Композиции и способы для борьбы с членистоногими паразитами и заражениями вредителями



Композиции и способы для борьбы с членистоногими паразитами и заражениями вредителями
Композиции и способы для борьбы с членистоногими паразитами и заражениями вредителями
Композиции и способы для борьбы с членистоногими паразитами и заражениями вредителями
Композиции и способы для борьбы с членистоногими паразитами и заражениями вредителями
Композиции и способы для борьбы с членистоногими паразитами и заражениями вредителями
Композиции и способы для борьбы с членистоногими паразитами и заражениями вредителями
Композиции и способы для борьбы с членистоногими паразитами и заражениями вредителями
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)
A01N43/00 - Консервирование тел людей или животных, или растений или их частей; биоциды, например дезинфектанты, пестициды, гербициды (препараты для медицинских,стоматологических или гигиенических целей A61K; способы или устройства для дезинфекции или стерилизации вообще, или для дезодорации воздуха A61L); репелленты или аттрактанты (приманки A01M 31/06; лекарственные препараты A61K); регуляторы роста растений (соединения вообще C01,C07,C08; удобрения C05; вещества, улучшающие или стабилизирующие состояние почвы C09K 17/00)

Владельцы патента RU 2694950:

МОНСАНТО ТЕКНОЛОДЖИ ЛЛС (US)
ДЗЕ ЮНАЙТЕД СТЕЙТС ОФ АМЕРИКА, ЭЗ РЕПРЕЗЕНТЕД БАЙ ДЗЕ СЕКРЕТЭРИ ОФ ЭГРИКАЛЧЕР (US)
БИОЛОДЖИКС, ИНК. (US)

Изобретение относится к области биохимии, в частности к композиции против клещей Varroa destructor, содержащей в эффективном количестве молекулу нуклеиновой кислоты, имеющую последовательность, которая по меньшей мере на 96% комплементарна или идентична по меньшей мере 21 смежному нуклеотиду последовательности гена кальмодулина, а также к ее использованию для снижения паразитизма Varroa destructor на медоносной пчеле и для селективной обработки видов членистоногих от Varroa destructor. Также раскрыт конструкт для ингибирования гена Varroa destructor, содержащий нуклеиновую кислоту, которая кодирует дцРНК, содержащую последовательность нуклеиновой кислоты, которая по меньшей мере на 96% идентична или комплементарна по меньшей мере 21 смежному нуклеотиду последовательности гена кальмодулина. Изобретение позволяет эффективно снижать паразитизм Varroa destructor на медоносной пчеле. 6 н. и 36 з.п. ф-лы, 7 ил., 6 табл., 11 пр.

 

ВКЛЮЧЕНИЕ ПЕРЕЧНЯ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

Перечень последовательностей в машиночитаемой форме подан с настоящим заявлением в электронном формате и включен в настоящую заявку посредством ссылки в полном объеме. Перечень последовательностей содержится в файле, который был создан 27 октября 2014 года, с именем "P34094US01_SEQ.txt, и размером 64,002 байтов (размер измерен в операционной системе Microsoft Windows®)

ОБЛАСТЬ ТЕХНИКИ

Предложены способы и композиции для борьбы с членистоногим паразитом и возбудителем инфекций. Также предложены композиции и способы для борьбы с заражением пчел клещом Варроа.

УРОВЕНЬ ТЕХНИКИ

Различные виды членистоногих все больше и больше культивируют в промышленных масштабах. Насекомые и их личинки питательны и употребляются в пищу во многих культурах как сырыми, так и приготовленными. Ракообразные, такие как крабы, омары, раки, морские и речные креветки, выращиваемые в крупном промышленном масштабе и представляющие собой важную часть рациона человека. Наряду с культурой видов членистоногих для производства продуктов питания, членистоногих также культивируют в рамках стратегий борьбы с вредителями, в том числе для биологического контроля других членистоногих, например, культуру паразитических ос для контроля над тараканами и муравьями. Членистоногие также могут служить источником сырья, такого как красители, лекарственные препараты, медикаменты и антибиотики. Культивирование, вместе с возрастающей важностью культуры членистоногих, сопровождается различными вредителями и паразитами, которые разрушают колонии членистоногих или значительно уменьшают выход продуктов, полученных из культуры членистоногих. Соответственно, существует растущая потребность в способах борьбы с членистоногими вредителями и паразитами.

Среди наиболее важных видов культивируемых членистоногих является медоносная пчела. Медоносные пчелы Apis mellifera необходимы для эффективного опыления культур и, следовательно, имеют важнейшее значение для мирового сельского хозяйства. Также медоносные пчелы производят экономически важные продукты, включая мёд и пчелиный воск. Пчелы восприимчивы к ряду паразитов и патогенов, в том числе к эктопаразитарному клещу Varroa destructor.

Клещи Варроа (Varroa destructor) являются одним из паразитов, регулирующих численность медоносных пчел (Apis mellifera), и представляют самую большую глобальную угрозу коммерческому пчеловодству (Rosenkranz et al. 2010). Взрослый клещ, как правило, проникает в соты трутовок и трутневого расплода, прежде чем они запечатываются, подвергаясь воздействию феромоном расплода медоносной пчелы. Клещ погружается в личиночный корм, который пчелы помещают внутрь сот в ожидании запечатывания, скорее всего, чтобы избежать узнавания и удаления пчелой-кормилицей. После запечатывания ячеек пчелой-кормилицей, клещ прилипает к личинке и начинает поглощать гемолимфу пчелиных личинок. Данный процесс представляет собой первичный оогенез у клещей, спустя несколько дней следует кладка мужских и женских яиц. В конце концов, взрослый Варроа покидает ячейку и цепляется за развивающихся пчел. Варроа непосредственно наносит ущерб медоносным пчелам несколькими способами, в первую очередь за счет истощения ресурсов, что отрицательно сказывается на врожденной иммунной системе медоносной пчелы, и, также является весьма эффективным переносчиком вирусов (Di Prisco et al. 2011), некоторые из которых, как известно, реплицируются в клеще, что значительно увеличивает уровень вирусной нагрузки.

Безопасное, эффективное и долговечное решение проблемы Варроа является актуальной задачей, которая до сих пор не решена. В настоящее время пчеловоды используют множество способов для контроля уровня Варроа, которые включают различные химические акарициды, большинство из которых потеряли эффективность и являются токсичными и/или оставляют остаточные вещества в воске и мёде. Другие способы включают применение щавелевой или муравьиной кислоты, монотерпенов (тимола), а также различных других способов контроля, с сильно изменяющимися результатами, включая токсичность для обработанных колоний. Разведение пчел на устойчивость к Варроа, такое как селекция гигиенического поведения, которое обеспечивает удаление инфицированного расплода, дало ограниченный практический успех.

Синдром разрушения пчелиных колоний (СРК) ставит под угрозу уничтожение мирового сельского хозяйства и сельского хозяйства США. Действительно, в связи с недавней вспышкой СРК в США в зимний период 2006-2007 годов, по оценкам 25 % или более 2,4 млн пчелиных ульев были утрачены из-за СРК. По оценкам 23 % пасек в Соединенных Штатах пострадали от СРК за зиму 2006-2007 годов, затронув в среднем 45 % пасек. В зимний период 2007-2008 годов, инициативная группа Службы сельскохозяйственных исследований (США) по СРК подсчитали, что СРК в общей сложности уничтожили 36 % всех ульев коммерческих пасек.

СРК характеризуется быстрой потерей взрослых пчел колонии, причем мертвых взрослых пчел обычно находят на некотором расстоянии от колонии. На завершающей стадии распада, королеву посещают только несколько вновь появившихся взрослых пчел. Разрушенные колонии часто имеют немалое количество запечатанного расплода и запасов еды. Явление СРК впервые было описано в 2006 году; тем не менее, пчеловоды отмечали уникальное снижение колоний из-за СРК еще в 2004 году. В качестве причин предполагали различные факторы, такие как клещи и инфекционные агенты, погодные условия, электромагнитные излучения (сотовых антенн), пестициды, плохое питание и стресс. На сегодняшний день,  контроль СРК сфокусирован на борьбе с клещом Варроа, санитарии и удалении пораженных ульев, лечении оппортунистических инфекций (таких как нозематоз) и улучшении питания. В настоящее время нет разработанных эффективных профилактических мер.

Клещи Варроа паразитируют на куколках и взрослых пчелах и размножаются в куколках печатного расплода. Клещи используют свои рты, чтобы проколоть экзоскелет, и питаются гемолимфой пчелы. Эти поврежденные участки экзоскелета место скопления бактериальных инфекций, таких как Melissococcus pluton, который вызывает европейский гнилец. Кроме того, к их паразитарному воздействию, клещи Варроа подозреваются в качестве векторов для ряда пчелиных патогенов, включая вирус деформации крыла (DWV), Кашмир-вирус (KBV), вирус острого паралича пчел (ABPV) и вирус черных маточников (BQCV), и могут ослабить иммунную систему своих хозяев, делая их уязвимыми к инфекциям. Если не лечить заражение паразитами Варроа, как правило, колония гибнет.

Современные методы лечения инвазии Варроа оказываются неэффективными, так как клещ развивает устойчивость к существующим акарицидам. Кроме того, использование таких акарицидов может привести к попаданию вредных химических веществ в мёд, который предназначен для употребления человеком.

КРАТКОЕ ОПИСАНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Настоящее изобретение предлагает и включает селективные инсектицидные композиции, содержащие антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую последовательность, которая по существу комплементарна или по существу идентична области последовательности гена кальмодулина или транскрибируемой из нее РНК. В некоторых аспектах настоящего изобретения композиция дополнительно содержит вспомогательное вещество.

В аспекте настоящего изобретения молекула нуклеиновой кислоты в селективной инсектицидной композиции представляет собой дцРНК. В некоторых аспектах настоящего изобретения дцРНК представляет собой миРНК.

В аспекте настоящего изобретения последовательность гена кальмодулина имеет по меньшей мере 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % или 100 % идентичности последовательности с последовательностью, выбранной из SEQ ID NO: 1- 4, 6, 23, 26-35 и 69-89. В некоторых аспектах настоящего изобретения последовательность гена кальмодулина содержит по меньшей мере 18 смежных нуклеотидов последовательности, выбранной из SEQ ID NO: 1-4, 6, 23, 26-35 и 69-89.

В аспекте настоящего изобретения селективная инсектицидная композиция дополнительно содержит одну или более антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, которая по существу является комплементарной или по существу идентичной первой области генной последовательности кальмодулина. В некоторых аспектах настоящего изобретения одна или более молекул нуклеиновых кислот содержит вторую последовательность нуклеиновой кислоты комплементарную второй области последовательности гена кальмодулина.

В аспекте настоящего изобретения селективная инсектицидная композиция поглощается пчелой, абсорбируется пчелой, поглощается клещом или абсорбируется клещом.

В аспекте настоящего изобретения средство для достижения цели выбрано из группы, состоящей из белка, пыльцы, углеводов, полимера, жидкого растворителя, сахарного сиропа, кристаллического сахара и полужидкой пищи. В некоторых аспектах настоящего изобретения жидкий растворитель выбирают из группы, состоящей из раствора сахарозы и раствора кукурузного сиропа. В некоторых аспектах настоящего изобретения белок выбирают из группы, состоящей из пыльцы и соевого белка. В другом аспекте настоящего изобретения вспомогательное вещество представляет собой твердое вещество, выбранное из сахара, заменителя сахара или сахарной добавки. В некоторых аспектах настоящего изобретения кристаллический сахар содержит микрочастицы сахара, пропитанные последовательностью нуклеиновой кислоты дцРНК.

В одном аспекте настоящая заявка раскрывает композиции, поглощаемые пчелой, содержащие пищу пчелы и молекулу нуклеиновой кислоты, имеющую последовательность, которая по существу идентична или по существу комплементарна одной или более областей последовательности гена кальмодулина или транскрибируемой из нее РНК. В некоторых аспектах настоящего изобретения корм пчелы содержит пищу пчелы, выбранную из группы, содержащую кукурузный сироп, заменитель пыльцы, пыльцу, лепешки из пыльцы и помадную массу. В некоторых аспектах настоящего изобретения корм пчелы дополнительно содержит одну или несколько минеральных солей, эфирное масло, пивные дрожжи, дрожжевой экстракт, трегалозу, триптон, сухое молоко, лецитин и витамин С. Примеры эфирных масел включают, но не ограничиваются ими, винтергриновое масло, кудрявомятное масло, масло перечной мяты, масло лимонника и масло чайного дерева.

В другом аспекте настоящая заявка раскрывает конструкцию нуклеиновой кислоты, содержащую антипаразитарную, дезинсекционную или инсектицидную последовательность нуклеиновой кислоты, которая по существу идентична или комплементарна области генной последовательности кальмодулина или РНК транскрибируемой из нее, функционально связанной с промоторной последовательностью, функциональной в клетке-хозяине и способной производить дцРНК при введении в указанную клетку-хозяина. В некоторых аспектах настоящего изобретения конструкт нуклеиновой кислоты дополнительно содержит по меньшей мере один регуляторный элемент их группы, состоящей из лидерных последовательностей трансляции, интронов, энхансеров, структур "петля-на-стебле", последовательность-связывающих репрессоров, последовательностей терминации, нечитающихся последовательностей, и последовательностей распознавания полиаденилирования. В некоторых аспектах настоящего изобретения клетка-хозяин представляет собой бактериальную или дрожжевую клетку.

В другом аспекте настоящая заявка раскрывает способ получения композиции для медоносных пчел, включающий обеспечение пчеле эффективного количества композиции, содержащей антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, которая по существу идентична или по существу комплементарна одной или более областей последовательности гена кальмодулина или транскрибируемой из нее РНК, в результате чего нуклеиновая кислота содержится в ткани медоносной пчелы.

В другом аспекте настоящая заявка раскрывает способ лечения или профилактики заболевания в колонии медоносной пчелы, включающий обеспечение эффективного количества композиции, содержащей антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, которая по существу идентична или по существу комплементарна одной или более областей последовательности гена кальмодулина медоносной пчелы в котором нуклеиновая кислота присутствует в ткани медоносной пчелы. В некоторых аспектах настоящего изобретения последовательность гена кальмодулина представляют собой последовательность гена кальмодулина Varroa destructor.

В другом аспекте настоящая заявка раскрывает способ снижения заражения пчелы Varroa destructor, включающий обеспечение пчеле эффективного количества антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты, где нуклеиновая кислота представляет собой по существу идентичную или по существу комплементарную одной или более областей последовательности гена кальмодулина Varroa destructor, или транскрибируемой из нее РНК, тем самым снижая паразитизм Varroa destructor на пчелах.

В другом аспекте настоящая заявка раскрывает способ снижения паразитарной нагрузки на ульи пчел, включающий обеспечение указанных ульев эффективным количеством антипаразитарной, дезинсекционной или инсектицидной нуклеиновой кислоты, которая является по существу идентичной или по существу комплементарной одной или более областей генной последовательности кальмодулина паразита или транскрибируемой из нее РНК, в результате чего паразитарная нагрузка указанного улья снижается.

В другом аспекте настоящее заявка раскрывает способ селективной обработки видов членистоногих паразитов, включающий доставку эффективного количества антипаразитарной, дезинсекционной или инсектицидной нуклеиновой кислоты, которая является по существу идентичной или по существу комплементарной одной или более областей последовательности гена кальмодулина паразита или РНК, транскрибируемой из нее, к видам членистоногих.

В другом аспекте настоящая заявка предлагает и раскрывает способ лечения или профилактики синдрома разрушения пчелиной семьи в пчелиной колонии, включающий обеспечение эффективного количества композиции в пчелиной колонии, которая содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую последовательность, которая по существу идентична или по существу комплементарна одной или более областей последовательности гена кальмодулина Varroa destructor, в результате чего уровень инвазии Varroa destructor понижают или предотвращают.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

Фигура 1 представляет филогенетическое дерево генов кальмодулина (CAM) разных видов. Число непосредственно предшествующее названию вида соответствует идентификационному номеру последовательности (SEQ ID NO).

Фигура 2 представляет выживаемость клещей, подвергшихся воздействию нуклеиновой кислоты SEQ ID NO: 3 (CAM373) методом прямого вскармливания на 3 день после обработки по отношению к необработанному контролю (КОНТРОЛЬ) или неспецифической последовательности (SCRAM, SEQ ID NO: 5).

Фигура 3. На панели А представлен анализ экспрессии генов на пятый день после обработки нуклеиновой кислотой SEQ ID NO: 3 (CAM373) или SEQ ID NO: 4 (CAM186) по отношению к контрольной группе. Панель Б демонстрирует выживаемость клещей, подвергшихся обработке нуклеиновыми кислотами SEQ ID NO: 3 (CAM373) и 4 (CAM186) по отношению к контрольной группе.

Фигура 4 представляет нагрузку клещ/100 пчел обработанных ульев по отношению к необработанному контролю за отчетный период времени.

Фигура 5 представляет % выживаемости клещей обработанных SEQ ID NO: 3, SEQ ID NO: 88 или SEQ ID NO: 89 по отношению к необработанным (НОК) на 5-й день (День %) или 6-й день (День6) после обработки.

Фигура 6 представляет % выживаемости клещей обработанных SEQ ID NO: 3 или смесью SEQ ID NO: 88 или SEQ ID NO: 89 по отношению к необработанным (НОК) на 5-й день (5), 6-й день (6) или 7-ой день (7).

Фигура 7 представляет нагрузку клещ Варроа/100 пчел обработанных ульев по отношению к необработанному контролю за 17-недельный период. Левые столбцы показывают ульи обработанные неспецифическими последовательностями (SCRAM, SEQ ID NO: 5), средние столбцы показывают необработанные ульи, а крайний правый столбец ульи обработанные SEQ ID NO: 3 (CAM 373).

ПОДРОБНОЕ ОПИСАНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Если не указано иное, технические и научные термины, используемые в данном документе, имеют то же значение, как их обычно понимает специалист в данной области техники. Специалистам в данной области техники будут очевидны многочисленные способы, применяемые в практике данного изобретения. Более того, настоящее изобретение никоим образом не ограничивается описанными способами и материалами. Все ссылочные источники, цитируемые в настоящем документе, полностью включены в настоящий документ посредством ссылок. В контексте настоящего изобретения следующие термины определены ниже.

Следует понимать, что любой идентификационным номер последовательности (SEQ ID NO), описанный в настоящей заявке может относиться либо к последовательности ДНК, или к последовательности РНК, в зависимости от контекста, в котором упоминается SEQ ID NO, даже если SEQ ID NO выражается только в виде последовательности ДНК или в виде последовательности РНК. Например, SEQ ID NO: 1 выражается в виде ДНК-последовательности (например, понимая под T тимин), но он может относиться либо к ДНК-последовательности, которая соответствует зрелой последовательности нуклеиновой кислоты кальмодулина Varroa destructor, или РНК- последовательности зрелой последовательности нуклеиновой кислоты кальмодулина Varroa destructor . Точно так же, хотя и SEQ ID NO: 3 экспрессируется в виде последовательности РНК (например, понимания под U урацил), в зависимости от описанного фактического типа молекулы, SEQ ID NO: 3 может относиться либо к последовательности молекулы РНК, содержащей дцРНК, или к последовательности молекулы ДНК, которая соответствует показанной последовательности РНК. В любом случае, как для ДНК, так и РНК молекул, имеющие описанные последовательности, предусмотрены любые замены.

Как используют в данном документе термин "около" относится к ± 10 %.

Как используют в данном документе формы единственного числа включают ссылки на множественное число, если из контекста явно не следует иное. Например, термин "соединение" или "по меньшей мере одно соединение", может включать множество соединений, в том числе их смеси.

Как используют в данном документе термин "по существу идентичны" или "по существу комплементарны" относится к нуклеиновой кислоте (или по меньшей мере одной нити двухцепочечной нуклеиновой кислоты или ее части, или части одной нити нуклеиновой кислоты), которая гибридизуется в физиологических условиях эндогенного гена, РНК, транскрибируемой из нее, или ее фрагмента, для регуляции или подавления эндогенного гена. Например, в некоторых аспектах настоящего изобретения нуклеиновая кислота имеет 100-процентную идентичность последовательности или по меньшей мере около 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 , или 99 процентов идентичности последовательности по сравнению с областью 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой с гена-мишени. Например, в некоторых аспектах настоящего изобретения нуклеиновая кислота имеет 100-процентную идентичность последовательности или по меньшей мере около 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 , или 99 процентов идентичности последовательности по сравнению с областью 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой с гена-мишени. В некоторых аспектах настоящего изобретения нуклеиновая кислота имеет 100-процентную идентичность или комплементарность последовательности к одному аллелю или одному члену семьи данного гена-мишени (кодирующей или некодирующей последовательностью гена). В некоторых аспектах настоящего изобретения нуклеиновая кислота имеет по меньшей мере около 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 или 99 процентов идентичности или комплементарности последовательности с множественными аллелями или членами семьи данного гена-мишени. В некоторых аспектах настоящего изобретения нуклеиновая кислота имеет 100-процентную идентичность или комплементарность последовательности с множественными аллелями или членами семьи данного гена-мишени.

