Применение ламинина в культуре клеток эндотелия роговицы

Изобретение относится к области биотехнологии. Предложена композиция для активации роста дифференцированных эндотелиальных клеток роговицы, содержащая эффективное количество, по меньшей мере, одного из ламинина 511, и/или ламинина 521, и/или его функционального фрагмента Е8, которые экспрессируются в эндотелиальных клетках роговицы. Изобретение может быть использовано в медицине. 6 н. и 4 з.п. ф-лы, 12 ил., 2 табл., 5 пр.

 

Подробное описание изобретения

Область техники, к которой относится изобретение

Данное изобретение относится к использованию ламинина как компонента культивирования или выращивания культуры клеток эндотелия роговицы. Конкретно, данное изобретение относится к композиции, контейнеру, способу культивирования и подобному, содержащим ламинин, для культивирования или выращивания эндотелиальных клеток роговицы.

Предшествующий уровень техники

Эндотелиальные клетки роговицы человека присутствуют при рождении с плотностью около 3000 клеток на квадратный миллиметр. Однако при повреждении эндотелиальные клетки роговицы человека не обладают способностью к регенерации. При таких обстоятельствах эндотелиальные клетки роговицы признаются трудными для культивирования. Вследствие современного состояния [в данной области], когда затруднительно культивировать или выращивать эндотелиальные клетки роговицы трансплантационными технологиями, лечение или хирургия эндотелия роговицы практически невозможны. В Японии, где на национальном уровне ежегодно выполняется приблизительно 1700 операций по трансплантации роговицы при около 2600 пациентов, ожидающих трансплантации роговицы, существует недостаток донорского материала роговицы.

[Список цитируемой литературы]

[Патентная литература]

[PTL 1] Открытая публикация Японии No. 2011-78370

[PTL 2] WO 2013/047763

[PTL 3] WO 2011/024070

[PTL 4] WO 2010/140464

[Непатентная литература]

[NPTL 1] Journal of the Medical Society of Toho University Vol. 56, No. 1, Page. 39 (01.01.2009)

[NPTL 2] Nippon Ganka Gakkai Zasshi [Journal of Japanese Ophthalmological Society] Vol. 105, extra edition, Page 196 (03.15.2001)

[NPTL 3] J Biol Chem. Sep 13, 2013. [предварительная электронная публикация]

[NPTL 4] PLoS One. 2013; 8(1):e53648. doi: 10.1371/journal.pone.0053648. Электронная публикация 7 января 2013

[NPTL 5] Cell Adh Migr. Jan-Feb 2013; 7(1):142-9. doi: 10.4161/cam.22125. Электронная публикация 17 октября 2012

[NPTL 6] J Cell Biochem. 15 февраля 2007; 100(3):545-56.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

[Решение проблемы]

Авторы данной патентной заявки совершили данное изобретение благодаря открытию того, что специфический ламинин пригоден для культивирования и выращивания эндотелия роговицы. Таким образом, данное изобретение предоставляет нижеследующие репрезентативные изделия:

(1) Композицию для культивирования или выращивания эндотелиальных клеток роговицы, содержащую, по меньшей мере, один агент, состоящий из ламининов и их фрагментов, которые экспрессируются в эндотелиальных клетках роговицы.

(2) Композицию по п. 1, в которой ламинины, включают в себя ламинин 511 (α5 β1 γ1) и ламинин 512 (α5 β2 γ1).

(3) Композицию по пп. 1 или 2, в которой фрагменты обладают адгезивной способностью эндотелиальных клеток роговицы.

(4) Композицию по какому-либо из пп. 1-3, в которой агент представляет собой ламинин 511, ламинин 521 или фрагмент Е8 ламинина 511.

(5) Композицию по какому-либо из пп. 1-4, в которой эндотелиальные клетки роговицы являются клетками человека.

(6) Среду для культивирования эндотелиальных клеток роговицы, содержащую композицию по какому-либо из пп. 1-5.

(7) Культуральный контейнер для эндотелиальных клеток роговицы, который покрыт композицией по п. 1.

(8) Способ культивирования эндотелиальных клеток роговицы, включающий в себя стадию использования композиции по какому-либо из пп. 1-5.

(9) Способ культивирования эндотелиальных клеток роговицы, содержащий стадию использования среды по п. 6.

(10) Способ культивирования эндотелиальных клеток роговицы, содержащий стадию использования контейнера по п. 7.

Понятно, что вышеупомянутый признак (признаки) могут быть использованы в комбинации. Дальнейшие варианты осуществления и преимущества данного изобретения будут оценены, если необходимо, специалистами в данной области техники в ходе чтения и понимания подробного описания данного изобретения, представленного ниже.

Полезные эффекты изобретения

Данное изобретение предоставляет компонент, который делает возможным культивирование, поддержание и рост эндотелиальных клеток роговицы (в частности, эндотелиальных клеток роговицы человека).

Краткое описание чертежей

[Фиг. 1] Фиг. 1 представляет собой диаграмму, показывающую экспрессию мРНК различных цепей ламинина в эндотелиальных клетках роговицы человека. Диаграмма, начиная слева, показывает маркер молекулярного веса, цепь α1 ламинина, цепь α2, цепь α3, цепь α4, цепь α5, цепь β1, цепь β2, цепь β3, цепь β4, цепь γ1, цепь γ2 и цепь γ3.

[Фиг. 2] Фиг. 2 показывает экспрессию мРНК различных цепей интегрина в эндотелиальных клетках роговицы человека. Верхний ряд, начиная слева, показывает цепь α1 интегрина, цепь α2, цепь α3, цепь α4, цепь α5, цепь α6, цепь α7, цепь α8, цепь α9, цепь α10, цепь α11, цепь αE, цепь αV и цепь αL. Нижний ряд, начиная слева, показывает цепь αM интегрина, цепь αX, цепь αD, цепь αIIb, цепь β1, цепь β2, цепь β3, цепь β4, цепь β5, цепь β6, цепь β7 и цепь β8.

[Фиг. 3A] Фиг. 3A-Фиг. 3C совместно показывают анализ с помощью проточной цитометрии экспрессии различных цепей интегрина в эндотелиальных клетках роговицы человека. Фиг. 3A показывает анализ экспрессии с помощью проточной цитометрии различных цепей интегрина в эндотелиальных клетках роговицы человека. В верхнем ряду, начиная слева, показаны интегрин α1, α2 и α3. В нижнем ряду, начиная слева, показаны интегрин α4, α5 и α6.

[Фиг. 3B] Фиг. 3B также показывает анализ экспрессии с помощью проточной цитометрии различных цепей интегрина в эндотелиальных клетках роговицы человека. В верхнем ряду, начиная слева, показаны интегрины αE, αV и αL. В нижнем ряду, начиная слева, показывает интегрины αM, αX и αIIb (CD41a).

[Фиг. 3C] Фиг. 3C также показывает анализ с помощью проточной цитометрии экспрессии различных цепей интегрина в эндотелиальных клетках роговицы человека. В верхнем ряду, начиная слева, показаны интегрины αIIb (CD41b), β1 и β2. В нижнем ряду, начиная слева, показаны интегрины β3, β4 и β7.

[Фиг. 4] Фиг. 4 представляет собой картину, показывающую, что ламинин 511 и ламинин 521 активируют клеточную адгезию эндотелиальных клеток роговицы человека. В верхнем ряду, начиная слева, показаны [эффекты] ламинина 511, ламинина 521 и ламинина 211. В нижнем ряду, начиная слева, показано отсутствие покрытия, покрытие FNC и покрытие желатином. Масштабная линейка 50 мкм.

[Фиг. 5] Фиг. 5 представляет собой диаграмму, показывающую, что ламинин 511 и ламинин 521 активируют клеточную адгезию эндотелиальных клеток роговицы человека. По оси y показано количество клеток (% от контроля). По оси x, начиная слева, показано отсутствие покрытия (контроль), ламинин 511, ламинин 521, ламинин 211, покрытие FNC, покрытие желатином и фрагментом Е8 ламинина 511.

[Фиг. 6] Фиг. 6 представляет собой диаграмму, показывающую, что фрагмент Е8 ламинина 511 активирует клеточную адгезию эндотелиальных клеток роговицы человека. По оси y показано количество клеток (% от контроля). По оси x, начиная слева, показано отсутствие покрытия (контроль), каждая концентрация фрагмента Е8 ламинина 511 (в следующем порядке: 0,001 мкг/см2, 0,01 мкг/см2, 0,1 мкг/см2, 0,5 мкг/см2, 1,0 мкг/см2 и 1,5 мкг/см2) и покрытие смесью FNC.

[Фиг. 7] Фиг. 7 представляет собой диаграмму, показывающую, что ламинин 511, ламинин 521 и фрагменты Е8 ламинина 511 активируют клеточную адгезию эндотелиальных клеток роговицы человека. По оси y показаны относительные значения (%) поглощения BrdU по отношению к контролю. По оси x, начиная слева, показано отсутствие покрытия (контроль), ламинин 511, ламинин 521, ламинин 211, покрытие смесью FNC и фрагментами Е8 ламинина 511 (начиная слева, 0,5 мкг/см2, 1,0 мкг/см2 и 1,5 мкг/см2).

[Фиг. 8] Фиг. 8 представляет собой фотографии фазо-контрастной микроскопии на 2-й день культивирования, показывающие, что ламинин 511 и ламинин 521 увеличивают эффективность культивирования эндотелиальных клеток роговицы человека. Вверху слева показан ламинин 511, вверху справа показан ламинин 521, внизу слева показан ламинин 211 и внизу справа показано отсутствие покрытия. Масштабный отрезок соответствует 100 мкм.

[Фиг. 9] Фиг. 9 представляет собой фотографии фазо-контрастной микроскопии на 20-й день культивирования, показывающие, что ламинин 511 и ламинин 521 делают возможным культивирование эндотелиальных клеток роговицы человека при высокой плотности клеток. Вверху слева показан ламинин 511, вверху справа показан ламинин 521, внизу слева показан ламинин 211 и внизу справа показано отсутствие покрытия. Масштабный отрезок соответствует 100 мкм.

[Фиг. 10] Фиг. 10 представляет собой фотографии, показывающие, что ламинин 511 и ламинин 521 делают возможным культивирование эндотелиальных клеток роговицы человека с высокой плотностью клеток. Красный цвет соответствует Na+/K+-АТФазе, а синий цвет соответствует DAPI (4',6-диамидино-2-фенилиндол). Вверху слева показан ламинин 511, вверху справа показан ламинин 521, внизу слева показан ламинин 211, а внизу справа показано отсутствие покрытия. Масштабный отрезок соответствует 100 мкм.

[Фиг. 11] Фиг. 11 представляет собой фотографии, показывающие, что ламинин 511 и ламинин 521 делают возможным культивирование эндотелиальных клеток роговицы человека при высокой плотности клеток. Зеленый цвет соответствует ZO-1, а синий цвет соответствует DAPI. Вверху слева показан ламинин 511, вверху справа показан ламинин 521, внизу слева показан ламинин 211, а внизу справа показано отсутствие покрытия. Масштабный отрезок соответствует 100 мкм.

[Фиг. 12] Фиг. 12 представляет собой диаграмму, показывающую, что клеточная адгезия эндотелиальных клеток роговицы человека активируется также в культуре, в которую ламинин 521 и фрагмент Е8 ламинина 511 добавлены в культуральную среду. По оси y показано количество клеток (% по отношению к контролю). По оси x, начиная слева, показано отсутствие покрытия (контроль), каждая из концентраций ламинина 521 (в следующем порядке: 1,0 мкг/см2, 2,0 мкг/см2 и 4,0 мкг/см2), каждая концентрация фрагментов Е8 ламинина 511 (в следующем порядке: 1,0 мкг/см2, 2,0 мкг/см2 и 4,0 мкг/см2) и покрытие смесью FNC.

Описание вариантов осуществления

Данное изобретение описано ниже. Во всем данном описании выражения в единственном числе следует понимать как охватывающие и множественное число для данного понятия, если иное не обозначено конкретно. Таким образом, артикли единственного числа (например, «a», «an», «the» и подобные в английском тексте) следует понимать как охватывающие форму множественного числа понятия, если иное не обозначено конкретно. Далее, термины, используемые в данном документе, следует понимать как используемые в общепринятом значении в данной области техники, если иное не обозначено конкретно. Таким образом, если не определено иное, все конкретные технические термины и научная терминология, использованные в данном документе, обладают теми же значениями, которые обычно понятны специалистам в данной области техники, к которой относится данное изобретение. В случае противоречий, данное описание (включая в себя определения) имеет более высокую юридическую силу.

[0008] (Определение)

Так, как это использовано в данном документе, «эндотелиальная клетка роговицы» используется в значении, общепринятом в данной области техники. Роговица представляет собой одну из пластинчатых тканей, образующих глаз. Роговица прозрачна и располагается в части [организма], наиболее близкой к внешней среде. Считается, что у человека роговица состоит из пяти слоев, начиная снаружи (с поверхности тела): эпителий роговицы, боуменова мембрана (передняя пограничная мембрана), собственно вещество роговицы*, десцеметова мембрана (базальная мембрана эндотелия роговицы) и эндотелий роговицы. В частности, если не оговорено иное, части, отличные от эпителия и эндотелия, могут быть обозначены вместе как «строма роговицы» и так и именуются в данном документе. Так, как это используется в данном документе, «HCEC» представляет собой аббревиатуру для эндотелиальных клеток роговицы человека. Понятно, что для эндотелиальных клеток роговицы, использованных в данном изобретении, могут быть использованы клетки, встречающиеся в природе, так же, как и клетки, дифференцированные из стволовых клеток, т.е., клеток, индуцированных к дифференцировке, из iPS или подобных.

[0009] Так, как это используется в данном документе, [термин] «изолированный» относится к состоянию, когда количество материала, которое в естественных условиях сопутствует клеткам в нормальной среде, по меньшей мере, уменьшено и предпочтительно к состоянию, в котором клетки практически свободны от таких материалов. Таким образом, изолированная клетка, ткань или подобное обозначает, что они практически свободны от другого материала (например, от других клеток, белка или нуклеиновой кислоты), которые сопутствуют клеткам в естественной среде.

[0010] Так, как это используется в данном документе, «формы эндотелия роговицы» обозначают какие-либо формы или лечебное средство, содержащие эндотелий роговицы или клетки эндотелия роговицы. Поскольку эндотелиальным клеткам роговицы, которые продуцируются и культивируются способом по данному изобретению, может быть придана [лекарственная] форма, форма/средство эндотелия роговицы может быть произведена с использованием эндотелиальных клеток роговицы, которые культивируются и продуцируются способом по данному изобретению.

[0011] Так, как это используется в данном документе, «внеклеточный матрикс» также именуется (ECM) и обозначает материал, который присутствует между соматическими клетками, независимо от того, являются они эпителиальными клетками или неэпителиальными клетками. Поскольку внеклеточный матрикс в основном продуцируется клетками, внеклеточный матрикс представляет собой биологический материал. Внеклеточный домен вовлечен не только в поддержание ткани, но также в создание внутренней среды, требующейся для выживания всех соматических клеток. Внеклеточный матрикс в основном продуцируется клетками соединительной ткани. Однако часть его секретируется самими клетками, имеющими базальную мембрану, такими как эпителиальные клетки или эндотелиальные клетки. Внеклеточный матрикс грубо подразделяется на фиброзные компоненты и матрикс, который заполняет пространство между фиброзными компонентами. Фиброзные компоненты включают в себя коллагеновые волокна и эластиновые волокна. Основными составляющими матрикса является глюкозоаминогликан (кислый мукополисахарид), большая часть которого образует макромолекулы протеогликанов (комплекс белка с кислым мукополисахаридом) путем связывания с неколлагеновым белком. В дополнение, матрикс содержит ламинин в базальной мембране, микрофибриллы на периферии эластиновых волокон, волокна и гликопротеин, такой как фибронектин на клеточной поверхности. Основная структура является такой же, как в специализированной ткани. Например, в гиалиновом хряще матрикс хряща, содержащий характерно большое количество протеогликанов, продуцируется хондробластами, а в кости костный матрикс, в котором имеет место кальциноз, продуцируется остеобластами. В этом плане репрезентативные материалы, образующие внеклеточный матрикс, включают в себя, но не ограничиваются ими, коллаген I, коллаген III, коллаген IV, коллаген V, эластин, коллаген VIII, витронектин, фибронектин, ламинин, тромбоспондин и протеогликаны (например, декорин, бигликан, фибромодулин, люмикан, гиалуроновая кислота, аггрекан и подобное). По данному изобретению могут быть использованы различные внеклеточные матриксы, играющие роль в клеточной адгезии.

[0012] Так, как это используется в данном документе, «ламинин» представляет собой белок, образующий базальную мембрану внеклеточного матрикса. Ламинин активирует многоклеточность/сборку ткани и их поддержание, клеточную адгезию, клеточную миграцию и клеточный рост и имеет тесную связь с раковыми клетками. Полагают, что ламинин экспрессируется на ранней стадии (стадия 2-х клеток) бластогенеза. Ламинин представляет собой гетеротример, состоящий из одной α-цепи, одной β-цепи и одной γ-цепи. Для наименования ламининов известна номенклатура в порядке их открытия (ламинин-1, ламинин-2 и т.д.). Однако, поскольку связь с субъединицами не учитывалась, также описан новый способ наименования, который учитывает названия подклассов α, β или γ (трехзначное число, в котором цифра в разряде сотен показывает количество α-[цепей], цифра в разряде десятков показывает количество β, а цифра в разряде единиц показывает количество γ) и используется в данном документе. В случае α1, β1 и γ1, такой ламинин именуется ламинин 111. Для ламинина открыты пять типов α-цепей, 3 типа β-цепей и три типа γ-цепей. Таким образом, теоретическое максимальное количество комбинаций составляет 5×3×3=45, и возможны 45 типов молекул ламинина. Однако полагают, что не все комбинации существуют в природе. Каждая субъединица именуется LAMA1, LAMA2, LAMA3, LAMA4 или LAMA5 для α-цепи, LAMB1, LAMB2 или LAMB3 для β-цепи и LAMC1, LAMC2 или LAMC3 для γ-цепи. Ламининовые белки, используемые по данному изобретению, могут иметь природную форму или модифицированную форму, в которой один или более аминокислотных остатков модифицированы при сохранении биологической активности, особенно активности, запускающей клеточную адгезию. Далее, ламининовые белки по данному изобретению не ограничиваются происхождением, способом их продукции или подобным, если только ламининовый белок обладает признаками, описанными в данном документе. Таким образом, ламининовые белки, используемые по данному изобретению, могут быть какими-либо встречающимися в природе белками, белками, экспрессирующимися рекомбинантной ДНК генно-инженерным способом, или химически синтезированными белками. Происхождение ламининовых белков, используемых по данному изобретению, конкретно не ограничено, но предпочтительно они человеческого происхождения. При культивировании клеток человека для целей получения медицинского материала это предпочтительно, но не ограничивается этим, ламинин человеческого происхождения используется, чтобы избежать использования материала, происходящего от другого животного.

[0013] Известно связывание молекул ламинина. α1β1, α2β1, α2β2, α3β1, α6β1, α6β4, α7β1, α9β1, αvβ3, αvβ5, αvβ8 являются интегринами, известными как рецептор ламинина.

[0014] Нижеследующая Таблица описывает репрезентативные ламинины и объяснения к ним.

