Улучшенная нитрилгидратаза

Группа изобретений относится к области биотехнологии. Предложены варианты улучшенной нитрилгидратазы, где нитрилгидратаза получена из бактерии Rhodococcus или бактерии Nocardia. Предложена ДНК, кодирующая указанную улучшенную нитрилгидратазу, а также вектор экспрессии, содержащий указанную ДНК. Предложен трансформант, представляющий собой бактерию, для продуцирования нитрилгидратазы, содержащий указанный вектор. Предложен способ получения нитрилгидратазы с использованием указанного трансформанта. Предложен способ получения амидного соединения с использованием указанной улучшенной нитрилгидратазы или с культурой, полученной при культивировании указанного трансформанта, или переработанным продуктом культуры. Группа изобретений позволяет получать улучшенную нитрилгидратазу с повышенной устойчивостью к амидным соединениям при высоких температурах. 7 н. и 5 з.п. ф-лы, 3 ил., 14 табл., 9 пр.

 

ОБЛАСТЬ ТЕХНИКИ

[0001] Настоящее изобретение относится к улучшенной (мутантной) нитрилгидратазе и способу получения улучшенной нитрилгидратазы. Кроме того, настоящее изобретение относится к ДНК, которая кодирует фермент, рекомбинантному вектору, содержащему ДНК, трансформанту, содержащему рекомбинантный вектор, и способу получения амидного соединения.

УРОВЕНЬ ТЕХНИКИ

[0002] Нитрилгидратаза представляет собой фермент, обладающий нитрилгидратационной активностью, которая катализирует гидратацию нитрильной группы в амидную группу. Кроме того, соответствующие амидные соединения могут быть получены из соединений нитрила с использованием ферментов или микроорганизмов, клеток или подобного, содержащих фермент. По сравнению с традиционными способами химического синтеза, этот способ, как известно, имеет высокую скорость преобразования и высокий уровень селективности из нитрильного соединения в соответствующее амидное соединение.

[0003] Примеры микроорганизмов, которые продуцируют нитрилгидратазу, включают род Corynebacterium, род Pseudomonas, род Rhodococcus, род Rhizobium, род Klebsiella, род Pseudonocardia и тому подобное. Среди этого, штамм Rhodococcus rhodochrous J1 был использован для промышленного производства акриламидов, и его полезность была подтверждена. Кроме того, был идентифицирован ген, кодирующий нитрилгидратазу, продуцируемую штаммом (см. патентную публикацию 1).

[0004] При этом, введение мутации в нитрилгидратазу было предпринято не только для использования нитрилгидратазы, выделенной из природного микроорганизма, или ее гена, но и для изменения ее активности, субстратной специфичности, Vmax, Km, термостойкости, устойчивости нитрилгидратазы в отношении субстрата, устойчивости нитрилгидратазы в отношении последующего продукта и подобного. Что касается нитрилгидратазы в Pseudonocardia thermophila JCM 3095, из данных о его трехмерной структуре выявлены предполагаемые участки, относящиеся к субстратной специфичности или термостабильности, и среди них были получены мутантные ферменты с измененной субстратной специфичностью (см. патентные документы с 2 по 4). Кроме того, авторами изобретения были подготовлены гены нитрилгидратазы с повышенными устойчивостью к высоким температурам и устойчивостью к амидным соединениям (см. патентные документы 5 до 9).

[0005] Тем не менее, разработка нитрилгидратазы, которая обладает дополнительными тепловой устойчивостью и устойчивостью к амидным соединениям и может реагировать при высоких температурах, и применение нитрилгидратазы для производства амидного соединения являются очень полезными с точки зрения издержек производства наподобие затрат, связанных с катализатором, и получение ферментов с такими характеристиками особенно желательно для того, чтобы достичь снижения количества фермента для реакций и уменьшения издержек производства или подобного.

СПИСОК ЛИТЕРАТУРЫ

ПАТЕНТНАЯ ПУБЛИКАЦИЯ

[0006] Патентная публикация 1: JP 3162091 В

Патентная публикация 2: WO 2004/056990 А

Патентная публикация 3: JP 2004-194588 А

Патентная публикация 4: JP 2005-160403 А

Патентная публикация 5: WO 2005/116206 А

Патентная публикация 6: JP 2007-143409 А

Патентная публикация 7: JP 2007-43910 А

Патентная литература 8: JP 2008-253182 А

Патентной литературы 9: JP 2010-172295 А

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

ЗАДАЧИ, РЕШАЕМЫЕ ИЗОБРЕТЕНИЕМ

[0007] Целью изобретения является способ получения амидного соединения с более высокой эффективностью производства за счет предоставления новой улучшенной нитрилгидратазы с повышенной устойчивостью к амидным соединениям при высоких температурах.

СРЕДСТВА ДЛЯ РЕШЕНИЯ ЗАДАЧИ

[0008] Для решения задач, описанных выше, авторы изобретения провели интенсивные исследования, и в результате обнаружили, что белок, в котором определенный аминокислотный остаток в аминокислотной последовательности нитрилгидратазы заменен другим аминокислотным остатком, обладает нитрилгидратазной активностью и обладает повышенной устойчивостью к амидным соединениям при высоких температурах. Соответственно, изобретение является осуществленным.

[0009] А именно, изобретение предоставляет следующее от [1] до [13].

[1] Улучшенная нитрилгидратаза, имеющая, по меньшей мере, одну аминокислотную последовательность, представленную следующими SEQ ID NO: 46 - 49 в α-субъединице;

(а) SEQ ID NO: 46: X1X2X3X4X5X6RX7KAX8E

(при условии, что R обозначает аргинин, K обозначает лизин, А обозначает аланин, Е обозначает глутаминовую кислоту, Х1 обозначает аминокислоту, отличную от тирозина, и каждый из Х28 независимо обозначает любой аминокислотный остаток);

(b) SEQ ID NO: 47: X9X10X11X12NX13X14X15X16X17X18X19X20X21CX22LC

(при условии, что N обозначает аспарагин, V обозначает валин, C обозначает цистеин, Т обозначает треонин, L обозначает лейцин, Х9 обозначает аминокислоту, отличную от серина, и каждый из Х1022 независимо обозначает любой аминокислотный остаток);

(с) SEQ ID NO: 48: X23WDSX25X26EX27RX28X29V

(при условии, что W обозначает триптофан, D обозначает аспарагиновую кислоту, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, V обозначает валин, X23 обозначает аминокислоту, отличную от валина, и каждый из Х2529 независимо обозначает любой аминокислотный остаток);

(d) SEQ ID NO: 49: VX24DSX25X26EX27RX28X29V

(при условии, что V обозначает валина, D обозначает аспарагиновую кислоту, S обозначает серин,а С, Е обозначает глутаминовую кислоту, R обозначает аргинин, Х24 обозначает аминокислоту, отличную от триптофана, и каждый из Х2529 независимо обозначает любой аминокислотный остаток);

[2] Улучшенная нитрилгидратаза, описанная выше в [1], где улучшенная нитрилгидратаза имеет по меньшей мере одну аминокислотную последовательность, представленную следующей SEQ ID NO: 46 - 49 в α-субъединице;

(а) SEQ ID NO: 46: X1X2X3X4X5X6RX7KAX8E

(при условии, что R обозначает аргинин, K обозначает лизин A обозначает аланин, Е обозначает глутаминовую кислоту, Х1 обозначает аминокислоту, отличную от тирозина, и каждый из Х28 независимо обозначает любой аминокислотный остаток);

(b) SEQ ID NO: 47: X9X10X11X12NX13X14X15X16X17X18X19X20X21CX22LC

(при условии, что N обозначает аспарагин, V обозначает валин, C обозначает цистеин, Т обозначает треонин, L обозначает лейцин, Х9 обозначает аминокислоту, отличную от серина, каждый из X10 до X20 независимо обозначает любой аминокислотный остаток, Х21 обозначает валин и X22 обозначает треонин);

(с) SEQ ID NO: 48: X23WDSX25X26EX27RX28X29V

(при условии, что W означает триптофан, D обозначает аспарагиновую кислоту, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, V обозначает валин, X23 обозначает аминокислоту, отличную от валина, и каждый из Х2529 независимо обозначает любой аминокислотный остаток);

(d) SEQ ID NO: 49: VX24DSX25X26EX27RX28X29V

(при условии, что V обозначает валин, D обозначает аспарагиновую кислоты, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, Х24 обозначает аминокислоту, отличную от триптофана и каждый из Х2529 независимо обозначает любой аминокислотный остаток);

[3] Улучшенная нитрилгидратаза, описанная выше в [1], где улучшенная нитрилгидратаза имеет, по меньшей мере, одну аминокислотную последовательность, представленную следующей SEQ ID NO: 46-49 в α-субъединице;

(а) SEQ ID NO: 46: X1X2X3X4X5X6RX7KAX8E

(при условии, что R обозначает аргинин, K обозначает лизин, А обозначает аланин, Е обозначает глутаминовую кислоту, Х1 обозначает глицин или валин и каждый из Х28 независимо обозначает любой аминокислотный остаток);

(b) SEQ ID NO: 47: X9X10X11X12NX13X14X15X16X17X18X19X20X21CX22LC

(при условии, что N обозначает аспарагин, V обозначает валин, C обозначает цистеин, Т обозначает треонин, L обозначает лейцин, Х9 обозначает валин или треонин, и каждый из Х1020 независимо обозначает любой аминокислотный остаток, Х21 обозначает валин и X22 обозначает треонин);

(с) SEQ ID NO: 48: X23WDSX25X26EX27RX28X29V

(при условии, что W означает триптофан, D обозначает аспарагиновую кислоту, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, V обозначает валин, X23 выбран из группы, состоящей из изолейцина, лейцина, метионина и треонина, и каждый из Х2529 независимо обозначает любой аминокислотный остаток);

(d) SEQ ID NO: 49: VX24DSX25X26EX27RX28X29V

(при условии, что V обозначает валин, D обозначает аспарагиновую кислоту, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, Х24 обозначает лейцин и каждый из Х2529 независимо обозначает любой аминокислотный остаток);

[4] улучшенная нитрилгидратаза, описанная в любом из вышеуказанных от [1] до [3], в котором

в приведенной SEQ ID NO: 46 Х2 обозначает Т (треонин), Х3 обозначает Е (глутаминовая кислота), Х4 обозначает Y (тирозин), Х5 обозначает Е (глутаминовая кислота), Х6 обозначает A (аланин), Х7 обозначает Т (треонин) и Х8 обозначает I (изолейцин),

в приведенной SEQ ID NO: 47, Х10 обозначает А (аланин), Х11 обозначает V (валин), Х12 обозначает F (фенилаланин), Х13 обозначает D (аспарагиновая кислота), Х14 обозначает S (серин), Х15 обозначает Q (глутамин), Х16 обозначает Т (треонин), Х17 обозначает Н (гистидин), Х18 обозначает Н (гистидин), Х19 обозначает V (валин) и Х20 обозначает V (валин), и

в приведенной SEQ ID NO: 48-49 Х25 обозначает S (серин), X26 обозначает S (серин), Х27 обозначает I (изолейцин), Х28 обозначает Y (тирозин) и Х29 обозначает I (изолейцина); и

аминокислотная последовательность, представленная как SEQ ID NO: 46, соответствует позициям с 8 по 19 аминокислотной последовательности α-субъединицы нитрилгидратазы, аминокислотная последовательность, представленная как SEQ ID NO: 47, соответствует позициям от 88 до 105 той же последовательности и аминокислотная последовательность, представленная как SEQ ID NO: 48 и 49, соответствует позициям с 153 до 164 той же последовательности;

[5] Улучшенная нитрилгидратаза, описанная в любом из вышеуказанных от [1] до [4], в котором улучшенная нитрилгидратаза имеет аминокислотную последовательность, представленную как SEQ ID NO: 50;

[6] Улучшенная нитрилгидратаза, имеющая аминокислотную последовательность, представленную как SEQ ID NO: 50 в α-субъединице, в которой, по меньшей мере, одна аминокислотная мутация выбрана из следующих с (I) до (IV), включает:

(I) Х1 обозначает G (глицин) или V (валин),

(II) в Х9 обозначает V (валин) или T (треонин),

(III) X23 является аминокислотой, выбранной из группы, состоящей из I (изолейцин), L (лейцин), М (метионин) и T (треонин), и

(IV) Х24 обозначает L (лейцин);

[7] улучшенная нитрилгидратаза, описанная выше в [6], где Х2 обозначает Т (треонин), Х3 обозначает Е (глутаминовая кислота), Х4-обозначает Y (тирозин), Х5 обозначает Е (глутаминовая кислота), Х6 обозначает (аланин), Х7 обозначает Т (треонин), Х8 обозначает I (изолейцин), Х10 обозначает (аланин), Х11 обозначает V (валин), Х12 обозначает F (фенилаланин), Х13 обозначает D (аспарагиновая кислота), Х14 обозначает S (серин), Х15 обозначает Q (глутамин), X16 обозначает Т (треонин), Х17 обозначает H (гистидин), Х18 обозначает H (гистидин), Х19 обозначает V (валин), Х20 обозначает V (валин), Х25 обозначает S (серин), X26 обозначает S (серин), Х27 обозначает I (изолейцин), Х28 обозначает Y (тирозин) и Х29 обозначает I (изолейцин);

[8] Улучшенная нитрилгидратаза, описанная в любом из вышеуказанных пп. с [1] по [7], в котором нитрилгидратаза получена из Rhodococcus bacterium или Nocardia bacterium;

[9] ДНК, кодирующая улучшенную нитрилгидратазу, описанную в любом из вышеуказанных пп. [1] до [8], или ДНК, которая гибридизуется в жестких условиях с ДНК, имеющей последовательность оснований, комплементарную вышеупомянутой ДНК, и кодирует белок, обладающий нитрилгидратазной активностью с повышенной устойчивостью к амидным соединениям при высоких температурах;

[10] рекомбинантный вектор, содержащий ДНК, описанную выше [9];

[11] Трансформант, содержащий рекомбинантный вектор, описанный выше в [10];

[12] Способ получения нитрилгидратазы, включающий культивирование трансформанта, описанного выше в [11], и сбор нитрилгидратазы из полученной культуры;

[13] Способ получения амидного соединения, включающий приведение нитрильного соединения в контакт с улучшенной нитрилгидратазой, описанной в любом из вышеуказанных пп. от [1] до [8], или с культурой, полученной при культивировании трансформанта, описанного выше [11], или обработанным продуктом культуры.

