Молекулы, связывающие лиганды, и их применение

Авторы патента:


Изобретение относится к области биотехнологии, конкретно к молекуле, связывающейся с фактором роста эндотелия сосудов С (VEGF-C) и фактором роста эндотелия сосудов D (VEGF-D) и может быть использовано в медицине для регулирования ангиогенеза. Молекула, состоящая из первых трёх Ig-подобных доменов VEGFR-3 с делецией сайта N-гликозилирования в домене 1 VEGFR-3 и присоединённых своей С-концевой аминокислоты к N-концевой аминокислоте фрагмента константного домена иммуноглобулина, обладает улучшенными фармакокинетическими свойствами. 2 н. и 4 з.п. ф-лы, 5 ил., 6 табл., 10 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

[0001] Изобретение относится в основном к модулированию роста сосудов, особенно в офтальмологии и онкологии.

ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

[0002] Электронный перечень последовательностей составляет часть данного описания.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

[0003] Белки фактора роста эндотелия сосудов (VEGF) и их рецепторы (VEGFR) играют важные роли как в васкулогенезе - развитии эмбриональной сосудистой системы из деференцируемых на ранней стадии клеток эндотелия, так и в ангиогенезе - процессе образования новых кровеносных сосудов из уже существующих, и лимфангиогенезе - процессе образования новых лимфатических сосудов. Белки тромбоцитарного фактора роста (PDGF) и их рецепторы (PDGFR) участвуют в регуляции клеточной пролиферации, выживания и миграции нескольких типов клеток.

[0004] Нарушение функции регуляторной системы клеток эндотелия является ключевой особенностью злокачественных новообразований и различных заболеваний, связанных с ненормальными васкулогенезом, ангиогенезом и лимфангиогенезом.

[0005] Ангиогенез происходит в процессах эмбрионального развития и нормального роста, восстановления и регенерации тканей, женского репродуктивного цикла, установления и поддержания беременности, заживления ран и переломов. Помимо ангиогенеза, который имеет место в здоровом организме, ангиогенные явления происходят при различных патологических процессах, а именно, при росте опухолей и метастазировании, и при других состояниях, при которых увеличивается рост кровеносных сосудов, особенно капиллярной системы, например, при диабетической ретинопатии, псориазе и артропатии. Подавление ангиогенеза полезно для предупреждения или облегчения этих патологических процессов или для замедления их прогрессирования.

[0006] Несмотря на то, что лечебные терапии, направленные на блокирование передачи сигналов VEGF/PDGF через их рецепторы, продемонстрировали положительный результат в подавлении ангиогенеза и роста опухолей, по-прежнему существует потребность в новых или улучшенных соединениях и лечебных терапиях для лечения таких заболеваний.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

[0007] Настоящее изобретение относится к новым композициям и способам их применения в подавлении аберрантного ангиогенеза, лимфангиогенеза или обоих и подавлению другого действия фактора роста эндотелия сосудов С (VEGF-C) и фактора роста эндотелия сосудов D (VEGF-D), каждый из которых способен связываться с по меньшей мере одним рецептором фактора роста тирозинкиназы (т.е. VEGFR-2 или VEGFR-3) и стимулировать его фосфорилирование. Композиции данного изобретения включают молекулы, связывающие лиганды, которые связываются с одним или обоими человеческим VEGF-C и человеческим VEGF-D. В некоторых вариантах осуществления молекулы, связывающие лиганды, включаю полипептид, например, фрагмент внеклеточного домена (ECD) рецептора фактора роста тирозинкиназы. Фрагмент может отличаться от последовательности дикого типа, но такое отличие не ограничивает связывание фактора роста, и этот фрагмент предпочтительно сконструирован так, как описано в данном документе, с целью улучшения его свойств в качестве терапевтического средства для введения нуждающимся в нем объектам/пациентам.

[0008] Изобретение также предлагает нуклеиновые кислоты, кодирующие такие молекулы, связывающие лиганды. Нуклеиновые кислоты применяются для экспрессии полипептидных молекул, связывающих лиганды, а также в некоторых вариантах осуществления в качестве терапевтического средства для получения экспрессии полипептидных молекул, связывающих лиганды, in vivo в биологически активной форме.

[0009] Введение композиции, содержащей молекулу, связывающую лиганды, описанные в данном документе (или кодирующий ее полипептид), нуждающимся в них пациентам подавляет стимуляцию факторами роста рецепторов VEGF (например, подавляет фосфорилирование рецепторов) и таким образом подавляет биологические ответные реакции, опосредованные этими рецепторами, включая, но ограничиваясь ими, опосредованные VEGFR ангиогенез, лимфангиогенез или оба из них.

[0010] VEGF-C и D связываются с высокой афинностью (и стимулируют фосфориляцию) с по меньшей мере одним рецептором VEGF (или гетеродимером рецептора), выбранным из VEGFR-2 и VEGFR-3. Это утверждение основано на хорошо известных свойствах факторов роста в отношении родственных им рецепторов и не предназначено ограничивать, как таковое, связывающие лиганды молекулы данного изобретения. Однако предпочтительные молекулы, связывающие лиганды, данного изобретения не только просто связывают свои целевые факторы риска. Предпочтительная молекула, связывающая лиганды, также подавляет стимулирование фосфориляции фактором(ами) роста, с которым(которыми) она связывается, по меньшей мере одного (и предпочтительно всех) рецептора тирозинкиназ, с которым связывается(связываются) фактор(ы) роста. Стимулирование фосфориляции тирозина легко измерить, используя основанные на клетках количественные анализы in vitro и антифосфотирозиновые антитела. Поскольку фосфорилирование рецептора тирозинкиназ является начальной стадией в сигнальном каскаде, это представляет собой удобный индикатор того, способна ли молекула, связывающая лиганд, подавлять опосредованную фактором роста трансдукцию сигнала, которая приводит к клеточной миграции, клеточному росту и другим ответным реакциям. Для подтверждения нейтрализующих факторы роста свойств связывающих лиганды молекул данного изобретения можно использовать некоторые другие основанные на клетках и in vivo количественные анализы.

[0011] Связывающие лиганды молекулы, "специфичные" для определенного фактора роста, представляют собой связывающие лиганды молекулы, которые специфично распознают активную форму фактора роста (например, форму, которая циркулирует в организме). Предпочтительно, чтобы связывающие лиганды молекулы также специфично связывали другие формы факторов роста. Например, VEGF-C (и VEGF-D) преобразуется как препро-молекула с большими амино-концевым и карбокси-концевым пропептидами, которые расщепляются с образованием "полностью преобразованной" формы VEGF-C (или VEGF-D), которая связывается и стимулирует VEGFR-2 и VEGFR-3. Связывающие лиганды молекулы, специфические к VEGF-C (или VEGF-D), по крайней мере связываются с полностью преобразованной формой VEGF-C (или VEGF-D), а также предпочтительно связываются с частично преобразованными и непреобразованными формами.

[0012] В одном аспекте описанная в данном документе молекула, связывающая лиганды, представляет собой очищенный или выделенный связывающий лиганды полипептид, включающий первую аминокислотную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична последовательности аминокислот, определяемой положениями 47-115 последовательности SEQ ID NO: 2 или положениями 25-115 последовательности SEQ ID NO: 2, при условии, что положения полипептида, соответствующие положениям 104-106 последовательности SEQ ID NO: 2, не идентичны N-X-S или N-X-T (X представляет собой любую аминокислоту), где полипептид связывается по меньшей мере с одним полипептидным лигандом, выбранным из семейств факторов роста VEGF или PDGF, таких как человеческие VEGF-A (VEGF), VEGF-B, VEGF-C, VEGF-D, PIGF, PDGF-A, PDGF-B, PDGF-C и PDGF-D. Последовательность SEQ ID NO: 2 содержит аминокислотную последовательность человеческого VEGFR-3, причем положения 1-24 последовательности SEQ ID NO: 2 соответствуют предполагаемому сигнальному пептиду, а положение 25 и далее последовательности SEQ ID NO: 2 соответствуют предполагаемой зрелой форме рецептора, не содержащей предполагаемый сигнальный пептид. Вышеприведенные сегменты последовательности SEQ ID NO: 2 примерно соответствуют или включают первый, сходный с иммуноглобулином, домен ECD человеческого VEGFR-3 ("D1 VEGFR-3"). Специально рассматриваются конструкции, включающие дополнительные, сходные с Ig, домены VEGFR-3 или других рецепторов, которые присоединены так, что в результате получают связывающий лиганды полипептид, а конструкции, которые связывают другие лиганды, составляют путем варьирования компонентов рецепторов, используемых для получения связывающего лиганды полипептида. В некоторых вариантах связывающий лиганды полипептид в основном основан на внеклеточном домене рецептора VEGFR-3, а в других вариантах осуществления связывающий лиганды полипептид основан на слиянии сегментов другого рецептора тирозинкиназ, такого как VEGFR-1, и/или VEGFR-2, и/или PDGFR-α, и/или PDGFR-β. В вариантах осуществления, основанных в основном на VEGFR-3, по меньшей мере один лиганд представляет собой лиганд, нативный для VEGFR-3, такой как полипептид VEGF-C или VEGF-D.

[0013] В некоторых вариантах осуществления связывающий лиганды полипептид содержит вторую аминокислотную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична последовательности аминокислот, определяемой положениями 154-210 последовательности SEQ ID NO:2, или положениями 248-314 последовательности SEQ ID NO: 2, где N-концевой остаток второй аминокислотной последовательности соединен с С-концевым остатком первой аминокислотной последовательности либо непосредственно, либо через спейсерную группу, где полипептид связывается по меньшей мере с одним полипептидным лигандом, выбранным из семейств факторов роста VEGF или PDGF, таких как человеческие VEGF-A (VEGF), VEGF-B, VEGF-C, VEGF-D, PIGF, PDGF-A, PDGF-B, PDGF-C и PDGF-D. Последовательность аминокислот, определяемая положениями полипептида, соответствующими положениям 154-210, примерно соответствует второму, сходному с иммуноглобулином, домену ECD человеческого VEGFR-3 ("D2 of VEGFR-3"), или включает его. Последовательность аминокислот, определяемая положениями полипептида, соответствующего положениям 248-314, примерно сходна с третьим, сходным с иммуноглобулином доменом ECD человеческого рецептора VEGFR-3 ("D3 или VEGFR-3"), или включает его. В случаях, когда вторая аминокислотная последовательность содержит последовательность аминокислот, примерно сходную с D2 рецептора VEGFR-3 или включающую его, предпочтительно, чтобы полипептид, связывающий лиганды, содержал третью аминокислотную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична последовательности аминокислот, определяемой положениями 248-314 последовательности SEQ ID NO: 2, где N-концевой остаток третей аминокислотной последовательности соединен с С-концевым остатком второй аминокислотной последовательности либо непосредственно, либо через спейсерную группу, где полипептид связывается по меньшей мере с одним полипептидным лигандом, выбранным из семейств факторов роста VEGF или PDGF, таких как человеческие VEGF-A (VEGF), VEGF-B, VEGF-C, VEGF-D, PIGF, PDGF-A, PDGF-B, PDGF-C и PDGF-D. Другими словами, в вариантах осуществления, где связывающий лиганды полипептид содержит аминокислотную последовательность, примерно сходную с D1 и D2 рецептора VEGFR-3, или включающую их, предпочтительно, чтобы связывающий лиганды полипептид также содержал аминокислотную последовательность примерно сходную с D3 рецептора VEGFR-3, или включающую его.

[0014] В вариантах осуществления, где полипептид, связывающий лиганды, включает аминокислотные последовательности, примерно сходные с двумя или несколькими составными доменами рецептора VEGFR-3, составные домены могут быть соединены непосредственно друг с другом или могут быть соединены одной или несколькими спейсерными группами. Предпочтительно, чтобы составные домены были соединены одной или несколькими спейсерными группами. В одном варианте осуществления спейсерная группа между составными доменами содержит одну или несколько пептидных последовательностей, длиной 1-100 аминокислот, предпочтительно 1-50 аминокислот. В одном варианте осуществления спейсерная группа между двумя составными доменами в основном состоит из пептидных последовательностей, естественным образом соединенных с составными доменом в нативном VEGFR-3.

[0015] В вариантах осуществления, где полипептид, связывающий лиганды, включает аминокислотные последовательности, примерно сходные со смежными составными доменами рецептора VEGFR-3 (например, D1-D2 или D1-D2-D3), или включающие их, составные домены соединены одной или несколькими спейсерными группами, содержащими между составными доменами одну или несколько пептидных последовательностей, длиной 1-100 аминокислот, предпочтительно 1-50 аминокислот. В одном варианте осуществления спейсерная группа между двумя составными доменами в основном состоит из пептидных последовательностей, соответствующих последовательностям, соединяющим соответственные смежные составные домены в нативном VEGFR-3. В некоторых вариантах осуществления спейсерная группа между двумя смежными составными доменами содержит аминокислотную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична последовательности аминокислот, соединяющих смежные домены в нативном VEGFR-3.

[0016] В одном варианте осуществления, где полипептид, связывающий лиганды, включает аминокислотные последовательности, примерно сходные с D1 и D2 рецептора VEGFR-3, или включающие их, составные домены D1 и D2 соединены спейсерной аминокислотной последовательностью, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична последовательности аминокислот, определяемой положениями 116-153 последовательности SEQ ID NO: 2. В случаях, когда полипептид, связывающий лиганды, включает аминокислотные последовательности, примерно сходные с D1, D2 и D3 рецептора VEGFR-3, или включающие их, составные домены D2 и D3 соединены спейсерной аминокислотной последовательностью, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична последовательности аминокислот, определяемой положениями 211-247 в последовательности SEQ ID NO: 2.

[0017] В некоторых вариантах осуществления очищенный или выделенный связывающий лиганды полипептид включает аминокислотную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична последовательности аминокислот, определяемой положениями 47-210 в последовательности SEQ ID NO: 2 или положениями 25-210 в последовательности SEQ ID NO: 2, или положениями 47-314 в последовательности SEQ ID NO: 2, или положениями 25-314 в последовательности SEQ ID NO: 2, или положениями 47-752 или 47-775 в последовательности SEQ ID NO: 2, или положениями 25-752 или 25-775 в последовательности SEQ ID NO: 2, при условии, что положения полипептида, соответствующие положениям 104-106 в последовательности SEQ ID NO: 2, не идентичны N-X-S или N-X-T, где полипептид связывается по меньшей мере с одним полипептидным лигандом, выбранным из человеческих VEGF-A, VEGF-C, VEGF-C, VEGF-D и PIGF. В одном варианте аминокислоту, соответствующую положению 104 в последовательности SEQ ID NO: 2, подвергают делеции и заменяют другой аминокислотой (такой как глутамин, аспартат, глутамат, аргинин и лизин). Положения 47-210 включают первые два сходные с иммуноглобулином домена ECD человеческого VEGFR-3, а также последовательность ECD рецептора VEGFR-3 между первыми двумя мотивами, сходными с Ig. Положения 47-314 включают первые три сходные с иммуноглобулином домена ECD человеческого VEGFR-3, а также последовательность ECD рецептора VEGFR-3 между первыми тремя мотивами, сходными с Ig.

[0018] В более общем случае связывающий лиганды полипептид данного изобретения включает аминокислотную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична фрагменту аминокислотной последовательности рецептора VEGFR-3, изложенной в SEQ ID NO: 2, где аминный конец фрагмента представляет собой любую аминокислоту, выбранную из положений 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 и 50 в последовательности SEQ ID NO: 2; и где карбоксильный конец фрагмента представляет собой любую аминокислоту, выбранную из положений 110-775 в последовательности SEQ ID NO: 2 (например, положения 110, 111, 112, 113, 114, 115, 116, … 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762,763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775), при условии, что положения полипептида, соответствующее положениям 104-106 в последовательности SEQ ID NO: 2 не идентичны N-X-S или N-X-T. По причинам, которые будут легко понятны из описания в данном документе, допускаемый вариант не является вариантом, который вводит новые секвоны гликозилирования, которые не встречаются в VEGFR-3 дикого типа.

[0019] В другом аспекте описанная в данном документе молекула, связывающая лиганды, представляет собой очищенный или выделенный полипептид, связывающий лиганды, включающий аминокислотную последовательность, которая идентична последовательности аминокислот, определяемой положениями полипептида, соответствующего положениям 47-115 в последовательности SEQ ID NO: 2, 47-210 в последовательности SEQ ID NO: 2, 47-314 в последовательности SEQ ID NO: 2, или положениями 47-752 или 47-775 в последовательности SEQ ID NO: 2, или 25-752 или 25-775 в последовательности SEQ ID NO: 2, при условии, что положения полипептида, соответствующие положениям 104-106 в последовательности SEQ ID NO: 2 не идентичны N-X-S или N-X-T. В одном варианте аминокислоту, соответствующую положению 104 в последовательности SEQ ID NO: 2, подвергают делеции и заменяют другой аминокислотой (такой как глутамин, аспартат, глутамат, аргинин и лизин).

[0020] В другом аспекте описанная в данном документе молекула, связывающая лиганды, представляет собой очищенный или выделенный связывающий лиганды полипептид, включающий аминокислотную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична последовательности аминокислот, определяемой положениями 47-115 последовательности SEQ ID NO: 2, где положения полипептида, соответствующие положениям 104-106 в последовательности SEQ ID NO: 2 представляют собой предполагаемый секвон гликозилирования рецептора VEGFR-3, и где указанный предполагаемый секвон гликозилирования удален из аминокислотной последовательности полипептида, связывающего лиганды. Термин "удален" в данном контексте означает изменение изначальной аминокислотной последовательности по меньшей мере в одном положении (путем замены, делеции или вставки) для уничтожения мотива N-X-T секвона.

[0021] Изобретение также включает мультимерные конструкции, связывающие лиганды, включающие две или несколько молекул, связывающих лиганды, как описывается в данном документе, ковалентно или не ковалентно соединенные между собой с образованием димерной или мультимерной структуры. В некоторых вариантах присоединение происходит между последовательностями связывающих лиганды полипептидов, сходными с VEGFR-3; в других вариантах присоединение происходит между гетерологичными полипептидами, присоединенными к одному или к обоим последовательностям, сходным с VEGFR-3.

[0022] Когда в описании в данном документе ссылаются на молекулу, связывающую лиганды, или на полипептид, связывающий лиганды, при этом подразумевается, что включены ссылки на их варианты, определенные выше, при условии, что такие связывающие лиганды полипептиды или молекулы (являются ли они мономерными, димерными или мультимерными) содержат, по меньшей мере, мотив, сходный с Ig, или мотив 1 рецептора VEGFR-3, идентичный Ig (например, ссылка на 47-115 в последовательности SEQ ID NO: 2), при условии, что положения полипептида соответствующие положениям 104-106 в последовательности SEQ ID NO: 2 (которая представляет собой секвон гликолизирования по N-связи в нативной последовательности VEGFR-3), не идентичны N-X-S или N-X-T.

[0023] В другом аспекте описанная в данном документе молекула, связывающая лиганды, представляет собой выделенный или очищенный полипептид, связывающий лиганды, включающий первый сходный с иммуноглобулином домен полипептида VEGFR-3ΔN2. Термин "полипептид VEGFR-3ΔN2", используемый в данном документе, относится к полипептиду, по меньшей мере на 95% идентичному последовательности аминокислот, определяющей ECD человеческого рецептора VEGFR-3, при условии, что часть последовательности полипептида, соответствующая второму предполагаемому секвону гликолизирования - NDT, изменена таким образом, больше не совпадает с мотивом N-X-S/T секвона, например, вследствие замены в одном из положений. В некоторых вариантах осуществления очищенный полипептид включает два первых сходных с иммуноглобулином домена полипептида VEGFR-3ΔN2, и предпочтительно включает последовательность VEGFR-3 между этими доменами. В некоторых вариантах осуществления очищенный полипептид включает три первых сходных с иммуноглобулином домена полипептида VEGFR-3ΔN2, и предпочтительно включает последовательность VEGFR-3 между этими доменами.

[0024] В еще одном аспекте в данном документе описана молекула, связывающая лиганды, представляющая собой полипептид, включающий фрагмент ECD человеческого рецептора VEGFR-3, присоединенный к партнеру по слиянию, где аминокислотная последовательность фрагмента ECD рецептора VEGFR-3 модифицирована по сравнению с VEGFR-3 дикого типа с целью удалить второй предполагаемый секвон гликолизирования по N-связи рецептора VEGFR-3 дикого типа, причем полипептид растворим в сыворотке человеческой крови и связывается с человеческим VEGF-C или человеческим VEGF-D; и где партнер по связыванию повышает растворимость в сыворотке или время полувыведения из нее фрагмента ECD (например, по сравнению с идентичным фрагментом, который не соединен с партнером по связыванию). В некоторых вариантах осуществления партнер по связыванию представляет собой гетерологичный полипептид.

[0025] В некоторых вариантах осуществления связывающий лиганды полипептид или связывающая лиганды молекула связывается с человеческим VEGF-C или человеческим VEGF-D. В некоторых вариантах осуществления связывающий лиганды полипептид или связывающая лиганды молекула ингибирует связывание VEGF-C или VEGF-D с рецептором VEGFR-3 или подавляет стимуляцию рецептора VEGFR-3 посредством VEGF-C- или VEGF-D в клетке, экспрессирующей на своей поверхности VEGFR-3. Ингибирование или стимуляция могут быть продемонстрированы, например, путем измерения фосфорилирования рецептора или путем измерения клеточного роста in vitro или in vivo, или путем роста кровеносного сосуда или других изменений на уровне ткани in vivo.

[0026] Связывающая лиганды молекула связывается с человеческим VEGF-C при Kd, равном примерно 1 нМ или менее (например, 500 пМ, 400 пМ, 300 пМ, 200 пМ, 100 пМ, 50 пМ, 10 пМ или менее). Связывающая лиганды молекула связывается с человеческим VEGF-D при Kd, равном примерно 5 нМ или менее (например, 2 нМ, 1 нМ, 500 пМ, 400 пМ, 300 пМ, 200 пМ, 100 пМ, 50 пМ, 10 пМ или менее).

[0027] В другом аспекте очищенная или выделенная молекула, связывающая лиганды, включает аминокислоты 22-290 последовательности SEQ ID NO: 3, аминокислоты 23-290 последовательности SEQ ID NO: 3, аминокислоты 23-537 последовательности SEQ ID NO: 3, или аминокислоты 22-537 последовательности SEQ ID NO: 3. В еще других вариантах молекула включает аминокислотную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична любой из вышеприведенных последовательностей при условии, что последовательность полипептида, соответствующая секвону (выравнивающаяся с секвоном) VEGFR-3 N2, не является последовательностью гликозилирования.

[0028] Как описывается в данном документе, молекулы, связывающие лиганды, могут быть химически модифицированы (например, с помощью гликозилирования, пегилирования и т.п.), для придания им требуемых свойств, при сохранении их специфических свойств связывания с факторами роста. Сходные с Ig домены I-III рецептора VEGFR-3 включают пять предполагаемых сайтов N-гликозилирования (здесь обозначаются как секвоны N1, N2, N3, N4 и N5 рецептора VEGFR-3, соответственно). N1 соответствует аминокислотам 33-35 в последовательности SEQ ID NO: 2; N2 соответствует аминокислотам 104-106 в последовательности SEQ ID NO: 2; N3 соответствует аминокислотам 166-168 в последовательности SEQ ID NO: 2; N4 соответствует аминокислотам 251-253 в последовательности SEQ ID NO: 2; N5 соответствует аминокислотам 299-301 в последовательности SEQ ID NO: 2. В некоторых вариантах осуществления описанная в данном документе молекула, связывающая лиганды, содержит модификацию в секвоне N2 молекулы. Например, в некоторых вариантах осуществления молекулы, связывающей лиганды, аминокислоту, соответствующую положению 104 в последовательности SEQ ID NO: 2, подвергают делеции и заменяют другой аминокислотой. Предпочтительными являются консервативные замены. В некоторых вариантах осуществления аминокислоту, соответствующую положению 104 в последовательности SEQ ID NO: 2, подвергают делеции и заменяют другой аминокислотой, выбранной из группы, состоящей из глутамина, аспартата, глутамата, аргинина и лизина. В вариантах осуществления, где секвон N2 в последовательности SEQ ID NO: 2 модифицирован описанным выше образом, предпочтительно, чтобы секвоны N1, N3, N4 и N5 в последовательности SEQ ID NO: 2 оставались без изменения в том, что касается аминокислотной последовательности.

[0029] Как описано в данном документе, молекулы, связывающие лиганды, могут быть соединены с партнером по слиянию либо непосредственно, либо через линкерную группу. Партнер по слиянию может быть любым гетерологичным компонентом, который усиливает функциональность молекулы, связывающей лиганды. В качестве примера пептидного партнера по слиянию приводится фрагмент (Fc) константного домена иммуноглобулина. В некоторых вариантах осуществления константный фрагмент иммуноглобулина включает аминокислотную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99%, или по меньшей мере на 100% идентична аминокислотам 306-537 в последовательности SEQ ID NO: 3.

[0030] Как описано в данном документе, молекулы, связывающие лиганды, могут быть химически модифицированы, чтобы, например, сделать возможным присоединение к партнеру по слиянию (такому как, например, гетерологичный пептид), или чтобы придать им желаемые свойства (такие как, например, увеличенное время полувыведения из сыворотки крови, повышенная растворимость в водной среде и способность быть направленной на специфическую клеточную популяцию, например, клетки опухоли или клетки сетчатки).

[0031] В некоторых вариантах осуществления описанная в данном документе молекула, связывающая лиганды, необязательно содержит по меньшей мере одну частицу ПЭГ, присоединенную к молекуле. Например, в некоторых вариантах осуществления, к аминному концу молекулы, связывающей лиганды, присоединена частица ПЭГ размером примерно 20-40 кДа.

[0032] В некоторых вариантах осуществления описанная в данном документе молекула, связывающая лиганды, необязательно содержит линкерную группу, соединяющую ее с партнером по слиянию, например, гетерологичный пептид с полипептидом, связывающим лиганды, такую как линкерная последовательность PIEGRGGGGG фактора Ха (SEQ ID NO: 4). В других вариантах осуществления молекула, связывающая лиганды, включает полипептид, в котором С-концевая аминокислота полипептида, связывающего лиганды, непосредственно присоединена пептидной связью к N-концевой аминокислоте гетерологичного пептидного партнера по слиянию. В некоторых вариантах осуществления полипептид, связывающий лиганды, и гетерологичный пептид соединены (непосредственно или посредством линкерного полипептида) амидной связью, при этом образуя единую полипептидную цепочку.

[0033] В некоторых вариантах осуществления молекула, связывающая лиганды, включает сигнальный пептид, который управляет выделением молекулы из клетки, экспрессирующей молекулу.

[0034] Нуклеиновые кислоты (полинуклеотиды) данного изобретения включают нуклеиновые кислоты, которые кодируют полипептидные молекулы, связывающие лиганды, которые могут применяться в генной терапии и рекомбинантной экспрессии in vitro полипептидных молекул, связывающих лиганды. В некоторых вариантах осуществления нуклеиновые кислоты очищены или выделены. В некоторых вариантах осуществления полинуклеотиды дополнительно содержат промоторную последовательность, оперативно связанную с нуклеотидной последовательностью, кодирующей полипептид, где промоторная последовательность стимулирует транскрипцию последовательности, кодирующей полипептид в клетке-хозяине. Полинуклеотиды также могут содержать сигнальную последовательность полиаденилирования. В некоторых вариантах нуклеиновая кислота имеет кодирующую нуклеотидную последовательность, сходную с нуклеиновой кислотой, кодирующей человеческий VEGFR-3 дикого типа. Например, нуклеиновая кислота включает кодирующую нуклеотидную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична последовательности человеческого VEGFR-3, изложенной в SEQ ID NO: 1, или ее фрагменту. В качестве примера в контексте нуклеотидной последовательности, кодирующей аминокислоты 47-314 в SEQ ID NO: 2, модифицированной в секвоне N2, иллюстративная нуклеиновая кислота включает кодирующую нуклеотидную последовательность, которая по меньшей мере на 80%, или по меньшей мере на 85%, или по меньшей мере на 90%, или по меньшей мере на 92%, или по меньшей мере на 95%, или по меньшей мере на 96%, или по меньшей мере на 97%, или по меньшей мере на 98%, или по меньшей мере на 99% идентична последовательности человеческого VEGFR-3, изложенной для положений от 157 до 961 в SEQ ID NO: 1, которые соответствуют кодонам 47-314.

[0035] Векторы, содержащие полинуклеотиды, также представляют собой аспекты данного изобретения. Такие векторы могут содержать регулирующие экспрессию последовательности, оперативно связанные с последовательностью, кодирующей полипептид. В некоторых вариантах вектор выбран так, чтобы оптимизировать рекомбинантную экспрессию in vitro в выбранной клетке-хозяине, такой как эукариотическая клетка-хозяин. В некоторых вариантах вектор выбран для доставки in vivo. Например, вектор может быть выбран из группы, состоящей из лентивирусного вектора, аденоассоциированного вирусного вектора, аденовирусного вектора, липосомального вектора и их комбинации. В некоторых вариантах осуществления вектор включает дефицитный по репликации аденовирус, причем указанный аденовирус содержит полинуклеотид, который оперативно связан с промотором и фланкирован аденовирусными полинуклеотидными последовательностями.

[0036] Клетки-хозяева, содержащие полинуклеотиды, векторы и другие нуклеиновые кислоты, и способы их применения для экспрессии и выделения молекул, связывающих лиганды, также представляют собой аспекты данного изобретения. Особенное внимание уделено эукариотическим клеткам-хозяевам, включающим клетки яичника китайского хомячка (СНО) и другие клеточные линии мелкопитающих, включающим полинуклеотиды, кодирующие полипептид, связывающий лиганды, или молекулу, связывающую лиганды, описанные в данном документе. В некоторых вариантах клеточные линии выбраны и сконструированы таким образом, чтобы вводить гликозилирование по типу человеческого или сходное с человеческим по секвонам гликозилирования полипептидов, получаемых в клетках.

[0037] Также предусматриваются способы получения полипептида, связывающего лиганды, или молекулы, связывающей лиганды, описанных в данном документе. (Такие способы могут также быть описаны в качестве применений полинуклеотидов или клеток данного изобретения). В одном аспекте способ включает выращивание клетки, которую трансформируют или трансфицируют полинуклеотидом или вектором, описанным в данном документе, в условиях, при которых экспрессируется кодируемый полинуклеотидом полипептид, связывающий лиганды, или молекула, связывающая лиганды. В некоторых вариантах осуществления способ дополнительно включает очистку или выделение полипептида, связывающего лиганды, или молекулы, связывающей лиганды, из клетки или из ростовой среды клеток. В некоторых вариантах осуществления способ дополнительно включает присоединение одного или нескольких частиц полиэтиленгликоля (ПЭГ) или других частиц к экспрессированному или очищенному/выделенному полипептиду.

[0038] Изобретение также включает композиции, содержащие полипептид, связывающую лиганды молекулу или кодирующую их нуклеиновую кислоту в сочетании с фармацевтически приемлемыми разбавителем, вспомогательным веществом или средой носителя. В некоторых вариантах осуществления композицию составляют для местного глазного применения (например, наружное применение, такое как мазь или глазные капли, или состав, пригодный для инъекции в стекловидное тело). В других вариантах осуществления композицию составляют для местного применения к опухолям или к органам или тканям, из которых было проведено хирургическое иссечение опухоли, например, путем внутривенной инъекции или инъекции непосредственно в затронутые ткани, или применение с помощью устройства в ходе резекции опухоли.

[0039] Изобретение также включает способы применения материалов, описанных в данном документе (полипептидов, молекул и конструкций, полинуклеотидов и векторов, преобразованных клеток, композиций) для подавления роста сосудов (кровеносных сосудов и/или лимфатических сосудов) в терапевтических и профилактических целях. Способы применения, описанные в данном документе, можно альтернативно охарактеризовать как применения различных материалов для указанной цели. Иллюстративные субъекты для лечения включают людей и других приматов, домашний скот (например, крупный рогатый скот, лошадей, свиней), животных в зоопарке (например, животных семейства кошачьих, собачьих, толстокожих, плотнорогих) и домашних животных (например, собак, кошек) и грызунов.

[0040] В некоторых вариантах изобретение включает способ подавления неоваскуляризации у субъекта, причем способ включает введение субъекту любых из вышеуказанных материалов или композиций, в количестве, эффективном для подавления неоваскуляризации у субъекта. Иллюстративные патологические неоваскулярные состояния включают глазную и опухолевую неоваскуляризацию.

[0041] В некоторых вариантах изобретение включает способ подавления неоваскуляризации сетчатки у субъекта, причем способ включает введение субъекту описанных здесь материалов или композиций, в количестве, эффективном для подавления неоваскуляризации сетчатки у субъекта. В относящихся к этому вариантах изобретение включает способ лечения субъекта, имеющего глазное расстройство, связанное с неоваскуляризацией сетчатки, причем способ включает введение субъекту описанных здесь и обобщенных выше материалов или композиций, в количестве, эффективном для подавления неоваскуляризации сетчатки у субъекта. Например, композицию, как описана выше, местно вводят в глаз субъекта, например, в виде глазных капель или в другой форме местного применения, путем подконъюнктивального введения (например, инъекции), путем введения в стекловидное тело или путем имплантации в стекловидное тело.

[0042] Композиции предпочтительно вводят в количестве и повторяющейся частотой дозировок и в продолжения периода, эффективных для ингибирования VEGF-C и/или VEGF-D в глазу субъекта от связывания с VEGFR-2 и/или VEGFR-3 или их стимулирования, экспрессируемых в клетках глаза или глазных сосудов. Такой благоприятный эффект можно измерить в отношении замедления или задержки ухудшения состояния/прогрессирования патологического глазного состояния (такого, как макулярная дегенерация, диабетическая ретинопатия и макулярная телеангиэктазия), или улучшения клинических симптомов. Благоприятный эффект можно также наблюдать с точки зрения наблюдения за ростом сосудов в целевой ткани и вокруг нее.

[0043] Способы и применения, описанные в данном документе, могут применяться в сочетании с дополнительными терапевтическими агентами или лечением (например, видами радиоактивного излучения), как подробно описывается в данном документе.

[0044] Способы (или применения) изобретения, описанные в данном документе, могут осуществляться с одной или несколькими молекулами, связывающими лиганды, или с одной или несколькими молекулами, связывающими лиганды, в сочетании с другим лекарственным средством (таким как стандартно используемое лекарственное средство для лечения злокачественного новообразования или для лечения расстройств задней стенки глаза). В вариантах осуществления, в которых молекулы, связывающие лиганды, предназначены для лечения расстройств задней стенки глаза, рассматриваемые дополнительные терапии включают фокусное лазерное лечение (или фотокоагуляция), рассеянное лазерное лечение (или панретинальная фотокоагуляция) и витрэктомию. В некоторых вариантах осуществления субъекту, получающему лечение, также вводят антибиотик.

[0045] В вариантах осуществления, где связывающие лиганды молекулы, описываемые в данном документе, предназначены для применения в лечении злокачественных новообразований, рассматриваемые стандартно используемые лекарственные средства включают антисмысловые РНК, РНК-интерференция, биспецифические антитела, другие типы антител, и малые молекулы, например, химиотерапевтические агенты, которые нацелены на факторы роста и/или их рецепторы. В сочетании с описываемой здесь молекулой, связывающей лиганды, также могут использоваться цитокины, радиотерапевтические агенты или радиационные терапии. Химиотерапевтические агенты или радиотерапевтические агенты могут входить в класс агентов, включающий антиметаболиты, агенты, повреждающие ДНК, цитокины или факторы роста, лекарство, ковалентно связывающее ДНК, ингибитор топоизомеразы, антимитотический агент, противоопухолевый антибиотик, агент дифференциации, алкилирующий агент, метилирующий агент, гормон или антагонист гормона, нитроген мустард, радиосенсибилизируещее вещество и фотосенсибилизируещее вещество. Конкретные примеры этих агентов описаны в других разделах этой заявки. Комбинированные терапии предпочтительно являются синергическими, но не обязательно, и аддитивные терапии также являются аспектом настоящего изобретения.

