Композиции для модуляции экспрессии атаксина 2



Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
Композиции для модуляции экспрессии атаксина 2
C12N2310/321 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2702838:

ИОНИС ФАРМАСЬЮТИКАЛЗ, ИНК. (US)

Изобретение относится к биотехнологии. Описано соединение, содержащее модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий последовательность нуклеотидных оснований, содержащую часть из по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19 или по меньшей мере 20 последовательных нуклеотидных оснований, комплементарных:

(a) части равной длины нуклеотидных оснований 1053-1109 SEQ ID NO: 1;

(b) части равной длины нуклеотидных оснований 606-656 SEQ ID NO: 1;

(c) части равной длины нуклеотидных оснований 1693-1767 SEQ ID NO: 1;

(d) части равной длины нуклеотидных оснований 1789-1826 SEQ ID NO: 1;

(e) части равной длины нуклеотидных оснований 1844-1877 SEQ ID NO: 1;

(f) части равной длины нуклеотидных оснований 1957-1988 SEQ ID NO: 1;

(g) части равной длины нуклеотидных оснований 2291-2350 SEQ ID NO: 1;

(h) части равной длины нуклеотидных оснований 3082-3141 SEQ ID NO: 1;

(i) части равной длины нуклеотидных оснований 3903-3946 SEQ ID NO: 1;

(j) части равной длины нуклеотидных оснований 4005-4054 SEQ ID NO: 1 или

(k) части равной длины нуклеотидных оснований 4429-4454 SEQ ID NO: 1;

причем модифицированный олигонуклеотид содержит по меньшей мере одну модификацию, выбранную из модифицированного сахарида и модифицированной межнуклеозидной связи, и причем модифицированный олигонуклеотид способен снижать уровни мРНК атаксина 2. Также описано соединение, содержащее модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий последовательность нуклеотидных оснований, содержащую по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19 или по меньшей мере 20 последовательных нуклеотидных оснований по любой из последовательностей нуклеотидных оснований SEQ ID NO: 18, 11-17 или 19-165, причем модифицированный олигонуклеотид содержит по меньшей мере одну модификацию, выбранную из модифицированного сахарида и модифицированной межнуклеозидной связи, и причем модифицированный олигонуклеотид способен снижать уровни мРНК атаксина 2. Описанные соединения пригодны для лечения, предупреждения или облегчения связанных с атаксином 2 заболеваний, нарушений и патологических состояний. Такие связанные с атаксином 2 заболевания включают спинально-церебеллярную атаксию 2 типа (SCA2), боковой амиотрофический склероз (БАС) и болезнь Паркинсона. 2 н. и 16 з.п. ф-лы, 13 табл., 9 пр.

 

Декларация государственной поддержки

Это изобретение выполнено при правительственной поддержке согласно R21 NS081182, предоставленной Национальными институтами здоровья США. Правительство США обладает в отношении данного изобретения определенными правами.

Перечень последовательностей

Настоящая заявка подается вместе с перечнем последовательностей в электронном формате. Перечень последовательностей представлен в виде файла под названием BIOL0239WOSEQ_ST25.txt, созданного 19 марта 2015 года, размером 232 Кб. Информация о перечне последовательностей в электронном формате включена в данный документ в полном объеме посредством ссылки.

ОБЛАСТЬ ТЕХНИКИ

В данном документе предложены композиции и способы снижения экспрессии мРНК и белка атаксина 2 (ATXN2) в организме животных. Такие способы пригодны для лечения, предупреждения или облегчения нейродегенеративных заболеваний, включающих спинально-церебеллярную атаксию 2 типа (SCA2), боковой амиотрофический склероз (БАС) и болезнь Паркинсона, путем ингибирования экспрессии атаксина 2 в организме животного.

УРОВЕНЬ ТЕХНИКИ

Спинально-церебеллярная атаксия 2 типа (SCA2) представляет собой аутосомальное доминантное нейродегенеративное заболевание, характеризующееся прогрессированием функциональной и клеточной потерей нейронов в мозжечке, стволе головного мозга и спинном мозге. Причиной SCA2 является экспансия CAG в гене ATXN2, приводящая к экспансии в белке атаксина-2 полиглутамина (polyQ). Пациенты с SCA2 характеризуются прогрессирующей мозжечковой атаксией, медленными саккадическими движениями глаз и другими неврологическими особенностями, такими как нейропатия (Pulst, S.M. (ed.), Genetics of Movement Disorders. Elsevier, Inc., Amsterdam, 2003, pp. 19-34.). Умеренная экспансия CAG в гене ATXN2 также связана с болезнью Паркинсона или боковым амиотрофическим склерозом (БАС), неотличимым от идиопатических форм этих заболеваний (Kim et al., Arch. Neurol, 2007, 64: 1510-1518; Ross et al., Hum. Mol. Genet., 2011, 20: 3207-3212; Corrado et al., Hum. Genet., 2011, 130: 575-580; Elden et al., Nature, 2010, 466: 1069-1075; Van Damme et al., Neurology, 2011, 76: 2066-2072).

К патогенным функциям белков с polyQ, обуславливающих заболевания, которые возникают при экспансии polyQ, можно отнести повышение токсичности, связанной с возникновением внутриядерных телец включения или растворимых токсичных олигомеров (Lajoie et al., PLoS One, 2011, 5: el5245). В то время как ткани головного мозга пациентов с SCA2 характеризуются потерей клеток Пуркинье, у клеток Пуркинье при SCA2 отсутствуют тельца включения, что указывает на то, что атаксин-2 с экспансией polyQ может обуславливать токсичность, которая не связана с образованием телец включения (Huynh et al., Ann. Neurol, 1999, 45: 232-241). Функции, приобретенные атаксином-2 при экспансии polyQ, могут включать аномальную аккумуляцию телец Гольджи (Huynh et al., Hum. Mol. Genet., 2003, 12: 1485-1496), приобретаемые аномальные функции (Duvick et al., Neuron, 2010, 67: 929-935) и секвестрование факторов транскрипции (TF) и глицеральдегид-3-фосфат дегидрогеназы, подобно другим белкам с polyQ (Yamanaka et al., Methods Mol. Biol., 2010: 648, 215-229; Koshy et al., Hum. Mol. Genet., 1996, 5: 1311-1318; Burke et al., Nat. Med., 1996, 2: 347-350). Было описано несколько нормальных функций атаксина-2. Атаксин-2 присутствует в стрессовых гранулах и Р-тельцах, что предполагает функционирование по секвестированию регуляции трансляции мРНК и белков во время стресса (Nonhoff et al., Mol. Biol. Cell, 2007, 18: 1385-1396). Сверхэкспрессия атаксина-2 препятствует сборке Р-телец, в то же время недостаточная экспрессия препятствует сборке стрессовых гранул (Nonhoff et al., Mol. Biol. Cell, 2007, 18: 1385-1396). Взаимодействия с polyA-связывающим белком 1, фактором сплайсинга РНК A2BP1/Fox1 и полирибосомами дополнительно подтверждает участие атаксина-2 в метаболизме РНК (Shibata et al., Hum. Mol. Genet., 2000, 9: 1303-1313; Ciosk et al., Development, 2004, 131: 4831-4841; Satterfield et al., Hum. Mol. Genet., 2006, 15: 2523-2532). Атаксин-2 представляет собой регулятор интернализации и передачи сигнала от рецептора EGF путем взаимодействия с SRC-киназой и эндоцитозным белком CIN85 (Nonis et al., Cell Signal, 2008, 20: 1725-1739). Атаксин-2 также взаимодействует со связанным с БАС белком TDP-43 РНК-зависимым способом, а наследственный и спорадичный БАС связан с частотой встречаемости в ATXN2 экспансии длинного нормального повтора CAG (Elden et al., Nature, 2010, 466: 1069-1075; Van Damme et al., Neurology, 2011, 76: 2066-2072).

В настоящее время отсутствуют приемлемые средства для лечения таких нейродегенеративных заболеваний. Поэтому целью данного документа является предложение способов лечения таких заболеваний.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

В данном описании предложены способы, соединения и композиции для модуляции экспрессии мРНК и белка атаксина 2 (ATXN2). В некоторых вариантах реализации изобретения соединения, пригодные для модуляции экспрессии мРНК и белка атаксина 2, представляют собой антисмысловые соединения. В некоторых вариантах реализации изобретения антисмысловые соединения представляют собой модифицированные олигонуклеотиды.

В некоторых вариантах реализации изобретения модуляция может происходить в клетке или ткани. В некоторых вариантах реализации изобретения клетка или ткань находится в организме животного. В некоторых вариантах реализации изобретения животное является человеком. В некоторых вариантах реализации изобретения уровни мРНК атаксина 2 снижаются. В некоторых вариантах реализации изобретения уровни белка атаксина 2 снижаются. Такое снижение может происходить времязависимым способом или дозозависимым способом.

В данном документе также предложены способы, соединения и композиции, пригодные для предупреждения, лечения и ослабления заболеваний, нарушений и патологических состояний. В некоторых вариантах реализации изобретения такие связанные с атаксином 2 заболевания, нарушения и патологические состояния представляют собой нейродегенеративные заболевания. В некоторых вариантах реализации изобретения такие нейродегенеративные заболевания, нарушения и патологические состояния включают спинально-церебеллярную атаксию 2 типа (SCA2), боковой амиотрофический склероз (БАС) и болезнь Паркинсона.

Такие заболевания, нарушения и состояния могут в целом сопровождаться одним и более факторами риска, причинами и исходами. Некоторые факторы риска и причины развития нейродегенеративного нарушения включают старение, наличие личной или семейной истории заболевания, или генетической предрасположенности. Некоторые симптомы и исходы заболевания, связанные с развитием нейродегенеративного нарушения, включают, но не ограничиваются ими: атаксию, затрудненность речи и глотания, ригидность, дрожание, офтальмоплегию, саккадическое замедление, периферическую нейропатию, атрофию, дистонию, хорею и деменцию.

В некоторых вариантах реализации изобретения способы лечения включают введение индивиду, нуждающемуся в этом, антисмыслового соединения атаксина 2. В некоторых вариантах реализации изобретения способы лечения включают введение индивиду, нуждающемуся в этом, модифицированного олигонуклеотида атаксина 2.

ПОДРОБНОЕ ОПИСАНИЕ

Следует понимать, что как приведенное выше общее описание, так и последующее подробное описание являются лишь иллюстративными и пояснительными и не ограничивают настоящего заявленного изобретения. В данном документе использование единственного числа включает множественное, если прямо не указано иное. В данном документе считается, что использование «или» означает «и/или», если не указано иное. В дополнение к этому, в данном документе считается, что использование «и» означает «и/или», если не указано иное. Кроме того, использование термина «включающий», а также других форм, таких как «включает» и «включенный», не является ограничивающим. Также такие термины, как «элемент» или «компонент», охватывают как элементы и компоненты, содержащие одну единицу, так и элементы и компоненты, которые содержат более одной субъединицы, если специально не указано иное.

Заголовки разделов в данном документе применяются только с целью организации текста и не должны истолковываться как ограничивающие описанный объект изобретения. Все документы или части документов, цитируемые в этом описании, включая, но не ограничиваясь ими, патенты, заявки на патенты, опубликованные заявки на патенты, статьи, книги, исследования, номера доступа в базу данных GENBANK и связанную информацию о последовательностях, которую можно получить из баз данных, таких как Национальный центр биотехнологической информации (NCBI), и другие данные, упоминаемые в данном документе, намеренно включены посредством ссылок в частях обсуждаемого здесь документа, а также в их полном объеме.

Определения

При отсутствии конкретных определений номенклатура, используемая в связи с ними, а также в связи с процедурами и методиками аналитической химии, синтетической органической химии, а также медицинской и фармацевтической химии, описанная в данном документе, является общеизвестной и общепринятой в данной области техники. Для химического синтеза и химического анализа могут быть использованы стандартные методики.

Если не указано иное, то следующие термины имеют следующие значения:

«2'-O-метоксиэтил» (также называемый 2'-MOE и 2'-OCH2CH2-OCH3O и MOE) относится к O-метоксиэтильной модификации 2'-положения фуранозного кольца. 2'-O-метоксиэтилмодифицированный сахарид представляет собой модифицированный сахарид.

«2'-MOE нуклеозид» (также называемый 2'-O-метоксиэтилнуклеозид) означает нуклеозид, содержащий 2'-MOE модифицированный сахаридный фрагмент.

«2'-замещенный нуклеозид» означает нуклеозид, содержащий заместитель в 2'-положении фуранозного кольца, отличающийся от H или OH. В некоторых вариантах реализации изобретения 2'-замещенные нуклеозиды включают нуклеозиды с бициклическими сахаридными модификациями.

«5-метилцитозин» означает цитозин, модифицированный метальной группой, присоединенной к 5-положению. 5-метилцитозин представляет собой модифицированное нуклеотидное основание.

«Около» означает нахождение в пределах значения ±7%. Например, если утверждается, что «соединение вызывает по меньшей мере около 70% ингибирование атаксина 2», то это подразумевает, что уровни атаксина 2 ингибируются в пределах диапазона от 63% до 77%.

«Совместное введение» относится к совместному введению двух фармацевтических агентов любым способом, при котором фармацевтическое действие обоих агентов проявляется у пациента одновременно. Совместное введение не требует, чтобы оба фармацевтических агента вводились в одной фармацевтической композиции, в одной и той же лекарственной форме или одинаковым путем введения. Не требуется, чтобы действие обоих фармацевтических агентов проявляло себя в одно и то же время. Действие должно перекрываться только в течение некоторого периода времени и не обязательно должно быть одинаковой протяженности.

«Введение» означает поступление фармацевтического агента в организм животного и включает, но не ограничивается этим, введение медицинским работником или самостоятельное введение.

«Облегчение» относится к уменьшению, замедлению, остановке или реверсии по меньшей мере одного показателя тяжести патологического состояния или заболевания. Тяжесть показателей может быть определена субъективными или объективными измерениями, которые известны специалистам в данной области техники.

«Животное» относится к человеку или животному, не являющемуся человеком, включая, но не ограничиваясь ими, мышей, крыс, кроликов, собак, кошек, свиней и не являющихся человеком приматов, включая, но не ограничиваясь ими, низших обезьян и шимпанзе.

«Антитело» относится к молекуле, для которой характерна способность определенным образом специфически реагировать с антигеном, когда антитело и антиген определяются в понятиях друг друга. Антитело может относиться к полной молекуле антитела либо к ее любому фрагменту или участку, такому как тяжелая цепь, легкая цепь, Fab-участок или Fc-участок.

«Антисмысловая активность» означает любую обнаруживаемую или поддающуюся измерению активность, присущую гибридизации антисмыслового соединения с его нуклеиновой кислотой-мишенью. В некоторых вариантах реализации изобретения антисмысловая активность уменьшает количество или экспрессию нуклеиновой кислоты-мишени или белка, кодируемого такой кислотой-мишенью.

«Антисмысловое соединение» означает олигомерное соединение, которое способно к прохождению гибридизации с нуклеиновой кислотой-мишенью при участии водородных связей. Примеры антисмысловых соединений включают одноцепочечные и двухцепочечные соединения, такие как антисмысловые олигонуклеотиды, миРНК, мшРНК, оцРНК и вещества, действующие на основе захватывания.

«Антисмысловое ингибирование» означает снижение уровней нуклеиновой кислоты-мишени в присутствии антисмыслового соединения, комплементарного нуклеиновой кислоте-мишени, по сравнению с уровнями нуклеиновой кислоты-мишени, или в отсутствие антисмыслового соединения.

«Антисмысловые механизмы» представляют собой все механизмы, которые охватывают гибридизацию соединения с нуклеиновой кислотой-мишенью, причем результат или влияние гибридизации приводит или к деградации мишени, или захватыванию мишени с сопутствующей остановкой клеточных механизмов, охватывающих, например, транскрипцию или сплайсинг.

«Антисмысловой олигонуклеотид» означает одноцепочечный олигонуклеотид с последовательностью нуклеотидных оснований, которая допускает гибридизацию с соответствующим сегментом нуклеиновой кислоты-мишени.

«Атаксин 2» означает ген атаксина 2 млекопитающих (ATXN2), включая ген атаксина 2 человека (ATXN2). Атаксин 2 человека картирован на хромосоме человека 12q24.1.

«Связанное с атаксином 2 заболевание» означает любое заболевание, связанное с любой нуклеиновой кислотой атаксина 2 или ее продуктом экспрессии. Такие заболевания могут включать нейродегенеративное заболевание. Такие нейродегенеративные заболевания могут включать спинально-церебеллярную атаксию 2 типа (SCA2), боковой амиотрофический склероз (БАС) и болезнь Паркинсона.

Термин «мРНК атаксина 2» означает любой продукт экспрессии матричной РНК последовательности ДНК, кодирующей атаксин 2.

«Нуклеиновая кислота атаксина 2» означает любую нуклеиновую кислоту, кодирующую атаксин 2. Например, в некоторых вариантах реализации изобретения нуклеиновая кислота атаксина 2 включает последовательность ДНК, кодирующую атаксин 2, последовательность РНК, транскрибируемую с ДНК, кодирующей атаксин 2 (включая геномную ДНК, содержащую интроны и экзоны), и последовательность мРНК, кодирующую атаксин 2. Термин «мРНК атаксина 2» означает мРНК, кодирующую белок атаксина 2.

«Белок атаксина 2» означает полипептидный продукт экспрессии нуклеиновой кислоты атаксина 2.

«Комплементарность оснований» относится к способности точного спаривания нуклеотидных оснований антисмыслового олигонуклеотида с соответствующими нуклеотидными основаниями в нуклеиновой кислоте-мишени (т.е. гибридизация); опосредована водородными связями Уотсона-Крика, Хугстина или обращенными водородными связями Хугстина между соответствующими нуклеотидными основаниями.

«Бициклический сахарид» означает фуранозильное кольцо, модифицированное мостиком между двумя атомами. Бициклический сахарид представляет собой модифицированный сахарид.

«Бициклический нуклеозид» (также называемый BNA) означает нуклеозид, имеющий сахаридный фрагмент, содержащий мостиковое соединение двух атомов углерода сахаридного кольца, благодаря чему образуется бициклическая кольцевая система. В некоторых вариантах реализации изобретения этот мостик соединяет 4'-углерод и 2'-углерод сахаридного кольца.

«Кэп-структура» или «терминальный кэп-фрагмент» означает химические модификации, которые были введены на любом конце антисмыслового соединения.

Обозначение «cEt» или «стерически затрудненный этил» означает бициклический нуклеозид, имеющий сахаридный фрагмент, содержащий мостиковое соединение 4'-углерода и 2'-углерода, причем данный мостик имеет формулу: 4'-СН(CH3)-O-2'.

«Стерически затрудненный этилнуклеозид» (также называемый cEt-нуклеозид) означает нуклеозид, содержащий бициклический сахаридный фрагмент, содержащий мостик 4'-CH(CH3)-O-2'.

«Химически отличающийся участок» относится к участку антисмыслового соединения, который определенным образом химически отличается от другого участка того же антисмыслового соединения. Например, участок, содержащий 2'-O-метоксиэтилнуклеозиды, химически отличается от участка, содержащего нуклеозиды без 2'-O-метоксиэтильных модификаций.

