Олигонуклеотидные праймеры и флуоресцентно-меченные зонды, способ и тест-система для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита крс с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени



Олигонуклеотидные праймеры и флуоресцентно-меченные зонды, способ и тест-система для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита крс с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени
Олигонуклеотидные праймеры и флуоресцентно-меченные зонды, способ и тест-система для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита крс с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени
Олигонуклеотидные праймеры и флуоресцентно-меченные зонды, способ и тест-система для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита крс с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени
Олигонуклеотидные праймеры и флуоресцентно-меченные зонды, способ и тест-система для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита крс с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени
Олигонуклеотидные праймеры и флуоресцентно-меченные зонды, способ и тест-система для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита крс с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени
C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2699195:

Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ") (RU)

Изобретение относится к биотехнологии, а именно к средствам молекулярной диагностики. Разработаны олигонуклеотидные праймеры и флуоресцентно-меченные зонды для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита КРС с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени:

полевой изолят ЗУД КРС:

f- 5'- TAGAAAATGGATGTACCACAAATACAG 3',

r 5' -TTGTTACAACTCAAATCGTTAGGTG-3',

зонд 5' -ACCACCTAATGATAGTGTTTATGATTTACC-3;

каприпоксвирусы:

f - 5' ATGAAACCAATGGATGGGATA 3',

r - 5' CGAAATGAAAAACGGTATATGGA 3',

зонд - 5' ATGAGCCATCCATTTTCCAA 3'4;

вакцинный штамм ЗУД КРС:

f- 5'-TGTTTCCATTCTCCACTGCT-3',

r - 5' -TACTTACTAAAAAATGGGCGCА-3',

зонд - 5'-TCGCTGACATCGTTAGTCCАСТС-3'.

Предложен способ дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита (нодулярного дерматита) КРС с дополнительной детекцией генома каприпоксвирусов с помощью ПЦР в режиме реального времени при одинаковом термическом профиле с использованием этих праймеров и зондов, и тест-система ПЦР в режиме реального времени для его проведения. Разработан высокочувствительный ПЦР-набор, состоящий из готовой ПЦР смеси, фермента Taq-полимеразы, положительного контроля и отрицательного контроля, позволяющий в кратчайшие сроки специфично выявить и дифференцировать геном. 3 н.п. ф-лы, 3 ил., 2 табл., 3 пр.

 

Изобретение относится к ветеринарной вирусологии, к средствам молекулярной диагностики, а именно к детекции и дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита (нодулярного дерматита) КРС с дополнительной детекцией генома каприпоксвирусов в полимеразной цепной реакции в режиме реального времени.

Заболевания, вызываемые возбудителями, относящимися к роду Capripoxvirus (оспа овец, оспа коз, заразный узелковый дерматит (ЗУД) КРС), в соответствии с классификацией МЭБ относятся к категории особо опасных инфекционных болезней, подлежащих обязательной нотификации, способны вызывать эпизоотии и наносить огромный экономический ущерб животноводству, слагающийся из гибели и вынужденного убоя больных животных, снижения продуктивности, абортов и затрат на проведение ветеринарно-санитарных и охранно-карантинных мероприятий [3, 10].

Все каприпоксвирусы являются ДНК-содержащими оболочечными вирусами, которые относятся к семейству Poxviridae рода Capripoxvirus [5]. Геном вируса представлен двуцепочечной ДНК длиной 151 тыс. пар оснований [11].

Заразный узелковый дерматит (нодулярный дерматит) крупного рогатого скота (ЗУД КРС) - трансграничная инфекционная болезнь КРС, проявляющаяся повышением температуры тела, образованием кожных узлов (бугорков), при генерализации инфекционного процесса - лимфаденитом, поражением конъюнктивы, слизистых оболочек органов дыхания, пищеварения и воспроизводства [6, 8].

Заболеванию подвержены только крупный рогатый скот и буйволы [7]. Основным путем распространения болезни считается передача с кровососущими насекомыми, перечень которых многообразен и в настоящее время подлежит уточнению.

Более того, активное использование живых гомологичных вакцин против ЗУД на основе вакцинного штамма типа Neethling в приграничных странах, как со стороны Азии, так и ЕС, подчеркивает острую необходимость разработки комплекса методов для выявления и дифференциации возбудителей каприпоксвирусных инфекций, включая вакцинный штамм, который также способен вызывать клинические проявления болезни у животных [4, 9].

Известен способ дифференциации вакцинного штамма вируса ЗУД с помощью ПЦР с последующим анализом кривых плавления ампликонов с высоким разрешением (HRM) [1]. Недостатком этого способа является высокая зависимость чувствительности реакции от качества и концентрации ДНК в исследуемой пробе. Более того, различия температуры пиков в пределах 1°С затрудняет интерпретацию полученных результатов.

Наиболее близким к заявляемому методу является тест-система, которая основана на выявление геномов вакцинного и полевого штаммов вируса ЗУД в режиме дуплекс [2]. Недостатком данного метода является наличие конкуренции между праймерами при одновременном присутствии обоих вирусов, что особенно критично в начале кампании по вакцинированию живыми вакцинами.

