Особые моноклональные антитела антигена м метапневмовируса человека (hmpv) и способ их использования в методе диагностики

Настоящее изобретение относится к биотехнологии, а именно к мышиным моноклональным антителам, которые соответствуют моноклональным антителам, выделяемым клеточными линиями гибридом 3G8/C11 и 7G4/A12, и которые реагируют на М-антиген hMPV. Данные антитела не вступают в конфликт друг с другом за участок связывания при связывании с антигеном, а также не препятствуют одновременному связыванию с антигеном. Моноклональные антитела могут использоваться в тестах для обнаружения, диагностики и/или определения заражения hMPV. 3 н. и 5 з.п. ф-лы, 6 ил., 8 пр.

 

ОБЛАСТЬ ТЕХНИКИ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к моноклональным антителам или их фрагментам, которые распознают М-белок респираторного метапневмовируса человека (hMPV), который используется для разработки способов диагностики заражения hMPV в клинической практике.

УРОВЕНЬ ТЕХНИКИ ИЗОБРЕТЕНИЯ

Метапневмовирус человека (далее - hMPV) представляет собой этиологический фактор типичного процента госпитализации и смертности, связанных с острыми респираторными заболеваниями верхних и нижних дыхательных путей, в частности у детей, пожилых людей и людей с ослабленным иммунитетом. Это заражение вирусом связано с различными патологиями, например, бронхиолит и пневмония, условиями, характеризующимися более высокой степенью социально-экономического воздействия. Заражение HMPV связано с гастроэнтеритом и кератоконъюнктивитом. Например, Кальво и соавт. (2008) за 3 года продемонстрировали, что кумулятивная частота острых респираторных инфекций, вызванных респираторными вирусами (респираторно-синцитиальный вирус (RSV), аденовирус (ADV) и hMPV) составляла 64,5% случаев госпитализации детей младше 2 лет, при этом частота по каждому отдельному вирусу составляла 35,4%, 19,3% и 9,8%, соответственно. Одной из примечательных особенностей, присущих как hMPV, так и прочим респираторным вирусам с высокой частотой, является возникновение рецидивирующих инфекций среди детей -явление, которое, вероятно, связано с невозможностью обеспечения защитной иммунной реакции для первого случая заражения в течение первых нескольких месяцев жизни. К настоящему времени нет исследований в отношении определенного экономического воздействия заражения hMPV, тем не менее, согласно оценкам частота госпитализации по hMPV составляет 1/3 от частоты госпитализации по респираторно-синцитиальному вирусу человека (hRSV). Согласно оценкам исследований, проведенных в развитых странах, отдельная стоимость лечения заражения hRSV составляет свыше 3000 евро (1,86 млн. чилийских песо) с максимальной стоимостью до 8400 евро (5,2 млн. чилийских песо). Расходы, связанные с отдельной госпитализацией, являются приблизительными и основаны на патологическом процессе с аналогичными характеристиками, требующем госпитализации.

Несмотря на то, что вирусы hMPV и hRSV отнесены к родам Metapneumovirus и pneumovirus соответственно, вирус hMPV относится к семейству Paramyxoviridae, подсемейству Pneumovirinae, т.е. к тому же семейству, к которому относится hRSV. Геном hMPV включает несегментированную, однонитевую, отрицательно-полярную рибонуклеиновую кислоту (ssRNA), поэтому вирусные белки расположены в направлении от 3' к 5' (относительно их последовательности) следующим образом: N, Р, М, F, М2 (ORF1 и ORF2), SH, G и L. Пять из этих белков отвечают за компоновку генетического материала и определяют структуру вирусной частицы, соответствующей нуклеокапсидному белку N и матриксному белку М вместе с трансмембранными гликопротеинами F, G и SH соответственно. Другие четыре белка, М2-1, М2-2, Р и L задействованы в репликации и транскрипции вируса. Существуют два подтипа hMPV, которые классифицируются как две антигенные группы А и В на основании разностей последовательности, преимущественно обнаруженных в белках F и G. Несмотря на то, что эти белки характеризуются определенной степенью разности, наблюдается высокая степень родства в сравнении с другими белками, закодированными вирусным геномом.

В настоящее время HMPV обнаруживается при помощи трех методик: RT-PCR, которая позволила амплифицировать сегменты генов F и N непосредственно из образцов мазков из носоглотки, респираторная панель (прямой иммунофлуоресцентный метод, обычно используемый в клинических лабораториях, которые позволяют обеспечить одновременное определение различных типов респираторных вирусов) и культура in vitro в клетках LLC-MK2 для обнаружения цитопатического эффекта. Чувствительность этих методик составляет не более 70% с противоречивыми результатами. Одна из проблем, возникших в связи с низкой чувствительностью и расхождением между этими методиками, связана с тем, что респираторные инфекции, отрицательные для респираторной панели, как правило, лечатся антибиотиками во избежание возможных бактериальных суперинфекций. Таким образом, ложноотрицательные результаты, полученные доступными методиками, не обеспечивают соответствующее лечение, и пациент подвергается ненужному лечению антибиотиками, что в дальнейшем увеличивает возможность возникновения у пациента устойчивости к антибиотикам.

Следовательно, для hMPV крайне необходимо предусмотреть эффективный и быстрый диагностический тест. В связи с этой проблемой, моноклональные антитела по настоящему изобретению выступают в качестве необходимой альтернативы для удовлетворения этой потребности, поскольку они обеспечивают определенное распознавание вирусных антигенов в образцах у пациентов, зараженных hMPV. Таким образом, настоящее изобретение включает такие продукты, как моноклональные антитела, и альтернативный способ, который предусматривает их использование для обеспечения точного, эффективного и быстрого определения и диагностики у пациентов, зараженных hMPV, со 100% специфичностью в клинических образцах и благодаря которому можно определить концентрации, эквивалентные 1,5 нг специфического антигена ELISA. Это позволит врачам-клиницистам обеспечивать своевременное и надлежащее лечение, которое может обеспечить предупреждение заболевания.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к моноклональным антителам к метапневмовирусу человека (hMPV). В частности, настоящее изобретение относится к двум мышиным моноклональным антителам, которые соответствуют моноклональным антителам, выделяемым клеточными линиями гибридом 3G8/C11 и 7G4/A12, которые реагируют на М-антиген hMPV. Данные антитела не вступают в конфликт друг с другом за участок связывания, а также не препятствуют одновременному связыванию с антигеном. Моноклональные антитела могут использоваться в тестах для обнаружения, диагностики и/или определения заражения hMPV. Данные антитела могут одновременно использоваться для увеличения чувствительности обнаружения в клинических образцах с небольшим количеством антигена. Например, как показано на фиг. 6, антитела из гибридомы 3G8/C11 могут эффективно захватывать М-белок hMPV в клинических образцах. Данные захваченные и иммобилизированные белки были последовательно обнаружены антителами, образованными гибридомой 7G4/A12, и связаны с ферментом, воздействующим на хромогенный субстрат. Эта характерная особенность обеспечивает комбинацию двух антител с различными метками для обнаружения того же антигена в образцах с небольшим количеством антигена.