В некоторых аспектах настоящего изобретения нуклеиновая кислота по существу идентична или по существу комплементарна по меньшей мере около 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 или более смежных нуклеотидов эндогенного гена кальмодулина целевого вредителя или РНК, транскрибируемого из него. Нуклеиновая кислота может быть одноцепочечной ДНК, одноцепочечной РНК, двухцепочечной РНК, двухцепочечной ДНК или двухцепочечным гибридом ДНК/РНК. В некоторых аспектах настоящего изобретения последовательность гена кальмодулина представляют собой последовательность гена кальмодулина Varroa destructor. В аспекте настоящего изобретения последовательность гена кальмодулина представляет собой последовательность гена кальмодулина, выбранную из SEQ ID NO: 1. В аспекте настоящего изобретения последовательность гена кальмодулина представляет собой последовательность гена кальмодулина, выбранную из SEQ ID NO: 2. В аспекте настоящего изобретения последовательность гена кальмодулина представляет собой последовательность гена кальмодулина, выбранную из SEQ ID NO: 3. В аспекте настоящего изобретения последовательность гена кальмодулина представляет собой последовательность гена кальмодулина, выбранную из SEQ ID NO: 4. В аспекте настоящего изобретения последовательность гена кальмодулина представляет собой последовательность гена кальмодулина, выбранную из SEQ ID NO: 69. В аспекте настоящего изобретения последовательность гена кальмодулина представляет собой последовательность гена кальмодулина, выбранную из SEQ ID NO: 70. В аспекте настоящего изобретения последовательность гена кальмодулина представляет собой последовательность гена кальмодулина, выбранную из SEQ ID NO: 71-87. В аспекте настоящего изобретения последовательность гена кальмодулина представляет собой последовательность гена кальмодулина, выбранную из SEQ ID NO: 88. В аспекте настоящего изобретения последовательность гена кальмодулина представляет собой последовательность гена кальмодулина, выбранную из SEQ ID NO: 89.

Как используют в данном документе термин "лечение" включает подавление по существу ингибирование, замедление или реверсию прогрессирования состояния, по существу облегчение характера клинических или эстетических симптомов, или по существу предотвращение появления клинических или эстетических симптомов. В соответствии с еще одним аспектом настоящего изобретения композиция может быть использована для лечения организма или колонии организмов от заражения. В аспекте настоящего изобретения композиция нуклеиновой кислоты может быть использована для лечения организма-хозяина или колонии от паразитов. В аспекте настоящего изобретения организм-хозяин представляет собой пчелу и паразит представляет собой клещ Varroa destructor.

Как используется в данном документе термин "РНК-сайленсинг" относится к группе регуляторных механизмов (например, РНК-интерференция (РНКи), транскрипционные гены сайленсинга (ТГС), посттранскрипционные гены сайленсинга (ПТГС), подавление, косупрессия, и трансляционная репрессия) опосредованные молекулами РНК, которые приводят к замедлению или "сайленсингу" экспрессии соответствующих белок-кодирующих генов или последовательностей РНК возбудителя пчелы. РНК-сайленсинг наблюдается во многих типах организмов, включая растения, животных и грибы. В соответствии с аспектами настоящего изобретения композиции нуклеиновых кислот обеспечивают РНК-сайленсинг. В некоторых аспектах настоящего изобретения композиции нуклеиновых кислот обеспечивают РНК-сайленсинг и смертность паразита.

Как используют в данном документе термин "агент РНК-сайленсинга" относится к нуклеиновой кислоте, которая способна ингибировать или "подавлять" экспрессию гена-мишени. В некоторых аспектах  настоящего изобретения агент РНК-сайленсинга способен предотвратить полный процессинг (например, полную трансляцию и/или экспрессию) молекулы мРНК через посттранскрипционный механизм сайленсинга. Агенты РНК-сайленсинга могут быть одно- или двухцепочечной РНК или одно- или двухцепочечной ДНК или двухцепочечными гибридами ДНК/РНК или их модифицированными аналогами. В некоторых аспектах настоящего изобретения агенты РНК-сайленсинга выбраны из группы, состоящей из (а) одноцепочечной молекулы РНК (оцРНК), (б) оцРНК молекулы, которая самостоятельно гибридизуется с образованием двухцепочечной молекулы РНК, (в) двухцепочечной молекулой РНК (дцРНК), (г) одноцепочечной молекулы ДНК (оцДНК), (д) молекулы оцДНК, которая самогибридизуется с образованием двухцепочечной молекулы ДНК, и (е) одноцепочечной молекулы ДНК, включая модифицированный ген Pol III, который транскрибируется в РНК-молекулы, (ж) двухцепочечной молекулы ДНК (дцДНК), (з) молекулы двухцепочечной ДНК, включая модифицированный промотор Pol III, который транскрибируется в РНК-молекулы, (и) двухцепочечной гибридной молекулы РНК/ДНК, или их комбинаций. В некоторых аспектах настоящего изобретения эти полинуклеотиды включают химически модифицированные нуклеотиды или неканонические нуклеотиды. В некоторых аспектах настоящего изобретения агенты РНК-сайленсинга представляют собой некодирующие молекулы РНК, например, РНК-дуплексы, содержащие спаренные нити, а также РНК-предшественников, из которых могут быть образованы такие малые некодирующие РНК. В некоторых аспектах настоящего изобретения агенты РНК-сайленсинга представляют собой дцРНК, такие как миРНК, микроРНК и короткие РНК. В аспекте настоящего изобретения агент РНК-сайленсинга способен индуцировать РНК-интерференцию. В другом аспекте настоящего изобретения агент РНК-сайленсинга способен к опосредованной трансляционной репрессии. В аспекте настоящего изобретения агент РНК-сайленсинга способен ингибировать экспрессию гена кальмодулина. В другом аспекте настоящего изобретения агент РНК-сайленсинга может быть использован в способах ингибирования экспрессии гена-мишени и тем самым убить организм-мишень. В некоторых аспектах настоящего изобретения ген-мишень представляет собой ген кальмодулина целевого организма Varroa destructor.

РНК-интерференция относится к процессу сиквенс-специфичного посттранскрипционного сайленсинга генов у животных, опосредованных малыми РНК. Соответствующий процесс у растений обычно называют посттранскрипционным сайленсингом генов или РНК-сайленсингом и также упоминается как подавление у грибов. В то же время, не ограничиваясь какой-либо конкретной теорией, процесс посттранскрипционного сайленсинга генов, как полагают, эволюционно-консервативный механизм клеточной защиты, используемый для предотвращения экспрессии чужеродных генов и обычно разделяет разнообразную флору и таксономические группы. Такая защита от экспрессии чужеродного гена, возможно, развились в ответ на продукцию двунитевых РНК (дцРНК), полученных от вирусной инфекции или от случайной интеграции транспозонов в геном хозяина через клеточный ответ, который специфически разрушает гомологичную одноцепочечную РНК или геномную РНК вируса. В соответствии с аспектами настоящего изобретения композиции нуклеиновой кислоты приводят к РНК-интерференции в организме-мишени. В некоторых аспектах настоящего изобретения композиции нуклеиновой кислоты приводят к РНК-интерференции в Varroa destructor, когда они присутствуют в организме-хозяине, пчеле. В соответствии с аспектами настоящего изобретения селективный инсектицид может вызывать РНК-интерференцию в целевом организме, при этом не иметь интерференционную активность РНК в нецелевых организмах.

Как используют в данном документе термин "малые РНК" относится к любой молекуле РНК, которая по меньшей мере 15 пар оснований в длину, как правило, длиной 15-30 нуклеотидов, с предпочтительной длиной 20-24 нуклеотидов. В соответствии с аспектами настоящего изобретения "малая РНК" более 50 пар оснований в длину. В аспекте настоящего изобретения малая РНК больше 50 пар оснований в длину, но менее чем около 500 пар оснований. В аспекте настоящего изобретения малая РНК более 100 пар оснований в длину, но менее чем около 500 пар оснований. В аспекте настоящего изобретения малая РНК более 200 пар оснований в длину, но менее чем около 500 пар оснований. Малая РНК может быть двухцепочечной или одноцепочечной. Малые РНК включает, без ограничения, микроРНК (микроРНК), та-миРНК (транс-активирующие малые интерферирующие РНК), миРНК, активирующая РНК (РНКа), нат-миРНК (натуральная антисмысловая миРНК), гх-миРНК (гетерохроматиновая миРНК), цис- активирующая миРНК, дмикроРНК (длинная микроРНК), дмиРНК (длинная миРНК) и эа-миРНК (эпигенетически активированная миРНК) и их соответствующие предшественники. В некоторых вариантах реализации настоящего изобретения описанные молекулы миРНК представляют собой молекулы микроРНК, молекулы та-миРНК и молекулы РНКа и их соответствующие предшественники. Малая РНК процессируется in vivo организмом в активную форму. В соответствии с аспектами настоящего изобретения селективный инсектицид может быть малой РНК.

В соответствии с аспектами настоящего изобретения малая РНК образуется непосредственно в композиции. В других аспектах настоящего изобретения малая РНК продуцируется in vivo организмом либо из ДНК, либо РНК-предшественника. В некоторых аспектах настоящего изобретения малая РНК образуется как продукт трансгена в организме, например, дрожжевой или бактериальной клетки. В некоторых аспектах настоящего изобретения малая РНК в качестве продукта трансгена образуется в качестве предшественника, который перерабатывается in vivo после приема внутрь или поглощения организмом. В других аспектах настоящего изобретения малая РНК в качестве продукта трансгена образуется в качестве предшественника, который перерабатывается in vivo после приема внутрь или поглощения организмом.

В некоторых аспектах настоящего изобретения агент РНК-сайленсинга может представлять собой искусственную микроРНК. Как используют в данном документе термин "искусственная микроРНК" (имиРНК) представляет собой тип микроРНК, который получен путем замены нативных дуплексов микроРНК из природного предшественника микроРНК. Как правило, искусственная микроРНК представляет собой не встречающуюся в природе микроРНК молекулу, которую получают из сконструированной молекулы пре-миРНК путем замены последовательности микроРНК, встречающейся в природе молекулы пре-микроРНК, интересующей последовательностью, соответствующей последовательности искусственного микроРНК. В соответствии с аспектами настоящего изобретения композиция нуклеиновой кислоты может представлять собой композицию имикроРНК.

Различные исследования показывают, что длинные дцРНК могут быть использованы для подавления экспрессии гена, не снижая ответ на стресс или вызывая значительные нецелевые эффекты, см. например (Strat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13 3803-3810; Bhargava A et al. Brain Res. Protoc. 2004;13:115-125; Diallo M., et al., Oligonucleotides. 2003;13:381-392; Paddison P.J., et al., Proc. Natl Acad. Sci. USA. 2002;99:1443-1448; Tran N., et al., FEBS Lett. 2004;573:127-134). Настоящее изобретение предлагает и включает способы и композиции, имеющие длинные дцРНК.

Как используют в данном документе по отношению к последовательности нуклеиновой кислоты, молекуле нуклеиновой кислоты или гену, термин "природный" или "нативный" означает, что соответствующая последовательность или молекула присутствует в диком типе организма, который не был генетически изменен или модифицирован человеком. Малая РНК молекула естественным образом нацеленная на ген-мишень означает малую РНК молекулу, присутствующую в диком организме, клетка которой не была генетически модифицирована или изменена человеком, нацеленная на ген-мишень, встречающийся в природе в соответствующем организме.

Как используют в данном документе термин "гомология" и "идентичность" используется в отношении нуклеиновых кислот, описывая степень сходства между двумя или более нуклеотидными последовательностями. Процент "идентичности последовательности" между двумя последовательностями определяется путем сравнения двух оптимально выровненных последовательностей в окне сравнения, таким образом, что часть последовательности в окне сравнения может содержать вставки или делеции (пропуски) по сравнению с эталонной последовательностью (которая не содержит вставок или делеций) для оптимального выравнивания двух последовательностей. Процент рассчитывается путем определения числа положений, в которых идентичные основания нуклеиновых кислот или аминокислотные остатки в обеих последовательностях, с получением числа совпадающих положений, деления числа совпадающих положений на общее число положений в окне сравнения и умножения результата на 100 для получения процента идентичности последовательностей. Последовательность, которая идентична в каждом положении в сравнении с эталонной последовательностью, называется идентичной эталонной последовательности, и наоборот. Выравнивание двух или более последовательностей, может быть выполнено с использованием любой подходящей компьютерной программы. Например, CLUSTALW v1.6 представляет собой широко используемую и общепринятую компьютерную программу для выполнения выравниваний (Thompson, et al. Nucl. Acids Res., 22: 4673-4680, 1994).

Как используют в данном документе термин "экзогенный полинуклеотид" и "экзогенная молекула нуклеиновой кислоты" по отношению к организмам относятся к гетерологичной последовательности нуклеиновой кислоты, которая неестественным путем экспрессируется в данном организме. Экзогенные молекулы нуклеиновой кислоты могут быть введены в организм в стабильном или неустойчивом виде. Экзогенная молекула нуклеиновой кислоты может включать последовательность нуклеиновой кислоты, которая является идентичной или частично гомологичной эндогенной последовательности нуклеиновой кислоты организма или вредителя или патогена этого организма. В некоторых аспектах настоящего изобретения термины "экзогенный полинуклеотид" и "экзогенная молекула нуклеиновой кислоты" может относиться к последовательности нуклеиновой кислоты паразита, экспрессируемой или присутствующей в хозяине или временно, или стабильно. Настоящее изобретение предлагает и включает композиции, содержащие экзогенные полинуклеотиды и экзогенные молекулы нуклеиновых кислот, и способы их введения в организм-мишень. В некоторых аспектах настоящего изобретения предлагают и включают композиции, содержащие экзогенные полинуклеотиды и экзогенные молекулы нуклеиновых кислот и способы их введения в нецелевой организм, который является хозяином для организма-мишени.

Как используют в данном документе термин "контрольный организм" означает организм, который не содержит рекомбинантную ДНК, малую РНК, или другую нуклеиновую кислоту (например, белок, микроРНК, малую РНК-резистентную мишени мРНК, дцРНК, целевой мимик), что обеспечивает контроль вредителя или паразита. Контрольные организмы, как правило, того же вида и той же стадии развития, выращиваемые в тех же условиях, как и обработанный организм. Аналогичным образом "контрольная колония" означает колонию организмов, которая не содержит рекомбинантную ДНК, малую РНК, или другую нуклеиновую кислоту (например, белок, микроРНК, малую РНК-резистентную мишени мРНК, дцРНК, целевой мимик), что обеспечивает контроль вредителя или паразита. Контрольные организмы, как правило, того же вида и той же стадии развития, выращиваемые в тех же условиях, как и обработанный организм. В качестве неограничивающего примера, контрольный организм может быть пчелой при условии, если композиция не содержит нуклеиновую кислоту по настоящему изобретению. В качестве другого неограничивающего примера, контрольный организм может быть пчелой при условии, если композиция, содержащая нуклеиновую кислоту, которая не действует на пчелу или паразита как сайленсер РНК, такой как SEQ ID NO: 5.

Как используется в настоящем документе термины " улучшение", " улучшенный", "увеличение" и "увеличенный" относятся к по меньшей мере около 2 %, по меньшей мере около 3 %, по меньшей мере около 4 %, по меньшей мере около 5 %, по меньшей мере около 10 %, по меньшей мере около 15 %, по меньшей мере около 20 %, по меньшей мере около 25 %, по меньшей мере около 30 %, по меньшей мере около 35 %, по меньшей мере около 40 %, по меньшей мере около 45 %, по меньшей мере около 50 %, по меньшей мере около 60 %, по меньшей мере около 70 %, по меньшей мере около 80 %, по меньшей мере около 90 %, или большее увеличение в организме или популяции колонии, в повышенной производительности организма или колонии (например, увеличение производства мёда), увеличение скорости роста организма или колонии, или повышенной репродуктивной скорости по сравнению с контрольной колонией или организмом. Настоящее изобретение относится к способам улучшения здоровья организма или колонии, обеспечиваемые селективной инсектицидной композицией.

Как используют в данном документе термин "снижение" уровня агента, такого как белок или мРНК означает, что уровень снижен по отношению к организму или колонии, у которых отсутствует нуклеиновая кислота способная подавлять агента. Кроме того, используемый в данном документе термин "снижение" в ссылке на паразитизм или паразитарную нагрузку, означает, что уровень снижен относительно организма или колонии, у которых отсутствует нуклеиновая кислота, такая как молекула дцРНК, способная к снижению жизнеспособности, плодовитости или количества паразита. Настоящее изобретение предлагает и включает способы и композиции для снижения уровня белка или мРНК, и снижение уровня или количества паразитов.

Как используют в данном документе термин "по меньшей мере частичное снижение" уровня агента, такого как белок или мРНК, означает, что уровень снижается, по меньшей мере на 25 % по отношению к организму или колонии, у которых отсутствует нуклеиновая кислота, такая как молекула дцРНК способная подавлять агента. Кроме того, используемый в данном документе термин "по меньшей мере частичное снижение" в ссылке на паразитизм или паразитарную нагрузку, означает, что уровень снижен по меньшей мере на 25 % относительно организма или колонии, у которых отсутствует нуклеиновая кислота, такая как молекула дцРНК, способная к снижению жизнеспособности, плодовитости или количества паразита. Настоящее изобретение предлагает и включает способы и композиции по меньшей мере частично снижающие уровень белка или мРНК, и по меньшей мере частично снижающие уровень или количество паразитов.

Используемое в данном документе "существенное снижение" уровня агента, такого как белок или мРНК означает, что уровень снижен относительно организма или колонии, у которого отсутствует нуклеиновая кислота, такая как молекула дцРНК, способная подавить агента, при этом снижение уровня агента составляет по меньшей мере 75 %. Кроме того, используемый в данном документе термин "существенное снижение" со ссылкой на паразитизм или паразитарную нагрузку, означает, что уровень снижается по меньшей мере на 75 % по отношению к организму или колонии, у которых отсутствует нуклеиновая кислота, такая как молекула дцРНК, способная к снижению жизнеспособности, плодовитости или количества паразита. Настоящее изобретение предлагает и включает способы и композиции для существенного снижения уровня белка или мРНК, так и в значительной степени снижения уровня или количества паразитов.

Как используют в данном документе термин "эффективное устранение" агента, такого как белок или мРНК по отношению к организму или колонии, у которых отсутствует молекула дцРНК, способная подавлять агента, при этом снижение уровня агента составляет более 95 %. Агент, такой как молекула дцРНК, предпочтительно способен обеспечить по меньшей мере частичное снижение, более предпочтительно, существенное снижение или, наиболее предпочтительно, эффективное устранение другого агента, такого как белок или мРНК, или паразита, где агент оставляет уровень второго агента или организма-хозяина по существу незатронутым, значительно незатронутым, или частично незатронутым. Кроме того, используемый в данном документе термин "эффективное устранение" в отношении паразитизма или паразитарной нагрузки, означает, что уровень снижается по меньшей мере на 95 % по отношению к организму или колонии, у которых отсутствует нуклеиновая кислота, такая как молекула дцРНК, способная снижать жизнеспособность, плодовитость или количество паразита. Настоящее изобретение предлагает и включает способы и композиции для снижения уровня белка или мРНК, и снижение уровня или количества паразитов.

Как используется в данном документе термины "супрессия", "репрессия" и "подавление", когда ссылаются на экспрессию или активность молекулы нуклеиновой кислоты в организме, используют то же самое здесь, и означает, что уровень экспрессии или активности нуклеиновой кислоты молекулы в клетке организма после применения способа по настоящему изобретению, ниже, чем его экспрессия или активность в клетке организма перед применением способа, или по сравнению с контрольным организмом, у которого отсутствует молекула нуклеиновой кислоты по настоящему изобретению. Настоящее изобретение предлагает и включает способы и композиции для супрессии, репрессии и снижении уровня белка или мРНК и супрессии, репрессии и снижении уровня или количества паразитов.

Термины "супрессировано", "репрессировано" и "подавляются", используемые в настоящем документе, являются синонимами и означают в данном документе низкую, предпочтительно значительно более низкую экспрессию или активность целевой молекулы нуклеиновой кислоты. Кроме того, как используется в данном документе термины "супрессировано", "репрессировано" и "подавляются" со ссылкой на паразитизм или паразитарную нагрузку означает, что уровень паразитизма или паразитарной нагрузки ниже, предпочтительно значительно ниже по отношению к организму или колонии, у которых отсутствует нуклеиновая кислота, такая как молекула дцРНК, способная к снижению жизнеспособности, плодовитости или количества паразита. Настоящее изобретение предлагает и включает способы и композиции для супрессии, репрессии и подавлении экспрессии или активности белка или мРНК и супрессии, репрессии и снижении активности паразитов.

Как используется в данном документе термин "супрессия", "репрессия", или "снижение” уровня или активности агента, такого как белок, мРНК или РНК означает, что уровень или активность снижается по сравнению с практически идентичной клеткой, организмом или колонией, выращиваемой в практически идентичных условиях, у которых отсутствуют описанные молекулы нуклеиновой кислоты, например, отсутствует комплементарная область по меньшей мере части описанной молекулы предшественника дцРНК или миРНК, рекомбинантного конструкта или рекомбинантного вектора. Как используется в данном документе термин "супрессия", "репрессия", или "снижение» уровня или активности агента, такого как, например, пре-РНК, мРНК, рРНК, тРНК, мякРНК, мяРНК экспрессии гена-мишени, и/или белкового продукта, кодируемого этими агентами, означает, что количество снижается на 10 % или более, например, 20 % или более, предпочтительно 30 % или более, более предпочтительно 50 % или более, еще более предпочтительно 70 % или более, наиболее предпочтительно 80 % или более, например, 90 %, по отношению к клетке, организму или колонии, у которых отсутствует рекомбинантная молекула нуклеиновой кислоты по настоящему изобретению. Настоящее изобретение предлагает и включает способы и композиции для супрессии, репрессии и подавлении агента, такого как белок, мРНК, РНК или паразит по сравнению с необработанным организмом или колонией.

