae, Alangiaceae, Alseuosmiaceae, Alzateaceae, Amaranthaceae (амарант), Amborellaceae, Anacardiaceae (сумах), Ancistrocladaceae, Anisophylleaceae, Annonaceae (аннона сетчатая), Apiaceae (морковь), Apocynaceae (кутра), Aquifoliaceae (падуб), Araliaceae (женьшень), Aristolochiaceae (кирказон), Asclepiadaceae (ваточник), Asteraceae (астра), Austrobaileyaceae, Balanopaceae, Balanophoraceae (баланофора), Balsaminaceae (мимоза стыдливая), Barbeyaceae, Barclayaceae, Basellaceae (базелла), Bataceae (солерос), Begoniaceae (бегония), Berberidaceae (барбарис), Betulaceae (береза), Bignoniaceae (кампсис укореняющийся), Bixaceae (аннато), Bombacaceae (хлопковое дерево), Boraginaceae (огуречная трава), Brassicaceae (горчица, также Cruciferae), Bretschneideraceae, Brunelliaceae (брунеллия), Bruniaceae, Brunoniaceae, Buddlejaceae (буддлея Давида), Burseraceae (босвеллия), Buxaceae (самшит), Byblidaceae, Cabombaceae (бразения), Cactaceae (кактус), Caesalpiniaceae, Callitrichaceae (болотник), Calycanthaceae (ластовень Шорта), Calyceraceae (калицера), Campanulaceae (колокольчик), Canellaceae (корица), Cannabaceae (конопля), Capparaceae (каперсы колючие), Caprifoliaceae (жимолость), Cardiopteridaceae, Caricaceae (папайя), Caryocaraceae (кариокар ореховый), Caryophyllaceae (гвоздика), Casuarinaceae (казуарина), Cecropiaceae (цекропия), Celastraceae (паслен сладко-горький), Cephalotaceae, Ceratophyllaceae (роголистник), Cercidiphyllaceae (церцидифиллюм), Chenopodioideae (лебеда), Chloranthaceae (хлорант), Chrysobalanaceae (икако), Circaeasteraceae, Cistaceae (ладанник), Clethraceae (клетра), Clusiaceae (мангостан, также Clusiaceae), Cneoraceae, Columelliaceae, Combretaceae (индийский миндаль), Compositae (астра), Connaraceae (коннарус), Convolvulaceae (ипомеи), Coriariaceae, Cornaceae (кизил), Corynocarpaceae (коринокарпус), Crassulaceae (очиток), Crossosomataceae (кроссосома), Crypteroniaceae, Cucurbitaceae (огурец), Cunoniaceae (кунония), Cuscutaceae (повилика), Cyrillaceae (цирилла), Daphniphyllaceae, Datiscaceae (датиска), Davidsoniaceae, Degeneriaceae, Dialypetalanthaceae, Diapensiaceae (диапенсия), Dichapetalaceae, Didiereaceae, Didymelaceae, Dilleniaceae (дилления), Dioncophyllaceae, Dipentodontaceae, Dipsacaceae (ворсянка), Dipterocarpaceae (шорея), Donatiaceae, Droseraceae (росянка), Duckeodendraceae, Ebenaceae (черное дерево), Elaeagnaceae (лох), Elaeocarpaceae (элеокарпус), Elatinaceae (повойничек), Empetraceae (водяника), Epacridaceae (эпакрис), Eremolepidaceae (сережка-омелы), Ericaceae (эрика), Erythroxylaceae (кока), Eucommiaceae, Eucryphiaceae, Euphorbiaceae (молочай), Eupomatiaceae, Eupteleaceae, Fabaceae (горох или бобы), Fagaceae (бук), Flacourtiaceae (флакуртия), Fouquieriaceae (фукьерия блестящая), Frankeniaceae (франкения), Fumariaceae (дымянка), Garryaceae (гаррия), Geissolomataceae, Gentianaceae (горечавка), Geraniaceae (герань), Gesneriaceae (геснера), Globulariaceae, Gomortegaceae, Goodeniaceae (гудения), Greyiaceae, Grossulariaceae (смородина), Grubbiaceae, Gunneraceae (гуннера), Gyrostemonaceae, Haloragaceae (уруть), Hamamelidaceae (гамамелиса), Hernandiaceae (эрнадия), Himantandraceae, Hippocastanaceae (конский каштан), Hippocrateaceae (Hippocratea), Hippuridaceae (водяная сосенка), Hoplestigmataceae, Huaceae, Hugoniaceae, Humiriaceae, Hydnoraceae, Hydrangeaceae (гортензия), Hydrophyllaceae (водолюб), Hydrostachyaceae, Icacinaceae (икацина), Idiospermaceae, Illiciaceae (анис звездчатый), Ixonanthaceae, Juglandaceae (грецкий орех), Julianiaceae, Krameriaceae (ратания), Lacistemataceae, Lamiaceae (мята, также Labiatae), Lardizabalaceae (лардизабала), Lauraceae (лавр), Lecythidaceae (бразильский орех), Leeaceae, Leitneriaceae (пробковое дерево), Lennoaceae (lennoa), Lentibulariaceae (пузырчатка), Limnanthaceae (пенник луговой), Linасеае (лен), Lissocarpaceae, Loasaceae (лоаза), Loganiaceae (логания), Loranthaceae (ремнецветник), Lythraceae (вербейник), Magnoliaceae (магнолия), Malesherbiaceae, Malpighiaceae (мальпигия), Malvaceae (мальва), Marcgraviaceae (маркгавия), Medusagynaceae, Medusandraceae, Melastomataceae (меластома), Meliaceae (красное дерево), Melianthaceae, Mendonciaceae, Menispermaceae (луносемянник), Menyanthaceae (вахта трилистная), Mimosaceae, Misodendraceae, Mitrastemonaceae, Molluginaceae (моллюго мутовчатая), Monimiaceae (монимия), Monotropaceae (вертляница одноцветковая), Moraceae (шелковица), Moringaceae (моринга), Myoporaceae (миопорум), Myricaceae (восковница), Myristicaceae (мускатный орех), Myrothamnaceae, Myrsinaceae (мурсин), Миртовые (мирт), Nelumbonaceae (лотос), Nepenthaceae (непентес кхаси), Neuradaceae, Nolanaceae, Nothofagaceae, Nyctaginaceae (ночная красавица), Nymphaeaceae (кувшинка), Nyssaceae (нисса лесная), Осhnасеае (охна), Olacaceae (олакс), Oleaceae (оливка), Oliniaceae, Onagraceae (энотера), Oncothecaceae, Opiliaceae, Orobanchaceae (заразиха), Oxalidaceae (кислица обыкновенная), Paeoniaceae (пион), Pandaceae, Papaveraceae (мак), Papilionaceae, Paracryphiaceae, Passifloraceae (пассифлора), Pedaliaceae (кунжут), Pellicieraceae, Penaeaceae, Pentaphragmataceae, Pentaphylacaceae, Peridiscaceae, Physenaceae, Phytolaccaceae (лаконоса), Piperaceae (перец), Pittosporaceae (питтоспорум), Plantaginaceae (подорожник), Platanaceae (платан), Plumbaginaceae (свинчатка), Podostemaceae (подостемовые), Polemoniaceae (флокс), Polygalaceae (молочай), Polygonaceae (гречка), Portulacaceae (портулак), Primulaceae (примула), Proteaceae (протея), Punicaceae (гранат), Pyrolaceae (грушанка), Quiinaceae, Rafflesiaceae (раффлезия), Ranunculaceae (лютик), Resedaceae (резеда), Retziaceae, Rhabdodendraceae, Rhamnaceae (крушина), Rhizophoraceae (красное мангровое дерево), Rhoipteleaceae, Rhynchocalycaceae, Rosaceae (роза), Rubiaceae (марена), Rutaceae (рута), Sabiaceae (сабия), Saccifoliaceae, Salicaceae (ива), Salvadoraceae, Santalaceae (сандаловое дерево), Sapindaceae (сапиндус), Sapotaceae (саподилла), Sarcolaenaceae, Sargentodoxaceae, Sarraceniaceae (саррацения), Saururaceae (заурурус поникший), Saxifragaceae (камнеломка), Schisandraceae (лимонник), Scrophulariaceae (норичник), Scyphostegiaceae, Scyropetalaceae, Simaroubaceae (кассия), Simmondsiaceae (жожоба), Solanaceae (картофель), Sonneratiaceae (соннератия), Sphaerosepalaceae, Sphenocleaceae (спеноклея), Stackhousiaceae (стакхузия), Stachyuraceae, Staphyleaceae (клетчатка), Sterculiaceae (какао), Stylidiaceae, Styracaceae (стиракс), Surianaceae (суриана), Symplocaceae (симплокос красильный), Tamaricaceae (тамарикс), Tepuianthaceae, Tetracentraceae, Tetrameristaceae, Theaceae (чай), Theligonaceae, Theophrastaceae (теофраст), Thymelaeaceae (волчье лыко), Ticodendraceae, Tiliaceae (липа), Tovariaceae, Trapaceae (водяной орех), Tremandraceae, Trigoniaceae, Trimeniaceae, Trochodendraceae, Tropaeolaceae (настурция), Turneraceae (турнера), Ulmaceae (вяз), Urticaceae (крапива), Valerianaceae (валериан), Verbenaceae (вербена), Violaceae (фиалка), Viscaceae (омела), Vitaceae (виноград), Vochysiaceae, Winteraceae (винтера), Xanthophyllaceae и Zygophyllaceae (креозотовый куст).

[00212] Если растения относятся к однодольным, однодольные могут быть выбраны из группы, состоящей из кукурузы, пшеницы, овса, риса, ячменя, проса, банана, лука, чеснока, спаржи, плевела, фонио, райшана, нипы, куркумы, шафраны, калганы, чеснока, кардамона, финика, ананаса, лука-шалота, лука-порея, водяного каштана, дикого лука, бусенника, бамбука, дагусса, вольфии бескорневой, маланги, ксантосомы, абаки, ареки, африканского проса, бетеля, сорго технического, цитронеллы, кокоса, колоказии съедобной, кукурузы, сорго, твердой пшеницы, эдо, фуркреа, формио, имбиря, ежы сборной, эспарто, суданской травы, сорго гвинейского, мексиканской пеньки, гибридной кукурузы, джовара, сорго лимонного, агавы, проса тростникового, проса пальчатого, проса итальянского, проса японского, проса обыкновенного, льна новозеландского, овса, масличной пальмы, пальмировой пальмы, саговой пальмы, полевицы белой, сизаля, пшеницы спельты, сахарной кукурузы, сорго сахарного, таро, теффа, тимофеевки луговой, тритикале, ванили, пшеницы и батата.

[00213] В альтернативном варианте однодольные могут относится к семействам, выбранным из группы, состоящей из Асоrасеае (аира), Agavaceae (агава американская), Alismataceae (частуха подорожниковая), Aloeaceae (алоэ), Aponogetonaceae (апоногетон двуколосый), Аrасеае (арум), Аrесасеае (пальма), Bromeliaceae (бромелия), Burmanniaceae (бурманния), Butomaceae (сусак зонтичный), Саnnасеае (пушница), Centrolepidaceae, Commelinaceae (традесканция), Corsiaceae, Costaceae (костус), Cyanastraceae, Cyclanthaceae (панамская пальма), Cymodoceaceae (сирингодиум), Cyperaceae (осока), Dioscoreaceae (батат), Eriocaulaceae (шерстестебельник), Flagellariaceae, Geosiridaceae, Haemodoraceae (тысячелистник), Hanguanaceae (гангуана), Heliconiaceae (хеликония), Hydatellaceae, Hydrocharitaceae (валлиснерия), Iridaceae (ирис), Joinvilleaceae (жуанвилея), Juncaceae (тростник), Juncaginaceae (триостренник), Lemnaceae (ряска), Liliaceae (лилия), Limnocharitaceae (гидроклеис кувшинковидный), Lowiaceae, Marantaceae (маранта беложильчатая), Mayacaceae (маяка), Musaceae (банан), Najadaceae (кувшинка пахучая), Orchidaceae (орхидея), Pandanaceae (панданус), Petrosaviaceae, Philydraceae (филидровые), Poaceae (травы), Pontederiaceae (водяной гиацинт), Posidoniaceae (посидония), Potamogetonaceae (рдест), Rapateaceae, Restionaceae, Ruppiaceae (паспалум двухрядный), Scheuchzeriaceae (шейхцерия), Smilacaceae (смилакс), Sparganiaceae (ежеголовник малый), Stemonaceae (стемона), Strelitziaceae, Taccaceae (така), Thurniaceae, Triuridaceae, Typhaceae (рогоз), Velloziaceae, Xanthorrhoeaceae, Xyridaceae (сисиринхиум полосатый), Zannichelliaceae (цаникеллия болотная), Zingiberaceae (имбирь) и Zosteraceae (зостера).

[00214] Если растения относятся к голосеменным, голосеменные могут относиться к семействам, выбранным из группы, состоящей из Araucariaceae, Boweniaceae, Cephalotaxaceae, Cupressaceae, Cycadaceae, Ephedraceae, Ginkgoaceae, Gnetaceae, Pinaceae, Podocarpaceae, Taxaceae, Taxodiaceae, Welwitschiaceae и Zamiaceae.

ПРИМЕРЫ

[00215] Следующие не ограничивающие примеры предназначены для дополнительной иллюстрации настоящего изобретения.

Пример 1. Использование рекомбинантного представителя семейства Bacillus cereus, выводящего липазы или эндоглюканазы для стимуляции роста растений сои.

[00216] Гены липазы и эндоглюканазы Bacillus subtilis были амплифицированы с помощью полимеразной цепной реакции (ПЦР) с использованием следующих праймеров, приведенных ниже в таблице 3:

[00217] Для создания гибридных конструкций гены сливали с нативным промотором BclA ДНК Bacillus thuringiensis, которая кодирует первые 35 аминокислот BclA (аминокислоты 1-35 из SEQ ID №: 1) с использованием техники сплайсинга путем перекрывающихся участков (SOE). Правильные ампликоны были клонированы в челночный вектор Е. coli/Bacillus рНР13 и правильные клоны были скринированы ДНК секвенированием последовательности ДНК. Правильные клоны были электропорированы в Bacillus Thuringiensis (Cry-, плазмида-) и скринированы на устойчивость к хлорамфениколу. Правильные трансформанты выращивали в сердечно-мозговом бульоне в течении ночи при 30°С, высевали на чашки с питательным агаром и инкубировали при 30°С в течение 3 дней. Споры, экспрессирующие гибридную конструкцию (BEMD споры), были собраны с чашек путем промывки в фосфатном буферном солевом растворе (PBS) и очищали центрифугированием и дополнительными промывками в натрий-фосфатном буфере. Нетрансформированные контрольные споры Bacillus thuringiensis (Bt.) получали идентичным образом.

[00218] Соевые бобы (штамм Jake 011-28-04) были посажены на 2,54 см в глубину в горшки глубиной 10 см со стандартным верхним суглинистым слоем. Споры разбавляли до концентрации 1×104/мл в 50 мл воды и применяли к каждому семени при посадке. Растения выращивали при идеальном освещении, используя лампы Т5, 54 Вт, и 11-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение двухнедельного обследования. В конце двух недель измеряли высоту каждого растения, и измерения были нормализованы к контрольным спорам Bacillus thuringiensis. Было проведено два независимых исследования.

[00219] Результаты показаны в таблице 4 вместе со стандартной ошибкой среднего. В обоих испытаниях растения сои, выращенные в присутствии спор ВЭВ, выводящих липазу или эндоглюканазу, вырастали значительно выше, чем контрольные растения сои, обработанные спорами Bt. (статистический анализ проводили с помощью t-теста).

Пример 2. Использование рекомбинантного представителя семейства Bacillus cereus, выводящего эндоглюканазу, для стимуляции роста растений кукурузы.

[00220] ВЭВ споры, экспрессирующие эндоглюканазу были созданы идентичным образом, как описано выше в примере 1. Кукуруза была посажена на 3,8 см в глубину 3 см в горшки глубиной 10 см со стандартным верхним суглинистым слоем. Споры, контрольные и ВЭВ, экспрессирующие эндоглюканазу, разводили до концентрации 1×104/мл в 50 мл воды и применяли к каждому растению при посадке. Также был включен контроль с одной водой. Растения были выращены при идеальном свете, используя лампы Т5, 54 Вт, и 11-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение одной недели испытаний. В конце двух недель измеряли высоту каждого растения, и измерения были нормализованы к контрольным спорам Bacillus thuringiensis.

[00221] Результаты приведены в таблице 5, вместе со стандартной ошибкой среднего. Кукуруза, выращенная в присутствии ВЭВ спор, выводящих эндоглюканазу, выросла значительно выше, чем контрольные растения сои, обработанные спорами Bt., и контрольные растения, обработанные только водой (статистический анализ проводили с помощью t-теста).

Пример 3. Использование рекомбинантного представителя семейства Bacillus cereus, выводящего эндоглюканазы или протеазы для стимуляции роста растений пшеницы.

[00222] Споры ВЭВ, экспрессирующие эндоглюканазу, были созданы идентичным образом, как описано выше в примере 1. Споры ВЭВ, эспрессирующие протеазу PtrB Е. coli, были созданы с использованием аналогичных способов, которые описаны выше в примере 1, и следующих праймеров: ggatccatgctaccaaaagcc (прямой, SEQ ID №: 41) и ggatccttagtccgcaggcgtagc (обратный, SEQ ID №: 42).

[00223] Твердая озимая пшеница была посажена на 2,54 см в глубину в горшки глубиной 10 см со стандартным верхним суглинистым слоем. Споры, контроль и ВЭВ, экспрессирующие эндоглюканазу или протеазу, разводили до концентрации 1×104/мл в 50 мл воды и применяли к каждому растению при посадке. Также был включен контроль только с водой. Растения выращивали при идеальном освещении, используя лампы Т5, 54 Вт, и 11-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение одной недели испытаний. В конце одной недели измеряли высоту каждого растения, и измерения были нормализованы по контрольным растениям.

[00224] Результаты приведены в таблице 6, вместе со стандартной ошибкой среднего. Пшеница, росшая в присутствии спор ВЭВ, выводящих эндоглюканазу или протеазу, выросла значительно выше, чем контрольные растения сои, обработанные спорами B.t., и контрольные растения, обработанные только водой (статистический анализ проводили с помощью t-теста).

Пример 4. Использование рекомбинантного представителя семейства Bacillus cereus, выводящего эндоглюканазу для стимуляции роста растений плевела.

[00225] Споры ВЭВ, экспрессирующие эндоглюканазу, были созданы идентичным образом, как описано выше в примере 1. Пастбищный плевел был посажен на 6,4 мм в глубину в горшки глубиной 10 см со стандартным верхним суглинистым слоем. Споры, контроль и ВЭВ, экспрессирующие эндоглюканазу, разводили до концентрации 1×104/мл в 50 мл воды и применяли к каждому растению при посадке. Также был включен контроль только с водой. Растения выращивали при идеальном освещении, используя лампы Т5, 54 Вт, и 11-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение двухнедельного обследования. В конце двух недель измеряли высоту каждого растения, и измерения были нормализованы по контрольным растениям, обработанным только водой.

[00226] Результаты приведены в таблице 7, вместе со стандартной ошибкой среднего. Плевел, выращенный в присутствии спор ВЭВ, выводящих эндоцеллюлазу, вырос значительно выше, чем контрольный, обработанный спорами B.t. или водой плевел (статистический анализ проводили с помощью t-теста).

Пример 5. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих ферменты, участвующие в синтезе или активации растительных гормонов для стимуляции роста растений.

[00227] Система ВЭВ также может быть использована для выведения ферментов, участвующих в синтезе гормонов растений. Например, растительный гормон индол-3-уксусная кислота является мощным стимулятором роста растений. Индол-3-уксусная кислота синтезируется in vivo из триптофана ферментами триптофан монооксигеназной и индол-3-ацетамид гидролазой. Индол-3-уксусная кислота и другие ауксиновые гормоны могут также быть синтезированы in vivo из триптофана и/или из индола ферментами нитрилазой, триптофан аминотрансферазой, индол-3-ацетальдегид дегидрогеназой, индол-3-пируват-декарбоксилазой, амин оксидазой, триптофан-декарбоксилазой и триптофан-оксидазой боковой цепи.

[00228] Система ВЭВ также может быть использована для выведения ферментов, участвующих в модификации гормонов роста растений в биологически активные или неактивные формы. Например, нитрилаза может экспрессироваться в системе ВЭВ для катализа превращения индол-3-ацетонитрила в биологически активную форму индол-3-уксусная кислота. Кроме того, неактивные формы гормонов растений, такие как индол-3-ацетонитрил, могут вводиться в среды роста растений с нитрилазой, экспрессированной в ВЭВ, чтобы обеспечить постепенное высвобождение активного гормона в среду роста растений. Многие другие неактивные или менее активные формы растительных гормонов могут быть изменены с помощью соответствующих им ферментов.

[00229] Подобные гормоны роста растений (ауксины) включают индол-3-пировиноградную кислоту, индол-3-ацетальдоксим, индол-3-ацетамид, индол-3-ацетонитрил, индол-3-этанол, индол-3-пируват, индол-3-масляную кислоту, фенилуксусную кислоту, 4-хлориндол-3-уксусную кислоту и индол-3-ацетальдоксим. Эти гормоны синтезируются из триптофана и/или индола в естественных условиях с помощью ферментов триптофан монооксигеназы, индол-3-ацетамид гидролазы, нитрилазы, нитрил гидролазы, ацетолактат синтетазы, альфа-ацетолактат декарбоксилазы, триптофан аминотрансферазы, индол-3-ацетальдегид дегидрогеназы, индол 3-пируватдекарбоксилазы, амин оксидазы, триптофан-декарбоксилазы и триптофан-оксидазы боковой цепи.

[00230] Гормоны роста цитокининового семейства можно также синтезировать с помощью ферментов, экспрессированных в системе ВЭВ. Примеры цитокининов включают кинетин, зеатин (цис и транс), 6-бензиламинопурин, дигидроксизеатин, N6-(D2-изопентенил) аденин, рибозилзеатин, N6-(D2-изопентенил) аденозин, 2-метилтио-цис-рибозилзеатин, цис-рибозилзеатин, рибозилзеатин-5-монофосфат, N6-метиламинопурин, N6-диметиламинопурин, 2'-дезоксизеатина рибозид, 4-гидрокси-3-метил-транс-2-бутенил аминопурин, орто-тополин, мета-тополин, бензиладенин, орто-метилтополин и мета-метилтополин. Эти соединения, стимулирующие рост растения, синтезируются in vivo из мевалоната или аденозин моно/ди/трифосфата ферментами, включающими аденозинфосфат изопентенилтрансферазы, фосфатазы, аденозин-киназы, аденин фосфорибозилтрансферазу, CYP735A, 5'-рибонуклеотид фосфогидролазу, аденозин нуклеозидазы, зеатин цис-транс-изомеразу, зеатин О-глюкозилтрансферазы, β-глюкозидазы, цис-гидроксилазы, СК цис-гидроксилазы, СК N-глюкозилтрансферазы, 2,5-рибонуклеотид фосфогидролазы, аденозин нуклеозидазы, пурин нуклеозидфосфорилазы и зеатин редуктазы.

