Штамм гриба beauveria bassiana, используемый для производства биопрепарата против колорадского жука, грибных патогенов и стимуляции роста картофеля в вегитационный период, биопрепарат на его основе и способ стимуляции роста картофеля в вегитационный период, защиты его от колорадского жука и ризоктониоза

Изобретение относится к области биотехнологии. Изобретение представляет собой штамм энтомопатогенного гриба Beauveria bassiana IC 1530-25-1, способ, включающий предпосадочную обработку клубней картофеля биопрепаратом и биопрепарат. При предпосадочной обработке клубней картофеля в качестве жидкой формы биопрепарата используют 1-3%-ный водный раствор спорово-мицелиальной биомассы штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды с титром не менее 105 КОЕ/мл. Обработку клубней картофеля указанным водным раствором биопрепарата производят однократно с расходом водного раствора биопрепарата 10 литров на 1 тонну картофеля. При опрыскивании картофеля в вегетационный период водным раствором биопрепарата в качестве него используют спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды титром не менее 106 КОЕ/мл и расходом водного раствора биопрепарата 300 л на 1 гектар площади посадки картофеля. Изобретение позволяет защитить картофель от колорадского жука, грибного патогена Thanatephorus cucumeris (несовершенная стадия гриба - Rhizoctonia solani), вызывающего ризоктониоз или черную паршу картофеля, а также стимулирует рост картофеля в вегетационный период. 3 н.п. ф-лы, 12 табл.

 

Изобретение относится к микробиологической промышленности, в частности, к производству средств защиты растений от вредных насекомых и грибных патогенов, и касается нового штамма гриба Beauveria bassiana для производства энтомопатогенного препарата и способа стимуляции роста картофеля в вегетационный период, защиты его от колорадского жука и ризоктониоза.

Энтомопатогенный гриб Beauveria bassiana представляет собой несовершенный гриб (Fungi imperfacti) и подразделение Deuteromycotonia. Род Beauveria Vuille относится к классу Deuteromycites; и отличается от других родов наличием конидий, которые держатся поодиночке, не располагаются мелкими цепочками, и имеют фертильную часть конидиофоры в форме зигзага и вытянутую кверху. Вид Beauveria bassiana имеет сферические, не эллипсоидальные конидии размером 2-3 - 2-2,5 мкм, и с конидофорами, образующими плотные пучки.

Известен штамм грибов вида Beauveria bassiana ВКПМ Г-399 для производства энтомопатогенных препаратов (авторское свидет. СССР №1688820, МПК A01N 63/00, опубл. 07.11.1991 г.).

Указанный штамм имеет недостаточную продуктивность и низкую терморезистентность.

Известен штамм гриба Beauveria bassiana ТС-92 для получения энтомопатогенного препарата (против трипса, вредящего растениям огурца), который получен путем селекции штамма Beauveria bassiana 124/1 на жидких и твердых питательных средах, содержащих гидролизат белково-витаминного концентрата (БВК) и глицерин с последующим отбором чистых культур по продуктивности, биологической активности на тест-насекомых и терморезистентности (патент РФ №2034469, МПК A01N 63/04, опубл. 10.05.1995 г. Штамм депонирован в Центральной коллекции микроорганизмов государственного концерна "Биопрепарат" (ЦКМК"Б") под № ЦКМ F-54Ц.

Известен штамм гриба Beauveria bassiana АТСС N 74040 (патент РФ №2103873, МПК A01N 63/00, C12N 1/14, опубл. 10.02.1998 г.), предназначенный для получения энтомопатогенного препарата против хлопкового долгоносика, белянки сладкого картофеля и хлопкового слепняка.

Известен штамм Beauveria bassiana, депонированый в коллекции микроорганизмов Института биохимии и физиологии микроорганизмов РАН в г. Москве под номером ВКМ F-3732 D и предназначенный против личинок и яиц саранчи в кубышках (патент РФ №2172588, МПК A01N 63/00, C12N 1/14, опубл. 27.08.2001 г.). Штамм Beauveria bassiana ВКМ F-3732 D получен в результате направленной изменчивости продуктивности наиболее активной культуры, выделенной из природных источников в местах массовой гибели насекомых в условиях сибирского региона. Обладает повышенной продуктивностью по сравнению с известным штаммом в условиях глубинного режима ферментации - 1,2-2,0⋅109 сп/мл. При выращивании на твердой питательной среде его продуктивность составляет 2,2-5,1⋅109 спор/г. Биологическая активность культуральной жидкости штамма при внесении с кормом, определяемая по гибели личинок саранчи, составляет 72-92%, а при внесении в почву - гибель яиц саранчи в кубышках составляет 69-92%.

Наиболее близким аналогом (прототипом) является штамм гриба Beauveria bassiana IMB F-100043, депонированный в Институте микробиологии и вирусологии им. Заболотного НАН Украины и применяемого для производства инсектицидных биопрепаратов (патент Украины №84325, МПК A01N 63/00, опубл. 10.11.2008 г.). Штамм получен в результате селекции изолята гриба Beauveria bassiana, полученного из погибших особей колорадского жука. Штамм обладает высокой инсектицидной активностью в отношении деструктивных насекомых, например, колорадского жука, американского белого мотылька, всеядного листовика, яблонной моли и может культивироваться на дешевой питательной среде.

Однако, указанный штамм-прототип не исследован против возбудителей парши картофеля, особенно - грибного патогена Thanatephorus cucumeris (А.В. Frank) Donk. (более широко распространено название несовершенной стадии гриба - Rhizoctonia solani J.G. Kuhn), вызывающего ризоктониоз или черную паршу картофеля, а также, не обладает свойством стимулирования роста картофеля в вегетационный период.

Известно применение антимикробного и фунгицидного химического соединения дицитратобората оксихинолиния в качестве средства против грибного патогена Rhizotonia solani Kuehn, вызывающего заболевание ризоктониоз (черная ножка) томатов и картофеля (патент РФ №2200393, МПК A01N 55/08, опубл. 20.03.2003 г.). Заявленное соединение обладает стимулирующим действием на рост некоторых растений, что способствует повышению их болезнеустойчивости.

Однако, указанное химическое соединение не обладает энтомопатогенным действием, т.е. не защищает растения от насекомых-вредителей, а также не приведены данные о стимулировании роста картофеля в фазе вегетации. Кроме того, данный препарат имеет свойство накапливаться в организме человека при неправильном применении препарата во время обработки растений (при нарушении техники безопасности при применении препарата во время обработки растений).

Известен препарат для защиты растений от возбудителей болезней сельскохозяйственных культур и винограда с ростстимулирующим эффектом, включающий культуральную жидкость штаммов микроорганизмов, отличающийся тем, что в качестве культуральной жидкости штаммов микроорганизмов он содержит культуральные жидкости штамма бактерий Bacillus subtilis БАГ-65 и штамма актиномицета Streptomyces sindenensis БАГ-55, а также, вспомогательные добавки и наполнители при следующем соотношении компонентов, мас. %: культуральная жидкость Bacillus subtilis БАГ-65 - 20,0-50,0; культуральная жидкость Streptomyces sindenensis БАГ-55 - 5,0-20,0; вспомогательные добавки и наполнители - остальное (патент РФ №2313941, МПК A01N 63/02, опубл. 10.01.2008 г.). Данный препарат обладает антагонистической активностью против грибного патогена Rhizotonia solani Kuehn, вызывающего заболевание ризоктониоз картофеля.

Однако данный препарат не обладает энтомопатогенным действием, т.е. не защищает растения от насекомых-вредителей, а также не приведены данные о стимулировании роста картофеля в фазе вегетации. Технология производства препарата сложна, требует раздельного культивирования каждого микроорганизма с последующим их смешиванием с наполнителем для получения готовой формы.