Таким образом, технической проблемой является разработка метода способного выявлять и достоверно дифференцировать геномы полевых изолятов и вакцинных штаммов вирусов ЗУД в независимости от периода вакцинации.

Изобретение касается тест-системы, состоящей из олигонуклеотидных праймеров и флуоресцентно-меченных зондов для дифференциации геномов вакцинного и полевого штаммов вируса заразного узелкового дерматита КРС с дополнительной детекцией генома каприпоксвирусов при проведении реакции в одинаковом термическом профиле. Представленный метод включает последовательности олигонуклеотидов, специфичные только для полевых изолятов вируса ЗУД КРС, вакцинного штамма и каприпоксвирусов, имеющие следующие нуклеотидные последовательности:

- Вакцинного штамма вируса ЗУД:

f- 5' -TGTTTCCATTCTCCACTGCT-3'

r - 5'-TACTTACTAAAAAATGGGCGCA-3',

зонд - 5'-TCGCTGACATCGTTAGTCCACTC-3';

- Каприпоксвирусов:

f- 5'-ATGAAACCAATGGATGGGATA-3'

r- 5'-CGAAATGAAAAACGGTATATGGA-3'

зонд - 5'-ATGAGCCATCCATTTTCCAA-3';

- Полевых изолятов вируса ЗУД:

f- 5'-AGAAAATGGATGTACCACAAATACAG-3'

r - 5'-TTGTTACAACTCAAATCGTTAGGTG-3'

зонд - 5'-ACCACCTAATGATAGTGTTTATGATTTACC-3'

В качестве источника флуоресценции на 5' конце зондов применяют краситель FAM, а для тушения флуоресценции на 3' конце - BHQ1. Флуоресценцию у всех зондов измеряют по каналу FAM.

При тестировании пробы на наличие геномов вакцинного штамма вируса ЗУД КРС, полевого изолята вируса ЗУД КРС и каприпоксвирусов:

- пересечение кривой флуоресценции линии threshold с праймерами на геном вакцинного штамма вируса ЗУД КРС и геном каприпоксвирусов свидетельствует о наличии в образце генома вакцинного штамма вируса;

- пересечение кривой флуоресценции линии threshold с праймерами на геном полевого изолята вируса ЗУД КРС и генома каприпоксвирусов свидетельствует о наличии в образце генома полевого изолята вируса;

- отсутствие пересечения кривой флуоресценции линии threshold для всех систем праймеров свидетельствует об отсутствии генома вируса ЗУД в исследуемом материале.

Изобретение может быть использовано в ветеринарии, клинической и лабораторной диагностике для дифференциации генома вакцинного и полевого штаммов вируса заразного узелкового дерматита КРС с дополнительной детекцией генома каприпоксвирусов в пробах патологического и биологического материала.

Технический результат от предлагаемого изобретения заключается в разработке современной, высокоспецифической тест-системы, предназначенной для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита (нодулярного дерматита) КРС с дополнительной детекцией генома каприпоксвирусов в полимеразной цепной реакции в режиме реального времени.

Сущность изобретения заключается в том, что специфичное выявление и дифференциация генома полевого изолята вируса ЗУД КРС от вакцинного штамма проводится с дополнительной детекцией генома каприпоксвирусов в индивидуальных пробирках при одном термическом профиле, что исключает возможную конкуренцию между праймерами во время амплификации.

1. При помощи пары праймеров для выявления генома полевого изолята вируса ЗУД КРС осуществляют ПЦР в режиме реального времени, позволяющей выявлять геном вирулентного штамма вируса ЗУД КРС. В качестве мишени выбран фрагмент гена наружного капсидного белка EEV с делецией 27 п.н., присутствующей у всех представителей вирусов сем. Capripoxviridae, включая вакцинные штаммы вируса ЗУД КРС, за исключением полевых изолятов вирусов ЗУД КРС.

2. При помощи праймеров для выявления генома вакцинного штамма вируса ЗУД проводят ПЦР в режиме реального времени, позволяющей выявлять геном аттенуированного вакцинного штамма вируса ЗУД КРС. В качестве мишени выбран фрагмент гена с неизвестной функцией, специфичный исключительно для вакцинных штаммов вирусов, полногеномные последовательности которых депонированы в базе данных GenBank.

3. При помощи праймеров и зонда для выявления генома каприпоксвирусов проводят ПЦР-РВ для выявления генома каприпоксвирусов. В качестве мишени выбран фрагмент гена, кодирующий поверхностный белок Р32, который консервативен для всех каприпоксвирусов, включая полевые и вакцинные штаммы вируса ЗУД КРС.

Сущность изобретения пояснена на графических материалах:

Фиг. 1: Линейность результатов ПЦР-РВ при тестировании 10-кратных разведений выделенной ДНК вируса ЗУД КРС штамма ВНД КРС/Дагестан/2015 (диагностический).

Фиг. 2: Линейность результатов ПЦР-РВ при тестировании 10-кратных разведений выделенной ДНК вируса оспы овец штамма «Афганский».

