Рекомбинантная плазмида, экспрессирующая клонированный ген шаперона hfq vibrio cholerae, и штамм escherichia coli - суперпродуцент шаперона hfq vibrio cholerae

Изобретение относится к биотехнологии, генной инженерии, медицинской микробиологии. Предложена рекомбинантная плазмида pHFQ2.21, экспрессирующая клонированный ген hfq (шаперона) Vibrio cholerae 01 биовара El Tor, встроенный по сайтам Bam HI-PstI в полилинкер векторной плазмиды pQE30, под контролем Т5-промотора. Указанной плазмидой трансформируют штамм Е. coli Jm109 с получением штамма Escherichia coli KM 2030, являющегося суперпродуцентом шаперона (Hfq) Vibrio cholerae 01 El Tor. Предложенный штамм депонирован в Государственной коллекции патогенных бактерий «Микроб». Содержание шаперона (Hfq) Vibrio cholerae 01 El Tor, находящегося внутри клеток в растворимой форме, составляет до 10% суммарных клеточных белков. Изобретение может быть использовано для получения препаратов шаперона (Hfq) Vibrio cholerae в целях создания специфических сорбентов для связывания малых РНК, а также для изучения свойств, биохимической и биологической активности шаперона (Hfq) Vibrio cholerae. 2 н.п. ф-лы, 1 ил., 2 пр.

 

Предлагаемое изобретение относится к биотехнологии, генной инженерии, медицинской микробиологии и может быть использовано для получения препаратов шаперона (Hfq) Vibrio cholerae в целях создания специфических сорбентов для связывания малых РНК, а также для изучения свойств, биохимической и биологической активности шаперона (Hfq) Vibrio cholerae.

Растворимый шаперон (Hfq) является регуляторным белком связывающий малые РНК холерных вибрионов (1, 2, 3). Выделение и очистка с последующим фракционированием малых РНК у холерного вибриона сопряжены с различными трудностями как-то отделение их от сопутствующей хромосомной и плазмидной ДНК, транспортной и матричной РНК (4). На практике эти задачи решаются применением многоступенчатых сложных этапов очистки включающих разделение молекул на хроматографических колонках и в полиакриамидных гелях с использованием специфических гидролитических ферментативных комлексов для ДНК, транспортной и матричной РНК(5).

В настоящее время существует проблема в разработке нового подхода в основе которого лежит прямое связывание малых РНК афинным белком шапероном Hfq V.cholerae иммобилизованным на латексных микрочастицах и прямое извлечение их смеси биомолекул. В свою очередь, для создания таких микрочастиц требуются препаративные количества искомого белка Hfq. Наиболее эффективным способом получения белка остается использование лабораторных штаммов Е.coli, содержащих и экспрессирующих клонированный ген hfq Vibrio cholera 01.

Известна рекомбинантная плазмида рЕТ28 [VcHfq], экспрессирующая клонированный в составе векторной плазмиды pET28b (Novagen) ген hfq Vibrio cholerae 017 в штамме E.coli BL21 (DE3) (6), однако продуктивность этого штамма как продуцента авторами не описана.

Однако о продуцирующей способности плазмиды рЕТ28 [VcHfq] данные отсутствуют, а недоступность для исследования в России не позволяет провести их.

Технической задачей предполагаемого изобретения является

- клонирование гена hfq в составе плазмидного вектора pQE30, обеспечивающего экспрессию чужеродных генов под контролем мощного Т5-промотора, и создание штамма E.coli - суперпродуцента рекомбинантного белка 6his-Hfq V.cholerae 01.

Задача решается путем создания:

- новой рекомбинантной плазмиды pHFQ2.21, экспрессирующей клонированный ген hfq холерного вибриона в штаммах кишечной палочки.

- штамма Escherichia coli Jm109 pHFQ2.21 - суперпродуцента Hfq холерных вибрионов посредством трансформации штамма Е. coli Jm109 рекомбинантной плазмидой pHfq.