ЭФФЕКТ ИЗОБРЕТЕНИЯ

[0010] В соответствии с изобретением, может быть предоставлена улучшенная новая (мутантная) нитрилгидратаза с повышенной устойчивостью к амидным соединениям при высоких температурах. Улучшенная нитрилгидратаза по изобретению обладает превосходной устойчивостью к амидным соединениям при высоких температурах и обеспечивает повышение эффективности получения амидных соединений.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

[0011] Фиг. 1 представляет собой схематическое изображение, иллюстрирующее плазмиду pSJ034;

Фиг. 2-1 представляет собой чертеж, иллюстрирующий последовательность аминокислот (часть N-концевой стороны) α-субъединицы нитрилгидратазы, полученной из различных микроорганизмов.

Фиг. 2-2 представляет собой чертеж, иллюстрирующий ту же аминокислотную последовательность, что и показанная на Фиг. 2-1, и он обозначает последовательность, следующую за аминокислотной последовательностью с Фиг. 2-1.

Фиг. 3 иллюстрирует аминокислотную последовательность α-субъединицы по изобретению, которая представлена как SEQ ID NO: 50.

[0012] Настоящая заявка претендует на приоритет на основании японской патентной заявки № 2014-118041 (поданной 6 июня 2014 года), раскрытие которой включено в настоящий документ путем ссылки в полном объеме.

СПОСОБ(Ы) ОСУЩЕСТВЛЕНИЯ ИЗОБРЕТЕНИЯ

[0013] 1. Нитрилгидратаза

1.1 Известные нитрилгидратазы

"Нитрилгидратаза" имеет пространственную структуру высокой размерности, которая состоит из группы доменов α- и β-субъединиц и содержит атом негемового железа или некорриновый атом кобальта в качестве простетический молекулы. Такие нитрилгидратазы определяются и называются железосодержащими нитрилгидратазами и кобальтсодержащими нитрилгидратазами, соответственно.

[0014] Типичный пример железосодержащих нитрилгидратаз включает гидратазу, полученную из Rhodococcus N-771. Трехмерная структура такой железосодержащей нитрилгидратазы была четко определена рентгеноструктурным структурным анализом. Фермент соединяется с негемовым железом через четыре аминокислотных остатка в цистеиновом кластере (Cys-Ser-Leu-Cys-Ser-Cys), образующем активный центр α-субъединицы.

[0015] Что касается кобальт-содержащих нитрилгидратаз, примерами являются нитрилгидратазы, полученные из штамма Rhodococcus rhodochrous J1 (в дальнейшем может упоминаться как "штамм J1") или полученные из Pseudonocardia thermophila.

[0016] Кобальт-содержащая нитрилгидратаза, полученная из штамма J1, связана с атомом кобальта через область, определенную как цистеиновый кластер (Cys-Thr-Leu-Cys-Ser-Cys), который образует активный центр α-субъединицы. В цистеиновом кластере кобальт-содержащей нитрилгидратазе, полученной из Pseudonocardia thermophila, цистеин (cys) в позиции 4 от стороны выше по течению (N-концевая сторона) цистеинового кластера, полученного из штамма J1, является цистеинсульфиновой кислотой (Csi), и цистеин (cys) в позиции 6 от дальней по течению стороны (С-концевой стороны) цистеинового кластера, полученного из штамма J1, является цистеинсульфеновой кислотой (Cse).

[0017] Как описано выше, простетическая молекула связана с областью, определенной как цистеиновые кластеры "C(S/T)LCSC" в α-субъединице. Примерами нитрилгидратазы, содержащей область связывания с такой простетической молекулой, являются таковые, которые имеют аминокислотные последовательности и кодируются генными последовательностями, полученными из следующих источников: Rhodococcus rhodochrous J1 (FERM BP-1478), Rhodococcus rhodochrous M8 (Old Soviet Union Patent No. 1731814 (SU 1731814), Rhodococcus rhodochrous M33 (VKM Ac-1515D), Rhodococcus rhodochrous ATCC 39484 (JP 2001-292772 A), Bacillus smithii (JP 9-248188 A), Pseudonocardia thermophila (JP 9-275978 A) или Geobacillus thermoglucosidasius. С другой стороны, β-субъединица считается относящейся к структурной стабильности.

[0018] Нитрилгидратаза, пролученная из штамма Rhodococcus rhodochrous J1 (FERM BP-1478) имеет инвентарный номер GenBank "P21220". Кроме того, инвентарным номером GenBank α-субъединицы, полученной из Rhodococcus rhodochrous M8 (SU 1731814), является "ATT79340" и инвентарный номер GenBank β-субъединицы является "ААТ79339". Инвентарным номером GenBank гена нитрилгидратазы, полученной из Rhodococcus pyridinivorans MW3, является "AJ582605", а инвентарным номером GenBank гена нитрилгидратазы, полученной из Rhodococcus pyridinivorans S85-2, является "AJ582605". Ген нитрилгидратазы актинобактерии Rhodococcus ruber RH (CGMCC No. 2380) описан в китайском патенте № 101463358 (CN1463358). Кроме того, инвентарным номером GenBank гена нитрилгидратазы, полученной из Nocardia YS-2002, является "X86737" и инвентарным номером GenBank гена нитрилгидратазы, полученной из Nocardia sp. JBRs, является "AY141130".

[0019] В SEQ ID NO: с 1 по 19 перечня последовательностей, описана аминокислотная последовательность и последовательность оснований известной нитрилгидратазы.

SEQ ID NO: 1: последовательность оснований β-субъединицы, полученной из Rhodococcus rhodochrous J1

SEQ ID NO: 2: аминокислотная последовательность β-субъединицы, полученной из Rhodococcus rhodochrous J1

SEQ ID NO: 3: последовательность оснований α-субъединицы, полученной из Rhodococcus rhodochrous J1

SEQ ID NO: 4: аминокислотная последовательность α-субъединицы, полученной из Rhodococcus rhodochrous J1

SEQ ID NO: 5: аминокислотная последовательность α-субъединицы из Rhodococcus rhodochrous М8

SEQ ID NO: 6: аминокислотная последовательность α-субъединицы из Rhodococcus ruber TH

SEQ ID NO: 7: аминокислотная последовательность α-субъединицы из Rhodococcus pyridinivorans MW33

SEQ ID NO: 8: аминокислотная последовательность α-субъединицы из Rhodococcus pyridinivorans S85-2

SEQ ID NO: 9: аминокислотная последовательность α-субъединицы из Rhodococcus pyridinivorans MS-38

SEQ ID NO: 10: аминокислотная последовательность α-субъединицы из Nocardia sp. JBRs

SEQ ID NO: 11: аминокислотная последовательность α-субъединицы из Nocardia sp. YS-2002

SEQ ID NO: 12: аминокислотная последовательность α-субъединицы из некультивируемой бактерии SP1

SEQ ID NO: 13: аминокислотная последовательность α-субъединицы из некультивируемой бактерии BD2

SEQ ID NO: 14: аминокислотная последовательность α-субъединицы из Rhodococcus rhodochrous ATCC39484

SEQ ID NO: 15: аминокислотная последовательность α-субъединицы Sinorhizobium medicae WSM419

SEQ ID NO: 16: аминокислотная последовательность α-субъединицы Sinorhizobium medicae Q6

SEQ ID NO: 17: аминокислотная последовательность α-субъединицы Pseudonocardia thermophila JCM3095

SEQ ID NO: 18: аминокислотная последовательность α-субъединицы из Rhodococcus rhodochrous Cr4

SEQ ID NO: 19: аминокислотная последовательность α-субъединицы Comamonas testosterone.

[0020] Кроме того, Фиг. 2-1 и Фиг. 2-2 показывают выравнивание аминокислотных последовательностей (в однобуквенном коде) α-субъединиц известных нитрилгидратаз, полученных из различных микроорганизмов. В каждой из фиг. 2-1 и Фиг. 2-2, каждая аминокислотная последовательность соответствует SEQ ID NO: 4, 5 до 19 в направлении от начала.

[0021] Нитрилгидратаза по изобретению не ограничивается таковой с описанной выше последовательностью, но включает белок, имеющий аминокислотную последовательность, которая является гомологичной или идентичной аминокислотной последовательности, описанной в любой из SEQ ID NO: с 1 по 19 примерно на 60% или выше, предпочтительно примерно на 70% или выше, более предпочтительно примерно на 80% или выше, еще более предпочтительно примерно на 90% или выше, особенно предпочтительно примерно на 95% или выше, и наиболее предпочтительно примерно на 98% или выше, а также обладает нитрилгидратазной активностью.

[0022] Кроме того, в отношении нитрилгидратазы по изобретению, белок, который имеет аминокислотную последовательность, описанную в любой из SEQ ID NO: с 1 по 19, в которой от 1 до нескольких аминокислот, в частности, от 1 до 20, предпочтительно от 1 до 10, более предпочтительно от 1 до 5, и даже более предпочтительно от 1 до 2 аминокислот были удалены, заменены или добавлены, и также обладает нитрилгидратазной активностью, также входит в нитрилгидратазу по изобретению.

[0023] 1.2 Улучшенная нитрилгидратаза

Улучшенная нитрилгидратаза по изобретению является новый улучшенной нитрилгидратазой с повышенной устойчивостью к амидным соединениям при высоких температурах.

[0024] Улучшенная нитрилгидратаза по изобретению не ограничивается полученными из какого-либо конкретного типа. Например, те, которые зарегистрированы как нитрилгидратаза в базе данных GenBank (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=protein), предоставленной Американским национальным центром биотехнологической информации (NCBI), или те, которые описаны как нитрилгидратаза в публикациях, могут быть переданы для использования.

[0025] Конкретные примеры включают нитрилгидратазы, которые описаны в WO 2005/116206 A, JP 2007-143409 A, JP 2007-43910 A, JP 2008-253182 A или JP 2010-172295 A (включены в настоящую спецификацию ссылкой). Эти нитрилгидратазы обладают тепловой устойчивостью и устойчивостью к акриламиду. При помощи дополнительного добавления аминокислотной замены можно получить характеристики для повышения устойчивости к амидным соединениям при высоких температурах.

[0026] Примеры улучшенной нитрилгидратазы по изобретению включают нитрилгидратазу, у которой α-субъединица имеет последовательность аминокислот (SEQ ID NO: 50), показанную на Фиг. 3. Среди аминокислотных последовательностей, показанных на фиг. 3, находятся аминокислотная последовательность, представленная SEQ ID NO: 46 с 8 по 19 аминокислоту, считая с N конца, аминокислотная последовательность, представленная SEQ ID NO: 47 с 88 по 105 аминокислоту и аминокислотная последовательность, представленная SEQ ID NO: 48 и SEQ ID NO: 49 с 153 по 165 аминокислоту.

[0027] В отношении аминокислотной последовательности, представленной SEQ ID NO: 50, имеющей, по меньшей мере, одну аминокислотную мутацию, выбранную из (a)-(d) может быть упомянута как один из вариантов осуществления изобретения (от X1 до X29 представляют собой независимые произвольные аминокислотные остатки).