Фиг. 3: Линейность результатов ПЦР-РВ при тестировании 10-кратных разведений выделенной ДНК вакцинного штамма вируса ЗУД КРС типа Neethling.

С помощью программного обеспечения BLAST и лабораторных исследований показана высокая специфичность праймеров тест-систем метода.

В таблицах 1 и 2, представлены эффективность, стандартное отклонение (SD) и коэффициент детерминированности (r2), воспроизводимости и повторяемости тест-систем. Как представлено в таблице 1 эффективность тест-систем метода находится в диапазоне 90-99%, SD - 0,03-0,6; r2 - 0,99-1. Оценка воспроизводимости и повторяемости тест-систем показала, что все тест-системы являются высоковоспроизводимы, а коэффициент вариации не превышал 2%, как в пределах внутри запуска ПЦР, так и между запусками ПЦР (Табл. 2).

Детекция продуктов амплификации осуществляется методом регистрации флуоресценции, генерируемой в результате разрушения гибридизационного зонда, находящегося на 5'-конце красителя FAM, а на 3'-конце - гасителя BHQ1. При отсутствии выявляемой ДНК краситель и гаситель сближены, и наблюдается лишь незначительная флуоресценция, так как гаситель поглощает испускаемое красителем излучение. При накоплении в ходе ПЦР специфических продуктов зонд гибридизуется на ампликон, что ведет к его разрушению за счет 5'-экзонуклеазной активности Taq-полимеразы. В результате краситель отделяется от гасителя и его излучение может быть детектировано. Таким образом, увеличение флуоресценции прямо пропорционально количеству синтезированного ПЦР-продукта.

Праймеры и зонды разработаны для амплификации и детекции фрагмента гена EEV полевого изолята вируса ЗУД КРС, в котором у других представителей сем. Capripoxviridae, включая вакцинные штаммы вируса ЗУД КРС типа Neethling, присутствует делеция 27 п.н. в данном локусе, тогда как у полевых вирусов ЗУД КРС она отсутствует.

Праймеры и зонды разработаны для амплификации и детекции фрагмента гена с неизвестной функцией вакцинного штамма вируса ЗУД КРС, в котором присутствует специфический участок, который не обнаруживается у полевых изолятов вируса ЗУД и других каприпоксвирусов.

Праймеры и зонды на каприпоксвирусы комплиментарны консервативной области гена, кодирующего поверхностный белок Р32, и не комплиментарны каким-либо участкам генома других поксвирусам.

Для разработки праймеров из базы данных GenBank были получены полногеномные последовательности каприпоксвирусов. Последовательности выравнивали с помощью программы Bioedit, затем визуально оценивали консервативные участки, на основе которых был получен ряд праймеров. В результате тестирования при различных параметрах была получена оптимальная комбинация праймеров и зонда, которые показывают высокую чувствительность и специфичность при одном термическом профиле.

Набор для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита КРС с дополнительной детекцией генома каприпоксвирусов в ПЦР-РВ состоит из следующих компонентов:

№1. Готовая ПЦР смесь для выявления генома полевого изолята вируса ЗУД КРС, объем 550 мкл;

№2. Готовая ПЦР смесь на вакцинный штамм, объем 550 мкл;

№3. Готовая ПЦР смесь на каприпоксвирусы, объем 550 мкл;

№4. Фермент Taq-ДНК-полимераза, объем 37,5 мл;

№5. Положительный контрольный образец, объем 100 мкл;

№6. Отрицательный контрольный образец, объем 100 мкл.

ПЦР-РВ проводится в одну стадию с использованием готовых ПЦР смесей (№1, №2, №3), включающей на одну реакцию буфер 5х для ПЦР-РВ (5,0 мкл), 25 мМ хлорид магния (3,5 мкл), дезоксирибонуклеотид трифосфаты (0,5 мкл 10 пмолль), олигонуклеотидные праймеры (1 мкл каждого праймера 10 пмоль), зонд (1 мкл 5 пмоль) и фермента Taq-ДНК-полимеразу в программируемом амплификаторе. Перед началом постановки реакции необходимо разморозить все необходимые компоненты реакции, встряхнуть на шейкере, затем центрифугировать несколько секунд на низкоскоростной центрифуге.

Реакционную смесь для проведения ПЦР-РВ готовят в пробирке в расчете на одну реакцию (V=25 мкл) следующим образом:

- готовая ПЦР смесь(№1, №2, №3) 20,0 мкл,
- фермент Taq-ДНК-полимераза №2 0,25 мкл,
- выделенная ДНК (включая полож. контроль №5 и отриц. контроль №6) 5,0 мкл.

Приготовленную в отдельных 1,5 мл пробирках реакционные ПЦР-смеси на каждый из вирусов переносят в 0,2 мл пробирки по 20 мкл в каждую и вносят 5 мкл суммарной ДНК. В соответствующие пробы на каждый вирус вносят выделенные образцы ДНК, отрицательного и положительного контролей. Общий объем смеси - 25 мкл.

Устанавливают пробирки в амплификатор для постановки ПЦР-РВ, отмечают в программе расположение и характеристику проб, выбирают рабочий краситель (FAM), устанавливают в программе температурно-временной профиль реакции.