На фиг. 1 представлена схема конструирования рекомбинантной плазмиды pHFQ2.21.

Векторная плазмида pQE30 несет ген устойчивости к ампициллину (bla) и содержит промоторно-операторную область, включающую Т5-промотор и два расположенных тандемом lac-оператора, обеспечивающих максимальную репрессию синтеза Hfq в присутствии глюкозы, а также синтетический сайт связывания рибосомальной РНК, старт-кодон последовательность триплетов, кодирующих синтез гексагистидина (6-His), полилинкер (MCS) и два терминатора транскрипции (t0 фага лямбда и Т1 из rrnB-оперона Е. coli). Экспрессия клонированных генов происходит при индукции изопропил-β-D-тиогалактозидом (ИПТГ) и начинается с плазмидного старт-кодона, при этом образуется гибридный белок, перед первой аминокислотой которого располагается гексагистидиновый блок.

Плазмида pHFQ2.21 представляет собой генно-инженерный вариант, полученный путем встраивания в вектор pQE30 гена hfq V.cholerae O1 биовара El Tor (см. фиг. 1).

Будучи трансформирована в штамм кишечной палочки Jm103 либо Jm109, рекомбинантная плазмида экспрессирует клонированный ген под контролем Т5-промотора. Экспрессия гена подавляется в присутствии глюкозы и индуцируется ИПТГ.

Штамм E.coli Jm109pHFQ2.21 представляет собой генно-инженерный вариант, полученный путем трансформации рекомбинантной плазмиды pHFQ2.21 в штамм E.coli Jm109, и является продуцентом шаперона Hfq V.cholerae. Первичный продукт трансляции не подвергается протеолитическому процессингу и остается в виде про-шаперона (6his-Hfq) с молекулярной массой субъединицы около 11,2 кДа, который, тем не менее, обладает способностью к агрегации в гексамер и связывать малые РНК. Штамм депонирован в Государственной коллекции патогенных бактерий «Микроб» под номером КМ 2030.

Полученный штамм-продуцент характеризуется следующими признаками:

Культуралыю-морфологические свойства

В жидких питательных средах (бульоне Хоттингера, мясо-пептонном бульоне) образует равномерную муть, на плотных - круглые, выпуклые, гладкие, белые полупрозрачные колонии с ровным краем, тестообразной консистенции.

Физиолого-биохимические свойства

Штамм разлагает с образованием кислоты и газа глюкозу, арабинозу и ман-нит, не разлагает сахарозу, на среде Эндо образует лактозонегативные колонии. Ауксотроф.

Устойчивость к антибиотикам

Штамм устойчив к 50-100 мкг/мл ампициллина за счет экспрессии гена bla, находящегося в составе векторной плазмиды pQE30.

Способ получения и использования рекомбинантной плазмиды и штамма-продуцента иллюстрируется следующими примерами.

Пример 1. Клонирование гена hfq и получение рекомбинантной плазмиды

Для ПЦР-синтеза гена hfq используют праймеры, сконструированные заявителями на основе анализа нуклеотидной последовательности гена hfq в хромосоме (NC_002505.1):

прямой - 5'- GAAAGGATCCATGGCTAAGGGGCAATCTCTAC -3' и

обратный - 5'- GTCACTGCAGCGATCAACTCCTTAAATAATTGTGCT -3'.

Поскольку амплификаты необходимо встроить в плазмидный вектор pQE30 в ориентации, обеспечивающей направление транскрипции под контролем Т5-промотора, на 5'-конце каждого праймера внесен сайт рестрикции для эндонук-леазы, образующей липкие концы: BamHI для прямого праймера и PstI - для обратного (в приведенных последовательностях выделены жирным шрифтом и подчеркнуты) в соответствии с порядком расположения сайтов рестрикции в полилинкере векторной плазмиды.

