Композиции и способы лечения mps1



Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
Композиции и способы лечения mps1
C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2708318:

ДЗЕ ТРАСТИЗ ОФ ДЗЕ ЮНИВЕРСИТИ ОФ ПЕНСИЛЬВАНИЯ (US)

Изобретение относится к области биотехнологии и молекулярной биологии. Предложена частица рекомбинантного аденоассоциированного вируса (rAAV) для применения в лечении мукополисахаридоза I типа (MPS I), имеющая AAV-капсид и имеющая упакованный в него 5’ инвертированный концевой повтор (ITR), ген альфа-L-идуронидазы человека (hIDUA) под контролем регуляторных последовательностей, которые контролируют его экспрессию, и 3’ ITR AAV, где упомянутый ген hIDUA имеет последовательность, показанную в SEQ ID NO: 1, которая кодирует функциональную альфа-L-идуронидазу человека, а также композиция и применение. Изобретение может быть использовано в медицине. 4 н. и 9 з.п. ф-лы, 2 ил., 4 пр.

 

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

Мукополисахаридозы представляют собой группу наследственных нарушений, вызванных отсутствием особых лизосомальных ферментов, участвующих в распаде гликозаминогликанов (GAG), также называемых мукополисахаридами. Накопление частично распавшихся GAG вызывает нарушение функции клеток, тканей и органов. Со временем GAG накапливаются в клетках, крови и соединительной ткани, приводя к повышенному повреждению клеток и органов. Причиной наиболее серьезного из мукополисахаридозов (MPS), MPS I, является недостаток фермента α-L-идуронидаза (IDUA). Это приводит к трем клиническим синдромам, которыми по степени тяжести являются синдромы Гурлер, Гурлер-Шейе и Шейе. Каждый наследуется по аутосомно-рецессивному типу, при этом степень недостаточности фермента непосредственно связана с тяжестью клинического фенотипа.

Сообщалось, что ген IDUA дает указания для выработки фермента под названием альфа-L-идуронидаза, который необходим для разрушения крупных молекул сахаров, называемых гликозаминогликаны (GAG). В частности, сообщается, что альфа-L-идуронидаза удаляет сульфатную группу в молекуле, известной как сульфатированная альфа-L-идуроновая кислота, которая присутствует у двух GAG, называемых гепарансульфат и дерматансульфат. Альфа-L-идуронидаза расположена в лизосомах, компартментах в клетках, которые переваривают и повторно используют молекул различных типов. Обнаружено, что мукополисахаридоз I типа (MPS I) вызывают более 100 мутаций в гене IDUA. Мутации, которые изменяют один строительный блок ДНК (нуклеотид), являются наиболее распространенными. Мутации, которые вызывают MPS I, снижают или полностью блокируют функцию альфа-L-идуронидазы.

В отношении клинических синдромов текущим стандартом лечения синдрома Гурлер является трансплантация гематопоэтических стволовых клеток (HSCT), такая как трансплантация костного мозга (BMT) или трансплантации пуповинной крови (UCBT). Процедуру проводят как можно раньше, и до достижения возраста двух лет, с целью оказания влияния как на соматическую картину заболевания, так и на картину заболевания в отношении ЦНС. Однако, HSCT для MPS I остается связанной со значительной заболеваемостью и 20% уровнем смертности. Если трансплантация невозможна, то можно начать заместительную ферментную терапию (ERT), которая требует еженедельной инфузии фермента в течение всей жизни пациента. ERT не оказывает влияния на прогрессирование заболевания ЦНС, однако, частично уменьшает соматические проявления. Значительно снижается органомегалия, однако, картина заболевания в отношении костной системы, глаз и сердца нормализуется лишь частично. Пациенты могут нуждаться в хирургическом вмешательстве для стабилизации бедра и колена, а также для лечения карпального туннельного синдрома и контрактур пальцев. Заболевание сердца лечат медикаментозными методами, однако, в конечном итоге может потребоваться хирургическое вмешательство.

ERT для MPS I предоставляет экзогенный фермент для захвата в лизосомы и повышения катаболизма GAG. Несмотря на то, что лизосомальные ферменты функционируют внутри клетки, рецепторы маннозо-6-фосфата на поверхности клетки способны к связыванию, интернализации и доставке этих ферментов к лизосомам. Рекомбинантная IDUA (Aldurazyme®, BioMarin) одобрена FDA для пациентов с формами Гурлер и Гурлер-Шейе MPS I и для пациентов с формой Шейе, у которых симптомы имеют умеренную - тяжелую степень тяжести, и, как было показано, улучшает легочную функцию и способность ходить. Также было замечено, что ERT снижает гепатомегалию у пациентов с MPS I, а также уровни GAG в моче. Однако, поскольку внутривенно фермент с трудом проникает в головной мозг, ERT в настоящее время не решает проблемы с симптомами, испытываемые некоторыми пациентами с MPS I.

Осложнения ERT связаны с иммунным ответом на рекомбинантный фермент, которые могут варьировать от легкой до резко выраженной анафилаксии, а также осложнений пожизненного периферического доступа, таких как местные и системные инфекции. До 91% пациентов, получающих альдуразим, вырабатывают антитела к ферменту, хотя, неясно, насколько это влияет на эффективность. Кроме того, ERT требует еженедельных внутривенных (в/в) инфузий, вводимых в течение периода 3-8 часов в больничных условиях, что значительно влияет на качество жизни пациента и, по большому счету, является главным бременем льготных систем здравоохранения.

В свете этих ограничений, лечение, которое может более эффективно купировать заболеваемость, связанную с MPS I, остается неудовлетворенной медицинской потребностью.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

В одном аспекте настоящее изобретение предлагает кассету экспрессии, содержащую ген альфа-L-идуронидазы человека (hIDUA), имеющий нуклеотидную последовательность SEQ ID NO: 1 или последовательность, по меньшей мере приблизительно на 95% идентичную SEQ ID NO: 1, которая кодирует функциональную альфа-L-идуронидазу человека в клетках человека, где упомянутая кассета экспрессии дополнительно содержит регуляторные контролирующие последовательности, которые управляют экспрессией альфа-L-идуронидазы человека в клетках человека, при этом упомянутые регуляторные контролирующие последовательности содержат печеночно-специфический промотор.

В другом аспекте настоящее изобретение предлагает вектор, содержащий кассету экспрессии. В одном варианте осуществления кассета экспрессии расположена на цис-плазмиде. В другом варианте осуществления кассета экспрессии расположена на pENN.TBG.hIDUA.nRBG.

В еще одном аспекте настоящее изобретение предлагает частицу рекомбинантного аденоассоциированного вируса (rAAV), имеющую AAV-капсид и имеющую упакованный в него левый инвертированный концевой повтор (ITR), ген альфа-L-идуронидазы человека (hIDUA) под контролем регуляторных последовательностей, которые контролируют его экспрессию, и правый ITR AAV, где упомянутый ген hIDUA имеет последовательность, показанную в SEQ ID NO: 1 (ФИГ. 1), или последовательность, по меньшей мере приблизительно на 95% идентичную ей, которая кодирует функциональную альфа-L-идуронидазу человека. В одном варианте осуществления функциональный ген hIDUA экспрессируется под контролем печеночно-специфического промотора. Таким промотором может быть промотор тироксин-связывающего глобулина (TBG).

В следующем аспекте настоящее изобретение предлагает частицу рекомбинантного аденоассоциированного вируса AAV2/8.TBG.hIDUA.co.

В еще одном аспекте настоящее изобретение предлагает композицию, пригодную для лечения мукополисахаридоза I типа (MPS I), содержащую rAAV, содержащий кассету экспрессии, описанную в данном документе, и фармацевтически приемлемый носитель.

В еще одном дополнительном аспекте настоящее изобретение предлагает способ лечения мукополисахаридоза I типа, включающий доставку эффективного количества композиции, содержащей фармацевтически приемлемый носитель и rAAV, который описан в данном документе.

В еще одном аспекте настоящее изобретение предлагает способ лечения или облегчения симптомов синдромов Гурлер, Гурлер-Шейе и/или Шейе.

Другие аспекты и преимущества настоящего изобретения будут очевидны из подробного описания настоящего изобретения.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На ФИГ. 1А-1D приведена последовательность плазмиды pENN.AAV.TBG.PI.hIDUA.RGB [SEQ ID NO: 3], описанной в данном документе, которая включает последовательность нуклеиновой кислоты функционального гена IDUA человека. Ген функциональной IDUA, расположенный в положении 1251-3213 ФИГ. 1, и кодируемая им последовательность фермента также приведены в SEQ ID NO: 1 и 2. Последовательность дополнительно имеет отметки для идентификации последовательностей энхансеров alpha mic/bik, интрона 1, поли-А глобулина кролика, ITR, точки начала репликации.

На ФИГ. 2 приведена кольцевая карта pENN.AAV.TBG.PI.hIDUA.RGB.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Композиции, описанные в данном документе, относятся к кассете экспрессии, несущей ген IDUA человека, которая экспрессирует у человека терапевтически эффективное количество функционального фермента альфа-L-идуронидаза.

Применяемое в данном документе “терапевтически эффективное количество” относится к количеству композиции, которая доставляет и экспрессирует в клетках-мишенях количество фермента, достаточное для облегчения или лечения симптомов синдромов Гурлер, Гурлер-Шейе и/или Шейе, и/или MPS I. “Лечение” может включать предотвращение ухудшения симптомов одного из синдромов (или MPS I) и, возможно, обращение одного или нескольких их симптомов.