После первоначальной денатурации при 95°С в течение 10 мин ПЦР в режиме реального времени проводят в следующих условиях: 95°С - 15 с, 60°С - 60 с - 45 циклов.

Результаты интерпретируют на основании наличия или отсутствия пересечения кривой флуоресценции с пороговой линией, что соответствует о наличии или отсутствии значения порогового цикла «Ct» в соответствующей графе в таблице результатов реакции, выведенной в результате машинного анализа.

Результат считается достоверным только в случае прохождения положительного (Ct<35) и отрицательного (Ct не определен) контролей амплификации.

Образец считается положительным, если значение Ct не более 35. Однако в случае, если значение Ct для проб находится в пределах от 30 до 37, необходимо повторить реакцию с целью подтвердить или опровергнуть наличие ДНК искомого вируса в исследуемой пробе.

Образец считается отрицательным на наличие ДНК вируса, если для него значение Ct отсутствует или более 37.

Результаты не подлежат учету (считаются недействительными):

- в случае отсутствия регистрации роста флуоресценции в пробе с положительным контролем, что может свидетельствовать об ошибках, допущенных на этапе постановки ПЦР-РВ;

- в случае регистрации значения Ct в таблице результатов для отрицательного контрольного образца, что указывает на наличие контаминации.

В любом из этих случаев необходимо повторить анализ всех проб, а при повторном выявлении контаминации отрицательного контроля принять меры по выявлению и ликвидации источника контаминации.

Сущность предлагаемого изобретения пояснена примерами его использования, которые не ограничивают объем изобретения.

Пример 1. Оценка специфичности тест-системы

Для оценки специфичности тест-системы использовались следующие образцы гетерологичных вирусов, депонированных в коллекции штаммов микроорганизмов ФГБУ «ВНИИЗЖ»: ДНК вируса заразного узелкового дерматита штамма ВИД КРС/Дагестан/2015 (диагностический) [13], ДНК вируса заразного узелкового дерматита штамма ВНД КРС Э-95, ДНК вакцинного штамма (Onderstepoort, ЮАР), ДНК вируса оспы овец штамма «Афганский», ДНК вируса оспы овец вакцинного штамма «ВНИИЗЖ», ДНК вируса оспы коз штамма «Приморский 2003», ДНК вируса оспы коз штамма «ВНИИЗЖ 2003», ДНК вируса чумы мелких жвачных штамма «ВНИИЗЖ», ДНК вируса везикулярного стоматита штамма «ВНИИЗЖ», ДНК вируса оспы коров штамма «ВНИИЗЖ».

Работу с ДНК проводили в условиях, регламентированных Методическими указаниями МУ 1.3. 2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности» [12].

Процедуру выделения ДНК из исследуемого материала проводили с использованием набора реагентов на основе мембранных колонок.

ПЦР в режиме реального времени проводили в реакционной смеси следующего состава (на 1 исследование):

- готовая ПЦР смесь №1 20,0 мкл,
- готовая ПЦР смесь №2 20,0 мкл,
- готовая ПЦР смесь №3 20,0 мкл,
- фермент Taq-ДНК-полимераза №4 0,25 мкл,
- выделенная ДНК (отриц. контроль №5) - 5,0 мкл.

ПЦР в режиме реального времени и регистрацию результатов проводили в ПЦР-РВ приборе по программе, описанной выше.

Результаты интерпретировали на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линии, что соответствует наличию (или отсутствию) значения порогового цикла Ct в соответствующей графе в таблице результатов. Результат считали положительным в случаи, если кривая накопления флуоресценции для соответствующего образца имела характерную «сигмовидную» форму и пересекала пороговую линию.

При тестировании специфичности тест-системы с использованием ДНК гомологичных и гетерологичных вирусов ложноположительных и ложноотрицательньгх результатов не выявлено.

Пример 2. Оценка чувствительности метода

Для оценки чувствительности тест-системы для выявления генома полевого штамма использовали ДНК вируса ЗУД КРС штамма ВНД КРС/Дагестан/2015 [13] с титром 5,21 lg ТЦЦ50/см3. Метод ПЦР-РВ выявлял ДНК вируса ЗУД КРС с чувствительностью 0,21 lg ТЦД50/см3. Для оценки эффективности амплификации было проведено 3 повторных эксперимента и получены значения Ct, которые использовались для вычисления эффективности. Полученные данные приведены на графическом изображении (Фиг. 1) С помощью средних значений Ct была получена линейная регрессия со значением эффективности амплификации (Е) 98,6% (Фиг. 1).

Для оценки чувствительности тест-системы для выявления генома каприпоксвирусов использовали ДНК вируса оспы овец штамм «Афганский» с титром 6,17 lg ТЦД50/СМ3. Метод ПЦР-РВ выявлял ДНК с чувствительностью 0,17 lg ТЦЦ50/см3. Для оценки эффективности амплификации было проведено 3 повторных эксперимента и получены значения Ct, которые использовались для вычисления эффективности. Полученные данные приведены на графическом изображении (Фиг. 2). С помощью средних значений Ct была получена линейная регрессия со значением эффективности амплификации (Е) 90,2% (Фиг. 2).