«Химерное антисмысловое соединение» означает антисмысловое соединение, которое имеет по меньшей мере два химически отличающихся участка, причем каждое положение содержит множество субъединиц.

«Совместное введение» означает введение индивиду двух и более фармацевтических агентов. Два или более фармацевтических агента могут быть представлены в одной фармацевтической композиции или в отдельных фармацевтических композициях. Каждый из двух и более фармацевтических агентов может вводиться посредством одних и тех же или разных путей введения. Совместное введение охватывает параллельное или последовательное введение.

«Комплементарность» означает способность к спариванию между нуклеотидными основаниями первой нуклеиновой кислоты и второй нуклеиновой кислоты.

Понятно, что «содержать», «содержит» и «содержащий» подразумевает включение установленного этапа или элемента либо группы этапов или элементов, но без исключения любого другого этапа или элемента либо группы этапов или элементов.

«Последовательные нуклеотидные основания» означают нуклеотидные основания, непосредственно соседствующие друг с другом.

«Конструирование» или «конструирование для» относится к процессу конструирования олигомерного соединения, которое специфически гибридизируется с выбранной молекулой нуклеиновой кислоты.

«Растворитель» означает ингредиент в композиции, у которого отсутствует фармакологическая активность, но который с фармацевтической точки зрения является необходимым или желательным. Например, растворитель в лекарственных средствах для инъекций может быть жидкостью, например, солевым раствором.

«Доза» означает установленное количество фармацевтического агента, доставляемого за одно введение или за указанный период времени. В некоторых вариантах реализации изобретения доза может вводиться в виде одной, двух или более болюсных введений, таблеток или инъекций. Например, в некоторых вариантах реализации изобретения, когда желательно подкожное введение, а нужная доза требует объема, который нелегко обеспечить одной инъекцией, для достижения требуемой дозы могут быть использованы две или более инъекций. В некоторых вариантах реализации изобретения фармацевтический агент вводят путем инфузии в течение продолжительного периода времени или непрерывно. Дозы могут быть указаны в виде количества фармацевтического агента, вводимого за час, сутки, неделю или месяц.

«Эффективное количество» в контексте модуляции активности или лечения, или предупреждения патологического состояния означает введение субъекту, нуждающемуся в такой модуляции, лечении или профилактике, одной дозой или как части серии, такого количества фармацевтического агента, которое эффективно для модуляции этого действия, или лечения, или профилактики, или улучшения этого патологического состояния. Эффективное количество может изменяться для индивидов в зависимости от состояния здоровья и физического состояния индивида, подлежащего лечению, таксономической группы индивидов, подлежащих лечению, состава композиции, оценки медицинского состояния индивида и других соответствующих факторов.

«Эффективность» означает способность вызывать требуемое действие.

«Экспрессия» включает все функции, с помощью которых кодированная генами информация превращается в структуры, представленные и действующие в клетке. Такие структуры включают, но не ограничиваются ими, продукты транскрипции и трансляции.

«Полная комплементарность» или «100% комплементарность» означает, что каждое нуклеотидное основание первой нуклеиновой кислоты имеет комплементарное нуклеотидное основание во второй нуклеиновой кислоте. В некоторых вариантах реализации изобретения первая нуклеиновая кислота представляет собой антисмысловое соединение, а нуклеиновая кислота-мишень представляет собой вторую нуклеиновую кислоту.

«Гэпмер» означает химерное антисмысловое соединение, в котором внутренний участок, содержащий множество нуклеозидов, которые обеспечивают расщепление РНКазой H, располагается между наружными участками, содержащими один или более нуклеозидов, причем нуклеозиды, составляющие внутренний участок, химически отличаются от нуклеозида или нуклеозидов, составляющих внешние участки. Внутренний участок может называться «гэп», а внешние участки могут называться «крыльями».

«Гэп-уменьшенное» означает химерное антисмысловое соединение, содержащее гэп-сегмент из 9 или менее последовательных 2'-дезоксирибонуклеотидов, расположенных между и непосредственно соседствующих с 5'- и 3'-сегментами крыльев, содержащими от 1 до 6 нуклеозидов.

«Гэп-расширенное» означает химерное антисмысловое соединение, содержащее гэп-сегмент из 12 или более последовательных 2'-дезоксирибонуклеозидов, расположенных между и непосредственно соседствующих с 5'- и 3'-сегментами крыльев, содержащими от 1 до 6 нуклеозидов.

«Гибридизация» означает отжиг (ренатурацию) молекул комплементарных нуклеиновых кислот. В некоторых вариантах реализации изобретения молекулы комплементарных нуклеиновых кислот включают, но не ограничиваются ими, антисмысловое соединение и нуклеиновую кислоту-мишень. В некоторых вариантах реализации изобретения молекулы комплементарных нуклеиновых кислот включают, но не ограничиваются ими, антисмысловой олигонуклеотид и нуклеиновую кислоту-мишень.

«Идентификация животного, пораженного связанным с атаксином 2 заболеванием» означает идентификацию животного с диагностированным связанным с атаксином 2 заболеванием или предрасположенного к развитию связанного с атаксином 2 заболевания. Индивиды, предрасположенные к развитию связанного с атаксином 2 заболевания, включают имеющих один и более факторов риска развития связанного с атаксином 2 заболевания, включая старение, наличие личной или семейной истории болезни либо генетическую предрасположенность к одному или более связанных с атаксином 2 заболеваний. Такая идентификация может выполняться любым способом, включающим оценку медицинской истории болезни индивида и стандартные клинические анализы или обследования, такие как генетическое исследование.

«Непосредственно соседствующий» означает, что между непосредственно соседствующими элементами отсутствуют промежуточные элементы.

«Индивид» означает человека или животное, не являющееся человеком, выбранных для лечения или проведения терапии.

«Ингибирование атаксина 2» означает снижение уровня или экспрессии мРНК и/или белка атаксина 2. В некоторых вариантах реализации изобретения уровни мРНК и/или белка атаксина 2 ингибируются в присутствии антисмыслового соединения, таргетирующего атаксин 2, включая антисмысловой олигонуклеотид, таргетирующий атаксин 2, по сравнению с экспрессией уровней мРНК и/или белка атаксина 2 в отсутствие антисмыслового соединения атаксина 2, такого как антисмысловой олигонуклеотид.

«Ингибирование экспрессии или активности» относится к снижению или блокаде экспрессии или активности и не обязательно означает полное исчезновение экспрессии или активности.

«Межнуклеозидная связь» относится к химической связи между нуклеозидами.

«Связанные нуклеозиды» означают соседствующие нуклеозиды, которые связаны вместе межнуклеозидной связью.

Термин «закрытая нуклеиновая кислота» или «ЗНК», или «ЗНК-нуклеозиды» означает мономеры нуклеиновых кислот, содержащие мостик, соединяющий два атома углерода между 4'- и 2'-положением нуклеозидной сахаридной единицы, тем самым образуя бициклический сахарид. Примеры такого бициклического сахарида включают, но не ограничиваются ими: A) α-L-метиленокси (4'-CH2-O-2') ЗНК, (В) β-D-метиленокси (4'-CH2-O-2') ЗНК, (С) этиленокси (4'-(CH2)2-O-2') ЗНК, (D) аминоокси (4'-CH2-O-N(R)-2') ЗНК и (Е) оксиамино (4'-CH2-N(R)-O-2') ЗНК, как описано ниже.

Используемые в данном документе соединения ЗНК включают, но не ограничиваются ими, соединения, содержащие по меньшей мере один мостик между 4'- и 2'-положением сахарида, причем каждый из мостиков независимо содержит 1 или от 2 до 4 связанных групп, независимо выбранных из -[C(R1)(R2)]n-, -C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O)x- и -N(R1)-; где: x представляет собой 0, 1 или 2; n представляет собой 1, 2, 3 или 4; каждый R1 и R2 независимо представляет собой H, защитную группу, гидроксил, C1-C12 алкил, замещенный C1-C12 алкил, C2-C12 алкенил, замещенный C2-C12 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, C5-C20 арил, замещенный C5-C20 арил, гетероциклический радикал, замещенный гетероциклический радикал, гетероарил, замещенный гетероарил, C5-C7 алициклический радикал, замещенный C5-C7 алициклический радикал, галоген, OJ1, NJ1J2, SJ1, N3, COOJ1, ацил (C(=O)-H), замещенный ацил, CN, сульфонил (S(=O)2-J1) или сульфоксил (S(=O)-J1); а каждый J1 и J2 независимо представляет собой H, C1-C12 алкил, замещенный C1-C12 алкил, C2-C12 алкенил, замещенный C2-C12 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, C5-C20 арил, замещенный C5-C20 арил, ацил (С(=O)-Н), замещенный ацил, гетероциклический радикал, замещенный гетероциклический радикал, C1-C12 аминоалкил, замещенный C1-C12 аминоалкил или защитную группу.

Примеры 4'-2' мостиковых групп, охваченные определением ЗНК, включают, но не ограничиваются ими, одну из формул: -[C(R1)(R2)]n-, -[C(R1)(R2)]n-O-, -C(R1R2)-N(R1)-O- or -C(R1R2)-O-N(R1)-. Кроме того, другие мостиковые группы, охваченные определением ЗНК, представляют собой 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-O-N(R1)-2' и 4'-CH2-N(R1)-O-2'- мостики, где каждый R1 и R2 независимо представляет собой H, защитную группу или C1-C12 алкил.

В соответствии с данным изобретением в определение ЗНК также включены ЗНК, в которых 2'-гидроксильная группа рибозильного сахаридного кольца соединена с 4'-атомом углерода сахаридного кольца, тем самым образуя метиленокси (4'-CH2-O-2') мостик для образования бициклического сахаридного фрагмента. Мостик также может быть метиленовой (-CH2-) группой, соединяющей 2'-атом кислорода и 4'-атом углерода, для чего используется термин метиленокси (4'-CH2-O-2') ЗНК. Кроме того, в случае бициклического сахаридного фрагмента, содержащего этиленовую мостиковую группу в этом положении, используется термин этиленокси (4'-CH2CH2-O-2') ЗНК. α-L-метиленокси (4'-CH2-O-2'), изомер метиленокси (4'-CH2-O-2') ЗНК, также охватывается определением ЗНК, используемым в данном документе.

«Мисматчевое» или «некомплементарное нуклеотидное основание» относится к случаю, когда нуклеотидное основание первой нуклеиновой кислоты не способно спариваться с соответствующим нуклеотидным основанием второй нуклеиновой кислоты или нуклеиновой кислоты-мишени.

«Модифицированная межнуклеозидная связь» относится к замещению или любому изменению встречающейся в природе межнуклеозидной связи (т.е. фосфодиэфирной межнуклеозидной связи).

«Модифицированное нуклеотидное основание» означает любое нуклеотидное основание, отличающееся от аденина, цитозина, гуанина, тимидина или урацила. «Немодифицированное нуклеотидное основание» означает пуриновые основания: аденин (А) и гуанин (G), и пиримидиновые основания: тимин (Т), цитозин (С) и урацил (U).

«Модифицированный нуклеозид» означает нуклеозид, независимо содержащий модифицированный сахаридный фрагмент и/или модифицированное нуклеотидное основание.

«Модифицированный нуклеотид» означает нуклеотид, независимо содержащий модифицированный сахаридный фрагмент, модифицированную межнуклеозидную связь и/или модифицированное нуклеотидное основание.

«Модифицированный олигонуклеотид» означает олигонуклеотид, содержащий по меньшей мере одну модифицированную межнуклеозидную связь, модифицированный сахарид и/или модифицированное нуклеотидное основание.

«Модифицированный сахарид» означает замещение и/или любое изменение, отличающееся от природного фрагмента сахарида.

«Мономер» означает одну единицу олигомера. Мономеры включают, но не ограничиваются ими, нуклеозиды и нуклеотиды, независимо от того, встречаются они в природе или являются модифицированными.

«Мотив» в антисмысловом соединении означает паттерн из немодифицированных и модифицированных нуклеозидов.

«Природный сахаридный фрагмент» означает сахаридный фрагмент, обнаруженный в ДНК (2'-H) или РНК (2'-OH).

«Встречающаяся в природе межнуклеозидная связь» означает фосфодиэфирную связь 3'-5'.

«Некомплементарное нуклеотидное основание» относится к паре нуклеотидных оснований, которые не образуют водородные связи друг с другом или иным образом не обеспечивают гибридизацию.

Термин «нуклеиновая кислота» означает молекулы, состоящие из мономерных нуклеотидов. Нуклеиновая кислота включает, но не ограничивается ими, рибонуклеиновые кислоты (РНК), дезоксирибонуклеиновые кислоты (ДНК), одноцепочечные нуклеиновые кислоты, двухцепочечные нуклеиновые кислоты, малые интерферирующие рибонуклеиновые кислоты (миРНК) и микроРНК (миРНК).

«Нуклеотидное основание» означает гетероциклический фрагмент, способный спариваться с основанием другой нуклеиновой кислоты.

Термин «комплементарность нуклеотидных оснований» относится к нуклеотидному основанию, которое способно к спариванию оснований с другим нуклеотидным основанием. Например, в ДНК аденин (А) комплементарен тимину (Т). Например, в РНК аденин (А) комплементарен урацилу (U). В некоторых вариантах реализации изобретения комплементарное нуклеотидное основание относится к нуклеотидному основанию антисмыслового соединения, которое способно к спариванию оснований с нуклеотидным основанием ее нуклеиновой кислоты-мишени. Например, если нуклеотидное основание в определенном положении антисмыслового соединения способно к водородному связыванию с нуклеотидным основанием в определенном положении нуклеиновой кислоты-мишени, тогда положение водородных связей между олигонуклеотидом и нуклеиновой кислотой-мишенью считается комплементарным в этой паре нуклеотидных оснований.

«Последовательность нуклеотидных оснований» означает порядок последовательных нуклеотидных оснований, независимый от любого сахарида, связи и/или модификации нуклеотидного основания.

«Нуклеозид» означает нуклеотидное основание, связанное с сахаридом.

«Нуклеозидный миметик» включает структуры, используемые для замены сахарида, или сахарида и основания, и не обязательно связи в одном или более положениях олигомерного соединения, такие как, например, нуклеозидные миметики, содержащие морфолино-, циклогексенил-, циклогексил-, тетрагидропиранил-, бицикло- или трициклосахаридные миметики, например, нефуранозные сахаридные единицы. «Нуклеотидный миметик» включает структуры, используемые для замены нуклеозида и связи в одном или более положениях олигомерного соединения, такие как, например, пептидные нуклеиновые кислоты или морфолины (морфолины связаны посредством -N(H)-С(=O)-O- или другой нефосфодиэфирной связью). Термин «заместитель сахарида» перекрывается с немного более широким термином «нуклеозидный миметик», но подразумевают только указание на замещение сахаридной единицы (фуранозного кольца). Тетрагидропиранильные кольца, представленные в данном документе, являются иллюстрациями примера заместителя сахарида, в котором фуранозная сахаридная группа была замещена системой тетрагидропиранильного кольца. Термин «миметик» относится к группам, которые замещены на сахарид, нуклеотидное основание и/или межнуклеозидную связь. Как правило, миметик используется вместо сахарида или комбинации сахарид-межнуклеозидная связь, а нуклеотидное основание обеспечивает гибридизацию с выбранной мишенью.

«Нуклеотид» означает нуклеозид, содержащий фосфатную группу, ковалентно связанную с сахаридной частью нуклеозида.

«Побочное действие» относится к нежелательному или вредному биологическому действию, связанному с модуляцией экспрессии РНК или белка гена, отличающегося от предполагаемой нуклеиновой кислоты-мишени.

«Олигомерное соединение» или «олигомер» означает полимер из связанных мономерных субъединиц, который способен гибридизироваться с по меньшей мере одним участком молекулы нуклеиновой кислоты.

«Олигонуклеотид» означает полимер из связанных нуклеозидов, каждый из которых независимо друг от друга может быть модифицированным или немодифицированным.

«Парентеральное введение» означает введение с помощью инъекции (например, болюсной инъекции) или инфузии. Парентеральное введение включает подкожное введение, внутривенное введение, внутримышечное введение, внутриартериальное введение, внутрибрюшинное введение или внутричерепное введение, например, интратекальное или интрацеребровентрикулярное введение.

«Пептид» означает молекулу, образованную связыванием по меньшей мере двух аминокислот посредством амидных связей. В данном документе термин «пептид» без ограничения относится к полипептидам и белкам.

«Фармацевтический агент» означает вещество, которое обеспечивает терапевтическое действие при введении индивиду. Например, в некоторых вариантах реализации изобретения фармацевтический агент представляет собой антисмысловой олигонуклеотид, таргетирующий атаксин 2.

«Фармацевтическая композиция» означает смесь веществ, пригодную для введения субъекту. Например, фармацевтическая композиция может содержать антисмысловой олигонуклеотид и стерильный водный раствор.

«Фармацевтически приемлемое производное» охватывает фармацевтически приемлемые соли, конъюгаты, пролекарства или изомеры соединений, описанных в данном документе.

Термин «фармацевтически приемлемые соли» означает физиологически и фармацевтически приемлемые соли антисмысловых соединений, т.е. соли, которые сохраняют требуемую биологическую активность исходного олигонуклеотида и не придают им нежелательного токсикологического действия.

«Тиофосфатная связь» означает связь между нуклеозидами, в которой фосфодиэфирная связь модифицирована заменой одного из немостиковых атомов кислорода атомом серы. Тиофосфатная связь представляет собой модифицированную межнуклеозидную связь.

«Часть» означает определенное количество последовательных (т.е. связанных) нуклеотидных оснований нуклеиновой кислоты. В некоторых вариантах реализации изобретения часть представляет собой определенное количество последовательных нуклеотидных оснований нуклеиновой кислоты-мишени. В некоторых вариантах реализации изобретения часть представляет собой определенное количество последовательных нуклеотидных оснований антисмыслового соединения.

«Предупреждать» или «предупреждение» относится к замедлению или предотвращению возникновения или развития заболевания, нарушения или патологического состояния в течение периода времени от минут до суток, от недель до месяцев или на неопределенный срок.

«Пролекарство» означает, что терапевтический агент приготовлен в неактивной форме, которая превращается в активную форму (т.е. в лекарственное вещество) в организме или его клетках под действием эндогенных ферментов или других химических веществ и/или условий.

«Профилактически эффективное количество» означает количество фармацевтического агента, которое обеспечивает профилактическую или предупреждающую заболевание пользу для животного.

«Участок» определяется как часть нуклеиновой кислоты-мишени, содержащей по меньшей мере одну идентифицируемую структуру, функцию или характеристику.

«Рибонуклеотид» означает нуклеотид, содержащий гидроксил в 2'-положении сахаридной части нуклеотида. Рибонуклеотиды могут быть модифицированы с помощью любого из разнообразных заместителей.

«Соли» означают физиологически и фармацевтически приемлемые соли антисмысловых соединений, т.е. соли, которые сохраняют требуемую биологическую активность исходного олигонуклеотида и не придают им нежелательного токсикологического действия.

«Сегменты» определяются как меньшие части или субчасти участков в пределах нуклеиновой кислоты-мишени.

«Укороченные» или «усеченные» варианты антисмысловых олигонуклеотидов, приведенные в данном документе, содержат один, два или более делетированных нуклеозидов.

