Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение



Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
Искусственная мкрнк с соответствием для контроля экспрессии генов и ее применение
C12N2310/141 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2697094:

ТОКИО МЕДИКАЛ ЮНИВЕРСИТИ (JP)
БОНАК КОРПОРЕЙШН (JP)

Изобретение относится к области биохимии. Описана группа изобретений, включающая искусственную мкРНК для подавления экспрессии гена-мишени, композицию и фармацевтическую композицию для подавления экспрессии гена-мишени, содержащие эффективное количество вышеуказанной искусственной мкРНК, способ подавления экспрессии гена-мишени, включающий применение искусственной мкРНК, способ лечения заболевания, включающий стадию введения искусственной мкРНК, применение искусственной мкРНК в лечении заболевания, где заболевание представляет собой злокачественную опухоль, фиброз легких или фиброз печени. Изобретение расширяет арсенал средств для подавления экспрессии гена-мишени. 6 н. и 31 з.п. ф-лы, 11 ил., 4 табл., 5 пр.

 

ОБЛАСТЬ ТЕХНИКИ

[0001]

Настоящее изобретение относится к искусственной мкРНК с соответствием, которая подавляет экспрессию генов, и к ее применению.

УРОВЕНЬ ТЕХНИКИ

[0002]

МикроРНК (мкРНК) известна как молекула нуклеиновой кислоты, которая подавляет экспрессию генов, и которая, как сообщалось, подавляет транскрипцию белка, кодируемого геном, через, например, следующий процесс формирования. Следовательно, продукт транскрипции мкРНК (первичная мкРНК), имеющий структуру кэпа на 5ʹ-конце и поли(A) на 3ʹ-конце, продуцируется в ядре. Упомянутая выше первичная мкРНК расщепляется РНКазой (Drosha) с образованием мкРНК-предшественника (пре-мкРНК). Упомянутая выше пре-мкРНК образует шпилечную структуру, имеющую область петли и область стебля. Пре-мкРНК перемещается из ядра и деградируется РНК-азой (Dicer) в цитоплазме, и вырезается двухцепочечная мкРНК (зрелая мкРНК), имеющая 1-4 выступающих оснований на 3ʹ-конце. Одна из цепей двухцепочечной мкРНК называется направляющей цепью, а другая цепь называется пассажирской цепью, и упомянутая выше направляющая цепь связывается с комплексом, сходным с РНК-индуцируемым комплексом сайленсинга (RISC). Этот комплекс мкРНК/RISC связывается с 3ʹ-нетранслируемой областью (3ʹUTR) конкретной мРНК, подавляя трансляцию белка с упомянутой выше мРНК.

[0003]

Было установлено, что мкРНК глубоко вовлечена в такие жизненные процессы, как дифференцировка, клеточная пролиферация, апоптоз и т.п., и многие заболевания, такие как вирусные инфекции, злокачественная опухоль и т.п. (патентный документ 1, непатентный документ 1, непатентный документ 2). Таким образом, является ожидаемым ее применение, в частности, в области медицины.

[Перечень документов]

[Патентный документ]

[0004]

Патентный документ 1: WO 2010/056737 A2

[Непатентные документы]

[0005]

Непатентный документ 1: Deiters, 2009, The AAPS Journal, 12, 51-60

Непатентный документ 2: Takeshita etal., 2010, Mol. Ther., 18, 181-187

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

ПРОБЛЕМЫ, РЕШАЕМЫЕ С ПОМОЩЬЮ ИЗОБРЕТЕНИЯ

[0006]

Для применения упомянутой выше мкРНК, например, доступен способ, включающий применение двухцепочечной зрелой мкРНК, и т.п. Однако этот способ перед использованием требует гибридизации двух одноцепочечных молекул нуклеиновой кислоты, которая обеспечивает возможность развития аутоиммунитета посредством TLR3 и т.п., которые распознают двойную цепь.

[0007]

Таким образом, задачей настоящего изобретения является предоставление новой искусственной мкРНК с соответствием с использованием мкРНК.

Способы решения проблем

[0008]

Для достижения упомянутой выше задачи искусственная мкРНК с соответствием по настоящему изобретению представляет собой одноцепочечную нуклеиновую кислоту, содержащую область X и область Y, отличающуюся тем, что

3ʹ-конец упомянутой выше области X и 5ʹ-конец упомянутой выше области Y связаны через линкерную область, имеющую ненуклеотидную структуру,

упомянутая выше область X содержит последовательность направляющей цепи зрелой мкРНК, и

упомянутая выше область Y содержит последовательность, полностью комплементарную упомянутой выше области X.

[0009]

Композиция по настоящему изобретению представляет собой композицию для ингибирования экспрессии гена и характерным образом содержит упомянутую выше искусственную мкРНК с соответствием по настоящему изобретению.

[0010]

Композиция по настоящему изобретению представляет собой фармацевтическую композицию, которая характерным образом содержит упомянутую выше искусственную мкРНК с соответствием по настоящему изобретению.

[0011]

Способ ингибирования экспрессии по настоящему изобретению представляет собой способ ингибирования экспрессии гена-мишени, в котором характерным образом используется упомянутая выше искусственная мкРНК с соответствием по настоящему изобретению.

[0012]

Способ лечения заболевания по настоящему изобретению включает стадию введения упомянутой выше искусственной мкРНК с соответствием по настоящему изобретению пациенту, где упомянутая выше последовательность направляющей цепи в упомянутой выше искусственной мкРНК с соответствием представляет собой последовательность направляющей цепи зрелой мкРНК, которая подавляет экспрессию генов, вовлеченных в упомянутые выше заболевания.

Эффект изобретения

[0013]

Искусственную мкРНК с соответствием по настоящему изобретению можно без труда синтезировать с низкими затратами, и она может подавлять трансляцию белка, кодируемого упомянутыми выше генами.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

[0014]

На фиг.1 представлена схема, демонстрирующая один вариант осуществления искусственной мкРНК с соответствием по настоящему изобретению.

На фиг.2 представлен график, демонстрирующий количество клеток на лунку в примере 1 по настоящему изобретению.

На фиг.3 представлен график, демонстрирующий относительные уровни пролиферации клеток в примере 1 по настоящему изобретению.

На фиг.4 представлен график, демонстрирующий относительный уровень апоптоза в примере 1 по настоящему изобретению.

На фиг.5 представлен график, демонстрирующий относительные уровни мРНК AXL и мРНК MET в примере 1 по настоящему изобретению.

На фиг.6 представлен график, демонстрирующий относительные уровни мРНК AXL в примере 2 по настоящему изобретению.

На фиг.7 представлен график, демонстрирующий относительные уровни мРНК MET в примере 2 по настоящему изобретению.

На фиг.8 представлен график, демонстрирующий относительные уровни мРНК AXL в примере 3 по настоящему изобретению.

На фиг.9 представлен график, демонстрирующий относительные уровни мРНК MET в примере 3 по настоящему изобретению.

На фиг.10 представлен график, демонстрирующий относительные уровни мРНК HMGA2 в примере 4 по настоящему изобретению.

На фиг.11 представлен график, демонстрирующий относительные уровни мРНК COLA1 в примере 5 по настоящему изобретению.

Описание вариантов осуществления

[0015]

Если нет иных указаний, термины, используемые в настоящем описании, означают то, что обычно подразумевается под ними в данной области.

[0016]

(1) Искусственная мкРНК с соответствием

Искусственная мкРНК с соответствием по настоящему изобретению представляет собой, как упоминалось выше, одноцепочечную нуклеиновую кислоту, содержащую область X и область Y, отличающуюся тем, что

3ʹ-конец упомянутой выше области X и 5ʹ-конец упомянутой выше области Y связаны через линкерную область, имеющую ненуклеотидную структуру,

упомянутая выше область X содержит последовательность направляющей цепи зрелой мкРНК, и

упомянутая выше область Y содержит последовательность, полностью комплементарную упомянутой выше области X.

[0017]

Искусственная мкРНК с соответствием по настоящему изобретению может подавлять, например, экспрессию гена-мишени. Подавление экспрессии означает, например, подавление трансляции упомянутого выше гена-мишени, т.е. подавление трансляции белка, кодируемого упомянутым выше геном-мишенью, более конкретно, подавление трансляции упомянутого выше белка с мРНК упомянутого выше гена-мишени. Упомянутое выше ингибирование экспрессии гена-мишени может подтверждаться, например, уменьшением количества продукта транскрипции, происходящего из гена-мишени; снижением активности упомянутого выше продукта транскрипции; снижением количества продукта трансляции, образованного с упомянутого выше гена-мишени; снижением активности упомянутого выше продукта трансляции; и т.п. Упомянутые выше белки могут представлять собой, например, зрелые белки, белки-предшественники до процессинга или посттрансляционной модификации.

[0018]

Поскольку искусственная мкРНК с соответствием по настоящему изобретению представляет собой одноцепочечную молекулу нуклеиновой кислоты, гибридизация двух отдельных цепей является необязательной, в отличие от зрелой мкРНК, и ее можно получать с низкими затратами. Более того, поскольку искусственная мкРНК с соответствием по настоящему изобретению представляет собой одноцепочечную молекулу нуклеиновой кислоты, например, она может избегать распознавания посредством TLR3, RIG-I, MDA5 и т.п., вовлеченных в аутоиммунитет.

[0019]

Принцип конфигурационной взаимосвязи между упомянутой выше областью X и упомянутой выше областью Y в искусственной мкРНК с соответствием по настоящему изобретению показан на фиг.1. На фиг.1 показан принцип, и, например, длина, форма и т.п. каждой области не ограничиваются. Искусственная мкРНК с соответствием по настоящему изобретению имеет, как показано на фиг.1, упомянутую выше область X на 5ʹ-стороне и упомянутую выше область Y на 3ʹ-стороне, и 3ʹ-конец упомянутой выше области X и 5ʹ-конец упомянутой выше области Y связаны через линкерную область (показанную посредством "P" на фигуре), имеющую ненуклеотидную структуру.

[0020]

В искусственной мкРНК с соответствием по настоящему изобретению, поскольку упомянутая выше область Y содержит последовательность, полностью комплементарную упомянутой выше области X, то упомянутая выше область X и упомянутая выше область Y подвергаются, например, внутримолекулярной гибридизации. Внутримолекулярную гибридизацию также называют, например, самогибридизацией. Также можно сказать, что искусственная мкРНК с соответствием по настоящему изобретению образует двойную цепь в упомянутой выше подвергнутой внутримолекулярной гибридизации области.

[0021]

Искусственная мкРНК с соответствием по настоящему изобретению также может быть называться одноцепочечной молекулой нуклеиновой кислоты, где ее 5ʹ-конец и 3ʹ-конец не связаны. Для поддержания несвязанного состояния обоих концов 5ʹ-конец искусственной мкРНК с соответствием по настоящему изобретению предпочтительно, например, не является группой фосфорной кислоты.

[0022]

В искусственной мкРНК с соответствием по настоящему изобретению упомянутая выше область X содержит, как указано выше, последовательность направляющей цепи зрелой мкРНК. Последовательность направляющей цепи зрелой мкРНК, например, является зарегистрированной в различных базах данных (например, http://www.mirbase.org/ и т.д.). Таким образом, упомянутая выше область X может быть выбрана, например, на основе информации об известных зрелых мкРНК. Направляющая цепь упомянутой выше зрелой мкРНК представляет собой цепь, которая захватывается белком Argonaute (Ago) РНК-индуцируемого комплекса сайленсинга (RISC) и связывается с мРНК мишени.

[0023]

Упомянутая выше область X может состоять, например, только из упомянутой выше последовательности направляющей цепи, или, кроме того, она может иметь дополнительную последовательность. В последнем случае упомянутая выше область X состоит, например, из упомянутой выше последовательности направляющей цепи и упомянутой выше дополнительной последовательности, и упомянутая выше дополнительная последовательность связана, например, с 3ʹ-концом упомянутой выше последовательности направляющей цепи.

[0024]

В искусственной мкРНК с соответствием по настоящему изобретению, когда упомянутую выше область X и упомянутую выше область Y выравнивают, упомянутая выше область Y имеет последовательность, полностью комплементарную упомянутой выше области X. Упомянутая выше область Y может состоять, например, только из последовательности, полностью комплементарной упомянутой выше области X, или, кроме того, она имеет выступающий конец в дополнение к упомянутой выше комплементарной последовательности. Таким образом, в искусственной мкРНК с соответствием по настоящему изобретению, когда, например, упомянутую выше область Y и упомянутую выше область X выравнивают, упомянутая выше область Y может иметь выступающий конец на 3ʹ-конце. Как используют в настоящем описании, упомянутый выше выступающий конец в области Y представляет собой, например, концевое основание, которое упомянутая выше область Y имеет в избытке относительно упомянутой выше области X, когда упомянутую выше область Y и упомянутую выше область X выравнивают. Длина (O) выступающего конца является такой, например, как показано в формуле ниже.

длина (O) выступающего конца=[количество оснований (Y) полноразмерной последовательности области Y]-[количество оснований (X) полноразмерной последовательности области X]

[0025]

В искусственной мкРНК с соответствием по настоящему изобретению длина каждой области конкретно не ограничена. Хотя примеры условий показаны ниже, искусственная мкРНК с соответствием по настоящему изобретению не ограничивается таким описанием. В рамках настоящего изобретения числовой диапазон количества оснований описывает все положительные целые числа, которые входят в диапазон и, например, "1-4 основания" означает все из "1, 2, 3, 4 основания" (далее то же самое).

[0026]

В упомянутой выше области X длина упомянутой выше последовательности направляющей цепи конкретно не ограничена и может представлять собой, например, длину последовательности направляющей цепи рассматриваемой зрелой мкРНК. Ее конкретные примеры включают нижний предел длины, составляющий 19 оснований, 20 оснований, и верхний предел длины, составляющий 25 оснований, 24 основания, и диапазоны 19-25 оснований, 20-24 оснований.

[0027]

Длина упомянутой выше дополнительной последовательности упомянутой выше области X конкретно не ограничена, и нижний предел составляет, например, 0 оснований, 1 основание, 2 основания, и верхний предел составляет, например, 5 оснований, 4 основания, 3 основания, и диапазон составляет, например, 0-5 оснований, 1-5 оснований, 1-4 основания, 2-3 основания, 3-5 оснований.

[0028]

Длина упомянутой выше области X конкретно не ограничена, нижний предел длины составляет, например, 19 оснований, 21 основание, 23 основания, верхний предел длины составляет, например, 30 оснований, 28 оснований, 26 оснований, и диапазон длины составляет, например, 19-30 оснований, 21-28 оснований, 23-26 оснований.

[0029]

Длина упомянутого выше выступающего конца в упомянутой выше области Y конкретно не ограничена, и нижний предел длины составляет, например, 0 оснований, 1 основание, и верхний предел длины составляет, например, 4 основания, 3 основания, и диапазон длины составляет, например, 0-4 основания, 1-3 основания, 2 основания.

[0030]

Последовательность упомянутого выше выступающего конца конкретно не ограничена и представляет собой, например, UU, CU, GC, UA, AA, CC, UG, CG, AU, TT и т.п. с 3ʹ-стороны. Упомянутому выше выступающему концу может быть сообщена устойчивость к рибонуклеазам посредством, например, последовательности TT.

[0031]

Длина упомянутой выше области Y конкретно не ограничена и нижний предел длины составляет, например, 19 оснований, 21 основание, 23 основания, и верхний предел длины составляет, например, 32 основания, 30 оснований, 28 оснований, и диапазон длины составляет, например, 19-32 основания, 21-30 оснований, 23-28 оснований.

[0032]

Полная длина (T) искусственной мкРНК с соответствием по настоящему изобретению конкретно не ограничена, и нижний предел длины составляет, например, 38 оснований, 42 основания, 46 оснований, верхний предел длины составляет, например, 62 основания, 58 оснований, 54 основания, и диапазон длины составляет, например, 38-62 основания, 42-58 оснований, 46-54 основания.

[0033]

В искусственной мкРНК с соответствием по настоящему изобретению тип упомянутой выше зрелой мкРНК конкретно не ограничен, и он может быть соответствующим образом выбран в зависимости от типа гена-мишени.

[0034]

Примеры упомянутой выше зрелой мкРНК включают зрелые мкРНК, такие как hsa-miR-34a (SEQ ID NO: 1), hsa-let-7a (SEQ ID NO: 2), hsa-let-7f (SEQ ID NO: 3), hsa-miR-150 (SEQ ID NO: 4), hsa-miR-29b (SEQ ID NO: 5) и т.п.

hsa-miR-34a (SEQ ID NO: 1)

UGGCAGUGUCUUAGCUGGUUGU

hsa-let-7a (SEQ ID NO: 2)

UGAGGUAGUAGGUUGUAUAGUU

hsa-let-7f (SEQ ID NO: 3)

UGAGGUAGUAGAUUGUAUAGUU

hsa-miR-150 (SEQ ID NO: 4)

UCUCCCAACCCUUGUACCAGUG

hsa-miR-29b (SEQ ID NO: 5)

UAGCACCAUUUGAAAUCAGUGUU

Нуклеотидная последовательность, показанная под каждым SEQ ID NO, представляет собой последовательность направляющей цепи.

[0035]

Направляющая цепь miR-34a нацелена, например, на AXL, MET, CDK4, CDK6, SIRT1, CCND1, SIRT1, BCL-2 и т.п., и подавление экспрессии этих генов-мишеней может обеспечивать предупреждение или лечение заболеваний, таких как рак легкого, рак ободочной и прямой кишки, рак желудка, рак печени, рак молочной железы и т п.