Применяемая в данном документе “функциональная альфа-L-идуронидаза человека” относится к ферменту альфа-L-идуронидаза человека, который нормально функционирует у людей без MPS1 или связанного синдрома, такого как синдромы Гурлер, Гурлер-Шейе и/или Шейе. В противоположность этому, вариант фермента альфа-L-идуронидаза человека, который вызывает MPS1 или один из этих синдромов, считается нефункциональным. В одном варианте осуществления функциональная альфа-L-идуронидаза человека имеет аминокислотную последовательность дикого типа альфа-L-идуронидазы человека, описанную Bremer et al, Mol. Genet. Metab. 104 (3): 289-294 (2011), эталонная последовательность NCBI NP_000194.2, воспроизведенная в SEQ ID NO:2 (653 аминокислоты). Тем не менее, были описаны несколько встречающихся в природе функциональных полиморфизмов (вариантов) этой последовательности, и они могут быть охвачены объемом настоящего изобретения. Эти варианты включают, в отношении SEQ ID NO: 2, N-связанное гликозилирование в положении 110 [Chen et al, J Proteome Res. , 8:651-661 (2009)], замену H на Q в аминокислотном положении 33 [SEQ ID NO: 7, VAR_003350; Scott, HS, et al, Proc Natl Acad. Sci, 88:9695-9699 (1991); Scott, HS, et al, Genomics, 12:1311-1313 (1992); Scott HS, et al, Hum Genet, 90:327-327 (1992); Bertola F., et al, Hum Mutat, 32: E2189-E2210 (2011)], восстановление H до Q в аминокислотном положении 82 [SEQ ID NO: 8, VAR_020976; Scott, HS, Hum Genet, цитировано выше], замену R на Q в положении 105 [SEQ ID NO:9, VAR_003356; Scott, Hum Genet, цитировано выше; Bertola et al, цитировано выше], замену G на R в положении 116 [SEQ ID NO: 12, VAR_003367], замену V на A в положении 279 [SEQ ID NO: 11, VAR_003359], замену L на R в положении 346 [SEQ ID NO: 12, VAR_017436, Teng, YN, et al, Clin. Genet, 57: 131-136 (2000)], замену A на T в положении 361 [SEQ ID NO: 13, VAR_003364; Scott, HS, et al, Hum Mol Genet, 2: 1471-1473 (1993); Yogalingam et al, Hum Mutat, 24: 199-207 (2004); Bertola, et al, цитировано выше], замену H на N в положении 449 [SEQ ID NO: 14, VAR_066228, Bertola et al, цитировано выше], замену V на I в положении 454 [SEQ ID NO: 15, VAR_003372; Yogalingam et al, цитировано выше; Bertola, et al, цитировано выше], замену A на T в положении 591 [SEQ ID NO: 16, VAR_0066231, Bertola et al, цитировано выше] и замену A на T в положении 622 [SEQ ID NO: 17, Scott et al, Genomics, цитировано выше]. См., например, UniProtKB/Swiss-Prot; www.uniprot.org/uniprot/P35475. В другом варианте осуществления функциональная альфа-L-идуронидаза человека может включать синтетическую аминокислотную последовательность, в которой все или часть из первых 26 аминокислот SEQ ID NO: 2, которые соответствуют лидерному (сигнальному) пептиду, замещены гетерологическим лидерным пептидом. Этот лидерный пептид, который отвечает за транспорт фермента из клетки посредством его секреторного пути в кровоток, может быть заменен другим подходящим лидерным пептидом, например, таким как лидерные пептиды из интерлейкина-2 (IL-2) или онкостатина. Подходящие лидерные пептиды имеют предпочтительно, но не обязательно, человеческое происхождение. Подходящие лидерные пептиды можно выбрать на http://proline.bic.nus.edu.sg/spdb/zhang270.htm, который включен в данный документ с помощью ссылки, или их можно определить с помощью ряда программ машинного расчета для определения лидерного (сигнального) пептида в выбранном белке. Без ограничений такие последовательности могут иметь длину от приблизительно 15 до приблизительно 50 аминокислот, или от приблизительно 20 до приблизительно 28 аминокислот, или, при необходимости, могут быть большими или меньшими. Кроме того, по меньшей мере один анализ in vitro был описан как пригодный для определения ферментативной активности фермента IDUA [см., например, Kakkis et al, Mol Genet Metabol, 2001 Mar; 72(3): 199-208].

Предпочтительно, композиция и способ, описанные в данном документе, не требуют долговременных повторных еженедельных инъекций терапевтической дозы. Не желая ограничиваться теорией, полагают, что способ, описанный в данном документе, пригоден для коррекции фенотипа центральной нервной системы помимо коррекции соматических симптомов, связанных с нарушениями MPSI.

Кассета экспрессии

Кассета экспрессии, как минимум, состоит из гена и его регуляторных последовательностей. Если кассета предназначена для экспрессии у рекомбинантного аденоассоциированного вируса, то кассета экспрессии дополнительно содержит 5’ и 3’ AAV инвертированные концевые повторы (ITR). Эти ITR могут иметь полную длину, или один или оба из этих ITR могут быть укороченными. Например, укороченный 5’ ITR, содержащий делецию последовательности D и делецию сайта концевого разрешения (trs), можно использовать, например, для самокомплементарного AAV. В одном варианте осуществления rAAV является псевдотипированным, т.е. AAV-капсид происходит из другого AAV-источника, нежели AAV-капсид, который обеспечивает ITR. В одном варианте осуществления используют ITR AAV серотипа 2. Тем не менее, ITR можно выбрать из других подходящих источников.

Как описано в данном документе, пациентам, страдающим от одного из описанных в данном документе состояний, вводят кассету экспрессии, которая несет функциональный ген альфа-L-идуронидазы человека (hIDUA) под контролем регуляторных последовательностей, которые управляют экспрессией функционального фермента альфа-L-идуронидаза человека в клетках.

Кассета экспрессии содержит ген hIDUA, характеризующийся наличием нуклеотидной последовательности SEQ ID NO: 1. Эта последовательность, разработанная авторами настоящего изобретения, приблизительно на 83% идентична опубликованной последовательности гена Genbank NP000194.2, кодирующей SEQ ID NO: 2. В другом варианте осуществления кассета экспрессии содержит ген hIDUA, характеризующийся наличием нуклеотидной последовательности, которая по меньшей мере приблизительно на 80% идентична SEQ ID NO: 1 и кодирует функциональную альфа-L-идуронидазу человека. В другом варианте осуществления последовательность по меньшей мере приблизительно на 85% идентична SEQ ID NO: 1 или по меньшей приблизительно на 90% идентична SEQ ID NO:1 и кодирует функциональную альфа-L-идуронидазу человека. В одном варианте осуществления последовательность по меньшей мере приблизительно на 95% идентична SEQ ID NO:1, по меньшей мере приблизительно на 97% идентична SEQ ID NO:1 или по меньшей мере приблизительно на 99% идентична SEQ ID NO: 1 и кодирует функциональную альфа-L-идуронидазу человека. В одном варианте осуществления она охватывает полноразмерный ген hIDUA, включающий последовательности лидерного пептида альфа-L-идуронидазы человека (т.е. кодирующие от приблизительно 26 аминокислоты или от приблизительно 27 аминокислоты до приблизительно 653 аминокислоты SEQ ID NO: 2), соответствующие от приблизительно 1 до приблизительно 78 SEQ ID NO: 1. В другом варианте осуществления ген hIDUA кодирует функциональный синтетический фермент альфа-L-идуронидаза человека, который является синтетическим пептидом, содержащим гетерологическую лидерную последовательность, слитую с секретируемой частью функционального фермента альфа-L-идуронидаза, т.е. от приблизительно 27 до приблизительно 653 аминокислоты SEQ ID NO: 2, или один из его функциональных вариантов, которые указаны в данном документе.

Идентичность или сходство по отношению к последовательности определяют в данном документе как процент аминокислотных остатков в кандидатной последовательности, которые являются идентичными (т.е. тот же самый остаток) или сходными (т.е. аминокислотный остаток из той же самой группы на основании общих свойств боковой цепи, см. ниже) по отношению к участкам пептида или полипептида, приведенным в данном документе, после выравнивания последовательностей и, при необходимости, введения гэпов для достижения максимального процента идентичности последовательностей. Процент (%) идентичности является мерой связи между двумя полинуклеотидами или двумя полипептидами, которую определяют путем сравнения, соответственно, их нуклеотидных или аминокислотных последовательностей. В целом, две последовательности, подлежащие сравнению, выравнивают для получения максимального согласования между последовательностями. Исследуют результаты выравнивания между двумя последовательностями и определяют число положений, дающих точное соответствие аминокислот или нуклеотидов между двумя определяемыми последовательностями, деленное на общую длину выравнивания и умноженное на 100 с получением значения % идентичности. Это значение % идентичности можно определять для всей длины последовательностей, подлежащих сравнению, что особенно подходит для последовательностей, которые имеют одинаковую или очень близкую длину и являются высокогомологичными, или для более коротких определяемых значений длины, что более подходит для последовательностей, которые имеют неравную длину или имеют более низкий уровень гомологии. Существует ряд алгоритмов и компьютерных программ на их основе, которые доступны для использования из литературных источников и/или общедоступны или коммерчески доступны для выполнения выравниваний и расчета процента идентичности. Выбор алгоритма или программы не является ограничением настоящего изобретения.