(а) Х1 представляет собой глицин или валин

(б) Х9 представляет собой валин или треонин

(с) X23 представляет собой аминокислоту, выбранную из группы, состоящей из изолейцина, лейцина, метионина и треонина

(д) Х24 представляет собой лейцин

[0028] В другом варианте осуществления, улучшенная нитрилгидратаза, имеющая аминокислотную последовательность, представленную SEQ ID NO: 50, в которой Х2 представляет собой Т (треонин), Х3 представляет собой Е (глутаминовая кислота), X4 представляет собой Y (тирозин), Х5 представляет собой Е (глутаминовая кислота), Х6 представляет собой A (аланин), Х7 представляет собой Т (треонин), Х8 представляет собой I (изолейцин), Х10 представляет собой (аланин), Х11 представляет собой V (валин), Х12 представляет собой F (фенилаланин), Х13 представляет собой D (аспарагиновой кислоты), Х14 представляет собой S (серин), Х15 представляет собой Q (глутамин), X16 представляет собой Т (треонин), Х17 представляет собой Н (гистидин), Х18 представляет собой Н (гистидин), Х19 представляет собой V (валин), Х20 представляет собой V (валин), Х25 представляет собой S (серин), X26 представляет собой S (серин), Х27 представляет собой I (изолейцин), Х28 представляет собой Y (тирозин), Х29 представляет собой I (изолейцин) и также имеет, по крайней мере, одну характеристику, выбранную из вышеуказанных (а) - (d), может быть упомянута.

[0029] При этом, также включенной в улучшенную нитрилгидратазу по изобретению является нитрилгидратаза, которая гомологична или идентична, в положении, отличном от вышеупомянутых положений замен, аминокислотной последовательности, описанной в SEQ ID NO: 50 на приблизительно 70% или выше, предпочтительно на приблизительно 80% или выше, более предпочтительно на приблизительно 90% или выше, еще более предпочтительно на приблизительно 95% или более, и особенно предпочтительно на приблизительно 98% или выше, в то же время обладающая такой же термоустойчивостью и/или устойчивостью к амидным соединениям.

[0030] Также включенной в улучшенную нитрилгидратазу по изобретению является нитрилгидратаза, которая имеет аминокислотную последовательность, описанную в SEQ ID NO: 50, в которой от 1 до 10, предпочтительно от 1 до 5, и более предпочтительно от 1 до 2 аминокислот удалены, заменены или добавлены в положении, отличном от вышеупомянутых положений замен и имеет такие же термоустойчивость и/или устойчивость к амидным соединениям.

[0031] В качестве другого примера улучшенной нитрилгидратазы по изобретению, касающиеся аминокислотной последовательности, представленной SEQ ID NO: 4 известной нитрилгидратазы, можно упомянуть имеющую, по меньшей мере, одну характеристику, выбранную из (e) - (h).

(е) 8-й аминокислотный остаток (тирозин) α-субъединицы заменен глицином или валином

(f) 88-й аминокислотный остаток (серин) α-субъединицы заменен на валин или треонин

(g) 153-й аминокислотный остаток (валин) α-субъединицы заменен аминокислотой, выбранной из изолейцина, лейцина, метионина и треонина

(h) 154-й аминокислотный остаток (триптофан) α-субъединицы заменен лейцином.

[0032] При этом, также включенной в улучшенную нитрилгидратазу по изобретению является нитрилгидратаза, которая гомологична или идентична аминокислотной последовательности, описанной в SEQ ID NO: 4 на приблизительно 70% или выше, предпочтительно на приблизительно 80% или выше, более предпочтительно на приблизительно 90% или выше, еще более предпочтительно на приблизительно 95% или более, и особенно предпочтительно на приблизительно 98% или выше, в положении, отличном от вышеупомянутых положений замен, а также имеет такую же термоустойчивость и/или устойчивость к амидным соединениям.

[0033] Кроме того, в отношении аминокислотной последовательности, идентифицированной как SEQ ID NO: 4, нитрилгидратаза, имеющая в положении замены, отличной от описанных выше, аминокислотную последовательность, в которой от 1 до 10, предпочтительно приблизительно от 1 до 5, и даже более предпочтительно от 1 до 2 аминокислотных остатков удалены, заменены или добавлены, и обладающая той же термоустойчивостью и/или устойчивостью к амидным соединениям, также входит в улучшенную нитрилгидратазу по изобретению.

[0034] Описанные выше аминокислотные замены от (e) до (h) обозначаются как "Yα8G, Sα88V, Vα153I, Wα154L". Стандартные аминокислоты обозначаются однобуквенным кодом. Буква слева от числа, показывающего замещенное положение (т. е. число аминокислотных остатков в замещенном участке), представляет аминокислоту в однобуквенном коде до замены, а число справа представляет аминокислоту в однобуквенном коде после замены.

[0035] В частности, относительно аминокислотной последовательности α-субъединицы, как показано в SEQ ID NO: 4, если есть описание "Yα8G", это означает вариант осуществления с аминокислотной заменой в улучшеной нитрилгидратазе, в которой тирозин (Y) в позиции 8, считая с N-концевого аминокислотного остатка (в том числе N-концевого аминокислотного остатка самого по себе) аминокислотной последовательности α-субъединицы (SEQ ID NO: 4) заменен на глицин (G).

[0036] Виды аминокислотных замен в более предпочтительных вариантах улучшенной нитрилгидратазы по изобретению приведены как следующие с 1 по 8:

1. Yα8G

2. Yα8V

3. Sα88V

4. Sα88T

5. Vα153I

6. Vα153L

7. Vα153M

8. Vα153T

9. Wα154L

[0037] Предпочтительные варианты осуществления нуклеотидных замен для получения вышеуказанных аминокислотных замен приведены ниже.

[0038] [Таблица 1]

Yα8G Кодон TAC (в положениях 22~24 в SEQ ID NO: 3) предпочтительно заменен на GGT, GGC, GGA, GGG. Особенно предпочтительным для замены является T в положении 22 на G, и A в положении 23 на G (TAC→GGC).
Yα8V Кодон TAC (в положениях 22~24 в SEQ ID NO: 3) предпочтительно заменен на GTT, GTC, GTA, GTG. Особенно предпочтительным для замены является T в положении 22 на G, и A в положении 23 на T (TAC→GTC).
Yα8T Кодон TAC (в положениях 22~24 в SEQ ID NO: 3) предпочтительно заменен на ACA, ACC, AACG, ACT. Особенно предпочтительным для замены является T в положении 22 на A, и A в положении 23 на C (TAC→ACC).
Sα88V Кодон TCG (в положениях 262~264 in SEQ ID NO: 3) предпочтительно заменен на GTT, GTC, GTA, GTG. Особенно предпочтительным для замены является T в положении 262 with T, C в положении 263 with T, G в положении 263 with C (GTT→GTC).
Sα88T Кодон TCG (в положениях 262~264 in SEQ ID NO: 3) предпочтительно заменен на ACA, ACC, ACG, ACT. Особенно предпочтительным для замены является T в положении 262 with A (TCG→ACG).
Vα153I Кодон GTT (в положениях 457~459 in SEQ ID NO: 3) предпочтительно заменен на ATT, ATC, ATA. Особенно предпочтительным для замены является G в положении 457 with A, и T в положении 459 with C (GTT→ATC).
Vα153L Кодон GTT (в положениях 457~459 in SEQ ID NO: 3) предпочтительно заменен на TTA, TTG, CTT, CTC, CTA, CTG. Особенно предпочтительным для замены является G в положении 457 with C (GTT→CTC).
Vα153M Кодон GTT (в положениях 457~459 in SEQ ID NO: 3) предпочтительно заменен на ACT, ACC, ACA, ACG. Особенно предпочтительным для замены является G в положении 457 with A, T в положении 458 with C, T в положении 459 with C (GTT→ACC).
Vα153T Кодон GTT (в положениях 457~459 in SEQ ID NO: 3) предпочтительно заменен на ATG.
Wα154L Кодон TGG (в положениях 460~462 in SEQ ID NO: 3) предпочтительно заменен на TTA, TTG, CTT, CTC, CTA, CTG. Особенно предпочтительным для замены является G в положении 461 with T (TGG→TTG).

[0039] В отношении активности улучшенной нитрилгидратазы по изобретению, устойчивость к амидным соединениям под воздействием высоких температур улучшена относительно активности нитрилгидратазы дикого типа, а природные характеристики сохраняются.

[0040] В настоящем документе, "нитрилгидратазная активность" означает ферментативную активность, катализирующую гидратацию для преобразования нитрильного соединения в соответствующее амидное соединение (RCN+H2O→RCONH2). Определение активности проводится путем приведения нитрильного соединения в качестве субстрата в контакт с нитрилгидратазой для преобразования в соответствующее амидное соединение и путем количественной оценки результирующего амидного соединения. Любое нитрильное соединение можно использовать в качестве субстрата при условии, что нитрилгидратаза реагирует с таким соединением, но акрилонитрил является предпочтительным.

[0041] Условия реакции включают концентрацию субстрата 2,5%, температуру реакции от 10°C до 30°C и времени реакции от 10 до 30 минут. Ферментативная реакция прекращается добавлением фосфорной кислоты. Затем, используя ВЭЖХ (высокоэффективную жидкостную хроматографию) или газовую хроматографию, аналируют полученный акриламид для определения количества амидного соединения.

[0042] Выражение "устойчивость к амидных соединений при высоких температурах" означает, что даже в присутствии амидных соединений нитрилгидратазная активность сохраняется при высоких температурах. Выражение "высокая температура" указывает конкретно на 40°C - 60°C, и более предпочтительно от 45°C до 55°C.

[0043] "Устойчивость к амидным соединениям при высоких температурах" можно оценить путем анализа культуры трансформанта, содержащего улучшенную нитрилагидратазу, или улучшенную нитрилгидратазу, выделенную из трансформанта в присутствии амидного соединения, такого как акриламид (при высокой концентрации от 30 до 50%, например) под воздействием высоких температур, на основании количества потребления или скорости потребления нитрильного соединения, такого как акрилонитрил в качестве субстрата. Например, когда улучшенную нитрилагидратазу приводят в контакт с амидным соединением в диапазоне от 40°C до 60°C, и нитрилагидратаза демонстрирует количество потребления или скорость потребления в 1,1 раза или более, предпочтительно в 1,15 раза или более, и более предпочтительно в 1,2 раза или более для таковой из сравнительного примера (т. е. нитрилгидратазы без мутации), то можно оценить, что она устойчива к амидным соединениям при высоких температурах.

[0044] Что касается "амидных соединений", можно отметить, например, амидное соединение, представленное общей формулой (1) ниже.

R-CONH2(1)

(в Формуле R представляет собой группу необязательно замещенного неразветвленного или разветвленного алкила или алкенила, имеющего от 1 до 10 атомов углерода, группу необязательно замещенного циклоалкила или арила, имеющую от 3 до 18 атомов углерода, или необязательно замещенную насыщенную или ненасыщенную гетероциклическую группу). Особенно предпочтительным является акриламид, в котором "R" в Формуле представляет собой "СН2=СН-".

[0045] Описанную выше улучшенную нитрилгидратазу получают путем осуществления аминокислотной замены в известной нитрилгидратазе. Например, такую улучшенную нитрилгидратазу получают путем введения вышеупомянутой мутации в аминокислотную последовательность (SEQ ID NO: 4) нитрилагидратазы, полученной происходит из трамма Rhodococcus rhodochrous J1, и путем скрининга нитрилагидратазы с увеличенной устойчивостью к амидному соединению при высоких температурах.

[0046] Даже для нитрилгидратазы, полученной из штаммов, отличных от J1, устойчивость к амидным соединениям при высоких температурах может быть повышена путем введения той же мутации в соответствующий сайт для модификации. Примеры бактерий для производства нитрилагидратаз включают Rhodococcus rhodochrous M8 (SEQ ID NO: 5), Rhodococcus ruber TH (SEQ ID NO: 6), Rhodococcus rhodochrous M33 (VKM Ac-1515D), Rhodococcus pyridinivorans MW3 (SEQ ID NO: 7), Rhodococcus pyridinivorans S85-2 (SEQ ID NO: 8), Nocardia sp. JBR (SEQ ID NO: 10) и Nocardia YS-2002 (SEQ ID NO: 11). При этом, Rhodococcus rhodochrous M33 (VKM Ac-1515D) был выбран потому, что он способен к конститутивной экспрессии нитрилагидратазы на основе естественной мутации вышеописанной бактерии М8 и аминокислота или генная последовательность нитрилагидратазы самой по себе не видоизменена (US 5,827,699).

[0047] Улучшенная нитрилгидратаза по изобретению может быть получена путем введения мутации, либо случайным образом, либо сайт-направленно в гене, кодирующем известную нитрилгидратазу в соответствии с известным способом, и отбора фермента с нужной функцией, т. е. устойчивостью к амидным соединениям при высоких температурах.

