Нуклеотидная последовательность, кодирующая слитый белок, состоящий из растворимого внеклеточного домена человеческого tnfr1 и константной части тяжёлой цепи человеческого igg4



Нуклеотидная последовательность, кодирующая слитый белок, состоящий из растворимого внеклеточного домена человеческого tnfr1 и константной части тяжёлой цепи человеческого igg4
Нуклеотидная последовательность, кодирующая слитый белок, состоящий из растворимого внеклеточного домена человеческого tnfr1 и константной части тяжёлой цепи человеческого igg4
Нуклеотидная последовательность, кодирующая слитый белок, состоящий из растворимого внеклеточного домена человеческого tnfr1 и константной части тяжёлой цепи человеческого igg4
Нуклеотидная последовательность, кодирующая слитый белок, состоящий из растворимого внеклеточного домена человеческого tnfr1 и константной части тяжёлой цепи человеческого igg4
Нуклеотидная последовательность, кодирующая слитый белок, состоящий из растворимого внеклеточного домена человеческого tnfr1 и константной части тяжёлой цепи человеческого igg4
C12N2330/51 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)
C12N15/1051 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)
C07K2319/00 - Пептиды (пептиды в пищевых составах A23, например получение белковых композиций для пищевых составов A23J, препараты для медицинских целей A61K; пептиды, содержащие бета-лактамовые кольца, C07D; циклические дипептиды, не содержащие в молекуле любого другого пептидного звена, кроме образующего их кольцо, например пиперазин-2,5-дионы, C07D; алкалоиды спорыньи циклического пептидного типа C07D519/02; высокомолекулярные соединения, содержащие статистически распределенные аминокислотные единицы в молекулах, т.е. при получении предусматривается не специфическая, а случайная последовательность аминокислотных единиц, гомополиамиды и блоксополиамиды, полученные из аминокислот, C08G 69/00; высокомолекулярные продукты, полученные из протеинов, C08H 1/00; получение

Владельцы патента RU 2689522:

Общество с ограниченной ответственностью "Пальмира Биофарма" (RU)

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков, и может быть использовано для получения антагониста фактора некроза опухолей. Методами генной инженерии получают слитый полипептид-антагонист фактора некроза опухолей, состоящий из растворимого внеклеточного домена человеческого TNFR1 и константной части тяжёлой цепи человеческого IgG4. Изобретение обеспечивает получение гибридного белка TNFR1-Fc, который обладает потенциально улучшенными фармакокинетическими свойствами и минимальной эффекторной функцией антитело-зависимой клеточной цитотоксичности, но не характеризуется комплемент-зависимой цитотоксичностью, из-за введения шарнирного участка, позволяющего эктодомену TNFR1 и домену Fc действовать независимо друг от друга. 3 н. и 1 з.п. ф-лы, 1 ил., 2 пр.

 

Область техники

Изобретение относится к биотехнологии, медицинским технологиям, в частности к созданию высокоэффективных лекарственных средств на основе биологических молекул.

Уровень техники

Последние достижения в области молекулярной и клеточной биологии позволили вывести понимание патофизиологических процессов, лежащих в основе большинства социально-значимых заболеваний на качественно новый уровень. В свою очередь это позволило создать новый класс биологических препаратов, специфически воздействующих лишь на ключевые молекулярные звенья патофизиологических процессов. Применение этого класса препаратов в медицине - «таргетная терапия» - по сравнению с предшествующими лекарственными препаратами показывает лучшую эффективность и безопасность за счет узкой направленности конкретные органы, ткани или типы клеток.

На сегодняшний день существует несколько подходов к созданию высоко специфичных препаратов. Из них в качестве лекарственных средств пока зарегистрирован ряд малых молекул, антител и растворимых рецепторов («трапы»). При этом биологические лекарственные препараты, например, на основе антител, в сочетании с равными или более высокими показателями эффективности, имеют лучшую переносимость и меньшие побочные эффекты, чем химические.

Большая часть ключевых игроков на рынке биологических препаратов используют для их создания технологию производства моноклональных антител (Novartis, Roche, Amgen). Она относится к одной из наиболее универсальных для создания лекарственных средств, поскольку позволяет создавать агенты против самых различных терапевтических мишеней. Однако, существенным «минусом» технологии является сложность и высокая стоимость разработки в сочетании с высокой наукоемкостью производством.