Способ микробиологической защиты растений от вредителей с использованием средства, включающее смесь культуральных жидкостей Trichoderma viride, Azotobacter chroococcum, Bacillus megaterium, Beauveria bassiana, Metarhizium anisopliae с необходимым количеством воды при соотношении культур в смеси 1:1:1:1:1 при титре каждой культуры не менее 1×107 КОЕ/мл (патент РФ №2539025, МПК A01N 63/00, опубл. 10.01.2015 г.). Способ защиты включает 2-3-кратное опрыскивание растений в период вегетации в дозировке 12,5 л средства на 1 га посевов, при достижении средних температур воздуха не ниже 15°С, с интервалом две-три недели.

Однако данный способ обработки направлен на защиту пшеницы от насекомых-вредителей. Информация о защите картофеля от насекомых-вредителей, грибных патогенов и стимулирования роста стеблей картофеля в период вегетации отсутствует.

Известен способ борьбы с почвенными патогенами картофеля в мерзлотных почвах, включающий предпосевную обработку клубней картофеля препаратом на основе Bacillus subtilis «ТНП-5 - ДЕП» из расчета 300 мл/кг и обработку растений картофеля в период вегетации препаратом «Мизорин» 23 мл/кг (патент РФ №2534889, МПК A01N 63/02, опубл. 10.12.2014 г.). «Мизорин» - бактериальный препарат на основе Arthrobacter mysorens.

Однако указанный способ трудоемок, требует вначале предпосевной обработки клубней картофеля препаратом на основе Bacillus subtilis «ТНП-5 - ДЕП», а затем обработку растений картофеля в период вегетации бактериальным препаратом на основе Arthrobacter mysorens.

Наиболее близким биопрепаратом-аналогом (прототипом) является средство для борьбы с колорадским жуком и повышения урожайности картофеля, содержащее экстракт лишайников Usnea, в количестве 0,0010-0,0015 г, полученный кипячением воздушно-сухого сырья в изопропиловом спирте, и водную суспензию конидий энтомопатогенного гриба Beauveria bassiana или Metarhizium anisopliae с титром соответственно 15×107 или 75×106 на 100 мл водной суспензии средства (патент РФ №2570548, МПК A01N 65/00, опубл. 10.12.2015 г.).

Способ применения против колорадского жука указанного биопрепарата в виде суспензии конидий энтомопатогенного гриба Beauveria bassiana 15×107 состоит в обработке картофеля (путем опрыскивания) в вегетационный период водным раствором указанного биопрепарата с титром 1,5×106 КОЕ/мл. (патент РФ №2570548).

Однако, данный биопрепарат содержит высокий титр 1,5×106 КОЕ/мл. энтомопатогенного гриба Beauveria bassiana в рабочей жидкости для обеспечения достаточной инсектицидной активности, что требует большой расход препарата (в 15 раз больше, чем в заявляемом). Кроме того, отсутствуют сведения об использовании данного препарата для защиты от грибных патогенов и стимуляции роста картофеля в период вегетации.

Наиболее близким аналогом способа применения является способ биологической защиты растений картофеля от фитофтороза и колорадского жука, включающий обработку клубней перед посадкой замачиванием и опрыскивание растений картофеля в период вегетации биопрепаратом в смеси с прилипателем (патент России №2343667, МПК А01С 1/00, A01N 63/00, опубл. 20.01.2009 г.). Для обработки клубней картофеля замачиванием в качестве биопрепарата используют планриз из расчета 1000 мл на тонну клубней, а для обработки опрыскиванием 1 га посадок растений в период вегетации используют смесь биопрепаратов планриз в количестве 0,5 л и банкол в количестве 0,2 л, разведенных в 300-350 л минеральной воды «Заманкул», при этом в качестве прилипателя используют кукурузный клейстер в количестве 1-1,5% от объема смеси.

Однако в данном способе отсутствуют данные о возможности стимулирования роста и защиты картофеля от ризоктониоза. Кроме того в способе используется сложная многокомпонентная смесь из фунгицида, инсектицида, миниральной воды и прилипателя, что повышает стоимость обработки, ограничивает область применения способа, т.к. используемая многокомпонентная смесь не является единой препаративной формой и требует наличия всех компонентов используемой смеси. Например, минеральная вода находится в источнике в Северной Осетии и труднодоступна для других регионов.

Техническим результатом заявляемого изобретения является получение штамма гриба Beauveria bassiana, обладающего свойством защиты картофеля от колорадского жука, возбудителей парши, особенно - грибного патогена Thanatephorus cucumeris (несовершенная стадия гриба - Rhizoctonia solani), вызывающего ризоктониоз или черную паршу картофеля, а также обладающего свойством стимулирования роста картофеля в вегетационный период.

Указанный технический результат достигается созданием нового штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1, полученного в результате селекции изолята гриба Beauveria bassiana, полученного из погибших личинок колорадского жука, обеспечивающего защиту картофеля от ризоктониоза (черной парши) и стимулирование роста картофеля в вегетационный период и депонированного в Биоресурсном Центре Всероссийской Коллекции Микроорганизмов (БРЦ ВКПМ) НИЦ «Курчатовский институт» - ГосНИИ генетика, регистрационный номер ВКПМ: F-1447 (справка о депонировании штамма прилагается).

Указанный технический результат достигается также тем, что в биопрепарате против колорадского жука, грибных патогенов и стимуляции роста картофеля в вегетационный период, включающем суспензию культуральной жидкости микроорганизма, согласно изобретения, в качестве суспензии культуральной жидкости микроорганизма, он содержит спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 с титром не менее 109 КОЕ/мл и компоненты питательной среды после культивирования указанного штамма энтомопатогенного гриба.

Указанный технический результат достигается также тем, что в способе стимуляции роста картофеля в вегетационный период, защиты его от колорадского жука и грибных патогенов, включающем предпосадочную обработку клубней картофеля биопрепаратом в жидкой форме путем погружения в него клубней картофеля и/или опрыскивание картофеля в вегетационный период водным раствором биопрепарата распылением, согласно изобретения, при предпосадочной обработке клубней картофеля в качестве жидкой формы биопрепарата используют 1-3%-ный водный раствор спорово-мицелиальной биомассы штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды по п.п. 1, 2 формулы с титром не менее 105 КОЕ/мл, обработку клубней картофеля указанным водным раствором биопрепарата производят однократно с расходом водного раствора биопрепарата 10 литров на 1 тонну картофеля, а при опрыскивании картофеля в вегетационный период водным раствором биопрепарата в качестве него используют спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды по п.п. 1, 2 формулы с титром не менее 106 КОЕ/мл и расходом водного раствора биопрепарата 300 л на 1 гектар площади посадки картофеля.

Характеристика заявляемого штамма гриба Beauveria bassiana IC-1530-25-1. Родительский штамм гриба Beauveria bassiana IC-1530-25-1 выделен из личинок колорадского жука на территории Новосибирской области. Заявляемый штамм гриба Beauveria bassiana IC-1530-25-1 получен путем селекции и идентифицирован на основании секвенированного фрагмента ДНК депонируемого штамма гриба Beauveria bassiana IC-1530-25-1.

Идентификация штамма IC 1530-25-1 на основе анализа последовательности рибосомальных генов (выписка из отчета Биоресурсного Центра Всероссийской Коллекции Микроорганизмов (БРЦ ВКПМ) НИЦ «Курчатовский институт» - ГосНИИ генетика от 25.09.2018 г.).

1. Рассев культуры заказчика до отдельных колоний и получение биомассы для анализа 18S РНК.