[0046] Кроме их применения в способах молекулы, связывающие лиганды, могут быть объединены или упакованы с другими лекарственными средствами в наборы или в виде стандартных доз. Онкологические заболевания - не единственные заболевания, в лечении которых могут использоваться связывающие лиганды молекулы. Связывающие лиганды молекулы можно использовать в качестве лекарственных средств для любых болезней, связанных с аберрантным ангиогенезом или лимфангиогенезом

[0047] Изобретение также описано в следующих дополнительных вариантах осуществления:

[0048] Очищенный или выделенный полипептид, связывающий лиганды, включающий аминокислотную последовательность, которая по меньшей мере на 95% идентична последовательности аминокислот, определяемой положениями 47-115 в последовательности SEQ ID NO: 2, при условии, что положения полипептида, соответствующие положениям 104-106 в последовательности SEQ ID NO: 2, не идентичны N-X-S или N-X-T, где полипептид связывается по меньшей мере с одним полипептидным лигандом, выбранным из человеческих VEGF-C, VEGF-D и PIGF.

[0049] Очищенный или выделенный связывающий лиганды полипептид по параграфу [0048], включающий аминокислотную последовательность, которая по меньшей мере на 95% идентична последовательности аминокислот, определяемой положениями 47-210 в последовательности SEQ ID NO: 2, при условии, что положения полипептида, соответствующие положениям 104-106 в последовательности SEQ ID NO: 2, не идентичны N-X-S или N-X-T.

[0050] Очищенный или выделенный связывающий лиганды полипептид по параграфу [0048], включающий аминокислотную последовательность, которая по меньшей мере на 95% идентична последовательности аминокислот, определяемой положениями 47-314 в последовательности SEQ ID NO: 2, при условии, что положения полипептида, соответствующие положениям 104-106 в последовательности SEQ ID NO: 2, не идентичны N-X-S или N-X-T.

[0051] Очищенный или выделенный связывающий лиганды полипептид по параграфу [0048], включающий аминокислотную последовательность, которая по меньшей мере на 95% идентична последовательности аминокислот, определяемой положениями 47-752 в последовательности SEQ ID NO: 2, при условии, что положения полипептида, соответствующие положениям 104-106 в последовательности SEQ ID NO: 2, не идентичны N-X-S или N-X-T.

[0052] Очищенный или выделенный связывающий лиганды полипептид по любому одному из параграфов [0048]-[0051], содержащий четыре сайта секвона N-гликозилирования, соответствующих положениям 33-35 в последовательности SEQ ID NO: 2, положениям 166-168 в последовательности SEQ ID NO: 2, положениям 251-253 в последовательности SEQ ID NO: 2 и положениями 299-301 в последовательности SEQ ID NO: 2.

[0053] Очищенный или выделенный связывающий лиганды полипептид по параграфу [0052], гликозилированный по указанным четырем сайтам секвона N-гликозилирования.

[0054] Очищенный или выделенный связывающий лиганды полипептид по любому одному из параграфов [0048]-[0053], представляющий собой растворимый полипептид.

[0055] Очищенный или выделенный связывающий лиганды полипептид по любому одному из параграфов [0048]-[0054], включающий аминокислотную последовательность, идентичную последовательности аминокислот, определяемой положениями 47-115 в последовательности SEQ ID NO: 2, положениями 47-210 в последовательности SEQ ID NO: 2, положениями 47-314 в последовательности SEQ ID NO: 2, или положениями 47-752 в последовательности SEQ ID NO: 2, при условии, что положения полипептида, соответствующие положениям 104-106 в последовательности SEQ ID NO: 2, не идентичны N-X-S или N-X-T.

[0056] Очищенный или выделенный связывающий лиганды полипептид по любому одному из параграфов [0048]-[0055], который связывается с человеческим VEGF-C или человеческим VEGF-D.

[0057] Очищенный или выделенный связывающий лиганды полипептид по параграфу [0056], который ингибирует связывание VEGF-C- или VEGF-D с рецептором VEGFR-3 или подавляет стимуляцию рецептора VEGFR-3 посредством VEGF-C или VEGF-D в клетке, экспрессирующей на своей поверхности VEGFR-3.

[0058] Очищенный или выделенный связывающий лиганды полипептид по любому одному из параграфов [0048]-[0057], который связывается с человеческим VEGF-C при Kd, равном примерно 1 нМ или менее.

[0059] Очищенный или выделенный связывающий лиганды полипептид по любому одному из параграфов [0048]-[0057], который связывается с человеческим VEGF-D при Kd, равном примерно 5 нМ или менее.

[0060] Очищенный или выделенный связывающий лиганды полипептид по любому одному из параграфов [0048]-[0059], где аминокислоту в полипептиде, соответствующую положению 104 в последовательности SEQ ID NO: 2, подвергают делеции или заменяют другой аминокислотой.

[0061] Очищенный или выделенный связывающий лиганды полипептид по параграфу [0055], где аминокислоту, в положении 104 в последовательности SEQ ID NO: 2, подвергают делеции или заменяют другой аминокислотой, выбранной из группы, состоящей из глутамина, аспартата, глутамата, аргинина и лизина.

[0062] Очищенный или выделенный связывающий лиганды полипептид по любому одному из параграфов [0048]-[0056], где полипептид включает аминокислоты, соответствующие положениям 23-290 в последовательности SEQ ID NO: 3.

[0063] Очищенный или выделенный связывающий лиганды полипептид по любому одному из параграфов [0048]-[0062], дополнительно содержащий сигнальный пептид.

[0064] Очищенный или выделенный связывающий лиганды полипептид по любому одному из параграфов [0048]-[0063], дополнительно содержащий по меньшей мере одну частицу полиэтиленгликоля, присоединенную к полипептиду.

[0065] Очищенный или выделенный связывающий лиганды полипептид по параграфу [0064], содержащий полиэтиленгликоль, размером примерно 20-40 кДа, присоединенную к аминному концу полипептида.

[0066] Связывающая лиганды молекула, содержащая связывающий лиганды полипептид по любому одному из параграфов [0048]-[0065], соединенный с гетерологичным пептидом.

[0067] Связывающая лиганды молекула по параграфу [0066], где гетерологичный пептид содержит фрагмент константного домена иммуноглобулина.

[0068] Связывающая лиганды молекула по параграфу [0066], где фрагмент константного домена иммуноглобулина представляет собой фрагмент константного домена IgG.

[0069] Связывающая лиганды молекула по параграфу [0067], где фрагмент константного домена иммуноглобулина включает аминокислоты 306-537 последовательности SEQ ID NO: 3.

[0070] Связывающая лиганды молекула по параграфу 19, где связывающая лиганды молекула включает аминокислоты 22-537 последовательности SEQ ID NO: 3.

[0071] Связывающая лиганды молекула по любому одному из параграфов [0066]-[0070], необязательно содержит линкерную группу, соединяющую гетерологичный пептид со связывающим лиганды полипептидом.

[0072] Связывающая лиганды молекула по любому одному из параграфов [0066]-[0070], включающая полипептид, в котором С-концевая аминокислота полипептида, связывающего лиганды, непосредственно присоединена пептидной связью к N-концевой аминокислоте гетерологичного пептида.

[0073] Связывающая лиганды молекула по любому одному из параграфов [0066]-[0072], дополнительно включающая сигнальный пептид, который управляет выделением молекулы из клетки, экспрессирующей молекулу.

[0074] Связывающая лиганды молекула по параграфу [0066], где молекула включает аминокислотную последовательность, приведенную в SEQ 10 NO: 3.

[0075] Связывающая лиганды молекула по любому одному из параграфов [0066]-[0070], где связывающий лиганды полипептид и гетерологичный пептид соединены амидной связью, образуя одну полипептидную цепочку.

[0076] Связывающий лиганды полипептид по любому одному из параграфов [0048]-[0065] или связывающая лиганды молекула по любому из параграфов 19-28, дополнительно содержащие детектируемую метку.

[0077] Коньюгат, содержащий связывающий лиганды полипептид по любому одному из параграфов 1-18 или связывающую лиганды молекулу по любому одному из параграфов [0066]-[0075] и химиотерапевтический агент.

[0078] Выделенный полинуклеотид, содержащий кодирующую нуклеотидную последовательность, кодирующую связывающий лиганды полипептид по любому одному из параграфов 1-18 или связывающую лиганды молекулу по любому одному из параграфов [0066]-[0075].

[0079] Полинуклеотид по параграфу [0078], дополнительно содержащий последовательность промотора, оперативно связанного с кодирующей нуклеотидной последовательностью, предназначенной стимулировать транскрипцию последовательности в клетке-хозяине.

[0080] Вектор, включающий полинуклеотид по параграфу [0078] или по параграфу [0079].

[0081] Вектор по параграфу [0080], дополнительно содержащий регулирующую экспрессию последовательность, оперативно связанную с кодирующей нуклеотидной последовательностью.

[0082] Вектор по параграфу [0080], где указанный вектор выбирают из группы, состоящей из лентивирусного вектора, аденоассоциированного вирусного вектора, аденовирусного вектора, липосомального вектора и их комбинации.

[0083] Вектор по параграфу [0080], где указанный вектор включает дефицитный по репликации аденовирус, причем указанный аденовирус содержит полинуклеотид, который оперативно связан с промотором и фланкирован аденовирусными полинуклеотидными последовательностями.

[0084] Выделенная клетка или клеточная линия, трансформированная или трансфицированная полинуклеотидом по параграфу [0078] или [0079] или вектором по параграфам [0080]-[0083].

[0085] Выделенная клетка или клеточная линия по параграфу [0084], представляющая собой эукариотическую клетку.

[0086] Выделенная клетка или клеточная линия по параграфу [0084], представляющая собой человеческую клетку.

[0087] Выделенная клетка или клеточная линия по параграфу [0084], представляющая собой клетку яичника китайского хомячка (СНО).

[0088] Способ получения полипептида, связывающего лиганды, включающий выращивание клетки по любому одному из параграфов [0084]-[0087] в условиях, при которых экспрессируется кодируемый полинуклеотидом полипептид, связывающий лиганды, или молекула, связывающая лиганды.

[0089] Способ по параграфу [0088], дополнительно включающий очистку или выделение полипептида, связывающего лиганды, или молекулы, связывающей лиганды, из клетки или из ростовой среды клеток.

[0090] Композиция, содержащая очищенный полипептид, связывающий лиганды, или молекулу, связывающую лиганды по любому одному из параграфов [0048]-[0076] и фармацевтически приемлемый разбавитель, вспомогательное вещество, наполнитель или среду носителя.

[0091] Композиция, содержащая полинуклеотид или вектор по любому одному из параграфов [0078]-[0083] и фармацевтически приемлемый разбавитель, вспомогательное вещество, наполнитель или среду носителя.

[0092] Композиция по параграфу [0090] или по параграфу [0091], составленная для наружного применения.

[0093] Композиция по параграфу [0092], имеющая форму твердого вещества, пасты, мази, геля, жидкости, аэрозоля, коллоидной системы типа жидкость в газе, полимера, пленки, эмульсии или суспензии.

[0094] Композиция по параграфу [0090] или по параграфу [0091], составленная для введения в стекловидное тело.

[0095] Способ подавления неоваскуляризации у субъекта, причем способ включает введение субъекту композиции по любому одному из параграфов [0090]-[0094] в количестве, эффективном для подавления неоваскуляризации у субъекта.

[0096] Способ подавления неоваскуляризации сетчатки у субъекта, причем способ включает введение субъекту композиции по любому одному из параграфов [0090]-[0094] в количестве, эффективном для подавления неоваскуляризации сетчатки у субъекта.

[0097] Способ лечения субъекта, имеющего глазное расстройство, связанное с неоваскуляризацией сетчатки, причем способ включает введение субъекту композиции по любому одному из параграфов [0090]-[0095] в количестве, эффективном для подавления неоваскуляризации сетчатки у субъекта.

[0098] Применение композиции по любому одному из параграфов [0090]-[0094] для подавления неоваскуляризации, например, неоваскуляризации сетчатки или опухолевой неоваскуляризации у нуждающихся в этом пациентов.

[0099] Способ или применение по любому одному из параграфов [0096]-[0098], где композицию местно вводят в глаз субъекта,

[00100] Способ или применение по параграфу [0099], где композицию вводят путем инъекции в стекловидное тело.

[00101] Способ или применение по параграфу [0099], где композицию вводят путем наружного применения.

[00102] Способ или применение по любому одному из параграфов [0096]-[00101], где композицию вводят в количестве, достаточном для ингибирования VEGF-C и/или VEGF-D в глазу у субъекта от связывания или стимулирования VEGFR-2 и/или VEGFR-3, экспрессируемых в клетках глаза или глазных сосудов.

[00103] Способ или применение по параграфу [0097] или [0098] где глазное расстройство выбирают из группы, состоящей из макулярной дегенерации, диабетической ретинопатии и макулярной телеангиэктазии.

[00104] Способ или применение по любому одному из параграфов [0096]-[00103], дополнительно включающие введение субъекту антибиотика.

[00105] Способ по параграфу [00104], где антибиотик выбирают из группы, состоящей из амикацина, гентамицина, канамицина, неомицина, нетилмицина, стрептомицина, тобрамицина, тейкопланина, ванкомицина, азитромицина, кларитромицина, кларитромицина, диритромицина, эритромицина, рокситромицина, тролеандомицина, амоксициллина, ампициллина, азлоциллина, карбенициллина, клозациллина, диклоксациллина, флукозациллина, мезиоциллина, нафциллина, пенициллина, пиперациллина, тикарциллина, бацитрацина, колистина, полимиксина В, ципрофлоксацина, эноксацина, гатифлоксацина, левофлоксацина, ломефлоксацина, моксифлоксацина, норфлоксацина, офлазацина, тровафлоксацина, мафенида, сульфацетамида, сульфаметизола, сульфасалазина, сульфисоксазола, триметоприма, котримоксазола, демеклоциклина, соксициклина, миноциклина, окситетрациклина и тетрациклина.

[00106] Способ или применение по параграфу [0095] или [0098], где у субъекта обнаружена опухоль, и где композицию вводят в количестве, достаточном для подавления неоваскуляризации в опухоли.

[00107] Способ или применение по параграфу [00106], где композицию вводят местно в область опухоли или в орган или ткани, из которых опухоль была удалена хирургически.

[00108] Способ или применение по параграфу [00106], где композицию вводят в количестве, достаточном для ингибирования VEGF-C и/или VEGF-D в опухоли у субъекта от связывания или стимулирования VEGFR-2 и/или VEGFR-3, экспрессируемых в клетках опухоли.

[00109] Не предполагается, что краткое описание изобретения будет иметь ограничивающий или исчерпывающий характер, и дополнительные варианты осуществления описаны в графических материалах и в подробном описании, включающем примеры. Все такие варианты осуществления представляют собой аспекты данного изобретения. Кроме того, в целях краткости различные подробности, применимые к нескольким вариантам осуществления, не повторяются в каждом варианте осуществления. Варианты, отражающие сочетания и перестановки вариантов осуществления, описанных в данном документе, предназначены отражать аспекты изобретения. Помимо вышеизложенного, изобретение включает в качестве дополнительного аспекта все варианты осуществления, охват которых уже в любом смысле, чем варианты особо отмеченные выше. Например, в случае аспектов, описанных как отдельный тип или интервал, каждый подтип, подинтервал или виды особо подразумеваются в качестве варианта осуществления данного изобретения.

КРАТКОЕ ОПИСАНИЕ ФИГУР

[00110] На фигуре 1А показаны ФК кривые VGX-300 и VGX-301-ΔN2, полученные транзиентной экспрессией СНО. На фигуре 1В показаны ФК кривые VGX-300 и VGX-301-ΔN2, полученные транзиентной экспрессией HEK.

[00111] На фигуре 2 продемонстрировано, что оба VGX-300 и VGX-301-ΔN2 специфически связываются как с VEGF-C, так и с VEGF-D.

[00112] На фигуре 3 показано, что VGX-300 блокирует связывание и сшивку VEGF-C и VEGF-D с a) VEGFR-2 и b) VEGFR-3.

[00113] На фигуре 4 показано, что VGX-300 и VGX-300-N2 блокируют связывание и сшивку a) VEGF-C и b) VEGF-D с VEGFR-3 в анализе Ba/F3 на основе клеток. Точечные данные представляют собой среднее от n≥2 ±SD.

[00114] На фигуре 5 показаны фармакокинетика и биораспределение в глазу у кроликов после введения в стекловидное тело.

ПОДРОБНОЕ ОПИСАНИЕ

[00115] Настоящее изобретение частично основано на исследовании, демонстрирующем то, что фрагменты ECD человеческого рецептора VEGFR-3, имеющего одну или несколько модификаций в области N-гликана домена ECD, способны связываться с человеческим VEGF-C и человеческим VEGF-D in vitro и нейтрализовать их, а также способны подавлять развитие сосудов в моделях на животных возрастной макулярной дегенерации.

[00116] Рецептор фактора роста тирозинкиназ в основном включает три основных домена: внеклеточный домен (ECD), трансмембранный домен и внутриклеточный домен. ECD связывает лиганды, трансмембранный домен присоединяет рецептор к клеточной мембране, и внутриклеточный домен обладает одним ли несколькими ферментными доменами тирозинкиназы и взаимодействует молекулами трансдукции сигнала по цепочке. Рецепторы фактора роста эндотелия сосудов (VEGFR) связывают свой лиганд посредством своих ECD, которые состоят из многочисленных сходных с иммуноглобулином доменов (сходные с Ig домены). Сходные с Ig домены обозначаются в данном документе символом "D#." Например, "D1" относится к первому сходному с Ig домену на определенном ECD рецептора. "D1-3" относится к конструкции, содержащей по меньшей мере первые три сходные с Ig домена и интрон между доменами 1 и 2 и 2 и 3 определенной связывающей лиганды молекулы.

[00117] Для связывания лигандов (факторов роста) ECD рецепторов VEGFR целиком не требуется. ECD рецептора VEGFR-3 имеет шесть интактных сходных с Ig доменов и один расщепленный сходный с Ig домен - D5 рецептора VEGFR-3 расщеплен посттрансляционно на связанные дисульфидными мостиками субъединицы, оставляющие VEGFR-3. Veikkola, Т., et al., Cancer Res. 60: 203-212 (2000). В некоторых вариантах осуществления фрагменты рецептора, содержащие по меньшей мере первые три сходные с Ig домена этого семейства, достаточны для связывания лиганда. Растворимые рецепторы, способные связывать VEGF-C и VEGF-D, таким образом ингибируя активность VEGF-C или VEGF-D или передачу сигнала посредством VEGFR-3, также раскрыты в публикациях WO 2000/023565, WO 2000/021560, WO 2002/060950 и WO 2005/087808, содержание которых во всей своей полноте включено путем ссылки в состав данной заявки. Такие растворимые рецепторы, модифицированные изменением секвона AN2, и, необязательно, другими модификациями, описанными в данном документе, рассматриваются в качестве аспекта данного изобретения.

[00118] В Таблице 1 приведены примерные границы сходных с Ig доменов человеческого VEGFR-3. Эти границы существенны, поскольку выбранные границы могут быть использованы для формирования связывающих лиганды молекул, и таким образом могут влиять на связывающие свойства получаемой конструкции.

[00119]

ECD целиком примерно доходят до положения 775 в последовательности SEQ ID NO: 2.

[00120] Конструкции растворимого рецептора для применения в качестве связывающей лиганды молекулы для человеческого VEGF-C или VEGF-D предпочтительно включает по меньшей мере один сходный с Ig домен рецептора VEGFR-3, как показано в Таблице 1, но может включать вплоть до семи. Связывающая лиганды молекула необязательно включает последовательность перед в основном расположенным в N-конце сходным с Ig доменом, необязательно включает последовательность после в основном расположенного в С-конце сходного с Ig домена, и необязательно также включает последовательность между сходными с Ig доменами. Также рассматриваются варианты, например, с одной или несколькими аминокислотными заменами, вставками или делециями аминокислотных остатков. В некоторых вариантах осуществления связывающая лиганды молекула включает фрагмент человеческого VEGFR-3, содержащего по меньшей мере первые три сходные с Ig домена человеческого VEGFR-3.

[00121] В некоторых вариантах осуществления связывающая лиганды молекула является полипептидом, содержащим часть ECD человеческого VEGFR-3, где эта часть связывается с одним или обоими человеческим VEGF-C и человеческим VEGF-D, и включает по меньшей мере первый, второй и третий сходные с Ig домена ECD VEGFR-3, где аминокислотная последовательность фрагмента ECD рецептора VEGFR-3 модифицирована по сравнению с VEGFR-3 дикого типа с целью удалить второй предполагаемый секвон гликолизирования по N-связи рецептора VEGFR-3 дикого типа, и где в полипептиде отсутствуют сходные с Ig домены 4-7 рецептора VEGFR-3 и, предпочтительно, любой трансмембранный домен и, предпочтительно, любой внутриклеточный домен.

[00122] В некоторых вариантах осуществления связывающая лиганды молекула включает полипептид, сходный или идентичный аминокислотной последовательности полипептида человеческого VEGFR-3 (SEQ ID NO: 2) или его фрагмента, при условии, что положения связывающей лиганды молекулы, соответствующие положениям 104-106 в полипептиде человеческого VEGFR-3, приведенные в SEQ ID NO: 2, не идентичны N-X-S или N-X-T, где связывающая лиганды молекула связывается с одним или несколькими факторами роста, выбранными из группы, состоящей из человеческого VEGF-C и человеческого VEGF-D. Фрагмент минимально включает достаточно последовательности VEGFR-3 для связывания лиганда и может включать весь рецептор. Предпочтительными являются фрагменты ECD. Предпочтительные полипептиды включают аминокислотную последовательность, которая по меньшей мере на 80% идентична его связывающему лиганды фрагменту. Значительно более предпочтительны фрагменты с более высокой идентичностью, например, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99,5% или 100%. Фрагменты, имеющие идентичность 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% или 75%, также рассматриваются. Род подобных полипептидов может альтернативно определяться по способности кодирующих полипептидов к гибридизации с комплементом нуклеотидной последовательности, соответствующей цДНК последовательности, кодирующей рецептор VEGFR-3.

[00123] «Идентичность», как это известно в данной области, представляет взаимосвязь между двумя или более полипептидными молекулами, или двумя или более молекулами нуклеиновой кислоты, как определено путем сравнения последовательностей. В данной области «идентичность» также означает степень сходства последовательностей между молекулами нуклеиновой кислоты или полипептидными последовательностями, в зависимости от конкретного случая, как определено по совпадению между нитями таких последовательностей. "Идентичностью" измеряют процентную долю идентичных совпадений между наименьшими из двух или более последовательностей с выравниванием разрывов (если есть), выполняемым с помощью определенной математической модели компьютерной программы (т.е. "алгоритмов"). Подходящими алгоритмами для определения процентных долей идентичности по данному изобретению включают BLASTP и BLASTN с использованием наиболее общих и принятых параметров по умолчанию.

[00124] Связывающие лиганды молекулы можно также описать как имеющие аминокислотную последовательность, кодированную последовательностью нуклеиновой кислоты, которая по меньшей мере на 80% идентична фрагменту последовательности SEQ ID NO: 1, кодирующему связывающий лиганды фрагмент рецептора VEGFR-3, при условии, что положения связывающей лиганды молекулы, соответствующие положениям 104-106 кодируемого связывающего лиганды фрагмента рецептора VEGFR-3, не идентичны N-X-S или N-X-T. Наиболее предпочтительны фрагменты нуклеиновой кислоты с более высокой идентичностью, например, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99,5% или 100%. Фрагменты, имеющие идентичность 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% или 75%, также рассматриваются. Например, предпочтительная связывающая лиганды молекула включает аминокислотную последовательность, которая связывается с человеческим VEGF-C и/или с человеческим VEGF-D, и которая кодируется нуклеотидной последовательностью, которая гибридизуется с комплементом последовательности SEQ ID NO: 1 в средних или высокожестких условиях, обсуждаемых в данном документе.

[00125] В некоторых вариантах осуществления связывающая лиганды молекула включает полипептид, включающий фрагмент человеческого VEGFR-3 (SEQ ID NO: 2), выбранный из группы, состоящей из положений 1-226 или 25-226 в последовательности SEQ ID NO: 2, положений 1-229 или 25-229 в последовательности SEQ ID NO: 2, положений 1-329 или 25-229 в последовательности SEQ ID NO: 2, при условии, что положения 104-106 кодируемого связывающего лиганды фрагмента рецептора VEGFR-3, не идентичны N-X-S или N-X-T. В некоторых вариантах осуществления связывающая лиганды молекула является полипептидом, содержащим фрагмент человеческого VEGFR-3 (SEQ ID NO: 2), выбранный из группы, состоящей из положений 47-224 в последовательности SEQ ID NO: 2, положениям 47-225 в последовательности SEQ ID NO: 2, положениям 47-226 в последовательности SEQ ID NO: 2, положениям 47-227 в последовательности SEQ ID NO: 2, положениям 47-228 в последовательности SEQ ID NO: 2, положениям 47-229 в последовательности SEQ ID NO: 2, положениям 47-230 в последовательности SEQ ID NO: 2, положениям 47-231 в последовательности SEQ ID NO: 2, положениям 47-232 в последовательности SEQ ID NO: 2, положениям 47-236 в последовательности SEQ ID NO: 2, положениям 47-240 в последовательности SEQ ID NO: 2 и положениями 47-245 в последовательности SEQ ID NO: 2, при условии, что положения 104-106 кодируемого связывающего лиганды фрагмента рецептора VEGFR-3, не идентичны N-X-S или N-X-Т. В некоторых вариантах осуществления связывающая лиганды молекула является полипептидом, содержащим фрагмент человеческого VEGFR-3 (SEQ ID NO: 2), выбранный из группы, состоящей из положений 47-314 в последовательности SEQ ID NO: 2, положениям 47-210 в последовательности SEQ ID NO: 2 и положениями 47-247 в последовательности SEQ ID NO: 2, при условии, что положения 104-106 кодируемого связывающего лиганды фрагмента рецептора VEGFR-3, не идентичны N-X-S или N-X-Т.

[00126] Связывающие лиганды молекулы также можно описать, как имеющие аминокислотную последовательность, сходную или идентичную аминокислотной последовательности, приведенной в SEQ ID NO: 3. Предпочтительные полипептиды имеют аминокислотную последовательность, по меньшей мере на 80% идентичную аминокислотной последовательности, приведенной в SEQ ID NO: 3, при условии, что положения 80-82 полипептида, приведенного в SEQ ID NO: 3, не идентичны N-X-S или N-X-T, где где связывающая лиганды молекула связывается с одним или несколькими факторами роста, выбранными из группы, состоящей из человеческого VEGF-C и человеческого VEGF-D. Наиболее предпочтительны полипептиды с более высокой идентичностью, например, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99,5% или 100%. Фрагменты, имеющие идентичность 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% или 75%, также рассматриваются. Род подобных полипептидов может альтернативно определяться по способности кодирующих полипептидов к гибридизации с комплементом нуклеотидной последовательности, соответствующей цДНК последовательности, кодирующей рецептор VEGFR-3.

[00127] В некоторых вариантах осуществления связывающая лиганды молекула включает аминокислотную последовательность, включающую аминокислоты в положениях 22-290 последовательности (SEQ ID NO: 3. В некоторых вариантах осуществления связывающая лиганды молекула включает аминокислотную последовательность, включающую аминокислоты в положениях 23-290 последовательности (SEQ ID NO: 3. В некоторых вариантах осуществления связывающая лиганды молекула включает аминокислоты в положениях 22-537 последовательности (SEQ ID NO: 3, или аминокислоты 23-537 последовательности SEQ ID NO: 3, или аминокислоты 1-537 последовательности SEQ ID NO: 3.

[00128] Термин "составный домен" в контексте данного документа относится к домену в пределах связывающей лиганды молекулы, который происходит из или основан на домене белка внутри внеклеточной части белка рецептора. Например, каждый домен Ig рецептора VEGFR-3 (D1-D7) и других представителей семейства рецепторов тирозинкиназ (например, таких как VEGFR-1 и VEGFR-2) образуют составные домены. В данном документе ссылки на составный домен включает как полный нативный домен дикого типа, так и его варианты, полученные вставкой, делецией и/или заменой, которые в значительной степени сохраняют функциональные характеристики интактного домена. Как будет легко понятно специалисту в данной области, можно получить многочисленные варианты вышеперечисленных доменов (например, доменов Ig), которые в значительной степени сохраняют функциональные характеристики домена дикого типа.

[00129] Рецепторы фактора роста, из которых можно получать связывающие лиганды молекулы, включают сплайсинг-варианты и встречающиеся в природе аллельные варианты. Аллельные варианты хорошо известны из уровня техники и представляют альтернативные формы или последовательность нуклеиновых кислот, которые включают замену, делецию или вставку одного или нескольких нуклеотидов, но которые не приводят к каким-либо значительным функциональным изменениям кодируемого полипептида. Об иллюстративных аллельных вариантах рецептора VEGFR-3 сообщалось в литературе, например, в http<colon>//www.uniprot.org/uniprot/P35916, они включают положения 149, 378, 494, 527 и 641 в пределах ECD. Для создания этих полипептидов можно легко использовать стандартные способы, включающие сайт-направленный мутагенез полинуклеотидов, или аланин-сканирующий мутагенез или специфическое ферментативное расщепление и лигирование. Сходным образом предполагается применение псевдомиметиков или соединений, в которых один или несколько аминокислотных остатков замещены искусственной аминокислотой или аналогом аминокислоты, сохраняющих связывающую активность. Предпочтительно, в случаях использования аминокислотной замены, замена является консервативной, т.е. аминокислота заменяется аминокислотой с похожими размером и зарядом. Термин "консервативная замена" в данном контексте означает замену аминокислотного остатка другим, биологически похожим остатком. Примеры консервативных замен включают замену одного гидрофобного остатка, такого как изолейцин, валин, лейцин, аланин, цистеин, глицин, фенилаланин, пролин, триптофан, тирозин, норлейцин или метионин другим, замену одного полярного остатка другим, например, замена аргинина лизином, глутамовой кислоты аспаргиновой кислотой, или глутамина аспарагином, и т.п. Нейтральные гидрофильные аминокислоты, которые могут замещаться одна другой, включают аспаргин, глутамин, серии и треонин. Термин "консервативная замена" также включает применение замещенной аминокислоты вместо незамещенной аминокислоты.

[00130] Альтернативно, консервативные аминокислоты можно сгруппировать, как описано в публикации Lehninger, (Biochemistry, Second Edition; Worth Publishers, Inc. NY:NY, pp. 71-77 (1975)), и приведено ниже: Неполярные (гидрофобные)

A. Алифатические: A, L, I, V, Р,

B. Ароматические: F, W,

C. Серосодержащие: М,

D. Пограничные: G.

Незаряженные полярные

A. Гидроксильные: S, Т, Y,

B. Амиды: N, Q,

C. Сульфгидрильные: С,

D. Пограничные: G.

Положительно заряженные (основные): K, R, Н.

Отрицательно заряженные (кислотные): D, Е.

[00131] Во избежание разночтений "составный домен" включает домен, соответствующий D1 рецептора VEGFR-3, в котором мотив N-X-S/T секвона в положениях 104-106 последовательности SEQ ID No: 2 был изменен, например, в результате замены.

[00132] В вариантах осуществления, где связывающая лиганды молекула включает многокомпонентные домены, например, составные домены D1, D2 и D3 рецептора VEGFR-3, составные домены могут быть соединены непосредственно друг с другом или могут быть соединены одной или несколькими спейсерными группами. В общем случае термин «спейсерная группа» означает одну или несколько молекул, например, нуклеиновых кислот или аминокслот, или частицы не пептидной природы, такие как полиэтиленгликоль или дисульфидные мостики, которые могут быть вставлены между одним или несколькими составными доменами, образуя ковалентную связь. Спейсерные последовательности могут использоваться для предоставления требуемого сайта, представляющего интерес, между компонентами для простоты обращения с ними. Спейсерная группа также может быть предоставлена для усиления экспрессии связывающего лиганды полипептида из клетки-хозяина, для уменьшения пространственной затрудненности, таким образом, чтобы компонент группы компонентов мог принять его/их оптимальную четвертичную геометрию и/или взаимодействовать соответствующим образом с его/их целевой молекулой. Спейсерные группы и способы определения требуемых спейсерных групп можно посмотреть, например, в публикации George et al. (2003) Protein Engineering 15: 871-879, включенной в данный документ путем ссылки. Спейсерная последовательность может включать одну или несколько аминокислот, естественным образом соединенные с компонентом рецептора, или может предоставлять собой привнесенную последовательность, используемую для усиления экспрессии связывающих лиганды полипептидов, предоставления специально требуемых сайтов, представляющих интерес, позволять составным доменам принимать оптимальную четвертичную геометрию и/или для усиления взаимодействия компонента или группы компонентов с его/их целевой молекулой. В одном варианте осуществления спейсерная группа между одним или несколькими компонентами включает одну или несколько пептидных последовательностей, длиной 1-100 аминокислот, предпочтительно 1-50 аминокислот. В предпочтительном варианте осуществления спейсерная группа между двумя составными доменами в основном состоит из аминокислот, естественным образом соединенных с компонентом рецептора в рецепторе дикого типа. В случае, когда связывающая лиганды молекула включает несколько составных доменов из одного и того же рецептора, домены которого находятся рядом друг с другом в нативном рецепторе, как например, D1, D2 и D3 рецептора VEGFR-3, в одном варианте осуществления домены соединены один с другим (например, D1, D2 и D3 рецептора VEGFR-3) с использованием спейсерных групп, соответствующих встречающимся в природе аминокислотным линкерным последовательностям.

[00133] В некоторых вариантах каждый связывающий лиганды полипептид экспрессируется в виде объединенной конструкции с белком партнера по слиянию, таким как константный участок иммуноглобулина, и гетерологичные партнеры по слиянию соединяются, образуя связывающую лиганды молекулу.

Мультимеры, мультимеризующие компоненты, партнеры по слиянию и линкерные группы

[00134] Партнер по слиянию представляет собой любой гетерологичный компонент, который усиливает функциональность молекулы, связывающей лиганды. Так, например, партнер по слиянию может увеличивать растворимость, изменять клиренс, способствовать нацеливанию на определенную клетку или типы тканей, усиливать биологическую активность, способствовать образованию и/или извлечению, усиливать фармакологические свойства или улучшать фармакокинетическую (ФК) кривую связывающего лиганды полипептида. В отношении улучшения ФК кривой, оно может быть достигнуто путем, например, увеличением времени полувыведения, проникновением в ткани, отсутствием иммуногенности и стабильностью связывающей лиганды молекулы. В предпочтительных вариантах осуществления партнер по слиянию выбирают из группы, состоящей из мультимеризующих компонентов, белка сыворотки или молекулы, способной связывать белок сыворотки.