Технология, которая решает указанную проблему, это технология производства рецепторов-«трапов». В первую очередь, рецепторы-«трапы» имеют лучшие показатели временных и финансовых затрат на создание и производство терапевтического препарата по сравнению с моноклональными антителами. Это обусловлено отсутствием необходимости проведения длительных и дорогостоящих экспериментов по иммунизации, гуманизации и скринингу антител. Во-вторых, терапевтически агенты рецепторы-«трапы» обладают большей эффективностью. Ключевым игроком на данном рынке является компания Регенерон, имеющая на территории РФ зарегистрированный в качестве лекарственного средства рецептор-«трап» для лечения макулодистрофии - Эйлеа® (Афлиберцепт).

Технология получения рецепторов-«трапов» основана на создании гибридного белка, способного эффективно и быстро связывать молекулу-мишень. Как правило, рецептор-«трап» состоит из двух частей - внеклеточного домена рецептора молекулы-мишени Fc-домена иммуноглобулина. Внеклеточный домен рецептора отвечает за связывание мишени, а Fc-домен осуществляет димеризацию гибридного белка. Последнее необходимо для увеличения эффективности связывания и обеспечения большей стабильности высокомолекулярного комплекса.

Присутствующий на рынке препарат на основе рецептора-«трапа» Etanercept (Enbrel), адресно связывающий фактор некроза опухолей (TNFα, ФНО), характеризуется рядом свойств, которые могут быть существенно превзойдены путем создания новой комбинаторной белковой конструкции, состоящей из частей биологических молекул с заданными свойствами.

Несмотря на наличие нескольких биологических препаратов, нейтрализующих фактор некроза опухолей TNFα, на рынке сохраняется потребность в новых биологических препаратах с улучшенными свойствами. Эта потребность обусловлена высокой стоимостью инновационных препаратов, часто возникающей резистентностью пациентов к определенному препарату (связанную с его иммуногенностью), а также с растущим во всем мире числом аутоиммунных заболеваний, в которых ФНО играет ключевую роль в патологическом процессе. Данное изобретение обладает рядом улучшенных свойств по сравнению с аналогами, и поэтому расширяет круг имеющихся кандидатов для лечения заболеваний, вызванных гиперактивацией ФНО.

Сущность изобретения

Задачей настоящего изобретения является расширение арсенала технических средств для лечения заболеваний, вызванных гиперактивацией TNFα (ФНО), и создание терапевтического агента на основе слитого белка TNFR-Fc с улучшенными свойствами. Указанная задача решается путем создания гибридного полипептид-антагониста фактора некроза опухолей, имеющего аминокислотную последовательность SEQ ID NO: 2, а также создания молекулы нуклеиновой кислоты, кодирующей данный гибридный полипептид-антагонист фактора некроза опухолей. В некоторых вариантах изобретения данная молекулы нуклеиновой кислоты имеет нуклеотидную последовательность SEQ ID NO: 1. Также указанная задача решается путем создания экспрессирующего вектора, содержащего данную молекулу нуклеиновой кислоты под контролем регуляторных элементов, необходимых для экспрессии данной нуклеиновой кислоты в клетке-хозяине. В предпочтительных вариантах изобретения в качестве клетки-хозяина могут выступать клетки яичников китайских хомячков CHO (клеточные линии CHO-К1 или CHO DG44), адаптированные для производства терапевтических белков.

В настоящем изобретении экспрессирующий вектор предпочтительно подбирается для экспрессии гетерологичных последовательностей в клетках млекопитающих, но в некоторых вариантах изобретения экспрессирующий вектор может быть выбран для экспрессии в других системах, таких как, например, клетки насекомых, дрожжевые или бактериальные клетки. Соответственно, каждый экспрессирующий вектор имеет свой набор регуляторных элементов, позволяющих проводить экспрессию гетерологичной последовательности (продукта) в клетке-хозяине, таких как промоторы и/или энхансеры, и/или polyA последовательности.