Примеры подходящих программ выравнивания включают, например, компьютерную программу CLUSTALW под Unix, результаты которой затем импортируют в программу Bioedit (Hall, T. A. 1999, BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41:95-98); Wisconsin Sequence Analysis Package, версия 9.1 (Devereux J. et al., Nucleic Acids Res., 12:387-395, 1984, предоставляемая Genetics Computer Group, Мэдисон, Висконсин, США). Программы BESTFIT и GAP можно использовать для определения % идентичности между двумя полинуклеотидами и % идентичности между двумя полипептидными последовательностями.

Другие программы для определения идентичности и/или сходства между последовательностями включают, например, семейство программ BLAST, предоставляемых Национальным центром биотехнологической информации (NCB), Бетесда, Мэриленд, США, и доступных на домашней странице NCBI на www.ncbi.nlm.nih.gov), программу ALIGN (версия 2.0), которая является частью пакета компьютерных программ выравнивания последовательности GCG. При использовании программы ALIGN для сравнения аминокислотных последовательностей можно использовать таблицу замен остатков PAM120, штраф за длину разрыва 12 и штраф за введение гэпа 4; и FASTA (Pearson W. R. и Lipman D. J., Proc. Natl. Acad. Sci. USA, 85:2444-2448, 1988, предоставляемую как часть Wisconsin Sequence Analysis Package), компьютерную программу SeqWeb Software (веб-интерфейс GCG Wisconsin Package: Gap program).

Применяемые в настоящем описании и формуле изобретения выражения “содержащий” и “включающий” являются включительными в отношении других компонентов, элементов, целых чисел, стадий и т.п. В противоположность этому, выражение “состоящий” и его варианты являются исключительными в отношении других компонентов, элементов, целых чисел, стадий и т.п. Выражение “приблизительно” охватывает вариацию в пределах и включая ± 10%, если не указано иное.

В одном варианте осуществления кассета экспрессии предназначена для управляемой в печени человека экспрессии. Таким образом, печеночно-специфический промотор особенно хорошо подходит для кассеты экспрессии. В одном варианте осуществления выбран промотор тироксин-связывающего глобулина. В одном варианте осуществления промотор TBG имеет последовательность нуклеотидов от 442 до 901 с ФИГ. 1. Альтернативно, можно выбрать другой печеночно-специфический промотор. Примеры промоторов, которые являются тканеспецифическими, хорошо известны для печени и других тканей (альбумин, Miyatake et al., (1997) J. Virol., 71:5124-32; коровый промотор вируса гепатита B, Sandig et al., (1996) Gene Ther., 3:1002-9; альфа-фетопротеин (AFP), Arbuthnot et al., (1996) Hum. Gene Ther., 7:1503-14), остеокальцин кости (Stein et al., (1997) Mol. Biol. Rep., 24:185-96); сиалопротеин кости (Chen et al., (1996) J. Bone Miner. Res., 11:654-64), лимфоциты (CD2, Hansal et al., (1998) J. Immunol., 161:1063-8; тяжелая цепь иммуноглобулина; цепь Т-клеточного рецептора), нейрональный, такой как промотор нейрон-специфической енолазы (NSE) (Andersen et al., (1993) Cell. Mol. Neurobiol., 13:503-15), ген легкой цепи нейрофиламентов (Piccioli et al., (1991) Proc. Natl. Acad. Sci. USA, 88:5611-5) и нейрон-специфический ген vgf (Piccioli et al., (1995) Neuron, 15:373-84), помимо прочих. Можно выбрать другие промоторы (не печеночно-специфические), однако, кассеты экспрессии, содержащие то же самое, могут не иметь все преимущества промоторов TBG или другого печеночно-специфического промотора. Альтернативно, можно выбрать регулируемый промотор. См., например, WO 2011/126808B2, включенный с помощью ссылки в данный документ.

В одном варианте осуществления кассета экспрессии содержит один или несколько энхансеров экспрессии. В одном варианте осуществления кассета экспрессии содержит два или более энхансеров экспрессии. Эти энхансеры могут быть одинаковыми или могут отличаться друг от друга. Например, энхансер может включать энхансер Alpha mic/bik. Этот энхансер может присутствовать в двух копиях, которые расположены рядом друг с другом. Альтернативно, двойные копии энхансера могут быть разделены одной или несколькими последовательностями. В еще одном варианте осуществления кассета экспрессии дополнительно содержит интрон, например, интрон Promega. Другие подходящие интроны включают интроны, известные в данной области техники, например, такие как описанные в WO 2011/126808.

Дополнительно предложена кассета экспрессии по настоящему изобретению с подходящим сигналом полиаденилирования. В одном варианте осуществления последовательностью поли-А является поли-А глобулина кролика. В одном варианте осуществления последовательность поли-А характеризуется последовательностью, представляющей собой нуклеотиды 3261-3387 на ФИГ. 1. Альтернативно, может быть другая поли-А, например, последовательность полиаденилирования гормона роста человека (hGH), поли-А SV40 или синтетическая поли-А. В кассету экспрессии могут быть дополнительно или необязательно включены другие традиционные регуляторные элементы.

В одном варианте осуществления кассету экспрессии встраивают в подходящий вектор, например, плазмидный вектор, с помощью способов, известных специалистам в данной области техники. Необязательно, композиция по настоящему изобретению может содержать первую кассету экспрессии, содержащую модифицированный ген IDUA человека, и вторую кассету экспрессии, содержащую другой ген. В еще одном варианте осуществления функциональный IDUA человека может экспрессироваться с нескольких кассет экспрессии, которые могут быть расположены на нескольких векторах, например, как описано в WO 2011/126808.

В одном варианте осуществления кассета переносится с помощью pENN.TBG.hIDUA.nRBG, плазмиды, которую используют для создания рекомбинантного аденоассоциированного вируса, несущего кассету экспрессии.

Получение частиц AAV-вируса

В одном варианте осуществления настоящее изобретение предлагает частицу рекомбинантного аденоассоциированного вируса (rAAV), имеющую AAV-капсид и имеющую упакованный в него 5’ инвертированный концевой повтор (ITR), ген альфа-L-идуронидазы человека (hIDUA) под контролем регуляторных последовательностей, которые контролируют его экспрессию, и 3’ ITR AAV, где упомянутый ген hIDUA имеет последовательность, показанную в SEQ ID NO: 1 (ФИГ. 1), или последовательность, по меньшей мере приблизительно на 95% идентичную ей, которая кодирует функциональную альфа-L-идуронидазу человека. Одним особо предпочтительным rAAV является AAV2/8.TBG.hIDUA.co.

Известны способы получения векторов на основе AAV. См., например, опубликованную заявку на патент США №2007/0036760 (15 февраля 2007 г.), которая включена в данный документ с помощью ссылки. Применение AAV-капсидов AAV8 особенно хорошо подходит для композиций и способов, описанных в данном документе. Последовательности AAV8 и способы получения векторов на основе капсида AAV8 описаны в патенте США US 7282199 B2, US 7790449 и US 8318480, которые включены в данный документ с помощью ссылки. Также для применения в настоящем изобретении хорошо подходят капсиды AAV9. Последовательности AAV9 и способы получения векторов на основе капсида AAV9 описаны в патенте США US 7906111, который включен в данный документ с помощью ссылки. Тем не менее, можно выбрать или получить для применения в настоящем изобретении другие AAV-капсиды. Последовательности ряда таких AAV приведены в упомянутых выше патенте США US 7282199 B2, US 7790449, US 8318480 и патенте США US 7906111, и/или могут быть получены в GenBank. Последовательности любых AAV-капсидов можно легко получить синтетически или с помощью ряда методик молекулярной биологии и генетической инженерии. Специалистам в данной области хорошо известны подходящие методики получения. См., например, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (Cold Spring Harbor, NY). Альтернативно, олигонуклеотиды, кодирующие пептиды (например, CDR), или сами пептиды можно получить синтетически, например, с помощью хорошо известных способов твердофазного синтеза пептидов (Merrifield, (1962) J. Am. Chem. Soc., 85:2149; Stewart and Young, Solid Phase Peptide Synthesis (Freeman, San Francisco, 1969) pp. 27-62). Смотри также D M McCarty et al, “Self-complementary recombinant adeno-associated virus (scAAC) vectors promote efficient transduction independently of DNA synthesis”, Gene Therapy (August 2001), Vol 8, Number 16, Pages 1248-1254. Самокомплементарные AAV описаны, например, в патентах США №№ 6596535, 7125717 и 7456683, каждый из которых включен в настоящий документ с помощью ссылки во всей его полноте. Эти и другие подходящие способы получения находятся в пределах компетенции специалистов в данной области техники и не являются ограничением настоящего изобретения.

Рекомбинантный аденоассоциированный вирус (AAV), описанный в данном документе, можно получить с помощью методик, которые являются известными. Такой способ включает культивирование клетки-хозяина, которая содержит последовательность нуклеиновой кислоты, кодирующую AAV-капсид; функциональный ген rep; кассету экспрессии, состоящую из, как минимум, инвертированных концевых повторов AAV (ITR) и трансгена; и соответствующие вспомогательные функциональные элементы для обеспечения упаковки кассеты экспрессии в белок AAV-капсида.