Как используется в данном документе термин "членистоногие" относится как к взрослым беспозвоночным животным так и к куколкам, имеющим экзоскелет (внешний скелет), сегментированное тело и членистые придатки. Членистоногие входят в состав типа Arthropoda и включает насекомых, паукообразных и ракообразных. Членистоногие в соответствии с настоящим изобретением, включают, но не ограничиваются, Apis mellifera, Apis cerana, Trigona minima, Halictidae, Bombus sp., блох, мух, вшей, клещей, клещиков и полезных насекомых. Настоящее изобретение предлагает и включает способы и композиции для лечения членистоногих, как хозяина, так и паразита или вредителя.

В аспекте настоящего изобретения членистоногое может быть насекомым. В некоторых аспектах настоящего изобретения насекомое может быть пчелой. Как используется в данном документе термин «пчела» относится как к взрослой пчеле, так и к куколке. В соответствии с одним аспектом настоящего изобретения пчела находится в улье. Взрослая пчела определяется как любая из нескольких крылатых, волосатых, как правило, жалящих насекомых надсемейства Apoidea в порядке Hymenoptera, включая как одиночные, так и общественные виды, и характеризуются сосущими и грызущими ротовыми аппаратами для сбора нектара и пыльцы. Примеры видов пчел включают, но не ограничиваются ими, Apis, Bombus, Trigona, Osmia и тому подобное. В аспекте настоящего изобретения пчелы включают, но не ограничиваются, шмелями (Bombus terrestris), медоносными пчелами (Apis mellifera) (включая полевых и медоносных пчел) и Apis cerana. Настоящее изобретение предлагает и включает способы и композиции для лечения пчел как хозяев от паразитов, таких как клещи Варроа.

В соответствии с одним аспектом настоящего изобретения пчела является частью колонии. Термин "колония" относится к популяции пчел, содержащих множество, как правило, несколько десятков тысяч пчел, которые взаимодействуют в гнездостроении, сборе продуктов питания, выводе расплода. Колония обычно имеет одну королеву, оставшаяся часть пчел является либо «рабочими» (самки), либо"трутнями" (самцы). Социальная структура колонии поддерживается королевой и рабочими и зависит от эффективной системы коммуникации. Разделение труда в пределах касты в первую очередь зависит от возраста пчелы, но меняется в зависимости от потребностей колонии. Воспроизводство и сила колонии зависит от королевы, количества продовольственных запасов и величины рабочей силы. Пчел также можно отнести к категории "ульевых пчел ", как правило, на первом этапе рабочей жизни " ульевые пчелы " выполняет задачи в улье, а на позднем этапе жизни являются уже "пчелами-фуражирами", "фуражиры" находят и собирают пыльцу и нектар за пределами улья, и приносят нектар или пыльцу в улей для потребления и хранения. Настоящее изобретение предлагает и включает способы и композиции для лечения колоний насекомых.

Как используется в данном документе термин "вредитель" относится как к взрослым, так и незрелым формам организма, который является инвазивным или плодовитым, причиняющим вред, опасным, отравляющим, деструктивным, неблагоприятным либо для растений, либо для животных или для экосистем. Паразит представляет собой один из видов вредителей. Вполне возможно организм может являться вредителем в одних условиях, но полезным, одомашненным или приемлемым в других.

Как используется в данном документе термин "паразит" относится как взрослым, так и незрелым формам организмов, которые непосредственно существуют за счет другого, хозяина, организма, например, путем питания кровью или жидкостью организма хозяина, живущие внутриклеточно в клетке организма-хозяина, или живущие в теле организма-хозяина. Паразиты включают организмы животных, грибов, бактерий или растений и идентифицируются их негативным или вредным взаимодействием с хозяином. В некоторых аспектах настоящего изобретения паразит, используемый в данном документе, может в свою очередь, служит в качестве хозяина для второго паразита. В некоторых аспектах настоящего изобретения паразит и хозяин могут быть одного и того же типа организма (например, членистоногий хозяин и членистоногий паразит). Паразиты включают, но не ограничиваются ими, Acari (клещи, клещики), Hippoboscoidea (мухи), Ichneumonoidea (паразитические осы), Oestridae (носоглоточные оводы), Phthiraptera (вши), Siphonaptera (блохи), Tantulocarida, краб-горошинку и Sacculina. Как используется в данном документе вредитель может включать как паразитарные, так и непаразитарные стадии жизни. Настоящее изобретение предлагает и включает способы и композиции для обработки паразитов. В аспекте настоящего изобретения паразит может быть Varroa destructor.

Как это предложено и включено в настоящем изобретении паразиты и/или вредители включают Varroa destructor, Ixodes scapularis, Solenopsis invicta, Tetranychus urticae, Aedes aegypti, Culex quinquefasciatus, Acyrthosiphon pisum и Pediculus humanus. В соответствии с аспектами настоящего изобретения селективные инсектициды могут быть селективным для Varroa destructor, Ixodes scapularis, Solenopsis invicta, Tetranychus urticae, Aedes aegypti, Culex quinquefasciatus, Acyrthosiphon pisum и Pediculus humanus и неактивны, или значительно менее активны против нецелевого организма, такого как организм-хозяин.

Как используется в данном документе термин "вспомогательное вещество" относится к любому неактивному веществу, включенному в лекарственную форму, имеющую активный ингредиент, такой как антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота, включая без ограничения, дцРНК, малые РНК, микроРНК и антисмысловые РНК. В некоторых вариантах реализации настоящего изобретения вспомогательное вещество содержит вещества, которые могут обеспечивать дополнительные функциональные возможности для композиции, которая отличается антипаразитарной, дезинсекционной или инсектицидной нуклеиновой кислотой. Функции вспомогательного вещества включают, но не ограничиваются ими, "балластными веществами", "наполнителями", "разбавителями" и "носителями". Увеличивающие объем газов, что позволяет удобно и точно распределять композиции по настоящему изобретению. Вспомогательные вещества могут также служить для облегчения проглатывания композиций организмами и содержат различные углеводы, белки, жирные кислоты, пыльцу и заменители пыльцы. Вспомогательные вещества могут также служить для облегчения абсорбции композиций организмами, включая, например, как водные, так и неводные растворы активных ингредиентов. Неограничивающие примеры вспомогательных веществ содержат кукурузный сироп, сахарный сироп, кристаллический сахар, полужидкий сахар, пыльцу, соевый белок, пыльцу и белковые смеси. Вспомогательные вещества могут дополнительно содержать аттрактанты, буфера и питательные добавки. Композиции по настоящему изобретению могут быть покрыты, инкапсулированы в, растворены в, смешаны с или иным образом комбинированы со вспомогательным веществом. Как используется в данном документе термин вспомогательное вещество может относиться к смеси неактивных веществ.

Настоящая заявка предлагает и раскрывает антипаразитарные, дезинсекционные или инсектицидные молекулы нуклеиновых кислот, которые являются по существу гомологичными или комплементарными полинуклеотидной последовательности гена-мишени кальмодулина или РНК, экспрессированной из целевого гена кальмодулина или его фрагмента, и функции для подавления экспрессии гена-мишени кальмодулина или получения нокдауна фенотипа. Антипаразитарные, дезинсецкционные или инсектицидные молекулы нуклеиновой кислоты способны ингибировать или "подавлять" экспрессию целевого гена кальмодулина. Эти молекулы нуклеиновых кислот, как правило, описаны в связи с их "последовательностью-мишенью." В некоторых вариантах реализации настоящего изобретения последовательность-мишень выбрана из SEQ ID NO: 1, 2 и 6-77. Антипаразитические, дезинсекционные или инсектицидные молекулы нуклеиновых кислот могут быть одноцепочечной ДНК (оцДНК), одноцепочечной РНК (оцРНК), двухцепочечной РНК (дцРНК), двухцепочечной ДНК (дцДНК) или двухцепочечным гибридом ДНК/РНК. Молекулы нуклеиновой кислоты могут содержать встречающиеся в природе нуклеотиды, модифицированные нуклеотиды, аналоги нуклеотидов или любые их комбинации. В некоторых вариантах реализации настоящего изобретения антипаразитарные, дезинсекционные или инсектицидные молекулы нуклеиновой кислоты, могут содержаться в составе более крупного полинуклеотида, например, в молекуле первичной микроРНК. В некоторых вариантах реализации изобретения антипаразитарная, дезинсекционная или инсектицидная молекула нуклеиновой кислоты может быть процессирована в малую интерферирующую РНК (миРНК). В некоторых вариантах реализации настоящего изобретения молекулы нуклеиновых кислот предложены или раскрыты как селективные антипаразитарные или акарицидные, и способы модуляции экспрессии или активности их генов-мишеней для снижения или устранения паразитов из колонии или популяции.

В соответствии с аспектами настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная молекула нуклеиновой кислоты содержит нуклеотидную последовательность, имеющую по меньшей мере 80 %, 85 %, 88 %, 90 %, 92 %, 95 %, 96 %, 97 % , 98 % или 99 % идентичности последовательности с последовательностью или частью последовательности, выбранной из группы, состоящей из SEQ ID NO: с 1 по 89. В некоторых аспектах настоящего изобретения молекула нуклеиновой кислоты выбрана из группы, состоящей из одноцепочечной ДНК, оцРНК, дцРНК, дцДНК или ДНК/РНК-гибридов. Несколько вариантов реализации настоящего изобретения относятся к дцРНК, содержащей нуклеотидную последовательность, имеющую по меньшей мере 80 %, 85 %, 88 %, 90 %, 92 %, 95 %, 96 %, 97 %, 98 % или 99 % идентичности последовательности с последовательностью или частью последовательности, выбранной из группы, состоящей из SEQ ID NO: с 1 по 89. В другом аспекте настоящего изобретения ДНК, кодирующая по меньшей мере одну нуклеиновую кислоту, такую как оцРНК или дцРНК, содержит нуклеотидную последовательность или часть нуклеотидной последовательности, выбранной из группы, состоящей из SEQ ID NO: с 1 по 89, или имеющей по меньшей мере 80 %, 85 %, 88 %, 90 %, 92 %, 95 %, 96 %, 97 %, 98 % или 99 % идентичности последовательности с SEQ ID NO: от 1 до 89 или части из предложенного. В еще одном аспекте настоящего изобретения рекомбинантная ДНК, кодирующая по меньшей мере одну нуклеиновую кислоту, такой как оцРНК или дцРНК, содержит нуклеотидную последовательность или часть нуклеотидной последовательности, выбранной из группы, состоящей из SEQ ID NO: с 1 по 89, предложенных гетерологичного промотора и последовательности терминации транскрипции. В другом аспекте настоящее изобретение относится к рекомбинантной ДНК, кодирующей по меньшей мере одну нуклеиновую кислоту, такую как оцРНК или дцРНК, которая содержит нуклеотидную последовательность, имеющую по меньшей мере 80 %, 85 %, 88 %, 90 %, 92 %, 95 % , 96 %, 97 %, 98 % или 99 % идентичности последовательности с последовательностью, или частью последовательности, выбранной из группы, состоящей из SEQ ID NO: с 1 по 89, и дополнительно содержащей гетерологичный промотор и терминатор транскрипции.

В соответствии с аспектами настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 10 до 17 или более смежных нуклеотидов гена-мишени или РНК, транскрибируемой с гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 18 до 25 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 20 до 30 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 25 до 35 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 30 до 40 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 40 до 50 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 50 до 60 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 45 до 60 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью до 60 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью до 50 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью до 40 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 25 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 35 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 40 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 50 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 60 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: с 1 по 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 1. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 2. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 3. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 4. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 69. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 70. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 88. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 6-68.

В соответствии с аспектами настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 10 до 17 или более смежных нуклеотидов гена-мишени или РНК, транскрибируемой с гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от18 до 25 или более смежных нуклеотидов гена-мишени или РНК, транскрибируемой с гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 20 до 30 или более смежных нуклеотидов гена-мишени или РНК, транскрибируемой с гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 25 до 35 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 30 до 40 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 40 до 50 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная композиция содержит молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 50 до 60 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 45 до 60 или более смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью до 60 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью до 50 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью до 40 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 25 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 35 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 40 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 50 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 60 смежных нуклеотидов в гене-мишени или РНК, транскрибируемой из гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 98-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 97-процентную идентичность последовательности с областью гена-мишени. В некоторых аспектах настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 96-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 95-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 94-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 93-процентную идентичность последовательности с областью гена-мишени. В некоторых аспектах настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 92-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 91-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере около 83, 84, 85, 86, 87, 88, 89, 90 процентов идентичности с областью гена-мишени, как указано выше. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: с 1 по 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 1. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 2. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 3. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 4. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 69. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 70. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 88. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранную из SEQ ID NO: 71-87. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 6-68.

В соответствии с аспектами настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 10 до 17 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 18 до 25 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 20 до 30 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 25 до 35 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 30 до 40 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 40 до 50 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 50 до 60 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 45 до 60 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью до 60 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью до 50 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью до 40 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 25 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 35 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 40 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 50 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 60 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: с 1 по 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 1. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 2. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 3. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 4. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 69. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 70. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 88. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 6-68.

В соответствии с аспектами настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 10 до 17 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 18 до 25 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 20 до 30 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 25 до 35 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 30 до 40 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 40 до 50 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 50 до 60 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 45 до 60 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью до 60 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью до 50 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью до 40 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 25 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 35 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 40 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 50 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 60 смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 98-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 97-процентную идентичность последовательности с областью гена-мишени. В некоторых аспектах настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 96-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 95-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 94-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере 93-процентную идентичность последовательности с областью гена-мишени. В некоторых аспектах настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет 92-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере 91-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере около 83, 84, 85, 86, 87, 88, 89, 90 процентов идентичности с областью гена-мишени, как указано выше. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: с 1 по 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 1. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 2. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 3. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 4. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 69. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 70. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 88. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 6-68.

В соответствии с аспектами настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 10 до 17 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 18 до 25 или более смежных нуклеотидов к одному аллелю или одному члену семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 20 до 30 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 25 до 35 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 30 до 40 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 40 до 50 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 50 до 60 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью от 45 до 60 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью до 60 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью до 50 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью до 40 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 25 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 35 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 40 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 50 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 100-процентную идентичность последовательности с областью по меньшей мере 60 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: с 1 по 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 1. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 2. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 3. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 4. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 69. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 70. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 88. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 6-68.

В соответствии с аспектами настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 10 до 17 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 18 до 25 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 20 до 30 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 25 до 35 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 30 до 40 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 40 до 50 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 50 до 60 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью от 45 до 60 или более смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью до 60 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью до 50 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью до 40 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 25 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 35 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 40 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 50 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты, имеющую 99-процентную идентичность последовательности с областью по меньшей мере 60 смежных нуклеотидов идентичных или комплементарных множественным аллелям или членам семьи данного гена-мишени. В некоторых аспектах настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере 98-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере 97-процентную идентичность последовательности с областью гена-мишени. В некоторых аспектах настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере 96-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере 95-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере 94-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере 93-процентную идентичность последовательности с областью гена-мишени. В некоторых аспектах настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере 92-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере 91-процентную идентичность последовательности с областью гена-мишени. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота имеет по меньшей мере около 83, 84, 85, 86, 87, 88, 89, 90 процентов идентичности с областью гена-мишени, как указано выше. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: с 1 по 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 1. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 2. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 3. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 4. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 69. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 70. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 88. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим SEQ ID NO: 89. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения ген-мишень может быть геном, содержащим последовательность, выбранной из SEQ ID NO: 6-68.

Настоящая заявка предлагает и раскрывает композиции, содержащие антипаразитарную, дезинсекционную или инсектицидную молекулу нуклеиновой кислоты и вспомогательное вещество. В аспекте настоящего изобретения вспомогательное вещество может представлять собой сочетание одного или нескольких неактивных компонентов. В некоторых аспектах настоящего изобретения вспомогательное вещество содержит сахар. Примеры сахаров включают гексозы, дисахариды, трисахариды и высшие сахара. Вспомогательные вещества включают сахара, например, фруктозу, глюкозу, сахарозу, трегалозу, лактозу, галактозу, рибозу. В других аспектах настоящего изобретения вспомогательное вещество содержит сахар и растворитель. В других аспектах настоящего изобретения вспомогательное вещество содержит белок. В аспекте настоящего изобретения белок представляет собой соевый белок. В других аспектах настоящего изобретения вспомогательное вещество может быть пыльцой. В соответствии с аспектами настоящего изобретения вспомогательное вещество может быть пищей пчелы. В некоторых аспектах настоящего изобретения вспомогательное вещество содержит триптон. В некоторых аспектах настоящего изобретения вспомогательное вещество содержит дрожжевой экстракт. В некоторых аспектах настоящего изобретения вспомогательное вещество содержит эфирное масло.

Кормление пчел является обычной практикой среди пчеловодов, для обеспечения как пищевых, так и других, например, дополнительных потребностей. Пчелы, как правило, питаются мёдом и пыльцой, но, как известно, заодно глотают ненатуральные корма. Пчелы могут питаться различными пищевыми продуктами, включая, но не ограничиваясь, Wheast (молочные дрожжи, выращенные на твороге), соевая мука, дрожжи ( например, пивные дрожжи, дрожжи торула) и дрожжевые продукты, продукты давали в пищу отдельно или в комбинации, и соевую муку подавали в виде сухой смеси или влажной лепешки внутри улья или в виде сухой смеси в открытых кормушках за пределами улья. Также полезным является сахар или сахарный сироп. Добавление от 10 до 12 процентов пыльцы в качестве добавки к корму пчелам улучшает его вкусовую привлекательность. Добавление от 25 процентов пыльцы улучшает качество и количество необходимых питательных веществ, которые необходимы для жизнедеятельности пчел. Тростниковый или свекловичный сахар, изомеризованный кукурузный сироп и сахарный сироп тип-50 являются удовлетворительными заменителями мёда в естественном рационе медоносных пчел. Последние два могут подаваться только в виде жидкости для пчел. Жидкий корм может подаваться пчелам внутрь улья, например, любым из следующих способов: ведром с отверстием, гребенками в пределах гнездового корпуса улья, высоким контейнером с несколькими отверстиями, кормушкой Бродмана и др. Сухой сахар может быть подан путем размещения фунта или двух на перевернутой внутренней крышке. Запас воды должен быть доступен для пчел во все времена. В одном из аспектов настоящего изобретения в мисках или лотках предусмотрены плавучие опоры, такие как древесные стружки, пробки или пластиковые губки. Подробное описание дополнительного корма для пчел можно найти, например, в публикации USDA Standifer, et al. 1977, озаглавленную “Supplemental Feeding of Honey Bee Colonies” (USDA, Agriculture Information Bulletin No 413

В соответствии с аспектами настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота, например, дцРНК, абсорбируется. Как используется в данном документе термин "абсорбируемый" относится к механизмам, которые обеспечивают поглощение нуклеиновой кислоты не с помощью заглатывания. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота может впитываться через кожу организма, или экзоскелет членистоногого. В аспекте настоящего изобретения абсорбируемая нуклеиновая кислота растворена во вспомогательном веществе. В других аспектах настоящего изобретения абсорбируемая нуклеиновая кислота суспензирована во вспомогательном веществе. Вспомогательные вещества для раствора или суспензии могут быть водными или неводными. В некоторых аспектах настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота абсорбируется организмом-хозяином и переносится в паразитический организм посредством кормления. В других аспектах настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота абсорбируется организмом-хозяином и переносится в паразитический организм путем абсорбции. В аспекте настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота абсорбируется непосредственно паразитом.

В соответствии с аспектами настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота, например, дцРНК, комбинируется со вспомогательным веществом. В аспекте настоящего изобретения нуклеиновая кислота может быть представлена в виде соотношения нуклеиновой кислоты к вспомогательному веществу. В аспекте настоящего изобретения это соотношение может равняться одной части нуклеиновой кислоты к 4 частям вспомогательного вещества. В аспекте настоящего изобретения соотношение нуклеиновой кислоты к вспомогательному веществу может быть 1:1, 1:2, 1:5 или 1:10. В других аспектах настоящего изобретения соотношение нуклеиновой кислоты к вспомогательному веществу может быть 1:20, 1: 25, 1:30, 1:40 или более. В аспекте настоящего изобретения соотношение нуклеиновой кислоты к вспомогательному веществу может быть 1:50. В соответствии с аспектами настоящего изобретения соотношение может быть определено как отношение объем к объему (объем/объем), масса:масса (масса/масса). В некоторых аспектах настоящего изобретения отношение может быть выражено как вес:объем (масса/объем). В некоторых аспектах настоящего изобретения нуклеиновая кислота и вспомогательное вещество могут быть дцРНК и вспомогательным веществом.