Направляющая цепь let-7a нацелена, например, на HMGA2 (группа белков с высокой подвижностью AT-hook 2), KRAS, NRAS, HRAS, MYC, TLR4 и т.п., и подавление экспрессии этих генов-мишеней может обеспечивать предупреждение или лечение заболеваний, таких как рак легкого, рак ободочной и прямой кишки, рак желудка, рак печени, рак молочной железы и т.п.

Направляющая цепь let-7f нацелена, например, на HMGA2 (группа белков с высокой подвижностью AT-hook 2), KRAS, NRAS, HRAS, MYC, TLR4 и т.п., и подавление экспрессии этих генов-мишеней может обеспечивать предупреждение или лечение заболеваний, таких как рак легкого, рак ободочной и прямой кишки, рак желудка, рак печени, рак молочной железы и т.п.

Направляющая цепь miR-150 нацелена, например, на COL1A1, COL4A4, SMAD2, SP1 и т.п., и подавление экспрессии этих генов-мишеней может обеспечивать предупреждение или лечение заболеваний, таких как фиброз легких, фиброз печени и т.п.

Направляющая цепь miR-29b нацелена, например, на COL1A1, MCL1, DNMT3A, DNMT3B, TCL1A, TGFb3 и т.п., и подавление экспрессии этих генов-мишеней может обеспечивать предупреждение или лечение заболеваний, таких как рак легкого, рак ободочной и прямой кишки, рак желудка, рак печени, рак молочной железы, фиброз легких, фиброз печени и т.п.

[0036]

Составные элементы искусственной мкРНК с соответствием по настоящему изобретению конкретно не ограничены. Их примеры включают нуклеотидные остатки. Примеры упомянутых выше нуклеотидных остатков включают рибонуклеотидный остаток и дезоксирибонуклеотидный остаток. В искусственной мкРНК с соответствием по настоящему изобретению упомянутый выше нуклеотидный остаток предпочтительно представляет собой, например, рибонуклеотидный остаток. Упомянутый выше нуклеотидный остаток может представлять собой, например, остаток, который не является модифицированным (немодифицированный нуклеотидный остаток) или остаток, который был модифицирован (модифицированный нуклеотидный остаток). Посредством формирования искусственной мкРНК с соответствием по настоящему изобретению так, чтобы она включала упомянутый выше модифицированный нуклеотидный остаток, например, может быть повышена устойчивость искусственной мкРНК с соответствием к нуклеазам, тем самым позволяя повышение стабильности искусственной мкРНК с соответствием. Более того, искусственная мкРНК с соответствием по настоящему изобретению дополнительно может включать, например, ненуклеотидный остаток в дополнение к упомянутому выше нуклеотидному остатку.

[0037]

Когда искусственная мкРНК с соответствием включает, например, упомянутый выше модифицированный рибонуклеотидный остаток(и) в дополнение к упомянутым выше немодифицированным рибонуклеотидным остаткам, количество упомянутых выше модифицированного рибонуклеотидного остатка(ов) конкретно не ограничено, и составляет, например, "от одного до нескольких", в частности, например, от 1 до 5, предпочтительно от 1 до 4, более предпочтительно от 1 до 3, и наиболее предпочтительно 1 или 2. Упомянутый выше модифицированный рибонуклеотидный остаток в противоположность упомянутому выше немодифицированному рибонуклеотидному остатку может представлять собой, например, упомянутый выше дезоксирибонуклеотидный остаток, полученный путем замены остатка рибозы остатком дезоксирибозы. Когда искусственная мкРНК с соответствием по настоящему изобретению включает, например, упомянутый выше дезоксирибонуклеотидный остаток(и) в дополнение к упомянутому выше немодифицированному рибонуклеотидному остатку(ов), количество упомянутых выше дезоксирибонуклеотидного остатка(ов) конкретно не ограничено и составляет, например, "от одного до нескольких", в частности, например, от 1 до 5, предпочтительно от 1 до 4, более предпочтительно от 1 до 3, и наиболее предпочтительно 1 или 2.

[0038]

Упомянутый выше нуклеотидный остаток в качестве его компонентов включает, например, сахар, основание и фосфат. Упомянутый выше рибонуклеотидный остаток имеет, например, остаток рибозы в качестве сахара; и аденин (A), гуанин (G), цитозин (C) или урацил (U) в качестве основания. Упомянутый выше дезоксирибозный остаток имеет, например, остаток дезоксирибозы в качестве сахара; и аденин (A), гуанин (G), цитозин (C) или тимин (T) в качестве основания.

[0039]

Упомянутые выше компоненты упомянутого выше немодифицированного нуклеотидного остатка являются такими же или по существу такими же, например, как и компоненты встречающегося в природе нуклеотидного остатка. В частности, например, компоненты являются такими же или по существу такими же, как и компоненты нуклеотидного остатка, встречающегося естественным образом в организме человека.

[0040]

Например, упомянутый выше модифицированный нуклеотидный остаток может быть таким, что любой из компонентов упомянутого выше нуклеотидного остатка является модифицированным. Примеры упомянутого выше модифицированного нуклеотидного остатка включают встречающиеся в природе нуклеотидные остатки и искусственным образом модифицированные нуклеотидные остатки.

[0041]

Упомянутый выше модифицированный нуклеотидный остаток может представлять собой, например, остаток, являющийся альтернативным упомянутому выше нуклеотиду. Примеры упомянутой выше альтернативы включают мономерные остатки искусственной нуклеиновой кислоты. Ее примеры включают PNA (пептидно-нуклеиновая кислота), LNA (замкнутая нуклеиновая кислота) и ENA (нуклеиновые кислоты с 2ʹ-O,4ʹ-C-этиленовым мостиком).

[0042]

В упомянутом выше нуклеотидном остатке упомянутое выше основание конкретно не ограничено. Упомянутое выше основание может представлять собой, например, природное основание или неприродное основание. Упомянутое выше основание может представлять собой, например, основание природного происхождения или синтетическое основание. В качестве упомянутого выше основания можно использовать, например, обычное основание, его модифицированный аналог и т.п.

[0043]

В искусственной мкРНК с соответствием по настоящему изобретению линкерная область упомянутой выше ненуклеотидной структуры предпочтительно содержит по меньшей мере один элемент, выбранный из группы, состоящей из аминокислотного остатка, остатка полиамина и остатка поликарбоновой кислоты. Упомянутая выше линкерная область может содержать или может не содержать остаток, отличный от аминокислотного остатка, остатка полиамина и остатка поликарбоновой кислоты. Например, упомянутая выше линкерная область может содержать любой из остатка поликарбоновой кислоты остатка терефталевой кислоты и аминокислотного остатка.

[0044]

В рамках настоящего изобретения "полиамин" означает любое соединение, содержащее множество (две, три или более) аминогрупп. Упомянутая выше "аминогруппа" не ограничивается группой -NH2, и также включает иминогруппу (-NH-). В рамках настоящего изобретения упомянутый выше полиамин конкретно не ограничен, и его примеры включают 1,4-диаминобензол, 1,3-диаминобензол, 1,2-диаминобензол и т.п. В рамках настоящего изобретения, более того, "поликарбоновая кислота" означает любое соединение, содержащее множество (две, три или более) карбоксигрупп. В рамках настоящего изобретения упомянутая выше поликарбоновая кислота конкретно не ограничена, и ее примеры включают 1,4-дикарбоксибензол (терефталевая кислота), 1,3-дикарбоксибензол (изофталевая кислота), 1,2-дикарбоксибензол (фталевая кислота) и т.п. Более того, в рамках настоящего изобретения "аминокислота" означает любое органическое соединение, содержащее одну или несколько аминогрупп и одну или несколько карбоксигрупп в молекуле, как упоминалось ниже. Упомянутая выше "аминогруппа" не ограничивается группой -NH2 и также включает иминогруппу (-NH-).

[0045]

В искусственной мкРНК с соответствием по настоящему изобретению упомянутый выше аминокислотный остаток может состоять из множества связанных между собой аминокислотных остатков. В рамках настоящего изобретения аминокислотный остаток, который представляет собой множество связанных между собой аминокислотных остатков, представляет собой, например, остаток, содержащий пептидную структуру. Более конкретно, упомянутый выше аминокислотный остаток, который представляет собой множество связанных между собой аминокислотных остатков, представляет собой, например, аминокислотный остаток упомянутой ниже химической формулы (I), где соединение упомянутой ниже химической формулы (Ia) представляет собой пептид (например, димер глицина или тример глицина и т.д.).

[0046]

В искусственной мкРНК с соответствием по настоящему изобретению упомянутый выше аминокислотный остаток может представлять собой остаток глицина, остаток амида терефталевой кислоты, остаток пролина или остаток лизина. Упомянутый выше аминокислотный остаток может представлять собой модифицированный аминокислотный остаток или производное аминокислоты.

[0047]

В искусственной мкРНК с соответствием по настоящему изобретению упомянутая выше линкерная область соответствует, например, следующей химической формуле (I-0).

[0048]

[0049]

В упомянутой выше химической формуле (I-0),

каждый из Q11 и Q12 независимо представляет собой одинарную связь, CH2 (группа метилена), NH (иминогруппа), C=O (карбонильная группа), C=S (тиокарбонильная группа), C=NH (группа иминометилена), O или S,

каждый из Q1 и Q2 независимо представляет собой одинарную связь, CH2 (группа метилена), NH (иминогруппа), C=O (карбонильная группа), C=S (тиокарбонильная группа), C=NH (группа иминометилена), O или S,

каждый из Y1 и Y2 независимо представляет собой одинарную связь, CH2, NH, O или S;

L1 представляет собой алкиленовую цепь, имеющую n атомов углерода, и атом водорода на атоме углерода алкилена может быть замещен OH, ORa, NH2, NHRa, NRaRb, SH или SRa, или может быть незамещенным, или

L1 представляет собой простую полиэфирную цепь, полученную путем замещения по меньшей мере одного атома углерода на упомянутой выше алкиленовой цепи атомом кислорода,

при условии, что: когда Y1 представляет собой NH, O или S, атом, связанный с Y1 в L1 представляет собой углерод, атом, связанный с OR1 в L1, представляет собой углерод, и атомы кислорода не являются соседними друг с другом;

L2 представляет собой алкиленовую цепь, имеющую m атомов углерода, и атом водорода на атоме углерода алкилена может быть замещен OH, ORc, NH2, NHRc, NRcRd, SH, или SRc, или может быть незамещенным, или

L2 представляет собой простую полиэфирную цепь, полученную путем замещения по меньшей мере одного атома углерода на упомянутой выше алкиленовой цепи атомом кислорода,

при условии, что: когда Y2 представляет собой NH, O или S, атом, связанный с Y2 в L2, представляет собой углерод, атом, связанный с OR2 в L2, представляет собой углерод, и атомы кислорода не являются соседними друг с другом;

каждый из Ra, Rb, Rc и Rd независимо представляет собой заместитель или защитную группу;

m представляет собой целое число в диапазоне от 0 до 30;

n представляет собой целое число в диапазоне от 0 до 30;

каждая из упомянутых выше областей X и Y связана с упомянутым выше линкерным остатком через -OR1- или -OR2-,

где R1 и R2 могут присутствовать или могут не присутствовать и, когда они присутствуют, каждый из R1 и R2 независимо представляет собой нуклеотидный остаток или упомянутую выше структуру (I-0); и

A представляет собой любую атомную группу.

[0050]

Комбинация упомянутых выше областей (X) и (Y) с -OR1- и -OR2- конкретно не ограничена, и она может представлять собой, например, любое из следующих условий.

Условие (1):

упомянутые выше области (X) и (Y) связаны со структурой упомянутой выше формулы (I) через -OR2- и -OR1-, соответственно.

Условие (2):

упомянутые выше области (X) и (Y) связаны со структурой упомянутой выше формулы (I) через -OR1- и -OR2-, соответственно.

[0051]

В упомянутой выше химической формуле (I-0), например, Q11 может представлять собой C=O (карбонильная группа), и Q1 может представлять собой NH (иминогруппа). Кроме того, например, Q11 может представлять собой NH (иминогруппа), и Q1 может представлять собой C=O (карбонильная группа). Более того, например, Q12 может представлять собой C=O (карбонильная группа), и Q2 может представлять собой NH (иминогруппа). Более того, например, Q12 может представлять собой NH (иминогруппа), и Q2 может представлять собой C=O (карбонильная группа).

[0052]

В упомянутой выше химической формуле (I-0), каждый из Q11 и Q12 может представлять собой, например, карбонильную группу. В этом случае, каждый из Q1 и Q2 предпочтительно представляет собой иминогруппу. Кроме того, в этом случае структура следующей химической формулы (Iα) более предпочтительно соответствует следующей химической формуле (Iα2).

[0053]

[0054]

В упомянутой выше химической формуле (Iα2),

R100 представляет собой любой заместитель, который может присутствовать или может не присутствовать. Когда он присутствует, он может присутствовать в единственном числе или в множественном числе. Когда он присутствует в множественном числе, они могут быть одинаковыми или могут отличаться друг от друга. Примеры упомянутого выше любого заместителя для R100 включают упомянутые ниже заместители, проиллюстрированные в качестве упомянутых выше Ra, Rb, Rc и Rd. Их более конкретные примеры включают галоген, гидрокси, алкокси, амино, карбокси, сульфо, нитро, карбамоил, сульфамоил, алкил, алкенил, алкинил, галоалкил, арил, арилалкил, алкиларил, циклоалкил, циклоалкенил, циклоалкилалкил, циклилалкил, гидроксиалкил, алкоксиалкил, аминоалкил, силил, силилоксиалкил, пирролил, имидазолил и т.п. Структура упомянутой выше химической формулы (Iα2) более предпочтительно соответствует следующей химической формуле (Iα3).

[0055]

[0056]

Когда Q11 и Q12 представляют собой карбонильные группы, и Q1 и Q2 представляют собой иминогруппы, линкерный остаток упомянутой выше химической формулы (I-0) может представлять собой остаток амида карбоновой кислоты или остаток карбоновой кислоты. Например, структура "TPA" в упомянутом ниже примере может представлять собой терефталамидный остаток или остаток терефталевой кислоты, соответствующий упомянутой выше химической формуле (Iα3).

[0057]

В упомянутой выше химической формуле (I-0) каждый из Q11 и Q12 может представлять собой иминогруппу. В этом случае, каждый из Q1 и Q2 предпочтительно представляет собой карбонильную группу. В этом случае, структура следующей химической формулы (Iβ) более предпочтительно соответствует следующей химической формуле (Iβ2).

[0058]

[0059]

В упомянутой выше химической формуле (Iβ2),

R100 представляет собой любой заместитель, который может присутствовать или может не присутствовать. Когда он присутствует, он может присутствовать в единственном числе или в множественном числе. Когда он присутствует в множественном числе, они могут быть одинаковыми или могут отличаться друг от друга. В частности, например, он является таким же, как и R100 в упомянутой выше химической формуле (Iα2). Кроме того, структура упомянутой выше химической формулы (Iβ2) более предпочтительно соответствует следующей химической формуле (Iβ3).

[0060]

[0061]

В искусственной мкРНК с соответствием по настоящему изобретению, когда упомянутый выше линкерный остаток представляет собой аминокислотный остаток, упомянутый выше аминокислотный остаток соответствует, например, следующей химической формуле (I). Структура следующей химической формулы (I) является одним из примеров структуры, соответствующей упомянутой выше химической формуле (I-0).

[0062]

[0063]

В упомянутой выше формуле (I), например, X1, X2, Y1, Y2, L1 и L2 являются такими, как определено выше.

Каждая из последовательностей, комплементарных последовательности упомянутой выше микроРНК, связана с упомянутым выше аминокислотным остатком через -OR1- или -OR2-,

где R1 и R2 могут присутствовать или могут отсутствовать, и, когда они присутствуют, каждый из R1 и R2 независимо представляет собой нуклеотидный остаток или упомянутую выше структуру (I); и

A представляет собой любую атомную группу при условии, что соединение следующей химической формулы (Ia) представляет собой аминокислоту или пептид.

[0064]

[0065]

Атомная группа A в упомянутой выше химической формуле (I), (Iα) или (Ia) может содержать или может не содержать, например, по меньшей мере один элемент, выбранный из группы, состоящей из прямой атомной группы, алициклической атомной группы, ароматической атомной группы, гетероароматической атомной группу и гетероалициклической атомной группы. Хотя упомянутая выше прямая атомная группа конкретно не ограничена, могут быть упомянуты, например, алкил, алкенил, алкинил, галоалкил, гидроксиалкил, алкоксиалкил, аминоалкил, силил, силилоксиалкил и т.п. Хотя упомянутая выше алициклическая атомная группа конкретно не ограничена, могут быть упомянуты, например, циклоалкил, циклоалкенил, циклоалкилалкил, циклилалкил и т.п. Хотя упомянутая выше ароматическая атомная группа конкретно не ограничена, могут быть упомянуты, например, арил, арилалкил, алкиларил, арил с конденсированными кольцами, арилалкил с конденсированными кольцами, алкиларил с конденсированными кольцами и т.п. Упомянутая выше гетероароматическая атомная группа конкретно не ограничена, и ее примеры включают гетероарил, гетероарилалкил, алкилгетероарил, гетероарил с конденсированными кольцами, гетероарилалкил с конденсированными кольцами, алкилгетероарил с конденсированными кольцами и т.п. В атомной группе A упомянутой выше химической формулы (I), (Iα) или (Ia), каждая из упомянутых выше атомных групп может дополнительно иметь заместитель или защитную группу, или может не иметь их. Когда упомянутый выше заместитель или защитная группа представлены в множественном числе, они могут быть одинаковыми или могут различаться. Упомянутые выше заместители представляют собой, например, заместители, проиллюстрированные для упомянутых выше Ra, Rb, Rc и Rd, более конкретно, например, галоген, гидрокси, алкокси, амино, карбокси, сульфо, нитро, карбамоил, сульфамоил, алкил, алкенил, алкинил, галоалкил, арил, арилалкил, алкиларил, циклоалкил, циклоалкенил, циклоалкилалкил, циклилалкил, гидроксиалкил, алкоксиалкил, аминоалкил, силил, силилоксиалкил, пирролил, имидазолил и т.п. Упомянутые выше защитные группы являются, например, такими же, как и защитные группы, проиллюстрированные для упомянутых выше Ra, Rb, Rc и Rd.