[00135] Если партнер по слиянию представляет собой белок сыворотки или его фрагмент его выбирают из группы, состоящей из α-1-микроглобулина, AGP-1, орозомукоида, α-1-кислого гликопротеина, связывающего витамин D белка (DBP), гемопексина, сывороточного альбумина человека (hSA), трансферрина, ферритина, афамина, гаптоглобина, α-фетопротеина тироглобулина, α-2-НS-гликопротеина, β-2-гликопротеина, белка, связывающего гиалуроновую кислоту, синтаксин, C1R, C1q а цепочки, галектин3-Мас2-связывающего белка, фибриногена, полимерного Ig рецептора (PIGR), α-2-макпроглобулина, транспортного белка мочевины, гаптоглобина, IGFBP, рецепторов-мусорщиков макрофагов, фибронектина, гиантина, Fc, α-1-антихимотрипсина, α-1-антитрипсина, антитромбина III, аполипопротеина А-1, аполипопротеина В, β-2-микоглобулина, церулоплазмина, компонента комплемента С3 или С4, ингибитора эстеразы CI, С-реактивного белка, цистатина С и белка С. В более конкретном варианте партнер в слиянии выбран из группы, состоящей из -1-микроглобулина, AGP-1, орозомукоида, α-1-кислого гликопротеина, связывающего витамин D белка (DBP), гемопексина, сывороточного альбумина человека (hSA), афамина и гаптоглобина. Включение компонента, являющегося партнером по слиянию, может при желании продлевать время полувыведения из сыворотки слитого полипептида данного изобретения. Смотри, например, патенты США №№6423512, 5876969, 6593295 и 6548653, специально включенные в данное описание в виде ссылки в полном объеме, в отношении примеров полипептида, слитого с сывороточным альбумином. hSA широко распределен в организме, особенно в кишечнике и компонентах крови, и играет важную роль в поддержании осмолярности и объема плазмы. Он медленно выводится из печени и у людей обычно имеет время полувыведения in vivo 14-20 дней (Waldmann et al. (1977) Albumin, Structure Function and Uses; Pergamon Press; pp. 255-275).

[00136] В том случае, когда партнером по слиянию является молекула, способная связывать белок сыворотки, молекула может быть синтетической малой молекулой, липидом или липосомой, нуклеиновой кислотой, включая синтетическую нуклеиновую кислоту, такую как аптомер, пептидом или олигосахаридом. Кроме того, молекула может быть таким белком, как, например, FcR1, FcR2, FcR3, полимерный рецептор Ig (PIGR), ScFv и другие фрагменты антител, специфичные по отношению к белку сыворотки.

[00137] В том случае, когда партнером по слиянию является мультимеризующий компонент, он представляет собой любую природную или синтетическую последовательность или соединение, способные оперативно связывать первую связывающую лиганды молекулу с другой связывающей лиганды молекулой или другим мультимеризующим компонентом другой связывающей лиганды молекулы с образованием структуры более высокого порядка, например, димера, тримера и т.д. Подходящие МС могут включать лейциновую молнию, включая домены лейциновой молнии, полученные из c-jun или c-fos; последовательности, полученные из константных областей легких цепей каппа или лямбда; синтетические последовательности, такие как мотивы спираль-петля-спираль (Muller et al. (1998) FEBS Lett. 432: 45-49), coil-coil мотивы и т.д., или другие общепринятые мультимеризующие домены, известные в данной области. В некоторых вариантах слитый компонент содержит домен, полученный из иммуноглобулина, например из IgG, IgM или IgA человека.

[00138] В одном аспекте связывающую лиганды молекулу, описанную здесь, получают в виде мультимера. Такая субъединица мультимера включает или состоит из связывающей лиганды молекулы, например, связывающего лиганды полипептида. Эти мультимеры могут быть гомодимерными, гетеродимерными или мультимерными растворимыми рецепторами, причем мультимерные рецепторы состоят из 9 или менее субъединиц, предпочтительно из 6 или менее субъединиц, еще более предпочтительно - из 3 или менее субъединиц, и наиболее предпочтительно - из 2 субъединиц. Предпочтительно, чтобы эти мультимерные растворимые рецепторы представляли собой гомодимеры молекул, связывающих лиганды.

[00139] По меньшей мере две субъединицы мультимера оперативно связаны друг с другом. Термин "оперативно связаны" указывает на то, что субъединицы ассоциированы посредством ковалентной и/или нековалентной связи. Субъединицы могут быть ковалентно связаны любыми пригодными средствами, например, посредством сшивающего реагента или линкерной группы, такой как полипептидный или пептидный линкер. В другом варианте осуществления субъединицы связаны посредством нековалентных связей. В некоторых вариантах две субъединицы (например, два связывающих лиганды полипептида) присоединены пептидной связью либо непосредственно, либо посредством "пептидного линкера". Пептидный линкер может быть коротким и состоять из 1-3 аминокислотных остатков (предпочтительно состоять из малых аминокислот, таких как глицин, серии, треонин или аланин) или быть длиннее и состоять из, например, 13, 15 или 16 аминокислотных остатков, вставленных между субъединицами. Предпочтительно пептидный линкер представляет собой иммунологически инертный пептид. Указанная линкерная группа может представлять собой трипептид последовательности E-F-M (Glu-Phe-Met), например, линкерную последовательность из 13-и аминокислот, состоящую из Glu-Phe-Gly-Ala-Gly-Leu-Val-Leu-Gly-Gly-Gln-Phe-Met (SEQ ID NO: 7), линкерную последовательность из 15-и аминокислот, состоящую из (G4S)3 (SEQ ID NO: 8), линкерную последовательность из 16-и аминокислот, состоящую из GGSGG SGGGG SGGGG S (SEQ ID NO: 9), или шарнирный участок человеческого IgG (например, IgG1, IgG2, IgG3 или IgG4). В некоторых вариантах две субъединицы представляют собой связывающие лиганды полипептиды, состоящие из двух индивидуальных полипептидных цепей, связанных друг с другом, например, дисульфидными связями или другими связями.

[00140] В некоторых вариантах осуществления связывающая лиганды молекула имеет вид слитого белка, включающего по меньшей мере две субъединицы, каждая из которых содержит связывающий лиганды полипептид. Таким образом, слитый белок можно получать рекомбинантно, путем прямой экспрессии в клетке-хозяине молекулы нуклеиновой кислоты, кодирующей его как одна открытая рамка считывания.

[00141] В некоторых вариантах связывающий лиганды полипептид экспрессируется в виде объединенной конструкции с гетерологичным белком партнера по слиянию, таким как константный участок иммуноглобулина, и гетерологичные партнеры по слиянию соединяются, образуя мультимерную связывающую лиганды молекулу. В одном варианте осуществления субъединицы оперативно связаны с мультимеризующим компонентом. Мультимеризующий компонент включает любую природную или синтетическую последовательность, способную оперативно связывать две или более субъединицы с образованием структуры более высокого порядка, например, димера, тримера и т.д. Мультимеризующий компонент может оперативно связывать две или более субъединицы путем "прямого" взаимодействия с субъединицами. Альтернативно, мультимеризующий компонент для одной субъединицы может взаимодействовать с другим мультимеризующим компонентом другой субъединицы, чтобы оперативно связывать субъединицы.

[00142] В одном варианте осуществления субъединицы оперативно связаны с дополнительным аминокислотным доменом, обеспечивающим мультимеризацию субъединиц (в частности, дополнительные домены, содержащие любую функциональную область, обеспечивающую димеризацию субъединиц). Термин "оперативно связаны" указывает на то, что субъединица, основанная на VEGFR-3, и дополнительный аминокислотный домен ассоциированы посредством пептидной связи, либо непосредственно, либо посредством "пептидного линкера" (как определено в данном документе), и субъединица, основанная на VEGFR-3, сохраняет свои свойства в отношении связывания лигандов. Дополнительный аминокислотный домен может находиться вверх (N-ter) или вниз (C-ter) от последовательности субъединицы VEGFR-3. Предпочтительно, он расположен вниз по отсчету (т.е. по направлению от первого домена, сходного с иммуноглобулином (домен Ig-I). Таким образом, слитый белок можно получать рекомбинантно, путем прямой экспрессии в клетке-хозяине молекулы нуклеиновой кислоты, кодирующей его. В таких вариантах осуществления описанная здесь связывающая лиганды молекула представляет собой мультимер слитого белка, содержащего связывающие лиганды полипептиды, и мультимеризующий компонент, способный взаимодействовать с мультимеризующим компонентом, находящимся в другом слитом белке, с образованием структуры более высокого порядка, например, димера. Такие типы слитых белков можно получать, оперативно связывая последовательность субъединицы VEGFR-3 (т.е. связывающий лиганды полипептид) с доменами, выделенными из других белков, обеспечивая образование димеров, тримеров и т.п. Примеры белковых последовательностей, позволяющих осуществлять мультимеризацию описываемых здесь связывающих лиганды полипептидов, включают, но не ограничиваются этим, домены, выделенные из таких белков, как иммуноглобулины, hCG (WO 97/30161), коллаген X (WO 04/33486), С4ВР (WO 04/20639), белки Erb (WO 98/02540) или coiled-coil пептиды (WO 01/00814), раскрытие которых во всей своей полноте включено путем ссылки в состав данной заявки.

[00143] Мультимеризующий компонент можно, например, выбирать из (i) аминокислотных последовательностей, длиной от 1 до примерно 500 аминокислот, (ii) лейциновых молний, (iii) мотивов спираль-петля и (iv) мотивов coil-coil. Если мультимеризующий компонент включает аминокислотную последовательность, длиной от 1 до примерно 500 аминокислот, последовательность может содержать одну или несколько цистеиновых остатков, способных образовывать дисульфидную связь с соответствующим цистеиновым остатком другого полипептида, содержащего мультимеризующий компонент с одним или несколькими цистеиновыми остатками.

[00144] В определенном аспекте мультимеры представляют собой димеры связывающих лиганды полипептидов, где полипептиды оперативно связаны с иммуноглобулином или частью иммуноглобулина в качестве партнера по связыванию, который также может действовать как мультимеризующий компонент. Термин "оперативно связаны" указывает на то, что связывающие лиганды полипептиды и иммуноглобулин или его часть ассоциированы посредством пептидной связи, либо непосредственно, либо посредством "пептидного линкера" (как определено в данном документе), и свойства связывающих лиганды полипептидов в отношении связывания лигандов сохраняются. В этом варианте осуществления связывающие лиганды полипептиды оперативно связаны со всем иммуноглобулином или его частью, особенно человеческим иммуноглобулином, и даже более конкретно - с Fc-частью человеческого иммуноглобулина. Обычно Fc-часть человеческого иммуноглобулина содержит два домена константной области (домены СН2 и СН3) и шарнирный участок, но не содержать вариабельную область. (См., например, патенты США №№6018026 и 5750375, включенные в данный документ путем ссылки.) Иммуноглобулин можно выбирать из любого из основных классов иммуноглобулинов, включая IgA, IgD, IgE, IgG и IgM, и любых подклассов и изотипов, например, IgG1, IgG2, IgG3 и IgG4; IgA-I и IgA-2. В одном варианте осуществления Fc фрагмент происходит из человеческого IgG4, который стабилен в растворе и не обладает или обладает в незначительной степени комплементарным активирующим действием. В другом варианте осуществления Fc фрагмент происходит из человеческого IgG4. Fc-часть может быть изменена с целью предотвратить нежелательную активность, такую как комплементарное связывание, связывания с рецепторами Fc и т.п. Аминокислотная последовательность, полученная из иммуноглобулина может быть присоединена к С-концу или N-концу связывающего лиганды полипептида, предпочтительно к С-концу. Такие слитые белки можно получать путем трансфицирования клеток и использованием ДНК, кодирующего слитый белок субъединица VEGFR-3:Fc и экспрессии димеров в этих же клетках. В определенном варианте осуществления на каждой мономерной субъединице находятся одинаковые связывающие лиганды полипептиды (т.е. димер представляет собой гомодимер). Способы получения слитых белков иммуноглобулина хорошо известны в области техники, как те, которые описаны, например, в публикации Hollenbaugh and Aruffo ("Construction of Immunoglobulin Fusion Proteins", in Current Protocols in Immunology, Suppl. 4, pages 10.19.1-10.19.11, 1992) или WO 01/03737, обе включены в данный документ путем ссылки.

[00145] Альтернативно, димеры связывающих лиганды полипептидов настоящего изобретения можно получать путем оперативного связывания одного из связывающих лиганды полипептидов с константной областью тяжелой цепи иммуноглобулина и оперативного связывания другого связывающего лиганды полипептида с константной областью легкой цепи иммуноглобулина. Например, связывающий лиганды полипептид может быть оперативно связан с участком СН1-шарнир-СН2-СН3 человеческого IgG1, а другой или тот же самый связывающий лиганды полипептид может быть оперативно связан с C каппа участком легкой цепи каппа Ig. В одном варианте осуществления тяжелая константная цепь представляет собой человеческую γ4, которая стабильна в растворе и не обладает или обладает в незначительной степени комплементарным активирующим действием. В другом варианте осуществления тяжелая константная цепь представляет собой человеческую γI. Тяжелая константная цепь может быть изменена с целью предотвратить нежелательную активность, такую как комплементарное связывание, связывания с рецепторами Fc и т.п.

[00146] Также, если необходимо, слитые белки, описанные в данном документе, могут включать любые функциональные участки, способствующие очистке или получению. Конкретные примеры таких дополнительных аминокислотных последовательностей включают последовательность GST или последовательность His tag. В некоторых вариантах участок, способствующий очистке, удаляют перед составлением композиции для фармацевтического применения.

[00147] Аминокислотная последовательность, полученная из иммуноглобулина может быть присоединена к С-концу или N-концу связывающего лиганды полипептида, предпочтительно к С-концу. Клетки, трансфицированные с использованием ДНК, кодирующей слитый белок легкой цепи иммуноглобулина и слитый белок тяжелой цепи иммуноглобулина, экспрессируют гетеродимеры тяжелая цепь/легкая цепь, причем каждая содержит связывающий лиганды полипептид. Оба связывающих лиганды полипептида при первоначальном синтезировании преимущественно содержат нативный или гетерологичный сигнальный пептид, что способствует выделению из клетки, но сигнальная последовательность отщепляется при выделении. Здесь рассматриваются варианты любого из предшествующих вариантов осуществления, которые включают сигнальный пептид. Нативный сигнальный пептид человеческого VEGFR-3 включает остатки 1-24 последовательности SEQ ID NO: 2. В литературе сообщается о многочисленных других сигнальных пептидных белках.

[00148] В другом конкретном аспекте настоящего изобретения связывающие лиганды полипептиды мультимеров связаны посредством нековалентных связей. Нековалентное связывание субъединиц можно осуществлять с помощью любых подходящих средств, которые не оказывают влияния на их биологическую активность (т.е. на способность связывать человеческий VEGF-C и/или VEGF-D). В определенном аспекте эти мультимеры представляют собой димеры связывающих лиганды полипептидов, где один связывающий лиганды полипептид оперативно связан с первым соединением, а другой или тот же самый связывающий лиганды полипептид оперативно связан с другими соединением, которое не образует нековалентной связи с первым соединением. Примеры таких соединений представляют собой биотин и авидин. Димеры связывающих лиганды полипептидов можно получать путем оперативного связывания одной субъединицы VEGFR-3 с биотином и оперативного связывания другого связывающего лиганды полипептида с авидином. Рецептор таким образом формируется путем нековалентного взаимодействия биотина и авидина. Другие примеры включают субъединицы из гетеродимерного белкового гормона. В этих вариантах осуществления конструкция ДНК, кодирующая один связывающий лиганды белок, сливают с конструкцией ДНК, кодирующей субъединицу из гетеродимерного белкового гормона, такую как hCG, и конструкция ДНК, кодирующая другой связывающий лиганды полипептид сливают с конструкцией ДНК, кодирующей другую субъединицу из гетеродимерного белкового гормона, такую как hCG (как раскрывается в патенте US 6193972). Эти конструкции ДНК совместно экспрессируются в одних и тех же клетках, приводят к экспрессии связывающей лиганды молекулы, поскольку каждая совместно экспрессируемая последовательность содержит соответствующую гормональную субъединицу таким образом, чтобы образовывать гетеродимер в ходе экспрессии. Аминокислотная последовательность, полученная из гетеродимерного белкового гормона, может быть присоединена к С-концу или N-концу связывающих лиганды полипептидов, предпочтительно к С-концу. Обе субъединицы при первоначальном синтезировании преимущественно содержат нативный или гетерологичный сигнальный пептид, что способствует выделению из клетки, но сигнальная последовательность отщепляется при выделении.

[00149] В одном варианте осуществления связывающая лиганды молекула оперативно связана со связывающей единицей, полученной не из VEGFR-3, т.е. связывающей единицей, которая не содержит составные домены, полученный из VEGFR-3. Такие химерные связывающие лиганды молекулы могут, например, содержать гетерологичные связывающие единицы, основанные на других рецепторах тирозинкиназы. В одном варианте осуществления такие гетерологичные связывающие единицы образуют связь с по меньшей мере одним связывающим лиганды полипептидом, выбранным из VEGF-A (VEGF), VEGF-B, PIGF, PDGF-A, PDGF-B, PDGF-C и PDGF-D. В предпочтительном варианте осуществления такие гетерологичные связывающие единицы образуют связь с по меньшей мере VEGF-A (VEGF).

[00150] В одном варианте осуществления такие гетерологичные связывающие единицы включают составные домены, полученные из VEGFR-1 или VEGFR-2 или из них обоих. Примеры гетерологичных связывающих единиц, пригодных к использованию вместе со связывающими лиганды молекулами настоящего изобретения в виде химерных связывающих лиганды молекул, включают молекулы VEGF-ловушки, описанные в публикациях, например, WO 2000/75319, WO 2005/000895 и WO 2006/088650. Предпочтительные гетерологичные связывающие единицы включают Ig-домен 2 из VEGFR-1 (R1D2) и Ig-домен 3 из VEGFR-2 (R2D3), необязательно слитые с Fc частью иммуноглобулина. В одном варианте осуществления представлена химерная молекула, содержащая связывающий лиганд полипептид настоящего изобретения, соединенный с Fc частью иммуноглобулина, оперативно связанной со связывающей единицей R1D2R2D3, слитой с Fc частью иммуноглобулина. Две связывающие единицы оперативно связаны посредством дисульфидных связей между двумя Fc частями. Линкеры

[00151] В то время как сходные с Ig домены рецептора VEGFR-3 могут быть присоединены непосредственно один к другому (посредством пептидной, дисульфидной или другого типа ковалентной связи) или к сходным с Ig доменам других рецепторов, связывающие лиганды молекулы, описываемые в данном документе, необязательно дополнительно содержат (один или несколько) линкер(ов), которые соединяют вместе две или более различные связывающие единицы, например, фрагменты ECDVEGFR-3 с другими фрагментами ECDVEGFR-3, или даже со своей копией. Линкер также может связывать связывающую единицу с другими субъединицами, описываемыми в данном документе. В некоторых вариантах осуществления линкер представляет собой гетерологичный полипептид. Например, в некоторых вариантах осуществления линкер включает в себя пептид, который связывает связывающие единицы с образованием одного непрерывного пептида, который можно экспрессировать как одну связывающую лиганды молекулу. Линкеры можно выбирать таким образом, чтобы они в меньшей степени вызывали аллергические реакции. Для присоединения связывающих единиц с целью формирования связывающей лиганды молекулы также можно использовать полисахариды или другие частицы.

[00152] Можно использовать более одного линкера на связывающую лиганды молекулу. Линкеры можно выбирать из различных связывающих лиганды единиц в зависимости от степени свободы (стерической) их оптимальной конформации, чтобы позволить им взаимодействовать друг с другом, если необходимо, например, для образования димеров, или чтобы позволить им взаимодействовать с лигандом. Линкеры могут быть линейными, таким образом, чтобы последовательные связывающие единицы были связаны последовательно, или же линкер может выполнять роль каркаса, к которому присоединены различные связывающие единицы, например, разветвленный линкер. Линкер также может иметь многочисленные ответвления, например, как описано в публикации Tam, J. Immunol. Methods 196: 17 (1996). Связывающие единицы могут быть присоединены друг к другу или к линкерному каркасу посредством N-концевых аминогрупп, С-концевых карбоксильных групп, боковых цепей, химически модифицированных групп, боковых цепей или других средств.

[00153] Линкерные пептиды могут быть сконструированы так, чтобы иметь последовательность, которая позволяет им иметь желаемые свойства. Например, использование остатков глицила позволяет иметь относительно высокую степень конформационной свободы, в то время как пролин предрасположен оказывать обратный эффект. Пептидные линкеры можно выбирать так, чтобы они приобретали определенные структуры второго и третьего порядка, например, альфа-спиралей, бета-листов или бета баррелей. Четвертичные структуры также можно использовать для получения линкеров, которые нековалентным образом объединяют вместе две связывающие единицы. Например, сливание белкового домена с гидрофобной поверхностью с каждой связывающей единицей может позволить осуществить объединение двух связывающих единиц посредством взаимодействия вследствие гидрофобного взаимодействия двух молекул. В некоторых вариантах осуществления линкер может осуществлять полярные взаимодействия. Например, можно использовать домен лейциновой молнии прото-онкобелков Myc и Мах, соответственно. Luscher and Larsson, Ongogene 18: 2955-2966 (1999). В некоторых вариантах осуществления линкеры позволяют осуществлять образование солевого мостика или дисульфидной связи. Линкеры могут включать не встречающиеся в природе аминокислоты, а также натуральные аминокислоты, которые естественным образом не включены в полипептид. В некоторых вариантах осуществления линкер включает в себя координационный комплекс между металлом или другим ионом и различными остатками из многочисленных пептидов, объединенных в комплексе.

[00154] Рассматриваются линейные пептидные линкеры из по меньшей мере одного аминокислотного остатка. В некоторых вариантах осуществления линкер содержит более чем 10000 остатков. В некоторых вариантах осуществления линкер содержит 1-10000 остатков, 1-1000 остатков, 1-100 остатков, 1-50 остатков или 1-10 остатков. В некоторых вариантах осуществления линейный пептидный линкер включает в себя остатки с относительно инертными боковыми цепями. Аминокислотные остатки пептидного линкера не нуждаются или нуждаются в незначительной степени в связывании посредством альфа-карбокси- или альфа-аминогруппами. То есть пептиды могут быть связаны посредством групп боковых цепей различных остатков.

[00155] Линкер может влиять на способность полипептида(ов), к которому(ым) он присоединен, к димеризации друг с другом или другими полипептидами. Линкер выполняет ряд функций. Мономеры нативного рецептора, закрепленные в примерно двумерной плоскости клеточной мембраны, характеризуются относительно высокой местной концентрацией и доступностью корецепторов (связывающих единиц), что повышает вероятность нахождения партнера. Свободным в растворе рецепторам, не обладающим такими преимуществами, может помочь линкер, который повышает эффективную концентрацию мономеров.

[00156] В некоторых вариантах осуществления связывающая лиганды молекула может содержать больше чем один тип линкеров. Подходящие линкеры могут включать в себя химические модификации, обсуждаемые выше.

[00157] Связывающие лиганды молекулы, описываемые в данном документе, могут содержать дополнительные N-концевые аминокислотные остатки, предпочтительно метионин. Действительно, в зависимости от системы для экспрессии и условий, полипептиды можно экспрессировать в рекомбинантной клетке-хозяине, начиная с метионина. Эта дополнительная аминокислота может либо оставаться в получаемом рекомбинантном белке, или может удаляться посредством экзопептидазы, такой как метионин аминопептидаза в соответствии со способами, раскрытыми в литературе (Van Valkenburgh НА and Kahn RA, Methods Enzymol. (2002) 344: 186-93; Ben-Bassat A, Bioprocess Technol. (1991) 12: 147-59).

Заместители и другие химические модификации

[00158] Связывающие лиганды молекулы, описываемые в данном документе, необязательно химически модифицированы различными заместителями. Такие модификации предпочтительно не снижают в значительной степени аффинность связывания факторов роста связывающей лиганды молекулы. Скорее, химические модификации придают дополнительные требуемые свойства, как обсуждалось выше. Химические модификации могут иметь ряд различных форм, таких как гетерологенные пептиды, полисахариды, липиды, радиоизотопы, нестандартные аминокислотные остатки и нуклеиновые кислоты, хелаты металлов и различные токсины.

[00159] Фрагменты рецепторов (или "связывающие единицы" или "составные домены") и связывающие лиганды молекулы, описываемые в данном документе, необязательно присоединяют гетерологичным партнерам по слиянию, таким как гетерологичные полипептиды, для придания им различных свойств, например, повышенную растворимость, изменение клиренса, нацеленности на определенные клетки или типы тканей. В некоторых вариантах осуществления фрагмент рецептора соединен с доменом Fc IgG или другого иммуноглобулина. В некоторых вариантах осуществления фрагмент рецептора присоединен к щелочной фосфотазе (АР). Способы изготовления слитых конструкций Fc или АР можно найти в публикации WO 02/060950. Путем слияния связывающего лиганды полипептида или молекулы с доменами белка, обладающими определенными свойствами (например, временем полувыведения, биодоступностью, партнерами по взаимодействию), становится возможным придать эти свойства связывающей лиганды молекуле (например, молекуле, сконструированной для специфического распределения в тканях или специфического времени полувыведения). В некоторых вариантах осуществления связывающая лиганды молекула включает корецептор и фрагмент VEGFR.

[00160] Конкретный партнер по слиянию (например, гетерологичный полипептид), используемый в конкретной связывающей лиганды молекуле, может влиять на то, будет ли фрагмент VEGR-3 образовывать димер, что в свою очередь может влиять на связывание лиганда.

[00161] Для заместителей, таких как Fc область человеческого IgG, слияние может быть проведено непосредственно со связывающей лиганды молекулой или посредством интрона. Например, шарнирный, СН2 и СН3 участки человеческого IgG могут быть слиты либо с N-концом, либо с С-концом связывающей лиганды молекулы для присоединения Fc области. Получаемая слитая Fc-конструкция позволяет проводить очистку, используя аффинную колонку Protein A (Pierce, Rockford, III.). Пептиды и белки, слитые с Fc областью, могут иметь значительно более продолжительное время полувыведения in vivo, чем неслитый аналог. Слияние с Fc областью позволяет проводить димеризацию/мультимеризацию слитого полипептида. Fc область может быть встречающейся в природе Fc областью, но и может быть модифицирована с целью придания превосходных характеристик, например, терапевтических свойств, времени циркуляции, пониженной аггрегации.

[00162] Полипептиды можно модифицировать, например, путем гликозилирования, амидирования, карбоксилирования или фосфорилирования, или путем создания солей присоединения кислоты, амидов, сложных эфиров, в частности, С-концевых эфиров и N-ацильных производных. Сходные с Ig домены I-III рецептора VEGFR-3 включают 5 предполагаемых сайтов N-гликозилирования (здесь обозначаются как секвоны или области N1, N2, N3, N4 и N5 рецептора VEGFR-3, соответственно). N1 соответствует аминокислотам 33-35 в последовательности SEQ ID NO: 2; N2 соответствует аминокислотам 104-106 в последовательности SEQ ID NO: 2; N3 соответствует аминокислотам 166-168 в последовательности SEQ ID NO: 2; N4 соответствует аминокислотам 251-253 в последовательности SEQ ID NO: 2; N5 соответствует аминокислотам 299-301 в последовательности SEQ ID NO: 2. В некоторых вариантах осуществления описанная в данном документе связывающая лиганды молекула содержит модификацию на участке N2 молекулы. Например, в некоторых вариантах осуществления молекулы, связывающей лиганды, аминокислоту, соответствующую положению 104 в последовательности SEQ ID NO: 2, подвергают делеции и заменяют другой аминокислотой. Предпочтительными являются консервативные замены. В некоторых вариантах осуществления аминокислоту, соответствующую положению 104 в последовательности SEQ ID NO: 2, подвергают делеции и заменяют другой аминокислотой, выбранной из группы, состоящей из глутамина, аспартата, глутамата, аргинина и лизина. Еще в других вариантах в положении 106 произведена замена с целью удаления секвона N2. В вариантах осуществления, где секвон N2 в последовательности SEQ ID NO: 2 модифицирован описанным выше образом, предпочтительно, чтобы секвоны N1, N3, N4 и N5 в последовательности SEQ ID NO: 2 оставались не модифицированными.

[00163] Белки также можно модифицировать, создавая пептидные производные путем формирования ковалентных или нековалентных комплексов с другими частицами. Ковалетно связанные комплексы можно получать путем связывания химических частиц с функциональными группами в боковых цепях аминокислот полипептидов или с N- или С-концами.

[00164] Полипептиды можно конъюгировать с репортерной группой, включая, но не ограничиваясь ими, радиоактивную метку, флуоресцентную метку, фермент (например, который катализирует калориметрическую или флуорометрическую реакцию), субстрат, твердый матрикс или носитель (например, биотин или авидин). Примеры аналогов описаны в публикации WO 98/28621 и в работе Olofsson, et al., Proc. Nat'l Acad. Sci. USA, 95: 11709-11714 (1998), патентах США №№5512545 и 5474982; патентных заявках США №№20020164687 и 20020164710.

[00165] Цистеиновые остатки обычно реагируют с галогенацетатами (и соответствующими аминами), такими как хлоруксусная кислота или хлорацетамид, давая сакбоксиметильные или карбоксиамидометильные производные. Цистеиновые остатки также подвергают дериватизации реакцией с бромтрифторацетоном, α-бром-β(5-имидозоил)пропионовой кислотой, хлорацетилфосфатом, N-алкилмалеимидами, 3-нитро-2-пиридилдисульфидом, метил 2-пиридилдисульфидом, п-хлормеркурибензоатом, 2-хлормеркури-4-нитрофенолом или хлор-7-нитробензо-2-окса-1,3-диазолом.

[00166] Гистидиловые остатки подвергают дериватизации взаимодействием с диэтилпрокарбонатом при рН 5,5-7,0, поскольку этот реагент является относительно специфичным в отношении боковой цепи гистидила. Также можно применять пара-бромфенацил бромид; реакцию предпочтительно проводят в 0,1М какодилате натрия при рН 6,0.

[00167] Лизиниловые и аминные концевые остатки подвергают взаимодействию с ангидридами янтарной или карбоновой кислоты. Дериватизация с этими реагентами приводит к обращению заряда остатков лизинила. Другими пригодными реагентами для дериватизации α-аминосодержащих остатков включают сложные имидоэфиры, такие как метилпиколинимидат; пиридоксал фосфат; пиридоксал; хлорборогидрид; тринитробензолсульфокислота; О-метилизомочевина; 2,4-пентандион; и реакцию с глиоксилатом, катализируемую трансаминазой.

[00168] Остатки аргинила модифицируют реакцией с одним или несколькими традиционными реагентами, в частности, фенилглиоксалом, 2,3-бутандионом, 1,2-циклогександионом и нингидрином. Для дериватизации остатки аргинина требуется, чтобы реакция проводилась в щелочных условиях из-за высокого рК функциональной группы гуанидина. Кроме того, эти реагенты могут взаимодействовать в группами лизина, а также с эпсилон-аминогруппой аргинина.

[00169] Специфические модификации остатков тирозила как такового подробно исследовались, причем особый интерес представляет введение в остатки тирозила спектральных меток с помощью реакции с ароматическими соединениями диазония или тетранитрометаном. Чаще всего для образования О-ацетилтирозиловых разновидностей и 3-нитро-производных применяют N-ацетилимидазол и тетранитрометан, соответственно. Остатки тирозина иодируют, применяя 1251 или 1311 для получения меченых белков для применения в радиоиммунологических анализах.

[00170] Боковые карбоксильные группы (аспартильную или глутамильную) селективно модифицируют с помощью реакции с карбодиимидами (R1), такими как 1-циклогексил-3-(2-морфолинил-4-этил)карбодиимид или 1-этил-3-(4-азониа-4,4-диметилпентил)карбодиимид. Кроме того, остатки аспарагиновой и глутаминовой кислот превращают в остатки аспарагина и глутамина с помощью реакции с ионами аммония.

[00171] Дериватизация с помощью бифункциональных агентов полезна для сшивания антител с нерастворимой в воде поддерживающей матрицей. Такая дериватизация может также обеспечить ликер, который может соединять соседние связывающие элементы в связывающей лиганды молекуле, или связывающие элементы с гетерологичным пептидом, например, Fc фрагментом. Обычно применяемые сшивающие агенты включают, например, 1,1-бис(диазоацетил)-2-фенилэтан, глутаровый альдегид, N-гидроксисукцинимидные эфиры, например эфиры с 4-азидосалициловой кислотой, гомофункциональные имидоэфиры, включающие дисукцинимидильные эфиры, такие как 3,3'-дитиобис(сукцинимидилпропионат) и бифункциональные малеимиды, такие как бис-N-малеимидо-1,8-октан. Дериватизирующие агенты, такие как метил-3-[(пара-азидофенил)дитио]пропиоимидат, позволяют получить фотоактивируемые интермедиаты, которые способны к образованию поперечных сшивок в присутствии света. Альтернативно, реакционноспособные нерастворимые в воде матрицы, такие как активированные цианогенбромидом углеводы и реакционноспособные субстраты, описанные в патентах США №№3969287, 3691016, 4195128, 4247642, 4229537 и 4330440, включенные в данный документ ссылкой, применяют для иммобилизация белка.

[00172] Остатки глутамина и аспарагина часто деамидируют для получения соответствующих остатков глутаминовой и аспарагиновой кислот. Альтернативно, эти остатки можно деамидировать в мягких кислых условиях. Оба способа образования этих остатков входят в объем настоящего изобретения.

[00173] Другие изменения включают гидроксилирование пролина и лизина, фосфорилирование гидроксильных групп остатков серила или треонила, метилирование α-аминогрупп лизина, аргинина и гистидина в боковых цепях (Т.Е. Creighton, Proteins: Structure and Molecule Properties, W.H. Freeman & Co., San Francisco, pp. 79-86, 1983), ацетилирование амина на N-конце, и в некоторых случаях - амидирование С-концевых карбоксильных групп. Такие производные представляют собой химически модифицированные полипептидные композиции, в которых полипептид связывающей лиганды молекулы присоединен к полимеру. Выбираемый полимер обычно водорастворим, поэтому белок, который к нему присоединен, не выпадает в осадок в водной среде, такой как физиологическая окружающая среда. Выбираемый полимер обычно модифицируют так, чтобы он содержал одну реакционноспособную группу, такую как реакционноспособный сложный эфир для ацилирования или альдегид для алкилирования, таким образом, чтобы можно было контролировать степень полимеризации, как предложено в данных способах. Полимер может иметь любую молекулярную массу и может быть разветвленным или неразветвленным. Охватываемый объем полипептидных полимеров связывающей лиганды молекулы включают в себя смесь полимеров. Для терапевтического применения препарата конечного продукта, предпочтительно, чтобы полимер был фармацевтически приемлемым.

[00174] Каждый полимер может иметь любую молекулярную массу и может быть разветвленным или неразветвленным. Каждый полимер обычно имеет молекулярную массу в интервале от примерно 2 «кДа до примерно 100 кДа (термин "примерно" указывает на то, что в препаратах водорастворимого полимера некоторые молекулы будут иметь массу больше, а некоторые - меньше, чем указанная молекулярная масса). Средняя молекулярная масса каждого полимера составляет от примерно 5 кДа до примерно 50 кДа, более предпочтительно от примерно 12 «кДа до примерно 40 кДа, и особенно предпочтительно от примерно 20 кДа до примерно 35 кДа.