Термин «побочные явления» означает физиологические реакции, обусловленные лечением, отличающиеся от требуемого действия. В некоторых вариантах реализации изобретения побочные явления включают, без ограничения, реакции в месте инъекции, исследуемые нарушения функционирования печени, нарушения функционирования почек, токсичность для печени, токсичность для почек, нарушения центральной нервной системы и миопатии.

«Одноцепочечный олигонуклеотид» означает олигонуклеотид, который не гибридизирован с комплементарной цепью.

«Сайты» в данном документе определяются как уникальные положения нуклеотидных оснований в пределах нуклеиновой кислоты-мишени.

«Замедление прогрессирования» означает уменьшение развития заболевания.

«Способный к специфичной гибридизации» относится к антисмысловому соединению, обладающему достаточной степенью комплементарности между антисмысловым олигонуклеотидом и нуклеиновой кислотой-мишенью для индуцирования требуемого действия, при проявлении минимального влияния или отсутствии влияния на нецелевые нуклеиновые кислоты в условиях, в которых требуется специфическое связывание, т.е. в физиологических условиях в случае анализов in vivo и терапевтического лечения.

«Жесткие условия гибридизации» или «жесткие условия» относятся к условиям, при которых олигомерное соединение будет гибридизироваться со своей последовательностью-мишенью, но с минимальным количеством других последовательностей.

«Субъект» означает человека или животное, не являющееся человеком, выбранных для лечения или проведения терапии.

«Мишень» относится к белку, в отношении которого требуется модуляция.

«Ген-мишень» относится к гену, кодирующему мишень.

«Таргетинг» или «таргетированный» означает процесс конструирования и выбора антисмыслового соединения, которое будет специфически гибридизироваться с нуклеиновой кислотой-мишенью и индуцировать требуемое действие.

Все термины «нуклеиновая кислота-мишень», «РНК-мишень», «транскрипт РНК-мишени» «мишень нуклеиновой кислоты» означают нуклеиновую кислоту, способную таргетироваться антисмысловыми соединениями.

«Участок-мишень» означает часть нуклеиновой кислоты-мишени, на которую таргетировано одно или более антисмысловых соединений.

«Сегмент-мишень» означает последовательность нуклеотидов нуклеиновой кислоты-мишени, на которую таргетировано антисмысловое соединение. «5' сайт-мишень» относится к наиболее удаленному 5'-нуклеотиду сегмента-мишени. «3' сайт-мишень» относится к наиболее удаленному 3'-нуклеотиду сегмента-мишени.

«Терапевтически эффективное количество» означает количество фармацевтического агента, которое обеспечивает терапевтическую пользу для индивида.

«Лечить» или «проводить лечение», или «лечение» относится к введению композиции для достижения изменения или улучшения течения заболевания или патологического состояния.

«Немодифицированное нуклеотидное основание» означает пуриновые основания: аденин (А) и гуанин (G), и пиримидиновые основания: тимин (Т), цитозин (С) и урацил (U).

«Немодифицированный нуклеотид» означает нуклеотид, состоящий из встречающихся в природе нуклеотидных оснований, сахаридных фрагментов и межнуклеозидных связей. В некоторых вариантах реализации изобретения немодифицированный нуклеотид представляет собой РНК-нуклеотид (т.е. β-D-рибонуклеозиды) или ДНК-нуклеотид (т.е. β-D-дезоксирибонуклеозиды).

«Сегмент крыла» означает множество нуклеозидов, модифицированных так, чтобы придавать олигонуклеотиду такие свойства, как усиленная ингибирующая активность, повышенная аффинность связывания нуклеиновой кислоты-мишени или устойчивость к деградации нуклеазами in vivo.

Некоторые варианты реализации изобретения

Некоторые варианты реализации изобретения предлагают способы, соединения и композиции для ингибирования экспрессии мРНК и белка атаксина 2. Некоторые варианты реализации изобретения предлагают способы, соединения и композиции для снижения уровней мРНК и белка атаксина 2.

Некоторые варианты реализации изобретения предлагают антисмысловые соединения, таргетирующие нуклеиновую кислоту атаксина 2. В некоторых вариантах реализации изобретения нуклеиновая кислота атаксина 2 представлена последовательностью, указанной в базе данных GENBANK № доступа NM_002973.3 (включена в данный документ как SEQ ID NO: 1), комплементарной последовательностью с № доступа в базе данных GENBANK NT_009775.17, усеченной от нуклеотидов 2465000 до 2616000 (включена в данный документ как SEQ ID NO: 2) и № доступа в базе данных GENBANK ВХ410018.2 (включена в данный документ как SEQ ID NO: 3).

Некоторые варианты реализации изобретения предлагают способы лечения, предупреждения или облегчения заболеваний, нарушений и патологических состояний, связанных с атаксином 2, у нуждающегося в этом индивида. Рассматриваются также способы получения лекарственного средства для лечения, предупреждения или облегчения заболевания, нарушения и патологического состояния, связанного с атаксином 2. Связанные с атаксином 2 заболевания, нарушения и патологические состояния включают нейродегенеративные заболевания. В некоторых вариантах реализации изобретения связанные с атаксином 2 заболевания включают спинально-церебеллярную атаксию 2 типа (SCA2), боковой амиотрофический склероз (БАС) и болезнь Паркинсона.

Некоторые варианты реализации изобретения предлагают соединения, содержащие модифицированный олигонуклеотид, состоящий из от 12 до 30 связанных нуклеозидов и содержащий последовательность нуклеотидных оснований, содержащую по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19 или по меньшей мере 20 последовательных нуклеотидных оснований по любой из последовательностей нуклеотидных оснований SEQ ID NO: 11-165.

В некоторых вариантах реализации изобретения последовательность нуклеотидных оснований модифицированного олигонуклеотида по меньшей мере на 80%, по меньшей мере на 81%, по меньшей мере на 82%, по меньшей мере на 83%, по меньшей мере на 84%, по меньшей мере на 85%, по меньшей мере на 86%, по меньшей мере на 87%, по меньшей мере на 88%, по меньшей мере на 89%, по меньшей мере на 90%, по меньшей мере на 91%, по меньшей мере на 92%, по меньшей мере на 93%, по меньшей мере на 94%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, по меньшей мере на 99% или на 100% комплементарна SEQ ID NO: 1, SEQ ID NO: 2, или SEQ ID NO: 3.

В некоторых вариантах реализации изобретения соединение представляет собой одноцепочечный модифицированный олигонуклеотид.

В некоторых вариантах реализации изобретения по меньшей мере одна межнуклеозидная связь модифицированного олигонуклеотида представляет собой модифицированную межнуклеозидную связь.

В некоторых вариантах реализации изобретения по меньшей мере одна модифицированная межнуклеозидная связь представляет собой тиофосфатную межнуклеозидную связь.

В некоторых вариантах реализации изобретения каждая модифицированная межнуклеозидная связь представляет собой тиофосфатную межнуклеозидную связь.

В некоторых вариантах реализации изобретения по меньшей мере одна межнуклеозидная связь представляет собой фосфодиэфирную межнуклеозидную связь.

В некоторых вариантах реализации изобретения по меньшей мере одна межнуклеозидная связь представляет собой тиофосфатную связь и по меньшей мере одна межнуклеозидная связь представляет собой фосфодиэфирную связь.

В некоторых вариантах реализации изобретения по меньшей мере один нуклеозид содержит модифицированное нуклеиновое основание.

В некоторых вариантах реализации изобретения модифицированное нуклеотидное основание представляет собой 5-метилцитозин.

В некоторых вариантах реализации изобретения по меньшей мере один нуклеозид модифицированного олигонуклеотида содержит модифицированный сахарид.

В некоторых вариантах реализации изобретения по меньшей мере один модифицированный сахарид представляет собой бициклический сахарид.

В некоторых вариантах реализации изобретения бициклический сахарид содержит химическую связь между 2'- и 4'-положением сахаридного 4'-CH2-N(R)-O-2' мостика, где R независимо представляет собой H, C1-C12 алкил или защитную группу.

В некоторых вариантах реализации изобретения бициклический сахарид содержит мостик 4'-CH2-N(R)-O-2', где R независимо представляет собой H, C1-C12 алкил или защитную группу.

В некоторых вариантах реализации изобретения по меньшей мере один модифицированный сахарид содержит 2'-O-метоксиэтильную группу.

В некоторых вариантах реализации изобретения модифицированный сахарид содержит группу 2'-O(CH2)2-OCH3.

В некоторых вариантах реализации изобретения модифицированный олигонуклеотид содержит:

гэп-сегмент, состоящий из 10 связанных дезоксинуклеозидов;

сегмент 5'-крыла, состоящий из 5 связанных нуклеозидов, и

сегмент 3'-крыла, состоящий из 5 связанных нуклеозидов;

причем гэп-сегмент расположен между сегментом 5'-крыла и сегментом 3'-крыла, и при этом каждый нуклеозид каждого сегмента крыльев содержит модифицированный сахарид.

В некоторых вариантах реализации изобретения модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов.

Некоторые варианты реализации изобретения предлагают композиции, содержащие любое соединение, описанное в данном документе, или его соль, и по меньшей мере один фармацевтически приемлемый носитель или растворитель.

Некоторые варианты реализации изобретения предлагают способы, включающие введение животному любого соединения или композиции, описанных в данном документе.

В некоторых вариантах реализации изобретения животное представляет собой человека.

В некоторых вариантах реализации изобретения введение соединения предупреждает, лечит, облегчает или замедляет прогрессирование связанного с атаксином 2 заболевания, нарушения или патологического состояния.

В некоторых вариантах реализации изобретения связанное с атаксином 2 заболевание, нарушение или патологическое состояние представляют собой спинально-церебеллярную атаксию 2 типа (SCA2), боковой амиотрофический склероз (БАС) и болезнь Паркинсона.

Некоторые варианты реализации изобретения предлагают использование любого из соединений или композиций, описанных в данном документе, для производства лекарственного средства для лечения нейродегенеративного заболевания.

Антисмысловые соединения

Олигомерные соединения включают, но не ограничиваются ими, олигонуклеотиды, олигонуклеозиды, аналоги олигонуклеотидов, миметики олигонуклеотидов, антисмысловые соединения, антисмысловые олигонуклеотиды и миРНК. Олигомерное соединение может быть «антисмысловым» по отношению к нуклеиновой кислоте-мишени, что означает, что оно способно претерпевать гибридизацию с нуклеиновой кислотой-мишенью посредством водородных связей.

В некоторых вариантах реализации изобретения антисмысловое соединение имеет последовательность нуклеотидных оснований, которая записана в направлении 5'-3', и содержит обратную комплементарность к сегменту-мишени нуклеиновой кислоты-мишени, которую это соединение таргетирует. В некоторых таких вариантах реализации изобретения антисмысловой олигонуклеотид имеет последовательность нуклеотидных оснований, которая записана в направлении 5'-3', и содержит обратную комплементарность к сегменту-мишени нуклеиновой кислоты-мишени, которую это соединение таргетирует.

В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину от 12 до 30 нуклеотидов. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину от 12 до 25 нуклеотидов. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину от 12 до 22 нуклеотидов. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину от 14 до 20 нуклеотидов. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину от 15 до 25 нуклеотидов. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину от 18 до 22 нуклеотидов. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину от 19 до 21 нуклеотида. В некоторых вариантах реализации изобретения антисмысловое соединение составляет в длину от 8 до 80, от 12 до 50, от 13 до 30, от 13 до 50, от 14 до 30, от 14 до 50, от 15 до 30, от 15 до 50, от 16 до 30, от 16 до 50, от 17 до 30, от 17 до 50, от 18 до 30, от 18 до 50, от 19 до 30, от 19 до 50 или от 20 до 30 связанных субъединиц.

В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 12 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 13 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 14 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 15 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 16 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 17 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 18 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 19 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 20 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 21 субъединицу. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 22 субъединицы. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 23 субъединицы. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 24 субъединицы. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 25 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 26 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 27 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 28 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 29 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 30 субъединиц. В некоторых вариантах реализации изобретения антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, составляет в длину 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 или 80 связанных субъединиц или находится в диапазоне, определенном любыми двумя из указанных выше значений. В некоторых вариантах реализации изобретения антисмысловое соединение представляет собой антисмысловой олигонуклеотид, а связанные субъединицы представляют собой нуклеозиды.

В некоторых вариантах реализации изобретения антисмысловые олигонуклеотиды, таргетирующие нуклеиновую кислоту атаксина 2, могут быть укороченными или усеченными. Например, может быть делетирована одна субъединица с 5'-конца (5'-усечение) или, альтернативно, с 3'-конца (3'-усечение). Укороченное или усеченное антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, может иметь две субъединицы, делетированные с 5'-конца антисмыслового соединения или, в альтернативном варианте, иметь две субъединицы, удаленные с 3'-конца. В альтернативном варианте делетированные нуклеозиды могут быть распределены по всему антисмысловому соединению, например, в антисмысловом соединении, имеющем один делетированный нуклеозид с 5'-конца и один делетированный нуклеозид с 3'-конца.

Когда одна дополнительная субъединица присутствует в удлиненном антисмысловом соединении, то дополнительная субъединица может быть расположена на 5'- или 3'-конце антисмыслового соединения. Когда присутствуют две или более дополнительных субъединиц, то добавленные субъединицы могут соседствовать друг с другом, например, в антисмысловом соединении, имеющем две субъединицы, добавленные к 5'-концу (5'-добавление) или, в альтернативном варианте, к 3'-концу (3'-добавление) антисмыслового соединения. В альтернативном варианте добавленные субъединицы могут быть распределены по всему антисмысловому соединению, например, в антисмысловом соединении, имеющем одну субъединицу, добавленную к 5'-концу, и одну субъединицу, добавленную к 3'-концу.

Возможно увеличение или уменьшение длины антисмыслового соединения, такого как антисмысловой олигонуклеотид, и/или введение мисматчевых нуклеотидных оснований без исчезновения активности. Например, в Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) ряд антисмысловых олигонуклеотидов длиной 13-25 нуклеотидных оснований исследовали на способность индуцировать расщепление РНК-мишени в модели с инъекцированием в ооцит. Антисмысловые олигонуклеотиды длиной 25 нуклеотидных оснований с 8 или 11 мисматчевыми основаниями возле концов антисмысловых олигонуклеотидов были способны непосредственно специфически расщеплять мРНК-мишень, хоть и в меньшей степени, чем антисмысловые олигонуклеотиды, которые не содержали мисматчевых оснований. Аналогичным образом, специфическое расщепление мишени было достигнуто с использованием антисмысловых олигонуклеотидов размером 13 нуклеотидных оснований, включая те, которые содержали 1 или 3 мисматчевых основания.

Авторами Gautschi et al (J. Natl. Natl. Cancer Inst. 93:463-471, March 2001) продемонстрирована способность олигонуклеотида, имеющего 100% комплементарность к мРНК bcl-2 и содержащего 3 мисматчевых основания к мРНК bcl-xL, снижать экспрессию как гена bcl-2, так и bcl-xL в условиях in vitro и in vivo. Кроме того, данный олигонуклеотид продемонстрировал высокую противоопухолевую активность in vivo.

Авторы Maher и Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) испытывали ряд тандемных антисмысловых олигонуклеотидов размером 14 нуклеотидных оснований и антисмысловых олигонуклеотидов размером 28 и 42 нуклеотидных оснований, содержащих, соответственно, последовательность из двух или трех тандемных антисмысловых олигонуклеотидов, на способность блокировать трансляцию дигидрофолатредуктазы (DHFR) человека при анализе на ретикулоцитах кролика. Каждый из этих трех антисмысловых олигонуклеотидов размером 14 нуклеотидных оснований сам по себе был способен ингибировать трансляцию, хоть и на более низком уровне, чем антисмысловые олигонуклеотиды размером 28 или 42 нуклеотидных оснований.

Мотивы антисмысловых соединений

В некоторых вариантах реализации изобретения антисмысловые соединения, таргетирующие нуклеиновую кислоту атаксина 2, содержат химически модифицированные субъединицы, сгруппированные в паттерны, или мотивы, для того чтобы придать антисмысловым соединениям такие свойства, как усиленная ингибирующая активность, повышенная аффинность связывания нуклеиновой кислоты-мишени или устойчивость к деградации нуклеазами in vivo.

Химерные антисмысловые соединения обычно содержат по меньшей мере один участок, модифицированный так, чтобы придать повышенную устойчивость к деградации нуклеазами, повышенное поглощение клетками, повышенную аффинность связывания нуклеиновой кислоты-мишени и/или повышенную ингибирующую активность. Второй участок химерного антисмыслового соединения необязательно может служить субстратом для клеточной эндонуклеазы - РНКазы H, которая расщепляет нить РНК в дуплексе РНК:ДНК.

Антисмысловые соединения, содержащие гэпмер-мотив, считают химерными антисмысловыми соединениями. В гэпмере внутренний участок, содержащий множество нуклеотидов, которые обеспечивают расщепление РНКазой Н, расположен между внешними участками, содержащими множество нуклеотидов, которые химически отличаются от нуклеозидов внутреннего участка. В случае, когда антисмысловой олигонуклеотид содержит гэпмер-мотив, то гэп-сегмент обычно служит субстратом для расщепления эндонуклеазами, тогда как сегменты крыльев содержат модифицированные нуклеозиды. В некоторых вариантах реализации изобретения участки гэпмера различаются по типам сахаридных фрагментов в составе каждого отдельного участка. Типы сахаридных фрагментов, которые используются для различения участков гэпмера, в некоторых вариантах реализации изобретения могут включать β-D-рибонуклеозиды, β-D-дезоксирибонуклеозиды, 2'-модифицированные нуклеозиды (такие 2'-модифицированные нуклеозиды могут включать среди прочих варианты 2'-MOE и 2'-O-CH3) и бициклические сахаридные модифицированные нуклеозиды (такие бициклические сахаридные модифицированные нуклеозиды могут включать содержащие мостик 4'-(CH2)n-O-2', где n=1 или n=2, и 4'-CH2-O-CH2-2'). В некоторых вариантах реализации изобретения крылья могут включать несколько модифицированных сахаридных фрагментов, включая, например, 2'-MOE. В некоторых вариантах реализации изобретения крылья могут включать несколько модифицированных и немодифицированных сахаридных фрагментов. В некоторых вариантах реализации изобретения крылья могут включать различные комбинации 2'-MOE-нуклеозидов и 2'-дезоксинуклеозидов.

Каждый отдельный участок может содержать одинаковые сахаридные фрагменты, отличающиеся или чередующиеся сахаридные фрагменты. Мотив крыло-гэп-крыло часто описывают как «Х-Y-Z», где «X» представляет длину 5'-крыла, «Y» представляет длину гэпа, a «Z» представляет длину 3'-крыла. Участки «X» и «Z» могут содержать одинаковые, отличающиеся или чередующиеся сахаридные фрагменты. В некоторых вариантах реализации изобретения участки «X» и «Y» могут включать один или более 2'-дезоксинуклеозидов. Участок «Y» может содержать 2'-дезоксинуклеозиды. Используемый в данном документе гэпмер, описываемый как «Х-Y-Z» имеет такую конфигурацию, что гэп расположен непосредственно по соседству с каждым 5'-крылом и 3'-крылом. Таким образом, не существует промежуточных нуклеотидов между 5'-крылом и гэпом или гэпом и 3'-крылом. Любое из антисмысловых соединений, описанных в данном документе, может содержать гэпмер-мотив. В некоторых вариантах реализации изобретения значения «X» и «Z» одинаковые, в других вариантах реализации изобретения они разные.