2. Выделение ДНК. (Genomic DNA Purification Kit)

3. Идентификация штамма по последовательности 18S рДНК.

3.1. Выбор праймеров и режимы ПЦР

Консервативные праймеры для наработки последовательности гена, кодирующего 18S рРНК (Michael A. Innis, David Н. Gelfand, John J. Sninsky, Thomas J. White. PCR protocols. A guide to methods and applications. Academic press, INC. 1990.) [1]:

NS1 - gtagtcatatgcttgtctc

NS4 - cttccgtcaattcctttaag

Режим реакции ПЦР:

- 95°C - 3 мин.

- 35 циклов:

95°С - 30 сек.

57°С - 30 сек.

72°С - 30 сек.

- 72°С - 5 мин

Консервативные праймеры для наработки последовательности гена, кодирующего 5.8S рРНК и внутренние транскрибируемые спейсеры ITS1 и ITS2 (Биохимия, 2007, 72, 12, 1659-1667) [2]:

ITS1 - TCCGTAGGTGAACCTGCG

ITS4 - TCCTCCGCTTATTGATATGC

Режим реакции ПЦР:

- 95°С - 3 мин.

- 35 циклов:

95°С - 30 сек.

57°С - 30 сек.

72°С - 30 сек.

- 72°С - 5 мин.

Консенвативные праймеры для амплификации домена D1/D2 гена 26S рРНК:

NL-1 GCATATCAATAAGCGGAGGAAAG

NL-4 GGTCCGTGTTTCAAGACGG

Режим реакции ПЦР:

- 95°С - 3 мин.

- 35 циклов:

95°С - 30 сек.

52°С - 30 сек.

72°С - 30 сек.

- 72°С - 5 мин

3.2. Секвенирование генов 18S рРНК и 5.8S рРНК, сравнение секвенсов и построение деревьев родства.

Секвенирование проводилось на автоматическом секвенаторе АЕ3000.

Для анализа секвенсов использовалась специализированная компьютерная программа BLAST [http://www.ncbi.nlm.nih.gov/blast].

Достоверность результатов. Были определены последовательности достаточные для отнесения штамма к определенной таксономической группе микроорганизмов.

4. Условия электрофореза ПЦР исследуемых образцов. 1,0% агарозный гель, электрофорез при напряженности электрического поля 5 В/см.

Этапы анализа.

а) Секвенирование участков последовательности, кодирующей ген 18S рРНК.

При секвенировании участка ДНК, кодирующего ген 18S рДНК исследуемого штамма, получена следующая последовательность:

б) Анализ последовательностей гена, кодирующего 18S рРНК.

Анализ сходства нуклеотидной последовательности гена, кодирующего 18S рДНК, изучаемого штамма был проведен с помощью сервера BLAST [http://www.ncbi.nlm.nih.gov/blast].

Результаты. Критерием отнесения микроорганизма к тому или иному виду считается гомология не менее 97% [2].

Первичный скрининг по базе данных GenBank показал, что исследуемый штамм принадлежит к следующей систематической группе: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Cordycipitaceae; Beauveria.

Для установления филогенетического родства близких видов был также использован метод сравнения нуклеотидных последовательностей, кодирующих ген 5,8 S рРНК и внутренние транскрибируемые спейсеры ITS1 и ITS2 [2].

При секвенировании участка ДНК, кодирующего ген 5,8 S рРНК и внутренние транскрибируемые спейсеры ITS1 и ITS2, получена следующая последовательность:

Кроме того, для установления филогенетического родства близких видов был также использован метод сравнения нуклеотидных последовательностей, кодирующих домен D1/D2 гена 26S рРНК.

При секвенировании участка ДНК, кодирующего домен D1/D2 гена 26S рРНК, получена следующая последовательность:

Анализ филогенетического родства, построенный с использованием штаммов близкородственных микроорганизмов, показал, что наиболее близким к исследуемому штамму является вид Beauveria bassiana.

Заключение. По результатам проведенного анализа нуклеотидной последовательности, кодирующей часть генов рРНК установлено, что исследуемый штамм наиболее близок к виду Beauveria bassiana (99%).

Штамм гриба Beauveria bassiana IC-1530-25-1 характеризуется следующими культурально-морфологическими признаками.

При выращивании штамма на твердой среде Чапека при 26-27°С в течение 6 суток колонии беловатого цвета с точкой в центре, с ровными краями. Воздушный мицелий разветвленный, септированный, гифы мицелия в диаметре 3,0-5,0 мкм, конидиеносцы бутылевидные формируются одиночно, попарно или мутовками. Размер конидий 2,8-3,5 мкм одноклеточные, одноядерные на среде Сабуро при тех же условиях выращивания колонии с ровными краями белые пушистые колонии войлочного типа сверху и снизу, врастающие в агар, после спороношения - порошистые.

Характер роста: колония пушистая по всей площади, край ровный.

Размер колонии (при определенном времени инкубации): на 14-15 сутки роста диаметр колонии составляет 35-40 мм.

Воздушный мицелий: белый, спороношение белое, слегка порошистое;

Цвет обратной стороны колонии - белый.

Морфологические признаки штамма при культивировании на жидкой питательной среде Сабуро при 24-26°С в течение 72 ч:

- после 24 часов культивирования мицелий истонченный и составляет 15-20%, а 80-85% составляют не проросшие споры;

- после 48 часов культивирования мицелия мало, культура развивается слабо; мицелий имеет среднюю толщину; свободных спор 5-10%;

- после 72 часов культивирования мицелий составляет 50-60%; остальной мицелий утолщенный, с четкими перегородками.

Физиолого-биохимические признаки штамма.

Растет при 18-32°С, оптимально 25-27°, рН среды 5,35-7,2, оптимально 5,8-6,8.

Отношение к источникам углерода: усваивает сахарозу, глюкозу, лактозу, глицерин.

Отношение к источникам азота: утилизирует пептон, казеин, рыбо-костную муку, мясной бульон, дрожжи и их гидролизаты.

При глубинном культивировании штамма на различных составах сред происходит изменение рН культуральной жидкости различно в зависимости от состава среды.

Процентное содержание биомассы штамма Beauveria bassiana IC-1530-25-1 по сухому остатку после фильтрации культуральной жидкости составляет 15-17%.

Исследована терморезистентность предложенного штамма Beauveria bassiana IC-1530-25-1 и исходного штамма при 80°С в течение 1-2 мин.

Заявляемый штамм устойчивее на 20%.

Заявляемый штамм гриба Beauveria bassiana IC-1530-25-1 хранится:

- на картофельно-глюкозном агаре при температуре 6-8°С;

- в 10-20%-ном глицерине при -70°С;

Способ, условия и состав сред для размножения штамма:

- оптимальная среда агар Сабуро;

- рН 4,6;

- время инкубации 20 дней;

- в освещении необходимости нет;

- другие среды, используемые для культивирования: агар Чапека, картофельно-глюкозный агар;

Среда для ферментации: бульон Сабуро.

Штамм заявляемого гриба Beauveria bassiana IC-1530-25-1 является энтомопатогенным. Не патогенен для пчел.

Методы селекции исходного гриба В. bassiana при получении заявляемого штамма Beauveria bassiana IC-1530-25-1.

Для селекции гриба использовали явление спонтанной изменчивости. При изучении спонтанной изменчивости штаммов в культуре использовали набор питательных сред, с помощью которых оценивали гетерогенность моноконидиальных изолятов по морфологии и культуральным свойствам. Кроме этого, в качестве показателей изменчивости изучали показатели ферментативной активности полученных морфологических вариантов и их вирулентность.