Настоящее изобретение предусматривает способы диагностики ex vivo или in vitro для обнаружения вирусного М-антигена hMPV, т.е. способы, в которых используются моноклональные антитела, вырабатываемые и выделяемые гибридомами 3G8/C11 и 7G4/A12 в тестах, например, ELISA, флуоресцентная микроскопия и иммуноблотирование. Анализируемыми образцами могут быть: клетки, зараженные hMPV in vitro, носовые секреты, носовые смывы, фарингеальные секреты и/или бронхиальные секреты или смывы и прочее. Настоящее изобретение предусматривает способ обнаружения hMPV в биологических образцах и клеточных культурах при помощи моноклональных антител, вырабатываемых и выделяемых вышеуказанными клеточными линиями гибридомы, связанными на любой твердой подложке, например, нитроцеллюлоза, найлоновая мембрана, магнитные микроносители, флуоресцентные гранулы или прочая подложка; или связанными с любой другой молекулой, например, ферменты, белки, флуорофоры, радиоактивные изотопы или любое другое химическое соединение. Настоящее изобретение может использоваться в наборах для обнаружения hMPV, включающих антитела, вырабатываемые гибридомами. Объем настоящего изобретения охватывает любой тип химически связанной молекулы или субстрата, например, метки, флуорофоры, биотин, радиоизотопы, металлы, ферменты и/или любой химический элемент, связанный с моноклональными антителами, выделяемыми гибридомами 3G8/C11 и 7G4/A12, причем химически связанная молекула или субстрат обеспечивает визуализацию или обнаружение антитела. Таким образом, настоящее изобретение также предусматривает антитела, которые распознают М-белок, связанный с различными молекулами или субстратами или маркерами антитела, выступающие как часть способа обнаружения, анализа и/или диагностики в биологических образцах.

ОПИСАНИЕ ЧЕРТЕЖЕЙ

Фиг. 1: Обнаружение М-белка hMPV с помощью моноклональных антител, вырабатываемых гибридомами 3G8/C11 и 7G4/A12, с помощью белка непрямого теста ELISA. Планшет активировался с 50 нг очищенного рекомбинантного М-белка hMPV или 1×106 БОЕ hMPV. Другие ячейки были активированы с 1×106 БОЕ респираторно-синцитиального вируса (RSV) или 50 нг BSA-белка в качестве отрицательного контроля; также были включены контрольные ячейки без антигена с первичным антителом, антимышиным антителом IgG, связанным с HRP (неактивированным), и ячейки без антигена или первичного антитела только с антимышиным антителом IgG (HRP). Далее ячейки выдерживались с анти-М антителами из гибридомы 3G8/C11, в количестве 170 нг(А); гибридомы 7G4/A12 в количестве 170 нг (В); и неочищенного антитела к метапневмовирусу человека 75.1, клон 1В7, номер по каталогу МАВ8510 (EMD Millipore, используемого в количестве 680 нг (С)). Данные, представленные на графике, указывают на оптическую плотность, обнаруженную при 450 нм путем преобразования субстрата тетраметилбензидина в окрашенное соединение, катализированное ферментом пероксидазы хрена (HRP) на вторичном антимышином антителе IgG, связанном с антителами, выделяемыми гибридомами 3G8/C11, 7G4/A12 и МАВ8510 компании Millipore. Показатели являются средними значениями +/- стандартное отклонение оптической плотности каждого образца как минимум в двух отдельных опытах. ** Значения Р<0,01 и *** Р<0,0001, полученные путем однофакторного дисперсионного анализа в отношении отрицательного контроля, и проверенные путем множественного сравнения Даннетта; не, отсутствие значительной разницы в сравнении с отрицательным контролем.

Фиг. 2: Определение чувствительности моноклональных антител, вырабатываемых гибридомами 3G8/C11 и 7G4/A12 для обнаружения М-белка hMPV. Планшеты ELISA активировали путем последовательных разбавлений 1:2, начиная с 50 нг М-белка и заканчивая 0,04 нг (А); или путем последовательных разбавлений 1:2, начиная с инокулята 1×105 БОЕ hMPV до разбавления 1:5 120 (В); и путем последовательных разбавлений 1:2, начиная с инокулята 1×106 БОЕ hMPV до разбавления 1:64 (С). Неактивированные ячейки были включены в качестве отрицательного контроля. Данные, представленные на графике, указывают на оптическую плотность, обнаруженную при 450 нм путем преобразования субстрата тетраметилбензидина в окрашенное соединение, катализированное ферментом пероксидазы хрена (HRP) на анти-М антителах из гибридом 3G8/C11 и 7G4/A12 в количестве 170 нг (А и В). Неочищенное анти-hMPV М-антитело использовалось в большем количестве (680 нг) (С). Показатели являются средними значениями оптической плотности каждого образца как минимум в двух отдельных анализах.

Фиг. 3: Метод последовательного разбавления моноклонального анти-hMPV М-антитела, вырабатываемого гибридомами 3G8/C11 и 7G4/A12, для обнаружения очищенных антигенов hMPV. Планшеты ELISA активировали с помощью 50 нг рекомбинантного М-белка hMPV, а антиген определяли путем последовательных разбавлений 1:2 анти-М антител 3G8/C11 или 7G4/A12, начиная с концентрации 3,4 мкг/мл (170 нг). Все данные выражены в качестве средних значений оптической плотности при 450 нм каждого образца как минимум в двух отдельных анализах.