Из токсигенного штамма V.cholerae Эль Тор 5879 (Музей живых культур Ростовского-на-Дону противочумного института) фенольным методом выделяют хромосомную ДНК, которая служит матрицей для синтеза искомого гена.

300 мкл реакционной смеси для полимеразной цепной реакции содержат 0,5 нг ДНК-матрицы и следующие компоненты в указанных концентрациях: по 2,5 мкл каждого праймера, по 2,5 мМ всех четырех дезоксинуклеотидтрифосфатов, 3 ед. Taq-полимеразы и 0,1 объема прилагаемого к ней 10-кратного буфера. Смесь разливают по 30 мкл в 0,5-мл пластиковые пробирки и осуществляют реакцию по следующей схеме: 94°С - денатурация (20 сек), 58°С - отжиг (10 сек), 72°С - синтез (10 сек). Всего проводят 30 циклов амплификации, в последнем цикле время синтеза увеличивают до 3 минут. По окончании реакции содержимое пробирок объединяют, очищают смесью фенол: хлороформ : изоамиловый спирт в соотношении 25:24:1 и осаждают этиловым спиртом.

Полученный таким образом ПЦР-амплификат длиной 315 п. н. и ДНК векторной плазмиды pQE30 гидролизуют эндонуклеазами рестрикции BamHI и PstI согласно рекомендациям фирмы - изготовителя ферментов, очищают смесью фенол : хлороформ : изоамиловый спирт (25:24:1) и осаждают этиловым спиртом. Осадок растворяют в минимальном объеме деионизованной воды и лигируют с использованием ДНК-лигазы фага Т4 и прилагаемого к ней буфера согласно рекомендациям изготовителя.

Лигазными смесями трансформируют электорокомпетентные клетки E.coli Jm109, приготовленные накануне. После процедуры электропорации (2,6 кВольт, +4°С, 25 мкФ, 200 Ом, кювета 2 мм) клетки разводят в 5 раз средой SOC с 0,5% глюкозы, подращивают в течение 1 ч и высевают на агар LB, содержащий 50 мкг/мл ампициллина и 0,5% глюкозы. Посевы инкубируют при 37°С. На следующие сутки выросшие ампициллинрезистентые колонии тестируют с помощью вышеприведенных праймеров и отбирают позитивные клоны, из которых выделяют плазмидную ДНК и подтверждают наличие вставок длиной -315 п. н. гидролизом этих плазмид эндонуклеазами рестрикции BamHI и PstI с последующим электрофорезом в 1% агарозном геле.

Пример 2. Изучение экспрессии клонированного гена Hfq в E.coli

В клетках E.coli, в отличие от V.cholerae, шаперон не подвергается протеолитическому процессингу и синтезируется в виде 6his-шаперона (6his-Hfq). Для выявления способности рекомбинантов к синтезу proHfq рекомбинантный штамм E.coli Jm109pHFQ2.21 (KM 2030), а также контрольный штамм, содержащий векторную плазмиду pQE30 без вставки, выращивают в жидкой среде LB, содержащей 50 мкг/мл ампициллина, в течение 3-4 ч при 37°С с шуттелированием при 120 об/мин и затем индуцируют 1 мМ ИПТГ в течение 1-2 ч, клетки осаждают центрифугированием, лизируют в буфере, содержащем 65 мМ трис-HCl рН 6.8, 1% SDS и 10 мМ 2-меркаптоэтанола, при температуре 99°С в течение 10 мин. Лизат подвергают электрофорезу в 8-20% градиентном полиакриламидном геле (ПААГ) с 0,1% SDS и окрашивают гель Coomassi Blue R250. В клеточном лизате выявляется мажорная белковая полоса в области ~12 кДа, что соответствует молекулярной массе искомого рекомбинантного белка, содержащего на N-конце гексагистидиновый блок. Процентное содержание бШэ-белка определяют с помощью программы Quantity One, оно составляет -10% суммарных клеточных белков штамма E.coli Jm109pHFQ2.21. В лизатах штамма E.coli Jm109 pHFQ2.21, выращенного без индукции ИПТГ, и контрольного штамма E.coli Jm109 pQE30 независимо от индукции данная мажорная полоса отсутствует.