В некоторых вариантах реализации изобретения гэпмеры, предложенные в данном документе, включают, например, 20-меры, содержащие мотив 5-10-5.

В некоторых вариантах реализации изобретения гэпмеры, предложенные в данном документе, включают, например, 19-меры, содержащие мотив 5-9-5.

В некоторых вариантах реализации изобретения гэпмеры, предложенные в данном документе, включают, например, 18-меры, содержащие мотив 5-8-5.

В некоторых вариантах реализации изобретения гэпмеры, предложенные в данном документе, включают, например, 18-меры, содержащие мотив 4-8-6.

В некоторых вариантах реализации изобретения гэпмеры, предложенные в данном документе, включают, например, 18-меры, содержащие мотив 6-8-4.

В некоторых вариантах реализации изобретения гэпмеры, предложенные в данном документе, включают, например, 18-меры, содержащие мотив 5-7-6.

Нуклеиновые кислоты-мишени, участки-мишени и нуклеотидные последовательности

Нуклеотидные последовательности, которые кодируют атаксин 2, включают, без ограничения, следующие: № доступа в базе данных GENBANK NM_002973.3 (включена в данный документ как SEQ ID NO: 1), комплементарная последовательность № доступа в базе данных GENBANK NT_009775.17, усеченной от нуклеотидов 2465000 до 2616000 (включена в данный документ как SEQ ID NO: 2) и № доступа в базе данных GENBANK ВХ410018.2 (включена в данный документ как SEQ ID NO: 3).

Понятно, что последовательность, указанная в каждой SEQ ID NO в примерах, содержащихся в данном документе, является независимой от любой модификации сахаридного фрагмента, межнуклеозидной связи или нуклеотидного основания. По сути, антисмысловые соединения, определенные SEQ ID NO, могут независимо содержать одну или более модификаций сахаридного фрагмента, межнуклеозидной связи или нуклеотидного основания. Антисмысловые соединения, описанные номером Isis (№ Isis), указывают комбинацию последовательности и мотива нуклеотидных оснований.

В некоторых вариантах реализации изобретения участок-мишень представляет собой структурно определенный участок нуклеиновой кислоты-мишени. Например, участок-мишень может охватывать 3'-HTO, 5'-НТО, экзон, интрон, соединение экзона/интрона, кодирующий участок, участок инициации трансляции, участок терминации трансляции или другой определенный участок нуклеиновой кислоты. Структурно определенные участки атаксина 2 могут быть получены по номеру доступа из баз данных последовательностей, таких как NCBI, и такая информация включена в данный документ посредством ссылки. В некоторых вариантах реализации изобретения участок-мишень может охватывать последовательность от 5' сайта-мишени одного сегмента-мишени в пределах участка-мишени до 3' сайта-мишени другого сегмента-мишени в пределах того же участка-мишени.

Таргетирование включает определение по меньшей мере одного сегмента-мишени, с которым гибридизируется антисмысловое соединение, вследствие чего проявляется требуемое действие. В некоторых вариантах реализации изобретения требуемое действие заключается в снижении уровней мРНК нуклеиновой кислоты-мишени. В некоторых вариантах реализации изобретения требуемое действие заключается в снижении уровней белка, кодируемого нуклеиновой кислотой-мишенью, или фенотипическом изменении, связанном с нуклеиновой кислотой-мишенью.

Участок-мишень может содержать один или более сегментов-мишеней. Множество сегментов-мишеней в пределах участка-мишени могут быть перекрывающимися. В альтернативном варианте они могут быть неперекрывающимися. В некоторых вариантах реализации изобретения сегменты-мишени в участке-мишени разделены не более, чем около 300 нуклеотидами. В некоторых вариантах реализации изобретения сегменты-мишени в участке-мишени разделены количеством нуклеотидов равным, равным около, равным не более чем, равным не более чем около 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 или 10 нуклеотидами на нуклеиновой кислоте-мишени, или равным диапазону, определенному любыми двумя из предыдущих значений. В некоторых вариантах реализации изобретения сегменты-мишени в участке-мишени разделены не более чем или не более чем около 5 нуклеотидами на нуклеиновой кислоте-мишени. В некоторых вариантах реализации изобретения сегменты-мишени являются последовательными. Предполагается, что участки-мишени определены диапазоном, содержащим инициирующую нуклеиновую кислоту, которая представлена любым из 5' сайтов-мишеней или 3' сайтов-мишеней, перечисленных в данном документе.

Подходящие сегменты-мишени могут быть найдены в 5'-НТО, кодирующем участке, 3'-НТО, интроне, экзоне или соединении экзона/интрона. Сегменты-мишени, содержащие инициирующий кодон или терминирующий кодон, также являются подходящими сегментами-мишенями. Подходящий сегмент-мишень может специфически исключать конкретный структурно определенный участок, такой как инициирующий кодон или терминирующий кодон.

Определение подходящих сегментов-мишеней может включать сравнение последовательности нуклеиновой кислоты-мишени с другими последовательностями по всему геному. Например, для идентификации участков сходства среди разных нуклеиновых кислот может быть использован алгоритм BLAST. Это сравнение может предупредить выбор последовательностей антисмысловых соединений, которые могут гибридизироваться неспецифическим образом с последовательностями, отличающимися от выбранной нуклеиновой кислоты-мишени (т.е., нецелевыми или побочными последовательностями).

Могут быть вариации активности (например, которые определяют по проценту снижения уровней нуклеиновых кислот-мишеней) антисмысловых соединений в пределах активного участка-мишени. В некоторых вариантах реализации изобретения снижение уровней мРНК атаксина 2 является показателем ингибирования экспрессии атаксина 2. Снижение уровней белка атаксина 2 также является показателем ингибирования экспрессии мРНК-мишени. Фенотипические изменения являются показателем ингибирования экспрессии атаксина 2. Улучшение нейрологического функционирования является показателем ингибирования экспрессии атаксина 2. Улучшенная двигательная функция и память являются показателем ингибирования экспрессии атаксина 2.

Гибридизация

В некоторых вариантах реализации изобретения гибридизация происходит между антисмысловым соединением, описанным в данном документе, и нуклеиновой кислотой атаксина 2. Наиболее распространенный механизм гибридизации задействует водородное связывание (например, Уотсон-Криковское, Хугстиновское или обратное Хугстиновское водородное связывание) между комплементарными нуклеотидными основаниями молекул нуклеиновых кислот.

Гибридизация может происходить в различных условиях. Жесткие условия зависят от последовательности и определяются природой и составом молекул нуклеиновых кислот, подлежащих гибридизации.

Способы определения того, является ли последовательность способной специфически гибридизироваться с нуклеиновой кислотой-мишенью, хорошо известны в данной области. В некоторых вариантах реализации изобретения антисмысловые соединения, предложенные в данном документе, способны специфически гибридизироваться с нуклеиновой кислотой атаксина 2.

Комплементарность

Антисмысловое соединение и нуклеиновая кислота-мишень комплементарны друг другу, если достаточное количество нуклеотидных оснований антисмыслового соединения может образовать водородную связь с соответствующими нуклеотидными основаниями нуклеиновой кислоты-мишени так, что будет проявляться требуемое действие (например, антисмысловое ингибирование нуклеиновой кислоты-мишени, такой как нуклеиновой кислоты атаксина 2).

Некомплементарные нуклеотидные основания между антисмысловым соединением и нуклеиновой кислотой атаксина 2 могут быть допустимыми при условии, что данное антисмысловое соединение остается способным специфически гибридизироваться с нуклеиновой кислотой-мишенью. Более того, антисмысловое соединение может гибридизироваться по всей длине одного или более сегментов нуклеиновой кислоты атаксина 2 так, чтобы промежуточные или соседствующие сегменты не участвовали в гибридизационном событии (например, петлевая структура, мисматчевая или шпильковая структура).

В некоторых вариантах реализации изобретения антисмысловые соединения, представленные в данном документе, или их указанная часть, являются или являются по меньшей мере на 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или 100% комплементарными нуклеиновой кислоте атаксина 2, участку-мишени, сегменту-мишени или их указанной части. Процент комплементарности антисмыслового соединения с нуклеиновой кислотой-мишенью может быть определен с использованием традиционных способов.

Например, антисмысловое соединение, в котором 18 из 20 нуклеотидных оснований антисмыслового соединения являются комплементарными участку-мишени, и поэтому может специфически гибридизироваться, должно представлять комплементарность на 90 процентов. В этом примере оставшиеся некомплементарные нуклеотидные основания могут быть собраны в кластеры или рассеяны с комплементарными нуклеотидными основаниями и не требуют последовательного расположения друг к другу или к комплементарным нуклеотидным основаниям. По сути, антисмысловое соединение, которое составляет в длину 18 нуклеотидных оснований, имеющее 4 (четыре) некомплементарных нуклеотидных основания, которые фланкированы двумя участками с полной комплементарностью к нуклеиновой кислоте-мишени, может иметь 77,8% общей комплементарности к нуклеиновой кислоте-мишени и, таким образом, должно попадать в объем настоящего изобретения. Процент комплементарности антисмыслового соединения с участком нуклеиновой кислоты-мишени может быть определен традиционным способом с использованием программ BLAST (основные инструменты для исследования локального выравнивания) и программ PowerBLAST, известных в данной области техники (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang и Madden, Genome Res., 1997, 7, 649 656). Процент гомологии, идентичность или комплементарность последовательностей могут быть определены, например, программой Gap (висконсинский пакет анализа последовательностей, версия 8 для Unix, Genetics Computer Group, Университетский исследовательский парк, г. Мэдисон, штат Висконсин) с применением настройки по умолчанию, которая использует алгоритм Смита и Уотермана (Adv. Appl. Math., 1981, 2, 482 489).

В некоторых вариантах реализации изобретения антисмысловые соединения, представленные в данном документе, или их указанные части, являются полностью комплементарными (т.е. на 100% комплементарными) нуклеиновой кислоте-мишени или ее указанной части. Например, антисмысловое соединение может быть полностью комплементарным нуклеиновой кислоте атаксина 2 или ее участку-мишени, или сегменту-мишени или последовательности-мишени. Используемый в данном документе термин «полностью комплементарный» означает, что каждое нуклеотидное основание антисмыслового соединения способно к точному спариванию оснований с соответствующими нуклеотидными основаниями нуклеиновой кислоты-мишени. Например, антисмысловое соединение размером 20 нуклеотидных оснований является полностью комплементарным последовательности-мишени, которая в длину составляет 400 нуклеотидных оснований, поскольку есть соответствующая часть размером 20 нуклеотидных оснований нуклеиновой кислоты-мишени, которая полностью комплементарна данному антисмысловому соединению. Полная комплементарность также может быть использована в сравнении с указанной частью первой и/или второй нуклеиновой кислоты. Например, часть размером 20 нуклеотидных оснований антисмыслового соединения размером 30 нуклеотидных оснований может быть «полностью комплементарной» последовательности-мишени длиной 400 нуклеотидных оснований. Часть размером 20 нуклеотидных оснований антисмыслового соединения размером 30 нуклеотидных оснований полностью комплементарна последовательности-мишени, если последовательность-мишень имеет соответствующую часть размером 20 нуклеотидных оснований, в которой каждое нуклеотидное основание является комплементарным части размером 20 нуклеотидных оснований данного антисмыслового соединения. В то же время, целое антисмысловое соединение размером 30 нуклеотидных оснований может быть или может не быть полностью комплементарным последовательности-мишени, в зависимости от того, комплементарны ли также оставшиеся 10 нуклеотидных оснований антисмыслового соединения последовательности-мишени.

Некомплементарное нуклеотидное основание может располагаться на 5'-конце или 3'-конце антисмыслового соединения. В альтернативном варианте некомплементарное нуклеотидное основание или нуклеотидные основания могут находиться во внутреннем положении антисмыслового соединения. Если присутствуют два или более некомплементарных нуклеотидных оснований, то они могут быть последовательными (т.е. связанными) или непоследовательными. В одном варианте реализации изобретения некомплементарное нуклеотидное основание расположено в сегменте крыла гэпмера антисмыслового олигонуклеотида.

В некоторых вариантах реализации изобретения антисмысловые соединения, которые в длину составлены из или составлены из вплоть до 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 нуклеотидных оснований, содержат не более 4, не более 3, не более 2 или не более 1 некомплементарного(-ых) нуклеотидного(-ых) основания(-й) по сравнению с нуклеиновой кислотой-мишенью, такой как нуклеиновая кислота атаксина 2 или ее указанная часть.

В некоторых вариантах реализации изобретения антисмысловые соединения, которые в длину составлены из или составлены из вплоть до 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидных оснований, содержат не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 некомплементарного(-ых) нуклеотидного(-ых) основания(-й) относительно нуклеиновой кислоты-мишени, такой как нуклеиновая кислота атаксина 2 или ее указанная часть.

Антисмысловые соединения, предложенные в данном документе, также включают такие, которые комплементарны части нуклеиновой кислоты-мишени. Используемый в данном документе термин «часть» относится к определенному количеству последовательных (т.е. связанных) нуклеотидных оснований в пределах участка или сегмента нуклеиновой кислоты-мишени. «Часть» также может относиться к определенному количеству последовательных нуклеотидных оснований антисмыслового соединения. В некоторых вариантах реализации изобретения антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени размером 8 нуклеотидных оснований. В некоторых вариантах реализации изобретения антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени размером 9 нуклеотидных оснований. В некоторых вариантах реализации изобретения антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени размером 10 нуклеотидных оснований. В некоторых вариантах реализации изобретения антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени размером 11 нуклеотидных оснований. В некоторых вариантах реализации изобретения антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени размером 12 нуклеотидных оснований. В некоторых вариантах реализации изобретения антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени размером 13 нуклеотидных оснований. В некоторых вариантах реализации изобретения антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени размером 14 нуклеотидных оснований. В некоторых вариантах реализации изобретения антисмысловые соединения комплементарны по меньшей мере части сегмента-мишени размером 15 нуклеотидных оснований. Предполагаются также антисмысловые соединения, которые комплементарны по меньшей мере 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 или более нуклеотидным основаниям части сегмента-мишени или диапазону, определенному любыми двумя из этих значений.

Идентичность

Антисмысловые соединения, предложенные в данном документе, также могут иметь определенный процент идентичности с конкретной нуклеотидной последовательностью, SEQ ID NO, или соединением, представленным специальным номером Isis, или его частью. Используемое в данном документе антисмысловое соединение идентично последовательности, описанной в данном документе, если оно имеет такую же способность к спариванию нуклеотидных оснований. Например, РНК, которая в описанной последовательности ДНК содержит урацил вместо тимидина, должна считаться идентичной последовательности ДНК, поскольку и урацил и тимидин образуют пару с аденином. Рассматриваются также укороченные и удлиненные варианты антисмысловых соединений, описанных в данном документе, а также соединений, содержащих неидентичные основания по отношению к антисмысловым соединениям, представленным в данном документе. Неидентичные основания могут соседствовать друг с другом или быть распределенными по всему антисмысловому соединению. Процент идентичности антисмыслового соединения рассчитывается в соответствии с количеством оснований, которые имеют идентичное спаривание оснований относительно последовательности, с которой оно сравнивается.

В некоторых вариантах реализации изобретения антисмысловые соединения или их части по меньшей мере на 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичны одному или более антисмысловым соединениям или SEQ ID NO, или их частям, описанным в данном документе.

В некоторых вариантах реализации изобретения часть антисмыслового соединения сравнивается с частью равной длины нуклеиновой кислоты-мишени. В некоторых вариантах реализации изобретения часть размером 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 нуклеотидных оснований сравнивается с частью равной длины нуклеиновой кислоты-мишени.

В некоторых вариантах реализации изобретения часть антисмыслового олигонуклеотида сравнивается с частью равной длины нуклеиновой кислоты-мишени. В некоторых вариантах реализации изобретения часть размером 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 нуклеотидных оснований сравнивается с частью равной длины нуклеиновой кислоты-мишени.

Модификации

Нуклеозид представляет собой комбинацию основание-сахарид. Часть нуклеотидного основания (также известного как основание) обычно представляет собой фрагмент гетероциклического основания. Нуклеотиды представляют собой нуклеозиды, которые дополнительно включают фосфатную группу, ковалентно связанную с сахаридной частью нуклеозида. Для тех нуклеозидов, которые содержат пентофуранозильный сахарид, фосфатная группа может быть связана с 2', 3' или 5'-гидроксильным фрагментом сахарида. Олигонуклеотиды образуются посредством ковалентного связывания соседствующих друг с другом нуклеозидов с образованием линейного полимерного олигонуклеотида. В олигонуклеотидной структуре фосфатные группы обычно предназначены для образования межнуклеозидных связей олигонуклеотида.

Модификации антисмысловых соединений охватывают замены или изменения межнуклеозидных связей, сахаридных фрагментов или нуклеотидных оснований. Модифицированные антисмысловые соединения часто предпочтительны по сравнению с нативными формами, потому что обладают требуемыми свойствами, такими как, например, усиленное поглощение клетками, усиленная аффинность к нуклеиновой кислоте-мишени, увеличенная устойчивость в присутствии нуклеаз или увеличенная ингибирующая активность.

Химически модифицированные нуклеозиды также могут применяться для увеличения аффинности связывания укороченного или усеченного антисмыслового олигонуклеотида с его нуклеиновой кислотой-мишенью. Следовательно, сопоставимые результаты часто могут быть получены с помощью более коротких антисмысловых соединений, которые содержат такие химически модифицированные нуклеозиды.

Модифицированные межнуклеозидные связи

Встречающаяся в природе межнуклеозидная связь РНК и ДНК представляет собой 3'-5' фосфодиэфирную связь. Антисмысловые соединения, содержащие одну или более модифицированных, т.е. не встречающихся в природе, межнуклеозидных связей выбирают чаще, чем антисмысловые соединения, содержащие встречающиеся в природе межнуклеозидные связи, потому что они обладают требуемыми свойствами, такими как, например, усиленное поглощение клетками, усиленная аффинность к нуклеиновым кислотам-мишеням и увеличенная устойчивость в присутствии нуклеаз.

Олигонуклеотиды, содержащие модифицированные межнуклеозидные связи, включают межнуклеозидные связи, которые сохраняют атом фосфора, а также межнуклеозидные связи, которые не содержат атома фосфора. Типичные фосфорсодержащие межнуклеозидные связи включают, но не ограничиваются ими, фосфодиэфиры, фосфотриэфиры, метилфосфонаты, фосфорамидаты и тиофосфаты. Способы получения фосфорсодержащих и не содержащих фосфор связей хорошо известны.