Для выделения моноспоровых изолятов проводили рассевы суспензии смытых с поверхности агаризованной питательной среды конидий гриба, далее отбирали выросшие колонии, отсевали их в чашки Петри и оценивали морфологию в сравнении с родительскими штаммами. Сходные по морфологии колонии объединяли в морфологические группы. Для оценки стабильности морфоваров их культивировали в течение пяти вегетативных пассажей на наборе питательных сред. Согласно методике, все выделенные варианты во всех пассажах перевивали с каждой среды на ту же среду из используемого набора. При выявлении стабильных групп морфоваров проводили сравнение их биохимических свойств и вирулентности. Морфологию вновь полученных изолятов оценивали по окраске и форме колоний, размерам колоний и скорости роста мицелия на разных искусственных питательных средах.

Изучение ферментативной активности заявляемого гриба В. bassiana. Методика определения ферментативной активности

Определение ферментативной активности проводили на агаризованных питательных средах, эстеразную активность определяли спектрофотометрическим методом.

Протеазную активность оценивали по гидролизу казеина на среде следующего состава (в %): агар-агар - 2, молоко сухое обезжиренное - 0,5, глюкоза - 1, вода дистиллированная - 1000 мл, рН после стерилизации (6,5±0,1). Активность экзопротеаз определяли по ширине зоны просветления агаризованной среды вокруг колонии на 10-е сутки роста (за вычетом диаметра колонии из диаметра зоны лизиса).

Амилазную активность оценивали по гидролизу водорастворимого крахмала на среде следующего состава (в %): агар-агар - 2, крахмал - 0,2, глюкоза - 1, вода дистиллированная - 1000 мл, рН после стерилизации (6,5±0,1). Активность экзоамилаз определяли по ширине зоны лизиса среды вокруг колонии на 10-е сутки роста (за вычетом диаметра колонии из диаметра зоны лизиса), которая появлялась после окрашивания агаровой пластинки в чашке Петри с помощью раствора Люголя.

Для определения липазной активности использовали две среды: с твином-80 и оливковым маслом. Состав (в %): агар-агар - 2,0; твин-80 - 1,0 (либо оливковое масло - 2,0); пептон - 1,0; дрожжевой экстракт - 0,2; вода дистиллированная - 1000 мл, рН после стерилизации (6,5±0,1). Активность липаз определяли по ширине зоны просветления агаризованной среды вокруг колонии на 10-е сутки роста (за вычетом диаметра колонии из диаметра зоны лизиса).

Хитиназную активность оценивали на среде с коллоидным хитином, полученным гидролитическим расщеплением хитина панцирей камчатских крабов с помощью уксусной кислоты. Активность липаз определяли по ширине зоны просветления агаризованной среды вокруг колонии на 10-е сутки роста (за вычетом диаметра колонии из диаметра зоны лизиса).

Для определения эстеразной активности штаммы В. bassiana засевали в пенфлаконы с 10 мл жидкой среды Сабуро (дрожжевой экстракт - 0,2%, пептон - 1%, глюкоза - 4%, агар-агар - 2%, вода дистиллированная - 1000 мл) и инкубировали при (27±0,5)°С в течение 10 дней. После окончания времени инкубации из флаконов отбирали по 1 мл культуральной жидкости в пробирки Эппендорфа, образцы центрифугировали при 5000 оборотов в течение 10 мин. Субстрат готовили следующим образом: 1 мл 0,5М буфера трис-HCl с рН 7,0 доводили до объема 10 мл дистиллированной водой. Параллельно готовили навеску субстрата - р-нитрофенилацетата - из расчета 1 мг субстрата на 10 мл разведенного буфера. Навеску предварительно растворяли в 1 мл ацетона, затем переносили в емкость с буфером.

В кювету спектрофотометра наливали 100, 150 или 200 мкл культуральной жидкости (КЖ) и 1 мл буфера с субстратом. Оптическую плотность продукта реакции субстрата с КЖ определяли при длине волны 410 нм. Результаты исследования приведены в таблице 1.

Методы определения вирулентности заявляемого штамма гриба В. bassiana

Вирулентность полученного штамма Beauveria bassiana IC-1530-25-1 и исходного штамма определяли в лабораторных условиях на личинках колорадского жука Leptinotarsa decemlineata Say. Насекомых содержали при температуре (35±1)°С без освещения. В качестве корма использовали питательную среду Вейзера. Работу проводили с личинками 1-2 возраста.

Заражение производили путем нанесения суспензии спор гриба исследуемых концентраций на личинок с помощью кисточки. Учет гибели насекомых проводили визуально, начиная с первых суток после инокуляции. Для проведения пассажей штаммов через живой организм использовали колорадского жука Leptinotarsa decemlineata. Личинок инфицировали путем погружения в суспензию конидий гриба.

После появления признаков заражения (множественные темные пятна на кутикуле) погибших насекомых переносили на поверхность питательной среды Сабуро в чашки Петри и инкубировали при комнатной температуре до появления обильного роста мицелия и развития спороношения.

Споры собирали в стерильную пробирку и использовали для дальнейшего заражения следующей генерации личинок. Вирулентность полученных вариантов определяли описанным выше способом в лабораторных условиях. Учет гибели насекомых проводили визуально, начиная с первых суток после инокуляции. Результаты приведены в табл. 2.

Биологическая эффективность заявляемого штамма Beauveria bassiana IC-1530-25-1 и препарата на его основе на личинках колорадского жука составляет 98% на 5-е сутки, а у исходного родительского штамма соответственно 90%.

Таким образом, предложенный штамм превосходит родительский штамм по продуктивности и биологической эффективности.

Испытание заявляемого грибного штамма на фитопатогенах

Опыт проводили с использованием методики агаровых блоков. Суспензию препарата в концентрации с титром 105 спор/мл вносили в питательную среду с температурой 36-37°С. Для выращивания грибных фитопатогенов, в качестве питательной среды был взят картофельно-глюкозный агар. Инокулированную среду разливали в чашки Петри и на застывшую поверхность в центр помещали блок диаметром 10 мм, вырезанный из колонии фитопатогена.

Учет проводили на 3, 5, 7, 10 сутки. Активность препарата учитывали по изменению диаметра колонии гриба в сравнении с контролем (среда без внесения биопрепарата). На основании полученных данных определяли ингибирующую активность (табл. 3).

Пример 1. Использование заявляемого штамма для получения энтомопатогенного препарата. Культивирование энтомопатогенного штамма гриба В. bassiana IC-1530-25-1. Схема культивирования энтомопатогенного гриба В. bassiana была выбрана согласно методическим указаниям (Евлахова, Велицкая, 1961) и включала в себя следующие стадии:

1. Получение исходной культуры штаммов из музейных пробирок;

2. Наработка посевного материала штаммов;

3. Получение биомассы штаммов;

4. Контроль качества полученной биомассы по отобранным критериям.

В процессе культивирования использовали следующее технологическое оборудование и материалы:

1. Автоклав ВК-75.

2. Баня водяная с терморегулятором, позволяющая поддерживать температуру 30°С-100°С с отклонением до 1°С от заданной.

3. Весы лабораторные общего назначения с наибольшим пределом взвешивания 200 г и пределом допускаемой погрешности ±2 мг для взвешивания реактивов.

4. Шкаф сушильный.

5. Термостаты электрические для выращивания культур грибов с автоматическим терморегулятором до температуры 35°С и с ценой деления 0,2°С.

6. Холодильник бытовой электрический по ГОСТ 26678.

7. Центрифуга.

8. Шейкер лабораторный на 6 колб.

9. Электроплита по ГОСТ 14919.

10. Микроскоп световой биологический с увеличением в 900х - 1000х раз.

11. рН-метр с пределом допускаемой погрешности не более 0,05 ед. рН.

12. Дистиллятор.