[00231] Используя способы, подобные описанным выше в примере 1, любой из этих ферментов может быть включен в систему ВЭВ для выведения на ВЭВ споры путем создания слитой конструкции, содержащей фермент и сигнальную последовательность, которая направляет экспрессированный фермент в экзоспорий, когда гибридная конструкция экспрессируется в представителе семейства Bacillus cereus. Рекомбинантный представитель семейства Bacillus cereus, экспрессирующий такую конструкцию, может быть добавлен в почву, или другую среду для роста растений, или нанесен непосредственно на листву растений с помощью способов, аналогичных тем, которые описаны выше в примере 1 для стимуляции роста растений.

[00232] Среда роста растений может быть дополнена предшественниками или субстратами для ферментов. Например, среда для роста растений может быть дополнена триптофаном, аденозинмонофосфатом, аденозиндифосфатом, аденозинтрифосфатом или индолом. Подходящие концентрации этих субстратов находятся между 100 нМ и 100 мкМ.

Пример 6. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих протеазы или пептидазы, расщепляющие белки, пептиды, пробелки или препробелки в биологически активные пептиды для стимуляции роста растений.

[00233] Протеазы и пептидазы могут быть экспрессированы в системе ВЭВ, что может ферментативно расщеплять доступные белки в среде для роста растений в биологически активных пептидов, которые могут действовать на растение непосредственно или косвенно. Примеры включают ферментативное расщепление соевого шрота, дрожжевого экстракта или другой богатой белком пищи, добавляющейся к среде для роста растений, в активные пептиды, которые могут непосредственно стимулировать рост растений. Биологически активные пептиды, полученные путем ферментативного расщепления белковых питательных добавок, включают RHPP и RKN 16D10, мощные стимуляторы развития корневой системы растений. Кроме того, пробелки или препробелки могут разрезаться в активные формы с помощью протеаз и пептидаз, экспрессированых в ВЭВ. Неактивные пробелки или препробелки могут быть добавлены в среду роста растений чтобы облегчить их постепенное расщепление ВЭВ протеазами и замедлить высвобождение биологически активных белков.

[00234] Используя способы, подобные описанным выше в примере 1, любая из этих протеаз и пептидаз может быть включена в систему ВЭВ для выведения на ВЭВ споры путем создания слитой конструкции, содержащей протеазу или пептидазу и сигнальную последовательность, которая направляет экспрессированный фермент в экзоспорий, когда гибридная конструкция экспрессирована в представителе семейства Bacillus cereus. Рекомбинантный представитель семейства Bacillus cereus, экспрессирующий такую конструкцию, может потом быть добавлен к почве или другой среде для роста растений с добавлением соевой муки, дрожжевого экстракта или другой богатой белком питательной добавки для стимуляции роста растений. Соевый шрот, дрожжевой экстракт, или другая богатая белком питательная добавка предпочтительно добавляется к среде для роста растений в виде жидкой композиции, содержащей от около 10 мкг/л до около 100 мг/л в белковой муки, дрожжевого экстракта или другой богатой белком питательной добавки.

Пример 7. Использование спор ВЭВ, экспрессирующих протеазы PtrB, для стимуляции роста растений.

[00235] Споры ВЭВ, экспрессирующие протеазы PtrB Е. coli, были получены, как описано выше в примере 3. Семена сои были посажены на глубину 2,54 см в горшки глубиной 10 см со стандартным суглинистым верхним слоем почвы. Споры, контрольные и ВЭВ, экспрессирующие протеазу, разводили до концентрации 1×104/мл в 50 мл воды и применяли к каждому растению при посадке. Также был включен контроль с одной водой. Соевая мука в дозе 25 мг/горшок была добавлена в воду при посадке. Растения выращивали при идеальном освещении, используя лампы Т5, 54 Вт, и 13-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение одной недели испытаний. По окончанию двух недель измеряли высоту каждого растения, и измерения были нормированы по контрольным растениям, обработанным только водой.

[00236] Результаты показаны в таблице 8, вместе со стандартной ошибкой среднего, в процентах от контроля с водой. Соя, росшая в присутствии спор ВЭВ, выводящих протеазу, выросла значительно выше чем контрольные растения сои, обработанные спорами Bt. и контрольные растения, обработанные только водой (статистический анализ проводили с помощью t-теста). Добавление соевой муки к контролю с водой или контролю В. thuringiensis не производило большого эффекта. В отличие от этого, в присутствии соевой муки и системы протеаз ВЭВ, растения сои существенно отвечали на все другие виды обработки.

Пример 8. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих белки или пептиды, участвующие в стимулировании роста растений.

[00237] Система ВЭВ также может быть использована для выведения белков или пептидов, которые непосредственно вовлечены в стимулировании роста растений. Например, пептидные гормоны растений или не гормональные пептиды, которые стимулируют рост растений, могут экспрессироваться в системе ВЭВ. Например, негормональные пептиды, которые непосредственно связываются и активируют рецепторы растений, могут экспрессироваться в системе ВЭВ для непосредственного воздействия на рецепторы в растении и корнях целевых растений. Такие пептидные гормоны и негормональные пептиды включают фитосульфокин, calcalva 3 (CLV3), системны, РКН 16D10, Hg-Syv46, eNOD40, NOD белков семейства, ZmlGF, белки семейства SCR/SP11 и пептиды, RHPP, POLARIS и ИТК. Эти пептиды и родственные пептиды могут быть выражены в системе ВЭВ и доставлены в среде для роста растений или непосредственно применены на листву для стимуляции роста растений.

[00238] Используя способы, подобные описанным выше в примере 1, любой из этих белков или пептидов может быть включен в систему ВЭВ для выведения на ВЭВ спорах путем создания слитой конструкции, содержащей фермент и сигнальную последовательность, которая направляет экспрессированный фермент в экзоспорий, когда гибридная конструкция экспрессирован в представителе семейства Bacillus cereus. Рекомбинантный представитель семейства Bacillus cereus, экспрессирующий такую конструкцию, может быть добавлен в почву, или другую среду для роста растений, или нанесен непосредственно на листву растений с помощью способов, аналогичных тем, которые описаны выше в примере 1, для стимуляции роста растений.

Пример 9. Использование спор ВЭВ, экспрессирующих POLARIS или ИТК для стимуляции роста растений.

[00239] Споры ВЭВ растений, экспрессирующие пептид POLARIS и соевый пептид ИТК, были созданы путем синтеза генов, кодирующих пептиды POLARIS или ИТК, связанных с сигнальной последовательностью SEQ ID №: 60. Гены затем были введены в Bacillus thuringiensis и были получены споры, как описано в примере 1. Семена сои были посажены на 2,54 см в глубину в горшки глубиной 10 см со стандартным верхним суглинистым слоем. Споры ВЭВ, экспрессирующие POLARIS или ИТК, разводили до концентрации 1×104/мл в 50 мл воды и применяли к каждому растению при посадке. Также включали контроль только с водой. Чистые пептиды POLARIS и ИТК также были протестированы на их воздействие на сою в количестве 0,05 мг/горшок. Растения выращивали при идеальном освещении, используя лампы Т5, 54 Вт, и 13-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение двух недельного испытания. По окончанию двух недель измеряли высоту каждого растения, и измерения были нормированы по контрольным растениям, обрабатываемых только водой.

[00240] Результаты приведены в таблице 9, вместе со стандартной ошибкой среднего в процентах от контроля только с водой. Соя, росшая в присутствии спор ВЭВ, выводящих POLARIS, выросла выше и имела некоторое повышение в развитии корней при сравнении с контрольной соей. Присутствие свободного пептида ИТК приводило к значительной низкорослости растений, терявших 6-8% их высоты, но прибавлявших 15% в длине корней. Экспрессия ИТК в системе ВЭВ приводила к повышению в росте корней, но не вызывала задержки в росте растений в высоту. Важно отметить, что присутствие контрольных спор Bacillus thuringiensis со свободным пептидом ИТК не предотвращало эффект задержки в росте, вызванный ИТК, в то время как ВЭВ с ИТК не проявляла такой задержки роста.

Пример 10. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих ферменты, разрушающие или модифицирующие бактериальный, грибковый или растительный источник питательных веществ, для стимуляции роста растений и/или получения питательных веществ.

[00241] Система ВЭВ также может быть использована для выведения ферментов, разрушающих или благотворно модифицирующих бактериальный, грибковый или растительный источник питательных веществ, присутствующий в почве или другой среде для роста растений. Такие ферменты разлагают продукты, присутствующие в почве или другой среде для роста растений в формы, которые могут быть легко поглощены растениями и/или полезными бактериями и/или грибами ризосферы. Такие ферменты включают, например, глюкозид-гидролазы для расщепления сложных углеводов, целлюлазы для расщепления целлюлозы; липазы для расщепления липидов, в том числе масла, жиров и восков; лигнин оксидазы для расщепления лигнина и гуминовых кислот; протеазы для расщепления полипептидов; фосфолипазы для расщепления мембран; амидазы и нитрогеназы для восстановления азота; амилазы для обработки крахмалов; нуклеазы для восстановления нуклеотидов, пектиназы для расщепления пектина, сульфатазы для восстановления серы и ксиланазы для расщепления ксиланов и арабиноксиланов. Полученные продукты, в том числе простые сахара, аминокислоты, жирные кислоты и другие питательных вещества, будут легко доступна для прямого поглощения растениями и/или для стимуляции роста и разрастания полезных бактерий и/или грибов в ризосфере растений.

[00242] Кроме того, ферменты и другие биологические молекулы могут быть использованы для высвобождения или изолирования фосфата, азота и других ключевых элементарных питательных веществ для поглощения растениями из их различных органических и неорганических форм в почве. Например, фосфатазы могут быть использованы для разложения фосфатов в среде в неорганические фосфаты, пригодные для использования растениями. Фосфатами могут быть природные фосфаты, присутствующие в среде для роста растений. В альтернативном варианте или в дополнение, среда для роста растений может быть дополнена фосфатами, такими как триметафосфат, обычной сельскохозяйственной добавки. Примеры полезных фосфатаз включают фосфорный моноэфир гидролазы, фосфомоноэстеразы, фосфорный диэфир гидролазы, фосфодиэстеразы, трифосфорный моноэфир гидролазы, фосфорный ангидрид гидролазы, пирофосфатазы, фитазу, триметафосфатазы и трифосфатазы. Например, ферменты триметафосфатазы, трифосфатазы и пирофосфатазы последовательно расщепляют триметафосфат в доступный неорганический фосфат.

[00243] Семейство ферментов нитрогеназ преобразует атмосферный азот (N2) в аммиак, таким образом превращая азот, по-другому не доступный для растений, в доступную форму. Подходящие ферменты относятся к семейству нитрогеназ Nif.

[00244] Химическая энергия может быть непосредственно добавлена в среду для роста растений в виде аденозинтрифосфата, ферродоксина или дополнительных ферментов, которые производят такую энергию в системе ВЭВ. Они являются кофакторами для нитрогеназ и ограничено присутствуют в почве. Таким образом, такие кофакторы могут быть добавлены в почву, чтобы ускорить реакции, описанные ранее.

[00245] Другие добавки, которые могут быть добавлены в среду для роста растений, включают крахмалы, целлюлозу и производные целлюлозы, пектины, ксиланы и арабиноксиланы, жиры, воски, масла, фитиновые кислоты, лигнины, гуминовые кислоты и других источники питательных веществ, к которым выше приведенные классы ферментов проявляют активность.

[00246] Используя способы, подобные описанным выше в примере 1, любой из этих ферментов может быть включен в систему ВЭВ для выведения на ВЭВ споры путем создания слитой конструкции, содержащей фермент и сигнальную последовательность, которая направляет экспрессированный фермент в экзоспорий, когда гибридная конструкция экспрессируется в представителе семейства Bacillus cereus. Гибридная конструкция затем может экспрессироваться в представителе семейства Bacillus cereus, и этот рекомбинантный представитель семейства Bacillus cereus может быть добавлен к почве или другой среде для роста растений с помощью способов, аналогичных тем, которые описаны выше в примере 1 для стимуляции роста растений.

Пример 11. Использование ВЭВ спор, экспрессирующих фосфатазы для стимуляции роста растений.

[00247] ВЭВ споры Bacillus subtilis, экспрессирующие фосфатазу А4 (PhoA4) были созданы путем синтеза гена, кодирующего PhoA4, связанного с сигнальной последовательностью SEQ ID №: 60. Этот ген затем был введен в Bacillus thuringiensis, и споры были получены, как в примере 1. Кукуруза была посажена на глубину 2,54 см в горшки глубиной 10 см со стандартным верхним суглинистым слоем. ВЭВ споры, экспрессирующие PhoA4, разводили до концентрации 1×104/мл в 50 мл воды и применяли к каждому растению при посадке. Также включали контроль только с водой. Полифосфат был добавлен в горшки в жидком виде в расчете 0,5 мг/горшок. Растения выращивали при идеальном освещении, используя лампы Т5, 54 Вт, и 13-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение двухнедельного испытания. В конце двух недель измеряли высоту каждого растения, и измерения были нормализованы по контрольным растениям, обработанным только водой.

[00248] Результаты приведены в таблице 10. Кукуруза, росшая в присутствии спор ВЭВ, выводящих PhoA4, показывает повышенный рост, в особенности в присутствии добавленного полифосфата. Этот эффект был выше, чем эффект только от полифосфата.

Пример 12. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих ферменты, участвующие в синтезе 2,3-бутандиола или активации гибберелловой кислоты для стимуляции роста растений.

[00249] Система ВЭВ также может быть использована для выведения ферментов, участвующие в синтезе 2,3-бутандиола, соединения, способствующего росту растений, in vivo 2,3-бутандиол синтезируется полезными бактериями и грибами в ризосфере из ацетоина, диацетила, ацетолактата или пирувата ферментами ацетолактат синтетазой, α-ацетолактат декарбоксилазой, пируватдекарбоксилазой, диацетил редуктазой, бутандиол дегидрогеназой и ацетоин редуктазой.

[00250] Система ВЭВ также может быть использована для выведения ферментов, участвующих в синтезе или активации соединения, способствующего росту растения, гибберелловой кислоты. Гибберелловая кислота может быть образована путем действия ферментов, включая, но не ограничиваясь, гидроксиламин редуктазы, 2-оксоглутарат диоксигеназы, гиббереллин 2В/3В гидролазы, гиббереллина-3 оксидазы и гиббереллина-20 оксидазы.

[00251] Любой из этих ферментов может быть включен в систему ВЭВ для выведения на ВЭВ споры с помощью способов, аналогичных тем, которые описаны выше в примере 1. Может быть получена гибридная конструкция, содержащая фермент и сигнальную последовательность, которая направляет фермент в экзоспорий, если гибридная конструкция экспрессируется в представителе семейства Bacillus cereus. Гибридная конструкция затем экспрессируется в представителе семейства Bacillus cereus и представитель семейства Bacillus cereus вносится в почву или другую среду роста растений для стимуляции роста растений.

[00252] Чтобы увеличить эффект отображаемых на ВЭВ ферментов, почва может быть дополнена субстратами для ферментов. Например, почва или другая среда для роста растений может быть дополнена ацетоином, который является субстратом для ацетоин редуктазы; пируватом, который является субстратом для пируватдекарбоксилазы; диацетилом, который является субстратом для диацетил редуктазы; и/или ацетолактатом, который является субстратом для ацетолактат декарбоксилазы. В альтернативном варианте или в дополнение, почва или другая среда для роста растений может быть дополнена более слабыми или неактивными формами гибберелловой кислоты, которые будут преобразованы в более активные формы в почве или другой среде роста растений под действием ферментов, описанных ранее.

Пример 13. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих протеазы для защиты растений от патогенов.

[00253] Система ВЭВ также может быть использована для выведения ферментов, которые защищают растения от одного или нескольких патогенов. Например, некоторые бактериальные патогены могут взаимодействовать между отдельными особями с помощью секреции бактериальных гомосеринлактонов или похожих сигнальных молекул. Таким образом, протеазы, специфичные к бактериальным сигнальным молекулам гомосеринлактонам, могут защитить растения от таких бактериальных патогенов, разрушая коммуникацию между бактериями - шаг, необходимый бактериям для вырабатывания токсинов и активирования факторов вирулентности. Подходящие протеазы, специфичные к бактериальным сигнальным молекулам гомосеринлактонам, включают эндопептидазы и экзопептидазы.

[00254] Протеазы, специфичные к бактериальным сигнальным молекулам гомосеринлактонам, могут быть включены в систему ВЭВ, используя способы, аналогичные описанным выше в примере 1. Может быть получена гибридная конструкция, включающая протеазу и сигнальную последовательность, которая направляет фермент в экзоспорий, если гибридная конструкция экспрессируется в представителе семейства Bacillus cereus. Гибридная конструкция затем экспрессируется в представителе семейства Bacillus cereus, и представитель семейства Bacillus cereus вносится в почву или другую среду для роста растений для стимуляции роста растений. Протеаза затем может расщепить бактериальные сигнальные молекулы гомосеринов, блокируя ключевой шаг в вирулентности этих микроорганизмов и, таким образом, помогает защитить растение от этих патогенов. Другие протеазы и пептидазы эффективно работают в этом применении в системе ВЭВ, как было показано выше в примере 6 и 7.

Пример 14. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих антимикробные белки и пептиды для защиты растений от патогенов.

[00255] Система ВЭВ также может быть использована для выведения ферментов, которые имеют антибактериальные и/или антигрибковые активности, что может защитить растения от одного или более патогенов. Например, антимикробные белки и пептиды, такие как бактериоцины, лизоцимы (например, LysM), сидерофоры, кональбумин, альбумин, лактоферрины (например, LfcinB) или TasA могут быть экспрессированы в системе ВЭВ для оказывания своего воздействия на бактериальные и грибковые патогены растений. Бактериоцины, альбумин, кональбумин, лизоцимы и лактоферрин оказывают прямое антимикробное действие на свои цели, в то время как сидерофоры связывают важные питательные вещества, требуемые патогенами для вирулентности. Например, пептид лактоферрина LfcinB, при экспрессии на поверхности системы ВЭВ, будет лизировать клетки бактерий, которые чувствительны к пептидам лактоферрина в среде для роста растений. Эти белки и пептиды имеют специфическое действие на некоторых микробов и могут быть селективно направлены против целевой группы патогенов, не влияя на все микробы в среде для роста растений.

[00256] Любой из этих белков или пептидов может быть включен в систему ВЭВ для выведения на спорах ВЭВ с помощью способов, аналогичных тем, которые описаны ранее в примере 1. Может быть получена гибридная конструкция, содержащая фермент и сигнальную последовательность, которая направляет фермент в экзоспорий, если гибридная конструкция экспрессируется в представителе семейства Bacillus cereus. Гибридная конструкция затем экспрессируется в представителе семейства Bacillus cereus, и представитель семейства Bacillus cereus вносится в почву или другую среду для роста растений для защиты растений от одного или более патогенов.

Пример 15. Использование спор ВЭВ, экспрессирующих антимикробные пептиды для защиты растений от бактерий.

[00257] Гены были синтезированы таким образом, что они кодировали любой из двух антимикробных пептидов, LfcinB (получен из бычьего лактоферрина) и LysM (получен из куриного лизоцима), связанных с сигнальной последовательностью BclA (SEQ ID №: 60), находящейся под контролем промотора BclA (SEQ ID №: 85). Гены были введены в Bacillus thuringiensis ВТ013А и споры были получены путем выращивания ночной культуры трансформированных Bacillus на бульоне с сердечно-мозговой вытяжкой, высевание на чашки с питательным агаром при 30°С и последующим выращиванием в течение 3 дней. Споры смывали с чашек и промывали 3 раза в натрий-фосфатном буфере. Культуры Staphylococcus epidermidis выращивали в течение ночи на трипсиновом соевом бульоне при 37°С. После этого ночную культуру затем осаждали, промывали в натрий-фосфатном буфере и ресуспендировали в натрий-фосфатном буфере при Abs595=0,2. ВЭВ в концентрации 1×104, экспрессирующий пептиды LysM или LfcinB, инкубировали в натрий-фосфатном буфере с S. epidermidis в течение 3 часов при 37°С со встряхиванием. Контрольный образец S. epidermidis не обрабатывали (без спор ВЭВ). После 3-часовой инкубации разбавление пластины S. epidermidis были сделаны и инкубировали при 37°С в течение ночи. На следующий день культуры S. epidermidis подсчитывали и определяли процент погибших. Максимальная активность уничтожения зарегистрирована в таблице 11 ниже. Пептиды, экспрессированные ВЭВ, уничтожили значительное число клеток S. epidermidis. Это может непосредственно привести к уничтожению бактерий на ризосфере, семени или другом растительном материале. Выбор пептидов, специфичных для некоторых классов бактерий, также может изменить популяцию микроорганизмов в районе растения в выгодную сторону, или селективно воздействовать на ключевые патогены.

Пример 16. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих ферменты для защиты растений от патогенов.

[00258] Система ВЭВ также может быть использована для выведения ферментов, которые защищают растения от одного или более патогенов. Например, поименный клеточные стенки дрожжей и плесневого гриба разрушаются под действием ферментов, таких как β-1,3-глюканазы, β-1,4-глюканазы, β-1,6-глюканазы, хитозиназы, хитиназы, хитозиназа-подобные белки и лутиказы. Клеточные стенки бактерий разрушаются ферментами, выбранными из протеиназ, протеаз, мутанолизина, стафолизина и лизоцимов. Каждый из этих ферментов, разрушающих клеточные стенки, может быть экспрессирован на системе ВЭВ и внесен в среду для роста растений для селективного ингибирования патогенных микробов в ризосфере.

[00259] Система ВЭВ также может быть использована для выведения ферментов или белков, которые защищают растения от патогенных насекомых или червей, например, путем подавления поедания желаемых растений насекомым или червями. Примеры таких целевых белков и ферментов включают эндотоксины, Cry токсины, другие инсектицидные белковые токсины, ингибиторы протеаз, цистеиновые протеазы, белок Cry5B, белок Cry 21А, хитиназа, белки ингибитора протеазы, пептиды ингибитора протеазы, ингибиторы трипсина, и стреловидный ингибитор протеазы.

[00260] Любой из этих белков или пептидов может быть включен в систему ВЭВ для выведения на спорах ВЭВ спор с помощью способов, аналогичных тем, которые описаны выше в примере 1. Также может быть получена гибридная конструкция, включающая фермент и сигнальную последовательность, которая транспортирует фермент в экзоспорий, если гибридная конструкция экспрессируется в представителе семейства Bacillus cereus. Данная гибридная конструкция затем экспрессируется в представителе семейства Bacillus cereus, и представитель семейства Bacillus cereus вносится в почву или другую среду для роста растений для защиты растений от патогенов.