В некоторых вариантах реализации изобретения антисмысловые соединения, таргетирующие нуклеиновую кислоту атаксина 2, содержат одну или более модифицированных межнуклеозидных связей. В некоторых вариантах реализации изобретения модифицированные межнуклеозидные связи являются рассеянными по всему антисмысловому соединению. В некоторых вариантах реализации изобретения модифицированные межнуклеозидные связи представляют собой тиофосфатные связи. В некоторых вариантах реализации изобретения каждая межнуклеозидная связь антисмыслового соединения представляет собой тиофосфатную межнуклеозидную связь.

Модифицированные сахаридные фрагменты

Антисмысловые соединения необязательно могут содержать один или более нуклеозидов, в которых сахаридная группа была модифицирована. Такие нуклеозиды с модифицированными сахаридами могут придавать антисмысловым соединениям усиленную устойчивость к нуклеазам, увеличенную аффинность связывания или некоторые другие полезные биологические свойства. В некоторых вариантах реализации изобретения нуклеозиды содержат химически модифицированные фрагменты рибофуранозного кольца. Примеры химически модифицированных рибофуранозных колец включают, без ограничения: добавление групп заместителей (включающих 5'- и 2'-группы заместителей, мостиковое соединение негеминальных атомов кольца с образованием бициклических нуклеиновых кислот (BNA), замену атома кислорода рибозильного кольца на S, N(R) или C(R1)(R2) (R, R1 и R2, каждый независимо, представляют собой H, C1-C12 алкил или защитную группу) и их комбинации. Примеры химически модифицированных сахаридов включают 2'-F-5'-метилзамещенный нуклеозид (см. международную заявку PCT WO 2008/101157, опубликованную 21.08.2008 г. для других описанных 5',2'-бисзамещенных нуклеозидов) или замену атома кислорода рибозильного кольца атомом S с дальнейшим замещением в 2'-положении (см. опубликованную заявку на патент США US 2005-0130923, опубликованную 16 июня 2005 г.) или, в альтернативном варианте, 5'-замещение BNA (см. международную заявку PCT WO 2007/134181, опубликованную 22.11.2007 г., где ЗНК замещается, например, 5'-метильной или 5'-винильной группой).

Примеры нуклеозидов, содержащих модифицированные сахаридные фрагменты включают, без ограничения, нуклеозиды, содержащие 5'-винил, 5'-метил (R или S), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F и 2'-O(CH2)2OCH3 замещающие группы. Заместитель в 2'-положении также может быть выбран из аллила, амино, азидо, тио, O-аллила, O-C1-C10 алкила, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-O-N(Rm)(Rn), O-CH2-C(=O)-N(Rm)(Rn) и O-CH2-C(=O)-N(R1)-(CH2)2-N(Rm)(Rn), где каждый Rl, Rm и Rn независимо представляет собой H или замещенный или незамещенный C1-C10 алкил.

Используемые в данном документе «бициклические нуклеозиды» относятся к модифицированным нуклеозидам, содержащим бициклический сахаридный фрагмент. Примеры бициклических нуклеозидов включают, без ограничения, нуклеозиды, содержащие мостик между 4'- и 2'-атомами рибозильного кольца. В некоторых вариантах реализации изобретения антисмысловые соединения, предложенные в данном документе, включают один или более бициклических нуклеозидов, содержащих мостик 4'-2'. Примеры таких связанных мостиками 4'-2' бициклических нуклеозидов, включают, без ограничения, одну из формул: 4'-(CH2)-O-2' (ЗНК); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-СН(CH3)-O-2' и 4'-СН(CH2OCH3)-O-2' (и их аналоги, см. патент США 7399845, выданный 15 июля 2008 г.); 4'-С(CH3)(CH3)-O-2' (и их аналоги, см. опубликованную международную заявку WO/2009/006478, опубликованную 8 января 2009 г.); 4'-CH2-N(OCH3)-2' (и их аналоги, см. опубликованную международную заявку WO/2008/150729, опубликованную 11 декабря 2008 г.); 4'-CH2-O-N(CH3)-2' (см. опубликованную заявку на патент США US 2004-0171570, опубликованную 2 сентября 2004 г.); 4'-CH2-N(R)-O-2', где R представляет собой H, C1-C12-алкил или защитную группу (см. патент США 7427672, выданный 23 сентября 2008 г.); 4'-CH2-C(H)(CH3)-2' (см. Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134) и 4'-CH2-C(=CH2)-2' (и их аналоги см. опубликованную международную заявку WO 2008/154401, опубликованную 8 декабря 2008 г.).

Дополнительные отчеты, касающиеся бициклических нуклеозидов, также могут быть найдены в опубликованной литературе (см., например: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7 и Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; патенты США №6268490; 6525191; 6670461; 6770748; 6794499; 7034133; 7053207; 7399845; 7547684 и 7696345; публикацию патента № US 2008-0039618; US 2009-0012281; патенты с серийными №60/989574; 61/026995; 61/026998; 61/056564; 61/086231; 61/097787 и 61/099844; опубликованные международные заявки PCT WO 1994/014226; WO 2004/106356; WO 2005/021570; WO 2007/134181; WO 2008/150729; WO 2008/154401 и WO 2009/006478. Каждый из предыдущих бициклических нуклеозидов может быть получен с содержанием одной или более конфигураций стереохимических сахаридов, включая, например, α-L-рибофуранозу и β-D-рибофуранозу (см. международную заявку PCT - PCT/DK98/00393, опубликованную 25 марта 1999 г. как заявку WO 99/14226).

В некоторых вариантах реализации изобретения бициклические сахаридные фрагменты BNA-нуклеозидов включают, но не ограничиваются ими, соединения, содержащие по меньшей мере один мостик между 4'- и 2'-положениями пентофуранозного сахаридного фрагмента, в котором такие мостики независимо содержат 1 или от 2 до 4 связанных групп, независимо выбранных из -[C(Ra)(Rb)]n-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=O)-, -C(=NRa)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x- и -N(Ra)-;

где:

x представляет собой 0, 1 или 2;

n представляет собой 1, 2, 3 или 4;

каждый Ra и Rb независимо представляет собой H, защитную группу, гидроксил, C1-C12 алкил, замещенный C1-C12 алкил, C2-C12 алкенил, замещенный C2-C12 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, C5-C20 арил, замещенный C5-C20 арил, гетероциклический радикал, замещенный гетероциклический радикал, гетероарил, замещенный гетероарил, C5-C7 алициклический радикал, замещенный C5-C7 алициклический радикал, галоген, OJ1, NJ1J2, SJ1, N3, COOJ1, ацил (C(=O)-H), замещенный ацил, CN, сульфонил (S(=O)2-J1) или сульфоксил (S(=O)-J1) и

каждый J1 и J2 независимо представляет собой H, C1-C12 алкил, замещенный C1-C12 алкил, C2-C12 алкенил, замещенный C2-C12 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, C5-C20 арил, замещенный C5-C20 арил, ацил (C(=O)-Н), замещенный ацил, гетероциклический радикал, замещенный гетероциклический радикал, C1-C12 аминоалкил, замещенный C1-C12 аминоалкил или защитную группу.

В некоторых вариантах реализации изобретения мостик бициклического сахаридного фрагмента представляет собой -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(RaRb)-N(R)-O- или -C(RaRb)-O-N(R)-. В некоторых вариантах реализации изобретения мостик представляет собой 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-O-N(R)-2' и 4'-CH2-N(R)-O-2'-, где каждый R независимо представляет собой H, защитную группу или C1-C12 алкил.

В некоторых вариантах реализации изобретения бициклические нуклеозиды дополнительно определяются изомерной конфигурацией. Например, нуклеозид, содержащий 4'-2'-метиленокси мостик, может находиться в α-L-конфигурации или β-D-конфигурации. Раннее, α-L-метиленокси (4'-CH2-O-2') BNA были введены в антисмысловые олигонуклеотиды, которые показали антисмысловую активность (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

В некоторых вариантах реализации изобретения бициклические нуклеозиды включают, но не ограничиваются ими: (A) α-L-метиленокси (4'-CH2-O-2') BNA, (B) β-D-метиленокси (4'-CH2-O-2') BNA, (С) этиленокси (4'-(CH2)2-O-2') BNA, (D) аминоокси (4'-CH2-O-N(R)-2') BNA, (Е) оксиамино (4'-CH2-N(R)-O-2') BNA и (F) метил(метиленокси) (4'-СН(CH3)-O-2') BNA, (G) метилентио (4'-CH2-S-2') BNA, (H) метиленамино (4'-CH2-N(R)-2') BNA, (I) метилкарбоциклические (4'-CH2-СН(CH3)-2') BNA и (J) пропиленкарбоциклические (4'-(CH2)3-2') BNA, как изображено ниже.

где Bx представляет собой фрагмент основания, а R независимо представляет собой H, защитную группу или C1-C12 алкил.

В некоторых вариантах реализации изобретения предложенные бициклические нуклеозиды имеют формулу I:

где:

Bx представляет собой фрагмент гетероциклического основания;

-Qa-Qb-Qc- представляет собой -CH2-N(Rc)-CH2-, -C(=O)-N(Rc)-CH2-, -CH2-O-N(Rc)-, -CH2-N(Rc)-O- или -N(Rc)-O-CH2;

Rc представляет собой C1-C12 алкил- или аминозащитную группу; а

Ta и Tb, каждый независимо, представляют собой H, гидроксилзащитную группу, группу конъюгации, реакционно-способную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к субстрату.

В некоторых вариантах реализации изобретения предложенные бициклические нуклеозиды имеют формулу II:

где:

Bx представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой H, гидроксилзащитную группу, группу конъюгации, реакционно-способную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к субстрату;

Za представляет собой C1-C6 алкил, C2-C6 алкенил, C2-C6 алкинил, замещенный C1-C6 алкил, замещенный C2-C6 алкенил, замещенный C2-C6 алкинил, ацил, замещенный ацил, замещенный амид, тиол или замещенный тиол.

В одном варианте реализации изобретения каждая из замещенных групп независимо представляет собой моно- или полизамещенную группами заместителей, независимо выбранных из галогена, оксо, гидроксила, OJc, NJcJd, SJc, N3, OC(=X)Jc и NJeC(=X)NJcJd, где каждый Jc, Jd и Je независимо представляет собой H, C1-C6 алкил или замещенный C1-C6 алкил, а X представляет собой O или NJc.

В некоторых вариантах реализации изобретения предложенные бициклические нуклеозиды имеют формулу III:

где:

Bx представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой H, гидроксилзащитную группу, группу конъюгации, реакционно-способную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к субстрату;

Zb представляет собой C1-C6 алкил, C2-C6 алкенил, C2-C6 алкинил, замещенный C1-C6 алкил, замещенный C2-C6 алкенил, замещенный C2-C6 алкинил или замещенный ацил (C(=O)-).

В некоторых вариантах реализации изобретения предложенные бициклические нуклеозиды имеют формулу IV:

где:

Bx представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой H, гидроксилзащитную группу, группу конъюгации, реакционно-способную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к субстрату;

Rd представляет собой C1-C6 алкил, замещенный C1-C6 алкил, C2-C6 алкенил, замещенный C2-C6 алкенил, C2-C6 алкинил или замещенный C2-C6 алкинил;

каждый qa, qb, qc и qd независимо представляет собой H, галоген, C1-C6 alkyl, замещенный C1-C6 алкил, C2-C6 алкенил, замещенный C2-C6 алкенил, C2-C6 алкинил или замещенный C2-C6 алкинил, C1-C6 алкоксил, замещенный C1-C6 алкоксил, ацил, замещенный ацил, C1-C6 аминоалкил или замещенный C1-C6 аминоалкил.

В некоторых вариантах реализации изобретения предложенные бициклические нуклеозиды имеют формулу V:

где:

Bx представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой H, гидроксилзащитную группу, группу конъюгации, реакционно-способную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к субстрату;

qa, qb, qe и qf, каждый независимо, представляют собой водород, галоген, C1-C12 алкил, замещенный C1-C12 алкил, C2-C12 алкенил, замещенный C2-C12 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, C1-C12 алкокси, замещенный C1-C12 алкокси, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, O-C(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk или N(H)C(=S)NJjJk;

или qe и qf вместе представляют собой =C(qg)(qh);

qg и qh, каждый независимо, представляют собой H, галоген, C1-C12 алкил или замещенный C1-C12 алкил.

Были описаны синтез и получение метиленокси (4'-CH2-O-2') BNA-мономеров аденина, цитозина, гуанина, 5-метилцитозина, тимина и урацила вместе с их олигомеризацией и свойствами распознавания нуклеиновых кислот (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNA и их получение также описаны в заявках WO 98/39352 и WO 99/14226.

Были также получены аналоги метиленокси (4'-CH2-O-2') BNA и 2'-тио-BNA (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Также было описано получение закрытых нуклеозидных аналогов, содержащих олигодезоксирибонуклеотидные дуплексы в качестве субстратов для полимераз нуклеиновых кислот (Wengel et al., WO 99/14226). Кроме того, в данной области техники был описан синтез 2'-амино-BNA, нового конформационно ограниченного высокоаффинного олигонуклеотидного аналога (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). В дополнение к этому, были получены 2-амино- и 2'-метиламино-BNA, а ранее сообщили о термической устойчивости их дуплексов с комплементарными цепями РНК и ДНК.

В некоторых вариантах реализации изобретения предложенные бициклические нуклеозиды имеют формулу VI:

где:

Bx представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой H, гидроксилзащитную группу, группу конъюгации, реакционно-способную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к субстрату;

каждый qi, qj, qk и ql, независимо, представляет собой H, галоген, C1-C12 алкил, замещенный C1-C12 алкил, C2-C12 алкенил, замещенный C2-C12 алкенил, C2-C12 алкинил, замещенный C2-C12 алкинил, C1-C12 алкоксил, замещенный C1-C12 алкоксил, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, O-C(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk или N(H)C(=S)NJjJk; a

qi и qj или ql и qk вместе представляют собой =C(qg)(qh), где qg и qh, каждый независимо, представляют собой H, галоген, C1-C12 алкил или замещенный C1-C12 алкил.

Был описан один карбоциклический бициклический нуклеозид, содержащий мостик 4'-(CH2)3-2' и мостик алкенильного аналога 4'-СН=СН-CH2-2' (Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 и Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). Были также описаны синтез и получение карбоциклических бициклических нуклеозидов вместе с их олигомеризацией и биохимическими исследованиями (Srivastava et al., J. Am. Chem. Soc., 2007, 129(26), 8362-8379).

Используемый в данном документе «4'-2' бициклический нуклеозид» или «бициклический нуклеозид 4'-2') относится к бициклическому нуклеозиду, содержащему фуранозное кольцо, содержащее мостик, соединяющий два атома углерода фуранозного кольца, который соединяет 2'-атом углерода с 4'-атомом углерода сахаридного кольца.

Используемые в данном документе «моноциклические нуклеозиды» относятся к нуклеозидам, содержащим модифицированные сахаридные фрагменты, которые не являются бициклическими сахаридными фрагментами. В некоторых вариантах реализации изобретения сахаридный фрагмент или аналог сахаридного фрагмента нуклеозида может быть модифицирован или замещен в любом положении.

Используемый в данном документе «2'-модифицированный сахарид» означает фуранозильный сахарид, модифицированный в 2'-положении. В некоторых вариантах реализации изобретения такие модификации включают заместители, выбранные из: галогенидов, включающих, но не ограниченных ими, замещенный и незамещенный алкокси, замещенный и незамещенный тиоалкил, замещенный и незамещенный аминоалкил, замещенный и незамещенный алкил, замещенный и незамещенный аллил и замещенный и незамещенный алкинил. В некоторых вариантах реализации изобретения 2'-модификации выбраны из заместителей, включающих, но не ограничивающихся ими: O[(CH2)nO]mCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nF, O(CH2)nONH2, OCH2C(=O)N(H)CH3 и O(CH2)nON[(CH2)nCH3]2, где n и m составляют от 1 до около 10. Другие 2'-группы заместителей также могут быть выбраны из: C1-C12 алкила, замещенного алкила, алкенила, алкинила, алкарила, аралкила, О-алкарила или О-аралкила, SH, SCH3, OCN, Cl, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, гетероциклоалкила, гетероциклоалкарила, аминоалкиламино, полиалкиламино, замещенного силила, РНК-расщепляющей группы, репортерной группы, интеркалятора, группы для улучшения фармакокинетических свойств или группы для улучшения фармакодинамических свойств антисмыслового соединения, и других заместителей с подобными свойствами. В некоторых вариантах реализации изобретения модифицированные нуклеозиды содержат 2'-MOE боковую цепь (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Такое замещение 2'-MOE было описано как обладающее улучшенной аффинностью связывания по сравнению с немодифицированными нуклеозидами и другими модифицированными нуклеозидами, такими как 2'-O-метил, O-пропил и О-аминопропил. Было также показано, что олигонуклеотиды, содержащие заместитель 2'-MOE, являются антисмысловыми ингибиторами экспрессии генов с перспективными свойствами для использования in vivo (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637 и Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

Используемый в настоящем документе «модифицированный тетрагидропирановый нуклеозид» или «модифицированный ТГП-нуклеозид» означает нуклеозид, содержащий шестичленный тетрагидропирановый «сахарид», замещенный пентофуранозильным остатком в обычных нуклеозидах (заменитель сахарида). Модифицированные ТГП-нуклеозиды включают, но не ограничиваются ими, такие, которые называются в данной области техники гекситной нуклеиновой кислотой (HNA), анитной нуклеиновой кислотой (ANA), манитной нуклеиновой кислотой (MNA) (см. Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), фтор-HNA (F-HNA) или теми соединениями, которые имеют формулу VII:

где независимо для каждого из упомянутого по меньшей мере одного аналога тетрагидропиранового нуклеозида формулы VII:

Bx представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой межнуклеозидную связывающую группу, связывающую аналог тетрагидропиранового нуклеозида с антисмысловым соединением, или один из Ta и Tb представляет собой межнуклеозидную связывающую группу, связывающую аналог тетрагидропиранового нуклеозида с антисмысловым соединением, а другой из Ta и Tb представляет собой H, гидроксилзащитную группу, связанную конъюгирующую группу или 5'- или 3'-концевую группу;

q1, q2, q3, q4, q5, q6 и q7, каждый независимо, представляют собой H, C1-C6 алкил, замещенный C1-C6 алкил, C2-C6 алкенил, замещенный C2-C6 алкенил, C2-C6 алкинил или замещенный C2-C6 алкинил, а каждый R1 и R2 выбран из водорода, гидроксила, галогена, замещенного или незамещенного алкокси, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 и CN, где X представляет собой O, S или NJ1, а каждый J1, J2 и J3 независимо представляет собой H или C1-C6 алкил.

В некоторых вариантах реализации изобретения предложены модифицированные ТГП-нуклеозиды формулы VII, где q1, q2, q3, q4, q5, q6 и q7 каждый представляет собой H. В некоторых вариантах реализации изобретения по меньшей мере один из q1, q2, q3, q4, q5, q6 и q7 отличается от H. В некоторых вариантах реализации изобретения по меньшей мере один из q1, q2, q3, q4, q5, q6 и q7 представляет собой метил. В некоторых вариантах реализации изобретения в данном документе предлагаются ТГП-нуклеозиды формулы VII, где один из R1 и R2 представляет собой фтор. В некоторых вариантах реализации изобретения R1 представляет собой фтор, a R2 представляет собой H; R1 представляет собой метокси, a R2 представляет собой H, и R1 представляет собой H, a R2 представляет собой метоксиэтокси.