[0066]

В рамках настоящего изобретения "аминокислота" относится, как упоминалось выше, к любому органическому соединению, содержащему по меньшей мере одну аминогруппу и по меньшей мере одну карбоксигруппу в молекуле. Упомянутая выше "аминогруппа" не ограничивается группой -NH2, и также включает иминогруппу (-NH-). Например, пролин, гидроксипролин и т.п., не содержащие группу -NH2 в молекуле, но содержащие иминогруппу (-NH-), входят в определение "аминокислоты" в рамках настоящего изобретения. В рамках настоящего изобретения упомянутая выше "аминокислота" может представлять собой, как упоминалось ниже, природную аминокислоту или искусственную аминокислоту. Например, поскольку соединение, соответствующее упомянутой ниже химической формуле (Ia2) или (Ia3), содержит аминогруппу и карбоксигруппу в молекуле, оно охватывается определением "аминокислота" в рамках настоящего изобретения. Таким образом, например, упомянутая выше химическая формула (I), где атомная группа A представляет собой структуру, показанную упомянутой ниже химической формулой (A2) или химической формулой (A2a), включена в определение "аминокислотного остатка" в рамках настоящего изобретения. Например, структура "TPA" в упомянутом ниже примере также входит в определение "аминокислотный остаток" в рамках настоящего изобретения. "Пептид" в рамках настоящего изобретения относится к органическому соединению, имеющему структуру, где не менее 2 молекул аминокислот связаны через пептидную связь. Упомянутая выше пептидная связь может представлять собой структуру амида кислоты или структуру имида кислоты. Когда в аминокислоте или молекуле пептида, соответствующих упомянутой выше химической формуле (Ia), присутствует множество аминогрупп, аминогруппа, явно показанная в упомянутой выше химической формуле (Ia), может представлять собой любую аминогруппу. Кроме того, когда в аминокислоте или молекуле пептида, соответствующих упомянутой выше химической формуле (Ia), присутствует множество карбоксигрупп, карбоксигруппа, явно показанная в упомянутой выше химической формуле (Ia), может представлять собой любую карбоксигруппу.

[0067]

В упомянутом выше аминокислотном остатке искусственной мкРНК с соответствием по настоящему изобретению упомянутая выше аминокислота может представлять собой, как упоминалось выше, природную аминокислоту или искусственную аминокислоту. В рамках настоящего изобретения "природная аминокислота" относится к аминокислоте, имеющей встречающуюся в природе структуру, или к ее оптическому изомеру. Способ получения упомянутой выше природной аминокислоты конкретно не ограничен и, например, она может быть экстрагированной из природного источника или может быть синтезированной. В рамках настоящего изобретения, более того, "искусственная аминокислота" относится к аминокислоте, имеющей структуру, не встречающуюся в природе. Таким образом, упомянутая выше искусственная аминокислота представляет собой аминокислоту, т.е. производное карбоновой кислоты, содержащее аминогруппу (органическое соединение, содержащее по меньшей мере одну аминогруппу и по меньшей мере одну карбоксигруппу в молекуле) и имеющее структуру, не встречающуюся в природе. Упомянутая выше искусственная аминокислота предпочтительно не содержит, например, гетерокольцо. Упомянутая выше аминокислота может представлять собой аминокислоту, составляющую, например, белок. Упомянутая выше аминокислота может представлять собой, например, по меньшей мере один тип, выбранный из группы, состоящей из глицина, α-аланина, аргинина, аспарагина, аспарагиновой кислоты, цистеина, цистина, глутамина, глутаминовой кислоты, гистидина, изолейцина, лейцина, лизина, гидроксилизина, метионина, фенилаланина, серина, треонина, тирозина, валина, пролина, 4-гидроксипролина, триптофана, β-аланина, 1-амино-2-карбоксициклопентана, аминобензойной кислоты, аминопиридинкарбоновой кислоты и аминокислоты, соответствующей следующей химической формуле (Ia2), и она может дополнительно иметь заместитель или защитную группу или может не иметь их. Примеры упомянутого выше заместителя включают заместители, проиллюстрированные для вышеупомянутых Ra, Rb, Rc и Rd. Более конкретно, могут быть упомянуты, например, галоген, гидрокси, алкокси, амино, карбокси, сульфо, нитро, карбамоил, сульфамоил, алкил, алкенил, алкинил, галоалкил, арил, арилалкил, алкиларил, циклоалкил, циклоалкенил, циклоалкилалкил, циклилалкил, гидроксиалкил, алкоксиалкил, аминоалкил, силил, силилоксиалкил, пирролил, имидазолил и т.п. Упомянутая выше защитная группа является такой же, как, например, защитные группы, проиллюстрированные для вышеупомянутых Ra, Rb, Rc и Rd. Когда аминокислота упомянутой выше химической формулы (Ia), которая не является пептидом, имеет изомеры, такие как оптический изомер, геометрический изомер, стереоизомер и т.п., можно использовать любой изомер.

[0068]

[0069]

В упомянутой выше химической формуле (Ia2), R100 представляет собой необязательный заместитель, и он может присутствовать или может не присутствовать. Когда он присутствует, он может присутствовать в количестве одного или нескольких, и, когда он присутствует в множественном числе, они могут быть одинаковыми или различающимися. Примеры вышеупомянутого необязательного заместителя для R100 включают заместители, проиллюстрированные для вышеупомянутых Ra, Rb, Rc и Rd, более конкретно, например, галоген, гидрокси, алкокси, амино, карбокси, сульфо, нитро, карбамоил, сульфамоил, алкил, алкенил, алкинил, галоалкил, арил, арилалкил, алкиларил, циклоалкил, циклоалкенил, циклоалкилалкил, циклилалкил, гидроксиалкил, алкоксиалкил, аминоалкил, силил, силилоксиалкил, пирролил, имидазолил, и т.п. Структура упомянутой выше химической формулы (Ia2) может соответствовать, например, следующей химической формуле (Ia3).

[0070]

[0071]

Когда структура упомянутой выше химической формулы (Ia) соответствует упомянутой выше химической формуле (Ia2), структура атомной группы A в вышеупомянутой химической формуле (I) соответствует следующей химической формуле (A2). R100 в следующей химической формуле (A2) является таким же, как и в упомянутой выше химической формуле (Ia2). Когда структура упомянутой выше химической формулы (Ia) соответствует вышеупомянутой химической формуле (Ia3), структура атомной группе A упомянутой выше химической формуле (I) соответствует следующей химической формуле (A2a).

[0072]

[0073]

Структура упомянутой выше химической формулы (I) соответствует, например, следующим химическим формулам (I-1)-(I-7), где n и m являются такими же, как и в вышеупомянутой химической формуле (I).

[0074]

[0075]

В упомянутых выше химических формулах (I-1)-(I-7), n и m конкретно не ограничены, и являются такими, как описано выше. Их конкретные примеры включают n=11 и m=12 или n=5 и m=4 в упомянутой выше химической формуле (I-1), n=5 и m=4 в упомянутой выше химической формуле (I-4), n=4 и m=4 в упомянутой выше химической формуле (I-6), и n=5 и m=4 в упомянутой выше химической формуле (1-7). Их структуры показаны на следующих формулах (I-1a), (I-1b)(I-4a), (I-6a) и (I-7a).

[0076]

[0077]

В искусственной мкРНК с соответствием по настоящему изобретению упомянутая выше линкерная область соответствует, например, следующей формуле (II):

[0078]

В упомянутой выше формуле (II), например,

каждый из X1 и X2 независимо представляет собой H2, O, S или NH;

каждый из Y1 и Y2 независимо представляет собой одинарную связь, CH2, NH, O или S;

R3 представляет собой атом водорода или заместитель, который связан с C-3, C-4, C-5 или C-6 на кольце A,

L1 представляет собой алкиленовую цепь, имеющую n атомов, и атом водорода на атоме углерода алкилена может быть замещен OH, ORa, NH2, NHRa, NRaRb, SH или SRa, или может быть незамещенным, или

L1 представляет собой простую полиэфирную цепь, полученную путем замещения по меньшей мере одного атома углерода на вышеупомянутой алкиленовой цепи атомом кислорода,

при условии, что: когда Y1 представляет собой NH, O или S, атом, связанный с Y1 в L1, представляет собой углерод, атом, связанный с OR1 в L1, представляет собой углерод, и атомы кислорода не являются соседними друг с другом;

L2 представляет собой алкиленовую цепь, имеющую m атомов, и атом водорода на атоме углерода алкилена может быть замещен OH, ORc, NH2, NHRc, NRcRd, SH, или SRc, или может быть незамещенным, или

L2 представляет собой простую полиэфирную цепь, полученную путем замещения по меньшей мере одного атома углерода на вышеупомянутой алкиленовой цепи атомом кислорода,

при условии, что: когда Y2 представляет собой NH, O или S, атом, связанный с Y2 в L2, представляет собой углерод, атом, связанный с OR2 в L2 представляет собой углерод, и атомы кислорода не являются соседними друг с другом;

каждый из Ra, Rb, Rc и Rd независимо представляет собой заместитель или защитную группу;

l равно 1 или 2;

m представляет собой целое число в диапазоне от 0 до 30;

n представляет собой целое число в диапазоне от 0 до 30; и

в кольце A, один атом углерода, отличный от упомянутого выше C-2 на кольце A, может быть замещен азотом, кислородом или серой, и может содержать в упомянутом выше кольце A, углерод-углеродную двойную связь или углерод-азотную двойную связь,

каждая из упомянутых выше областей (X) и (Y) связана с упомянутой выше ненуклеотидной структурой через -OR1- или -OR2-,

где R1 и R2 могут присутствовать или могут не присутствовать и, когда они присутствуют, каждый из R1 и R2 независимо представляет собой нуклеотидный остаток или вышеупомянутую структуру (II).

[0079]

В вышеупомянутой формуле (II), например, каждый из X1 и X2 независимо представляет собой H2, O, S или NH. В вышеупомянутой формуле (II), "X1 представляет собой H2" означает, что X1 образует CH2 (группа метилена) вместе с атомом углерода, с которым X1 связывается. То же применимо к X2.

[0080]

В вышеупомянутой формуле (II), каждый из Y1 и Y2 независимо представляет собой одинарную связь, CH2, NH, O или S.

[0081]

В вышеупомянутой формуле (II), l в кольце A равно 1 или 2. Когда l=1, кольцо A представляет собой 5-членное кольцо, например, вышеупомянутый пирролидиновый остов. Вышеупомянутый пирролидиновый остов представляет собой, например, пролиновый остов, пролиноловый остов и т.п., и иллюстрируется его двухвалентными структурами. Когда l=2, кольцо A представляет собой 6-членное кольцо, например, вышеупомянутый пиперидиновый остов. В кольце A один атом углерода, отличный от C-2 на кольце A, может быть заменен азотом, кислородом или серой. Кольцо A может содержать углерод-углеродную двойную связь или углерод-азотную двойную связь. Кольцо A представляет собой, например, кольцо L-типа или D-типа.

[0082]

В вышеупомянутой формуле (II), R3 представляет собой атом водорода или заместитель, связанный с C-3, C-4, C-5 или C-6 на кольце A. Когда R3 представляет собой вышеупомянутый заместитель, может присутствовать один или несколько заместителей R3, или они могут отсутствовать. Когда R3 присутствует в множественном числе, они могут быть одинаковыми или различаться.

[0083]

Заместитель R3 представляет собой, например, галоген, OH, OR4, NH2, NHR4, NR4R5, SH, SR4, оксогруппу (=O) и т.п.

[0084]

Каждый из R4 и R5 независимо представляет собой, например, заместитель или защитную группу, и они могут быть одинаковыми или могут различаться. Примеры вышеупомянутого заместителя включают галоген, алкил, алкенил, алкинил, галоалкил, арил, гетероарил, арилалкил, циклоалкил, циклоалкенил, циклоалкилалкил, циклилалкил, гидроксиалкил, алкоксиалкил, аминоалкил, гетероциклилалкенил, гетероциклилалкил, гетероарилалкил, силил, силилоксиалкил и т.п. То же самое применимо в настоящем описании далее. Заместитель R3 может быть выбран из заместителей, приведенных выше.

[0085]

Вышеупомянутая защитная группа представляет собой функциональную группу, которая инактивирует, например, высокореакционноспособную функциональную группу. Примеры защитной группы включают известные защитные группы и т.п. Что касается вышеупомянутой защитной группы, например, описание в литературе (J. F. W. McOmie, "Protecting Groups in Organic Chemistry", Prenum Press, London and New York, 1973) может быть включено в настоящее описание. Вышеупомянутая защитная группа конкретно не ограничена, и ее примеры включают трет-бутилдиметилсилильную группу (TBDMS), бис(2-ацетоксиэтилокси)метильную группу (ACE), триизопропилсилилоксиметильную группу (TOM), 1-(2-цианоэтокси)этильную группу (CEE), 2-цианоэтоксиметильную группу (CEM), толилсульфонилэтоксиметильную группу (TEM), диметокситритильную группу (DMTr) и т.п. Когда R3 представляет собой OR4, вышеупомянутая защитная группа конкретно не ограничена, и ее примеры включают группу TBDMS, группу ACE, группу TOM, группу CEE, группу CEM, группу TEM и т.п. Другие примеры защитной группы включают силилсодержащие группы. То же самое применимо в настоящем описании далее.

[0086]

В вышеупомянутой формуле (II), L1 представляет собой алкиленовую цепь, имеющую n атомов. Атом(ы) водорода на вышеупомянутом алкиленовом атоме(ах) углерода может быть замещен, например, OH, ORa, NH2, NHRa, NRaRb, SH или SRa или может быть незамещенным. Альтернативно L1 может представлять собой простую полиэфирную цепь, полученную путем замещения по меньшей мере одного атома углерода на вышеупомянутой алкиленовой цепи атомом кислорода. Вышеупомянутая простая полиэфирная цепь представляет собой, например, полиэтиленгликоль. Когда Y1 представляет собой NH, O или S, атом, связанный с Y1 в L1, представляет собой углерод, атом, связанный с OR1 в L1, представляет собой углерод, и атомы кислорода не являются соседними друг с другом. Таким образом, например, когда Y1 представляет собой O, этот атом кислорода и атом кислорода в L1 не являются соседними друг с другом, и атом кислорода в OR1 и атом кислорода в L1 не являются соседними друг с другом.

[0087]

В вышеупомянутой формуле (II), L2 представляет собой алкиленовую цепь, имеющую m атомов. Атом(ы) водорода на вышеупомянутом атоме(ах) углерода алкилена может быть замещен, например, OH, ORc, NH2, NHRc, NRcRd, SH или SRc или может быть незамещенным. Альтернативно L2 может представлять собой простую полиэфирную цепь, полученную путем замещения по меньшей мере одного атома углерода на вышеупомянутой алкиленовой цепи атомом кислорода. Когда Y2 представляет собой NH, O или S, атом, связанный с Y2 в L2, представляет собой углерод, атом, связанный с OR2 в L2, представляет собой углерод, и атомы кислорода не являются соседними друг с другом. Таким образом, например, когда Y2 представляет собой O, этот атом кислорода и атом кислорода в L2 не являются соседними друг с другом, и атом кислорода в OR2 и атом кислорода в L2 не являются соседними друг с другом.

[0088]

n в L1 и m в L2 конкретно не ограничены, и нижний предел каждого из них может быть равен 0, например, и их верхний предел конкретно не ограничен. Например, n и m могут быть выбраны соответствующий образом в зависимости от желаемой длины вышеупомянутой ненуклеотидной структуры. Например, с точки зрения стоимости производства, выхода и т.п. каждый из n и m предпочтительно равен от 0 до 30, более предпочтительно от 0 до 20, и еще более предпочтительно от 0 до 15. n и m могут быть одинаковыми (n=m) или могут различаться. n+m составляет, например, от 0 до 30, предпочтительно от 0 до 20, и более предпочтительно от 0 до 15.

[0089]

Например, каждый из Ra, Rb, Rc и Rd независимо представляет собой заместитель или защитную группу. Примеры вышеупомянутого заместителя и вышеупомянутой защитной группы являются такими, как описано выше.

[0090]

В вышеупомянутой формуле (II) каждый из атомов водорода независимо может бать замещен, например, галогеном, таким как Cl, Br, F, I и т.п.