Состав тримера (название) Основное место экспрессии Специфичность связывания интегрина
α1β1γ1 (ламинин-1)
α1β2γ1 (ламинин-3)
Эмбриональная ткань α5β1
α2β1γ1 (ламинин-2)
α2β2γ1 (ламинин-4)
α2β1γ3 (ламинин-12)
Мышцы, нервы (шванновские клетки) α3β1, α5β1, α3β1
α3β3γ2 (ламинин-5)
α3β1γ1 (ламинин-6)
α3β2γ1 (ламинин-7)
Кожа, легкие и другие эпителиальные ткани α3β1, α5β1
α4β1γ1 (ламинин-8)
α4β2γ1 (ламинин-9)
Кровеносные сосуды α5β1,α3β1
α5β1γ1 (ламинин-10)
α5β2γ1 (ламинин-11)
Кровеносные сосуды, печень, легкие и другие эпителиальные ткани α3β1, α5β1

[0015] Так, как это используется в данном документе, «цепь α1» (LAMA1) представляет собой субъединицу белка ламинина·- молекулы клеточной адгезии во внеклеточном матриксе и именуется LAMA1, LAMA, S-LAM-α или подобным образом. Для LAMA1 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_005559 и NP_005550, соответственно. Идентификация по OMIM (онлайн-каталог фенетических маркеров у человека) имеет номер доступа 150320. При использовании для целей данного документа следует понимать, что «цепь α1» или «LAMA1» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0016] Так, как это используется в данном документе, «цепь α2» (LAMA2) представляет собой субъединицу белка ламинина·- молекулы клеточной адгезии во внеклеточном матриксе, и именуется LAMA2, LAMM или подобным образом. Для LAMA2 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_000426 и NP_000417, соответственно. Идентификация по OMIM имеет номер доступа 156225. При использовании для целей данного документа следует понимать, что «цепь α1» или «LAMA1» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0017] Так, как это используется в данном документе, «цепь α3» (LAMA3) представляет собой субъединицу белка ламинина·- молекулы клеточной адгезии во внеклеточном матриксе, и именуется LAMA3, BM600, E170, LAMNA, LOCS, lama3a или подобным образом. Для LAMA3 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_000227 и NP_000218, соответственно. Идентификация по OMIM имеет номер доступа 600805. При использовании для целей данного документа следует понимать, что «цепь α3» или «LAMA3» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0018] Так, как это используется в данном документе, «цепь α4» (LAMA4) представляет собой субъединицу белка ламинина··- молекулы клеточной адгезии во внеклеточном матриксе, и именуется LAMA4, LAMA3, LAMA4*-1, CMD1JJ или подобным образом. Для LAMA4 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_001105206 и NP_001098676, соответственно. Идентификация по OMIM имеет номер доступа 600133. При использовании для целей данного документа следует понимать, что «цепь α4» или «LAMA4» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0019] Так, как это используется в данном документе, «цепь α5» (LAMA5) представляет собой субъединицу белка ламинина··- молекулы клеточной адгезии во внеклеточном матриксе, и именуется LAMA5, KIAA1907 или подобным образом. Для LAMA5 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_005560 и NP_005551, соответственно. Идентификация по OMIM имеет номер доступа 601033. При использовании для целей данного документа следует понимать, что «цепь α5» или «LAMA5» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0020] Так, как это используется в данном документе, «цепь β1» (LAMB1) представляет собой субъединицу белка ламинина·- молекулы клеточной адгезии во внеклеточном матриксе, и именуется LAMB1, CLM, LIS5 или подобным образом. Для LAMB1 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_002291 и NP_002282, соответственно. Идентификация по OMIM имеет номер доступа 150240. При использовании для целей данного документа следует понимать, что «цепь β1» или «LAMB1» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0021] Так, как это используется в данном документе, «цепь β2» (LAMB2) (ламинин S) представляет собой субъединицу белка ламинина·- молекулы клеточной адгезии во внеклеточном матриксе, и именуется LAMB2, LAMS, NPHS5 или подобным образом. Для LAMB2 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_002292 и NP_002283, соответственно. Идентификация по OMIM имеет номер доступа 150325. При использовании для целей данного документа следует понимать, что «цепь β2» или «LAMB2» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0022] Так, как это используется в данном документе, «цепь β3» (LAMB3) представляет собой субъединицу белка ламинина··- молекулы клеточной адгезии во внеклеточном матриксе, и именуется LAMB3, BM600-125KDA, LAM5, LAMNB1 или подобным образом. Для LAMB3 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_000228 и NP_000219, соответственно. Идентификация по OMIM имеет номер доступа 150310. При использовании для целей данного документа следует понимать, что «цепь β3» или «LAMB3» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0023] Так, как это используется в данном документе, «цепь γ1» (LAMC1) представляет собой субъединицу белка ламинина·- молекулы клеточной адгезии во внеклеточном матриксе, и именуется LAMC1, LAMB2 или подобным образом. Для LAMC1 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_002293 и NP_002284, соответственно. Идентификация по OMIM имеет номер доступа 150290. При использовании для целей данного документа следует понимать, что «цепь γ1» или «LAMC1» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0024] Так, как это используется в данном документе, «цепь γ2» (LAMC2) представляет собой субъединицу белка ламинина·- молекулы клеточной адгезии во внеклеточном матриксе, и именуется LAMC2, B2T, BM600, CSF, EBR2, EBR2A, LAMB2T, LAMNB2 или подобным образом. Для LAMC2 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_005562 и NP_005553, соответственно. Идентификация по OMIM имеет номер доступа 150292. При использовании для целей данного документа следует понимать, что «цепь γ2» или «LAMC2» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0025] Так, как это используется в данном документе, «цепь γ3» (LAMC3) представляет собой субъединицу белка ламинина·- молекулы клеточной адгезии во внеклеточном матриксе, и именуется LAMC3, OCCM или подобным образом. Для LAMC3 человека последовательности гена и белка зарегистрированы в NCBI под регистрационными номерами NM_006059 и NP_006050, соответственно. Идентификация по OMIM имеет номер доступа 604349. При использовании для целей данного документа следует понимать, что «цепь γ3» или «LAMC3» означает не только белок, имеющий аминокислотную последовательность, описанную под специфическим номером последовательности или номером доступа (или нуклеиновую кислоту, кодирующую белок), но также функционально активное производное, функционально активный фрагмент или их гомологи, или мутант, кодирующий нуклеиновую кислоту, которая гибридизуется с нуклеиновой кислотой, кодирующей белок при высокой или пониженной жесткости условий.

[0026] Так, как это используется в данном документе, «ламинин, экспрессирующийся в эндотелиальных клетках роговицы» относится к типу гена ламинина, который экспрессируется в нормальном состоянии или предпочтительно в значительной степени экспрессируется на уровне белка в эндотелиальных клетках роговицы. Анализом в данном документе подтверждено, что экспрессируются α5, β1, β2 и γ1 (Фиг. 2). Таким образом, по меньшей мере, подтверждено, что в эндотелиальных клетках роговицы экспрессируются ламинин 511 и ламинин 521. Dev.Dyn. 218, 213-234, 2000, и J.Biol.Chem. 277(15), 12741-12748, 2002 содержат подробное описание для ламинина 511. Таким образом, содержание, изложенное в этих документах, включено по ссылке. В случае ламинина 511 или подобного возможно использование коммерчески доступного [вещества]. Например, рекомбинантные белки ламинин 511 и ламинин 521 коммерчески доступны, и их возможно приобрести на фирме BioLamina AB.

[0027] Так, как это используется в данном документе, «экспрессия» гена, полинуклеотид, полипептид или подобное относится к гену или подобному, который подвергается определенному воздействию in vivo, переводящему его в иную форму. Предпочтительно термин относится к гену, полинуклеотиду или подобному, транскрибируемому или транслируемому в форму полипептида. Однако ген, полинуклеотид или подобное, транскрибируемый в результате в мРНК, может быть одной из форм экспрессии. Также предпочтительно, чтобы такая форма полипептида могла подвергаться процессингу после трансляции (обозначаемая в данном документе как дериват). Например, уровень экспрессии любой цепи ламинина может быть определен каким-либо способом. Конкретно, уровень экспрессии любой цепи ламинина может быть найден путем оценки количества мРНК любой цепи ламинина, количества белка любой цепи ламинина и биологической активности белка любой цепи ламинина. Количество мРНК или белка любой цепи ламинина может быть определено способом, описанным в данном документе.

[0028] Так, как это используется в данном документе, [понятие] «функциональный эквивалент» относится к чему-либо, что имеет ту же конечную функцию, но отличную структуру относительно исходной сущности объекта. Таким образом, понятно, что, когда упоминается «группа, состоящая из ламинина или любой цепи ламинина, или их функционального эквивалента» или «группа, состоящая из ламинина, любой цепи ламинина и их функционального эквивалента», здесь охватывается нижеследующее: ламинин или любая цепь ламинина сама по себе, так же как фрагменты, мутанты или варианты ламинина или любой цепи ламинина (например, вариант аминокислотной последовательности или подобное), имеющие одну или более способностей из клеточной адгезии, регуляции дифференцировки и (или) действия, активирующего рост клеток глаза или подобное; и вещества, которые сами могут превращаться в ламинин или любую цепь ламинина или фрагмент, мутант или вариант ламинина или любой цепи ламинина в ходе воздействия (включая в себя, например, нуклеиновую кислоты, кодирующую ламинин или любую цепь ламинина отдельно, или фрагмент, мутант или вариант ламинина или любой цепи ламинина и вектор, клетка или подобное, содержащие такую нуклеиновую кислоту). Репрезентативный пример «группы, состоящей из ламинина или любой цепи ламинина, или их функционального эквивалента» или «группы, состоящей из ламинина, любой цепи ламинина и их функционального эквивалента» включает в себя, по меньшей мере, один агент, выбранный из группы, состоящей из ламинина** и его фрагментов. По данному изобретению понятно, что функциональный эквивалент ламинина или любой цепи ламинина могут быть использованы сходным образом с ламинином или любой цепью ламинина без какого-либо конкретного его упоминания.

[0029] Так, как это используется в данном документе, [термин] «фрагмент» относится к полипептиду или полинуклеотиду с последовательностью длиной от 1 до n-1 по отношению к полной длине полипептида или полинуклеотида (длина n). Длина фрагмента может быть надлежащим образом изменена в соответствии с задачей. Например, для полипептида нижний предел его длины включает в себя 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50 и более аминокислот. В дополнение, длины, представленные числами, которые конкретно не перечислены в данном документе (например, 11 и подобные), могут также быть пригодны в качестве нижнего предела. Кроме того, для полинуклеотида нижний предел его длины включает в себя 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100 и более нуклеотидов. В дополнение, длины, представленные числами, которые конкретно не перечислены в данном документе (например, 11 и подобные) могут также быть подходящими в качестве нижнего предела. В данном документе понятно, что сами по себе фрагменты такой цепи ламинина, когда они функционируют как фактор активности, например, запуск роста или его поддержание, находятся в сфере данного изобретения. По данному изобретению, так, как это используется в данном документе, термин «активность» обозначает функцию молекулы в самом широком понимании. Активность в основном охватывает, но не направлена на ограничение этим, биологическую функцию, биохимическую функцию, физическую функцию или химическую функцию молекулы. Активность охватывает, например, ферментативную активность, способность взаимодействовать с другой молекулой и способность активировать, запускать, стабилизировать, ингибировать, подавлять или дестабилизировать функцию другой молекулы, стабильность и способность локализоваться в специфическом положении в клетке. Когда это применимо, термин направлен на функцию белкового комплекса в наиболее широком значении. Так, как это используется в данном документе, «биологическая функция», когда делается ссылка на ген или нуклеиновую кислоту, или связанный с ними полипептид, относится к специфической функции, которую ген, нуклеиновая кислота или полипептид могут иметь в живом организме. «Биологическая функция» включает в себя, но не ограничивается этим, формирование специфических антител, ферментативную активность, дающую сопротивляемость и подобное. Так, как это используется в данном документе, биологическая функция может быть вызвана «биологической активностью». Так, как это используется в данном документе, «биологическая активность» относится к активности, которую фактор (например, полинуклеотид и белок) может иметь в живом организме, и активность, влияющую на множество функций (например, активность, запускающую транскрипцию). Например, также охватывается активность активации или деактивации молекулы во взаимодействии с другой молекулой. Когда взаимодействуют два фактора, их биологическая активность может рассматриваться как связывание двух молекул и вызванные этим биологические изменения, например, в случае, когда две молекулы связываются при совместной преципитации при использовании антитела против любой из этих молекул. Таким образом, способ определения включает в себя наблюдение такой совместной преципитации. Например, когда фактор представляет собой фермент, его биологическая активность охватывает его ферментативную активность. В другом примере, когда фактор представляет собой лиганд, охватывается его связывание с соответствующим рецептором. Такая биологическая активность может быть измерена технологией, хорошо известной в данной области техники. Таким образом, «активность» относится к различным измеримым индикаторам, которые показывают или выявляют связывание (прямо или косвенно) или вызывают ответ (т.е., имеют измеримый эффект в ответ на какое-либо воздействие или стимуляцию). Например, «активность» включает в себя соединение, которое связывает полипептид или полинуклеотид по данному изобретению, количество белков, которое увеличивается или уменьшается после некоего воздействия или стимуляции, или измерение другой аналогичной функции.

[0030] [Термин] «функционально активный» так, как это используется в данном документе, относится к полипептиду, фрагменту или производному, имеющему биохимическую функцию, регуляторную функцию или структурную функцию белка, такую как биологическая активность в соответствии с вариантом осуществления, связанным с полипептидом, фрагментом или дериватом по данному изобретению.

[0031] Так, как это используется в данном документе, [термин] «фрагмент» ламинина относится к какому-либо фрагменту ламинина. Что касается агента, используемого в данном изобретении, следует понимать, что не только полноразмерный ламинин, но также фрагмент ламинина может быть использован постольку, поскольку фрагмент сохраняет функцию полноразмерного ламинина, особенно способность к клеточной адгезии эндотелиальных клеток. Таким образом, фрагмент ламинина, используемый в данном изобретении, в целом имеет, по меньшей мере, один признак ламинина. Такой признак может охватывать, в частности, способность к клеточной адгезии эндотелиальных клеток.

[0032] Последовательность ламинина, которая, как было обнаружено, экспрессируется в эндотелиальных клетках роговицы, по данному изобретению, будет описана ниже. Ясно, что эти ламинины показывают предпочтительные репрезентативные примеры по данному изобретению, и данное изобретение не ограничено этими специфическими подтипами ламинина.

[0033] Репрезентативная нуклеотидная последовательность цепи α5 ламинина может представлять собой

(a) полинуклеотид, имеющий последовательность оснований, описанную в SEQ ID NO: 1, или фрагмент его последовательности;

(b) полинуклеотид, кодирующий полипептид, состоящий из аминокислотной последовательности, описанной в SEQ ID NO: 2, или его фрагмент;

(c) полинуклеотид, кодирующий вариант полипептида или его фрагмент, в котором одна или более аминокислот являются мутациями, выбранными из группы, состоящей из замещения, вставки и делеции в аминокислотной последовательности, описанной в SEQ ID NO: 2, в которой вариант полипептида обладает биологической активностью;

(d) полинуклеотид, который представляет собой аллель или сплайс-мутацию последовательности оснований, описанной в SEQ ID NO: 1, или ее фрагмент;

(e) полинуклеотид, кодирующий видовой гомолог полипептида, состоящего из аминокислотной последовательности, описанной в SEQ ID NO: 2, или его фрагмент;

(f) полинуклеотид, который гибридизуется с полинуклеотидом по какому-либо из пп. (a) - (e) при жестких условиях и кодирует полипептид, обладающий биологической активностью; или

(g) полинуклеотид, состоящий из последовательности оснований с идентичностью, по меньшей мере, 70%, 80%, 90%, 95%, 96%, 97%, 98% или 99% с полинуклеотидом по одному из пп. (a) - (e) или ее комплементарной последовательностью и кодирующей полипептид, обладающий биологической активностью. В этом отношении биологическая активность обычно относится к активности цепи α5 ламинина. По цепям α5 возможна ссылка на Doi M et al., J.Biol.Chem. 277(15), 12741-12748, 2002 и Патент США No. 6,933,273.

[0034] Аминокислотная последовательность цепи α5 ламинина может представлять собой

(a) полипептид, содержащий аминокислотную последовательность, описанную в SEQ ID NO: 2 или его фрагмент;

(b) полипептид, имеющий биологическую активность и одну или более аминокислот с мутацией, выбранной из группы, состоящей из замены, вставки или делеции в аминокислотной последовательности, описанной в SEQ ID NO: 2;

(c) полипептид, кодируемый аллелью или сплайс-мутант последовательности оснований, описанной в SEQ ID NO: 1;

(d) полипептид, который представляет собой видовой гомолог аминокислотной последовательности, описанной в SEQ ID NO: 2; или

(e) полипептид, имеющий аминокислотную последовательность идентичной, по меньшей мере, 70%, 80%, 90%, 95%, 96%, 97%, 98% или 99% полипептиду по какому-либо из пп. (a) - (d). В этом отношении биологическая активность обычно относится к активности цепи α5 ламинина. По цепям α5 возможна ссылка на Doi M et al., J.Biol.Chem. 277(15), 12741-12748, 2002 и Патент США No. 6, 933, 273.

[0035] Репрезентативная нуклеотидная последовательность цепь β1 ламинина может представлять собой

(a) полинуклеотид, имеющий последовательность оснований, описанную в SEQ ID NO: 3, или его фрагмент;

(b) полинуклеотид, кодирующий полипептид, состоящий из аминокислотной последовательности, описанной в SEQ ID NO: 4, или его фрагмент;

(c) полинуклеотид, кодирующий вариант полипептида или его фрагмент, в котором одна или более аминокислота представляют собой мутацию, выбранную из группы, состоящей из замещения, вставки и делеции в аминокислотной последовательности, описанной в SEQ ID NO: 4, в которой вариант полипептида обладает биологической активностью;

(d) полинуклеотид, который представляет собой аллель или сплайс-мутант последовательности оснований, описанной в SEQ ID NO: 3, или их фрагмент;

(e) полинуклеотид, кодирующий видовой гомолог полипептида, состоящего из аминокислотной последовательности, описанной в SEQ ID NO: 4, или ее фрагмента;

(f) полинуклеотид, который гибридизуется с полинуклеотидом по одному из пп. (a) - (e) при жестких условиях и кодирует полипептид, обладающий биологической активностью; или

(g) полинуклеотид, состоящий из последовательности оснований, идентичных, по меньшей мере, на 70%, 80%, 90%, 95%, 96%, 97%, 98% или 99% полинуклеотиду по одному из пп. (a) - (e) или его комплементарной последовательности, и кодирующий полипептид, обладающий биологической активностью. В этом отношении биологическая активность обычно относится к активности цепи β1 ламинина.

[0036] Аминокислотная последовательность цепи β1 ламинина может представлять собой

(a) полипептид, состоящий из аминокислотной последовательности, описанной в SEQ ID NO: 4, или ее фрагмент;

(b) полипептид, имеющий биологическую активность и одну или более аминокислотных мутаций, выбранных из группы, состоящей из замещения, вставки и делеции в аминокислотной последовательности, описанной в SEQ ID NO: 4;

(c) полипептид, кодируемый аллелью или сплайс-мутантом последовательности оснований, описанной в SEQ ID NO: 3;

(d) полипептид, который представляет собой видовой гомолог аминокислотной последовательности, описанной в SEQ ID NO: 4; или

(e) полипептид, имеющий аминокислотную последовательность, идентичную, по меньшей мере, на 70%, 80%, 90%, 95%, 96%, 97%, 98% или 99% полипептиду по одному из пп. (a) - (d). по цепям β1 возможна ссылка на Pillarainen et al., J. Biol. Chem. 262 (22), 10454-10462, 1987 и Патент США No. 6,933,273.