[00175] Пригодные водорастворимые полимеры или из смеси включают, но не ограничиваются ими, N-присоединенные или О-присоединенные углеводы, сахара, фосфаты, углеводы; сахара; фосфаты; полиэтиленгликоль (ПЭГ) (включая формы ПЭГ, используемые для дериватизации белков, включая моно-(С1-С10) аклкокси- или арилокси-полиэтиленгликоль); монометокси-полиэтиленгликоль; декстран (такой как декстран с низкой молекулярной массой, равной, например, примерно 6 кДа), целлюлозу; целлюлозу; другие основанные на углеводах полимеры, поли-(N-винилпирролидон)полиэтиленгликоль, гомополимеры пропиленгликоля, сополимер пропиленоксида/этиленоксида, полиоксиэтилированные многоатомные спирты (например, глицерин) и поливиниловый спирт. Изобретение также охватывает бифункциональные сшивающие молекулы, которые могут применяться для получения ковалентно присоединенных мультимеров.

[00176] Вообще химическую дериватизацию можно проводить в любых подходящих условиях, используемых для проведения реакции белка с реакционноспособной молекулой полимера. Способы получения химических производных полипептидов обычно включают в себя стадии (а) взаимодействия полипептида с реакционноспособной молекулой полимера (такой, как реакционноспособное производное сложного эфира или альдегида полимерной молекулы) в условиях, в которых связывающая лиганды молекула присоединяется к одному или нескольким полимерным молекулам, и (b) получение продукта(ов) реакции. Оптимальные условия реакции можно определять на основании известных параметров и желаемого результата. Например, чем выше отношение полимерные молекулы : белок, тем больше количество присоединенных молекул полимера. В одном варианте осуществления производное полипептида связывающей лиганды молекулы может содержать одну частицу молекулы полимера на аминном конце. (См., например, патент США №5234784).

[00177] Особенно предпочтителен водорастворимый полимер для применения в данном изобретении представляет собой полиэтиленгликоль (ПЭГ). Как используется в данном контексте, предполагается, что полиэтиленгликоль охватывает любые формы ПЭГ, которые можно использовать для дериватизации других белков, такие как моно-(С1-С10) алкокси- или арилокси-полиэтиленгликоль. ПЭГ представляет собой линейный или разветвленный нейтральный простой полиэфир, который имеет широкий интервал молекулярных масс, и растворим в воде и большинстве органических растворителей. ПЭГ эффективно исключает другие полимеры или пептиды, если присутствует в воде, прежде всего потому, что ему присущи очень высокая динамическая подвижность цепи и гидрофильная природа, тем самым создается водная оболочка или сфера гидратации при присоединении к другим белкам или полимерным поверхностям. ПЭГ является нетоксичным, неиммуногенным веществом и одобрен Управлением по контролю за продуктами и лекарствами для употребления внутрь.

[00178] Конъюгированные с ПЭГ белки и ферменты проявляют биоактивность, не обладают антигенными свойствами и снижают скорость клиренса при введении животным. F.М. Veronese et al., Preparation and Properties of Monomethoxypoly(ethylene glycol)-modified Enzymes for Therapeutic Applications, in J.M. Harris ed., Poly(Ethylene Glycol) Chemistry-Biotechnical and Biomedical Applications, 127-36, 1992, включено в данный документ путем ссылки. Это явление обусловлено свойствами исключения ПЭГ в предотвращении распознавания иммунной системой. Кроме того, ПЭГ широко используется в процедурах модификации поверхности для снижения адсорбции белка и для улучшения совместимости с кровью. S.W. Kim et al., Ann. N.Y. Acad. Sci. 516: 116-30 1987; Jacobs et al., Artif. Organs 12: 500-501, 1988; Park et al., J. Poly. Sci, Part A 29: 1725-31, 1991, включенные в данный документ путем ссылки. Гидрофобные полимерные поверхности, такие как полиуретаны и полистиролы можно модифицировать, прививая ПЭГ (ММ 3400), и применять их в качестве нетромбогенных поверхностей. Поверхностные свойства (угол контакта) могут более соответствовать гидрофильным поверхностям благодаря гидратирующему эффекту ПЭГ. Еще важнее то, что можно значительно уменьшить адсорбцию белков (альбумина и других белков плазмы), что является результатом высокой подвижности цепи, образования сферы гидратации и свойствами исключения белков, присущими ПЭГ.

[00179] Было определено, что ПЭГ (ММ 3400) имел оптимальный размер в исследовании поверхностной иммобилизации, Park et al., J. Biomed. Mat. Res. 26: 739-45, 1992, в то время как ПЭГ (MM 5000) имел особо благоприятный эффект в снижении антигенности белка. (F.М. Veronese et al., In J.M. Harris, et al., Poly(Ethylene Glycol) Chemistry - Biotechnical and Biomedical Applications, 127-36.)

[00180] Способы получения пэгилированных связывающих лиганды молекул обычно включают в себя стадии (а) взаимодействия полипептида с полиэтиленгликолем (таким, как реакционноспособное производное сложного эфира или альдегида ПЭГ) в условиях, в которых связывающая лиганды молекула присоединяется к одному или нескольким группам ПЭГ, и (b) получение продукта(ов) реакции. В общем случае, оптимальные реакционные условия для реакции ацилирования можно определять на основании известных параметров и желаемого результата. Например, чем выше отношение ПЭПбелок, тем больше процентная доля поли-пэгилированного продукта. В некоторых вариантах осуществления связывающая лиганды молекула может содержать одну частицу ПЭГ на аминном конце. См. патент США №8234784, включенный в данный документ ссылкой. В некоторых вариантах осуществления описанная в данном документе молекула, связывающая лиганды, необязательно содержит по меньшей мере одну частицу ПЭГ, присоединенную к молекуле. Например, в некоторых вариантах осуществления, к аминному концу молекулы, связывающей лиганды, присоединена частица ПЭГ размером примерно 20-40 кДа.

[00181] Дериватизированные молекулы, связывающие лиганды, раскрываемые в данном документе, могут иметь дополнительное действие, повышенную или сниженную биологическую активность, или другие характеристики, такие как увеличенное или уменьшенное время полувыведения, по сравнению с недериватизированными молекулами.

Полинуклеотиды, кодирующие связывающие лиганды молекулы и экспрессирующие системы

[00182] Изобретение включает не только связывающие лиганды молекулы, связывающие единицы и полипептиды, описанные в данном документе, но также и нуклеиновые кислоты, кодирующие такие молекулы, векторы, содержащие такие молекулы, и клетки-хозяева, содержащие такие векторы. Способы, использующие любые молекулы, единицы, полипептиды, нуклеиновые кислоты, векторы и клетки-хозяева, рассматриваются как аспекты данного изобретения.

[00183] Иллюстративная последовательность, кодирующая человеческий VEGFR-3, приведена в SEQ ID NO: 1, и фрагменты последовательности SEQ ID NO: 1 (измененные в N2 секвоне) рассматриваются как кодирующие последовательности для связывающих лиганды полипептидов, описываемых в данном документе. (Например, включены фрагменты, кодирующие целиком VEGFR-3 ECD или его фрагменты.) Вследствие широко известного явления вырождения генетического кода, для любой кодирующей полипептид последовательности существуют многочисленные эквивалентные кодирующие последовательности, и все эти эквиваленты рассматриваются как аспекты данного изобретения.

[00184] Кроме того, вариант последовательности нуклеиновой кислоты подразумевается так же, как подразумевается вариант аминокислотной последовательности из ECD дикого типа рецептора VEGFR-3, описываемый выше. Вариант последовательности нуклеиновой кислоты можно охарактеризовать как процент идентичности по отношению к SEQ ID NO: 1 (например, не менее 80, 85, 90, 92, 93, 94, 95, 96, 97, 98 или 99% идентичности).

[00185] Вариант нуклеотидной последовательности также можно охарактеризовать его способностью к гибридизации с комплементом предпочтительной кодирующей последовательности. Молекулы нуклеиновых кислот включают те молекулы, которые включают в себя нуклеотидные последовательности, которые гибридизуются в средних или высокожестких условиях, определяемых в данном документе, с ECD-кодирующей последовательностью молекулы нуклеиновой кислоты, изложенной в SEQ ID NO: 1, или молекулой, кодирующей полипептид, причем данный полипептид включает в себя аминокислотную последовательность рецептора тирозинкиназ, изложенную в SEQ ID NO: 2 и 3, или фрагментом нуклеиновой кислоты, как описывается в данном документе, или фрагментом нуклеиновой кислоты, кодирующим полипептид, как описывается в данном документе.

[00186] Термин "особо жесткие условия" относится к таким условиям, которые предназначены обеспечить гибридизацию нитей ДНК, последовательности которых являются в высшей степени комплементарными, и исключить гибиридизацию в значительной степени несовпадающих ДНК. Жесткость гибридизации принципиально определяется температурой, ионной силой и концентрацией денатурирующих агентов, таких как формамид. Примерами "особо жестких условий" гибридизации и промывки являются 0,015 М хлорид натрия, 0,0015 М цитрат натрия при 65-68°С или 0,015 М хлорид натрия, 0,0015 М цитрат натрия, и 50% формамида при 42°С. См. Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, (Cold Spring Harbor, N.Y. 1989); и Anderson et al., Nucleic Acid Hybridization: a Practical approach, Ch. 4, IRL Press Limited (Oxford, England). Limited, Oxford, England. В гибридизацию могут быть включены другие агенты и промывочные буферы с целью уменьшения неспецифической и/или фоновой гибридизации. Примеры представляют собой 0,1% альбумин бычьей сыворотки, 0,1% поливинилпирролидон, 0,1% пирофосфат натрия, 0,1% додецилсульфонат натрия (NaDodSO4 или SDS), фиколл, раствор Денхардта, обработанную ультразвуком ДНК спермы лосося (или другую некомплементарную ДНК) и сульфат декстрана, хотя возможно применение и других пригодных агентов. Концентрация и типы этих добавок можно менять без заметного влияния на жесткость условий гибридизации. Эксперименты по гибридизации обычно проводят при рН 6,8-7,4; однако, при типичных значениях ионной силы раствора, скорость гибридизации практически не зависит от рН. См. Anderson et al., Nucleic Acid Hybridization: a Practical Approach, Ch. 4, IRL Press Limited (Oxford, England).

[00187] Факторы, влияющие на стабильность дуплекса ДНК, включают состав основания, длину и степень несовпадения щелочных пар. Специалист в данной области может подобрать условия гибридизации, учитывающие эти переменные и позволяющие ДНК с различным сродством последовательностей формировать гибриды. Температуру плавления отлично подобранного дуплекса ДНК можно установить, используя следующее уравнение:

[00188] Tm(°С)=81,5+16,6(log[Na+])+0,41(%G+C)-600/N-0,72(% формамида)

[00189] где N представляет собой образовавшийся дуплекс, [Na+] представляет собой молярную концентрацию ионов натрия в растворе для гибридизации или в промывочном растворе, %G+C является процентной долей (гуанин + цитозин) в пересчете на гибрид. Для неидеально подобранных гибридов, температура плавления снижается примерно на 1°С на каждый 1% ошибочных спариваний.

[00190] Термин "условия средней жесткости" относится к условиям, при которых способен образовываться ДНК дуплекс с более высоким числом ошибочных спариваний пар оснований, чем могло бы произойти при "особо жестких условиях". Примерами типичных "условий средней жесткости" являются 0,015 М хлорид натрия, 0,0015 М цитрат натрия при 50-65°С или 0,015 М хлорид натрия, 0,0015 М цитрат натрия, и 20% формамида при 37-50°С. В качестве примера, условия "средней жесткости" при 50°С в 0,015 М ионах натрия приведут к примерно 21% ошибочных спариваний.

[00191] Хорошую оценку температуры плавления в 1М NaCl* для олигонуклидных зондов вплоть до примерно 20-и можно получить, используя:

[00192] Tm=2°С на А-Т пару оснований +4°С на G-C пару оснований

[00193] *Концентрация ионов натрия в 6х соли цитрата натрия (SSC) составляет 1 М. См. Suggs et al., Developmental Biology Using Purified Genes, p. 683, Brown and Fox (eds.) (1981).

[00194] Особо жесткие условия промывки для олигонуклеотидов представляют собой обычно температуру, которая на 0-5°С ниже Тпл. олигонуклеотида в 6х SSC, 0,1% SDS.

[00195] Различие в последовательности нуклеиновой кислоты может привести к консервативным и/или неконсервативным изменениям аминокислотной последовательности по отношению к аминокислотной последовательности в SEQ ID NO: 2 или SEQ ID NO: 3. Изобретение также направлено на выделение и/или очистку ДНК, которая соответствует, или которая гибридизуется в жестких условиях с, любой одной из вышеуказанных последовательностей ДНК.

[00196] Молекула нуклеиновой кислоты, кодирующая весь или часть полипептида данного изобретения, такой как связывающая лиганды молекула или связывающая единица, описываемые здесь, могут быть получены различными способами, включая, без ограничения, химический синтез, скрининг цДНК или геномных библиотек, срининг библиотек экспрессии и/или амплификацию с использованием ПЦР цДНК или геномной ДНК. Эти и другие способы, полезные при выделении такой ДНК, приведены, например, в работе Sambrook, et al., "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), в работе Ausubel, et al., eds., "Current Protocols In Molecular Biology," Current Protocols Press (1994), и в работе Berger and Kimmel, "Methods In Enzymology: Guide To Molecular Cloning Techniques," vol. 152, Academic Press, Inc., San Diego, Calif. (1987). Предпочтительными последовательностями нуклеиновой кислоты являются последовательности млекопитающих, таких как человек, крыса и мышь.

[00197] Химический синтез молекул нуклеиновой кислоты можно выполнить, используя способы, хорошо известные в области техники, такие как те, что приведены в работе Engels, et al., Angew. Chem. Intl. Ed., 28: 716-734 (1989). Эти способы включают, в частности, фосфотриэфирный, фосфоамидиновый и Н-фосфонатный способы синтеза нуклеиновой кислоты. Нуклеиновые кислоты, имеющие в длину больше чем 100 нуклеотидов, можно синтезировать в виде нескольких фрагментов, причем каждый фрагмент будет в длину иметь вплоть до примерно 100 нуклеотидов. Затем фрагменты можно лигировать вместе, как описано ниже, с образованием интересующей нуклеиновой кислоты полной длины. Предпочтительным способом является синтез на полимерной подложке с использованием стандартной химии фосфорамидита.

[00198] Термин "вектор" относится к амплификации, репликации молекулы нуклеиновой кислоты и/или средству экспрессии, часто получаемому в виде плазмиды и вирусной системы ДНК или РНК, где плазмида или вирусные ЛНК или РНК могут функционировать в выбранной клетке-хозяине, такой как бактериальная, дрожжевая, растительная клетка-хозяин и/или клетки беспозвоночных и/или млекопитающих. Вектор может оставаться независимым от геномной ДНК клетки-хозяина или может интегрироваться полностью или частично с геномной ДНК. Вектор будет содержать все необходимые элементы так, чтобы быть способным функционировать в любой клетке-хозяине, с которой он совместим. Такие элементы приведены ниже.

[00199] Когда нуклеиновая кислота, кодирующая полипептид или его фрагмент, уже изолирована, ее предпочтительно вводят в вектор амплификации и/или экспрессии с целью увеличения числа копий гена и/или экспрессии кодируемого полипептида в подходящей клетке-хозяине и/или для преобразования клеток в организм-мишень (для экспрессии полипептида in vivo). Пригодны многие доступные в продаже векторы, хотя "специально изготовленные" векторы также можно использовать. Вектор выбирают так, чтобы он был способным функционировать в определенной клетке-хозяине или ткани-хозяине (т.е. для репликации и/или экспрессии). Полипептид или его фрагмент можно амплифицировать/экспрессировать в прокариотических и/или эукариотических клетках-хозяевах, например, клетках дрожжей, насекомых (системы бакуловируса), растений и млекопитающих. Выбор клетки-хозяина будет по меньшей мере частично зависеть от того, требуется ли гликозилирование полипептида или его фрагмента. Если да, то предпочтительны клетки дрожжей, насекомых или млекопитающих; клетки дрожжей и млекопитающих будут гликозилировать полипептид, если в аминокислотной последовательности присутствует сайт гликозилирования.

[00200] Обычно, векторы, используемые в любой клетке-хозяине, будут содержать 5' фланкирующую последовательность и другие управляющие элементы, такие как энхансер(ы), промотор, элемент точки начала репликации, элемент терминации транскрипции, полную последовательность интрона, содержащую сайт донора и акцептора сплайсинга, последовательность сигнального пептида, элемент сайта связывания рибосомы, последовательность полиаденилирования, полилинкерная область для вставки нуклеиновой кислоты, кодирующей подлежащий экспрессии полипетид, и элемент селектируемого маркера. По выбору, вектор может содержать последовательность метки ("tag"), т.е. олигунуклеотидную последовательность, расположенную на 5' или 3' кодирующей последовательности, кодирующей поли-His (такой, как гекса-His), или другую малую иммуногенную последовательность. Эта метка будет экспрессироваться вместе с белком и может служить в качестве метки аффинности при очистке полипептида от клетке-хозяина. По выбору, маркер можно впоследствии удалять из очищенного полипептида различными путями, например, используя выбранную пептидазу.

[00201] Конструкция вектор/экспрессия может по выбору включать элементы, такие как 5'-фланкирующая последовательность, точка начала репликации, последовательность терминации транскрипции, последовательность селектируемого маркера, сайт связывания рибосомы, сигнальная последовательность и одну или несколько интронных последовательностей. 5'-фланкирующая последовательность может быть гомологической (т.е. происходить из той же разновидности организма и/или штамма, что и клетке-хозяин), гетерологичной (т.е. происходить из другой разновидности организма и/или штамма), гибридной (т.е. комбинации 5'-фланкирующих последовательностей из более чем одного источника), синтетической, или может быть нативной 5'-фланкирующей последовательностью. Как таковой источник 5'-фланкирующей последовательности может быть любым одноклеточным прокариотическим или эукариотическим организмом, любым беспозвоночным организмом или любым растением, при условии, что 5'-фланкирующая последовательность способна функционировать в системе клетки-хозяина и активироваться ею.

[00202] Элемент терминации транскрипции обычно находится на 3' в конце кодирующей полипептид последовательности и служит для терминации транскрипции полипептида. Обычно элемент терминации транскрипции в прокариотических клетках представляет собой G-C-обогащенный фрагмент, за которым следует поли-Т последовательность. Такие элементы можно клонировать из библиотеки, покупаемой у производителя как часть вектора, и легко синтезируется.

[00203] Гены селектируемого маркера кодируют белки, необходимые для выживания и роста клетки-хозяина в селективной культуральной среде. Типичные гены селектируемого маркера кодируют белки, которые (а) придают устойчивость к антибиотикам или другим токсинам, например, ампициллину, тетрациклину или канамицину, клеткам-хозяевам, (b) дополняют ауксотрофные дефициты клетки; или (с) поставляют питательные вещества, не доступные в комплексных средах.

[00204] Связывающий участок рибосомы, обычно называемый Шайно-Дальгарно последовательностью (прокариоты) или Козак последовательностью (эукариоты), необходим для трансляции инициирования мРНК. Участок обычно находится в 3' по отношению к промотору и в 5' по отношению к кодирующей последовательности синтезируемого полипептида. Шайно-Дальгарно последовательность изменчива, но обычно представляет собой полипурин (т.е. имеет высокое содержание A-G). Были определены многие Шайно-Дальгарно последовательности, каждые из которых можно легко синтезировать, используя изложенные выше способы.

[00205] Все участки, изложенные выше, а также другие участки, полезные в данном изобретении, хорошо известны специалисту в данной области и описаны, например, в работе Sambrook, et al., "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) и Berger, et al., eds., "Guide To Molecular Cloning Techniques," Academic Press, Inc., San Diego, Calif. (1987].

[00206] В тех вариантах осуществления изобретения, где необходимо выделять рекомбинантный полипептид, сигнальная последовательность предпочтительно включена с целью непосредственного выделения из клетки, где он синтезируется. Обычно полинуклеотид, кодирующий сигнальную последовательность, расположен в 5'-конце кодирующей области. Идентифицированы многие сигнальные последовательности, и любые из них, способные функционировать в целевой клетке или организмах, можно использовать в сочетании с трансгеном.

[00207] Во многих случаях транскрипция гена усиливается в присутствии одного или нескольких интронов на векторе. Интрон может быть природным, особенно если трансген имеет полную длину или представляет собой фрагмент последовательности геномной ДНК. Интрон может быть гомологичным или гетерологичным по отношению к трансгену и/или к трансгенному млекопитающему, которому ввели этот ген. Важно положение интрона по отношению к промотору и трансгену, поскольку при транскрипции интрон должен оставаться эффективным. Предпочтительным положением интрона является 3' относительно сайта точки начала транскрипции и 5' относительно последовательности поли-А терминации транскрипции. Для трансгенов цДНК интрон помещают на одну сторону или на другую сторону (т.е. 5' или 3') последовательности, кодирующей трансген. Интрон из любого источника, включая любые вирусные, прокариотические и эукариотические (растительные или животные) организмы, можно использовать для экспрессии полипептида, при условии что он совместим с клеткой-хозяином (клетками-хозяевами), в которую(ые) его вводят. Также в данный документ включены синтетические интроны. По выбору, в векторе можно использовать больше одного интрона.

[00208] Иллюстративные векторы для рекомбинантной экспрессии - это векторы, совместимые с бактериальными клетками-хозяевами и клетками насекомых и млекопитающих. Такие векторы включают, в частности, pCRII (Invitrogen Company, San Diego, Calif.), pBSII (Stratagene Company, La Jolla, Calif.) и pETL (BlueBacll; Invitrogen).

[00209] После окончания сборки вектора и вставки нуклеиновой кислоты в правильный сайт вектора, готовый вектор можно вводить в подходящую клетку-хозяина для амплификации и/или экспрессии полипептида. Обычно используемые клетки включают: Прокариотические клетки, такие, как грамотрицательные или грамположительные бактерии, а именно, любые штаммы Е.coli, Bacillus, Streptomyces, Saccharomyces, Salmonella и подобные им; эукариотические клетки, такие как клетки СНО (клетки яичников китайского хомячка); клетки 293 человеческой почки; клетки COS-7; клетки насекомых, такие как Sf4, Sf5, Sf9 и Sf21 и High 5 (все производства компании Invitrogen Company, San Diego, Calif.); растительные клетки и дрожжевые клетки, такие как Saccharomyces и Pichia. Пригодна любая способная к трансформации или трансфекции клетка или клеточная линия, полученная из любого организма, такого как бактерия, дрожжи, грибы, однодольные и двудольные растения, растительные клетки и животные.

[00210] Вставку (также называемую "трансформация" или трансфекция") вектора выбранную клетку-хозяина можно выполнять, используя такие способы, как способы с использованием хлорида кальция, электропорации, микроинъекции, липофекции или способа с DEAE-декстраном. Выбранные способы частично будут являться функцией типа клетки-хозяина, предназначенной к использованию. Эти способы и другие подходящие способы хорошо известны специалисту в данной области и изложены, например, в указанной выше работе Sambrook, et al.

[00211] Клетку-хозяина, содержащую вектор (т.е. трансформированная или трансфицированная), можно культивировать, используя стандартную среду, хорошо известную специалисту в данной области. Среда обычно содержит все питательные вещества, необходимые для роста и выживания клеток. Подходящими ростовыми средами для клеток Е.Coli, являются, например, бульон Лурия (LB) и/или бульон Тартоффа-Хоббса (ТВ). Подходящими средами для культивирования эукариотических клеток являются RPMI 1640, MEM, DMEM, каждую из которых можно дополнять сывороткой и/или факторами роста, если это требуется для определенной выращиваемой клеточной линии. Подходящей средой для культур насекомых является среда Грейс, дополненная по мере необходимости yeastolate, лактальбумин гидролизатом и/или фетальной телячьей сывороткой.

[00212] Обычно антибиотик или другое вещество, полезное для селективного роста трансформированных клеток, можно вносить только в качестве дополнения к среде. Выбор вещества для данной цели будет зависеть от элемента селектируемого маркера, находящегося на плазмиде, с помощью которой трансформировали клетку-хозяина. Например, если элемент селектируемого маркера устойчив к канамицину, добавляемым к культуральной среде веществом будет канамицин.

[00213] Количество полипептида, производимого в клетке-хозяине можно оценить, используя стандартные способы, известные в области техники. Такие способы включают, без ограничения, Вестерн-блоттинг анализ, электрофорез в ДСН-полиакриламидном геле, неденатурирующий гель-электрофорез, разделение путем ВЭЖХ, иммуноосаждение и/или анализ связывания.

[00214] Если полипептид был сконструирован для выделения из клетки-хозяина, основное количество полипептида скорее всего будет в клеточной культуральной среде. Однако, если полипептид не выделяется из клетки-хозяина, он будет находиться в цитоплазме (в случае эукариотических, грамположительных бактериальных клеток-хозяев и клеток насекомых) или в периплазме (в случае грамотрицательных бактериальных клеток-хозяев).

[00215] Для внутриклеточных полипептидов, клетки-хозяева сначала механически или осмотически разрушают с целью высвобождения цитоплазматического содержимого в забуференный раствор. Затем полипептид выделяют из этого раствора.

[00216] В случае долговременного производства с высоким выходом рекомбинантного полипептида, предпочтительна стабильная экспрессия. Например, клеточные линии, которые стабильно экспрессируют интересующий полипептид, можно преобразовывать, используя векторы для экспрессии, которые могут содержать вирусные точки начала репликации и/или элементы эндогенной экспрессии и ген селектируемого маркера на том же самом или отдельном векторе. Вслед за введением вектора клеткам можно позволить расти 1-2 дня в обогащенной среде, прежде чем их переводить в селективную среду. Целью селектируемого маркера является придание устойчивости селекции, и его наличие обеспечивает рост и восстановление клеток, которые успешно экспрессируют введенные последовательности. Устойчивые клоны стабильно трансформированных клеток можно пролиферировать, используя методы тканевой культуры в зависимости от типа клетки. Клеточную линию, постоянно обогащаемую такими клетками, можно затем выделять для получения стабильной клеточной линии.

[00217] Особенно предпочтительный способ настоящего изобретения осуществляется путем использования амплификации дигидрофолатрекутразы (DHFR) в DHFR-дефицитных клетках СНО, с помощью использования последовательно увеличивающегося уровня метотрексата, как описано в публикации US 4889803. Полученный полипептид может быть в гликозилированной форме.

[00218] Очистку полипептида от раствора можно проводить, используя различные методы. Если полипептид синтезировали таким образом, что он содержит метку (tag) такую, как гексагистидин или другой малый пептид либо на своем карбоксильном, либо на аминном конце, его можно в основном очищать в одноступенчатом процессе, пропуская раствор через аффинную колонку, где матрица колонки имеет высокую аффинность к метке или непосредственно к полипептиду (т.е. моноклональное антитело, специфически распознающее полипептид). Например, полигистидин связывается специфически и с большой аффинностью с никелем, так, аффинная колонка из никеля (такая как никелевые колонки Qiagen) можно использовать для очистки полипептида с меткой His. (См., например, Ausubel, et al., eds., "Current Protocols In Molecular Biology," Section 10.11.8, John Wiley & Sons, New York (1993)).

[00219] Сильная аффинность лиганда к своему рецептору позволяет осуществлять аффинную очистку связывающих лиганды молекул, и связывающих лиганды молекул, используя аффинную матрицу, содержащую комплементарного партнера по связыванию. Аффинную хроматографию можно использовать, например, используя либо натуральных партнеров по связыванию (например, лиганды при очистке связывающих лиганды молекул с аффинностью к ним же) или антитела, получаемые с использованием стандартных процедур (например, иммунизацией мыши, кролика или других животных соответствующим полипептидом). Пептиды настоящего изобретения можно использовать для производства таких антител. Можно использовать известные антитела или антитела к известным рецепторам факторов роста, если они разделяют эпитоп с целевой связывающей лиганды молекулой.

[00220] Кроме того, можно использовать другие хорошо известные процедуры очистки. Такие процедуры включают, без ограничения, ионообменную хроматографию, хроматографию на молекулярных ситах, ВЭЖХ, электрофорез на нативном геле в сочетании с элюированием геля, и препаративное изоэлектрическое фокусирование (прибор/методика "Isoprime", Hoefer Scientific). В некоторых случаях два или более из этих методов можно комбинировать для достижения повышенной очистки. Предпочтительные способы очистки включают мечение полигистидином и ионообменную хроматографию в комбинации с препаративным изоэлектрическим фокусированием.

[00221] Полипептид, находящийся в периплазматическом пространстве бактерии или в цитоплазме эукариотических клеток, содержимом периплазмы или цитоплазмы, включая тела включения (бактерии), если перерабатываемый полипептид образовал такие комплексы, можно экстрагировать из клетки-хозяина, используя стандартные методы, известные специалисту. Например, клетку-хозяина можно лизировать с целью высвобождения содержимого периплазмы, используя французский пресс, гомогенизацию и/или обработку ультразвуком. Гомогенизат затем можно центрифугировать.

[00222] Если полипептид образовал тела включения в периплазме, тела включения часто можно связывать с внутренними и/или внешними клеточными мембранами и, таким образом, они в основном будут находиться в материале осадка после центрифугирования. Материал осадка затем можно обрабатывать хаотропным агентом, таким как гуанидин или мочевина с целью высвобождения, разбивки и солюбилизации тел включения. Солюбилизированный полипептид можно затем анализировать, используя гель-электрофорез, иммуноосаждение и т.п. Если требуется выделять полипептид, выделение можно выполнять, используя стандартные способы, такие как изложены ниже и в публикации [Marston, et al., Meth. Enz., 182: 264-275 (1990).]

Генная терапия

[00223] В некоторых вариантах осуществления полинуклеотиды данного изобретения дополнительно содержат добавочные последовательности для облегчения проведения генной терапии. В одном варианте осуществления для генной терапии применяют "голый" трансген, кодирующий связывающую лиганды молекулу, описанную в данном документе (т.е. трансген без вирусной, липосомальной или другого сорта вектора для облегчения трансфекции).

[00224] Векторы также полезны для схем лечения "генной терапии", где полинуклеотид, кодирующий связывающий лиганды полипептид или молекулу, вводят субъекту, нуждающемуся в подавлении неоваскуляризации, в том виде, которые заставляет клетки субъекта экспрессировать in vivo связывающую лиганды молекулу данного изобретения. Также здесь применимы аспекты генной терапии, описанные в публикации патентов США №2002/0151680 и WO 01/62942, оба из которых включены в данный документ ссылкой.

[00225] Для введения в клетку-хозяина полинуклеотида, кодирующего связывающую лиганды молекулу, описываемую в данном документе, можно использовать любой подходящий вектор. Иллюстративные векторы, описанные в литературе, включают дефицитные по репликации ретровирусные векторы, включая, но не ограничиваясь этим, лентивирусные векторы (Kim et al., J. Virol., 72(1): 811-816, 1998; Kingsman & Johnson, Scrip Magazine, October, 1998, pp. 43-46); аденоассоциированные вирусные (AAV) векторы (патенты США №№5474935I, 5139941, 5622856, 5658776, 5773289, 5789390, 5834441, 5863541, 5851521, 5252479, Gnatenko et al., J. Invest. Med., 45: 87-98, 1997); аденовирусные (AV) векторы (патенты США №№5792453, 5824544, 5707618, 5693509, 5670488, 5585362; Quantin et al., Proc. Natl. Acad. Sci. USA, 89: 2581-2584, 1992; Stratford Perricadet et al., J. Clin. Invest., 90: 626-630, 1992; и Rosenfeld et al., Cell, 68: 143-155, 1992); аденовирусный аденоассоциированный вирусный химерный (патент США №5856152) или вирусный коровьей оспы или герпеса (патенты США №№5879934, 5849571, 5830727, 5661033, 5,328,688); Липофектин опосредованный перенос генов (BRL); липосомные векторы (патент США №№5631237, Liposomes comprising Sendai virus proteins); и их комбинации. Все вышеперечисленные документы включены во всей своей полноте путем ссылки в состав данной заявки.

[00226] Другие рассматриваемые не вирусные механизмы доставки включают, но не ограничиваются этим, осаждение фосфатом кальция (Graham and Van Der Eb, Virology, 52: 456-467, 1973; Chen and Okayama, Mol. Cell Biol., 7: 2745-2752, 1987; Rippe et al., Mol. Cell Biol., 10: 689-695, 1990), DEAE-декстран (Gopal, Mol. Cell Biol., 5: 1188-1190, 1985), электропорацию (Tur-Kaspa et al., Mol. Cell Biol., 6: 716-718, 1986; Potter et al., Proc. Nat. Acad. Sci. USA, 81: 7161-7165, 1984), прямую микроинъекцию (Harland and Weintraub, J. Cell Biol., 101: 1094-1099, 1985.), ДНК-нагруженные липосом (Nicolau and Sene, Biochim. Biophys. Acta, 721: 185-190, 1982; Fraley et al., Proc. Natl. Acad. Sci. USA, 76: 3348-3352, 1979; Felgner, Sci Am. 276(6): 102-6, 1997; Felgner, Hum Gene Ther. 7(15): 1791-3, 1996), ультразвуковую обработку клеток (Fechheimer et al., Proc. Natl. Acad. Sci. USA, 84: 8463-8467, 1987), бомбардировку генов с использованием высокоскоростных микроснарядов (Yang et al., Proc. Natl. Acad. Sci USA, 87: 9568-9572, 1990), и рецептор-опосредованную трансфекцию (Wu and Wu, J. Biol. Chem., 262: 4429-4432, 1987; Wu and Wu, Biochemistry, 27: 887-892, 1988; Wu and Wu, Adv. Drug Delivery Rev., 12: 159-167, 1993).

[00227] Экспрессионная конструкция (да и вообще описываемая здесь связывающая лиганды молекула) может быть заключена в липосоме. Липосомы представляют собой везикулярные структуры, характеризуются мембраной из двух фосфолипидных слоев и внутренней водной средой. Мульти-пластинчатые липосомы имеют многочисленные липидные слои, разделенные водной средой. Они образуются спонтанно при суспендировании избытка фосфолипидов в водном растворе. Липидные компоненты подвергаются самоорганизации до формирования замкнутых структур и заключении в них воды и растворенных веществ между двойными липидными слоями (Ghosh and Bachhawat, In: Liver diseases, targeted diagnosis and therapy using specific receptors and ligands, Wu G, Wu С ed., New York: Marcel Dekker, pp. 87-104, 1991). Добавка ДНК к катионным липосомам приводит к топологическому переходу от липосом к оптически двулучепреломляющим жидкокристаллическим конденсированным глобулам (Radler et al., Science, 275(5301): 810-4, 1997). Эти ДНК-липосомные комплексы являются потенциальными не вирусными векторами для применения в генной терапии и доставке.

[00228] Опосредованная липосомами доставка нуклеиновой кислоты и экспрессия in vitro чужой ДНК были успешными. Также в настоящем изобретении рассматриваются различные коммерческие подходы к вовлечению технологии "липофекции". В некоторых вариантах осуществления изобретения липосомы могут образовывать комплексы с гемагглютинирующим вирусом (HVJ). Это, как показано, облегчает слияние с клеточной мембраной и ускоряет клеточное вхождение липосомо-инкапсулированной ДНК (Kaneda et al., Science, 243: 375-378, 1989). В других вариантах липосома может комплексоваться или использоваться вместе с ядерными негистонными хромосомными белками (HGM-1) (Kato et al., J. Biol. Chem., 266: 3361-3364, 1991). Еще в других вариантах липосома может комплексоваться или применяться вместе с обоими HVJ и HMG-1. Благодаря тому, что такие экспрессионные конструкции были успешно применены в переносе и экспрессии нуклеиновой кислоты in vitro и in vivo, они тем самым являются применимыми для настоящего изобретения.