Фиг. 4: Подтверждение специфичности моноклональных антител, выделяемых гибридомами 3G8/C11 и 7G4/A12, с помощью дот-блоттинга. Анти-hMPV М-антитела, вырабатываемые гибридомами 3G8/C11 или 7G4/A12, выдерживались на протяжении 1 часа на нитроцеллюлозной мембране, содержащей следующие иммобилизированные образцы (в качестве пятен): RSV (1×106 БОЕ), hMPV (1×106 БОЕ), BSA (1 БОЕ), М-белок hMPV (1 мкг, 500 нг и 50 нг), 20 мкг незараженных клеток и экстракт клеток LLC-MK2, зараженных hMPV. После выдерживания мембрану промывали и выдерживали в течение 1 часа с вторичными антимышиными антителами IgG, связанными с HRP. После выдерживания, связывание моноклональных антител с антигеном определяли путем захвата хемилюминесценции, полученной посредством катализа неочищенного субстрата («система обнаружения с вестерн-блоттингом и повышенной хемилюминесценцией» Amersham ECL, Уппсала, Швеция). Определено, что антитела вырабатываются гибридомами 3G8/C11 или 7G4/A12, связанными только с пятнами, где присутствуют М-белок hMPV, вирус hMPV и клетки, зараженные hMPV, что подтверждает специфичность данных антител.

Фиг. 5. Обнаружение М-белка hMPV с помощью иммунофлуоресценции в клетках LLC-MK2, зараженных hMPV. Клетки LLC-MK2 выращивались in vitro до достижения соединения (70-80%) для заражения hMPV в течение 48 часов. Затем их фиксировали с помощью параформальдегида и подготавливали для непрямой иммунофлуоресценции. При этом использовалось моноклональное антитело из гибридомы 3G8/C11, гибридомы 7G4/A12 или неочищенного антитела МАВ8510 компании Millipore. В качестве вторичного антитела использовалось неочищенное антимышиное антитело IgG, связанное с флуорофором Alexa Fluor 488, обеспечивающим флуоресценцию при 519 нм (интенсивный сигнал). Ядра клеток были помечены иодидом TOPRO-3 флуорофора, обеспечивающим флуоресценцию при 661 нм (закрашенные круги). Сильно выраженная химическая активность в цитоплазме (белые стрелки) наблюдается только в зараженных клетках при использовании любого первичного антитела.

Фиг. 6: Обнаружение hMPV в клинических образцах посредством «сэндвич» ELISA с помощью комбинации моноклональных антител, выделяемых гибридомами 3G8/C11 и 7G4/A12. Планшеты ELISA были активированы с помощью 170 нг антитела, выделенного гибридомой 3G8/C11, выступающей в качестве захватывающего антитела. Ячейки, активированные захватывающими антителами, выдерживались в 50 мкл образцов мазков из носоглоток (NPS) пациентов с вирусными респираторными симптомами. 10 образцов, взятых у здоровых пациентов, были проанализированы в качестве отрицательного контроля. Было использовано 20 образцов, взятых у пациентов, зараженных hMPV, а также 20 образцов, взятых у пациентов, зараженных респираторно-синцитиальным вирусом, которые были включены в качестве контроля специфичности. Ячейки, в которые был введен очищенный М-белок hMPV, были включены в качестве положительного контроля. Для обнаружения белка, захваченного с помощью антитела 3G8/C11, использовались антитела, производимые гибридомой 7G4/A12, связанной с ферментом пероксидазы хрена в разбавлении 1:2000 (75 нг на ячейку). Указанные данные являются средними значениями +/- стандартное отклонение оптической плотности при 450 нм для каждого образца (**Р<0,01 ***р<0,0001 и не: существенная разница в однофакторном дисперсионном анализе между пациентами, зараженными RSV, и здоровыми пациентами отсутствует).

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к моноклональным антителам IgG2a двух изотипов или их фрагментам, которые распознают М-белок (также анти-М антитела) метапневмовируса человека (hMPV).

Моноклональное антитело является видом гомогенного антитела, характеризующегося распознаванием отдельного антигена. Они вырабатываются отдельной гибридной клеткой (гибридома), которая является продуктом слияния лимфоцитного клона и новообразованной плазматической клетки. Свойство специфической связи и высокого сродства с антигеном обеспечило развитие моноклональных антител как практического средства для обнаружения молекул, которые вызывают огромный научный и клинический интерес, и которые имеют широкое применение в промышленности. В настоящее время моноклональные антитела часто используются как в фундаментальных, так и в прикладных исследованиях благодаря своей специфичности и воспроизводимости, что обеспечивает более надежную поддержку исследования. Тем не менее, биомедицина является разделом, в котором моноклональные антитела имеют значительное практическое применение, как для диагностики и лечения разнообразных инфекционных болезней, так и в качестве терапии других патологий. Наивысшие результаты в проектировании диагностических наборов in vitro были достигнуты при использовании моноклональных антител для всех способов обнаружения и диагностики. Для этого имеются несколько наборов быстрого обнаружения, таких как тест на определение беременности, который основывается на обнаружении уровней человеческого хорионического гонадотропина (hCG) в моче с помощью анти-hCG антитела. Кроме того, высокое значение получили моноклональные антитела, предназначенные для использования в терапевтических целях. В настоящее время существуют терапевтические воздействия на различные патологии с помощью неочищенных моноклональных антител, таких как, среди прочих, алемтузумаб, гемтузумаб озогамицин, ретуксимаб, трастузумаб.

Авторы настоящего изобретения разработали два типа моноклональных антител, которые распознают М-белок hMPV. Как указано выше, данные антитела вырабатываются гибридомами 3G8/C11 и 7G4/A12. Аминокислотные последовательности вариабельных областей обеих цепей антитела, вырабатываемого гибридомой 3G8/C11, изложены в SEQ ID №1 для тяжелой цепи и SEQ ID №2 для легкой цепи. Кодирующие нуклеотидные последовательности изложены в SEQ ID №3 и SEQ ID №4 соответственно. Аналогичным образом, аминокислотные последовательности вариабельных областей обеих цепей антитела, вырабатываемого гибридомой 7G4/A12, изложены в SEQ ID №5 для тяжелой цепи и SEQ ID №6 для легкой цепи. Кодирующие нуклеотидные последовательности изложены в SEQ ID №7 и SEQ ID №8 соответственно.

Любой специалист в данной области, начиная с этих переменных последовательностей, может воспроизвести химерные антитела, включая либо только один вариабельный участок, либо сочетая их с помощью всех возможных комбинаций. Все подобные варианты осуществления включены в объем настоящего изобретения. Это значит, что настоящее изобретение включает антитела, состоящие как минимум из одной последовательности SEQ ID №1, SEQ ID №2, SEQ ID №5 и SEQ ID №6, а также аналогичные последовательности со сходством или родством 90%, 95% или 99% с любой из указанных аминокислотных последовательностей. Кроме того, нуклеотидные последовательности включают как минимум одну последовательность из SEQ ID №3, SEQ ID №4, SEQ ID №7 и SEQ ID №8, а также их обратно-комплементарные и аналогичные последовательности со сходством или родством 90%, 95% или 99% с любой из указанных нуклеотидных последовательностей. Наивысшая степень сходства, рассматриваемая в нуклеотидной последовательности, основывается на вырождение генетического кода. Таким образом, настоящее изобретение также включает набор нуклеотидных последовательностей, кодирующих моноклональное антитело или его фрагмент, который распознает М-белок hMPV.