В соответствии с аспектами настоящего изобретения композиция может содержать массу антипаразитарной, дезинсекционной или инсектицидной нуклеиновой кислоты в сочетании со вспомогательным веществом. В аспекте настоящего изобретения нуклеиновая кислота может содержать процент от общей массы композиции. В аспекте настоящего изобретения нуклеиновая кислота может содержать около 0,1 % от массы композиции. В аспекте настоящего изобретения нуклеиновая кислота может содержать около 0,2 % от массы композиции. В аспекте настоящего изобретения нуклеиновая кислота может содержать около 0,3 % от массы композиции. В другом аспекте настоящего изобретения нуклеиновая кислота может содержать около 0,4 % от массы композиции. В аспекте настоящего изобретения нуклеиновая кислота может содержать до 0,5 % от массы композиции. В аспекте настоящего изобретения нуклеиновая кислота может содержать до 0,6 % от массы композиции. В аспекте настоящего изобретения нуклеиновая кислота может содержать до 0,7 % от массы композиции. В аспекте настоящего изобретения нуклеиновая кислота может содержать до 0,8 % от массы композиции. В другом аспекте настоящего изобретения нуклеиновая кислота может содержать до 1,0 % от массы композиции. В других аспектах настоящего изобретения нуклеиновая кислота может содержать до 1,5 % от массы композиции. В еще одном аспекте настоящего изобретения нуклеиновая кислота может содержать до 2,0 % от массы или 2,5 % от массы композиции. В некоторых аспектах настоящего изобретения нуклеиновая кислота и вспомогательное вещество могут быть дцРНК и вспомогательным веществом.

Настоящее изобретение предлагает и включает композиции, содержащие от 0,1 % до 5 % по массе одной или более антипаразитарных, дезинсекционных или инсектицидных нуклеиновых кислот. В другом аспекте настоящего изобретения композиция может содержать от 0,1 до 4 %, от 0,1 до 3 %, от 0,1 до 2 %, от 0,1 до 1 %, от 0,1 до 2 %, от 0,1 до 3 %, или от 0,1 до 4 % по массе нуклеиновой кислоты. В аспекте настоящего изобретения композиция может содержать от 0,2 % до 5 % по массе нуклеиновой кислоты. В других аспектах настоящего изобретения композиция может содержать от 0,2 до 4 %, от 0,2 до 3 %, от 0,2 до 2 %, от 0,2 до 1 %, от 0,2 до 2 %, от 0,2 до 3 % или от 0,2 до 4 % по массе нуклеиновой кислоты. В других аспектах настоящего изобретения композиция может содержать до 1 %, до 2 %, до 3 %, до 4 %,или до 5 % нуклеиновой кислоты. В других аспектах настоящего изобретения композиция может содержать до 7,5 %, до 10 % или до 15 % нуклеиновой кислоты. В некоторых аспектах настоящего изобретения нуклеиновая кислота и вспомогательное вещество могут быть дцРНК и вспомогательным веществом.

Настоящее изобретение предлагает и включает, композиции, содержащие от 0,1 до 10 мг/мл одной или более антипаразитарных, дезинсекционных или инсектицидных нуклеиновых кислот. В другом аспекте настоящего изобретения композиция может содержать от 0,1 до 1,0 мг/мл, от 0,1 до 2,0 мг/мл, от 0,1 до 2,5 мг/мл, от 0,1 до 5 мг/мл, от 0,1 до 10 мг/мл, от 0,1 до 15 мг/мл или от 0,1 до 20 мг/мл нуклеиновой кислоты. В некоторых аспектах настоящего изобретения композиция может содержать по меньшей мере 0,1 мкг/мл нуклеиновой кислоты. В некоторых других аспектах настоящего изобретения композиция может содержать по меньшей мере 1,0 мкг/мл нуклеиновой кислоты. В еще других аспектах настоящего изобретения композиция может содержать по меньшей мере 10 мкг/мл нуклеиновой кислоты. В аспекте настоящего изобретения композиция может содержать от 0,5 до 10 мкг/мл нуклеиновой кислоты. В другом аспекте настоящего изобретения композиция может содержать от 0,5 до 1,0 мг/мл, от 0,5 до 2,0 мг/мл, от 0,5 до 2,5 мг/л, от 0,5 до 5 мг/мл, от 0,5 до 10 мг/мл, от 0,5 до 15 мг/мл, или от 0,5 до 20 мг/мл нуклеиновой кислоты. В аспекте настоящего изобретения композиция может содержать от 1,0 до 10 мг/мл нуклеиновой кислоты. В другом аспекте настоящего изобретения композиция может содержать от 1,0 до 2,0 мг/мл, от 1,0 до 2,5 мг/мл, от 1,0 до 5 мг/мл, от 1,0 до 10 мг/мл, от 1,0 до 15 мг/мл или от 1,0 до 20 мг/мл нуклеиновой кислоты. В некоторых аспектах настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота в композиции содержит дцРНК.

Настоящее изобретение предлагает и включает способы и композиции селективные инсектицидные композиции и способы применения селективных инсектицидных композиций.

Как используется в данном документе термин "селективная инсектицидная композиция" представляет собой композицию, которая более эффективна для одного или нескольких видов членистоногих и менее эффективна для одного или более различных видов членистоногих. Селективная инсектицидная композиция включает композиции, которые убивают взрослых или незрелых членистоногих и включает композиции ларвицидов и овицидов. Селективный инсектицид может представлять собой системный инсектицид, включенный в обработанную пищу, в том числе кровь или гемолимфу, полученную от организма-хозяина. Селективный инсектицид может быть контактным инсектицидом, который токсичен для некоторых насекомых при непосредственном контакте, и не токсичен или минимально токсичен для некоторых других насекомых. В некоторых вариантах реализации изобретения селективная инсектицидная композиция является дезинсекционной. В некоторых вариантах реализации изобретения селективная инсектицидная композиция является антипаразитарной. В некоторых вариантах реализации изобретения селективная инсектицидная композиция является акарицидной. В некоторых вариантах реализации изобретения селективная инсектицидная композиция является токсичной для целевых паразитов или насекомых-вредителей и нетоксичной или минимально токсичной для нецелевых организмов. Примеры нецелевых организмов включают, но не ограничиваясь этим, полезных насекомых, нематод, птиц, млекопитающих и растения. В некоторых вариантах реализации изобретения селективная инсектицидная композиция является токсичной для паразитического насекомого, например клеща Варроа, и нетоксичной или минимально токсичной для организма-хозяина, например, пчел. В некоторых вариантах реализации изобретения селективная инсектицидная композиция является токсичной для одного или нескольких вредителей или насекомых-паразитов, выбранных из группы, состоящей из: Varroa destructor, Ixodes scapularis, Solenopsis invicta, Tetranychus urticae, Aedes aegypti, Culex quinquefasciatus, Acyrthosiphon pisum и Pediculus humanus.

В некоторых аспектах в соответствии с настоящим изобретением селективный инсектицид может быть включен в бактерии или дрожжи путем генетической модификации (например, трансгенные бактерии или дрожжи, сконструированные для экспрессии нуклеиновой кислоты по настоящему изобретению). Селективный инсектицид, введенный путем генетической модификации бактерий или дрожжей, может воздействовать непосредственно на организм вредителя, или косвенно путем заглатывания хозяином организма-вредителя.

В соответствии с еще одним аспектом настоящего изобретения селективный инсектицид может быть более эффективным инсектицидом против одного или нескольких первых насекомых, чем в отношении одного или более вторых насекомых. В аспекте настоящего изобретения селективный инсектицид может быть токсичным для первого насекомого и не оказывать никакого влияния на второе насекомое. В аспекте настоящего изобретения селективный инсектицид может быть токсичен по отношению к первому насекомому и требуют значительно более высоких концентраций или количеств, чтобы оказывать влияние на второе насекомое. В аспекте настоящего изобретения селективный инсектицид может быть в 2 раза или более токсичен по отношению к первому насекомому по сравнению со вторым насекомым. В аспекте настоящего изобретения селективный инсектицид может быть в 4 раза или более токсичен по отношению к первому насекомому по сравнению со вторым насекомым. В аспекте настоящего изобретения селективный инсектицид может быть в 5 раз или более токсичен по отношению к первому насекомому по сравнению со вторым насекомым. В аспекте настоящего изобретения селективный инсектицид может быть в 10 раз или более токсичен по отношению к первому насекомому по сравнению со вторым насекомым.

В аспекте настоящего изобретения селективный инсектицид может подавлять рост, развитие или плодовитость первого насекомого и не оказывать никакого влияния на второе насекомое. В аспекте настоящего изобретения селективный инсектицид может подавлять рост, развитие или плодовитость первого насекомого и требуют значительно более высоких концентраций или количества, чтобы иметь такой же эффект на второе насекомое. В аспекте настоящего изобретения селективный инсектицид может требовать в 2 раза или более активного ингредиента для ингибирования роста, развития или плодовитости второго насекомого. В аспекте настоящего изобретения селективный инсектицид может требовать в 4 раза или более активного ингредиента для ингибирования роста, развития или плодовитости второго насекомого. В аспекте настоящего изобретения селективный инсектицид может требовать в 5 раз или более активного ингредиента для ингибирования роста, развития или плодовитости второго насекомого. В аспекте настоящего изобретения селективный инсектицид может требовать в 10 раз или более активного ингредиента для ингибирования роста, развития или плодовитости второго насекомого.

Настоящее изобретение дополнительно включает и предлагает способы лечения или профилактику синдрома разрушения пчелиных колоний, включающие обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной к области последовательности гена кальмодулина Varroa destructor к медоносной пчеле, в результате чего уровень зараженности Varroa destructor снижается. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 19 смежным нуклеотидам SEQ ID NO: 1. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 19 смежным нуклеотидам SEQ ID NO: 2. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 19 смежным нуклеотидам SEQ ID NO: 69. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 19 смежным нуклеотидам SEQ ID NO: 70. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту в соответствии с SEQ ID NO: 3. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту в соответствии с SEQ ID NO: 4. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту в соответствии с SEQ ID NO: 88. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту в соответствии с SEQ ID NO: 89. В одном аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей две или более нуклеиновых кислот, имеющих последовательность, выбранную из группы, состоящей из SEQ ID NO: 3, 4, 88 и 89. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 19 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 23 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 30 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 40 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 50 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 60 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 70 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 80 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 90 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 100 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 110 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 120 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 130 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной по меньшей мере 140 смежным нуклеотидам последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, которая является по существу идентичной или по существу комплементарной последовательности, выбранной из SEQ ID NO: 71-87. В аспекте настоящего изобретения способ включает обеспечение эффективного количества композиции, содержащей нуклеиновую кислоту, в соответствии с последовательностью, выбранной из SEQ ID NO: 71-87.

Настоящее изобретение предлагает и включает способы снижения паразитарной нагрузки организма-хозяина. В аспекте настоящего изобретения паразитарная нагрузка относится к числу паразитов на особь хозяина. В аспекте настоящего изобретения паразитарная нагрузка относится к среднему числу паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения паразитарная нагрузка может относиться к числу паразитов на колонию хозяев паразитов. В соответствии с аспектами настоящего изобретения паразит представляет собой Varroa destructor и хозяин представляет собой медоносную пчелу Apis mellifera. В некоторых аспектах настоящего изобретения паразитарная нагрузка относится к числу паразитов Varroa destructor на 100 пчел в колонии. В некоторых вариантах реализации настоящее изобретение предлагает и включает способы и композиции для снижения паразитарной нагрузки до уровня менее 6 паразитов Varroa destructor на 100 пчел в колонии. В некоторых вариантах реализации настоящее изобретение предлагает и включает способы и композиции для снижения паразитарной нагрузки до уровня менее 5 паразитов Varroa destructor на 100 пчел в колонии. В некоторых вариантах реализации настоящее изобретение предлагает и включает способы и композиции для снижения паразитарной нагрузки до уровня менее 4 паразитов Varroa destructor на 100 пчел в колонии. В некоторых вариантах реализации настоящее изобретение предлагает и включает способы и композиции для снижения паразитарной нагрузки до уровня менее 2 паразитов Varroa destructor на 100 пчел в колонии.

В аспекте настоящего изобретения способы снижения нагрузки паразита включают обеспечение эффективного количества антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты для организма-хозяина. Эффективное количество композиции по настоящему изобретению приводит к снижению нагрузки паразита в течение определенного периода времени. В аспекте настоящего изобретения снижение паразитарной нагрузки может измеряться в течение дня внесения эффективного количества композиции нуклеиновой кислоты. В аспекте настоящего изобретения паразитарная нагрузка может быть измерена после 2-х дней. В аспекте настоящего изобретения паразитарная нагрузка может быть измерена после 3-х дней. В других аспектах настоящего изобретения паразитарная нагрузка может быть измерена после 5 дней или после одной недели В еще одном аспекте настоящего изобретения паразитарная нагрузка может быть измерена более чем один раз, например, каждые 3 дня, каждые 5 дней, каждую неделю или один раз в месяц. В соответствии с некоторыми аспектами настоящего изобретения снижение числа паразитов может быть измерено и сравнено с необработанным контрольным организмом или колонией. В соответствии с аспектами настоящего изобретения паразит представляет собой Varroa destructor и хозяин представляет собой медоносную пчелу Apis mellifera.

В соответствии с аспектами настоящего изобретения снижение паразитарной нагрузки после определенного периода времени означает снижение числа паразитов. В аспекте настоящего изобретения количество паразитов может снизиться на 10 %, 20 %, 30 % или более между измерениями. В другом аспекте настоящего изобретения количество паразитов может снизиться на 40 % или более между измерениями. В другом аспекте настоящего изобретения количество паразитов может снизиться на 50 % или более между измерениями. В другом аспекте настоящего изобретения численность паразитов может снизиться на 60 % или более между измерениями. В другом аспекте настоящего изобретения численность паразитов может снизиться на 70 % или более между измерениями. В другом аспекте настоящего изобретения численность паразитов может снизиться на 80 % или более между измерениями. В другом аспекте настоящего изобретения численность паразитов может снизиться на 90 % или более между измерениями.

В других аспектах настоящего изобретения паразитарная нагрузка может быть измерена как среднее число паразитов в организме-хозяине. В аспекте настоящего изобретения сниженная паразитарная нагрузка может составлять менее 20 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может составлять менее 15 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может насчитывать менее 10 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может насчитывать менее 5 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может составлять менее 4 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может насчитывать менее 3 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может насчитывать менее 2 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может составлять менее 1 паразита на 100 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может составлять менее 20 паразитов на 1000 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может составлять менее 15 паразитов на 1000 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может насчитывать менее 10 паразитов на 1000 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может составлять менее 5 паразитов на 1000 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может составлять менее 4 паразитов на 1000 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может насчитывать менее 3 паразитов на 1000 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может составлять менее 2 паразитов на 1000 организмов-хозяев. В аспекте настоящего изобретения сниженная паразитарная нагрузка может составлять менее 1 паразита на 1000 организмов-хозяев.

В соответствии с аспектами настоящего изобретения колония организмов-хозяев имеет начальную паразитарную нагрузку до того как обеспечивается источником эффективного количества нуклеиновой кислоты. В аспекте настоящего изобретения начальная паразитарная нагрузка может составлять менее 20 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения начальная паразитарная нагрузка может составлять менее 15 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения начальная паразитарная нагрузка может насчитывать менее 10 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения начальная паразитарная нагрузка может составлять менее 5 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения начальная паразитарная нагрузка может составлять менее 4 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения начальная паразитарная нагрузка может насчитывать менее 3 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения начальная паразитарная нагрузка может составлять менее 2 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения начальная паразитарная нагрузка может составлять менее 1 паразитов на 100 организмов-хозяев.

В соответствии с аспектами настоящего изобретения эффективное количество может вноситься периодически или непрерывно. В аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты может быть внесено один раз, два раза или три раза в день. В других аспектах настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты вносится один раз в день. В другом аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты вносится один или несколько раз через день. В аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты может быть внесено каждые два дня, каждые три дня или один раз в неделю. В аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты может вноситься каждые две недели. В аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты может быть внесено каждые три недели. В аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты может быть внесено один раз в месяц. В аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты может вноситься каждые два месяца. В аспекте настоящего изобретения эффективное количество композиции нуклеиновой кислоты может вноситься непрерывно в нуждающийся организм, например, обеспечивая постоянный источник пищи. В аспекте настоящего изобретения эффективное количество композиции нуклеиновой кислоты может постоянно вноситься в качестве поглощаемой пчелой композиции. В соответствии с аспектами настоящего изобретения паразит представляет собой Varroa destructor и хозяин представляет собой медоносную пчелу Apis mellifera. В соответствии с аспектами настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота может быть дцРНК.

В соответствии с аспектами настоящего изобретения паразитарная нагрузка может снизиться в течение определенного периода времени. В аспекте настоящего изобретения период времени необходимый для снижения паразитарной нагрузки может составлять 15 недель. В другом аспекте настоящего изобретения период времени снижения паразитарной нагрузки может составлять 12 недель. В аспекте настоящего изобретения снижение паразитарной нагрузки происходит в течение 10 недель. В аспекте настоящего изобретения период времени необходимый для снижения паразитарной нагрузки может составлять 5 недель. В другом аспекте настоящего изобретения период времени снижения паразитарной нагрузки может составлять 2 недели. В аспекте настоящего изобретения снижение паразитарной нагрузки происходит в течение 1 недель. В некоторых аспектах настоящего изобретения паразитарная нагрузка может снизиться после одного дня, двух дней или трех дней.

Настоящее изобретение предлагает способы снижения паразитизма в колонии медоносной пчелы, включающие обеспечение колонии пчел эффективным количеством антипаразитической, дезинсекционной или инсектицидной композиции нуклеиновой кислоты. Эффективное количество композиции по настоящему изобретению приводит к снижению паразитизма в течение определенного периода времени. В одном аспекте настоящего изобретения снижение паразитизма может измеряться не позднее одного дня после внесения эффективного количества антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновых кислот. В аспекте настоящего изобретения снижение паразитизма может быть измерено после 2-х дней. В аспекте настоящего изобретения снижение паразитизма может быть измерено после 3-х дней. В других аспектах настоящего изобретения снижение паразитизма может быть измерено после 5 дней или после одной недели В еще одном аспекте настоящего изобретения снижение паразитизма может быть измерено более чем один раз, например, каждые 3 дня, каждые 5 дней, каждую неделю или один раз в месяц. В соответствии с некоторыми аспектами настоящего изобретения снижение паразитизма может быть измерено и сравнено с необработанным контрольным организмом или колонией.

В соответствии с аспектами настоящего изобретения снижение паразитизма после определенного периода времени означает снижение общей численности паразитов. В аспекте настоящего изобретения количество паразитов может снизиться на 10 %, 20 %, 30 % или более между измерениями. В другом аспекте настоящего изобретения количество паразитов может снизиться на 40 % или более между измерениями. В другом аспекте настоящего изобретения количество паразитов может снизиться на 50 % или более между измерениями. В другом аспекте настоящего изобретения численность паразитов может снизиться на 60 % или более между измерениями. В другом аспекте настоящего изобретения численность паразитов может снизиться на 70 % или более между измерениями. В другом аспекте настоящего изобретения численность паразитов может снизиться на 80 % или более между измерениями. В другом аспекте настоящего изобретения численность паразитов может снизиться на 90 % или более между измерениями.

В других аспектах настоящего изобретения снижение паразитизма может быть измерено как среднее число паразитов на организм хозяина. В аспекте настоящего изобретения снижение паразитизма может составлять менее 20 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения снижение паразитизма может составлять менее 15 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения снижение паразитизма может составлять менее 10 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения снижение паразитизма может составлять менее 5 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения снижение паразитизма может составлять менее 4 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения снижение паразитизма может составлять менее 3 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения снижение паразитизма может составлять менее 2 паразитов на 100 организмов-хозяев. В аспекте настоящего изобретения снижение паразитизма может составлять менее 1 паразита на 100 организмов-хозяев.

В соответствии с аспектами настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота, которая приводит к снижению паразитизма, вносится периодически или постоянно. В аспекте настоящего изобретения эффективное количество композиции нуклеиновой кислоты может быть внесено один раз, два раза или три раза в день. В других аспектах настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты вносится один раз в день. В другом аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты вносится один или несколько раз через день. В аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты вносится каждые два дня, каждые три дня или один раз в неделю. В аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты вносится непрерывно в нуждающийся организм, например, обеспечивая постоянный источник пищи. В одном аспекте настоящего изобретения эффективное количество антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновой кислоты постоянно вносится в качестве поглощаемой пчелой композиции. В соответствии с аспектами настоящего изобретения паразит представляет собой Varroa destructor и хозяин представляет собой медоносную пчелу Apis mellifera. В соответствии с аспектами настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота может быть дцРНК.

В соответствии с аспектами настоящего изобретения паразитарная нагрузка может снизиться в течение определенного периода времени. В аспекте настоящего изобретения период времени необходимый для снижения паразитизма может составлять 15 недель. В другом аспекте настоящего изобретения период времени снижения паразитизма может составлять 12 недель. В аспекте настоящего изобретения снижение паразитизма происходит в течение 10 недель. В аспекте настоящего изобретения период времени необходимый для снижения паразитизма может составлять 5 недель. В другом аспекте настоящего изобретения период времени снижения паразитизма может составлять 2 недели. В аспекте настоящего изобретения снижение паразитизма происходит в течение 1 недели. В некоторых аспектах настоящего изобретения паразитизм может снизиться через один день, два дня или три дня.

