Способ скрининга противомикробного реагента

Предложен способ скрининга противомикробного агента против микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха. Способ включает (a) получение одного или нескольких микроорганизмов, которые вызывают неприятный запах в системе кондиционирования воздуха; (b) взаимодействие образца для анализа с микроорганизмом; (c) измерение ингибирования роста микроорганизма; и (d) определение того, что образец обладает противомикробной активностью в отношении микроорганизма, если рост микроорганизма ингибируется. Микроорганизмы, которые вызывают неприятный запах в системе кондиционирования воздуха, выбирают из группы, состоящей из Microbacterium trichothecenolyticum HKMC-112 (accession number: KCCM11395P), Microbacterium flavescens HKMC-104 (accession number: KCCM11387P), Methylobacterium dankookense HKMC-101 (accession number: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (accession number: KCCM11385P), Methylobacterium tardum HKMC-103 (accession number: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (accession number: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (accession number: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (accession number: KCCM11389P), Sphingomonas humi HKMC-107 (accession number: KCCM11390P), Sphingomonas melonis HKMC-108 (accession number: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (accession number: KCCM11392P), Staphylococcus warneri HKMC-110 (accession number: KCCM11393P) или их культуры. Предложен также способ ингибирования роста микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха, и способ удаления неприятного запаха в системе кондиционирования воздуха. 3 н. и 3 з.п. ф-лы, 3 ил, 10 табл., 3 пр.

 

Предпосылки создания изобретения

(a) Область техники, к которой относится изобретение

Настоящее изобретение относится к способу скрининга противомикробного реагента, который позволяет контролировать микроорганизмы, которые могут вызвать неприятный запах в системе кондиционирования воздуха, и к способу устранения неприятного запаха в системе кондиционирования воздуха.

(b) Уровень техники

Чистый воздух считается неотъемлемым компонентом здоровья и хорошего самочувствия человека, и неприятно пахнущий или загрязненный воздух портит приятную окружающую среду. Например, неудовлетворительное качество воздуха в герметично закрытом помещении обусловлено двумя важными факторами. Одним фактором являются загрязнители воздуха, возникающие из самой структуры (здания или транспортного средства), представляющей собой герметичную среду, и другим фактором является запах, возникающий в результате жизнедеятельности человека или из материалов, полученных извне.

Система кондиционирования воздуха, которую используют в зданиях, транспортных средствах, поездах, судах, самолетах и т.п., относится к системе, предназначенной для снижения температуры в помещении и оптимизации внутренней среды с целью приведения к требуемым условиям температуры, влажности, скорости потока и чистоты воздуха. С увеличением уровня жизни постепенно возрастает использование системы кондиционирования воздуха. Хотя имеются значительные улучшения в основной функции системы кондиционирования воздуха, многие проблемы еще предстоит решить в экологическом аспекте качества воздуха в помещении.

Известно, что причиной запаха системы кондиционирования воздуха, в частности, кондиционера, являются метаболиты, вырабатываемым плесневыми грибками и бактериями. Однако типы плесневых грибков и бактерий, и вещества и количество, производимое плесневыми грибками и бактериями, еще не были конкретно определены.

В системе кондиционирования воздуха, весь воздух, который прошел через воздуходув, передается на сердцевину испарителя. Во время теплообмена между холодным хладагентом и воздухом, конденсация воды происходит на поверхности сердцевины испарителя вследствие разницы температур. Если продолжается конденсация воды, среда, благоприятная для проживания и размножения плесневых грибков и бактерий, создается на сердцевине испарителя. Если плесневые грибки и бактерии размножаются на сердцевине испарителя, подвергающегося воздействию внешнего воздуха, микробные летучие органические соединения (mVOCs) продуцируются микроорганизмами в качестве метаболитов. Таким образом, когда воздух, который прошел через сердцевину испарителя, поступает в помещение, помещение может подвергаться воздействию неприятного запаха, обусловленного летучими органическими соединениями, продуцируемыми плесневыми грибками и бактерими, после длительного использования.

После длительного использования поверхность сердцевины испарителя покрывается биопленкой, которая включает бактерии, скопления клеток и внеклеточные полимерные вещества (EPS). EPS включает различные компоненты, такие как белки, полисахариды, полиуроновые кислоты, нуклеиновые кислоты, липиды и т.п. На поверхности сердцевины испарителя пролифирируют различные бактерии и плесневые грибки с использованием биопленки в качестве питательных веществ и производят различные микробные летучие органические соединения (mVOCs) в качестве метаболитов, которые известны, как одна из причин неприятного запаха из кондиционера.

Хотя различные типы освежителя воздуха являются коммерчески доступными для удаления такого неприятного запаха, они по существу не устраняют плесневые грибки и бактерии, пролиферирующие на сердцевине испарителя, а просто временно разбавляют неприятный запах. Хотя противомикробные реагенты, которые коммерчески доступны в настоящее время, не были созданы для специфического воздействия на определенные виды плесневых грибков или бактерий, пролиферирующих на сердцевине испарителя, но их используют, так как они обладают противомикробным действием в отношении распространенных патогенных микроорганизмов.

Соответственно, создание противомикробного реагента, который может создать приятную воздушную среду в помещении путем специфического ингибирования или предотвращения пролиферации плесневых грибков и бактерий, размножающихся на сердцевине испарителя, и способа устранения неприятного запаха с использованием указанного противомикробного реагента является насущной необходимостью.

Приведенное выше описание предшествующего уровня техники предназначено только для улучшения понимания уровня техники настоящего изобретения, и его не следует рассматривать как признание того, что описанные выше технологии известны обычным специалистам в данной области техники, к которой относится настоящее изобретение.

Сущность изобретения

Авторы настоящего изобретения предприняли усилия, чтобы найти способ эффективного контроля микроорганизмов, пролиферирующих в системе кондиционирования воздуха и вызывающих неприятный запах. В результате, авторы изобретения успешно провели скрининг 12 видов микроорганизмов, которые пролиферируют в системе кондиционирования воздуха, образуют биопленку и вызывают неприятный запах, и подтвердили, что неприятный запах системы кондиционирования воздуха можно существенно устранить путем контроля микроорганизмов.

Соответственно, настоящее изобретение относится к предоставлению способа скрининга противомикробного реагента против микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха, который выбран из группы, состоящей из Microbacterium trichothecenolyticum, Microbacterium flavescens, Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium tardum, Methylobacterium radiotolerans, Sphingomonas dokdonensis, Sphingomonas ginsenosidimutans, Sphingomonas humi, Sphingomonas melonis, Staphylococcus hominis subsp. hominis и Staphylococcus warneri.

Настоящее изобретение также относится к получению микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха.

Настоящее изобретение также относится к предоставлению способа ингибирования роста микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха, который включает нанесение или распыление противомикробного реагента в системе кондиционирования воздуха.

Настоящее изобретение также относится к предоставлению способа удаления неприятного запаха в системе кондиционирования воздуха, который включает выделение или устранение микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха.

Настоящее изобретение также относится к предоставлению способа удаления неприятного запаха в системе кондиционирования воздуха, который включает ингибирование роста микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха.

Другие отличительные признаки и аспекты настоящего изобретения будут очевидны из приведенного ниже подробного описания, чертежей и формулы изобретения.

В одном аспекте настоящее изобретение предлагает способ скрининга противомикробного реагента против микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха, который включает:

(a) получение одного или нескольких микроорганизмов, которые вызывают неприятный запах в системе кондиционирования воздуха и которые выбирают из группы, состоящей из Microbacterium trichothecenolyticum, Microbacterium flavescens, Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium tardum, Methylobacterium radiotolerans, Sphingomonas dokdonensis, Sphingomonas ginsenosidimutans, Sphingomonas humi, Sphingomonas melonis, Staphylococcus hominis subsp. hominis и Staphylococcus warneri или их культуры;

(b) контактирование образца для анализа с микроорганизмом;

(c) измерение ингибирования роста микроорганизма или уменьшения образования неприятного запаха; и

(d) определение того, что образец обладает противомикробной активностью в отношении микроорганизма, если ингибируется рост микроорганизма или уменьшается образование неприятного запаха.