[00229] Другим вариантом осуществления данного изобретения для переноса экспрессионной конструкции "голой" ДНК в клетку может быть бомбардировка частицами. Этот способ зависит от возможности ускорять микроснаряды с покрытием из ДНК до больших скоростей, позволяющим им проходить сквозь клеточные мембраны и проникать в клетки, не убивая их (Klein et al., Nature, 327: 70-73, 1987). Были разработаны несколько устройств для ускорения малых частиц. Одно такое устройство основано на высоковольтном разряде, создающем электрический ток, который в свою очередь обеспечивает движущую силу (Yang et al., Proc. Natl. Acad. Sci USA, 87: 9568-9572, 1990). Используемые микроснаряды состоят из биологически инертных веществ, таких как частицы вольфрама или золота.

[00230] В вариантах осуществления, использующих вирусный вектор, предпочтительные нуклеотиды по-прежнему включают подходящие промоторы и последовательность полиаденилирования, как описано выше. Кроме того, будет несложно понять, что в этих вариантах осуществления полинуклеотид дополнительно включает векторные полинуклеотидные последовательности (например, аденовирусные полинуклеотидные последовательности), оперативно связанные с последовательностью, кодирующей полипептид данного изобретения.

Терапевтические применения связывающих лиганды молекул

[00231] Связывающие лиганды полипептиды и молекулы, описываемые в данном документе, и полинуклеотиды и векторы, кодирующие их, полезны для ингибирования клеточных процесов, опосредованных факторами роста эндотелия, которые индуцируют трансдукцию сигнала через VEGFR-2 or VEGFR-3, показаны для применения в профилактике или терапии расстройств, связанных с абберантным ангиогенезом и/или лимфангиогенезом (например, различные глазные расстройства и онкологические заболевания), которые стимулируются действием факторов роста на эти рецепторы. Связывающие лиганды полипептиды и молекулы, описываемые в данном документе, и полинуклеотиды и векторы, кодирующие их, полезны для применения в лечении или предотвращении любой болезни или состояния, которое улучшается, облегчается, подавляется и или предотвращается путем удаления, ингибирования или снижения уровней VEGF-C и/или VEGF-D. Не исчерпывающий список специфических состояний, улучшаемых путем ингибирования или уменьшения уровней VEGF-C и/или VEGF-D (и, в частности, хотя бы VEGF-C) включают: клинические состояния, характеризующиеся повышенной пролиферацией клеток эндотелия сосудов, проницаемостью сосудов, отеком или воспалением, такими как отек мозга, связанный с повреждением, таким как инсульт или опухоль; отеком, связанным с воспалительными расстройствами, такими как псориаз или артрит, включая ревматоидный артрит; астмой; генерализованным отеком, связанным с ожогами; асцитом и плевритом, связанными с опухолями, воспалением или травмой; хроническим воспалением воздушных путей; синдромом капиллярной утечки; сепсисом; болезнями почек, связанными с повышенной утечкой белка; и глазными расстройствами, такими как возрастная макулярная дегенерация и диабетическая ретинопатия

[00232] Хотя для краткости многие из способов в отношении композиций, включающих связывающую лиганды молекулу, описаны ниже, следует понимать, что рассматривается практическое приложение изобретения с любой из конструкций, описываемых в данном документе (связывающие лиганды полипептиды, молекулы и конструкции, и полинуклеотиды, кодирующие их, димеры и другие мультимперы, и т.п.).

[00233] Иллюстративным терапевтическим применением является способ подавления неоваскуляризации у нуждающегося в этом субъекта, включающий введение субъекту композиции, содержащей описываемую здесь связывающую лиганды молекулу, в количестве, эффективном для подавления неоваскуляризации у субъекта. В некоторых вариантах осуществления неоваскуляризация включает хориоидальную или ретинальную неоваскуляризацию. В некоторых вариантах осуществления неоваскуляризация включает опухолевую неоваскуляризацию, которая встречается при злокачественных новообразованиях и других опухолях.

[00234] В другом аспекте описываемый здесь способ профилактики и терапии глазного расстройства, связанного с неоваскуляризацией, включает введение субъекту, нуждающемуся в профилактике или лечении глазного расстройства, композиции, содержащей связывающую лиганды молекулу, описываемую здесь.

[00235] В другом аспекте здесь описывается способ профилактики или терапии глазного расстройства, которое приводит к отеку сетчатки, включающий введение субъекту, нуждающемуся в профилактике или лечении глазного расстройства или заболевания, композиции, содержащей связывающую лиганды молекулу, описываемую здесь.

[00236] Примеры, глазных расстройств, которые можно лечить, включают хориоидальную неоваскуляризацию, диабетический макулярный отек, возрастную макулярную дегенерацию, пролиферативную диабетическую ретинопатию, окклюзию вен сетчатки и неоваскуляризацию роговицы/отторжение трансплантата. Предпочтительно, применяемое количество связывающей лиганды молекулы является достаточным для ингибирования связывания лиганда VEGF-C и/или VEGF-D с VEGFR-3 (а также, предпочтительно, и с VEGFR-2) или стимулирующего действия VEGF-C и/или VEGF-D на VEGFR-3 (а также, предпочтительно, и на VEGFR-2).

[00237] В одном варианте осуществления глазное расстройство представляет собой возрастную макулярную дегенерацию. Примерами возрастной макулярной дегенерации являются не неоваскулярная (также известная как "сухая") и неоваскулярная (также известная как "влажная") макулярная дегенерация. В предпочтительном варианте осуществления глазное расстройство представляет собой влажную возрастную макулярную дегенерацию. Лечение или предотвращение влажной возрастной макулярной дегенерации также охватывает лечение или предотвращение хориоидальной неоваскуляризации или отслоения пигментного эпителия.

[00238] В одном варианте осуществления глазное расстройство представляет собой полиповидную хориоидальную васкулопатию. Полипоидная хориоидальная васкулопатия характеризуется патологическими изменениями во внутренних отделах хориоидальной сосудистой сети, приводящими к выпуклой аневризме или выступу (Ciardella et al. (2004) Surv Ophthalmol. 49: 25-37).

[00239] В одном варианте осуществления глазное расстройство представляет собой состояние, связанное с хориоидальной неоваскуляризацией. Примеры состояний, связанных с хориоидальной неоваскуляризацией включают дегенеративное, воспалительное, травматическое или идиопатическое состояние. Лечение или предотвращение состояния, связанного с хориоидальной неоваскуляризацией, также охватывает encompasses лечение или предотвращение наследственных дегенеративных расстройств. Примеры наследственных дегенеративных расстройств включают вителлиформную макулярную дистрофию, fundus flavimaculatus и друзы диска зрительного нерва. Примеры дегенеративных состояний, связанных с хориоидальной неоваскуляцией, включают дегенеративные изменения при миопии и ангиоидные полосы. Лечение и предотвращение воспалительных расстройств, связанных с хориоидальной неоваскуляризацией, также охватывают лечение или предотвращение синдрома глазного гистоплазмоза, мультифокального хориоидита, серпигинозного хориоидита, токсоплазмоза, токсокароза, краснухи, синдрома Фогта-Коянаги-Харада, синдрома Бехчета и симпатической офтальмии. Лечение и предотвращение травматических расстройств, связанных с хориоидальной неоваскуляризацией, также охватывают лечение или предотвращение хориоидального разрыва или травматического состояния, вызванного интенсивной фотокоагуляцией.

[00240] В одном варианте осуществления глазное расстройство представляет собой гипертоническую ретинопатию.

[00241] В одном варианте осуществления глазное расстройство представляет собой диабетическую ретинопатию. Диабетическая ретинопатия может быть непролиферативной или пролиферативной диабетической ретинопатией. Примеры непролиферативной диабетической ретинопатии включают макулярный отек и макулярную ишемию.

[00242] В одном варианте осуществления глазное расстройство представляет собой серповидно-клеточную ретинопатию.

[00243] В одном варианте осуществления глазное расстройство представляет собой состояние, связанное с периферической неоваскуляризацией сетчатки. Примеры состояний, связанных с периферической неоваскуляризацией сетчатки, включают ишемическое васкулярное заболевание, воспалительное заболевание с возможной ишемией, недержание пигмента, пигментный ретинит, ретиношизис или хроническое отслоение сетчатки.

[00244] Примеры ишемического васкулярного заболевания включают пролиферативную диабетическую ретинопатиею, окклюзию ответвлений вен сетчатки, окклюзия ответвлений артериол сетчатки, каротидно-кавенозный свищ, серповидно-клеточную гемоглобинопатию, несерповидно-клеточную гемоглобинопатию, синдром IRVAN (васкулитные расстройства сетчатки, характеризующиеся идиопатическим васкулитом сетчатки, аневризмом и нейроретинитом), эмболизацию сетчатки, ретинопатию недоношенных, семейную экссудативную витреоретинопатию, синдром гипервязкости, синдром дуги аорты или болезнь Илза. Примеры серповидно-клеточной гемоглобинопатии включают SS гемоглобинопатию и SC гемоглобинопатию. Примеры несерповидно-клеточной гемоглобинопатии включают АС гемоглобинопатию и AS гемоглобинопатию. Примеры синдрома гипервязкости включают лейкемию, макроглобулинемию Вальденстрема, множественную миелому, полицитемию или миелопролиферативное расстройство.

[00245] Лечение или предотвращение воспалительных расстройств с возможной ишемией также охватывает лечение или предотвращение васкулита сетчатки, связанного с системным заболеванием, васкулита сетчатки, связанного с инфекционным агентом, увеита или vitiliginous chorioretinitis. Примеры системного заболевания включают системную красную волчанку, болезнь Бехчета, воспалительное заболевание кишечника, саркоидоз, рассеянный склероз, гранулематоз Вегнера и узелковый полиартрит. Примеры инфекционных агентов включают бактериальные агенты, которые являются возбудителями сифилиса, туберкулеза, болезнь Лайма или болезнь кошачьих царапин, вирус, такой как вирус герпеса, или паразита, такого как Toxocara canis или Toxoplasma gondii. Примеры увеита включают pars planitis или гетерохромию Фукса.

[00246] В одном варианте осуществления глазное расстройство представляет собой ретинопатию недоношенных. Ретинопатия недоношенных может возникать из-за ненормального роста кровеносных сосудов в васкулярном русле, поддерживающем развивающуюся сетчатку (Pollan С (2009) Neonatal Netw. 28: 93-101).

[00247] В одном варианте осуществления глазное расстройство представляет собой венозное облитерирующее заболевание. Примеры облитерирующего заболевания включают окклюзию ответвлений вен сетчатки и окклюзию центральной вены сетчатки. Окклюзия ответвлений вен сетчатки может представлять собой закупорку части циркуляции, отводящей кровь из сетчатки. Закупорка может вызывать давление подпора в капиллярах, которое может привести к кровоизлияниям и также к утечке жидкости и других составляющих крови.

[00248] В одном варианте осуществления глазное расстройство представляет собой артериальное облитерирующее заболевание. Примеры артериального облитерирующего заболевания включает окклюзию ответвлений артерии сетчатки, окклюзию центральной артерии сетчатки и глазной ишемический синдром. Окклюзия ответвлений артерии сетчатки (branch retinal artery occlusion, BRAO) может развиваться, когда закупоривается одно из ответвлений артериального кровоснабжения сетчатки.

[00249] В одном варианте осуществления глазное расстройство представляет собой центральную серозную хориоретинопатию (CSC). В одном варианте осуществления CSC характеризуется утечной жидкости в центральную макулу.

[00250] В одном варианте осуществления глазное расстройство представляет собой цистоидный отек макулы (СМЕ). В одном варианте осуществления СМЕ затрагивает центр сетчатки или макулу. В другом варианте осуществления СМЕ развивается после операции на катаракте.

[00251] В одном варианте осуществления глазное расстройство представляет собой телеангиэктазию сетчатки. В одном варианте осуществления телеангиэктазия сетчатки характеризуется расширением и извилистостью сосудов сетчатки и образованием многочисленных аневризмов. Идиопатическая юкстафовеолярная телеангиэктазия, милиарные аневризмы Лебера и болезнь Коатса представляют собой три типа телеангиэктазии сетчатки.

[00252] В одном варианте осуществления глазное расстройство представляет собой ретинальная артериальная макроаневризма.

[00253] В одном варианте осуществления глазное расстройство представляет собой ангиоматоз сетчатки. В одном варианте осуществления ангиоматоз сетчатки развивается, когда глазные сосуды образуют многочисленные ангиомы.

[00254] В одном варианте осуществления глазное расстройство представляет собой радиационно-индуцированную ретинопатию (RIRP). В одном варианте осуществления RIRP может иметь симптомы такие, как макулярный отек и непролиферативная и пролиферативная ретинопатия.

[00255] В одном варианте осуществления глазное расстройство представляет собой рубеоз радужки. В другом варианте осуществления рубеоз радужки приводит к возникновению неоваскулярной глаукомы. В другом варианте осуществления рубеоз радужки вызван диабетической ретинопатией, окклюзией центральной вены сетчатки, глазным ишемическим синдромом или хроническим отслоением сетчатки.

[00256] В одном варианте осуществления глазное расстройство представляет собой новообразование. Примеры новообразований включают опухоль на веке, опухоль конъюнктивы, хориоидальную опухоль, опухоль радужки, опухоль зрительного нерва, опухоль сетчатки, инфильтративную внутриглазную опухоль и опухоль орбиты. Примеры опухоли на веке включают базально-клеточную карциному, плоскоклеточный рак, сальную карциному, злокачественную меланому, капиллярную гемангиому, гидроцистому, невус или себорейный кератоз. Примеры опухоли конъюнктивы включают конъюнктивальную саркому Капоши, плоскоклеточный рак, интраэпителиальную неоплазию конъюнктивы, эпибульбарный дермоид, конъюнктивальную лимфому, меланому, pingueculum или птеригиум. Примеры хориоидальной опухоли включают хориоидальный невус, хориоидальную гемангиому, метастатическую хориоидальную опухоль, хориоидальную остеому, хориоидальную меланому, меланому цилиарного тела или невус Ота. Примеры опухоли радужки включают передние увеальные метастазы, кисту радужки, меланоцитому радужки или жемчужную кисту радужки. Примеры опухоли зрительного нерва включают меланоцитому зрительного нерва, менингиому оболочки зрительного нерва, хориоидальную меланому, затрагивающую зрительный нерв или циркумпапиллярное метастазирование с оптической нейропатией. Примеры опухоли сетчатки включают гипертрофию пигментного эпителия сетчатки (retinal pigment epithelial - RPE), аденому RPE, карциному RPE, ретинобластому, гамартому RPE или ангиому фон Гиппеля. Примеры инфильтративной внутриглазной опухоли включают хронический лимфоцитарный лейкоз, инфильтративный хориоидит или внутриглазную лимфому. Примеры опухоли орбиты включают аденоидную кистозную аденому слезной железы, кавернозная гемангиома орбиты, лимфангиома орбиты, мукоцеле орбиты, псевдотумор орбиты, рабдомиосаркома орбиты, периокулярная гемангиома детства или склерозирующий орбитальный псевдотумор.

[00257] В дополнительном аспекте изобретение описывает способ лечения травмы глаза, включающий местное введение эффективного количества связывающей лиганды молекулы, описываемой в данном документе, нуждающемуся в этом субъекту таким образом, чтобы уменьшать травму глаза или улучшать ее состояние. Предпочтительно травма глаза представляет собой травму роговицы или травму конъюнктивы, и способ лечения уменьшает ангиогенез и воспаление, связанные с травмой глаза. В некоторых вариантах осуществления способ полезен в лечении острой или подострой травмы роговицы или травмы конъюнктивы. Лечение острой травмы роговицы можно проводить в течении 24 часов с момента ее возникновения, и она включает травму роговицы или травму конъюнктивы, вызванную проникающим объектом или посторонним предметом, или химической травмой или ожогом. Лечение подострой травмы можно проводить в течение вплоть до двух недель с момента травмы и может включать перечисленные выше травмы, а также травмы инфекционной этиологии. В некоторых вариантах осуществления травма глаза вызвана повреждением, например, хирургическая травма, химический ожог, трансплантат роговицы, инфекционные или воспалительные заболевания.

[00258] Продолжительность лечения будет различной в зависимости от травмы, но продолжительность лечения может быть короткой, например, вплоть до одного месяца, и может включать период наблюдения продолжительностью 3-6 месяцев, в ходе которого может быть проведено повторное лечение. При введении можно также включать второе средство, такое как иммуноподавляющее средство, например, один или несколько кортикостероидов, дексаметазон или циклоспорин А. Местное введение включает, например, введение связывающей лиганды молекулы в глазных каплях, применяемых в глаз, подконъюнктивальную инъекцию в глаз.

[00259] В дополнительном аспекте здесь описан способ вылечивания травмы глаза, включающий местное введение эффективного количества связывающей лиганды молекулы, описываемой в данном документе, нуждающемуся в этом субъекту таким образом, чтобы вылечивать травму глаза.

[00260] В дополнительном аспекте здесь описан способ уменьшения ангиогенеза или улучшения его симптомов, связанных с травмой глаза, включающий местное введение эффективного количества связывающей лиганды молекулы, описываемой в данном документе, нуждающемуся в этом субъекту таким образом, чтобы ангиогенез, связанный с травмой глаза, уменьшался или его симптомы улучшались.

[00261] В дополнительном аспекте здесь описан способ уменьшения воспаления или улучшения его симптомов, связанных с травмой глаза, включающий местное введение эффективного количества связывающей лиганды молекулы, описываемой в данном документе, нуждающемуся в этом субъекту таким образом, чтобы воспаление, связанное с травмой глаза, уменьшалось или его симптомы улучшались.

[00262] В дополнительном аспекте здесь описан способ введения связывающей лиганды молекулы настоящего изобретения для лечения ангиогенеза и/или воспаления, связанных с травмой глаза или инфекцией, включающий местное введение глазных капель, содержащих связывающую лиганды молекулу, описываемую в данном документе, или подконъюнктивальное введение путем инъекции или имплантации.

[00263] В дополнительном аспекте здесь описан способ увеличения продолжительности выживаемости трансплантата роговицы после пересадки роговицы у пациента путем введения пациенту эффективного количества фармацевтической композиции, содержащей связывающую лиганды молекулу, описываемую в данном документе, (посредством чего подавляют ангиогенез и/или лимфангиогенез в роговице пациента).

[00264] Исследование зависимости доза-ответ позволяет точно определять правильное количество применяемой связывающей лиганды молекулы. Эффективные количества можно установить, например, путем измерений аффинности связывания полипептида с целевым рецептором, количества рецептора, содержащегося на целевой клетке, предполагаемого объема разведения (например, вес пациента и объем крови в вариантах осуществления in vivo) и скорости клиренса полипептида. Например, в опубликованной литературе, описывающей дозирование известных антител к VEGF-C, также даются рекомендации для дозирования связывающих лиганды молекул, описываемых в данном документе. Для выработки рекомендаций по дозированию терапевтических молекул, описываемых в данном документе можно также использовать литературные источники, описывающие дозирование афлиберсепта (регенерона) - ловушки лигандов на основе VEGFR-1/VEGFR-2.

[00265] В некоторых вариантах осуществления при введении путем инъекции в стекловидное тело связывающую лиганды молекулу вводят в количестве, составляющем от примерно 2 мг до примерно 4 мг в каждый глаз (или от примерно 1 мг до примерно 3 мг, или от примерно 1 мг до примерно 4 мг, или от примерно 3 мг до примерно 4 мг, или от примерно 1 мг до примерно 2 мг в каждый глаз). В некоторых вариантах осуществления связывающую лиганды молекулу вводят в количестве, составляющем примерно 1 мг, или примерно 2 мг, или примерно 3 мг, или примерно 4 мг, или примерно 5 мг, или примерно 6 мг в каждый глаз. Связывающая лиганды молекула в некоторых вариантах осуществления присутствует в любом из количеств, перечисленных выше, в объеме, равном 10 мл, 15 мл, 20 мл, 25 мл, 30 мл, 35 мл, 40 мл, 45 мл, 50 мл, 60 мл, 70 мл, 80 мл, 90 мл, 95 мл или 100 мл. В некоторых вариантах осуществления связывающую лиганды молекулу вводят в концентрации, равной 2-4 мг/50 мл.

[00266] Связывающую лиганды молекулу, описываемую в данном документе, можно вводить исключительно как профилактическое лечение для предотвращения неоваскуляризации у субъекта, у которого существует риск развития глазного заболевания, связанного с неоваскуляризацией (например, диабетической ретинопатии, макулярной дегенерации), или в качестве терапевтического лечения субъектов, страдающих глазным заболеванием, с целью подавления неоваскуляризации в глазу нуждающегося в лечении субъекта.

[00267] Субъекты, у которых существует риск развития диабетической ретинопатии или макулярной дегенерации, включают субъектов в возрасте старше пятидесяти лет; субъектов, страдающих ревматоидным артритом, диабетиков, субъектов в отклонениями щитовидной железы, астматиков, субъектов, страдающих катарактой, субъектов, страдающих глаукомой, субъектов, страдающих волчанкой, субъектов, с высоким кровяным давлением и субъектов с отслоившейся сетчаткой. Другие факторы риска включают генетику, диету, курение и длительное пребывание в условиях недостаточного освещения.

[00268] В некоторых вариантах осуществления описан способ выбора схемы лечения для пациента, нуждающегося в нем, включающий обследование субъекта с целью выявления одного или нескольких симптомов глазного расстройства, связанного с неоваскуляризацией сетчатки, и назначение субъекту введения композиции, содержащей связывающую лиганды молекулу, описываемую в данном документе. В другом варианте осуществления описан способ лечения субъекта, страдающего от глазного расстройства, связанного с неоваскуляризацией сетчатки, включающий выявление у субъекта одного или нескольких симптомов глазного расстройства и введение субъекту композиции, содержащей связывающую лиганды молекулу. Симптомы, связанные с глазным расстройством, связанным с неоваскуляризацией сетчатки, включают, но не ограничиваются этим, нечеткость зрения и медленную потерю зрения со временем, мелкие частицы, плавающие в глазу, затенение или частичное выпадение полей зрения, искаженное зрение и куриную слепоту.

[00269] В некоторых вариантах осуществления описываемый здесь способ дополнительно включает назначение (или введение) стандартного режима ухода для лечения болезни сухих глаз. В контексте описываемых здесь способов выражение "стандартный уход" относится к лечению, который обычно принят лечащими врачами для определенных типов пациентов с выявленным типом заболевания. В случаях диабетической ретинопатии и макулярной дегенерации, например, аспектом изобретения является улучшение терапии стандартного ухода с помощью сопутствующей терапии молекулой, связывающей лиганды, описываемой в данном документе, которая подавляет неоваскуляризацию сетчатки. Иллюстративным лекарственным средством для стандартного ухода за диабетической ретинопатией и макулярной дегенерацией включает, но не ограничивается этим, гигиену век, наружные антибиотики (включая, но не ограничиваясь этим, эритромициновые или бацитрациновые мази), принимаемые перорально тетрациклины (тетрациклин, доксициклин или миноциклин), противовоспалительные соединения (включая, но не ограничиваясь этим, циклоспорин), кортикостероиды, лазерную фотокоагуляцию и фотодинамическую терапию.

[00270] Также рассматриваются способы лечения субъекта-млекопитающего с выявленным глазным расстройством, связанным с неоваскуляризацией сетчатки, с пониженным ответом на стандартный режим ухода для лечения глазного расстройства, включающий введение связывающей лиганды молекулы субъекту в количестве, достаточном для лечения этого расстройства.

[00271] Субъект-млекопитающий предпочтительно представляет собой субъекта-человека. Также рассматривается применение способов данного изобретения в других субъектах-млекопитающих, особенно млекопитающих, которые традиционно используются в качестве моделей для демонстрации терапевтической эффективности у людей (например, приматы, свиньи, собаки или кролики).

Комбинированные терапии и дополнительные активные ингредиенты

[00272] Варианты осуществления данного изобретения, относящиеся к комбинированной терапии и профилактике, включают продукты и способы. Иллюстративные соединения можно вводить в комбинации с одним или несколькими связывающими лиганды молекулами, описанными здесь, включают, но не ограничиваются ими, соединения, приведенные в Таблице 2.

[00273] Связывающие лиганды молекулы можно вводить в комбинации с одним или несколькими дополнительными активными ингредиентами или терапиями, включая вторую молекулу-ловушку рецептора, цитотоксическое средство, хирургическое вмешательство, катетерное устройство и радиацию. Иллюстративные комбинированные продукты включают два или несколько средстве, составленные как одна композиция или упакованные вместе как отдельные композиции, например, как упакованные стандартные дозы или наборы. Иллюстративные комбинированные способы включают предписание для введения или введение одного или нескольких средств одновременно или в отдельные периоды времени со сдвигом, (т.е. последовательно).

[00274] Термин «цитотоксическое средство» в используемом в данном описании смысле относится к веществу, которое ингибирует или предотвращает функционирование клеток и/или вызывает разрушение клеток. Подразумевается, что термин включает радиоактивные изотопы (например, I131, I125, Y90 and Re186), химиотерапевтические средства и токсины, такие как ферментативно активные токсины из бактерий, грибов, растений или животных или их фрагменты.

[00275] «Химиотерапевтическим средством» является химическое соединение, применимое для лечения злокачественной опухоли. Примеры хемотерапевтических средств включают алкилирующие агенты, такие как тиотепа и циклофосфамид (Cytoxan®); алкилсульфонаты, такие как бусульфан, импросульфан и пипосульфан; азиридины, такие как бензодопа, карбоквон, метуредопа и уредопа; этиленимины и метилмеламины, включая альтретамин, триэтиленмеламин, триэтиленфосфорамид, триэтилентиофосфорамид и триметилолмеламин; азотистые иприты, такие как хлорамбуцил, хлорнафазин, хлорфосфамид, эстрамустин, ифосфамид, мехлоретамин, гидрохлорид оксида мехлоретамина, мелфалан, новембихин, фенестерин, преднимустин, трофосфамид, урациловый иприт; нитрозомочевины, такие как кармустин, хлорозотоцин, фотемустин, ломустин, нимустин, ранимустин; антибиотики, такие как аклациномицин, актиномицин, аутрамицин, азасерин, блеомицины, кактиномицин, калихеамицин, карабицин, карминомицин, карзинофилин, хромомицины, дактиномицин, даунорубицин, деторубицин, 6-диазо-5-оксо-L-норлейцин, доксорубицин, эпирубицин, эзорубицин, идарубицин, марцелломицин, митомицины, микофеноловая кислота, ногаламицин, оливомицины, пепломицин, потфиромицин, пуромицин, квеламицин, родорубицин, стрептонигрин, стрептозоцин, туберцидин, убенимекс, зиностатин, зорубицин; антиметаболиты, такие как метотрексат и 5-фторурацил (5-FU); аналоги фолиевой кислоты, такие как деноптерин, метотрексат, птероптерин, триметрексат; аналоги пурина, такие как флударабин, 6-меркаптопурин, тиамиприн, тиогуанин; аналоги пиримидина, такие как анцитабин, азацитидин, 6-азауридин, кармофур, цитарабин, дидезоксиуридин, доксифлуридин, эноцитабин, флоксуридин; андрогены, такие как калустерон, пропионат дромостанолона, эпитиостанол, мепитиостан, тестолактон; антиадренальные средства, такие как аминоглютетимид, митотан, трилостан; пополнитель фолиевой кислоты, такой как фолиновая кислота; ацеглатон; гликозид альдофосфамида; аминолевулиновая кислота; амсакрин; бестрабуцил; бисантрен; эдатраксат; дефофамин; демекольцин; диазиквон; элфорнитин; ацетат эллиптиния; этоглюцид; нитрат галлия; гидроксимочевину; лентинан; лонидамин; митогуазон; митоксантрон; мопидамол; нитракрин; пентостатин; фенамет; пирарубицин; подофиллиновая кислота; 2-этилгидразид; прокарбазин; PSK®; разоксан; сизофиран; спирогерманий; тенуазоновую кислота; триазиквон; 2,2',2''-трихлортриэтиламин; уретан; виндезин; дакарбазин; манномустин; митобронитол; митолактол; пипоброман; гацитозин; арабинозид («Ara-С»); циклофосфамид; тиотепа; таксаны, например паклитаксел (Taxol®, Bristol-Myers Squibb Oncology, Princeton, N.J.) и доцетаксел (Taxotere®; Aventis Antony, France); хлорамбуцил; гемцитабин; 6-тиогуанин; меркаптопурин; метотрексат; аналоги платины, такие как цисплатин и карбоплатин; винбластин; платина; этопозид (VP-16); ифосфамид; митомицин С; митоксантрон; винкристин; винорелбин; навелбин; новантрон; тенипозид; дауномицин; аминоптерин; кселода; ибандронат; СРТ-11; ингибитор топоизомеразы RFS 2000; дифторметилорнитин (DMFO); ретиноевая кислота; эсперамицины; капецитабин; и фармацевтически приемлемые соли, кислоты или производные любого из указанных выше средств. Также в данное определение включены антигормональные средства, которые действуют, регулируя или ингибируя действие гормонов на опухоли, такие как антиэстрогены, включая, например, тамоксифен, ралоксифен, ингибирующие ароматазу 4(5)-имидазолы, 4-гидрокситамоксифен, триоксифен, кеоксифен, LY117018, онапристон и торемифен (Fareston); и антиандрогены, такие как флутамид, нилутамид, бикалутамид, леупролид и госерелин; и фармацевтически приемлемые соли, кислоты или производные любого из указанных выше средств.

[00276] «Подавляющее рост средство» при использовании в данном описании относится к соединению или композиции, которая подавляет рост клетки, особенно клетки злокачественной опухоли, либо in vitro, либо in vivo. Примеры подавляющих рост средств включают средства, которые блокируют прохождение клеточного цикла (в другой фазе, отличной от S-фазы), такие как средства, которые индуцируют задержку в G1 и задержку в М-фазе. Классические блокаторы фазы М включают алкалоиды барвинка (винкристин и винбластин), Taxol® и ингибиторы топоизомеразы II, такие как доксорубицин, эпирубицин, даунорубицин, этопозид и блеомицин. Указанные средства, которые задерживают G1, также распространяются на задержку S-фазы, например ДНК-алкилирующие агенты, такие как тамоксифен, преднизон, дакарбазин, мехлорэтамин, цисплатин, метотрексат, 5-фторурацил и ara-С.

Продукты, ингибирующие VEGF-A (VEGF)

[00277] В некоторых вариантах осуществления описанные здесь способы в оптимальном случае включают введение лечебного средства, активность которого заключается в ингибировании связывания VEGF-A с одним или несколькими родственными ему рецепторами, особенно VEGFR-2. Продукт-ингибитор VEGF-A можно вводить в комбинации с одной или несколькими связывающими лиганды молекулами, описываемыми в данном документе. В некоторых вариантах осуществления продукт-ингибитор VEGF-A и связывающую лиганды молекулу вместе вводят в одной композиции. В других вариантах осуществления продукт-ингибитор VEGF-A вводят в виде композиции, отдельной от связывающей лиганды молекулы.

[00278] В одном варианте осуществления продукт-ингибитор VEGF-A выбирают из ранибизумаба, бавацизумаба, афлиберцепта, KH902 VEGF рецептора-Fc слитого белка, антитела 2С3, ORA102, пегаптаниба, бевазираниба, SIRNA-027, декурсина, декурсинола, пикроподофиллина, гуггулстерона, PLG101, экозаноида LXA4, PTK787, пазопаниба, акситиниба, CDDO-Me, CDDO-Imm, шиконина, бета-гидроксиизовалерилшиконина, EYE001, ганглиозида GM3, антитела DC101, антитела Mab25, антитела Mab73, антитела 4А5, антитела 4Е10, антитела 5F12, антитела VA01, антитела BL2, связанного с VEGF белка, sFLT01, sFLT02, Пептида В3, TG100801, сорафениба или антитела G6-31, или фармацевтически приемлемой соли любого из вышеперечисленного.

[00279] цДНК и аминокислотные последовательности ECD человеческого VEGFR-2 приведены SEQ ID NO: 5 и 6 соответственно. "Продукт-ингибитор VEGF-A" может быть любой молекулой, которая действует специфично в отношении уменьшения взаимодействий VEGF-A/VEGFR-2, например, путем блокировки связывания VEGF-A с VEGFR-2 или путем уменьшения экспрессии VEGFR-2. Термин "VEGF-A" в контексте данного документа относится к фактору роста эндотелия сосудов, индуцирующему ангиогенез или процесс ангиогенеза и включает различные подтипы VEGF, возникающие в результате, например, альтернативного сплайсинга гена VEGF-A, включая VEGF121, VEGF165 и VEGF189, индуцирующих ангиогенез или процесс ангиогенеза. Термин "VEGF" может использоваться при ссылке на полипептид "VEGF" или кодирующий "VEGF" ген или нуклеиновую кислоту.

[00280] Термин "продукт-ингибитор VEGF-A" относится к средству, которое снижает или ингибирует как частично, так и полностью, активность или образование VEGF-A. Продукт-ингибитор VEGF-A может прямо или косвенно снижать или ингибировать активность или образование специфических VEGF-A, каких как VEGF165. Кроме того, "продукт-ингибитор VEGF-A" включает средства, которые действуют либо на лиганд VEGF-A, либо на родственный ему рецептор, таким образом, чтобы снижать или ингибировать связанный с VEGF-A сигнал рецептора. Примеры "продукта-ингибитора VEGF-A" включают антисмысловые молекулы, рибозимы или PHKi, которые нацелены на нуклеиновую кислоту VEGF-A; аптамеры к VEGF-A; антитела к VEGF-A; растворимые ложные цели рецептора VEGF, которые предотвращают связывание VEGF-A с родственным ему рецептором; антисмысловые молекулы, рибозимы или PHKi, которые нацелены на нуклеиновую кислоту родственного VEGF-A рецептора (VEGFR-1 и/или VEGFR-2); аптамеры к VEGFR-1 и VEGFR-2 или антитела к VEGFR-1 и VEGFR-2; и VEGFR-1 и/или ингибиторы тирозинкиназы VEGFR-2.

[00281] Ингибитор VEGF-A может представлять собой полипептид, включающий растворимый ECD фрагмент VEGFR-2 (аминокислоты 20-764 последовательности SEQ ID NO: 6), который связывает VEGF; растворимый ECD фрагмент VEGFR-1, растворимую ловушку лигандов на основе VEGFR-1/R2, такую как афлиберцепт (регенерон); антисмысловые полинуклеотиды VEGFR-2 или короткая интерферирующая РНК (киРНК); антитела к VEGFR-2; ингибитор полипептида VEGFR-2, включающий антиген-связывающий фрагмент антитела к VEGFR-2, который ингибирует связывание между VEGFR-2 и VEGF; аптамер, который ингибирует связывание между VEGFR-2 и VEGF-A. В некоторых вариантах, ловушка лигандов на основе VEGFR-2 включает слитый белок, содержащий растворимый полипептидный фрагмент VEGFR-2, слитый с фрагментом константной области (Fc) иммуноглобулина. В некоторых вариантах осуществления, фрагмент полипептида VEGFR-2 сливают со щелочной фосфатазой (ЩФ или АР). Способы получения слитой конструкции Fc или АР можно найти в публикации WO 02/060950, раскрытие которой во всей своей полноте включено в данный документ путем ссылки.

[00282] Несколько антител VEGF-A описаны в литературе, см., например, патенты США №№8349322, 8236312, 8216571, 8101177, 8092797, 8088375, 8034905; 5730977, 6342219, 6524583, 6451764, 6448077, 6416758, 6342221 и публикации РСТ WO 96/30046, WO 97/44453 и WO 98/45331, содержание которых включено во всей своей полноте путем ссылки. Иллюстративные антитела VEGF-A включают бевацизумаб (авастин®) и ранибизумаб (луцентис®). В некоторых вариантах осуществления одну или несколько связывающих лиганды молекул, описываемых в данном документе, вводят в комбинации с бевацизумабом. В некоторых вариантах осуществления одну или несколько связывающих лиганды молекул, описываемых в данном документе, вводят в комбинации с ранибизумабом.