13. Термометры жидкостные стеклянные с диапазоном температуры 0°С-50°С и 50°С-100°С по ГОСТ 28498 с пределом допускаемой погрешности ±0,5°С с ценой деления шкалы 0,5°С.

Музейная культура В. bassiana хранилась на скошенной агаризованной питательной среде Сабуро следующего состава (на 1 дм3 дистиллированной воды): пептон мясной ферментативный - 10 г, глюкоза кристаллическая моногидрат - 40 г, дрожжевой экстракт - 0,5 г, агар микробиологический - 20 г, рН 6,5 до стерилизации.

На первом этапе технологического процесса культивирование осуществлялось размножением музейных культур путем поэтапного пересева спорово-мицелиальной массы на ряд последовательных пробирок со скошенной плотной питательной средой Сабуро.

На втором этапе осуществлялось получение посевного материала путем смыва спорово-мицелиальной массы с маточных пробирок стерильным физиологическим раствором в колбы вместимостью 50 см3. Полученную, таким образом суспензию, с титром 106 КОЕ/мл использовали для инокулирования ростовых колб вместимостью 500 см3, содержащих 250 см3 жидкой картофельно-глюкозной среды следующего состава (на 1 дм3 дистиллированной воды): картофель измельченный - 500 г, глюкоза кристаллическая моногидрат - 20 г, дрожжевой экстракт - 0,5 г, рН 6,5 до стерилизации. Колбы инкубировали на термостатируемом шейкере при температуре (23±1)°С в течение 7 дней. По окончании культивирования содержимое колб разливали в стерильные стеклянные флаконы, укупоривали резиновыми пробками и завальцовывали алюминиевыми колпачками. Полученная жидкая биомасса гриба Beauveria bassiana IC-1530-25-1 с титром 109 КОЕ/мл служит готовой препаративной формой, которую хранили в холодильнике при температуре (6±1)°С для дальнейшего использования. Технологический процесс наработки занимал 15 суток, включая стадию выращивания посевной культуры на агаризованной питательной среде.

Пример 2. Состав заявляемого биопрепарата. Биопрепарат против колорадского жука, грибных патогенов и стимуляции роста картофеля в вегетационный период содержит спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 с титром не менее 109 КОЕ/мл и компоненты питательной среды после культивирования указанного штамма энтомопатогенного гриба.

Хранят препарат в холодильнике при температуре от 0 до 10°С. Срок годности биопрепарата - 6 месяцев от даты изготовления. В 1 см3 препарата содержится не менее 1×109 КОЕ (колониеобразующих единиц) живых микробных клеток штамма гриба Beauveria bassiana.

Пример. 3. Способ обработки клубней картофеля для защиты от грибных патогенов и стимуляции роста картофеля в вегетационный период.

3.1. Заявляемый способ включает предпосадочную обработку клубней картофеля биопрепаратом в жидкой форме путем полного погружения в него клубней картофеля или смачивания всей поверхности. В качестве жидкой формы биопрепарата используют 1-3%-ный рабочую суспензию спорово-мицелиальной биомассы штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды с титром не менее 105 КОЕ/мл. Обработку клубней картофеля указанным рабочим составом биопрепарата производят однократно перед посадкой с расходом рабочей суспензии биопрепарата 10 литров на 1 тонну картофеля.

3.2. Результаты полевых испытаний по стимуляции роста картофеля в вегетационный период и защиты его от ризоктониоза

Возбудитель болезни - гриб-базидиомицет Thanatephorus cucumeris (А.В. Frank) Donk. (более широко распространено название несовершенной стадии гриба - Rhizoctonia solani J.G. Kuhn). Базидиальная стадия не является обязательной в цикле развития патогена: базидиоспоры образуются при высокой влажности на мицелии, находящемся на стебле вблизи поверхности земли.

Симптомы и жизненный цикл возбудителя болезни. Гриб Rhizoctonia solani J.G. Kuhn способен поражать картофель на всех этапах онтогенеза. В настоящее время насчитывают несколько форм проявления ризоктониоза. Заболевание проявляется в виде черной парши, углубленной (ямчатой) пятнистости и сетчатого некроза клубней, загнивания глазков и ростков, отмирания столонов и корней, а также в виде сухой гнили подземной части стебля в виде коричневых язв различной величины "трухлявая древесина" и "белой ножки" стеблей.

Гриб может перезимовывать в виде мицелия или склероциев на клубнях или в почве в течение 3-4 лет. Кроме картофеля, R. solani может поражать овощные культуры (томаты, тыквенные, свеклу) и многие дикорастущие сорные растения (осот, хвощ, лебеду и др.).

Важными условиями, определяющими развитие ризоктониоза на картофеле, являются температура и влажность почвы и воздуха. Оптимальная температура почвы для развития заболевания - около 17°С, влажность - 60-70% от полной влагоемкости. Оптимальные условия для инфицирования растений создаются на тяжелых (суглинистых) почвах. Кислотность в диапазоне рН от 4,5 до 8 не имеет существенного значения.

Вредоносность проявляется на всех формах развития заболевания. Особенно опасно поражение ростков и взошедших растений, приводящее к сильному изреживанию всходов (до 15-20%) и снижению продуктивности растений. Урожай стабильно уменьшается на 10-15%, а в отдельные годы - до 30-40%.

Для защиты картофеля от ризоктониоза и стимуляции роста картофеля в вегетационный период его клубни обрабатывали препаратом в соответствии со способом по примеру 3.1. перед посадкой в почву.

2015 год. В период вегетации были проведены 3 учета (через 4, 6, 10 недель после посадки) по оценке влияния биоагента на пораженность стеблей и столонов картофеля четырех сортов разных групп спелости: ранних сортах Любава и Юна, среднераннем - Свитанок киевский и среднеспелом - Хозяюшка.

Учет через 6 недель показал, что под действием заявляемого биопрепарата на всех сортах увеличивалась биомасса растений, особенно на раннем сорте Любава (в 3,8 раз), а на среднеспелом (Хозяюшка) - всего в 1,1 раза. Та же тенденция сохраняется по высоте растений и количеству стеблей.

Суспензия энтомопатогенного гриба Beauveria bassiana (Bb) статистически достоверно оказала ростостимулирующее действие на картофель. Высота растений увеличивалась, особенно в начальный период роста и через 6 неделю на сорте Любава и Свитанок киевский в 1,3 (Bb) раза превышала контрольные растения.

В контрольных вариантах (без применения биопрепаратов) распространенность болезни на стеблях была самая высокая на сортах Юна и Хозяюшка, которая достигала 82,4-85,7%. В опытных образцах стебли, практически, не были поражены ризоктониозом (единично наблюдали штрихи и небольшие язвочки - поражение первым баллом, а в контроле - 1, 2 и 3 баллами, т.е. присутствовали язвы на стебле длиной 50 мм и более). Распространенность болезни на стеблях значительно снизилась на всех сортах, независимо от микробного агента в 2,1-14,1 раз. Однако, лучшие результаты получены при использовании В. bassiana, особенно на раннеспелых сортах Любава и Юна (снижение по сравнению с контролем в 5,3-6,2 раза). Соответственно снижалось и развитие болезни на стеблях: В. bassiana лучше оздоравливал ранние сорта - Любаву и Юну, на которых развитие болезни снизилось до 2,1-2,7%, т.е. - в 7,3-10,6 раз.

Через 10 недель в опытных вариантах растения всех сортов достоверно были выше контрольных, в среднем в 1,2-1,6 раза (табл. 4). По увеличению количества стеблей в кусте достоверные различия получены на сортах Свитанок киевский и Юна. Под воздействием биоагентов статистически достоверно увеличивалась по сравнению с контролем (р<0.05) общая биомасса растений (Хозяюшка и Юна) в 2,0-2,3 раза при обработке В. bassiana.