Для оценки чувствительности тест-системы для выявления генома вакцинного штамма вируса использовали ДНК вакцинного штамма вируса ЗУД КРС типа Neethling (Onderstepoort, ЮАР) с титром 5,21 lg ТЦД50/см3. Метод ПЦР-РВ выявлял ДНК с чувствительностью 0,21 lg ТЦЦ50/см3. Для оценки эффективности амплификации было проведено 3 повторных эксперимента и получены значения Ct, которые использовались для вычисления эффективности. Полученные данные приведены на графическом изображении (Фиг. 3) С помощью средних значений Ct была получена линейная регрессия со значением эффективности амплификации (Е) 95,16% (Фиг. 3).

Пример 3. Оценка воспроизводимости и повторяемости тест-систем метода.

Воспроизводимость для тест-системы на полевой изолят вируса ЗУД определяли с помощью величины стандартного отклонения (SD) для каждой серии разведений, используя полученные значения Ct. Стандартное отклонение SD варьировало от 0,11 до 0,33 на протяжении 5 10-кратных разведений. При этом коэффициент детерминации r2 составил 0,990 (Табл. 1).

Как, представлено в таблице 1, воспроизводимость для тест-системы на каприпоксвирусы определяли с помощью величины стандартного отклонения (SD) для каждой серии разведений, используя полученные значения Ct. Стандартное отклонение SD варьировало от 0,12 до 0,32 на протяжении 6-ти 10-кратных разведений. При этом коэффициент детерминации г2 составил 0,999.

Воспроизводимость для тест-системы на вакцинный штамм вируса ЗУД определяли с помощью величины стандартного отклонения (SD) для каждой серии разведений, используя полученные значения Ct. Стандартное отклонение SD варьировало от 0,03 до 0,6 на протяжении 5-ти 10-кратных разведений. При этом коэффициент детерминации г2 составил 0,998.

Вариабельность значений Ct (повторяемость) в пределах одного запуска и между запусками тест-систем метода представлена в таблице 2. Оценка воспроизводимости и повторяемости тест-систем показала, что все тест-системы являются высоковоспроизводимыми, а коэффициент вариации не превышал 2%, как в пределах внутри запуска ПЦР, так и между запусками ПЦР (Табл. 2).

Таким образом, изобретение может быть использовано в ветеринарной практике для дифференциации генетического материала полевого изолята вируса ЗУД КРС от вакцинного штамма в контролем на выявление генома каприпоксвирусов в биологических и культуральных образцах для постановки и уточнения диагноза, для решения научно-исследовательских задач по мониторингу распространения вируса ЗУД КРС среди восприимчивых животных. Использование специфических праймеров и зондов позволяет выявить и дифференцировать генетический материал полевого изолята вируса ЗУД КРС от вакцинного штамма в исследуемых образцах методом полимеразной цепной реакции (ПЦР) с гибридизационно-флуоресцентной детекцией в режиме реального времени (РВ).

Источники информации, принятые во внимание при составлении описания изобретения к заявке на выдачу патента РФ на изобретение «Олигонуклеотидные праймеры и флуоресцентно-меченный зонды, способ и тест-система для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита КРС с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени»:

1. A high-resolution melting (HRM) assay for the differentiation between Israeli field and Neethling vaccine lumpy skin disease viruses. Menasherow S, Erster O, Rubinstein-Giuni M, Kovtunenko A, Eyngor E, Gelman B, Khinich E, Stram Y. J Virol Methods. 2016 Jun; 232:12-5. doi: 10.1016/j.jviromet.2016.02.008

2. Agianniotaki EI, Chaintoutis SC, Haegeman A, Tasioudi KE, De Leeuw I, Katsoulos PD, Sachpatzidis A, De Clercq K, Alexandropoulos T, Polizopoulou ZS, Chondrokouki ED, Dovas CI. J Virol Methods. Development and validation of a TaqMan probe-based real-time PCR method for the differentiation of wild type lumpy skin disease virus from vaccine virus strains. 2017 Nov; 249:48-57. doi: 10.1016/j.jviromet.2017.08.011.

3. Beard, P.M. Lumpy skin disease: a direct threat to Europe. // Vet Rec, 2016, v. 28, p. 557-558.

4. T, I, N, I. Detection of lumpy skin disease virus in skin lesions, blood, nasal swabs and milk following preventive vaccination. Transbound Emerg Dis. 2017 Oct 30. doi: 10.1111/tbed.12730

5. Buller R.M., Arif В.M., Black D.N., Dumbell K.R, Esposito J.J., Lefkowitz E.J., McFadden G., Moss В., Mercer A.A., Moyer R.W., Skinner M.A., and Tripathy D.N. Family Poxviridae. In: Fauquet, С.M., M.A. Mayo, J. Maniloff, U. Desselberger, and L.A. Ball, (eds), Virus Taxonomy: Classification and Nomenclature of Viruses. Eighth Report of the International Committee on Taxonomy of Viruses, 2005, pp. 117-133. Elsevier Academic Press, San Diego

6. Coetzer J.A. W. Lumpy skin disease. In: Coetzer J.A. W. and R.C. Tustin, eds, Infectious Diseases of Live-stock. Oxford University Press, Cape Town, 2004, pp. 1268-1276.