[00283] В некоторых вариантах осуществления ингибитор VEGF-A представляет собой EYE001 (ранее обозначаемый как NX1838), который представляет собой модифицированный, пэгилированный аптамер, связывающийся с высокой и специфической аффинностью с основной растворимой человеческой изоформой VEGF (см. патенты США №№6011020, 6051698 и 6147204). Аптамер связывается и подавляет активность VEGF способом, сходным с действием антител с высокой аффинностью, направленных на VEGF. Другим полезным аптамером к VEGF является EYE001 в своей непэгелированной форме.

[00284] В предпочтительном варианте осуществления одну или несколько связывающих лиганды молекул, описанных в данном документе, вводят в комбинации с афлиберцептом (Eylea®) (Holash et al., Proc. Natl. Acad. Sci. USA, 99: 11393-11398, 2002, раскрытие которой во всей своей полноте включено в данный документ.

[00285] В литературе описаны несколько VEGFR-2 антител, см., например, патент США №6334339 и публикации патентных заявок США №№2002/0064528, 2005/0214860 и 2005/0234225 (которые в полном объеме включены в данный документ путем ссылки). Антитела полезны для изменения взаимодействия VEGFR-2/VEGF благодаря возможности легко производить антитела с относительной специфичностью и благодаря продолжающемуся усовершенствованию технологий, приспосабливающих антитела к лечению людей. Так, изобретение рассматривает использование антител (например, моноклональных и поликлональных антител, антител с одной цепочкой, химерных антител, бифункциональных/биспецифических антител, гуманизированных антител, человеческих антител, и антитела с привитыми областями, определяющими комплементарность (CDR), включая соединения, содержащие последовательности CDR, которые специфически распознают полипептиды данного изобретения), специфичных к VEGFR-2. Человеческие антитела можно также получать, используя различные методики, известные в уровне техники, включая библиотеки, в которых представлены фаги [Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581 (1991)]. Методики, разработанные Cole et al. и Boerner et al., также пригодны для получения человеческих моноклональных антител (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(1): 86 95 (1991)]. Сходным образом человеческие антитела можно изготовлять путем введения человеческого иммуноглобулина loci трансгенным животным, например, мышам, у которых эндогенные гены иммуноглобулина частично или полностью инактивированы. При инфицировании наблюдается образование человеческих антител, что во всех отношениях весьма напоминает такой процесс в человеческом организме, включая генную перестройку, сборку репертуар антитела. Этот подход описан, например, в патентах США №№5545807, 5545806, 5569825, 5625126, 5633425, 5661016 и в следующих научных публикациях: Marks et al., Bio/Technology 10, 779 783 (1992); Lonberg et al., Nature 368 856 859 (1994); Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13: 65-93 (1995).

Продукты ингибиторы PDGF

[00286] В некоторых вариантах осуществления способы, описываемые в данном документе, необязательно включают введение терапевтически активного для подавления связывания PDGF с одним или несколькими рецепторами. Продукт-ингибитор PDGF можно вводить в комбинации с одной или несколькими связывающими лиганды молекулами, описываемыми в данном документе. В некоторых вариантах осуществления продукт-ингибитор PDGF и связывающую лиганды молекулу вместе вводят в одной композиции. В других вариантах осуществления продукт-ингибитор PDGF вводят в виде композиции, отдельной от связывающей лиганды молекулы.

[00287] Термин "PDGF" относится к тромбоцитарному фактору роста, регулирующему рост или деление клеток. В контексте данного документа "PDGF" включает различные подтипы PDGF, включая PDGF-B, PDGF-A, PDGF-C, PDGF-D, их вариантные формы и их димерные формы, включая PDGF-AA, PDGF-AB, PDGF-BB, PDGF-CC и PDGF-DD. Тромбоцитарные факторы роста включают гомо- или гетеродимеры А-цепочки (PDGF-A) и В-цепочки (PDGF-B), которые оказывают свое действие путем связывания и димеризации двух родственных тирозинкиназному рецептору рецепторов тромбоцитарного фактора роста на поверхности клеток (т.е., PDGFRs), PDGFR-α и PDGFR-β. Кроме того, были идентифицированы PDGF-C и PDGF-D - два дополнительных активируемых протеазой лиганда для комплексов PDGFR (Li et al., (2000) Nat. Cell. Biol. 2: 302-9; Bergsten et al., (2001) Nat. Cell. Biol. 3: 512-6; и Uutele et al., (2001) Circulation 103: 2242-47). Благодаря различной специфичности PDGFR при связывании лигандов, известно, что PDGFR-α/α связывает PDGF-AA, PDGF-BB, PDGF-AB и PDGF-CC; PDGFR-β/β связывает PDGF-BB и PDGF-DD; в то время как PDGFR-α/β связывает PDGF-AB, PDGF-BB, PDGF-CC и PDGF-DD (Betsholtz et al., (2001) BioEssays 23: 494-507). 494-507). В контексте данного документа термин "PDGF" также относится к тем представителям класса факторов роста, которые индуцируют синтез ДНК и митогенез путем связывания с PDGFR и активации его на клетках, дающих ответную реакцию. PDGF могут влиять, например, на: направленную миграцию клеток (хемотаксис) и активацию клеток; активацию фосфолипазы; повышенный оборот фосфотидилиноситола и метаболизм простагландинов; стимулирование синтеза как коллагена, так и коллагеназы, клетками дающими ответную реакцию; изменение клеточных метаболических активностей, включая синтез матрикса, образование цитокинов и усвоение липопротеинов; непрямую индукцию пролиферативных ответных реакций на недостаток клеток с рецепторами PDGF; и сильную сосудосужающую активность. Термин "PDGF" может использоваться при ссылке на полипептид "PDGF", кодирующий "PDGF" ген или нуклеиновую кислоту или его димерную форму.

[00288] Термин "продукт-ингибитор PDGF" относится к средству, снижающему или подавляющему как частично, так и полностью, активность или образование PDGF. Продукт-ингибитор PDGF может прямо или косвенно снижать или подавлять активность или образование специфических PDGF, таких как PDGF-B. Кроме того, "продукт-ингибитор PDGF" включает средства, которые действуют на лиганд PDGF или на родственный ему рецептор таким образом, чтобы снижать или подавлять рецепторный сигнал, связанный с PDGF. Примеры "продуктов-ингибиторов PDGF" включают антисмысловые молекулы, рибозимы или PHKi, которые нацелены на нуклеиновую кислоту PDGF; аптамеры к PDGF; антитела к самому PDGF или его рецептору, ложные цели рецептора PDGF, которые предотвращают связывание PDGF с родственным ему рецептором; антисмысловые молекулы, рибозимы или PHKi, которые нацелены на нуклеиновую кислоту родственного PDGF рецептора (PDGFR); аптамеры к PDGFR или антитела к PDGFR, которые связываются с родственным PDGFR рецептором; и ингибиторы PDGFR тирозинкиназы.

[00289] В одном варианте осуществления продукт-ингибитор PDGF выбирают из: соединения формулы А, В, С, D или Е как описано и определено в патенте US 2012/0100136 (полное содержание которого включено в данный документ ссылкой), антитела р1В3, CDP860, IMC-3G3, антитела 162.62, антитела 163.31, антитела 69.14, антитела 169.31, антитела αR1, антитела 2А1Е2, антитела M4TS.11, антитела M4TS.22, антитела Hyb 120.1.2.1.2, антитела Hyb 121.6.1.1.1, антитела Hyb 127.5.7.3.1, антитела Hyb 127.8.2.2.2, антитела Hyb 1.6.1, антитела Hyb 1.11.1, антитела Hyb 1.17.1, антитела Hyb 1.18.1, антитела Hyb 1.19.1, антитела Hyb 1.23.1, антитела Hyb 1.24, антитела Hyb 1.25, антитела Hyb 1.29, антитела Hyb 1.33, антитела Hyb 1.38, антитела Hyb 1.39, антитела Hyb 1.40, антитела Hyb 1.45, антитела Hyb 1.46, антитела Hyb 1.48, антитела Hyb 1.49, антитела Hyb 1.51, антитела Hyb 6.4.1, антитела F3, гуманизированного антитела F3, антитела С1, гуманизированного антитела С1, антитела 6.4, анти-mPDGF-C козлиного антитела IgG, антитела С3.1, моноклонального антитела PDGFR-B1, моноклонального антитела PDGFR-B2, моноклонального антитела 6D11, моноклонального антитела Sis 1, моноклонального антитела PR7212, моноклонального антитела PR292, моноклонального антитела HYB 9610, моноклонального антитела HYB 9611, моноклонального антитела HYB 9612, или моноклонального антитела HYB 9613, или их фармацевтически приемлемой соли любого из вышеперечисленного.

[00290] В предпочтительном варианте осуществления одна или несколько связывающих лиганды молекул, описываемых в данном документе, вводят в комбинации с PDGFR-бета антителом (как то, которое было разработано компанией Regeneron Inc. для глазных применений) или аптамер против PDGF (такой, как Е10030, разработанный компанией Ophthotech Inc. для глазных применений).

[00291] Предусматриваются фрагменты антител, например, продуктов-ингибиторов VEGF-A и PGDF, включая Fab, Fab', F(ab')2, Fv, scFv. Термин "специфичный для" если он используется для описания антител данного изобретения, означает что вариабельные участки антител данного изобретения распознают и связываются исключительно с интересующим полипептидом (т.е. способны отличать интересующие полипептиды от других известных полипептидов того же семейства, благодаря измеряемой разнице в аффинности связывания, несмотря на возможное существование локализованной идентичности последовательностей, гомологии или схожести между представителями семейства). Следует понимать, что специфические антитела могут также взаимодействовать с другими белками (например, белком A S.aureus или другими антителами в методике ELISA) вследствие взаимодействий с последовательностями вне вариабельного участка антител, и в частности, в константном участке молекулы. Скрининговый анализ для определения специфичности связывания антител данного изобретения хорошо известны и обычно практикуются в этой области техники. Полное обсуждение таких анализов см. в публикации Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor, NY (1988), Chapter 6. Антитела данного изобретения можно получать любым способом, хорошо известным и обычно практикующимся в этой области техники.

[00292] В другом варианте осуществления описанные здесь способы по выбору включают введение субъекту антисмысловой (например, антисмысловой к VEGFR-2) молекулы нуклеиновой кислоты. Антисмысловые молекулы нуклеиновых кислот к определенным белкам (например, к VEGFR-2) терапевтически полезны для ингибирования трансляции мРНК, кодирующих этот белок (например, VEGFR-2), где терапевтическая цель состоит в желании исключить присутствие белка или снизить его уровни содержания. РНК, антисмысловая к VEGFR-2, например, может быть полезна в качестве средства-антагониста VEGFR-2 в лечении заболеваний, в которых VEGFR-2 участвует как возбудитель, например, в воспалительных заболеваниях.

[00293] Антисмысловая нуклеиновая кислота содержит нуклеотидную последовательность, комплементарную "смысловой" нуклеиновой кислоте, кодирующей белок (например, комплементарную кодирующей нити двунитчатой молекулы цДНК или комплементарную последовательности мРНК). (См, например, последовательность cDNA VEGFR-3 последовательности SEQ ID NO: 1). Способы конструирования и оптимизации антисмысловых нуклеотидов описаны в публикации Lima et al., (J Biol Chem; 272: 626-38. 1997) and Kurreck et al., (Nucleic Acids Res.; 30: 1911-8. 2002). В конкретных аспектах предложены антисмысловые молекулы нуклеиновых кислот, содержащие последовательность, комплементарную по меньшей мере примерно 10, 25, 50, 100, 250 или 500 нуклеотидам или кодирующей нити целого белка (например, VEGFR-2), или только его части. Рассматриваются также молекулы нуклеиновых кислот, кодирующих фрагментов, гомологов, производных и аналогов белка (например, VEGFR-2), или антисмысловые нуклеиновые кислоты, комплементарные белку (VEGFR-2) последовательности нуклеиновых кислот.

[00294] В одном варианте осуществления антисмысловая молекула нуклеиновой кислоты является антисмысловой к "кодирующей области" кодирующей нити нуклеотидной последовательности, кодирующей белок, такой как, например VEGFR-2. Термин "кодирующая область" относится к нуклеотидной последовательности, содержащий кодоны, которые транслируются в аминокислотные остатки. В другом варианте осуществления антисмысловая молекула нуклеиновой кислоты является антисмысловой к "пропускаемая область" кодирующей нити нуклеотидной последовательности, кодирующей белок, такой как, например VEGFR-2. Термин "пропускаемая область" относится к последовательностям 5' и 3', которые фланкируют кодирующую область, транслируемую в аминокислоты (т.е. также относится к нетранслируемым областям 5' и 3').

[00295] Антисмысловые нуклеиновые кислоты данного изобретения можно конструировать согласно правилам Ватсона и Крика или Хугстиновскому спариванию оснований. Антисмысловая молекула нуклеиновой кислоты может быть комплементарной целой области белка мРНК, но более предпочтительно является нуклеотидом, который является антисмысловым к только одной части кодирующей или некодирующей последовательности белка мРНК. Антисмысловой олигонуглеотид может иметь в длину, например, примерно 5, 10, 15, 20, 25, 30, 35, 40, 45 или 50 нуклеотидов. Антисмысловая нуклеиновая кислота данного изобретения может быть сконструирована с использованием химического синтеза или реакций ферментного лигирования, используя процедуры, известные в уровне техники. Например, антисмысловая нуклеиновая кислота (например, антисмысловой нуклеотид) можно химически синтезировать, используя встречающиеся в природе нуклеотиды или различным образом модифицированные нуклеотиды, предназначенные повышать биологическую стабильность молекул или повышать физическую стабильность дуплекса, образованного между антисмысловой и смысловой нуклеиновыми кислотами (например, можно использовать производные фосфоротиоата или замещенные акридином нуклеотиды).

[00296] Примеры модифицированных нуклеотидов, которые можно использовать для получения антисмысловой нуклеиновой кислоты, включают: 5-фторурацил, 5-бромурацил, 5-хлорурацил, 5-йодурацил, гипоксантин, ксантин, 4-ацетилцитозин, 5-(карбоксигидроксиметил)урацил, 5-карбоксиметиламинометил-2-тиоуридин, 5-карбоксиметиламинометилурацил, дигидроурацил, бета-D-галактозилквеозин, инозин, N6-изопентениладенин, 1-метилгуанин, 1-метилинозин, 2,2-диметилгуанин, 2-метиладенин, 2-метилгуанин, 3-метилцитозин, 5-метилцитозин, N6-аденин, 7-метилгуанин, 5-метиламинометилурацил, 5-метоксиаминометил-2-тиоурацил, бета-D-маннозилквеозин, 5'-метоксикарбоксиметилурацил, 5-метоксиурацил, 2-метилтио-N6-изопентениладенин, урацил-5-оксиуксусную кислоту (v), вибутоксозин, псевдоурацил, квеозин, 2-тиоцитозин, 5-метил-2-тиоурацил, 2-тиоурацил, 4-тиоурацил, 5-метилурацил, метиловый эфир урацил-5-оксиуксусной кислоты, урацил-5-оксиуксусную кислоту (v), 5-метил-2-тиоурацил, 3-(3-амино-3-N-2-карбоксипропил)урацил, (acp3)w и 2,6-диаминопурин. Альтернативно, антисмысловую нуклеиновую кислоту можно получить биологическим путем с использованием экспрессирующего вектора, в который субклонируют нуклеиновую кислоту в антисмысловой ориентации.

[00297] Молекулы антисмысловых нуклеиновых кислот обычно вводят субъекту или воспроизводят in situ таким образом, чтобы они гибридизовались или связывались с клеточной мРНК и/или геномной ДНК, кодирующей белок (например, VEGFR-2), тем самым ингибируя экспрессию белка (например, подавлением транскрипции и/или трансляции). Гибридизация может быть основана на обычной комплементарности нуклеотидов с образованием стабильного дуплекса или, например, в случае молекулы антисмысловой нуклеиновой кислоты, которая связывается с ДНК-дуплексами, путем специфических взаимодействий в большой бороздке двойной спирали.

[00298] В еще одном варианте осуществления белок РНК можно использовать для индуцирования интерференции РНК (PHKi), используя двунитчатую (днРНК) (Fire et al., Nature 391: 806-811. 1998) или короткие интерферирующие РНК (киРНК) последовательности (Yu et al., Proc Natl Acad Sci USA. 99: 6047-52, 2002). "PHKi" представляет собой процесс, при котором днРНК индуцирует зависящую от гомологии деструкцию комплементарной мРНК. В одном варианте осуществления молекула нуклеиновой кислоты данного изобретения гибридизуют путем комплементарного спаривания оснований со «смысловой» рибонуклеиновой кислотой данного изобретения с образованием двунитчатой РНК. Предложены антисмысловая и смысловая молекулы нуклеиновых кислот днРНК, которые соответствуют не менее чем примерно 20, 25, 50, 100, 250 или 500 нуклеатидам или целой молекуле белка (например, VEGFR-2) кодирующей нити, или любой ее части. В альтернативном варианте осуществления киРНК имеют в длину 30 нуклеотидов или менее, и более предпочтительно - от 21- до 23-нуклеотидов, с характерными 2- - 3- нуклеотидами 3'-выступающими концами, которые образуются при отщеплении рибонуклеазой III от более длинных днРНК. См., например, Tuschl Т. (Nat Biotechnol. 20: 446-48. 2002). Получение и использование соединений PHKi описано в публикации патента США №2004/0023390, раскрытие которого во всей своей полноте включено в данный документ ссылкой.

[00299] Внутриклеточную транскрипцию малых молекул РНК можно достичь клонированием киРНК шаблонов в транскрипционные единицы РНК полимеразы III (Pol III), которые обычно кодируют малые ядерные РНК (мяРНК) U6 или человеческие PHKse Р РНК Н1. Можно применять два подхода к экспрессии киРНК: в одном варианте осуществления смысловую и антисмысловую нити, составляющие дуплекс киРНК, транскрибируют с помощью индивидуальных промоторов (Lee, et al. Nat. Biotechnol. 20, 500-505. 2002); в альтернативном варианте осуществления киРНК экспрессируют в струкрурах РНК типа «шпильки» - ствол-петля - что приводит к образованию киРНК после внутриклеточного преобразования (Brummelkamp et al. Science 296: 550-553. 2002) (включена в данный документ ссылкой).

[00300] днРНК/киРНК наиболее часто вводят путем отжига смысловой и антисмысловой нитей РНК in vitro перед доставкой в организм. В альтернативном варианте осуществления PHKi может выполняться путем введения смысловой и антисмысловой нуклеиновых кислот в один и тот же раствор без отжига перед введением, и даже может выполняться путем введения нуклеиновых кислот в разные вены с очень коротким временным интервалом. Также предполагаются кодирующие фрагменты нуклеиновых кислот, гомологи, производные и аналоги белков (такие как, например, VEGFR-2) или антисмысловые нуклеиновые кислоты, комплементарные последовательности нуклеиновых кислот mVEGFR-2.

[00301] Аптамеры представляют собой другой способ, основанный на нуклеиновых кислотах, для вмешательства во взаимодействие рецептора и родственного ему лиганда, таких как, например VEGFR-2 с VEGF-A и PDGFR с PGDF. Аптамеры представляют собой молекулы ДНК или РНК, которые выбирают из случайного множества, основанного на их способности связывать другие молекулы. Были выбраны аптамеры, которые связывают нуклеиновые кислоты, белки, малые органические соединения и даже целые организмы. Способы и композиции для идентификации и изготовления аптамеров известны специалистам в данной области техники и описаны, например, в патенте США №5840867 и патенте США №5582981, которые включены в данный документ путем ссылки во всей своей полноте.

[00302] Недавние успехи в развитии области комбинаторки позволили обнаружить короткие полимерные последовательности с высокой аффинностью и специфичностью к выбранной цели. Например, технология SELEX используется для идентификации ДНК и РНК аптамеров со связывающими свойствами, которые конкурируют с антителами млекопитающих, в области иммунологии разработаны и выделены антитела или фрагменты антител, которые связываются с многочисленными соединениями, и фаговый дисплей используют для обнаружения новых пептидных последовательностей с различными благоприятными связывающими свойствами. Основываясь на успехе этих молекулярных эволюционных технологий, с определенной уверенностью можно создавать молекулы, которые связываются с любой целевой молекулой. Для придания требуемых свойств связывания часто привлекают структуру типа петли, как в случае: аптамеров, которые часто задействуют петли типа булавки, создаваемые из коротких участков без комплементарного щелочного спаривания, получаемых естественным путем антител, которые используют комбинаторное расположение петлевых гипервариабельных областей, и новые библиотеки фаговых дисплеев, использующие циклические пептиды, которые показали улучшенные результаты по сравнению с результатами фаговых дисплеев линейных пептидов. Так, получено достаточно свидетельств тому, что лиганды с высокой аффинностью можно создавать и идентифицировать с помощью комбинаторных методов молекулярной эволюции. В случае данного изобретения можно использовать методы молекулярной эволюции для выделения связывающих лиганды молекул, специфических для лигандов, описываемых в данном документе. Подробнее об аптамерах в целом см. Gold, L, Singer, В., Не, Y.Y., Brody. Е., "Aptamers As Therapeutic And Diagnostic Agents," J. Biotechnol. 74: 5-13 (2000). Соответствующие методы для создания аптамеров можно найти в патенте США №6699843, который включен ссылкой во всей своей полноте.

[00303] В некоторых вариантах осуществления аптамер можно создавать путем приготовления библиотеки нуклеиновых кислот; приведения в контакт библиотеки нуклеиновых кислот с фактором роста, где отбирают и амплифицируют нуклеиновые кислоты, имеющие наиболее высокую аффинность связывания с факторами роста (по сравнению с остальной библиотекой нуклеиновых кислот), получая смесь нуклеиновых кислот, обогащенную нуклеиновыми кислотами с относительно более высокой аффинностью и специфичностью связывания с фактором роста. Процесс можно повторить, а отобранные нуклеиновые кислоты подвергнуть мутации и повторному скринингу, посредством чего идентифицируют аптамер фактора роста.

[00304] В еще одном варианте продукт-ингибитор VEGF-A включает растворимый фрагмент ECD рецептора VEGFR-1, связывающий VEGF и ингибирующий связывание VEGF с VEGFR-2. цДНК и аминокислотые последовательности VEGFR-1 приведены в последовательностях SEQ ID NO: 10 и 11. Иллюстративные фрагменты ECD раецептора VEGFR-1 в публикации патентной заявки США 2006/0030000 и публикации международной патентной заявки №WO 2005/087808, раскрытие которых включено в данный документ путем ссылки во всей своей полноте.

Противовоспалительные средства

[00305] В другом варианте осуществления описываемые здесь способы необязательно включают введение субъекту одного или нескольких противовоспалительных средств. В некоторых вариантах осуществления противовоспалительное средство и связывающую лиганды молекулу вводят совместно в одной композиции. В других вариантах осуществления противовоспалительное средство вводят в виде композиции, отдельной от связывающей лиганды молекулы. Комбинации, включающие связывающую лиганды молекулу, продукт-ингибитор VEGF-A и противовоспалительное средство рассматриваются особо. В используемом здесь значении термин "противовоспалительное средство" в общем случае относится к любому средству, снижающему воспаление и отек у субъекта. Здесь приводится ряд иллюстративных противовоспалительных средств, но следует понимать, что могут существовать дополнительные подходящие противовоспалительные средства, которые конкретно не перечислены здесь, но которые входят в объем данного изобретения.

[00306] В одном варианте противовоспалительное средство представляет собой нестероидное противовоспалительное лекарственное средство (НПВС). Иллюстративные НПВС включают, но не ограничиваются этим: аспирин, Сульфасалазин™, АсаколТМ, Дипентум™, Пентазу™, Anaprox™, Anaprox DSTM (напроксена натрий); АнсаидТМ (флурбипрофен); Артротек™ (диклофенака натрий + мисопростил); Катафлам™/Волтарен™ (диклофенака калий); Клинорил™ (сулиндак); Дайпро™ (оксапрозин); Дисалцид™ (салсалат); Долобид™ (дифлунисал); ЕС Напросин™ (напроксена натрий); Фелден™ (пироксикам); Индоцин™, Индоцин SR™ (индометацин); Лодин™, Лодин XL™ (этодолак); Мотрин™ (ибупрофен); Напрелан™ (напроксен); Напросин™ (напроксен); Орудис™, (кетопрофен); Оруваил™ (кетопрофен); Релафен™ (набуметон); Tolectin™, (толметина натрий); Trilisate™ (холина магния трисалицилат); ингибиторы Сох-1; ингибиторы Сох-2, такие как Vioxx™ (рофекоксиб); Аркоксия™ (эторикоксиб), Целебрекс™ (целекоксиб); Mobic™ (мелоксикам); Бекстра™ (вальдекоксиб), Династат™ паракоксиба натрий; Prexige™ (лумиракоксиб) и намбуметон. Дополнительные пригодные НПВС включают, но не ограничиваются следующим: 5-аминосалициловую кислоту (5-ASA, мезаланин, лесалазин), ε-ацетамидокапроновую кислоту, S-аденозилметионин, 3-амино-4-гидроксимасляную кислоту, амиксетрин, анитразафен, антрафенин, бендазак, бендазак лизинат, бензидамин, бепрозин, броперамол, буколом, бефезолак, ципроквазон, клоксимат, дазидамин, дебоксамет, детомидин, дифенпайрамид, дифенпирамид, дифисаламин, дитазол, эморфазон, фанетилизол месилат, фенфлумизол, флоктафенин, флумизол, флуниксин, флупроквазон, фопиртолин, фосфозал, кваймезал, квайзолен, изониксирн, лефетамин HCl, лефлуномид, лофемизол, лотифазол, лизин клониксинат, мезеклазон, набуметон, никтиндол, нимесулид, орготеин, опраноксин, оксацепролм, оксападол, паранилин, перизоксаль, перизоксаль цитрат, пифоксим, пипроксен, пиразолак, пирфенидон, проквазон, проксазол, тиелавин В, тифламизол, тимегадин, толектин, толпадол, триптамид и препараты, имеющие кодовые обозначения производителя, такие как 480156S, АА861, AD1590, AFP802, AFP860, AI77B, АР504, AU8001, ВРРС, BW540C, CHINOIN 127, CN100, ЕВ382, EL508, F1044, FK-506, GV3658, ITF182, KCNTEI6090, КМЕ4, LA2851, MR714, MR897, MY309, ON03144, PR823, PV102, PV108, R830, RS2131, SCR152, SH440, SIR133, SPAS510, SQ27239, ST281, SY6001, ТА60, TAI-901 (4-бензоил-1-инданкарбоновая кислота), TVX2706, U60257, UR2301 и WY41770.

[00307] В другом варианте противовоспалительное средство включает соединение, которое ингибирует взаимодействие воспалительных цитокинов с их рецепторами. Примеры ингибиторов цитокинов, полезных для комбинирования со специфичными связывающими агентами изобретения включают, например, антагонисты (такие как антитела), направленные против интерлейкинов, участвующих в воспалительном процессе. Такие интерлейкины описаны в данном документе и предпочтительно включают, но не ограничиваются этим, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-8, IL-9, IL-12, IL-13, IL-17 и IL-18. See Feghali, et al., Frontiers in Biosci., 2: 12-26 (1997).

[00308] В другом варианте противовоспалительное средство представляет собой кортикостероид. Иллюстративные кортикостероиды включают, но не ограничиваются ими, дифлоразона диацетат, клобетазола пропионат, галобетазол пропионат, бетаметазон, бетаметазон дипропионат, будесонид, кортизон, дексаметазон, флуоцинонид, гальцинонид дезоксиметазон, триамцинолон, флутиказон пропионат, флуоцинолона ацетонид, флурандренолид, мометазон фуроат, бетаметозон, флутиказон пропионат, флуоцинолона ацетонид, аклометасом дипропионат, метилпреднизолон, преднизолон, преднизон, триамцинолон, десонид и гидрокортизон.

[00309] В другом варианте противовоспалительное средство представляет собой циклоспорин.

Антибиотики

[00310] В другом варианте осуществления описываемые здесь способы необязательно дополнительно включают введение субъекту антибиотика. В некоторых вариантах осуществления антибиотик и связывающую лиганды молекулу вводят совместно в одной композиции. В других вариантах осуществления антибиотик вводят в виде композиции, отдельной от связывающей лиганды молекулы. Примеры антибиотиков включают, но не ограничиваются ими, тетрациклин, аминогликозиды, пенициллины, цефалоспорины, сульфонамидные препараты, хлорамфеникол натрия сукцинат, эритромицин, ванкомицин, линкомицин, клиндамицин, нистатин, амфотерицин В, амантидин, идоксуридин, п-аминосалициловую кислоту, изониазид, рифампин, антиномицин D, митрамицин, дауномицин, адриамицин, блеомицин, винбластин, винкристин, прокарбазин и имидазолкарбоксамид.

Ингибиторы тирозинкиназ

[00311] В другом варианте осуществления описываемые здесь способы необязательно дополнительно включают введение субъекту ингибитора тирозинкиназ, который подавляет активность VEGFR-2 и/или VEGFR-3.

[00312] Примеры ингибиторов тирозинкиназ для использования в описываемых здесь способах включают, но не ограничиваются ими, АЕЕ788 (TKI, VEGFR-2, EGFR: Novartis); ZD6474 (TKI, VEGFR-1, -2, -3, EGFR: Zactima: AstraZeneca); AZD2171 (TKI, VEGFR-1, -2: AstraZeneca); SU 11248 (TKI, VEGFR-1, -2, PDGFR: Сунтиниб: Pfizer); AG13925 (TKI, VEGFR-1, -2: Pfizer); AG013736 (TKI, VEGFR-1, -2: Pfizer); CEP-7055 (TKI, VEGFR-1, -2, -3: Цефалон); CP-547,632 (TKI, VEGFR-1, -2: Pfizer); GW7S6024 (TKL VEGFR-1, -2, -3: GlaxoSmithKline); GW786034 (TKI, VEGFR-1, -2, -3: GlaxoSmithKline); сорафениб (TKI, Bay 43-9006, VEGFR-1, -2, PDGFR: Bayer/Onyx); SU4312 (TKI, VEGFR-2, PDGFR: Pfizer); AMG706 (TKI, VEGFR-1, -2, -3: Amgen); XL647 (TKI, EGFR, HER2, VEGFR, ErbB4: Exelixis); XL999 (TKI, FGFR, VEGFR, PDGFR, FII-3: Exelixis); PKC412 (TKI, KIT, PDGFR, PKC, FLT3, VEGFR-2: Novartis); AEE788 (TKI, EGFR, VEGFR2, VEGFR-1: Novartis): OSI-030 (TKI, c-kil, VEGFR: OSI Pharmaceuticals); OS1-817 (TKI c-kit, VEGFR: OSI Pharmaceuticals); DMPQ (TKI, ERGF, PDGFR, ErbB2. p56. pkA, pkC); MLN518 (TKI, Flt3, PDGFR, c-KIT (T53518: Millennium Pharmaceuticals); лестауриниб (TKI, FLT3, CEP-701, Cephalon); ZD 1839 (TKI, EGFR: гефтиниб, Iressa: AstraZсneca); OSI-774 (TKI, EGFR: Эрлотиниб: Тарцева: OSI Pharmaceuticals); лапатиниб (TKI, ErbB-2, EGFR и GD-2016: Тикерб: GlaxoSmithKline).

[00313] В некоторых вариантах осуществления описываемые здесь способы дополнительно включают введение субъекту ингибитора тирозинкиназ, который подавляет ангиогенез у субъекта. Примеры антиангиогенезных ингибиторов тирозинкиназ и их мишени приведены в Таблице 2 ниже.

[00314] Связывающие лиганды молекулы можно вводить в комбинации с более чем одним дополнительным активным ингредиентом или терапией. В одном варианте осуществления связывающую лиганды молекулу настоящего изобретения вводят в комбинации с продуктом-ингибитором PDGF и продуктом-ингибитором VEGF-A. Например, связывающую лиганды молекулу (например, такую, которая включает аминокислотную последовательность, приведенную в SEQ ID NO: 3) можно вводить в комбинации с (i) афлиберсептом (Eylea®) и (ii) антителом PDGFR (таким, как разработано компанией Regeneron Inc. для глазных применений) или аптамер PDGF (такой, как Е10030 (Fovista™), разработанный компанией Ophthotech Inc. для глазных применений).

Введение и комбинированная терапия

[00315] Комбинированную терапию с использованием одного или нескольких дополнительных активных ингредиентов, описываемых в данном документе, можно осуществлять путем введения субъекту одной композиции или фармакологического состава, включающих связывающую лиганды молекулу и один или несколько дополнительных активных ингредиента, или путем введения субъекту двух (или более) отдельных композиций или составов, одновременно, где одна композиция включает связывающую лиганды молекулу, а другая включает дополнительный активный ингредиент.

[00316] Альтернативно, комбинированная терапия, использующая описываемую здесь связывающую лиганды молекулу, может осуществляться до или вслед за обработкой вторым ингредиентом с интервалами, варьирующимися от нескольких минут до недель. В вариантах осуществления, где второй ингредиент и связывающую лиганды молекулу вводят отдельно, следует в общем случае следить за тем, чтобы между моментами каждого из введений не было значительных перерывов, таким образом, чтобы ингредиент и связывающая лиганды молекула могли оказывать благоприятный комбинированный эффект. В таких случаях, предполагается, что обе модификации будут осуществлены оба метода терапевтического воздействия один за другим в течение примерно 12-24 часов и, более предпочтительно, один за другим в течение примерно 6-12 часов, особенно предпочтительна задержка не более примерно 12 часов. В некоторых случаях может быть желательно значительно продлить временной период лечения, однако, когда от нескольких дней (2, 3, 4, 5, 6 или 7) до нескольких недель (1, 2, 3, 4, 5, 6, 7 или 8) проходит между соответствующими введениями. Особо рассматриваются повторные лечения одним или обоими ингредиентами.

Составы и Фармацевтически приемлемые носители

[00317] Настоящее изобретение также предлагает фармацевтические композиции, включающие связывающую лиганды молекулу данного изобретения. Такие композиции включают терапевтически эффективные количества одной или нескольких связывающих лиганды молекул и фармацевтически приемлемый носитель. В одном варианте осуществления такие композиции включают одну или несколько связывающих лиганды молекул и необязательно один или несколько активных ингредиентов (в случае комбинированной терапии). В одном варианте осуществления такие композиции включают одну или несколько связывающих лиганды молекул и необязательно один или несколько дополнительных активних ингредиентов, выбранных из продукта-ингибитора PDGF и продукта-ингибитора VEGF-A. В другом варианте осуществления вводят такую композицию, включающую одну или несколько связывающих лиганды молекул данного изобретения и другую композицию, включающую продукт-ингибитор PDGF и продукт-ингибитор VEGF-A.