[0037] Репрезентативная нуклеотидная последовательность цепь β2 ламинина может представлять собой

(a) полинуклеотид, имеющий последовательность оснований, описанную в SEQ ID NO: 5, или фрагмент его последовательности;

(b) полинуклеотид, кодирующий полипептид, состоящий из аминокислотной последовательности, описанной в SEQ ID NO: 6, или его фрагмент;

(c) полинуклеотид, кодирующий вариант полипептида или его фрагмент, в котором одна или более аминокислота имеет мутацию, выбранную из группы, состоящей из замещения, вставки и делеции в аминокислотной последовательности, описанной в SEQ ID NO: 6, в которой вариант полипептида обладает биологической активностью;

(d) полинуклеотид, который представляет собой аллель или сплайс-мутанта последовательности оснований, описанной в SEQ ID NO: 5, или его фрагмент;

(e) полинуклеотид, кодирующий видовой гомолог полипептида, состоящего из аминокислотной последовательности, описанной в SEQ ID NO: 6, или его фрагмент;

(f) полинуклеотид, который гибридизуется с полинуклеотидом по одному из пп. (a)-(e) при жестких условиях и кодирует полипептид, обладающий биологической активностью; или

(g) полинуклеотид, состоящий из последовательности оснований, идентичной, по меньшей мере, на 70%, 80%, 90%, 95%, 96%, 97%, 98% или 99% полинуклеотиду по одному из пп. (a)-(e) или ее комплементарной последовательности, и кодирующей полипептид, обладающий биологической активностью. В этом отношении биологическая активность обычно относится к активности цепи β2 ламинина. По цепям β2 возможна ссылка на Wewer UM et al., Genomics. Nov 15, 1994; 24(2): 243-52, 1987 и Патент США No. 6,933,273.

[0038] Аминокислотная последовательность цепи β2 ламинина может представлять собой

(a) полипептид, состоящий из аминокислотной последовательности, описанной в SEQ ID NO: 6, или его фрагмент;

(b) полипептид, обладающий биологической активностью и одной или более аминокислотными мутациями, выбранными из группы, состоящей из замещения, вставки и делеции в аминокислотной последовательности, описанной в SEQ ID NO: 6;

(c) полипептид, кодируемый аллелью или сплайс-мутантом последовательности оснований, описанной в SEQ ID NO: 5;

(d) полипептид, который представляет собой видовой гомолог аминокислотной последовательности, описанной в SEQ ID NO: 6; или

(e) полипептид, имеющий аминокислотную последовательность, идентичную, по меньшей мере, на 70%, 80%, 90%, 95%, 96%, 97%, 98% или 99% полипептиду по одному из пп. (a)-(d). В этом отношении биологическая активность обычно относится к активности цепи β2 ламинина. По цепям α5*** возможна ссылка на Wewer UM et al., Genomics. Nov 15, 1994; 24(2):243-52., 1987 и Патент США No. 6,933,273.

[0039] Репрезентативная нуклеотидная последовательность цепи γ1 ламинина может представлять собой

(a) полинуклеотид, имеющий последовательность оснований, описанную в SEQ ID NO: 7, или фрагмент такой последовательности;

(b) полинуклеотид, кодирующий полипептид, состоящий из аминокислотной последовательности, описанной в SEQ ID NO: 8, или его фрагмент;

(c) полинуклеотид, кодирующий вариант полипептида или его фрагмент, в котором одна или более аминокислот имеют мутации, выбранные из группы, состоящей из замещения, вставки и делеции в аминокислотной последовательности, описанной в SEQ ID NO: 8, в которой вариант полипептида обладает биологической активностью;

(d) полинуклеотид, который представляет собой аллель или сплайс-мутант последовательности оснований, описанной в SEQ ID NO: 7, или его фрагмент;

(e) полинуклеотид, кодирующий видовой гомолог полипептида, состоящий из аминокислотной последовательности, описанной в SEQ ID NO: 8, или его фрагмент;

(f) полинуклеотид, который гибридизуется с полинуклеотидом по одному из пп. (a)-(e) при жестких условиях и кодирует полипептид, обладающий биологической активностью; или

(g) полинуклеотид, состоящий из последовательности оснований, идентичной, по меньшей мере, на 70%, 80%, 90%, 95%, 96%, 97%, 98% или 99% полинуклеотиду по одному из пп. (a)-(e) или комплементарной ему последовательности, и кодирует полипептид, обладающий биологической активностью. В этом отношении биологическая активность обычно связана с активностью цепи γ1 ламинина. по цепям γ1 возможна ссылка на Pillarainen et al., J.Biol.Chem.263(14), 6751-6758, 1988 и Патент США No. 6,933,273.

[0040] Аминокислотная последовательность цепи γ1 ламинина может представлять собой

(a) полипептид, состоящий из аминокислотной последовательности, описанной в SEQ ID NO: 8, или его фрагмент;

(b) полипептид, обладающий биологической активностью и одну или более аминокислоту с мутацией, выбранные из группы, состоящей из замещения, вставки и делеции в аминокислотной последовательности, описанной в SEQ ID NO: 8;

(c) полипептид, кодируемый аллелью или сплайс-мутантом последовательности оснований, описанной в SEQ ID NO: 7;

(d) полипептид, который представляет собой видовой гомолог аминокислотной последовательности, описанной в SEQ ID NO: 8; или

(e) полипептид, имеющий аминокислотную последовательность, идентичную, по меньшей мере, на 70%, 80%, 90%, 95%, 96%, 97%, 98% или 99% полипептиду по одному из пп. (a)-(d). В этом отношении биологическая активность обычно относится к активности цепи γ1 ламинина. по цепям γ1 возможна ссылка на Pillarainen et al., J.Biol.Chem.263(14), 6751-6758, 1988 и Патент США No. 6,933,273.

[0041] Так, как это используется в данном документе, [термины] «белок», «полипептид», «олигопептид» и «пептид» являются взаимозаменяемыми с одним и тем же значением, и они относятся к полимеру аминокислотной последовательности какой-либо длины. Этот полимер может иметь линейную цепь или разветвленную цепь, или циклическую цепь. Аминокислоты могут быть природными или неприродными, или могут представлять собой измененные аминокислоты. Этот термин может также охватывать таковые, объединенные в комплекс из множества полипептидных цепей. Этот термин также охватывает природные или искусственно измененные полимеры аминокислот. Такие изменения охватывают, например, образование дисульфидных мостиков, гликозилирование, липидизацию, ацетилирование, фосфорилирование или какая-либо иную операцию или изменение (например, сшивка с меченым компонентом). Это определение также охватывает, например, полипептид, содержащий один или более аналогов аминокислоты (например, включает в себя неприродную аминокислоту), пептидоподобное соединение (например, пептоид) и другие изменения, известные в области техники, относящейся к данному предмету. Что касается белка по данному изобретению (например, любой цепи ламинина), ДНК, кодирующая любую из заданных цепей гена, включается в соответствующий вектор, который вводится в эукариотическую или прокариотическую клетку с помощью вектора экспрессии, который способен экспрессироваться в какой-либо [клетке]-хозяине, и, таким образом, соответствующая цепь может быть экспрессирована с получением желаемого белка. Клетки-хозяева, которые могут быть использованы для экспрессии ламинина, включают в себя, без особых ограничений, прокариотические клетки-хозяева, такие как E. coli и bacillus subtilis, и эукариотические клетки-хозяева, такие как дрожжи, грибы, клетки насекомых, растения и растительные клетки и клетки млекопитающих. Векторы, сконструированные для экспрессии выбранной цепи ламинина или подобного, могут быть интродуцированы в вышеупомянутые клетки-хозяева с помощью трансформации, трансфекции, конъюгации, слияния протопластов, электропробоя мембраны, технологии генной пушки, преципитации фосфатом кальция, способом Agrobacterium, прямой микроинъекцией или подобным. Клетки, содержащие векторы, выращиваются в соответствующей культуральной среде, чтобы продуцировать цепи ламинина, используемые по данному изобретению, и цепи ламинина очищают от клеток или культуральной среды, получая, таким образом, цепи ламинина или подобное. Очистка может быть выполнена с помощью гель-фильтрационной хроматографии, жидкостной хроматографии высокого давления (HPLC), ионообменной хроматографии, иммуноаффинной хроматографии или подобного.

[0042] Так, как это используется в данном документе, «аминокислота» может быть природной или неприродной постольку, поскольку это удовлетворяет цели данного изобретения.

[0043] Так, как это используется в данном документе, [термины] «полинуклеотид», «олигонуклеотид» и «нуклеиновая кислота» используются взаимозаменяемо с одним и тем же значением, и они относятся к полимеру нуклеотидов какой-либо длины. Эти термины также включают в себя «производные олигонуклеотидов» или «производные полинуклеотидов». [Термины] «производное олигонуклеотида» или «производное полинуклеотида» относятся к олигонуклеотиду или полинуклеотиду, которые включают в себя производное нуклеотида или в котором связи между нуклеотидами отличаются от нормальных связей, и они используются взаимозаменяемо. Что касается такого олигонуклеотида, ниже приводится конкретные примеры: 2'-O-метил-рибонуклеотид; производное олигонуклеотида, в котором фосфодиэфирная связь в олигонуклеотиде преобразована в фосфоротиоатную связь; производное олигонуклеотида, в котором фосфодиэфирная связь в олигонуклеотиде преобразована в N3'-P5' фосфородиамидатную связь; производное олигонуклеотида, в котором рибоза и фосфодиэфирная связь в олигонуклеотиде преобразована в связь пептид-нуклеиновая кислота; производное олигонуклеотида, в котором урацил в олигонуклеотиде замещен на C-5 пропинил урацил; производное олигонуклеотида, в котором урацил в олигонуклеотиде замещен C-5 тиазол урацилом; производное олигонуклеотида, в котором цитозин в олигонуклеотиде замещен на C-5 пропинил цитозин; производное олигонуклеотида, в котором цитозин в олигонуклеотиде замещен феноксазин-модифицированным цитозином; производное олигонуклеотида, в котором рибоза в ДНК замещена на 2'-O-пропилрибозу; и производное олигонуклеотида, в котором рибоза в олигонуклеотиде замещена на 2'-метоксиэтоксирибозу. Если не указано иное, конкретные последовательности нуклеиновых кислот предназначены, чтобы охватить консервативно измененный вариант (например, замещение вырожденного кодона) и его комплементарную последовательность как сходную с однозначно определенными последовательностями. Конкретно, замещение вырожденного кодона может быть достигнуто созданием последовательности, в которой третье положение в одном или более выбранных кодонах замещается (или в них всех) другим основанием и (или) остатком деоксиинозина (Batzer et al., Nucleic Acid Res.19:5081(1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). Так, как это используется в данном документе, «нуклеиновая кислота» взаимозаменяемо используется с [терминами] ген, кДНК, мРНК, олигонуклеотид и полинуклеотид. Так, как это используется в данном документе, «нуклеотид» может быть природным или неприродным.

[0044] Так, как это используется в данном документе, [термин] «ген» относится к агенту, который определяет генетический признак. Обычно гены располагаются в хромосоме в определенном порядке. Ген, который определяет первичную структуру белка, относится к структурным генам, а ген, который влияет на их экспрессию, обозначается как регуляторный ген. В данном документе, «ген» может обозначать «полинуклеотид», «олигонуклеотид» и «нуклеиновую кислоту».

[0045] Аминокислоты могут быть обозначены в данном документе их общеизвестными трехбуквенными кодами или однобуквенным кодом, рекомендованным Комиссией по биохимической номенклатуре IUPAC-IUB. Сходным образом, нуклеотиды могут быть обозначены общепризнанными однобуквенными кодами. В данном документе сравнение сходства, идентичности и гомологии аминокислотных последовательностей и последовательностей оснований рассчитано, исходя из стандартных параметров с помощью инструментов анализа последовательностей BLAST. Сравнение на совпадения проводили, например, с помощью BLAST 2.2.26 (выпуск 30 октября 2011) NCBI. Значения совпадений, использованные в данном документе, обычно относятся к значениям для выравнивания при стандартных условиях с помощью BLAST. Однако если более высокие значения могли быть получены благодаря изменениям параметров, принимались наивысшие значения идентичности. Если идентичность оценивается во множестве участков, как значение идентичности принимается наиболее высокое значение для участков. Сходство представляет собой числовое значение, в котором сходные аминокислоты учитываются при расчете в дополнение к идентичности.

[0046] Так, как это используется в данном документе, «полинуклеотид, гибридизующийся в жестких условиях» обозначает хорошо известные условия, обычно используемые в данной области. Понятно в отношении ламинина, использованного в данном изобретении, что также может быть использован таковой, кодируемый «полинуклеотидом, гибридизованным в жестких условиях» относительно последовательностей нуклеиновых кислот соответствующих конкретно описанным ламининам. С помощью полинуклеотида, выбранного из полинуклеотидов по данному изобретению в качестве зонда, использование технологии гибридизации колоний, технологии гибридизации бляшек или технологии саузерн-блоттинг гибридизации позволяет получить такой полинуклеотид. Конкретно, это означает полинуклеотид, полученный проведением гибридизации при 65°C в присутствии 0,7-1,0 M NaCl с помощью фильтра, на котором иммобилизуется ДНК, полученная из колонии или бляшки, а затем отмывкой фильтра в условиях 65°C раствором SSC (физиологический раствор - цитрат натрия) в 0,1-2-кратной концентрации (в которой композиция раствора SSC однократной концентрации составляет 150 мМ хлористого натрия и 15 мМ цитрата натрия). Гибридизация может быть проведена способами, описанными в экспериментальных документах, таких как Molecular Cloning 2nd ed., Current Protocols in Molecular Biology, Supplement 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford University Press (1995). В данном случае, последовательности, содержащие только последовательность A или последовательность T, предпочтительно исключались из последовательностей, которые гибридизуются при жестких условиях. Поэтому полипептиды (например, транстиретин), использованные в данном изобретении также охватывают полипептид, кодируемый молекулой нуклеиновой кислоты, которая гибридизуется в жестких условиях c молекулой нуклеиновой кислоты, кодирующей полипептид, конкретно описанный в данном изобретении. Такие условия пониженной жесткости включают в себя проведение гибридизации в течение 18-20 часов при 40°C в буфере, содержащем 35% формамида, 5×SSC, 50 мМ Tris-HCl (рН 7,5), 5 мМ ЭДТА, 0,02% PVP, 0,02% бычьего сывороточного альбумина (BSA), 100 мкг/мл денатурированной ДНК спермы лосося и 10% (вес/объем) декстран сульфата; отмывку в течение 1-5 часов при 55°C в буфере, состоящем из 2×SSC, 25 мМ Tris-HCl (рН 7,4), 5 мМ ЭДТА и 0,1% SDS (додецилсульфат натрия); и отмывки в течение 1,5 часов при 60°C в буфере, состоящем из 2xSSC, 25 мМ Tris-HCl (рН 7,4), 5 мМ ЭДТА и 0,1% SDS.

[0047] Что касается функциональных эквивалентов по данному изобретению, могли быть использованы таковые, в которых одна или множество аминокислот вставлены, замещены или делетированы или добавлены с обоих концов в аминокислотную последовательность. В данном документе «одна или множество аминокислот, вставленные, замещенные или делетированные или добавленные к одному или обоим концам аминокислотной последовательности» означают, что изменения проведены путем замещения или подобного в отношении множества аминокислот, которые могут происходить естественным образом с помощью хорошо известного технического способа, такого как направленный мутагенез или естественная мутация.

[0048] Измененными аминокислотными последовательностями, такими как любая цепь ламинина, использованная в данном изобретении, могут быть таковые, в которых, например, 1-30, предпочтительно 1-20, более предпочтительно 1-9, еще более предпочтительно 1-5, особенно предпочтительно 1-2 аминокислоты вставлены, замещены или делетированы, или добавлены к одному или обоим ее концам. Измененные аминокислотные последовательности могут быть предпочтительно такими аминокислотными последовательностями, имеющими одно или множество (предпочтительно, 1 или несколько, или 1, 2, 3 или 4) консервативных замещений в аминокислотной последовательности в любой цепи ламинина или подобном. В данном документе «консервативное замещение» означает замещение одного или множества аминокислотных остатков другими химически схожими аминокислотными остатками, так что функции белка существенно не изменяются. Например, такие варианты могут быть упомянуты, как замещение данного гидрофобного остатка другим гидрофобным остатком или данный полярный остаток замещается другим полярным остатком, имеющим такой же электрический заряд. Функционально схожие аминокислоты, способные к такому замещению, широко известны в данной области для каждой аминокислоты. Конкретные примеры неполярных (гидрофобных) аминокислот включают в себя аланин, валин, изолейцин, лейцин, пролин, триптофан, фенилаланин, метионин и подобные. Конкретные примеры полярных (нейтральных) аминокислот включают в себя глицин, серин, треонин, тирозин, глютамин, аспарагин, цистеин и подобные. Конкретные примеры (основных) аминокислот, имеющих положительный электрический заряд, включают в себя аргинин, гистидин, лизин и подобные. Далее, конкретные примеры (кислых) аминокислот, обладающих отрицательным электрическим зарядом, включают в себя аспарагиновую кислоту, глютаминовую кислоту и подобные.

[0049] Так, как это используется в данном документе, «агент» может в широком смысле представлять собой какое-либо вещество или какие-либо иные элементы (например, энергию, такую как свет, радиоактивность, тепло и электричество) постольку, поскольку вещество может использоваться взаимозаменяемо и может достигать поставленной цели. Такие вещества включают в себя без ограничений, например, белок, полипептид, олигопептид, пептид, полинуклеотид, олигонуклеотид, нуклеотид, нуклеиновую кислоту (включая в себя, например, ДНК, такую как геномная ДНК и кДНК, РНК, такую как мРНК), полисахарид, олигосахарид, липид, органическую молекулу малого молекулярного веса (например, гормон, лиганд, мессенджер, органическую молекулу малого молекулярного веса, молекулу, синтезированную комбинаторной химией, молекулу малого молекулярного веса, которая может быть использована в качестве медикамента (например, низкомолекулярный лиганд) и подобное), и комплекс таких молекул. Агенты, специфичные для полинуклеотидов, обычно включают в себя без ограничений полинуклеотиды, обладающие комплементарностью с заданной гомологией последовательности к последовательности вышеупомянутого полинуклеотида (например, 70% или более идентичности последовательностей), полипептид, связывающийся подобно фактору транскрипции с промоторным участком и подобное. Агенты, специфичные для полипептидов, обычно включают в себя без ограничений антитела, специфически направленные против полипептида или их производные, или их аналоги (например, одноцепопчечное антитело), специфический лиганд или рецептор в случае, когда полипептид представляет собой рецептор или лиганд, его матрикс - в случае, когда полипептид представляет собой фермент и подобное.

[0050] Так, как это используется в данном документе, «культура» обозначает растущий клеточный объект, а в ограниченном смысле это обозначает состояние, в котором поддерживаются условия клеточного объекта, состояние которого в противном случае ухудшается (например, когда количество клеток существенно не уменьшается). В более узком смысле термин используется для обозначения того же смысла, что и поддержание культуры или содержание.

[0051] Так, как это используется в данном документе, «рост» обозначает состояние, когда количество клеток увеличивается.

[0052] Так, как это используется в данном документе, «способность к росту» обозначает способность клеток к росту. Если это специально не обозначено в данном документе, состояние роста обозначает возможность роста в стационарном состоянии. «Стационарное состояние» обозначает нормальные условия для живых организмов, в которых поддерживается гомеостаз живых организмов. Такое состояние легко определяется специалистами в данной области техники. Например, это может быть подтверждено анализом плотности клеток, когда плотность клеток почти постоянна - остается без изменений, или выявляется экспрессия маркера клеточного роста, или подобное. Так, как это используется в данном документе, «активация роста» обозначает состояние роста данной клетки. Если интересующая клетка в начальный момент не растет, начало даже небольшого роста соответствует активации роста. Если клетка уже растет, и уровень роста поддерживается или возрастает, и этот рост предпочтителен, это соответствует активации роста.