[0091]

Каждая из упомянутой выше области X и упомянутой выше области Y связана с упомянутой выше ненуклеотидной структурой через, например, -OR1- или -OR2-. В данном случае, R1 и R2 могут присутствовать или могут не присутствовать. Когда R1 и R2 присутствуют, каждый из R1 и R2 независимо представляет собой нуклеотидный остаток или структуру, соответствующую вышеупомянутой формуле (II). Когда R1 и/или R2 представляют собой вышеупомянутый нуклеотидный остаток, вышеупомянутая ненуклеотидная структура образована, например, вышеупомянутым ненуклеотидным остатком, имеющим структуру вышеупомянутой формулы (II), за исключением нуклеотидного остатка R1 и/или R2, и вышеупомянутым нуклеотидным остатком(ами). Когда R1 и/или R2 представляют собой структуру, соответствующую вышеупомянутой формуле (II), структура вышеупомянутой ненуклеотидной структуры является такой, что, например, два или более из вышеупомянутых ненуклеотидных остатков, имеющих структуру вышеупомянутой формулы (II), связаны друг с другом. Количество структур вышеупомянутой формулы (II) может составлять, например, 1, 2, 3 или 4. Когда вышеупомянутая структура включает множество вышеупомянутых структур, структуры вышеупомянутой формулы (II) могут быть связаны, например, либо прямо, либо через вышеупомянутый нуклеотидый остаток(и). С другой стороны, когда R1 и R2 не присутствуют, вышеупомянутая ненуклеотидная структура образована, например, вышеупомянутым ненуклеотидным остатком, имеющим структуру вышеупомянутой формулы (II) отдельно.

[0092]

Комбинация вышеупомянутых областей X и Y с -OR1- и -OR2- конкретно не ограничена, и она может представлять собой, например, любое из следующих условий:

условие (1)

вышеупомянутые области X и Y связаны со структурой вышеупомянутой формулы (II) через -OR2- и -OR1-, соответственно;

условие (2)

вышеупомянутые области X и Y связаны со структурой вышеупомянутой формулы (II) через -OR1- и -OR2-, соответственно;

[0093]

Примеры структуры вышеупомянутой формулы (II) включают структуры следующих формул с (II-1) по (II-9). В следующих формулах n и m являются такими же, как и в вышеупомянутой формуле (II). В следующих формулах, q представляет собой целое число, составляющее 0-10.

[0094]

В вышеупомянутых формулах с (II-1) по (II-9), n, m и q конкретно не ограничены и являются такими, как описано выше. Их конкретными примерами являются вышеупомянутая формула (II-1), где n=8, вышеупомянутая формула (II-2), где n=3, вышеупомянутая формула (II-3), где n=4 или 8, вышеупомянутая формула (II-4), где n=7 или 8, вышеупомянутая формула (II-5), где n=3 и m=4, вышеупомянутая формула (II-6), где n=8 и m=4, вышеупомянутая формула (II-7), где n=8 и m=4, вышеупомянутая формула (II-8), где n=5 и m=4, и вышеупомянутая формула (II-9), где q=1 и m=4. Один вариант осуществления (n=8) вышеупомянутой формулы (II-4) показан в следующей формуле (II-4a), и один вариант осуществления (n=5, m=4) упомянутой выше формулы (II-8) показан в следующей формуле (II-8a).

[0095]

В рамках настоящего изобретения термин "алкил" охватывает, например, прямые и разветвленные алкильные группы. Количество атомов углерода в вышеупомянутом алкиле конкретно не ограничено и составляет, например, от 1 до 30, предпочтительно от 1 до 6, более предпочтительно от 1 до 4. Примеры вышеупомянутой алкильной группы включают: метил, этил, н-пропил, изопропил, н-бутил, изобутил, втор-бутил, трет-бутил, н-пентил, изопентил, неопентил, н-гексил, изогексил, н-гептил, н-октил, н-нонил и н-децил и т.п. Среди них, например, метил, этил, н-пропил, изопропил, н-бутил, изобутил, втор-бутил, трет-бутил, н-пентил, изопентил, неопентил, н-гексил, изогексил и т.п., являются предпочтительными.

[0096]

В рамках настоящего изобретения термин "алкенил" охватывает, например, прямые и разветвленные алкенилы. Примеры вышеупомянутого алкенила включают вышеупомянутые алкилы, имеющие одну или несколько двойных связей, и т.п. Количество атомов углерода в вышеупомянутом алкениле конкретно не ограничено и, например, является таким же, как и количество атомов углерода в вышеупомянутом алкиле, предпочтительно от 2 до 8. Примеры вышеупомянутого алкенила включают винил, 1-пропенил, 2-пропенил, 1-бутенил, 2-бутенил, 3-бутенил, 1,3-бутадиенил, 3-метил-2-бутенил и т.п.

[0097]

В рамках настоящего изобретения термин "алкинил" охватывает, например, прямые и разветвленные алкинилы. Примеры вышеупомянутого алкинила включают вышеупомянутые алкилы, имеющие одну или несколько тройных связей, и т.п. Количество атомов углерода в вышеупомянутом алкиниле конкретно не ограничено и является, например, таким же, как и количество атомов углерода в вышеупомянутом алкиле, предпочтительно от 2 до 8. Примеры вышеупомянутого алкинила включают этинил, пропинил, бутинил и т.п. Вышеупомянутый алкинил, кроме того, может включать, например, одну или несколько двойных связей.

[0098]

В рамках настоящего изобретения термин "арил" охватывает, например, моноциклические ароматические углеводородные группы и полициклические ароматические углеводородные группы. Примеры вышеупомянутой моноциклической ароматической углеводородной группы включают фенил и т.п. Примеры вышеупомянутой полициклической ароматической углеводородной группы включают 1-нафтил, 2-нафтил, 1-антрил, 2-антрил, 9-антрил, 1-фенантрил, 2-фенантрил, 3-фенантрил, 4-фенантрил, 9-фенантрил и т.п. Среди них предпочтительными являются, например, фенил, нафтилы, такие как 1-нафтил и 2-нафтил, и т.п.

[0099]

В рамках настоящего изобретения термин "гетероарил" охватывает, например, моноциклические ароматические гетероциклические группы и конденсированные ароматические гетероциклические группы. Примеры вышеупомянутого гетероарила включают фурилы (например, 2-фурил, 3-фурил), тиенилы (например, 2-тиенил, 3-тиенил), пирролилы (например, 1-пирролил, 2-пирролил, 3-пирролил), имидазолилы (например, 1-имидазолил, 2-имидазолил, 4-имидазолил), пиразолилы (например, 1-пиразолил, 3-пиразолил, 4-пиразолил), триазолилы (например, 1,2,4-триазол-1-ил, 1,2,4-триазол-3-ил, 1,2,4-триазол-4-ил), тетразолилы (например, 1-тетразолил, 2-тетразолил, 5-тетразолил), оксазолилы (например, 2-оксазолил, 4-оксазолил, 5-оксазолил), изоксазолилы (например, 3-изоксазолил, 4-изоксазолил, 5-изоксазолил), тиазолилы (например, 2-тиазолил, 4-тиазолил, 5-тиазолил), тиадиазолилы, изотиазолилы (например, 3-изотиазолил, 4-изотиазолил, 5-изотиазолил), пиридилы (например, 2-пиридил, 3-пиридил, 4-пиридил), пиридазинилы (например, 3-пиридазинил, 4-пиридазинил), пиримидинилs (например, 2-пиримидинил, 4-пиримидинил, 5-пиримидинил), фуразанилы (например, 3-фуразанил), пиразинилы (например, 2-пиразинил), оксадиазолилы (например, 1,3,4-оксадиазол-2-ил), бензофурилы (например, 2-бензо[b]фурил, 3-бензо[b]фурил, 4-бензо[b]фурил, 5-бензо[b]фурил, 6-бензо[b]фурил, 7-бензо[b]фурил), бензотиенилs (например, 2-бензо[b]тиенил, 3-бензо[b]тиенил, 4-бензо[b]тиенил, 5-бензо[b]тиенил, 6-бензо[b]тиенил, 7-бензо[b]тиенил), бензимидазолилы (например, 1-бензимидазолил, 2-бензимидазолил, 4-бензимидазолил, 5-бензимидазолил), дибензофурилы, бензоксазолилы, бензотиазолилы, хиноксалинилы (например, 2-хиноксалинил, 5-хиноксалинил, 6-хиноксалинил), циннолинилы (например, 3-циннолинил, 4-циннолинил, 5-циннолинил, 6-циннолинил, 7-циннолинил, 8-циннолинил), хиназолинилы (например, 2-хиназолинил, 4-хиназолинил, 5-хиназолинил, 6-хиназолинил, 7-хиназолинил, 8-хиназолинил), хинолилы (например, 2-хинолил, 3-хинолил, 4-хинолил, 5-хинолил, 6-хинолил, 7-хинолил, 8-хинолил), фталазинилы (например, 1-фталазинил, 5-фталазинил, 6-фталазинил), изохинолилы (например, 1-изохинолил, 3-изохинолил, 4-изохинолил, 5-изохинолил, 6-изохинолил, 7-изохинолил, 8-изохинолил), пурилы, птеридинилы (например, 2-птеридинил, 4-птеридинил, 6-птеридинил, 7-птеридинил), карбазолилы, фенантридинилы, акридинилы (например, 1-акридинил, 2-акридинил, 3-акридинил, 4-акридинил, 9-акридинил), индолилы (например, 1-индолил, 2-индолил, 3-индолил, 4-индолил, 5-индолил, 6-индолил, 7-индолил), изоиндолилы, феназинилы (например, 1-феназинил, 2-феназинил) и фенотиазинилы (например, 1-фенотиазинил, 2-фенотиазинил, 3-фенотиазинил, 4-фенотиазинил) и т.п.

[0100]

В рамках настоящего изобретения, например, термин "циклоалкил" относится к циклическим насыщенным углеводородным группам и количество атомов углерода в циклоалкиле равно, например, от 3 до 15. Примеры вышеупомянутого циклоалкила включают циклопропил, циклобутил, циклопентил, циклогексил, циклогептил, циклооктил, мостиковые циклические углеводородные группы, углеводородные спирогруппы и т.п. Среди них, предпочтительными являются циклопропил, циклобутил, циклопентил, циклогексил, мостиковые циклические углеводородные группы и т.п.

[0101]

В рамках настоящего изобретения примеры "мостиковых циклических углеводородных групп" включают бицикло[2.1.0]пентил, бицикло[2.2.1]гептил, бицикло[2.2.2]октил и бицикло[3.2.1]октил, трицикло[2.2.1.0]гептил, бицикло[3.3.1]нонан, 1-адамантил, 2-адамантил и т.п.

[0102]

В рамках настоящего изобретения примеры "углеводородных спирогрупп" включают спиро[3.4]октил и т.п.

[0103]

В рамках настоящего изобретения термин "циклоалкенил" охватывает, например, ненасыщенные циклические алифатические углеводородные группы и количество атомов углерода в циклоалкениле равно, например, от 3 до 7. Примеры вышеупомянутого циклоалкенила включают циклопропенил, циклобутенил, циклопентенил, циклогексенил, циклогептенил и т.п. Среди них предпочтительными являются циклопропенил, циклобутенил, циклопентенил, циклогексенил и т.п. Вышеупомянутый термин "циклоалкенил" также охватывает, например, мостиковые циклические углеводородные группы и углеводородные спирогруппы, имеющие ненасыщенную связь в их кольцах.

[0104]

В рамках настоящего изобретения примеры "арилалкила" включают бензил, 2-фенэтил, нафталенилметил и т.п. Примеры "циклоалкилалкила" и "циклилалкила" включают циклогексилметил адамантилметил и т.п. Примеры "гидроксиалкила" включают гидроксиметил, 2-гидроксиэтил и т.п.

[0105]

В рамках настоящего изобретения "алкокси" охватывает, например, группы, состоящие из любого из вышеупомянутых алкилов и кислорода (алкил-O-группы), и их примеры включают метокси, этокси, н-пропокси, изопропокси, н-бутокси и т.п. Примеры "алкоксиалкила" включают метоксиметил и т.п. Примеры "аминоалкила" включают 2-аминоэтил и т.п.

[0106]

В рамках настоящего изобретения примеры "гетероциклила" включают 1-пирролинил, 2-пирролинил, 3-пирролинил, 1-пирролидинил, 2-пирролидинил, 3-пирролидинил, пирролидинон, 1-имидазолинил, 2-имидазолинил, 4-имидазолинил, 1-имидазолидинил, 2-имидазолидинил, 4-имидазолидинил, имидазолидинон, 1-пиразолинил, 3-пиразолинил, 4-пиразолинил, 1-пиразолидинил, 3-пиразолидинил, 4-пиразолидинил, пиперидинон, пиперидинo, 2-пиперидинил, 3-пиперидинил, 4-пиперидинил, 1-пиперазинил, 2-пиперазинил, пиперазинон, 2-морфолинил, 3-морфолинил, морфолино, тетрагидропиранил, тетрагидрофуранил и т.п.

[0107]

В рамках настоящего изобретения примеры "гетероциклилалкила" включают пиперидинилметил, пиперазинилметил и т.п. Примеры "гетероциклилалкенила" включают 2-пиперидинилэтенил и т.п. Примеры "гетероарилалкила" включают пиридилметил, хинолин-3-илметил и т.п.

[0108]

В рамках настоящего изобретения термин "силил" охватывает группы, соответствующие химической формуле R3Si-, где R независимо может быть выбран из вышеупомянутых алкилов, арилов и циклоалкилов. Примеры силила включают триметилсилильную группу, трет-бутилдиметилсилильную группу и т.п. Примеры "силилокси" включают триметилсилилоксигруппу и т.п. Примеры "силилоксиалкила" включают триметилсилилоксиметил и т.п.

[0109]

В рамках настоящего изобретения примеры "алкилена" включают метилен, этилен, пропилен и т.п.

[0110]

В рамках настоящего изобретения описанные выше различные группы могут быть замещенными. Примеры вышеупомянутого заместителя включают гидрокси, карбокси, сульфо, галоген, алкилгалогенид (галогеналкил, например, CF3, CH2CF3, CH2CCl3), нитро, нитрозо, циано, алкил (например, метил, этил, изопропил, трет-бутил), алкенил (например, винил), алкинил (например, этинил), циклоалкил (например, циклопропил, адамантил), циклоалкилалкил (например, циклогексилметил, адамантилметил), циклоалкенил (например, циклопропенил), циклилалкил, гидроксиалкил (например, гидроксиметил, гидроксиэтил), алкоксиалкил (например, метоксиметил, этоксиметил, этоксиэтил), арил (например, фенил, нафтил), арилалкил (например, бензил, фенэтил), алкиларил (например, п-метилфенил), гетероарил (например, пиридил, фурил), гетероарилалкил (например, пиридилметил), гетероциклил (например, пиперидил), гетероциклилалкенил, гетероциклилалкил (например, морфолилметил), алкокси (например, метокси, этокси, пропокси, бутокси), галогенированный алкокси (например, OCF3), алкенилокси (например, винилокси, аллилокси), арилокси (например, фенилокси), алкилоксикарбонил (например, метоксикарбонил, этоксикарбонил, трет-бутоксикарбонил), арилалкилокси (например, бензилокси), амино [алкиламино (например, метиламино, этиламино, диметиламино), ациламино (например, ацетиламино, бензоиламино), арилалкиламино (например, бензиламино, тритиламино), гидроксиамино], аминоалкил (например, аминометил), алкиламиноалкил (например, диэтиламинометил), карбамоил, сульфамоил, оксо, силил, силилоксиалкил и т.п.

[0111]

Искусственная мкРНК с соответствием по настоящему изобретению может включать, например, вещество для мечения и она может быть мечена вышеупомянутым веществом для мечения. Вышеупомянутое вещество для мечения конкретно не ограничено, и оно может представлять собой, например, флуоресцентное вещество, краситель, изотоп и т.п. Примеры вышеупомянутого вещества для мечения включают: флуорофоры, такие как пирен, TAMRA, флуоресцеин, краситель Cy3, краситель Cy5 и т.п. Примеры вышеупомянутого красителя включают красители Alexa, такие как Alexa 488 и т.п. Примеры вышеупомянутого изотопа включают стабильные изотопы и радиоизотопы. Среди них предпочтительными являются стабильные изотопы. Более того, например, вышеупомянутый стабильный изотоп не изменяет физических свойств соединения, меченного им, и, таким образом, обладает превосходным свойством в качестве метки. Вышеупомянутый стабильный изотоп конкретно не ограничен, и его примеры включают 2H, 13C, 15N, 17O, 18O, 33S, 34S и 36S.

[0112]

Как описано выше, искусственная мкРНК с соответствием по настоящему изобретению может ингибировать вышеупомянутую экспрессию гена-мишени. Таким образом, искусственную мкРНК с соответствием по настоящему изобретению можно использовать, например, в качестве лекарственного средства для лечения заболевания, обусловленного геном. Когда искусственная мкРНК с соответствием по настоящему изобретению имеет последовательность направляющей цепи зрелой мкРНК, которая ингибирует экспрессию гена, вызывающего вышеупомянутое заболевание, например, является возможным лечение вышеупомянутого заболевания путем ингибирования экспрессии вышеупомянутого гена-мишени. В рамках настоящего изобретения термин "лечение" охватывает, например, предупреждение вышеупомянутых заболеваний; улучшение при заболевании и улучшение прогноза, и оно может означать любое из них. Вышеупомянутое заболевание конкретно не ограничено и, например, вышеупомянутая последовательность, которая подавляет экспрессию, может быть выбрана соответствующим образом в зависимости от рассматриваемого заболевания. Примеры вышеупомянутого заболевания включают злокачественную опухоль, такую как рак молочной железы, рак легкого, рак желудка, рак ободочной и прямой кишки, рак печени, рак поджелудочной железы, рак пищевода, рак предстательной железы, рак желчного пузыря, рак тела матки, рак шейки матки, рак яичника, остеосаркома, лейкоз и т.п., и заболевания, такие как фиброз легких, фиброз печени и т.п.