Авторы настоящего изобретения приложили усилия, чтобы найти способ эффективного контроля микроорганизмов, пролифирирующих в системе кондиционирования воздуха и вызывающих неприятный запах. В результате, авторы настоящего изобретения успешно провели скрининг 12 видов микроорганизмов, которые пролиферируют в системе кондиционирования воздуха, образуя в то же время биопленку, и вызывают неприятный запах, и подтвердили, что неприятный запах системы кондиционирования воздуха можно существенно ингибировать путем их контроля.

В настоящем изобретении термин “система кондиционирования воздуха” относится к системе, которая поддерживает приятную температуру, влажность, чистоту, поток и т.п. воздуха внутри пространства, которое полностью или частично изолировано от внешней среды. В качестве конкретного примера, изолированное пространство может представлять собой закрытое пространство, которое полностью или частично изолировано снаружи, например, внутри здания, транспортного средства, поезда, корабля, самолета и т.п. В качестве конкретного примера, система кондиционирования воздуха может представлять собой кондиционер.

В системе кондиционирования воздуха, весь воздух, который прошел через воздуходув, поступает на сердцевину испарителя. На поверхности сердцевины испарителя, создается среда, благоприятная для роста микроорганизмов, поскольку из-за разности температур постоянно происходит конденсация воды. В результате со временем формируется биопленка. Микроорганизмы усваивают различные вещества, плавающие в воздухе внутри или вне помещения, в качестве питательных веществ, и производят различные микробные летучие органические соединения (mVOCs) в виде метаболитов, которые издают неприятный запах.

Биопленка представляет собой группу живых микроорганизмов, заключенных в мембрану. Мембрана защищает микроорганизмы от внешней среды и обеспечивает питательными веществами. Мембрана содержит внеклеточные полимерные вещества (EPS), которые включают различные компоненты, такие как белки, полисахариды, полиуроновые кислоты, нуклеиновые кислоты, липиды и т.п. На поверхности сердцевины испарителя разнообразные микроорганизмы пролиферируют, используя их в качестве питательных веществ, и производят метаболиты, которые издают неприятный запах.

Авторы настоящего изобретения провели скрининг микроорганизмов, которые вызывают неприятный запах из сердцевины испарителя и, с помощью культивирования, выделили доминирующие штаммы среди микроорганизмов, образующих колонии. Доминирующие штаммы можно выделить и культивировать согласно различным способам, известными из предшествующего уровня техники, и они могут быть подвергнуты скринингу, например, на основе показателей разведения или морфологических характеристик, таких как цвет, размер, форма и т.п. колоний.

Преобладающие микроорганизмы включают микроорганизмы рода Microbacterium, Methylobacterium, Sphingomonas или Staphylococcus, предпочтительно два вида из рода Microbacterium (Microbacterium trichothecenolyticum или Microbacterium flavescens), четыре вида из рода Methylobacterium (Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium tardum или Methylobacterium radiotolerans), четыре вида из рода Sphingomonas (Sphingomonas dokdonensis, Sphingomonas ginsenosidimutans, Sphingomonas humi или Sphingomonas melonis) или два вида из рода Staphylococcus (Staphylococcus hominis subsp. hominis или Staphylococcus warneri).

Указанные микроорганизмы были депонированы 26 февраля 2013 в Корейском центре культур микроорганизмов и получили следующие учетные номера: Microbacterium trichothecenolyticum HKMC-112 (учетный номер: KCCM11395P), Microbacterium flavescens HKMC-104 (учетный номер: KCCM11387P), Methylobacterium dankookense HKMC-101 (учетный номер: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (учетный номер: KCCM11385P), Methylobacterium tardum HKMC-103 (учетный номер: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (учетный номер: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (учетный номер: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (учетный номер: KCCM11389P), Sphingomonas humi HKMC-107 (учетный номер: KCCM11390P), Sphingomonas melonis HKMC-108 (учетный номер: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (учетный номер: KCCM11392P) и Staphylococcus warneri HKMC-110 (учетный номер: KCCM11393P).

Микроорганизмы, вызывающие неприятный запах, являются промышленно применимым для различных целей. Например, они могут быть использованы для создания нового противомикробного реагента, способного ингибировать рост микроорганизмов, или для создания освежителя воздуха, предназначенного для удаления неприятного запаха, путем выявления химических свойств метаболитов микроорганизмов. Кроме того, они могут быть использованы для радикального устранения причины неприятного запаха путем предоставления системы кондиционирования воздуха со средой, где микроорганизмы не могут жить.

Образец, используемый в способе скрининга противомикробного реагента по настоящему изобретению, представляет собой образец, предназначенный для определения обладает ли он противомикробной активностью в отношении микроорганизмов. Например, если конкретный образец обладает противомикробной активностью в отношении Methylobacterium dankookense, образец может быть отобран в качестве противомикробного реагента против Methylobacterium dankookense.

Предпочтительно, противомикробный реагент, отобранный с помощью способа скрининга настоящего изобретения, может обладать противомикробной активностью в отношении одного или нескольких микроорганизмов, выбранных из группы, состоящей из Microbacterium trichothecenolyticum, Microbacterium flavescens, Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium tardum, Methylobacterium radiotolerans, Sphingomonas dokdonensis, Sphingomonas ginsenosidimutans, Sphingomonas humi, Sphingomonas melonis, Staphylococcus hominis subsp. hominis и Staphylococcus warneri. Более предпочтительно, он может дополнительно обладать противомикробной активностью против других видов микроорганизмов.

Например, один противомикробный реагент может обладать противомикробной активностью в отношении всех 12 видов микроорганизмов, и другой противомикробный реагент может вообще не обладать противомикробной активностью в отношении одного или нескольких видов. Кроме того, противомикробный реагент, обладающий противомикробной активностью в отношении всех 12 видов микроорганизмов, может обладать различной противомикробной активностью в отношении различных микроорганизмов (смотреть таблицы 8 и 9).

В одном предпочтительном варианте осуществления настоящего изобретения противомикробный реагент, отобранный с помощью метода скрининга по настоящему изобретению, может обладать противомикробной активностью в отношении одного или нескольких микроорганизмов, выбранных из группы, состоящей из Microbacterium trichothecenolyticum HKMC-112 (учетный номер: KCCM11395P), Microbacterium flavescens HKMC-104 (учетный номер: KCCM11387P), Methylobacterium dankookense HKMC-101 (учетный номер: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (учетный номер: KCCM11385P), Methylobacterium tardum HKMC-103 (учетный номер: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (учетный номер: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (учетный номер: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (учетный номер: KCCM11389P), Sphingomonas humi HKMC-107 (учетный номер: KCCM11390P), Sphingomonas melonis HKMC-108 (учетный номер: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (учетный номер: KCCM11392P) и Staphylococcus warneri HKMC-110 (учетный номер: KCCM11393P).

В одном предпочтительном примере осуществления по настоящему изобретению, образец для скрининга включает одно соединение, смесь соединений, животный или растительный экстракт, биологический агент, содержащий генетическую информацию, такую как нуклеотид, полипептид, и т.п., и смесь соединения и биологического агента.