[0048] Примеры способа введения мутации включают способ введения случайных мутаций, такой как подверженная ошибкам ПЦР и сайт-направленный мутагенез, такой как способ Кункеля или способ дуплексов с пробелом.

[0049] [ПЦР сниженной точности]

Случайный мутагенез известен в качестве способа изучения функции и характеристики белков с использованием мутанта. Случайный мутагенез представляет собой способ введения случайной мутации в ген, кодирующий определенный белок, так что продуцируется мутант. В случайном мутагенезе с помощью ПЦР, условия жесткости установлены на минимальном уровне для периода амплификации ДНК, так что мутантное основание может быть введено (ПЦР сниженной точности).

В таком способе ПЦР сниженной точности, мутация вводится случайным образом в любое положение на всем участке амплифицируемой ДНК. Затем, исследуя функцию полученного мутанта, в котором мутация введена в случайный сайт, получают информацию об аминокислоте или домене, важном для определенной функции белка. В качестве нитрилгидратазы, используемой для матрицы в ПЦР сниженной точности, может быть использован ген нитрилгидратазы, полученный из штамма дикого типа, или ДНК, полученная как продукт амплификации при ПЦР сниженной точности.

Условия реакции для ПЦР сниженной точности, например, композиционное соотношение любого одного, двух или трех из dNTP (dGTP, dCTP, dATP или dTTP) в реакционной смеси уменьшается относительно других dNTP. Соответственно, во время синтеза ДНК, в положении, которое требует dNTP, чье соотношение уменьшено, другой dNTP, скорее всего, будет использован по ошибке, что может привести к мутации. Кроме того, другие предпочтительные условия реакции представляют собой композицию, в которой количество MgCl2 и/или MnCl2 в реакционной смеси увеличено.

[0050] [Сайт-направленный мутагенез (сайт-специфическое введение мутации)]

Что касается способа введения мутации в конкретном сайте, обычный способ представляет собой следующее: цепь ДНК, содержащая ген-мишень, разделяют на отдельные цепи и отжигают с олигонуклеотидной цепью, содержащей ген-мишень, которую затем подготавливают в качестве двойной цепи путем удлинения одной цепи с использованием ДНК-полимеразы, двойную цепь комбинируют в E. coli для репликации, и, после репликации путем слияния в E. coli отбирают клон, содержащий нужную мутацию (см., Molecular Cloning, A Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory Press (1989), Current Protocols in Molecular Biology, John Wiley & Sons (1987-1997)или подобное). Известны различные способы, отличные от способа Кункеля, такие как способ дуплекса с разрывом, и способ удобно осуществлять с помощью имеющегося в продаже набора для мутагенеза, такого как набор для сайт-направленного мутагенеза QuickChange™ XL (производства компания Stratagene), системы сайт-направленного мутагенеза GeneTailor™ (производства корпорации Invitrogen), системы сайт-направленного мутагенеза TaKaRa (Mutan-K, Mutan-Super Express Km и подобные, изготовленные Takara Bio Inc.) или подобных.

[0051] Кроме способа, включающего введение мутации в ген известной нитрилгидратазы, как описано выше, улучшенную нитрилгидратазу по изобретению также можно получить путем метагеномного скрининга из ДНК окружающей среды.

[0052] 1.3 ДНК, кодирующая улучшенную нитрилгидратазу

Изобретение также предоставляет ДНК, кодирующую улучшенную нитрилгидратазу по изобретению.

"ДНК, кодирующая улучшенную нитрилгидратазу" по изобретению также включает ДНК, которая гибридизуется в жестких условиях с ДНК, имеющей нуклеотидную последовательность, комплементарную нуклеотидной последовательности ДНК, кодирующей улучшенную нитрилгидратазу по изобретению, а также кодирует белок с нитрилгидратазной активностью, который обладает устойчивостью к амидным соединениям при высоких температурах.

[0053] "Жесткие условия" представляют собой условия для промывки после гибридизации; концентрация соли от 300 до 2000 мМ и температура от 40 до 75°С, предпочтительно концентрация соли составляет от 600 до 900 мМ и температура 65°С. Например, могут быть использованы условия 2×SSC при 50°C. Дополнительно к такой концентрации соли буфера, температуры и т. п. специалист в данной области техники может подобрать условия для получения ДНК, которая кодирует нитрилгидратазу по изобретению путем добавления различных условий, таких как концентрация зонда, длина зонда, время реакции и тому подобное.

[0054] Для подробного описания процедуры гибридизации можно сослаться на Molecular Cloning, A Laboratory Manual, 2nd edition (Cold Spring Harbor Laboratory Press (1989)) или подобное. Гибридизуемая ДНК включает ДНК или ее частичный фрагмент, содержащий последовательность оснований, которая имеет 40% или более, предпочтительно 60% или более, и более предпочтительно 90% или более гомологии последовательности ДНК гена по изобретению.

[0055] 1.4 Рекомбинантный вектор, трансформант

Для ДНК, кодирующей ген улучшенной нитрилгидратазы, необходимо быть имплантированной в вектор, с тем, чтобы нитрилгидратаза экспрессировалась в организме хозяина при трансформации. Примеры таких векторов для использования включают плазмидную ДНК, ДНК бактериофага, ДНК ретротранспозона, ДНК искусственной хромосомы и тому подобное.

[0056] В дополнение к гену нитрилгидратазы, вектор может включать промотор, терминатор, энхансер, сигнал сплайсинга, сигнал присоединения полиА, селективный маркер, последовательность связывания с рибосомой (SD-последовательность) или тому подобное. Примеры селективных маркеров включают ген устойчивости к канамицину, ген дигидрофолатредуктазы, ген устойчивости к ампициллину, ген устойчивостя к неомицину и тому подобное.

[0057] Организм-хозяин для использования по изобретению не ограничивается каким-либо конкретным типом, при условии, что он может экспрессировать нитрилгидратазу-мишень после того, как рекомбинантный вектор вводят в организм-хозяин. Примеры включают бактерии, такие как E. coli и Bacillus subtilis, дрожжи, клетки животных, клетки насекомых, клетки растений и тому подобное.

[0058] При использовании E. coli в качестве хозяина предпочтителен экспрессионный вектор с высокой эффективностью экспрессии, такой как экспрессионный вектор pkk 233-2 с trc-промотор (произведено корпорацией Amersham Biosciences), pTrc 99A (произведено корпорацией Amersham Biosciences) или тому подобное.

[0059] При использовании бактерии в качестве организма-хозяина, может быть использован E. coli, например, и штамм Rhodococcus, такой как Rhodococcus rhodochrous ATCC 12674, Rhodococcus rhodochrous ATCC 17895 и Rhodococcus rhodochrous ATCC 19140 также могут быть использованы. Эти АТСС-штаммы могут быть получены из Американской коллекции типов культур. Способ введения рекомбинантного вектора в бактерию не ограничивается каким-либо конкретным способом, при условии, что ДНК вводится в бактерию. Например, можно применять способ с использованием ионов кальция, электропорации или подобный.

[0060] При использовании дрожжей в качестве организма-хозяина, примерами являются Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris и тому подобное. В качестве способа введения рекомбинантного вектора в дрожжи специальные ограничения отсутствуют, при условии, что ДНК вводится в дрожжи. Например, можно использовать способ электропорации, способ сферопластирования, способ с ацетатом лития.

[0061] При использовании клеток животных в качестве организма-хозяина, клетки обезьяны COS-7, Vero, клетки CHO, мышиные L-клетки, GH3-клетки крысы, FL-клетки человека или подобные могут быть использованы. В качестве способа введения рекомбинантного вектора в клетки животных, например, способ электропорации, способ с фосфатом кальция, способ липофекции или подобное могут быть использованы.

[0062] При использовании клеток насекомых в качестве организма-хозяина, клетки Sf9, клетки Sf21 или подобное могут быть использованы. Способ введения рекомбинантного вектора в клетки насекомых, например, способ с фосфатом кальция, способ липофекции, способ электропорации или подобное могут быть использованы.

[0063] При использовании растительных клеток в качестве организма-хозяина, клетки табака BY-2 или подобное могут быть использованы, но без ограничения этим. Способ введения рекомбинантного вектора в клетки растения, например, способ агробактерий, способ генной пушки, способ с ПЭГом, способ электропорации или подобное могут быть использованы.

[0064] При использовании E. coli в качестве организма-хозяина, поскольку большая часть экспрессируемой нитрилгидратазы образуется в виде телец включения и не растворяется, получается трансформант с низкой каталитической активностью. С другой стороны, если штамм Rhodococcus используется в качестве организма-хозяина, нитрилгидратаза присутствует в растворимой фракции, и, таким образом, получается трансформант с высокой активностью. Хозяин может быть выбран на основе задач. Однако в случае, когда усовершенствованный фермент отобран при жестких условия, трансформант с высокой активностью, полученный из штамма Rhodococcus, является предпочтительным.

[0065] 1.5 Способ получения улучшенной нитрилгидратазы

Улучшенную нитрилгидратазу можно продуцировать при культивировании вышеописанного трансформанта и собирать белок с нитрилгидратазной активностью из полученной культуры. Изобретение также предоставлет такой способ получения улучшенной нитрилгидратаз.

[0066] В настоящем изобретении, "культура" означает любое из культурального супернатанта, культивируемой клетки, культивируемой бактериальной клетки и клеточных гомогенатов или бактериально-клеточных гомогенатов.

[0067] Культивирование трансформанта осуществляется в соответствии со способом, который обычно используется для культивирования организма-хозяина. Что касается среды для культивирования трансформанта по изобретению, натуральная или синтетическая питательная среда используется при условии, что она содержит источник углерода, источник азота, неорганические соли и т. п. для усвоения бактериями-хозяевами, и культивирование трансформанта осуществляется эффективно. Примеры источника углерода включают углеводы, такие как глюкоза, галактоза, фруктоза, сахарозы, раффинозы и крахмал; органические кислоты, такие как уксусная кислота и пропионовая кислота; спирты, такие как этанол и пропанол; и тому подобное. Примеры источников азота включают неорганические кислоты, такие как аммиак, хлорид аммония, сульфат аммония, ацетат аммония и фосфат аммония; аммонийные соли органических кислот и другие азотсодержащие соединения.

[0068] Кроме того, пептон, дрожжевой экстракт, мясной экстракт, коммерческая жидкость для замочки, различные аминокислоты и т. п. также могут использоваться. Примеры неорганического вещества включают монокалийфосфат, дикалийфосфат, фосфат магния, сульфат магния, хлорид натрия, сульфат железа, сульфат марганца, сульфат цинка, сульфат меди, карбонат кальция и тому подобное. Также, при необходимости, пеногасителя могут быть использованы для предотвращения пенообразования в процессе культуры. Кроме того, ионы кобальта или ионы железа в качестве простетической молекулы нитрилгидратазы, или нитрилы и амиды в качестве индуктора фермента, также могут быть добавлены к культуре.

[0069] Культивирование может проводиться с добавлением селективного давления для предотвращения потери вектора и гена-мишени. А именно, если селективный маркер представляет собой ген лекарственной устойчивости, соответствующего препарат может быть добавлен, или если селективным маркером является ген, комплементирующий ауксотрофность, могут быть удалены соответствующие факторы питания.

[0070] Кроме того, если селективным маркером является ген, добавляющий усвоение, эквивалентный фактор усвоения может быть добавлен в качестве отдельного фактора, при необходимости. Например, при культивировании Е. coli, трансформированных вектором, содержащим генов ампициллин-резистентности, ампициллин можно добавлять по мере необходимости в процессе культивирования.

[0071] При культивировании трансформанта, трансформированного рекомбинантным вектором, содержащим, в качестве промотора, индуцибельной промотор, так что к среде может быть добавлен индуктор, если это необходимо. Например, при культивировании трансформанта, трансформированного вектором экспрессии с промотором, индуцируемым изопропил-β-D-тиогалактопиранозидом (IPTG), IPTG или подобное может быть добавлен в среду. Аналогичным образом, при культивировании трансформанта, трансформированного вектором экспрессии с trp-промотором, индуцируемым индолилуксусной кислотой (IAA), IAA и подобное может быть добавлена в среду.

[0072] Условия культивирования трансформанта специально не ограничены, при условии отсутствия препятствия продуктивности улучшенной нитрилгидратазы-мишени и росту организма-хозяина. Как правило, предпочтительными являются условия от 10°C до 40°С, более предпочтительно от 20°C до 37°С, в течение 5-100 часов. Значение рН устанавливают с помощью неорганической или органической кислоты, щелочного раствора или подобного. Если это Rhodococcus, рН доводят до 6-9.