Используемый в данном документе «2'-модифицированный» или «2'-замещенный» относится к нуклеозиду, содержащему сахарид, содержащий в 2'-положении заместитель, отличающийся от H или OH. 2'-модифицированные нуклеозиды включают, но не ограничиваются ими, бициклические нуклеозиды, в которых мостик, соединяющий два атома углерода сахаридного кольца, соединяет 2'-углерод и другой атом углерода сахаридного кольца; и нуклеозиды с немостиковыми 2'-заместителями, такими как аллил, амино, азидо, тио, О-аллил, O-C1-C10 alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-O-N(Rm)(Rn) или O-CH2-C(=O)-N(Rm)(Rn), где каждый Rm и Rn независимо представляет собой H либо замещенный или незамещенный C1-C10 алкил. 2'-модифицированные нуклеозиды могут дополнительно содержать другие модификации, например, в других положениях сахарида и/или нуклеотидного основания.

В данном документе «2'-F» относится к нуклеозиду, содержащему сахарид, содержащий в 2'-положении фторогруппу.

В данном документе «2'-ОМе» или «2'-OCH3» или «2'-Ометил» каждый относится к нуклеозиду, содержащему сахарид, содержащий -OCH3 группу в 2'-положении сахаридного кольца.

В данном документе «MOE» или «2'-MOE», или «2'-OCH2CH2OCH3», или «2'-O-метоксиэтил», каждый относится к нуклеозиду, содержащему сахарид, содержащий -OCH2CH2OCH3 группу в 2'-положении сахаридного кольца.

В данном документе «олигонуклеотид» относится к соединению, содержащему множество связанных нуклеозидов. В некоторых вариантах реализации изобретения один или более из множества нуклеозидов модифицированы. В некоторых вариантах реализации изобретения олигонуклеотид содержит один или более рибонуклеозидов (РНК) и/или дезоксирибонуклеозидов (ДНК).

В данной области техники также известны многие другие бицикло- и трициклокольцевые системы заменителей сахаридов, которые могут быть использованы при модификации нуклеозидов для введения в антисмысловые соединения (см., например, обзорную статью: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854).

Такие кольцевые системы могут претерпевать различные дополнительные замещения для усиления активности.

Способы получения модифицированных сахаридов хорошо известны специалистам в данной области техники.

В нуклеозидах, содержащих модифицированные сахаридные фрагменты, фрагменты нуклеотидных оснований (природные, модифицированные или их комбинация) обеспечивают гибридизацию с соответствующей нуклеиновой кислотой-мишенью.

В некоторых вариантах реализации изобретения антисмысловые соединения содержат один или более нуклеозидов, содержащих модифицированные сахаридные фрагменты. В некоторых вариантах реализации изобретения модифицированный сахаридный фрагмент представляет собой 2'-MOE. В некоторых вариантах реализации изобретения 2'-MOE модифицированные нуклеозиды располагаются в гэпмерном мотиве. В некоторых вариантах реализации изобретения модифицированный сахаридный фрагмент представляет собой бициклический нуклеозид, содержащий (4'-СН(CH3)-O-2') мостиковую группу. В некоторых вариантах реализации изобретения (4'-СН(CH3)-O-2') модифицированные нуклеозиды располагаются по всей длине крыльев гэпмерного мотива.

Композиции и способы разработки составов фармацевтических композиций

Антисмысловые олигонуклеотиды могут быть смешаны с фармацевтически приемлемыми действующими или инертными субстанциями для получения фармацевтических композиций или составов. Композиции и способы разработки составов фармацевтических композиций зависят от множества критериев, включающих, но не ограничивающихся ими, способ введения, тяжесть заболевания или дозу, подлежащую введению.

Антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, может использоваться в фармацевтических композициях путем комбинирования антисмыслового соединения с подходящим фармацевтически приемлемым растворителем или носителем. Фармацевтически приемлемый растворитель включает фосфатно-солевой буферный раствор (PBS). PBS представляет собой растворитель, пригодный для применения в композициях, которые требуют парентеральной доставки. Соответственно, в одном варианте реализации изобретения предложена фармацевтическая композиция, применяемая в способах, описанных в данном документе, содержащая антисмысловое соединение, таргетирующее нуклеиновую кислоту атаксина 2, и фармацевтически приемлемый растворитель. В некоторых вариантах реализации изобретения фармацевтически приемлемый растворитель представляет собой PBS. В некоторых вариантах реализации изобретения антисмысловое соединение представляет собой антисмысловой олигонуклеотид.

Фармацевтические композиции, содержащие антисмысловые соединения, охватывают любые фармацевтически приемлемые соли, сложные эфиры или соли таких сложных эфиров, или любой другой олигонуклеотид, который при введении животному, включая человека, способен обеспечить образование (прямо или косвенно) биологически активного метаболита или его остатка. Соответственно, данное описание относится также, например, к фармацевтически приемлемым солям антисмысловых соединений, пролекарствам, фармацевтически приемлемым солям таких пролекарств и к другим биоэквивалентным соединениям. Подходящие фармацевтически приемлемые соли включают, но не ограничиваются ими, соли натрия и калия.

Пролекарство может включать введение дополнительных нуклеозидов в один или оба конца антисмыслового соединения, которые в организме расщепляются эндогенными нуклеазами с образованием активного антисмыслового соединения.

Конъюгированные антисмысловые соединения

Антисмысловые соединения могут быть ковалентно связаны с одним или более фрагментами или конъюгатами, которые усиливают активность, распределение в клетках или поглощение клетками полученных антисмысловых олигонуклеотидов. Типичные конъюгирующие группы включают холестериновые фрагменты и липидные фрагменты. Дополнительные конъюгирующие группы включают углеводы, фосфолипиды, биотин, феназин, фолат, фенантридин, антрахинон, акридин, флуоресцеины, родамины, кумарины и красители.

Антисмысловые соединения также могут быть модифицированы таким образом, чтобы содержать одну и более стабилизирующих групп, которые обычно присоединены к одному или обоим концам антисмысловых соединений для усиления свойств, таких как, например, устойчивость к нуклеазам. В стабилизирующие группы входят кэп-структуры. Эти концевые модификации защищают антисмысловое соединение, содержащее концевую нуклеиновую кислоту, от экзонуклеазной деградации и могут облегчать доставку и/или локализацию в клетке. Кэп может быть расположен на 5'-конце (5'-кэп) или на 3'-конце (3'-кэп), или может быть расположен на обоих концах. Кэп-структуры хорошо известны в данной области техники и включают, например, инвертированные дезоксикэпы без оснований. Дополнительно 3'- и 5'-стабилизирующие группы, которые могут быть использованы для кэпирования одного или обоих концов антисмыслового соединения для придания устойчивости к нуклеазам, включают описанные в заявке WO 03/004602, опубликованной 16 января 2003 г.

Культура клеток и обработка антисмысловыми соединениями

Влияние антисмысловых соединений на уровень, активность или экспрессию нуклеиновых кислот атаксина 2 может исследоваться на различных типах клеток in vitro. Типы клеток, применяемых для таких анализов, доступны от коммерческих поставщиков (например, Американская коллекция типовых культур, г. Манассас, штат Вирджиния; Zen-Bio Inc., Research Triangle Park, NC; Clonetics Corporation, г. Уолкерсвилл, штат Мэриленд) и культивируются в соответствии с инструкциями поставщиков с использованием коммерчески доступных реактивов (например, Invitrogen Life Technologies, г. Карлсбад, штат Калифорния). Иллюстративные типы клеток включают, но не ограничиваются ими, клетки HepG2, клетки Hep3B и первичные гепатоциты.

Испытание антисмысловых олигонуклеотидов in vitro.

В данном документе описаны способы обработки клеток антисмысловыми олигонуклеотидами, которые могут быть соответствующим образом модифицированы для обработки другими антисмысловыми соединениями.

Клетки могут быть обработаны антисмысловыми олигонуклеотидами, когда в культуре клетки достигнут приблизительно 60-80% заселенности.

Один реактив, обычно используемый для введения антисмысловых олигонуклеотидов в культивируемые клетки, включает катионный липидный реактив для трансфекции LIPOFECTIN (Invitrogen, г. Карлсбад, штат Калифорния). Антисмысловые олигонуклеотиды могут быть смешаны с LIPOFECTIN в среде OPTI-MEM 1 (Invitrogen, г. Карлсбад, штат Калифорния) для достижения требуемой конечной концентрации антисмыслового олигонуклеотида и концентрации LIPOFECTIN, которая может находиться в диапазоне от 2 до 12 мкг/мл на 100 нМ антисмыслового олигонуклеотида.

Другой реактив, используемый для внедрения антисмысловых олигонуклеотидов в культивируемые клетки, включает LIPOFECTAMINE (Invitrogen, г. Карлсбад, штат Калифорния). Антисмысловой олигонуклеотид смешивают с LIPOFECTAMINE в среде с пониженным содержанием сыворотки OPTI-MEM 1 (Invitrogen, г. Карлсбад, штат Калифорния) до достижения требуемой концентрации антисмыслового олигонуклеотида и концентрации LIPOFECTAMINE, которая может находиться в диапазоне от 2 до 12 мкг/мл на 100 нМ антисмыслового олигонуклеотида.

Другая методика, используемая для внедрения антисмысловых олигонуклеотидов в культивируемые клетки, включает электропорацию.

Клетки обрабатывают антисмысловыми олигонуклеотидами традиционными способами. Клетки могут собирать через 16-24 часов после обработки антисмысловыми олигонуклеотидами, в этом момент измеряют уровни РНК или белка нуклеиновых кислот-мишеней методами, известными в данной области техники и описанными в данном документе. Как правило, когда обработки проводят в нескольких повторениях, то данные представляют как среднее значение результатов повторных обработок.

Концентрация используемого антисмыслового олигонуклеотида изменяется в зависимости от линии клеток. Способы определения оптимальной концентрации антисмыслового олигонуклеотида для конкретной линии клеток хорошо известны в данной области техники. Антисмысловые олигонуклеотиды при трансфекции с помощью LIPOFECTAMINE обычно используют в концентрациях в диапазоне от 1 нМ до 300 нМ. Антисмысловые олигонуклеотиды при трансфецировании с использованием электропорации используются в более высоких концентрациях в диапазоне от 625 до 20000 нМ.

Выделение РНК

Анализ РНК может выполняться по общей клеточной РНК или поли(А)+ мРНК. Способы выделения РНК хорошо известны в данной области техники. РНК получают, используя способы, хорошо известные в данной области техники, например, с использованием реактива TRIZOL (Invitrogen, г. Карлсбад, штат Калифорния) в соответствии с рекомендованными производителем протоколами.

Анализ ингибирования уровней или экспрессии мишеней

Ингибирование уровней или экспрессии нуклеиновой кислоты атаксина 2 может быть проанализировано разнообразными способами, известными в данной области техники. Например, уровни нуклеиновой кислоты-мишени могут количественно измеряться, например, с применением анализам нозерн-блота, конкурентной полимеразной цепной реакции (ПЦР) или количественной ПЦР в режиме реального времени. Анализ РНК может выполняться по общей клеточной РНК или поли(А)+ мРНК. Способы выделения РНК хорошо известны в данной области техники. Анализ нозерн-блота также является общепринятым в данной области техники. Количественная ПЦР в режиме реального времени может беспрепятственно выполняться с использованием коммерчески доступной системы для детекции последовательностей ABI PRISM 7600, 7700 или 7900, поставляемой компанией PE-Applied Biosystems, г. Фостер-Сити, штат Калифорния, и используемой согласно инструкций производителя.

Анализ уровней РНК-мишеней методом количественной ПЦР в режиме реального времени

Количественное определение уровней РНК-мишеней может выполняться методом количественной ПЦР в режиме реального времени, используя систему для детекции последовательностей ABI PRISM 7600, 7700 или 7900 (PE-Applied Biosystems, г. Фостер-Сити, штат Калифорния) согласно инструкций производителя. Методы количественного определения ПЦР в режиме реального времени хорошо известны в данной области техники.

Перед проведением ПЦР в режиме реального времени, выделенную РНК подвергают реакции с обратной транскриптазой (ОТ), синтезирующей комплементарную ДНК (кДНК), которая затем используется в качестве субстрата для ПЦР-амплификации в режиме реального времени. Реакции ОТ и ПЦР в режиме реального времени выполняют последовательно в одной и той же лунке с образцом. Реактивы для реакций ОТ и ПЦР в режиме реального времени могут получать в компании Invitrogen (г. Карлсбад, штат Калифорния). Реакции ОТ - ПЦР в режиме реального времени проводят методами, хорошо известными специалистам в данной области техники.

Количество гена (или РНК)-мишени, полученное методом ПЦР в режиме реального времени, нормализируют с использованием или уровня экспрессии гена, экспрессия которого является постоянной, такого как ген циклофилина A, или методом количественного определения общей РНК с использованием реактива RIBOGREEN (Invitrogen, Inc. г. Карлсбад, штат Калифорния). Экспрессию циклофилина A количественно определяют ПЦР в режиме реального времени, проводя ее одновременно с анализом мишени, мультиплексированием или анализом по отдельности. Общую РНК количественно определяют с использованием реактива для количественного определения РНК RIBOGREEN (Invetrogen Inc. г. Юджин, штат Орегон). Методы количественного определения РНК с помощью RIBOGREEN изложены в Jones L.J., et al., (Analytical Biochemistry, 1998, 265, 368-374). Для измерения флуоресценции RIBOGREEN используют прибор CYTOFLUOR 4000 (PE Applied Biosystems).

Зонды и праймеры сконструированы для гибридизации с нуклеиновой кислотой атаксина 2. Способы конструирования зондов и праймеров для ПЦР в режиме реального времени хорошо известны в данной области техники и могут включать применение программного обеспечения, такого как программное обеспечение PRIMER EXPRESS (Applied Biosystems, г. Фостер-Сити, штат Калифорния).

Анализ уровней белка

Антисмысловое ингибирование нуклеиновых кислот атаксина 2 может оцениваться методом измерения уровней белка атаксина 2. Уровни белка атаксина 2 могут оцениваться или количественно определяться различными способами, хорошо известными в данной области техники, такими как иммунопреципитация, анализ вестерн-блота (иммуноблоттинг), иммуноферментный анализ (ИФА), количественные анализы белков, анализы активности белков (например, анализы активности каспазы), иммуногистохимические анализы, иммуноцитохимические анализы или сортировка флуоресцентно-активированных клеток (FACS). Нацеленные на мишень антитела могут быть идентифицированы и получены из различных источников, таких как каталог антител MSRS (Aerie Corporation, г. Бирмингем, штат Мичиган) или могут быть получены посредством общепринятых методов создания моноклональных или поликлональных антител, хорошо известных в данной области техники.

Испытание антисмысловых соединений in vivo

Антисмысловые соединения, например антисмысловые олигонуклеотиды, испытывают на животных для оценки их способности ингибировать экспрессию атаксина 2 и вызывать фенотипические изменения, такие как улучшение двигательной функции и когнитивных функций. В некоторых вариантах реализации изобретения двигательную функцию измеряют посредством анализа начала движения, теста с вращающимся стержнем, по силе захвата, теста с лазанием по шесту, активности в тесте «открытое поле», в тесте с балансиром, посредством испытания по отпечатку задней ноги животного.

Испытание может выполняться на здоровых животных или в экспериментальных моделях заболеваний. Для введения животным антисмысловые олигонуклеотиды готовят в виде составов с фармацевтически приемлемым растворителем, таким как фосфатно-солевой буферный раствор. Введение включает парентеральные пути введения, такие как внутрибрюшинный, внутривенный и подкожный. Расчет дозировки антисмысловых олигонуклеотидов и частоты дозирования входит в компетенцию специалистов в данной области техники и зависит от таких факторов, как путь введения и масса тела животного. После периода лечения антисмысловыми олигонуклеотидами из ткани ЦНС или СМЖ выделяют РНК и измеряют изменения экспрессии нуклеиновой кислоты атаксина 2.

Некоторые показания

В некоторых вариантах реализации изобретения в данном документе предложены способы, соединения и композиции лечения индивида, включающие введение одной или более фармацевтических композиций, описанных в данном документе. В некоторых вариантах реализации изобретения индивид имеет нейродегенеративное заболевание. В некоторых вариантах реализации изобретения у индивида существует риск развития нейродегенеративного заболевания, включая, но не ограничиваясь ими, спинально-церебеллярную атаксию 2 типа (SCA2), боковой амиотрофический склероз (БАС) или болезнь Паркинсона. В некоторых вариантах реализации изобретения индивид идентифицирован как имеющий связанное с атаксином 2 заболевание. В некоторых вариантах реализации изобретения в данном документе предложены способы профилактического снижения у индивида экспрессии атаксина 2. Некоторые варианты реализации изобретения включают лечение индивида, нуждающегося в этом, путем введения индивиду терапевтически эффективного количества антисмыслового соединения, таргетирующего нуклеиновую кислоту атаксина 2.

В одном варианте реализации изобретения введение терапевтически эффективного количества антисмыслового соединения, таргетирующего нуклеиновую кислоту атаксина 2, сопровождается мониторингом у индивида уровней атаксина 2 для определения ответа индивида на введение антисмыслового соединения. Ответ индивида на введение антисмыслового соединения может использоваться врачом для определения количества и длительности терапевтического воздействия.

В некоторых вариантах реализации изобретения введение антисмыслового соединения, таргетирующего нуклеиновую кислоту атаксина 2, приводит к снижению экспрессии атаксина 2 на по меньшей мере 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100%, или в диапазоне, определенном любыми двумя из этих значений. В некоторых вариантах реализации изобретения введение антисмыслового соединения, таргетирующего нуклеиновую кислоту атаксина 2, приводит к улучшению двигательной функции животного. В некоторых вариантах реализации изобретения введение антисмыслового соединения атаксина 2 улучшает двигательную функцию на по меньшей мере 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100%, или в диапазоне, определенном любыми двумя из этих значений.

В некоторых вариантах реализации изобретения фармацевтические композиции, содержащие антисмысловое соединение, таргетирующее атаксин 2, используют для получения лекарственного средства для лечения пациента, страдающего или восприимчивого к нейродегенеративному заболеванию, включая спинально-церебеллярную атаксию 2 типа (SCA2), боковой амиотрофический склероз (БАС) или болезнь Паркинсона.

ПРИМЕРЫ

Примеры, не ограничивающие описание, и данные, включенные посредством ссылки

Несмотря на то, что некоторые соединения, композиции и способы, описанные в данном документе, были подробно описаны в соответствии с некоторыми вариантами реализации изобретения, следующие примеры служат лишь для иллюстрации соединений, описанных в данном документе, и не подразумевают ограничения указанных объектов. Каждая ссылка, упоминаемая в настоящей заявке, включена в данный документ в полном объеме посредством ссылки.