Пример 17. Использование спор ВЭВ, экспрессирующих противогрибковый фермент, для защиты растений, и демонстрация эффективности против Sacchromyces.

[00261] Ген синтезировали таким образом, что он кодировал противогрибковый фермент β-1,3-глюканазу из Bacillus subtilis, связанный с сигнальной последовательностью BclA (SEQ ID №: 60) под контролем промотора BclA (SEQ ID №: 85). Ген вводили в Bacillus thuringiensis ВТ013А, и споры были получены путем выращивания ночной культуры трансформированного Bacillus на бульоне в сердечно-мозговой вытяжкой, высевания на чашки с питательным агаром при 30°С и последующего выращивания в течение 3 дней. Споры смывали с чашек и промывали 3 раза в натрий-фосфатном буфере. Культуры Saccharomyces cerevisiae выращивали в течение ночи в бульоне YZ при 37°С. После этого ночную культуру осаждали, промывали в натрий-фосфатном буфере и ресуспендировали в натрий-фосфатном буфере при Abs595=0,2. ВЭВ в концентрации 1×104, экспрессирующую β-1,3-глюканазу, инкубировали в натрий-фосфатном буфере с Saccharomyces в течение 1 часа при 37°С со встряхиванием. Контрольный образец Saccharomyces не обрабатывали (без спор ВЭВ). После 3 часов инкубации делали разведение Saccharomyces на чашках и инкубировали при 37°С в течение ночи. На следующий день культуры Saccharomyces подсчитывали и определяли процент погибших. В таблице 12 ниже показана активность уничтожения спорами ВЭВ, экспрессирующими β-1,3-глюканазу. Фермент, экспрессируемый ВЭВ, уничтожил значительное количество клеток Saccharomyces. Это может непосредственно привести к уничтожению грибковых микроорганизмов на ризосфере, семени или другом растительном материале. Выбор белков, специфичных для некоторых классов грибов, также может изменить популяцию микроорганизмов в районе растения в выгодную сторону, или селективно воздействовать на ключевые грибковые патогены.

Пример 18. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих пептиды или белки, стимулирующие иммунную систему растений, для защиты растений от патогенов.

[00262] Система ВЭВ также может быть использована для выведения пептидов и белков, усиливающих иммунную систему растений. Эти белки могут экспрессироваться на внешней стороне споры ВЭВ доставляться в среду для роста растений, для стимуляции иммунной системы растений, чтобы позволить растению, защищать себя от фитопатогенов. Белки и пептиды-примеры включают гарпин, α-эластин, β-эластин, системин, фенилаланин аммиак-лиазу, элиситин, дефензин, криптогеин и белок и пептид флагеллина. Воздействие этих белков и пептидов на растение будет стимулировать устойчивость ко многим растительным патогенам в растениях.

[00263] Любой из этих белков или пептидов может быть включен в систему ВЭВ для выведения на спорах ВЭВ с помощью способов, аналогичных тем, которые описаны выше в примере 1. Также может быть получена гибридная конструкция, включающая фермент и сигнальную последовательность, которая транспортирует фермент в экзоспорий, если гибридная конструкция экспрессируется в представителе семейства Bacillus cereus. Данная гибридная конструкция затем экспрессируется в представителе семейства Bacillus cereus, и представитель семейства Bacillus cereus вносится в почву или другую среду для роста растений для защиты растений от патогенов.

Пример 19. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих белок или пептид, связывающийся с корнем или листом, для иммобилизации рекомбинантного представителя семейства Bacillus cereus на корневой системе растения или листьях растения.

[00264] Белки или пептиды, связывающиеся с корнем или листом, могут также быть включены в систему ВЭВ, чтобы иммобилизировать споры ВЭВ на корневой системе или на листьях растения. Выведение на ВЭВ таких лигандов, связывающихся с корнем или листом, позволяет транспортировать споры на корневую систему растения или субструктуру корневой системы, или на листья, или на субструктуру листьев для сохранения споры ВЭВ в месте, оптимальном для того, чтобы другие выведенные биологические молекулы и ферменты были эффективными.

[00265] Например, rhicadhesin представляет собой лиганд, связывающийся с корнем, который связывается с корневыми волосками. Таким образом, выведение rhicadhesin на спорах ВЭВ приводит к транспортировке спор на корневые волоски. Дополнительные белки, которые можно использовать для избирательного связывания с корнем или листьями растений, включают адгезины, флагеллины, омптины, лектины, нитевидные белки, белки curlus, интимины, инвазины, агглютинин, нефибриальные белки, TasA или YuaB.

[00266] Такие белки или пептиды, связывающиеся с корнем или листом, могут быть включены в систему ВЭВ с использованием способов, аналогичных описанным выше в примере 1. Также может быть получена гибридная конструкция, включающая белок или пептид, связывающиеся с корнем или листом, и сигнальную последовательность, которая транспортирует белок или пептид в экзоспорий, если гибридная конструкция экспрессируется в представителе семейства Bacillus cereus. После этого гибридная конструкция, содержащая лиганд, связывающийся с корнем или листом, экспрессируется в представителе семейства Bacillus cereus. Такие гибридные конструкции могут экспрессироваться совместно с одной или более дополнительной гибридной конструкцией, включающей любой из полезных ферментов, описанных в данном документе (например, фермент, участвующий в синтезе растительного гормона, фермент, разрушающий источник питательных веществ, или протеазы, защищающие растение от патогена). Рекомбинантный представитель семейства Bacillus cereus вносится в почву или другую среду для роста растений или применяется к листьям растения. Лиганд, связывающийся с корнем или листом, транспортирует представителя семейства Bacillus cereus на корневую систему растения или на листья растения и иммобилизует его там, позволяя таким образом дополнительно экспрессированной гибридной конструкции оказывать воздействие в непосредственной близости к корневой системе или листьям.

Пример 20. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих ферменты для повышения устойчивости растений к стрессу.

[00267] Белки, пептиды и ферменты, которые повышают устойчивость к стрессу в растении могут быть включены в систему ВЭВ и доставлены в целевые растения путем введения в корни, листья или среду для роста растений. В периоды стресса, растения выделяют соединения, связанные со стрессом, в том числе аминоциклопропан-1 карбоновую кислоту (АКК), активные формы кислорода и другие, что отрицательно влияет на рост растения. Система ВЭВ может быть использована для выведения ферментов, которые расщепляют такие связанные со стрессом соединения, такие как дезаминаза аминоциклопропан-1-карбоновой кислоты, супероксиддисмутазы, оксидазы, каталазы и другие ферменты, которые действуют на реактивные формы кислорода. Эти ферменты снижают количество этих вызванных стрессом соединений и позволяют растениям расти и даже развиваться при стрессовых условиях.

[00268] Любой из этих белков или пептидов может быть включен в систему ВЭВ для выведения на спорах ВЭВ с помощью способов, аналогичных тем, которые описаны выше в примере 1. Может быть получена гибридная конструкция, содержащая фермент и сигнальную последовательность, которая направляет фермент в экзоспорий, если гибридная конструкция экспрессируется в представителе семейства Bacillus cereus. Затем гибридная конструкция экспрессируется в представителе семейства Bacillus cereus, и представитель семейства Bacillus cereus добавляется в почву или другую среду для роста растений или применяется к листьям растения для повышения устойчивости растения к стрессу.

Пример 21. Получение спор ВЭВ, экспрессирующих защитный фермент каталазу.

[00269] Синтезировали ген, который кодировал защитный фермент каталазу из Bacillus cereus, связанный с сигнальной последовательностью BetA (SEQ ID NO: 61), под контролем промотора BetA (SEQ ID NO: 86). Этот ген был введен в Bacillus Thuringiensis ВТ013А. Споры были получены путем выращивания культур трансформированного Bacillus и штамма дикого типа в сердечно-мозговым бульоне в течение ночи, высаживания на питательные чашки с агаром при 30°С, после чего их оставляли расти в течение 3 дней. Споры смывались с чашек и промывались 3 раза в натрий-фосфатном буфере. Было добавлено 3 капли перекиси водорода в каждую гранулу спор. Фермент каталаза преобразует пероксид водорода на воду и газ О2. Контрольные спор не пенились, в то время как ВЭВ споры с каталазой активно это делали, демонстрируя активность фермента на поверхности спор. Другие защитные ферменты могут выводиться аналогичным образом и доставляться в растение для влияния на свободные радикалы, образующиеся во растениями во время стресса.

Пример 22. Использование рекомбинантных представителей семейства Bacillus cereus, выводящих белки или ферменты, которые защищают семена или растения от стрессовой среды.

[00270] Белки, пептиды и ферменты, которые защищают растение от воздействия окружающей среды, могут быть включены в систему ВЭВ и доставлены в целевые растения путем введения в корни, листья, плоды или в среду роста растений. В периоды замерзания растения могут быть повреждены действием льда. Система ВЭВ может быть использована для выведения пептидов, белков или ферментов, которые защищают растения от таких эффектов. Например, система ВЭВ может быть использована для выведения холин дегидрогеназ, которые действуют путем создания защитных продуктов, которые защищают растения или семена от мороза. Субстраты для этих ферментов (например, холин и/или производные холина) также могут быть добавлены в среду роста растений. Добавление таких субстратов может увеличить количество защитного вещества (бетаин и подобные соединения), образованного в растении ферментами, экспрессированными в ВЭВ. Известно, что производные бетаина защищают семена от холодового стресса.

[00271] Любой из этих белков или пептидов может быть включен в систему ВЭВ для выведения на ВЭВ спорах, используя способы, аналогичные описанным выше в примере 1. Гибридная конструкция может быть сделана так, чтобы включать фермент и сигнальную последовательность, которая направляет фермент в экзоспорий, при условии, что гибридная конструкция экспрессируется в представителе семейства Bacillus cereus. Затем гибридная конструкция экспрессируется в представителе семейства Bacillus cereus, и представитель семейства Bacillus cereus добавляется в почву или другую среду для роста растений или применяется к листьям растения для защиты растения от воздействий и факторов окружающей среды.

Пример 23. Усиленная экспрессия гибридных конструкций в системе ВЭВ с использованием усиленых или альтернативных элементов промотора.

[00272] Система ВЭВ может выявлять широкий спектр белков, пептидов и ферментов, используя одну или более сигнальных последовательностей, описанных в данном документе. Некоторые из этих сигнальных последовательностей имеют высокое сродство к экзоспорию, что было бы полезным для экспрессии гибридного белка, но низкий уровень экспрессии гибридного белка ограничивает их использование в системе ВЭВ. Для таких гибридных белков и последовательностей могут быть использованы альтернативные сильные промоторы споруляции вместо нативных промоторов.

[00273] Например, SEQ ID №: 13 (аминокислоты 1-39 из гена 3572 В. weihenstephensis КВАВ4) обеспечивает очень эффективную N-концевую последовательность для доставки белков в экзоспорий представителей семейства Bacillus cereus, как показано ниже в таблице 13. Все гены были синтезированы в полноразмерной форме (включая промоторные области и области, кодирующие гибридные белки), как описано в данном документе. При использовании нативных элементов промотора гена 3572 В. weihenstephensis КВАВ4 (SEQ ID №: 88) для экспрессии гибридного белка, содержащего сигнальную последовательность из SEQ ID №: 13 слитую с ферментом β-галактозидазой (из Е. coli), наблюдали низкий уровень экспрессии гибридного белка, что приводило к снижению ферментативной активности на поверхности спор. Активность фермента измеряли по превращению 0,5 М о-нитрофенилгалактозида в растворе в течение 10 минут.Ферментативное превращение измеряли с помощью спектрофотометра при ABS540. Замена нативных элементов промотора гена 3572 В. weihenstephensis КВАВ4 на сильные промоторы SEQ ID №: 86 (В. anthracis BetA/BAS3290) или SEQ ID №: 89 (YVTN β-пропеллер белок В. weihenstephensis КВАВ4) привела к значительному увеличению ферментативной активности спор. С другой стороны, замена нативных элементов промотора гена 3572 В. weihenstephensis КВАВ4 на нативный промотор Sterne BAS1882 В. anthracis (SEQ ID №: 87) привела к снижению ферментативной активности спор. Уровень экспрессии сигнальной последовательности SEQ ID №: 13, слитой с β-галактозидазой, был значительно ниже (0,38х), когда контролировался промотором BAS1882 (SEQ ID №: 87), и был значительно улучшен, когда контролировался промотором BetA (SEQ ID №: 86) или промотором белка YVTN (SEQ ID №: 89).

Пример 24. Изолирование и идентификация бактериальных штаммов, усиливающих рост растений.

[00274] Были отобраны образцы грунта из ризосфер наиболее здоровых и наиболее устойчивых растений картофеля (Solanum tuberosum), тыквы обыкновенной (Cucurbita реро), томата (Solarium lycopersicum) и фасоли огненно-красной (Phaseolus coccineus), разведены в стерильной воде и нанесены на чашки с агаризированной питательной средой. Бактериальные изоляты, показавшие высокие темпы роста и которые можно было пассировать и размножать, были отобраны для дальнейшего изучения. Выбранные штаммы выращивали на минимальной среде (KH2PO4 3 г, Na2HPO4 6 г, NH4Cl 1 г, NaCl 0,50 г, MgSO42О 0,15 г, CaCl22О 0,013 г и глюкоза 1 г на л сухого веса). Ночные культуры (30°С) выбранных штаммов осаждали, удаляли среду и ресуспендировали в равном количестве дистиллированной воды. Для одной обработки десять семян салата латука были посажены на глубину 1 см в суглинистый верхний слой почвы (Колумбия, МО), который просеивали для удаления крупных частиц. При посадке в 4 см горшки семена инокулировали 0,5 мкл бактерий, ресуспендированных в воде, смешанными с 10 мл Н2О. Десять мл Н2О было достаточно для разнесения бактерий в 3 дюймах3 (7,62 см3) почвы, а также для насыщения почвы для надлежащего прорастания семян. Растения выращивали при температуре 65-75°F (18-24°С) при 11-часовом световом дне и с поливом по 5 мл каждые 3 дня. Через неделю данные по высоте растений и диаметру листьев, а также по общему физиологическому состоянию растений были собраны. Предварительный скрининг ризосферных изолятов привел в результате к получению более чем 200 различных видов бактерий и грибков из ризосферы четырех растений. Некоторые из видов бактерий описаны в таблице 14. Идентифицированные штаммы указаны под своими присущими бактериальными названиями. Другие штаммы указаны под неизвестным идентификационным номером. Инокулянты, давшие результаты вблизи контроля (±2%), не были включены в таблицу.

[00275] Бактериальные штаммы, произведшие наибольшее влияние на общее физиологическое состояние растения и высоту растения в предварительном испытании на салате латуке, в дальнейшем идентифицировались. Бактериальные штаммы выращивали в течение ночи в бульоне Лурии-Бертани при 37°С, и ночные культуры осаждали в центрифуге. Среду удаляли, а из оставшегося бактериального осадка выделяли хромосомную ДНК с помощью набора Qiagen Bacterial Chromosomal DNA Isolation. Хромосомную ДНК подвергали ПЦР-амплификации 16S рРНК кодирующих областей с использованием праймеров E338F 5'- ACT ССТ ACG GGA GGC AGC AGT -3' (SEQ ID №: 122), E1099R А 5'- GGG TTG CGC TCG TTG С -3' (SEQ ID №: 123) и E1099R В 5'-GGG TTG CGC TCG ТТА С-3' (SEQ ID №: 124). ПЦР ампликоны очищали, используя набор Promega PCR purification, и полученные ампликоны разводили и отправляли в университет Миссури (DNA Core) для секвенирования ДНК. Последовательности ДНК сравнивали с базой данных NCBI BLAST бактериальных изолятов, и род и вид идентифицировали путем непосредственного сравнения с известными штаммами. Наиболее хорошо идентифицированные виды приведены в таблице 14. Во многих случаях по последовательностям ДНК 16S рРНК можно было лишь определить род выбранного бактериального штамма. В тех случаях, когда прямая идентификация не удалась, проводили дополнительные биохимические анализы с использованием стандартных в данной области техники способов для дифференцирования штаммов на видовом и штаммовом уровнях, и они приведены в таблице 15.

Пример 25. Изолирование и идентификация дополнительных бактериальных штаммов, усиливающих рост растений.

[00276] Были отобраны образцы грунта из сельскохозяйственных полей вблизи г. Газа, штат Канзас, разбавлены в стерильной воде и нанесены на чашки с агаризированной питательной средой. Бактериальные изоляты, продемонстрировавшие высокие темпы роста и которые можно было пассировать и размножать, были отобраны для дальнейшего изучения. Выбранные штаммы выращивали на минимальной среде (КН2РО4 3 г, Na2HPO4 6 г, NH4Cl 1 г, NaCl 0,50 г, MgSO4 7H2O 0,15 г, CaCl2 2H2O 0,013 г и глюкоза 1 г на л сухого веса). Ночные культуры (30°С) выбранных штаммов осаждали, удаляли среду и ресуспендировали в равном количестве дистиллированной воды. Семена кукурузы покрывали коммерческим полимером для семян, смешанным только с водой (1,6 мкл на все семена), или коммерческим полимером для семян, содержащим выбранные бактериальные штаммы (1,6 мкл на все семена). Покрытые семена сажали в 3-дюймовые (7,62 см в диаметре) горшки на глубину 1 дюйм (2,54 см) в суглинистый верхний слой почвы (Колумбия, МО), который просеивали для удаления крупных частиц. Растения выращивали при температуре 18-24°С (65-75°F) при 11-часовом световом дне и с поливом по 50 мл каждые 3 дня. Через две недели данные по высоте растений и диаметру листьев, а также по общему физиологическому состоянию растений были собраны. Для анализа прорастания и определения длины 3-дневного корня, семена покрывали так, как указано ранее, и равномерно распределяли по 10 семян на бумажное полотенце. Бумажные полотенца смачивали 10 мл воды, скручивали, помещали в небольшой пластиковый пакет и инкубировали при 30°С или помещали на подогреваемый коврик для прорастания при 27-30°С (80-85°F). Измерения корней регистрировали после 3 дней. Предварительный скрининг ризосферных изолятов привел в результате к получению более чем 100 различных видов бактерий и грибков из ризосферы. Некоторые из бактериальных видов описаны в таблице 16. Идентифицированные штаммы указаны под своими присущими бактериальными названиями.

[00277] Бактериальные штаммы, произведшие наибольшее влияние на общее физиологическое состояние растения, описаны в таблице 16. Бактериальные штаммы выращивали в течение ночи в бульоне Лурии-Бертани при 37°С, и ночные культуры осаждали в центрифуге. Среду удаляли, а из оставшегося бактериального осадка выделяли хромосомную ДНК с помощью набора Qiagen Bacterial Chromosomal DNA Isolation. Хромосомную ДНК подвергали ПЦР-амплификации 16S рРНК кодирующих областей с использованием праймеров E338F 5'-АСТ ССТ ACG GGA GGC AGC AGT-3' (SEQ ID №: 122), E1099R A 5'-GGG TTG CGC TCG TTG С-3' (SEQ ID №: 123) и E1099R В 5'-GGG TTG CGC TCG ТТА С-3' (SEQ ID №: 124). ПЦР ампликоны очищали, используя набор Promega PCR purification, и полученные ампликоны разводили и отправляли в университет Миссури (DNA Core) для секвенирования ДНК. Последовательности ДНК сравнивали с базой данных NCBI BLAST бактериальных изолятов, и род и вид идентифицировали путем непосредственного сравнения с известными штаммами. Наиболее хорошо идентифицированные виды приведены в таблице 16. Во многих случаях по последовательностям ДНК 16S рРНК можно было лишь определить род выбранного бактериального штамма. В тех случаях, когда прямая идентификация не удалась, проводили дополнительные биохимические анализы с использованием стандартных в данной области техники способов для дифференцирования штаммов на видовом и штаммовом уровнях, и дифференцированные штаммы приведены в таблице 17.

Пример 26. Тестирование бактериальных штаммов, усиливающих рост растений, на люцерне.

[00278] Выбранные штаммы выращивали на минимальной среде (КН2РО4 3 г, Na2HPO4 6 г, NH4Cl 1 г, NaCl 0,50 г, MgSO42О 0,15 г, CaCl22О 0,013 г и глюкоза 1 г на л сухого веса). Ночные культуры (30°С) выбранных штаммов осаждали, удаляли среду и ресуспендировали в равном количестве дистиллированной воды. Для каждой обработки десять семян люцерны, покрытые Zeba полимером, были посажены на глубину 0,6 см в суглинистый верхний слой почвы (Колумбия, МО), который просеивали для удаления крупных частиц. При посадке семена инокулировали 0,5 мкл бактерий, ресуспендированных в воде, смешанными с 10 мл Н2О. Десять мл Н2О было достаточно для разнесения бактерий в 3 дюймах3 (7,62 см3) почвы, а также для насыщения почвы для надлежащего прорастания семян. Растения выращивали при температуре 65-75°F (18-24°С) при 11-часовом световом дне и с поливом по 5 мл каждые 3 дня. Люцерну растили в течение 1 недели для анализирования появления и начального прироста растений в описанных условиях. Идентифицированные штаммы, указанные под своими присущими бактериальными названиями, и конечные данные о высоте приведены в таблице 18.

Пример 27. Тестирование бактериальных штаммов, усиливающих рост растений, на огурцах.

[00279] Выбранные штаммы выращивали на минимальной среде (КН2РО4 3 г, Na2HPO4 6 г, NH4Cl 1 г, NaCl 0,50 г, MgSO42О 0,15 г, CaCl2 2H2O 0,013 г и глюкоза 1 г на л сухого веса). Ночные культуры (30°С) выбранных штаммов осаждали, удаляли среду и ресуспендировали в равном количестве дистиллированной воды. Для каждой обработки десять семян огурцов были посажены на глубину 1 см в суглинистый верхний слой почвы (Колумбия, МО), который просеивали для удаления крупных частиц. При посадке семена инокулировали 0,5 мкл бактерий, ресуспендированных в воде, смешанными с 10 мл Н2О. Десять мл Н2О было достаточно для разнесения бактерий в 3 дюймах3 (7,62 см3) почвы, а также для насыщения почвы для надлежащего прорастания семян. Растения выращивали при температуре 65-75°F (18-24°С) при 11-часовом световом дне и с поливом по 5 мл каждые 3 дня. Огурцы растили в течение 2 недель для анализирования появления и начального прироста растений в описанных условиях. Идентифицированные штаммы, указанные под своими присущими бактериальными названиями, и конечные данные о высоте приведены в таблице 19.

Пример 28. Тестирование бактериальных штаммов, усиливающих рост растений, на тыкве.