Для определения локализации рекомбинантного proHfq клетки продуцента, выращенного с индукцией, разрушают ультразвуком на дезинтергаторе QSonica Q700 в течение 10 мин (40 импульсов по 5 сек, 357 Дж с перерывами в 10 сек; амплитуда 50) и подвергают электрофорезу растворимую фракцию клеток. Искомый белок выявляется в растворимой фракции штамма E.coli Jm109pHFQ2.21, где его содержание составляет ~10% суммарных клеточных белков.

Преимуществами полученного продуцента по сравнению с холерными вибрионами является высокий выход искомого белка, возможность культивирования без соблюдения режима работы с возбудителями особо опасных инфекций, отсутствие способности к синтезу каких-либо дополнительных биологически активных субстанций, которые могли бы затруднить его выделение и очистку, а по сравнению с известными рекомбинантными штаммами-продуцентами - непродолжительный период наращивания биомассы (4-6 часов включая индукцию), беспечивая возможность ускоренного получения препарата.

Источники информации

1. Aiba Н. Mechanism of RNA silencing by Hfq-binding small RNAs //Current opinion in microbiology. - 2007. - T. 10. - №. 2. - C. 134-139.

2. Sun X., Zhulin I., Wartell R.M. Predicted structure and phyletic distribution of the RNA-binding protein Hfq //Nucleic acids research. - 2002. - T. 30. - №. 17. - C. 3662-3671.

3. Васильева Ю.M., Гарбер M.Б. Регуляторная роль белка Hfq в жизнедеятельности бактериальных клеток (Обзор) (2002). Молекулярная биология (Москва), т. 36, 970-977.

4. Bohn С, Rigoulay С, Bouloc P. No detectable effect of RNA-binding protein Hfq absence in Staphylococcus aureus //BMC microbiology. - 2007. - T. 7. - №. 1. - C. 10.

5. Мурина B.H., Никулин А.Д. РНК-связывающие Sm-подобные белки бактерий и архей: сходство и различие структур и функций (Обзор) (2011). Успехи биологической химии, т. 51, 3-164.

6. Vincent Н. A. et al. Characterization of Vibrio cholerae Hfq provides novel insights into the role of the Hfq C-terminal region //Journal of molecular biology. - 2012. - T. 420. - №. 1-2. - C. 56-69.

1. Рекомбинантная плазмида pHFQ2.21, экспрессирующая клонированный ген hfq (шаперона) Vibrio cholerae 01 биовара El Tor, встроенный по сайтам Bam HI-PstI в полилинкер векторной плазмиды pQE30, под контролем Т5-промотора.

2. Штамм Escherichia coli KM 2030 Государственной коллекции патогенных бактерий «Микроб» представляет собой продукт, полученный путем трансформации рекомбинантной плазмиды pHFQ2.21 по п. 1 в штамм Е. coli Jm109, и является суперпродуцентом шаперона (Hfq) Vibrio cholerae 01 El Tor.



 

Похожие патенты:

Изобретение относится к области биотехнологии и генной инженерии. Предложен способ получения штамма Е.

Изобретение относится к биотехнологии. Предложен способ повышения продуктивности бактерий Escherichia coli.

Изобретение относится к биотехнологии. Микробный препарат содержит смесь предварительно высушенных до влажности не более 10% штаммов Rhodococcus erythropolis BKM Ас-2784D, Acinetobacter guillouiae B-3216D, Acinetobacter guillouiae B-3217D в равных объемах с содержанием каждого компонента не менее 1×107 KOE/г.

Группа изобретений относится к биотехнологии и сельскому хозяйству. Предложены выделенный штамм вида Mycosphaerella sp.