При осуществлении изобретения достигается следующий технический результат: создан новый вариант терапевтического агента на основе гибридного белка с улучшенными свойствами и с последовательностью SEQ ID NO: 2 для блокировки воспалительного цитокина ФНО, при этом данный гибридный белок обладает: а) только минимальной эффекторной функцией антитело-зависимой клеточной цитотоксичности; б) не обладает комплемент-зависимой цитотоксичностью; в) потенциально улучшенными фармакокинетическими свойствами из-за введения шарнирного участка, позволяющего эктодомену TNFR1 и домену Fc действовать независимо друг от друга.

Краткое описание рисунков

Рис.1. Схема экспрессирующего вектора, содержащего заявляемую нуклеотидную последовательность, кодирующую гибридный полипептид-антагонист фактора некроза опухолей TNFR1-hinge-hIgG4_Fc.

Подробное раскрытие изобретения

В описании данного изобретения термины «включает» и «включающий» интерпретируются как означающие «включает, помимо всего прочего». Указанные термины не предназначены для того, чтобы их истолковывали как «состоит только из».

Сущность технического решения заключается в создании нуклеотидной последовательности (SEQ ID No:1), которая кодирует гибридный белок с последовательностью SEQ ID No:2, состоящий из сигнального пептида (аминокислоты 1 - 20) и трех функциональных частей, первая из которых кодирует растворимый внеклеточный домен человеческого TNFR1 (он же TNFRSF1A, CD120a; FPF; MS5; TBP1; TNF-R; TNF-R-I; TNF-R55; TNFAR; TNFR1; TNFR1-d2; TNFR55; TNFR60; p55; p55-R; p60) (аминокислоты 21 - 255), вторая кодирует шарнирный участок (аминокислоты 261 - 267), а третья кодирует константную часть тяжёлой цепи человеческого IgG4 (аминокислоты 268 - 484).

Кодирующая нуклеотидная последовательность SEQ ID No:1 может быть изменена для оптимизации уровня экспрессии в клетках определенного типа. При использовании гетерологичных систем экспрессии (например, клетки насекомых, бактериальные или дрожжевые клетки) может потребоваться оптимизация кодонов в последовательности (замена редко используемых в организме кодонов на часто используемые). Это можно сделать с помощью алгоритмов, реализованных во многих имеющихся алгоритмах для проектирования последовательностей, например, Codon optimizer, Gene Designer, или OPTIMIZER.

Экспрессия гибридной конструкции в клетках млекопитающих возможна при помощи создания стабильных клонов-продуцентов после трансфекции клеток этой конструкцией. Может быть использована трансфекция электропорацией или с использованием трансфецирующего реагента, такого как Lipofectamine 2000. Данная гибридная конструкция может быть также использована для введения в лентивирусную конструкцию и последующего заражения клеток. Для увеличения выхода гибридного белка в клетках млекопитающих возможно использование различных подходов. Методы оптимизации известны специалистам и описаны, например, в (Almo SC, Love JD. Better and faster: improvements and optimization for mammalian recombinant protein production. Curr Opin Struct Biol. 2014 Jun;26:39-43).

Заявляемый продукт является ранее не создававшейся комбинацией нуклеотидных последовательностей генома человека и призван быть экспрессионной основой для слитого белка с предсказываемыми улучшенными фармакологическими свойствами для блокировки воспалительных цитокина ФНО при лечении ревматоидного артрита и увеита, а именно: (1) минимальной эффекторной функцией для антитело-зависимой клеточной цитотоксичности (antibody-dependent cellular cytotoxicity - ADCC) и комплемент-зависимой цитотоксичности (complement-dependent cytotoxicity - CDC) благодаря использованию константной части иммуноглобулина человека IgG4-изотипа; (2) потенциально улучшенными фармакокинетическими свойствами из-за введения шарнирного участка, который позволяет двум частям молекулы, а именно внеклеточному домену TNFR1 и Fc действовать независимо друг от друга за счет увеличения гибкости молекулы на данном участке. Предполагаемая константа связывания гибридного полипептида с фактором некроза опухолей составляет около 1 нM, что достаточно для осуществления эффективной блокировки ФНО in vivo (Lang I et al., "Binding Studies of TNF Receptor Superfamily (TNFRSF) Receptors on Intact Cells" J Biol Chem, 2016 Mar 4;291(10):5022-37). После прохождения испытаний по безопасности на животных и клинических испытаний, гибридный белок по настоящему изобретению может быть включен в состав фармацевтической композиции для лечения заболеваний человека, таких как ревматоидный артрит и увеит.