[00280] Выбранные штаммы выращивали на минимальной среде (KH2PO4 3 г, Na2HPO4 6 г, NH4Cl 1 г, NaCl 0,50 г, MgSO4 7H2O 0,15 г, CaCl22О 0,013 г и глюкоза 1 г на л сухого веса). Ночные культуры (30°С) выбранных штаммов осаждали, удаляли среду и ресуспендировали в равном количестве дистиллированной воды. Для каждой обработки десять семян тыквы были посажены на глубину 1 см в суглинистый верхний слой почвы (Колумбия, МО), который просеивали для удаления крупных частиц. При посадке семена инокулировали 0,5 мкл бактерий, ресуспендированных в воде, смешанными с 10 мл Н2О. Десять мл Н2О было достаточно для разнесения бактерий в 3 дюймах3 (7,62 см3) почвы, а также для насыщения почвы для надлежащего прорастания семян. Растения выращивали при температуре 65-75°F (18-24°С) при 11-часовом световом дне и с поливом по 5 мл каждые 3 дня. Тыкву растили в течение 2 недель для анализирования появления и начального прироста растений в описанных условиях. Идентифицированные штаммы, указанные под своими присущими бактериальными названиями, и конечные данные о высоте и конечном диаметре листа (по ширине двух листьев) приведены в таблице 20.

Пример 29. Тестирование бактериальных штаммов, усиливающих рост растений, на плевеле.

[00281] Выбранные штаммы выращивали на минимальной среде (КН2РО4 3 г, Na2HPO4 6 г, NH4Cl 1 г, NaCl 0,50 г, MgSO42О 0,15 г, CaCl22О 0,013 г и глюкоза 1 г на л сухого веса). Ночные культуры (30°С) выбранных штаммов осаждали, удаляли среду и ресуспендировали в равном количестве дистиллированной воды. Для каждой обработки тридцать семян плевела были посажены на глубину 0,3 см в суглинистый верхний слой почвы (Колумбия, МО), который просеивали для удаления крупных частиц. При посадке семена инокулировали 0,5 мкл бактерий, ресуспендированных в воде, смешанными с 10 мл Н2О. Десять мл Н2О было достаточно для разнесения бактерий в 3 дюймах3 (7,62 см3) почвы, а также для насыщения почвы для надлежащего прорастания семян. Растения выращивали при температуре 65-75°F (18-24°С) при 11-часовом световом дне и с поливом по 5 мл каждые 3 дня. Плевел растили в течение 1,5 недели для анализирования появления и начального прироста растений в описанных условиях. Идентифицированные штаммы, указанные под своими присущими бактериальными названиями, и конечные данные о высоте приведены в таблице 21.

Пример 30. Тестирование бактериальных штаммов, усиливающих рост растений, на кукурузе.

[00282] Выбранные штаммы выращивали на минимальной среде (КН2РО4 3 г, Na2HPO4 6 г, NH4Cl 1 г, NaCl 0,50 г, MgSO42О 0,15 г, CaCl2 2H2O 0,013 г и глюкоза 1 г на л сухого веса). Ночные культуры (30°С) выбранных штаммов осаждали, удаляли среду и ресуспендировали в равном количестве дистиллированной воды. Для каждой обработки десять семян кукурузы были посажены на глубину 2,5 см в суглинистый верхний слой почвы (Колумбия, МО), который просеивали для удаления крупных частиц. При посадке семена инокулировали 0,5 мкл бактерий, ресуспендированными в воде, смешанными с 10 мл Н2О. Десять мл Н2О было достаточно для разнесения бактерий в 3 дюймах3 (7,62 см3) почвы, а также для насыщения почвы для надлежащего прорастания семян. Растения выращивали при температуре 65-75°F (18-24°С) при 11-часовом световом дне и с поливом по 5 мл каждые 3 дня. Кукурузу растили в течение 2 недель для анализирования появления и начального прироста растений в описанных условиях. Идентифицированные штаммы, указанные под своими присущими бактериальными названиями, и конечные данные о высоте приведены в таблице 22.

Пример 31. Тестирование бактериальных штаммов, усиливающих рост растений, на сое.

[00283] Выбранные штаммы выращивали на минимальной среде (КН2РО4 3 г, Na2HPO4 6 г, NH4Cl 1 г, NaCl 0,50 г, MgSO4 7H2O 0,15 г, CaCl22О 0,013 г и глюкоза 1 г на л сухого веса или для Bradyrhizobium или Rhizobium на дрожжевой среде с маннитолом). Ночные культуры (30°С) выбранных штаммов осаждали, удаляли среду и ресуспендировали в равном количестве дистиллированной воды. Для каждой обработки десять семян сои были посажены на глубину 2,5 см в суглинистый верхний слой почвы (Колумбия, МО), который просеивали для удаления крупных частиц. При посадке семена инокулировали 0,5 мкл бактерий, ресуспендированных в воде, смешанными с 10 мл Н2О. При тестировании двух бактериальных штаммов 0,5 мкл каждой суспензии бактерий смешивали с 10 мл Н2О. Десять мл Н2О было достаточно для разнесения бактерий в 3 дюймах3 (7,62 см3) почвы, а также для насыщения почвы для надлежащего прорастания семян. Растения выращивали при температуре 65-75°F (18-24°С) при 11-часовом световом дне и с поливом по 5 мл каждые 3 дня. Сою растили в течение 2 недель для анализирования появления и начального прироста растений в описанных условиях. Идентифицированные штаммы указаны под своими присущими бактериальными названиями и конечные данные о высоте приведены в таблице 23. Ко-инокуляция бактериальных штаммов по данному изобретению с представителями Bradyrhizobium sp.или Rhizobium sp.привела к увеличению роста растений по сравнению с любым единичным инокулянтом.

Пример 32. Члены семейства Bacillus cereus, обладающие свойствами усиления роста растений.

[00284] Bacillus mycoides штамм ВТ155, Bacillus mycoides штамм ЕЕ118, Bacillus mycoides штамм EE141, Bacillus mycoides штамм BT46-3, член семейства Bacillus cereus штамм EE349, Bacillus thuringiensis штамм BT013A и Bacillus megaterium штамм EE281 выращивали в бульоне Лурии-Бертани при 37°С, и ночные культуры осаждали, удаляли среду и ресуспендировали в равном количестве дистиллированной воды. Для каждой обработки 20 семян кукурузы были посажены на глубину 2,5 см в суглинистый верхний слой почвы (Колумбия, МО), который просеивали для удаления крупных частиц. При посадке семена инокулировали 0,5 мкл бактерий, ресуспендированных в воде, смешанными с 50 мл Н2О. Пятьдесят мл Н2О было достаточно для разнесения бактерий в 29 дюймах3 (442,5 см3) почвы, а также для насыщения почвы для надлежащего прорастания семян. Растения выращивали при температуре 65-72°F при 13-часовом световом дне и с поливом по 5 мл каждые 3 дня. Саженцы растили в течение 2 недель для анализирования появления и начального прироста растений в описанных условиях. Идентифицированные штаммы указаны под своими присущими бактериальными названиями и конечные данные о высоте приведены в таблице 24.

Все протестированные бактерии, усиливающие рост растений, оказали благоприятное влияние на высоту кукурузы на вторую неделю в описанных условиях. Член семейства Bacillus cereus штамм ЕЕ128 имел наибольший эффект в этом испытании, давая более чем 14% прироста высоты кукурузы.

Пример 33. Повышенный отбор членов семейства Bacillus cereus для скрининга на усиленный рост растений и другие полезные изменения, как хозяина для ВЭВ экспрессии.

[00285] Система ВЭВ может быть использована для выявления широкого спектра белков, пептидов и ферментов с использованием любой из сигнальных последовательностей, описанных в данном документе, для обеспечения полезных сельскохозяйственных эффектов. Дополнительные полезные эффекты могут быть получены путем отбора хозяина для экспрессии (члена семейства Bacillus cereus), имеющего присущие полезные свойства. Многие штаммы членов семейства Bacillus cereus имеют преимущества по улучшению роста растений. Кроме того, многие штаммы членов семейства Bacillus cereus обеспечивают наличие защитных эффектов, посредством прямых фунгицидных, инсектицидных, нематоцидных или других защитных действий. При использовании таких штаммов в качестве хозяина для экспрессии в системе ВЭВ, конечный споровый продукт будет иметь комбинацию положительных преимуществ для сельского хозяйства.

[00286] Таблица 25 предоставляет результаты экспериментов, в которых гибридный белок экспрессировался в различных штаммах членов семейства Bacillus cereus. Все штаммы экспрессировали гибридный белок, содержащий аминокислоты 1-35 из SEQ ID №: 1, и фосфатазу PhoA4 из Bacillus subtilis, фермент, полезный для интенсивного поглощение фосфата, в кукурузе. Ген был синтезирован, клонирован в вектор рМК4 и введен в каждый из Bacillus spp., указанный ниже в таблице 25. Штаммы вводили в споруляцию путем инкубации при 30°С на чашках с питательной агаризированной средой, содержащей 10 мкг/мл хлорамфеникола, в течение трех дней. Споры собирали, промывали и применяли к кукурузе при посадке с показателем 1×105 КОЕ/мл в 50 мл воды на горшок с диаметром 7,62 см с 5 мг полифосфата на горшок. Кукурузу выращивали в иловой суглинистой почве в течение двух недель. Растения выращивали при идеальном освещении, используя лампы Т5, 54 Вт, и 13-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение двухнедельного испытания. По окончанию двух недель измеряли высоту каждого растения, и измерения были нормированы по контролю спор Bacillus thuringiensis. Экспрессия гибридного белка SEQ ID №: 1-фосфатаза привела к увеличению высоты кукурузы на 2-ю неделю, независимо от выбранного для экспрессии штамма хозяина. Как показано в таблице 25, использование члена семейства Bacillus cereus, усиливающего рост растений, дополнительно увеличивало высоту кукурузы.

Пример 34. Использование различных сигнальных последовательностей для экспрессии β-галактозидазы на поверхности Bacillus thuringiensis.

[00287] Широкое разнообразие сигнальных последовательностей, имеющих высокую степень гомологии с аминокислотами 20-35 из BclA (аминокислоты 20-35 из SEQ ID №: 1), может быть использовано для выявления ферментов, белков и пептидов на поверхности членов семейства Bacillus cereus. Несколько сигнальных последовательностей сравнивали путем создания гибридных белков, содержащих сигнальные последовательности, связанные с липазой Bacillus subtilis. Гибридные конструкции синтезировали, используя нативные для сигнальных последовательностей промоторы, клонировали в репликативную плазмиду рМК4 и вводили в Bacillus thuringiensis ВТ013А. Штаммы вводили в споруляцию путем инкубации при 30°С на чашках с питательной агаризированной средой, содержащей 10 мкг/мл хлорамфеникола, в течение трех дней. Споры собирали, промывали и ресуспендировали в натрий-фосфатном буфере до показателя 1×108/мл. Использовали 1×105 спор для каждой гибридной конструкции, споры суспендировали в 400 мкл дистилированной Н2О. Реакционные смеси нагревались реакционными компонентами до желаемой температуры реакции (40°С). Добавляли 200 мкл рабочего буфера (9:1 раствор А: раствор Б). Раствор А содержал 50 мМ Трис рН 10 и 13,6 мМ деоксихолевую кислоту, а раствор Б содержал 3 мг/мл р-нитрофенил пальмитат в изопропаноле. Реакционную смесь инкубировали при 40°С в течение 10 минут и помещали в лед, центрифугировали для удаления спор, и регистрировали оптическую плотность при 420 нм. Результаты показаны ниже в таблице 26. Активность была нормирована по контрольному гибридному белку, содержащему аминокислоты 1-35 из SEQ ID №: 1, слитые с липазой Bacillus subtilis.

[00288] Связывание нескольких сигнальных последовательностей с липазой приводит к более высоким уровням экспрессии и активности фермента на поверхности спор. В частности, SEQ ID №№60, 62 и 64, каждый из которых содержит более короткую сигнальную последовательность, приводило в результате к усиленной гибридной экспрессии на поверхности ВЭВ спор. Все гибридные белки, содержащие тестированные сигнальные последовательности, приводили к выявлению на поверхностности липазы.

Пример 35. Использование различных последовательностей экзоспория для экспрессии липазы на поверхности Bacillus thuringiensis и демонстрация локализации гибридного белка на поверхности экзоспория.

[00289] Широкое разнообразие белков экзоспория может быть использовано для выявления ферментов, белков и пептидов на поверхности членов семейства Bacillus cereus. Несколько различных белков экзоспория сравнивали путем создания гибридных белков, содержащих белки экзоспория, связанные с липазой Bacillus subtilis, как описано в примере 34. Гибридные конструкции синтезировали, используя нативный для белка экзоспория промотор, указанный ниже в таблице 27, клонировали в репликативную плазмиду рМК4 и вводили в Bacillus thuringiensis ВТ013А. Споры, выявляющие различные гибриды белка экзоспория-липазы Bacillus subtilis 168, были получены путем выращивания трансформированных бактерий в бульоне с сердечно-мозговой вытяжкой при селективном давлении 10 мкг/мл хлорамфеникола, высеванием на чашки с питательной агаризированной средой и инкубированием при 30°С в течение 3 дней. После 3 дней споры смывали с чашек, очищали центрифугированием и ресуспендировали в натрий-фосфатном буфере до 1×108 КОЕ/мл.

[00290] 1×105 спор для каждой гибридной конструкции суспендировали в 400 мкл дистилированной Н2О. Реакционные смеси нагревались реакционными компонентами до желаемой температуры реакции (40°С). Добавляли 200 мкл рабочего буфера (9:1 раствор А: раствор Б). Раствор А содержал 50 мМ Трис рН 10 и 13,6 мМ деоксихолевую кислоту, а раствор Б содержал 3 мг/мл р-нитрофенил пальмитат в изопропаноле. Реакционную смесь инкубировали при 40°С в течение 10 минут и помещали в лед, центрифугировали для удаления спор, и регистрировали оптическую плотность при 420 нм. Результаты показаны ниже в таблице 27. Активность была нормирована по SEQ ID №: 72, связанному с липазой.

[00291] Использование белков экзоспория из SEQ ID №№72 и 73 привело в результате к самой высокой активности фермента на споре. Все гибридные белки, содержащие белки экзоспория, в результате выявляли на поверхности активную липазу Bacillus subtilis 168, хотя на различных уровнях.

[00292] С использованием флуоресцентного репортера mCherry было показано, что дополнительные белки экзоспория в результате направляли гибридные белки в экзоспорий. Были созданы гибридные конструкции, включающие белки экзоспория из SEQ ID №№74, 83 и 73, присоединенные к репортеру mCherry. Споры выращивали в течение 1,5 дня, собирали и ресуспендировали, как описано ранее. 7 мкл флуоресцентных спор клали под микроскоп Nikon E1000 и делали изображения во время поздней споруляции. Круговая локализация в кольце указывает на локализацию внешнего слоя споры, а проявление соответствует белку экзоспория. Результаты флуоресцентной микроскопии проиллюстрированы на фигуре 2. Фиг. 2А, 2Б и 2В представляют собой изображения флуоресцентной микроскопии спор, экспрессирующих гибридные белки, содержащие белки экзоспория из SEQ ID №№74, 83 и 73, соответственно, и репортер mCherry. Все три гибрида продемонстрировали высокий уровень флуоресценции и локализации на экзоспорий, демонстрируя свою потенциальную полезность для экспрессии чужеродных белков на поверхности экзоспория.

Пример 36. Использование различных сигнальных последовательностей и белков экзоспория для экспрессии фосфатазы в спорах Bacillus subtilis, и воздействия спор, содержащих фосфатазу, в сое.

[00293] ВЭВ споры, экспрессирующие фосфатазу А4 (PhoA4) Bacillus subtilis ЕЕ148, были созданы путем генного синтеза генов, кодирующих различные сигнальные последовательности и белки экзоспория под контролем нативных промоторов, связанных с PhoA4. Синтезированные гены были клонированы в рМК4 и введены в Bacillus thuringiensis ВТ013А. Споры, выявляющие различные гибриды белка экзоспория-PhoA4 Bacillus subtilis ЕЕ148, были получены путем выращивания трансформированных бактерий в бульоне с сердечно-мозговой вытяжкой при селективном давлении 10 мкг/мл хлорамфеникола, высеванием на чашки с питательной агаризированной средой и инкубированием при 30°С в течение 3 дней. После 3 дней споры смывали с чашек, очищали центрифугированием и ресуспендировали в натрий-фосфатном буфере до 1×108 КОЕ/мл.

[00294] Сою сажали на глубину 2,54 см в горшки глубиной 10 см, наполненные стандартным суглинистым верхним слоем почвы. ВЭВ споры, экспрессирующие PhoA4, разводили до концентрации 1×104/мл в 50 мл воды и применяли к каждому растению при посадке. Также включали контроль только с водой. Полифосфат добавляли в горшки в форме жидкости в рассчете 0,5 мг/горшок. Растения выращивали при идеальном освещении, используя лампы Т5, 54 Вт, и 13-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение двухнедельного испытания. По окончанию двух недель измеряли высоту каждого растения, и измерения были нормированы по контролю растения только с водой.

[00295] Результаты приведены в таблице 28. Сою выращивали в присутствии ВЭВ спор, экспрессирующих гибридные белки, содержащие PhoA4, связанную с различными сигнальными последовательностями, и белки экзоспория с различными партнерами слияния, с PhoA4 все демонстрировали усиленный рост, но продолжительность влияния варьировала в зависимости от используемой сигнальной последовательности или белка экзоспория.

Пример 37. Совместное применение ВЭВ спор с обработками семян, жидкими удобрениями и другими добавками.

[00296] ВЭВ споры, экспрессирующие гибридные белки, тестировали на совместимость с различными обработками семян. ВЭВ споры экспрессировали гибридные белки, содержащие сигнальную последовательность аминокислот 1-35 SEQ ID №: 1, связанную с фосфатазой (PhoA4) из Bacillus subtilis ЕЕ148 или пептидом POLARIS. Синтезированные гены клонировали в рМК4 и вводили в Bacillus thuringiensis ВТ013А. Споры, выявляющие различные гибриды белка экзоспория-РhоА4 Bacillus subtilis ЕЕ148 или POLARIS, были получены путем выращивания трансформированных бактерий в бульоне с сердечно-мозговой вытяжкой при селективном давлении от 10 мкг/мл хлорамфеникола, высеванием на чашки с питательной агаризированной средой и инкубированием при 30°С в течение 3 дней. После 3 дней споры смывали с чашек, очищали центрифугированием и ресуспендировали в натрий-фосфатном буфере до 1×108 КОЕ/мл.

[00297] Растения выращивали при идеальном освещении, используя лампы Т5, 54 Вт, и 13-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение двухнедельного испытания. По окончанию двух недель измеряли высоту каждого растения, и измерения были нормированы по контролю растений только с водой. Результаты показаны ниже в таблице 29. Смачивание = применялось к почве по 50 мл на горшок. Полимер = только полимер ACCELERON для покрытия семян. ВЭВ споры в количестве 1×104 клеток/50 мл добавляли для смачивания. ВЭВ споры в количестве 1,3×104/клетки/семя добавляли для покрытия семян. 10-34-0 и 6-24-6 представляют собой стандартные коммерческие стартовые композиции удобрений. 10-34-0 представляет собой жидкий фосфат аммония. 6-24-6 представляет собой слабосолевое жидкбе фосфатное удобрение с орто/поли композицией. Краситель = Becker Underwood, красный, краситель для покрытия семян. MACHO, APRON и CRUISER представляют собой коммерческие фунгициды, используемые для семян. МАСНО содержит активный ингредиент имидаклоприд, APRON содержит активный ингредиент мефеноксам, и CRUISER содержит смесь активных ингредиентов тиаметоксама, мефеноксама и флудиоксонила. Было обнаружено, что споры совместимы со многими обработками семян и сохраняли способность стимулировать рост растений кукурузы.

[00298] Было обнаружено, что ВЭВ споры совместимы со всеми тестируемыми веществами для покрытия семян. Показано незначительное снижение активности, когда ВЭВ PhA4 споры сочетались только с красителем и полимером, но споры восстанавливали полноценную активность с красителем в комбинации с другими фунгицидами. ВЭВ споры также хорошо работали с жидкими удобрениями. Наиболее вероятно, что стартовые удобрения способствовали росту растений через непосредственное дополнение питательных веществ. ВЭВ споры работали с обоими стартовыми удобрениями, предполагая, что активность фосфатазы все еще может приводить к увеличению роста растений в присутствии избытка питательных веществ. Комбинации ВЭВ спор с фунгицидами представляли большее увеличение роста растений, чем только ВЭВ споры, что, похоже, связано с защитой, обеспечиваемой молодым растениям кукурузы на ранних этапах роста.

Пример 38. Использование ВЭВ спор, как добавку для листьев для уменьшения ингибирования роста во время стресса, на кукурузе.

[00299] Система выявления ВЭВ спор может быть использована для доставки ферментов, способных облегчать воздействие некоторых стрессовых факторов на растущие в поле или теплице растения. Для достижения этого выбирали ферменты, избирательно действующие на активные формы кислорода в почве. Активные формы кислорода являются основными маркерами стресса у растений.

[00300] Были получены ВЭВ споры, экспрессирующие гибридные белки, содержащие сигнальную последовательность аминокислот 1-35 из SEQ ID №: 1, связанную с хитозиназой, супероксиддисмутазой, каталазой или β-1,3-глюканазой из Bacillus thuringiensis ВТ013А. Синтезированные гены клонировали в рМК4 и вводили в Bacillus thuringiensis ВТ013А. Споры, выявляющие различные гибридные белки, были получены путем выращивания трансформированных бактерий в бульоне с сердечно-мозговой вытяжкой при селективном давлении 10 мкг/мл хлорамфеникола, высеванием на чашки с питательной агаризированной средой и инкубированием при 30°С в течение 3 дней. После 3 дней споры смывали с чашек, очищали центрифугированием и ресуспендировали в натрий-фосфатном буфере до 1×108 КОЕ/мл.

[00301] Трехнедельные растения кукурузы на стадии V5 выращивали при идеальном освещении, используя лампы Т5, 54 Вт, и 13-часовой световой экспозиции в день, при контролируемых температурных условиях в пределах 15,5-25,5°С. Растения поливали до насыщения каждые три дня в течение всего испытания. Когда растения достигали стадии V5, ВЭВ споры или положительные контрольные химикаты распыляли на листья либо 1×105 ВЭВ спор/мл, либо в рекомендуемых дозах для химических реагентов. Для каждого индивидуального растения применяли 1 мл расплытеля. Высоту растений измеряли непосредственно перед нанесением листовых распылителей. Затем растения кукурузы подвергали тепловому стрессу при 32,2°С и уменьшали полив до одного раза в неделю. Растения содержали в стрессовых условиях в течение двух недель. По окончанию двух недель снова измеряли высоту растений и регистрировали внешние проявления. В этих стрессовых условиях рост растений при контрольных обработках был минимальным. Способность расти в стрессовых условиях оценивали по увеличению высоты растения в течение двухнедельного промежутка по сравнению с контролем, обработанным только водой. Результаты показаны ниже в таблице 30.