[0113]

Способ с использованием искусственной мкРНК с соответствием по настоящему изобретению конкретно не ограничен. Например, вышеупомянутую искусственную мкРНК с соответствием можно вводить индивидууму, имеющему вышеупомянутый ген-мишень.

[0114]

Примеры вышеупомянутого индивидуума включают клетки, ткани и органы. Примеры вышеупомянутого индивидуума также включают людей, не являющихся человеком животных, таких как не являющиеся человеком млекопитающие. Вышеупомянутое введение можно проводить, например, in vivo или in vitro. Вышеупомянутые клетки конкретно не ограничены, и их примеры включают: различные культивируемые клетки, такие как клетки HeLa, клетки 293, клетки NIH3T3, клетки COS и т.п.; стволовые клетки, такие как клетки ES, гемопоэтические клетки и т.п.; и выделенные клетки из живых организмов, таких как первичные культивируемые клетки и т.п.

[0115]

В рамках настоящего изобретения вышеупомянутый ген-мишень, экспрессия которого подлежит ингибированию, конкретно не ограничен, и любой желаемый ген может быть выбран в качестве гена-мишени. Как упоминалось выше, вышеупомянутая зрелая мкРНК может быть выбрана в зависимости от типа вышеупомянутого гена-мишени.

[0116]

Что касается применения искусственной мкРНК с соответствием по настоящему изобретению, может быть приведено следующее описание, касающееся композиции, способа ингибирования экспрессии, способа лечения и т.п. в соответствии с настоящим изобретением.

[0117]

Поскольку искусственная мкРНК с соответствием по настоящему изобретению может ингибировать экспрессию гена-мишени, например, как описано выше, она пригодна в качестве фармацевтического продукта, диагностического средства, сельскохозяйственного химического реагента и инструмента для проведения исследований в сельском хозяйстве, медицинской науке, науке о жизни и т.п.

[0118]

Способ синтеза искусственной мкРНК с соответствием по настоящему изобретению конкретно не ограничен, и можно использовать общеизвестный способ получения нуклеиновой кислоты. Примеры вышеупомянутого способа синтеза включают способы синтеза в соответствии с методиками генной инженерии, способы химического синтеза и т.п. Примеры методик генной инженерии включают: способы синтеза с использованием транскрипции in vitro; способы с использованием вектора; способы, проводимые с использованием кассеты для ПЦР и т.п. Вышеупомянутый вектор конкретно не ограничен, и его примеры включают невирусные векторы, такие как плазмида и т.п., и вирусные векторы и т.п. Вышеупомянутые способы химического синтеза конкретно не ограничены, и их примеры включают способ с фосфорамидитом, способ с H-фосфонатом и т.п. Вышеупомянутые способы химического синтеза можно выполнять, например, с использованием коммерчески доступного автоматического устройства для синтеза нуклеиновых кислот. В вышеупомянутых способах химического синтеза обычно используют амидит. Вышеупомянутый амидит конкретно не ограничен. Примеры коммерчески доступных амидитов включают РНК-фосфорамидиты (2ʹ-O-TBDMSi, торговое название, Samchully Pharm. Co., Ltd.), амидит ACE, амидит TOM, амидит CEE, амидит CEM, амидит TEM и т.п.

[0119]

(2) композиция

Ингибирующая экспрессию композиция в соответствии с настоящим изобретением представляет собой, как описано выше, композицию для ингибирования экспрессии гена-мишени, характерным образом содержащую вышеупомянутую искусственную мкРНК с соответствием по настоящему изобретению. Композиция по настоящему изобретению характеризуется тем, что она содержит вышеупомянутую искусственную мкРНК с соответствием по настоящему изобретению, и другие конфигурации никоим образом не ограничены. Ингибирующая экспрессию композиция по настоящему изобретению также может называться, например, ингибирующим экспрессию реагентом.

[0120]

В соответствии с настоящим изобретением, например, путем введения индивидууму, у которого присутствует вышеупомянутый ген-мишень, является возможным ингибирование экспрессии вышеупомянутого гена-мишени.

[0121]

Более того, как описано выше, фармацевтическая композиция в соответствии с настоящим изобретением характерным образом содержит вышеупомянутую искусственную мкРНК с соответствием по настоящему изобретению. Композиция по настоящему изобретению характеризуется тем, что она содержит вышеупомянутую искусственную мкРНК с соответствием по настоящему изобретению, и другие конфигурации не являются никоим образом ограниченными. Фармацевтическая композиция по настоящему изобретению также может быть названа, например, фармацевтическим продуктом.

[0122]

В соответствии с настоящим изобретением, например, введение пациенту с заболеванием, обусловленным геном, может ингибировать экспрессию вышеупомянутого гена, тем самым осуществляя лечение вышеупомянутого заболевания. В рамках настоящего изобретения термин "лечение" охватывает, как упоминалось выше, предупреждение вышеупомянутых заболеваний; улучшение при заболеваниях; и улучшение прогноза, например, и оно может означать любое из них.

[0123]

В рамках настоящего изобретения заболевание, подлежащее лечению, конкретно не ограничено, и его примеры включают заболевания, вызванные экспрессией генов. В зависимости от типа вышеупомянутого заболевания, ген, который вызывает заболевание, может быть выбран в качестве вышеупомянутого гена-мишени, и, кроме того, в зависимости от вышеупомянутого гена-мишени может быть выбрана вышеупомянутая последовательность направляющей цепи вышеупомянутой зрелой мкРНК.

[0124]

Способ с использованием ингибирующей экспрессию композиции и фармацевтической композиции в соответствии с настоящим изобретением (далее обе композиции просто обозначаются как "композиции") конкретно не ограничен, и его примеры включают введение вышеупомянутой искусственной мкРНК с соответствием индивидууму, имеющему вышеупомянутый ген-мишень.

[0125]

Примеры вышеупомянутого индивидуума включают клетки, ткани и органы. Примеры вышеупомянутого индивидуума также включают людей, не являющихся человеком животных, таких как не являющиеся человеком млекопитающие. Вышеупомянутое введение можно проводить, например, in vivo или in vitro. Вышеупомянутые клетки конкретно не ограничены и их примеры включают: различные культивируемые клетки, такие как клетки HeLa, клетки 293, клетки NIH3T3, клетки COS и т.п.; стволовые клетки, такие как клетки ES, гемопоэтические клетки и т.п.; и выделенные клетки из живых организмов, таких как первичные культивируемые клетки и т.п.

[0126]

Вышеупомянутый способ введения конкретно не ограничен и его можно определять, например, соответствующим образом в зависимости от индивидуума. Когда вышеупомянутым индивидуумом является культивируемая клетка, способ введения может представлять собой, например, способ с использованием реагента для трансфекции, способ электропорации и т.п.

[0127]

Например, каждая из композиций по настоящему изобретению может содержать только искусственную мкРНК с соответствием по настоящему изобретению или, кроме того, она может содержать добавку(и) в дополнение к искусственной мкРНК с соответствием. Вышеупомянутая добавка конкретно не ограничена, и предпочтительно представляет собой, например, фармацевтически приемлемую добавку. Тип вышеупомянутой добавки конкретно не ограничен и может быть выбран соответствующим образом в зависимости, например, от типа индивидуума.

[0128]

В композиции по настоящему изобретению, например, вышеупомянутая искусственная мкРНК с соответствием может образовывать комплекс с вышеупомянутой добавкой. Вышеупомянутая добавка также может быть обозначена, например, как комплексообразующий агент. Образование вышеупомянутого комплекса позволяет, например, эффективную доставку вышеупомянутой искусственной мкРНК с соответствием.

[0129]

Вышеупомянутый комплексообразующий агент конкретно не ограничен, и его примеры включают полимеры, циклодекстрины, адамантин и т.п. Примеры вышеупомянутых циклодекстринов включают линейные сополимеры циклодекстрина, линейные сополимеры окисленного циклодекстрина и т.п.

[0130]

Другие примеры вышеупомянутой добавки включают носитель, связующее вещество, которое связывается с клеткой-мишенью, конденсирующий агент, фузогенный агент, эксципиент и т.п.

[0131]

(3) Способ ингибирования экспрессии

Способ ингибирования экспрессии в соответствии с настоящим изобретением представляет собой, как описано выше, способ ингибирования экспрессии гена-мишени, в котором характерным образом используют вышеупомянутую искусственную мкРНК с соответствием по настоящему изобретению. Способ ингибирования экспрессии по настоящему изобретению характеризуется тем, что в нем используется вышеупомянутая искусственная мкРНК с соответствием по настоящему изобретению, и другие стадии и условия никоим образом не ограничены.

[0132]

В способе ингибирования экспрессии по настоящему изобретению механизм, посредством которого ингибируется вышеупомянутая экспрессия гена-мишени, конкретно не ограничен, и его примеры включают ингибирование экспрессии зрелой мкРНК.

[0133]

Способ ингибирования экспрессии по настоящему изобретению включает, например, стадию введения вышеупомянутой искусственной мкРНК с соответствием индивидууму, у которого вышеупомянутый ген-мишень присутствует. Посредством вышеупомянутой стадии введения, например, вышеупомянутую искусственную мкРНК с соответствием приводят в контакт с вышеупомянутым индивидуумом. Примеры вышеупомянутого индивидуума включают клетки, ткани и органы. Примеры вышеупомянутого индивидуума также включают человека, не являющихся человеком животных, таких как не являющиеся человеком млекопитающие. Вышеупомянутое введение можно проводить, например, in vivo или in vitro.

[0134]

В способе ингибирования экспрессии по настоящему изобретению, например, можно вводить вышеупомянутую искусственную мкРНК с соответствием отдельно, или можно вводить вышеупомянутую композицию по настоящему изобретению, содержащую вышеупомянутую искусственную мкРНК с соответствием. Вышеупомянутый способ введения конкретно не ограничен и, например, может быть выбран соответствующим образом в зависимости от типа индивидуума.

[0135]

(4) Способ лечения

Как описано выше, способ лечения заболевания в соответствии с настоящим изобретением включает стадию введения вышеупомянутой искусственной мкРНК с соответствием по настоящему изобретению пациенту, и он характеризуется тем, что вышеупомянутая последовательность направляющей цепи в вышеупомянутой искусственной мкРНК с соответствием представляет собой последовательность направляющей цепи зрелой мкРНК, которая ингибирует экспрессию гена, вызывающего вышеупомянутое заболевание. Способ лечения по настоящему изобретению характеризуется использованием вышеупомянутой искусственной мкРНК с соответствием по настоящему изобретению, и другие стадии и условия никоим образом не ограничены.

[0136]

Вышеупомянутый способ ингибирования экспрессии по настоящему изобретению также применим, например, к способу лечения по настоящему изобретению. Вышеупомянутый способ введения конкретно не ограничен и может представлять собой, например, любой из перорального введения и парентерального введения.

[0137]

(5) Применение искусственной мкРНК с соответствием

Применение в соответствии с настоящим изобретением представляет собой применение вышеупомянутой искусственной мкРНК с соответствием по настоящему изобретению для вышеупомянутого ингибирования экспрессии гена-мишени.

[0138]

Одноцепочечная нуклеиновая кислота в соответствии с настоящим изобретением представляет собой одноцепочечную нуклеиновую кислоту для применения для лечения заболевания. Вышеупомянутая одноцепочечная нуклеиновая кислота представляет собой вышеупомянутую искусственную мкРНК с соответствием по настоящему изобретению, и она характеризуется тем, что вышеупомянутая последовательность направляющей цепи в вышеупомянутой искусственной мкРНК с соответствием представляет собой последовательность направляющей цепи зрелой мкРНК, которая ингибирует экспрессию гена, вызывающего вышеупомянутое заболевание.

[0139]

Ниже настоящее изобретение подробно описано с помощью примеров и т.п. Однако следует отметить, что настоящее изобретение никоим образом не ограничивается ими.

Примеры

[0140]

(Пример 1)

Искусственную мкРНК с соответствием по настоящему изобретению синтезировали на основе направляющей цепи зрелой miR-34a, и подтверждали подавление роста клеток H1299.

[0141]

(1) Синтез мкРНК

В качестве положительной контрольной мкРНК синтезировали зрелую miR-34a человека, состоящую из направляющей цепи (SEQ ID NO: 1) и пассажирской цепи (SEQ ID NO: 6), показанных ниже. В качестве отрицательного контроля синтезировали зрелую miR-34a с рандомизированной последовательностью, состоящую из рандомизированной последовательности направляющей цепи (SEQ ID NO: 7), где композиция оснований вышеупомянутой направляющей цепи рандомизирована, и соответствующей пассажирской цепи (SEQ ID NO: 8).

[0142]

В качестве искусственной мкРНК с соответствием в примерах синтезировали miR-34a с соответствием, где область X, состоявшая из вышеупомянутой направляющей цепи (SEQ ID NO: 1) и дополнительной последовательности, и область Y, состоявшая из последовательности, полностью комплементарной упомянутой выше области X и выступающего конца, связаны посредством ненуклеотидной структуры (показана посредством [P] в последовательностях) в виде производного пролина следующей ниже формулы. В следующих последовательностях подчеркнутая часть соответствует вышеупомянутой направляющей цепи. Вышеупомянутая ненуклеотидная структура в вышеупомянутой мкРНК с соответствием показана в следующей формуле, и ее вносили с использованием L-пролиндиамидамидита (см. WO 2012/017919) в вышеупомянутом синтезе мкРНК с соответствием. Кроме того, в качестве отрицательного контроля для искусственной мкРНК с соответствием синтезировали рандомизированную miR-34a с соответствием, состоящую из вышеупомянутой направляющей цепи, где композиция оснований направляющей цепи рандомизирована, и пассажирской цепи, соответствующей ей.

[0143]

[0144]

Последовательности и структуры этих мкРНК показаны ниже. Ниже последовательности, показанные посредством подчеркнутых частей, соответствуют направляющим цепям.

Зрелая miR-34a

направляющая цепь (SEQ ID NO: 1)

5ʹ-UGGCAGUGUCUUAGCUGGUUGU-3ʹ

пассажирская цепь (SEQ ID NO: 6)

5ʹ-CAAUCAGCAAGUAUACUGCCCU-3ʹ

рандомизированная зрелая miR-34a

направляющая цепь (SEQ ID NO: 7)

5ʹ-UGUAUCGUUAUCGGGUCGGUUG-3ʹ

пассажирская цепь (SEQ ID NO: 8)

5ʹ-CAACCGACCCGAUAACGAUACA-3ʹ

miR-34a с соответствием (SEQ ID NO: 9)

5ʹ-UGGCAGUGUCUUAGCUGGUUGUUCC-[P]-GGAACAACCAGCUAAGACACUGCCAUA-3ʹ

рандомизированная miR-34a с соответствием (SEQ ID NO: 10)

5ʹ-UGUAUCGUUAUCGGGUCGGUUGUCC-[P]-GGACAACCGACCCGAUAACGAUACAUA-3ʹ

[0145]

[0146]

(2) Влияние искусственной мкРНК с соответствием на клетки, происходящие из рака легкого

Вышеупомянутую искусственную мкРНК с соответствием вводили в клеточную линию немелкоклеточного рака легкого человека (NCI-H1299) и подтверждали влияние на вышеупомянутые клетки.

[0147]

(2-1) Трансфекция

Вышеупомянутую мкРНК растворяли в дистиллированной воде для инъекций (Otsuka Pharmaceutical Co., Ltd., далее то же самое) с получением раствора мкРНК в концентрации 100 мкмоль/л. В качестве среды использовали среду RPMI 1640 (Invitrogen), содержавшую 10% FBS. Условия культивирования представляли собой 37°C, 5% CO2.

[0148]

Сначала клетки культивировали в вышеупомянутой среде, и культуральный раствор распределяли в 24-ячеечный планшет, так чтобы каждая лунка содержала 500 мкл культурального раствора, для достижения плотности 1×104 клеток/лунка. Клетки в вышеупомянутых лунках культивировали в течение 24 часов. Клетки трансфицировали вышеупомянутой мкРНК с использованием реагента для трансфекции RNAi MAX (торговое название, Life Technologies) в соответствии с прилагаемым протоколом. Трансфекцию проводили путем добавления композиции на лунку следующим образом. В представленной ниже композиции, (B) представляет собой Opti-MEM (торговое название, Life Technologies), (C) представляет собой вышеупомянутый раствор РНК, и добавляли всего 49 мкл. Конечная концентрация вышеупомянутой мкРНК в вышеупомянутой лунке составляла 100 нмоль/л. После трансфекции, клетки в вышеупомянутой лунке культивировали в течение 3 суток. После вышеупомянутого культивирования в течение 3 суток проводили проверку культивируемых клеток.

[0149]

Таблица 1
(композиция на лунку: мкл)
Культуральный раствор 450
Реагент для трансфекции (A) 1
(B)+(C) 49
500

[0150]

(2-2) Подсчет количества клеток

После культивирования подсчитывали количество культивируемых клеток на лунку. Результаты представлены на фиг.2. На фиг.2 представлен график, демонстрирующий количество клеток на лунку. На фиг.2, "норма" показывает результаты для необработанных клеток, "имитация" показывает клетки, в которые был введен только реагент для трансфекции, "рандомизированная" показывает рандомизированную miR-34a в качестве отрицательного контроля, "miR-34a" показывает зрелую miR-34a в качестве положительного контроля, "рандомизированная с соответствием" показывает рандомизированную miR-34a с соответствием в качестве отрицательного контроля, и "miR-34a с соответствием" показывает miR-34a с соответствием, представленную в примерах (далее то же самое). Как показано на фиг.2, miR-34a с соответствием в примерах могла снижать количество клеток до того же уровня, как и положительная контрольная зрелая miR-34a.