Нижеследующие примеры приведены в целях раскрытия характеристик настоящего изобретения и их не следует рассматривать как каким-либо образом ограничивающие объем изобретения.

Пример 1. Конструирование плазмиды.

Для конструирования плазмиды с заявляемой нуклеотидной последовательностью использована плазмида RG208641, содержащая участок, кодирующий рецепторную часть белка hTNFR - TNFRSF1B (NM_001066) Human Tagged ORF Clone (CAT#: RG208641, OriGene, US, https://www.origene.com/catalog/cdna-clones/expression-plasmids/rg208641/tnfrsf1b-nm_001066-human-tagged-orf-clone ). Рецепторная (внеклеточная, растворимая) часть белка TNFR1 была выбран биоинформатическим анализом последовательности и использована для последующего клонирования. Для клонирования этого участка подобраны следующие праймеры:

Lob_TNF_F TATGAATTCGTTGCCCGCCCAGGTGGCA

Lob_TNF_R TATCCATGGCGTCGCCAGTGCTCCCTTCA

В праймеры были включены сайты рестрикции для рестриктаз EcoRI (прямой праймер Lob_TNF_F) и NcoI (обратный праймер Lob_TNF_R)

Проведена ПЦР со следующими условиями: 94 оС 3 мин, 25 циклов (94 оС 15 сек, 61 оС 15 сек, 72 оС 1 мин), 72оС 5 мин. Компоненты реакции: полимераза – смесь 9:1 Taq – полимеразы с Furia – полимеразой (производство «Бигль»), буфер для Taq-полимеразы с сульфатом аммония и 2,5 mM MgCl2 (Fermentas), по 0,4 mM каждого из праймеров и 0,25 mM смеси трифосфатов нуклеотидов (Fermentas). После ПЦР: ПЦР продукт очищали набором для очистки ПЦР продуктов PCR Purification kit QIAquick (QiaGene Cat.No 28106). Концентрация и соответствие предсказанному молекулярному весу проверяли при помощи гель-электрофореза в 1% агарозе (ТАЕ буфер). Полученный ПЦР продукт с рестрикционными сайтами EcoRI и NcoI был использован для дальнейшего конструирования.

Целевой вектор (InvivoGen) и ПЦР продукт обрабатывали рестриктазами EcoRI и NcoI (Fermentas) в течение 1 часа при 37 оС, очищали с помощью PCR Purification kit QIAquick и лигировали, используя 1 U лигазы (Fermentas) по протоколу производителя. Лигазной смесью трансформировали компетентные клетки E.coli Xl10-gold и высевали на среду LB, содержащую зеоцин. Чашки инкубировали в термостате в течение ночи при 37 oC. На следующий день из 20 колоний проверяли на присутствие нужной вставки, для этого часть колонии разводили в 50 мкл воды и кипятили в течение 5 минут. После охлаждения смесь использовали в качестве матрицы в реакции ПЦР. Присутствие вставки проверяли после электрофореза ПЦР продуктов. Из двух колоний, содержащих вставку выделяли плазмидную ДНК и секвенировали на секвенаторе Applied Biosystems 3500 по инструкции производителя, используя праймеры F2(прямой) и FC(обратный).

Сконструированная в результате плазмида, содержащая заявляемую нуклеотидную последовательность, была проверена на отсутствие ошибок при помощи секвенирования с двух праймеров F2 (прямой) и FC (обратный), и показана на Рис. 1.

Пример 2. Продукция гибридного белка.