[00318] Термин "фармацевтически приемлемый" означает одобренный регулирующим органом Федерального правительства или правительства штата или перечислены в Фармакопеи США или других общепризнанных фармакопеях для применения в животных, и более конкретно - для людей. Термин "носитель" относится к разбавителю, вспомогательному веществу, наполнителю, или веществу-носителю, с которым вводят лекарственное средство. Такие фармацевтические носители могут представлять собой стерильные жидкости, такие как вода и масла, включая таковые углеводородного, животного, растительного или синтетического происхождения, такие как арахисовое масло, соевое масло, минеральное масло, тахинное масло и подобные им. Подходящие фармацевтические разбавители включают крахмал, глюкозу, лактозу, сахарозу, желатин, солод, рис, муку, мел, силикагель, стеарат натрия, глицерина моностеарат, тальк, хлорид натрия, сухое обезжиренное молоко, глицерин, пропилен, гликоль, воду, этанол и т.п. Композиция, по желанию, может также содержать небольшие количества смачивающих и эмульгирующих средств или, или буферирующих рН средств.

[00319] Композиции могут быть в виде раствором, суспензий, эмульсий, таблеток, пилюль, капсул, порошков, гранул, гелей, включая гидрогели, паст, мазей, кремов, устройств доставки, составов замедленного высвобождения, суппозиториев, инъекционных препаратов, имплантатов, распыляемых составов, капель, аэрозолей и т.п. Композиции, включающие связывающую лиганды молекулу, один или несколько дополнительных активных ингредиентов, или их обоих, можно составлять согласно традиционной фармацевтической практике (см., например, Remington: The Science and Practice of Pharmacy, (20th ed.) ed. A.R. Gennaro, 2000, Lippincott Williams & Wilkins, Philadelphia, Pa. and Encyclopedia of Pharmaceutical Technology, eds., J. Swarbrick and J.C. Boylan, 1988-2002, Marcel Dekker, New York). Примеры приемлемых фармацевтических носителей описаны в работе "Remington's Pharmaceutical Sciences", написанной E.W. Martin.

[00320] Введение композиций можно производить любым подходящим методом, который приводит к количеству связывающей лиганды молекулы и/или дополнительного активного ингредиента, эффективному для лечения или предотвращения определенного заболевания или расстройства. Каждую связывающую лиганды молекулу, например, можно смешивать с пригодным веществом носителя, при этом она присутствует в количестве 1-95% от общего веса композиции. Композицию можно предоставлять в виде лекарственной формы, пригодной для офтальмологического, перорального, парентерального (например, внутривенного, внутримышечного, подкожного), ректального, чрескожного, назального или ингаляторного введения. В одном варианте осуществления композиция представлена в форме, пригодной для инъекции непосредственно в глаз.

[00321] Связывающие лиганды молекулы данного изобретения и, при условии их наличия в комбинационной терапии - один или несколько дополнительных активных ингредиентов, можно составлять как нейтральные формы или в форме солей. Фармацевтичеки приемлемые соли включают те, которые образованы со свободными аминогруппами, такие как полученные из хлористоводородно, фосфорно, уксусной, щавелевой, винной кислот и т.п., и те, которые образованы со свободными карбоксильными группами, такими как полученные из гидроксидов натрия, калия, аммония, кальция, железа, изопропиламина, триэтиламина, 2-этиламиноэтанола, гистидина, прокаина и т.п.

[00322] Связывающие лиганды молекулы и дополнительные активные ингредиенты настоящего изобретения могут иметь в достаточной степени щелочную группу, которая может реагировать с любой из числа неорганических и органических кислот с образованием фармацевтически приемлемой соли. Фармацевтически приемлемые соли присоединения кислоты образуют из фармацевтически приемлемой кислоты, как хорошо известно в уровне техники. Такие соли включают фармацевтически приемлемые кислоты, перечисленные в Journal of Pharmaceutical Science, 66, 2-19 (1977) и The Handbook of Pharmaceutical Salts; Properties, Selection, and Use. P.H. Stahl and C.G. Wermuth (ED.s), Verlag, Zurich (Switzerland) 2002, полное содержание которы таким образом включены путем ссылки.

[00323] Фармацевтически приемлемые соли включают следующие соли: сульфат, цитрат, ацетат, оксалат, хлорид, бромид, иодид, нитрат, бисульфат, фосфат, кислый фосфат, изоникотинат, лактат, салицилат, кислый цитрат, тартрат, олеат, таннат, пантотенат, битартрат, аскорбат, сукцинат, малеат, гентизинат, фумарат, глюконат, глюкаронат, сахарат, формиат, бензоат, глутамат, метансульфонат, этансульфонат, бензолсульфонат, п-толуолсульфонат, камфорсульфонат, памоат, фенилацетат, трифторацетат, aery late, хлорбензоат, динитробензоат, гидроксибензоат, метоксибензоат, метилбензоат, о-ацетоксибензоат, нафталин-2-бензоат, изобутират, фенилбутират, альфа-гидроксибутират, бутин-1,4-дикарбоксилат, гексин-1,4-дикарбоксилат, капрат, каприлат, циннамат, гликоллат, гептаноат, гиппурат, малат, гидроксималеат, малонат, манделаты, мезилаты, никотинаты, фталаты, терефталаты, пропиолаты, пропионаты, фенилпропионат, себацинат, суберинат, п-бромбензолсульфонат, хлорбензолсульфонат, этилсульфонат, 2-гидроксиэтилсульфонат, метилсульфонат, нафталин-1-сульфонат, нафталин-2-сульфонат, нафталин-1,5-сульфонат, ксиленсульфонат и тартраты.

[00324] Термин "фармацевтически приемлемая соль" также относится к соли связывающей лиганды молекулы и дополнительного активного ингредиента, имеющих кислотную функциональную группу, такую как карбоксильная кислотная функциональная группа, и основания. Подходящие основания включают, но не ограничиваются ими, гидроксиды щелочных металлов, такие как натрий, калий и литий; гидроксиды щелочно-земельного металла, такого как кальций и магний; гидроксиды других металлов, таких как алюминий и цинк; аммоний и органические амины, такие как незамещенные или гидрокси-замещенные моно-, ди- или три-алкиламины, дициклогексиламин; трибутиламин; пиридин; N-метил, N-этиламин; диэтиламин; триэтиламин; моно-, бис- или трис-(2-ОН-низшие алкиламины), такие как моно-, бис- или трис-(2-гидроксиэтил)амин, 2-гидрокси-трет-бутиламин или трис(гидроксиметил)метиламин, N,N-ди-низший алкил-N(гидроксил-низший алкил)-амины, такие как N,N-диметил-N-(2-гидроксиэтил)амин или три-(2-гидроксиэтил)амин; N-метил-D-глюкамин; и аминоксилоты как аргинин, лизин, и т.п. Термин "фармацевтически приемлемая соль" также включает гидрат соединения данного изобретения.

[00325] Композиции в одном полезном аспекте включают введенные парентерально (например, путем внутримышечной, внутрибрюшинной, внутривенной, внутриглазной, интравитреальной, ретробульбарной, подконъюнктивальной, субтеновой или подкожной инъекции или инплантата) или системно. Составы для парентерального или системного введения включают стерильные водные или неводные растворы, суспензии или эмульсии. Можно использовать различные водные носители, например, воду, забуференную воду, физиологический раствор и т.п. Примеры других пригодных веществ-носителей включают полипропиленгликоль, полиэтиленгликоль, растительные масла, желатин, гидрогели, гидрированные нафталины и пригодные для инъекции органические сложные эфиры, такие как этилолеат. Такие составы могут также содержать вспомогательные вещества, такие как консерванты, смачивающие, буферирующие, эмульгирующие и/или разрыхляющие средства. Биосовместимые, биоразлагаемые лактидный полимер, сополимер лактида/гликолида или сополимеры полиоксиэтилена-полиоксипропилена можно использовать для регулирования высвобождения активных ингредиентов.

[00326] Альтернативно, композиции можно вводить путем перорального приема внутрь. Композиции, предназначенные для перорального применения можно получать в твердой или жидкой формах согласно любому способу, известному в уровне техники, для производства фармацевтических композиций.

[00327] Твердые лекарственные формы для перорального введения включают капсулы, таблетки, пилюли, порошки и гранулы. Как правило, эти фармацевтические препараты содержат активные ингредиенты, смешанные с нетоксичными фармацевтически приемлемыми разбавителями. Они включают, например, инертные разбавители, такие как карбонат кальция, карбонат натрия, лактозу, сахарозу, глюкозу, маннитол, целлюлозу, крахмал, фосфат кальция, фосфат натрия, каолин и т.п. Связывающие средства, буферирующие средства и/или смазывающие средства (например, стеарат магния) также можно использовать. На таблетки и пилюли можно дополнительно наносить кишечнорастворимые покрытия. Композиции могут по выбору содержать подсластители, вкусовые, окрашивающие средства, отдушки и консерванты с целью получения более приемлемых препаратов.

[00328] Твердые лекарственные формы могут быть полезными для лечения глазных расстройств. Композиции, пригодные для глазных применений включают таблетки, содержащие одну или несколько связывающих лиганды молекул в смеси с фармацевтически приемлемым разбавителем. Эти разбавители могут быть, например, инертными разбавителями или наполнителями (например, сахароза и сорбит), смазывающими средствами, средствами, улучшающими скольжение, и антиадгезивами (например, стеарат магния, стеарат цинка, стеариновая кислота, оксиды кремния, гидрогенизированные растительные масла или тальк).

[00329] Композиции настоящего изобретения можно вводить в глаз внутриглазно путем интравитреальной инъекции в глаз, а также путем подконъюнктивальной и субтеновой инъекциями. Другие пути введения включают чрессклеральный, ретробульбарный, внутрибрюшинной, внутримышечный и внутривенный. Альтернативно, композиции можно вводить, используя устройство для доставки лекарства или внутриглазного имплантата.

[00330] Жидкие лекарственные формы для перорального введения могут включать фармацевтически приемлемые эмульсии, растворы, суспензии, сиропы и мягкие желатиновые капсулы. Эти формы могут содержать инертные разбавители, обычно используемые в данном уровне техники, такие как вода или масляная среда, и могут также включать вспомогательные средства, такие как смачивающие средства, эмульгирующие средства и суспендирующие средства.

[00331] В некоторых случаях композиции можно также вводить наружно, например, с помощью пластыря, или непосредственно применяя на участок, такой как эпидермис или глаз, подверженный неоваскуляризационному расстройству или затронутый им, или путем ионофореза.

[00332] В случае комбинированных терапий настоящего изобретения связывающие лиганды молекулы и один или несколько активных ингредиентов можно смешивать в таблетку или другую форму доставки, или можно не смешивать. В одном примере связывающая лиганды молекула заключена внутри таблетки, а дополнительный активный ингредиент находится снаружи, таким образом, высвобождение значительной части дополнительного активного ингредиента происходит раньше высвобождения удерживаемой связывающей лиганды молекулы.

[00333] В одном варианте осуществления композиции, включающие связывающую лиганды молекулу (и необязательно один или несколько дополнительных активных ингредиентов), может содержать один или несколько фармацевтически приемлемых разбавителей. В одном варианте осуществления такие разбавители включают, но не ограничиваются ими, буферные средства, неионные ПАВ, консерванты, средства регулирования тоничности, аминокислоты, сахара и средства регулирования рН. Подходящие буферные средства включают, но не ограничиваются ими, одноосновный фосфат натрия, двухосновный фосфат натрия и ацетат натрия. Подходящие неионные ПАВ включают, но не ограничиваются ими, эфиры жирных кислот и полиоксиэтиленсорбината, такие как полисорбат 20 и полисорбат 80. Подходящие консерванты включают, но не ограничиваются ими, бензиловый спирт. Подходящие средства регулирования тоничности включают, но не ограничиваются ими, хлорид натрия, маннит и сорбит. Подходящие сахара включают, но не ограничиваются ими, безводную α,α-трегалозу. Подходящие аминокислоты включают, но не ограничиваются ими, глицин и гистидин. Подходящие средства регулирования рН включают, но не ограничиваются ими, соляную кислоту, уксусную кислоту и гидроксид натрия. В одном варианте осуществления средство или средства регулирования рН присутствуют в количестве, эффективном для обеспечения рН, равного от примерно 3 до примерно 8, от примерно 4 до примерно 7, от примерно 5 до примерно 6, от примерно 6 до примерно 7, или от примерно 7 до примерно 7,5. В одном варианте осуществления композиция, включающая связывающую лиганды молекулу, не содержит консервант. В другом варианте осуществления композиция, включающая связывающую лиганды молекулу, не содержит антимикробное средство. В другом варианте осуществления композиция, включающая связывающую лиганды молекулу не содержит бактериостатическое средства.

[00334] В одном варианте осуществления композиция, включающая связывающую лиганды молекулу (и необязательно один или несколько дополнительных активных ингредиентов), представлена в виде водного раствора, пригодного для инъекций. В одном варианте осуществления композиция включает связывающую лиганды молекулу, буферное средство, средство регулирования рН и воду для инъекций. В другом варианте осуществления композиция включает связывающую лиганды молекулу, одноосновный фосфат натрия, двухосновный фосфат натрия, хлорид натрия, соляную кислоту и гидроксид натрия. В другом варианте осуществления композиция включает связывающую лиганды молекулу, фосфат (например, одноосновный фосфат натрия), трегалозу, хлорид натрия и полисорбат.

[00335] Водные композиции, полезные для практического применения способов данного изобретения в глазной области, характеризуются офтальмологически совместимыми рН и осмоляльностью. В композицию данного изобретения могут быть включены одно или несколько офтальмологически приемлемых средств регулирования рН и/или буферных средств, включая кислоты, такие как уксусная, борная, лимонная, молочная, фосфорная и соляная кислоты; основания, такие как гидроксид натрия, фосфат натрия, борат натрия, цитрат натрия, ацетат натрия и лактат натрия; и буферы, такие как цитрат/декстроза, бикарбонат натрия и хлорид аммония. Такие кислоты, основания и буферы включены в количество, необходимое для поддержания рН композиции в офтальмологически приемлемых пределах. Одна или несколько офтальмологически приемлемых солей могут быть включены в композицию в количестве, достаточном для приведения осмоляльности композиции в офтальмологически приемлемые пределы. Такие соли включают те, которые содержат катионы натрия, калия или аммония и анионы хлорида, цитрата, аскорбата, бората, фосфата, бикарбоната, сульфата, тиосульфата или бисульфита.

[00336] В некоторых вариантах осуществления композицию, содержащую связывающую лиганды молекулу настоящего изобретения, составляют для доставки в глаз субъекта. Подходящие офтальмологические носители известны специалистам в данной области, и все такие обычные носители можно использовать в настоящем изобретении. Иллюстративные вещества включены в состав с целью облегчения и осуществления чрескожной доставки наружных композиций в глазные ткани или ткани придатков, включая, но не ограничиваясь ими, спирт (этанол, пропанол и нонанол), жирный спирт (лауриловый спирт), жирную кислоту (валериановую кислоту, капроновую кислоту и каприновую кислоту), эфир жирной кислоты (изопропилмиристат и изопропил-н-гексаноат), алкиловый сложный эфир (этилацетат и бутилацетат), многоатомный спирт (пропиленгликоль, пропандион и гексантриол), сульфоксид (диметилсульфоксид и децилметилсульфоксид), амид (мочевину, диметилацетамид и производные пирролидона), ПАВ (лаурилсульфат натрия, цетилтриметиламмония бромид, полоксамеры, Span®, Tween®, соли желчных кислот и лецитин), терпен (d-лимонен, альфа-терпинеол, 1,8-цинеол и ментон) и алканон (N-гептан и N-нонан). Кроме того, вводимые наружно композиции включают средства модулирования поверхностных адгезивных молекул, включая, но не ограничиваясь ими, антагонист кадгерина, антагонист селектина и антагонист интегрина. Так, конкретный носитель может иметь вид стерильной офтальмологической мази, крема, геля, раствора или дисперсии. Также в качестве пригодных офтальмологичских влючены полимеры с медленным высвобождением, например, полимеры "Ocusert", полимеры "Hydron" и т.д.

[00337] Иллюстративные офтальмологические средства, повышающие вязкость, которые можно использовать в настоящем составе, включают: натрий карбоксиметилцеллюлозу; метилцеллюлозу; гидроксипропилцеллюлозу; гидроксипропилметилцеллюлозу; гидроксиэилцеллюлозу; полиэтиленгликоль 300; полиэтиленгликоль 400; поливиниловый спирт; и провидон.

[00338] Некоторые натуральные природные продукты, такие как вигум, альгинаты, ксантановая камедь, желатин, акация и трагакант, также можно использовать для повышения вязкости офтальмологических растворов.

[00339] Важность тоничности обусловлена тем, что гипотонические глазные капли вызывают отек роговицы, а гипертонические глазные капли вызывают деформацию роговицы. Идеальная тоничность составляет приблизительно 300 мОсМ. Требуемую тоничность можно получить способами, описанными в публикации Remington: The Science and Practice of Pharmacy, известной специалистам в данной области.

[00340] Также можно использовать стабилизаторы, такие как, например, хелатообразующие средства, например, EDTA. Также можно использовать антиоксиданты, например, бисульфит натрия, тиосульфит натрия, 8-гидроксихинолин или аскорбиновую кислоту. Стерильность водных составов обычно обеспечивается традиционными офтальмологическими консервантами, например, хлорбутанолом, хлоридом бензалкония, хлоридом цетилпиридиния, фенилртутными солями, тимеросалом и т.п., которые используются в количествах, не являющихся токсичными и обычно находящихся в пределах от примерно 0,001 до примерно 0,1% от веса водной композиции. Обычные консерванты для мазей включают метил- и пропилпарабены. Типичные основы для мази включают белый вазелин и минеральное масло или белый вазелин. Однако предпочтительны консервированные водные носители. Растворы можно доставлять в глаз вручную в пригодной лекарственной форме, например, в форме глазных капель, или доставлять с помощью подходящего микрокапельного или распыляющего прибора, обычно доставляющего отмеренную дозу лекарственного средства. Примеры подходящих носителей включают стерильные, в основном изотонические, водные растворы, содержащие незначительные количества, т.е. менее чем примерно 5 масс. % гидроксипропилметилцеллюлозы, поливинилового спирта, карбоксиметилцеллюлозы, гидроксиэтилцеллюлозы, глицерина и EDTA. рН растворов поддерживается в основном нейтральным, а растворы - изотоническими с помощью соответствующих количеств обычных буферов, например, фосфатного, борного, ацетатного, tris.

[00341] В некоторых вариантах осуществления в офтальмологический носитель добавляют средства, усиливающие проницаемость.

[00342] Количество связывающей лиганды молекулы, которое будет эффективным для предусмотренного терапевтического применения можно определять стандартными клиническими методами, основанными на настоящем описании. Помимо этого, по выбору можно применять количественные анализы in vitro, чтобы облегчить определение интервала, в котором находится оптимальная доза. Количество связывающей лиганды молекулы, смешиваемое с материалами носителя для получения одинарной дозы, может варьироваться в зависимости от млекопитающего, получающего лечение, и от конкретного способа введения.

[00343] Дозирование связывающей лиганды молекулы может зависеть от нескольких факторов, включая тяжесть состояния, необходимо лечение состояния или его профилактика, и возраст, вес и состояние здоровья лица, нуждающегося в лечении. Кроме того, фармакогеномная (влияние генотипа на фармакокинетическую, фармакодинамическую кривую или кривую эффективности лекарственного средства) информация о конкретном пациенте может повлиять на используемую дозировку. Кроме того, точные индивидуальные дозировки в некоторой степени могут быть подобраны в зависимости от разнообразных факторов, включая конкретный характер вводимых комбинированных терапий, время введения, путь введения, свойства состава, скорость выведения, лечение какого конкретного заболевания проводится (например, лечение какого конкретного глазного расстройства проводится), степень тяжести расстройства и анатомическое расположение неоваскулярного расстройства. Следует ожидать некоторого варьирования дозировки.

[00344] В общем случае, при пероральном введении млекопитающему, дозировка связывающей лиганды молекулы обычно составляет от 0,001 мг/кг/день до 100 мг/кг/день, от 0,01 мг/кг/день до 50 мг/кг/день, или от 0,1 мг/кг/день до 10 мг/кг/день. В общем случае, при пероральном введении человеку, дозировка антагониста настоящего изобретения обычно составляет от 0,001 мг до 300 мг в день, от 1 мг до 200 мг в день, или от 5 мг до 50 мг в день. Может потребоваться дозировка вплоть до 200 мг в день.

[00345] Для введения антагониста настоящего изобретения путем парентеральной инъекции дозировка обычно составляет от 0,1 мг до 250 мг в день, от 1 mg to 20 мг в день, или от 3 мг до 5 мг в день. Инъекции можно проводить вплоть до 5 раз в день.

[00346] В общем случае, при пероральном или парентеральном введении, дозировка связывающей лиганды молекулы согласно применению по настоящему изобретению обычно составляет от 0,1 мг до 1500 мг в день, или от 0,5 мг до 10 мг в день, или от 0,5 мг до 5 мг в день. Вводимая доза может составлять вплоть до 3000 мг в день.

[00347] При офтальмологическом введении человеку, например, в стекловидное тело, дозировка связывающей лиганды молекулы в один глаз на одно введение обычно варьируется от 0,003 мг, 0,03 мг, 0,03 мг, 0,1 мг или 0,5 мг до 5,0 мг, 4 мг, 3 мг, 2 мг или 1 мг, или от 0,5 мг до 1,0 мг. Дозировка связывающей лиганды молекулы обычно находится в пределах от 0,003 мг до 5,0 мг в один глаз на одно введение, или 0,03 мг до 4,0 мг в один глаз на одно введение, или от 0,1 мг до 4,0 мг в один глаз на одно введение, или от 0,03 мг до 3,0 мг в один глаз на одно введение, или от 0,1 мг до 3,0 мг в один глаз на одно введение, или от 0,1 мг до 1,0 мг в один глаз на одно введение, или от 0,5 мг до 4,0 мг в один глаз на одно введение, или от 0,5 мг до 3,0 мг в один глаз на одно введение, от 0,5 мг до 2,0 мг в один глаз на одно введение, или от 1,0 мг до 4,0 мг в один глаз на одно введение, или от 1,0 мг до 3,0 мг в один глаз на одно введение, или от 1,0 мг до 2,0 мг в один глаз на одно введение. В некоторых вариантах осуществления связывающую лиганды молекулу вводят в количестве, составляющем примерно 1 мг, или примерно 2 мг, или примерно 3 мг, или примерно 4 мг, или примерно 5 мг, или примерно 6 мг в каждый глаз на одно введение. Связывающая лиганды молекула в некоторых вариантах осуществления присутствует в любом из количеств, перечисленных выше, в объеме, равном 10 мл, 15 мл, 20 мл, 25 мл, 30 мл, 35 мл, 40 мл, 45 мл, 50 мл, 60 мл, 70 мл, 80 мл, 90 мл, 95 мл или 100 мл. В некоторых вариантах осуществления связывающую лиганды молекулу вводят в концентрации, равной 2-4 мг/50 мл. Дозируемый объем может изменяться от 0,01 мл до 0,2 мл, вводимых в каждый глаз, или от 0,03 мл до 0,15 мл, вводимых в каждый глаз, или от 0,05 мл до 0,10 мл, вводимых в каждый глаз.

[00348] В некоторых вариантах осуществления при введении путем инъекции в стекловидное тело связывающую лиганды молекулу вводят в количестве, составляющем от примерно 2 мг до примерно 4 мг в каждый глаз (или от примерно 1 мг до примерно 3 мг, или от примерно 1 мг до примерно 4 мг, или от примерно 3 мг до примерно 4 мг, или от примерно 1 мг до примерно 2 мг в каждый глаз). В некоторых вариантах осуществления связывающую лиганды молекулу вводят в количестве, составляющем примерно 1 мг, или примерно 2 мг, или примерно 3 мг, или примерно 4 мг, или примерно 5 мг, или примерно 6 мг в каждый глаз. Связывающая лиганды молекула в некоторых вариантах осуществления присутствует в любом из количеств, перечисленных выше, в объеме, равном 10 μл, 15 μл, 20 μл, 25 μл, 30 μл, 35 μл, 40 μл, 45 μл, 50 μл, 60 μл, 70 μл, 80 μл, 90 μл, 95 μл или 100 μл. В некоторых вариантах осуществления связывающую лиганды молекулу вводят в концентрации, равной 2-4 мг/50 мл.

[00349] Обычно, подходящая дозировка варьируется в случае внутривенного введения обычно в пределах примерно 50-5000 микрограммов активного соединения на килограмм веса тела. Подходящая дозировка варьируется в случае интраназального введения обычно в пределах от примерно 0,01 пг/кг веса тела до 1 мг/кг веса тела. Эффективные дозы можно экстраполировать исходя из кривой зависимости доза-ответ, полученной из модели исследования in vitro или на животных.

[00350] Для системного введения терапевтически эффективную дозу можно сначала устанавливать, исходя из количественных анализов in vitro. Например, дозу можно составлять, используя модель на животных, чтобы достичь циркулирующей концентрации в интервале, включающем IC50, как определено в клеточной культуре. Такую информацию можно использовать для более точного определения пригодных для использования доз в людях. Размер первоначальных дозировок можно оценить, исходя из данных in vivo, например, моделей на животных, используя хорошо известные в уровне техники методы. Средний специалист в данной области может легко оптимизировать введение людям на основании данных, полученных на животных.

[00351] Дозируемое количество и интервал можно подбирать индивидуально с целью получения уровней содержания соединения в плазме, которые достаточны для получения терапевтического эффекта. В случаях местного введения или избирательного поглощения, эффективная местная концентрация может не быть связанной с концентрацией в плазме. Специалист в данной области сможет оптимизировать терапевтически эффективные местные дозировки без излишнего экспериментирования.

[00352] Вводимое количество будет, конечно, зависеть от получающего лечение субъекта, от веса субъекта, тяжести болезни, способа введения и решения лечащего врача. Терапию можно повторять периодически во время обнаружения симптомы или даже когда они не обнаруживаются. Терапию можно проводить саму по себе или в комбинации с другими лекарствами.

[00353] Введение связывающей лиганды молекулы и, в случае комбинированной терапии - дополнительного средства, может независимо проводиться от одного до четырех раз в день, или от одного до четырех раз в месяц, или от одного до шести раз в год, или один раз каждые два, три, четыре или пять лет. Введение может осуществляться в течение одного дня или одного месяца, двух месяцев, трех месяцев, шести месяцев, одного года, двух лет, трех лет или может быть даже в течение всей жизни пациента. В одном варианте осуществления введение выполняют один раз в месяц в течение трех месяцев. Хроническое, долговременное введение может быть показано во многих случаях. Дозировку можно осуществлять как разовую дозу, разделенную на несколько доз. В общем случае желаемая дозировка должна вводиться с определенными интервалами в течение продолжительного периода, обычно в течение по меньшей мере нескольких недель или месяцев, хотя могут потребоваться более длительные периоды введения, составляющие несколько месяцев или лет.

[00354] Помимо лечения уже существующих расстройств, композиции можно вводить профилактически с целью предотвращения или замедления возникновения этих расстройств. В профилактических применениях, композицию можно вводить пациенту, предрасположенному к определенному заболеванию, такого как глазное расстройства, или иным образом подверженного риску его возникновения.

Пути введения

[00355] Композиция, содержащая описываемую здесь содержащую лиганды молекулу, можно вводить пациенту несколькими способами в зависимости, в частности, от типа вводимого средства и медицинской истории, факторов риска и симптомов пациента. Пути введения, пригодные для способов данного изобретения, включают как системное, так и местное введение. В контексте данного докумнета термин "системное введение" означает режим введения, приводящий к доставке фармацевтической композиции, по существу, по всему тебу пациента. Иллюстративные режимы системного введения включют, без ограничения, внутривенную инъекцию или пероральное введение. Термин "метное введение" в данном контексте означают режим введения, приводящий к доставке значительно большего количества фармацевтической композиции в глаза или в окружающую их область (или в опухоль или другие целевые ткани), чем в области, удаленные от глаз (или опухоли или других целевых тканей).

[00356] Системные или местные пути введения, полезные в способах данного изобретения, охватывают, без ограничения, желудочный зонд; внутривенную инъекцию; внутрикишечную инъекцию; внутримышечную инъекцию; подкожную инъкцию; чрескожную диффузию и электрофорез; наружные глазные капли и мази; периокулярную и внутриглазную инъекции, включая подконъюнктивальную инъекцию; устройства доставки с замеделенным высвобождением, включая местно имплантированное устройства с замеделенным высвобождением; и внутриглазные и периокулярные имплантаты, включая биоэродидруемые и резервуарные имплантаты.

[00357] Так в одном аспекте способ лечения глазного заболевания, связанного с неоваскуляризацией сетчатки, осуществляют путем местного введения субъекту связывающей лиганды молекулы. Например, в некоторых вариантах осуществления, фармацевтичпескую композицию, содержащую связывающую лиганды молекулу, вводят наружно, или путем местной инъекции (например, путем внутриглазной, например, интраветриальной инъекции), или высвобождается из внутриглазного или периокулярного имплантата, такого как биоэродидруемый или резервуарный имплантаты. Композицию предпочтительно вводят в количестве, эффективном для ингибирования VEGF-C и/или VEGF-D в глазу у субъекта от связывания или стимулирования VEGFR-2 и/или VEGFR-3, экспрессируемых в клетках глаза или глазных сосудов.

[00358] В случае комбинированных терапий введение связывающей лиганды молекулы и дополнительного средства может быть последовательным или одновременным во времени. При последовательном введении, введение каждого компонента может быть одним путем или разными путями. В одном варианте осуществления дополнительное средство (например, продукт-ингибитор VEGF-A или PDGF) вводят в пределах 90 дней, 30 дней, 10 дней, 5 дней, 24 часов, 1 часа, 30 минут, 10 минут, 5 минут или одной минуты от введения связывающей лиганды молекулы. Если дополнительное средство вводят до связывающей лиганды молекулы, связывающую лиганды молекулу вводят в течение такого времени и в таком количестве, чтобы общее количество дополнительного средства и связывающей лиганды молекулы было эффективным для лечения или предотвращения целевого показания, например глазного расстройства. Если связывающую лиганды молекулу вводят до дополнительного средства, дополнительное средство вводят в течение такого времени и в таком количестве, чтобы общее количество дополнительного средства и связывающей лиганды молекулы было эффективным для лечения или предотвращения целевого показания, например глазного расстройства.

[00359] Фармацевтические композиции согласно данному изобретению можно составлять так, чтобы высвобождение связывающей лиганды молекулы и, по выбору, дополнительного средства в комбинированной терапии происходило в основном немедленно после введения или в течение любого заранее определенного периода после введения, используя составы для регулируемого высвобождения. Например, фармацевтическую композицию можно предоставлять как форму с длительным высвобождеднием. Применение композиций с немедленным или длительным высвобождением зависит от характера состояния, на которое направлено лечение. Если состояние представляет собой острое заболевание, применение лечения с немедленным высвобождением предпочтительно композициям с замедленным высвобождением. Для некоторых профилактических или долговременных терапий может быть пригодна композиция с замедленным высвобождением.

[00360] Введение связывающей лиганды молекулы или обоих связывающей лиганды молекулы и одного или нескольких дополнительных средств в составах с контролируемым высвобождением может быть полезным, если связывающая лиганды молекула, либо сама по себе либо в комбинации, характеризуется (i) узким интервалом значений терапевтического индекса (например, небольшой разницей между концентрацией в плазме, приводящей к вредным побочным явлениям или токсическим реакциям, и концентрацией в плазме, приводящей к терапевтическому эффекту; в общем случае терапевтический индекс - TI, определяется как отношение средней летальной дозы (LD50) к средней эффективной дозе (ED 50)); (ii) узким интервалом поглощения в желудочно-кишечном тракте; или (iii) коротким биологическим временем полувыведения, и поэтому требуется частое дозирование в течение дня для поддержания содержания в плазме на терапевтическом уровне.

[00361] Можно следовать разным стратегиям с целью получения контролируемого высвобождения, при котором скорость высвобождения опережает скорость разложения или метаболизма активных ингредиентов. Например, контролируемого высвобождения можно достичь путем соответствующего выбора характеристик состава и ингредиентов, включая, например, соответствующие композиции с контролируемым высвобождением и покрытия. Примеры включают композиции с одной или многократными единицами в таблетках или капсулах, масляных растворах, суспензиях, эмульсиях, микрокапсулах, микросферах, наночастицах, пластырях и липосомах. Способы получения таких составов с замедленным или контролируемым высвобождеднием хорошо известны в этой области техники.

[00362] Связывающая лиганды молекула и, если присутствует - дополнительное средство, могут также доставляться, используя устройство доставки лекарства, такое как имплантат. В данном контексте термин "имплантат" относится ко многим материалам, которые не предвигаются в значительной мере от места введения после имплантации. Имплантат может быть биодеградируемым, небиодеградируемым или состоять из обоих биодеградируемого и небиодеградируемого материалов. Небиодеградируемый имплантат может включать, по желанию, резервуар с многоразовым наполнением. Имплантаты, полезные в способах данного изобретения, представляют собой, например, пластыри, частицы, листы, пластины, микрокапсулы и т.п., и могут иметь любую форму и размер, совместимые в выбранным участком введения, который может быть, без ограничения, задней камерой, передней камерой, над сосудистой оболочной или под конъюнктивой. Следует понимать, что имплантат, полезный в данном изобретении, в общем случае высвобождает имплантированную фармацевтическую композицию в глаз пациента в размере эффективной дозы в течение длительного времени.

Различные глазные имплантаты и составы с замедленным высвобождением, пригодные для высвобождения в глазу, хорошо известны в этой области техники, как описано в патентах США №№5869079 и 5443505, раскрытие которых во всей своей полноте включено в данный документ. Глазные устройства доставки лекарства можно вводить в камеру глаза, такую как переднюю или заднюю камеру, или можно имплантировать в или на склеру, хориоидальное пространство или бессосудистой области снаружи стекловидного тела. В одном варианте осуществления имплантат может быть размещен в бессосудистой области, например, на склере, таким образом, чтобы осуществлять диффузию через склеру связывающей лиганды молекулы и любых дополнительных средств к требуемому участку лечения, например, во внутриглазное пространство и желтое пятно глаза. Кроме того, участок диффузии через склеру должен находиться рядом с участком неоваскуляризации, таким как участок, находящийся рядом с желтым пятном. Подходящие устройства для доставки лекарственного средства описаны в публикациях патентных заявок США №№2008/0286334; 2008/0145406; 2007/0184089; 2006/0233860; 2005/0244500; 2005/0244471; и 2005/0244462, и патентах США №№6808719 и 5322691, полное содержание которых во всей своей полноте включено в данный документ ссылкой.

[00363] В других вариантах осуществления описанную здесь связывающую лиганды молекулу применяют к глазу посредством липосом. В еще одном варианте осуществления связывающая лиганды молекула содержится в сплошном устройстве или устройстве с выборочным высвобождением, например, мембраны, такие как, но не ограничиваются ими, мембраны, используемые в Ocusert™System (Alza Corp., Palo Alto, Calif.). В качестве дополнительного варианта осуществления связывающая лиганды молекула содержится, переносится посредством или присоединена к контактным линзам, которые помещаются на глаз. В еще одном варианте осуществления связывающая лиганды молекула содержится в тампоне или губке, которые могут применяться к глазной поверхности. Другой вариант осуществления настоящего изобретения использует связывающую лиганды молекулу, содержащуюся в жидком распыляемом составе, который можно применять на глазную поверхность.