Необходимые компоненты, подлежащие культивированию в клетке-хозяине для упаковки кассеты экспрессии AAV в AAV-капсид, могут быть введены в клетку-хозяину в положении транс. Альтернативно, один или несколько необходимых компонентов (например, кассета экспрессии, последовательности rep, последовательности cap и/или вспомогательные функциональные элементы) могут быть представлены в качестве стабильной клетки-хозяина, которая была сконструирована как содержащая один или нескольких необходимых компонентов с помощью способов, известных специалистам в данной области техники. Наиболее подходящим является, когда такая стабильная клетка-хозяин будет содержать необходимый(необходимые) компонент(компоненты) под контролем индуцируемого промотора. Однако, необходимый(необходимые) компонент(компоненты) может(могут) находиться под контролем конститутивного промотора. Примеры подходящих индуцируемых и конститутивных промоторов приведены в данном документе в описании регуляторных элементов, подходящих для применения с трансгеном. В еще одном альтернативном варианте выбранная стабильная клетка-хозяин может содержать выбранный(выбранные) компонент(компоненты) под контролем конститутивного промотора и другой(другие) выбранный(выбранные) компонент(компоненты) под контролем одного или нескольких индуцируемых промоторов. Например, можно получить стабильную клетку-хозяина, которая происходит от 293 клеток (которые содержат вспомогательные функциональные элементы E1 под контролем конститутивного промотора), однако, которая содержит белки rep и/или cap под контролем индуцируемых промоторов. Специалистом в данной области техники могут быть получены и другие стабильные клетки-хозяева.

Кассету экспрессии, последовательности rep, последовательности cap и вспомогательные функциональные элементы, необходимые для получения rAAV по настоящему изобретению, можно ввести в упаковывающую клетку-хозяина в форме любого генетического элемента, который переносит находящиеся на нем последовательности. Выбранный генетический элемент может быть доставлен любым подходящим способом, в том числе описанными в данном документе. Способы, применяемые для создания любого варианта осуществления по настоящему изобретению, известны специалистам в области техники, связанной с работой с нуклеиновыми кислотами, и включают способы генетической инженерии, рекомбинантной инженерии и способы синтеза. См., например, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Аналогично, хорошо известны способы получения вирионов rAAV, и выбор подходящего способа не является ограничением настоящего изобретения. См., например, K. Fisher et al, (1993) J. Virol., 70:520-532, и патент США №5478745.

Если не указано иное, ITR AAV и другие выбранные AAV-компоненты, описанные в данном документе, можно легко выбрать среди любого AAV. Эти ITR или другие AAV-компоненты можно легко выделить из последовательности AAV с помощью методик, доступных специалистам в данной области. Такой AAV можно выделить или получить из учебных, промышленных или общественных источников (например, Американской коллекции типовых культур, Манассас, Виргиния). Альтернативно, последовательности AAV можно получить с помощью способов синтеза или других подходящих способов, отталкиваясь от опубликованных последовательностей, например, доступных в литературе или в базах данных, таких как, например, GenBank®, PubMed® или др.

A. Кассета экспрессии

Кассетой экспрессии является кассета, определение которой дано в данном документе. Кроме этого, кассета экспрессии и/или вектор экспрессии, которые описаны в данном документе, могут содержать дополнительные последовательности трансгена или регуляторные последовательности. Кассета экспрессии является кассетой, которая упаковывается в белок капсида и доставляется в выбранную клетку-хозяина.

1. Трансген

Настоящее изобретение может включать применение нескольких трансгенов. Подходящие трансгены могут быть легко выбраны специалистом в данной области техники. Выбор трансгена не рассматривают в качестве ограничения настоящего изобретения.

2. Регуляторные элементы

Кроме основных элементов, указанных ранее для кассеты экспрессии, вектор также включает традиционные контролирующие элементы, которые функционально связаны с трансгеном таким образом, чтобы обеспечивалась транскрипция, трансляция и/или экспрессия в клетке, которая трансфицирована плазмидным вектором или инфицирована вирусом, полученным согласно настоящему изобретению. Применяемые в данном документе “функционально связанные” последовательности включают как контролирующие экспрессию последовательности, которые прилегают к рассматриваемому гену, так и контролирующие экспрессию последовательности, которые функционируют в положении транс или на расстоянии, осуществляя контроль рассматриваемого гена. Контролирующие экспрессию последовательности включают соответствующие последовательности инициации, терминации транскрипции, промоторов и энхансеров; эффективные сигналы процессинга РНК, такие как сигналы сплайсинга и полиаденилирования (поли-А); последовательности, которые стабилизируют цитоплазматическую мРНК; последовательности, которые усиливают эффективность трансляции (т.е., консенсусную последовательность Козак); последовательности, которые усиливают стабильность белков, и, при необходимости, последовательности, которые усиливают секрецию кодируемого продукта. В данной области техники известно и может быть использовано большое число контролирующих экспрессию последовательностей, в том числе промоторы, которые являются нативными, конститутивными, индуцируемыми и/или тканеспецифическими.

Примеры конститутивных промоторов включают, без ограничений, промотор LTR ретровируса, вызывающего саркому Рауса (RSV) (необязательно с энхансером RSV), промотор цитомегаловируса (CMV) (необязательно с энхансером CMV) [см., например, Boshart et al, (1985) Cell, 41:521-530], промотор SV40, промотор дигидрофолатредуктазы, промотор β-актина, промотор фосфоглицеролкиназы (PGK) и промотор EF1 [Invitrogen]. Индуцируемые промоторы осуществляют регуляцию экспрессии генов и могут регулироваться экзогенно вводимыми соединениями, средовыми факторами, таким как температура, или наличием специфического физиологического состояния, например, острой фазы, определенного состояния дифференцировки клетки или только в реплицирующихся клетках. Индуцируемые промоторы и индуцируемые системы доступны из ряда коммерческих источников, включая, без ограничений, Invitrogen, Clontech и Ariad. Было описано множество других систем, и они могут быть легко подобраны специалистом в данной области техники. Примеры индуцируемых промоторов, регулируемых поставляемыми экзогенно соединениями, включают индуцируемый цинком промотор металлотионина (MT) овцы, индуцируемый дексаметазоном (Dex) промотор вируса опухоли молочной железы мыши (MMTV), промоторную систему полимеразы T7 [международная патентная публикация № WO 98/10088]; промотор экдизона насекомых [No et al, (1996) Proc. Natl. Acad. Sci. USA, 93:3346-3351], репрессируемую тетрациклином систему [Gossen et al, (1992) Proc. Natl. Acad. Sci. USA, 89:5547-5551], индуцируемую тетрациклином систему [Gossen et al, (1995) Science, 268:1766-1769, см. также Harvey et al, (1998) Curr. Opin. Chem. Biol., 2:512-518], RU486-индуцируемую систему [Wang et al, (1997) Nat. Biotech., 15:239-243 и Wang et al, (1997) Gene Ther., 4:432-441] и индуцируемую рапамицином систему [Magari et al, (1997) J. Clin. Invest., 100:2865-2872], в том числе, например, систему Argent™, которая доступна у Ariad. Другими типами индуцируемых промоторов, которые могут быть пригодны в данном контексте, являются промоторы, которые регулируются специфическим физиологическим состоянием, например, температурой, острой фазой, определенным состоянием дифференцировки клетки или только в реплицирующихся клетках.

Другой вариант осуществления трансгена включает ген, функционально связанный с тканеспецифическим промотором. Например, если необходима экспрессия в скелетной мышце, то необходимо использовать промотор, который активен в мышцах. В их число входят промоторы из генов, кодирующих мышечный β-актин, легкую цепь 2A миозина, дистрофин, десмин, MHC, мышечную креатинкиназу, а также синтетические промоторы мышц с активностями, превышающими активности встречающихся в природе промоторов (см. Li et al., (1999) Nat. Biotech., 17:241-245). Примеры промоторов, которые являются тканеспецифическими и известны для ЦНС/нейронов, включают, например, помимо прочих, специфический для нейронов промотор енолазы (NSE) (Andersen et al., (1993) Cell. Mol. Neurobiol., 13:503-15), гена легкой цепи нейрофиламентов (Piccioli et al., (1991) Proc. Natl. Acad. Sci. USA, 88:5611-5) и нейрон-специфического гена vgf (Piccioli et al., (1995) Neuron, 15:373-84). В другом варианте осуществления для трансгена будет использован нативный промотор. Нативный промотор может быть предпочтительным, если необходимо, чтобы экспрессия трансгена должна была имитировать естественную экспрессию. Нативный промотор можно использовать, если экспрессия трансгена должна регулироваться во времени, или в процессе развития, или тканеспецифическим путем, или в ответ на специфические транскрипционные факторы. В дополнительном варианте осуществления для имитирования естественной экспрессии можно использовать другие нативные контролирующие экспрессию элементы, такие как энхансерные элементы, сайты полиаденилирования или консенсусные последовательности Козак.

Комбинацию трансгена, промотора/энхансера и 5’ и 3’ ITR AAV для удобства в данном документе называют кассетой экспрессии. В соответствии с идеями настоящего изобретения, разработку такой кассеты экспрессии можно выполнить с помощью традиционных способов.