В большей степени, на контроле были поражены ризоктониозом стебли сортов Свитанок киевский и Хозяюшка: средний балл поражения составил 0,6-0,8 баллов (отмечено поражение 3 и 4 баллами, т.е. язвы на стебле были длиной 50 мм и более). На сортах Любава и Юна средний балл поражения составил 0,4. Под воздействием препарата произошло значительное оздоровление стеблей на всех сортах (единично штрихи и небольшие язвочки - поражение первым баллом).

Микробные агенты положительно повлияли на увеличение общего количества столонов (в 2,8-2,2-1,3-1,7 раз) соответственно на сортах: Любава, Свитанок киевский, Хозяюшка и Юна, при снижении количества пораженных и опавших.

Распространенность болезни на стеблях в контроле (без применения препарата) была самая высокая на сорте Свитанок киевский и достигала 94,4%, меньшее - на сорте Хозяюшка (но статистически не доказана).

Таким образом, применение препаратов позволило значительно снизить (р<0.05) распространенность болезни на всех сортах. При применении В. bassiana снизилась распространенность ризоктониоза на стеблях (р<0.05) в 4,5 (Любава) - 3,5 (Свитанок киевский) - 7,2 (Хозяюшка) - 3,5 (Юна).

Препарат на основе биомассы энтомопатогенного гриба В. bassiana был высокоэффективен. На ранних сортах: Любаве и Юне биологическая эффективность В. bassiana достигала 84,8-88,5%, а на среднеспелом сорте Хозяюшка - 94,0%.

При копке картофеля (3 сентября 2015 г.) была определена пораженность клубней путем оценки развития склероциального индекса (S.i.) и распространенности ризоктониоза (табл. 5). Препарат положительно повлиял на оздоровление клубней. Гриб В. bassiana снижал заболеваемость и увеличивал выход здоровых клубней, в среднем, в 1,5-2,7 раза. Пораженность опасной склероциальной формой ризоктониоза резко снизилась.

Склероциальный индекс снизился в 11,4 (с. Любава) и в 5,7 (с. Юна) раз. Энтомопатогенный гриб В. bassiana положительно повлиял на снижение (в 3,2-5,7 раз) склероциальной стадии на этих сортах.

Полностью свободными от склероциев были клубни сорта Любава. Снижение распространенности склероциальной стадии болезни на клубнях сорта Юна - в 1,4 (смесь) - 4,0 (гриб) раза, на сортах Хозяюшка и Свитанок киевский колебалось в 1,5-2,7 раза. Очевидно, растения, выросшие из клубней, обработанные микробиологическим агентом были более устойчивы к суховейным явлениям, которые наблюдались в конце июня-начале июля, и попали под двойной стресс.

Результаты, полученные на среднеспелом сорте Хозяюшка, показали, что без применения препаратов на этом сорте более 50% клубней были покрыты склероциями (очевидно, из-за более позднего срока созревания).

Помимо оценки зараженности столонов, стеблей и клубней ризоктониозом нами оценено влияние микробиологических агентов на Rh. solani в ризосфере картофеля сорта Любава. Анализ заселенности почвы грибом Rhizoctonia solani проводили в лаборатории методом множественных почвенных таблеток при помощи пробоотборника (табл. 6).

Значительно снизилось количество пропагул Rh. solani в почве (в 9,2 раза) под воздействием В. bassiana.

Таким образом, энтомопатогенный гриб Beauveria bassiana не только контролировал возбудителя ризоктониоза на стеблях, столонах и клубнях картофеля, но и снижал численность пропагул Rh. solani в почве, что значительно повлияло на качество и количество клубней.

2016 год. Аналогичные учеты проведены в 2016 году на трех сортах. При учете на 4-ю неделю после посадки на сорте Любава не отмечалось проявления заболевания, а на сортах Свитанок киевский и Хозяюшка, хотя и было поражение, но только первым, и частично вторым баллами.

Применение препаратов снизило распространенность ризоктониоза на стеблях в 1,6-1,7 раза (В. bassiana) по сравнению с контролем. При следующих учетах происходило дальнейшее улучшение состояния стеблей: в 2 раза на 6-ю неделю и в 3,5-6,4 раза - на 10-ю (табл. 7).

Ростостимулирующее действие выражалось в ускорении развития растений, увеличения массы, высоты и количества стеблей и столонов. Через месяц поле посадки статистически достоверное увеличение массы растений под воздействием микробного агента (в вариантах с обработкой клубней перед посадкой) наблюдали только на раннеспелом сорте Любава - в 1,5-1,7 раз больше по сравнению с контролем (табл. 8).

Однако, в этот период достоверных различий по высоте, количеству стеблей и столонов не получено, т.к. стояла сухая погода (осадков выпало в 1,5 раза меньше нормы). Тем не менее, на сортах среднеранней (Свитанок киевский) и среднеспелой (Хозяюшка) групп спелости, препарат оказал положительное действие на увеличение стеблей и столонов - в 1,3 раза (на сорте Хозяюшка) больше стеблей и в 2 раза - столонов при применении В. bassiana. На этих же сортах стабильно шло увеличение показателей на 6-ю неделю. На 10-ю неделю все препараты и на всех сортах достоверно увеличили массу растений в 1,4 раза (сорта Любава и Свитанок киевский) и в 1,6-2 раза - на сорте Хозяюшка, количество стеблей - в 1,1 раза и, особенно - столонов в 1,8-2,7 раз в зависимости от сорта.

На клубнях нового урожая, на сортах Свитанок киевский и Хозяюшка развитие склероциальной стадии было ниже, чем в контрольном варианте в 2,8-3,3 раза - при предпосадочной обработке В. bassiana. На сорте Любава в опытных вариантах все клубни были, практически, свободны от черной парши (табл. 9). Выход здоровых клубней увеличился, в 5,5 раза на сорте Хозяюшка и в 5,2 раза на сорте Любава. Пораженность опасной склероциальной формой ризоктониоза на клубнях нового урожая резко снизилась.

Склероциальный индекс (S.i.) снизился в 6,0 (сорт Любава), в 3,6 (сорт Свитанок киевский) и в 2,2 раза (сорт Хозяюшка).

Клубни всех сортов, обработанные экспериментальным препаратом перед посадкой, были поражены, в основном, только единичными склероциями, занимающие 1/10 поверхности (20,0-39,0%) и незначительно - 1/4 поверхности (0-8,3%).

Снижение распространенности склероциальной стадии болезни на клубнях сорта Любава - в 3,5 (В. bassiana) раза, на сортах Хозяюшка и Свитанок киевский колебалось в 1,5-3,0 раза.

Пример. 4. Способ обработки картофеля в вегетационный период для защиты от колорадского жука.

4.1. Заявляемый способ включает опрыскивание картофеля в вегетационный период водным раствором биопрепарата распылением. В качестве водного раствора биопрепарата используют спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды с титром не менее 106 КОЕ/мл и расходом водного раствора биопрепарата 300 л на 1 гектар площади посадки картофеля.

4.2. Оценка эффективных концентраций препарата на основе В. bassiana в отношении колорадского жука в лабораторном опыте

Эффективность биологического агента - Beauveria bassiana (B.b) в лабораторных условиях зависела от возраста личинок и времени, прошедшего от заражения. Личинки первого и второго возрастов более восприимчивы к действию В.b (1×106 КОЕ/мл), их гибель хотя и начиналась на вторые-третьи сутки (БЭ=23,3%), на седьмые сутки достигала 50%-й гибели, а на 15-е сутки - 100% (L1) (табл. 10). Личинки 3-4 возрастов более устойчивы к действию: на 3-5 сутки эффективность составила около 17%, а на 20-е сутки - 50%. Имаго колорадского жука еще более устойчиво к действию энтомопатогена: биологическая эффективность на 20-е сутки была на уровне 21,4%.