Для продукции гибридного полипептид-антагониста фактора некроза опухолей TNFR1-hinge-hIgG4_Fc получали стабильную клеточную линию на основе клеток яичников китайских хомячков CHO-K1, адаптированных для производства терапевтических белков. Для получения стабильной клеточной линии использовали прибор Nucleofector 2b (Lonza, Швейцария) и набор Amaxa® Nucleofector® kit T (Lonza, Швейцария) согласно инструкции производителя. Клетки, находившиеся в состоянии 60% конфлюэнтности, снимали с флакона обработкой 0.25% раствором трипсина в изотоническом буфере. Открепившиеся клетки ресуспендировали в 4.5 мл среды DMEM с 10% бычьей фетальной сыворотки и использовали 1 млн. клеток для одной трансфекции. Суспензию клеток центрифугировали 5 мин при 150 g. Полученный клеточный осадок ресуспендировали в свежеприготовленном растворе Nucleofector® Solution (Lonza, Швейцария), добавляли 2 мкг соответствующей линеаризованной плазмиды, переносили в кювету и запускали программу трансфекции U-023 (максимальная эффективность, низкая выживаемость). После чего рассевали в 6-луночные планшеты в ростовой среде без селектирующего антибиотика. Спустя 6 часов прикрепившиеся клетки снимали и рассевали 1 лунку 6-луночного планшета на 24-луночный планшет. Спустя 16 часов после трансфекции клеточная культура подвергалась селекции на антибиотике зеоцин с концентрацией 600 мкг/мл. Для этого ростовую среду заменяли на свежую с антибиотиком по 0.5 мл в лунку. Спустя 3 дня среду меняли на 0.5 мл свежей среды с антибиотиком. Процедуру повторяли каждые 3 дня до достижения конфлюэнтности клеток в лунках. После этого лунки тестировали с целью определения уровня экспрессии гибридного белка. Для скрининга на экспрессию Fc-гибрида одиночные колонии выращивали в 96-луночном планшете (Corning, США) с 80 мкл среды CSFM (полная бессывороточная среда, содержащая 25 мM Hepes, 50 IU/мл пенициллина, инсулин, трансферрин и селениум (Invitrogen, США). На следующий день отбирали среду и содержимое анализировали при помощи стандартного гель-электрофореза в полиакриамидном геле (SDS-PAGE). Секретируемый гибридный белок визуализировали с использованием кроличьих антител против человечьего Fc-домена (Jackson Immunoresearch, США). Отдельные отобранные по уровню экспрессии колонии подвергали трипсинизации и клетки переносили в лунку 12-луночного планшета. Далее выросшие клетки частично замораживали, а частично субклонировали, используя 96-луночный планшет. Субклонирование повторяли до тех пор, пока все одиночные колонии показывали стабильно высокий уровень экспрессии гибридного белка, тогда такую колонию сохраняли для создания банка из клонов-продуцентов. Для продукции гибридного белка размороженные клетки ресуспендировали в 10 мл свежей ростовой среды и высевали в 2 флакона (25 см2). По достижении конфлюэнтности клетки пересевали последовательно последовательно во флаконы большей емкости. Спустя 3 дня среду с сывороткой меняли на бессывороточную среду ProCHO4 (Lonza, Швейцария) с добавками 4 мМ дипептида GlutaMAX (Gibco, США) и смеси антибиотиков. Для очистки гибридного белка культуральную среду, полученную в процессе роста клонов-продуцентов, подвергали фильтрации от клеточного дебриса с использованием фильтрационных модулей 0.45 мкм и 0.22 мкм (Millipore, США). Далее гибридный белок очищали при помощи аффинной хроматографии с использованием Протеин А сефарозы (Millipore, США); элицию с колонки проводили при помощи буфера с низким рН. Полученный гибридный белок тестировали на функциональную активность (связывание и инактивация ФНО) при помощи стандартных методов, таких как метод поверхностного плазмонного резонанса (SPR) и функциональные тесты на активность ФНО.

Несмотря на то, что изобретение описано со ссылкой на раскрываемые варианты воплощения, для специалистов в данной области должно быть очевидно, что конкретные подробно описанные эксперименты приведены лишь в целях иллюстрирования настоящего изобретения, и их не следует рассматривать как каким-либо образом ограничивающие объем изобретения. Должно быть понятно, что возможно осуществление различных модификаций без отступления от сути настоящего изобретения.

1. Гибридный полипептид-антагонист фактора некроза опухолей, имеющий аминокислотную последовательность SEQ ID NO: 2.

2. Изолированная молекула нуклеиновой кислоты, кодирующая гибридный полипептид-антагонист фактора некроза опухолей по п. 1.

3. Изолированная молекула нуклеиновой кислоты по п. 2, имеющая последовательность SEQ ID NO: 1.