7. Elhaig M.M., Selim A., Mahmoud M. Lumpy skin disease in cattle: Frequency of occurrence in a dairy farm and a preliminary assessment of its possible impact on Egyptian buffaloes. Onderstepoort J Vet Res. 2017 Mar 28; 84(1):e1-e6. doi: 10.4102/ojvr.v84i1.1393

8. Hunter P., D. Wallace. Lumpy skin disease in southern Africa: a review of the disease and aspects of control. J.S. Afr. Vet. Assoc, 2001, 72, 68-71.

9. Katsoulos PD, Chaintoutis SC, Dovas CI, Polizopoulou ZS, Brellou GD, Agianniotaki EI, Tasioudi KE, Chondrokouki E, Papadopoulos O, Karatzias H, Boscos C. Investigation on the incidence of adverse reactions, viraemia and haematological changes following field immunization of cattle using a live attenuated vaccine against lumpy skin disease. Transbound Emerg Dis. 2017 Apr 8. doi: 10.1111/tbed.12646.

10. M, M. Epidemiological and Molecular Studies on Lumpy Skin Disease Outbreaks in Turkey during 2014-2015. // Transbound Emerg Dis. 2016 (in Press).

11. Tulman E.R., Afonso C.L., Lu Z., Zsak L., Kutish G.F., Rock D.L. Genome of lumpy skin disease virus. J Virol. 2001 Aug; 75(15):7122-30

12. МУ 1.3.2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности».

13. Патент РФ №2606254, С12№ 7/00, А62К 39/126 G01N 33/569 «Штамм вируса нодулярного дерматита крупного рогатого скота Dermatitis nodularis bovum рода Capripoxvirus для изготовления биопрепаратов для диагностики и специфической профилактики нодулярного дерматита крупного рогатого скота», 10.01.2017

1. Набор, включающий олигонуклеотидные праймеры и флуоресцентно-меченные зонды для амплификации и детекции фрагмента гена:

- наружного капсидного белка EEV полевых изолятов вируса заразного узелкового дерматита крупного рогатого скота (ЗУД КРС):

f-5'-TAGAAAATGGATGTACCACAAATACAG 3',

r 5'-TTGTTACAACTCAAATCGTTAGGTG-3',

зонд 5'-ACCACCTAATGATAGTGTTTATGATTTACC-3;

- Р32 каприпоксвирусов:

f-5' ATGAAACCAATGGATGGGATA 3',

r-5' CGAAATGAAAAACGGTATATGGA 3',

зонд - 5' ATGAGCCATCCATTTTCCAA 3';

- вакцинного вируса:

f-5'-TGTTTCCATTCTCCACTGCT-3',

r-5'-TACTTACTAAAAAATGGGCGCA-3',

зонд - 5'-TCGCTGACATCGTTAGTCCACTC-3'.

2. Способ выявления и дифференциации генома полевого изолята вируса ЗУД КРС (по уникальному локусу в гене EEV) от вакцинного штамма (по локусу LSD008) с дополнительной детекцией генома каприпоксвирусов (по фрагменту гена Р32) с использованием олигонуклеотидных праймеров и зондов по п. 1 в реакции ПЦР-РВ, состоящей из следующих этапов: первоначальная денатурация при 95°С в течение 10 мин и термическое циклирование при 95°С - 15 с, 60°С - 60 с - 45 циклов, при этом образец считается положительным на наличие ДНК вируса ЗУД КРС, если значение Ct не более 35, однако в случае, если значение Ct для проб находится в пределах от 35 до 37, необходимо повторить реакцию с целью подтвердить или опровергнуть наличие ДНК искомого вируса в исследуемой пробе, образец считается отрицательным на наличие ДНК вируса, если для него значение Ct отсутствует или более 37.

3. Тест-система для выявления и дифференциации генома полевого изолята вируса ЗУД КРС от вакцинного штамма с дополнительной детекцией генома каприпоксвирусов в реакции ПЦР-РВ, включающая готовую ПЦР смесь, фермент Taq-ДНК-полимеразу, положительный контрольный образец, отрицательный контрольный образец, содержащие олигонуклеотидные праймеры и зонд по п. 1.



 