В соответствии с некоторыми аспектами настоящего изобретения снижение паразитизма измеряется по количеству выживших паразитов по сравнению с начальным замером количества паразитов в колонии организмов-хозяев. В аспекте настоящего изобретения паразит может быть клещом Varroa destructor и хозяин может быть медоносной пчелой Apis mellifera. В аспекте настоящего изобретения количество выживших паразитов может составлять 25 % от исходного количества паразитов. В аспекте настоящего изобретения количество выживших паразитов может составлять 15 % от исходного количества паразитов. В аспекте настоящего изобретения количество выживших паразитов может составлять 10 % от исходного количества паразитов. В аспекте настоящего изобретения количество выживших паразитов может составлять 5 % от исходного количества паразитов. В аспекте настоящего изобретения количество выживших паразитов может быть меньше, чем 5 % или могут быть не выявлены после обеспечения колонии хозяина эффективным количеством антипаразитарной, дезинсекционной или инсектицидной композиции нуклеиновых кислот.

В одном аспекте настоящее изобретение предлагает способы и композиции для снижения восприимчивости пчел к инвазии клеща Варроа. В другом аспекте настоящее изобретение предлагает способы и композиции для предотвращения заражения колонии пчел. В других аспектах настоящее изобретение предлагает способы и композиции для снижения заражения медоносных пчел клещом Varroa destructor.

В соответствии с аспектами настоящего изобретения организм-хозяин, обеспеченный источником антипаразитарной, дезинсекционной или инсектицидной нуклеиновой кислоты, может накапливать нуклеиновую кислоту в теле хозяина, обычно в гемолимфе. Накапливающие нуклеиновую кислоту, такие организмы-хозяева становятся устойчивыми, или менее чувствительны к паразитам. В других аспектах настоящего изобретения колония организмов-хозяев, обеспеченная источником нуклеиновой кислоты, может накапливать нуклеиновую кислоту в телах хозяина многих членов колонии, тем самым обеспечивая устойчивость или снижение чувствительности к паразиту. Нуклеиновая кислота, содержащаяся в организме-хозяине, обеспечиваемая источником нуклеиновой кислоты, может быть обнаружена с помощью способов известных специалистам в данной области техники. В соответствии с аспектами настоящего изобретения антипаразитарная, дезинсекционная или инсектицидная нуклеиновая кислота может быть дцРНК.

В аспекте настоящее изобретение предлагает способы и композиции для лечения инвазий клеща Варроа у пчел путем регуляции в сторону уменьшения кальмодулина и кальмодулин-связанных генных продуктов клеща Варроа. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 1. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 2. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, соответствующую последовательность кальмодулина Varroa destructor SEQ ID NO: 69. В аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 70. В некоторых аспектах настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, соответствующую последовательность кальмодулина Varroa destructor SEQ ID NO: 71-87. В другом аспекте настоящего изобретения композиция содержит антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 3, 4, 88 и 89. В аспекте настоящего изобретения композиции содержат малую РНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 1. В аспекте настоящего изобретения композиции содержат малую РНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 2. В аспекте настоящего изобретения композиции содержат малую РНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 69. В аспекте настоящего изобретения композиции содержат малую РНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 70. В некоторых аспектах настоящего изобретения композиции содержат малую РНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 71-87. В другом аспекте настоящего изобретения композиции содержат малую РНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 3, 4, 88 и 89. В аспекте настоящего изобретения композиции содержат дцРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 1. В аспекте настоящего изобретения композиции содержат дцРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 2. В аспекте настоящего изобретения композиции содержат дцРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 69. В аспекте настоящего изобретения композиции содержат дцРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 70. В некоторых аспектах настоящего изобретения композиции содержат дцРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 71-87. В другом аспекте настоящего изобретения композиции содержат дцРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 3, 4, 88 и 89. В аспекте настоящего изобретения композиции содержат миРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 1. В аспекте настоящего изобретения композиции содержат миРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 2. В аспекте настоящего изобретения композиции содержат миРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 69. В аспекте настоящего изобретения композиции содержат миРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 70. В некоторых аспектах настоящего изобретения композиции содержат миРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 71-87. В другом аспекте настоящего изобретения композиции содержат миРНК, соответствующую последовательности кальмодулина Varroa destructor SEQ ID NO: 3, 4, 88 и 89. В соответствии с аспектами настоящего изобретения композиция может содержать антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, соответствующую области SEQ ID NO: 1 или 2. В соответствии с другими аспектами настоящего изобретения композиция может содержать антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, соответствующую области SEQ ID NO: 69 или 70. В соответствии с еще другими аспектами настоящего изобретения композиция может содержать антипаразитарную, дезинсекционную или инсектицидную нуклеиновую кислоту, соответствующую области последовательности, выбранной из SEQ ID NO: 3, 4, 88 и 89.

Клещи Варроа паразитируют на куколках и взрослых пчелах и размножаются в куколках печатного расплода. Клещи используют свои рты, чтобы проколоть экзоскелет и питаются гемолимфой пчелы. Авторы настоящего изобретения неожиданно обнаружили, что полинуклеотидные агенты вводимые пчелам для лечения заражений клещами Варроа, представленные в гемолимфе пчелы, таким образом, становятся доступными для клеща.

Авторы настоящего изобретения показали, что фрагменты дцРНК направленные на воздействие на ген кальмодулина могут быть успешно перенесены клещам Варроа (смотри, например, Фигуру 2), что дцРНК может служить для подавления экспрессии генов кальмодулина клеща Варроа (смотри, например, Фигуру 3А) и, кроме того, направленное воздействие на ген кальмодулина для подавления экспрессии может привести к сокращению числа клещей Варроа (см, например, Фигура 3Б).

Таким образом, согласно одному аспекту настоящего изобретения предложен способ профилактики или лечения инвазии клеща Varroa destructor у пчелы, причем указанный способ включает введение пчеле эффективного количества агента нуклеиновой кислоты, содержащего последовательность нуклеиновой кислоты, которая подавляет экспрессию гена кальмодулина клеща Varroa destructor, тем самым предупреждая или излечивая инвазии клещом Varroa destructor у пчелы.

В соответствии с аспектами настоящего изобретения агенты настоящего изобретения используются для профилактики клеща Varroa destructor, живущего как паразит на пчеле или ее личинках. Термин "клещ Varroa destructor" относится к поверхностному паразитическому клещу, который нападает на медоносных пчел Apis cerana и Apis mellifera. Клещ может быть на имагинальной стадии, питаясь пчелами, или на личиночной стадии, внутри ячеек сот медоносной пчелы.

Как уже упоминалось, агенты настоящего изобретения способны селективно подавлять экспрессию продукта гена клеща Varroa destructor. Как использовано в настоящем описании, термин "генный продукт" относится к молекуле РНК или белку. В соответствии с одним аспектом настоящего изобретения генный продукт клеща Varroa destructor имеет важное значение для жизнеспособности клеща. Снижение экспрессии такого генного продукта обычно приводит гибели клеща Varroa. В соответствии с другим аспектом настоящего изобретения клещ Varroa destructor имеет важное значение для размножения клеща. Снижение экспрессии такого генного продукта обычно приводит к предотвращению размножения клеща Варроа и возможному уничтожению популяции клеща. В соответствии с еще одним аспектом настоящего изобретения генный продукт клеща Varroa destructor необходим для развития болезнетворных симптомов у пчелы. В некоторых аспектах настоящего изобретения генный продукт Varroa destructor представляет собой ген кальмодулина. В некоторых аспектах настоящего изобретения ген кальмодулина может содержать последовательность нуклеиновой кислоты в соответствии с SEQ ID NO: 1 или SEQ ID NO: 2. В некоторых аспектах настоящего изобретения ген кальмодулина может содержать последовательность нуклеиновой кислоты в соответствии с SEQ ID NO: 69 или SEQ ID NO: 70.

Примеры продуктов генов, экспрессия которых могут быть подавлена в соответствии с этим аспектом настоящего изобретения включают, но не ограничиваясь этим, ген кальмодулина.

В соответствии с аспектом настоящего изобретения агенты способные подавлять экспрессию генного продукта клеща Varroa destructor или другого паразита, могут в меньшей степени подавлять экспрессию генного продукта у других животных, таких как пчелы или другие нецелевые организмы. Соответственно, некоторые агенты по настоящему изобретению способны различать ген клеща и ген пчелы, подавляя в большей степени первый, чем последний. В некоторых аспектах некоторые агенты по настоящему изобретению способны различить ген-мишень в организме-мишени и ортологи у нецелевых организмов, подавляя в большей степени первый, чем последний. В других аспектах настоящего изобретения ген-мишень паразита подавляется, в то время как гомологичный ген хозяина нет. В еще одном аспекте настоящего изобретения ген-мишень паразита не имеет гомолога у хозяина. В соответствии с другим аспектом агенты по настоящему изобретению вообще не подавляют ген пчелы. Например, это может быть осуществлено путем ориентации гена, который экспрессируется по-разному у клеща и пчелы, например, ген натриевого канала клеща FJ216963. В альтернативном варианте агенты настоящего изобретения могут быть направлены на конкретные последовательности гена клеща, который экспрессируется как в клеще, так и у пчелы.

В соответствии с аспектом настоящего изобретения агенты целевых сегментов генов Варроа с длиной по меньшей мере 100 оснований и не несущих никакой последовательности более, чем 19 оснований, которые полностью гомологичны любой последовательности генома пчелы или последовательности человеческого генома. В это же время следует понимать, что более чем один ген может быть направлен на цель для максимального цитотоксического эффекта у клещей Варроа, композиции, которые содержат одну или несколько малых РНК, увеличивают вероятность того, что селективная инсектицидная композиция в виде перекрестной специфичности с другими насекомыми может быть снижена.

Согласно одному аспекту, дцРНК композиция может быть приготовлена аналогичной гену кальмодулина-1 и кальмодулина-2 Varroa destructor (например, с использованием агентов нуклеиновых кислот, имеющих последовательность, представленную в SEQ ID NO: от 1 до 4 и от 69 до 89, их комплементов или нуклеиновых кислот, направленных на их области).

Следует принять во внимание, что в качестве подавления экспрессии ряда генов настоящее изобретение также предлагает и включает использование ряда агентов для подавления экспрессии того же гена (например, количество нуклеиновых кислот или дцРНК каждая из которых гибридизует другой сегмент того же гена). Например, в аспекте настоящего изобретения комбинация одной или нескольких нуклеиновых кислот, соответствующих последовательности, выбранной из группы, состоящей из SEQ ID NO: от 1 до 4, 6, 23,от 26 до 35 и от 69 до 89 могут быть использованы для увеличения цитотоксического и антипаразитарного эффектов композиции. Инструменты, которые могут идентифицировать видоспецифические последовательности, используют для этой цели, например BLASTN и другие подобные компьютерные программы. Патент Публикация патента США № 20090118214 и 20120108497 предлагает использование дцРНК для профилактики и лечения вирусных инфекций медоносных пчел. Патент Публикация патента США № 20120258646 предлагает использование дцРНК для контроля Varroa destructor у медоносной пчелы. Каждая публикация включена в данный документ в полном объеме.

Настоящее изобретение предлагает и включает композиции и способы подавления экспрессии гена в организме-мишени. В аспекте настоящего изобретения организм-мишень может быть паразитом. В некоторых аспектах настоящего изобретения паразит может быть Varroa destructor. Как используется в данном документе термин "подавление экспрессии" относится к причине, прямо или косвенно, снижая транскрипцию целевого гена, снижая количество, стабильность или переносимость продуктов транскрипции (например, РНК) гена, и/или снижение трансляции полипептида(ов), кодируемого целевым геном. Подавление экспрессии генных продуктов клеща Varroa destructor можно контролировать, например, путем прямого обнаружения генных транскриптов (например, с помощью ПЦР), путем обнаружения полипептида (ов), кодируемого геном, или РНК патогена пчелы (например, с помощью вестерн-блоттинга или иммунопреципитации), путем выявления биологической активности полипептидов, кодируемой геном (например, каталитической активности, связывания лиганда и тому подобным), или путем мониторинга изменений у клеща Varroa destructor (например, снижение распространения клеща, снижение вирулентности клеща, снижение подвижности клеща и т.д.) и тестированием инфекционности/патогенности у пчел.

Подавление генного продукта вредителя или паразита может быть осуществлено на уровне транскрипта или генома с использованием различных агентов, которые препятствуют транскрипции и/или трансляции (например, агенты РНК-сайленсинга, рибозим, ДНКзим и антисмысловые молекулы нуклеиновых кислот). Подавление генного продукта вредителя или паразита может быть осуществлено на уровне транскрипта или генома с использованием различных агентов, которые препятствуют транскрипции и/или трансляции (например, агенты РНК-сайленсинга, рибозимы, ДНКзимы и антисмысловые молекулы нуклеиновых кислот).

В соответствии с одним аспектом настоящего изобретения агент, который понижает экспрессию генного продукта вредителя или паразита представляет собой малую РНК, такую как агент РНК-сайленсинга. В соответствии с этим аспектом настоящего изобретения малая РНК более 15 пар оснований в длину. В другом аспекте настоящего изобретения малая РНК более 50 пар оснований в длину. В аспекте настоящего изобретения малая РНК больше 50 пар оснований в длину, но менее чем около 500 пар оснований. В аспекте настоящего изобретения малая РНК более 100 пар оснований в длину, но менее чем около 500 пар оснований. В аспекте изобретения малая РНК более 200 пар оснований в длину, но менее чем около 500 пар оснований. В аспекте настоящего изобретения организм-хозяин представляет собой пчелу, и паразит представляет собой клещ Varroa destructor.

Другой способ подавления экспрессии генного продукта вредителя или паразита представляет собой введение малых интерферирующих РНК (миРНК). Другой способ подавления экспрессии генного продукта Варроа представляет собой введение малых интерферирующих РНК (миРНК).

В одном из аспектов настоящего изобретения синтез агентов РНК-сайленсинга пригодных для использования в настоящем изобретении могут влиять следующим образом. Во-первых, мишень мРНК вредителя или паразита сканируется в прямом направлении от стартового кодона AUG к динуклеотидной последовательности АА. Встречаемость каждого АА и 3'-прилегающих 19 нуклеотидов, записывается в качестве потенциальных мишеней областей миРНК. Предпочтительно, целевые области миРНК выбирают из открытой рамки считывания, так как нетранслируемые области (НТО) богаче областей связывания с регуляторным белком. НТО-связывающие белки и/или комплексы инициации трансляции могут препятствовать связыванию комплекса эндонуклеазы и миРНК (Tuschl ChemBiochem. 2:239-245). Следует понимать, однако, что миРНК, направленные на нетранслируемые области также могут быть эффективными, как показано для GAPDH, при этом миРНК, направленные на опосредованные 5 '-НТО уменьшили клеточную мРНК GAPDH на около 90 % и полностью устранили содержание белка (доступен в интернете по адресу www.ambion.com/techlib/tn/91/912.html).

Во-вторых, потенциальные целевые области сравнивали с соответствующей геномной базой данных (например, человека, пчелы, данаиды монарха, мыши, крысы и т.д.) с помощью любого программного обеспечения выравнивания последовательностей, такого как программное обеспечение BLAST, доступное с сервера NCBI (доступен в интернете по адресу www.ncbi.nlm.nih.gov/BLAST/). Предполагаемые сайты-мишени, которые обладают значительной гомологией с другими кодирующими последовательностями, отфильтрованы.

Соответствующие требованиям целевые последовательности выбраны в качестве матрицы для синтеза миРНК. Предпочтительные последовательности представляют собой последовательности, в том числе с низким содержанием G/C, поскольку они оказались более эффективными в опосредовании генов сайленсинга по сравнению с теми, где содержание G/C выше 55 %. Для оценки несколько целевых областей предпочтительно выбирают по длине гена-мишени или последовательности. Для лучшей оценки выбранных миРНК отрицательный контроль используют предпочтительно в комбинации. Отрицательный контроль миРНК предпочтительно содержит один и тот же нуклеотидный состав, как и миРНК, но не имеет значительной гомологии с геномом. Таким образом, предпочтительно используют скремблированную нуклеотидную последовательность миРНК, при условии, что она не показывает какой-либо значительной гомологии с любым другим геном последовательности-мишени или вредителя, или паразита. Пример скремблированной нуклеотидной последовательности приводится в SEQ ID NO: 5.

Например, для миРНК, которые могут быть использованы в этом аспекте настоящего изобретения, целью является клещ-специфический ген кальмодулина. Примеры миРНК представлены в SEQ ID NO: 3, 4, 88 и 89.

Следует принять во внимание, что агенты РНК-сайленсинга по настоящему изобретению не ограничены молекулами, содержащими только РНК, но дополнительно содержат химически модифицированные нуклеотиды и “ненуклеотиды”.

В некоторых аспектах настоящего изобретения агент РНК-сайленсинга, предлагаемый в данном документе, может быть функционально связан с проникающим пептидом. Как используется в данном документе термин "проникающий пептид" представляет собой пептид, который включает короткую (около 12-ти остатков) аминокислотную последовательность или функциональный мотив, который придает энергонезависимые свойства транслокации (например, не эндоцитоз), связанные с транспортом мембранно-проницаемого комплекса через плазму и/или ядерные мембраны клетки. Проникающий в клетку пептид, используемый в мембранно-проницаемом комплексе по настоящему изобретению, предпочтительно содержит по меньшей мере один нефункциональный остаток цистеина, который является либо свободным или дериватизированным, для формирования связи дисульфида с двухцепочечной рибонуклеиновой кислотой, которая была модифицирована для такой связи. Характерные аминокислотные мотивы, придающие такие свойства, перечислены в патенте США № 6348185, содержание которого включено в данный документ посредством ссылки. Проникающие пептиды по настоящему изобретению предпочтительно включают, но не ограничиваясь этим, пенетратин, транспортан plsl, TAT (48-60), pVEC, МТС и MAP.

Другой агент, способный снижать количество генного продукта вредителя или паразита, представляет собой молекулу ДНКзима способную специфически расщеплять транскрипт мРНК или ДНК-последовательность полипептида патогена пчелы. ДНКзимы представляют собой одноцепочечные полинуклеотиды, которые способны расщеплять как одиночные, так и двухцепочечные последовательности-мишени (Breaker, R.R. и Joyce, G. Chemistry and Biology 1995;2:655; Santoro, S.W. & Joyce, G.F. Proc. Natl, Acad. Sci. USA 1997;943:4262). Была предложена общая модель (модель "10-23") для ДНКзима. ДНКзим "10-23" имеют каталитический домен из 15 дезоксирибонуклеотидов, по бокам два домена, распознающие субстрат, по семь-девять дезоксирибонуклеотидов каждый. Этот тип ДНКзима может эффективно расщеплять субстрат РНК на пуриновые: пиримидиновые переходы (Santoro, S.W. & Joyce, G.F. Proc. Natl, Acad. Sci. USA 199; для обзора ДНКзимов смотри Khachigian, LM, Curr Opin Mol Ther 4:119-21 (2002)). В аспекте настоящего изобретения генный продукт вредителя или паразита может быть генным продуктом клеща Варроа. Снижение количества генных продуктов вредителя или паразита может быть также осуществлено с использованием антисмыслового полинуклеотида способного к специфической гибридизации с транскриптом мРНК, кодирующим генный продукт вредителя или паразита. Структура антисмысловых молекул, которые могут быть использованы для эффективного снижения количества генного продукта вредителя или паразита должен быть осуществлен при рассмотрении двух аспектов важных для антисмыслового подхода. Первый аспект представляет собой доставку олигонуклеотида в цитоплазму соответствующих клеток, в то время как второй аспект представляет собой структуру олигонуклеотида, который специфически связывается с обозначенной мРНК или последовательностью РНК-мишени в клетках таким образом, что препятствует их трансляции. В аспекте настоящего изобретения генный продукт вредителя или паразита может быть генным продуктом клеща Варроа. В другом аспекте настоящего изобретения генный продукт вредителя или паразита может быть продуктом гена кальмодулина.

Существует несколько методов доставки, которые могут быть использованы для эффективной доставки олигонуклеотидов самым разнообразным типам клеток (см, например, Luft, J Mol Med 76: 75-6 (1998); Kronenwett et al. Blood 91: 852-62 (1998); Rajur et al. Bioconjug Chem 8: 935-40 (1997); Lavigne et al. Biochem Biophys Res Commun 237: 566-71 (1997) and Aoki et al. (1997) Biochem Biophys Res Commun 231: 540-5 (1997)).

Кроме того, также доступны алгоритмы для определения тех последовательностей с высокой прогнозируемой аффинностью связывания с их мРНК-мишенями на основании термодинамического цикла, который учитывает энергетику структурных изменений в обеих мРНК-мишенях и олигонуклеотиде (см, например,Walton et al. Biotechnol Bioeng 65: 1-9 (1999)). Такие алгоритмы были успешно использованы для реализации антисмыслового подхода в клетках. Например, алгоритм, разработанный Walton и др. позволили ученым успешно разрабатывать антисмысловые олигонуклеотиды для транскриптов бета-глобина кролика (RBG) и фактора некроза опухолей-альфа мыши (TNF-альфа). Та же исследовательская группа недавно сообщила о том, что антисмысловая активность рационально отобранных олигонуклеотидов против трех модельных мРНК мишеней (человеческая лактатдегидрогеназа А и В и GP1 крысы) в культуре клеток, которую оценивали с помощью метода ПЦР в реальном времени, доказали свою эффективность почти во всех случаях, включая тесты против трех различных целей в двух типах клеток с фосфодиэфирными и тиофосфатными олигонуклеотиднами структурами. Кроме того, также были опубликованы несколько подходов к разработке и прогнозированию эффективности специфических олигонуклеотидов с использованием систем in vitro (Matveeva et al., Nature Biotechnology 16: 1374 - 1375 (1998)).