[00364] В одном варианте осуществления имплантат содержит связывающую лиганды молекулу и необязательно, если есть в наличии - дополнительный ингредиент, распределенный в биоразлагаемой полимерной матрице. Матрица может включать в себя PLGA (сополимер полимолочная кислота-полигликолевая кислота), полимер, оканчивающийся сложным эфиром, и полимер, оканчивающийся кислотой, или их смесь. В другом варианте осуществления имплантат содержит связывающую лиганды молекулу и необязательно, если есть в наличии - дополнительный ингредиент, поверхностно-активное вещество и липофильное вещество. Количество липофильного вещества может составлять примерно 80-99% от веса имплантата. Пригодные липофильные вещества включают, но не ограничиваются ими, глицерилпальмитостеарат, диэтиленгликоль моностеарат, пропиленгликоль моностеарат, глицерина моностеарат, глицерина монолинолеат, глицерина моноолеат, глицерина монопальмитат, глицерилмонолаурат, глицерина дилаурат, глицерина мономиристат, глицерина димиристат, глицерина монопальмитат, глицерина дипальмитат, глицерина моностеарат, глицерина дистеарат, глицерина моноолеат, глицерина диолеат, глицерина монолинолеат, глицерина дилинолеат, глицерина моноарахидат, глицерина диарахидат, глицерина монобегенат, глицерина дибегенат и их смеси. В другом варианте осуществления имплантат содержит связывающую лиганды молекулу и необязательно, если есть в наличии - дополнительный ингредиент, размещенный внутри полого рукава. Связывающая лиганды молекула и необязательно, если есть в наличии - дополнительный ингредиент, доставляются в глаз путем введения рукава в глаз, высвобождения имплантата из рукава в глаз, а затем удаления рукава из глаза. Пример такой доставки описан в публикации патентной заявки США №2005/0244462, полное содержание которого тем самым включено в данный документ.

[00365] В одном варианте осуществления имплантат представляет собой гибкое вставляемое глазное устройство, приспособленное для регулируемого замедленного высвобождения связывающей лиганды молекулы и необязательно, если есть в наличии - дополнительного ингредиента, в глаз. В одном варианте осуществления устройство включает в себя удлиненный корпус из полимерного материала в форме стержня или трубки, содержащий связывающую лиганды молекулу и необязательно, если есть в наличии - дополнительный ингредиент, с по меньшей мере двумя закрепляющими выступами, проходящими в радиальном направлении от корпуса. Устройство может быть длиной по меньшей мере 8 мм и диаметром корпусной части, включая выступы, не превышающим 1,9 мм. Механизмом замедленного высвобождения может, например, быть осмос или биоэрозия. Вставляемое устройство можно вводить в верхней или нижней свод глаза таким образом, чтобы не зависеть от движения глаза благодаря анатомии свода. Выступы могут быть различной формы такой, как ребра, винтовая резьба, ямочки или шишки, усеченные конусообразные сегменты или заплетаемые сегменты брейда. В дополнительном варианте осуществления полимерный материал для корпуса выбирают из набухающих в жидкой среде материалов. Таким образом, можно использовать устройство с меньшим первоначальным размером. Вставляемое устройство может иметь размер и конфигурацию такого свойства, которые при введении в верхней или нижней свод глаза обеспечивают постоянное расположение устройства вне поля зрения в установленном месте и незаметны для реципиента в течении продолжительного периода использования. Устройство может удерживаться в верхнем или нижнем своде в течение 7-14 дней или дольше. Пример такого устройства описан в патенте США №5322691, который таким образом включен ссылкой во всей своей полноте.

[00366] В другом аспекте способ подавления неоваскуляризации у субъекта, у которого была обнаружена опухоль, использует местное введение субъекту связывающей лиганды молекулы. Например, в некоторых вариантах осуществления фармацевтическую композицию, включающую связывающую лиганды молекулу, вводят местно в область опухоли или в орган или ткани, из которых опухоль была удалена хирургически. В таких вариантах осуществления композицию предпочтительно вводят в количестве, достаточном для подавления неоваскуляризации в опухоли.

[00367] В тех случаях, когда связывающая лиганды молекула представляет собой молекулу нуклеиновой кислоты, введение фармацевтической композиции, включающей связывающую лиганды молекулу, можно проводить, используя многочисленные способы, хорошо известные в области генной терапии. Такие способы включают, но не ограничиваются ими, лентивирусное преобразование, аденовирусное преобразование, цитомегаловирусное преобразование, микроинъекцию и электропорацию.

Наборы и стандартные дозы

[00368] Изобретение также относится к наборам, включающим одну или несколько фармацевтических композиций и инструкции по применению. Связывающую лиганды молекулу можно упаковывать или составлять вместе с другой связывающей лиганды молекулой или другим терапевтическим средством, описываемым в данном документе, например, в наборе или стандартной дозе, которые позволяют осуществлять одновременное введение; эти два компонента могут быть составлены вместе (т.е. смешаны) или быть в разных композициях (т.е. не смешаны) и в индивидуальных дозируемых количествах. Каждая из композиций в наборе может содержаться в контейнере. В некоторых вариантах осуществления два компонента набора/стандартной дозы упакованы вместе с инструкцией по введению двух соединений субъекту-человеку для лечения одного из расстройств или заболеваний, описываемых в данном документе.

[00369] Наборы могут включать контейнер. Контейнер можно использовать для разделения компонентов и включают, например, бутылку с отделениями или пакет из фольги с отделениями. Отдельные композиции могут также, при желании, содержаться в одном контейнере без отделений. Наборы могут также включать инструкции по введению компонентов. Особенно предпочтительны контейнеры, из которых отдельные компоненты вводятся в различных лекарственных формах, вводятся в различных дозировках, или когда требуется титрование индивидуальных антагонистов.

[00370] Все публикации и патенты, упоминаемые в данном документе, тем самым во всей своей полноте включаются ссылкой, как если бы каждая отдельная публикация или патент были специально и индивидуально указаны как включаемые в состав документа путем ссылки. В случае диспута превалирует настоящая заявка, включая любые определения данного документа.

ПРИМЕРЫ

Пример 1 - ECD фрагменты белков VEGFR.

[00371] Были проведены эксперименты с целью охарактеризовать фрагменты и варианты и продукты слияния VEGFR-3 и/или VEGFR-2 и/или VEGFR-1, эффективные для связывания целевых лигандов, таких как VEGF-C и/или VEGF-D и/или VEGF-A. См. публикации международных патентов №№: WO 2005/087808, WO 2005/000895, WO 2006/088650, WO 2006/099154, WO 2004/106378, WO 2005/123104 and U.S. Patent No. 7,855,178, и патента США №7855178, которые в полном объеме включены в данный документ путем ссылки. Эти исследования показывают, что ECD этих рецепторе могут быть усечены, а также то, что домены из этих различных рецепторов можно рекомбинировать с образованием связывающих лиганды молекул.

Пример 2 - Создание связывающей лиганды молекулы VGX-301-ΔN2

[00372] Связывающую лиганды молекулу, включающую сходные с Ig домены I-III рецептора VEGFR-3 (обозначаемые здесь как "VGX-300") получали так, как описано в работе Makinen et al., Nat. Med., 7: 199-205, 2001, раскрытие которой во всей своей полноте включено в данный документ путем ссылки.

[00373] Основное свойство молекулы VGX-300 заключается в том, что она содержит 12 сайтов гликозилирования; 2×6 возможных сайтов гликозилирования с N-связью, 5 на каждом фрагменте рецептора (сходные с Ig домены I, II и III VEGFR-3) и 1 в каждой области Fc гамма цепи. Доказательства гликозилирования с О-связью отсутствуют.

[00374] [00374] Свойства гликозилирования могут влиять на ФК, но гликаны Fc слабо влияют на ФК (Jones et al., Glycobiology, 17(5), 2007 pp. 529-540). Вкратце, асиалогликопротеиновые рецепторы связываются с гликановыми структурами комплексного типа с N-связями, в которых отсутствуют две или более сиаловых кислоты, где лежащие в основе остатки галактозы (Gal) превращаются в концевые сахариды. Кроме того, рецептор маннозы (Man) распознает только высокоманнозные гликаны с N-связью и концевые остатки N-ацетилглюкозамина (tGlcNAc). Каждый из этих рецепторов может вызывать быстрый метаболический клиренс белков.

[00375] С целью определить, какие из сайтов гликозилирования важны для активности продукта, была предпринята последовательная делеция каждого из пяти предполагаемых сайтов с N-связью. Для введения одинарных мутаций в кодирующую область VGX-300 были использованы пять пар праймеров для уничтожения консенсусного присоединения каждого из пяти гликанов с N- связью (N-Q).

[00376] Использованные пары праймеров представляют собой следующее:

Смысловой N1: 5' GACCCCCCCGACCTTGCAGATCACGGAGGAGTCACAC 3' (SEQ ID NO: 12)

Антисмысловой N1: 5' GTGTGACTCCTCCGTGATCTGCAAGGTCGGGGGGGTC 3' (SEQ ID NO: 13)

Смысловой N2: 5' CTGCACGAGGTACATGCCCAGGACACAGGCAGCTACGTC 3' (SEQ ID NO: 14)

Антисмысловой N2: 5' GACGTAGCTGCCTGTGTCCTGGGCATGTACCTCGTGCAG 3' (SEQ ID NO: 15)

Смысловой N3: 5' GTCCATCCCCGGCCTCCAAGTCACGCTGCGCTCGC 3' (SEQ ID NO: 16)

Антисмысловой N3: 5' GCGAGCGCAGCGTGACTTGGAGGCCGGGGATGGAC 3' (SEQ ID NO: 17)

Смысловой N4: 5' GGGAGAAGCTGGTCCTCCAGTGCACCGTGTGGGCTGA 3' (SEQ ID NO: 18)

Антисмысловой N4: 5' TCAGCCCACACGGTGCACTGGAGGACCAGCTTCTCCC 3' (SEQ ID NO: 19)

Смысловой N5: 5' AGCATCCTGACCATCCACCAGGTCAGCCAGCACGACCT 3' (SEQ ID NO: 20)

Антисмысловой N5: 5' AGGTCGTGCTGGCTGACCTGGTGGATGGTCAGGATGCT 3' (SEQ ID NO: 21)

[00377] Наличие мутаций подтверждали секвенированием, после чего в клетки 293Т (HEK) временно трансфицировали плазмидные векторы. Образцы культур анализировали, используя вестерн-блот. Жизнеспособные конструкции затем прогрессировали до промежуточных пригодных для суспензии клеток 293F (НЕК) и надосадочные жидкости очищали, используя ProSepA хроматографию и гель-фильтрацию, с тем чтобы впоследствии исследовать с помощью иммуноферментного анализа (ИФА или ELISA) и биологического количественного анализа BaF/3 для определения выхода и активности. В Таблице 3 приведены данные экспрессии и активности каждого полученного мутанта.

[00379] Из Таблицы 3 видно, что только мутант N2 (обозначенный здесь как "VGX-301-ΔN2") демонстрирует благоприятную экспрессию и свойства активности по сравнению с родительской молекулой (т.е. VGX-300). VGX-301-ΔN2 и родительская VGX-300 получали в клетках СНО и HEK путем кратковременной экспрессии, а фармакокинетики (ФК) каждой молекулы исследовали следующим образом. Крыс Спрэг-Доули распределяли по группам из 2, 3 или 5 животных на соединение в каждом эксперименте. Крысы в каждой из группу получали по однократной инъекции VGX-300 или VGX-301-ΔN2 путем внутривенного введения в виде болюсной инъекции при концентрации дозы, составляющей 1 мг/кг. Промежуточные образцы крови отбирали путем протыкания латеральной хвостовой вены на 1-й день (перед дозой) и в целом в 12 временных точках после дозы, причем временные промежутки изменялись от 5 мин до 14 дней после начальной обработки. Образцы сыворотки получали из каждого образца крови и исследовали, используя количественную VEGF-C лиганд-улавливающий ELISA для определения циркулирующей концентрации каждого из соединений. Результаты этих анализов затем использовали для расчетов фармакокинетических параметров. Данные ФК VGX-300 и VGX-301-ΔN2 приведены ниже в Таблице 4.

[00380]

[00381] ФК кривые, представленные на Фигуре 1, и данные в Таблице 4 показывают, что VGX-301-ΔN2 может иметь благоприятный эффект на ФК характеристики по сравнению с VGX-300, полученной в той же экспрессионной системе.

Пример 3 - Связывание VGX-301-ΔN2 с VEGF-C и VEGF-D

[00382] Чтобы определить специфичность связывания VGX-300 и VGX-301-ΔN2 с VEGF-C и VEGF-D, VEGF-C или VEGF-D (2 мкг/мл) предварительно наносили на поверхность чашек ELISA и использовали в качестве улавливающих антигенов. Увеличивающиеся концентрации (от 0 до 10 мкг/мл) либо VGX-300, либо VGX-301-ΔN2, подавали в планшеты и определяли, используя конъюгат кроличьего античеловеческого IgG и пероксидазы хрена, используя набор тетраметилбензидиновых субстратов. Результаты продемонстрировали, что оба VGX-300 и VGX-301-ΔN2 специфически связываются как с VEGF-C, так и с VEGF-D. См. фигуру 2. Неожиданно, VGX-301-ΔN2 продемонстрировал более сильное связывание с обоими лигандами, чем VGX-300.

Пример 4 - Афинность связывания VGX-300 и VGX-301-ΔN2

[00383] Связывание VEGF-C и VEGF-D с VGX-300 или VGX-301-ΔN2 анализировали с помощью поверхностного плазмонного резонанса (SPR), выполненного на биосенсоре ProteOn XPR36 (Bio-Rad). Либо VGX-300, либо VGX-301-ΔN2 улавливали на белке G', закрепленном на сенсорном GLM чипе, и измеряли аффинность молекулы к VEGF-C или VEGF-D. Результаты исследования аффинности приведены ниже в Таблице 5.

[00384]

[00385] Данные, приведенные в Таблице 5 выше, показывают, что образцы VGX-300 и VGX-301-ΔN2 связывали человеческие VEGF-C и VEGF-D с практически одинаковой аффинностью, при этом обе молекулы демонстрировали более сильное связывание с VEGF-C, чем с VEGF-D.

Пример 5 - VGX-301-ΔN2 блокирует связывание и сшивку VEGF-C и VEGF-D с VEGFR-3

[00386] Были разработаны основанные на клетках количественные анализы для оценки способности лигандов семейства VEGF связываться и сшиваться с VEGFR-2 и VEGFR-3. Эти биологические анализы применяли для исследования нейтрализующей активности VGX-300 и VGX-301-ΔN2. Клеточные линии для биологических анализов состоят из мышиной IL-3-зависимой про-В клеточной линии Ba/F3, стабильно трансфицированной химерным рецептором, состоящим из ECD рецептора VEGFR-2 или VEGFR-3, слитого в рамке с трансмембранным и внутриклеточным доменами мышиного эритропоэтинового рецептора (как описано в примере 5 публикации WO 2005/087808, содержание которой включено путем ссылки в состав данной заявки во всей своей полноте). В отсутствие IL-3, эти клетки выживают и пролиферируют только в присутствии факторов роста, способных связываться и сшиваться с ECD соответствующего VEGFR.

[00387] Вкратце, клетки Ba/F3, трансфицированные с использованием VEGFR-2 или VEGFR-3 (10,000 клеток/лунку; 96-луночный планшет), культивировали в среде с добавлением VEGF-C или VEGF-D в присутствии повышающихся концентраций VGX-300 или VGX-301-ΔN2 (0-100 мкг/мл) в течение 48 часов при 37°С. Пролиферацию клеток измеряли, используя реагент WST 1; клетки инкубировали в течении 4 часов при 37°C с WST-1 и измеряли абсорбцию при 450 нм (n=3; планки погрешностей = стандартной ошибке среднего, SEM).

[00388] Результаты показали, что VGX-300 нейтрализовала активность VEGF-C и VEGF-D, как продемонстрировано с помощью дозозависимого ингибирования VEGF-C и VEGF-D в биоисследовании Ba/F3 рецепторов VEGFR-2 и VEGFR-3. VGX-300 показали повышенную активность в нейтрализации VEGF-C по сравнению с VEGF-D в исследовании обоих VEGFR-2 и -3. См. фигуры 3 и 4.

[00389] Анализ VGX-301-ΔN2 продемонстрировал, что эта молекула также способна блокировать связывание обоих VEGF-C и VEGF-D с VEGFR-3. Активность нейтрализации со стороны VGX-301-N2 была несколько выше, чем у VGX-300. См. фигуру 4. В Таблице 6 приведены результаты связывания (IC50) VGX-300 и VGX-301-ΔN2 с VEGF-C и VEGF-D в биоисследовании Ba/F3 рецептора VEGFR-3.

[00391]

Пример 6 - Глазное распределение и фармакокинетики VGX-300 и VGX-301AN2 после введения в стекловидное тело

[00391] Это исследование проводили с целью определения глазного распределения и фармакокинетики VGX-300, VGX-301-ΔN2 и афлиберсепта (EYLEA) после введения однократной дозы в стекловидное тело пигментированных кроликов.

[00392] Схема исследования включала 3 группы по 8 самок кроликов в каждой группе. Животным вводили 500 мкг меченых радиоактивными изотопами VGX-300, VGX-301-ΔN2 или афлиберсепта путем болюсной инъекции 50 мкл в стекловидное тело (IVT) обоих глаз.

[00393] Одно животное в группе умерщвляли на 1, 12, 24, 72, 168, 366, 504 и 672 после введения дозы. Образцы сыворотки, полученной из крови, и отобранных глазных тканей брали в каждый установленный момент времени и определяли концентрацию радиоактивных веществ, используя анализ радиоактивности. Отобранные глазные ткани включали внутриглазную жидкость, сосудистую оболочку глаза, роговицу, радужку и цилиарное тело (ICB), хрусталик, зрительный нерв, сетчатку, пигментный эпителий сетчатки (ПЭС), склеру, трабекулярную сеть и стекловидное тело. На фигуре 5 показаны средние концентрации радиоактивных веществ в различных тканях и сыворотке за время ведения наблюдений.

[00394] Исследуемые вещества, [125I]VGX-300, [125I]афлиберсепт (EYLEA) и [125I]VGX-301-ΔN2, хорошо переносились, были стабильны в стекловидном теле и находились под длительным воздействием глазных тканей как заднего сегмента, так и переднего сегмента. Несмотря на то, что воздействие сыворотки было различным после введения [125I]VGX-300 и [125I]VGX-301-ΔN2 в стекловидное тело, как [125I]VGX-300, так и [125I]VGX-301-ΔN2 подвергались незначительному системному воздействию по сравнению с воздействием на афлиберсепт (EYLEA), скорее всего в результате клиренса путем всасывания через сосудистую оболочку глаза, а также с оттоком внутриглазной жидкости. ФК и биораспределение [125I]VGX-300 и [125I]VGX-301-ΔN2, наблюдаемые в данном исследовании, были сходны для обоих веществ и сравнимы с этими показателями для [125I]афлиберсепта (EYLEA).

Пример 7 - Ретинопатия в модели для недоношенных

[00395] Последующий пример представляет собой иллюстративное исследование для оценки способности VGX-300 и VGX-301-ΔN2 подавлять наступление неоваскуляризации сетчатки, используя модель ретинопатии недоношенных (ROP). В этой модели на 7-й день после рождения (Р7) мышей подвергали гипероксии (75% кислорода) в течение 5 дней (до Р12). После воздействия в условиях гипероксии, мышей Р12 возвращали в нормоксические условия и делали инъекцию в стекловидное тело человеческого контрольного антитела изотипа VGX-300, VGX-301-ΔN2, Eylea (VEGF-Trap), VGX-300 + Eylea или VGX-301-ΔN2 + Eylea. Всех мышей затем содержали в нормоксических условиях в течение 5 дней до умерщвления на Р17, энуклеации и фиксации в 10%-ном формалине/ФБР. Количественный анализ кровеносных сосудов в каждой группе проводили, используя методы окрашивания гематоксилин-эозином (Н&Е) и/или иммуногистохимии (IHC).

Пример 8 - Вызываемая аргоновым лазером неоваскуляризация сосудистой оболочки глаза (CNV)

[00396] В этой модели возрастной макулярной дегенерации (AMD), CNV вызывают путем разрыва с применением аргонового лазера мембраны Бруха у мышей в 0-ой день (по 3 ожога на каждую мышь). Изучали группы из 10 мышей и лечение осуществляли путем инъекций в стекловидное тело раз в неделю (в 0-ой день и 7-ой день) человеческого контрольного антитела изотипа VGX-301-ΔN2, VGX-300, Eylea (VEGF-Trap), VGX-301-ΔN2 + Eylea или VGX-300 + Eylea. На 14-ый день животных умерщвляли и готовили хороидальные предметные стекла, которые окрашивали, используя ICAM-2, для визуализации неоваскуляризации с помощью флуоресцентной микроскопии.

[00397] Предполагается, что VGX-301-ΔN2, в качестве монотерапии, в значительной степени подавляет хороидальную неоваскуляризацию в мышиной модели неоваскулярной AMD, что сравнимо с эффектом, получаемым от Eylea®.

Пример 9 - Ингибирующий эффект связывающих лиганды молекул на рост опухолей и метастазирование, опосредованные VEGF-C

[00398] Чтобы показать способность связывающей лиганды молекулы, описываемой в данном документе, подавлять рост опухолей и/или метастазирование, можно использовать любую принятую модель опухоли. Иллюстративные модели включают животных, предрасположенных к возникновению различных типов злокачественных образования, животных, которым путем инъекции вводят клетки опухоли или клеточные линии опухолей из одинаковых с ними или отличающихся видов, включая, необязательно, клетки, преобразованные для рекомбинантной свехэкспрессии одного или нескольких факторов роста, таких как VEGF-C или VEGF-D. Для предоставления модели опухолей in vivo, в которых определяются многочисленные факторы роста, можно преобразовывать клеточные линии опухолей, используя экзогенную ДНК для стимулирования экспрессии многочисленных факторов роста.

[00399] Связывающую лиганды молекулу, описываемую в данном документе, можно вводить непосредственно, например, в виде белка, путем внутривенного вливания или путем имплантированных в тело микронасосов, или в виде нуклеиновой кислоты как часть лечения генной терапией. Субъекты предпочтительно группируют согласно полу, весу, возрасту и медицинской истории болезни с целью минимизировать отклонения среди субъектов.

[00400] Эффективность оценивают по уменьшению размера (объема) и веса опухоли. Эффективность можно также исследовать по действию на размер опухоли, распространению (метастазам) и числу опухолей. Например, чтобы продемонстрировать действие на ангиогенез по сравнению с лимфангиогенезом можно использовать специфические клеточные метки. Предполагается, что конструкция, связывающая VEGF-A, будет более эффективной в отношении ангиогенеза, а конструкция, связывающая VEGF-C, будет более эффективной в отношении лимфангиогенеза. Наблюдения за животными в целом можно проводить с точки зрения периода выживания и изменения их веса. Опухоли и образцы исследовали на наличие ангиогенеза, лимфангиогенеза и/или некроза.

[00401] В качестве субъектов для исследования способности связывающей лиганды молекулы, описанной в данном документе, подавлять или предотвращать рост опухолей, можно использовать SCID мышей. Связывающую лиганды молекулу, используемую в терапии, в общем случае выбирают таким образом, чтобы она связывалась с лигандом фактора роста, экспрессируемого клеткой опухоли, особенно факторов роста, которые сверхэкспрессируются клеткой опухоли по сравнению с не являющейся онкологической клеткой субъекта. В SCID модели клетки опухоли, например, клетки MCF-7, можно трансфицировать, используя вирус, кодирующий определенный фактор роста под контролем промотора или другой последовательности, регулирующей экспрессию, которая обеспечивает сверхэкспрессию фактора роста, как описано в публикации WO 02/060950. В альтернативном случае можно использовать другие клеточные линии, например, НТ-1080, как описано в патенте США №6375929. Можно трансфицировать опухолевые клетки с любым количеством лигандов факторов роста, которые необходимо сверхэкспрессировать, или можно выбрать опухолевые клеточные линии, которые уже сверхэкспрессируют один или несколько интересующих лигандов факторов роста. Одной группе субъектов имплантировали клетки, которые были псевдо-трансфицированы, т.е. использовался вектор, в котором отсутствовала вставка лиганда фактора роста.

[00402] До, одновременно с или после имплантации опухоли с помощью вышеописанных клеток, субъектов обрабатывали, используя определенную связывающую лиганды молекулу. Существует несколько различных путей введения связывающей лиганды молекулы. Можно использовать генную терапию in vivo и/или ex vivo. Например, клетки можно трансфицировать аденовирусом или другим вектором, кодирующим связывающую лиганды молекулу, и имплантировать в клетки опухоли, экспрессирующие фактор(ы) роста, клетки, трансфицированные молекулой, связывающей лиганды, могут быть теми же клетками, которые преобразуются фактором(ами) роста (или уже сверхэкспрессируют фактор(ы) роста). В некоторых вариантах осуществления аденовирус, кодирующий эту молекулу, связывающую лиганды, вводят путем инъекции in vivo, например, внутривенно. В некоторых вариантах осуществления саму связывающую лиганды молекулу (например, в белковой форме) вводят либо системно, либо местно, например, используя микронасос. При исследовании действенности определенной связывающей конструкции обычно осуществляют по меньшей мере один контрольный эксперимент. Например, в случае основанной на векторе терапии, применяют вектор с пустой вставкой или LacZ, или вставка может представлять собой связывающую лиганды молекулу, включающую целиком ECD рецептора VEGFR-3, способный связываться с VEGF-C или VEGF-D, в таком контрольном эксперименте, если необходимо, может использоваться больше чем одна конструкция ECD (например, для связывания нескольких лигандов, если используется связывающая конструкция со многими аффинностями при связывании лигандов).

А. Иллюстративные процедуры

Получение плазмидных векторов для экспрессии, трансфицирование клеток и их испытания

[00403] цДНК, кодирующую VEGF-C или VEGF-D или их комбинацию, вводят в плазмиду pEBS7 (Peterson and Legerski, Gene, 107: 279-84, 1991.). Тот же вектор можно использовать для экспрессии связывающей лиганды молекулы.

[00404] Субклон MCF-7S1 человеческой MCF-7 клеточной линии карциномы молочной железы трансфицируют плазмидной ДНК с помощью электропорации, и стабильные группы клеток отбирают и культивируют, как описано ранее (Egeblad and Jaattela, Int. J. Cancer, 86: 617-25, 2000). Клетки метят метаболически в не содержащей метионин и цистеин MEM (Gibco), содержащей добавку 100 MKCi/мл [35S]-метионина и [35S]-цистеина (Redivue Pro-Mix, Amersham Pharmacia Biotech). Меченные факторы роста иммунопреципитировали из кондиционированной среды, используя антитела к экспрессированному(ым) фактору(ам) роста. Иммунокомплексы и связывающие комплексы осаждали, используя белок А сефарозу (Amersham Pharmacia Biotech), дважды промывают в 0,5% BSA, 0,02% Tween 20 в ФБР и один раз в ФБР, и анализируют в SDS-PAGE в восстановительной среде.

Подготовка и обработка субъекта

[00405] Клетки (20000/лунку) помещают по четыре на образец в 24-луночный планшет, обрабатывают трипсином на реплицированных планшетах через 1, 4, 6 или 8 дней, и подсчитывают, используя гемоцитометр. Свежую среду добавляют через 4 и 6 дней. Для анализа онкогенеза субконфлуентные культуры собирают с помощью обработки трипсином, дважды промывают и, используя 107 клеток в ФБР, заражают SCID мышей с удаленными яичниками, внося культуру в жировые отложения второй (вспомогательной) молочной железы, причем мыши подкожно снабжены 60-дневными гранулами, медленно высвобождающими 0,72 мг 17β-эстрадиола (Innovative Research of America). Удаление яичников и имплантацию гранул проводят за 4-8 дней до заражения опухолевыми клетками.

[00406] цДНК кодирования для связывающей конструкции(й) субклонируют в плазмиду pAdBgIII и аденовирусы получают, как описано выше (Laitinen et al., Hum. Gene Then, 9: 1481-6, 1998). Связывающая лиганды молекула(ы) или контрольные LacZ (Laitinen et al., Hum. Gene Ther., 9: 1481-6, 1998) аденовирусы, 109 БОЕ/мышь, внутривенно вводят SCID мышам за 3 часа до заражения опухолевыми клетками.

Анализ действенности способа

[00407] Длину и ширину опухоли измеряют дважды в неделю слепым методом и объем опухоли рассчитывают как длина × ширину × глубину × 0,5, считая, что опухоль имеет полуэллипсоидную форму и ее глубина равна ширине (Benz et al., Breast Cancer Res. Treat, 24: 85-95, 1993).

[00408] Опухоли иссекают, фиксируют в 4%-ном параформальдегиде (рН 7,0) в течение 24 часов и заливают в парафин. Срезы (7 мкм) иммуноокрашивают моноклональными антителами к, например, РЕСАМ-1 (Pharmingen), VEGFR-1, VEGFR-2, VEGFR-3 (Kubo et al., Blood, 96: 546-553, 2000) или PCNA (Zymed Laboratories), PDGFR-α, PDGFR-β или поликлональными антителами к LYVE-1 (Banerji et al., J Cell Biol, 144: 789-801, 1999), VEGF-C (Joukov et al., EMBO J., 16: 3898-911, 1997), ламинином согласно опубликованным протоколам (Partanen et al., Cancer, 86: 2406-12, 1999), или любыми другими факторами роста. Среднее число РЕСАМ-1 положительных сосудов определяют по трем областям (при х60 увеличении) наиболее высокой васкулярной плотности (васкулярные горячие точки) в сечении. Все гистологические анализы проводят, используя «слепые» образцы опухолей.

[00409] Через три недели после инъекции аденовирусной конструкции и/или белковой терапии четырех мышей из каждой группы наркотизируют, открывают брюшную кожу и проводят инъекцию в опухоль нескольких микролитров 3%-ного голубого красителя Эванса (Sigma) в ФБР. Дренажирование красителя из опухоли наблюдают макроскопически.

[00410] Можно также проводить визуализацию и наблюдение за кровью и белками крови для получения свидетельства о здоровье субъектов и протяженности сосудистой сети опухоли.

Пример 10 - Действие на прогрессирование опухоли у субъектов, используя комбинированную терапию молекулой, связывающей лиганды, и химиотерапевтическим агентом

[00411] Это исследование проводят для испытания действенности применения связывающей лиганды молекулы, описанной в данном документе, в комбинации с другими противораковыми терапиями. Такие терапии включают химиотерапию, радиационную терапию, анти-смысловую терапию, РНК-интерференцию и моноклональные антитела, направленные на онкологические цели. Комбинированный эффект может быть аддитивным, но предпочтительно он является синергическим в отношении противопухолевых действий, например, предотвращение, подавление, регрессия и устранение злокачественных опухолей, продление жизни и/или уменьшение побочных эффектов.

[00412] Субъектов делят на группы, при этом одна группа получает химиотерапевтический агент, одна группа получает связывающую лиганды молекулу, и одна группа получает как химиотерапевтический агент, так и связывающую лиганды молекулу, через одинаковые периодические интервалы, например, ежедневно, еженедельно или ежемесячно. В человеческих исследованиях субъектов в общем случае группируют согласно полу, весу, возрасту и медицинской истории болезни с целью минимизировать отклонения среди субъектов. В идеальном случае у субъектов выявлен один и тот же тип злокачественной опухоли. У субъектов (людей или отличных от людей) прогресс можно определять по измерениям опухоли, метастазов, потере/прибавке веса, сосудистой сети опухолей и содержанию белых кровяных клеток.

[00413] Из опухолей через регулярные интервалы времени берут биопсии как до, так и после начала лечения. Например, биопсии берут сразу перед лечением, через неделю, а затем с интервалом в один месяц, или когда есть возможность, поскольку, например, произведено удаление опухоли. Образцы биопсий исследуют с целью обнаружения клеточных маркеров и в целом морфологии клеток и тканей для определения эффективности лечения. Помимо этого или вместо этого, могут использоваться методы визуализации.

[00414] В исследованиях на субъектах отличных от людей можно использовать дополнительный контрольный эксперимент с плацебо. Исследования на животных, проводимые в соответствии с директивами НИЗ, также предоставляли преимущество в том, что позволяли вносить относительно одинаковую популяцию раковых клеток, и на опухоли, которые выборочно сверхпроизводили один или несколько факторов роста, нацеливали молекулы, связывающие лиганды.

1. Связывающая лиганды молекула, содержащая связывающий лиганды полипептид, соединенный с гетерологичным пептидом,

где связывающий лиганды полипептид состоит из аминокислотной последовательности, определяемой положениями 25-314 в SEQ ID NO: 2, при условии, что секвон N-гликозилирования, соответствующий положениям 104-106 в SEQ ID NO: 2, удален посредством изменения изначальной аминокислотной последовательности в пределах положений 104-106 в SEQ ID NO: 2 путём консервативной замены по меньшей мере одной аминокислоты для уничтожения N-X-S или N-X-T мотива секвона N-гликозилирования,

где связывающий лиганды полипептид гликозилирован по четырем сайтам секвона N-гликозилирования, соответствующим положениям 33-35 в SEQ ID NO: 2, положениям 166-168 в SEQ ID NO: 2, положениям 251-253 в SEQ ID NO: 2 и положениям 299-301 в SEQ ID NO: 2,

где гетерологичный пептид представляет собой фрагмент константного домена иммуноглобулина,

где связывающий лиганды полипептид присоединен своей С-концевой аминокислотой посредством пептидной связи к N-концевой аминокислоте гетерологичного пептида,

где связывающая лиганды молекула связывается с фактором роста эндотелия сосудов С (VEGF-C) и фактором роста эндотелия сосудов D (VEGF-D) и ингибирует их,

и где связывающая лиганды молекула является растворимой.

2. Связывающая лиганды молекула по п. 1, где аминокислота в положении 104 в SEQ ID NO: 2 заменена другой аминокислотой, выбранной из группы, состоящей из глутамина, аспартата, глутамата, аргинина и лизина.

3. Связывающая лиганды молекула по п. 1, где фрагмент константного домена иммуноглобулина представляет собой фрагмент константного домена IgG.

4. Связывающая лиганды молекула по п. 3, где фрагмент константного домена иммуноглобулина включает аминокислоты 306-537 последовательности SEQ ID NO: 3.

5. Связывающая лиганды молекула по любому из пп. 1-4, где молекула включает аминокислотную последовательность, приведенную в SEQ ID NO: 3.

6. Выделенный полинуклеотид, кодирующий связывающий лиганды полипептид, соединенный с гетерологичным пептидом, в составе растворимой связывающей лиганды молекулы, которая связывается с фактором роста эндотелия сосудов С (VEGF-C) и фактором роста эндотелия сосудов D (VEGF-D) и ингибирует их, где связывающий лиганды полипептид состоит из аминокислотной последовательности, определяемой положениями 25-314 в SEQ ID NO: 2, при условии, что секвон N-гликозилирования, соответствующий положениям 104-106 в SEQ ID NO: 2, удален посредством изменения изначальной аминокислотной последовательности в пределах положений 104-106 в SEQ ID NO: 2 путём консервативной замены по меньшей мере одной аминокислоты для уничтожения N-X-S или N-X-T мотива секвона N-гликозилирования,

где связывающий лиганды полипептид присоединен своей С-концевой аминокислотой посредством пептидной связи к N-концевой аминокислоте гетерологичного пептида, и

где гетерологичный пептид представляет собой фрагмент константного домена иммуноглобулина.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к молекуле, связывающейся с фактором роста эндотелия сосудов С и фактором роста эндотелия сосудов D и может быть использовано в медицине для регулирования ангиогенеза. Молекула, состоящая из первых трёх Ig-подобных доменов VEGFR-3 с делецией сайта N-гликозилирования в домене 1 VEGFR-3 и присоединённых своей С-концевой аминокислоты к N-концевой аминокислоте фрагмента константного домена иммуноглобулина, обладает улучшенными фармакокинетическими свойствами. 2 н. и 4 з.п. ф-лы, 5 ил., 6 табл., 10 пр.

Наверх