[0073] В качестве способов культивирования, находящаяся в состоянии покоя культура, статическая культура, встряхиваемая культура, перемешиваемая аэрируемая культура и подобное может использоваться. При культивировании трансформанта Rhodococcus, в частности, предпочтительным является использование встряхиваемой культуры и перемешиваемой аэрируемой культуры (ферментация в емкости) в аэробных условиях.

[0074] При культивировании в вышеописанных условиях культивирования, улучшенная нитрилгидратаза по изобретению накапливается с высоким выходом в указанном выше продукте культивирования, а именно, по меньшей мере, в любом из культурального супернатанта, культивируемых клеток, культивируемых бактериальных клеток, клеточных гомогенатов или бактериально-клеточных гомогенатов.

[0075] После культивирования, когда улучшенная нитрилгидратаза производится в клетке или бактериальной клетке, нитрилгидратазу-мишень можно получить путем гомогенизации клеток или бактериальных клеток. Клетки или бактериальные клетки гомогенизировали при обработке при высоком давлении, используя френч-пресс или гомогенизатор, ультразвуковую обработку, перемалывание, используя стеклянные бусы или ферментативную обработку с помощью лизоцимом, целлюлазой, пектиназой и подобным, обработку замораживанием и оттаиванием, обработку гипотоническим раствором, обработку фагом для индукции лизиса бактерий и так далее.

[0076] После гомогенизации, остатки клеточных гомогенатов или бактериально-клеточных гомогенатов (в том числе нерастворимых фракций клеточного экстракт) снимаются, при необходимости. Для удаления осадков, используются способы центрифугирования или фильтрации, при необходимости. Для повышения эффективности удаления осадков может быть использован коагулянт или фильтрующее средство. Супернатант, полученный после удаления осадков, представляет собой растворимые фракции клеточного экстракта, который можно использовать в качестве раствора грубо очищенной улучшенной нитрилгидратазы.

[0077] Кроме того, когда улучшенную нитрилгидратазу продуцируют в бактериальных клетках или в клетках, также возможно, что бактериальных клеток или клетки сами по себе собирают путем центрифугирования и мембранной фильтрации для использования без их гомогенизации.

[0078] В случае, когда улучшенную нитрилгидратазу продуцируют вне клеток или бактериальных клеток, культуры могут быть использованы как таковые, или клетки или бактериальные клетки удаляются с помощью способов центрифугирования или фильтрации. Затем улучшенную нитрилгидратазу собирают из культуры, экстрагируя при помощи преципитации сульфатом аммония, если это необходимо. Кроме того, диализ или различные способы хроматографии (гель-фильтрация, ионообменная хроматография, аффинная хроматография и т. д.) можно использовать для выделения и очистки нитрилгидратазы.

[0079] Эффективность продуцирования нитрилгидратазы, которую получают путем культивирования трансформанта, можно подтвердить в единицах на культуральный раствор, сырую массу или сухую массу бактериальных клеток, белок неочищенного раствора фермента или при помощи SDS-PAGE (электрофорез в полиакриламидном геле), измерения нитрилгидратазной активности или подобного, но без особого ограничения этим. SDS-PAGE можно проводить способом, хорошо известным специалистам в данной области техники. Описанную выше активность можно использовать также, как и для нитрилгидратазной активности.

[0080] Кроме описанных выше способов, улучшенную нитрилгидратазу можно продуцировать с использованием бесклеточной системы синтеза белка. В бесклеточной системе синтеза белка, белок синтезируется в искусственном сосуде, таком как пробирка, с использованием экстракта клеток. Бесклеточная система синтеза белка, используемая в настоящем изобретении, включает бесклеточную систему транскрипции, которая синтезирует РНК с использованием ДНК в качестве матрицы.

[0081] В таком случае организм, соответствующий вышеописанному организму, соответствует организму, из которого получен клеточный экстракт. В настоящем описании, для клеточного экстракта, могут быть использованы экстракты из эукариотического или прокариотического происхождения, такие как экстракт из зародышей пшеницы, E. coli и подобные. Такие клеточные экстракты могут быть концентрированными или нет.

[0082] Клеточный экстракт может быть получен путем ультрафильтрации, диализа, преципитации полиэтиленгликолем (ПЭГ) или подобным, например. В изобретении, имеющийся в продаже комплект также может быть использован для мобильного-бесплатные синтез белка. Примеры такого комплекта включают в себя набор реагентов PROTEIOS™ (TOYOBO CO., LTD.), система TNT™ (Promega Corporation), синтезатор PG-Mate™ (TOYOBO CO., LTD.), RTS (Roche Diagnostics K.K.) и подобные.

[0083] Улучшенная нитрилгидратаза, полученная внеклеточным синтезом белка, как описано выше, может быть также очищен при помощи хроматографии правильно выбранного типа.

[0084] 2. Способ получения амидного соединения

Улучшенная нитрилгидратаза по изобретению может быть использована в качестве фермента-катализатора для получения продукта. Например, амидное соединение получают путем приведения нитрильного соединения в контакт с улучшенной нитрилгидратазой. Затем собирают амидное соединение, полученное при контактировании. Соответственно, получается амидное соединение.

[0085] В качестве ферментного катализатора, в дополнение к выделенной и очищенной нитрилгидратазе, как описано выше, культура после культивирования трансформанта по изобретению или переработанный продукт культивирования также могут быть использованы. Примеры переработанных продуктов включают клетки после культивирования (т. е. трансформант), иммобилизованные акриламидным гелем или подобным, клетки, обработанные глутаровым альдегидом, клетки, которые поддерживаются неорганическими носителями, такими как оксид алюминия, диоксид кремния, цеолит, диатомитовая земля и подобные.

[0086] В настоящем описании, "контактирование" означает, что улучшенная нитрилгидратаза и нитрильное соединение присутствуют в одной и той же реакционной системе или системе культивирования: например, выделенная и очищенная улучшенная нитрилгидратаза и нитрильное соединения смешивают; нитрильное соединение добавляют в емкость для культивирования клеток (трансформант), чтобы экспрессировать ген улучшенной нитрилгидратазы; клетки культивируют в присутствии нитрильного соединения; экстракт клеток смешивают с нитрильным соединением; и так далее.

[0087] Нитрильное соединение для использования в качестве субстрата выбирают с учетом субстратной специфичности фермента, стабильность фермента на субстрате и тому подобное. Что касается нитрильного соединения, предпочтительным является акрилонитрил. Способ реакции и способ сбора амидного соединения после завершения реакции правильно подбирают в зависимости от характеристик субстрата и фермента-катализатора.

[0088] Предпочтительно, фермент-катализатор используют повторно при условии, что его активность не утрачивается. С точки зрения предотвращения потери активности и легкости повторного использования, фермента-катализатор является предпочтительным для использования в качестве переработанного продукта.

ПРИМЕРЫ

[0089] Далее изобретение будет более конкретно объяснено в примерах. Однако изобретение ими не ограничивается. При этом "%", приводимый в настоящем документе, означает % по массе.

[0090] [Пример 1] Подготовка плазмиды для экспрессии улучшенной нитрилгидратазы

Плазмида в качестве матрицы для введения аминокислотной замены по изобретению готовили следующим образом.

В качестве матрицы, содержащей ген нитрилгидратазы штамма J1, была использована pSJ034 (Фиг. 1). pSJ034 представляет собой плазмиду, которая способна экспрессировать нитрилгидратазу в штамме Rhodococcus. Плазмида pJD034 была получена из pSJ023 по методике, раскрытой в JP 10-337185. В частности, путем частичного расщепления по XbaI-сайту и лигирования с линкером Sse8387I, плазмида pSJ033 была подготовлена так, что один сайт XbaI плазмиды pSJ023 был заменена Sse8387I. Далее плазмиду pSJ033 частично расщепляли по сайту Sse8387I, и Кленовский фрагмент был использован для тупых концов, чтобы вызвать лигирование самих на себя. Соответственно, была получена плазмида pSJ034.

[0091] В настоящем документе, штамм Rhodococcus rhodochrous J-1 был зарегистрирован под входящим номером "FERM BP-1478" в Депозитарии международной патентной организации Национальный институт передовой промышленной науки и технологии (Central 6, 1-1-1 Higashi, Tsukuba, Ибараки, (в настоящее время, Депозитарный центр запатентованных микроорганизмов NITE: 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Room No. 120)), (первоначальная дата депозиции 18сентября, 1987).

[0092] Кроме того, pSJ023 представляет собой трансформант "R. rhodochrous АТСС 12674/pSJ023" и имеет международную регистрацию с идентификационным номером "FERM BP-6232" в Депозитарии международной патентной организации Национальный институт передовой промышленной науки и технологии (Central 6, 1-1-1 Higashi, Tsukuba, Ибараки, (в настоящее время, Депозитарный центр запатентованных микроорганизмов NITE: 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Room No. 120)), (первоначальная дата депозиции 4 марта, 1997).

[0093] [Пример 2] Получение улучшенной нитрилгидратазы

С помощью плазмиды pSJ034, подготовленной в примере 1, была выполнена аминокислотная замена. ПЦР осуществляли, используя состав реакционной смеси, условия реакции и праймеры, описанные ниже.

[0094] Состав ПЦР-реакционного раствора

Стерильная вода 20 мкл
pSJ034 (1 нг/мл) 1 мкл
Прямой праймер (10 мМ) 2 мкл
Обратный праймер (10 мМ) 2 мкл
PrimeSTAR MAX (2×) 25 мкл
Всего 50 мкл

[0095] Условия реакции для ПЦР

(98°C в течение 10 секунд, 55°C в течение 5 секунд и 72°C в течение 90 секунд) × 30 циклов

[0096] [Таблица 2]

Праймер

Название праймера Последовательность (5'-3') SEQ ID NO
α8G-F AATAAGGGCACGGAGTACGAGGCACGT 20
α8G-R CTCCGTGCCCTTATTGACGTGCTCGCT 21
α8V-F AATAAGGTCACGGAGTACGAGGCACGT 22
α8V-R CTCCGTGACCTTATTGACGTGCTCGCT 23
α88V-F CCAAATTGTCGCGGTCTTCAACGACTC 24
α88V-R GACCGCGACAATTTGGTGTGCCTGCTC 25
α88T-F CCAAATTACCGCGGTCTTCAACGACTC 53
α88T-R GACCGCGGTAATTTGGTGTGCCTGCTC 54
α153I-F GTCAGGATCTGGGACAGCAGCTCCGAA 26
α153I-R GTCCCAGATCCTGACCTCCACCTCATC 27
α153L-F GTCAGGCTCTGGGACAGCAGCTCCGAA 28
α153L-R GTCAGGGAGTGGGACAGCAGCTCCGAA 29
α153M-F GTCAGGATGTGGGACAGCAGCTCCGAA 30
α153M-R GTCAGGCATTGGGACAGCAGCTCCGAA 31
α153T-F GTCAGGACCTGGGACAGCAGCTCCGAA 32
α153T-R GTCAGGGGTTGGGACAGCAGCTCCGAA 33
α154L-F AGGGTTCTCGACAGCAGCTCCGAAATC 34
α154L-R GCTGTCGAGAACCCTGACCTCCACCTC 35
α153I-α154L-F GTCAGGATCCTCGACAGCAGCTCCGAA 36
α153I-α154L-R GCTGTCGAGGATCCTGACCTCCACCTC 37
α153L-α154L-F GTCAGGCTCCTCGACAGCAGCTCCGAA 38
α153L-α154L-R GCTGTCGAGGAGCCTGACCTCCACCTC 39
α153M-α154L-F GTCAGGATGCTCGACAGCAGCTCCGAA 40
α153M-α154L-R GCTGTCGAGCATCCTGACCTCCACCTC 41
α153T-α154L-F GTCAGGACCCTCGACAGCAGCTCCGAA 42
α153T-α154L-R GCTGTCGAGGAGCCTGACCTCCACCTC 43

[0097] После завершения ПЦР, 5 мкл реакционной смеси предоставляли для электрофореза в 0,7% агарозном геле, подтверждали амплифицированный фрагмент 11 т.п.н. и 1 мкл DpnI (в комплекте) добавляли к ПЦР реакционной смеси, которая затем реагировала при 37°C в течение одного часа. Соответственно, матричная плазмида была удалена. После этого реакционную смесь очищают с помощью Wizard SV Gel и PCR Clean-Up System (Promega Corporation), и трансформацию в JM109 проводили с помощью очищенного продукта ПЦР. Из полученного культурального продукта выделяли плазмидную ДНК, используя набор QIAprep Spin Miniprep Kit (Qiagen), и нуклеотидную последовательность нитрилгидратазы подтверждали, используя автоматический секвенатор CEQ 8000 (производства Beckman Coulter, Inc). Полученные плазмиды были названы, как показано в Таблице 3.