3. Доставка кассеты экспрессии в упаковывающую клетку-хозяина для AAV

Кассета экспрессия может переноситься на любом подходящем векторе, например, плазмиде, которая доставляется в клетку-хозяина. Плазмиды, подходящие для настоящего изобретения, можно разработать таким образом, чтобы они были пригодны для репликации и, необязательно, интеграции в прокариотические клетки, клетки млекопитающих или и те, и другие. Эти плазмиды (или другие векторы, несущие кассету экспрессии) содержат последовательности, обеспечивающие репликацию кассеты экспрессии у эукариот и/или прокариот, и селекционные маркеры для этих систем. Селектируемые маркеры или репортерные гены могут включать последовательности, кодирующие, помимо прочего, устойчивость к канамицину, генетицину, гидромицину или пуримицину. Плазмиды также могут содержать некоторые селектируемые репортеры или маркерные гены, которые можно использовать для передачи сигнала о наличии вектора в бактериальных клетках, например, в виде устойчивости к ампициллину. Другие компоненты плазмиды могут включать точку начала репликации и ампликон, такой как система ампликона с использованием ядерного антигена вируса Эпштейна-Барра. Данная система ампликона или другие подобные компоненты ампликона осуществляют многокопийную эписомальную репликацию в клетках. Предпочтительно, молекулу, несущую кассету экспрессии, трансфицируют в клетку, где она может временно существовать. Альтернативно, кассету экспрессии можно стабильно интегрировать в геном клетки-хозяина, либо в хромосому, либо в виде эписомы. В некоторых вариантах осуществления кассета экспрессии может присутствовать в нескольких копиях, необязательно, в конкатемерах голова-к-голове, голова-к-хвосту или хвост-к-хвосту. Для доставки кассеты экспрессии в клетку-хозяина известны и могут быть легко использованы соответствующие методики трансфекции.

В целом, при доставке с помощью трансфекции вектора, содержащего кассету экспрессии, вектор вносят в количестве от приблизительно 5 мкг до приблизительно 100 мкг ДНК, от приблизительно 10 мкг до приблизительно 50 мкг ДНК на от приблизительно 1×104 клеток до приблизительно 1×1013 клеток, или на приблизительно 1×105 клеток. Тем не менее, относительные количества векторной ДНК в клетках-хозяевах можно корректировать с учетом таких факторов, как выбранный вектор, способ доставки и выбранные клетки-хозяева.

B. Упаковывающие клетки-хозяева

Кроме кассеты экспрессии клетка-хозяин содержит последовательности, которые управляют экспрессией белка AAV-капсида по настоящему изобретению в клетке-хозяине, и последовательности rep из того же источника, что и у ITR AAV из кассеты экспрессии, или взаимодополняющего источника. Для упаковки rAAV по настоящему изобретению упаковывающая клетка-хозяин также нуждается во вспомогательных функциональных элементах. Такие вспомогательные функциональные элементы хорошо известны в данной области техники и не будут воспроизведены в данном документе. Аналогично, известны способы получения подходящих векторов, имеющих AAV-капсиды. [См., например, опубликованную заявку на патент США № US 2007/0036760].

Конструкцию rAAV, кодирующую кассету экспрессии, описанную в данном документе, также можно суспендировать в физиологически совместимом носителе и можно ввести субъекту. В одном варианте осуществления носителем является стерильный физиологический раствор отдельно или необязательно с любым из ряда буферных растворов (например, фосфатным буферным физиологическим раствором). Другие иллюстративные носители включают лактозу, сахарозу, фосфат кальция, желатин, декстран, агар, пектин, кунжутное масло и воду. Выбор носителя не является ограничением настоящего изобретения.

Необязательно композиции настоящего изобретения могут содержать, кроме rAAV и носителя(носителей), другие традиционные фармацевтические ингредиенты, такие как консерванты или химические стабилизаторы. В одном варианте осуществления доставку осуществляют посредством внутривенной доставки. Однако, можно выбрать и другие пути введения. Альтернативно или дополнительно, при необходимости, пути введения можно комбинировать.

В одном варианте осуществления настоящее изобретение включает лиофилизированную композицию, которая содержит rAAV, который описан в данном документе, или смесь с rAAV в лиофилизированной форме. Необязательно в данной композиции присутствует один или несколько стабилизаторов или консервантов. Соответственно, для применения лиофилизированную композицию разводят подходящим разбавителем, например, стерильным физиологическим раствором или буферным физиологическим раствором.

Дозировки вирусного вектора будут зависеть преимущественно от таких факторов, как состояние, подлежащее лечению, возраст, масса и состояние здоровья пациента, и, таким образом, могут варьировать среди пациентов. Например, терапевтически эффективная дозировка вирусного вектора находится, как правило, в диапазоне от приблизительно 0,1 мл до приблизительно 100 мл, или от приблизительно 0,1 мл до приблизительно 10 мл, или от приблизительно 0,1 мл до приблизительно 5 мл, или от приблизительно 0,5 мл до приблизительно 1 мл раствора, содержащего концентрации от приблизительно 3×109 до 3×1013 геномов в вирусных векторах (частицах)/мл водного суспендирующего средства. Другая иллюстративная дозировка составляет от приблизительно 3×109 до 3×1013 геномов AAV на 1 кг. Один подходящий объем составляет приблизительно 1 мл. В другом варианте осуществления терапевтически эффективная доза конструкции rAAV находится в диапазоне от приблизительно 0,001 нг до приблизительно 1000 мг/70 кг животного, которую можно доставлять за одну дозировку или в течение последовательности из двух или нескольких доз. Можно определить другие подходящие дозировки. Дозировку будут корректировать для уравновешивания терапевтической пользы и любых побочных эффектов, и такие дозировки могут варьировать в зависимости от терапевтического назначения, для которого используют рекомбинантный вектор.

СПОСОБЫ ЛЕЧЕНИЯ

Композиции настоящего изобретения позволяют избежать осложнений в результате ферментной заместительной терапии, связанных с иммунным ответом на рекомбинантный фермент, которые могут варьировать от легкой до резко выраженной анафилаксии, а также осложнений в виде пожизненного периферического доступа, таких как местные и системные инфекции. Дополнительно, в противоположность ERT, композиция по настоящему изобретению не требует долговременных, повторных еженедельных инъекций. Не желая ограничиваться теорией, полагают, что направленный на печень терапевтический способ, описанный в данном документе, пригоден для коррекции фенотипа центральной нервной системы, связанного с нарушениями MPSI, путем осуществления эффективного долговременного переноса гена, обеспечиваемого с помощью векторов с высокой эффективностью трансдукции, может обеспечивать постоянные повышенные уровни циркулирующей IDUA, которые создают терапевтическое давление на гематоэнцефалический барьер. Кроме того, перенос генов AAV в печень может обеспечивать эффективную переносимость и предупреждать образование антител против фермента.

Предложен способ лечения мукополисахаридоза I типа, включающий доставку терапевтически эффективного количества кассеты экспрессии с модифицированным hIDUA, как описано в данном документе. Также предложен способ лечения и/или облегчения симптомов синдромов Гурлер, Гурлер-Шейе и/или Шейе.

В одном варианте осуществления rAAV доставляют внутривенно.

В другом варианте осуществления rAAV доставляют субъекту в количестве от приблизительно 3×109 до приблизительно 3×1012. Несмотря на то, что предполагают, что эффективным будет однократное введение rAAV, поскольку печень является восстанавливающимся органом, введение можно повторять (например, ежеквартально, дважды в год, ежегодно или, при необходимости, иным образом). Необязательно изначальную дозу терапевтически эффективного количества можно доставлять за несколько раздельных сеансов инфузии, принимая во внимание возраст и способность субъекта переносить инфузии. В то же время, повторные еженедельные инфузии полной терапевтической дозы не требуются, что обеспечивает преимущество для пациента с точки зрения как комфорта, так и терапевтического результата.

Приведенные далее примеры носят лишь иллюстративный характер и не являются ограничением описанного в данном документе настоящего изобретения.

Пример 1 - Получение трансгена и вектора

Синтезировали модифицированную нуклеотидную последовательность, кодировавшую функциональную альфа-L-идуронидазу человека. Полученная в результате последовательность особенно хорошо подходила для экспрессии у человека и была менее чем приблизительно на 90% идентичной функциональному гену IDUA человека (hIDUA; Genbank NP000194.2). Полученный в результате трансген затем вставляли в плазмиду, содержавшую цис-элементы, необходимые для упаковки в AAV-вектор, доступную от UPenn Vector Core, с использованием сконструированных сайтов MluI и SalI. Экспрессия гена управлялась по типу тироксин-связывающего глобулина человека (TBG, Hayashi Y, Mori Y, Janssen OE, et al. Human thyroxine-binding globulin gene: complete sequence and transcriptional regulation. Mol Endocrinol 1993; 7: 1049-1060]. Полученная в результате плазмида, показанная на фигуре 2, pENN.AAV.TBG.PI.hIDUA.RGB, содержала модифицированный ген hIDUA под контролем контролирующих экспрессию последовательностей, в том числе печеночно-специфического промотора TBG. Плазмида дополнительно содержала 5’ ITR AAV2, тандемные повторы энхансеров alpha mic/bic, промотор TBG, последовательность интрона Promega, модифицированный ген IDUA человека SEQ ID NO: 1, поли-А глобулина кролика и 3’ ITR AAV2.