Пример 1. Антисмысловое ингибирование MOE-гэпмерами атаксина 2 человека в клетках HepG2

Были сконструированы антисмысловые олигонуклеотиды, таргетирующие нуклеиновую кислоту атаксина 2, и было испытано их действие на мРНК атаксина 2 in vitro. Антисмысловые олигонуклеотиды испытывали в серии экспериментов, которые имели сходные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, приведенных ниже. Культивированные до плотности 20000 клеток на лунку клетки HepG2 трансфецировали с использованием электропорации с помощью антисмыслового олигонуклеотида в концентрации 4500 нМ. После периода обработки приблизительно 24 часа из клеток выделяли РНК и измеряли уровни мРНК атаксина 2 методом количественной ПЦР в режиме реального времени. Набор RTS3642 праймеров-зондов человека (прямая последовательность ACCAAAGAGTAGTTAATGGAGGTGTTC, обозначенная в данном документе как SEQ ID NO: 5; обратная последовательность AGAAGGTGGGCGAGAGGAA, обозначенная в данном документе как SEQ ID NO: 6; последовательность зонда CTGGCCATCGCCTTGCCCA, обозначенная в данном документе как SEQ ID NO: 7) применяли для измерения уровней мРНК. Уровни мРНК атаксина 2 корректировали в соответствии с содержанием общей РНК, измеренной методом RIBOGREEN®. Результаты представлены в виде процента ингибирования атаксина 2 относительно необработанных контрольных клеток.

Химерные антисмысловые олигонуклеотиды в таблицах ниже были сконструированы в виде 5-10-5 MOE-гэпмеров. Гэпмеры составляют в длину 20 нуклеозидов, причем центральный гэп-сегмент состоит из десяти 2'-дезоксинуклеозидов и фланкирован сегментами крыльев в 5'-направлении и 3'-направлении, содержащими по пять нуклеозидов каждый. Каждый нуклеозид в сегменте 5'-крыла и каждый нуклеозид в сегменте 3'-крыла содержит модификацию 2'-MOE. Межнуклеозидные связи по всей длине каждого гэпмера представляют собой тиофосфатные связи. Все остатки цитозина по всей длине каждого гэпмера представляют собой 5-метилцитозины. «Сайт инициации» обозначает в последовательности гена человека наиболее удаленный 5'-нуклеозид, на который таргетирован гэпмер. «Сайт терминации» обозначает в последовательности гена человека наиболее удаленный 3'-нуклеозид, на который таргетирован гэпмер. Каждый гэпмер, перечисленный в таблицах ниже, таргетирован или на мРНК атаксина 2 человека, обозначенную в данном документе как SEQ ID NO: 1 (№ доступа в базе данных GENBANK NM_002973.3), или геномную последовательность атаксина 2 человека, обозначенную в данном документе как SEQ ID NO: 2 (комплементарная последовательность №доступа в базе данных GENBANK NT_009775.17, усеченная от нуклеотидов 2465000 до 2616000). Некоторые олигонуклеотиды не таргетируют ни SEQ ID NO: 1, ни SEQ ID NO: 2, но вместо этого таргетируют вариантную последовательность гена, SEQ ID NO: 3 (№ доступа в базе данных GENBANK ВХ410018.2). «Н/д» означает, что антисмысловой олигонуклеотид не таргетирует конкретную последовательность гена со 100% комплементарностью.

Пример 2. Дозозависимое антисмысловое ингибирование MOE-гэпмерами атаксина 2 человека в клетках HepG2

Гэпмеры из примера 1, проявившие значительное ингибирование мРНК атаксина 2 in vitro, были отобраны и испытаны в различных дозах на клетках HepG2. Клетки высевали с плотностью 20000 клеток на лунку и трансфецировали концентрациями антисмыслового олигонуклеотида 0,625 мкМ, 1,250 мкМ, 2,500 мкМ, 5,000 мкМ и 10,000 мкМ с использованием электропорации, как указано в таблице ниже. После периода обработки приблизительно 16 часов из клеток выделяли РНК и измеряли уровни мРНК атаксина 2 методом количественной ПЦР в режиме реального времени. Для измерения уровней мРНК использовали набор RTS3642 праймеров-зондов человека. Уровни мРНК атаксина 2 корректировали в соответствии с содержанием общей РНК, измеренной методом RIBOGREEN®. Результаты представлены в виде процента ингибирования атаксина 2 относительно необработанных контрольных клеток.

Для каждого олигонуклеотида также приведена полумаксимальная ингибирующая концентрация (IC50). В обработанных антисмысловым олигонуклеотидом клетках дозозависимым образом были значительно снижены уровни мРНК атаксина 2.

Пример 3. Антисмысловое ингибирование атаксина 2 человека в мышиной модели SCA2 BAC

Гэпмеры из примера 1, проявившие значительное ингибирование мРНК атаксина 2 in vitro, были отобраны и испытаны в мышиной модели SCA2[Q22]-BAC in vivo. Эту мышиную модель создали в лаборатории Pulst (Университет штата Юта, г. Солт-Лейк-Сити) с использованием мышей с гибридным происхождением FVB/B6 для исследования спинально-церебеллярной атаксии 2 типа (SCA2). Эти мыши обладали целым участком размером 176 т.н. гена ATXN2 человека, включая расположенную вверх по ходу транскрипции последовательность размером 16 т.н. и расположенную вниз по ходу транскрипции последовательность размером 2,5 т.н.

Лечение

Группам из 3 мышей каждая посредством интрацеребровентрикулярных инъекций вводили нормальный солевой раствор (0,9%) или антисмысловой нуклеотид. Мышам возрастом от пяти до семи недель для достижения седативного состояния по отдельности вводили смесь из кислорода и 3% изофлурана в течение 3-4 минут. Затем с помощью устройства для стрижки удаляли волосы на голове. Мышь помещали в стереотаксический инструмент (компании Stoelting для мышей). Кожу головы очищали, сначала средством для очистки с йодом, а потом 70% этанолом. Делали надрез скальпельным лезвием №10 от участка точно сзади места между глазами до участка 1,5 см за ним. Надкостницу удаляли стерильным хлопковым тампоном. В держатель шприца стереотаксического инструмента помещали шприц Гамильтона с иглой 26 калибра и наполняли его до метки 10 мкл или нормальным солевым раствором (0,9%), или антисмысловым олигонуклеотидом (250 мкг) в солевом растворе (0,9%). Иглу помещали на брегме черепа, а затем перемещали на 1 мм вправо и 0,46 мм в направлении тыльной области. Острие иглы затем вводили прямо через череп и затем помещали на 2,5 мм ниже в правый боковой желудочек мозга. Потом нажимали на поршень шприца для доставки требуемого объема 5-7 мкл. После ожидания в течение 4 минут, чтобы дать возможность выровняться вентрикулярному давлению, иглу извлекали и кожу головы зашивали. Затем надрез обрабатывали раствором повидона и мышь возвращали в свою клетку в положении на спине для восстановления. Ежедневно мониторили состояние мышей.

Анализ РНК

Через 7 суток мышей помещали в атмосферу изофурана до тех пор, пока они не переставали дышать. Затем извлекали головной мозг. Из корональных срезов отбирали три части головного мозга, включая срез размером 3 мм для анализа РНК. РНК выделяли из 30 мг ткани с использованием набора RNeasy (Qiagen). Получали кДНК с использованием набора для обратной транскрипции QuantiTect (Qiagen). В четырех повторах проводили ПЦР в режиме реального времени (кПЦР) методом SYBR Green с построением стандартных кривых на приборе iCycler (Bio-Rad) в 96-луночных планшетах. Реакции проводили в объеме 20 мкл, содержащем 15 нг кДНК, по 2 мкл каждого праймера (конечная концентрация 0,3 мкМ) и 10 мкл мастер-смеси SYBR Green (Bio-Rad). Параметры проведения циклов включали этап денатурации при 95°C в течение 10 секунд, инкубацию при температуре отжига в течение 20 секунд и вторую инкубацию в течение 40 секунд при 72°C. Каждый планшет включал построение стандартной кривой с использованием церебеллярной РНК, полученной из множества трансгенных мышей pGL2-5A3. Единичные ампликоны верифицировали методом анализа денатурации и гель-электрофореза.

Результаты анализа РНК атаксина 2 мыши и человека представлены в таблице ниже. Как было показано, некоторые олигонуклеотиды ISIS снижали мРНК атаксина 2 человека в головном мозге мышей.

Пример 4. Антисмысловое ингибирование атаксина 2 человека в мышиной модели ATXN2-Q127

Гэпмеры из примера 1, проявившие значительное ингибирование мРНК атаксина 2 in vitro, были отобраны и испытаны в мышиной модели ATXN2-Q127 in vivo. В этой мышиной модели (Hansen, S.T. et al., Human. Molecular Genetics 2012. 1-13) экспрессируется полноразмерная мутантная ДНК, комплементарная ATXN2Q127, под управлением промотора белка-2 (Рср2) клеток Пуркинье. В этой модели показан фенотип с ранним проявлением прогрессирующей двигательной недостаточности, сопровождающейся образованием диффузных цитоплазматических агрегатов в церебеллярных клетках Пуркинье.

Лечение

Группам из 3 мышей каждая посредством интрацеребровентрикулярных инъекций вводили нормальный солевой раствор (0,9%) или антисмысловой нуклеотид. Мышам возрастом от пяти до семи недель для достижения седативного состояния по отдельности вводили смесь из кислорода и 3% изофлурана в течение 3-4 минут. Затем с помощью устройства для стрижки удаляли волосы на голове. Мышь помещали в стереотаксический инструмент (компании Stoelting для мышей). Кожу головы очищали, сначала средством для очистки с йодом, а потом 70% этанолом. Делали надрез скальпельным лезвием №10 от участка точно сзади места между глазами до участка 1,5 см за ним. Надкостницу удаляли стерильным хлопковым тампоном. В держатель шприца стереотаксического инструмента помещали шприц Гамильтона с иглой 26 калибра и наполняли его до метки 10 мкл или нормальным солевым раствором (0,9%), или антисмысловым олигонуклеотидом (250 мкг) в солевом растворе (0,9%). Иглу помещали на брегме черепа, а затем перемещали на 1 мм вправо и 0,46 мм в направлении тыльной области. Острие иглы затем вводили прямо через череп и затем помещали на 2,5 мм ниже в правый боковой желудочек мозга. Потом нажимали на поршень шприца для доставки требуемого объема 5-7 мкл. После ожидания в течение 4 минут, чтобы дать возможность выровняться вентрикулярному давлению, иглу извлекали и кожу головы зашивали. Затем надрез обрабатывали раствором повидона и мышь возвращали в свою клетку в положении на спине для восстановления. Ежедневно мониторили состояние мышей.

Анализ РНК

Через 7 суток мышей помещали в атмосферу изофурана до тех пор, пока они не переставали дышать. Затем извлекали головной мозг. Из корональных срезов отбирали три части головного мозга, включая срез размером 3 мм для анализа РНК. РНК выделяли из 30 мг ткани с использованием набора RNeasy (Qiagen). Получали кДНК с использованием набора для обратной транскрипции QuantiTect (Qiagen). В четырех повторах проводили ПЦР в режиме реального времени (кПЦР) методом SYBR Green с построением стандартных кривых на приборе iCycler (Bio-Rad) в 96-луночных планшетах. Реакции проводили в объеме 20 мкл, содержащем 15 нг кДНК, по 2 мкл каждого праймера (конечная концентрация 0,3 мкМ) и 10 мкл мастер-смеси SYBR Green (Bio-Rad). Параметры проведения циклов включали этап денатурации при 95°C в течение 10 секунд, инкубацию при температуре отжига в течение 20 секунд и вторую инкубацию в течение 40 секунд при 72°C. Каждый планшет включал построение стандартной кривой с использованием церебеллярной РНК, полученной из множества трансгенных мышей pGL2-5A3. Единичные ампликоны верифицировали методом анализа денатурации и гель-электрофореза. Все уровни мРНК нормализовали к конститутивному гену актина.

Результаты анализа РНК атаксина 2 мыши и человека представлены в таблице ниже. Как было показано, некоторые олигонуклеотиды ISIS снижали мРНК атаксина 2 человека в головном мозге мышей.

Для измерения степени воспаления выполняли также анализ кПЦР маркера микроглиоза, AIF/Iba1. Результаты представлены в таблице ниже.

Пример 4. Дозозависимое антисмысловое ингибирование атаксина 2 человека в мышиной модели ATXN2-Q127

В мышиной модели ATXN2-Q127 испытывали разные дозы ISIS 564133.

Лечение

Группам из 3 мышей каждая посредством интрацеребровентрикулярных инъекций дозированно вводили нормальный солевой раствор (0,9%) или ISIS 564133 в дозах 50 мкг, 100 мкг, 200 мкг, 250 мкг или 300 мкг. Мышам проводили введение тем же способом, как описано в исследованиях выше, и осуществляли ежедневный мониторинг.

Анализ РНК

Через 7 суток мышей помещали в атмосферу изофурана до тех пор, пока они не переставали дышать. Затем извлекали головной мозг. Как описано выше, из корональных срезов отбирали три части головного мозга, включая срез размером 3 мм для анализа РНК. Все уровни мРНК нормализовали к конститутивному гену актина.

Результаты анализа РНК атаксина 2 мыши и человека представлены в таблице ниже.

Пример 5. Времязависимое антисмысловое ингибирование атаксина 2 человека в мышиной модели ATXN2-Q127

В мышиной модели ATXN2-Q127 вводили ISIS 564133 и в разные временные точки исследовали снижение уровня мРНК.

Лечение

Группам из 3 мышей каждая посредством интрацеребровентрикулярных инъекций вводили нормальный солевой раствор (0,9%) или ISIS 564133 в дозе 200 мкг. Мышам проводили введение тем же способом, как описано в исследованиях выше, и осуществляли ежедневный мониторинг.

Анализ РНК

Через 9 суток, 18 суток, 27 суток и 84 суток мышей помещали в атмосферу изофурана до тех пор, пока они не переставали дышать. Затем извлекали головной мозг. Как описано выше, из корональных срезов отбирали три части головного мозга, включая срез размером 3 мм для анализа РНК. Все уровни мРНК нормализовали к конститутивному гену актина.

Результаты анализа РНК атаксина 2 человека представлены в таблице ниже. Выполняли анализ вестерн-блота соответствующих белков и подтверждали результаты методом кПЦР.

На 7-е сутки выполняли иммуногистохимическое окрашивание церебеллярных клеток Пуркинье с использованием анти-олигонуклеотидного антитела кролика, полученного от компании-заявителя. Результаты продемонстрировали, что олигонуклеотид ISIS локализовался в церебеллярных клетках Пуркинье мышей ATXN-Q127.

Пример 6. Влияние антисмыслового ингибирования атаксина 2 человека в мышиной модели ATXN2-Q127

ISIS олигонуклеотид вводили мышам модели ATXN2-Q127 и мышам дикого типа. На 3-й сутки оценивали показатели двигательной функции с использованием теста с вращающимся стержнем.

Группам мышей ATXN2-Q127 таким же образом, как описано в исследованиях выше, посредством интрацеребровентрикулярных инъекций вводили нормальный солевой раствор (0,9%) или ISIS 564133 в дозах 50 мкг, 100 мкг или 200 мкг. Группам мышей дикого типа таким же образом, как описано в исследованиях выше, посредством интрацеребровентрикулярных инъекций дозированно вводили нормальный солевой раствор (0,9%) или олигонуклеотид ISIS в дозе 200 мкг. Группам мышей ATXN2-Q127 таким же образом, как описано в исследованиях выше, посредством интрацеребровентрикулярных инъекций дозированно вводили нормальный солевой раствор (0,9%), или ISIS 546127, или ISIS 564216 в дозе 200 мкг. Через 6 недель мыши проходили тест с вращающимся стержнем.

Исследование с использованием вращающегося стержня

Исследование с использованием ускоряющегося вращающегося стержня выполняли на вращающемся стержне Rotamex. Тестирование с вращающимся стержнем проводили в течение пяти суток. В первые сутки мышей приручали, чтобы они привыкли к техническому персоналу. На вторые сутки мышей помещали на вращающийся стержень по 4-минутной схеме, включающей 2 минуты при постоянной скорости 10 об./мин., затем в течение 2 минут скорость изменялась в диапазоне от 10 до 30 об./мин. Тестирование на 3-5 сутки было идентичным, когда мышей помещали на вращающийся стержень на скорости 0 об./мин., затем вращающийся стержень ускоряли до 40 об./мин. в течение 6 минут. Тестирование проводили дважды в сутки и записывали среднее значение «задержки до падения» в сутки, в секундах. Задержка до падения определялась как количество времени, прошедшее до падения животного с вращающегося стержня. Время записывалось автоматически, когда мышь больше не пересекала инфракрасные лучи, направленные выше вращающегося стержня. Автоматически также записывалось время для первого пассивного вращения (когда мышь останавливалась, удерживалась и вращалась со стержнем), и оно обычно отображало задержку по отношению к времени падения. Исследование состояло из трех последовательных испытаний по 5 минут каждое с 20-минутным периодом отдыха между испытаниями. На 3-5 сутки мышам давали возможность отдохнуть в течение 1,5-2 часов между двумя повторами, проведенными в каждый из этих дней.

Результаты теста с вращающимся стержнем представлены в таблице ниже. Как показано в таблице ниже, лечение с помощью ASO улучшает показатели теста с вращающимся стержнем на около 20%.

Пример 7. Влияние антисмыслового ингибирования атаксина 2 человека в мышиной модели ATXN2-Q127

ISIS олигонуклеотид вводили мышам модели ATXN2-Q127 и мышам дикого типа. Оценивали церебеллярную экспрессию атаксина 2, а также некоторых генов клеток Пуркинье (PC).

Группам мышей ATXN2-Q127 таким же образом, как описано в исследованиях выше, посредством интрацеребровентрикулярных инъекций дозированно вводили нормальный солевой раствор (0,9%) или ISIS 564133 в дозе 200 мкг. Группам мышей дикого типа таким же образом, как описано в исследованиях выше, посредством интрацеребровентрикулярных инъекций дозированно вводили нормальный солевой раствор (0,9%) или ISIS 564133 в дозе 200 мкг. Через 5 недель мышей подвергали эвтаназии и оценивали церебеллярную экспрессию уровней мРНК различных генов.

Анализ РНК

Группы мышей помещали в атмосферу изофурана до тех пор, пока они не переставали дышать. Затем извлекали головной мозг. Как описано выше, из корональных срезов отбирали три части головного мозга, включая срез размером 3 мм для анализа РНК. Все уровни мРНК нормализовали к конститутивному гену актина. Измеряли уровни РНК атаксина 2 человека, атаксина 2 мыши, Pcp2, Calb1, Rgs8 и Fam107b. Продемонстрировано, что изменения транскрипции некоторых из этих PC-специфических генов постепенно снижаются в моделях SCA2 (Hansen, S.T. et al., Hum. Mol. Genet. 2013. 22: 271-283).

Результаты анализа РНК представлены в таблице ниже и демонстрируют, что лечение олигонуклеотидами ISIS, таргетирующими атаксин 2, увеличило уровни экспрессии всех РС-специфических генов по сравнению с трансгенной контрольной группой.

Пример 8. Влияние антисмыслового ингибирования атаксина 2 человека в мышиной модели ATXN2-Q127

ISIS олигонуклеотид вводили мышам модели ATXN2-Q127 и мышам дикого типа. Оценивали показатели двигательной функции с использованием теста с вращающимся стержнем.