В одном аспекте настоящего изобретения предложен микроорганизм, вызывающий неприятный запах в системе кондиционирования воздуха.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Microbacterium trichothecenolyticum, более предпочтительно Microbacterium trichothecenolyticum HKMC-112, депонированный с учетным номером KCCM11395P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Microbacterium flavescens, более предпочтительно Microbacterium flavescens HKMC-104, депонированный с учетным номером KCCM11387P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Methylobacterium dankookense, более предпочтительно Methylobacterium dankookense HKMC-101, депонированный с учетным номером KCCM11384P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Methylobacterium phyllosphaerae, более предпочтительно Methylobacterium phyllosphaerae HKMC-102, депонированный с учетным номером KCCM11385P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Methylobacterium tardum, более предпочтительно Methylobacterium tardum HKMC-103, депонированный с учетным номером KCCM11386P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Methylobacterium radiotolerans, более предпочтительно Methylobacterium radiotolerans HKMC-11,1 депонированный с учетным номером KCCM11394P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Sphingomonas dokdonensis, более предпочтительно Sphingomonas dokdonensis HKMC-105, депонированный с учетным номером KCCM11388P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Sphingomonas ginsenosidimutans, более предпочтительно Sphingomonas ginsenosidimutans HKMC-106, депонированный с учетным номером KCCM11389P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Sphingomonas humi, более предпочтительно Sphingomonas humi HKMC-107, депонированный с учетным номером KCCM11390P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Sphingomonas melonis, более предпочтительно Sphingomonas melonis HKMC-108, депонированный с учетным номером KCCM11391P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Staphylococcus hominis subsp. hominis, более предпочтительно Staphylococcus hominis subsp. hominis HKMC-109, депонированный с учетным номером KCCM11392P.

Микроорганизм, вызывающий неприятный запах, может быть предпочтительно Staphylococcus warneri, более предпочтительно Staphylococcus warneri HKMC-110, депонированный с учетным номером KCCM11393P.

В другом аспекте в настоящем изобретении предложен способ ингибирования роста микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха, который включает нанесение или распыление противомикробного реагента в системе кондиционирования воздуха.

Противомикробный реагент, который можно использовать в настоящем изобретении, может представлять собой любой противомикробный реагент, который, как установлено, или как может быть установлено, обладает противомикробной активностью в отношении одного или нескольких микроорганизмов, выбранных из группы, состоящей из Microbacterium trichothecenolyticum, Microbacterium flavescens, Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium tardum, Methylobacterium radiotolerans, Sphingomonas dokdonensis, Sphingomonas ginsenosidimutans, Sphingomonas humi, Sphingomonas melonis, Staphylococcus hominis subsp. hominis и Staphylococcus warneri, или против микроорганизмов, включая по меньшей мере один из перечисленных выше микроорганизмов. Противомикробный реагент может быть нанесен или распылен в системе кондиционирования воздуха для ингибирования роста одного или нескольких микроорганизмов, вызывающих неприятный запах, которые выбирают из группы, состоящей из Microbacterium trichothecenolyticum, Microbacterium flavescens, Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium tardum, Methylobacterium radiotolerans, Sphingomonas dokdonensis, Sphingomonas ginsenosidimutans, Sphingomonas humi, Sphingomonas melonis, Staphylococcus hominis subsp. hominis и Staphylococcus warneri, или рост микроорганизмов, включая по меньшей мере один из перечисленных выше микроорганизмов. Противомикробный реагент может быть нанесен или распылен в различных формах, известных в данной области техники, таких как газ, жидкость, гель, суспензия и т.п.

Нанесение или распыление может быть осуществлено частично или полностью на внутренней поверхности или внутренних компонентах системы кондиционирования воздуха. Предпочтительно, нанесение или распыление может быть осуществлено на сердцевину испарителя в системе кондиционирования воздуха. Нанесение или распыление может быть осуществлено после того, как один или несколько микроорганизмов, выбранных из группы, состоящей из Microbacterium trichothecenolyticum, Microbacterium flavescens, Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium tardum, Methylobacterium radiotolerans, Sphingomonas dokdonensis, Sphingomonas ginsenosidimutans, Sphingomonas humi, Sphingomonas melonis, Staphylococcus hominis subsp. hominis и Staphylococcus warneri, или микроорганизма, содержащего по меньшей мере один из перечисленных выше микроорганизмов, образует биопленку или перед тем как один или неколько микроорганизмов, выбранных из группы, состоящей из Microbacterium trichothecenolyticum, Microbacterium flavescens, Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium tardum, Methylobacterium radiotolerans, Sphingomonas dokdonensis, Sphingomonas ginsenosidimutans, Sphingomonas humi, Sphingomonas melonis, Staphylococcus hominis subsp. hominis и Staphylococcus warneri или микроорганизма, содержащего по меньшей мере один из перечисленных выше микроорганизмов, образует биопленку.

Сердцевина испарителя может быть сделана из любого материала. Предпочтительно, сердцевина испарителя может быть сделана из алюминия, сплава алюминия, меди или сплава меди.

В одном аспекте в настоящем изобретении предложен способ удаления неприятного запаха в системе кондиционирования воздуха, который включает нанесение или распыление противомикробного реагента в системе кондиционирования воздуха.

Нанесение или распыление может быть осуществлено для удаления всего или некоторой части неприятного запаха или для предотвращения появления неприятного запаха до его образования.

Различные микроорганизмы размножаются в системе кондиционирования воздуха. Микроорганизмы по большей части можно разделить на микроорганизмы, вызывающие неприятный запах, и микроорганизмы, не вызывающие неприятный запах. Соответственно, если противомикробный реагент специфически воздействует только на микроорганизмы, вызывающие неприятный запах, или обладает ингибирующей активностью в отношении роста всех или некоторых доминирующих видов микроорганизмов, вызывающих неприятный запах, неприятный запах системы кондиционирования воздуха может быть улучшен частично или полностью.

В одном аспекте настоящее изобретение предлагает способ удаления неприятного запаха в системе кондиционирования воздуха, который включает выделение или уничтожение одного или нескольких микроорганизмов, вызывающих неприятный запах в системе кондиционирования воздуха, который выбран из группы, состоящей из Microbacterium trichothecenolyticum, Microbacterium flavescens, Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium tardum, Methylobacterium radiotolerans, Sphingomonas dokdonensis, Sphingomonas ginsenosidimutans, Sphingomonas humi, Sphingomonas melonis, Staphylococcus hominis subsp. hominis и Staphylococcus warneri.

Микроорганизм или микроорганизм, содержащий по меньшей мере один из перечисленных выше микроорганизмов, может быть выделен или уничтожен частично или полностью физическим, химическим или биологическим способом. Физический способ может представлять собой способ искусственного выделения или уничтожения микроорганизма или микроорганизма, содержащего по меньшей мере один из перечисленных выше микроорганизмов, с использованием физической аппаратуры. Химический способ может представлять собой способ выделения или уничтожения микроорганизма или микроорганизма, содержащего по меньшей мере один из перечисленных выше микроорганизмов, с использованием противомикробного реагента или стерилизующего вещества против микроорганизма. Биологический способ может представлять собой способ выделения или уничтожения микроорганизма с использованием биологического реагента, который является токсичным для микроорганизма, или с использованием другого микроорганизма, который конкурирует с микроорганизмом за выживание. Однако настоящее изобретение не ограничивается указанными примерами.

В одном аспекте настоящее изобретение предлагает способ удаления неприятного запаха в системе кондиционирования воздуха, который включает ингибирование роста одного или нескольких микроорганизмов, вызывающих неприятный запах в системе кондиционирования воздуха, которые выбраны из группы, состоящей из Microbacterium trichothecenolyticum, Microbacterium flavescens, Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium tardum, Methylobacterium radiotolerans, Sphingomonas dokdonensis, Sphingomonas ginsenosidimutans, Sphingomonas humi, Sphingomonas melonis, Staphylococcus hominis subsp. hominis и Staphylococcus warneri.

Отличительные признаки и преимущества настоящего изобретения могут быть суммированы следующим образом.

(i) В настоящем изобретении предложен микроорганизм, вызывающий неприятный запах в системе кондиционирования воздуха.

(ii) В настоящем изобретении также предложен способ скрининга противомикробного реагента, который позволяет контролировать микроорганизм.