[0053] Так, как это используется в данном документе, «стволовая клетка» обозначает клетку, которая обладает способностями и к дифференцировке во множество систем клеток (мультилинейный потенциал), и способностями к поддержанию мультилинейного потенциала даже после клеточного деления (способность к самообновлению). Стволовые клетки включают в себя эмбриональные стволовые клетки, зародышевые клетки, индуцированные плюрипотентные стволовые клетки (iPS), тканевые стволовые клетки и подобное. Эндотелиальные клетки роговицы, на которые направлено данное изобретение, могут быть такими клетками, которые дифференцировались из стволовых клеток. Дифференцировка из стволовых клеток в эндотелиальные клетки роговицы может быть достигнута с помощью способов, широко известных в рассматриваемой области.

[0054] Так, как это используется в данном документе, «нормальная клеточная функция» клетки обозначает функцию, которой клетка исходно обладает, когда имеются в виду специфические клетки, такие как эндотелиальные клетки роговицы. В отношении эндотелиальных клеток роговицы такая функция включает в себя без ограничений, ZO-1 и Na+/K+-АТФазу, адаптивную способность трансплантата роговицы (Matsubara M, Tanishima T: Wound-healing of the роговицы endothelium in the monkey: a morphometric study, Jpn J Ophthalmol 1982, 26:264-273; Matsubara M, Tanishima T: Wound-healing of роговицы endothelium in monkey: an autoradiographic study, Jpn J Ophthalmol 1983, 27:444-450; Van Horn DL, Hyndiuk RA: Endothelial wound repair in primate cornea, Exp Eye Res 1975, 21:113-124 и Van Horn DL, Sendele DD, Seideman S, Buco PJ: Regenerative capability of the corneal endothelium in rabbit and cat, Invest Ophthalmol Vis Sci 1977, 16:597-613), и подобные.

[0055] ZO-1 и Na+/K+-АТФаза могут быть оценены по наблюдению экспрессии белков иммунологическими средствами или на уровне мРНК [таким средством], как полимеразная цепная реакция с обратной транскрипцией (RT-PCR). Подтверждение экспрессии и (или) функции Na+/K+-АТФазы и ZO-1 на том же уровне, что в нормальных клетках, позволяет подтвердить, обладают или нет клетки, представляющие собой предмет исследования, нормальной функцией.

[0056] Что касается адаптивной способности трансплантата роговицы, тесты на имплантацию культивированных клеток могут быть проведены с помощью механического кюретажа эндотелия роговицы как модели буллезной кератопатии на экспериментальных животных, таких как кролики. Однако, поскольку эндотелиальные клетки роговицы кроликов способны расти in vivo, нельзя исключить возможности естественного заживления благодаря росту эндотелиальных клеток роговицы хозяина (Matsubara M, et al., Jpn J Ophthalmol 1982, 26:264-273; Matsubara M, et al., Jpn J Ophthalmol 1983, 27:444-450; Van Horn DL, et al., Exp Eye Res 1975, 21:113-124 и Van Horn DL, et al., Invest Ophthalmol Vis Sci 1977, 16:597-613). Поэтому, чтобы оценить адаптивную способность трансплантата более точно, предпочтительно оценивать приживление у приматов. Когда оценивается адаптивная способность трансплантата у человека, адаптивность оценивается у приматов, таких как макаки-крабоеды, через, по меньшей мере, один месяц, предпочтительно, по меньшей мере, через два месяца, более предпочтительно, по меньшей мере, через три месяца, еще более предпочтительно, по меньшей мере, через шесть месяцев и даже более предпочтительно, по меньшей мере, например, через двенадцать месяцев. Подтверждение адаптивной способности трансплантата у приматов, таких как обезьяны, особенно важно применительно к человеку.

[0057] Так, как это используется в данном документе, «BrdU» представляет собой аббревиатуру бромдеоксиуридина. Так как BrdU включается в синтез ДНК как аналог деокситимидин трифосфата (dTTP), ДНК (клеточное ядро), в которую включается BrdU, может быть детектирована антителами, специфичными к BrdU, включенному в ДНК. Таким образом, BrdU используется как показатель высокой способности к росту/способности к дифференцировке.

[0058] Так, как это используется в данном документе, «BrdU-положительный» означает состояние, при котором клеточный маркер BrdU экспрессируется в клетках, представляющих интерес.

[0059] Так, как это используется в данном документе, «культуры» обозначают таковые, полученные путем культивирования таких клеток, как эндотелий роговицы. Таким образом, «культуры эндотелия роговицы» обозначают культуры эндотелия роговицы, а термин обычно обозначает таковые, происходящие от существующих in vivo и существующие в различных состояниях. Культуры эндотелия роговицы, полученные общепринятыми способами, были проблематичны тем, что такие культуры имеют низкую способность к росту и легко трансформируются и утрачивают функцию (Peh GS, Beuerman RW, Colman A, Tan DT, Mehta JS (2011) Human corneal endothelium cell expansion for corneal endothelium transplantation: an overview. Transplantation 91: 811-819., Okumura N, Kay E, Nakahara M, Hamuro J, Kinoshita S, et al. (2013) Inhibition of TGF-β signaling enables human corneal endothelial cell expansion in vitro for use in regenerative medicine. PLoS One 8:e58000.). Поэтому с точки зрения культур такая плотность клеток не могла быть достигнута таковыми, которые культивировались в течение особенно долгого периода времени или таковыми, которые были пересеяны. Конкретно, плотность эндотелиальных клеток роговицы легко уменьшается при культивировании. Плотность эндотелия роговицы является одним из наиболее клинически важных показателей уровня здоровья. Таким образом, культивирование до высокой плотности [клеток] важно с точки зрения регенерационной медицины. Далее, возможно увеличение плотности эндотелия заранее, а затем проведение внесения in vivo, что может быть крайне важным терапевтическим агентом. В этом смысле важен факт, что плотность клеток, которая обычно снижается при обычном способе культивирования, теперь может быть увеличена. Нормальный уровень эндотелия роговицы человека in vivo находится в диапазоне около 2500-3000/мм2. Данное изобретение предоставляет то преимущество, что данное изобретение предоставляет технологию получения плотности клеток культуры с вышеупомянутым уровнем или превосходящим его.

[0060] Так, как это используется в данном документе, «среда» обозначает какую-либо среду, пригодную к культивированию или выращиванию эндотелиальных клеток роговицы, и среда может иметь различные формы, такие как жидкая среда (культуральная среда), суспензионная среда и твердая среда, по мере необходимости и пригодности. Компоненты среды, используемой для таких эндотелиальных клеток роговицы, включают в себя, например, DMEM (фирма GIBCO BRL), OptiMEM фирма (Life Technologies), сыворотку (например, сыворотку крови эмбрионов коров (FBS), сыворотку человека), фактор пролиферации/фактор роста (например, b-FGF), вещества-антибиотики (например, пенициллин, стрептомицин, гентамицин) и подобное.

[0061] Так, как это используется в данном документе, «(культуральный) контейнер» обозначает контейнер для культивирования эндотелиальных клеток роговицы. Тип культуральных контейнеров особо не ограничивается, и какие-либо контейнеры могут быть использованы в стерилизованном виде, чтобы предупредить загрязнение бактериями, и изготовленные из какого-либо материала и какой-либо формы, пригодные для культивирования клеток. Примеры таких культуральных контейнеров включают в себя без ограничений культуральные чашки, культуральные колбы, культуральные сосуды Скейлс, культуральные планшеты, такие как 96-луночные, 48-луночные, 12-луночные, 6-луночные и 4-луночные, культуральные бутылки, обычно используемые в области объекта изобретения.

[0062] (Общие технологии)

Молекулярно-биологическая технология, биохимическая технология, микробиологический процесс, используемые в данном документе, хорошо известны и обычно используются в области объекта изобретения, которые описаны в, например, Sambrook J. et al.(1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F. M. (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, F. M. (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Innis, M. A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, F. M. (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, F. M. (1995).Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Innis, M. A. et al. (1995). PCR Strategies, Academic Press; Ausubel, F. M. (1999). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, и ежегодные обновления; Sninsky, J. J. et al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press, Gait, M. J. (1985). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Gait, M. J. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F. (1991). Oligonucleotides and Analogues: A Practical Approach, IRL Press; Adams, R. L. et al.(1992).The Biochemistry of the Nucleic Acids, Chapman & Hall; Shabarova, Z. et al.(1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G. M. et al.(1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G. T. (1996). Bioconjugate Techniques, Academic Press, and Bessatsu Jikken Igaku "Idenshi Dounyu & Hatsugen Kaiseki Jikken Hou" Yodosha Co., Ltd., 1997. Что касается эндотелиальных клеток роговицы, также известно сообщение Nancy Joyce et al., {Joyce, 2004 #161} {Joyce, 2003 #7}; однако, как упоминалось ранее, трансформация клеток фибробластов происходила вследствие длительного культивирования или пересева культуры. Таким образом, исследования эффективных способов продолжаются и сегодня. Связанные с этим части работ (которые могут представлять собой и целую работу) включены в данный документ по ссылке.

[Описание вариантов осуществления]

[0063] Ниже будет сделано описание предпочтительных вариантов осуществления. Однако следует понимать, что варианты осуществления представляют собой примеры по данному изобретению, и сфера данного изобретения не ограничена такими предпочтительными вариантами осуществления. Далее, следует понимать, что специалисты в данной области техники могут легко использовать модификацию, изменение или подобное в пределах сферы данного изобретения при ссылке на следующие предпочтительные варианты осуществления. Далее, следует понимать, что какие-либо варианты осуществления могут быть скомбинированы.

[0064] (Композиция и культивационный контейнер для культивирования или выращивания эндотелиальных клеток роговицы)

Один из объектов данного изобретения предоставляет композицию для культивирования или выращивания эндотелиальных клеток роговицы, содержащую, по меньшей мере, один объект, состоящий из ламининов и их фрагментов, которые экспрессируются в эндотелиальных клетках роговицы.

[0065] Хотя агент (ламинин или подобное) по данному изобретению может быть включен в культуральную среду для использования, агент может быть и нанесен на (или может покрывать) используемую культуральную чашку. Чтобы провести первичное культивирование и (или) пересев культуры клеток, представляющих интерес, использовали подходящую среду (например, DMEM (минимальная эссенциальная среда Игла, модифицированная по способу Дульбекко) или OptiMEM) и клетки, которые собирали и изолировали, высевали в первичную культуру или перевиваемую культуру в культуральные чашки для культивирования. В данном изобретении хороший результат роста может быть получен даже при добавлении в среду количества сыворотки, составляющее 10% или менее. Кроме того, в данном изобретении, в добавление к ламинину или в добавление к покрытию ламинином в среду в качестве добавок могли вноситься цитокины (например, фактор роста фибробластов (FGF)). Агент по данному изобретению пригоден для изолированных клеток, как описано в Примерах, и в эндотелиальных клетках, индуцированных из клеток iPS или ES (эмбриональных стволовых клеток). Далее, понятно, что такой агент является эффективным для индукции сам по себе.

[0066] Концентрации использующегося ламинина, включает в себя, например, около 0,1 мкг до около 500 мкг/мл в растворе культуральной среды (например, PBS). Покрытие - количество около 0,75 мкг/см2 на единицу площади (например, см2) может быть использовано для покрытия. Для использования в обработке культурального контейнера количество ламининов по данному изобретению или их фрагментов конкретно не ограничено. Благоприятный результат может быть получен при обработке раствором ламинина или его фрагментов, предпочтительно в количестве около 0,01 мкг/ил или более, предпочтительно около 0,01-10 мкг/мл, еще предпочтительнее около 0,01 до около 2 мкг/мл. Около 0,01-10 мкг/мл или около 0,01 до около 2 мкг/мл ламинина или его фрагментов соответствуют около 0,0015-1,5 мкг/см2 или около 0,0015-0,3 мкг/см2 количества ламинина или его фрагментов в твердой фазе на поверхность культурального контейнера.

[0067] В предпочтительном варианте осуществления ламинин включает в себя ламинин 511 и ламинин 521. Таким образом, в данном варианте осуществления агент по данному изобретению может представлять собой ламинин 511, ламинин 521 или их фрагменты. Какой-либо фрагмент может быть использован как фрагмент ламинина 511 или фрагмент ламинина 521 по данному изобретению постольку, поскольку фрагмент может быть использован в культивировании (которое может быть обозначено как «содержание» или «поддержание культуры» в данном документе, но использоваться в том же значении, что культивирование) или рост эндотелиальных клеток роговицы. Такие фрагменты включают в себя, но не ограничиваются фрагментом Е8 ламинина 511 и фрагментом ламинина 521 (соответственно, последовательности номер 9, 10 (последовательность нуклеиновой кислоты, аминокислотная последовательность) и последовательности с номерами 11, 12 (последовательность нуклеиновой кислоты, аминокислотная последовательность)) (см. Taniguchi Y, Ido H, Sanzen N, Hayashi M, Sato-Nishiuchi R, Futaki S, Sekiguchi K. The C-terminal region of laminin beta chains modulates the integrin binding affinities of laminins. J Biol Chem. 284:7820-7831, 2009. Доступно на фирме Nippi, Incorporated). Фрагмент Е8 ламинина 511 и фрагмент ламинина 521 являются фрагментами, полученными обработкой эластазой, и содержат часть суперспирализованного домена и три домена LG (LG1 - LG3) в α-цепи C-концевого участка гетеротримера. Фрагмент E8 считается соответствующим сайту связывания интегрина гетеротримерной молекулы, в которой α-цепь, β-цепь и γ-цепь ламинина собраны через суперспирализованный домен еще с одним. Таким образом, в качестве предпочтительного фрагмента, может быть использован таковой, в котором сайт связывания интегрина практически сохраняется по всей длине ламинина. Понятно, что такой фрагмент может быть создан соответствующим изменением, основывающимся на информации о фрагментах Е8 ламинина 511 и ламинина 521.

[0068] В этом плане фрагмент E8 ламинина человека α5β1γ1 (также обозначаемый в данном документе как «ламинин человека 511-E8») означает фрагмент ламинина α5β1γ1 человека (также обозначаемый как в данном документе как «ламинин 511 человека»), соответствующий фрагменту Е8 ламинина α1β1γ1 мыши (также обозначаемого в данном документе как «ламинин 111-E8 мыши»). Фрагмент E8 ламинина был идентифицирован среди фрагментов, которые были получены перевариванием ламинина α1β1γ1 мыши как фрагмент с сильной активностью в клеточной адгезии (далее в тексте описываемый как «ламинин 111 мыши») эластазой (Edgar D., Timpl R., Thoenen H. The heparin-binding domain of laminin is responsible for its effects on neurite outgrowth and neuronal survival. EMBO J., 3:1463-1468, 1984., Goodman SL., Deutzmann R., von der Mark K. Two distinct cell-binding domains in laminin can independently promote nonneuronal cell adhesion and spreading. J. Cell Biol., 105: 589-598, 1987.). Для ламинина 511 человека и ламинина 332 человека присутствие фрагмента, соответствующего ламинину 111-E8 мыши, предполагается в результате переваривания эластазой. Не требуется, чтобы ламинин 511-E8 человека, используемый по данному изобретению, был продуктом переваривания эластазой ламинина 511 человека. Ламинин 511-E8 человека, использованный в данном изобретении, может представлять собой фрагмент ламинина 511 человека, имеющего схожую активность в клеточной адгезии, схожую структуру и приблизительной такой же молекулярный вес, как ламинин 111-E8 мыши. Способ производства ламинина 511-E8 человека конкретно не ограничен. Например, такой способ включает в себя способ, позволяющий переваривание полноразмерного ламинина 511 человека протеолитическим ферментом, таким как эластаза, для фракционирования и очистки интересующего фрагмента, способ производства рекомбинантного белка и подобные. Производство рекомбинантного белка предпочтительно с точки зрения количества произведенного, единообразия качества, расходов на производство и подобного. Рекомбинантный ламинин 511-E8 человека может быть произведен с помощью соответствующего использования известной технологии рекомбинации генов. Способом производства рекомбинантного ламинина 511-Е8 человека, например, можно производить рекомбинантный ламинин 511-Е8 человека получением ДНК, кодирующей белок каждой из α-цепей, β-цепей и γ-цепей ламинина 511-E8 человека, путем встраивания каждой из полученных ДНК в вектор экспрессии, экспрессирующий полученные три вида векторов экспрессии путем ко-трансфекции в соответствующие клетки-хозяева, и очистки тримерных белков известными способом (например, см. Hiroyuki Ido, et al, "The requirement of the glutamic acid residue at the third position from the carboxyl termini of the laminin γ chains in integrin binding by lMININs" The Journal of Biological Chemistry, 282, 11144-11154, 2007.). На [патент Японии] JP 2011-78370 можно сослаться как на конкретный способ производства. Схожие фрагменты могут быть произведены с использованием ламинина 521 человека, который обозначается как «фрагмент Е8 ламинина 521 (ламинин 521-Е8)». Понятно, что такой фрагмент может быть произведен схожим образом с ламинином 511-E8, и что таким образом сохранит схожую активность с таковой ламинина 511-E8.

[0069] В предпочтительном варианте осуществления, агент представляет собой ламинин 511, ламинин 521, фрагмент E8 ламинина 511 или фрагмент E8 ламинина 521.

[0070] В предпочтительном варианте осуществления эндотелиальные клетки роговицы представляют собой клетки человека.

[0071] Эндотелиальные клетки, являющиеся целью данного изобретения, могут быть приготовлены из слущенного эндотелия роговицы путем переноса нативного эндотелия роговицы на донорскую роговицу без повреждения целостности десцеметовой мембраны и структуры и функционирования стромального слоя (например, WO 2005/038015). Слущенная роговица может быть использована как культивируемые клетки эндотелия роговицы человека.

[0072] Еще один объект данного изобретения предоставляет культуральный контейнер для эндотелиальных клеток роговицы, покрытый агентом или композицией по данному изобретению.

[0073] Приготовление контейнера с покрытием или культурального планшета для ламинина или подобного для культивирования эндотелиальных клеток роговицы может быть выполнено путем обращения к известному способу в данной области техники. Приготовление (покрытие) культурального контейнера может быть выполнено нижеследующим образом: например, после разбавления раствора ламинина фосфатным буфером до 20 мкг/мл он добавляется в культуральную чашку и инкубируется в течение двух часов при 37°C (5% CO2), раствор удаляется и дважды отмывается фосфатным буфером в используемой среде.

[0074] Таким образом, еще один объект данного изобретения относится к композиции для твердофазного (покрытия) контейнера для культивирования клеток среди эндотелиальных клеток роговицы с помощью системы, содержащей, по меньшей мере, один агент, выбранный из группы, состоящей из ламининов, экспрессируемых в эндотелиальных клетках роговицы, или их фрагментов (например, ламинин 511, ламинин 521 или их фрагменты), или агент твердофазного (покрытия) контейнера для культуры клеток. В одном из вариантов осуществления композиция или агент по данному изобретению представляет собой композицию для покрытия или покрывающий агент. Технология обработки твердофазными ламининами поверхности культурального контейнера известна в данной области техники. Таким образом, специалисты в данной области техники могут использовать какой-либо культуральный контейнер в соответствии с целью данного изобретения и применять обработку контейнера для использования контейнера способом по данному изобретению.

[0075] Еще один объект данного изобретения также относится к набору, содержащему вышеописанную композицию или агент. Набор по данному изобретению может также содержать среду для культуры клеток, контейнер для культуры клеток или подобное. Контейнер для культуры клеток может быть, культуральной чашкой с предварительно нанесенным покрытием или культуральным планшетом с предварительно нанесенным покрытием. В качестве альтернативы контейнер для культуры клеток из набора может быть в таком состоянии, когда, по меньшей мере, один агент, выбранный из группы, состоящей из ламининов, экспрессирующихся в эндотелиальных клетках роговицы или его фрагмент (например, ламинин 511, ламинин 521 или их фрагмент) присутствует в твердой фазе. Контейнер для культуры клеток, композиция, агент или набор по данному изобретению могут быть использованы в способе культивирования клеток млекопитающих в системе, содержащей, по меньшей мере, один фактор, выбранный из группы, состоящей из ламининов, экспрессирующихся в эндотелиальных клетках роговицы или их фрагментов (например, ламинин 511, ламинин 521 или их фрагменты).