В. bassiana (титр 1×107 КОЕ/мл) на личинок 1-2 возрастов оказывала несколько меньший эффект, чем 1×106, однако, на 15% больше вызывала гибель личинок 3-го возраста, и, практически на одном уровне - в отношении личинок 4-г возраста и в 2 раза более эффективна против имаго.

Таким образом, спорово-мицелиальная биомасса энтомопатогенного гриба Beauveria bassiana с титром водной суспензии (1×106 КОЕ/мл) более эффективно воздействовала на личинок 1-2 возрастов, а с титром 1×107 КОЕ/мл - на личинок 3-4 возрастов и имаго.

4.3. Влияние заявляемого энтомопатогенного препарата на основе штамма Beauveria bassiana на колорадского жука в полевых условиях

В модельном полевом опыте, проведенном в «Саду Мичуринцев» Новосибирского ГАУ на участке, где преобладали личинки младших возрастов, эффективность испытуемого препарата составила 56,7%, а всех возрастов - только 24,6-31,2% (табл. 11).

Таким образом, в полевых опытах для обеспечения высокой эффективности биопрепаратов необходимо своевременно проводить обработки в начале отрождения и появления личинок первых 2-х возрастов.

Инсектицидное действие биоагентов на посадках картофеля в полевых условиях на сортах разных групп спелости

На стационарном участке «Сада Мичуринцев» Новосибирского ГАУ была оценена эффективность заявляемого энтомопатогенного препарата в отношении колорадского жука на трех сортах картофеля разных групп спелости.

В результате более ранней теплой погоды вегетационного периода 2016 г. колорадский жук на посадках картофеля появился раньше, чем в 2015 году и был более многочислен (на момент опрыскивания (29 июня) - по 30-50 экз./куст и более). Осадки, выпавшие в июле (126% от нормы), помешали сделать своевременные обработки посадок. Опрыскивание посадок картофеля препаратом Фитоп 22.78 против колорадского жука показало их более низкую по сравнению с 2015 г. инсектицидную активность (табл. 12) (благоприятные погодные условия способствовали быстрому развитию колорадского жука, а обильные последующие дожди снизили эффективность препаратов).

На среднераннем (Свитанок киевский) и среднеспелом (Хозяюшка) сортах эффективность биопрепарата была, практически, на одном уровне (66-68%), а на раннеспелом сорте Любава эффективность в разные годы была нестабильной и колебалась от 52,7% до 80%.

Пример. 5. Способ обработки клубней картофеля для защиты от грибных патогенов и стимуляции роста картофеля в вегетационный период, а также обработки ботвы картофеля в вегетационный период для защиты от колорадского жука.

Заявляемый способ включает предпосадочную обработку клубней картофеля биопрепаратом в жидкой форме путем полного погружения в него клубней картофеля или смачивания всей поверхности. В качестве жидкой формы биопрепарата используют 1-3%-ный рабочую суспензию спорово-мицелиальной биомассы штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды с титром не менее 105 КОЕ/мл. Обработку клубней картофеля указанным рабочим составом биопрепарата производят однократно перед посадкой с расходом рабочей суспензии биопрепарата 10 литров на 1 тонну картофеля.

Предпосадочная обработка клубней картофеля обеспечивает защиту от грибных патогенов и стимуляцию роста картофеля в вегетационный период, что подтверждается, результататами полевых испытаний по стимуляции роста картофеля в вегетационный период и защиты его от ризоктониоза (см. пункт 3.2 примера 3).

Далее заявляемый способ включает опрыскивание картофеля в вегетационный период водным раствором биопрепарата распылением. В качестве водного раствора биопрепарата используют спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды с титром не менее 106 КОЕ/мл и расходом водного раствора биопрепарата 300 л на 1 гектар площади посадки картофеля.

Для защиты от колорадского жука посадки картофеля в вегетационный период опрыскивают водной суспензией В. bassiana IC 1530-25-1 с титром 1×106 КОЕ/мл (при преобладании личинок 1-2 возрастов) или 1×107 - разных личиночных возрастов и имаго. Способ нанесения биоагента - наземное механизированное опрыскивание (ОП-2000-М, агрегатируемый с МТ3-82). Расход рабочей жидкости из расчета 300 л/га (300 мл исходной концентрации В. bassiana IC 1530-25-1 с титром 1×109 КОЕ/мл).

Для защиты небольших площадей посадок картофеля в частном секторе в период отрождения личинок колорадского жука препарат применяется в виде водной суспензии (3 мл маточного состава - 1×109 КОЕ/мл) в объеме 3 л/100 м2 (на 1 сотку), используя ручной опрыскиватель с мелким распылом (например - марки «Квазар»).

В результате проведенной серии экспериментов (лабораторных, полевых, модельных, производственных) выявилась общая картина эффектов от применения грибного штамма на картофеле, который обладал не только инсектицидной активностью (при опрыскивании посадок картофеля), но и антифунгальным и ростосимулирующее действием (при обработке клубней перед посадкой), что способствовала получению здорового, качественного и более высокого урожая (см. лабораторные данные и результаты полевых испытаний п.п. 4.2 и 4.3 примера 4).

Таким образом, из описания изобретения видно достижение заявляемого технического результата, а именно: получен штамм гриба Beauveria bassiana, обладающего свойством защиты картофеля от колорадского жука, возбудителей парши, особенно - грибного патогена Thanatephorus cucumeris (несовершенная стадия гриба - Rhizoctonia solani), вызывающего ризоктониоз или черную паршу картофеля, а также обладающий свойством стимулирования роста картофеля в вегетационный период.

1. Штамм гриба Beauveria bassiana IC 1530-25-1, для производства биопрепарата против колорадского жука, грибных патогенов и стимуляции роста картофеля в вегитационный период, депонированного в Биоресурсном Центре Всероссийской Коллекции Микроорганизмов (БРЦ ВКПМ) НИЦ «Курчатовский институт» - ГосНИИ генетика, регистрационный номер ВКПМ: F-1447.

2. Биопрепарат против колорадского жука, грибных патогенов и стимуляции роста картофеля в вегетационный период, включающий суспензию культуральной жидкости микроорганизма, отличающийся тем, что в качестве суспензии культуральной жидкости микроорганизма он содержит спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 по п. 1 формулы с титром не менее 109 КОЕ/мл и компоненты питательной среды после культивирования указанного штамма энтомопатогенного гриба.

3. Способ стимуляции роста картофеля в вегетационный период, защиты его от колорадского жука и грибных патогенов, включающий предпосадочную обработку клубней картофеля биопрепаратом в жидкой форме путем погружения в него клубней картофеля и/или опрыскивание картофеля в вегетационный период водным раствором биопрепарата распылением, отличающийся тем, что при предпосадочной обработке клубней картофеля в качестве жидкой формы биопрепарата используют 1-3%-ный водный раствор спорово-мицелиальной биомассы штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды по пп. 1, 2 формулы с титром не менее 105 КОЕ/мл, обработку клубней картофеля указанным водным раствором биопрепарата производят однократно с расходом водного раствора биопрепарата 10 литров на 1 тонну картофеля, а при опрыскивании картофеля в вегетационный период водным раствором биопрепарата в качестве него используют спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды по пп. 1, 2 формулы с титром не менее 106 КОЕ/мл и расходом водного раствора биопрепарата 300 л на 1 гектар площади посадки картофеля.