Получение вектора в большом масштабе выполняли фактически как описано у Lock et al. [Rapid, simple, and versatile manufacturing of recombinant adeno-associated viral vectors at scale. Hum Gene Ther 21(10): 1259-1271. (2010)]. Трансфекции на основе PEI выполняли в наборах клеток из 10 слоев, содержавших 75% конфлуэнтные монослои клеток HEK293. 10 л маточной среды для культивирования из наборов клеток осветляли, а затем концентрировали с помощью тангенциальной поточной фильтрации. Концентрированный осветленный маточный раствор очищали в градиентах йодиксанола (Optiprep; Sigma Chemical Co., Сент-Луис, Миссури). Все фракции непосредственно под видимой полосой загрязняющего белка собирали и объединяли. Объединенные фракции подвергали диафильтрации против PBS/35 мМ NaCl и концентрировали с использованием центрифужных концентраторов Amicon Ultra 15 (Millipore). К диафильтрованному концентрированному продукту добавляли глицерин до 5% конечного объема и препарат делили на аликвоты и хранили при -80°C. Полученные в результате векторы обозначены в данном документе AAV8.TBG.hIDUA или AAV2/8.TBG.hIDUA. В некоторых местах частицы рекомбинантного AAV обозначены как AAV8.TBG.hIDUAco или AAV2/8.TBG.hIDUAco. Плазмида дополнительно содержала 5’ ITR AAV2, тандемные повторы энхансеров alpha mic/bic, промотор TBG, последовательность интрона Promega, модифицированный ген IDUA человека SEQ ID NO: 1, поли-А глобулина кролика и 3’ ITR AAV2.

Пример 2 -

A. Клеточные анализы

Клетки HEK 293 поддерживали в питательной среде, содержавшей модифицированную по способу Дульбекко среду Игла (DMEM; Gibco®, Life Technologies™) с 5% фетальной бычьей сывороткой (FBS; XXX), 1% раствором пенициллина/стрептомицина (p/s; Life Technologies ™). Трансфекции плазмидными ДНК проводили с помощью Lipofectamine™ 2000 (Invitrogen™, Life Technologies™) в соответствии с рекомендациями производителя. Вкратце, клетки высеивали при плотности 5×10^5 клеток/лунка в 6-луночные планшеты для культивирования тканей в среде для трансфекции (DMEM + 5% FBS, без p/s) и оставляли на ночь для закрепления при 37° в 5% CO2. На следующий день клетки проверяли в отношении 90-95% конфлуэнтности и среду освежали. Плазмидную ДНК и Lipofectamine™ 2000 разводили бессывороточной средой Opti-MEM I ® (без сыворотки) до конечного отношения 1:2,5 (ДНК: Lipofectamine™ 2000). Раствор для трансфекции Lipofectamine™ 2000 инкубировали в течение пяти минут при 22°C перед смешиванием с раствором ДНК. Данную конечную смесь для трансфекции, содержавшую раствор ДНК:Lipofectamine™ 2000, инкубировали в течение дополнительных 20 минут (22°C) перед добавлением в лунки, содержавшие клетки и среду. Контрольные клетки не получали плазмидную ДНК, а в качестве контроля трансфекции использовали плазмиду, кодировавшую eGFP. Для каждой исследуемой конструкции трансфицировали три лунки. Клетки инкубировали при 37° в 5% CO2; спустя четыре часа среду заменяли питательной средой. Содержимое каждой лунки извлекали через 72 часа и собирали при 4000 об./мин. в течение 15 минут при 4°C. Клетки ресуспендировали в 100 мкл/лунка буфера для лизиса (0,2% Triton X-100, 0,9% NaCl, pH 4,0) и трижды замораживали/размораживали при перемешивании с помощью вортекса. Помимо этого, лизаты обрабатывали бензоназой в течение 30 минут при 37°C перед окончательным замораживанием/размораживанием. Клеточный дебрис осаждали центрифугированием при 10000 об./мин. (4°C) в течение 10 минут, а конечные осветленные клеточные лизаты помещали на лед и сразу анализировали в отношении ферментативной активности.

B. Лизис тканей и экстракция белка

Замороженные ткани наполовину размораживали в емкости на поверхности сухого льда и небольшие кусочки влажной ткани разрезали (~20 мг, ~10 мг селезенки) в небольшой чашке Петри. Предварительно обработанные ткани затем погружали в 2 мл пробирку типа Эппендорф с 1 мл буфера для лизиса (0,2% Triton X-100, 0,9% NaCl, pH 4,0) и 5 мм стальной гранулой. Образцы гомогенизировали на гомогенизаторе тканей при 30 Гц в течение 2 минут. Гомогенизированные образцы быстро центрифугировали на 6000 об./мин. в течение 30 секунд и удаляли 5 мм стальные гранулы. Лизаты тканей дополнительно разрушали ультразвуком с применением наконечника типа Microhorn диаметром 1-1/16” и замораживали на ночь при -80°C. Обработанные образцы размораживали на следующий день при 22°C и осветляли с помощью центрифугирования (10000 об./10 минут/4°C). Плавающие липидные слои из головного мозга или других жировых тканей аспирировали перед анализом. Затем образцы сохраняли на влажном льду и сразу анализировали в отношении ферментативной активности.

C. Оценка белка

Общий белок оценивали по методу Брэдфорда с использованием кумасси (Thermo Scientific) в соответствии с протоколом производителя. Вкратце, стандартную кривую строили с использованием бычьего сывороточного альбумина (BSA) для получения рабочего диапазона 1-25 мкг/мл и холостой пробы для того, чтобы принять в учет буферный раствор для разведения белка без BSA. Образцы разводили серийными двухкратными разведениями от 1/300 до 1/1200 и смешивали в отношении 1:1 разбавленный белок:реагент Брэдфорда в 96-луночном плоскодонном планшете. Образцам давали отстояться при 22°C в течение 15 минут и снимали коэффициенты поглощения на планшет-ридере при примерной длине волны 595 нм. Исходные значения преобразовывали в концентрации в мкг/мл с использованием стандартной кривой с поправкой на контроль. Количества микрограмм затем преобразовывали и описывали в миллиграммах.

D. Анализы ферментативной активности

Анализировали ферментативную активность IDUA с помощью 4-метилумбеллиферил-альфа-L-идопиранозидуроновой кислоты, соли циклогексиламмония (4-MU-Ido; Toronto Research Chemicals, Inc.) в качестве субстрата, в соответствии с ранее опубликованными способами [Kakkis et al, Mol Genet Metab, 2001 Mar; 72(3): 199-208]. Вкратце, 5-15 мкл лизатов или сыворотки доводили до 100 мкл бидистиллированной водой (ddH2O) и 100 мкл 100 мкM субстрата 4-MU-Ido, разведенного реакционным буфером (0,1M ацетат натрия pH 3,5, 0,15M NaCl, 0,05% Triton X-100), объединяли в кювете с метилакрилатом (Thermo Scientific). Реакционные смеси инкубировали в течение 1-3 часов в водяной бане при 37°C и завершали добавлением 1x стоп-буфера (290 мМ глицин, 180 мМ натрия карбонат, pH 10,5). Продукты измеряли на QuantiFluorTM-ST (Promega) посредством УФ-канала (возбуж. 365 нм, испуск. 440-470 нм). Первичные значения флуоресценции записывали и преобразовывали в нмоль/мл/ч с помощью стандартной кривой известных количеств 4-метилумбеллиферона (M-5410; Biosynth®). Лизаты клеток и тканей нормализовали до рассчитанных значений белка (нмоль/мг/ч; см. способы в разделе под заголовком “Оценка белка”).

E. Экстракция ДНК и анализ геномных копий

ПЦР с применением Taqman использовали для определения содержания векторной ДНК в диплоидных клетках. Для обнаружения и количественного определения векторных геномов с помощью ПЦР в реальном времени всю ДНК клетки экстрагировали из тканей с помощью набора QIAamp DNA Mini Kit (Qiagen, Валенсия, Калифорния, США). Для направленного связывания с участком поли-А nRBG вектора были разработаны наборы праймеров и зондов со следующими последовательностями; прямой: GCCAAAAATTATGGGGACAT, обратный: ATTCCAACACACTATTGCAATG, зонд: 6FAM-ATGAAGCCCCTTGAGCATCTGACTTCT-TAMRA. Стандартные кривые для количественного определения векторных геномов создавали с помощью цис-плазмид, применяемых для получения соответствующего вектора. ПЦР выполняли с помощью TaqMan Universal PCR Master Mix (Applied Biosystems, Фостер Сити, Калифорния, США) с использованием 200 нг общей ДНК клетки в качестве матрицы, 300 нМ праймеров и 200 нМ зондов каждый. Циклы представляли собой 2 минуты при 50°C, 10 минут при 95°C, 40 циклов по 15 секунд при 95°C и 1 минуту при 60°C.

F. Иммуноблоттинг

Иммуноблоттинг проводили в соответствии со стандартными способами. Вкратце, использовали гелевую систему NuPAGE (Life Technologies), 4-12% бис-трис-гели. Перенос осуществляли через 30 минут при 20 В на мембрану из PVDF. Блокирующий реагент представлял собой 10% NFDM в T-PBS (в течение ночи). Первичное MAb представляло собой мышиное антитело к IDUA человека 1:300 (1,5 часов); 1% NFDM в T-PBS. Вторичное: HRP-связанное антитело кролика к антителу мыши 1:3000 (1 час); 1% NFDM в T-PBS.