[0076] (Способ культивирования эндотелиальных клеток роговицы)

Еще один объект данного изобретения предоставляет способ культивирования эндотелиальных клеток роговицы, который использует композицию по данному изобретению. То есть, данное изобретение предоставляет способ культивирования или выращивания эндотелиальных клеток роговицы, содержащий стадию культивирования эндотелиальных клеток роговицы путем использования агента (ламинина, его фрагмента или подобного) по данному изобретению. Понятно, что агент (ламинин, его фрагмент или подобное), используемый в способе по данному изобретению может быть использован в какой-либо форме, описанной в данном документе. Далее, какой-либо компонент культуры может быть использован в способе по данному изобретению постольку, поскольку компонент может быть использован в культивировании эндотелия роговицы, и компонент культуры какой-либо формы, описанный в данном документе, может служить в качестве примера.

[0077] В одном из вариантов осуществления эндотелиальные клетки роговицы, культивируемые по данному изобретению, являются клетками приматов. В предпочтительном вариант осуществления эндотелиальные клетки роговицы, культивируемые по данному изобретению, являются клетками человека.

[0078] В предпочтительном варианте осуществления культивирование интересующих клеток способом по данному изобретению предназначено для профилактики или лечения заболеваний эндотелия роговицы и может быть использовано, в особенности, для продуцирования клеток, тканей или подобного для трансплантации.

[0079] Температурные условия при культивировании эндотелиальных клеток роговицы конкретно не ограничены в такой степени как у растущих эндотелиальных клеток роговицы. Однако, например, температурные условия составляют около 25°C до около 45°C, или предпочтительно около 30°C до около 40°C, учитывая эффективность роста, или еще предпочтительнее около 37°C. Применялся способ культивирования в обычном инкубаторе культуры клеток в увлажненной среде с концентрацией CO2 около 5-10%.

[0080] Какой-либо компонент, который может быть использован в культивирования эндотелия роговицы, может быть использован как компонент культуры, который может быть использован в данном изобретении. В дополнение, компонент культуры может быть компонентом среды, который общедоступен коммерчески и используется, или компонентом, который разработан специально для эндотелия роговицы. Примеры такого компонента среды включают в себя, но не ограничиваются ими, OptiMEM, DMEM, M199, MEM и подобные (они доступны на фирме INVITROGEN или подобных).

[0081] Данное изобретение характеризуется повышенной активностью разнообразных специфических ламининов или их фрагментов путем использования специфического полипептида и (или) пептида в системе клеточной культуры, содержащей агент (например, специфический ламинин или его фрагмент) по данному изобретению в клеточном культивировании. Полипептид представляет собой выбранный из группы, состоящей из белков крови и других, отличающихся от белков внеклеточного матрикса, которые представляют собой сыворотку, сывороточный альбумин, преальбумин, иммуноглобулин, α-глобулин, β-глобулин, α1-антитрипсин (α1-AT), гаптоглобин (Hp), α2-макроглобулин (α2-M), α-фетопротеин (AFP), трансферрин, ретинол-связывающий белок (RBP) или адипонектин, и желатин, семейство белков фактора некроза опухолей (TNF) и пептон. В одном из вариантов осуществления данного изобретения полипептид и (или) пептид, который может быть использован как дополнительный компонент, представляет собой, но не ограничивается им, сывороточный альбумин, семейство белков фактора некроза опухолей (TNF) или пептон, или полипептид и (или) пептид представляет собой иммуноглобулин или желатин.

[0082] В данном изобретении предпочтительно белок крови, а более предпочтительно белок крови, отличающийся от белка внеклеточного матрикса, может быть использован с агентом (специфическим ламинином или его фрагментом) по данному изобретению. Белок крови предпочтительно выбран из сыворотки, сывороточного альбумина, преальбумина, иммуноглобулина, α-глобулина, β-глобулина, α1-антитрипсина (α1-AT), гаптоглобина (Hp), α2-макроглобулина (α2-M), α-фетопротеина (AFP), трансферрина, ретинол-связывающего белка (RBP) или адипонектина, которые все представляют собой белки крови, отличающиеся от белка внеклеточного матрикса. «Внеклеточный матрикс» представляет собой вещество, которое заполняет внеклеточное пространство. В то же время, внеклеточный матрикс играет скелетную роль (например, хряща или кости животных), роль каркаса при клеточной адгезии (например, базальная мембрана или фибронектин), роль в поддержания или обеспечения клетки фактором роста или подобным (например, фактор роста клеток FGF, который связывается с гепаринсульфатом) и подобное. Многие отдельные клетки, образующие многоклеточный организм, который являются живыми, погружены в ложе или ячейку из внеклеточного матрикса. Основные компоненты внеклеточного матрикса позвоночных, включающих в себя человека, представляют собой гликопротеины, такие как коллаген, протеогликан, фибронектин и ламинин (частично представляющий собой молекулы клеточной адгезии). «Внеклеточный белок матрикса» означает белок, образующий такой внеклеточный матрикс.

[0083] «Белки крови, отличающиеся от белка внеклеточного матрикса» по данному изобретению означает белки крови, иные, чем белок внеклеточного матрикса, вовлеченные в клеточную адгезию или подобное. Все они представляют собой известные белки, которые специалисты в данной области техники могут получить надлежащим образом. Белки крови, иные, чем белок внеклеточного матрикса, предпочтительно представляют собой, но не ограничиваются ими, сывороточный альбумин человека (HSA/ например доступный на фирме Nacalai Tesque), рекомбинантный сывороточный альбумин человека (rHSA/ например, доступный на фирме SIGMA-ALDRICH), или бычий сывороточный альбумин (BSA/ например, доступный на фирме SIGMA-ALDRICH). Далее, «белки крови, иные, чем белки внеклеточного матрикса» могут представлять собой иммуноглобулины. Иммуноглобулины, включающие в себя IgG, IgA, IgM, IgD и IgE, известны специалистам в данной области техники. Например, может быть использован, но не ограничиваясь им, иммуноглобулин человека (IgG/ например, доступный на фирме Oriental Yeast Col, Ltd.).

[0084] «Желатин» в данном документе представляет собой вещество, экстрагированное путем нагрева коллагена, который является основным компонентом соединительной ткани, такой как кожа, кость или связки животных. Основным компонентом желатина является белок.

[0085] Дополнительный компонент - белок семейства фактора некроза опухолей (TNF) может быть использован в данном документе. «Фактор некроза опухолей, TNF)» представляет собой один из типов цитокинов. В узком смысле, существует три типа TNF, т.е., TNF-α, TNF-β (лимфотоксин (LT)-α) и LT-β. «Белки семейства TNF» включают в себя, по меньшей мере, 19 типов молекул, таких как лиганд, активирующий рецептор NFκB (RANKL), лиганд Fas и лиганд CD40. Предпочтительно, лиганд, активирующий рецептор NFκB (RANKL, sRANKL), может быть использован как пример белка семейства TNF и как дополнительный компонент, используемый в данном изобретении.

[0086] По данному изобретению пептон может быть использован как дополнительный компонент. «Пептон» представляет собой белок, полученный растворением белка протеолитическим ферментом. Белок in vivo переваривается в пептон в желудке пепсином, а получившийся пептон затем переваривается до аминокислот соком поджелудочной железы, секретируемым поджелудочной железой и кишечным секретом, выделяемым тонкой кишкой. Так как пептон пригоден в качестве источника питательных веществ для микроорганизмов, его часто добавляют в среду. Пептон как источник питательных веществ для среды получали гидролизом белка до аминокислот и низкомолекулярных пептидов. В целом, обычно используется пептон, полученный из молочного белка (молочный казеин), претерпевшего ферментолиз (используя протеазы в такие как панкреатин, экстрагированный из поджелудочной железы свиньи). Пептон, происходящий из растений, используется предпочтительно, но не ограничиваясь им. Например, пептон, выбран из группы, состоящей из пептона, происходящего из семени хлопчатника, пептона, происходящего из соевых бобов, пептона, происходящего из пшеницы, и пептона, происходящего из гороха.

[0087] (Эндотелиальные клетки роговицы и формы эндотелия роговицы)

Данное изобретение предоставляет эндотелиальные клетки роговицы, культивированные и продуцированные способом по данному изобретению. Данное изобретение может быть рассмотрено как имеющее характеристики, которых отсутствуют у общепринятых клеток, при которых нормально культивированные и растущие клетки получаются даже, когда проводится обычное культивирование, а также при проведении пересева. В дополнение, наиболее важная характеристика состоит в том, что клетка имеет характеристики эндотелиальных клеток роговицы с нормальной функцией. Соответственно, эндотелиальные клетки роговицы, предоставляемые данным изобретением, могут быть предоставлены в виде формы, что означает, что данное изобретение предоставляет форму эндотелия роговицы. Соответственно, данное изобретение предоставляет способ производства формы эндотелия роговицы, содержащий стадию культивирования эндотелиальных клеток роговицы с использованием культурального раствора, содержащего агент или композицию по данному изобретению или контейнер, на который агент или композиция по данному изобретению нанесены.

[0088] Согласно одному из объектов [данного изобретения] форма эндотелия роговицы по данному изобретению содержит материал основы и слой эндотелиальных клеток роговицы на материале основы.

[0089] Материал основы, использованный по данному изобретению, конкретно не ограничен постольку, поскольку он может поддерживать слой культивированных эндотелиальных клеток роговицы и поддерживать их форму in vivo в течение заданного периода времени, предпочтительно, по меньшей мере, трех дней после трансплантации. Далее, материал основы, использованный в данном изобретении, может быть таковым, играющим роль поддерживающей структуры при культивировании эндотелиальных клеток роговицы в пробирке, или может быть таковым, играющим только роль поддержки слоя эндотелиальных клеток роговицы после культивирования. Предпочтительно, материал основы, использованный в данном изобретении, является таковым, играющим роль поддерживающей структуры, использованной для культивирования эндотелиальных клеток роговицы, и непосредственно предназначены для трансплантации после завершения культивирования.

[0090] Материал основы, использованный в данном изобретении, включает в себя, например, высоко полимеризованный материал, происходящий из природных продуктов, таких как коллаген, желатин и целлюлоза; синтетический макромолекулярный материал, такой как полистирол, полиэфир, поликарбонат и поли (N-изопропил акриламид); биодеградирующий полимерный материал, такой как полимолочная кислота и полигликолевая кислота; гидроксиапатит, амнион и подобное.

[0091] Форма материала основы, используемого в данном изобретении, конкретно не ограничена постольку, поскольку она поддерживает слой эндотелиальных клеток роговицы, и эта форма пригодна для трансплантации. Однако форма предпочтительно представляет собой пласт. Когда форма по данному изобретению имеет вид пласта, она может быть отрезана и использована по размеру в соответствии с местом применения при трансплантации. Далее, возможно плотно скатать пласт и вставить в рану. Как предпочтительный конкретный пример, круглая форма представляет собой пример того, как покрывается около 80% поверхности поврежденного эндотелия роговицы. В дополнение, также предпочтительно врезать периферическую часть круга так, чтобы она плотно адгезировала с местом приложения.

[0092] В предпочтительном варианте осуществления примером материала основы, использованного в данном изобретении, является коллаген. Что касается коллагена, пласт коллагена, описанный в японской открытой публикации No. 2004-24852, может быть использован предпочтительно. Интересующий коллагеновый пласт может быть изготовлен из, например, амниона в соответствии со способом, описанным в японской открытой публикации No. 2004-24852.

[0093] Далее в данном документе препарат слоя эндотелиальных клеток роговицы будет описан как пример формы эндотелия роговицы.

[0094] Слой эндотелиальных клеток роговицы, использованный в данном изобретении, предпочтительно содержит, по меньшей мере, одну из следующих характеристик. Более предпочтительно, слой эндотелиальных клеток роговицы, использованный в данном изобретении, содержит две или более нижеследующих характеристик. Еще более предпочтительно, слой эндотелиальных клеток роговицы, использованный в данном изобретении, содержит все нижеследующие характеристики.

(1) Слой клеток имеет однослойную структуру. Это одна из характеристик, которой обладает слой клеток эндотелия роговицы живых организмов.

(2) Плотность клеток в клеточном слое составляет около 1000 - около 4000 клеток/мм2. В частности, плотность клеток предпочтительно составляет около 2000 - около 3000 клеток/мм2 в случае взрослого реципиента.

(3) Плоская форма клеток, образующих клеточный слой является практически гексагональной. Это является одной из характеристик, которой обладают клетки, образующие слой эндотелиальных клеток роговицы, содержащийся в живых организмах. Форма по данному изобретению схожа со слоями эндотелиальных клеток роговицы живых организмов, которые способны реализовывать сходную функцию, что и нативные слои эндотелиальных клеток роговицы, и также проявляют способность к росту in vivo.

(4) Клетки правильным образом организованы в клеточный слой. В слое эндотелиальных клеток роговицы живых организмов, клетки, образующие слои, организованы правильным образом. Таким образом, считается, что поддерживаются нормальные функции и высокая прозрачность эндотелиальных клеток роговицы, и функция увлажнения роговицы, реализующаяся надлежащим образом. Следовательно, при наличии таких морфологических характеристик форма по данному изобретению считается реализующей функцию, схожую с таковой клеточного слоя эндотелия роговицы в живых организмах.

[0095] Способ производства по данному изобретению содержит стадию культивирования эндотелиальных клеток роговицы с использованием агента, композиции или контейнера по данному изобретению, и может быть выполнен, например, следующим способом.

[0096] <1> Сбор и культивирование эндотелиальных клеток роговицы в пробирке

Эндотелиальные клетки роговицы собирали из роговицы самого реципиента или от подходящего донора обычным способом. Что касается условий трансплантации по данному изобретению, то могут быть приготовлены эндотелиальные клетки роговицы, происходящие от того же сорта клеток. Например, десцеметова мембрана и слой эндотелиальных клеток ткани роговицы, слущенные с паренхимы роговицы, переносятся в культуральную чашку и обрабатываются диспазой (Dispase) или подобным. соответственно, эндотелиальные клетки роговицы спадают с десцеметовой мембраны. Эндотелиальные клетки роговицы, оставшиеся на десцеметовой мембране, могут быть сняты с нее пипетированием или подобным. После удаления десцеметовой мембраны эндотелиальные клетки роговицы культивировали в культуральном растворе по данному изобретению. Что касается культуры или культурального раствора, например, может быть использовано следующее: FBS (сыворотка крови эмбрионов коров) (например, фирмы BIOWEST, каталожный номер: S1820-500), b-FGF (основной фактор роста фибробластов) (например, фирмы INVITROGEN, каталожный номер: 13256-029), и вещество- антибиотик, такое как пенициллин и стрептомицин, могли быть надлежащим образом добавлены в коммерчески доступный DMEM (среда Игла, модифицированная по способу Дульбекко)(например, фирмы INVITROGEN, каталожный номер: 12320 или подобное), за чем следует добавление компонентов нормализации культуры по данному изобретению. путем нанесения покрытия агентом по данному изобретению для проведения культивирования, активируется адгезия эндотелиальных клеток роговицы к поверхности культурального контейнера, обеспечивая тем самым оптимальный рост. В дополнение, при проведении культивирования путем добавления ламинина в культуральный раствор, предпочтительно использовать культуральную чашку, поверхность которой покрыта коллагеном типа I, коллагеном типа IV, фибронектином, ламинином или внеклеточным матриксом эндотелиальных клеток роговицы коров или подобным. В качестве альтернативы, возможно использовать обычный культуральный контейнер, который обработан коммерчески доступным покрывающим агентом, таким как смесь для покрытия FNC coating mix® (50 мл(AES-0407), фирма ATHENA, каталожный номер: 0407). Температурные условия для культивирования эндотелиальных клеток роговицы конкретно не ограничены постольку, поскольку эндотелиальные клетки роговицы [способны] расти. Например, для температурного диапазона около 25°C - около 45°C, с учетом эффективности роста [клеток], предпочтительно от около 30°C до около 40°C, а более предпочтительно около 37°C. Способ культивирования реализуется в таких условиях при концентрации CO2 около 5-10% и увлажнении в обычном инкубаторе для культивирования клеток.

[0097] <2> Пересев культуры

После того, как подвергнутые культивированию эндотелиальные клетки роговицы начинают расти, может быть проведен пересев. Предпочтительно, пересев проводится во время, когда [культура] находится в субконфлюентном или конфлюентном состоянии. Пересев может быть проведен следующим образом. Во-первых, клетки обрабатываются трипсин-ЭДТА или подобным, так что клетки удаляются с поверхности культурального контейнера. Затем клетки собирают. К собранным клеткам добавляют нормализатор культуры или среду по данному изобретению, чтобы получить суспензию клеток. Предпочтительно провести обработку центрифугированием, когда клетки собирают или после сбора клеток. Из полученного при обработке центрифугированием готовят клеточную суспензию с высокой плотностью клеток. Предпочтительная плотность клеток составляет около 1-2×106 клеток/мл. Отметьте, что условия обработки центрифугированием включают в себя без ограничений, например, 500 об/мин (30 g) - 1000 об/мин (70 g), и 1-10 минут.

[0098] Клеточную суспензию высевают в культуральный контейнер, схожий с описанным выше для исходной культуры, таким образом, подвергая ее культивированию. Разбавление при пересеве варьирует в зависимости от состояния клеток, но составляет около 1:2-1:4, а предпочтительно 1:3. Пересев может быть проведен при условиях культивирования, схожих с вышеизложенными для исходной культуры. Время инкубации варьирует в соответствии с состоянием клеток, которые должны быть использованы, и подобного, и составляет, например 7-30 дней. Вышеописанный пересев может быть проведен много раз по мере возникновения необходимости. Когда в агенте, композиции среде или контейнере по данному изобретению используется агент, активирующий клеточную адгезию (например, ROCK ингибитор или подобное), клеточная адгезия в начальный период культивирования может быть усилена, делая возможным укорочение периода культивирования.

[0099] <3> Приготовление клеточного слоя эндотелия роговицы

Клеточную суспензию высевали на материал основы, такую как пласт коллагена, для проведения культивирования. На этой стадии число высеваемых клеток устанавливалось так, чтобы желаемая плотность клеток клеточного слоя сформировалась в форме эндотелия роговицы, которая образуется в конце. Конкретно, клетки высевали так, что формировался клеточный слой с плотностью клеток в диапазоне около 1000 - около 4000 клеток/мм2. Культивирование может проводиться в условиях, схожих с вышеизложенным исходным культивированием. Время инкубации варьирует в соответствии с состоянием клеток, которые должны быть использованы, но составляет, например, 3-30 дней.

[0100] При проведении культивирования, как описано выше, получали форму эндотелия роговицы, в которой культивированный слой эндотелиальных клеток роговицы формировался на материале основы в пробирке.

[0101] В данном изобретении форма эндотелия роговицы может содержать агент или композицию по данному изобретению, или среду, содержащую что-либо из них, или форма эндотелия роговицы может поддерживаться в контейнере, содержащем что-либо из них, для культивирования или роста эндотелиальных клеток роговицы. Форма эндотелия роговицы может содержать агент или композицию по данному изобретению, или среду, содержащую их, или форма эндотелия роговицы может поддерживаться в контейнере, содержащем их, до тех пор, пока не подвергнется трансплантации. Данное изобретение может содержать форму эндотелия роговицы, агент или композицию по данному изобретению, или среду, содержащую что-либо из них; а в качестве альтернативы, данное изобретение предоставляет комбинацию с контейнером, содержащим что-либо из них.