(iii) Кроме того, в настоящем изобретении предложен способ удаления неприятного запаха в системе кондиционирования воздуха путем контроля микроорганизма.

(iv) Микроорганизм, вызывающий неприятный запах в системе кондиционирования воздуха по настоящему изобретению, можно использовать для создания нового противомикробного реагента или для создания освежителя воздуха, предназначенного для удаления неприятного запаха путем выявления химических свойств метаболитов микроорганизмов. Кроме того, он может быть использован для радикального устранения причины неприятного запаха путем предоставления системы кондиционирования воздуха со средой, где микроорганизмы не могут жить.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фиг. 1 показан образец, взятый из сердцевины испарителя подержанного автомобиля, издающего неприятный запах.

На фиг. 2 представлен способ тестирования противобактериальной активности согласно настоящему изобретению.

На фиг. 3 представлена комбинация доминирующих не имеющих запаха микроорганизмов, культивируемых на алюминевом ребре теплообменного устройства, в котором алюминий является материалом сердцевины испарителя.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Настоящее изобретение будет описано более подробно с помощью примеров. Следующие примеры приведены только в иллюстративных целях, и специалистам в данной области очевидно, что объем настоящего изобретения не ограничивается приведенными примерами.

ПРИМЕРЫ

Пример 1. Скрининг доминирующих микроорганизмов, вызывающих неприятный запах

1. Подготовка подержанного автомобиля, издающего неприятный запах, и отсоединение системы кондиционирования воздуха

Для того, чтобы выявить причину неприятного запаха, образующегося в герметичной среде, например, внутри автомобиля, системы кондиционирования воздуха вынимали из 10 подержанных машин, испускавших неприятный запах, в разные времена года (зима: февраль-март, лето: июнь-июль). Затем брали образцы из сердцевин испарителей, которые, как предполагали, имели биопленки, образованные на них микроорганизмами, вызывающими неприятный запах в системах кондиционирования воздуха (таблица 1).

Таблица 1
No. Пробег автомобиля Время года
1 89000 км зима (февраль-март)
2 70000 км
3 10300 км
4 37100 км
5 149970 км
6 35000 км лето (июнь-июль)
7 28000 км
8 42000 км
9 110000 км
10 90000 км

2. Получение образца сердцевины испарителя

Сердцевины испарителей, взятые из подержанных автомобилей 1-10, издающих неприятный запах, хранили при температуре 4°C перед тем, как использовали образцы, полученные из сердцевины испарителя, в полиэтиленовых мешках. Для выделения и культивирования микроорганизмов 5 г образца брали из выбранных случайным образом частей каждой сердцевины испарителя, включая передние и задние поверхности, с использованием стерилизованных длинноносых плоскогубцев (фиг. 1).

3. Выделение микроорганизмов

Микроорганизмы выделяли из образца, взятого из сердцевины испарителя, как указано далее.

1) Образец, взятый из сердцевины испарителя, перемешивали и помещали в смеситель.

2) 200 мл стерильного 1x фосфатно-солевого буферного раствора (PBS) добавляли в смеситель.

3) Перемешанный образец и PBS смешивали в течение 30 сек.

4) Смеситель оставляли на льду в течение 1 мин.

5) Стадии 3) и 4) повторяли еще два раза.

6) Полученную суспензию центрифугировали при температуре 4°С в течение 3 мин при 13000 об/мин.

7) Брали супернатант и переносили в новую пробирку.

8) Поверхность сердцевины испарителя, с которой брали пробу, протирали несколько раз стерильным ватным тампоном, смоченным супернатантом.

9) Головку ватного тампона помещали в супернатант и затем перемешивали на вортексе.

10) Осадок, полученный на стадии 6), и смесь, полученную на стадии 9), смешивали и использовали в качестве раствора для инокуляции.

Микроорганизмы физически выделяли из сердцевин испарителей автомобилей 1-10 посредством стадий 1)-10).

4. Выделение микроорганизмов, вызывающих неприятный запах, и скрининг доминирующих видов.

Аэробные гетеротрофные бактерии, обычно называемые нормальными бактериями, выделяли из кондиционера путем культивирования на чашке с гетеротрофной питательной средой. Нормальные бактерии выделяли путем культивирования при температуре 28-30°C в течение 14 дней с использованием агаровой среды PTYG и агаровой среды R2A в качестве сложных питательных сред. Агаровую среду PTYG получали путем добавления 0,25 г пептона (Difco), 0,25 г триптона (Difco), 0,5 г дрожжевого экстракта (Difco), 0,5 г глюкозы (Difco), 30 мг MgSO4 (Sigma), 3 мг CaCl2 (Sigma) и 15 г агара Bacto (Difco) к 980 мл дистиллированной воды и стерилизации при температуре 121°C в течение 15 минут под высоким давлением с последующим доведением значения рН до 7,0. Агаровую среду R2A получали путем добавления 0,5 г дрожжевого экстракта (Difco), 0,5 г протеозопептона No.3 (Difco), 0,5 г казаминовых кислот (Difco), 0,5 г декстрозы (Difco), 0,5 г растворимого крахмала (Difco), 0,3 г пирувата натрия (Difco), 0,3 г сульфата калия двузамещенного (Difco), 0,05 г сульфата магния (Difco) и 15 г агара Bacto (Difco) к 980 мл дистиллированной воды и стерилизации при температуре 121°C в течение 15 минут под высоким давлением с последующим доведением значения рН до 7,2. Для выделения недоминирующих бактерий антибиотические среды готовили путем инокулирования канамицина, ампициллина или хлорамфеникола при температуре 50°С после стерилизации сред фильтрованием до концентрации 100 м.д.

Доминирующие штаммы выделяли и культивировали на основе показателей разведения или морфологических характеристик, таких как цвет, размер, форма и т.п. колоний, как указано далее.

1) Плесневые грибки и бактерии выделяли из среды с изолированными культурами.

2) Бактерии, проявляющие различные морфологические свойства, разделяли путем инокуляции в сложные среды с использованием петли.

3) Из инокулированных сред выбирали и пересевали бактериальную культуру, показывающую наилучший рост.

4) Плесневые грибки инокулировали в сложные среды после удаления концевых частей грибных нитей с использованием скальпеля.

5) Из инокулированных сред выбирали и пересевали грибковую культуру, показывающую наилучший рост.

5. Идентификация доминирующих микроорганизмов

Для точной идентификации выделенных микроорганизмов, проводили анализ 16S рРНК, как указано далее.

a) Метод "отпечатков пальцев", основанный на анализе паттерна REP-ПЦР

REP-ПЦР представляет собой молекулярно-биологическую технологию "отпечатков пальцев", предназначенную для структурного анализа бактериальных хромосом, которая обеспечивает распознавание каждого бактериального штамма. Генетические характеристики анализировали с помощью REP-ПЦР, как указано далее.

(1) Лизис клеток

1) 2,5 мкл реагента для ПЦР, Lyse-N-Go (Thermo), добавляли в пробирку для ПЦР.

2) Колонию пипетировали в пробирке на рабочем месте с асептическими условиями. Во время пипетирования соблюдали осторожность, чтобы полученный раствор не стал мутным.

3) Культивирование осуществляли с помощью ПЦР-машины в соответствии с инструкциями изготовителя.

(2) ПЦР

С использованием реагента для ПЦР, приготовленного, как описано в таблице 2, ПЦР-амплификацию осуществляли путем проведения преденатурации при температуре 93°C в течение 7 мин и повторения 33 циклов денатурации при температуре 92°C в течение 1 мин, отжига при температуре 51,5°C в течение 1 мин и удлинение при температуре 65°C в течение 8 мин, как описано в таблице 3.