4. Экспрессирующий вектор, содержащий молекулу нуклеиновой кислоты по п. 2 под контролем регуляторных элементов, необходимых для экспрессии данной нуклеиновой кислоты в клетке-хозяине.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков, и может быть использовано для получения рекомбинантного противоопухолевого белка DR5-B в Е.

Изобретение относится к области биотехнологии, конкретно к модуляции количества гепсидина, и может быть применено в медицине для лечения заболеваний, связанных с метаболизмом железа у субъекта.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных аналогов лактаптина, и может быть использовано в медицине. Сконструирована плазмидная ДНК pEL1, обеспечивающая синтез рекомбинантного пептида EL1 в клетках млекопитающего, и получен рекомбинантный пептид EL1, имеющий молекулярную массу 14,1 кДа.

Настоящее изобретение относится к области биотехнологии, конкретно к клеточным технологиям, и может быть использовано для экспрессии представляющего интерес полипептида в клетках CHO.

Изобретение относится к области биотехнологии и может быть использовано для получения рекомбинантного альфа-2,3- и альфа-2,6-сиалированного фолликулостимулирующего гормона (ФСГ).

Изобретение относится к биотехнологии. Предложены клетка-хозяин E.coli для получения анти-VEGF антитела или антигенсвязывающего фрагмента анти-VEGF, свободных от ошибки включения норлейцина, клетка-хозяин E.coli для получения антитела против фактора D или антигенсвязывающего фрагмента против фактора D, свободных от ошибки включения норлейцина, и Клетка-хозяин E.coli для получения анти-МЕТ антитела или антигенсвязывающего фрагмента анти-МЕТ, свободных от ошибки включения норлейцина.

Изобретение относится к области биотехнологии, конкретно к получению иммуногенного полипептида, обеспечивающего формирование иммунного ответа против инфекции, вызываемой спирохетами комплекса Borrelia burgdorferi sensu lato, и может быть использовано для серодиагностики клещевого боррелиоза.

Настоящее изобретение относится к области биотехнологии, конкретно к терапевтическим химерным белкам, которые можно применять в медицине для лечения мукополисахаридоза IIIB типа (Синдром Санфилиппо В).

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков, и может быть использовано для получения слитого белка MBP84-106-Fc, состоящего из лидерного пептида тяжелой цепи моноклонального антитела FI0, слитого с фрагментом основного белка миелина 84-106 (МВР84-106) и затем с Fc-фрагментом антитела IgG 1 (домены СН2-СН3) человека, в клетках яичника китайского хомячка (СНО).

Изобретение относится к биотехнологии. Описан способ лечения расстройства, связанного или ассоциированного с действием желчных кислот, включающий введение пептида.

Группа изобретений относится к области диагностики в ветеринарии, в частности, к тесту для обнаружения антител против CSFV. Раскрыт способ обнаружения антител против вируса классической чумы свиней (CSFV) дикого типа в тестируемом образце, где указанный образец также может содержать антитела против мутантного эпитопа TAVSPTTLR из CSFV E2, где способ включает стадию совместной инкубации указанного тестового образца с иммобилизованным носителем, который содержит эпитоп TAVSPTTLR из CSFV E2 и с носителем, который содержит мутантный эпитоп TAVSPTTLR из CSFV E2.

Изобретение относится к области биотехнологии, в частности к in vitro пролиферации стволовых клеток, полученных из подкожной жировой ткани, и применению устройства для генерирования переменного тока для усиления пролиферации стволовых клеток in vitro.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков, и может быть использовано для получения рекомбинантного противоопухолевого белка DR5-B в Е.

Изобретение относится к области биотехнологии, а именно к дифференцировке клеточного кластера плюрипотентных стволовых клеток в клетки дефинитивной энтодермы. Способ включает получение клеточного кластера плюрипотентных стволовых клеток из плюрипотентных стволовых клеток, выращенных на плоской прикрепленной культуре, сформированного из скопления клеток или не выделенного из суспензий отдельных клеток, причем плюрипотентные стволовые клетки представляют собой плюрипотентные стволовые клетки неэмбрионального происхождения, индуцибельные плюрипотентные клетки, репрограмированные плюрипотентные клетки, клетки, выделенные из соматических клеток взрослого человека, индуцированные плюрипотентные стволовые клетки, клетки, полученные из амниотической жидкости человека, человеческие партеноты или клетки из линий эмбриональных стволовых клеток человека H1, H7, H9 или SA002.