Изобретение относится к биотехнологии. Штамм лактобактерий Enterococcus hirae Т-8 13-2018, обладающий способностью продуцировать молочную кислоту и высокой антагонистической активностью по отношению к условно-патогенной и патогенной микрофлоре депонированный под регистрационным номером ВКПМ В-13055.

Генотерапевтический днк-вектор на основе генотерапевтического днк-вектора vtvaf17, несущий целевой ген, выбранный из группы генов ski, tgfb3, timp2, fmod для повышения уровня экспрессии этих целевых генов, способ его получения и применения, штамм escherichia coli scs110-af/vtvaf17-ski или escherichia coli scs110-af/vtvaf17-tgfb3 или escherichia coli scs110-af/vtvaf17-timp2 или escherichia coli scs110-af/vtvaf17-fmod, несущий генотерапевтический днк-вектор, способ его получения, способ производства в промышленных масштабах генотерапевтического днк-вектора // 2705256
Изобретение относится к генной инженерии. Описан генотерапевтический ДНК-вектор на основе генотерапевтического ДНК-вектора VTvaf17 для лечения заболеваний, характеризующихся развитием фиброза тканей, формированием рубцов, повреждением соединительной ткани и для ускорения заживления ран, реэпителизации, для увеличения образования грануляционной ткани и ингибирования образования рубцовой ткани, путем повышения уровня экспрессии целевого гена SKI в организме человека и животных, при этом генотерапевтический ДНК-вектор содержит кодирующую часть целевого гена SKI, клонированную в генотерапевтический ДНК-вектор VTvaf17, с получением генотерапевтического ДНК-вектора VTvaf17-SKI, с нуклеотидной последовательностью SEQ ID №1.

Генотерапевтический днк-вектор на основе генотерапевтического днк-вектора vtvaf17, несущий целевой ген cftr, или nos1, или aq1, или aq3, или aq5, для лечения заболеваний, связанных с необходимостью повышения уровня экспрессии этих целевых генов, способ его получения и использования, штамм escherichia coli scs110-af/vtvaf17-cftr, или escherichia coli scs110-af/vtvaf17-nos1, или escherichia coli scs110-af/vtvaf17-aq1, или escherichia coli scs110-af/vtvaf17-aq3, или escherichia coli scs110-af/vtvaf17-aq5, несущий генотерапевтический днк-вектор, способ его получения, способ производства в промышленных масштабах генотерапевтического днк-вектора // 2705252
Изобретение относится к генной инженерии, биотехнологии, медицине и представляет собой генотерапевтический ДНК-вектор на основе генотерапевтического ДНК-вектора VTvaf17, несущий целевой ген CFTR, или NOS1, или AQ1, или AQ3, или AQ5, для лечения заболеваний, связанных с необходимостью повышения уровня экспрессии этих целевых генов, представляющий собой группу генотерапевтических ДНК-векторов, каждый из которых содержит кодирующую часть по крайней мере одного целевого гена, выбранного из CFTR, или NOS1, или AQ1, или AQ3, или AQ5, клонированную в генотерапевтический ДНК-вектор VTvaf17, при этом группу генотерапевтических ДНК-векторов составляют генотерапевтический ДНК-вектор VTvaf17-CFTR, размером 7606 п.н., или VTvaf17-NOS1, размером 7468 п.н., или VTvaf17-AQ1 размером 3982 п.н., или VTvaf17-AQ3, размером 4024 п.н., или VTvaf17-Q5, размером 3943 п.н., с нуклеотидной последовательностью SEQ ID №1, или SEQ ID №2, или SEQ ID №3, или SEQ ID №4, или SEQ ID №5 соответственно или их сочетание.
Изобретение относится к биотехнологии. Штамм Lactobacillus plantarum Лб (н)37 2-2018, обладающий антагонистической активностью по отношению к условно-патогенной и патогенной микрофлоре, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-13052.