Таблица 2
1 дНТФ (2,5 мМ каждый) 12,5 мкл
2 Буфер Gitschier 5,0 мкл
3 ДМСО (100%) 2,5 мкл
4 Автоклавированная 3° дист. вода 0,3 мкл
5 Праймер BOXA1R (50 пмоль/мкл)
5'CTACGGCAAGGCGACGCTGACG
1,0 мкл
6 БСА (10 мг/мл) 0,4 мкл
7 Бактериальная ДНК 2,5 мкл
8 Полимераза Taq (Roche) (5 Ед/мкл) 0,8 мкл

Таблица 3
Стадия 1 93°C 7 мин
Стадия 2 92°C 1 мин
Стадия 3 51,5°C 1 мин
Стадия 4 65°C 8 мин
Стадия 5 стадии 2, 3 & 4: дополнительные 33 цикла
Стадия 6 65°C 16 мин
Стадия 7 4°C

(3) Гель-электрофорез

Фрагменты ДНК-амплифицированной ДНК помещали на 1,2-1,5% агарозный гель, с добавлением EtBr после смешивания 6x красителя с образцом в отношении 1:5. Поскольку большинство продуктов ПЦР находилось в диапазоне 100-1000 п.о., их помещали вместе с маркерами длиной 100 п.о. Затем проводили электрофорез как можно медленнее (50 V), так, чтобы красители бромфеноловый синий и ксиленцианол проходили половину всего геля. Штаммы, демонстрирующие аналогичный паттерн ДНК на геле, считали одинаковыми штаммами.

b) Идентификация доминирующих бактерий, полученных из кондиционера, на основе анализа генов 16S рРНК

Ген 16S рибосомальной рибонуклеиновой кислоты (рРНК) используется для генетической идентификации бактерий. Бактерии, дифференцированные с помощью REP-ПЦР, могут быть идентифицированы на уровне рода и вида.

(1) Лизис клеток

1) 5 мкл реагента для ПЦР, Lyse-N-Go (Thermo), добавляли в пробирку для ПЦР.

2) Колонию пипетировали в пробирке на рабочем месте с асептическими условиями. Пипетирование осуществляли таким образом, чтобы полученный раствор стал слегка мутным.

3) Лизис клеток проводили на ПЦР-машине в соответствии с инструкциями изготовителя (таблица 4).

Таблица 4
Программа лизиса
Цикл Температура (°C) Время (сек)
1 65 30
2 8 30
3 65 90
4 97 180
5 8 60
6 65 180

(2) ПЦР 16S рРНК

Смесь (44,5 мкл) растворов, описанных в приведенной ниже таблице 5, за исключением ДНК и Taq, добавляли в лизирующий раствор, описанный выше (общий объем 50 мкл, в таблице 5). Затем осуществляли ПЦР-амплификацию путем проведения преденатурации при температуре 94°C в течение 5 мин и повторения 29 циклов денатурации при температуре 94°C в течение 1 мин, отжига при температуре 55°C в течение 1 мин и удлинения при температуре 72°C в течение 1 мин и 30 сек, как описано в таблице 6.

Таблица 5
Автоклавированная 3° дист. вода 22 мкл
10x буфер (Roche) 5 мкл
dNTP (Roche, 2,5 мМ) 5 мкл
ДМСО 5 мкл
БСА (10 мг/мл) 2,5 мкл
27mf (20 пмоль/мкл) 2,5 мкл
1492r (20 пмоль/мкл) 2,5 мкл
ДНК 5 мкл
Taq (Roche) 0,5 мкл

Таблица 6
Стадия 1 94°C 5 мин
Стадия 2 94°C 1 мин
Стадия 3 55°C 1 мин
Стадия 4 72°C 1 мин 30 сек
Стадия 5 Переход на стадию 2: дополнительные 29 циклов
Стадия 6 72°C 10 мин
Стадия 7 4°C ожидание

(3) Очистка продуктов ПЦР

Продукты ПЦР 16S рРНК очищали с использованием набора для очистки продутов ПЦР QIAquick, как указано далее.

1) Продукты ПЦР добавляли к буферу 5x PB.

2) Полученный раствор переносили в колонку QIAquick.

3) Для связывания ДНК, раствор центрифугировали в течение 1 мин и затем отфильтрованный раствор удаляли.

4) Для отмывки добавляли 750 мкл буфера PE к колонке QIAquick и осуществляли центрифугирование в течение 1 мин, и затем отфильтрованный раствор удаляли.

5) Центрифугирование осуществляли в течение 1 мин.

6) Колонку QIAquick переносили в новую пробирку.

7) Для экстракции ДНК добавляли 30 мкл буфера EB и полученный раствор оставляют стоять в течение 1 мин.

8) После проведения центрифугирования в течение 1 мин, ДНК, растворенную в EB, собирали в пробирке.

Чтобы установить издают ли выделенные микроорганизмы неприятный запах, проводили сенсорную оценку, как указано далее.

1) Выделенные микроорганизмы инокулировали в жидкую питательную среду.

2) Культивирование проводили при температуре 28°C в течение 5-7 дней.

3) 100 мкл микроорганизмов, культивируемых в жидкой среде, инокулировали в твердую питательную среду.

4) Инокулированные микроорганизмы равномерно распределяли с помощью шпателя.

5) Микроорганизмы культивировали в герметично закрытой чашке Петри при температуре 28°C в течение 10 дней.

Проводили скрининг доминирующих микроорганизмов, вызывающих неприятный запах, на основе среднего значения органолептической оценки 7 членов рабочей группы по 5-балльной шкале. В общей сложности 12 доминирующих видов идентифицировали с помощью анализа 16S рРНК, как показано в приведенной ниже таблице 7, и они были депонированы в Корейском центре культур микроорганизмов 26 февраля 2013.

Таблица 7
Учетные номера 12 доминирующих микроорганизмов, вызывающих неприятный запах
No. Идентификационный No. Название Учетный No.
1 HKMC-101 Methylobacterium dankookense KCCM11384P
2 HKMC-102 Methylobacterium phyllosphaerae KCCM11385P
3 HKMC-103 Methylobacterium tardum KCCM11386P
4 HKMC-104 Microbacterium flavescens KCCM11387P
5 HKMC-105 Sphingomonas dokdonensis KCCM11388P
6 HKMC-106 Sphingomonas ginsenosidimutans KCCM11389P
7 HKMC-107 Sphingomonas humi KCCM11390P
8 HKMC-108 Sphingomonas melonis KCCM11391P
9 HKMC-109 Staphylococcus hominis subsp. hominis KCCM11392P
10 HKMC-110 Staphylococcus warneri KCCM11393P
11 HKMC-111 Methylobacterium radiotolerans KCCM11394P
12 HKMC-112 Microbacterium trichothecenolyticum KCCM11395P

Пример 2. Оценка противомикробной активности противомикробного реагента в отношении отобранных микроорганизмов, вызывающих неприятный запах.

1. Методика эксперимента

Оценивали противомикробную активность различных коммерчески доступных противомикробных реагентов в отношении доминирующих микроорганизмов, отобранных в примере 1. Тестируемые противомикробные реагенты представляют собой следующие реагенты.

Противомикробный реагент A: дезодорант для ткани, приобретенный в P&G Korea.

Противомикробный реагент B: дезинфицирующее средство для рук, приобретенное в Paru Corporation.

Противомикробный реагент C: противомикробный реагент массового производства, содержащий 45-50% метилового спирта, 1-5% сульфата хрома (CAS 10101-53-8), 1-5% бромина и воду.

Противомикробный реагент D: катионный противомикробный реагент (Parkerizing, Japan).

Противомикробный реагент E: противомикробный реагент на основе изотиазолинона, содержащий метилизотиазолинон (CAS 26172-55-4), бронопол (CAS 52-51-7) и т.п. (Parkerizing, Japan).

Противомикробную активность оценивали следующим образом.

1) Готовили стерильный бумажный фильтр.

2) Готовили пять противомикробных реагентов (контрольная группа: не обрабатывали противомикробным реагентом, опытные группы: обрабатывали противомикробным реагентом A, противомикробным реагентом B, противомикробным реагентом C, противомикробным реагентом D и противомикробным реагентом E).