[0102] Форма эндотелия роговицы, полученная способом производства по данному изобретению, может быть использована как трансплантат при лечении заболеваний, которые требуют трансплантации эндотелия роговицы, таких как буллезная кератопатия, отек роговицы, бельмо роговицы, в частности, дистрофия роговица и буллезная кератопатия, вызванные нарушениями в эндотелии роговицы вследствие внешнего повреждения или внутреннего офтальмологического хирургического вмешательства. Причины такой буллезной кератопатии, нарушений эндотелия роговицы или подобного включают в себя, помимо хирургического вмешательства, дистрофию роговицы Фукса, эксфолиативный синдром, эндотелит роговицы.

[0103] Объекты введения формы эндотелия роговицы по данному изобретению включают в себя млекопитающих (например, человека, мышей, крыс, хомяков, кроликов, кошек, собак, коров, овец, обезьян и подобных), и предпочтительно, приматов (например, человека).

[0104] (Лечение или профилактика заболеваний, нарушений или состояний эндотелия роговицы)

Данное изобретение предоставляет медикамент для лечения или профилактики заболеваний, нарушений или состояний эндотелия роговицы, содержащий эндотелиальные клетки роговицы, полученный способом культивирования или выращивания эндотелиальных клеток роговицы, содержащим стадию культивирования эндотелиальных клеток роговицы с помощью агента, композиции или среды или контейнер по данному изобретению. Понятно, что агент, композиция или среда или контейнер по данному изобретению могут быть использованы в какой-либо форме, описанной в данном документе. Например, могут быть рассмотрены материалы, описанные в данном документе, такие как (Композиция для культивирования или выращивания эндотелиальных клеток роговицы), (Способ культивирования эндотелиальных клеток роговицы) и (Клетки эндотелия роговицы и формы эндотелия роговицы). Далее, понятно, что эндотелиальные клетки роговицы, использованные в качестве медикамента, могут иметь какую-либо форму, использованную в данном документе. Например, можно рассмотреть материалы, описанные в (Клетки эндотелия роговицы и форма эндотелия роговицы).

[0105] В одном из вариантов осуществления медикамент по данному изобретению предназначен для целей лечения или профилактики эндотелия роговицы приматов. Предпочтительно, объектом такого лечения или профилактики является эндотелий роговицы человека.

[0106] В одном из вариантов осуществления эндотелиальные клетки роговицы, используемые как медикамент по данному изобретению, происходят от приматов. Предпочтительно, эндотелиальные клетки роговицы, используемые как медикамент по данному изобретению, происходят от человека.

[0107] В одном из вариантов осуществления заболевание, нарушение или состояние эндотелия роговицы, на которые направлен медикамент по данному изобретению, представляет собой буллезную кератопатию, эндотелит роговицы, отек роговицы, лейкому и подобное.

[0108] В одном из вариантов осуществления медикамент по данному изобретению предоставляется в форме пласта или суспензии.

[0109] В одном из вариантов осуществления медикамент по данному изобретению также содержит агент, активирующий клеточную адгезию. Агент, активирующий клеточную адгезию, оказывает действие, активирующее адгезию, на эндотелиальные клетки роговицы, отделенные от ткани роговицы или эндотелиальные клетки роговицы, отделенные и пересеянные. Такой агент, активирующий клеточную адгезию, может предоставляться вместе или отдельно от эндотелиальных клеток роговицы, предоставляемых как медикамент. В конкретном варианте осуществления агент, активирующий клеточную адгезию, используемый в медикаменте по данному изобретению, включает в себя ингибитор Rho-киназы. Ингибиторы Rho-киназы включают в себя соединения, описанные в следующих ссылках: Патент США No. 4678783, Патент Японии 3421217, Международная публикация No. WO 95/28387, Международная публикация No. WO 99/2062, Международная публикация No. WO 99/6140, Международная публикация No. WO 02/076976, Международная публикация No. WO 02/076977, Международная публикация No. WO 2002/083175, Международная публикация No. WO 02/100833, Международная публикация No. WO 03/059913, Международная публикация No. WO 03/062227, Международная публикация No. WO 2004/009555, Международная публикация No. WO 2004/022541, Международная публикация No. WO 2004/108724, Международная публикация No. WO 2005/003101, Международная публикация No. WO 2005/039564, Международная публикация No. WO 2005/034866, Международная публикация No. WO 2005/037197, Международная публикация No. WO 2005/037198, Международная публикация No. WO 2005/035501, Международная публикация No. WO 2005/035503, Международная публикация No. WO 2005/035506, Международная публикация No. WO 2005/080394, Международная публикация No. WO 2005/103050, Международная публикация No. WO 2006/057270, and Международная публикация No. WO 2007/026664. Такие соединения могут быть произведены способами, описанными в любой из перечисленных ссылок, и включают в себя, например, 1-(5-изохинолинсульфонил) гомопиперазин или его соли (например, фасудил (1-(5-изохинолинсульфонил) гомопиперазин)), и (+)-транс-4-(1-аминоэтил)-1-(4-пиридилкарбомоил) циклогексанкарбоксамид или их соли (например, Y-27632((R)-(+)-транс-(4-пиридил)-4-(1-аминоэтил)-циклогексанкарбоксамид дигидрохлорид моногидрат.

[0110] Мишени введения (трансплантации) медикамента или способа по данному изобретению включают в себя млекопитающих (например, человека, мышей, крыс, хомяков, кроликов, кошек, собак, коров, овец, обезьян и подобных). Однако приматы являются предпочтительными, а человек предпочтителен в особенности. В лечении эндотелия роговицы приматов удовлетворительных [ранее] результатов не было достигнуто. В этом смысле данное изобретение предоставляет новаторский терапевтический способ и медикамент.

[0111] Еще один предмет данного изобретения предоставляет способ лечения или профилактики заболевания, нарушения или состояния эндотелия роговицы, содержащий стадию использования эндотелиальных клеток роговицы, продуцированных обычным способом культивирования эндотелиальных клеток роговицы, содержащим стадию культивирования эндотелиальных клеток роговицы с использованием агента, композиции, среды или контейнера по данному изобретению.

[0112] Упомянутые ссылки, процитированные в данном документе, такие как научные публикации, патенты и патентные заявки, включены по ссылке в данный документ во всей полноте так же, как содержание любой ссылки, конкретно описанной в данном документе.

[0113] Как описано выше, данное изобретение было описано представлением предпочтительных вариантов осуществления для облегчения понимания. Далее по тексту данное изобретение будет описано, основываясь на Примерах. Однако изложенное выше описание и нижеследующие Примеры предоставлены исключительно с целью иллюстрации, и не предназначены для целей ограничения данного изобретения. Таким образом, сфера данного изобретения ограничена исключительно Формулой изобретения, а не вариантами осуществления или Примерами, конкретно описанными в данном документе.

[0114] [Примеры]

Далее в этом документе будет описан Пример, в котором клетки эндотелия роговицы по данному изобретению культивировались обычным образом. В тех случаях, когда это применимо, стандарты, установленные Министерством здравоохранения, труда и социального обеспечения, Министерством образования, культуры, спорта и науки и технологий, или подобных учитывались при содержании биологических образцов или подобного, а когда это было применимо, содержание осуществляли на основе Хельсинкской декларации или моральных установок, созданных на основе Хельсинкской декларации. Что касается предоставления глаз для исследований, разрешительные письма получали от близких родственников всех больных доноров. Данное исследование одобрено этическим обзором банка глаз SightLifeTM (Seattle, WA).

[0115] (Экспериментальный способ: ткань роговицы человека исследовательского уровня качества)

Роговицы от двенадцати доноров-людей были получены от банка глаз SightLifeTM, и все роговицы хранили в среде хранения (Optisol; фирма Chiron Vision Corporation, Irvine, CA) при 4°C в течение периода менее чем 14 дней перед первичным культивированием.

[0116] (Статистический анализ)

Статистически достоверная разность (значение P) средних значений при сравнении двух образцов определяли с помощью t-теста Стьюдента. Статистически достоверная разность в сравнении множества наборов образцов анализировалась с помощью критерия множественного сравнения Даннета. Значения, показанные в диаграмме, представляют среднее±стандартная ошибка (SE).

[0117] (Пример 1: Экспрессия цепи ламинина и цепи интегрина в эндотелиальных клетках роговицы и десцеметовой мембране)

В данном Примере, наблюдалась экспрессия цепи ламинина в десцеметовой мембране, которая представляет собой базальную мембрану эндотелиальных клеток роговицы.

[0118] (Материалы и Способы)

Экспрессию мРНК цепи ламинина проводили с помощью способа полимеразной цепной реакции (PCR). Хотя данные не показаны, экспрессия белков подтверждена путем иммуноокрашивания.

[0119] Вторые антитела разбавляли фосфатно-солевым буфером (PBS) и полученный раствор инкубировали в течение тридцати минут при комнатной температуре. AlexaTM Fluor 488 меченный (конъюгированный) антикроличьим IgG коз (каталожный номер: A11034; 1:1500; фирма Molecular Probe-Invitrogen) был использован как второе антитело. После встряхивания и двукратной отмывки 0,15% Triton/PBS и однократной - PBS проводили ядерное окрашивание пропидиум йодидом (каталожный номер: SP29004-41; PI; фирма Nacalai Tesque, Inc. Киото, Япония), и наносили вторые антитела путем накрытия покровным стеклом. Флуоресцентно меченые вторые антитела наблюдали с помощью конфокального лазерного сканирующего микроскопа (фирма Olympus Fluoview, Токио, Япония) и получения фотоснимков.

[0120] Последовательности праймеров цепей ламинина, использованных в способе ПЦР, показаны в нижеследующей Таблице 1. Последовательности праймеров цепей интегрина, использованных в способе ПЦР, показаны в нижеследующей Таблице 2. Праймеры были получены на фирме Life Technologies Japan Ltd (каталожный номер: 10336022).

Таблица 1
Олигонуклеотидные последовательности для ПЦР
Ген Смысловой праймер Антисмысловой праймер Размер (пар оснований bp)
Ламинин α1 5'-GAGTCCGTCTCTCTG6ACATAG-3' (SEQ ID NO: 9) 5'-CGTGGCATTCACAGGGTTGAC-3' (SEQ ID NO: 10) 180
Ламинин α2 5'-TGCTAGAATTTACCTCCGCTCG-3' (SEQ ID NO: 11) 5'-GATCAAGTGGACAAGCCCTG-3' (SEQ ID NO: 12) 203
Ламинин α3 5'-CTCCAAAGGCCCAACTCAAG-3' (SEQ ID NO: 13) 5'-CCATAACTGCCTCCTTAGTCTC-3' (SEQ ID NO: 14) 304
Ламинин α4 5'-CTTACGCAACACCACCGGATTC-3' (SEQ ID NO: 15) 5'-CCTTCTTCCAAGCATTCTCCG-3' (SEQ ID NO: 16) 140
Ламинин α5 5'-GAGGACTGAA6TGAAAACTCAA-3' (SEQ ID NO; 17) 5'-CCACTGAAGTTGTAAATGGTG-3' (SEQ ID NO: 18) 221
Ламинин β1 5',-GATGGT6AACTTGATGAAAAGT-3' (SEQ ID NO: 19] 5'-GGCnATATCCTTTAGGAGTGA-3' (SEQ ID NO 20) 258
Ламинин β2 5'-GATGATCGCATCCAAGGGAC-3' (SEQ ID NO; 21) 5'-GTCCAGAGTAGGGAGTCTCAG-3' (SEQ ID NO: 22) 150
Ламинин β3 5'-CCCAGATGGAGGAAGATGTC-3' (SEQ ID NO: 23) 5'GTAGCTGAGTCTGTGGGCAG-3' (SEQ ID NO: 24) 144
Ламинин β4 5'-GGCAGGCTACTTTGGATTTC-3' (SEQ ID NO: 25) 5'-GCTTGAGGGATCATCTGGAC-3' (SEQ ID NO: 26) 204
Ламинин γ1 5'-GATGAGATGGTGACAGATCAAG-3' (SEQ ID NO: 27) 5',-TTTCCAGTCTCTTCAATGGTAT-3' (SEQ ID NO: 28) 199
Ламинин γ2 5'-ATCGAAGGTTACTGCGGAATC-3' (SEQ ID NO: 29) 5'--GTAGCCAGAAGCACAATCCTG-3' (SEQ ID NO: 30) 193
Ламинин γ3 5'-GGGATACAAGAGGGAGATGC-3' (SEQ ID NO: 31) 5'-CATAGAAACCTGGCAAACAGC-3' (SEQ ID NO: 32) 157

Таблица 2
Олигонуклеотидные последовательности для ПЦР
Ген Смысловой праймер Антисмысловой праймер Размер (пар оснований bp)
интегрин α1 5'-gaagaacctcctgaaacccttt-3' (SEQ ID NO: 33) 5'-tgatgtcatattggggaatgac-3' (SEQ ID NO: 34) 254
интегрин α2 5'-tgatgggacagaagtaacatgc-3' (SEQ ID NO: 35) 5'-tggaccaacatcttcaaaactg-3' (SEQ ID NO: 36) 333
интегрин α3 5'-gctctgcctttggtttatctgt-3' (SEQ ID NO: 37) 5'-ttcccactagaaggtdgggta-3' (SEQ ID NO: 38) 257
интегрин α4 5'-atattcagtcggagctggtcat 3' (SEQ ID NO: 39) 5'-gcatatttgtcacttccaacga-3' (SEQ ID NO: 40) 338
интегрин α5 5'-tcctcagcaagaatctcaacaa-3' (SEQ ID NO; 41) 5'-gttgagtcccgtaactctggtc-3' (SEQ ID NO: 42) 304
интегрин α6 5'-agcaaggcagatggaataatgt-3' (SEQ ID NO 43) 5'-cagggtaggaatttcgatcaag-3' (SEQ ID NO 44) 275
интегрин α7 5'-caggtcaccttctacctcatcc-3' (SEQ ID NO: 45) 5'-accgtgacctcatacttgacct-3' (SEQ ID NO: 46) 262
интегрин α8 5'-atggaaaatgtaaccaggatgg-3' (SEQ ID NO: 47) 5'-cagttatgaatgggcagaacaa-3' (SEQ ID NO: 48) 265
интегрин α9 5'-cactttcagcccatcaatatca-3' (SEQ ID NO: 49) 5'-acagtgtgctgttaggcaagaa-3' (SEQ ID NO: 50) 305
интегрин α10 5'-atcagtgtggttcagagggact-3' (SEQ ID NO: 51) 5'-gccctggctttgtagtattgtc-3' (SEQ ID NO: 52) 330
интегрин α11 5'-ggacactgctgactacgtgaag-3' (SEQ ID NO: 53) 5,-gcgtgtgctctctatgatgaag-3' (SEQ ID NO: 54) 294
интегрин αE 5'-tagcagtgaagaagctgacgag-3' (SEQ ID NO: 55) 5'-tctttcaggaagaagacgacagtga-3' (SEQ ID NO: 56) 300
интегрин αV 5'-atctgtgaggtcgaaacaggat-3' (SEQ ID NO: 57) 5'-accttgccaataaaagctacca-3' (SEQ ID NO: 58) 255
интегрин αL 5'-gaaccattgacaccagaagtga-3' (SEQ ID NO; 59) 5'-cctcaaaccccaactgtett-3' (SEQ ID NO: 60) 341
интегрин αM 5'-gatcggctaagagaaggacaga-3' (SEQ ID NO: 61) 5'-cattgccacaattcttctcaaa-3' (SEQ ID NO: 62) 330
интегрин αX 5'-ccaacatctgcctttacattga-3' (SEQ ID NO: 63) 5',-cgtgaagtatctctgagcatcg-3' (SEQ ID NO: 64) 331
интегрин αD 5'-ttaaccagatgaagggctttgt-3' (SEQ ID NO: 65) 5'-ggtctttgtacttctgcccatc-3' (SEQ ID NO: 66) 296
интегрин αIIb 5'-gaaaagactgaggaggctgaga-3' (SEQ ID NO: 67) 5'-gagaaaatatccgcaactggag-3' (SEQ ID NO: 68) 245
интегрин β1 5'-gctgaagactatcccattgacc-3' (SEQ ID NO: 69) 5'-atttccagatatgcgctgtttt-3' (SEQ ID NO: 70) 321
интегрин β2 5'-tgatggacctctcctactccat-3' (SEQ ID NO: 71) 5'-gaaactggttggagttgttggt-3'- (SEQ ID NO: 72) 258
интегрин β3 5'-tgtttaccactgatgccaagac-3' (SEQ ID NO: 73) 5'-tcccataagcatcaacaatgag-3' (SEQ ID NO: 74) 308
интегрин β4 5'-gcttcacacctatttccctgtc-3' (SEQ ID NO: 75) 5'-gaaggaaggtttcagatggatg-3' (SEQ ID NO: 76) 316
интегрин β5 5'-gctggtgttcacaacagatgat-3' (SEQ ID NO: 77) 5'-atcccagactgacaactccact-3' (SEQ ID NO: 78) 349
интегрин β6 5'-tgtgactgtggtgaatgtgtgt-3' (SEQ ID NO: 79) 5'-caccagctagtttgcacttgtc-3' (SEQ ID NO: 80) 289
интегрин β7 5'-cacttcagacgacacattccat-3' (SEQ ID NO: 81) 5'-cccaactgcagacttaggaatc-3' (SEQ ID NO: 82) 250
интегрин β8 5'-gcattatgtcgaccaaacttca-3' (SEQ ID NO: 83) 5'-atttcttcaggcttctcacgtc-3' (SEQ ID NO: 84) 255

[0121] *Способ ПЦР: Способ ПЦР выполняли на любой цепи ламинина и цепи интегрина с помощью RT-PCR (полуколичественной обратной полимеразной цепной реакции). Праймеры приобретались у фирмы INVITROGEN, которая является компанией, синтезирующей олигонуклеотиды, и использовались таковые, которые были обработаны обессоливанием. Набор RNEasy Mini Kit (фирма QIAGEN Gmbh, каталожный номер: 74106) был использован для экстракции из клеток суммарной РНК. Десцеметову мембрану, включающую в себя эндотелиальные клетки роговицы, слущивали с роговицы, предназначенной для исследовательских целей, которую приобретали у Глазного банка Сиэтла, а эндотелиальные клетки роговицы механически слущивали с базальной мембраны для использования в экстракции РНК из эндотелиальных клеток роговицы. Реакция обратной транскрипции (42°C, шестьдесят минут) выполнялась на РНК с ReverTra Ace (фирма Toyobo Co., Ltd. (каталожный номер: TRT-101)), и CD166 и CD73 амплифицировались с глицеральдегид-3-фосфатдегидрогеназой (GAPDH) в качестве внутреннего стандарта с использованием TAKARA Taq HotStart Version ДНК-полимеразы (фирма Takara Bio Inc, каталожный номер: RR001A). То же количество кДНК было амплифицировано с помощью устройства для PCR (GeneAmp 9700; фирма Applied Biosystems) и нижеследующих пар праймеров. В реакции PCR использовались праймеры, показанные в Табл. 1, Табл. 2 и таковые, описанные ниже.

*GAPDH-F: GAGTCAACGGATTTGGTCGT (SEQ ID NO: 85)

*GAPDH-R: TTGATTTTGGAGGGATCTCG (SEQ ID NO: 86)

[0122]

Амплифицированный фрагмент кДНК подвергался электрофорезу в 1,5% агарозном геле (фирма Nacalai Tesque, каталожный номер: 01149-76) и детектировался путем окрашивания с этидиум бромидом (фирма Nacalai Tesque, каталожный номер: 14603-51).