Изобретение относится к области биотехнологии, в частности к получению популяции клеток, экспрессирующих MAFA. Способ включает дифференцировку клеток человека, экспрессирующих маркеры, характерные для линии сформированной эндодермы, полученные из плюрипотентных стволовых клеток, которые представляют собой плюрипотентные стволовые клетки человека не эмбрионального происхождения, клетки из линии человеческих эмбриональных стволовых клеток H1, клетки из линии человеческих эмбриональных стволовых клеток H7, клетки из линии человеческих эмбриональных стволовых клеток H9, или клетки из линии человеческих эмбриональных стволовых клеток SA002, в клетки человека, экспрессирующие маркеры, характерные для линии панкреатической эндодермы.

Изобретение относится к биотехнологии. Описана двунитевая рибонуклеиновая кислота (днРНК) для ингибирования экспрессии ALAS1.

Изобретение относится к области биотехнологии. Описано получение рекомбинантного антигена вирусного капсида цирковируса свиней 2 (PCV-2) и его модификации путем экспрессии в прокариотической системе, очистки в мономерной форме, выделения вирусоподобных частиц (ВПЧ) и его применение в композициях вакцин, диагностических наборах и системе для количественной оценки антигена PCV-2 в партиях вакцин путем анализа с помощью (антиген)захватывающего ELISA.

Настоящее изобретение относится к генной инженерии. Предложен способ in vitro модификации генома в представляющем интерес геномном локусе в нечеловеческой плюрипотентной клетке млекопитающего, включающий внесение в клетку компонентов системы CRISPR/Cas9 в комбинации с крупным направляющим вектором (LTVEC), который составляет по меньшей мере 10 т.п.о.

Изобретение относится к области генной инженерии, конкретно к получению рекомбинантных полипептидов аденовируса, и может быть использовано в медицине для увеличения эффективности терапевтического лечения солидной опухоли, экспрессирующей десмоглеин 2 (DSG2).

Настоящее изобретение относится к иммунологии. Предложен химерный антигенный рецептор (CAR), который содержит дисиалоганглиозид (GD2)-связывающий домен.

Изобретение относится к биотехнологии. Описана сконструированная не встречающаяся в природе векторная система, содержащая один или несколько векторов, содержащихa) первый регуляторный элемент, функционально связанный с нуклеотидной последовательностью, кодирующей одну или несколько направляющих РНК системы CRISPR-Cas, которые способны гибридизоваться с целевыми последовательностями в геномных локусах молекул ДНК, кодирующих один или несколько продуктов генов, b) второй регуляторный элемент, функционально связанный с нуклеотидной последовательностью, кодирующей белок Cas, где белок Cas представляет собой белок Cas9 и содержит один или несколько NLS,где компоненты (a) и (b) находятся в одном и том же или разных векторах системы,вследствие чего направляющие РНК осуществляют нацеливание на геномные локусы молекул ДНК, кодирующих один или несколько продуктов генов, в эукариотической клетке, а белок Cas способен расщеплять геномные локусы молекул ДНК, кодирующих один или несколько продуктов генов, вследствие чего экспрессия одного или нескольких продуктов генов изменяется в эукариотической клетке; и где белок Cas и направляющие РНК не встречаются вместе в естественных условиях.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков, и может быть использовано для получения антагониста фактора некроза опухолей. Методами генной инженерии получают слитый полипептид-антагонист фактора некроза опухолей, состоящий из растворимого внеклеточного домена человеческого TNFR1 и константной части тяжёлой цепи человеческого IgG4. Изобретение обеспечивает получение гибридного белка TNFR1-Fc, который обладает потенциально улучшенными фармакокинетическими свойствами и минимальной эффекторной функцией антитело-зависимой клеточной цитотоксичности, но не характеризуется комплемент-зависимой цитотоксичностью, из-за введения шарнирного участка, позволяющего эктодомену TNFR1 и домену Fc действовать независимо друг от друга. 3 н. и 1 з.п. ф-лы, 1 ил., 2 пр.

Наверх