3) Каждый противомикробный реагент добавляли на фильтровальную бумагу.

4) Каждый микроорганизм, вызывающий неприятный запах, наносили на питательную среду.

5) Фильтровальную бумагу, на которую был добавлен противомикробный реагент, помещали на питательную среду, на которую был нанесен микроорганизм, вызывающий неприятный запах.

6) Микроорганизм культивировали при температуре 28-30°С в течение 5 дней.

7) Измеряли зону ингибирования роста.

Диаметр зоны ингибирования роста измеряли с использованием штангенциркуля, как показано на фиг. 2.

2. Результат эксперимента

Результат измерения диаметра зоны подавления роста для 12 видов микроорганизмов, вызывающий неприятный запах, представлен в таблице 8.

Таблица 8
Диаметр зоны подавления роста (единицы: мм)
No. Микроорганизм (название, под которым депонирован микроорганизм) Противомикробный реагент
нет A B C D E
1 Methylobacterium dankookense HKMC-101 0 18,3 22,3 27,3 29,5 36,1
2 Methylobacterium phyllosphaerae HKMC-102 0 18,3 11,6 35,3 47,3 45,3
3 Methylobacterium tardum HKMC-103 0 0 0 0 43 38,3
4 Microbacterium flavescens HKMC-104 0 19,6 14 28 19,1 33,9
5 Sphingomonas dokdonensis HKMC-105 0 15 11,6 21,7 16,2 39,1
6 Sphingomonas ginsenosidimutans HKMC-106 0 0 11,3 17,6 21.8 31,1
7 Sphingomonas humi HKMC-107 0 11,6 14,3 22,5 19,1 36,1
8 Sphingomonas melonis HKMC-108 0 17 11 31,6 22,6 37,3
9 Staphylococcus hominis subsp. hominis HKMC-109 0 0 0 25,6 28,6 54
10 Staphylococcus warneri HKMC-110 0 0 0 33,3 17 38,6
11 Methylobacterium radiotolerans HKMC-111 0 17,6 0 23,3 28,1 31
12 Microbacterium trichothecenolyticum HKMC-112 0 19 18,3 20,6 18,5 32,3

Противомикробную активность катионного противомикробного реагента (противомикробный реагент D) и противомикробного реагента на основе изотиазолинона (противомикробный реагент E) сравнивали с противомикробной активностью противомикробного реагента массового производства (противомикробный реагент С), и результаты представлены в таблице 9 ниже.

Таблица 9
Противомикробная активность катионного противомикробного реагента и противомикробного реагента на основе изотиазолинона в сравнении с противомикробной активностью противомикробного реагента массового производства.
No. Микроорганизм (название, под которым депонирован микроорганизм) Противо-бактериальный реагент
D E
1 Methylobacterium dankookense HKMC-101 8,1% 32,2%
2 Methylobacterium phyllosphaerae HKMC-102 34% 28,3%
3 Methylobacterium tardum HKMC-103 43% 38,3%
4 Microbacterium flavescens HKMC-104 -31,8% 21%
5 Sphingomonas dokdonensis HKMC-105 -25,3% 80,1%
6 Sphingomonas ginsenosidimutans HKMC-106 23,8% 76,7%
7 Sphingomonas humi HKMC-107 -15,1% 60,4%
8 Sphingomonas melonis HKMC-108 -28,5% 18%
9 Staphylococcus hominis subsp. hominis HKMC-109 11,7% 110,9%
10 Staphylococcus warneri HKMC-110 -48,9% 15,9%
11 Methylobacterium radiotolerans HKMC-111 20,6% 33%
12 Microbacterium trichothecenolyticum HKMC-112 -10,2% 56,8%

Как показано в приведенных выше таблицах 8 и 9, противомикробный реагент A вообще не проявил противомикробной активности в отношении Methylobacterium tardum, Sphingomonas ginsenosidimutans, Staphylococcus hominis subsp. hominis и Staphylococcus warneri. Хотя противомикробный реагент B показал противомикробную активность в отношении Sphingomonas ginsenosidimutans в отличие от противомикробного реагента A, он не проявил противомикробную активность в отношении Methylobacterium radiotolerans.

Кроме того, противомикробный реагент C не показал противомикробную активность в отношении Methylobacterium tardum. Напротив, противомикробные реагенты D и E показали противомикробную активность в отношении всех 12 видов микроорганизмов. Однако противомикробный реагент D показал более низкую противомикробную активность в отношении Microbacterium flavescens, Sphingomonas dokdonensis, Sphingomonas humi, Sphingomonas melonis, Staphylococcus warneri и Microbacterium trichothecenolyticum по сравнению с активностью противомикробного реагента C. В отношении микроорганизмов, принадлежащих к тому же роду Methylobacterium, противомикробный реагент E показал более специфичную противомикробную активность в отношении Methylobacterium dankookense и Methylobacterium radiotolerans по сравнению с противомикробным реагентом D, и противомикробный реагент D показал более специфичную противомикробную активность в отношении Methylobacterium phyllosphaerae и Methylobacterium tardum по сравнению с противомикробным реагентом E. То есть противомикробные реагенты показали различную противомикробную активность в отношении различных микроорганизмов, принадлежащих к одному роду.

Пример 3. Оценка запаха сердцевины испарителя, в случае когда микроорганизм, вызывающий неприятный запах, удален.

Для получения сердцевины испарителя, из которой микроорганизмы, вызывающие неприятный запах, удалены или отделены, комбинации микроорганизмов, не имеющих запаха, исключающие микроорганизмы, вызывающие неприятный запах, примера 1 из доминирующих микроорганизмов, живущих на сердцевине испарителя, культивировали на алюминиевом ребре теплообменного устройства, в котором алюминий представлял собой материал сердцевины испарителя (таблица 10, фиг. 3).

Доминирующие виды, которые образовывали колонии на сердцевине испарителя, но не вызывали неприятного запаха, выбирали в качестве микроорганизмов, не имеющих запаха, и культивировали, как указано далее.

1) Выделенные микроорганизмы, не имеющие запаха, инокулировали в жидкую среду R2A.

2) Микроорганизмы культивировали при температуре 28°C в течение 5-7 дней.

3) Получали алюминиевое ребро, простерилизованное при температуре 121°C в течение 20 мин при высоком давлении.

4) Поверхность алюминиевого ребра равномерно покрывали каждым противомикробным реагентом.

5) Покрытое противомикробным реагентом алюминиевое ребро помещали на чашку Петри.

6) 1 мл культуры микроорганизма, не имеющего запаха, центрифугировали и удаляли супернатант.

7) После добавления 1 мл стерилизованного раствора 1 x PBS, смесь снова центрифугировали.

8) Стадию 7) повторяли два раза.

9) 100 мкл культуры микроорганизмов не имеющих запаха, отмытой PBS, капали на центр алюминиевого ребра.

10) Алюминиевое ребро высушивали при комнатной температуре.

11) После высевания на чашку Петри микроорганизмы, не имеющие запаха, культивировали при температуре 28°C в течение 1 месяца.

В результате обнаружили, что все комбинации, описанные в прведенной ниже таблице 10, не вызывали неприятного запаха.