Как показано на фиг. 1 и 4, настоящие антитела не вступают в реакцию с другими белками или молекулами, присутствующими в соответствующих вирусах или образцах, взятых у пациентов с другими респираторными инфекциями, связанными с вирусом. Тем самым при использовании в способах диагностики значительно понижается вероятность ложноотрицательных результатов.

Для демонстрации разных вариантов применения моноклональных антител по настоящему изобретению ниже приведены примеры.

Пример 1: Определение нуклеотидной последовательности, кодирующей легкие (VL) и тяжелые (VH) цепи вариабельной области анти-hMPV М-антитела, выделяемого из гибридомы 3G8/C11.

Гибридома 3G8/C11 была выращена из культуральной среды DMEM с высоким содержанием глюкозы, дополненной бикарбонатом натрия в концентрации 3,7 г/л и 10% эмбриональной телячьей сыворотки при 37°С, 10% СО2 при плотности клеток 700000 клеток/мл. При обработке соединением Тризол (Invitrogen) была получена РНК с общей концентрацией 3,5×106 клеток. Для получения кДНК посредством реакции обратной транскрипции с использованием набора Impron II (Promega) было использовано 0,5 мкг РНК. Вариабельная область генов, кодирующая каппа- и лямбда-цепи иммуноглобулина, была амплифицирована посредством PCR. Для этого были использованы универсальные праймеры из набора Novagen Ig-Primer Set (№69831-3 по каталогу) согласно инструкциям производителя. Вариабельная область легкой цепи была амплифицирована праймерами MuIgκVL5'-B: 5'GGGААТТСATGGAGACAGACACACTCCTGCTAT3' (SEQ ID №9) и MuIgκVL5'-C: 5'ACTAGTCGACATGGAGWCAGACACACTSCTGYTATGGGT3' (SEQ ID №10), а вариабельная область тяжелой цепи была амплифицирована праймерами MuIgVH5'-А: 5'GGGAАТТСATGRASTTSKGGYTMARCTKGRTTT3' (SEQ ID №11) и MuIgVH5'-F: 5'ACTAGTCGACATGAACTTYGGGYTSAGMTTGRTTT3' (SEQ ID №12). Продукты PCR были клонированы в клонирующем векторе рТОРО-ТА (Invitrogen) согласно инструкциям производителя и секвенированы службой секвенирования Папского Католического университета Чили в секвенаторе ABI prism 3130xl (Applied Biosystem). Расшифрованная аминокислотная последовательность была получена с помощью биоинформационной программы Vector NTI (Invitrogen).

Пример 2: Определение нуклеотидной последовательности, кодирующей вариабельные легкие (VL) и тяжелые (VH) цепи анти-hMPV М-антитела, выделяемого из гибридомы 7G4/A12.

Гибридома 7GA/A12 была выращена из культуральной среды DMEM с высоким содержанием глюкозы, дополненной бикарбонатом натрия в концентрации 3,7 г/л и 10% эмбриональной телячьей сыворотки при 37°С, 10% СО2 при плотности клеток 700000 клеток/мл. С помощью Тризола (Invitrogen) была получена РНК с общей концентрацией 3,5×106 клеток. Для получения кДНК посредством реакции обратной транскрипции с использованием набора Impron II (Promega) было использовано 0,5 мкг РНК. Вариабельная область генов, кодирующая каппа- и лямбда-цепи иммуноглобулина, была амплифицирована посредством PCR. Для этого были использованы универсальные праймеры из набора Novagen Ig-Primer Set (№69831-3 по каталогу) согласно инструкциям производителя. Вариабельная область легкой цепи была амплифицирована праймерами MuIgκVL5'-B: 5'GGGAATTCATGGAGACAGACACACTCCTGCTAT3' (SEQ ID №9) и MuIgκVL5'-C: 5'ACTAGTCGACATGGAGWCAGACACACTSCTGYTATGGGT3' (SEQ ID №10), a вариабельная область тяжелой цепи была амплифицирована праймерами MuIgVH5'-A: 5'GGGAATTCATGRASTTSKGGYTMARCTKGRTTT3' (SEQ ID №11) и MuIgVH5'-F: 5'ACTAGTCGACATGAACTTYGGGYTSAGMTTGRTTT3' (SEQ ID №12). Продукты PCR были клонированы в клонирующем векторе рТОРО-ТА (Invitrogen) согласно инструкциям производителя и секвенированы службой секвенирования Папского Католического университета Чили в секвенаторе ABI prism 3130xl (Applied Biosystem). Расшифрованная аминокислотная последовательность была получена с помощью биоинформационной программы Vector NTI (Invitrogen).

Пример 3: Тест для обнаружения hMPV-антигена, определения специфичности моноклональных анти-hMPV М-антител для очищенных hMPV-антигенов посредством непрямого теста ELISA.

Цель настоящего теста - выявить специфичность антител, вырабатываемых гибридомами 3G8/C11 и 7G4/A12 относительно М-белка hMPV. Обнаружение антигена было осуществлено посредством непрямого теста ELISA, в котором планшет ELISA был активирован 50 нг очищенного антигена в течение 1 часа при 37°С. Аналогичным образом, планшет был активирован бляшкообразующими единицами (БОЕ) в концентрации 1×106.