[0123] *Проточная цитометрия: Культивированный эндотелий роговицы человека засевали в культуральную чашку, покрытую покрытием FNC, и культивировали около 14 дней до достижения конфлюентного состояния в условиях 5% CO2 при 37°C. Клетки слущивали с помощью TrypLETM Select и собирали. Затем проводили анализ на поверхностный антиген цепи интегрина с помощью проточного цитометра (BD FACSCantoTM II (фирма BD Biosciences, Franklin Lakes, NJ)) в соответствии с инструкцией по эксплуатации при использовании набора для скрининга маркеров клеточной поверхности человека (Human Cell Surface Marker Screening Panel) (BD LyoplateTM, фирма BD Bio-sciences, Franklin Lakes, NJ).

[0124] Клетки эндотелиального слоя роговицы человека культивировали, как описано ниже. Десцеметову мембрану, включая в нее эндотелиальные клетки роговицы, слущивали с роговицы, предназначенной для исследования и приобретенной в глазном банке Сиэтла, и эндотелиальные клетки роговицы механически слущивали с базальной мембраны. После отделения (обычно обработанных в течение двух часов при 37°C с помощью 1 мг/мл коллагеназы A (фирма Roche Applied Science)) и сбора [клеток] с базальной мембраны с помощью коллагеназы (фирма ROCHE каталожный номер: 10 103 586 001), проводили первичное культивирование. Что касается среды, была использована среда, в которой кондиционировалось для клеток-фидеров 3T3 следующее: жидкая среда Opti-MEM I Reduced-Serum Medium (фирма INVITROGEN, каталожный номер: 31985-070)+8% сыворотки крови эмбрионов коров (FBS) (фирма BIOWEST, каталожный номер: S1820-500)+200 мг/мл CaCl2×2H2O (фирма SIGMA, каталожный номер: C7902-500G)+0,08% хондроитин сульфата (фирма SIGMA, каталожный номер: C9819-5G)+20 мкг/мл аскорбиновой кислоты (фирма SIGMA, каталожный номер: A4544-25G)+50 мкг/мл гентамицина (фирма INVITROGEN, каталожный номер: 15710-064)+5 нг/мл эпидермального фактора роста (EGF) (фирма INVITROGEN, каталожный номер: PHG0311). Конкретно, после переваривания при 37°C, HCEC, полученные из индивидуальной роговицы, ресуспендировали в культуральной среде и наносили в одну из лунок 12-луночного планшета, покрытого FNC Coating MixTM. Культуральную среду готовили в соответствии с опубликованным протоколом, в который были внесены изменения. Объясняя кратко: готовили основную культуральную среду, содержащую OptiMEM-I (фирма Life Technologies), 8% FBS, 5 нг/мл эпидермального фактора роста (EGF) (фирма Sigma-Aldrich Co., St. Louis, MO), 1 мкМ SB431542 (фирма Merck Millipore), 20 мкг/мл аскорбиновой кислоты (фирма Sigma-Aldrich), 200 мг/л хлористого кальция (фирма Sigma-Aldrich), 0,08% хондроитин сульфата (фирма Wako Pure Chemical Industries, Ltd., Osaka) и 50 мкг/мл гентамицина. Далее, собирали среду, кондиционированную культивированием инактивированный 3T3 фибробластов. Инактивацию 3T3 фибробластов выполняли, как описано выше. Объясняя кратко: конфлюентные 3T3 фибробласты инкубировали в течение двух часов при 37°C под 5% CO2 с 4 мкг/мл митомицина C (MMC) (фирма Kyowa Hakko Kirin Co., Ltd., Tokyo), а затем получившееся обрабатывали трипсином и наносили на пластиковый планшет при плотности 2×104 клеток/см2. HCEC культивировали в увлажненной атмосфере при 37°C в 5% CO2, а культуральную среду заменяли каждые три дня. Когда HCEC достигала конфлюентного состояния за 14-28 дней, HCEC споласкивали в PBS без Ca2+ и Mg2+, обрабатывали трипсином в 0,05% трипсин-ЭДТА в течение пяти минут при 37°C, а затем пересевали в соотношении 1:2.

[0125] (Результаты)

Когда наблюдается экспрессия цепи ламинина в десцеметовой мембране (базальная мембрана эндотелиальных клеток роговицы), наиболее заметна была экспрессия цепи α5 ламинина, цепи β1 ламинина и цепи γ1 ламинина γ1. С другой стороны, экспрессия цепи α1 ламинина, цепи α2 ламинина и цепи α3 ламинина не были очевидны (данные не показаны).

[0126] Как показано на Фиг. 1, когда наблюдалась экспрессия мРНК цепи ламинина эндотелиальных клеток роговицы человека, экспрессия цепи α5 ламинина, цепи β1 ламинина, цепи β2 ламинина и цепи γ1 ламинина была наиболее заметной. С другой стороны, экспрессия цепи α1 ламинина, цепи α2 ламинина, цепи α3 ламинина, цепи α4 ламинина, цепи β3 ламинина, цепи γ2 ламинина и цепи γ3 ламинина не была очевидной.

[0127] Как показано на Фиг. 2, распознана экспрессия цепи α1 интегрина, цепи α2 интегрина, цепи α3 интегрина, цепи α6 интегрина, цепи α10 интегрина, цепи α11 интегрина, цепи β1 интегрина, цепи β5 интегрина, цепи β8 интегрина и цепи αV интегрина. Слабая экспрессия также распознана для цепи β3 интегрина, цепи β4 интегрина и цепи β6 интегрина. Таким образом, приведенное выше предполагает, что эндотелиальные клетки роговицы экспрессируют, по меньшей мере, одно [из сочетаний] α1β1, α2β1, α3β1, α6β1, α7β1 и α6β4, которые представляют собой интегрины, известные как ламинин-связывающие интегрины.

[0128] Как показано на Фиг. 3 (Фиг. 3A, 3B и 3C), экспрессия цепи α1 интегрина, цепи α2 интегрина, цепи α3 интегрина, цепи α5 интегрина и цепи β1 интегрина распознавалась как экспрессия антигена клеточной поверхности.

[0129] (Пример 2: Активация клеточной адгезии эндотелиальных клеток роговицы человека)

В данном Примере, чтобы подтвердить происходит или нет клеточная адгезия эндотелиальных клеток роговицы человека, использовался культуральный контейнер, покрытый ламинином или подобным.

(Материал и Способ)

*ламинин 511 (LN511, фирма VERITAS Corporation)

*ламинин 521(LN521, фирма VERITAS Corporation)

* фрагмент Е8 ламинина 511 (382-02413, фирма Nippi. Inc.)

*FNC coating mix® (50 мл (AES-0407), фирма ATHENA, каталожный номер: 0407)

*желатин (G1890-500G, фирма Sigma-Aldrich Co. LLC.)

*контейнер (3526, фирма CORNING)

(Способ) *Эндотелиальные клетки роговицы человека (HCEC, Source and Culture Method): культивирование HCEC проводили, как в изложенном выше Примере. Культивированные клетки споласкивали PBS без Ca2+ и Mg2+ и трипсинизировали при 37°C в течение пяти минут [смесью] 0,05% трипсин-ЭДТА, после чего высевали в 12-луночный планшет, покрытый FNC Coating Mix®. Культуральную среду готовили в соответствии с опубликованным протоколом со сделанными в нем частичными изменениями. Коротко говоря, готовили основную культуральную среду, которая содержала OptiMEM-I (фирма Life Technologies), 8% FBS, 5 нг/мл эпидермального фактора роста (EGF) (фирма Sigma-Aldrich Co., St. Louis, MO), 10 мкМ SB431542 (фирма Merck Millipore), 20 мкг/мл аскорбиновой кислоты (фирма Sigma-Aldrich), 200 мг/л хлористого кальция (фирма Sigma-Aldrich), 0,08% хондроитин сульфата (фирма Wako Pure Chemical Industries, Ltd., Osaka) и 50 мкг/мл гентамицина. Затем, после культивирования инактивированный клеток фибробластов 3T3, получали кондиционированную среду. Инактивацию клеток фибробластов 3T3 проводили, как описано ранее. Объясняя кратко: конфлюентные клетки фибробластов 3T3 инкубировали вместе с 4 мкг/мл митомицина C (MMC) (фирма Kyowa Hakko Kirin Col, Ltd, Tokyo) под 5% CO2 при 37°C в течение двух часов, после чего следовала обработка трипсином, и нанесение при плотности 2×104 клеток/см2 на пластиковый планшет. HCEC культивировали в 5% CO2 при 37°C в увлажненной атмосфере, а культуральную среду заменяли каждые три дня.

[0132] (Способ) HCEC высевали в каждую лунку 96-луночного планшета, покрытого ламинином 511, ламинином 521, ламинином 211, желатином, FNC Coating Mix®, и образовавшиеся через 24 часа клетки наблюдали в фазо-контрастном микроскопе. Посев культуры проводили при плотности посева в 5000 клеток/лунка в 96-луночные культуральные планшеты, а количество адгезировавших клеток проверяли через 24 часа после посева клеток с помощью теста жизнеспособности клеток CellTiter-Glo® Luminescent Cell Viability Assay (фирма Promega Corporation, Madison, WI, США). В дополнение, клеточная адгезия была оценена для культуральных планшетов, покрытых фрагментом Е8 ламинина 511 (0,001-1,5 мкг/см2). Далее, различные концентрации ламинина 521 и фрагмента Е8 ламинина 511 добавляли в среду для посева и сходным образом оценивали количество клеток через 24 часа.

[0133] (Измерение клеточного роста по захвату BrdU)

Сходным образом захват BrdU в HCEC, покрытые различными матриксами, оценивали с помощью твердофазного иммуноферментного анализа (ELISA). Посев проводили в 96-луночный культуральный планшет при плотности посева клеток 5000 клеток/лунка, после чего культивировали в течение ночи. Затем, в среду добавляли 5-бромо-2'-диоксиуридин (BrdU), после чего культивировали в течение ночи. Среду удаляли и добавляли фиксирующий раствор (Amersham cell proliferation biotrak ELISA system, version 2) для инкубации в течение 30 минут при комнатной температуре. Затем удаляли фиксирующий раствор и добавляли блокирующий раствор (Amersham cell proliferation biotrak ELISA system, version 2), за чем следовала инкубация в течение 30 минут при комнатной температуре. Затем удаляли блокирующий раствор и добавляли антитела к BrdU, конъюгированные с пероксидазой, за чем следовала инкубация в течение 90 минут при комнатной температуре. Планшеты отмывали три раза отмывочным буфером, и добавляли матрикс TMB (3,3',5,5'-тетраметил бензидин) (Amersham cell proliferation biotrak ELISA system, version 2), после чего инкубировали 5-30 минут. Реакцию останавливали с помощью 1M серной кислоты, и измеряли поглощение на [длине волны] 450 на с помощью планшет-ридера. Результат показан как среднее значение пяти измерений±стандартная ошибка.

[0134] (Результат)

Как показано на Фиг. 4, в присутствии ламинина 511 и ламинина 521 адгезия и растяжение эндотелиальных клеток роговицы были наиболее эффективны, тогда как рост не был эффективным при других условиях.

[0135] Как показано на Фиг. 5, в присутствии ламинина 511 и ламинин 521 клеточная адгезия эндотелиальных клеток роговицы наиболее эффективна по сравнению с другими условиями.

[0136] Как показано на Фиг. 6, в присутствии фрагмента Е8 ламинина 511 рост клеток эндотелия роговицы наиболее эффективен по сравнению с другими условиями. В частности, клеточная адгезия наиболее эффективна при концентрации 0,1-1,5 мкг/см2.

[0137] Как показано на Фиг. 7, в присутствии ламинина 511, ламинина 521 и фрагмента Е8 ламинина 511 клеточный рост эндотелиальных клеток роговицы наиболее эффективен по сравнению с другими условиями.

[0138] (Пример 3: Функциональный анализ на ламинин 511 и ламинин 521 в культуре эндотелиальных клеток роговицы человека)

В данном Примере функциональный анализ проводили на ламинин 511 и ламинин 521 в культуре эндотелиальных клеток роговицы человека.

[0139] (Материал и Способ)

*Эндотелиальные клетки роговицы человека (HCEC, Источник и способ культивирования): культивирование HCEC проводили, как описано ниже. Кратко: Десцеметова мембрана, включая в себя эндотелиальные клетки роговицы, была слущена с роговиц, предназначенных для исследовательских целей и приобретенных в глазном банке Сиэтла; затем базальную мембрану механически слущивали вместе с эндотелиальными клетками роговицы, которые затем слущивались с базальной мембраны с помощью коллагеназы (фирма ROCHE, каталожный номер: 10 103 586 001) (обычно они обрабатывались в течение двух часов с помощью 1 мг/мл коллагеназы A (фирма Roche Applied Science) при 37°C). После получения [клеток] проводили первичное культивирование. В первичной культуре проводили посев в 1 лунку из 12 в планшет, покрытый ламинином 511, ламинином 521, ламинином 211, FNC Coating Mix®. Что касается среды - была использована та же самая, что в Примере 1. Просмотр клеток проводили в течение периода времени с помощью фазо-контрастного микроскопа.

[0140] *Способ наблюдения клеток для окрашивания или подобного (гистологический тест): после иммобилизации культивированных HCEC проводили иммуноокрашивание с помощью ZO-1, Na+/K+-АТФазы в качестве маркера, связанного с функцией, после чего просматривали с помощью флуоресцентного микроскопа. HCEC иммобилизовали 4% формальдегидом в течение 10 минут при комнатной температуре (RT), после чего инкубировали в 1% бычьем сывороточном альбумине (BSA) в течение 30 минут. Иммунохимический анализ ткани был проведен на белок, связанный с тесными контактами, ZO-1, и с белком, относящимся к насосной функции Na+/K+-АТФазой. Каждое из первичных антител использовали в разбавлении 1:200. Для вторых антител использовали меченные Alexa Fluor™ 488 или меченные Alexa Fluor™ 594 антимышиные IgG коз (Life Technologies) в разбавлении 1:2000. Затем ядра клеток были окрашены DAPI (фирма Vector Laboratories, Inc., Burlingame, CA). Затем препараты просматривали во флуоресцентном микроскопе (BZ-9000; фирма Keyence, Osaka, Япония).

[0141] *Антитела к Na+/K+-АТФазе: были использованы таковые, произведенные фирмой MILLIPORE (фирма MILLIPORE, каталожный номер: 05-369).

[0142] *Антитела к ZO-1: были использованы таковые, произведенные в кролике фирмой ZYMED LABORATORIES (фирма ZYMED LABORATORIES, каталожный номер: 61-7300).

[0143] (Результат)

Как показано на Фиг. 8, ламинин 511 и ламинин 521 делают клеточную культуру эндотелиальных клеток роговицы человека более эффективной. Фотографии показывают клетки в фазо-контрастном микроскопе через два дня после первичного культивирования.

[0144] Как показано на Фиг. 9, ламинин 511 и ламинин 521 позволяют клеточное культивирование эндотелиальных клеток роговицы человека с высокой плотностью. Фотографии показывают клетки через двадцать дней после первичной культуры в фазо-контрастном микроскопе.

[0145] Как показано на Фиг. 10 и 11, ламинин 511 и ламинин 521 сохраняют активность ZO-1 и Na+/K+-АТФазы, и было продемонстрировано, что культивирование способом по данному изобретению позволяет рост при сохранении нормальных функций. Плотность клеток в ламинине 511 и ламинине 521 была выше по сравнению с ламинином и контролем без покрытия.

[0146] Как показано на Фиг. 12, добавление в среду перед посевом ламинина 521 и фрагмента Е8 ламинина 511 в различных концентрациях, таким образом, активировало клеточную адгезию эндотелиальных клеток роговицы.

[0147] (Пример 4: иллюстративные формы: Культуральный раствор для приготовления эндотелиального пласта роговицы)

В данном Примере, как примере формы, культуральный раствор для приготовления пласта эндотелия роговицы, содержащей агент по данному изобретению, был изготовлен нижеследующим образом.

[0148] Культуральный раствор, показанный ниже, готовили общепринятым способом.

Ламинин 511, ламинин 521 и (или) их фрагменты (0,75 мкг/см2)

Сыворотка крови эмбрионов коров (FBS) 10 мл
Раствор пенициллин-стрептомицин 1 мл
FGF основной 200 нг
DMEM соответствующее количество
Общее количество 100 мл

[0149] Например, BIOWEST (каталожный номер: S1820-500) или таковой, произведенный фирмой Invitrogen, может быть использован вместо FBS. Что касается пенициллин-стрептомицинового раствора, таковой, произведенный фирмой Nacalai Tesque (содержащий пенициллин 5000 мкг/мл, стрептомицин 5000 мкг/мл), может быть использован. В дополнение, например, вместо основного FGF, может быть использован таковой, произведенный фирмой Invitrogen (INVITROGEN, каталожный номер: 13256-029). Могут быть использованы SB431542, произведенный фирмой Tocris Cookson Ltd, а SB203580, фирмы CALBIOCHEM. DMEM может быть использован производства фирмы Invitrogen.

[0150] (Пример 5: иллюстративные формы: композиция для контейнера для сохранения или амплификации роговицы)

В данном примере, в качестве примера формы, раствор для покрытия контейнера, содержащего агент по данному изобретению, производился нижеследующим образом.

[0151] Раствор для хранения, показанный ниже, готовили общепринятым способом.

Ламинин 511, ламинин 521 и (или) их фрагмент (0,75 мкг/см2)

Соответствующий буфер Соответствующее количество
Общее количество 100 мл

[0152] Каждый ингредиент может быть получен сходным образом, как в Примере 4.

[0153] Как описано выше, данное изобретение проиллюстрировано использованием предпочтительных вариантов осуществления данного изобретения. Однако понятно, что сфера данного изобретения должна интерпретироваться, исключительно основываясь на формуле изобретения. Далее, следует понимать, что какой-либо патент, какая-либо патентная заявка и какая-либо ссылка, процитированная в данном документе, должны быть включены в данный документ по ссылке таким же образом, как содержание конкретно описанное здесь. Данный предмет заявки претендует на приоритет японской патентной заявки No. 2013-244972, заполненной 27 ноября, 2013, которая должна быть включена в данный документ по ссылке по всей ее полноте.

[Промышленная применимость]

[0154] Имеются компоненты культуры и способ культивирования для активации роста клеток эндотелия роговицы. Представлена технология, доступная в промышленности, связанная с технологией, относящейся к имплантам роговицы (промышленность культуры клеток, производство лекарственных препаратов и подобного).