Определение осуществляли с помощью хемилюминесцентного субстрата SuperSignal West Dura (Thermo Scientific) при 30-секундной экспозиции на рентгеновскую пленку.

Пример 3 - Исследования in vivo у мышей и собак

Недостаточности IDUA можно встретить у собак, что делает возможным исследование заболевания и видов лечения у крупного животного. Собаки с MPS I являются носителями рецессивной (нулевой) мутации в гене IDUA, при которой мутация G>A в сайте сплайс-донора интрона 1 образует кодон преждевременной терминации на стыке экзона и интрона [Menon, K.P., P.T. Tieu, и E.F. Neufeld, Architecture of the canine IDUA gene and mutation underlying canine mucopolysaccharidosis I. Genomics, 1992. 14(3): p. 763-8.]. Динамика заболевания у собаки аналогична синдрому Гурлер-Шейе; проявления заболевания включают значительное нарушение скелета, в том числе деформацию грудной клетки.

Анализ GAG мочи является биохимическим маркером, используемым для определения эффективности видов лечения MPS I в клинических условиях.

Накопление гликозаминогликанов (GAG) оценивали в основных органах с помощью окрашивания альцианом синим (pH 1) парафиновых срезов. Накопление непереработанных GAG в клетках особенно хорошо визуализировали на срезах толщиной 1 мкм из заключенных в пластмассу тканей, окрашенных толуидином синим. Тонкие срезы (1 мкм) заключенных в эпон тканей окрашивали толуидином синим. Оно выявляло клетки, содержавшие запасное вещество (“пенистые, губчатые клетки”).

Иммуногистохимический анализ проводили с использованием антитела к ганглиозиду GM3 в головном мозге. Он показывал аномальное отложение GM3 в нейронах. У собак исследовали кору головного мозга, а у мышей - кору головного мозга и гипоталамус. Экспрессию IDUA человека в печени оценивали с помощью иммунофлуоресцентного анализа.

A. Исследования на мышах

AAV8.TBG.модифицированный hIDUA получали как описано в Примере 1. Мышей (в возрасте приблизительно 3 месяцев) инъецировали внутривенно дозами приблизительно 1×1011 GC, 3×1010 GC, 3×109 GC, 1×109 GC и оценивали приблизительно через 2 недели после инъекции.

Результаты показали уменьшенное или полностью отсутствовавшее окрашивание GAG у животных, получавших дозы 1×1011, 3×1010 и 3×109. У этих животных в тонких срезах наблюдали уменьшенные или полностью отсутствовавшие накопительные повреждения.

У животных, получавших дозу 1×109 , отложение GAG выглядели примерно так же, как у мышей, не получавших лечения, и накопительные повреждения выглядели примерно так же, как у мышей, не получавших лечения.

При изучении отложения GM3 исследовали только животных, получавших дозу 1×1011 GC и 3×1010 GC, и отмечали лишь небольшое улучшение в отложении GM3 в нейронах.

Сильную экспрессию (100% у гепатоцитов) IDUA наблюдали у животных, получавших дозу 1×1011 GC. Она снижалась при более низких дозах, при этом лишь незначительное количество позитивных гепатоцитов было заметно при 1×109 GC.

B. Исследования на собаках

AAV8.TBG.модифицированный hIDUA получали как описано в Примере 1. Собак (в возрасте приблизительно 8 месяцев) инъецировали внутривенно дозой 1×1011 GC и оценивали через четыре месяца после инъекции (т.е. в возрасте 1 года).

Это исследование показывало обратимость накопительных повреждений. В частности, практически полное удаление отложения GAG во всех основных органах наблюдали при окрашивании альцианом синим. Накопительные повреждения не наблюдали в тонких срезах сердца, почки или печени. Снижение или полное удаление накопления GM3 наблюдали в нейронах. Экспрессию IDUA в печени наблюдали с помощью иммунофлуоресцентного анализа у >95% гепатоцитов.

Пример 4 - Лечение синдрома Гурлер-Шейе с помощью AAV2/8.TBG.hIDUA

Опосредованный AAV8 перенос генов IDUA будет оценен у пациентов с синдромом Гурлер-Шейе. Субъекты будут получать однократную инфузию вектора в периферическую вену, что на основании доклинических данных приведет к стабильной выработке фермента в количествах, которые близки к таким, которые получают от нормальных субъектов. Исследование может включать различные дозы вектора, например, 3×1011 GC/кг; 1×1012 GC/кг; 3×1012 GC/кг и к этому следует добавить диапазон доз. Самой неинвазивной оценкой эффективности является уровень GAG мочи, который повышен при заболевании и частично корректируется после ERT. Приживление трансгена и уровень его экспрессии будут определять с помощью измерения IDUA сыворотки. GAG мочи также будут измерять до и после генной терапии.

(Произвольный текст Перечня последовательностей)

Последующая информация приведена для последовательностей, содержащих произвольный текст под числовым идентификатором <223>.

SEQ ID NO:
(содержащая произвольный текст)
Произвольный текст под <223>
SEQ ID NO: 3 <220> <221> <222> <223> повторяющийся участок
(1)..(130)
5' ITR
<220> <221> <222> <223> энхансер
(221) .. (320)
Alpha mic/bik
<220> <221> <222>
<223>
энхансер
(327) .. (426)
Alpha mic/bik
<220> <221> <222> <223> промотор
(442)..(901)
промотор TBG
<220> <221> <222> Сигнал TATA
(885)..(888)
<220> <221> <222> <223> Интрон
(1027)..(1159)
интрон 1
<220> <221> <222> <223> CDS
(1251)..(3212)
альфа-L-IDUE человека
<220> <221> <222> сигнал поли-А
(3261)..(3387)
<220>
<221> повторяющийся участок
<222> (3476)..(3605)
<223> 3'ITR (расположен на комплементарной цепи)
<220> <221> точка начала репликации
<222> (3782)..(4220)
<223> fl\ori (расположена на комплементарной цепи)
<220>
<221> точка начала репликации
<222> (4249)..(4891)
<223> pUC\ точка начала репликации\
<220>
<221> другой признак
<222> (5566)..(6381)
<223> маркер устойчивости к канамицину расположен на комплементарной цепи

Посредством этого перечень последовательностей под заголовком “Z6622PCT_ST.txt” подается в электронной форме; данный перечень последовательностей, таким образом, включен с помощью ссылки. Все публикации, патенты и заявки на патенты, упомянутые в настоящей заявке, в том числе приоритетной заявке на выдачу патента США № 61/788724, поданной 15 марта 2013 года, таким образом, включены с помощью ссылки во всей своей полноте, как если бы каждая отдельная публикация или заявка на патент была конкретно и отдельно указана как включенная с помощью ссылки. Несмотря на то, что изложенное выше изобретение в целях ясности понимания было описано довольно подробно посредством иллюстрации и примера, специалистам в данной области техники в свете идеи настоящего изобретения будет совершенно очевидно, что в нем можно выполнить некоторые изменения и модификации без отклонения от сущности или объема прилагаемой формулы изобретения.

1. Частица рекомбинантного аденоассоциированного вируса (rAAV) для применения в лечении мукополисахаридоза I типа (MPS I), имеющая AAV-капсид и имеющая упакованный в него 5’ инвертированный концевой повтор (ITR), ген альфа-L-идуронидазы человека (hIDUA) под контролем регуляторных последовательностей, которые контролируют его экспрессию, и 3’ ITR AAV, где упомянутый ген hIDUA имеет последовательность, показанную в SEQ ID NO: 1, которая кодирует функциональную альфа-L-идуронидазу человека.

2. Частица rAAV по п.1, где ген hIDUA экспрессируется под контролем печеночно-специфического промотора.

3. Частица rAAV по п.1, где регуляторные последовательности содержат один или несколько энхансеров, необязательно, где энхансеры являются одинаковыми или разными.

4. Частица rAAV по п.3, где энхансеры выбраны из группы, состоящей из интрона, энхансера цитомегаловируса (CMV) и энхансера предшественника альфа-1-микроглобулина/бикунина (Alpha mic/bik), необязательно, где в векторе присутствуют несколько копий выбранного энхансера, дополнительно необязательно, где несколько копий энхансера расположены в тандеме.

5. Частица rAAV по п.1, где частица rAAV содержит капсид AAV8.

6. Частица rAAV по п.1, где частица rAAV содержит капсид AAV9.

7. Частица rAAV по п.5 или 6, где rAAV является псевдотипированным, необязательно, где ITR происходят из AAV2.

8. Частица rAAV по п.1, где последовательность, показанная в нуклеотидах с 1 по 3605 SEQ ID NO:3, упакована в капсид AAV.

9. Частица рекомбинантного аденоассоциированного вируса (rAAV) для использования в лечении мукополисахаридоза I типа (MPS I), где частица вируса, имеющая капсид AAV8 и имеющая упакованный в него 5’ ITR, ген hIDUA под контролем регуляторных последовательностей и 3’ ITR AAV, где упомянутый ген hIDUA имеет последовательность, показанную в SEQ ID NO: 1, и где контрольные регуляторные последовательности включают печеночно-специфический промотор TBG, тандемные повторы энхансеров alpha mic/bic, интрон и поли-А.

10. Частица rAAV по п.9, которую используют в лечении или облегчении симптомов синдромов Гурлер-Шейе.

11. Композиция для применения в лечении мукополисахаридоза I типа (MPS I), содержащая эффективное количество частицы rAAV по любому из пп.1-10 и фармацевтически приемлемый носитель.