Респираторно-синцитиальный вирус (RSV) в тех же условиях выдерживания hMPV и 50 нг BSA-белка в отдельной ячейке были добавлены в качестве от отрицательного контроля. Впоследствии планшет дважды промывали с помощью фосфатно-солевого буфера (PBS)/0,05% Tween. Затем планшет блокировали в течение 2 часов при 37°С с помощью PBS/10% FBS. Смывы впоследствии повторяли, и каждое из антител (3G8/C11 и 7G4/A12) выдерживали в окончательной концентрации 3,4 мкг/мл, разбавляя в PBS/10% FBS в течение 1 часа при комнатной температуре (каждое антитело в отдельном планшете). Контрольный тест проводили в другом планшете в тех же условиях с помощью неочищенного моноклонального антитела, распознающего М-белок hMPV (антитело к метапневмовирусу человека 75.1, клон 1В7, номер по каталогу МАВ8510, EMD Millipore) в концентрации 13,6 мкг/мл. По окончании выдерживания смывы повторяли, а вторичное антимышиное антитело IgG, помеченное ферментом пероксидазы хрена (фермент пероксидазы хрена, HRP) в разбавлении 1:2000 (25 нг на ячейку) в PBS/10% FBS, добавляли в каждую ячейку в течение 1 часа при комнатной температуре. В заключение, проводились смывы, и было добавлено 50 мкл цитратного буфера/тетраметилбензидина (ТМВ, 3-3'-5-5'-тетраметилбензидин, 1 мг/мл, Becton Dickinson). 50 мкл 2N H2SO4 добавили, чтобы остановить реакцию, и результат считывали в считывающем устройстве для планшетов ELISA при 450 нм. Для оценки того, была ли реакция вторичного антитела специфичной для распознавания первичного антитела, и не был ли полученный сигнал вызван неспецифическим связыванием вторичного антитела с вирусным антигеном, контроль проводили только с применением вторичного антитела, но без первичного антитела и образца. Другой контроль для оценки того, была ли реакция первичного антитела специфичной для антигена, заключался в использовании антител на планшете ELISA, не активированном антигеном (ячейка без антигена), либо с помощью антитела на планшете ELISA, имеющем 50 нг BSA-белка или другой вирус (RSV). Результаты свидетельствуют о том, что моноклональные антитела по настоящему изобретению способны точно распознавать 50 нг очищенного антигена, так как они не распознают BSA-белок или белки из другого ассоциированного вируса (фиг.1А и 1В). Кроме того, было определено, что неочищенное антитело (фиг. 1С), использовавшееся в тесте в качестве контроля, даже будучи специфичным для обнаружения вируса, не оказалось эффективным при обнаружении очищенного рекомбинантного М-белка hMPV в нашей лаборатории.

Пример 4: Испытание для определения чувствительности моноклональных антител для обнаружения вирусного антигена.

Тест проводился для определения максимального уровня разбавления вируса и белка, который можно обнаружить с помощью моноклональных анти-hMPV М-антител из гибридом 3G8/C11 и 7G4/A12 посредством непрямого теста ELISA. Для этого использовалась та же методика, описанная в примере 3. Планшет активировали путем одиннадцати последовательных разбавлений 1:2 М-белка hMPV, начиная с 50 нг очищенного антигена. Для вируса планшет активировали путем последовательных разбавлений 1:2, начиная с 1×105 БОЕ вируса. Анти-М антитела 3G8/C11 или 7G4/A12 использовались в концентрации 3,4 мкг/мл (170 нг/ячейка) с разбавлением в PBS/10% FBS. Затем добавляли детекторное антимышиное антитело IgG в разбавлении 1:2000 (25 нг/ячейка). Результаты показали, что анти-М антитело 3G8/C11 способно распознавать до 190 пикограмм (пг) М-белка hMPV. Анти-М антитело из гибридомы 7G4/A12 было более чувствительным и позволяло обнаружить до 90 нг М-белка hMPV (фиг. 2А).

Что касается чувствительности антител, выраженной их способностью обнаруживать hMPV при сильном разбавлении, было определено, что анти-М антитело из гибридомы 3G8/C11 может обнаруживать разбавления вируса вплоть до 1 к 60, в то время как антитело из гибридомы 7G4/A12 способно обнаруживать белок в вирусе в разбавлении 1:2 560, что эквивалентно примерно 390 вирусным частицам (фиг. 2В).

Оценивалась способность неочищенного антитела Millipore обнаруживать вирус, и разбавления 1:2 начинались с 1×106 БОЕ. Было установлено, что антитело способно обнаруживать 1×106 БОЕ и еще два разбавления, т.е. до разбавления общего объема вируса 1:4 (фиг. 2С).

Группы контроля, которые могли исключить неспецифические реакции обоих антител, были включены во все тесты и содержали все компоненты тестов, кроме образца (М-белок или вирус hMPV).

Пример 5: Тест для определения эффективности моноклонального антитела с целью обнаружения вирусных антигенов.

Тест проводился для определения максимального уровня разбавления моноклональных анти-hMPV М-антител из гибридом 3G8/C11 и 7G4/A12, что позволяет обнаружить вирусный антиген. Для этого использовалась методика ELISA, описанная в примере 4. Планшет активировали с помощью 50 нг очищенного антигена, а анти-М антитела 3G8/C11 или 7G4/A12 использовали в разбавлениях 1:2, начиная с рабочей концентрации (3,4 мкг/мл) до 11-го разбавления в PBS/10% FBS. На фиг. 3 показано, что анти-М антитела 3G8/C11 и 7G4/A12 способны обнаружить М-белок hMPV во всех разбавлениях, используемых в тесте.

При отрицательном контроле, входящем в состав данного теста, использовалась одна ячейка без образца (М-белок); ее блокировали PBS/10% FBS; первичное антитело (анти-М 3G8/C11 или анти-М 7G4/A12) не добавлялось и содержало только антимышиное антитело IgG, связанное с HRP.

Пример 6: Тест специфичности моноклональных анти-hMPV М-антител для очищенных антигенов hMPV посредством дот-блот анализа.

Тест проводится для подтверждения специфичности антител, вырабатываемых гибридомами 3G8/C11 и 7G4/A12 для М-белка hMPV, используя метод иммуноблотирования. Обнаружение антигена выполнялось посредством методики дот-блоттинга, в которой нитроцеллюлозная мембрана используется в качестве твердой подложки для иммобилизации антигена в одной капле суспензии. Для этого было нанесено 20 мкл на нитроцеллюлозную мембрану, которая содержит: 1×1066 БОЕ RSV, 1×106 БОЕ hMPV, очищенный М-белок hMPV (1 мкг, 500 нг и 50 нг), 20 мкг экстракта клеток LLC-MK2, зараженных hMPV, и 20 мкг экстракта незараженных клеток LLC-MK2. 500 нг BSA, содержащегося в 20 мкл, применяли в качестве отрицательного контроля. Растворы, наносимые на мембрану, сушили на воздухе в течение 15 минут. Затем мембрану блокировали с помощью 5% BSA в PBS, содержащем 0,05% Tween-20, в течение 1 ч при 25°С. Мембраны выдерживали с 3,4 мкг/мл моноклонального анти-М антитела из гибридомы 3G8/C11 или гибридомы 7G4/A12 в блокирующем растворе в течение 1 ч при 25°С. Излишек антитела, не связанного с антигеном, удаляли путем трех смывов с PBS 0,05% Tween-20 при 25°С. Антитела, связанные с антигеном, обнаруживали посредством антимышиного антитела IgG, связанного с HRP (Invitrogen, Life Technologies №62-6520). Их выдерживали в течение 1 ч в блокирующем растворе при 25°С для последующего удаления излишка несвязанного антитела путем трех смывов с PBS 0,05% Tween-20 при 25°С. Связывание моноклональных антител с антигеном определяли путем захвата хемилюминесценции, полученной посредством катализа неочищенного субстрата («система обнаружения с вестерн-блоттингом и повышенной хемилюминесценцией» Amersham ECL, Уппсала, Швеция) при содействии фермента HRP, связанного с антимышиным антителом IgG. Захват хемилюминесценции выполняли посредством системы фотодокументирования MyECL (Thermo Fisher). Как видно на фиг. 4, антитела из гибридом 3G8/C11 и 7G4/A12 связываются только с «пятнами», содержащими hMPV или М-белок, и не связываются неспецифически с «пятнами», содержащими посторонние белки, другие вирусы или незараженные клетки.