[0151]

(2-3) Анализ с MTT

После культивирования культивированные клетки подвергали анализу с MTT с использованием коммерчески доступного набора с реагентами (торговое название Cell Count Reagent SF, Nacalai Tesque), и оценивали пролиферацию клеток. Оценка пролиферации клеток показана в относительных величинах, принимая результаты нормы (без обработки) за 1. Результаты показаны на фиг.3. На фиг.3 представлен график, демонстрирующий относительную величину пролиферации клеток. Как показано на фиг.3, miR-34a с соответствием согласно примерам могла снижать количество клеток до того же уровня, что и положительная контрольная зрелая miR-34a.

[0152]

(2-4) Апоптоз

После культивирования в культивированных клетках проводили выявление апоптоза с использованием коммерчески доступного набора с реагентами (торговое название Annexin V:PE Apoptosis Detection Kit, BD Biosciences). Результаты показаны на фиг.4. На фиг.4 представлен график, демонстрирующий раннюю стадию апоптоза (%) и позднюю стадию апоптоза (%). Как показано на фиг.4, miR-34a с соответствием согласно примерам могла стимулировать апоптоз до того же уровня, что и положительная контрольная зрелая miR-34a.

[0153]

(2-5) Подавление экспрессии мРНК

РНК выделяли из культивируемых клеток после культивирования с использованием реагента ISOGEN (торговое название, NIPPON GENE) в соответствии с прилагаемым протоколом.

[0154]

Затем с использованием обратной транскриптазы (торговое название M-MLV reverse transcriptase, Invitrogen) в соответствии с прилагаемым протоколом синтезировали кДНК с вышеупомянутой РНК. Количественную ПЦР проводили с использованием вышеупомянутой синтезированной кДНК в качестве матрицы и измеряли количества кДНК AXL и кДНК MET. Количество кДНК также измеряли с использованием кДНК GAPDH в качестве внутреннего контроля.

[0155]

В вышеупомянутой количественной ПЦР в качестве реагента использовали FastStart Universal SYBR Green Master (торговое название, Roche), в качестве термоциклера использовали MX3000P (торговое название, Stratagene), и в качестве устройства для анализа использовали MxPro (торговое название, Stratagene) (далее то же самое). Для амплификации вышеупомянутой кДНК AXL, вышеупомянутой кДНК MET и вышеупомянутой кДНК GAPDH использовали следующие наборы праймеров. Общее количество реакционной смеси составляло 25 мкл, и измерение проводили 3 раза в каждом случае.

[0156]

набор праймеров AXL

5ʹ-CTCAACCAGGACGACTCCAT-3ʹ (SEQ ID NO: 11)

5ʹ-AGACCGCTTCACTCAGGAAA-3ʹ (SEQ ID NO: 12)

набор праймеров MET

5ʹ-CAGGCAGTGCAGCATGTAGT-3ʹ (SEQ ID NO: 13)

5ʹ-TGTCCAACAAAGTCCCATGA-3ʹ (SEQ ID NO: 14)

набор праймеров GAPDH

5ʹ-ATGGGGAAGGTGAAGGTCG-3ʹ (SEQ ID NO: 15)

5ʹ-GGGTCATTGATGGCAACAATATC-3ʹ (SEQ ID NO: 16)

[0157]

Вычисляли относительные величины мРНК AXL и мРНК MET в каждой трансфицированной клетке, когда количество мРНК AXL или мРНК MET в контроле без добавления мкРНК принимали за 1. Результаты представлены на фиг.5. На фиг.5(A) показаны результаты для мРНК AXL, и на фиг.5(B) показаны результаты для мРНК MET.

[0158]

Как показано на фиг.5, miR-34a с несоответствием согласно примером снижала количество мРНК AXL и количество мРНК MET до того же уровня, что и положительная контрольная зрелая miR-34a. Таким образом, можно сказать, что трансляция белков, кодируемых мРНК AXL и мРНК MET, подавляется вышеупомянутой искусственной мкРНК с соответствием.

[0159]

Из этих результатов было обнаружено, что miR-34a с соответствием согласно примерам может подавлять экспрессию мРНК AXL и мРНК MET и т.п., и обеспечивает подавление роста клеток H1299 и стимуляцию апоптоза.

[0160]

В отличие от двухцепочечной зрелой miR-34a, поскольку вышеупомянутая искусственная мкРНК с соответствием представляет собой одноцепочечную молекулу нуклеиновой кислоты, для нее требуется гибридизация каждой отдельной цепи при применении, и она может избегать распознавания посредством TLR3 и т.п., вовлеченных в естественный иммунитет.

[0161]

(Пример 2)

В miR-34a с соответствием согласно примеру 1 дополнительная последовательность области X и выступающий конец области Y были укороченными.

[0162]

(1) Синтез мкРНК

Как показано ниже miR-34a с соответствием имеет дополнительную последовательность (J) длиной 3 основания, заключенную в прямоугольник, на 3ʹ-стороне области X, и выступающий конец (O) длиной 2 основания, заключенный в прямоугольник, на 5ʹ-стороне области Y. Таким образом, были синтезированы молекула, где вышеупомянутая дополнительная последовательность была укорочена на 1 основание с 3ʹ-стороны, и последовательность, соответствующая ей, на стороне области Y, была укорочена на 1 основание с 5ʹ-стороны; молекула, где выступающий конец был укорочен на 1 основание с 3ʹ-стороны; и молекула, где вышеупомянутая дополнительная последовательность и выступающий конец были укорочены на 1 основание, и подавление экспрессии мРНК AXL и мРНК MET подтверждали аналогично тому, как в вышеупомянутом примере 1. В следующих последовательностях область с 5ʹ-стороны от [P] представляет собой область X; в упомянутой выше области X подчеркнутая часть представляет собой вышеупомянутую последовательность направляющей цепи, остальная часть представляет собой вышеупомянутую дополнительную последовательность, и область с 3ʹ-стороны от [P] представляет собой область Y; и в упомянутой выше области Y, область, заключенная в прямоугольник, представляет собой выступающий конец.

[0163]

[0164]

[0165]

Результаты представлены на фиг.6 и фиг.7. На фиг.6 показаны результаты для мРНК AXL, и на фиг.7 показаны результаты для мРНК MET. Как показано на фиг.6 и фиг.7, эффект подавления экспрессии сохранялся, даже когда дополнительная последовательность упомянутой выше области X и выступающий конец упомянутой выше области Y были укороченными.

[0166]

(Пример 3)

В miR-34a с соответствием ненуклеотидную структуру линкера изменяли и дополнительную последовательность области X увеличивали или уменьшали, и исследовали эффект подавления экспрессии мРНК AXL и РНК MET.

[0167]

(1) Синтез мкРНК

Как показано ниже, синтезировали miR-34a с соответствием (PH-0039), где последовательность оснований выступающей области была изменена относительно miR-34a с соответствием согласно примеру 1. Более того, синтезировали молекулу, где дополнительная последовательность PH-0039 и последовательность, соответствующая ей, на стороне области Y были удалены (PH-0037), и молекулу, где дополнительная последовательность и последовательность, соответствующая ей, на стороне области Y были удлинены на 5 оснований (PH-0093).

Также синтезировали молекулы, в которых линкерные области PH-0037, PH-0039 и PH-0093 заменены ненуклеотидной структурой (показанной как [TP] в последовательностях) в производном терефталевой кислоты представленной ниже формулы (XH-0016, XH-0025 и XH-0027, соответственно). Ненуклеотидную структуру вносили с использованием амидита терфталевой кислоты (см. WO 2013/133221).

[0168]

[0169]

Синтезировали молекулы, в которых линкерные области PH-0037 и PH-0039 заменены ненуклеотидной структурой (показанной как [Gly] в последовательностях) в производном глицина следующей формулы (XH-0012 и XH-0028, соответственно), и

[0170]

[0171]

Синтезировали молекулы, в которых линкерные области PH-0037 и PH-0039 заменены ненуклеотидной структурой (показанной как [GlyGly] в последовательностях) в производном глицилглицина следующей формулы (XH-0014 и XH-0029, соответственно).

[0172]

[0173]

GlyGly в вышеупомянутой химической формуле (G2) представляет собой атомную группу, соответствующую следующей химической формуле (GlyGly), где концевой углерод карбонила связан с атомом N в упомянутой выше химической формуле (G2), и концевой атом азота в представленной ниже химической формуле (GlyGly) связан с углеродом карбонила в упомянутой выше химической формуле (G2).

[0174]

[0175]

Также синтезировали молекулы, в которых линкерные области PH-0037 и PH-0039 заменены ненуклеотидной структурой (показанной как [K] в последовательностях) в производном лизина следующей формулы (KH-0007 и KH-0011, соответственно).

[0176]

[0177]

Ненуклеотидную структуру вышеупомянутого производного глицина вносили с использованием глицинамидамидита (см. WO 2013/103146), ненуклеотидную структуру вышеупомянутого производного глицилглицина вносили с использованием глицилглицинамидамидита (см. WO 2013/133221), и ненуклеотидную структуру производного лизина вносили с использованием L-лизинамидамидита (см. WO 2013/103146).

[0178]

[0179]

В представленных ниже последовательностях область с 5ʹ-стороны от каждого линкера представляет собой область X; в упомянутой выше области X подчеркнутая часть представляет собой вышеупомянутую последовательность направляющей цепи, остальное представляет собой вышеупомянутую дополнительную последовательность, и область с 3ʹ-стороны от каждого линкера представляет собой область Y.

PH-0037 (SEQ ID NO: 28)

5ʹ-UGGCAGUGUCUUAGCUGGUUGU-[P]-ACAACCAGCUAAGACACUGCCACU-3ʹ

PH-0039 (SEQ ID NO: 29)

5ʹ-UGGCAGUGUCUUAGCUGGUUGUUCC-[P]-GGAACAACCAGCUAAGACACUGCCACU-3ʹ

PH-0093 (SEQ ID NO: 30)

5ʹ-UGGCAGUGUCUUAGCUGGUUGUUCCGG-[P]-CCGGAACAACCAGCUAAGACACUGCCACU-3ʹ

XH-0016 (SEQ ID NO: 28)

5ʹ-UGGCAGUGUCUUAGCUGGUUGU-[TP]-ACAACCAGCUAAGACACUGCCACU-3ʹ

XH-0025 (SEQ ID NO: 29)

5ʹ-UGGCAGUGUCUUAGCUGGUUGUUCC-[TP]-GGAACAACCAGCUAAGACACUGCCACU-3ʹ

XH-0027 (SEQ ID NO: 30)

5ʹ-UGGCAGUGUCUUAGCUGGUUGUUCCGG-[TP]-CCGGAACAACCAGCUAAGACACUGCCACU-3ʹ

XH-0012 (SEQ ID NO: 28)

5ʹ-UGGCAGUGUCUUAGCUGGUUGU-[Gly]-ACAACCAGCUAAGACACUGCCACU-3ʹ

XH-0028 (SEQ ID NO: 29)

5ʹ-UGGCAGUGUCUUAGCUGGUUGUUCC-[Gly]-GGAACAACCAGCUAAGACACUGCCACU-3ʹ

XH-0014 (SEQ ID NO: 28)

5ʹ-UGGCAGUGUCUUAGCUGGUUGU-[GlyGly]-ACAACCAGCUAAGACACUGCCACU-3ʹ

XH-0029 (SEQ ID NO: 29)

5ʹ-UGGCAGUGUCUUAGCUGGUUGUUCC-[GlyGly]-GGAACAACCAGCUAAGACACUGCCACU-3ʹ

KH-0007(SEQ ID NO: 28)

5ʹ-UGGCAGUGUCUUAGCUGGUUGU-[K]-ACAACCAGCUAAGACACUGCCACU-3ʹ

KH-0011 (SEQ ID NO: 29)

5ʹ-UGGCAGUGUCUUAGCUGGUUGUUCC-[K]-GGAACAACCAGCUAAGACACUGCCACU-3ʹ

В качестве отрицательного контроля синтезировали мкРНК с соответствием (PH-0000), содержащую направляющую цепь, состоящую из последовательности, не имеющую комплементарности ни с какими последовательностями, зарегистрированными в базах данных нуклеиновых кислот, и пассажирскую цепь, соответствующую ей.

PH-0000 (SEQ ID NO: 31)

5ʹ-UACUAUUCGACACGCGAAGUUCC-[P]-GGAACUUCGCGUGUCGAAUAGUAUU-3ʹ

В качестве положительного контроля синтезировали молекулу, где направляющая цепь зрелой miR-34a и пассажирская цепь связаны через область петли пре-мкРНК природного типа (NM-0004), и двухцепочечную РНК с соответствием, где направляющая цепь зрелой мкРНК и последовательность, комплементарная ей, гибридизованы (NI-0209).

[0180]

[0181]

NM-0004 (SEQ ID NO: 32)

5ʹ-UGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCU-3ʹ

NI-0209

направляющая цепь (SEQ ID NO: 1)/ пассажирская цепь (SEQ ID NO: 33)

5ʹ-UGGCAGUGUCUUAGCUGGUUGU-3ʹ/5ʹ-AACCAGCUAAGACACUGCCACU-3ʹ

[0182]

(2) Определение уровня экспрессии гена AXL

Каждую из упомянутых выше РНК растворяли в дистиллированной воде для инъекций (Otsuka Pharmaceutical Co., Ltd.) в концентрации 4 мкмоль/л, посредством чего получали раствор РНК.

[0183]

В качестве клеток использовали клетки H1299 (ATCC). В качестве среды использовали среду RPMI 1640 (Life Technologies), содержавшую 10% FBS. Условия культивирования представляли собой 37°C, 5% CO2.

[0184]

Сначала клетки культивировали в вышеупомянутой среде, и культуральный раствор распределяли в 24-ячеечный планшет, так чтобы каждая лунка содержала 400 мкл культурального раствора, для достижения плотности 4×104 клеток/лунка. Клетки трансфицировали вышеупомянутой РНК с использованием реагента для трансфекции RNAiMAX (Life Technologies) в соответствии с протоколом, прилагаемым к упомянутому выше реагенту для трансфекции. В частности, трансфекцию проводили путем добавления композиции на лунку следующим образом. В представленной ниже композиции, (B) представляет собой Opti-MEM (Life Technologies), (C) представляет собой вышеупомянутый раствор РНК в концентрации 4 мкмоль/л, всего добавляли 98,5 мкл. Конечная концентрация вышеупомянутой РНК в вышеупомянутой лунке составляла 2 нмоль/л.

[0185]

Таблица 2
(композиция на лунку: мкл)
Культуральный раствор 450
Реагент для трансфекции (A) 1
(B)+(C) 49
500

[0186]

После трансфекции клетки в вышеупомянутых лунках культивировали в течение 24 часов, а затем РНК собирали с использованием набора RNeasy Mini Kit (Qiagen, Нидерланды) в соответствии с протоколом, предоставляемым с ним. Затем с упомянутой выше РНК синтезировали кДНК с использованием набора Transcriptor First Strand cDNA Synthesis Kit (Roche) в соответствии с протоколом, предоставляемым с ним. Затем, как показано ниже, проводили ПЦР с использованием вышеупомянутой синтезированной кДНК в качестве матрицы и измеряли уровни экспрессии генов AXL и MET и гена GAPDH в качестве внутреннего стандарта. Вышеупомянутые уровни экспрессии генов AXL и MET приводили к уровням экспрессии гена GAPDH, упомянутым выше.

[0187]

Вышеупомянутую ПЦР проводили с использованием LightCycler 480 SYBR Green I Master (торговое название, Roche) в качестве реагента и LightCycler 480 Instrument II (торговое название, Roche) в качестве устройства (далее то же самое). Вышеупомянутые гены AXL, MET и GAPDH амплифицировали с использованием следующих наборов праймеров, соответственно.

Набор ПЦР-праймеров для гена AXL

(SEQ ID NO: 11) 5ʹ-CTCAACCAGGACGACTCCAT-3ʹ

(SEQ ID NO: 12) 5ʹ-AGACCGCTTCACTCAGGAAA-3ʹ

набор ПЦР-праймеров для гена MET

(SEQ ID NO: 13) 5ʹ-CAGGCAGTGCAGCATGTAGT-3ʹ

(SEQ ID NO: 14) 5ʹ-TGTCCAACAAAGTCCCATGA-3ʹ

набор праймеров для гена GAPDH

(SEQ ID NO: 15) 5ʹ-ATGGGGAAGGTGAAGGTCG-3ʹ

(SEQ ID NO: 16) 5ʹ-GGGTCATTGATGGCAACAATATC-3ʹ

[0188]

В качестве контроля 1, для клеток, к которым было добавлено 100 мкл вышеупомянутого раствора (B) отдельно к вышеупомянутому культуральному раствору, также измеряли уровни экспрессии генов (-). Более того, в качестве контроля 2, для клеток, подвергнутых тем же методикам трансфекции, которые описаны выше, за исключением того, что вышеупомянутый раствор РНК не добавляли, а добавляли вышеупомянутый (B) и 1,5 мкл вышеупомянутого (A), так чтобы общее количество (A) и (B) составило 100 мкл, также измеряли уровень экспрессии гена (имитация).