 

Похожие патенты:

Изобретение относится к биотехнологии. Штамм Emericellopsis alkalina депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ F-1428.

Изобретение относится к лабораторной микологии. Питательная среда для получения дрожжевых клеток диморфного микроскопического гриба Histoplasma capsulatum содержит сернокислотный гидролизат рыбной муки, ферментированную кровь как стимулятор роста гемофильных микроорганизмов, дрожжевой экстракт, сульфит натрия, L-цистеин, сернокислый магний, агар микробиологический, ферментативный пептон, хлористый натрий, дефибринированную кровь животного, L-цистин, D-глюкозу, RPMI 1640 - концентрат раствора витаминов и дистиллированную воду при заданном содержании компонентов.

Изобретение относится к микробиологии. Штамм гриба Alternaria sonchi S-102-15, депонированный в Государственной коллекции микроорганизмов ВИЗР под номером Г-52 ВИЗР, обладает гербицидной активностью в отношении осота полевого (Sonchus arvensis L.).

Изобретение относится к биотехнологии. Предложен штамм гриба Stagonospora cirsii, являющийся продуцентом гербарумина I и стагонолида А.

Изобретение относится к штамму Glomus iranicum var. tenuihypharum var.

Изобретение относится к области биотехнологии. Предложены штамм Trichoderma reesei ВКМ F-4789D, способ получения кормового комплексного ферментного препарата и способ повышения кормовой ценности зерновых и зернобобовых смесей.

Группа изобретений относится к области биотехнологии. Предложен рекомбинантный штамм мицелиального гриба Penicillium verruculosum EЕ-105, депонированный во Всероссийской коллекции микроорганизмов под номером ВКМ F-4812D, продуцент эндо1,4-β-глюканазы II Penicillium verruculosum и эндо1,4-β-глюканазы I Trichoderma reesei.

Изобретение относится к биотехнологии и может быть использовано для детекции гриба Microsporum canis, являющегося возбудителем микроспории. Предлагаемая питательная среда содержит глюкозу, пептон, агар, хитозан низкомолекулярный пищевой водорастворимый и дистиллированную воду при заданном содержании компонентов.

Изобретение относится к биотехнологии. Способ культивирования микромицета Trichoderma virens включает подготовку плотной питательной среды, на поверхность которой вносят порошок из минерала шунгита и посев на нее микромицета Trichoderma virens с последующим культивированием под воздействием постоянного магнитного поля при комнатной температуре.

Изобретение относится к биотехнологии. Предложен биокомпозитный материал для очистки сточных вод от фосфатов, включающий микроорганизмы-деструкторы фосфатов Bacillus sp.
Изобретение относится к области биотехнологии. Изобретение представляет собой способ защиты картофеля от проволочника, заключающийся во внесении отпугивающего препарата.

Изобретение относится к биотехнологии. Предложен штамм гриба Stagonospora cirsii, являющийся продуцентом гербарумина I и стагонолида А.

Группа изобретений относится к биотехнологии и включает кристаллообразующий штамм бактерий Brevibacillus laterosporus ВКПМ В-13186 и варианты его применения. Предлагаемый штамм является спорообразующим и обладает широким спектром антагонистической активности против различных видов организмов, что позволяет использовать его как эффективный биоцид.

Изобретение относится к ветеринарной санитарии, в частности, к дезинфекции животноводческих помещений в присутствии животных. Раскрыт способ дезинфекции животноводческих помещений при температуре от -2,0±0,5°С до 10±0,1°С в присутствии животных, согласно которому в качестве дезинфицирующего средства используют суспензию штаммов бактерий «Bacillus subtilis ТНП-3-ДЕП» и «Bacillus subtilis ТНП-5-ДЕП» в равных соотношениях с концентрацией 1×109 КОЕ в 1 мл с расходом 400 мл/м2.

Изобретение относится к сельскому хозяйству. Средство для предпосевной обработки клубней картофеля содержит салициловую кислоту, метаболиты гриба Trichoderma, селен и источник магния при следующем соотношении компонентов, масс.
Изобретение относится к сельскому хозяйству. Для получения инсектоакарицидного препарата для хранения зерна и обработки зернохранилищ диатомит измельчают на мельнице и сушат, после чего отделяют с помощью блока циклонов целевую фракцию с размером частиц 5-100 мкм, очищенную от примесных минералов, которую подают в печь с потоком воздуха, подвергают обжигу и затем осаждают обожженный порошок.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ борьбы с гусеницами непарного шелкопряда (Lymantria dispar), включающий использование инсектицида на основе антисмыслового фрагмента ДНК, избирательно действующего на личинок насекомых определенного вида, где проводят контактную обработку пульверизатором гусениц насекомого водным раствором короткого 11 нуклеотидов длиной антисмыслового фрагмента ДНК гена 5,8S рибосомальной РНК непарного шелкопряда с последовательностью 5'-TGCGTTGAAA-3' в концентрации 200 пмоль/мкл таким образом, чтобы на гусеницу I-II возраста попало не менее 0,3 мкл раствора.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ защиты растений, включающий посев растений, привлекающих естественных врагов вредителей, размножение энтомофагов с последующей интродукцией в природу, создание островков безопасности их деятельности и распространения, установку на защищаемых территориях рабочих емкостей со стабильными благоприятными микроэкологическими условиями для развития и функционирования живых объектов защиты растений - полезной флоры, микрофлоры и фауны, где в целях искусственного территориального сближения естественных врагов с патогенами и вредителями растений для их успешного уничтожения емкости со стабильными благоприятными микроэкологическими условиями для развития и функционирования живых объектов защиты растений - полезной флоры, микрофлоры и фауны - остаются открытыми, а находящиеся в них агенты биоэкологической борьбы питаются вредными организмами, привлекаемыми желтыми флажками, которые служат также ориентирами для быстрого нахождения и пополнения запасов агентов биоэкологической борьбы в случае их неожиданной гибели.

Группа изобретений относится к биотехнологии. Предложены пестицидная смесь, включающая Bacillus amyloliquefaciens AP-188 (NRRL B-50331; NRRL B-50615); агрохимическая композиция, содержащая смесь и инертное вспомогательное вещество; комплект для приготовления пестицидной композиции; способ борьбы с вредителями растений, предусматривающий обработку растений, материала для размножения растений или почвы эффективным количеством смеси; материал для размножения растений, представляющий семена, стебель или луковицы растений, обработанные смесью.

Группа изобретений относится к штамму бактерии Bacillus subtilis ssp. shriramensis, проявляющему противомикробную и/или противогрибковую активность и активность, стимулирующую рост растений.

Изобретение относится к области биотехнологии. Изобретение представляет собой штамм энтомопатогенного гриба Beauveria bassiana IC 1530-25-1, способ, включающий предпосадочную обработку клубней картофеля биопрепаратом и биопрепарат. При предпосадочной обработке клубней картофеля в качестве жидкой формы биопрепарата используют 1-3-ный водный раствор спорово-мицелиальной биомассы штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды с титром не менее 105 КОЕмл. Обработку клубней картофеля указанным водным раствором биопрепарата производят однократно с расходом водного раствора биопрепарата 10 литров на 1 тонну картофеля. При опрыскивании картофеля в вегетационный период водным раствором биопрепарата в качестве него используют спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды титром не менее 106 КОЕмл и расходом водного раствора биопрепарата 300 л на 1 гектар площади посадки картофеля. Изобретение позволяет защитить картофель от колорадского жука, грибного патогена Thanatephorus cucumeris, вызывающего ризоктониоз или черную паршу картофеля, а также стимулирует рост картофеля в вегетационный период. 3 н.п. ф-лы, 12 табл.

Наверх