Пример 7: Обнаружение заражения hMPV в клетках LLC-MK2 путем иммунофлуоресценции с помощью моноклональных анти-М антител hMPV.

Данный тест проводился для расширения спектра методов, которые позволяют обнаружить заражение hMPV благодаря раскрытому изобретения. Был проведен тест с флуоресцентной микроскопией, в котором незараженные и зараженные hMPV клетки LLC-MK2 выдерживались с моноклональными анти-hMPV М-антителами, полученными из гибридом 3G8/C11 или 7G4/A12. Используемый протокол включал следующее: клетки фиксировали с помощью 4% параформальдегида, разбавленного в PBS, в течение 10 минут при 25°С. Затем клетки промывали PBS и пермеабилизировали с помощью 0,2% сапонина, разбавленного в PBS/10% FBS, в течение 30 минут при 25°С. Моноклональные антитела, полученные из гибридом 3G8/C11 или 7G4/A12, добавляли в концентрации 3,4 мкг/мл, разбавляя в PBS/10% FBS в течение 1 часа при 25°С. Затем были проведены два смыва с помощью PBS, а вторичное антимышиное антитело IgG, связанное с флуорофором Alexa Fluor 488 (Life Technologies), добавляли в разбавлении 1 к 200 в PBS/10% FBS в течение 1 часа при 25°С в темноте. Смывы повторяли, и ядра помечали иодидом TOPRO-3 642/661 (Invitrogen, №-Т3605) в разбавлении 1:5000 в течение 15 минут при 25°С в темноте. В заключение, был выполнен смыв с помощью PBS, и покровные стекла были введены в эпифлуоресцентный микроскоп для дальнейшего наблюдения. Полученные результаты демонстрируют, что антитела по настоящему изобретению также полезны для распознавания специфически зараженных клеток путем иммунофлуоресценции без неспецифического связывания с незараженными клетками (фиг. 5).

Пример 8: Клиническая диагностика образцов, взятых у пациентов, зараженных hMPV, с помощью моноклональных анти-hMPV М-антител из гибридом 3G8/C11 и 7G4/A12 путем «сэндвич» ELISA или ELISA с захватом.

Из-за дефицита и низкой концентрации вирусных белков в клинических образцах, полученных из мазков из носоглотки, было необходимо изменить способ обнаружения и использовать ELISA с захватом или «сэндвич» ELISA с применением анти-М антитела из гибридомы 3G8/C11 в качестве захватывающего антитела и анти-М клона 7G4/A12, связанного с HRP, в качестве детекторного антитела. В ходе теста ячейки планшета ELISA активировались 3,4 мкг/мл (170 нг/ячейка) анти-М антитела из гибридомы 3G8/C11, разбавленной в PBS, в течение 1 часа при 37°С. Было выполнено два смыва с помощью PBS 0,05% Tween 20, а затем планшет блокировался 200 мкл PBS/10% FBS в течение 2 часов при 37°С. Его промывали повторно и выдерживали при 4°С на протяжении ночи, и каждая ячейка содержала 50 мкл носоглоточных аспиратов, взятых у пациентов, зараженных hMPV, по способу диагностики «Набор для скрининга и определения респираторных вирусов D3 Ultra DFA компании DHI (Diagnostics Hibryds), США», который обычно называют «вирусной панелью», которые обрабатывались, как описано ниже*. В качестве групп контроля были включены: 1) контроль специфичности (50 мкл образца, взятого у пациентов с RSV посредством вирусной панели), 2) положительный контроль (50 нг рекомбинантного М-белка hMPV) и 3) отрицательный контроль, соответствующий образцам, взятым у здоровых пациентов (отрицательный для вируса посредством вирусной панели). Смывы выполнялись на следующий день, и каждая ячейка выдерживалась в течение 1 часа при комнатной температура с 50 мкл анти-М антитела, связанного с HRP, из гибридомы 7G4/A12. Планшет промывали еще 2 раза, в него добавляли 50 мкл раствора ТМВ, и выдерживали в течение 10-15 минут в темноте. Реакцию останавливали с помощью 50 мкл 2N H2SO4.. Считывание планшетов осуществлялось в считывающем устройстве ELISA Epoch, аттестованном на клиническую диагностику. Результаты данного теста показаны на фиг. 6, где видно, что «сэндвич»-метод ELISA, в котором антитело из гибридомы 3G8/C11 используется в качестве захватывающего антитела, а антитело из гибридомы 7G4/A12-HRP - в качестве детекторного антитела, позволял обнаружить антиген в образцах, взятых у пациентов, зараженных hMPV, которые ранее были определены как положительные путем прямой иммунофлуоресценции в сертифицированной клинической лаборатории посредством вирусной панели. Количество пациентов, включенных в исследование, составляло 20, 18 из которых имели положительные результаты ELISA с оптической плотностью (OD) выше 0,1. Данное испытание показывает универсальность антител из гибридом 3G8/C11 и 7G4/A12, поскольку они способны одновременно связывать антиген, не вступая в конфликт и не препятствуя друг другу, а также обеспечивая захват и последующее обнаружение М-белка в образцах, взятых у пациентов.

* Обработка клинических образцов. Образцы, используемые для тестирования, были получены из мазков из носоглотки, содержащихся в универсальной транспортной среде. Образцы центрифугировали на скорости 2000 об/мин в течение 10 минут при 4°С. Впоследствии супернатант (SN1) отделяли от сгустка; последний выдерживали в 100 мкл буфера RIPA (50 ммоль трис-HCl рН 8,0, 150 ммоль NaCl, 1% NP-40, 0,5% дезоксихолата натрия, 0,1% SDS и смесь ингибиторов протеазы) в течение 15 минут при 4°С, с перемешиванием вихревым способом каждые 5 минут. Затем его центрифугировали на скорости 2000 об/мин в течение 10 минут при 4°С. В конечном итоге, полученный супернатант (SN2) собирали и смешивали с SN1.