[00302] Несколько противострессовых ферментов применяли для кукурузы, используя систему ВЭВ, как показано ранее в таблице 30. Контольные споры не оказали существенного влияния (снижение высоты растений -1,6%). ВЭВ фермент хитозиназа оказал положительное влияние в сочетании со своим субстратом хитозаном. Двумя наиболее показательными ферментами были ВЭВ β-1,3-глюканаза и ВЭВ супероксиддисмутаза. ВЭВ β-1,3-глюканаза обладает, в первую очередь, противогрибковой активностью, но также может непосредственно влиять на растения. Салициловая кислота и БТД служили положительными контролями анализа листьев и положительные ответы были отмечены для обоих. Этот способ переноса на листья может быть использован для доставки противострессовых ферментов растениям в разное сезонное время.

Пример 39. Уровни экспрессии гибридных белков с использованием различных промоторов, содержащих сигма-К.

[00303] Как показано ранее в примере 23, замена нативного промотора сигнальной последовательности, белка экзоспория или фрагмента белка экзоспория может существенно повлиять на уровень гибридного белка, экспрессируемого на экзоспории споры семейства Bacillus cereus. Например, замена нативного промотора BclA на промотор BclB значительно снижает уровень гибридного белка на поверхности спор члена семейства Bacillus cereus. В альтернативном варианте замена нативного промотор BclB на промотор BclA существенно повышает уровни гибридного белка на экзоспории.

[00304] Относительные уровни экспрессионной активности промотора для различных белков экзоспория под контролем нативных промоторов споруляции были получены по данным микрочипов из Bergman et al., 2008. Относительные уровни экспрессии определяли во время поздней стадии споруляции (300 минут после начала эксперимента), когда сигма К промоторы наиболее активны. Сигма К промоторы являются основными промоторами при экспрессии генов локализации в экзоспорий и ассоциированных белков. Относительная экспрессия представляет собой увеличение уровня экспрессии гена по сравнению со средним показателем всех других генов хромосомы на всех заданных временных точках. Таблица 31 ниже показывает относительные уровни экспрессии различных генов под контролем сигма К у членов семейства Bacillus cereus.

[00305] В свете вышеизложенного, будет видно, что достигнуто несколько объектов изобретения и достигнуты другие полезные результаты.

[00306] Поскольку различные изменения могут быть произведены в указанных ранее гибридных белках, членах семейства Bacillus cereus, препаратах и способах, без отклонения от объема изобретения, поразумевается, что весь материал, содержащийся в приведенном ранее описании и проиллюстрированный в прилагаемых графических материалах, должен быть интерпретирован в иллюстративном, а не в ограничивающем смысле.

1. Способ стимулирования роста растений, включающий введение рекомбинантной бактерии группы Bacillus cereus, экспрессирующей гибридный белок в среде для роста растений, или применение рекомбинантной бактерии группы Bacillus cereus, экспрессирующей гибридный белок, к растению, семени растения или области, окружающей растение или семя растения, причем гибридный белок включает:

белок или пептид, стимулирующий рост растения, где белок или пептид, стимулирующий рост растения, включает:

пептидный гормон, включающий фитосульфокин, clavata 3 (CLV3), системин, ZmlGF или SCR/SP11;

негормональный пептид, включающий RKN 16D10, Hg-Syv46, eNOD40 пептид, мелиттин, мастопаран, Mas7, RHPP, POLARIS или ингибитор трипсина Кунитца (ИТК);

фермент, участвующий в продуцировании или активации соединения, стимулирующего рост растения, где фермент включает ацетоинредуктазу, индол-3-ацетамидгидролазу, триптофанмонооксигеназу, ацетолактатсинтетазу, α-ацетолактатдекарбоксилазу, пируватдекарбоксилазу, диацетилредуктазу, бутандиолдегидрогеназу, аминотрансферазу, триптофандекарбоксилазу, аминоксидазу, индол-3-пируватдекарбоксилазу, индол-3-ацетальдегид-дегидрогеназу, триптофан боковой цепи-оксидазу, нитрилгидролазу, нитрилазу, пептидазу, протеазу, аденозинфосфат-изопентилтрансферазу, фосфатазу, аденозинкиназу, аденин-фосфорибозилтрансферазу, CYP735A, 5’-рибонуклеотид-фосфогидролазу, аденозин-нуклеозидазу, зеатин-цис-транс-изомеразу, зеатин-О-глюкозилтрансферазу, β-глюкозидазу, цис-гидроксилазу, ЦK-цис-гидроксилазу, ЦК-N-глюкозилтрансферазу, 2,5-рибонуклеотид-фосфогидролазу, аденозин-нуклеозидазу, пурин-нуклеозидфосфорилазу, зеатинредуктазу, гидроксиламинредуктазу, 2-оксоглутаратдиоксигеназу, гибберелловую-2В/3В-гидролазу, гиббереллин-3-оксидазу, гиббереллин-20-оксидазу, хитозаназу, хитиназу, β-1,3-глюканазу, β-1,4-глюканазу, β-1,6-глюканазу или аминоциклопропан-1-карбоновой кислоты-деаминазу;

фермент, разрушающий или модифицирующий бактериальный, грибковый или растительный источник питательных веществ, включающий целлюлазу, липазу, лигниноксидазу, протеазу, гликозидгидролазу, фосфатазу, нитрогеназу, нуклеазу, амидазу, нитратредуктазу, нитритредуктазу, амилазу, аммоний-оксидазу, лигниназу, глюкозидазу, фосфолипазу, фитазу, пектиназу, глюканазу, сульфатазу, уреазу или ксиланазу; или

белок флагеллин или пептид флагеллина; и

сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория, где сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория выбирают из группы, состоящей из:

(a) сигнальной последовательности, содержащей аминокислотную последовательность, имеющую по меньшей мере примерно 43% идентичность аминокислотам 20–35 последовательности SEQ ID NO: 1, где идентичность аминокислотам 25–35 составляет по меньшей мере примерно 54%;

(b) сигнальной последовательности, содержащей аминокислоты 1–35 последовательности SEQ ID NO: 1;

(c) сигнальной последовательности, содержащей аминокислоты 20–35 последовательности SEQ ID NO: 1;

(d) сигнальной последовательности, содержащей SEQ ID NO: 1;

(e) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 2;

(f) сигнальной последовательности, содержащей аминокислоты 1–27 последовательности SEQ ID NO: 3;

(g) сигнальной последовательности, содержащей аминокислоты 12–27 последовательности SEQ ID NO: 3;

(h) сигнальной последовательности, содержащей SEQ ID NO: 3;

(i) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 4;

(j) сигнальной последовательности, содержащей аминокислоты 1–38 последовательности SEQ ID NO: 5;

(k) сигнальной последовательности, содержащей аминокислоты 23–38 последовательности SEQ ID NO: 5;

(l) сигнальной последовательности, содержащей SEQ ID NO: 5;

(m) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 6;

(n) сигнальной последовательности, содержащей аминокислоты 1–28 последовательности SEQ ID NO: 7;

(o) сигнальной последовательности, содержащей аминокислоты 13–28 последовательности SEQ ID NO: 7;

(p) сигнальной последовательности, содержащей SEQ ID NO: 7;

(q) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 8;

(r) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 9;

(s) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 9;

(t) сигнальной последовательности, содержащей SEQ ID NO: 9;

(u) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 10;

(v) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 11;

(w) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 11;

(x) сигнальной последовательности, содержащей SEQ ID NO: 11;

(y) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 12;

(z) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 13;

(aa) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 13;

(ab) сигнальной последовательности, содержащей SEQ ID NO: 13;

(ac) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 14;

(ad) сигнальной последовательности, содержащей аминокислоты 1–43 последовательности SEQ ID NO: 15;

(ae) сигнальной последовательности, содержащей аминокислоты 28–43 последовательности SEQ ID NO: 15;

(af) сигнальной последовательности, содержащей SEQ ID NO: 15;

(ag) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 16;

(ah) сигнальной последовательности, содержащей аминокислоты 1–27 последовательности SEQ ID NO: 17;

(ai) сигнальной последовательности, содержащей аминокислоты 12–27 последовательности SEQ ID NO: 17;

(aj) сигнальной последовательности, содержащей SEQ ID NO: 17;

(ak) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 18;

(al) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 19;

(am) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 19;

(an) сигнальной последовательности, содержащей SEQ ID NO: 19;

(ao) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 20;

(ap) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 21;

(aq) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 21;

(ar) сигнальной последовательности, содержащей SEQ ID NO: 21;

(as) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 22;

(at) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 23;

(au) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 23;

(av) сигнальной последовательности, содержащей SEQ ID NO: 23;

(aw) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 24;

(ax) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 25;

(ay) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 25;

(az) сигнальной последовательности, содержащей SEQ ID NO: 25;

(ba) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 26;

(bb) сигнальной последовательности, содержащей аминокислоты 1–30 последовательности SEQ ID NO: 27;

(bc) сигнальной последовательности, содержащей аминокислоты 15–30 последовательности SEQ ID NO: 27;

(bd) сигнальной последовательности, содержащей SEQ ID NO: 27;

(be) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 28;

(bf) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 29;

(bg) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 29;

(bh) сигнальной последовательности, содержащей SEQ ID NO: 29;

(bi) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 30;

(bj) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 31;

(bk) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 31;

(bl) сигнальной последовательности, содержащей SEQ ID NO: 31;

(bm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 32;

(bn) сигнальной последовательности, содержащей аминокислоты 1–15 последовательности SEQ ID NO: 33;

(bo) сигнальной последовательности, содержащей SEQ ID NO: 33;

(bp) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 34;

(bq) сигнальной последовательности, содержащей аминокислоты 1–16 последовательности SEQ ID NO: 35;

(br) сигнальной последовательности, содержащей SEQ ID NO: 35;

(bs) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 36;

(bt) сигнальной последовательности, содержащей аминокислоты 1–29 последовательности SEQ ID NO: 43;

(bu) сигнальной последовательности, содержащей аминокислоты 14–29 последовательности SEQ ID NO: 43;

(bv) сигнальной последовательности, содержащей SEQ ID NO: 43;

(bw) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 44;

(bx) сигнальной последовательности, содержащей аминокислоты 1–35 последовательности SEQ ID NO: 45;

(by) сигнальной последовательности, содержащей аминокислоты 20–35 последовательности SEQ ID NO: 45;

(bz) сигнальной последовательности, содержащей SEQ ID NO: 45;

(ca) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 46;

(cb) сигнальной последовательности, содержащей аминокислоты 1–43 последовательности SEQ ID NO: 47;

(cc) сигнальной последовательности, содержащей аминокислоты 28–43 последовательности SEQ ID NO: 47;

(cd) сигнальной последовательности, содержащей SEQ ID NO: 47;

(ce) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 48;

(cf) сигнальной последовательности, содержащей аминокислоты 1–32 последовательности SEQ ID NO: 49;

(cg) сигнальной последовательности, содержащей аминокислоты 17–32 последовательности SEQ ID NO: 49;

(ch) сигнальной последовательности, содержащей SEQ ID NO: 49;

(ci) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 50;

(cj) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 51;

(ck) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 51;

(cl) сигнальной последовательности, содержащей SEQ ID NO: 51;

(cm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 52;

(cn) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 53;

(co) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 53;

(cp) сигнальной последовательности, содержащей SEQ ID NO: 53;

(cq) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 54;

(cr) сигнальной последовательности, содержащей аминокислоты 1–30 последовательности SEQ ID NO: 55;

(cs) сигнальной последовательности, содержащей аминокислоты 15–30 последовательности SEQ ID NO: 55;

(ct) сигнальной последовательности, содержащей SEQ ID NO: 55;

(cu) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 56;

(cv) сигнальной последовательности, содержащей аминокислоты 1–130 последовательности SEQ ID NO: 57;

(cw) сигнальной последовательности, содержащей аминокислоты 115–130 последовательности SEQ ID NO: 57;

(cx) сигнальной последовательности, содержащей SEQ ID NO: 57;

(cy) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 58;

(cz) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 59;

(da) сигнальной последовательности, содержащей SEQ ID NO: 60;

(db) сигнальной последовательности, содержащей SEQ ID NO: 61;

(dc) сигнальной последовательности, содержащей SEQ ID NO: 62;

(dd) сигнальной последовательности, содержащей SEQ ID NO: 63;

(de) сигнальной последовательности, содержащей SEQ ID NO: 64;

(df) сигнальной последовательности, содержащей SEQ ID NO: 65;

(dg) сигнальной последовательности, содержащей SEQ ID NO: 66;

(dh) сигнальной последовательности, содержащей SEQ ID NO: 67;

(di) сигнальной последовательности, содержащей SEQ ID NO: 68;

(dj) сигнальной последовательности, содержащей SEQ ID NO: 69;

(dk) сигнальной последовательности, содержащей SEQ ID NO: 70;

(dl) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 71;

(dm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 72;

(dn) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 73;

(do) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 74;

(dp) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 76;

(dq) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 77;

(dr) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 80;

(ds) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 81;

(dt) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 83;

(du) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 84;

(dv) сигнальной последовательности, содержащей аминокислоты 22–31 последовательности SEQ ID NO: 1;

(dw) сигнальной последовательности, содержащей аминокислоты 22–33 последовательности SEQ ID NO: 1;

(dx) сигнальной последовательности, содержащей аминокислоты 20–31 последовательности SEQ ID NO: 1;

(dy) сигнальной последовательности, содержащей аминокислоты 14–23 последовательности SEQ ID NO: 3;

(dz) сигнальной последовательности, содержащей аминокислоты 14–25 последовательности SEQ ID NO: 3; или

(ea) сигнальной последовательности, содержащей аминокислоты 12–23 последовательности SEQ ID NO: 3.

2. Семя растения, покрытое препаратом для покрытия семян, содержащим рекомбинантную бактерию группы Bacillus cereus и сельскохозяйственно-приемлемый носитель, где указанное семя применяют для получения растения, имеющего повышенный рост по сравнению с ростом растения, выращенного из семени, не покрытого препаратом для покрытия семян, и где рекомбинантная бактерия группы Bacillus cereus содержит вектор или модифицированную хромосомную ДНК, кодирующую гибридный белок, где рекомбинантная бактерия группы Bacillus cereus экспрессирует гибридный белок, и гибридный белок включает:

белок или пептид, стимулирующий рост растения, где белок или пептид, стимулирующий рост растения, включает:

пептидный гормон, включающий фитосульфокин, clavata 3 (CLV3), системин, ZmlGF или SCR/SP11;

негормональный пептид, включающий RKN 16D10, Hg-Syv46, eNOD40 пептид, мелиттин, мастопаран, Mas7, RHPP, POLARIS или ингибитор трипсина Кунитца (ИТК);

фермент, участвующий в продуцировании или активации соединения, стимулирующего рост растения, где фермент включает ацетоинредуктазу, индол-3-ацетамидгидролазу, триптофанмонооксигеназу, ацетолактатсинтетазу, α-ацетолактатдекарбоксилазу, пируватдекарбоксилазу, диацетилредуктазу, бутандиолдегидрогеназу, аминотрансферазу, триптофандекарбоксилазу, аминоксидазу, индол-3-пируватдекарбоксилазу, индол-3-ацетальдегид-дегидрогеназу, триптофан боковой цепи-оксидазу, нитрилгидролазу, нитрилазу, пептидазу, протеазу, аденозинфосфат-изопентилтрансферазу, фосфатазу, аденозинкиназу, аденин-фосфорибозилтрансферазу, CYP735A, 5’-рибонуклеотид-фосфогидролазу, аденозин-нуклеозидазу, зеатин-цис-транс-изомеразу, зеатин-О-глюкозилтрансферазу, β-глюкозидазу, цис-гидроксилазу, ЦK-цис-гидроксилазу, ЦК-N-глюкозилтрансферазу, 2,5-рибонуклеотид-фосфогидролазу, аденозин-нуклеозидазу, пурин-нуклеозидфосфорилазу, зеатинредуктазу, гидроксиламинредуктазу, 2-оксоглутаратдиоксигеназу, гибберелловую-2В/3В-гидролазу, гиббереллин-3-оксидазу, гиббереллин-20-оксидазу, хитозаназу, хитиназу, β-1,3-глюканазу, β-1,4-глюканазу, β-1,6-глюканазу или аминоциклопропан-1-карбоновой кислоты-деаминазу;

фермент, разрушающий или модифицирующий бактериальный, грибковый или растительный источник питательных веществ, включающий целлюлазу, липазу, лигниноксидазу, протеазу, гликозидгидролазу, фосфатазу, нитрогеназу, нуклеазу, амидазу, нитратредуктазу, нитритредуктазу, амилазу, аммоний-оксидазу, лигниназу, глюкозидазу, фосфолипазу, фитазу, пектиназу, глюканазу, сульфатазу, уреазу или ксиланазу;

белок флагеллин или пептид флагеллина; и

сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория, где сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория выбирают из группы, состоящей из:

(a) сигнальной последовательности, содержащей аминокислотную последовательность, имеющую по меньшей мере примерно 43% идентичность аминокислотам 20–35 последовательности SEQ ID NO: 1, где идентичность аминокислотам 25–35 составляет по меньшей мере примерно 54%;

(b) сигнальной последовательности, содержащей аминокислоты 1–35 последовательности SEQ ID NO: 1;

(c) сигнальной последовательности, содержащей аминокислоты 20–35 последовательности SEQ ID NO: 1;

(d) сигнальной последовательности, содержащей SEQ ID NO: 1;

(e) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 2;

(f) сигнальной последовательности, содержащей аминокислоты 1–27 последовательности SEQ ID NO: 3;

(g) сигнальной последовательности, содержащей аминокислоты 12–27 последовательности SEQ ID NO: 3;

(h) сигнальной последовательности, содержащей SEQ ID NO: 3;

(i) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 4;

(j) сигнальной последовательности, содержащей аминокислоты 1–38 последовательности SEQ ID NO: 5;

(k) сигнальной последовательности, содержащей аминокислоты 23–38 последовательности SEQ ID NO: 5;

(l) сигнальной последовательности, содержащей SEQ ID NO: 5;

(m) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 6;

(n) сигнальной последовательности, содержащей аминокислоты 1–28 последовательности SEQ ID NO: 7;

(o) сигнальной последовательности, содержащей аминокислоты 13–28 последовательности SEQ ID NO: 7;

(p) сигнальной последовательности, содержащей SEQ ID NO: 7;

(q) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 8;

(r) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 9;

(s) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 9;

(t) сигнальной последовательности, содержащей SEQ ID NO: 9;

(u) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 10;

(v) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 11;

(w) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 11;

(x) сигнальной последовательности, содержащей SEQ ID NO: 11;

(y) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 12;

(z) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 13;

(aa) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 13;

(ab) сигнальной последовательности, содержащей SEQ ID NO: 13;

(ac) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 14;

(ad) сигнальной последовательности, содержащей аминокислоты 1–43 последовательности SEQ ID NO: 15;

(ae) сигнальной последовательности, содержащей аминокислоты 28–43 последовательности SEQ ID NO: 15;

(af) сигнальной последовательности, содержащей SEQ ID NO: 15;

(ag) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 16;

(ah) сигнальной последовательности, содержащей аминокислоты 1–27 последовательности SEQ ID NO: 17;

(ai) сигнальной последовательности, содержащей аминокислоты 12–27 последовательности SEQ ID NO: 17;

(aj) сигнальной последовательности, содержащей SEQ ID NO: 17;

(ak) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 18;

(al) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 19;

(am) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 19;

(an) сигнальной последовательности, содержащей SEQ ID NO: 19;

(ao) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 20;

(ap) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 21;

(aq) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 21;

(ar) сигнальной последовательности, содержащей SEQ ID NO: 21;

(as) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 22;

(at) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 23;

(au) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 23;

(av) сигнальной последовательности, содержащей SEQ ID NO: 23;

(aw) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 24;

(ax) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 25;

(ay) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 25;

(az) сигнальной последовательности, содержащей SEQ ID NO: 25;

(ba) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 26;

(bb) сигнальной последовательности, содержащей аминокислоты 1–30 последовательности SEQ ID NO: 27;

(bc) сигнальной последовательности, содержащей аминокислоты 15–30 последовательности SEQ ID NO: 27;

(bd) сигнальной последовательности, содержащей SEQ ID NO: 27;

(be) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 28;

(bf) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 29;

(bg) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 29;

(bh) сигнальной последовательности, содержащей SEQ ID NO: 29;

(bi) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 30;

(bj) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 31;

(bk) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 31;

(bl) сигнальной последовательности, содержащей SEQ ID NO: 31;

(bm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 32;

(bn) сигнальной последовательности, содержащей аминокислоты 1–15 последовательности SEQ ID NO: 33;

(bo) сигнальной последовательности, содержащей SEQ ID NO: 33;

(bp) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 34;

(bq) сигнальной последовательности, содержащей аминокислоты 1–16 последовательности SEQ ID NO: 35;

(br) сигнальной последовательности, содержащей SEQ ID NO: 35;

(bs) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 36;

(bt) сигнальной последовательности, содержащей аминокислоты 1–29 последовательности SEQ ID NO: 43;

(bu) сигнальной последовательности, содержащей аминокислоты 14–29 последовательности SEQ ID NO: 43;

(bv) сигнальной последовательности, содержащей SEQ ID NO: 43;

(bw) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 44;

(bx) сигнальной последовательности, содержащей аминокислоты 1–35 последовательности SEQ ID NO: 45;

(by) сигнальной последовательности, содержащей аминокислоты 20–35 последовательности SEQ ID NO: 45;

(bz) сигнальной последовательности, содержащей SEQ ID NO: 45;

(ca) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 46;

(cb) сигнальной последовательности, содержащей аминокислоты 1–43 последовательности SEQ ID NO: 47;

(cc) сигнальной последовательности, содержащей аминокислоты 28–43 последовательности SEQ ID NO: 47;

(cd) сигнальной последовательности, содержащей SEQ ID NO: 47;

(ce) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 48;

(cf) сигнальной последовательности, содержащей аминокислоты 1–32 последовательности SEQ ID NO: 49;

(cg) сигнальной последовательности, содержащей аминокислоты 17–32 последовательности SEQ ID NO: 49;

(ch) сигнальной последовательности, содержащей SEQ ID NO: 49;

(ci) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 50;

(cj) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 51;

(ck) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 51;

(cl) сигнальной последовательности, содержащей SEQ ID NO: 51;

(cm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 52;

(cn) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 53;

(co) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 53;

(cp) сигнальной последовательности, содержащей SEQ ID NO: 53;

(cq) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 54;

(cr) сигнальной последовательности, содержащей аминокислоты 1–30 последовательности SEQ ID NO: 55;

(cs) сигнальной последовательности, содержащей аминокислоты 15–30 последовательности SEQ ID NO: 55;

(ct) сигнальной последовательности, содержащей SEQ ID NO: 55;

(cu) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 56;

(cv) сигнальной последовательности, содержащей аминокислоты 1–130 последовательности SEQ ID NO: 57;

(cw) сигнальной последовательности, содержащей аминокислоты 115–130 последовательности SEQ ID NO: 57;

(cx) сигнальной последовательности, содержащей SEQ ID NO: 57;

(cy) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 58;

(cz) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 59;

(da) сигнальной последовательности, содержащей SEQ ID NO: 60;

(db) сигнальной последовательности, содержащей SEQ ID NO: 61;

(dc) сигнальной последовательности, содержащей SEQ ID NO: 62;

(dd) сигнальной последовательности, содержащей SEQ ID NO: 63;

(de) сигнальной последовательности, содержащей SEQ ID NO: 64;

(df) сигнальной последовательности, содержащей SEQ ID NO: 65;

(dg) сигнальной последовательности, содержащей SEQ ID NO: 66;

(dh) сигнальной последовательности, содержащей SEQ ID NO: 67;

(di) сигнальной последовательности, содержащей SEQ ID NO: 68;

(dj) сигнальной последовательности, содержащей SEQ ID NO: 69;

(dk) сигнальной последовательности, содержащей SEQ ID NO: 70;

(dl) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 71;

(dm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 72;

(dn) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 73;

(do) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 74;

(dp) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 76;

(dq) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 77;

(dr) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 80;

(ds) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 81;

(dt) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 83;

(du) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 84;

(dv) сигнальной последовательности, содержащей аминокислоты 22–31 последовательности SEQ ID NO: 1;

(dw) сигнальной последовательности, содержащей аминокислоты 22–33 последовательности SEQ ID NO: 1;

(dx) сигнальной последовательности, содержащей аминокислоты 20–31 последовательности SEQ ID NO: 1;

(dy) сигнальной последовательности, содержащей аминокислоты 14–23 последовательности SEQ ID NO: 3;

(dz) сигнальной последовательности, содержащей аминокислоты 14–25 последовательности SEQ ID NO: 3; или

(ea) сигнальной последовательности, содержащей аминокислоты 12–23 последовательности SEQ ID NO: 3.