[0098] [Таблица 3]

Название плазмиды Аминокислотные замены
pSJ034
(Сравнительный пример)
pSJH001 Yα8G
pSJH002 Sα88V
pSJH064 Sα88T
pSJH004 Wα153M
pSJH005 Vα154L
pSJH022 Sα88V, Vα153M
pSJH023 Sα88V, Vα153M, Wα154L
pSJH024 Yα8G, Sα88V
pSJH025 Yα8G, Vα153M
pSJH026 Yα8V, Wα154L
pSJH027 Yα8V, Vα153I
pSJH028 Yα8G, Sα88V, Vα153I
pSJH030 Yα8V, Vα153T, Wα154L
pSJH032 Yα8G, Sα88V, Vα153M, Wα154L

[0099] [Пример 3] Подготовка трансформанта Rhodococcus

Клетки штамма Rhodococcus rhodochrous АТСС 12674 в логарифмической фазе роста собирали с помощью центрифуги, промывали три раза охлажденной во льду стерильной водой и суспендировали в стерильной воде. Затем, 1 мкл плазмиды, полученной в Примере 2, и 10 мкл суспензии бактериальных клеток смешивали и охлаждали во льду. ДНК и суспензию бактериальных клеток помещали в кювету и подвергали электрическому импульсу при помощи устройства для электропорации, Gene Pulser (Bio-Rad Laboratories), при условиях 2,0 кВ и 200 Ом. Обработанную электрическим импульсом смесь отставляли во льду в течение 10 минут, и подвергали тепловому шоку при 37°C в течение 10 минут. После добавления 500 мкл культуральной среды MYK (0,5% полипептон, 0,3% дрожжевой экстракт Bacto, 0,3% солодовый экстракт Bacto, 0,2% K2HPO4, 0,2% KH2PO4) и предоставления возможности стоять при 30°C в течение 5 часов, штамм высевали на агаризованную питательную среду MYK, содержащую 50 мкг/мл канамицина, и культивировали при 30°C в течение 3 дней. Полученная колония после культивирования при 30°C в течение 3 дней была использована в качестве трансформанта.

[0100] Каждый трансформант, полученный вышеописанным процессом, засевали в питательную среду MYK (50 мкг/мл канамицина) и подвергали культивированию со встряхиванием при 30°C в течение 2 дней. Затем 1% культуры засевали в культуральную среду GGPK (1,5% глюкозы, 1% глутамата натрия, 0,1% дрожжевого экстракта, 0,05% K2HPO4, 0,05% KH2PO4, 0,05% Mg2O4·7H2O, 1% CoCl2, 0,1% мочевины, 50 мкг/мл канамицина, рН 7,2), и подвергали культивированию со встряхиванием при 30°C в течение 3 дней. Бактериальные клетки собирали с помощью центрифугирования и промывали 100 мМ фосфатным буфером (рН 7,0) для приготовления суспензии бактериальных клеток.

[0101] [Пример 4] Оценка устойчивости к амидным соединениям при высоких температурах

Устойчивость к амидным соединениям улучшенной нитрилгидратазы, полученной в Примере 3, измеряли в соответствии со следующим способом.

0,2 мл смеси бактериальных клеток и 4,8 мл 50 мМ фосфатного буфера (рН 7,0) смешивали, и к этому добавляли еще 5 мл 50 мМ фосфатного буфера (рН 7,0), содержащий 5,0% (масс/об) акрилонитрила. Далее смесь оставляли реагировать при встряхивании при 10°C в течение 10 минут. Затем бактериальные клетки отфильтровывали, и количество вырабатываемого акриламида определяли с помощью газовой хроматографии.

[0102] Условия анализа

Приборы анализа: газовый хроматограф GC2014 (производства Shimadzu Corporation)

Детектор: FID (детекция при 200°С)

Колонка: 1 м стеклянная колонка, заполненная PoraPak PS (наполнитель колонки изготовлен Waters Corporation)

Температура колонки: 190°С

[0103] Активность нитрилгидратазы определяли путем конверсии от количества акриламида. В настоящем описании, в отношении активности нитрилгидратазы, количество фермента для производства 1 мкмоля акриламида за 1 минуту устанавливается в размере 1 U.

[0104] Далее, тестирование проводили в следующем составе для реакционной смеси и условий реакции. Между тем, каждую клеточную суспензию, использованную для реакции, соответственно разводили в растворе 100 мМ фосфатного буфера (рН 7,0) так, что она имела то же количество ферментативной активности от ранее определенной активности фермента. В качестве сравнительного контроля, был использован сравнительный штамм ATCC12674/pSJ034.

[0105] Состав реакционного раствора

50% раствор акриламида
Акрилонитрил
Раствор 1 М фосфатного буфера
Раствор клеток (с тем же
количеством единиц (U)
активности фермента)

[0106] Условия реакции

Температура реакции 45°С

Время реакции 3 часа

[0107] 1 мл каждого реакционного раствора отбирали либо до начала реакции (0 час), либо через 3 часа после реакции. После его фильтрации через 0,45 мкм фильтр полученный профитьтрованный раствор подвергали газовой хроматографии. Результат анализа соотношения оставшегося акрилонитрила (%) показан в Таблице 4.

[0108] [Таблица 4]

Название плазмиды Количество потребленного акрилонитрила (%) Относительное соотношение (%)
pSJ034
(Сравнительный пример)
0,8 100%
pSJH001 1,0 125%
pSJH002 1,4 163%
pSJH064 0,88 110%
pSJH004 1,8 225%
pSJH005 1,1 138%
pSJH022 2,3 288%
pSJH023 2,6 325%
pSJH024 1,3 163%
pSJH025 2,3 288%
pSJH026 1,7 213%
pSJH027 1,5 188%
pSJH028 1,6 200%
pSJH030 2,4 300%
pSJH032 2,6 325%

[0109] Из приведенных выше результатов было установлено, что скорость потребления акрилонитрила каждой улучшенной нитрилгидратазой составляет 110% или более, чем pSJ034 в качестве сравнительного примера. В реакции синтезирования амидных соединений с помощью нитрилгидратазы вопросом является потеря активности в результате воздействия высокой температуры и высокой концентрацией продукта, а также ингибирование реакции, вызванное амидными соединениями в качестве продукта реакции. В этой связи, поскольку улучшенная нитрилгидратаза по изобретению поддерживает нитрилгидратазную активности даже при высокой температуре и даже в присутствии акриламида в высокой концентрации, полагают, что она обладает увеличенной устойчивостью к акриламиду при высоких температурах.

[0110] [Пример 5] Продуцирование улучшенной нитрилгидратазы

Аминокислотную замену выполняли таким же образом, как в примере 2, используя нитрилгидратазу, описанную в WO 2012/164933 А (pSJ306A). Подготовленные плазмиды приведены в Таблице 5.

[Таблица 5]

Название плазмиды Аминокислотные замены
pSJ306A
(Сравнительный пример)
Pβ17G, Sβ57M, Tβ107K, Kβ114Y,, Nβ167S, Cβ218H, Vβ219A, Gαl74L
pSJA006 Yα8G, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJA018 Yα8V, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJB18 Sα88V, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJC008 Vα153I, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJC010 Vα153L, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJC017 Vα153T, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJC011 Vα153M, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJD010 Wα154L, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJG001 Sα88V, Vα153M, Pβ17G, Sβ57 M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJG002 Sα88V, Vα153M, Wα154L, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJG003 Sα88V, Vα153L, Wα154L, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJG004 Vα153M, Wα154L, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L
pSJG005 Vα153L, Wα154L, Pβ17G, Sβ57M, Tβ107K, Kβ114Y, Nβ167S, Cβ218H, Vβ219A, Gα174L

[0111] С помощью плазмид, описанных в таблице 5, трансформант Rhodococcus rhodochrous ATCC12674 был получен таким же образом, что и в примере 3, и его культивировали в среде MYK. С помощью полученных в культуре клеток, оценка устойчивости к амидным соединениям при высоких температурах проводилась в соответствии со следующими условиями.

[0112] Состав реакционного раствора

50% раствор акриламида
Акрилонитрил
Раствор 1 М фосфатного буфера
Раствор клеток (с тем же
количеством единиц (U)
активности фермента)

[0113] Условия реакции

Температура реакции 45°С

Время реакции 5 часов

[Таблица 6]

Название плазмиды Количество потребления акрилонитрила (%) Скорость потребления акрилонитрила
(%)
pSJ306A (Сравнительный пример) 1,63 100%
pSJA006 2,16 133%
pSJA018 1,99 122%
pSJB018 1,79 110%
pSJC008 2,20 135%
pSJC010 2,41 148%
pSJC011 2,26 139%
pSJC017 2,42 148%
pSJD010 2,31 142%
pSJG001 2,26 139%
pSJG002 2,3 161%
pSJG003 2,68 164%
pSJG004 2,57 158%
pSJG005 2,38 146%

[0114] Из приведенных выше результатов было установлено, что скорость потребления акрилонитрила каждой улучшенной нитрилгидратазой составляет 110% или более от pSJ306A, в качестве сравнительного примера. Соответственно, поскольку улучшенная нитрилгидратаза по изобретению поддерживает нитрилгидратазную активности даже при высокой температуре, и даже при наличии высокой концентрации акриламида, полагают, что она обладает увеличенной устойчивостью к акриламиду при высоких температурах.

[0115] [Пример 6] Продуцирование улучшенной нитрилгидратазы (JBRs)

Плазмида для экспрессии гена нитрилгидратазы, полученной из Nocardia sp. JBRs (идентификационный номер в GenBank: AY141130), была получена в соответствии со следующим способом.

При помощи проведения ПЦР, в которой pSJ034 используется в качестве матрицы, векторной фрагмент был подготовлен с помощью Wizard SV Gel и PCR Clean-Up System (Promega Corporation).

[0116] Состав раствора для ПЦР-реакции

Стерильная вода 20 мкл
pSJ034 (1 нг/мл) 1 мкл
Прямой праймер (10 мМ) 2 мкл
Обратный праймер (10 мМ) 2 мкл
PrimeSTAR MAX (2×) 25 мкл
Всего 50 мкл

[0117] Условия ПЦР-реакции

(98°C в течение 10 секунд, 55°C в течение 5 секунд и 72°C в течение 90 секунд) × 30 циклов

NH-F: GAAGTGATCG TATGAGTGAA GACACACTCA CTG (SEQ ID NO: 51)

NH-R: GTGGATACCA TCCATTTCCT CATTCCTTTC ATC (SEQ ID NO: 52)

[0118] Фрагмент вектора, полученный как описано выше, и искусственно синтезированный ген нитрилгидратазы, полученный из Nocardia sp. JBRs (SEQ ID NO: 44), были клонированы с помощью In-Fusion Cloning Kit (Takara Bio Inc.) и трансформированы в E. coli HST08 (Takara Bio Inc.). Из полученных колоний выделяли плазмиды и подтверждали последовательность ДНК. Таким образом, была получена плазмида (pSJ-JBRs) для экспрессиии нитрилгидратазы, полученной из Nocardia sp. JBRs.

[0119] Кроме того, с помощью pSJ-JBRs в качестве матрицы, аминокислотную замену проводили таким же образом, как в примере 2. Полученные плазмиды приведены в Таблице 7.

[Таблица 7]

Название плазмиды Аминокислотные замены в штамме дикого типа
pSJ-JBRs (Сравнительный пример)
pSJH006 Yα8G
pSJH007 Yα8V
pSJH061 Sα88T
pSJH008 Vα153L
pSJH009 Vα153T
pSJH033 Vα153L,Wα154L
pSJH034 Sα88V, Vα153M, Wα154L
pSJH035 Sα88V, Vα153T, Wα154L
pSJH036 Yα8G, Sα88V
pSJH037 Yα8V, Wα154L
pSJH038 Yα8G, Sα88V, Vα153I
pSJH039 Yα8G, Sα88V, Vα153L, Wα154L
pSJH040 Yα8G, Sα88V, Vα153M, Wα154L

[0120] С помощью плазмид, описанных в таблице 7, трансформант Rhodococcus rhodochrous ATCC12674 был получен таким же образом, как в примере 3, и его культивировали в среде MYK. С помощью полученных в культуре клеток, оценка устойчивости к амидным соединениям при высоких температурах проводилось в соответствии с условиями Примера 4. Результаты показаны в таблице 8.

[0121] [Таблица 8]

Название плазмиды Количество потребления акрилонитрила (%) Скорость потребления акрилонитрила
(%)
pSJ-JBRs
(Сравнительный пример)
1,3 100%
pSJH006 1,45 112%
pSJH007 1,45 112%
pSJH061 1,6 125%
pSJH008 2,6 200%
pSJH009 1,9 146%
pSJH033 2,7 208%
pSJH034 2,7 208%
pSJH035 2,4 185%
pSJH036 1,4 108%
pSJH037 2,4 208%
pSJH038 1,5 123%
pSJH039 2,7 208%
pSJH040 2,7 208%

[0122] Из приведенных выше результатов было установлено, что скорость потребления акрилонитрила каждой улучшенной нитрилгидратазой составляет 108% или более от pSJ-JBRs, в качестве сравнительного примера. Соответственно, поскольку улучшенная нитрилгидратаза по изобретению поддерживает нитрилгидратазную активности даже при высокой температуре, и даже при наличии высокой концентрации акриламида, полагают, что она обладает увеличенной устойчивостью к акриламиду при высоких температурах.