[0189]

Что касается нормализованных уровней экспрессии генов AXL и MET, относительную величину экспрессии в клетках, в которые была введена каждая РНК, определяли, исходя из уровня экспрессии в клетках контроля (имитации), принятого за 1.

[0190]

(3) Результаты

Как показано на фиг.8 и 9, эффект подавления экспрессии мРНК AXL и РНК MET сохранялся, даже когда ненуклеотидная структура линкерной области была изменена или дополнительная последовательность области X была удалена или удлинена.

[0191]

(Пример 4)

Различные искусственные мкРНК с соответствием по настоящему изобретению синтезировали на основе направляющей цепи зрелой let-7a, и исследовали эффект подавления экспрессии мРНК гена-мишени HMGA2.

[0192]

(1) Синтез мкРНК

В качестве положительного контроля синтезировали молекулу, где направляющая цепь (SEQ ID NO: 2) зрелой let-7a и пассажирская цепь (SEQ ID NO: 34) связаны через область петли пре-let-7a природного типа (NM-0003), и двухцепочечную РНК с соответствием, где направляющая цепь зрелой let-7a и последовательность, комплементарная ей, гибридизованы (NI-0207).

[0193]

[0194]

В представленных ниже последовательностях подчеркнутой частью показана вышеупомянутая последовательность направляющей цепи.

NM-0003 (SEQ ID NO: 35)

5ʹ-UGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUC-3ʹ

NI-0207

направляющая цепь (SEQ ID NO: 2)/ пассажирская цепь (SEQ ID NO: 34)

5ʹ-UGAGGUAGUAGGUUGUAUAGUU-3ʹ/5ʹ-CUAUACAACCUACUACCUCAUC-3ʹ

[0195]

Как показано ниже, синтезировали различные искусственные let-7a с соответствием, где линкеры производного пролина ([P]), производного терефталевой кислоты ([TP]), производного глицина ([Gly]), производного глицилглицина ([GlyGly]) и производного лизина ([K]) вносят между областью X, содержащей последовательность направляющей цепи зрелой let-7a и дополнительную последовательность (длиной 0, 3 или 5 оснований) на ее 3ʹ-стороне, и областью Y, которая полностью комплементарна области X, и имеющей выступающий конец из 2 оснований на 5ʹ-стороне, как и в примере 3.

[0196]

[0197]

В представленных ниже последовательностях область с 5ʹ-стороны каждого линкера представляет собой область X; в упомянутой выше области X подчеркнутая часть представляет собой вышеупомянутую последовательность направляющей цепи, остальная часть представляет собой вышеупомянутую дополнительную последовательность, и область с 3ʹ-стороны каждого линкера представляет собой область Y.

PH-0013 (SEQ ID NO: 36)

5ʹ-UGAGGUAGUAGGUUGUAUAGUU-[P]-AACUAUACAACCUACUACCUCAUC-3ʹ

PH-0015 (SEQ ID NO: 37)

5ʹ-UGAGGUAGUAGGUUGUAUAGUUUCC-[P]-GGAAACUAUACAACCUACUACCUCAUC-3ʹ

PH-0094 (SEQ ID NO: 38)

5ʹ-UGAGGUAGUAGGUUGUAUAGUUUCCGG-[P]-CCGGAAACUAUACAACCUACUACCUCAUC-3ʹ

XH-0010 (SEQ ID NO: 36)

5ʹ-UGAGGUAGUAGGUUGUAUAGUU-[TP]-AACUAUACAACCUACUACCUCAUC-3ʹ

XH-0030 (SEQ ID NO: 37)

5ʹ-UGAGGUAGUAGGUUGUAUAGUUUCC-[TP]-GGAAACUAUACAACCUACUACCUCAUC-3ʹ

XH-0031 (SEQ ID NO: 38)

5ʹ-UGAGGUAGUAGGUUGUAUAGUUUCCGG-[TP]-CCGGAAACUAUACAACCUACUACCUCAUC-3ʹ

XH-0008 (SEQ ID NO: 36)

5ʹ-UGAGGUAGUAGGUUGUAUAGUU-[Gly]-AACUAUACAACCUACUACCUCAUC-3ʹ

XH-0032 (SEQ ID NO: 37)

5ʹ-UGAGGUAGUAGGUUGUAUAGUUUCC-[Gly]-GGAAACUAUACAACCUACUACCUCAUC-3ʹ

XH-0009 (SEQ ID NO: 36)

5ʹ-UGAGGUAGUAGGUUGUAUAGUU-[GlyGly]-AACUAUACAACCUACUACCUCAUC-3ʹ

XH-0033(SEQ ID NO: 37)

5ʹ-UGAGGUAGUAGGUUGUAUAGUUUCC-[GlyGly]-GGAAACUAUACAACCUACUACCUCAUC-3ʹ

KH-0005 (SEQ ID NO: 36)

5ʹ-UGAGGUAGUAGGUUGUAUAGUU-[K]-AACUAUACAACCUACUACCUCAUC-3ʹ

KH-0012 (SEQ ID NO: 37)

5ʹ-UGAGGUAGUAGGUUGUAUAGUUUCC-[K]-GGAAACUAUACAACCUACUACCUCAUC-3ʹ

В качестве отрицательного контроля использовали PH-0000, синтезированный согласно примеру 3.

[0198]

(2) Измерение уровня экспрессии гена HMGA2

Каждую из вышеупомянутых РНК растворяли в дистиллированной воде для инъекций (Otsuka Pharmaceutical Co., Ltd.) в концентрации 0,4 мкмоль/л, посредством чего получали раствор РНК.

[0199]

В качестве клеток использовали клетки A549 (DS Pharma Biomedical Co., Ltd.). В качестве среды использовали DMEM, содержавшую 10% FBS (Life Technologies). Условия культивирования представляли собой 37°C и 5% CO2.

[0200]

Сначала клетки культивировали в вышеупомянутой среде, и культуральный раствор распределяли в 24-ячеечный планшет, так чтобы каждая лунка содержала 400 мкл культурального раствора, для достижения плотности 4×104 клеток/лунка. Клетки трансфицировали вышеупомянутой РНК с использованием реагента для трансфекции RNAiMAX (Life Technologies) в соответствии с протоколом, прилагаемым к упомянутому выше реагенту для трансфекции. В частности, трансфекцию проводили путем добавления композиции на лунку следующим образом. В представленной ниже композиции, (B) представляет собой Opti-MEM (Life Technologies), (C) представляет собой вышеупомянутый раствор РНК в концентрации 0,4 мкмоль/л, всего добавляли 98,5 мкл. Конечная концентрация вышеупомянутой РНК в вышеупомянутой лунке составляла 2 нмоль/л.

[0201]

Таблица 3
(композиция на лунку: мкл)
Культуральный раствор 450
Реагент для трансфекции 1,5
(B)+(C) 98,5
Всего 500

[0202]

После трансфекции клетки в вышеупомянутых лунках культивировали в течение 24 часов, а затем РНК собирали с использованием набора RNeasy Mini Kit (Qiagen, Нидерланды) в соответствии с протоколом, предоставляемым с ним. Затем с упомянутой выше РНК синтезировали кДНК с использованием набора Transcriptor First Strand cDNA Synthesis Kit (Roche) в соответствии с протоколом, предоставляемым с ним. Затем, как показано ниже, проводили ПЦР с использованием вышеупомянутой синтезированной кДНК в качестве матрицы и измеряли уровни экспрессии гена HMGA2 и гена GAPDH в качестве внутреннего стандарта. Вышеупомянутые уровни экспрессии гена HMGA2 приводили к уровням экспрессии гена GAPDH, упомянутым выше.

[0203]

Вышеупомянутую ПЦР проводили с использованием LightCycler 480 SYBR Green I Master (торговое название, Roche) в качестве реагента и LightCycler 480 Instrument II (торговое название, Roche) в качестве устройства (далее то же самое). Вышеупомянутые гены HMGA2 и GAPDH амплифицировали с использованием следующих наборов праймеров, соответственно.

Набор ПЦР-праймеров для гена HMGA2

(SEQ ID NO: 39) 5ʹ-GAAGCCACTGGAGAAAAACG-3ʹ

(SEQ ID NO: 40) 5ʹ-CTTCGGCAGACTCTTGTGAG-3ʹ

набор праймеров для гена GAPDH

(SEQ ID NO: 15) 5ʹ-ATGGGGAAGGTGAAGGTCG-3ʹ

(SEQ ID NO: 16) 5ʹ-GGGTCATTGATGGCAACAATATC-3ʹ

[0204]

В качестве контроля 1, для клеток, к которым было добавлено 100 мкл вышеупомянутого раствора (B) отдельно к вышеупомянутому культуральному раствору, также измеряли уровни экспрессии генов (-). Более того, в качестве контроля 2, для клеток, подвергнутых тем же методикам трансфекции, которые описаны выше, за исключением того, что вышеупомянутый раствор РНК не добавляли, а добавляли вышеупомянутый (B) и 1,5 мкл вышеупомянутого (A), так чтобы общее количество (A) и (B) составило 100 мкл, также измеряли уровень экспрессии гена (имитация).

[0205]

Что касается нормализованного уровня экспрессии генов HMGA2, относительную величину экспрессии в клетках, в которые была введена каждая РНК, определяли, исходя из уровня экспрессии в клетках контроля (имитации), принятого за 1.

[0206]

(3) Результаты

Как показано на фиг.10, let-7a с соответствием согласно примеру подавляла экспрессию мРНК HMGA2 на том же уровне или в не меньшей степени, чем положительная контрольная зрелая let-7a и двухцепочечная let-7a с соответствием. Кроме того, эффект подавления экспрессии мРНК HMGA2 сохранялся, даже когда ненуклеотидная структура линкерной области или длина оснований дополнительной последовательности области X были изменены.

[0207]

(Пример 5)

Различные искусственные мкРНК с соответствием по настоящему изобретению синтезировали на основе направляющей цепи зрелой miR-29b, и исследовали эффект подавления экспрессии мРНК гена-мишени COLA1.

[0208]

(1) Синтез мкРНК

В качестве положительного контроля синтезировали молекулу, где направляющая цепь (SEQ ID NO: 5) зрелой miR-29b и пассажирская цепь (SEQ ID NO: 41) связаны через область петли пре-miR-29b природного типа (NM-0005), и двухцепочечную РНК с соответствием, где направляющая цепь зрелой miR-29b и последовательность, комплементарная ей, гибридизованы (NI-0211).

[0209]

[0210]

В представленных ниже последовательностях подчеркнутой частью показана вышеупомянутая последовательность направляющей цепи.

NM-0005 (SEQ ID NO: 42)

5ʹ-GCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUU-3ʹ

NI-0211

пассажирская цепь (SEQ ID NO: 41)/направляющая цепь (SEQ ID NO: 5)

5ʹ-CACUGAUUUCAAAUGGUGCUAGA-3ʹ/5ʹ-UAGCACCAUUUGAAAUCAGUGUU-3ʹ

[0211]

Как показано ниже, синтезировали различные искусственные miR-29bs с соответствием, где линкеры производного пролина ([P]), производного терефталевой кислоты ([TP]), производного глицина ([Gly]), производного глицилглицина ([GlyGly]) и производного лизина ([K]) вносят между областью X, содержащей последовательность направляющей цепи зрелой miR-29b и дополнительную последовательность (длиной 0, 3 или 5 оснований) на ее 3ʹ-стороне, и областью Y, которая полностью комплементарна области X, и имеющей выступающий конец из 2 оснований на 5ʹ-стороне, как и в примере 3.

[0212]

[0213]

В представленных ниже последовательностях область с 5ʹ-стороны каждого линкера представляет собой область X; в упомянутой выше области X подчеркнутая часть представляет собой вышеупомянутую последовательность направляющей цепи, остальная часть представляет собой вышеупомянутую дополнительную последовательность, и область с 3ʹ-стороны каждого линкера представляет собой область Y.

PH-0071 (SEQ ID NO: 43)

5ʹ-UAGCACCAUUUGAAAUCAGUGUU-[P]-AACACUGAUUUCAAAUGGUGCUAGA-3ʹ

PH-0073 (SEQ ID NO: 44)

5ʹ-UAGCACCAUUUGAAAUCAGUGUUUCC-[P]-GGAAACACUGAUUUCAAAUGGUGCUAGA-3ʹ

PH-0095 (SEQ ID NO: 45)

5ʹ-UAGCACCAUUUGAAAUCAGUGUUUCCGG-[P]-CCGGAAACACUGAUUUCAAAUGGUGCUAGA-3ʹ

XH-0034 (SEQ ID NO: 43)

5ʹ-UAGCACCAUUUGAAAUCAGUGUU-[TP]-AACACUGAUUUCAAAUGGUGCUAGA-3ʹ

XH-0035 (SEQ ID NO: 44)

5ʹ-UAGCACCAUUUGAAAUCAGUGUUUCC-[TP]-GGAAACACUGAUUUCAAAUGGUGCUAGA-3ʹ

XH-0036 (SEQ ID NO: 45)

5ʹ-UAGCACCAUUUGAAAUCAGUGUUUCCGG-[TP]-CCGGAAACACUGAUUUCAAAUGGUGCUAGA-3ʹ

XH-0037(SEQ ID NO: 43)

5ʹ-UAGCACCAUUUGAAAUCAGUGUU-[Gly]-AACACUGAUUUCAAAUGGUGCUAGA-3ʹ

XH-0038 (SEQ ID NO: 44)

5ʹ-UAGCACCAUUUGAAAUCAGUGUUUCC-[Gly]-GGAAACACUGAUUUCAAAUGGUGCUAGA-3ʹ

XH-0039 (SEQ ID NO: 43)

5ʹ-UAGCACCAUUUGAAAUCAGUGUU-[GlyGly]-AACACUGAUUUCAAAUGGUGCUAGA-3ʹ

XH-0040 (SEQ ID NO: 44)

5ʹ-UAGCACCAUUUGAAAUCAGUGUUUCC-[GlyGly]-GGAAACACUGAUUUCAAAUGGUGCUAGA-3ʹ

KH-0013 (SEQ ID NO: 43)

5ʹ-UAGCACCAUUUGAAAUCAGUGUU-[K]-AACACUGAUUUCAAAUGGUGCUAGA-3ʹ

KH-0014 (SEQ ID NO: 44)

5ʹ-UAGCACCAUUUGAAAUCAGUGUUUCC-[K]-GGAAACACUGAUUUCAAAUGGUGCUAGA-3ʹ

В качестве отрицательного контроля использовали PH-0000, синтезированный согласно примеру 3.

[0214]

(2) Измерение уровня экспрессии гена COL1A1

Каждую из вышеупомянутых РНК растворяли в дистиллированной воде для инъекций (Otsuka Pharmaceutical Co., Ltd.) в концентрации 1 мкмоль/л, посредством чего получали раствор РНК.

[0215]

В качестве клеток использовали клетки A549 (DS PHARMA BIOMEDICAL). В качестве среды использовали DMEM, содержавшую 10% FBS (Life Technologies). Условия культивирования представляли собой 37°C и 5% CO2.

[0216]

Сначала клетки культивировали в вышеупомянутой среде, и культуральный раствор распределяли в 24-ячеечный планшет, так чтобы каждая лунка содержала 400 мкл культурального раствора, для достижения плотности 4×104 клеток/лунка. Клетки трансфицировали вышеупомянутой РНК с использованием реагента для трансфекции липофектамин RNAiMAX (Life Technologies) в соответствии с протоколом, прилагаемым к упомянутому выше реагенту для трансфекции. В частности, трансфекцию проводили путем добавления композиции на лунку следующим образом. В представленной ниже композиции, (B) представляет собой Opti-MEM (Life Technologies), (C) представляет собой вышеупомянутый раствор РНК в концентрации 1 мкмоль/л, всего добавляли 98,5 мкл. Конечная концентрация вышеупомянутой РНК в вышеупомянутой лунке составляла 0,5 нмоль/л.

[0217]

Таблица 4
(композиция на лунку: мкл)
Культуральный раствор 450
Реагент для трансфекции 1,5
(B)+(C) 98,5
Всего 500

[0218]

После трансфекции клетки в вышеупомянутых лунках культивировали в течение 24 часов, а затем РНК собирали с использованием набора RNeasy Mini Kit (Qiagen, Нидерланды) в соответствии с протоколом, предоставляемым с ним.

Затем с упомянутой выше РНК синтезировали кДНК с использованием набора Transcriptor First Strand cDNA Synthesis Kit (Roche) в соответствии с протоколом, предоставляемым с ним. Затем, как показано ниже, проводили ПЦР с использованием вышеупомянутой синтезированной кДНК в качестве матрицы и измеряли уровни экспрессии гена COL1A1 и гена GAPDH в качестве внутреннего стандарта. Вышеупомянутые уровни экспрессии гена COL1A1 приводили к уровням экспрессии гена GAPDH, упомянутым выше.

[0219]

Вышеупомянутую ПЦР проводили с использованием LightCycler 480 SYBR Green I Master (торговое название, Roche) в качестве реагента и LightCycler 480 Instrument II (торговое название, Roche) в качестве устройства (далее то же самое). Вышеупомянутые гены COL1A1 и GAPDH амплифицировали с использованием следующих наборов праймеров, соответственно.