3. Рекомбинантная бактерия группы Bacillus cereus для стимулирования роста растения, где рекомбинантная бактерия группы Bacillus cereus, содержащая вектор или модифицированную хромосомную ДНК, кодирующую гибридный белок, где рекомбинантная бактерия группы Bacillus cereus экспрессирует гибридный белок и где гибридный белок включает:

эндоглюканазу, фосфолипазу, хитозаназа, протеазу, гликозидгидролазу, фосфатазу, нитрогеназу, нуклеазу, амидазу, нитратредуктазу, нитритредуктазу, аммоний-оксидазу, глюкозидазу, фитазу, пектиназу, глюканазу, сульфатазу, уреазу или ксиланазу и сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория, где сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория выбирают из группы, состоящей из:

(a) сигнальной последовательности, содержащей аминокислотную последовательность, имеющую по меньшей мере примерно 43% идентичность аминокислотам 20–35 последовательности SEQ ID NO: 1, где идентичность аминокислотам 25–35 составляет по меньшей мере примерно 54%;

(b) сигнальной последовательности, содержащей аминокислоты 1–35 последовательности SEQ ID NO: 1;

(c) сигнальной последовательности, содержащей аминокислоты 20–35 последовательности SEQ ID NO: 1;

(d) сигнальной последовательности, содержащей SEQ ID NO: 1;

(e) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 2;

(f) сигнальной последовательности, содержащей аминокислоты 1–27 последовательности SEQ ID NO: 3;

(g) сигнальной последовательности, содержащей аминокислоты 12–27 последовательности SEQ ID NO: 3;

(h) сигнальной последовательности, содержащей SEQ ID NO: 3;

(i) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 4;

(j) сигнальной последовательности, содержащей аминокислоты 1–38 последовательности SEQ ID NO: 5;

(k) сигнальной последовательности, содержащей аминокислоты 23–38 последовательности SEQ ID NO: 5;

(l) сигнальной последовательности, содержащей SEQ ID NO: 5;

(m) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 6;

(n) сигнальной последовательности, содержащей аминокислоты 1–28 последовательности SEQ ID NO: 7;

(o) сигнальной последовательности, содержащей аминокислоты 13–28 последовательности SEQ ID NO: 7;

(p) сигнальной последовательности, содержащей SEQ ID NO: 7;

(q) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 8;

(r) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 9;

(s) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 9;

(t) сигнальной последовательности, содержащей SEQ ID NO: 9;

(u) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 10;

(v) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 11;

(w) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 11;

(x) сигнальной последовательности, содержащей SEQ ID NO: 11;

(y) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 12;

(z) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 13;

(aa) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 13;

(ab) сигнальной последовательности, содержащей SEQ ID NO: 13;

(ac) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 14;

(ad) сигнальной последовательности, содержащей аминокислоты 1–43 последовательности SEQ ID NO: 15;

(ae) сигнальной последовательности, содержащей аминокислоты 28–43 последовательности SEQ ID NO: 15;

(af) сигнальной последовательности, содержащей SEQ ID NO: 15;

(ag) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 16;

(ah) сигнальной последовательности, содержащей аминокислоты 1–27 последовательности SEQ ID NO: 17;

(ai) сигнальной последовательности, содержащей аминокислоты 12–27 последовательности SEQ ID NO: 17;

(aj) сигнальной последовательности, содержащей SEQ ID NO: 17;

(ak) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 18;

(al) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 19;

(am) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 19;

(an) сигнальной последовательности, содержащей SEQ ID NO: 19;

(ao) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 20;

(ap) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 21;

(aq) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 21;

(ar) сигнальной последовательности, содержащей SEQ ID NO: 21;

(as) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 22;

(at) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 23;

(au) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 23;

(av) сигнальной последовательности, содержащей SEQ ID NO: 23;

(aw) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 24;

(ax) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 25;

(ay) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 25;

(az) сигнальной последовательности, содержащей SEQ ID NO: 25;

(ba) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 26;

(bb) сигнальной последовательности, содержащей аминокислоты 1–30 последовательности SEQ ID NO: 27;

(bc) сигнальной последовательности, содержащей аминокислоты 15–30 последовательности SEQ ID NO: 27;

(bd) сигнальной последовательности, содержащей SEQ ID NO: 27;

(be) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 28;

(bf) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 29;

(bg) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 29;

(bh) сигнальной последовательности, содержащей SEQ ID NO: 29;

(bi) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 30;

(bj) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 31;

(bk) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 31;

(bl) сигнальной последовательности, содержащей SEQ ID NO: 31;

(bm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 32;

(bn) сигнальной последовательности, содержащей аминокислоты 1–15 последовательности SEQ ID NO: 33;

(bo) сигнальной последовательности, содержащей SEQ ID NO: 33;

(bp) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 34;

(bq) сигнальной последовательности, содержащей аминокислоты 1–16 последовательности SEQ ID NO: 35;

(br) сигнальной последовательности, содержащей SEQ ID NO: 35;

(bs) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 36;

(bt) сигнальной последовательности, содержащей аминокислоты 1–29 последовательности SEQ ID NO: 43;

(bu) сигнальной последовательности, содержащей аминокислоты 14–29 последовательности SEQ ID NO: 43;

(bv) сигнальной последовательности, содержащей SEQ ID NO: 43;

(bw) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 44;

(bx) сигнальной последовательности, содержащей аминокислоты 1–35 последовательности SEQ ID NO: 45;

(by) сигнальной последовательности, содержащей аминокислоты 20–35 последовательности SEQ ID NO: 45;

(bz) сигнальной последовательности, содержащей SEQ ID NO: 45;

(ca) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 46;

(cb) сигнальной последовательности, содержащей аминокислоты 1–43 последовательности SEQ ID NO: 47;

(cc) сигнальной последовательности, содержащей аминокислоты 28–43 последовательности SEQ ID NO: 47;

(cd) сигнальной последовательности, содержащей SEQ ID NO: 47;

(ce) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 48;

(cf) сигнальной последовательности, содержащей аминокислоты 1–32 последовательности SEQ ID NO: 49;

(cg) сигнальной последовательности, содержащей аминокислоты 17–32 последовательности SEQ ID NO: 49;

(ch) сигнальной последовательности, содержащей SEQ ID NO: 49;

(ci) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 50;

(cj) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 51;

(ck) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 51;

(cl) сигнальной последовательности, содержащей SEQ ID NO: 51;

(cm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 52;

(cn) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 53;

(co) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 53;

(cp) сигнальной последовательности, содержащей SEQ ID NO: 53;

(cq) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 54;

(cr) сигнальной последовательности, содержащей аминокислоты 1–30 последовательности SEQ ID NO: 55;

(cs) сигнальной последовательности, содержащей аминокислоты 15–30 последовательности SEQ ID NO: 55;

(ct) сигнальной последовательности, содержащей SEQ ID NO: 55;

(cu) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 56;

(cv) сигнальной последовательности, содержащей аминокислоты 1–130 последовательности SEQ ID NO: 57;

(cw) сигнальной последовательности, содержащей аминокислоты 115–130 последовательности SEQ ID NO: 57;

(cx) сигнальной последовательности, содержащей SEQ ID NO: 57;

(cy) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 58;

(cz) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 59;

(da) сигнальной последовательности, содержащей SEQ ID NO: 60;

(db) сигнальной последовательности, содержащей SEQ ID NO: 61;

(dc) сигнальной последовательности, содержащей SEQ ID NO: 62;

(dd) сигнальной последовательности, содержащей SEQ ID NO: 63;

(de) сигнальной последовательности, содержащей SEQ ID NO: 64;

(df) сигнальной последовательности, содержащей SEQ ID NO: 65;

(dg) сигнальной последовательности, содержащей SEQ ID NO: 66;

(dh) сигнальной последовательности, содержащей SEQ ID NO: 67;

(di) сигнальной последовательности, содержащей SEQ ID NO: 68;

(dj) сигнальной последовательности, содержащей SEQ ID NO: 69;

(dk) сигнальной последовательности, содержащей SEQ ID NO: 70;

(dl) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 71;

(dm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 72;

(dn) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 73;

(do) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 74;

(dp) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 76;

(dq) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 77;

(dr) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 80;

(ds) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 81;

(dt) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 83;

(du) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 84;

(dv) сигнальной последовательности, содержащей аминокислоты 22–31 последовательности SEQ ID NO: 1;

(dw) сигнальной последовательности, содержащей аминокислоты 22–33 последовательности SEQ ID NO: 1;

(dx) сигнальной последовательности, содержащей аминокислоты 20–31 последовательности SEQ ID NO: 1;

(dy) сигнальной последовательности, содержащей аминокислоты 14–23 последовательности SEQ ID NO: 3;

(dz) сигнальной последовательности, содержащей аминокислоты 14–25 последовательности SEQ ID NO: 3; или

(ea) сигнальной последовательности, содержащей аминокислоты 12–23 последовательности SEQ ID NO: 3.

4. Гибридный белок для стимуляции роста растения, где гибридный белок включает

белок или пептид, стимулирующий рост растения, где белок или пептид, стимулирующий рост растения, включает:

пептидный гормон, включающий фитосульфокин, clavata 3 (CLV3), системин, ZmlGF или SCR/SP11;

негормональный пептид, включающий RKN 16D10, Hg-Syv46, eNOD40 пептид, мелиттин, мастопаран, Mas7, RHPP, POLARIS или ингибитор трипсина Кунитца (ИТК);

фермент, участвующий в продуцировании или активации соединения, стимулирующего рост растения, где фермент включает ацетоинредуктазу, индол-3-ацетамидгидролазу, триптофанмонооксигеназу, ацетолактатсинтетазу, α-ацетолактатдекарбоксилазу, пируватдекарбоксилазу, диацетилредуктазу, бутандиолдегидрогеназу, аминотрансферазу, триптофандекарбоксилазу, аминоксидазу, индол-3-пируватдекарбоксилазу, индол-3-ацетальдегид-дегидрогеназу, триптофан боковой цепи-оксидазу, нитрилгидролазу, нитрилазу, пептидазу, протеазу, аденозинфосфат-изопентилтрансферазу, фосфатазу, аденозинкиназу, аденин-фосфорибозилтрансферазу, CYP735A, 5’-рибонуклеотид-фосфогидролазу, аденозин-нуклеозидазу, зеатин-цис-транс-изомеразу, зеатин-О-глюкозилтрансферазу, β-глюкозидазу, цис-гидроксилазу, ЦK-цис-гидроксилазу, ЦК-N-глюкозилтрансферазу, 2,5-рибонуклеотид-фосфогидролазу, аденозин-нуклеозидазу, пурин-нуклеозидфосфорилазу, зеатинредуктазу, гидроксиламинредуктазу, 2-оксоглутаратдиоксигеназу, гибберелловую-2В/3В-гидролазу, гиббереллин-3-оксидазу, гиббереллин-20-оксидазу, хитозаназу, хитиназу, β-1,3-глюканазу, β-1,4-глюканазу, β-1,6-глюканазу или аминоциклопропан-1-карбоновой кислоты-деаминазу; или

белок флагеллин или пептид флагеллина; и

сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория, где сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория выбирают из группы, состоящей из:

(a) сигнальной последовательности, содержащей аминокислотную последовательность, имеющую по меньшей мере примерно 43% идентичность аминокислотам 20–35 последовательности SEQ ID NO: 1, где идентичность аминокислотам 25–35 составляет по меньшей мере примерно 54%;

(b) сигнальной последовательности, содержащей аминокислоты 1–35 последовательности SEQ ID NO: 1;

(c) сигнальной последовательности, содержащей аминокислоты 20–35 последовательности SEQ ID NO: 1;

(d) сигнальной последовательности, содержащей SEQ ID NO: 1;

(e) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 2;

(f) сигнальной последовательности, содержащей аминокислоты 1–27 последовательности SEQ ID NO: 3;

(g) сигнальной последовательности, содержащей аминокислоты 12–27 последовательности SEQ ID NO: 3;

(h) сигнальной последовательности, содержащей SEQ ID NO: 3;

(i) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 4;

(j) сигнальной последовательности, содержащей аминокислоты 1–38 последовательности SEQ ID NO: 5;

(k) сигнальной последовательности, содержащей аминокислоты 23–38 последовательности SEQ ID NO: 5;

(l) сигнальной последовательности, содержащей SEQ ID NO: 5;

(m) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 6;

(n) сигнальной последовательности, содержащей аминокислоты 1–28 последовательности SEQ ID NO: 7;

(o) сигнальной последовательности, содержащей аминокислоты 13–28 последовательности SEQ ID NO: 7;

(p) сигнальной последовательности, содержащей SEQ ID NO: 7;

(q) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 8;

(r) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 9;

(s) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 9;

(t) сигнальной последовательности, содержащей SEQ ID NO: 9;

(u) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 10;

(v) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 11;

(w) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 11;

(x) сигнальной последовательности, содержащей SEQ ID NO: 11;

(y) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 12;

(z) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 13;

(aa) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 13;

(ab) сигнальной последовательности, содержащей SEQ ID NO: 13;

(ac) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 14;

(ad) сигнальной последовательности, содержащей аминокислоты 1–43 последовательности SEQ ID NO: 15;

(ae) сигнальной последовательности, содержащей аминокислоты 28–43 последовательности SEQ ID NO: 15;

(af) сигнальной последовательности, содержащей SEQ ID NO: 15;

(ag) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 16;

(ah) сигнальной последовательности, содержащей аминокислоты 1–27 последовательности SEQ ID NO: 17;

(ai) сигнальной последовательности, содержащей аминокислоты 12–27 последовательности SEQ ID NO: 17;

(aj) сигнальной последовательности, содержащей SEQ ID NO: 17;

(ak) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 18;

(al) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 19;

(am) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 19;

(an) сигнальной последовательности, содержащей SEQ ID NO: 19;

(ao) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 20;

(ap) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 21;

(aq) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 21;

(ar) сигнальной последовательности, содержащей SEQ ID NO: 21;

(as) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 22;

(at) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 23;

(au) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 23;

(av) сигнальной последовательности, содержащей SEQ ID NO: 23;

(aw) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 24;

(ax) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 25;

(ay) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 25;

(az) сигнальной последовательности, содержащей SEQ ID NO: 25;

(ba) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 26;

(bb) сигнальной последовательности, содержащей аминокислоты 1–30 последовательности SEQ ID NO: 27;

(bc) сигнальной последовательности, содержащей аминокислоты 15–30 последовательности SEQ ID NO: 27;

(bd) сигнальной последовательности, содержащей SEQ ID NO: 27;

(be) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 28;

(bf) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 29;

(bg) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 29;

(bh) сигнальной последовательности, содержащей SEQ ID NO: 29;

(bi) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 30;

(bj) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 31;

(bk) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 31;

(bl) сигнальной последовательности, содержащей SEQ ID NO: 31;

(bm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 32;

(bn) сигнальной последовательности, содержащей аминокислоты 1–15 последовательности SEQ ID NO: 33;

(bo) сигнальной последовательности, содержащей SEQ ID NO: 33;

(bp) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 34;

(bq) сигнальной последовательности, содержащей аминокислоты 1–16 последовательности SEQ ID NO: 35;

(br) сигнальной последовательности, содержащей SEQ ID NO: 35;

(bs) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 36;

(bt) сигнальной последовательности, содержащей аминокислоты 1–29 последовательности SEQ ID NO: 43;

(bu) сигнальной последовательности, содержащей аминокислоты 14–29 последовательности SEQ ID NO: 43;

(bv) сигнальной последовательности, содержащей SEQ ID NO: 43;

(bw) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 44;

(bx) сигнальной последовательности, содержащей аминокислоты 1–35 последовательности SEQ ID NO: 45;

(by) сигнальной последовательности, содержащей аминокислоты 20–35 последовательности SEQ ID NO: 45;

(bz) сигнальной последовательности, содержащей SEQ ID NO: 45;

(ca) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 46;

(cb) сигнальной последовательности, содержащей аминокислоты 1–43 последовательности SEQ ID NO: 47;

(cc) сигнальной последовательности, содержащей аминокислоты 28–43 последовательности SEQ ID NO: 47;

(cd) сигнальной последовательности, содержащей SEQ ID NO: 47;

(ce) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 48;

(cf) сигнальной последовательности, содержащей аминокислоты 1–32 последовательности SEQ ID NO: 49;

(cg) сигнальной последовательности, содержащей аминокислоты 17–32 последовательности SEQ ID NO: 49;

(ch) сигнальной последовательности, содержащей SEQ ID NO: 49;

(ci) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 50;

(cj) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 51;

(ck) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 51;

(cl) сигнальной последовательности, содержащей SEQ ID NO: 51;

(cm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 52;

(cn) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 53;

(co) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 53;

(cp) сигнальной последовательности, содержащей SEQ ID NO: 53;

(cq) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 54;

(cr) сигнальной последовательности, содержащей аминокислоты 1–30 последовательности SEQ ID NO: 55;

(cs) сигнальной последовательности, содержащей аминокислоты 15–30 последовательности SEQ ID NO: 55;

(ct) сигнальной последовательности, содержащей SEQ ID NO: 55;

(cu) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 56;

(cv) сигнальной последовательности, содержащей аминокислоты 1–130 последовательности SEQ ID NO: 57;

(cw) сигнальной последовательности, содержащей аминокислоты 115–130 последовательности SEQ ID NO: 57;

(cx) сигнальной последовательности, содержащей SEQ ID NO: 57;

(cy) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 58;

(cz) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 59;

(da) сигнальной последовательности, содержащей SEQ ID NO: 60;

(db) сигнальной последовательности, содержащей SEQ ID NO: 61;

(dc) сигнальной последовательности, содержащей SEQ ID NO: 62;

(dd) сигнальной последовательности, содержащей SEQ ID NO: 63;

(de) сигнальной последовательности, содержащей SEQ ID NO: 64;

(df) сигнальной последовательности, содержащей SEQ ID NO: 65;

(dg) сигнальной последовательности, содержащей SEQ ID NO: 66;

(dh) сигнальной последовательности, содержащей SEQ ID NO: 67;

(di) сигнальной последовательности, содержащей SEQ ID NO: 68;

(dj) сигнальной последовательности, содержащей SEQ ID NO: 69;

(dk) сигнальной последовательности, содержащей SEQ ID NO: 70;

(dl) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 71;

(dm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 72;

(dn) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 73;

(do) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 74;

(dp) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 76;

(dq) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 77;

(dr) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 80;

(ds) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 81;

(dt) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 83;

(du) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 84;

(dv) сигнальной последовательности, содержащей аминокислоты 22–31 последовательности SEQ ID NO: 1;

(dw) сигнальной последовательности, содержащей аминокислоты 22–33 последовательности SEQ ID NO: 1;

(dx) сигнальной последовательности, содержащей аминокислоты 20–31 последовательности SEQ ID NO: 1;

(dy) сигнальной последовательности, содержащей аминокислоты 14–23 последовательности SEQ ID NO: 3;

(dz) сигнальной последовательности, содержащей аминокислоты 14–25 последовательности SEQ ID NO: 3; или

(ea) сигнальной последовательности, содержащей аминокислоты 12–23 последовательности SEQ ID NO: 3.

5. Способ по п. 1, семя растения по п. 2, рекомбинантная бактерия группы Bacillus cereus по п. 3 или гибридный белок по п. 4, где сигнальная последовательность содержит аминокислотную последовательность, имеющую по меньшей мере примерно 62% идентичность аминокислотам 20–35 последовательности SEQ ID NO: 1, где идентичность аминокислотам 25–35 составляет по меньшей мере примерно 72%.

6. Способ по п. 1, семя растения по п. 2, рекомбинантная бактерия группы Bacillus cereus по п. 3 или гибридный белок по п. 4, где сигнальная последовательность содержит аминокислотную последовательность, имеющую по меньшей мере примерно 81% идентичность аминокислотам 20–35 последовательности SEQ ID NO: 1, где идентичность аминокислотам 25–35 составляет по меньшей мере примерно 90%.

7. Способ по п. 1, семя растения по п. 2, рекомбинантная бактерия группы Bacillus cereus по п. 3 или гибридный белок по п. 4, отличающиеся тем, что сигнальная последовательность состоит из:

a) аминокислот 1–35 из SEQ ID №: 1;

b) аминокислот 20–35 из SEQ ID №: 1;

c) SEQ ID №: 1;

d) SEQ ID №: 60; или

(e) аминокислотной последовательности, состоящей из 16 аминокислот и имеющей по меньшей мере примерно 43% идентичность аминокислотам 20–35 последовательности SEQ ID NO: 1, где идентичность аминоксилотам 25–35 составляет по меньшей мере примерно 54%.

8. Способ по п. 1, семя растения по п. 2, рекомбинантная бактерия группы Bacillus cereus по п. 3 или гибридный белок по п. 4, отличающиеся тем, что гибридный белок включает белок экзоспория или фрагмент белка экзоспория, который включает аминокислотную последовательность, имеющую по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 98%, по меньшей мере 99% или 100% идентичности с SEQ ID №: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26 , 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59.