Группам мышей ATXN2-Q127 (возрастом 7,5 недель) таким же образом, как описано в исследованиях выше, посредством интрацеребровентрикулярных инъекций дозированно вводили нормальный солевой раствор (0,9%), или ISIS 546127, или ISIS 564216 в дозе 200 мкг. Через 5 недель и 9 недель мыши проходили тест с вращающимся стержнем.

Исследование с использованием вращающегося стержня

Исследование с использованием ускоряющегося вращающегося стержня выполняли на вращающемся стержне Rotamex. Тестирование с вращающимся стержнем проводили в течение пяти суток. В первые сутки мыши привыкали к техническому персоналу, который их с этой целью приручал. На вторые сутки мышей помещали на вращающийся стержень по 4-минутной схеме, включающей 2 минуты при постоянной скорости 10 об./мин., затем в течение 2 минут скорость изменялась в диапазоне от 10 до 30 об./мин. Тестирование на 3-5 сутки было идентичным, когда мышей помещали на вращающийся стержень на скорости 0 об./мин., затем вращающийся стержень ускоряли до 40 об./мин. в течение 6 минут. Тестирование проводили дважды в сутки и записывали среднее значение «задержки до падения» в сутки, в секундах. Задержка до падения определялась как количество времени, прошедшее до падения животного с вращающегося стержня. Время записывалось автоматически, когда мышь больше не пересекала инфракрасные лучи, направленные выше вращающегося стержня. Автоматически также записывалось время для первого пассивного вращения (когда мышь останавливалась, удерживалась и вращалась со стержнем), и оно обычно отображало задержку по отношению к времени падения. Исследование состояло из трех последовательных испытаний по 5 минут каждое с 20-минутным периодом отдыха между испытаниями. На 3-5 сутки мышам давали возможность отдохнуть в течение 1,5-2 часов между двумя повторами, проведенными в каждый из этих дней.

Результаты теста с вращающимся стержнем представлены в таблице ниже. Как показано в таблице ниже, лечение с помощью ASO улучшает показатели теста с вращающимся стержнем на около 20% на 5-ю неделю и на около 27% на 9-ю неделю.

Пример 9. Влияние антисмыслового ингибирования атаксина 2 человека в мышиной модели ATXN2-Q127

Олигонуклеотид ISIS вводили мышам модели ATXN2-Q127. Оценивали показатели двигательной функции с использованием теста с вращающимся стержнем.

Мыши ATXN2-Q127 возрастом семь недель проходили тест с вращающимся стержнем, затем их делили на две группы по 30 мышей каждая, так чтобы средние показатели для теста с вращающимся стержнем, средние массы тела и состав полов был одинаковым в обеих группах. Таким же образом, как описано в исследованиях выше, одна группа мышей в возрасте 8 недель посредством интрацеребровентрикулярной (ICV) инъекции получала солевой раствор, а другая группа посредством ICV-инъекции получала ISIS 564216 в дозе 210 мкг. Пятью неделями позже (в возрасте 13 недель) мыши снова проходили тест с вращающимся стержнем. Через шесть недель после инъекции (в возрасте 14 недель) мыши получали вторую ICV-инъекцию, идентичную инъекции, полученной в возрасте 8 недель. Пятью неделями позже (в возрасте 19 недель, 11 недель после первой ICV-инъекции) мыши проходили третий тест с вращающимся стержнем.

Тест с вращающимся стержнем

Тест с использованием ускоряющегося вращающегося стержня выполняли на вращающемся стержне Rotamex. Тестирование с вращающимся стержнем проводили в течение пяти суток. В первые сутки мыши привыкали к техническому персоналу, который для этого приручал их, занимаясь с ними три раза по 5 минут. На вторые сутки мышей помещали три раза на вращающийся стержень, каждый раз по 10 минут на скорости в диапазоне от 0 до 10 об./мин. На 3-5 сутки каждый день мышей помещали на вращающийся стержень на скорости 0 об./мин., затем вращающийся стержень ускоряли до 40 об./мин. в течение 6 минут, и это испытание проводили с каждой мышью три раза. Проводили три полных испытания в сутки и рассчитывали среднее значение «задержки до падения» в сутки, в секундах. Задержка до падения определялась как количество времени, прошедшее до падения животного с вращающегося стержня. Время записывалось автоматически, когда мышь больше не пересекала инфракрасные лучи, направленные над вращающимся стержнем. Автоматически также записывалось время для первого пассивного вращения (когда мышь останавливалась, удерживалась и вращалась со стержнем), и оно обычно отображало задержку по отношению к времени падения.

Результаты теста с вращающимся стержнем представлены в таблице ниже в виде среднего для каждой группы лечения. Как показано в таблице ниже, лечение с помощью ASO улучшило показатели теста с вращающимся стержнем.

1. Соединение, содержащее модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий последовательность нуклеотидных оснований, содержащую часть из по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19 или по меньшей мере 20 последовательных нуклеотидных оснований, комплементарных:

(a) части равной длины нуклеотидных оснований 1053-1109 SEQ ID NO: 1;

(b) части равной длины нуклеотидных оснований 606-656 SEQ ID NO: 1;

(c) части равной длины нуклеотидных оснований 1693-1767 SEQ ID NO: 1;

(d) части равной длины нуклеотидных оснований 1789-1826 SEQ ID NO: 1;

(e) части равной длины нуклеотидных оснований 1844-1877 SEQ ID NO: 1;

(f) части равной длины нуклеотидных оснований 1957-1988 SEQ ID NO: 1;

(g) части равной длины нуклеотидных оснований 2291-2350 SEQ ID NO: 1;

(h) части равной длины нуклеотидных оснований 3082-3141 SEQ ID NO: 1;

(i) части равной длины нуклеотидных оснований 3903-3946 SEQ ID NO: 1;

(j) части равной длины нуклеотидных оснований 4005-4054 SEQ ID NO: 1 или

(k) части равной длины нуклеотидных оснований 4429-4454 SEQ ID NO: 1;

причем модифицированный олигонуклеотид содержит по меньшей мере одну модификацию, выбранную из модифицированного сахарида и модифицированной межнуклеозидной связи, и причем модифицированный олигонуклеотид способен снижать уровни мРНК атаксина 2.

2. Соединение, содержащее модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий последовательность нуклеотидных оснований, содержащую по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19 или по меньшей мере 20 последовательных нуклеотидных оснований по любой из последовательностей нуклеотидных оснований SEQ ID NO: 18, 11-17 или 19-165, причем модифицированный олигонуклеотид содержит по меньшей мере одну модификацию, выбранную из модифицированного сахарида и модифицированной межнуклеозидной связи, и причем модифицированный олигонуклеотид способен снижать уровни мРНК атаксина 2.

3. Соединение по п. 1 или 2, отличающееся тем, что последовательность нуклеотидных оснований модифицированного олигонуклеотида по меньшей мере на 80%, по меньшей мере на 81%, по меньшей мере на 82%, по меньшей мере на 83%, по меньшей мере на 84%, по меньшей мере на 85%, по меньшей мере на 86%, по меньшей мере на 87%, по меньшей мере на 88%, по меньшей мере на 89%, по меньшей мере на 90%, по меньшей мере на 91%, по меньшей мере на 92%, по меньшей мере на 93%, по меньшей мере на 94%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, по меньшей мере на 99% или на 100% комплементарна SEQ ID NO: 1, SEQ ID NO: 2 или SEQ ID NO: 3.

4. Соединение по любому из предшествующих пунктов, содержащее одноцепочечный модифицированный олигонуклеотид.

5. Соединение по любому из предшествующих пунктов, отличающееся тем, что по меньшей мере одна модифицированная межнуклеозидная связь представляет собой тиофосфатную межнуклеозидную связь.

6. Соединение по любому из предшествующих пунктов, отличающееся тем, что каждая модифицированная межнуклеозидная связь представляет собой тиофосфатную межнуклеозидную связь.

7. Соединение по любому из предшествующих пунктов, отличающееся тем, что по меньшей мере одна межнуклеозидная связь представляет собой фосфодиэфирную межнуклеозидную связь.

8. Соединение по любому из предшествующих пунктов, отличающееся тем, что по меньшей мере одна межнуклеозидная связь представляет собой тиофосфатную связь и по меньшей мере одна межнуклеозидная связь представляет собой фосфодиэфирную связь.

9. Соединение по любому из предшествующих пунктов, отличающееся тем, что по меньшей мере один нуклеозид содержит модифицированное нуклеотидное основание.

10. Соединение по п. 9, отличающееся тем, что модифицированное нуклеотидное основание представляет собой 5-метилцитозин.

11. Соединение по любому из предшествующих пунктов, отличающееся тем, что по меньшей мере один модифицированный сахарид представляет собой бициклический сахарид.

12. Соединение по п. 11, отличающееся тем, что бициклический сахарид содержит мостик 4'-CH(R)-O-2', где R независимо представляет собой Н, С14 алкил или защитную группу.

13. Соединение по п. 12, отличающееся тем, что R представляет собой метил.

14. Соединение по п. 12, отличающееся тем, что R представляет собой Н.

15. Соединение по любому из предшествующих пунктов, отличающееся тем, что по меньшей мере один модифицированный сахарид содержит 2'-O-метоксиэтильную группу или 2'-O-СН3 группу.

16. Соединение по любому из предшествующих пунктов, отличающееся тем, что модифицированный олигонуклеотид содержит:

гэп-сегмент, состоящий из 10 связанных дезоксинуклеозидов;

сегмент 5'-крыла, состоящий из 5 связанных нуклеозидов, и

сегмент 3'-крыла, состоящий из 5 связанных нуклеозидов;

причем гэп-сегмент расположен между сегментом 5'-крыла и сегментом 3'-крыла и при этом каждый нуклеозид каждого сегмента крыльев содержит модифицированный сахарид.

17. Соединение по любому из предшествующих пунктов, отличающееся тем, что модифицированный олигонуклеотид состоит из 20 связанных нуклеозидов.

18. Соединение по любому из предшествующих пунктов, где модифицированный олигонуклеотид представляет собой конъюгированное антисмысловое соединение.



 

Похожие патенты:

Настоящее изобретение относится к биотехнологии. Предложены композиции и системы, содержащие векторы, включающие полинуклеотидные последовательности, кодирующие компоненты комплекса CRISPR-Cas типа II, а также набор, содержащий одну из таких композиций или систем.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая соединение для ингибирования экспрессии фактора комплемента В (CFB) (варианты), фармацевтическую композицию для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, способ лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, применение вышеуказанного соединения или композиции для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента, применение вышеуказанного соединения или композиции при изготовлении лекарственного средства для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков и может быть использовано для получения активного фрагмента (1-34) эндогенного человеческого паратиреоидного гормона.

Группа изобретений относится к биотехнологии и медицине, а именно к соединениям и композиции для ингибирования экспрессии рецептора гормона роста (GHR). Соединение содержит модифицированный олигонуклеотид длиной 18-30 связанных нуклеозидов, который имеет последовательность нуклеотидных оснований, содержащую часть из по меньшей мере 18 непрерывных нуклеотидных оснований, на 100% комплементарную относительно равной по длине части нуклеотидных оснований 153921-153940 нуклеиновой кислоты рецептора гормона роста SEQ ID NO: 2.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая аптамерный ДНК олигонуклеотид, специфически связывающийся с EGFR, характеризующийся нуклеотидной последовательностью:ACGCACCATTTGTTTAATATGTTTTTTAATTCCCCTTGTGGTGTGT, и способ получения вышеуказанного аптамерного ДНК олигонуклеотида.

Изобретение относится к генной инженерии. Описано применение патогенного вируса кори (MV) из живого ослабленного штамма вируса кори (MV), в котором нокаутирован ген, кодирующий вирусный акцессорный белок С (MV-deltaC), в лечении агрессивной злокачественной опухоли или агрессивного рака при введении индивидууму, у которого диагностирована такая злокачественная опухоль или раковое заболевание.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая соединение, специфически ингибирующее экспрессию нуклеиновой кислоты аро(а) и/или белка аро(а), композиция для лечения, предупреждения или замедления прогрессирования заболевания, связанного с повышенной экспрессией аро(а) и/или повышенной экспрессией Lp(a), содержащая терапевтически эффективное количество соединения, cпособ предупреждения, лечения, облегчения или замедления прогрессирования заболевания, связанного с повышенной экспрессией аро(а) и/или повышенной экспрессией Lp(a), включающий введение животному вышеуказанного соединения или композиции.

Изобретение относится к области биохимии. Описана группа изобретений, включающая полипептид, подходящий для индукции иммунного ответа против вируса PCV2, рекомбинантную клетку, содержащую молекулу нуклеиновой кислоты, кодирующую вышеуказанный полипептид, нуклеиновую кислоту, вектор, содержащий нуклеиновую кислоту, рекомбинантный вирус оспы свиней, содержащий в своем геноме нуклеиновую кислоту, композицию, вакцину, применение полипептида, клетки и нуклеиновой кислоты для получения лекарственного средства для лечения или профилактики PCV2-ассоциированного заболевания у свиньи.

Изобретение относится к биотехнологии. Изобретение может быть использовано в разработке и оптимизации ПЦР и ОТ-ПЦР систем, применяемых для выявления нуклеиновых кислот, в том числе при диагностике генетических, вирусных и других заболеваний.

Изобретение относится к области биотехнологии, конкретно к векторам на основе серотипа AAV-Rh74 аденоассоциированного вируса (AAV), содержащим полинуклеотидную последовательность, кодирующую фактор IX человека, и может быть использовано в медицине.

Изобретение относится к области биохимии, в частности к двухцепочечной рибонуклеиновой кислоте (dsRNA) для ингибирования экспрессии TMPRSS6, а также к композиции ее содержащей.

Изобретение относится к биотехнологии. Описана система CRISPR-Cas для редактирования генома в эукариотической клетке, содержащая: белок Cas9, содержащий по меньшей мере одну последовательность ядерной локализации, и химерную РНК (chiRNA) системы CRISPR-Cas, содержащую: (a) направляющую последовательность, способную гибридизироваться с целевой последовательностью в эукариотической клетке, (b) парную tracr-последовательность, способную гибридизоваться с tracr-последовательностью, и (c) tracr-последовательность, где (a), (b) и (c) расположены в 5’-3’ ориентации, где одна или несколько из направляющей, tracr- и парной tracr-последовательностей модифицированы для повышения стабильности и где необязательно белок Cas9 образует комплекс с химерной РНК (chiRNA) системы CRISPR-Cas.
Изобретение относится к биотехнологии. Описана вакцина для усиления иммунного ответа у птиц против антигена, экспрессируемого векторной вакциной на основе герпесвируса птиц.

Настоящая группа изобретений относится к медицине, а именно к микробиологии, молекулярной генетике и биотехнологии, и касается создания живой вакцины на основе штамма Enterococcus faecium L3 для профилактики и лечения пневмонии, вызываемой пневмококками Streptococcus pneumoniae.

Изобретение относится к биотехнологии и ветеринарной вирусологии. Описано получение рекомбинантного штамма дрожжей Pichia pastoris Х3351.

Настоящее изобретение относится к биотехнологии. Предложены композиции и системы, содержащие векторы, включающие полинуклеотидные последовательности, кодирующие компоненты комплекса CRISPR-Cas типа II, а также набор, содержащий одну из таких композиций или систем.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая соединение для ингибирования экспрессии фактора комплемента В (CFB) (варианты), фармацевтическую композицию для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, способ лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, применение вышеуказанного соединения или композиции для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента, применение вышеуказанного соединения или композиции при изготовлении лекарственного средства для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента.

Изобретение относится к биотехнологии. Изобретение представляет собой набор олигонуклеотидных праймеров и зонда для выявления вируса герпеса крупного рогатого скота 4-го типа в пробах биоматериала от крупного рогатого скота, где праймеры имеют нуклеотидные последовательности SEQ ID NO: 1-5' acatcacattaaacccattggc 3', SEQ ID NO: 2-5' actccttctgtgtttaacctatcag 3', зонд имеет нуклеотидную последовательность SEQ ID NO: 3-5' caattggaatgtgctgtggt 3'.

Изобретение относится к области биохимии, в частности к способу увеличения устойчивости растения к грибковой инфекции, вызываемой грибами семейства Sclerotiniaceae, включающему повышение в указанном растении экспрессии белка AtRLP30, а также к способу получения трансгенного растения с повышенной устойчивостью к грибковой инфекции, вызываемой грибами семейства Sclerotiniaceae, включающему трансформацию растения или растительной клетки с помощью нуклеотидной последовательности, кодирующей AtRLP30 или AtRLP30-подобный белок.

Группа изобретений относится к биотехнологии и медицине, а именно к соединениям и композиции для ингибирования экспрессии рецептора гормона роста (GHR). Соединение содержит модифицированный олигонуклеотид длиной 18-30 связанных нуклеозидов, который имеет последовательность нуклеотидных оснований, содержащую часть из по меньшей мере 18 непрерывных нуклеотидных оснований, на 100% комплементарную относительно равной по длине части нуклеотидных оснований 153921-153940 нуклеиновой кислоты рецептора гормона роста SEQ ID NO: 2.

Изобретение относится к биотехнологии. Описано соединение, содержащее модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий последовательность нуклеотидных оснований, содержащую часть из по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19 или по меньшей мере 20 последовательных нуклеотидных оснований, комплементарных: части равной длины нуклеотидных оснований 1053-1109 SEQ ID NO: 1; части равной длины нуклеотидных оснований 606-656 SEQ ID NO: 1; части равной длины нуклеотидных оснований 1693-1767 SEQ ID NO: 1; части равной длины нуклеотидных оснований 1789-1826 SEQ ID NO: 1; части равной длины нуклеотидных оснований 1844-1877 SEQ ID NO: 1; части равной длины нуклеотидных оснований 1957-1988 SEQ ID NO: 1; части равной длины нуклеотидных оснований 2291-2350 SEQ ID NO: 1; части равной длины нуклеотидных оснований 3082-3141 SEQ ID NO: 1; части равной длины нуклеотидных оснований 3903-3946 SEQ ID NO: 1; части равной длины нуклеотидных оснований 4005-4054 SEQ ID NO: 1 или части равной длины нуклеотидных оснований 4429-4454 SEQ ID NO: 1;причем модифицированный олигонуклеотид содержит по меньшей мере одну модификацию, выбранную из модифицированного сахарида и модифицированной межнуклеозидной связи, и причем модифицированный олигонуклеотид способен снижать уровни мРНК атаксина 2. Также описано соединение, содержащее модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий последовательность нуклеотидных оснований, содержащую по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19 или по меньшей мере 20 последовательных нуклеотидных оснований по любой из последовательностей нуклеотидных оснований SEQ ID NO: 18, 11-17 или 19-165, причем модифицированный олигонуклеотид содержит по меньшей мере одну модификацию, выбранную из модифицированного сахарида и модифицированной межнуклеозидной связи, и причем модифицированный олигонуклеотид способен снижать уровни мРНК атаксина 2. Описанные соединения пригодны для лечения, предупреждения или облегчения связанных с атаксином 2 заболеваний, нарушений и патологических состояний. Такие связанные с атаксином 2 заболевания включают спинально-церебеллярную атаксию 2 типа, боковой амиотрофический склероз и болезнь Паркинсона. 2 н. и 16 з.п. ф-лы, 13 табл., 9 пр.

Наверх