Примеры, описанные в настоящем документе, демонстрируют специфичность, эффективность, чувствительность и универсальность моноклональных анти-hMPV М-антител, выделяемых клеточными линиями гибридом 3G8/C11 и 3G8/C11. B представленных здесь примерах приведены некоторые варианты использования моноклональных анти-hMPV М-антител, но они ни в коем случае не ограничивают объем настоящего изобретения.

1. Моноклональное антитело или его фрагмент, которые связываются с М-белком респираторного метапневмовируса человека (hMPV), отличающееся/отличающийся тем, что он/оно включает вариабельную область тяжелой цепи, имеющую последовательность как минимум с родством 90%, 95% или 99% с SEQ ID №1 или SEQ ID №5, и вариабельную область легкой цепи, имеющую последовательность как минимум с родством 90%, 95% или 99% с SEQ ID №2 или SEQ ID №6.

2. Антитело или его фрагмент по п. 1, отличающееся/отличающийся тем, что антитело или фрагмент дополнительно связываются с маркером, выбранным из группы, включающей флуорофоры, биотин, радиоизотопы, металлы и ферменты.

3. Набор нуклеотидных последовательностей для получения моноклонального антитела или его фрагмента, которые связываются с М-белком респираторного метапневмовируса человека (hMPV) по п. 1 или 2, отличающийся тем, что они включают нуклеотидную последовательность как минимум с одним родством 80%, 85%, 90%, 95% и 99% с SEQ ID №3 или SEQ ID №7, а также нуклеотидную последовательность, имеющую как минимум родство 80%, 85%, 90%, 95% и 99% с SEQ ID №4 или SEQ ID №8.

4. Способ диагностики in vitro и/или ex vivo заражения hMPV в биологическом образце, отличающийся тем, что он включает контактирование биологического образца с моноклональным антителом к hMPV или его фрагментом по п. 1 или 2 и обнаружение антитела, способного связываться с антигеном.

5. Способ диагностики in vitro и/или ex vivo по п. 4, отличающийся тем, что биологический образец выбирается из группы, включающей клетки, зараженные hMPV in vitro, носовые секреты, носовые смывы, фарингеальные секреты и/или бронхиальные секреты или смывы.

6. Способ диагностики in vitro и/или ex vivo по любому из пп. 4 или 5, отличающийся тем, что используемая методика предусматривает ELISA, иммунофлуоресценцию, иммуногистохимию, иммунохроматографию, проточную цитометрию, сортировку клеток, иммунопреципитацию и/или вестерн-блоттинг.

7. Способ диагностики in vitro и/или ex vivo по любому из пп. 4-6, отличающийся тем, что антитело или его фрагмент по п. 1 или 2 связывается с маркером, обеспечивающим его обнаружение.

8. Способ диагностики in vitro и/или ex vivo по п. 7, отличающийся тем, что антитело связывается с маркером, выбранным из группы, включающей флуорофоры, биотин, радиоизотопы, металлы и ферменты.



 

Похожие патенты:

Настоящее изобретение относится к ингибированию прогрессирования структурных повреждений у пациентов с псориатическим артритом. Описан способ такого ингибирования, в котором ежемесячно подкожно вводят примерно 150 мг или примерно 300 мг анти-IL-17 антитела с соответствующими аминокислотными последовательностями VH и VL.

Настоящее изобретение относится к области иммунологии. Предложены антитела, связывающиеся с человеческим альфа-синуклеином, а также конъюгат антитела с челночным модулем для гематоэнцефалического барьера.

Изобретение относится к EGFRvIII-связывающему белку, содержащему EGFRvIII-связывающий сайт, и его использованию. Предложен EGFRvIII-связывающий белок, содержащий EGFRvIII-связывающий сайт, и, необязательно, (i) содержащий по меньшей мере один дополнительный функциональный домен или (ii) являющийся мультиспецифичным.

Изобретение относится к области биотехнологии, конкретно к линкерному звену, и может быть использовано в качестве сшивающего средства для объединения различных антител или иных биологически активных агентов в конъюгаты и построения молекулярных конструкций с конкретной комбинацией нацеливающих и эффекторных элементов с применением химического синтеза, либо рекомбинантной технологии.

Изобретение относится к биотехнологии. Описана иммуносвязывающая молекула, содержащая: CDR1, CDR2 и CDR3 легкой цепи от донорной иммуносвязывающей молекулы зайцеобразного и CDR1, CDR2 и CDR3 тяжелой цепи от донорной иммуносвязывающей молекулы зайцеобразного; каркас вариабельной области легкой цепи человека и каркас вариабельной области тяжелой цепи человека, который по меньшей мере на 85% идентичен последовательности SEQ ID NO: 4 и содержит треонин (T) в положении 24 (нумерация AHo).

Изобретение относится к области биохимии, в частности к конструкции нуклеиновой кислоты для получения биспецифического антитело-подобного связывающего белка, связывающего пару антигенов.

Изобретение относится к биотехнологии. Описан вектор экспрессии на основе поксвируса, который содержит молекулу(ы) нуклеиновой кислоты, кодирующую(ие) гибрид гетероолигомерных микобактериальных антигенов ESAT6 и CFP10 и предпочтительно гибрид, содержащий аминокислотную последовательность, представленную в SEQ ID NO: 1.

Изобретение относится к биотехнологии и решает задачу лечения заболеваний, в частности системной красной волчанки, фрагментом антитела, специфически связывающимся с CD154.

Изобретение относится к области биотехнологии, конкретно к способу получения конъюгатов терапевтического соединения с пролонгированным периодом полувыведения, и может быть использовано в медицине.

Изобретение относится к области биохимии, в частности к рекомбинантной нуклеиновой кислоте легкой цепи иммуноглобулина, содержащей по меньшей мере два нереаранжированных генных сегмента VL человека и по меньшей мере один нереаранжированный генный сегмент JL человека, функционально связанный с последовательностью константной области легкой цепи иммуноглобулина.

Изобретение относится к области биотехнологии и касается способа получения энтеровирусоподобной частицы (EVLP) в растении. В растение, часть растения или клетку растения вводят первую нуклеиновую кислоту и вторую нуклеиновую кислоту.

Изобретение относится к области биотехнологии и касается способа получения энтеровирусоподобной частицы (EVLP) в растении. В растение, часть растения или клетку растения вводят первую нуклеиновую кислоту и вторую нуклеиновую кислоту.