Другой агент способный снижать количество генного продукта вредителя или паразита представляет собой молекулу рибозима способную специфически расщеплять транскрипт мРНК, кодирующий продукт гена клеща Варроа. Рибозимы все чаще используются для сиквенс-специфичного ингибирования экспрессии гена путем расщепления мРНК, кодирующих представляющие интерес белки (Welch et al., Curr Opin Biotechnol. 9:486-96 (1998)). Возможность конструирования рибозимов, расщепляющих любую специфическую РНК-мишень, в том числе вирусную РНК, предоставляет ценные инструменты, как в области фундаментальных исследований, так и в применении в терапевтических целях. В аспекте настоящего изобретения генный продукт вредителя или паразита может быть генным продуктом клеща Варроа. В другом аспекте настоящего изобретения генный продукт вредителя или паразита может быть продуктом гена кальмодулина.

Дополнительный способ подавления экспрессии продукта гена вредителя или паразита в клетках представляет собой образование триплекса олигонуклеотидов (TFO). Недавние исследования показали, что сконструированные TFO могут распознавать и связываться с полипуриновыми/полипиримидиновыми областями в спиральной двухцепочечной ДНК сиквенс-специфичным способом. Эти правила распознавания изложены Maher III, L. J., et al., Science (1989) 245:725-7; Moser, H. E., et al., Science, (1987) 238:645-6; Beal, P. A., et al., Science (1992) 251:1360-1363; Cooney, M., et al., Science (1988) 241:456-459; and Hogan, M. E., et al., EP Publication 375408. Модификация олигонуклеотидов, такая как введение интеркаляторов и замен в последовательности, и оптимизация условий связывания (рН и концентрация катионов) помогли в преодолении препятствий присущих для активности TFO, такие как сила отталкивания зарядов и нестабильность, и недавно было показано, что синтетические олигонуклеотиды могут быть направлены на конкретные последовательности (последний обзор, см. Seidman and Glazer, J Clin Invest 2003;112:487-94). В аспекте настоящего изобретения генный продукт вредителя или паразита может быть генным продуктом клеща Варроа. В другом аспекте настоящего изобретения генный продукт вредителя или паразита может быть продуктом гена кальмодулина.

В общем, триплекс-образующие олигонуклеотиды имеют соответствующую последовательность:

oligo
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
3’--A
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
G
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
G
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
T
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
duplex
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
5’--A
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
G
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
C
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
T
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
duplex
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
3’--T
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
C
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
G
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A
A
3’--A
G
G
T
duplex
5’--A
G
C
T
duplex
3’--T
C
G
A

Однако, было показано, что триплексы А-АТ и G-GC имеют наибольшую тройную спиральную устойчивость (Reither and Jeltsch, BMC Biochem, 2002, Sept12, Epub). Те же авторы показали, что TFO сконструированные в соответствии с правилом А-АТ и G-GC не образуют неспецифические триплексы, указывая на то, что образованный триплекс действительно является сиквенс-специфичным.

Триплекс-образующие олигонуклеотиды предпочтительно по меньшей мере 15, более предпочтительно 25 или еще более предпочтительно более нуклеотидов в длину, вплоть до 50 или 100 пар оснований.

Трансфекция клеток (например, через катионные липосомы) с TFO и формирование тройной спиральной структуры с ДНК-мишенью индуцирует стерические и функциональные изменения, блокирование инициации транскрипции и относительное удлинение, что позволяет внедрять желаемые изменения последовательности в эндогенной ДНК и приводит к специфическому подавлению экспрессии генов.

Подробное описание конструирования, синтеза и введения эффективных TFO можно найти в Публикации патента США № 2003/017068 и 2003/0096980 Froehler et al., и 2002/0128218 и 2002/0123476 Emanuele et al., и патенте США № 5,721,138 Lawn.

Полинуклеотидные агенты понижающей регуляции настоящего изобретения могут быть получены в соответствии с любым способом синтеза полинуклеотидов, известным в данной области техники, таким как ферментативный синтез или твердофазный синтез. Оборудование и реагенты для выполнения твердофазного синтеза имеются в продаже, например, у Applied Biosystems. Также могут быть использованы любые другие средства для такого синтеза; данный синтез полинуклеотидов в пределах возможностей специалиста в данной области техники и может быть выполнен с помощью установленных методик, как подробно изложено, например, в "Molecular Cloning: A laboratory Manual” Sambrook et al., (1989); “Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., “Current Protocols in Molecular Biology”, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, “A Practical Guide to Molecular Cloning”, John Wiley & Sons, New York (1988) and “Oligonucleotide Synthesis” Gait, M. J., ed. (1984) с использованием твердофазной химической структуры, например, цианоэтиламидофосфитом с последующим снятием защиты, обессоливанием и очисткой с помощью, например, автоматизированный способ без снятия тритила или ВЭЖХ.

Полинуклеотидные агенты настоящего изобретения могут содержат гетероциклические нуклеозиды, состоящие из оснований пурина и пиримидина, связанных 3'- 5' 5 фосфодиэфирной связью. Предпочтительно используется полинуклеотидные агенты с модифицированными и последовательностью, и межнуклеотидными связями или основаниями, как в общих чертах описано ниже.

Конкретные примеры полинуклеотидных агентов, используемые в соответствии с данным аспектом настоящего изобретения включают полинуклеотидные агенты, содержащие модифицированные скелеты или искусственные межнуклеозидные связи. Полинуклеотидные агенты, имеющие модифицированные скелеты, содержат те, которые сохраняют атом фосфора в последовательности, как описано в патентах США №№ 4469863; 4476301; 5023243; 5177196; 5188897; 5264423; 5276019; 5278302; 5286717; 5321131; 5399676; 5405939; 5453496; 5455233; 5466677; 5476925; 5519126; 5536821; 5541306; 5550111; 5563253; 5571799; 5587361; и 5625050.

Модифицированные полинуклеотиднные цепи содержат, например, тиофосфаты, хиральные тиофосфаты, дитиофосфаты, фосфотриэфиры, аминоалкилфосфотриэфиры, метил- и другие алкил фосфонаты, включая 3'-алкилен фосфонаты и хиральные фосфонаты, фосфинаты, фосфороамидаты, включая 3'- амино фосфороамидат и аминоалкилфосфороамидаты, тионофосфороамидаты, тионоалкилфосфонаты, тионоалкилфосфотриэфиры и боранофосфаты, имеющие нормальные 3'-5 'связи, 2'-5' связанные аналоги этих, и тех, которые имеют инвертированную полярность, где смежные пары нуклеозидных единиц связаны 3'-5 'к 5'-3' или 2'-5 'к 5'-2'. Также могут быть использованы различные соли, смешанные соли и свободные кислоты

В качестве альтернативы, модифицированные полинуклеотидные цепи, которые не содержат атом фосфора, имеют скелеты, которые образованы короткой алкильной цепью или циклоалкильными межнуклеозидными связями, смешанным гетероатомом и алкил или циклоалкил межнуклеозидными связями, или одной или более короткой цепью гетероатомной или гетероциклической межнуклеозидной связью. В их число входят те, которые имеют связи морфолино (образованные частично из сахарной части нуклеозида); силоксановые скелеты; сульфиды, сульфоксиды и сульфоновые скелеты; скелеты формацетильные и тиоформацетильные ; метиленформацетильные и тиоформацетильные скелеты; алкен, содержащие цепи; сульфаматные скелеты; метиленимино- и метиленгидразин- скелеты; сульфонатные и сульфонамидные скелеты; амидные скелеты; и другие смешанные N, 0, S и СН2 составные части, как описано в патенте США №№ 5034506; 5166315; 5,185444; 5216141; 5235033; 5264562; 5264564; 5405938; 5470967; 5489677; 5541307; 5561225; 5596086; 5602240; 5602240; 5608046; 5610289; 5618704; 5623070; 5663312; 5214134; 5466677; 5610289; 5633360; 5677437 и 5677439.

Другие полинуклеотидные агенты, которые могут быть использованы в соответствии с настоящим изобретением, модифицированы как в сахаре, так и в межнуклеозидной связи, например, последовательность нуклеотидных единиц заменяется новыми группами. Основания сохраняют комплементарность соответствующим целевым полинуклеотидам. Примером такого полинуклеотидного миметика является пептидо-нуклеиновая кислота (ПНК). Полинуклеотид ПНК относится к полинуклеотиду, где сахарный скелет заменен амидом, содержащим скелет, в частности, скелет аминоэтилглицина. Основания удерживаемые и связанные непосредственно или опосредованно с аза атомами азота амидной части скелета. Патенты США, которые описывают получение соединений ПНК содержат, но не ограничиваясь этим, патенте США №№ 5539082; 5714331; и 5719262, каждый из которых включен в данный документ посредством ссылки. Другие модификации скелета, которые могут быть использованы в настоящем изобретении, описаны в патенте США № 6303374.

Полинуклеотидные агенты настоящего изобретения могут также включать модификации оснований или замены. Как используется в данном документе термин "немодифицированные" или "природные" основания содержат пуриновые основания аденин (А) и гуанин (G), и пиримидиновые основания тимин (Т), цитозин (С) и урацил (U). Модифицированные основания содержат, но не ограничиваясь этим, другие синтетические и природные основания, такие как 5-метилцитозин (5-Ме-С), 5-гидроксиметилцитозин, ксантин, гипоксантин, 2-аминоаденин, 6-метил и другие алкиловые производные аденина и гуанина , 2-пропил и другие алкиловые производные аденина и гуанина, 2-тиоурацил, 2-тиотимин и 2-тиоцитозин, 5-галоген урацил и цитозин, 5-пропинилурацил и цитозин, 6-азоурацил, цитозин и тимин, 5-урацил (псевдоурацил), 4-тиоурацил, 8-галоген, 8-амино, 8-тиол, 8-тиоалкил, 8-гидроксил и другие 8-замещенные аденина и гуанины, 5-галоген в частности, 5-бром, 5-трифторметил и другие 5 -замещенные урацила и цитозина, 7-метилгуанин и 7-метиладенин, 8-азагуанин и 8-азааденин, 7-деазагуанин и 7-деазааденин и 3-деазагуанин и 3- деазааденин. Дополнительные основания основания содержат те, которые описаны в патенте США № 3687808, которые описаны в The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, которые описаны Englisch et al., Angewandte Chemie, International Edition, 1991, 613, и которые описаны Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-2, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Такие основания являются особенно полезными для увеличения аффинности связывания олигомерных соединений настоящего изобретения. В их число входят 5-замещенные пиримидины, 6-азапиримидины и N-2, N-6 и 0-6 замещенные пурины, в том числе 2-аминопропиладенин, 5-пропинилурацил и 5-пропинилцитозин. Было показано, что замены 5- метилцитозином увеличивают стабильность нуклеиновой кислоты на 0,6-1,2°C. (Sanghvi YS et al. (1993) Antisense Research and Applications, CRC Press, Boca Raton 276-278) и в настоящее время замены оснований являются предпочтительными, еще более конкретно в сочетании с 2'-О-метоксиэтил модифицированным сахаром.

Полинуклеотидные агенты настоящего изобретения могут также включать модификации оснований или замены. Например, полинуклеотиды могут быть очищены из смеси путем экстракции растворителем или смолой, осаждением, электрофорезом, хроматографией или их комбинациями. В качестве альтернативы полинуклеотиды могут быть использованы без какой-либо очистки, либо с минимальной очисткой, чтобы избежать потерь в результате обработки образцов. Полинуклеотиды могут быть высушены для хранения или растворены в водном растворе. Раствор может содержать буферы и соли для поддержания отжига, и/или стабилизации двойной нити.

Следует принять во внимание, что полинуклеотидный агент по настоящему изобретению может быть обеспечен сам по себе или в виде конструкта нуклеиновой кислоты, содержащий последовательность нуклеиновой кислоты, кодирующей полинуклеотидный агент. Как правило, конструкт нуклеиновой кислоты содержит промоторную последовательность, которая является функциональной в клетке-хозяине, как подробно описано в данном документе ниже.

Полинуклеотидные последовательности согласно настоящему изобретению находятся под контролем функционально связанной последовательности промотора, могут быть дополнительно фланкированы дополнительными последовательностями, которые преимущественно влияют на их транскрипцию и/или стабильность результирующего транскрипта. Такие последовательности обычно расположены против хода транскрипции от промотора и/или по ходу от 3'-конца конструкта экспрессии.

Термин "функционально связанный", как он используется в качестве ссылки с регуляторной последовательностью и структурной нуклеотидной последовательностью, означает, что регуляторная последовательность вызывает регулируемую экспрессию связанной структурной нуклеотидной последовательности. "Регуляторные последовательности" или "регуляторные элементы" относятся к нуклеотидным последовательностям, расположенных выше, в пределах или ниже структурной нуклеотидной последовательности, и которые влияют на время и уровень или объем транскрипции, процессинг или стабильность РНК, или трансляцию соответствующей структурной нуклеотидной последовательности. Регуляторные последовательности могут содержать промоторы, лидерную последовательность трансляции, интроны, энхансеры, структуру "петля-на-стебле", репрессор-связывающие последовательности, последовательности терминации, нечитающиеся последовательности, последовательности распознавания полиаденилирования и тому подобному.

Следует принять во внимание, что агенты нуклеиновых кислот могут быть доставлены к вредителю или паразиту в большом разнообразии путей. В соответствии с одним аспектом настоящего изобретения агенты нуклеиновых кислот доставляются непосредственно к вредителю или паразиту (например, путем распыления над ульем, зараженным клещом). Агенты нуклеиновых кислот или конструкты, кодирующие тоже самое могут проникать в тела клещей путем диффузии. В этом аспекте настоящего изобретения промотор полинуклеотида конструкта, как правило, действует в клетках клеща. В аспекте настоящего изобретения вредитель или паразит представляет собой клещ Varroa destructor.

Следует принять во внимание, что, поскольку многие паразиты используют свои рты для прокалывания экзоскелета членистоногого хозяина и питаются гемолимфой членистоногих, настоящее изобретение предлагает доставку полинуклеотидных агентов по настоящему изобретению к членистоногим, в результате чего полинуклеотидные агенты обнаруживаются в гемолимфе членистоногих, таким образом, становятся доступными для вредителя или паразита. Таким образом, в соответствии с другим аспектом настоящего изобретения агенты нуклеиновых кислот косвенно доставляются к вредителю или паразиту (например, к клещу через хозяина, пчелу). В этом аспекте настоящего изобретения промотор полинуклеотида конструкта, как правило, действует в клетках клеща. В некоторых аспектах настоящего изобретения вредитель или паразит может быть Varroa destructor и членистоногий хозяин может быть пчелой.

В соответствии с одним из аспектов настоящего изобретения агенты нуклеиновой кислоты доставляются к инфицированным хозяевам путем распыления. Агенты нуклеиновых кислот или конструкты, кодирующие тоже самое могут проникать в тела клещей путем диффузии. В некоторых аспектах настоящего изобретения вредитель или паразит может быть Varroa destructor и членистоногий хозяин может быть пчелой.

В соответствии с другим аспектом настоящего изобретения агенты нуклеиновой кислоты поступают в питание к хозяину. Авторы настоящего изобретения считают, что после употребления в пищу агентов нуклеиновых кислот по настоящему изобретению, агенты могут быть обнаружены, например, в членистоногом хозяине в гемолимфе хозяина, в результате чего они становятся доступными для паразита, например, клеща Варроа.

Таким образом, полинуклеотиды по настоящему изобретению могут быть синтезированы in vitro или in vivo, например, в бактериальной или дрожжевой клетке, и добавлены к пище. Например, двухцепочечная РНК может быть синтезирована путем добавления противоположно ориентированных промоторов (например, Т7 промоторы) на концах сегментов гена, в котором промотор помещен непосредственно к 5' гену и промотор, который помещен непосредственно в положение 3' к генному сегменту в противоположной ориентации. ДцРНК может быть получена транскрибированием in vitro с использованием Т7 РНК-полимеразы.

Примеры последовательностей для синтеза нуклеиновых кислот, в том числе миРНК, в соответствии с аспектами настоящего изобретения представлены в SEQ ID NO: от 1 до 4, 6, 23, от 26 до 35 и от 69 до 89.

Следует принять во внимание, что некоторые вредные организмы или паразиты являются причиной ран в экзоскелете членистоногого хозяина. Такие раневые участки являются местом скопления бактериальных инфекций. Например, раневые участки пчелы-хозяина могут быть местом скопления таких бактерий как Melissococcus pluton, которые вызывают гнилец открытого расплода. Кроме того, к их паразитарным эффектам, паразиты, как известно, выступают в качестве векторов для ряда других патогенных микроорганизмов и паразитов. Например, клещи Варроа подозреваются в качестве векторов для ряда пчелиных патогенов, включая вирус деформации крыла (DWV), Кашмир-вирус (KBV), вирус острого паралича пчел (ABPV) и вирус черных маточников (BQCV), и могут ослабить иммунную систему своих хозяев, делая их уязвимыми к инфекциям.

Таким образом, убивая вредителя или паразита (или предотвращая их размножение), антипаразитарные, дезинсекционные или инсектицидные агенты настоящего изобретения могут быть использованы для профилактики и/или лечения бактериальных инфекций организмов-хозяев. Например, Melissococcus pluton и вирусные инфекции у пчел-хозяев, вызванные вышеназванными вирусами. Поскольку инвазии клеща Варроа и вирусные инфекции, как считается, ответственны за синдром разрушения (пчелиных) семей (СРК), настоящие агенты также могут быть использованы для предотвращения или уменьшения чувствительности пчел колонии к СРК.

Следует принять во внимание, что в дополнение к вскармливанию антипаразитарными, дезинсекционными или инсектицидными агентами нуклеиновых кислот для снижения возбудителей инфекций и инвазий пчел, соблюдение надлежащих санитарных условий (например, отказ от повторного использования инвазированных ульев) может усилить эффективность лечения и профилактики инфекций.

Также настоящее изобретение включает и предлагает трансгенные бактериальные и дрожжевые клетки, которые экспрессируют селективный инсектицид. В одном из аспектов настоящего изобретения нуклеиновая кислота, кодирующая малую РНК, дцРНК, микроРНК, или малую РНК или молекулу нуклеиновой кислоты устойчивую к микроРНК-мишени, используемая в настоящем документе, функционально связанная с промотором и необязательно с терминатором. В некоторых вариантах реализации изобретения трансгенные бактериальные и дрожжевые клетки убивают, например, путем нагрева или давления. В некоторых вариантах реализации изобретения трансгенные бактериальные и дрожжевые клетки лизируют для обеспечения селективным инсектицидом организма-мишени. В некоторых вариантах реализации изобретения трансгенные бактериальные и дрожжевые клетки не лизируют.

В одном из аспектов настоящего изобретения экзогенная молекула нуклеиновой кислоты, используемая в настоящем документе, или кодирует малую РНК, или в определенном аспекте миРНК, которая может модулировать экспрессию гена в организме-мишени. В аспекте настоящего изобретения экзогенная нуклеиновая кислота кодирует малую РНК, имеющую по меньшей мере 80 %, 85 %, 88 %, 90 %, 92 %, 95 %, 96 %, 97 %, 98 % или 99 % идентичности последовательности с последовательностью выбранный из группы, состоящей из SEQ ID NO: 1-4 и 6-89. В дополнительном аспекте настоящего изобретения экзогенная молекула нуклеиновой кислоты, используемая в настоящем документе, или кодирующая молекулу дцРНК. В другом аспекте настоящего изобретения экзогенная молекула нуклеиновой кислоты, используемая в настоящем документе, или кодирующая искусственную микроРНК. В дополнительном аспекте настоящего изобретения экзогенная молекула нуклеиновой кислоты, используемая в настоящем документе, или кодирующая миРНК. В одном из аспектов настоящего изобретения экзогенная молекула нуклеиновой кислоты, используемая в данном документе, или кодирующая предшественника малой РНК. В другом аспекте настоящего изобретения экзогенная молекула нуклеиновой кислоты, используемая в данном документе, или кодирующая предшественника микроРНК или малой РНК В дополнительном аспекте настоящего изобретения экзогенная молекула нуклеиновой кислоты, используемая в настоящем документе, или кодирующая молекулу природного происхождения. В другом аспекте настоящего изобретения экзогенная молекула нуклеиновой кислоты, используемая в настоящем документе, представляет собой синтетическую молекулу.

В одном из аспектов настоящего изобретения экзогенная молекула нуклеиновой кислоты, используемая в настоящем документе, или кодирующая предшественника "петли-на-стебле" малой РНК или в конкретном аспекте микроРНК, содержащую последовательность, имеющую по меньшей мере 80 %, 85 %, 88 %, 90 %, 92 %, 95 %, 96 %, 97 %, 98 % или 99 % идентичности последовательности с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 1-4 и 6-89. Предшественник "петли-на-стебле", используемый в настоящем документе, содержит последовательность, имеющую по меньшей мере 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 88 %, 90 %, 92 %, 95 %, 96 %, 97 %, 98 % или 99 % идентичности последовательности с последовательностью, выбранной из группы, состоящей из SEQ ID NO: 1-4 и 6-89.

В одном из аспектов настоящего изобретения экзогенная молекула нуклеиновой кислоты, используемая в настоящем документе, представляет собой открытую РНК или экспрессирующий конструкт нуклеиновой кислоты, где она функционально связана с регуляторной последовательностью.

В одном аспекте настоящего изобретения рекомбинантный ДНК-конструкт или трансген, описанный в данном документе, дополнительно содержит терминатор транскрипции.