Таблица 10
Запах, вызываемый микроорганизмами, населяющими сердцевину испарителя, после удаления микроорганизмов, вызывающих неприятный запах
Комбинация No. Микроорганизмы Наличие запаха после культивирования в течение 1 месяца
1 Methylobacterium brachiatum без запаха
2 Methylobacterium platani без запаха
3 Methylobacterium aquaticum + Methylobacterium platani без запаха
4 Methylobacterium platani + Methylobacterium brachiatum без запаха
5 Methylobacterium aquaticum + Methylobacterium platani + Methylobacterium brachiatum без запаха
6 Methylobacterium aquaticum + Methylobacterium platani + Methylobacterium brachiatum + Acinetobacter johnsonii без запаха
7 Methylobacterium aquaticum + Methylobacterium platani + Methylobacterium brachiatum + Bacillus vietnamensis без запаха
8 Methylobacterium aquaticum + Methylobacterium platani + Methylobacterium brachiatum + Brevibacillus invocatus без запаха
9 Methylobacterium aquaticum + Methylobacterium platani + Methylobacterium brachiatum + Deinococcus ficus без запаха
10 Methylobacterium aquaticum + Methylobacterium platani + Methylobacterium brachiatum + Leifsonia soli без запаха
11 Methylobacterium aquaticum + Methylobacterium platani + Methylobacterium brachiatum + Methylobacterium komagatae без запаха
12 Methylobacterium aquaticum + Methylobacterium platani + Methylobacterium brachiatum + Pseudomonas nitroreducens без запаха
13 Methylobacterium aquaticum + Methylobacterium platani + Methylobacterium brachiatum + Sphingomonas aquatilis без запаха
14 Sphingomonas aquatilis + Brevibacillus invocatus без запаха
15 Leifsonia soli + Methylobacterium komagatae без запаха
16 Acinetobacter johnsonii + Sphingomonas aquatilis + Methylobacterium komagatae без запаха
17 Pseudomonas nitroreducens без запаха
18 Acinetobacter johnsonii + Pseudomonas nitroreducens без запаха
19 Brevibacillus invocatus + Acinetobacter johnsonii + Pseudomonas nitroreducens без запаха
20 Leifsonia soli + Pseudomonas nitroreducens без запаха
21 Brevibacillus invocatus + Sphingomonas aquatilis + Pseudomonas nitroreducens без запаха
22 Acinetobacter johnsonii + Sphingomonas aquatilis + Pseudomonas nitroreducens без запаха
23 Methylobacterium aquaticum + Methylobacterium komagatae + Bacillus vietnamensis + Deinococcus ficus без запаха
24 Methylobacterium aquaticum + Methylobacterium komagatae + Curtobacterium flaccumfaciens + Deinococcus apachensis + Bacillus subtilis subsp. subtilis без запаха
25 Methylobacterium aquaticum + Methylobacterium komagatae + Spirosoma linguale +Sphingomonas dokdonensis + Leifsonia soli без запаха

Из таблицы 10, видно, что неприятный запах, возникающий в системе кондиционирования воздуха, может быть в значительной степени устранен путем химического или физического удаления микроорганизмов, вызывающих неприятный запах, из числа микроорганизмов, населяющих систему кондиционирования воздуха, и предоставления комбинаций микроорганизмов, не вызывающих неприятный запах.

Настоящее изобретение подробно описано со ссылкой на конкретные варианты его осуществления. Однако специалистам в данной области понятно, что различные изменения и модификации могут быть сделаны в указанных вариантах осуществления без отступления от принципов и существа изобретения, объем которого определен в прилагаемых пунктах формулы изобретения и их эквивалентах.

Микроорганизмы, вызывающие неприятный запах в системе кондиционирования воздуха по настоящему изобретению, являются промышленно применимым для различных целей. Например, они могут быть использованы для создания нового противомикробного реагента, способного ингибировать рост микроорганизмов, или для создания освежителя воздуха, предназначенного для удаления неприятного запаха, путем выявления химических свойств метаболитов микроорганизмов. Кроме того, они могут быть использованы для радикального устранения причины неприятного запаха путем предоставления системы кондиционирования воздуха со средой, где микроорганизмы не могут жить.

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Methylobacterium dankookense HKMC-101
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11384P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Methylobacterium phyllosphaerae HKMC-102
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11385P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Methylobacterium tardum HKMC-103
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11386P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Microbacterium flavescens HKMC-104
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11387P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Sphingomonas dokdonensis HKMC-105
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11388P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Sphingomonas ginsenosidimutans HKMC-106
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11389P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Sphingomonas humi HKMC-107
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11390P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Sphingomonas melonis HKMC-108
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11391P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Staphylococcus hominis subsp. hominis HKMC-109
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11392P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Staphylococcus warneri HKMC-110
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11393P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Methylobacterium radiotolerans HKMC-111
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11394P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

БУДАПЕШТСКИЙ ДОГОВОР О МЕЖДУНАРОДНОМ ПРИЗНАНИИ ДЕПОНИРОВАНИЯ МИКРООРГАНИЗМОВ ДЛЯ ЦЕЛЕЙ ПАТЕНТНОЙ ПРОЦЕДУРЫ
МЕЖДУНАРОДНАЯ ФОРМА
Кому: HYUNDAI MOTOR COMPANY
12, Heolleung-ro. Seocho-gu.
Сеул 137-938,
Республика Корея
УВЕДОМЛЕНИЕ В ОТНОШЕНИИ ОРИГИНАЛА, оформленного в соответствии с Правилом 7.1 МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ, указанным в нижней части страницы
I. ИДЕНТИФИКАЦИЯ МИКРООРГАНИЗМА
Идентификационное обозначение, данное ЛИЦОМ, ПРЕДОСТАВЛЯЮЩИМ ДЛЯ РЕГИСТРАЦИИ:
Microbacterium trichothecenolyticum HKMC-112
Учетный номер, присвоенный МЕЖДУНАРОДНЫМ ОРГАНОМ ПО ДЕПОНИРОВАНИЮ:
KCCM11395P
II. НАУЧНОЕ ОПИСАНИЕ И/ИЛИ ПРЕДЛАГАЕМОЕ ТАКСОНОМИЧЕСКОЕ ОБОЗНАЧЕНИЕ
Микроорганизм, идентифицированный под I выше, сопровождался:
научным описанием
предлагаемым таксономическим обозначением
(Отметить крестом, где применимо)
III. ПОЛУЧЕНИЕ И ПРИНЯТИЕ
Международный орган по депонированию принимает микроорганизм, идентифицированный под I выше, который был получен 26 февраля 2013 (дата исходного депонирования)1.
IV. МЕЖДУНАРОДНЫЙ ОРГАН ПО ДЕПОНИРОВАНИЮ
Название: Корейский центр культур микроорганизмов
Адрес: 351-221, Yurim B/D
Hongje-l-dong
Seodaemun-gu
Сеул 120-091
Республика Корея
Подпись(и) специалиста(ов), имеющего полномочия представлять международный орган по депонированию или уполномоченного должностного лица(ц):
Дата: 26 февраля 2013.
1 Если применяется Правило 6.4 (d), такой датой является дата, на которую был получен статус международного органа по депонированию; если депонирование, осуществленное вне Будапештского договора, после присвоения статуса международного органа по депонированию преобразуется в депонирование по Будапештскому договору, такой датой является дата, на которую микроорганизм был получен международным органом по депонированию.
Форма BP/4Отдельная страница

1. Способ скрининга противомикробного агента против микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха, который включает:

(a) получение одного или нескольких микроорганизмов, которые вызывают неприятный запах в системе кондиционирования воздуха, и которые выбирают из группы, состоящей из Microbacterium trichothecenolyticum HKMC-112 (accession number: KCCM11395P), Microbacterium flavescens HKMC-104 (accession number: KCCM11387P), Methylobacterium dankookense HKMC-101 (accession number: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (accession number: KCCM11385P), Methylobacterium tardum HKMC-103 (accession number: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (accession number: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (accession number: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (accession number: KCCM11389P), Sphingomonas humi HKMC-107 (accession number: KCCM11390P), Sphingomonas melonis HKMC-108 (accession number: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (accession number: KCCM11392P), Staphylococcus warneri HKMC-110 (accession number: KCCM11393P) или их культуры;

(b) взаимодействие образца для анализа с микроорганизмом;

(c) измерение ингибирования роста микроорганизма; и

(d) определение того, что образец обладает противомикробной активностью в отношении микроорганизма, если рост микроорганизма ингибируется.