Похожие патенты:
Изобретение относится к области медицины, а именно к оториноларингологии, и касается способа определения предрасположенности к развитию экссудативного среднего отита.
Изобретение относится к медицине, а именно к офтальмологии, и предназначено для прогнозирования неблагоприятного течения увеальной меланомы. Определяют наличие экссудата и уровень абсолютного количества и относительного содержания Т-цитотоксических лимфоцитов с фенотипом CD3+ CD8+ от общего количества лимфоцитов в периферической крови.
Изобретение относится к области медицины, психиатрии, психологии и может быть использовано для выбора тактики лечения психического расстройства. Осуществляют иммунологическое, патопсихологическое и нейрофизиологическое исследования.
Изобретение относится к области биотехнологии и ветеринарной вирусологии и представляет собой способ диагностики цирковируса свиней, включающий посев культуры клеток РК-15, инфицирование ее биологическим материалом, фиксацию клеток РК-15, инкубирование последовательно со специфическими сыворотками и антисвиными меченными пероксидазой хрена иммуноглобулинами и выявление антигена цирковируса свиней по наличию темно-красного окрашивания цитоплазмы клеток, отличающийся тем, что фиксацию клеток РК-15 проводят в течение 30-40 минут в 0,01-0,02 М фосфатно-солевом буфере с рН 7,2-7,4, содержащем 1-4% параформальдегида и 0,2-0,4% нонилфенилполиэтиленгликоля, при температуре 22-24°С, затем обрабатывают последовательно 10-15 минут 0,01-0,02 М фосфатно-солевым буфером с рН 7,2-7,4, содержащим 0,3-0,4 М глицина и 1-2% казеина, затем 10-15 минут 0,3-0,6%-ной перекисью водорода, после чего наносят специфические поликлональные антитела.

Изобретение относится к медицине, а именно к иммунологии, и позволяет прогнозировать прогрессирование ВИЧ-инфекции у больных, получающих антиретровирусную терапию.
Изобретение относится к медицине, а именно к гинекологии. С целью оптимизации диагностики хронического эндометрита у пациенток после прерывания неразвивающейся беременности и с неблагоприятными потерями беременности в анамнезе предлагается исследование менструальной крови на содержание в ней эндометриального белка гликоделина.

Настоящее изобретение относится соединению формулы (I) или его мезомерным формам: где mCat+ или mAn- представляет собой органический или неорганический положительно/отрицательно заряженный противоион, и m представляет собой целое число, составляющее от 0 до 2; р представляет собой целое число, составляющее от 1 до 2; q представляет собой целое число, составляющее от 1 до 5; alk представляет собой углеродную цепочку, содержащую от 1 до 5 атомов углерода; Y представляет собой О или СН2; Z представляет собой ОН; n представляет собой 0 или 1; X представляет собой ОН или О-; Ra1 представляет собой SO3- или дополнительный С6-цикл, сконденсированный с соседним атомом углерода, где дополнительный цикл содержит SO3-; Ra2 представляет собой Н; Rc1 представляет собой С1-С6 алкил; Rc2 представляет собой С1-С6 алкил или группу С1-С6 алкилсульфоновой кислоты.

Изобретение относится к области биотехнологии. Предложен способ диагностики рака молочной железы и рака яичников.
Изобретение относится к области биотехнологии, молекулярной биологии и медицины. Предложен способ выделения вирусных нуклеиновых кислот из различных фракций экстраклеточных везикул.
Изобретение относится к диагностике, а именно к прогнозированию состояния плода при преждевременном разрыве плодных оболочек с 24 до 33 недель беременности. Способ прогнозирования состояния плода при преждевременном разрыве плодных оболочек с 24 до 33 недель беременности, включающий исследование околоплодных вод у беременных женщин с преждевременным разрывом околоплодных оболочек на недоношенном сроке беременности, заключающийся в том, что на 24-33 неделях беременности дополнительно проводят исследование венозной крови матери, в сыворотке крови и околоплодных водах при их излитии определяют содержание лактоферрина (ЛФ) методом твердофазного иммуноферментного анализа, уровни альфа2-макроглобулина (а2-МГ) и альфа1-антитрипсина (a1-AT) методом количественного иммуноэлектрофореза в пластинах агарозного геля с использованием исследовательских тест-систем, при концентрации в сыворотке крови а2-МГ более 2,8 г/л, a1-AT более 3,4 г/л, в околоплодных водах а2-МГ более 48,4 мг/л, ЛФ более 4,5 мг/л прогнозируют внутриутробную инфекцию у плода, а при концентрации в сыворотке крови а2-МГ менее 2,8 г/л, a1-AT менее 3,4 г/л, в околоплодных водах а2-МГ менее 48,4 мг/л, ЛФ менее 4,5 мг/л прогнозируют отсутствие внутриутробной инфекции у плода.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложен набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации РНК возбудителей сапа Burkholderia mallei и мелиоидоза Burkholderia pseudomallei на основе транскрипционной амплификации NASBA в режиме реального времени.

Изобретение относится к области медицины, биологии и биотехнологии и предназначено для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы 3 (ММР3) -1171>5А/6А.

Изобретение относится к области медицины, в частности к молекулярной биологии, онкологии, и предназначено для прогнозирования развития метастазов у больных раком тела матки.

Изобретение относится к области биотехнологии. Изобретение представляет собой тест-систему для выявления РНК возбудителя вируса артериита у лошадей, включающую буфер для проведения полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени, смесь для ее проведения, состоящую из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов, специфичных для возбудителя вируса инфекции и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента TAQ POLYMERASE; буфер для разведения РНК, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, согласно изобретению для выделения РНК используют биологический материал, взятый от инфицированных возбудителем вируса артериита (Equine viral arteritis - EAV) лошадей, при этом для внутреннего контрольного образца используют суспензию бактериофага MS2 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца - смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса артериита (Equine viral arteritis - EAV) у лошадей и фрагмент генома бактериофага MS2, взятых в соотношении 1:1.