Ожидается, что в течение срока действия патента настоящей заявки могут быть разработаны многие соответствующие методов подавления экспрессии генных продуктов и объем термина "подавление экспрессии продукта гена клеща Varroa destructor " предназначен для включения всех таких новых технологий априори.

Следует понимать, что определенные отличительные признаки изобретения, которые для ясности описаны в контексте отдельных аспектов, также могут быть представлены в комбинации в одном аспекте. С другой стороны, различные признаки изобретения, которые для краткости описаны в контексте одного аспекта, могут также быть представлены отдельно или в любой подходящей подкомбинации или в качестве пригодных в любом другом описанном аспекте настоящего изобретения. Некоторые особенности, описанные в контексте различных аспектов настоящего изобретения, не следует рассматривать как существенные признаки этих аспектов, если аспект не функционирует без этих элементов. Различные особенности и аспекты настоящего изобретения, которые обозначены выше, и как заявлено в формуле изобретения находят экспериментальное подтверждение в следующих примерах.

ПРИМЕРЫ

Пример 1. Последовательности гена кальмодулина клеща Варроа

Гены кальмодулина (CAM) представлены в таблице 1 (SEQ ID NO: 1 и 2), или их соответствующие транскрипты, использованные в качестве мишеней полинуклеотидных композиций, содержащих полинуклеотид, который имеет по меньшей мере 18 смежных нуклеотидов идентичных или комплементарных этим генам или транскриптам. Генные последовательности, представленные в таблице 1, белковые последовательности, кодируемые этими генами, или последовательностями, которые содержатся в этих генах, были использованы для получения ортологичных генов кальмодулина (CAM) от других вредителей и паразитических видов членистоногих, не указанных в таблице 1. Такие ортологичные гены и их транскрипты могут служить в качестве мишеней полинуклеотидов, представленных в данном документе, или в качестве источника антипаразитарных, дезинсекционных или инсектицидных полинуклеотидов, которые специально предназначены для целевых ортологичных генов или транскриптов.

Таблица 1. Целевые гены кальмодулина (CAM)Varroa destructor.

Название гена SEQ ID Открытые рамки считывания последовательности ДНК
CAM-1 1 ATGGCTGATCAGCTAACTGAGGAACAGATCGCCGAGTTCAAAGAGGCGTTTAGCCTGTTTGACAAGGACGGAGATGGCACGATCACGACAAAGGAGCTCGGTACGGTAATGCGATCTCTCGGCCAGAACCCCACTGAGGCTGAACTGCAGGACATGATCAACGAGGTCGACGCCGACGGCTCCGGAACGATAGATTTCCCTGAGTTCCTCACAATGATGGCAAGAAAGATGAAGGACACCGACTCGGAGGAGGAGATCCGAGAGGCGTTCCGCGTATTCGACAAGGATGGCAACGGTTTCATTTCGGCGGCCGAGCTCAGGCACGTTATGACCAACCTTGGCGAGAAGCTTACGGACGAGGAGGTAGATGAGATGATTCGGGAGGCAGATATTGACGGTGATGGTCAGGTCAACTACGAGGAGTTCGTCACCATGATGACGTCCAAGTAA
CAM-2 2 ATGGCGGATCAGCTGACCGAGGAGCAAATCGCCGAATTCAAGGAGGCTTTCAGCCTGTTCGATAAAGACGGTGATGGCACAATTACGACCAAGGAACTAGGGACCGTCATGCGGTCCCTCGGCCAGAACCCTACTGAGGCTGAGCTTCAAGACATGATCAACGAGGTCGACGCTGACGGTAACGGCACTATTGACTTTCCAGAGTTTCTCACGATGATGGCGCGTAAAATGAAGGACACCGACTCCGAGGAGGAGATCCGGGAAGCTTTTAGGGTTTTTGATAAAGACGGAAATGGCTTCATTTCGGCTGCAGAGCTGAGGCACGTAATGACCAACCTTGGCGAAAAGCTCACGGACGAGGAAGTGGACGAGATGATCCGCGAGGCGGATATCGACGGCGACGGACAGGTCAACTACGAGGAGTTCGTCACGATGATGACATCAAAATGA

Для каждой последовательности ДНК гена кальмодулина, представленной в SEQ ID NO: 1 и 2, одноцепочечной или двухцепочечной ДНК или фрагментов РНК в смысловой или антисмысловой ориентации, обеих скармливают in vitro клещам Варроа, выращиваемых в чашке Петри или местно наносят на пчелиные ульи, для экспрессии генов-мишеней CAM и снижения численности клеща Varroa destructor.

Пример 2. Подавление генов кальмодулина (CAM) Varroa destructor .

Полинуклеотиды для подавления экспрессии генов кальмодулина (САМ) у клещей Varroa destructor, соответствующие SEQ ID NO: 3 и 4 (таблица 2) предложены и были использованы для подавления экспрессии генов кальмодулина (CAM) клеща Varroa destructor. SEQ ID NO: 3 и 4 описывают 373 п.н. полинуклеотидной последовательности дцРНК и 186 п.н. полинуклеотидной последовательности дцРНК, соответственно, выбранные из CAM-1 (SEQ ID NO: 1). SEQ ID NO: 3, соответствующей полинуклеотидной дцРНК CAM_L/CAM 373, покрывающей большую часть открытой рамки считывания гена кальмодулина CAM-1 (SEQ ID NO: 1). SEQ ID NO: 4, соответствующей полинуклеотидной дцРНК CAM_S/CAM186, которая представляет собой частичный фрагмент CAM_L/CAM373 (SEQ ID NO: 3) и также выводится из CAM-1 (SEQ ID NO: 1). SEQ ID NO: 5 в таблице 2 представляет собой полинуклеотидную последовательность контрольной последовательности дцРНК, с идентичностью последовательности не более 19 пар нуклеотидов к любому известному гену Varroa destructor.

Таблица 2. дцРНК направленные на гены кальмодулина (CAM) Varroa destructor.

Название дцРНК SEQ ID Последовательность нуклеиновой кислоты.
CAM_L/CAM373 3 ACAGAUCGCCGAGUUCAAAGAGGCGUUUAGCCUGUUUGACAAGGACGGAGAUGGCACGAUCACGACAAAGGAGCUCGGUACGGUAAUGCGAUCUCUCGGCCAGAACCCCACUGAGGCUGAACUGCAGGACAUGAUCAACGAGGUCGACGCCGACGGCUCCGGAACGAUAGAUUUCCCUGAGUUCCUCACAAUGAUGGCAAGAAAGAUGAAGGACACCGACUCGGAGGAGGAGAUCCGAGAGGCGUUCCGCGUAUUCGACAAGGAUGGCAACGGUUUCAUUUCGGCGGCCGAGCUCAGGCACGUUAUGACCAACCUUGGCGAGAAGCUUACGGACGAGGAGGUAGAUGAGAUGAUUCGGGAGGCAGAUAUUGAC
CAM_S/CAM186 4 ACAAUGAUGGCAAGAAAGAUGAAGGACACCGACUCGGAGGAGGAGAUCCGAGAGGCGUUCCGCGUAUUCGACAAGGAUGGCAACGGUUUCAUUUCGGCGGCCGAGCUCAGGCACGUUAUGACCAACCUUGGCGAGAAGCUUACGGACGAGGAGGUAGAUGAGAUGAUUCGGGAGGCAGAUAUUGAC
SCRAM 5 AUACUUACUGGUGCUAAUUUUUAUCGAGGAUGCCCAACUCCCCCCACUUUAAAACUGCGAUCAUACUAACGAACUCCCGAAGGAGUGAAAGGUGUCUAUGUUGAGCUUAAUAACCUACCUUGCGAGCAAAGAAGGACUAGUUGACCCUGGGCACCCUAUAUUGUUAUGUUGUUUCGAACUGAGUUGGCACCCAUGCUGCACAUGCAACAAACAUGUCGGCCUUCGUGUCUAUCCUAGAAAAGUACCUGUGAACUUGGCUGUCUACAUCAUCAUC

Пример 3. Биологический анализ Varroa destructor на 3 день после обработки специфичными дцРНК

Взрослые самки клеща были собраны из колоний пчел и помещены в чашку Петри, сверху раствора искусственной питательной среды, содержащей смесь 1 % триптона, 0,5 % дрожжевого экстракта, 1 % NaCl и 15 мг/мл агара. В этом примере пища была дополнена 50 мкг канамицина на 1 мл раствора питательной среды. Раствор пища/агар также дополнен 200-500 мкг/мл дцРНК, и полученный раствор наливали в чашку Петри. ДцРНК в этом примере состоит из любой последовательности SEQ ID NO: 3 (CAM_L/CAM373) или SEQ ID NO: 5 (SCRAM). В каждую чашку Петри помещали пятнадцать клещей, и эксперимент проводили в трех повторностях. ​Чашки Петри с пищей и клещами инкубировали при 29°С и при относительной влажности в 50-60 %.​ Через определенные промежутки времени чашки Петри осматривали и мертвых клещей подсчитывали и удаляли. Для исследования смертность клещей подсчитывали через три дня после их размещения на питательном растворе (фиг. 2). Фиг. 2 демонстрирует, что все клещи были мертвы через три дня после обработки по сравнению с необработанными чашками Петри или чашками Петри, где клещей кормили пищей, дополненной неспецифическим полинуклеотидом дцРНК (SCRAM).

Пример 4. Биологический анализ Varroa destructor на 5 день после обработки кальмодулин-целевым дцРНК.

Взрослые самки клеща были собраны из колоний пчел и помещены в чашку Петри на вершину искусственного питательного раствора. Искусственный корм содержал смесь 1 % триптона, 0,5 % дрожжевого экстракта, 1 % NaCl и 15 мг/мл агара. В этом примере пища была дополнена антимикотическим раствором (100х, Sigma Aldrich) в 8-кратной конечной концентрации, 500 мкг/мл канамицина и 220 ед./мл нистатина. Раствор пища/агар также дополнен 200-500 мкг/мл дцРНК и полученный раствор наливали в чашку Петри. ДцРНК в этом примере состоит из любой последовательности SEQ ID NO: 3 (CAM_L/CAM373) или SEQ ID NO: 4 (CAM_S/CAM186) или SEQ ID NO: 5 (SCRAM). В каждую чашку Петри помещали пятнадцать клещей, и эксперимент проводили в трех повторностях. Чашки Петри с пищей и клещами инкубировали при 29°С и при относительной влажности в 50-60 %. Через определенные промежутки времени чашки Петри осматривали и мертвых клещей подсчитывали и удаляли. Для исследования смертности клещей подсчитывали через пять дней после их размещения на питательном растворе (фиг. 3). Для молекулярного анализа живых клещей снимали с чашек Петри, замораживали в жидком азоте и проводили TaqMan™ анализ для оценки уровня РНК кальмодулина (САМ). На фиг. 3, панели A уровень РНК генов кальмодулина клещей, подвергшихся SEQ ID NO: 3 (CAM_L/CAM373) или SEQ ID NO: 4 (CAM_S/CAM186) сильно снижен по сравнению с неспецифической обработкой (SCRAM) или без обработки (CNTR). На фиг. 3, панели Б продемонстрирована статистически значимая смертность клещей, которых подвергали воздействию дцРНК против кальмодулина (CAM), в течение 5 дней после обработки.

Пример 5. Способ доставки полинуклеотидов дцРНК, нацеленных на гены Варроа с использованием полужидкой композиции или высушенной распылением.

ДцРНК, используемая для подавления экспрессии целевого гена кальмодулина, была приготовлена в композиции, содержащей 1 часть дцРНК и ~14 частей трегалозы в фосфатном буфере (раствор 1,15 мМ KH 2PO4 (одноосновной) и 8 мМ Na2HPO4 (двухосновный), рН 8,0, как показано в таблице 3. С использованием мини-распылительной сушилки Büchi B-290, жидкий препарат диспергировали в капли и нагревали с газом для получения сыпучего порошка.

Таблица 3. Приготовление композиции

дцРНК Маточный буферный раствор (Х% масса/объем трегалозы + фосфатный буфер) Буферный раствор (Х% масса/объем трегалозы + фосфатный буфер) Общий объем (мл) Маточный буферный раствор (мл) Исходная дцРНК (мл) Соотношение Активный ингредиент (АИ) конц. (мг/мл) Активный ингредиент (АИ) конц. (% сухого вещества) Отношение AИ (дцРНК) к буферу (трегалоза + фосфатный буфер)
CAM_L/CAM373 40 10 1100 275,00 825,00 ¼ 7,20 0,720 13,9
CAM_S/CAM186 40 10 1285 321,21 963,75 ¼ 6,75 0,675 14,8

Полученные частицы были приготовлены с сахарной пудрой и равномерно наносили на ульи, равномерно распределяя сахарную пудру по верхней части рамы. В других аспектах настоящего изобретения полужидкий препарат, высушенный распылением материала, приготовленный с водой и сахарной водой ("конфета-пчела"), препарат поступает в пчелиные ульи, позволяя пчелам питаться им.

Пример 6. Снижение количества клеща Варроа in vivo в пчелиных ульях после обработки с помощью дцРНК, нацеленных на гены кальмодулина (CAM).

Клещи Варроа, паразитирующие на взрослых медоносных пчелах в ульях, были собраны и подсчитаны с использованием стандартной методики подсчета клеща. Ульи обрабатывали распылением сухой дцРНК в соответствии с примером 7, содержащим SEQ ID NO: 3 (CAM-L), SEQ ID NO: 4 (CAM_S/CAM186) или без обработки (КОНТРОЛЬ). Клещевую нагрузку каждого улья оценивали в начале эксперимента и через 2 недели, 4 недели и 12 недель после обработки. Фиг. 4 показывает клещевую нагрузку обработанных ульев по сравнению с ульями, которые не обрабатывали. Число подсчитанных клещей нормализовали до 100 взрослых пчел, и характеризовали особенности клещевой нагрузки Варроа.

Пример 7. Обнаружение транзитивных малых РНК Варроа после обработки с использованием дцРНК, нацеленных на гены кальмодулина (CAM).

Клещи Варроа были собраны из ульев, обработанных полинуклеотидами дцРНК из SEQ ID NO: 3, и собирали из улья на 7-й день после обработки. РНК Варроа экстрагировали и проводили анализ секвенирования малых РНК с использованием платформы SOLiD. У большинства молекул малые РНК были обнаружены за пределами области последовательности дцРНК и конкретно в направлении части 3' дцРНК области SEQ ID NO: 3. Кроме того, большинство транзитивных читались в антисмысловой ориентации по отношению к последовательности транскрипта гена кальмодулина. Кроме того, малые РНК специфичные для CAM-2 (SEQ ID NO: 2), обнаруженные в этом эксперименте, несмотря на обработку ульев дцРНК SEQ ID NO: 3, по прогнозам будут специфичными для CAM-1 (SEQ ID NO: 1). Это наблюдение подтверждает гипотезу о том, что подавление экспрессии РНК и образование переходной малой РНК у Варроа работает даже тогда, когда только небольшой фрагмент между двумя генами полностью идентичен на уровне ДНК (в этом случай 23 нуклеотидов).

Пример 8. Гомологи гена кальмодулина (CAM) вредителей и паразитов видов членистоногих и соответствующих полинуклеотидов дцРНК.

С использованием стандартной биоинформатической методики и последовательностей SEQ ID NO: 1 и 2 для Varroa destructor был идентифицирован набор из 31 консервативной последовательности гена кальмодулина (CAM) у видов членистоногих вредителей, паразитирующих либо на других членистоногих или млекопитающих, и которые будут нацелены на регуляцию генов. Эти последовательности были идентифицированы и представлены в виде филогенетического дерева на фиг. 1. Последовательности ДНК на фиг. 1 далее анализировали путем идентификации консервативного домена 373 п.н. в пределах каждой последовательности, соответствующей SEQ ID NO: 3 (CAM_L/CAM373). В таблице 4 приведен перечень SEQ ID NO вновь идентифицированных последовательностей гена кальмодулина (САМ), а также соответствующих 373 п.н. полинуклеотидных триггерных последовательностей дцРНК. 373 п.н. полинуклеотидные последовательности дцРНК будут протестированы либо по отдельности, либо в комбинации с тестами непосредственного кормления в борьбе с соответствующими видами членистоногих.

Таблица 4. Последовательности гена кальмодулина (CAM), идентифицированные у членистоногих вредителей и паразитов и их соответствующие 373 п.н. полинуклеотидные РНК.

SEQ ID NO Название гена Организм/Виды Тип
6 CAM-3 Varroa destructor кДНК
7 CAM-1 Ixodes scapularis кДНК
8 CAM-1 Aedes aegypti кДНК
9 CAM-1 Culex quinquefasciatus кДНК
10 CAM-1 Acyrthosiphon pisum кДНК
11 CAM-1 Harpegnathos saltator кДНК
12 CAM-1 Pediculus humanus corporis кДНК
13 CAM-1 Anopheles gambiae кДНК
14 CAM-1 Solenopsis invicta кДНК
15 CAM-1 Ixodes scapularis РНК
16 CAM-1 Aedes aegypti РНК
17 CAM-1 Culex quinquefasciatus РНК
18 CAM-1 Acyrthosiphon pisum РНК
19 CAM-1 Harpegnathos saltator РНК
20 CAM-1 Pediculus humanus corporis РНК
21 CAM-1 Anopheles gambiae РНК
22 CAM-1 Solenopsis invicta РНК
23 CAM-3 Varroa destructor РНК
24 CAM-1 Tetranychus urticae кДНК
25 CAM-1 Tetranychus urticae РНК
26 CAM-4 Varroa destructor кДНК
27 CAM-4 Varroa destructor РНК
28 CAM-5 Varroa destructor кДНК
29 CAM-5 Varroa destructor РНК
30 CAM-7 Varroa destructor кДНК
31 CAM-7 Varroa destructor РНК
32 CAM-8 Varroa destructor кДНК
33 CAM-8 Varroa destructor РНК
34 CAM-9 Varroa destructor кДНК
35 CAM-9 Varroa destructor РНК
36 CAM Ixodes scapularis кДНК
37 CAM Ixodes scapularis РНК
38 CAM Ixodes scapularis кДНК
39 CAM Ixodes scapularis РНК
40 CAM Ixodes scapularis кДНК
41 CAM Ixodes scapularis кДНК
42 CAM Ixodes scapularis РНК
43 CAM Aedes aegypti кДНК
44 CAM Aedes aegypti РНК
45 CAM Aedes aegypti кДНК
46 CAM Aedes aegypti РНК
47 CAM Aedes aegypti кДНК
48 CAM Aedes aegypti РНК
49 CAM Culex quinquefasciatus кДНК
50 CAM Culex quinquefasciatus РНК
51 CAM Culex quinquefasciatus кДНК
52 CAM Culex quinquefasciatus РНК
53 CAM Culex quinquefasciatus кДНК
54 CAM Culex quinquefasciatus РНК
55 CAM Culex quinquefasciatus кДНК
56 CAM Culex quinquefasciatus РНК
57 CAM Acyrthosiphon pisum кДНК
58 CAM Acyrthosiphon pisum РНК
59 CAM Acyrthosiphon pisum кДНК
60 CAM Acyrthosiphon pisum РНК
61 CAM Pediculus humanus кДНК
62 CAM Pediculus humanus РНК
63 CAM Pediculus humanus кДНК
64 CAM Pediculus humanus РНК
65 CAM Pediculus humanus кДНК
66 CAM Pediculus humanus РНК
67 CAM Pediculus humanus кДНК
68 CAM Pediculus humanus РНК

Пример 9. Транскрипт гена кальмодулина (CAM) Варроа и триггерная последовательность дцРНК.

Последовательности кальмодулина (CAM) представлены в таблице 5 (SEQ ID NO: 69 и 70), или их соответствующие транскрипты, используемые в качестве мишеней полинуклеотидных композиций, содержащих полинуклеотид, который имеет по меньшей мере 18 смежных нуклеотидов идентичных или комплементарных этим генам или транскриптам. 5 'и 3'-НТО последовательности кальмодулина Варроа были идентифицированы с помощью секвенирования РНК.

Таблица 5. Целевые транскрипты генов кальмодулина (CAM) Varroa destructor.

Название гена и виды SEQ ID NO Тип
CAM-1; Varroa destructor 69 РНК
CAM-2; Varroa destructor 70 РНК

SEQ ID NO: 69 или 70 с неперекрывающимися 150 п.н. фрагментами. В таблице 6 показана верхняя цепь (5'-3 ') для 150 п.н. фрагментов, которые не перекрывают SEQ ID NO: 69 или 70.

Таблица 6. Неперекрывающиеся полинуклеотидные последовательности генов CAM-1 и CAM-2

Название гена SEQ ID NO Положение в пределах последовательности транскрипта
CAM-1 71 1 -150
CAM-1 72 151 -300
CAM-1 73 301-450
CAM-1 74 451-600
CAM-1 75 601-750
CAM-1 76 751-900
CAM-1 77 901-1050
CAM-1 78 1051-1200
CAM-1 79 1201-1350
CAM-1 80 1351-1500
CAM-2 81 1 -150
CAM-2 82 151 -300
CAM-2 83 301-450
CAM-2 84 451-600
CAM-2 85 601-750
CAM-2 86 751-900
CAM-2 87 901-1050

Одна или более дцРНК, содержащая последовательность, выбранную из SEQ ID NO: 71-87, обеспечивает у клещей Варроа in vitro, выращиваемых в чашке Петри или наносимых местно на пчелиные ульи, экспрессию генов-мишеней CAM и снижение численности клеща Varroa destructor.