2. Способ скрининга по п.1, где система кондиционирования воздуха представляет собой воздушный кондиционер.

3. Способ скрининга по п.1, где микроорганизм вызывает неприятный запах путем образования биопленки на сердцевине испарителя в системе кондиционирования воздуха.

4. Способ скрининга по п.3, где сердцевина испарителя изготовлена из алюминия, сплава алюминия, меди или медного сплава.

5. Способ ингибирования роста микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха, который выбран из группы, состоящей из Microbacterium trichothecenolyticum HKMC-112 (accession number: KCCM11395P), Microbacterium flavescens HKMC-104 (accession number: KCCM11387P), Methylobacterium dankookense HKMC-101 (accession number: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (accession number: KCCM11385P), Methylobacterium tardum HKMC-103 (accession number: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (accession number: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (accession number: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (accession number: KCCM11389P), Sphingomonas humi HKMC-107 (accession number: KCCM11390P), Sphingomonas melonis HKMC-108 (accession number: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (accession number: KCCM11392P), Staphylococcus warneri HKMC-110 (accession number: KCCM11393P) или их культуры, и где способ включает нанесение или распыление противомикробного агента выбранного способом по п.1 в системе кондиционирования воздуха.

6. Способ удаления неприятного запаха в системе кондиционирования воздуха, где указанный неприятный запах вызван микроорганизмом, который выбран из группы, состоящей из Microbacterium trichothecenolyticum HKMC-112 (accession number: KCCM11395P), Microbacterium flavescens HKMC-104 (accession number: KCCM11387P), Methylobacterium dankookense HKMC-101 (accession number: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (accession number: KCCM11385P), Methylobacterium tardum HKMC-103 (accession number: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (accession number: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (accession number: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (accession number: KCCM11389P), Sphingomonas humi HKMC-107 (accession number: KCCM11390P), Sphingomonas melonis HKMC-108 (accession number: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (accession number: KCCM11392P), Staphylococcus warneri HKMC-110 (accession number: KCCM11393P) или их культуры, и способ включает нанесение или распыление противомикробного агента, выбранного способом по п.1 в системе кондиционирования воздуха.



 

Похожие патенты:
Изобретение относится к биотехнологии. Штамм лактобактерий Enterococcus faecalis К-45(5-2018), обладающий способностью продуцировать молочную кислоту и антибиотические вещества, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-13049.

Изобретение относится к области биотехнологии. Предложены штамм Trichoderma reesei ВКМ F-4789D, способ получения кормового комплексного ферментного препарата и способ повышения кормовой ценности зерновых и зернобобовых смесей.

Группа изобретений относится к области биотехнологии. Предложен рекомбинантный штамм мицелиального гриба Penicillium verruculosum EЕ-105, депонированный во Всероссийской коллекции микроорганизмов под номером ВКМ F-4812D, продуцент эндо1,4-β-глюканазы II Penicillium verruculosum и эндо1,4-β-глюканазы I Trichoderma reesei.

Изобретение относится к биотехнологии. Штамм микроорганизма Streptomyces iakyrus Ре6, обладающий способностью продуцировать нибомицин, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером Ас-2084.

Изобретение относится к области сельскохозяйственной микробиологии и может быть использовано для защиты растений от вредителей, стимуляции роста и повышения урожайности томата.
Изобретение относится к области биотехнологии. Штамм бактерий Pseudomonas deceptionensis ARC 44, обладающий способностью к деструкции нефти и нефтепродуктов, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-13090.
Изобретение относится к биотехнологии. Штамм бактерий Pseudomonas extremaustralis ARC 38, обладающий способностью к деструкции нефти и нефтепродуктов, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-13084.

Изобретение относится к биотехнологии. Предложен способ приготовления посевных культур сибиреязвенного микроба.

Изобретение относится к биотехнологии и экологии. Предложено применение арилхалькогенилацетатов трис(2-гидроксиэтил)аммония общей формулы ArYCH2CO2-⋅HN+(CH2CH2OH)3, где Ar = арил; Y=О (1), S (2), SO2 (3), в частности соединений или или , в качестве биостимулятора роста углеводородокисляющих бактерий Rhodococcus erythropolis.

Изобретение относится к биотехнологии. Штамм бактерий Pseudomonas koreensis ИБ-4 используют в качестве средства для стимуляции роста и повышения устойчивости к болезням растений гороха.

Изобретение относится к биоизмерительным технологиям. Предложен способ определения бактерицидных свойств материалов.

Изобретение относится к биотехнологии и микробиологии. Предложен способ определения токсичности проб, содержащих нефтепродукты.

Изобретение относится к биотехнологии и микробиологии. Предложен способ определения бактерицидных свойств веществ.

Изобретение относится к биоизмерительным технологиям. Предложен способ определения антибиотических свойств материалов.

Изобретение относится к биоизмерительным технологиям. Предложен способ оценки про- и антимикробных свойств проб.

Изобретение относится к области биотехнологии. Предложен способ определения агрессивности микроорганизмов-биодеструкторов полимерных материалов, заключающийся в газохроматографическом определении метаболической активности микроорганизмов по эмиссии диоксида углерода.

Настоящее изобретение относится к композициям для полоскания полости рта, содержащим одно или более активных веществ для ухода за полостью рта и ароматических масел, составленным в виде эмульсий типа масло-в-воде.
Изобретение относится к биотехнологии и клинической микробиологии. Предложен способ определения чувствительности микроорганизмов полости рта в биопленке к антимикробным средствам.

Изобретение относится к области медицины, а именно комбустиологии, гнойной хирургии, клинической микробиологии, и касается способа оценки антибактериального действия антисептиков на микробные биопленки.

Изобретение относится к биотехнологии, конкретно к методам поиска антибактериальных веществ природного и синтетического происхождения с одновременным анализом механизма их действия, и может быть использовано для идентификации соединений, ингибирующих биосинтез белка и/или вызывающих SOS-ответ у бактерий.

Изобретение относится к области биохимии. Описан способ выявления генома возбудителя вируса парагриппа 3 типа у крупного рогатого скота, включающий выделение РНК из биологического материала сорбционным методом, синтез кДНК на матрице РНК путем постановки одноэтапной с добавлением внутреннего и положительного контрольных образцов мультиплексной реакции обратной транскрипции и полимеразной цепной реакции - с проведением 45 циклов амплификации с детекцией в реальном времени с использованием специфичных для участка генома вирусного возбудителя олигонуклеотидных праймеров флуоресцентно-меченного зонда и контрольных образцов.

Предложен способ скрининга противомикробного агента против микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха. Способ включает получение одного или нескольких микроорганизмов, которые вызывают неприятный запах в системе кондиционирования воздуха; взаимодействие образца для анализа с микроорганизмом; измерение ингибирования роста микроорганизма; и определение того, что образец обладает противомикробной активностью в отношении микроорганизма, если рост микроорганизма ингибируется. Микроорганизмы, которые вызывают неприятный запах в системе кондиционирования воздуха, выбирают из группы, состоящей из Microbacterium trichothecenolyticum HKMC-112, Microbacterium flavescens HKMC-104, Methylobacterium dankookense HKMC-101, Methylobacterium phyllosphaerae HKMC-102, Methylobacterium tardum HKMC-103, Methylobacterium radiotolerans HKMC-111, Sphingomonas dokdonensis HKMC-105, Sphingomonas ginsenosidimutans HKMC-106, Sphingomonas humi HKMC-107, Sphingomonas melonis HKMC-108, Staphylococcus hominis subsp. hominis HKMC-109, Staphylococcus warneri HKMC-110 или их культуры. Предложен также способ ингибирования роста микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха, и способ удаления неприятного запаха в системе кондиционирования воздуха. 3 н. и 3 з.п. ф-лы, 3 ил, 10 табл., 3 пр.

Наверх