[0123] [пример 7] Получение улучшенной нитрилгидратазы (S85-2)

Плазмида для экспрессии гена нитрилгидратазы, полученного из Rhodococcus pyridinivorans S85-2 (идентификационный номер в GenBank: AJ582605), был произведена таким же образом, как в примере 6, с использованием искусственно синтезированного гена нитрилгидратазы (SEQ ID NO: 45). Полученная плазмида была названа pSJ-S85-2.

Кроме того, с помощью pSJ-S85-2 в качестве матрицы, аминокислотную замену проводили таким же образом, как в примере 2. Произведенный плазмиды приведены в Таблице 9.

[0124] [Таблица 9]

Название плазмиды Аминокислотные замены в штамме дикого типа
pSJ-S85-2
(Сравнительный пример)
pSJH013 Yα8V
pSJH014 Vα153L
pSJH048 Vα153L, Wα154L
pSJH049 Sα88V, Vα153L, Wα154L
pSJH051 Yα8G, Vα153M
pSJH052 Yα8V, Wα154L
pSJH053 Yα8V, Vα153L

[0125] С помощью плазмид, описанных в таблице 9, трансформант Rhodococcus rhodochrous ATCC12674 был получен таким же образом, как в примере 3, и его культивировали в среде MYK. С помощью полученных в культуре клеток, оценка устойчивости к амидным соединениям при высоких температурах проводилось в соответствии с условиями примера 4. Результаты показаны в таблице 10.

[0126] [Таблица 10]

Название плазмиды Количество потребления акрилонитрила (%) Скорость потребления акрилонитрила (%)
pSJ-S85-2
(сравнительный пример)
1,19 100%
pSJH013 1,70 143%
pSJH014 1,77 148%
pSJH048 2,59 218%
pSJH049 2,58 217%
pSJH051 2,59 218%
pSJH052 1,65 139%
pSJH053 1,87 158%

[0127] Из приведенных выше результатов было установлено, что скорость потребления акрилонитрила каждой улучшенной нитрилгидратазой составляет 130% или более от pSJ-S85-2, в качестве сравнительного примера. Соответственно, поскольку улучшенная нитрилгидратаза по изобретению поддерживает нитрилгидратазную активности даже при высокой температуре, и даже при наличии высокой концентрации акриламида, полагают, что она обладает увеличенной устойчивостью к акриламиду при высоких температурах.

[0128] [Пример 8] Продуцирование улучшенной нитрилгидратазы (М8)

В качестве плазмиды для экспрессии гена нитрилгидратазы, полученного из Rhodococcus rhodochrous М8 (идентификационный номер в GenBank: AAT79340, AAT79339), была использована плазмида pSJ-NO1A, описанная в JP 2011-200132, и аминокислотная замена проводилась таким же образом, как в примере 2. Подготовленные плазмиды приведены в Таблице 11.

[Таблица 11]

Название плазмиды Аминокислотные замены в штамме дикого типа
pSJ -N01A
(Сравнительный пример)
Отсутствуют
pSJH010 Sα88V
pSJH062 Sα88T
pSJH011 Vα153M
pSJH012 Wα154L
pSJH041 Sα88V, Vα153M
pSJH042 Vα153M, Wα154L
pSJH044 Yα8V, Vα153M
pSJH045 Yα8V, Vα153I
pSJH046 Yα8V, Vα153T, Wα154L
pSJH047 Yα8V, Sα88V, Vα153T, Wα154L

[0129] С помощью плазмид, описанных в таблице 11, трансформант Rhodococcus rhodochrous ATCC12674 был получен таким же образом, как в примере 3, и его культивировали в среде MYK. С помощью полученных в культуре клеток, оценка устойчивости к амидным соединениям при высоких температурах проводили в соответствии с условиями примера 4. Результаты показаны в таблице 12.

[0130] [Таблица 12]

Название плазмиды Количество потребления акрилонитрила (%) Скорость потребления акрилонитрила
(%)
pSJ-N01A
(Сравнительный пример)
1,39 100%
pSJH010 1,60 115%
pSJH062 2,08 150%
pSJH011 2,57 185%
pSJH012 2,29 165%
pSJH041 1,91 137%
pSJH042 2,64 190%
pSJH044 2,57 185%
pSJH045 2,00 144%
pSJH046 2,40 173%
pSJH047 2,63 189%

[0131] Из приведенных выше результатов было установлено, что скорость потребления акрилонитрила каждой улучшенной нитрилгидратазой составляет 110% или более от pSJ-NO1A, в качестве сравнительного примера. Соответственно, поскольку улучшенная нитрилгидратаза по изобретению поддерживает нитрилгидратазную активности даже при высокой температуре, и даже при наличии высокой концентрации акриламида, полагают, что она обладает увеличенной устойчивостью к акриламиду при высоких температурах.

[0132] [Пример 9] Rhodococcus rhodochrous (бактерия Mitsui)

В качестве плазмиды для экспрессии гена нитрилгидратазы, полученного из Pseudonocardia thermophila ОСМ 3095 (идентификационный номер в GenBank: DD028560, DD028561), была использована плазмида pSJ-NO2A, описанная в JP 2011-200132, и аминокислотную замену проводили таким же образом, как в примере 2. Подготовленные плазмиды приведены в таблице 10.

[0133] [Таблица 13]

Название плазмиды Аминокислотные замены в штамме дикого типа
pSJ-N02A
(Сравнительный пример)
pSJH021 Wα160L (Соответствует Х22 in SEQ ID NO: 49)

[0134] С помощью плазмид, описанных в таблице 13, трансформант Rhodococcus rhodochrous ATCC12674 был получен таким же образом, как в примере 3, и его культивировали в среде MYK. С помощью полученных в культуре клеток, оценку устойчивости к амидным соединениям при высоких температурах проводили в соответствии с условиями примера 4. Результаты показаны в таблице 14.

[0135] [Таблица 14]

Название плазмиды Количество потребления акрилонитрила (%) Скорость потребления акрилонитрила
(%)
pSJ-N02A
(Сравнительный пример)
0,50 100%
pSJH021 1,20 240%

[0136] Из приведенных выше результатов было установлено, что скорость потребления акрилонитрила каждой улучшенной нитрилгидратазой составляет 240% или более от pSJ-NO2A, в качестве сравнительного примера. Соответственно, поскольку улучшенная нитрилгидратаза по изобретению поддерживает нитрилгидратазную активности даже при высокой температуре, и даже при наличии высокой концентрации акриламида, полагают, что она обладает увеличенной устойчивостью к акриламиду при высоких температурах.

ПРОМЫШЛЕННАЯ ПРИМЕНИМОСТЬ

[0137] Поскольку улучшенная нитрилгидратаза по изобретению обладает увеличенной устойчивостью к акриламиду под действием высоких температур, соответствующее амидное соединение может быть эффективно изготовлено из нитрильного соединения и, таким образом, нитрилгидратаза полезна для промышленного производства амидных соединений.

[0138] все публикации, патенты и патентные заявки, цитируемые в изобретении, включены в эту заявку путем ссылки.

НОМЕР ДЕПОЗИЦИИ

[0139] ШТАММ Rhodococcus rhodochrous J1: FERM BP-1478

R. rhodochrous ATCC12674/pSJ023: FERM BP-6232

ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ С ПРОИЗВОЛЬНЫМ ТЕКСТОМ

[0140] SEQ ID NO: 20: α8G-F праймер

SEQ ID NO: 21: праймер α8G-R

SEQ ID NO: 22: праймер α8V-F

SEQ ID NO: 23: праймер α8V-R

SEQ ID NO: 24: праймер α88V-F

SEQ ID NO: 25: праймер α88V-R

SEQ ID NO: 26: праймер α153I-F

SEQ ID NO: 27: праймер α153I-R

SEQ ID NO: 28: праймер α153L-F

SEQ ID NO: 29: праймер α153L-R

SEQ ID NO: 30: праймер α153M-F

SEQ ID NO: 31: праймер α153M-R

SEQ ID NO: 32: праймер α153T-F

SEQ ID NO: 33: праймер α153T-R

SEQ ID NO: 34: праймер α154L-F

SEQ ID NO: 35: праймер α154L-R

SEQ ID NO: 36: праймер α153I·α154L-F

SEQ ID NO: 37: праймер α153I·α154L-R

SEQ ID NO: 38: праймер α153L·α154L-F

SEQ ID NO: 39: праймер α153L·α154L-R

SEQ ID NO: 40: праймер α153M·α154L-F

SEQ ID NO: 41: праймер α153M·α154L-R

SEQ ID NO: 42: праймер α153T·α154L-F

SEQ ID NO: 43: праймер α153T·α154L-R

SEQ ID NO: 46: специфические аминокислоты согласно изобретению

SEQ ID NO: 47: специфические аминокислоты согласно изобретению

SEQ ID NO: 48: специфические аминокислоты согласно изобретению

SEQ ID NO: 49: специфические аминокислоты согласно изобретению

SEQ ID NO: 50: аминокислоты α субъединицы согласно изобретению

SEQ ID NO: 51: праймер НХ-F

SEQ ID NO: 52: праймер НХ-R

SEQ ID NO: 53: праймер α88T-F

SEQ ID NO: 54: праймер α88T-R

1. Улучшенная нитрилгидратаза, имеющая по меньшей мере одну аминокислотную последовательность, представленную следующими SEQ ID NO: 46 - 49 в α-субъединице;

(а) SEQ ID NO: 46: X1X2X3X4X5X6RX7KAX8E

(при условии, что R обозначает аргинин, K обозначает лизин, А обозначает аланин, Е обозначает глутаминовую кислоту, Х1 обозначает аминокислоту, отличную от тирозина);

(b) SEQ ID NO: 47: X9X10X11X12NX13X14X15X16X17X18X19X20X21CX22LC

(при условии, что N обозначает аспарагин, C обозначает цистеин, L обозначает лейцин, Х9 обозначает аминокислоту, отличную от серина);

(с) SEQ ID NO: 48: X23WDSX25X26EX27RX28X29V

(при условии, что W обозначает триптофан, D обозначает аспарагиновую кислоту, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, V обозначает валин, X23 обозначает аминокислоту, отличную от валина);

(d) SEQ ID NO: 49: VX24DSX25X26EX27RX28X29V

(при условии, что V обозначает валин, D обозначает аспарагиновую кислоту, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, Х24 обозначает аминокислоту, отличную от триптофана), где

в вышеуказанной SEQ ID NO: 46 X2 обозначает T (треонин), X3 обозначает E (глутаминовая кислота), X4 обозначает Y (тирозин), X5 обозначает E (глутаминовая кислота), X6 обозначает A (аланин), X7 обозначает T (треонин) и X8 обозначает I (изолейцин),

в вышеуказанной SEQ ID NO: 47 X10 обозначает A (аланин), X11 обозначает V (валин), X12 обозначает F (фенилаланин), X13 обозначает D (аспарагиновая кислота), X14 обозначает S (серин), X15 обозначает Q (глутамин), X16 обозначает T (треонин), X17 обозначает H (гистидин), X18 обозначает H (гистидин), X19 обозначает V (валин), X20 обозначает V (валин), Х21 обозначает V (валин) и Х22 обозначает Т (треонин), и

в вышеуказанной SEQ ID NO: 48 и 49 X25 обозначает S (серин), X26 обозначает S (серин), X27 обозначает I (изолейцин), X28 обозначает Y (тирозин) и X29 обозначает I (изолейцин), и

где нитрилгидратазу получают из бактерии Rhodococcus или бактерии Nocardia.

2. Улучшенная нитрилгидратаза по п. 1, имеющая по меньшей мере одну аминокислотную последовательность, представленную следующими SEQ ID NO: 46 - 49 в α-субъединице:

(а) SEQ ID NO: 46: X1X2X3X4X5X6RX7KAX8E

(при условии, что R обозначает аргинин, K обозначает лизин A обозначает аланин, Е обозначает глутаминовую кислоту, Х1 обозначает аминокислоту, отличную от тирозина);

(b) SEQ ID NO: 47: X9X10X11X12NX13X14X15X16X17X18X19X20X21CX22LC

(при условии, что N обозначает аспарагин, C обозначает цистеин, L обозначает лейцин, Х9 обозначает аминокислоту, отличную от серина, Х21 обозначает валин и X22 обозначает треонин);

(с) SEQ ID NO: 48: X23WDSX25X26EX27RX28X29V

(при условии, что W обозначает триптофан, D обозначает аспарагиновую кислоту, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, V обозначает валин, X23 обозначает аминокислоту, отличную от валина);

(d) SEQ ID NO: 49: VX24DSX25X26EX27RX28X29V

(при условии, что V обозначает валин, D обозначает аспарагиновую кислоты, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, Х24 обозначает аминокислоту, отличную от триптофана).