Изобретение относится к клинической и санитарной микробиологии. Питательная среда для выделения клебсиелл содержит панкреатический гидролизат рыбной муки, пептон мясной, дрожжевой экстракт, мезо-инозит, натрий хлористый, соли желчных кислот, кристаллический фиолетовый, нейтральный красный, натрий углекислый, карбенициллин, агар микробиологический и дистиллированную воду при заданном соотношении компонентов.

Изобретение относится к медицинской микробиологии и может быть использовано для изготовления вакцинных препаратов. Предложен способ получения вакцины гемофильной тип b конъюгированной.

Изобретение относится к области биотехнологии и генной инженерии. Предложен способ получения штамма Е.

Группа изобретений относится к биотехнологии. Полипептид, обладающий активностью по высвобождению О-ацетилгомосерина, где по меньшей мере одна аминокислота, выбранная из группы, состоящей из фенилаланина в положении 30, лейцина в положении 95 и фенилаланина в положении 165 аминокислотной последовательности SEQ ID NO: 1, заменена на другую аминокислоту, и необязательно валин в положении 1 аминокислотной последовательности SEQ ID NO: 1 дополнительно заменен на метионин.

Группа изобретений относится к области биотехнологии. Предложены способы получения содержащего две цепи полипептида, в частности содержащего тяжелую цепь и легкую цепь полуантитела, в частности полуантитела против ИЛ-13, а также против ИЛ-17 в прокариотической клетке-хозяине, а также способы получения биспецифического антитела, содержащего способное связывать первый антиген, в частности связывать ИЛ-13, первое полуантитело и способное связывать второй антиген, в частности связывать ИЛ-17, второе полуантитело.

Генотерапевтический днк-вектор на основе генотерапевтического днк-вектора vtvaf17, несущий целевой ген, выбранный из группы генов ski, tgfb3, timp2, fmod для повышения уровня экспрессии этих целевых генов, способ его получения и применения, штамм escherichia coli scs110-af/vtvaf17-ski или escherichia coli scs110-af/vtvaf17-tgfb3 или escherichia coli scs110-af/vtvaf17-timp2 или escherichia coli scs110-af/vtvaf17-fmod, несущий генотерапевтический днк-вектор, способ его получения, способ производства в промышленных масштабах генотерапевтического днк-вектора // 2705256
Изобретение относится к генной инженерии. Описан генотерапевтический ДНК-вектор на основе генотерапевтического ДНК-вектора VTvaf17 для лечения заболеваний, характеризующихся развитием фиброза тканей, формированием рубцов, повреждением соединительной ткани и для ускорения заживления ран, реэпителизации, для увеличения образования грануляционной ткани и ингибирования образования рубцовой ткани, путем повышения уровня экспрессии целевого гена SKI в организме человека и животных, при этом генотерапевтический ДНК-вектор содержит кодирующую часть целевого гена SKI, клонированную в генотерапевтический ДНК-вектор VTvaf17, с получением генотерапевтического ДНК-вектора VTvaf17-SKI, с нуклеотидной последовательностью SEQ ID №1.