12. Композиция для применения по п.11, где упомянутую частицу rAAV доставляют внутривенно или где частицу rAAV доставляют субъекту в количестве от 3×109 до 3×10132 геномных копий на кг.

13. Применение композиции, содержащей частицу rAAV по любому из пп.1-10 и фармацевтически приемлемый носитель, для применения при лечении MPS I.



 

Похожие патенты:

Изобретение относится к области биотехнологии и молекулярной биологии. Предложена нуклеиновая кислота для получения белка гемагглютинина (НА) гриппа типа B в растении, содержащая регуляторную область, активную в растении, и энхансер экспрессии, активный в растении, причем регуляторная область и энхансер экспрессии функционально связаны с нуклеотидной последовательностью, кодирующей модифицированный гемагглютинин гриппа типа В (НА), причем в модифицированном НА между субъединицами НА1 и НА2 полностью удалена протеолитическая петля, при этом протеолитическая петля содержит одноосновный или многоосновный сайт расщепления, при этом нуклеиновая кислота не содержит длинную межгенную область вируса желтой карликовости бобов (BeYDV LIR) и короткую межгенную область BeYDV (BeYDV SIR), а также предложены способ получения модифицированного белка, клетка и растение, экспрессирующие модифицированный белок.

Изобретение относится к биотехнологии и представляет собой изолированную рабдовирусную частицу для применения в онколитической вирусной терапии у пациента с глиобластомой, где выделенная рабдовирусная частица включает геном, способный экспрессировать: белок, имеющий последовательность, которая по меньшей мере на 85% идентична SEQ ID NO: 1, белок, имеющий последовательность, которая по меньшей мере на 85% идентична SEQ ID NO: 2, белок, имеющий последовательность, которая по меньшей мере на 85% идентична SEQ ID NO: 3, белок, имеющий последовательность, которая по меньшей мере на 85% идентична SEQ ID NO: 4, и белок, имеющий последовательность, которая по меньшей мере на 85% идентична SEQ ID NO: 7.

Изобретение относится к области биотехнологии, конкретно к получению слитых белков, связывающихся с PDGF и VEGF, и рекомбинантных вирусных частиц, кодирующих слитые белки, и может быть использовано в медицине.

Группа изобретений относится к области диагностики в ветеринарии, в частности, к тесту для обнаружения антител против CSFV. Раскрыт способ обнаружения антител против вируса классической чумы свиней (CSFV) дикого типа в тестируемом образце, где указанный образец также может содержать антитела против мутантного эпитопа TAVSPTTLR из CSFV E2, где способ включает стадию совместной инкубации указанного тестового образца с иммобилизованным носителем, который содержит эпитоп TAVSPTTLR из CSFV E2 и с носителем, который содержит мутантный эпитоп TAVSPTTLR из CSFV E2.

Изобретение относится к биотехнологии. Описано применение для лечения пациента с раком, экспрессирующим опухолеассоциированный антигенный белок MAGEA3, выделенной вирусной частицы Maraba MG1 и первого вируса.

Изобретение относится к биотехнологии. Описан вектор на основе аденоассоциированного вируса (AAV) для доставки субъекту гетерологичной последовательности нуклеиновой кислоты, содержащей капсидный белок VP1, который содержит одну или несколько замен лизина, где одна замена лизина представляет K137R.

Представленное изобретение относится к области вирусологии, в частности к рекомбинантным вирусам болезни Марека и их применению. Заявленное изобретение касается рекомбинантного вируса болезни Марека серотипа 1 (MDV1), включающего промотор из SEQ ID NO:5 и рекомбинантную последовательность нуклеотидов, кодирующую антигенный полипептид, которая находится под контролем указанного нуклеотида.

Изобретение относится к области биотехнологии и касается рекомбинантного онколитического вируса осповакцины Л-ИВП_oncoM депонированного в государственной коллекции возбудителей вирусных инфекций и реккетсиозов ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора под номером V-797.

Изобретение относится к области биотехнологии и касается рекомбинантного онколитического вируса осповакцины Л-ИВП_oncoB депонированного в государственной коллекции возбудителей вирусных инфекций и реккетсиозов ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора под номером V-796.

Изобретение относится к области биотехнологии и касается рекомбинантного онколитического вируса осповакцины Л-ИВП_oncoQ, депонированного в государственной коллекции возбудителей вирусных инфекций и реккетсиозов ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора под номером V-798.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложена рекомбинантная молекула нуклеиновой кислоты для получения аланина в рекомбинантном микроорганизме Е.

Изобретение относится к области биотехнологии. Изобретение представляет собой генетическую конструкцию, несущую оптимизированный по представленности кодонов, GC-составу, наличию полиА участков и структуре образуемой мРНК ген консенсусного гликопротеина (белка G) вируса бешенства.

Изобретение относится к биотехнологии. Описан способ модификации целевого геномного локуса в клетке млекопитающего, включающий в себя: введение в клетку нуклеазного агента, который осуществляет одно- или двухцепочечный разрыв в пределах целевого геномного локуса; введение в клетку первого большого нацеливающего вектора (LTVEC), который имеет длину по меньшей мере 10 т.п.н.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению мутантных белков человека, и может быть использовано для получения мутеинов липокалина 2 человека (hLcn2, hNGAL) по положению 100 аминокислотной последовательности hLcn2, связывающихся с определенными мишенями.

Изобретение относится к области биотехнологии, конкретно к модифицированному олигонуклеотиду, способному специфично ингибировать экспрессию ангиопоэтин-подобного белка 3 (ANGPTL3), и может быть использовано в медицине.

Данное изобретение относится к области геномной инженерии. Предложен способ мультиплексирования инсерций экзогенных последовательностей нуклеиновых кислот в ДНК клетки, экспрессирующей РНК-направляемый ДНК-связывающий белок из системы CRISPR II типа, включающий введение в клетку нескольких гидРНК, комплементарных различным сайтам ДНК, и нескольких экзогенных последовательностей донорных нуклеиновых кислот, получая несколько изменений ДНК клетки, и повторение указанной стадии множество раз.

Изобретение относится к области биохимии, в частности к молекуле рекомбинантной нуклеиновой кислоты для борьбы с вредителем, являющимся нематодой, а также к конструкту, вектору, клетке-хозяину, растению и семени, содержащим вышеуказанную молекулу.

Изобретение относится к биотехнологии. Описана нуклеиновая кислота, кодирующая адаптированную рекомбиназу, где адаптированная рекомбиназа способна к рекомбинированию асимметричных последовательностей-мишеней SEQ ID NO:1 внутри длинного концевого повтора провирусной ДНК множества штаммов ВИЧ-1, причем аминокислотная последовательность адаптированной рекомбиназы имеет по меньшей мере 95% идентичности последовательности с последовательностью в соответствии с SEQ ID NO:10, причем указанная адаптированная рекомбиназа содержит определенные аминокислотные замены по сравнению с SEQ ID NO:6: V7L, P12S, P15L, M30V, H40R, M44V, S51T, Y77H, K86N, Q89L, G93A, S108G, C155G, A175S, A249V, R259D, E262R, T268A, D278G, P307A, N317T, I320S.

Изобретение относится к биотехнологии. Описано моноклональное антитело, применяемое в иммуноферментном анализе для идентификации вируса Эбола.

Изобретение относится к биотехнологии и генной инженерии и представляет собой набор плазмид для дифференцирования процесса эпителиально-мезенхимальной трансформации клеток, включающий две плазмиды для трансфекции в клетки человека, одна из которых предназначена для выявления эпителиального состояния клеток в отношении процесса эпителиально-мезенхимальной трансформации, а вторая - для выявления мезенхимального состояния, при этом плазмида для выявления их эпителиального состояния включает участок с нуклеотидной последовательностью SEQ ID NO: 1 промотера гена-маркера эпителиального состояния, в качестве которого используют эпителиальный кадгерин человека, и по меньшей мере одну последовательность флуоресцентного белка TurboRFP, а плазмида для выявления мезенхимального состояния включает участок с нуклеотидной последовательностью SEQ ID NO: 2 промотера гена-маркера мезенхимального состояния, в качестве которого используют нейрональный кадгерин человека, и по меньшей мере одну последовательность флуоресцентного белка TurboGFP, при этом участки нуклеотидных последовательностей флуоресцентных белков в упомянутых плазмидах находятся под контролем промотеров соответствующих генов-маркеров.

Изобретение относится к новым соединениям - пара-толуолсульфонату и ди(пара-толуолсульфонату 1-{2-[4-(2-амино-5-хлор-3-пиридинил)фенокси]-5-пиримидинил}-3-[2-(метилсульфонил)-5-(трифторметил)фенил]мочевины и их кристаллическим формам.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложена частица рекомбинантного аденоассоциированного вируса для применения в лечении мукополисахаридоза I типа, имеющая AAV-капсид и имеющая упакованный в него 5’ инвертированный концевой повтор, ген альфа-L-идуронидазы человека под контролем регуляторных последовательностей, которые контролируют его экспрессию, и 3’ ITR AAV, где упомянутый ген hIDUA имеет последовательность, показанную в SEQ ID NO: 1, которая кодирует функциональную альфа-L-идуронидазу человека, а также композиция и применение. Изобретение может быть использовано в медицине. 4 н. и 9 з.п. ф-лы, 2 ил., 4 пр.

Наверх