3. Улучшенная нитрилгидратаза по п. 1, имеющая по меньшей мере одну аминокислотную последовательность, представленную следующими SEQ ID NO: 46-49 в α-субъединице:

(а) SEQ ID NO: 46: X1X2X3Х4X5X6RX7KAX8E

(при условии, что R обозначает аргинин, K обозначает лизин, А обозначает аланин, Е обозначает глутаминовую кислоту, Х1 обозначает глицин или валин);

(b) SEQ ID NO: 47: X9X10X11X12NX13X14X15X16X17Х18X19X20X21CX22LC

(при условии, что N обозначает аспарагин, C обозначает цистеин, L обозначает лейцин, Х9 обозначает валин или треонин, Х21 обозначает валин и X22 обозначает треонин);

(с) SEQ ID NO: 48: X23WDSX25X26EX27RX28X29V

(при условии, что W означает триптофан, D обозначает аспарагиновую кислоту, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, V обозначает валин, X23 выбран из группы, состоящей из изолейцина, лейцина, метионина и треонина);

(d) SEQ ID NO: 49: VX24DSX25X26EX27RX28X29V

(при условии, что V обозначает валин, D обозначает аспарагиновую кислоту, S обозначает серин, Е обозначает глутаминовую кислоту, R обозначает аргинин, Х24 обозначает лейцин).

4. Улучшенная нитрилгидратаза по любому из пп. 1-3, где улучшенная нитрилгидратаза имеет аминокислотную последовательность, представленную как SEQ ID NO: 50.

5. Улучшенная нитрилгидратаза по любому из пп. 1-4, где улучшенная нитрилгидратаза имеет повышенную устойчивость к амидным соединениям при высоких температурах по сравнению с нитрилгидратазой дикого типа.

6. Улучшенная нитрилгидратаза, имеющая а) аминокислотную последовательность, представленную как SEQ ID NO: 50 или b) аминокислотную последовательность, описанную в SEQ ID NO: 50, в которой от 1 до 10 аминокислот удалены, заменены или добавлены в положении, отличном от X1-X29 в α-субъединице, в которой по меньшей мере одна аминокислотная мутация, выбранная из следующих с (I) по (IV), включает:

(I) Х1 обозначает G (глицин) или V (валин),

(II) в Х9 обозначает V (валин) или T (треонин),

(III) X23 является аминокислотой, выбранной из группы, состоящей из I (изолейцин), L (лейцин), М (метионин) и T (треонин) и

(IV) Х24 обозначает L (лейцин), где Х2 обозначает Т (треонин), Х3 обозначает Е (глутаминовая кислота), Х4 обозначает Y (тирозин), Х5 обозначает Е (глутаминовая кислота), Х6 обозначает (аланин), Х7 обозначает Т (треонин), Х8 обозначает I (изолейцин), Х10 обозначает (аланин), Х11 обозначает V (валин), Х12 обозначает F (фенилаланин), Х13 обозначает D (аспарагиновая кислота), Х14 обозначает S (серин), Х15 обозначает Q (глутамин), X16 обозначает Т (треонин), Х17 обозначает H (гистидин), Х18 обозначает H (гистидин), Х19 обозначает V (валин), Х20 обозначает V (валин), Х21 обозначает V (валин), Х22 обозначает Т (треонин), Х25 обозначает S (серин), X26 обозначает S (серин), Х27 обозначает I (изолейцин), Х28 обозначает Y (тирозин) и Х29 обозначает I (изолейцин), где нитрилгидратаза получена из бактерии Rhodococcus или бактерии Nocardia.

7. Улучшенная нитрилгидратаза по п. 6, где улучшенная нитрилгидратаза имеет повышенную устойчивость к амидным соединениям при высоких температурах по сравнению с нитрилгидратазой дикого типа.

8. ДНК, кодирующая улучшенную нитрилгидратазу, описанную в любом из пп. 1-7, или ДНК, которая гибридизуется в жестких условиях с ДНК, имеющей последовательность оснований, комплементарную вышеупомянутой ДНК, и кодирует белок, обладающий нитрилгидратазной активностью с повышенной устойчивостью к амидным соединениям при высоких температурах.

9. Вектор экспрессии, содержащий ДНК по п. 8.

10. Трансформант для продуцирования нитрилгидратазы, содержащий рекомбинантный вектор по п. 9, где указанный трансформант представляет собой бактерию.

11. Способ получения нитрилгидратазы, включающий культивирование трансформанта по п. 10 и сбор нитрилгидратазы из полученной культуры.

12. Способ получения амидного соединения, включающий приведение нитрильного соединения в контакт с улучшенной нитрилгидратазой по любому из пп. 1-7, или с культурой, полученной при культивировании трансформанта по п. 10, или переработанным продуктом культуры.



 

Похожие патенты:

Изобретение относится к биотехнологии. Описана двунитевая рибонуклеиновая кислота (днРНК) для ингибирования экспрессии ALAS1.

Группа изобретений относится к области биотехнологии. Предложен генетически конструируемый микроорганизм, способный преобразовывать холестерин, аналоги и производные холестерина в предшественники стероидных гормонов, где указанный микроорганизм содержит по меньшей мере одну последовательность ДНК, кодирующую цитохром P450 эукариотического происхождения, экзогенную последовательность ДНК, кодирующую Adx, и экзогенную последовательность ДНК, кодирующую AdR, и где указанный микроорганизм представляет собой Bacillus megaterium.

Предложены жидкая или сухая гранулированная композиция молокосвертывающего фермента аспарагиновой протеазы, а также их применение. Композиция молокосвертывающего фермента аспарагиновой протеазы содержит (i) молокосвертывающий фермент аспарагиновую протеазу с активностью от 25 IMCU (Международных молокосвертывающих единиц)/г композиции до 30000 IMCU/г композиции; (ii) полимер в концентрации от 50 млн-1 до 2500 млн-1 (масс./масс.) и (iii) соль в концентрации от 1 до 350 г/кг.

Группа изобретений относится к области биотехнологии. Предложен выделенный белок с фосфатазной активностью, содержащий аминокислотную последовательность из по меньшей мере 365 последовательных аминокислот, имеющую по меньшей мере 98% идентичность с SEQ ID NO: 5, аминокислотную последовательность из 65 последовательных аминокислот, имеющую по меньшей мере 98% идентичность с SEQ ID NO: 6, и аминокислотную последовательность из 54 последовательных аминокислот, имеющую по меньшей мере 98% идентичность с SEQ ID NO: 7, где полноразмерный белок содержит аминокислотную последовательность, имеющую по меньшей мере 98% идентичность с полноразмерной аминокислотной последовательностью SEQ ID NO: 1, при условии, что содержит модификации 279L, 328V и 478L.

Группа изобретений относится к области биотехнологии. Предложен выделенный вариант полипептида химозина, включающий изменение в положении 117 относительно последовательности бычьего химозина, где указанный вариант имеет активность химозина, а исходный полипептид по меньшей мере на 90% идентичен зрелому полипептиду верблюжьего химозина.

Группа изобретений относится к области биотехнологии. Предложен вариант пируватдегидрогеназы, содержащий по меньшей мере одну аминокислотную замену в области аминокислот в положениях 190-205 или в области аминокислот в положениях 415-440 SEQ ID NO: 1.

Изобретение относится к области биотехнологии, в частности к трансформированной клетке для экспрессии цис-пренилтрансферазы и рецептора Nogo-B, полученной посредством введения в клетку кодирующего гена, кодирующего цис-пренилтрансферазу, и гена, кодирующего рецептор Nogo-B.

Изобретение относится к биотехнологии. Предложены клетка-хозяин E.coli для получения анти-VEGF антитела или антигенсвязывающего фрагмента анти-VEGF, свободных от ошибки включения норлейцина, клетка-хозяин E.coli для получения антитела против фактора D или антигенсвязывающего фрагмента против фактора D, свободных от ошибки включения норлейцина, и Клетка-хозяин E.coli для получения анти-МЕТ антитела или антигенсвязывающего фрагмента анти-МЕТ, свободных от ошибки включения норлейцина.

Настоящее изобретение относится к области биотехнологии, конкретно к терапевтическим химерным белкам, которые можно применять в медицине для лечения мукополисахаридоза IIIB типа (Синдром Санфилиппо В).

КОМПОЗИЦИЯ ПИЩЕВАРИТЕЛЬНЫХ ФЕРМЕНТОВ, ПОДХОДЯЩАЯ ДЛЯ ЭНТЕРАЛЬНОГО ВВЕДЕНИЯ. .

Предложен способ получения L-метионина, в котором О-фосфо-L-гомосерин (OPHS) и метантиол ферментативно превращают в L-метионин и Н3РО4 согласно схеме реакции: О-фосфо-L-гомосерин + CH3-SH <=> L-метионин + H3PO4.

Группа изобретений относится к области биохимии. Предложен способ производства акриламида из акрилонитрила и устройство для осуществления вышеуказанного способа.

Изобретение относится к получению акриламида. Способ осуществляют за счет применения биокатализатора для получения акриламида непрерывно из акрилонитрила, причем акриламид вводят в реактор, в который непосредственно подан акрилонитриловый раствор и инициируют непрерывные реакции привнесением акрилонитрила в контакт с биокатализатором.

Изобретение относится к области биохимии, в частности к способу увеличения концентрации авенантрамидов в овсяных зернах, включающему индуцирование или углубление состояния вторичного покоя у овсяных зерен и замачивание овсяных зерен в состоянии вторичного покоя, приводящее к ложному осолаживанию, а также к цельному овсяному зерну с концентрацией авенантрамидов, которая увеличена по сравнению с неосоложенным зерном согласно указанному способу.
Изобретение относится к водному раствору акриламида для получения полимера акриламида, содержащему ацетальдегид в концентрации от 1,5 мг/кг акриламида до 4 мг/кг акриламида для стабилизации водного раствора акриламида.

Изобретение относится к биотехнологии и представляет собой модифицированный полипептид c гомосерин-O-ацетилтрансферазной активностью с аминокислотной последовательностью SEQ ID NO:17 или с по меньшей мере 95% гомологией с ней, в котором аминокислоту в положении 111 от начальной аминокислоты метионина последовательности заменяют глутаминовой кислотой.

Группа изобретений относится к биотехнологии. Сконструированы рекомбинантные штаммы Rhodococcus erythropolis 37 p16-Ami ВКПМ Ac-1937 и Rhodococcus erythropolis HX7 p16-Ami ВКПМ Ac-1938, конститутивно продуцирующие фермент ациламидазу с ацилирующей активностью.

Изобретение относится к области биохимии. Предложен способ получения иммобилизованного биокатализатора для синтеза водных растворов амидов, в том числе акриламида и никотинамида из нитрилов карбоновых кислот.
Изобретение относится к биотехнологии, в частности к получению водных растворов акриламида. .

Изобретение относится к ферментативному получению органических соединений с по меньшей мере 3 атомами углерода или с по меньшей мере 2 атомами углерода и по меньшей мере одним атомом азота при применении содержащей сахар среды, которая включает по меньшей мере одну часть не содержащих крахмал твердых составляющих источника крахмала, для культивирования микроорганизмов.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Escherichia, продуцирующий L-триптофан, где активности эндогенных 6-фосфоглюконатдегидратазы (Edd) и 2-кето-3-дезокси-6-фосфоглюконатальдолазы (Eda) ослаблены или инактивированы, где микроорганизм имеет усиленный РРР (пентозофосфатный путь) посредством ослабленного или блокированного пути Энтнера-Дудорова.

Группа изобретений относится к области биотехнологии. Предложены варианты улучшенной нитрилгидратазы, где нитрилгидратаза получена из бактерии Rhodococcus или бактерии Nocardia. Предложена ДНК, кодирующая указанную улучшенную нитрилгидратазу, а также вектор экспрессии, содержащий указанную ДНК. Предложен трансформант, представляющий собой бактерию, для продуцирования нитрилгидратазы, содержащий указанный вектор. Предложен способ получения нитрилгидратазы с использованием указанного трансформанта. Предложен способ получения амидного соединения с использованием указанной улучшенной нитрилгидратазы или с культурой, полученной при культивировании указанного трансформанта, или переработанным продуктом культуры. Группа изобретений позволяет получать улучшенную нитрилгидратазу с повышенной устойчивостью к амидным соединениям при высоких температурах. 7 н. и 5 з.п. ф-лы, 3 ил., 14 табл., 9 пр.

Наверх