[0155] (Список последовательностей в свободной форме)

SEQ ID NO: 1 последовательность нуклеиновой кислоты цепи α5 ламинина (NM_005560)

SEQ ID NO: 2 аминокислотная последовательность цепи α5 ламинина (NP_005551)

SEQ ID NO: 3 последовательность нуклеиновой кислоты цепи β1 ламинина (NM_002291)

SEQ ID NO: 4 аминокислотная последовательность цепи β1 ламинина (NP_002282)

SEQ ID NO: 5 последовательность нуклеиновой кислоты цепи β2 ламинина (NM_002292)

SEQ ID NO: 6 аминокислотная последовательность цепи β2 ламинина (NP_002283)

SEQ ID NO: 7 последовательность нуклеиновой кислоты цепи γ1 ламинина (NM_002293)

SEQ ID NO: 8 аминокислотная последовательность цепи γ1 ламинина (NP_002284)

SEQ ID NO: 9 последовательность смыслового праймера цепи α1 ламинина: 5'-GAGTCCGTCTCTCTGGACATAG-3'

SEQ ID NO: 10 последовательность антисмыслового праймера цепи α1 ламинина: 5'-CGTGGCATTCACAGGGTTGAC-3'

SEQ ID NO: 11 последовательность смыслового праймера цепи α2 ламинина: 5'-TGCTAGAATTTACCTCCGCTCG-3'

SEQ ID NO: 12 последовательность антисмыслового праймера цепи α2 ламинина: 5'-GATCAAGTGGACAAGCCCTG-3'

SEQ ID NO: 13 последовательность смыслового праймера цепи α3 ламинина: 5'-CTCCAAAGGCCCAACTCAAG-3'

SEQ ID NO: 14 последовательность антисмыслового праймера цепи α3 ламинина: 5'-CCATAACTGCCTCCTTAGTCTC-3'

SEQ ID NO: 15 последовательность смыслового праймера цепи α4 ламинина: 5'-CTTACGCAACACCACCGGATTC-3'

SEQ ID NO: 16 последовательность антисмыслового праймера цепи α4 ламинина: 5'-CCTTCTTCCAAGCATTCTCCG-3'

SEQ ID NO: 17 последовательность смыслового праймера цепи α5 ламинина: 5'-GAGGACTGAAGTGAAAACTCAA-3'

SEQ ID NO: 18 последовательность антисмыслового праймера цепи α5 ламинина: 5'-CCACTGAAGTTGTAAATGGTG-3'

SEQ ID NO: 19 последовательность смыслового праймера цепи β1 ламинина: 5'-GATGGTGAACTTGATGAAAAGT-3'

SEQ ID NO: 20 последовательность антисмыслового праймера цепи β1 ламинина: 5'-GGCTTATATCCTTTAGGAGTGA-3'

SEQ ID NO: 21 последовательность смыслового праймера цепи β2 ламинина: 5'-GATGATCGCATCCAAGGGAC-3'

SEQ ID NO: 22 последовательность антисмыслового праймера цепи β2 ламинина: 5'-GTCCAGAGTAGGGAGTCTCAG-3'

SEQ ID NO: 23 последовательность смыслового праймера цепи β3 ламинина: 5'-CCCAGATGGAGGAAGATGTC-3'

SEQ ID NO: 24 последовательность антисмыслового праймера цепи β3 ламинина: 5'-GTAGCTGAGTCTGTGGGCAG-3'

SEQ ID NO: 25 ламинина β4 последовательность смыслового праймера цепи: 5'-GGCAGGCTACTTTGGATTTC-3'

SEQ ID NO: 26 ламинина β4 последовательность антисмыслового праймера цепи: 5'-GCTTGAGGGATCATCTGGAC-3'

SEQ ID NO: 27 последовательность смыслового праймера цепи γ1 ламинина: 5'-GATGAGATGGTGACAGATCAAG-3'

SEQ ID NO: 28 последовательность антисмыслового праймера цепи γ1 ламинина: 5'-TTTCCAGTCTCTTCAATGGTAT-3'

SEQ ID NO: 29 последовательность смыслового праймера цепи γ2 ламинина: 5'-ATCGAAGGTTACTGCGGAATC-3'

SEQ ID NO: 30 последовательность антисмыслового праймера цепи γ2 ламинина: 5'-GTAGCCAGAAGCACAATCCTG-3'

SEQ ID NO: 31 последовательность смыслового праймера цепи γ3 ламинина: 5'-GGGATACAAGAGGGAGATGC-3'

SEQ ID NO: 32 последовательность антисмыслового праймера цепи γ3 ламинина: 5'-CATAGAAACCTGGCAAACAGC-3'

SEQ ID NO: 33 последовательность смыслового праймера цепи α1 интегрина: 5'-gaagaacctcctgaaacccttt-3'

SEQ ID NO: 34 последовательность антисмыслового праймера цепи α1 интегрина: 5'-tgatgtcatattggggaatgaa-3'

SEQ ID NO: 35 последовательность смыслового праймера цепи α2 интегрина: 5'-tgatgggacagaagtaacatgc-3'

SEQ ID NO: 36 последовательность антисмыслового праймера цепи α2 интегрина: 5'-tggaccaacatcttcaaaactg-3'

SEQ ID NO: 37 последовательность смыслового праймера цепи α3 интегрина: 5'-gctctgcctttggtttatctgt-3'

SEQ ID NO: 38 последовательность антисмыслового праймера цепи α3 интегрина: 5'-ttcccactagaaggtctgggta-3'

SEQ ID NO: 39 последовательность смыслового праймера цепи α4 интегрина: 5'-atattcagtcggagctggtcat-3'

SEQ ID NO: 40 последовательность антисмыслового праймера цепи α4 интегрина: 5'-gcatatttgtcacttccaacga-3'

SEQ ID NO: 41 последовательность смыслового праймера цепи α5 интегрина: 5'-tcctcagcaagaatctcaacaa-3'

SEQ ID NO: 42 последовательность антисмыслового праймера цепи α5 интегрина: 5'-gttgagtcccgtaactctggtc-3'

SEQ ID NO: 43 интегрина α6 последовательность смыслового праймера цепи: 5'-agcaaggcagatggaataatgt-3'

SEQ ID NO: 44 интегрина α6 последовательность антисмыслового праймера цепи: 5'-cagggtaggaatttcgatcaag-3'

SEQ ID NO: 45 интегрина α7 последовательность смыслового праймера цепи: 5'-caggtcaccttctacctcatcc-3'

SEQ ID NO: 46 интегрина α7 последовательность антисмыслового праймера цепи: 5'-accgtgacctcatacttgacct-3'

SEQ ID NO: 47 интегрина α8 последовательность смыслового праймера цепи: 5'-atggaaaatgtaaccaggatgg-3'

SEQ ID NO: 48 интегрина α8 последовательность антисмыслового праймера цепи: 5'-cagttatgaatgggcagaacaa-3'

SEQ ID NO: 49 интегрина α9 последовательность смыслового праймера цепи: 5'-cactttcagcccatcaatatca-3'

SEQ ID NO: 50 интегрина α9 последовательность антисмыслового праймера цепи: 5'-acagtgtgctgttaggcaagaa-3'

SEQ ID NO: 51 интегрина α10 последовательность смыслового праймера цепи: 5'-atcagtgtggttcagagggact-3'

SEQ ID NO: 52 интегрина α10 последовательность антисмыслового праймера цепи: 5'-gccctggctttgtagtattgtc-3'

SEQ ID NO: 53 последовательность смыслового праймера цепи α11 интегрина: 5'-ggacactgctgactacgtgaag-3'

SEQ ID NO: 54 последовательность антисмыслового праймера цепи α11 интегрина: 5'-gcgtgtgctctctatgatgaag-3'

SEQ ID NO: 55 последовательность смыслового праймера цепи αE интегрина: 5'-tagcagtgaagaagctgacgag-3'

SEQ ID NO: 56 последовательность антисмыслового праймера цепи αE интегрина: 5'-tctttcaggaagacgacagtga-3'

SEQ ID NO: 57 последовательность смыслового праймера цепи αV интегрина: 5'-atctgtgaggtcgaaacaggat-3'

SEQ ID NO: 58 последовательность антисмыслового праймера цепии αV интегрина: 5'-accttgccaataaaagctacca-3'

SEQ ID NO: 59 последовательность смыслового праймера цепи αL интегрина: 5'-gaaccattgacaccagaagtga-3'

SEQ ID NO: 60 последовательность антисмыслового праймера цепи αL интегрина: 5'-ttcttcaaaccccaactgtctt-3'

SEQ ID NO: 61 последовательность смыслового праймера цепи αM интегрина: 5'-gatcggctaagagaaggacaga-3'

SEQ ID NO: 62 последовательность антисмыслового праймера цепи αM интегрина: 5'-cattgccacaattcttctcaaa-3'

SEQ ID NO: 63 последовательность смыслового праймера цепи αX интегрина: 5'-ccaacatctgcctttacattga-3'

SEQ ID NO: 64 последовательность антисмыслового праймера цепи αX интегрина: 5'-cgtgaagtatctctgagcatcg-3'

SEQ ID NO: 65 последовательность смыслового праймера цепи αD интегрина: 5'-ttaaccagatgaagggctttgt-3'

SEQ ID NO: 66 последовательность антисмыслового праймера цепи αD интегрина: 5'-ggtctttgtacttctgcccatc-3'

SEQ ID NO: 67 последовательность смыслового праймера цепи αIIb интегрина: 5'-gaaaagactgaggaggctgaga-3'

SEQ ID NO: 68 последовательность антисмыслового праймера цепи αIIb интегрина: 5'-gagaaaatatccgcaactggag-3'

SEQ ID NO: 69 последовательность смыслового праймера цепи β1 интегрина: 5'-gctgaagactatcccattgacc-3'

SEQ ID NO: 70 последовательность антисмыслового праймера цепи β1 интегрина: 5'-atttccagatatgcgctgtttt-3'

SEQ ID NO: 71 последовательность смыслового праймера цепи β2 интегрина: 5'-tgatggacctctcctactccat-3'

SEQ ID NO: 72 последовательность антисмыслового праймера цепи β2 интегрина: 5'-gaaactggttggagttgttggt-3'

SEQ ID NO: 73 последовательность смыслового праймера цепи β3 интегрина: 5'-tgtttaccactgatgccaagac-3'

SEQ ID NO: 74 последовательность антисмыслового праймера цепи β3 интегрина: 5'-tcccataagcatcaacaatgag-3'

SEQ ID NO: 75 последовательность смыслового праймера цепи β4 интегрина: 5'-gcttcacacctatttccctgtc-3'

SEQ ID NO: 76 последовательность антисмыслового праймера цепи β4 интегрина: 5'-gaaggaaggtttcagatggatg-3'

SEQ ID NO: 77 последовательность смыслового праймера цепи β5 интегрина: 5'-gctggtgttcacaacagatgat-3'

SEQ ID NO: 78 последовательность антисмыслового праймера цепи β5 интегрина: 5'-atcccagactgacaactccact-3'

SEQ ID NO: 79 последовательность смыслового праймера цепи β6 интегрина: 5'-tgtgactgtggtgaatgtgtgt-3'

SEQ ID NO: 80 последовательность антисмыслового праймера цепи β6 интегрина: 5'-caccagctagtttgcacttgtc-3'

SEQ ID NO: 81 последовательность смыслового праймера цепи β7 интегрина: 5'-cacttcagacgacacattccat-3'

SEQ ID NO: 82 последовательность антисмыслового праймера цепи β7 интегрина: 5'-cccaactgcagacttaggaatc-3'

SEQ ID NO: 83 последовательность смыслового праймера цепи β8 интегрина: 5'-gcattatgtcgaccaaacttca-3'

SEQ ID NO: 84 последовательность антисмыслового праймера цепии β8 интегрина: 5'-atttcttcaggcttctcacgtc-3'

SEQ ID NO: 85 GAPDH-F: GAGTCAACGGATTTGGTCGT

SEQ ID NO: 86 GAPDH-R: TTGATTTTGGAGGGATCTCG

1. Композиция для активации роста дифференцированных эндотелиальных клеток роговицы, содержащая эффективное количество, по меньшей мере, одного из ламинина 511, и/или ламинина 521, и/или его функционального фрагмента Е8, которые экспрессируются в эндотелиальных клетках роговицы.

2. Композиция по п. 1, где композиция содержит эффективное количество ламинина 511 (α5 β1 γ1) и/или ламинина 521 (α5 β2 γ1).

3. Композиция по п. 1, в которой фрагмент обладает способностью к клеточной адгезии эндотелиальных клеток роговицы.

4. Композиция по п. 1, где композиция содержит эффективное количество ламинина 511, и/или ламинина 521, и/или функциональный фрагмент Е8 ламинина 511.

5. Композиция по п. 1, в которой дифференцированные эндотелиальные клетки роговицы получены от человека.

6. Среда для активации роста дифференцированных эндотелиальных клеток роговицы, содержащая композицию по п. 1.

7. Культуральный контейнер для активаци роста дифференцированных эндотелиальных клеток роговицы, который покрыт композицией по п. 1.

8. Способ активации роста дифференцированных эндотелиальных клеток роговицы, содержащий стадию культивирования дифференцированных эндотелиальных клеток роговицы с использованием композиции по п. 1.

9. Способ активации роста дифференцированных эндотелиальных клеток роговицы, содержащий стадию культивирования дифференцированных эндотелиальных клеток роговицы с использованием среды по п. 6.

10. Способ активации роста дифференцированных эндотелиальных клеток роговицы, содержащий стадию культивирования дифференцированных эндотелиальных клеток роговицы с использованием контейнера по п. 7.



 

Похожие патенты:

Изобретение относится к области биотехнологии, а именно к бессывороточной питательной среде, и включает основной компонентный состав питательной среды Игла MEM, а также дополнительно содержит микроэлементы (соли кадмия, кобальта, цинка, никеля, селена, молибдена) в концентрации 0,00001-4,0 г/л, пируват натрия в концентрации 0,04-4,0 г/л, витамины B12 и Е в концентрации 0,0001-0,1 г/л, олеиновую кислоту в концентрации 0,000005-0,5 г/л, цистеин, глютатион, пролин, аланин, аспарагин, аспарагиновую кислоту в концентрации 0,001-1,5 г/л, (всего 45 компонентов), рекомбинантный инсулин человека в концентрации 0,000025-0,025 г/л, а также увеличена концентрация лейцина, фенилаланина, триптофана, лизина до 0,035-0,072 г/л.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ выявления генома возбудителя бруцеллезной инфекции (Brucella spp.) у сельскохозяйственных животных, включающий выделение ДНК из биологического материала от инфицированных животных сорбционным методом, постановку одноэтапной полимеразной цепной реакции - с одновременным проведением циклов амплификации с детекцией в реальном времени с использованием специфичных для участка генома (Brucella spp.) олигонуклеотидных праймеров, зондов, красителей и контрольных образцов в виде внутреннего и положительного, измерение специфического сигнала и сигнала контроля по каналам соответствующих красителей и интерпретацию результатов, где проводят флуоресцентную детекцию, измеряют по каналу JOE(HEX)/Yellow накопление флуоресцентного сигнала для специфического сигнала тестирования наличия генома возбудителя бруцеллезной инфекции (Brucella spp.), а по каналу FAM/Green - сигнал внутреннего контрольного образца, если кривые накопления флуоресцентного сигнала выходят до 35 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 35 цикла, то результат реакции - отрицательный, а интерпретацию результатов проводят на основании наличия/отсутствия пересечения кривой флуоресценции с пороговой линией, при этом для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома ДНК Brucella spp.

Изобретение относится к биотехнологии, а именно к идентификации гетерогенной популяции клеток почек, пригодной для обеспечения регенеративного стимула для почки, и лечению болезни почек у человека.

Изобретение относится к медицине, а именно к экспериментальной медицине, и может быть использовано для моделирования туберкулезной инфекции in vitro. Гранулемоподобные структуры получают из мононуклеарных клеток венозной крови в присутствии микобактерий туберкулеза, культивируемых в трехмерном матриксе.

Изобретение относится к области биотехнологии, а именно к получению клеток первичной кишечной трубки. Способ включает контактирование популяции, содержащей клетки первичной кишечной трубки, полученные последовательным дифференцированием плюрипотентных стволовых клеток человека, за исключением способа, где плюрипотентные стволовые клетки человека получены путем использования эмбриона человека, с лигандом или антителом, которые связывают Lif-рецептор.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая соединение для ингибирования экспрессии фактора комплемента В (CFB) (варианты), фармацевтическую композицию для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, способ лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, применение вышеуказанного соединения или композиции для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента, применение вышеуказанного соединения или композиции при изготовлении лекарственного средства для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента.

Изобретение относится к медицине, а именно к экспериментальной медицине, и может быть использовано для создания модели для изучения физиологии и патологии пренатального периода онтогенеза на курином эмбрионе.

Группа изобретений относится к области биотехнологии. Предложена печатающая головка и устройство печати тканевыми сфероидами.

Изобретение относится к области биотехнологии, конкретно к иммуногенным эпитопам URLC10, и может быть использовано в медицине для лечения пациента, страдающего раком.

Группа изобретений относится к области биотехнологии. Предложен выделенный или по существу очищенный гепарансульфат HS8, при этом указанный HS8 способен специфически и с высокой аффинностью связываться с полипептидом, состоящим из аминокислотной последовательности YCKNGGF (SEQ ID NO: 2) и имеющим от 0 до 20 дополнительных аминокислот на одном или на обоих концах указанной аминокислотной последовательности SEQ ID NO:2, при этом указанный по существу очищенный гепарансульфат HS8 содержит по меньшей мере 80% HS8, и при этом указанный гепарансульфат HS8 имеет определенный дисахаридный состав.
Изобретение относится к области биотехнологии, а именно к обратимому ингибированию в опухолевых клетках гепатоцеллюлярной карциномы экспрессии гена, кодирующего синтез аполипопротеина В. Способ включает введение в среду, содержащую опухолевые клетки Huh7 гепатоцеллюлярной карциномы человека, дисперсию липидных наночастиц модифицированных кристаллов магнетита, полученную путем смешения 138 мас.ч. кристаллов магнетита с размером 23-27 нм с 1 мас.ч. смеси липидов холестерина, 1,2-дистеароил-sn-глицеро-3-фосфохолина, 1,1'-(2-(4-(2-((2-(бис(2-гидроксидодецил)амино)этил)(2-гидроксидецил)амино)этил)пиперазин-1-ил)этилазанедиил)дидодекан-2-ола и 1,2-димиристоил-sn-глицеро-метокси(полиэтиленгликоля)-2000, взятых в массовом соотношении 15:7:75:3, соответственно, вначале с 60000 мас.ч. хлороформа, затем с 82240 мас.ч. N-метил-2-пирролидона, обработки смеси ультразвуком в течение 0,5-7,0 ч с мощностью ультразвука 116-580 Вт, удаления хлороформа, добавления в дисперсию воды объемом 400-600% от объема дисперсии, диализа полученной дисперсии против воды в течение 24-48 ч в диализном мешке с размером пор 25-50 килодальтон, концентрирования дисперсии до содержания магнетита 0,7-2,8 мг/мл под вакуумом, смешения 1 мас.ч. полученной дисперсии модифицированных кристаллов магнетита с раствором малой интерферирующей рибонуклеиновой кислоты в водном растворе ацетата натрия, содержащем 0,05-0,20 мас.ч. малой интерферирующей рибонуклеиновой кислоты, очистки полученной дисперсии повторным диализом против воды, добавления в очищенную дисперсию натрий-фосфатного буфера до получения дисперсии с ионной силой 0,15 М. Затем осуществляют обработку в течение 1-3 ч переменным магнитным полем с индуктивностью 50-100 миллитесла. Изобретение позволяет повысить степень обратимого ингибирования экспрессии гена, кодирующего синтез аполипопротеина В в опухолевых клетках Huh7 гепатоцеллюлярной карциномы человека. 4 пр.

Изобретение относится к области биотехнологии, а именно к получению одногормональных инсулинположительных клеток. Способ, за исключением способа, в котором клетки поджелудочной железы передней кишки и клетки энтодермы поджелудочной железы получены с использованием человеческих эмбрионов, включает дифференцировку клеток поджелудочной железы передней кишки, экспрессирующих PDX-1 и NKX6.1, в клетки энтодермы поджелудочной железы путем обработки клеток поджелудочной железы передней кишки, экспрессирующих PDX-1 и NKX6.1, ингибитором shh, низкой дозой ретиноевой кислоты и аскорбиновой кислотой. Затем осуществляют дифференцировку клеток энтодермы поджелудочной железы в одногормональные эндокринные клетки поджелудочной железы в среде, дополненной ингибитором shh, низкой дозой ретиноевой кислоты и аскорбиновой кислотой. Изобретение позволяет расширить арсенал технических средств. 15 з.п. ф-лы, 22 ил., 8 табл., 8 пр.

Изобретение относится к области биотехнологии. Предложена композиция для активации роста дифференцированных эндотелиальных клеток роговицы, содержащая эффективное количество, по меньшей мере, одного из ламинина 511, иили ламинина 521, иили его функционального фрагмента Е8, которые экспрессируются в эндотелиальных клетках роговицы. Изобретение может быть использовано в медицине. 6 н. и 4 з.п. ф-лы, 12 ил., 2 табл., 5 пр.

Наверх