9. Гибридный белок для стимуляции роста растения, включающий белок или пептид, стимулирующий рост растения, где белок или пептид, стимулирующий рост растения, включает:

пептидный гормон, включающий фитосульфокин, clavata 3 (CLV3), системин, ZmlGF или SCR/SP11;

негормональный пептид, включающий RKN 16D10, Hg-Syv46, eNOD40 пептид, мелиттин, мастопаран, Mas7, RHPP, POLARIS или ингибитор трипсина Кунитца (ИТК);

фермент, участвующий в продуцировании или активации соединения, стимулирующего рост растения, где фермент включает ацетоинредуктазу, индол-3-ацетамидгидролазу, триптофанмонооксигеназу, ацетолактатсинтетазу, α-ацетолактатдекарбоксилазу, пируватдекарбоксилазу, диацетилредуктазу, бутандиолдегидрогеназу, аминотрансферазу, триптофандекарбоксилазу, аминоксидазу, индол-3-пируватдекарбоксилазу, индол-3-ацетальдегид-дегидрогеназу, триптофан боковой цепи-оксидазу, нитрилгидролазу, нитрилазу, пептидазу, протеазу, аденозинфосфат-изопентилтрансферазу, фосфатазу, аденозинкиназу, аденин-фосфорибозилтрансферазу, CYP735A, 5’-рибонуклеотид-фосфогидролазу, аденозин-нуклеозидазу, зеатин-цис-транс-изомеразу, зеатин-О-глюкозилтрансферазу, β-глюкозидазу, цис-гидроксилазу, ЦK-цис-гидроксилазу, ЦК-N-глюкозилтрансферазу, 2,5-рибонуклеотид-фосфогидролазу, аденозин-нуклеозидазу, пурин-нуклеозидфосфорилазу, зеатинредуктазу, гидроксиламинредуктазу, 2-оксоглутаратдиоксигеназу, гибберелловую-2В/3В-гидролазу, гиббереллин-3-оксидазу, гиббереллин-20-оксидазу, хитозаназу, хитиназу, β-1,3-глюканазу, β-1,4-глюканазу, β-1,6-глюканазу или аминоциклопропан-1-карбоновой кислоты-деаминазу;

фермент, разрушающий или модифицирующий бактериальный, грибковый или растительный источник питательных веществ, включающий целлюлазу, липазу, лигниноксидазу, протеазу, гликозидгидролазу, фосфатазу, нитрогеназу, нуклеазу, амидазу, нитратредуктазу, нитритредуктазу, амилазу, аммоний-оксидазу, лигниназу, глюкозидазу, фосфолипазу, фитазу, пектиназу, глюканазу, сульфатазу, уреазу или ксиланазу; или

белок флагеллин или пептид флагеллина; и

белок экзоспория, где белок экзоспория содержит:

а) аминокислотную последовательность, имеющую по меньшей мере 95% идентичности с SEQ ID №: 71;

b) аминокислотную последовательность, имеющую по меньшей мере 95% идентичности с SEQ ID №: 72;

c) аминокислотную последовательность, имеющую по меньшей мере 95% идентичности с SEQ ID №: 73;

d) аминокислотную последовательность, имеющую по меньшей мере 95% идентичности с SEQ ID №: 74;

e) аминокислотную последовательность, имеющую по меньшей мере 95% идентичности с SEQ ID №: 76;

f) аминокислотную последовательность, имеющую по меньшей мере 95% идентичности с SEQ ID №: 77

g) аминокислотную последовательность, имеющую по меньшей мере 95% идентичности с SEQ ID №: 80;

h) аминокислотную последовательность, имеющую по меньшей мере 95% идентичности с SEQ ID №: 81;

i) аминокислотную последовательность, имеющую по меньшей мере 95% идентичности с SEQ ID №: 83; или

j) аминокислотную последовательность, имеющую по меньшей мере 95% идентичности с SEQ ID №: 84.

10. Гибридный белок по п. 9, включающий белок экзоспория, содержащий аминокислотную последовательность, имеющую по меньшей мере 98%, по меньшей мере 99% или 100% идентичности с SEQ ID №: 71, 72, 73, 74, 76, 77, 80, 81, 83 или 84.

11. Способ по п. 1, семя растения по п. 2, рекомбинантная бактерия группы Bacillus cereus по п. 3 или гибридный белок по любому из пп. 4, 9 и 10, отличающиеся тем, что гибридный белок включает аминокислотный линкер между сигнальной последовательностью, белком экзоспория или фрагментом белка экзоспория и белком или пептидом, стимулирующим рост растения, причем данный линкер необязательно включает:

полиаланиновый линкер, полиглициновый линкер или линкер, содержащий смесь как аланиновых, так и глициновых остатков; и/или

сайт узнавания протеазы.

12. Способ по п. 1, семя растения по п. 2 или гибридный белок по любому из пп. 4, 9 и 10, отличающиеся тем, что фермент, участвующий в продуцировании или активации соединения, стимулирующего рост растения, включает протеазу или пептидазу, расщепляющую белки, пептиды, пробелки или препробелки для получения биологически активного пептида, причем:

протеаза или пептидаза необязательно включает субтилизин, кислую протеазу, щелочную протеазу, протеиназу, эндопептидазу, экзопептидазу, термолизин, папаин, пепсин, трипсин, проназу, карбоксилазу, сериновую протеазу, глутаминовую протеазу, аспартатную протеазу, цистеиновую протеазу, треониновую протеазу или металлопротеазу;

биоактивный пептид необязательно включает RKN 16D10 или RHPP; и/или

протеаза или пептидаза необязательно расщепляет белки в пище, богатой белком.

13. Способ по п. 1, семя растения по п. 2 или слитый белок по п. 9 или 10, отличающиеся тем, что:

целлюлаза включает эндоцеллюлазу, экзоцеллюлазу или β-глюкозидазу;

липаза включает липазу Bacillus subtilis, липазу Bacillus thuringiensis, липазу Bacillus cereus или липазу Bacillus clausii; или

лигниноксидаза включает лигнинпероксидазу, лакказу, глиоксальоксидазу, лигниназу или марганецпероксидазу.

14. Способ по п. 1, семя растения по п. 2, рекомбинантная бактерия группы Bacillus cereus по п. 3 или гибридный белок по п. 9 или 10, где

протеаза включает субтилизин, кислую протеазу, щелочную протеазу, протеиназу, пептидазу, эндопептидазу, экзопептидазу, термолизин, папаин, пепсин, трипсин, проназу, карбоксилазу, сериновую протеазу, глутаминовую протеазу, аспартатную протеазу, цистеиновую протеазу, треониновую протеазу или металлопротеазу;

фосфатаза включает фосфорный моноэфир-гидролазу, фосфомоноэстеразу, фосфорный диэфир-гидролазу, фосфодиэстеразу, трифосфорный моноэфир-гидролазу, фосфорил ангидрид-гидролазу, пирофосфатазу, фитазу, триметафосфатазу или трифосфатазу; или

нитрогеназа включает нитрогеназу из Nif семейства.

15. Способ, семя растения или гибридный белок по п. 13, отличающиеся тем, что:

целлюлаза включает эндоцеллюлазу и эндоцеллюлаза включает эндоглюканазу;

целлюлаза включает экзоцеллюлазу и экзоцеллюлаза включает экзоцеллюлазу Trichoderma reesei;

целлюлаза включает β-глюкозидазу и β-глюкозидаза включает β-глюкозидазу Bacillus subtilis, β-глюкозидазу Bacillus thuringiensis, β-глюкозидазу Bacillus cereus или β-глюкозидазу Bacillus clausii;

фосфатаза включает фосфомоноэстеразу и фосфомоноэстераза включает PhoA4;

фосфатаза включает фитазу и фитаза включает фитазу Bacillus subtilis EE148 или фитазу Bacillus thuringiensis BT013A.

16. Рекомбинантная бактерия группы Bacillus cereus по п. 3, где:

фосфатаза включает фосфомоноэстеразу и фосфомоноэстераза включает PhoA4; или

фосфатаза включает фитазу и фитаза включает фитазу Bacillus subtilis EE148 или фитазу Bacillus thuringiensis BT013A.

17. Способ, семя растения или гибридный белок по п. 15, где эндоцеллюлаза включает эндоглюканазу и эндоглюканаза включает эндоглюканазу Bacillus subtilis, эндоглюканазу Bacillus thuringiensis, эндоглюканазу Bacillus cereus или эндоглюканазу Bacillus clausii.

18. Рекомбинантная бактерия группы Bacillus cereus по п. 3, где эндоглюканаза включает эндоглюканазу Bacillus subtilis, эндоглюканазу Bacillus thuringiensis, эндоглюканазу Bacillus cereus или эндоглюканазу Bacillus clausii.

19. Способ по п. 1, семя растения по п. 2 или гибридный белок по любому из пп. 4, 9 и 10, где пептид флагеллина включает flg22.

20. Рекомбинантная бактерия группы Bacillus cereus, экспрессирующая гибридный белок по любому из пп. 4, 9 и 10.

21. Рекомбинантная бактерия группы Bacillus cereus, коэкспрессирующая по меньшей мере один гибридный белок, содержащий белок или пептид, стимулирующий рост растения, по любому из пп. 4, 9 и 10 и по меньшей мере один гибридный белок, содержащий

белок или пептид, связывающийся с растением, где белок или пептид, связывающийся с растением, включает адгезин, флагеллин, омптин, лектин, экспансин, структурный белок биопленки, белок пилуса, белок curlus, интимин, инвазин, агглютинин, нефимбриальный белок; и

сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория, где сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория выбирают из группы, состоящей из:

(a) сигнальной последовательности, содержащей аминокислотную последовательность, имеющую по меньшей мере примерно 43% идентичность аминокислотам 20–35 последовательности SEQ ID NO: 1, где идентичность аминокислотам 25–35 составляет по меньшей мере примерно 54%;

(b) сигнальной последовательности, содержащей аминокислоты 1–35 последовательности SEQ ID NO: 1;

(c) сигнальной последовательности, содержащей аминокислоты 20–35 последовательности SEQ ID NO: 1;

(d) сигнальной последовательности, содержащей SEQ ID NO: 1;

(e) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 2;

(f) сигнальной последовательности, содержащей аминокислоты 1–27 последовательности SEQ ID NO: 3;

(g) сигнальной последовательности, содержащей аминокислоты 12–27 последовательности SEQ ID NO: 3;

(h) сигнальной последовательности, содержащей SEQ ID NO: 3;

(i) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 4;

(j) сигнальной последовательности, содержащей аминокислоты 1–38 последовательности SEQ ID NO: 5;

(k) сигнальной последовательности, содержащей аминокислоты 23–38 последовательности SEQ ID NO: 5;

(l) сигнальной последовательности, содержащей SEQ ID NO: 5;

(m) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 6;

(n) сигнальной последовательности, содержащей аминокислоты 1–28 последовательности SEQ ID NO: 7;

(o) сигнальной последовательности, содержащей аминокислоты 13–28 последовательности SEQ ID NO: 7;

(p) сигнальной последовательности, содержащей SEQ ID NO: 7;

(q) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 8;

(r) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 9;

(s) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 9;

(t) сигнальной последовательности, содержащей SEQ ID NO: 9;

(u) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 10;

(v) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 11;

(w) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 11;

(x) сигнальной последовательности, содержащей SEQ ID NO: 11;

(y) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 12;

(z) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 13;

(aa) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 13;

(ab) сигнальной последовательности, содержащей SEQ ID NO: 13;

(ac) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 14;

(ad) сигнальной последовательности, содержащей аминокислоты 1–43 последовательности SEQ ID NO: 15;

(ae) сигнальной последовательности, содержащей аминокислоты 28–43 последовательности SEQ ID NO: 15;

(af) сигнальной последовательности, содержащей SEQ ID NO: 15;

(ag) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 16;

(ah) сигнальной последовательности, содержащей аминокислоты 1–27 последовательности SEQ ID NO: 17;

(ai) сигнальной последовательности, содержащей аминокислоты 12–27 последовательности SEQ ID NO: 17;

(aj) сигнальной последовательности, содержащей SEQ ID NO: 17;

(ak) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 18;

(al) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 19;

(am) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 19;

(an) сигнальной последовательности, содержащей SEQ ID NO: 19;

(ao) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 20;

(ap) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 21;

(aq) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 21;

(ar) сигнальной последовательности, содержащей SEQ ID NO: 21;

(as) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 22;

(at) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 23;

(au) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 23;

(av) сигнальной последовательности, содержащей SEQ ID NO: 23;

(aw) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 24;

(ax) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 25;

(ay) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 25;

(az) сигнальной последовательности, содержащей SEQ ID NO: 25;

(ba) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 26;

(bb) сигнальной последовательности, содержащей аминокислоты 1–30 последовательности SEQ ID NO: 27;

(bc) сигнальной последовательности, содержащей аминокислоты 15–30 последовательности SEQ ID NO: 27;

(bd) сигнальной последовательности, содержащей SEQ ID NO: 27;

(be) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 28;

(bf) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 29;

(bg) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 29;

(bh) сигнальной последовательности, содержащей SEQ ID NO: 29;

(bi) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 30;

(bj) сигнальной последовательности, содержащей аминокислоты 1–24 последовательности SEQ ID NO: 31;

(bk) сигнальной последовательности, содержащей аминокислоты 9–24 последовательности SEQ ID NO: 31;

(bl) сигнальной последовательности, содержащей SEQ ID NO: 31;

(bm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 32;

(bn) сигнальной последовательности, содержащей аминокислоты 1–15 последовательности SEQ ID NO: 33;

(bo) сигнальной последовательности, содержащей SEQ ID NO: 33;

(bp) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 34;

(bq) сигнальной последовательности, содержащей аминокислоты 1–16 последовательности SEQ ID NO: 35;

(br) сигнальной последовательности, содержащей SEQ ID NO: 35;

(bs) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 36;

(bt) сигнальной последовательности, содержащей аминокислоты 1–29 последовательности SEQ ID NO: 43;

(bu) сигнальной последовательности, содержащей аминокислоты 14–29 последовательности SEQ ID NO: 43;

(bv) сигнальной последовательности, содержащей SEQ ID NO: 43;

(bw) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 44;

(bx) сигнальной последовательности, содержащей аминокислоты 1–35 последовательности SEQ ID NO: 45;

(by) сигнальной последовательности, содержащей аминокислоты 20–35 последовательности SEQ ID NO: 45;

(bz) сигнальной последовательности, содержащей SEQ ID NO: 45;

(ca) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 46;

(cb) сигнальной последовательности, содержащей аминокислоты 1–43 последовательности SEQ ID NO: 47;

(cc) сигнальной последовательности, содержащей аминокислоты 28–43 последовательности SEQ ID NO: 47;

(cd) сигнальной последовательности, содержащей SEQ ID NO: 47;

(ce) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 48;

(cf) сигнальной последовательности, содержащей аминокислоты 1–32 последовательности SEQ ID NO: 49;

(cg) сигнальной последовательности, содержащей аминокислоты 17–32 последовательности SEQ ID NO: 49;

(ch) сигнальной последовательности, содержащей SEQ ID NO: 49;

(ci) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 50;

(cj) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 51;

(ck) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 51;

(cl) сигнальной последовательности, содержащей SEQ ID NO: 51;

(cm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 52;

(cn) сигнальной последовательности, содержащей аминокислоты 1–33 последовательности SEQ ID NO: 53;

(co) сигнальной последовательности, содержащей аминокислоты 18–33 последовательности SEQ ID NO: 53;

(cp) сигнальной последовательности, содержащей SEQ ID NO: 53;

(cq) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 54;

(cr) сигнальной последовательности, содержащей аминокислоты 1–30 последовательности SEQ ID NO: 55;

(cs) сигнальной последовательности, содержащей аминокислоты 15–30 последовательности SEQ ID NO: 55;

(ct) сигнальной последовательности, содержащей SEQ ID NO: 55;

(cu) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 56;

(cv) сигнальной последовательности, содержащей аминокислоты 1–130 последовательности SEQ ID NO: 57;

(cw) сигнальной последовательности, содержащей аминокислоты 115–130 последовательности SEQ ID NO: 57;

(cx) сигнальной последовательности, содержащей SEQ ID NO: 57;

(cy) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 58;

(cz) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 59;

(da) сигнальной последовательности, содержащей SEQ ID NO: 60;

(db) сигнальной последовательности, содержащей SEQ ID NO: 61;

(dc) сигнальной последовательности, содержащей SEQ ID NO: 62;

(dd) сигнальной последовательности, содержащей SEQ ID NO: 63;

(de) сигнальной последовательности, содержащей SEQ ID NO: 64;

(df) сигнальной последовательности, содержащей SEQ ID NO: 65;

(dg) сигнальной последовательности, содержащей SEQ ID NO: 66;

(dh) сигнальной последовательности, содержащей SEQ ID NO: 67;

(di) сигнальной последовательности, содержащей SEQ ID NO: 68;

(dj) сигнальной последовательности, содержащей SEQ ID NO: 69;

(dk) сигнальной последовательности, содержащей SEQ ID NO: 70;

(dl) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 71;

(dm) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 72;

(dn) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 73;

(do) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 74;

(dp) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 76;

(dq) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 77;

(dr) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 80;

(ds) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 81;

(dt) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 83;

(du) белка экзоспория, содержащего аминокислотную последовательность, имеющую по меньшей мере 85% идентичность последовательности SEQ ID NO: 84;

(dv) сигнальной последовательности, содержащей аминокислоты 22–31 последовательности SEQ ID NO: 1;

(dw) сигнальной последовательности, содержащей аминокислоты 22–33 последовательности SEQ ID NO: 1;

(dx) сигнальной последовательности, содержащей аминокислоты 20–31 последовательности SEQ ID NO: 1;

(dy) сигнальной последовательности, содержащей аминокислоты 14–23 последовательности SEQ ID NO: 3;

(dz) сигнальной последовательности, содержащей аминокислоты 14–25 последовательности SEQ ID NO: 3; или

(ea) сигнальной последовательности, содержащей аминокислоты 12–23 последовательности SEQ ID NO: 3.

22. Рекомбинантная бактерия группы Bacillus cereus по п. 21, где

адгезин включает рикадгезин; или

структурный белок биопленки включает TasA или YuaB.

23. Способ по п. 1, семя растения по п. 2 или рекомбинантная бактерия группы Bacillus cereus по п. 3, отличающиеся тем, что рекомбинантная бактерия группы Bacillus cereus включает Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis или их комбинацию.

24. Способ по п. 1, семя растения по п. 2 или рекомбинантная бактерия группы Bacillus cereus по п. 3, отличающиеся тем, что рекомбинантная бактерия группы Bacillus cereus включает штамм бактерий, стимулирующий рост растения, причем штамм бактерий, стимулирующий рост растения, необязательно: продуцирует инсектицидный токсин, продуцирует фунгицидное соединение, продуцирует нематоцидное соединение, продуцирует бактерицидное соединение, является устойчивым к одному или более антибиотикам, содержит одну или более самостоятельно реплицирующихся плазмид, прикрепляется к корням растений, колонизирует корни растений, формирует биопленки, растворяет питательные вещества, секретирует органические кислоты или их комбинации.

25. Способ, семя растения или рекомбинантная бактерия группы Bacillus cereus по п. 24, где

инсектицидный токсин включает Cry токсин;

фунгицидное соединение включает β-1,3-глюканазу, хитозаназу, литиказу или их комбинацию; и/или

нематоцидное соединение включает Cry токсин.

26. Способ по п. 1, семя растения по п. 2 или 3 или рекомбинантная бактерия группы Bacillus cereus по п. 4, отличающиеся тем, что рекомбинантная бактерия группы Bacillus cereus включает Bacillus mycoides BT155, имеющий номер доступа NRRL No. B-50921; Bacillus mycoides EE118, имеющий номер доступа NRRL No. B-50918; Bacillus mycoides EE141, имеющий номер доступа NRRL No. B-50916; Bacillus mycoides BT46-3, имеющий номер доступа NRRL No. B-50922; член группы Bacillus cereus EE128, имеющий номер доступа NRRL No. B-50917; Bacillus thuringiensis BT013A, имеющий номер доступа NRRL No. B-50924, или член группы Bacillus cereus EE349, имеющий номер доступа NRRL No. B-50928.

27. Способ, семя растения или рекомбинантная бактерия группы Bacillus cereus по п. 26, отличающиеся тем, что гибридный белок включает сигнальную последовательность из SEQ ID №: 60.

28. Способ, семя растения или рекомбинантная бактерия группы Bacillus cereus по п. 27, отличающиеся тем, что белок или пептид, стимулирующий рост растения, включает негормональный пептид, негормональный пептид, включающий ингибитор трипсина Кунитца (ИТК); или где белок или пептид, стимулирующий рост растения, включает фермент, участвующий в продуцировании или активации соединения, стимулирующего рост растения, где фермент включает хитозаназу.

29. Способ по п. 1, семя растения по п. 2 или рекомбинантная бактерия группы Bacillus cereus по п. 3, где гибридный белок включает сигнальную последовательность, содержащую SEQ ID NO: 60, и эндоглюканазу или фосфатазу, где фосфатаза необязательно включает PhoA4 или фитазу.

30. Способ по п. 1, семя растения по п. 2 или рекомбинантная бактерия группы Bacillus cereus по п. 3, отличающиеся тем, что гибридный белок экспрессируется под контролем споруляционного промотора, нативного по отношению к сигнальной последовательности, белку экзоспория или фрагменту белка экзоспория в гибридном белке, и/или отличающиеся тем, что гибридный белок экспрессируется под контролем сильного споруляционного промотора; причем:

сильный споруляционный промотор необязательно включает промоторную последовательность сигма-K, специфическую для полимеразы споруляции, промоторную последовательность или последовательности сигма-K, специфические для полимеразы споруляции, необязательно имеющие 100% идентичности с соответствующими нуклеотидами из SEQ ID №: 85, 86, 87, 88, 89 , 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102 или 103; и/или

промотор споруляции необязательно включает нуклеотидную последовательность, имеющую по меньшей мере 95%, по меньшей мере 98%, по меньшей мере 99% или 100% идентичности с нуклеотидной последовательностью любой из SEQ ID №№: 85–103.