Изобретение относится к области биотехнологии. Предложен способ определения сапробности гидробионтов для оценки экологического состояния водоемов, характеризующийся тем, что отбирают пробы гидробионтов из водоема, определяют видовой состав организмов в пробе, получают очищенную ДНК этих организмов, получают последовательности генов с последующей трансляцией в последовательности маркерных белков, пополняют полученными первичными последовательностями генов и белков международные базы данных с последующей выборкой первичных последовательностей ДНК/РНК и белков гидробионтов водоемов.

Изобретение относится к области медицины, в частности к медицинской генетике и онкогематологии, и предназначено для количественного определения мутаций F317L и F359V/C киназного домена BCR-ABL у больных хроническим миелоидным лейкозом, резистентных к терапии ингибиторами тирозинкиназ.

Изобретение относится к области медицины, а именно к лабораторной диагностике, основанной на генетическом методе выявления критериев, свидетельствующих о тяжести клинического течения гемофилии.

Изобретение относится к биотехнологии. Изобретение может быть использовано в разработке и оптимизации ПЦР и ОТ-ПЦР систем, применяемых для выявления нуклеиновых кислот, в том числе при диагностике генетических, вирусных и других заболеваний.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложен способ определения нуклеотидной последовательности-мишени, включающий создание библиотеки для секвенирования нового поколения, что включает амплификацию нуклеотидной последовательности-мишени с использованием праймера, содержащего специфичную в отношении мишени последовательность и последовательность A, с получением ампликона, где указанный ампликон может быть одноцепочечным или двуцепочечным, при этом указанная последовательность А представляет собой известную последовательность, которая является одинаковой среди множества праймеров, при этом со всеми праймерами, содержащими указанную последовательность А, можно проводить манипуляции и/или амплификацию, идентификацию, секвенирование или выделение одинаковым или сходным образом; лигирование первого адаптерного олигонуклеотида, содержащего последовательность B, с указанным ампликоном для образования адаптера-ампликона, при этом указанная последовательность В представляет собой известную последовательность, которая является одинаковой среди множества праймеров, при этом со всеми праймерами, содержащими указанную последовательность В, можно проводить манипуляции и/или амплификацию, идентификацию, секвенирование или выделение одинаковым или сходным образом; и создание библиотеки, представляющей собой «лестницу» фрагментов, содержащей множество фрагментов для применения в качестве библиотеки для секвенирования нового поколения; и секвенирование фрагмента указанной библиотеки, представляющей собой «лестницу» фрагментов, где нуклеотидная последовательность, определенная в результате секвенирования, содержит нуклеотидную субпоследовательность нуклеотидной последовательности-мишени.
Изобретение относится к области медицины, в частности к медицинской генетике и кардиологии, и предназначено для выявления предрасположенности пациента к атеросклерозу или наличия доклинических признаков этой патологии.

Изобретение относится к области биохимии. Описана группа изобретений, включающая полипептид, подходящий для индукции иммунного ответа против вируса PCV2, рекомбинантную клетку, содержащую молекулу нуклеиновой кислоты, кодирующую вышеуказанный полипептид, нуклеиновую кислоту, вектор, содержащий нуклеиновую кислоту, рекомбинантный вирус оспы свиней, содержащий в своем геноме нуклеиновую кислоту, композицию, вакцину, применение полипептида, клетки и нуклеиновой кислоты для получения лекарственного средства для лечения или профилактики PCV2-ассоциированного заболевания у свиньи.

Изобретение относится к биотехнологии, а именно к средствам молекулярной диагностики. Разработаны олигонуклеотидные праймеры и флуоресцентно-меченные зонды для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита КРС с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени:полевой изолят ЗУД КРС:f- 5- TAGAAAATGGATGTACCACAAATACAG 3,r 5 -TTGTTACAACTCAAATCGTTAGGTG-3,зонд 5 -ACCACCTAATGATAGTGTTTATGATTTACC-3;каприпоксвирусы:f - 5 ATGAAACCAATGGATGGGATA 3,r - 5 CGAAATGAAAAACGGTATATGGA 3,зонд - 5 ATGAGCCATCCATTTTCCAA 34;вакцинный штамм ЗУД КРС:f- 5-TGTTTCCATTCTCCACTGCT-3,r - 5 -TACTTACTAAAAAATGGGCGCА-3,зонд - 5-TCGCTGACATCGTTAGTCCАСТС-3.Предложен способ дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита КРС с дополнительной детекцией генома каприпоксвирусов с помощью ПЦР в режиме реального времени при одинаковом термическом профиле с использованием этих праймеров и зондов, и тест-система ПЦР в режиме реального времени для его проведения. Разработан высокочувствительный ПЦР-набор, состоящий из готовой ПЦР смеси, фермента Taq-полимеразы, положительного контроля и отрицательного контроля, позволяющий в кратчайшие сроки специфично выявить и дифференцировать геном. 3 н.п. ф-лы, 3 ил., 2 табл., 3 пр.

Наверх