Генотерапевтический днк-вектор на основе генотерапевтического днк-вектора vtvaf17, несущий целевой ген cftr, или nos1, или aq1, или aq3, или aq5, для лечения заболеваний, связанных с необходимостью повышения уровня экспрессии этих целевых генов, способ его получения и использования, штамм escherichia coli scs110-af/vtvaf17-cftr, или escherichia coli scs110-af/vtvaf17-nos1, или escherichia coli scs110-af/vtvaf17-aq1, или escherichia coli scs110-af/vtvaf17-aq3, или escherichia coli scs110-af/vtvaf17-aq5, несущий генотерапевтический днк-вектор, способ его получения, способ производства в промышленных масштабах генотерапевтического днк-вектора // 2705252
Изобретение относится к генной инженерии, биотехнологии, медицине и представляет собой генотерапевтический ДНК-вектор на основе генотерапевтического ДНК-вектора VTvaf17, несущий целевой ген CFTR, или NOS1, или AQ1, или AQ3, или AQ5, для лечения заболеваний, связанных с необходимостью повышения уровня экспрессии этих целевых генов, представляющий собой группу генотерапевтических ДНК-векторов, каждый из которых содержит кодирующую часть по крайней мере одного целевого гена, выбранного из CFTR, или NOS1, или AQ1, или AQ3, или AQ5, клонированную в генотерапевтический ДНК-вектор VTvaf17, при этом группу генотерапевтических ДНК-векторов составляют генотерапевтический ДНК-вектор VTvaf17-CFTR, размером 7606 п.н., или VTvaf17-NOS1, размером 7468 п.н., или VTvaf17-AQ1 размером 3982 п.н., или VTvaf17-AQ3, размером 4024 п.н., или VTvaf17-Q5, размером 3943 п.н., с нуклеотидной последовательностью SEQ ID №1, или SEQ ID №2, или SEQ ID №3, или SEQ ID №4, или SEQ ID №5 соответственно или их сочетание.

Изобретение относится к биотехнологии и может быть использовано для получения глутаматоксалоацетаттрансаминазы человека. Предложен рекомбинантный штамм бактерий Escherichia coli rhGOT1-His ВКПМ № В-12963, продуцирующий глутаматоксалоацетаттрансаминазу человека с аминокислотной последовательностью SEQ ID NO:2, полученный трансформацией штамма BL21(DE3)Rosetta2pLysS плазмидой рЕТ22b, содержащей клонированную последовательностью GOT1 с десятью C-концевыми гистидинами.

Изобретение относится к биотехнологии. Описана рекомбинантная плазмида pHis6-flagG-protE со встроенными генами fliG и TBEVgp1, кодирующими гибридный рекомбинантный белок flagG-protE, индуцирующий иммунный ответ на вирус клещевого энцефалита.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ получения капсидного белка PCV2 и фармацевтической композиции, содержащей указанный капсидный белок.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков и может быть использовано для получения активного фрагмента (1-34) эндогенного человеческого паратиреоидного гормона.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм, трансформированный полинуклеотидом, кодирующим белок, обладающий лизиндекарбоксилазной активностью, содержащий аминокислотную последовательность SEQ ID NO: 1 или аминокислотную последовательность, гомологичную не менее чем на 75% этой последовательности, для экспрессии белка, обладающего лизиндекарбоксилазной активностью, где белок, обладающий лизиндекарбоксилазной активностью, происходит из Pseudomonas sp.

Настоящее изобретение относится к области иммунологии. Предложены химерные антигенные рецепторы (CAR), которые специфически связываются с ВСМА (антигеном созревания В-клеток).

Изобретение относится к биотехнологии, генной инженерии, медицинской микробиологии. Предложена рекомбинантная плазмида pHFQ2.21, экспрессирующая клонированный ген hfq Vibrio cholerae 01 биовара El Tor, встроенный по сайтам Bam HI-PstI в полилинкер векторной плазмиды pQE30, под контролем Т5-промотора. Указанной плазмидой трансформируют штамм Е. coli Jm109 с получением штамма Escherichia coli KM 2030, являющегося суперпродуцентом шаперона Vibrio cholerae 01 El Tor. Предложенный штамм депонирован в Государственной коллекции патогенных бактерий «Микроб». Содержание шаперона Vibrio cholerae 01 El Tor, находящегося внутри клеток в растворимой форме, составляет до 10 суммарных клеточных белков. Изобретение может быть использовано для получения препаратов шаперона Vibrio cholerae в целях создания специфических сорбентов для связывания малых РНК, а также для изучения свойств, биохимической и биологической активности шаперона Vibrio cholerae. 2 н.п. ф-лы, 1 ил., 2 пр.

Наверх