31. Препарат для стимуляции роста растения, где препарат содержит рекомбинантную бактерию группы Bacillus cereus по п. 3 или рекомбинантную бактерию группы Bacillus cereus, которая экспрессирует гибридный белок по любому из пп. 4, 9, и 10 и сельскохозяйственно-приемлемый носитель, причем:

сельскохозяйственно-приемлемый носитель необязательно включает диспергирующее вещество, сурфактант, добавку, воду, загуститель, противослеживающий агент, противоосадочное вещество, компостирующий препарат, гранулированную подкормку, диатомит, масло, краситель, стабилизатор, консервант, полимер, пленку или их комбинацию;

указанный препарат необязательно включает препарат для покрытия семян, жидкий препарат, применяемый для растений или растительных ростовых сред, или твердый препарат, применяемый для растений или растительных ростовых сред;

указанный препарат необязательно дополнительно включает удобрение, материал микроэлементов удобрения, инсектицид, гербицид, вещество, улучшающее рост растений, фунгицид, инсектицид, моллюскоцид, альгицид, бактериальный инокулянт, грибковый инокулянт или их комбинацию; и/или

сельскохозяйственно-приемлемый носитель включает вермикулит, древесный уголь, отходы сатурационного пресса сахарного завода, рисовую шелуху, карбоксиметилцеллюлозу, торф, перлит, мелкий песок, карбонат кальция, муку, квасцы, крахмал, тальк, поливинилпирролидон или их комбинацию.

32. Препарат по п. 31, где:

сурфактант включает тяжелое нефтяное масло, тяжелый нефтяной дистиллят, сложный эфир полиола жирной кислоты, полиэтоксилированный эфир жирной кислоты, арилалкил полиоксиэтиленгликоля, алкиламин ацетат, алкиларилсульфонат, многоатомный спирт, алкилфосфат или их комбинацию;

добавка включает масло, камедь, смолу, глину, полиоксиэтиленгликоль, терпен, вязкую органику, сложный эфир жирной кислоты, сульфатированный спирт, алкилсульфонат, нефтяной сульфонат, сульфат спирта, алкилбутандиамат натрия, полиэфир тиобутандиоата натрия, производное бензол-ацетонитрила, белковый материал или их комбинацию;

загуститель включает алкилсульфонат полиэтиленгликоля с длинной цепью, полиоксиэтиленолеат или их комбинацию;

противослеживающий агент включает соль натрия, карбонат кальция, диатомит или их комбинацию;

препарат для покрытия семян включает раствор на водной или масляной основе, применяемый для семян, или порошок или гранулированный препарат, применяемый для семян;

жидкий препарат, применяемый для растений или растительных ростовых сред, включает концентрированный препарат или препарат, готовый для использования; и/или

твердый препарат, применяемый для растений или растительных ростовых сред, включает гранулированный препарат или порошковое вещество.

33. Препарат по п. 31, отличающийся тем, что бактериальный инокулянт включает штамм бактерий, стимулирующий рост растения, причем штамм бактерий, стимулирующий рост растения, необязательно: продуцирует инсектицидный токсин, продуцирует фунгицидное соединение, продуцирует нематоцидное соединение, продуцирует бактерицидное соединение, является устойчивым к одному или более антибиотикам, содержит одну или более самостоятельно реплицирующихся плазмид, прикрепляется к корням растений, колонизирует корни растений, формирует биопленки, растворяет питательные вещества, секретирует органические кислоты или их комбинации.

34. Препарат по п. 33, где

инсектицидный токсин включает Cry токсин;

фунгицидное соединение включает β-1,3-глюканазу, хитозаназу, литиказу или их комбинацию; и/или

нематоцидное соединение включает Cry токсин.

35. Препарат по п. 33, отличающийся тем, что бактериальный инокулянт включает Bacillus aryabhattai CAP53, имеющий номер доступа NRRL No. B-50819; Bacillus aryabhattai CAP56, имеющий номер доступа NRRL No. B-50817; Bacillus flexus BT054, имеющий номер доступа NRRL No. B-50816; Paracoccus kondratievae NC35, имеющий номер доступа NRRL No. B-50820; Bacillus mycoides BT155, имеющий номер доступа NRRL No. B-50921; Enterobacter cloacae CAP12, имеющий номер доступа NRRL No. B-50822; Bacillus nealsonii BOBA57, имеющий номер доступа NRRL No. B-50821; Bacillus mycoides EE118, имеющий номер доступа NRRL No. B-50918; Bacillus subtilis EE148, имеющий номер доступа NRRL No. B-50927; Alcaligenes faecalis EE107, имеющий номер доступа NRRL No. B-50920; Bacillus mycoides EE141, имеющий номер доступа NRRL No. B-50916; Bacillus mycoides BT46-3, имеющий номер доступа NRRL No. B-50922; член группы Bacillus cereus EE128, имеющий номер доступа NRRL No. B-50917; Bacillus thuringiensis BT013A, имеющий номер доступа NRRL No. B-50924; Paenibacillus massiliensis BT23, имеющий номер доступа NRRL No. B-50923; член группы Bacillus cereus EE349, имеющий номер доступа NRRL No. B-50928; Bacillus subtilis EE218, имеющий номер доступа NRRL No. B-50926; Bacillus megaterium EE281, имеющий номер доступа NRRL No. B-50925, или их комбинацию.

36. Способ стимулирования роста растений, включающий следующие этапы:

введение рекомбинантной бактерии группы Bacillus cereus по п. 20 в среду для роста растений; или

применение рекомбинантной бактерии группы Bacillus cereus по п. 20 к растению, семени растения или области, окружающей растение или семя растения.

37. Способ для стимулирования роста растений по п. 1, отличающийся тем, что растения, выращенные в присутствии рекомбинантной бактерии группы Bacillus cereus, демонстрируют усиленный рост по сравнению с растениями, выращенными в отсутствие рекомбинантной бактерии группы Bacillus cereus в тех же условиях.

38. Способ по п. 37, где

растения, выращенные на среде для роста растений, содержащей рекомбинантную бактерию группы Bacillus cereus, демонстрируют усиленный рост по сравнению с ростом растений, выращенных в той же среде, которая не содержит рекомбинантную бактерию группы Bacillus cereus, в тех же условиях;

растения, на которых нанесли рекомбинантную бактерию группы Bacillus cereus, демонстрируют усиленный рост по сравнению с ростом растений, на которых не наносили рекомбинантную бактерию группы Bacillus cereus, в тех же условиях;

растения, выращенные из семян растений, на которые нанесли рекомбинантную бактерию группы Bacillus cereus, демонстрируют усиленный рост по сравнению с ростом растений, выращенных из семян растений, на которые не наносили рекомбинантную бактерию группы Bacillus cereus, в тех же условиях; или

растения, выращенные в области, на которую нанесли рекомбинантную бактерию группы Bacillus cereus, демонстрируют усиленный рост по сравнению с ростом растений, выращенных в области, на которую не наносили рекомбинантную бактерию группы Bacillus cereus, в тех же условиях.

39. Способ по п. 1, дополнительно включающий инактивацию рекомбинантной бактерии группы Bacillus cereus до введения в среду для роста растений или применения к растению, семени растения или области, окружающей растение или семя растения; причем рекомбинантная бактерия группы Bacillus cereus необязательно инактивируется термической обработкой; гамма-облучением; рентгеновским облучением; УФ-А-облучением; УФ-В-облучением; обработкой глютаровым альдегидом, формальдегидом, перекисью водорода, уксусной кислотой, отбеливателем или их комбинацией.

40. Способ по п. 1, отличающийся тем, что:

среда для роста растений включает почву, воду, водный раствор, песок, гравий, полисахарид, мульчу, компост, торф, солому, необработанный лесоматериал, глину, соевый шрот, дрожжевой экстракт или их комбинацию; и/или

среда для роста растений дополнена субстратом для фермента, при этом субстрат необязательно включает триптофан, аденозинмонофосфат, аденозиндифосфат, аденозинтрифосфат, индол, триметафосфат, ферродоксин, ацетоин, диацетил, пируват, ацетолактат, пектин, целлюлозу, метилцеллюлозу, крахмал, хитин, пектин, шрот, производное целлюлозы, фосфат, ацетоин, хитозан, неактивное производное индол-3-уксусной кислоты, неактивное производное гибберелловой кислоты, ксилан, арабиноксилан, жир, воск, масло, фитиновую кислоту, лигнин, гуминовую кислоту, холин, производное холина, пролин, полипролин, белок, богатый пролином, муку, богатую пролином, фенилаланин, хоризмат или их комбинацию.

41. Способ по п. 1, включающий покрытие семян рекомбинантной бактерией группы Bacillus cereus или препаратом, содержащим рекомбинантную бактерию группы Bacillus cereus, до посадки.

42. Способ по п. 1, включающий применение рекомбинантной бактерии группы Bacillus cereus или препарата к надземной части растения.

43. Способ по п. 1, отличающийся тем, что введение рекомбинантной бактерии группы Bacillus cereus в среду для роста растений включает применение жидкого или твердого препарата, содержащего рекомбинантную бактерию группы Bacillus cereus, для среды.

44. Способ по п. 1, дополнительно включающий введение по меньшей мере одного агрохимиката в среду для роста растений или применение по меньшей мере одного агрохимиката к растениям или семенам, причем агрохимикат включает удобрение, материал микроэлементов удобрения, инсектицид, гербицид, фунгицид, моллюскоцид, альгицид, вещество, улучшающее рост растений, бактериальный инокулянт, грибковый инокулянт или их комбинацию, причем:

удобрение включает жидкое удобрение;

материал микроэлементов удобрения включает борную кислоту, борат, борную фритту, сульфат меди, медную фритту, хелат меди, декагидрат тетрабората натрия, сульфат железа, оксид железа, сульфат железа-аммония, железную фритту, хелат железа, сульфат марганца, оксид марганца, хелат марганца, хлорид марганца, марганцевую фритту, молибдат натрия, молибденовую кислоту, сульфат цинка, оксид цинка, карбонат цинка, цинковую фритту, фосфат цинка, хелат цинка или их комбинацию;

инсектицид включает органофосфат, карбамат, пиретроид, акарицид, алкил-фталат, борную кислоту, борат, фторид, серу, мочевину, замещенную ароматическим галоидом, эфир насыщенного спирта, инсектицид на биологической основе или их комбинацию;

гербицид включает хлорфенокси соединение, нитрофенольное соединение, соединение нитрокрезола, соединение дипиридила, ацетамид, алифатическую кислоту, анилид, бензамид, бензойную кислоту, производное бензойной кислоты, анисовую кислоту, производное анисовой кислоты, бензонитрил, бензотиадиазинона диоксид, тиокарбамат, карбамат, карбанилат, хлорпиридинил, производное циклогексенона, производное динитроаминобензола, соединение фтор-динитро-толуидин, изоксазолидинон, никотиновую кислоту, изопропиламин, производные изопропиламина, оксадиазолинон, фосфат, фталат, соединение пиколиновой кислоты, триазин, триазол, урацил, производное мочевины, эндотал, хлорат натрия или их комбинацию;

фунгицид включает замещенный бензол, тиокарбамат, этилен-бис-дитиокарбамат, тиофталид амид, соединение меди, ртутьорганическое соединение, оловоорганическое соединение, соединение кадмия, анилазин, беномил, циклогексамид, додин, этридиазол, ипродион, металаксил, тиамимефон, трифорин или их комбинацию;

грибковый инокулянт включает грибковый инокулянт из семейства Glomeraceae, грибковый инокулянт из семейства Claroidoglomeraceae, грибковый инокулянт из семейства Gigasporaceae, грибковый инокулянт из семейства Acaulosporaceae, грибковый инокулянт из семейства Sacculosporaceae, грибковый инокулянт из семейства Entrophosporaceae, грибковый инокулянт из семейства Pacidsporaceae, грибковый инокулянт из семейства Diversisporaceae, грибковый инокулянт из семейства Paraglomeraceae, грибковый инокулянт из семейства Archaeosporaceae, грибковый инокулянт из семейства Geosiphonaceae, грибковый инокулянт из семейства Ambisporaceae, грибковый инокулянт из семейства Scutellosporaceae, грибковый инокулянт из семейства Dentiscultataceae, грибковый инокулянт из семейства Racocetraceae, грибковый инокулянт из типа Basidiomycota, грибковый инокулянт из типа Ascomycota, грибковый инокулянт из типа Zygomycota или их комбинацию;

бактериальный инокулянт включает бактериальный инокулянт из рода Rhizobium, бактериальный инокулянт из рода Bradyrhizobium, бактериальный инокулянт из рода Mesorhizobium, бактериальный инокулянт из рода Azorhizobium, бактериальный инокулянт из рода Allorhizobium, бактериальный инокулянт из рода Sinorhizobium, бактериальный инокулянт из рода Kluyvera, бактериальный инокулянт из рода Azotobacter, бактериальный инокулянт из рода Pseudomonas, бактериальный инокулянт из рода Azospirillium, бактериальный инокулянт из рода Bacillus, бактериальный инокулянт из рода Streptomyces, бактериальный инокулянт из рода Paenibacillus, бактериальный инокулянт из рода Paracoccus, бактериальный инокулянт из рода Enterobacter, бактериальный инокулянт из рода Alcaligenes, бактериальный инокулянт из рода Mycobacterium, бактериальный инокулянт из рода Trichoderma, бактериальный инокулянт из рода Gliocladium, бактериальный инокулянт из рода Glomus, бактериальный инокулянт из рода Klebsiella или их комбинацию; и/или

удобрение включает сульфат аммония, нитрат аммония, сульфат-нитрат аммония, хлорид аммония, бисульфат аммония, полисульфид аммония, тиосульфат аммония, водный раствор аммиака, безводный аммиак, полифосфат аммония, сульфат алюминия, нитрат кальция, известково-аммиачную селитру, сульфат кальция, обожжённый магнезит, кальцитовый известняк, оксид кальция, нитрат кальция, доломитовый известняк, гашеную известь, карбонат кальция, диаммонийфосфат, моноаммонийфосфат, нитрат магния, сульфат магния, нитрат калия, хлорид калия, сульфат калия-магния, сульфат калия, нитраты натрия, магнезиальный известняк, оксид магния, мочевину, карбамидоформальдегидные смолы, мочевино-аммониевый нитрат, покрытую серой мочевину, мочевину с полимерным покрытием, изобутилиден димочевину, K2SO4–2MgSO4, каинит, сильвинит, кизерит, эпсомскую соль, элементарную серу, мергель, измельченные устричные раковины, рыбную муку, жмыхи, рыбный тук, кровяную муку, фосфорит, суперфосфат, шлак, костную муку, древесную золу, навоз, гуано летучих мышей, торф, компост, зеленый песок, муку из семян хлопчатника, муку из перьев, муку из крабов, рыбную эмульсию, гуминовую кислоту или их комбинацию.



 

Похожие патенты:

Изобретение относится к области биохимии. Предложены иммуногенные полиэпитопные вакцинные конструкции, содержащие эпитопы опухоль-ассоциированных антигенов - ЦТЛ-эпитопы и Т-хелперные эпитопы - и оптимизированные спейсерные последовательности.

Настоящее изобретение относится к области биотехнологии, конкретно к терапевтическим химерным белкам, которые можно применять в медицине для лечения мукополисахаридоза IIIB типа (Синдром Санфилиппо В).

Группа изобретений относится к области биотехнологии, генной инженерии и медицины. Предложен искусственный ген YkuJ-MPER, кодирующий белок-иммуноген YkuJ-MPER против ВИЧ-1, имеющий нуклеотидную последовательность SEQ ID NO:1 длиной 360 п.н.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков, и может быть использовано для получения слитого белка MBP84-106-Fc, состоящего из лидерного пептида тяжелой цепи моноклонального антитела FI0, слитого с фрагментом основного белка миелина 84-106 (МВР84-106) и затем с Fc-фрагментом антитела IgG 1 (домены СН2-СН3) человека, в клетках яичника китайского хомячка (СНО).

Изобретение относится к биотехнологии, в частности к иммунологии, и представляет собой иммуногенный модифицированный белок, содержащий (i) белок, имеющий суперспиральный домен, и (ii), по меньшей мере, один положительно заряженный пептид, связанный с С-концом или N-концом суперспирального домена, где указанный модифицированный белок имеет последовательность, как показано в SEQ ID NO: 42 (IMX313P), или имеет последовательность, как показано в SEQ ID NO: 7.

Изобретение относится к области биотехнологии. Предложена генетическая конструкция pCXC8R-Fc, содержащая ранний промотор цитомегаловируса (CMV) человека, лидерную последовательность CD33, экстраклеточный домен рецептора интерлейкина 8, сайт узнавания фактора Ха, Fc фрагмент иммуноглобулина G1 человека, синтетический интрон IVS, участок внутренней посадки рибосомы вируса энцефаломиокардита (IRES), Neo(R), сигнальную последовательность полиаденилирования вируса SV40, ориджин репликации ColE1, Amp(R).

Изобретение относится к области биотехнологии, конкретно к вариантам исходного альбумина, что может быть использовано в медицине. Получают полипептид, который является вариантом альбумина или его фрагментом, где этот полипептид содержит изменения в двух или более положениях, выбранных из положений: (а) 492 и 580; (b) 492 и 574; (с) 492 и 550; (d) 550 и 573; (e) 550 и 574; (f) 550 и 580 в SEQ ID NO: 2, и не содержит мутаций E492G+K573P, E492G+K573A или E492G+N503K, а также получают слитые с ним полипептиды, полинуклеотиды, кодирующие эти варианты, конъюгаты, ассоциаты и наночастицы с ним, композиции, векторы, клетки-хозяева, содержащие эти полинуклеотиды, и способы использования этих вариантов.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к рекомбинантной плазмидной ДНК pET31b-pHLIP. Указанная плазмидная ДНК кодирует аминокислотную последовательность рекомбинантного рН-зависимого встраивающегося пептида и обеспечивает его синтез в составе белка-слияния с кетостероидизомеразой.

Изобретение относится к области генной инженерии, конкретно к рекомбинантному получению антиангиогенных белков, и может быть использовано в медицине. Сконструирована рекомбинантная плазмидная ДНК pERIG-PGS, обеспечивающая синтез в клетках Escherichia coli гибридного белка GyrA-PGS, содержащего модифицированный мини-интеин Мхе GyrA и антиангиогенный пептид Пигастин - производное фрагмента [44-77] фактора роста пигментного эпителия человека с присоединенной к С-концу последовательностью Pro-Gly-Pro.

Изобретение относится к биотехнологии, генной инженерии, биохимии, медицине, ветеринарии. Получают синтетическую последовательность ДНК, соответствующую гену, кодирующему белковую последовательность гепаринсвязывающего домена (HBD) из Danio rerio, слитую с последовательностью эритропоэтина (Еро) человека (белок HBD-Epo), спланированную таким образом, чтобы нуклеотидный состав кодонов был оптимизирован для гетерологичной экспрессии в непатогенном лабораторном штамме Е.

Настоящее описание относится к биотехнологии, в частности к рекомбинантным микроорганизмам, генетически модифицированным для усиления продуцирования требуемой аминокислоты.

Изобретение относится к области пищевой промышленности. Описан способ получения заквасочной культуры, включающей по крайней мере два различных устойчивых к бактериофагам вариантных штамма Streptococcus thermophiles.

Изобретение относится к области биотехнологии, а именно к технологии получения живых флуоресцентных микроорганизмов. Предложен штамм-продуцент флуоресцентного белка Katushka2S на основе штамма Escherichia coli DH5α, трансформированного экспрессионной векторной плазмидой pKatushka2S-B, содержащей нуклеотидные последовательности индуцибельного промотера Т5 в составе lac-оперона, гена дальне-красного флуоресцентного белка Katushka2S, гена blat устойчивости к ампициллину, обеспечивающей внутриклеточную продукцию дальне-красного флуоресцентного белка Katushka2S, для проведения ультравысокопроизводительного скрининга.

Изобретение относится к области биотехнологии. Представлен рекомбинантный штамм бактерии Streptococcus pyogenes М39 «Гуров», полученный путем трансформации штамма Streptococcus pyogenes «Гуров» плазмидой pT7ErmEMM, полученной на основе вектора p7ermB путем встраивания по сайтам HindIII и EcoRI фрагмента гена emm.

Группа изобретений относится к области биотехнологии. Предложен генетически конструируемый микроорганизм, способный преобразовывать холестерин, аналоги и производные холестерина в предшественники стероидных гормонов, где указанный микроорганизм содержит по меньшей мере одну последовательность ДНК, кодирующую цитохром P450 эукариотического происхождения, экзогенную последовательность ДНК, кодирующую Adx, и экзогенную последовательность ДНК, кодирующую AdR, и где указанный микроорганизм представляет собой Bacillus megaterium.

Изобретение относится к области биотехнологии, в частности к плазмиде для синтеза α-зеина В1 кукурузы вида Zea mays, а также к рекомбинантному штамму, содержащему вышеуказанную плазмиду.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Escherichia, продуцирующий L-триптофан, где активности эндогенных 6-фосфоглюконатдегидратазы (Edd) и 2-кето-3-дезокси-6-фосфоглюконатальдолазы (Eda) ослаблены или инактивированы, где микроорганизм имеет усиленный РРР (пентозофосфатный путь) посредством ослабленного или блокированного пути Энтнера-Дудорова.

Изобретение относится к биотехнологии и представляет собой рекомбинантную плазмидную ДНК pPA-OPRF-ATOX-OPRI, которая содержит слитые гены, кодирующие белки F и I наружной мембраны Pseudomonas aeruginosa, а также атоксический вариант экзотоксина A Pseudomonas aeruginosa.

Изобретение относится к области биотехнологии и биохимии, в частности к рекомбинантной клетке-хозяину для получения диальдегида кроцетина, кроцетина и гидроксил-β-циклоцитраля.

Группа изобретений относится к биотехнологии. Предложен микроорганизм рода Escherichia, продуцирующий О-ацетилгомосерин, где активность белка, содержащего аминокислотную последовательность SEQ ID NO: 1, повышена по сравнению с немодифицированным микроорганизмом, продуцирующим О-ацетилгомосерин, и где активность цистатионинсинтазы инактивирована по сравнению с немодифицированным микроорганизмом, продуцирующим О-ацетилгомосерин.

Изобретение относится к области биотехнологии, микробиологии и молекулярной генетики. Заявлен химерный рекомбинантный белок, состоящий из консервативных и иммуногенных фрагментов аминокислотных последовательностей поверхностных белков Streptococcus pyogenes: Sic, SpySEP, SpeA, ScpA, ScaAB и терминальных доменов флагеллина Salmonella typhiurium FliA и FliC, выполняющих функцию внутреннего адъюванта.

Изобретение относится к области биохимии, в частности к способу стимулирования роста растений, включающему введение рекомбинантной бактерии группы Bacillus cereus, экспрессирующей гибридный белок в среде для роста растений, или применение рекомбинантной бактерии группы Bacillus cereus, экспрессирующей гибридный белок, к растению, семени растения или области, окружающей растение или семя растения, причем гибридный белок включает белок или пептид, стимулирующий рост растения, а также сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория. Также раскрыты семя растения и рекомбинантная бактерия группы Bacillus cereus для стимулирования роста растения, содержащие гибридный белок, включающий сигнальную последовательность, белок экзоспория или фрагмент белка экзоспория. Изобретение также относится к гибридному белку для стимуляции роста растения. Изобретение позволяет эффективно стимулировать рост растений. 8 н. и 36 з.п. ф-лы, 2 ил., 31 табл., 39 пр.

Наверх