Изобретение относится к области иммунологии. Предложены штаммы гибридных культивируемых клеток животных и антитела, способные к связыванию с белком GP вируса Эбола, subtype Zaire.

Изобретение относится к биохимии и медицине и представляет собой способ профилактики или лечения инфекции, связанной с вирусом гриппа A H7N9, включающий введение субъекту, имеющему или обладающему риском наличия инфекции, связанной с вирусом гриппа A H7N9, терапевтически эффективного количества антитела, при этом антитело включает три гипервариабельных участка тяжелой цепи (HVR-H1, HVR-H2 и HVR-H3) и три гипервариабельных участка легкой цепи (HVR-L1, HVR-L2 и HVR-L3), при этом (a) HVR-H1 включает аминокислотную последовательность SEQ ID NO: 56; (b) HVR-H2 включает аминокислотную последовательность SEQ ID NO: 57; (c) HVR-H3 включает аминокислотную последовательность SEQ ID NO: 58; (d) HVR-L1 включает аминокислотную последовательность SEQ ID NO: 59; (e) HVR-L2 включает аминокислотную последовательность SEQ ID NO: 60; и (f) HVR-L3 включает аминокислотную последовательность SEQ ID NO: 61.

Изобретение относится к биохимии и медицине и представляет собой способ профилактики или лечения инфекции, связанной с вирусом гриппа A H7N9, включающий введение субъекту, имеющему или обладающему риском наличия инфекции, связанной с вирусом гриппа A H7N9, терапевтически эффективного количества антитела, при этом антитело включает три гипервариабельных участка тяжелой цепи (HVR-H1, HVR-H2 и HVR-H3) и три гипервариабельных участка легкой цепи (HVR-L1, HVR-L2 и HVR-L3), при этом (a) HVR-H1 включает аминокислотную последовательность SEQ ID NO: 56; (b) HVR-H2 включает аминокислотную последовательность SEQ ID NO: 57; (c) HVR-H3 включает аминокислотную последовательность SEQ ID NO: 58; (d) HVR-L1 включает аминокислотную последовательность SEQ ID NO: 59; (e) HVR-L2 включает аминокислотную последовательность SEQ ID NO: 60; и (f) HVR-L3 включает аминокислотную последовательность SEQ ID NO: 61.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению человеческих белков в клетках СНО, и может быть использовано для получения человеческого антитела к гемагглютинину вируса гриппа А (ВГА) изотипа IgA2m1.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению человеческих белков в клетках СНО, и может быть использовано для получения человеческого антитела к гемагглютинину вируса гриппа А (ВГА) изотипа IgA2m1.

Настоящее изобретение относится к иммунологии. Предложены варианты моноклональных антител и их фрагментов, которые связываются с вирусом гриппа A и нейтрализуют инфекцию, вызванную кладой H3 и по меньшей мере несколькими вариантами клады H7 вируса гриппа A.

Настоящее изобретение относится к иммунологии. Предложены варианты моноклональных антител и их фрагментов, которые связываются с вирусом гриппа A и нейтрализуют инфекцию, вызванную кладой H3 и по меньшей мере несколькими вариантами клады H7 вируса гриппа A.

Изобретение относится к биохимии и представляет собой способ скрининга антитела широкого спектра действия против представляющего интерес антигена из патогена, который представляет собой ВИЧ, вирус гриппа или вирус гепатита С, включающий: (а) введение первого иммуногена, полученного из представляющего интерес антигена, мыши из линии мышей, содержащей в своей зародышевой линии: (i) ограниченный локус тяжелой цепи иммуноглобулина, содержащий единичный человеческий неперестроенный генный сегмент VH, который является человеческим генным сегментом VH1-69 или его полиморфным вариантом, один или более человеческих генных сегментов DH и один или более человеческих генных сегментов JH функционально связанных с нуклеотидной последовательностью константной области тяжелой цепи, (ii) генетически модифицированный локус легкой цепи иммуноглобулина, содержащий один или более человеческих генных сегментов Vκ и один или более человеческих генных сегментов Jκ, причем генные сегменты Vκ и Jκ функционально связаны с нуклеотидной последовательностью константной области легкой цепи, и при этом первый иммуноген содержит множество эпитопов; (b) создание у мыши возможности развития иммунного ответа на первый иммуноген, при этом иммунный ответ включает генерацию В-клеток мыши, которые экспрессируют последовательности VDJ тяжелой цепи человеческого иммуноглобулина (IgH) и последовательности VJ легкой цепи человеческого иммуноглобулина (IgL); (c) выделение клонально родственных В-клеток из мыши, которая экспрессирует рецептор В-клеток (BCR), который специфически связывает первый эпитоп первого иммуногена; (d) определение аминокислотных последовательностей VDJ IgH и VJ IgL указанного рецептора В-клеток (BCR) клонально родственных В-клеток; (e) получение из последовательностей VDJ IgH и VJ IgL аминокислотных последовательностей VDJ и VJ немутированного рецептора В-клеток (BCR); и одной или более аминокислотных последовательностей VDJ и VJ промежуточного предшественника рецептора В-клеток (BCR) указанных В-клеток на промежуточном этапе дифференцировки; (f) обеспечение множества вторых иммуногенов, содержащих вторые эпитопы, отличные от первого эпитопа, которые с повышенной аффинностью связываются с немутированным рецептором В-клеток (BCR) или промежуточным предшественником рецептора В-клеток (BCR) по сравнению с первым иммуногеном; (g) серийное введение другой мыши указанной линии вторых иммуногенов, выбранных из множества вторых иммуногенов со стадии (f), серийное введение, начиная со второго иммуногена, в немутированный BCR и далее вторых иммуногенов в промежуточные BCR последовательно более удаленные филогенетически от немутированного BCR; и (h) определение, включает ли иммунный ответ у мыши со стадии (g) антитело широкого спектра действия, которое связывает множество вторых эпитопов.

Настоящее изобретение относится к биотехнологии, а именно к мышиным моноклональным антителам, которые соответствуют моноклональным антителам, выделяемым клеточными линиями гибридом 3G8C11 и 7G4A12, и которые реагируют на М-антиген hMPV. Данные антитела не вступают в конфликт друг с другом за участок связывания при связывании с антигеном, а также не препятствуют одновременному связыванию с антигеном. Моноклональные антитела могут использоваться в тестах для обнаружения, диагностики иили определения заражения hMPV. 3 н. и 5 з.п. ф-лы, 6 ил., 8 пр.

Наверх