Набор ПЦР-праймеров для гена COL1A1

(SEQ ID NO: 46) 5ʹ-CCCAAGGACAAGAGGCATGT-3ʹ

(SEQ ID NO: 47) 5ʹ-CCGCCATACTCGAACTGGAA-3ʹ

набор праймеров для гена GAPDH

(SEQ ID NO: 15) 5ʹ-ATGGGGAAGGTGAAGGTCG-3ʹ

(SEQ ID NO: 16) 5ʹ-GGGTCATTGATGGCAACAATATC-3ʹ

[0220]

В качестве контроля 1, для клеток, к которым было добавлено 100 мкл вышеупомянутого раствора (B) отдельно к вышеупомянутому культуральному раствору, также измеряли уровни экспрессии генов (-). Более того, в качестве контроля 2, для клеток, подвергнутых тем же методикам трансфекции, которые описаны выше, за исключением того, что вышеупомянутый раствор РНК не добавляли, а добавляли вышеупомянутый (B) и 1,5 мкл вышеупомянутого (A), так чтобы общее количество (A) и (B) составило 100 мкл, также измеряли уровень экспрессии гена (имитация).

[0221]

Что касается нормализованного уровня экспрессии генов COL1A1, относительную величину экспрессии в клетках, в которые была введена каждая РНК, определяли, исходя из уровня экспрессии в клетках контроля (имитации), принятого за 1.

[0222]

(3) Результаты

Как показано на фиг.11, miR-29b с соответствием согласно примеру подавляла экспрессию мРНК COLA1 на том же уровне или не в меньшей степени, чем положительная контрольная зрелая let-7a и двухцепочечная miR-29b с соответствием. Кроме того, эффект подавления экспрессии мРНК COLA1 сохранялся, даже когда ненуклеотидная структура линкерной области или длина оснований дополнительной последовательности области X были изменены.

[0223]

Хотя настоящее изобретение описано выше применительно к иллюстративным вариантам осуществления, настоящее изобретение не ограничивается ими. Различные изменения, которые могут стать очевидными специалистам в данной области, можно вносить в конфигурацию и характеристики настоящего изобретения без отклонения от объема настоящего изобретения. Кроме того, содержание любой публикации, цитированной в настоящем описании, включая патенты и патентные заявки, включено в настоящее описание в качестве ссылки в полном объеме в той степени, как если бы они были описаны в настоящем описании.

[0224]

Настоящая заявка основана на патентной заявке № 2013-273033, поданной в Японии (дата подачи: 27 декабря 2013 года), содержание которой включено в настоящее описание в полном объеме.

Промышленная применимость

[0225]

Искусственную мкРНК с соответствием по настоящему изобретению можно без труда синтезировать с низкой стоимостью, и она может подавлять трансляцию белка, кодируемого вышеупомянутым геном. Таким образом, искусственная мкРНК с соответствием по настоящему изобретению является пригодной в качестве, например, фармацевтического продукта, диагностического агента, сельскохозяйственного химического реагента и инструмента для проведения исследований в сельском хозяйстве, медицинской науке и т.п.

1. Искусственная мкРНК для подавления экспрессии гена-мишени, содержащая область X и область Y, где

3'-конец указанной области X и 5'-конец указанной области Y связаны через линкерную область, имеющую ненуклеотидную структуру,

указанная область X содержит последовательность направляющей цепи зрелой мкРНК, и

указанная область Y содержит последовательность, полностью комплементарную указанной области X,

где указанная область X имеет длину 19-30 оснований, где указанная область Y имеет длину 19-32 оснований, и

где указанная линкерная область содержит по меньшей мере один элемент, выбранный из группы, состоящей из аминокислотного остатка, остатка полиамина и остатка поликарбоновой кислоты.

2. Искусственная мкРНК по п.1, где, когда указанную область Y и указанную X выравнивают, указанная область Y имеет выступающий 3'-конец.

3. Искусственная мкРНК по п.2, где указанный выступающий конец имеет длину 0-4 основания.

4. Искусственная мкРНК по п.1, где указанная область X содержит дополнительную последовательность и указанная дополнительная последовательность связана с 3'-концом указанной последовательности направляющей цепи.

5. Искусственная мкРНК по п.4, где указанная дополнительная последовательность в указанной области X имеет длину 0-5 оснований.

6. Искусственная мкРНК по п.1, где полная длина составляет 40-68 оснований.

7. Искусственная мкРНК по п.1, где указанная линкерная область содержит остаток поликарбоновой кислоты.

8. Искусственная мкРНК по п.7, где указанный остаток поликарбоновой кислоты представляет собой остаток терефталевой кислоты.

9. Искусственная мкРНК по п.1, где указанная линкерная область содержит аминокислотный остаток.

10. Искусственная мкРНК по п.9, где указанный аминокислотный остаток представляет собой остаток глицина, остаток амида терефталевой кислоты, остаток пролина или остаток лизина.

11. Искусственная мкРНК по п.9, где указанный аминокислотный остаток представляет собой димер или тример глицина.

12. Искусственная мкРНК по п.1, где указанная линкерная область соответствует следующим химическим формулам (I-1)-(I-7), n представляет собой целое число, равное 0-30, и m представляет собой целое число, равное 0-30:

13. Искусственная мкРНК по п.1, где указанная аминокислота в указанном аминокислотном остатке представляет собой по меньшей мере одну из природной аминокислоты и искусственной аминокислоты.

14. Искусственная мкРНК по п.13, где указанная природная аминокислота представляет собой аминокислоту, которая составляет белок.

15. Искусственная мкРНК по п.12, где в указанной химической формуле (I-1), n=11 и m=12, или n=5 и m=4.

16. Искусственная мкРНК по п.12, где в указанной химической формуле (I-4), n=5 и m=4.

17. Искусственная мкРНК по п.12, где в указанной химической формуле (I-6), n=4 и m=4.

18. Искусственная мкРНК по п.12, где в указанной химической формуле (I-7), n=5 и m=4.

19. Искусственная мкРНК по любому из пп.1-6, 9 и 10, где ненуклеотидная структура указанной линкерной области содержит по меньшей мере один элемент из скелета пирролидина и скелета пиперидина.

20. Искусственная мкРНК по любому из пп.1-6, где указанная ненуклеотидная структура соответствует следующим формулам (II-1)-(II-9) и в указанных формулах (II-1)-(II-9) n представляет собой целое число, равное 0-30, и m представляет собой целое число, равное 0-30, и q представляет собой целое число, равное 0-10:

21. Искусственная мкРНК по п.20, где в указанной химической формуле (II-4) n=7 или n=8.

22. Искусственная мкРНК по п.20, где в указанной химической формуле (II-8) n=5 и m=4.

23. Искусственная мкРНК по п.1, где указанная область X содержит последовательность направляющей цепи зрелой мкРНК, выбранной из группы, состоящей из hsa-miR-34, hsa-miR-29 и hsa-let-7.

24. Искусственная мкРНК по п.23, где указанная зрелая мкРНК представляет собой hsa-miR-34a.

25. Искусственная мкРНК по п.24, где нуклеотидная последовательность представляет собой нуклеотидную последовательность, выбранную из группы, состоящей из SEQ ID NO: 9 и 17-28.

26. Искусственная мкРНК по п.23, где указанная зрелая мкРНК представляет собой hsa-let-7a.

27. Искусственная мкРНК по п.26, где нуклеотидная последовательность представляет собой нуклеотидную последовательность, выбранную из группы, состоящей из SEQ ID NO: 36-38.

28. Искусственная мкРНК по п.23, где указанная зрелая мкРНК представляет собой hsa-miR-29b.

29. Искусственная мкРНК по п.28, где нуклеотидная последовательность представляет собой нуклеотидную последовательность, выбранную из группы, состоящей из SEQ ID NO: 43-45.

30. Композиция для подавления экспрессии гена-мишени, содержащая эффективное количество искусственной мкРНК по любому из пп.1-29.

31. Фармацевтическая композиция для подавления экспрессии гена-мишени, содержащая эффективное количество искусственной мкРНК по любому из пп.1-29.

32. Способ подавления экспрессии гена-мишени, включающий применение эффективного количества искусственной мкРНК по любому из пп.1-29.

33. Способ по п.32, включающий стадию введения эффективного количества указанной искусственной мкРНК в клетку, ткань или орган.

34. Способ по п.32 или 33, где указанную искусственную мкРНК вводят in vivo или in vitro.

35. Способ по п.32 или 33, где указанную искусственную мкРНК вводят не являющемуся человеком животному.

36. Способ лечения заболевания, включающий стадию введения искусственной мкРНК по любому из пп.1-29 пациентам, где указанная последовательность направляющей цепи указанной искусственной мкРНК представляет собой последовательность направляющей цепи зрелой мкРНК, которая подавляет экспрессию гена, вовлеченного в указанное заболевание, и указанное заболевание представляет собой злокачественную опухоль, фиброз легких или фиброз печени.

37. Применение искусственной мкРНК по любому из пп.1-29 в лечении заболевания, где указанная последовательность направляющей цепи указанной искусственной мкРНК представляет собой последовательность направляющей цепи зрелой мкРНК, которая подавляет экспрессию гена, вовлеченного в указанное заболевание, и указанное заболевание представляет собой злокачественную опухоль, фиброз легких или фиброз печени.



 

Похожие патенты:

Изобретение относится к биотехнологии. Описан вектор экспрессии на основе поксвируса, который содержит молекулу(ы) нуклеиновой кислоты, кодирующую(ие) гибрид гетероолигомерных микобактериальных антигенов ESAT6 и CFP10 и предпочтительно гибрид, содержащий аминокислотную последовательность, представленную в SEQ ID NO: 1.

Изобретение относится к клеточным технологиям и может быть использовано для рекомбинантного получения фолликулостимулирующего гормона (ФСГ) человека. Клеточную линию huFSHKKc6 получают путем трансформации клеток huFSHIK экспрессионной плазмидой длиной 7719 п.о., состоящей из гена устойчивости PuroR с SV40 polyA, укороченного 3'LTR HIV-1, гена устойчивости AmpR, промотора AmpR, ориджина репликации SV40 и pBR322, промотора NP гена р53 человека, pgk - конститутивного промотора гена фосфоглицераткиназы, синтетической нуклеотидной последовательности, кодирующей полноразмерную альфа-субъединицу ФСГ человека, сигнала терминации трансляции, состоящего из 3 пар оснований и консенсусной сигнальной последовательности Козак.

Группа изобретений относится к области генетической инженерии, в частности к иммортализованным фибробластам эмбриона цыпленка (ФЭЦ) для размножения вирусов, способам их получения, к культурам клеток, включающим иммортализованные ФЭЦ, к способам репликации вирусов птиц в таких клетках и к способам получения вакцин.

Изобретение относится к соединению общей формулы (I): в которой K представляет собой активную группу эфира карбоновой кислоты или -О-RM; где RM обозначает атом Н, метальную, этильную, бензильную или трет-бутильную группу; Pr представляет собой атом Н или аминозащитную группу; # обозначает асимметричный атом С; Е представляет собой аденинильную, цитозинильную, псевдо-изоцитозинильную, гуанинильную, тиминильную, урацилильную или фенильную группу, при необходимости замещенную защитной группой для нуклеотидного основания; R1 обозначает группу общей формулы (II): в которой R2 обозначает группу эфира фосфоновой кислоты или группу фосфоновой кислоты; R3 обозначает аминозащитную группу; m обозначает 1, 2, 3 или 4; и h обозначает 0, 1, 2 или 3; при условии что сумма m и h в общей формуле (II) находится в пределах: 2≤х≤5.

Изобретение относится к области биотехнологии и касается способа получения энтеровирусоподобной частицы (EVLP) в растении. В растение, часть растения или клетку растения вводят первую нуклеиновую кислоту и вторую нуклеиновую кислоту.

Изобретение относится к биотехнологии. Описан способ получения микровезикул, содержащих трансгенный продукт и/или лентивирусную РНК, содержащую трансген.

Изобретение относится к области биотехнологии, конкретно к получению слитых белков, связывающихся с PDGF и VEGF, и рекомбинантных вирусных частиц, кодирующих слитые белки, и может быть использовано в медицине.

Группа изобретений относится к области ветеринарной биотехнологии. Предложена экспрессирующая кассета рекомбинантной ДНК, содержащая промотор предраннего гена 1 цитомегаловируса мыши (IE1 mCMV), ген вирусного белка 2 (VP2) вируса инфекционного бурсита (IBDV), терминатор транскрипции, промотор предраннего гена 1 цитомегаловируса человека (IE1 hCMV), ген белка слияния (F) вируса болезни Ньюкасла (NDV).

Изобретение относится к биотехнологии. Описано средство на основе двухцепочечной рибонуклеиновой кислоты (дцРНК) для ингибирования экспрессии серпина c1, где указанное средство на основе дцРНК содержит смысловую цепь и антисмысловую цепь, где указанная антисмысловая цепь содержит область комплементарности, которая содержит по меньшей мере 19 последовательно расположенных нуклеотидов, отличающихся не более чем на 3 нуклеотида от нуклеотидной последовательности 5’-UUGAAGUAAAUGGUGUUAACCAG-3’(SEQ ID NO: 562), где указанная смысловая цепь независимо имеет длину по меньшей мере 19 нуклеотидов и где лиганд, включающий одно или более производных N-ацетилгалактозамина (GalNAc), конъюгирован с 3’-концом указанной смысловой цепи указанного средства на основе дцРНК.

Изобретение относится к биотехнологии. Представлены способы модулирования экспрессии целевой нуклеиновой кислоты в клетках, включающие введение в клетки первой чужеродной нуклеиновой кислоты, кодирующей одну или несколько РНК, комплементарных к ДНК, причем ДНК включает целевую нуклеиновую кислоту, введение в клетки второй чужеродной нуклеиновой кислоты, кодирующей безнуклеазный белок Cas9, который связывается с ДНК и направляется одной или несколькими РНК, введение в клетки третьей чужеродной нуклеиновой кислоты, кодирующей регулирующий транскрипцию белок или домен, причем одна или несколько РНК, безнуклеазный белок Cas9 и регулирующий транскрипцию белок или домен экспрессируются, при этом одна или несколько РНК, безнуклеазный белок Cas9 и регулирующий транскрипцию белок или домен совместно локализуются на ДНК, а регулирующий транскрипцию белок или домен регулирует экспрессию целевой нуклеиновой кислоты.

Изобретение относится к области биохимии, в частности к фрагменту ДНК для модификации растений с целью получения рекомбинантных белков. Также раскрыты участок ДНК и экспрессионный вектор, содержащие указанный фрагмент ДНК.

Изобретение относится к области биохимии, в частности к растению Solanum lycopersicum с повышенной урожайностью, содержащему гены SP3D и SP и их промоторные последовательности, а также к его семени и плоду.

Изобретение относится к оценке вирулентности in vitro штаммов туляремийного микроба подвидов Francisella tularensis subsp. tularensis, subsp.

Изобретение относится к биотехнологии. Описан антисмысловой олигомер длиной от 15 до 30 оснований для пропуска 44 экзона в гене дистрофина человека, содержащий нуклеотидную последовательность, выбранную из группы, состоящей из SEQ ID NO: 7, 55, 8, 9, 106 и 6.

Изобретение относится к области биохимии, в частности к растению Eustoma, имеющему цитоплазматическую мужскую стерильность, а также к его части, семени, каллусу, митохондрии.

Изобретение относится к области биохимии, в частности к композиции против клещей Varroa destructor, содержащей в эффективном количестве молекулу нуклеиновой кислоты, имеющую последовательность, которая по меньшей мере на 96% комплементарна или идентична по меньшей мере 21 смежному нуклеотиду последовательности гена кальмодулина, а также к ее использованию для снижения паразитизма Varroa destructor на медоносной пчеле и для селективной обработки видов членистоногих от Varroa destructor.

Изобретение относится к области биохимии, в частности к рекомбинантной нуклеиновой кислоте легкой цепи иммуноглобулина, содержащей по меньшей мере два нереаранжированных генных сегмента VL человека и по меньшей мере один нереаранжированный генный сегмент JL человека, функционально связанный с последовательностью константной области легкой цепи иммуноглобулина.

Изобретение относится к области биохимии, в частности к способам идентификации вариантного сайта распознавания для нуклеазы для индукции двунитевого разрыва. Изобретение позволяет эффективно осуществлять идентификацию вариантного сайта распознавания для нуклеазы для индукции двунитевого разрыва.

Изобретение относится к области биохимии, в частности к вариабельным доменам тяжелой и легкой цепей мышиного антитела против интерферона альфа (IFN-α) человека. Также раскрыт антигенсвязывающий фрагмент (Fab), включающий указанные вариабельные домены.

Изобретение относится к области медицины, биотехнологии и генной инженерии. Описан комплекс StCas9 белка и нового РНК-проводника для подавления экспрессии вируса гепатита B в клетке-хозяине и для элиминации ДНК вируса гепатита В из клетки-хозяина, такой как клетка млекопитающего.

Изобретение относится к медицине, и может быть использовано при проведении комплексного оздоровления организма человека. Для этого последовательно проводят комплекс процедур в течение минимум семи дней.

Изобретение относится к области биохимии. Описана группа изобретений, включающая искусственную мкРНК для подавления экспрессии гена-мишени, композицию и фармацевтическую композицию для подавления экспрессии гена-мишени, содержащие эффективное количество вышеуказанной искусственной мкРНК, способ подавления экспрессии гена-мишени, включающий применение искусственной мкРНК, способ лечения заболевания, включающий стадию введения искусственной мкРНК, применение искусственной мкРНК в лечении заболевания, где заболевание представляет собой злокачественную опухоль, фиброз легких или фиброз печени. Изобретение расширяет арсенал средств для подавления экспрессии гена-мишени. 6 н. и 31 з.п. ф-лы, 11 ил., 4 табл., 5 пр.

Наверх