Пример 10. Биологический анализ in vitro кальмодулина (CAM), нацеленного на триггеры клеща Варроа.

Полинуклеотидные триггерные последовательности, нацеленные на кальмодулин (CAM)-1 и 2, были получены на основе перекрываемой консервативной последовательности между последовательностями CAM-1 и CAM-2. Они представлены как SEQ ID NO: 88 и 89 (нацеленные на CAM-1 и CAM-2, соответственно).

Полинуклеотидные последовательности, выбранные из SEQ ID NO: 88 и 89, были протестированы биологическим анализом in vitro в их способности подавлять жизнеспособность взрослых клещей Варроа. Взрослые самки клеща были собраны из колоний пчел и помещены в чашку Петри на вершину искусственного питательного раствора. Искусственный корм содержал смесь 1 % триптона, 0,5 % дрожжевого экстракта, 1 % NaCl и 15 мг/мл агара. В этом примере, корм также была дополнен антимикотическим раствором (100х, Sigma Aldrich) в 8-кратной конечной концентрации, 500 мкг/мл канамицина и 220 ед./мл нистатина. Раствор пища/агар также дополнен 200-500 мкг/мл дцРНК, и полученный раствор наливали в чашку Петри. ДцРНК в этом примере состоит из любой последовательности SEQ ID NO: 3 (CAM373), SEQ ID NO: 88 (CAM-1) или SEQ ID NO: 89 (CAM-2) или необработанный контроль (НОК). В каждую чашку Петри помещали пятнадцать клещей, и эксперимент проводили в трех повторностях. Чашки Петри с пищей и клещами инкубировали при 29 °С и при относительной влажности в 50-60 %. Через определенные промежутки времени чашки Петри осматривали и мертвых клещей подсчитывали и удаляли. Для исследования смертности клещей подсчитывали на пятый и шестой дни после их размещения на питательном растворе (фиг. 5). Кроме того, дцРНК для SEQ ID NO: 88 (CAM-1) или SEQ ID NO: 89 (CAM-2) смешивали в эквимолярном количестве и скармливали, как описано выше, клещам. На фигуре 6 показаны результаты настоящей заявки.

Для молекулярного анализа живых клещей снимали с чашек Петри, замораживали в жидком азоте и проводили TaqMan ™ анализ для оценки уровня РНК кальмодулина (САМ).

Пример 11. Уменьшение области поражения клещом Варроа in vivo в обработанных областях ульев пчел после обработки дцРНК, нацеленных на ген кальмодулина (CAM).

ДцРНК, используемая для подавления экспрессии целевых генов кальмодулина (CAM) Варроа, получали путем смешивания исходной дцРНК в фосфатном буфере с 66 % сахарным сиропом. Жидкий препарат готовится в виде сиропа для пчел, что позволяет питаться им до полного поглощения (приблизительно 2-3 дня). Каждая группа полевых испытаний содержала 33 улья. Группы состояли из необработанных ульев, неспецифической триггерной обработки (SEQ ID NO: 5) и специфической триггерной обработки (SEQ ID NO: 3). Пчел лечили в два этапа, каждый этап состоял из двух подкормок с разрывом в две недели: кормили в самом начале (0 неделя) и через две недели (2 неделя), а затем снова на 13 и 15 неделе. Оценку выживаемости пчел проводили на 4, 9, 13, 15 и 17 неделю (фиг. 7). Значительное снижение численности Варроа наблюдали после обработки специфичным триггером (SEQ ID NO: 3) на 9 неделю.

1. Селективная акарицидная композиция против клещей Varroa destructor, содержащая в эффективном количестве молекулу нуклеиновой кислоты, имеющую последовательность, которая по меньшей мере на 96% комплементарна или идентична по меньшей мере 21 смежному нуклеотиду последовательности гена кальмодулина, выбранной из группы, состоящей из SEQ ID NO: 3, 4, 88 и 89, или транскрибируемой из нее РНК, и вспомогательное вещество.

2. Селективная акарицидная композиция по п. 1, отличающаяся тем, что указанная молекула нуклеиновой кислоты представляет собой дцРНК.

3. Селективная акарицидная композиция по п. 2, отличающаяся тем, что дцРНК представляет собой миРНК.

4. Селективная акарицидная композиция по п. 1, отличающаяся тем, что указанная композиция является поглощаемой клещом.

5. Селективная акарицидная композиция по п. 1, отличающаяся тем, что указанная композиция является абсорбируемой клещом.

6. Селективная акарицидная композиция по п. 1, отличающаяся тем, что указанное вспомогательное вещество выбрано из группы, состоящей из белка, пыльцы, углевода полимера, жидкого растворителя, сахарного сиропа, кристаллического сахара и полужидкой пищи.

7. Селективная акарицидная композиция по п. 6, отличающаяся тем, что указанный жидкий растворитель выбирают из группы, состоящей из раствора сахарозы и раствора кукурузного сиропа.

8. Селективная акарицидная композиция по п. 6, отличающаяся тем, что указанный белок выбирают из группы, состоящей из белка пыльцы и сои.

9. Селективная акарицидная композиция по п. 6, отличающаяся тем, что указанное вспомогательное вещество представляет собой твердое вещество, выбранное из сахара, заменителя сахара или сахарной добавки.

10. Селективная акарицидная композиция по п. 9, отличающаяся тем, что указанное твердое вещество, представляющее собой сахар, содержит микрочастицы сахара, пропитанные последовательностью указанной нуклеиновой кислоты дцРНК.

11. Селективная акарицидная композиция по п. 1, отличающаяся тем, что указанная последовательность гена кальмодулина содержит по меньшей мере 21 смежный нуклеотид последовательности, выбранной из SEQ ID NO: 3, 4, 88 и 89.

12. Селективная акарицидная композиция по п. 2, отличающаяся тем, что указанная последовательность дцРНК представляет собой дцРНК, соответствующую последовательности нуклеиновой кислоты, выбранной из SEQ ID NO: 3, 4, 88 и 89.

13. Селективная акарицидная композиция по п. 1, где молекула нуклеиновой кислоты содержит последовательность, которая на 100% идентична или комплементарна SEQ ID NO: 3.

14. Поглощаемая клещем или абсорбируемая клещем композиция для ингибирования гена Varroa destructor, содержащая корм пчелы и эффективное количество молекулы нуклеиновой кислоты, имеющей последовательность, которая по меньшей мере на 96% комплементарна или идентична по меньшей мере 21 смежному нуклеотиду последовательности гена кальмодулина, выбранной из группы, состоящей из SEQ ID NO: 3, 4, 88 и 89, или транскрибируемой из нее РНК.

15. Композиция по п. 14, отличающаяся тем, что указанная последовательность нуклеиновой кислоты представляет собой дцРНК.

16. Композиция по п. 14, причем указанный корм пчелы содержит пищу пчелы, выбранную из группы, состоящей из кукурузного сиропа, заменителя пыльцы, пыльцы, лепешки из пыльцы и помадной массы.

17. Композиция по п. 15, отличающаяся тем, что указанная дцРНК представляет собой миРНК.

18. Композиция по п. 14, отличающаяся тем, что указанная последовательность гена кальмодулина содержит по меньшей мере 23 смежных нуклеотида последовательности, выбранной из SEQ ID NO: 3, 4, 88 и 89.

19. Композиция по п. 15, отличающаяся тем, что указанная последовательность дцРНК представляет собой дцРНК, соответствующую последовательности нуклеиновой кислоты, выбранной из SEQ ID NO:3, 4, 88 и 89.

20. Конструкт для ингибирования гена Varroa destructor, содержащий нуклеиновую кислоту, которая кодирует дцРНК, содержащую последовательность нуклеиновой кислоты, которая по меньшей мере на 96% идентична или комплементарна по меньшей мере 21 смежному нуклеотиду последовательности гена кальмодулина, выбранной из группы, состоящей из SEQ ID NO: 3, 4, 88 и 89, или транскрибируемой из нее РНК, функционально связанный с промоторной последовательностью, функциональной в клетке-хозяине и способной производить дцРНК при введении в указанную клетку-хозяина.

21. Конструкт нуклеиновой кислоты по п. 20, дополнительно содержащий по меньшей мере один регуляторный элемент, выбранный из группы, состоящей из лидерных последовательностей трансляции, интронов, энхансеров, структур "петля-на-стебле", последовательность-связывающих репрессоров, последовательностей терминации, последовательностей паузы и последовательностей распознавания полиаденилирования.

22. Конструкт нуклеиновой кислоты по п. 20, отличающийся тем, что указанная клетка-хозяин выбрана из группы, состоящей из клетки бактерии и дрожжевой клетки.

23. Конструкт нуклеиновой кислоты по п. 20, где дцРНК содержит последовательность, которая на 100% идентична или комплементарна SEQ ID NO: 3.

24. Способ снижения паразитизма Varroa destructor на медоносной пчеле, включающий обеспечение Varroa destructor эффективным количеством композиции нуклеиновой кислоты, причем указанная нуклеиновая кислота по крайней мере на 96% идентична или комплементарна по крайней мере 21 смежным нуклеотидам последовательности гена кальмодулина Varroa destructor, выбранной из группы, состоящей из SEQ ID NO: 3, 4, 88 и 89, или транскрибируемой из нее РНК, тем самым снижая паразитизм Varroa destructor на указанной пчеле.

25. Способ по п. 24 отличающийся тем, что указанная медоносная пчела представляет собой фуражира.

26. Способ по п. 24, отличающийся тем, что указанная медоносная пчела представляет собой ульевую пчелу.

27. Способ по п. 24, где нуклеиновая кислота содержит последовательность, которая по крайней мере на 95% идентична или комплементарна SEQ ID NO: 3.

28. Способ по п. 24, отличающийся тем, что указанное снижение паразитизма указанной колонии пчел включает выживаемость указанного Varroa destructor менее чем 25%.

29. Способ снижения паразитарной нагрузки на улей медоносных пчел, включающий обеспечение указанного улья эффективным количеством нуклеиновой кислоты, которая по крайней мере на 96% идентична или комплементарна по крайней мере 21 смежному нуклеотиду последовательности гена кальмодулина паразита, выбранной из группы, состоящей из SEQ ID NO: 3, 4, 88 и 89, или транскрибируемой из нее РНК, в результате чего паразитарная нагрузка на указанный улей снижается, и где указанный паразит представляет собой Varroa destructor.

30. Способ по п. 29, отличающийся тем, что указанный улей медоносной пчелы имеет первоначальную паразитарную нагрузку по меньшей мере 1 паразит на 100 пчел.

31. Способ по п. 30, отличающийся тем, что указанный улей медоносной пчелы имеет первоначальную паразитарную нагрузку по меньшей мере 2 или более паразита на 100 пчел.

32. Способ по п. 29, отличающийся тем, что указанная паразитарная нагрузка снижается до менее 10 паразитов на 100 пчел.

33. Способ по п. 29, где молекула нуклеиновой кислоты содержит последовательность, которая на 100% идентична или комплементарна SEQ ID NO: 3.

34. Способ селективной обработки видов членистоногих от Varroa destructor, включающий доставку композиции, содержащей эффективное количество нуклеиновой кислоты, которая по меньшей мере на 96% идентична или комплементарна по меньшей мере 21 смежному нуклеотиду последовательности гена кальмодулина паразита, выбранной из группы, состоящей из SEQ ID NO: 3, 4, 88 и 89, или транскрибируемой из нее РНК, видам членистоногих.

35. Способ по п. 34, отличающийся тем, что указанная обработка снижает паразитарную нагрузку указанных видов членистоногих, снижает гибель указанных видов членистоногих или предупреждает паразитарное заражение указанных видов членистоногих.

36. Способ по п. 34, отличающийся тем, что указанные виды членистоногих выбирают из группы, состоящей из Apis mellifera, Apis cerana, Trigona minima, Halictidae и Bombus sp.

37. Способ по п. 34, отличающийся тем, что указанный вид членистоногих представляют собой колониальный вид.

38. Способ по п. 37, отличающийся тем, что указанный вид членистоногих представляет собой Apis mellifera.

39. Способ по п. 34, отличающийся тем, что указанная доставка включает доставку при помощи кормушки.

40. Способ по п. 34, отличающийся тем, что указанная доставка включает распыление на рамки улья.

41. Способ по п. 34, отличающийся тем, что указанная доставка включает доставку посредством контакта с применением внутриульевого устройства, пропитанного указанной композицией.

42. Способ по п. 34, где нуклеиновая кислота содержит последовательность, которая на 100% идентична или комплементарна SEQ ID NO: 3.



 

Похожие патенты:

Изобретение относится к области биохимии, в частности к рекомбинантной нуклеиновой кислоте легкой цепи иммуноглобулина, содержащей по меньшей мере два нереаранжированных генных сегмента VL человека и по меньшей мере один нереаранжированный генный сегмент JL человека, функционально связанный с последовательностью константной области легкой цепи иммуноглобулина.

Изобретение относится к области биохимии, в частности к способам идентификации вариантного сайта распознавания для нуклеазы для индукции двунитевого разрыва. Изобретение позволяет эффективно осуществлять идентификацию вариантного сайта распознавания для нуклеазы для индукции двунитевого разрыва.

Изобретение относится к области биохимии, в частности к вариабельным доменам тяжелой и легкой цепей мышиного антитела против интерферона альфа (IFN-α) человека. Также раскрыт антигенсвязывающий фрагмент (Fab), включающий указанные вариабельные домены.

Изобретение относится к области медицины, биотехнологии и генной инженерии. Описан комплекс StCas9 белка и нового РНК-проводника для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, такой как клетка млекопитающего.

Изобретение относится к биотехнологии. Предложен набор таргетирующих конструкций, включающий первую конструкции, содержащую первую область гомологии с геном-мишенью микроорганизма, сайт узнавания эндонуклеазой и первую часть селектируемого маркера, и вторую конструкцию, содержащую вторую часть селектируемого маркера, сайт узнавания эндонуклеазой и вторую область гомологии с геном-мишенью микроорганизма, причем фрагмент первой части селектируемого маркера перекрывается с фрагментом второй части селектируемого маркера, обеспечивая возможность рекомбинации между первой и второй частями селектируемого маркера.

Изобретение относится к области биохимии, в частности к способу увеличения уровней по меньшей мере двух из PDE10a, DARPP-32, DRD1 и DRD2 в срединных шипиковых нейронах (MSN) субъекта-человека или субъекта-мыши.

Изобретение относится к соединению общей формулы (I): в которой K представляет собой активную группу эфира карбоновой кислоты или -О-RM; где RM обозначает атом Н, метальную, этильную, бензильную или трет-бутильную группу; Pr представляет собой атом Н или аминозащитную группу; # обозначает асимметричный атом С; Е представляет собой аденинильную, цитозинильную, псевдо-изоцитозинильную, гуанинильную, тиминильную, урацилильную или фенильную группу, при необходимости замещенную защитной группой для нуклеотидного основания; R1 обозначает группу общей формулы (II): в которой R2 обозначает группу эфира фосфоновой кислоты или группу фосфоновой кислоты; R3 обозначает аминозащитную группу; m обозначает 1, 2, 3 или 4; и h обозначает 0, 1, 2 или 3; при условии что сумма m и h в общей формуле (II) находится в пределах: 2≤х≤5.

Группа изобретений относится к рекомбинантной дрожжевой клетке-хозяину для продуцирования ксилита и ее применению. Указанная клетка-хозяин продуцирует D-арабит из глюкозы и содержит последовательность гетерологичной нуклеиновой кислоты, кодирующую NAD+-специфическую D-арабит-4-оксидоредуктазу (EC 1.1.1.11), использующую D-арабит в качестве субстрата и дающую D-ксилулозу в качестве продукта, и последовательность гетерологичной нуклеиновой кислоты, кодирующую NADPH-специфическую ксилитдегидрогеназу, использующую D-ксилулозу в качестве субстрата и дающую ксилит в качестве продукта.

Изобретение относится к области биохимии, в частности к способу получения семя-специфичного растительного промотора высокой экспрессии, содержащему функциональное связывание с промотором одной молекулы нуклеиновых кислот, усиливающих экспрессию нуклеиновой кислоты (NEENA), гетерологичных по отношению к указанному промотору.

Изобретение относится к биотехнологии, а именно к рекомбинантному штамму вируса осповакцины (ВОВ), продуцирующему апоптоз-индуцирующий онкотоксический белок NS1 парвовируса крыс Н-1 и обладающему онколитической активностью в отношении глиобластомы человека.

Изобретение относится к биотехнологии. Описано средство на основе двухцепочечной рибонуклеиновой кислоты (дцРНК) для ингибирования экспрессии серпина c1, где указанное средство на основе дцРНК содержит смысловую цепь и антисмысловую цепь, где указанная антисмысловая цепь содержит область комплементарности, которая содержит по меньшей мере 19 последовательно расположенных нуклеотидов, отличающихся не более чем на 3 нуклеотида от нуклеотидной последовательности 5’-UUGAAGUAAAUGGUGUUAACCAG-3’(SEQ ID NO: 562), где указанная смысловая цепь независимо имеет длину по меньшей мере 19 нуклеотидов и где лиганд, включающий одно или более производных N-ацетилгалактозамина (GalNAc), конъюгирован с 3’-концом указанной смысловой цепи указанного средства на основе дцРНК.

Изобретение относится к биотехнологии. Описана двунитевая рибонуклеиновая кислота (днРНК) для ингибирования экспрессии ALAS1.

Изобретение относится к области медицины. Предложена фармацевтическая композиция для лечения рака, включающая одну или несколько миРНК, выбранных из группы, состоящей из miR-3670 и miR-8078, где miR-3670 включает двухцепочечную РНК, представленную нуклеотидными последовательностями SEQ ID NO: 35 и SEQ ID NO: 36, и miR-8078 включает двухцепочечную РНК, представленную нуклеотидными последовательностями SEQ ID NO: 65 и SEQ ID NO: 66.

Изобретение относится к области медицины и предназначено для лечения спинальной мышечной атрофии (СМА). Способ включает введение посредством болюсной инъекции в интратекальное пространство субъекта, являющегося человеком, антисмыслового соединения, содержащего антисмысловой олигонуклеотид, состоящий из 18 связанных нуклеозидов, где каждая межнуклеозидная связь олигонуклеотида представляет собой фосфоротиоатную связь, где каждый нуклеозид олигонуклеотида представляет собой 2'-МОЭ нуклеозид и где введение антисмыслового соединения усиливает включение экзона 7 в SMN2 мРНК транскриптах у субъекта, являющегося человеком.

Настоящее изобретение представляет собой композицию вакцины от бешенства, включающую ИОВБ и адъювант PIKA, а также их фармацевтическое применение. Настоящее изобретение также относится к способу профилактики или лечения заражения вирусом бешенства, включающему стадию введения композиции вакцины от бешенства в организм хозяина.

Изобретение относится к фармацевтической промышленности, а именно к способу уменьшения продуцирующих внеклеточный матрикс клеток в легких или подавления увеличения продуцирующих внеклеточный матрикс клеток в легких (варианты) и к композиции для уменьшения продуцирующих внеклеточный матрикс клеток в легких или подавления увеличения продуцирующих внеклеточный матрикс клеток в легких.

Изобретение относится к биохимии. Описано двухцепочечное средство для РНКи для ингибирования экспрессии транстиретина (TTR), содержащее смысловую цепь, комплементарную антисмысловой цепи, где указанная антисмысловая цепь содержит последовательность, комплементарный нуклеотидам 504-526 гена транстиретина (TTR) (SEQ ID NO:1), где смысловая цепь имеет длину 21 нуклеотид, а антисмысловая цепь имеет длину 23 нуклеотида.

Настоящее изобретение относится к области биотехнологии, конкретно к полипептидному биомаркеру эффективности применения ингибитора FGFR при лечении рака мочевого пузыря и рака легких, что может быть использовано в медицине.

Изобретение относится к области биотехнологии, конкретно к самособирающейся в наночастицу олигонуклеотидной конструкции, и может быть использовано в медицине. Олигонуклеотидная конструкция согласно настоящему изобретению может быть полезной в качестве системы доставки на основе олигонуклеотида нового типа, а также инструмента для лечения злокачественных заболеваний, инфекционных заболеваний и т.п.

Настоящее изобретение относится к области биотехнологии. Предложены композиции для предотвращения или лечения заболеваний, ассоциированных с вирусом папилломы человека (HPV).

Изобретение относится к сельскому хозяйству. Предложен способ повышения продуктивности и устойчивости растений к фитопатогенам, предусматривающий получение биологически активной композиции из биомассы компостных олигохет и обработку семян или вегетирующих растений.

Изобретение относится к области биохимии, в частности к композиции против клещей Varroa destructor, содержащей в эффективном количестве молекулу нуклеиновой кислоты, имеющую последовательность, которая по меньшей мере на 96 комплементарна или идентична по меньшей мере 21 смежному нуклеотиду последовательности гена кальмодулина, а также к ее использованию для снижения паразитизма Varroa destructor на медоносной пчеле и для селективной обработки видов членистоногих от Varroa destructor. Также раскрыт конструкт для ингибирования гена Varroa destructor, содержащий нуклеиновую кислоту, которая кодирует дцРНК, содержащую последовательность нуклеиновой кислоты, которая по меньшей мере на 96 идентична или комплементарна по меньшей мере 21 смежному нуклеотиду последовательности гена кальмодулина. Изобретение позволяет эффективно снижать паразитизм Varroa destructor на медоносной пчеле. 6 н. и 36 з.п. ф-лы, 7 ил., 6 табл., 11 пр.

Наверх