Аллель-специфическая амплификация с использованием композиции перекрывающихся олигонуклеотидов в качестве не являющегося аллель-специфическим праймера и аллель-специфического блокатора

Изобретение относится к биотехнологии. Описана композиция олигонуклеотидов для амплификации последовательности-мишени. Композиция включает олигонуклеотид в качестве блокатора, включающий функциональную группу или некомплементарный участок последовательности на 3'-конце или вблизи него, которая предотвращает ферментативное удлинение. При этом олигонуклеотид в качестве блокатора включает первую последовательность, включающую нейтральную по отношению к мишени подпоследовательность и блокаторную вариабельную подпоследовательность, где блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах нейтральной по отношению к мишени подпоследовательностью и неразрывна с нейтральной по отношению к мишени подпоследовательностью. Олигонуклеотид в качестве первого праймера является достаточным для вызова ферментативного удлинения. Олигонуклеотид в качестве первого праймера включает вторую последовательность, где вторая последовательность перекрывается с нейтральной по отношению к мишени подпоследовательностью олигонуклеотида в качестве блокатора на протяжении по крайней мере 5 нуклеотидов, так что вторая последовательность включает перекрывающуюся подпоследовательность и неперекрывающуюся подпоследовательность, и вторая последовательность не включает блокаторную вариабельную подпоследовательность, вторая последовательность создает стандартную свободную энергию гибридизации (ΔGοPT), а первая последовательность создает стандартную свободную энергию гибридизации (ΔGοBT), которая удовлетворяет следующему условию: +2 ккал/моль≥ΔGοPT-ΔGοBT≥-8 ккал/моль. При этом концентрация олигонуклеотида в качестве блокатора в приблизительно 2 - приблизительно 10000 раз выше концентрации олигонуклеотида в качестве первого праймера. Изобретение расширяет арсенал средств для амплификации. 3 н. и 44 з.п. ф-лы, 14 ил., 1 табл., 11 пр.

 

Перекрестная ссылка на родственные заявки

Настоящая заявка притязает на приоритет предварительной заявки на патент США с № 62/000114, поданной 19 мая 2014 г., описание которой включено сюда посредством ссылки в полном объеме.

Список последовательностей

Список последовательностей подается с этой заявкой только в электронной форме и включен сюда посредством ссылки. Включающий список последовательностей текстовый файл «14-21013-WO (260947,00251)_SL.txt» был создан 18 мая 2015 г. и составляет 13 144 байта.

Предпосылки создания изобретения

Небольшие различия в последовательности ДНК и РНК могут привести к большим различиям в физическом здоровье в целом и хорошем самочувствии организмов, в том числе людей. Например, замена одного основания в бактериальном геноме может привести к устойчивости к антибиотикам, а замена одного основания в геноме человека может привести к прогрессированию рака. Благодаря достижению полного развития области геномики и сопутствующему открытию множества последовательностей и молекул нуклеиновых кислот-биомаркеров, существует большая потребность со стороны биотехнологической промышленности в разработке надежных, устойчивых к отклонениям, недорогих и точных анализов нуклеиновых кислот, которые могут различать замены одного основания. В частности, было разработано множество основанных на ПЦР анализов, которые являются аллель-специфическими.

Основанные на ПЦР подходы к избирательному детектированию редких мутаций могут быть подразделены в целом на два ряда подходов: (А) аллель-специфичные праймеры и (В) не являющиеся аллель-специфическими праймеры с аллель-специфическими блокаторами.

Примеры аллель-специфических праймеров включают амплификационную систему для идентификации мутаций (ARMS), ПЦР с использованием аллель-специфических блокаторов (ASB-PCR) и конкурентную аллель-специфическую TaqMan ПЦР (castPCR). Примеры (В) включают ПЦР с использованием ПНК-блокаторов и ПЦР с использованием коамплификации при более низкой температуре денатурация (COLD-PCR).

До настоящего изобретения аллель-специфические праймеры, как правило, были лучше (обладали большей чувствительностью к мутациям) при детектировании известных мутаций одного основания, в то время как не являющиеся аллель-специфическими праймеры с аллель-специфическими блокаторами, как правило, применяются для обнаружения множества тесно сгруппированных мутаций (горячих точек) или неизвестных последовательностей с мутациями.

Аллель-специфические праймеры для ПЦР, такой как ARMS, ASB-PCR, castPCR, как правило, имеют аллель-специфический нуклеотид в самом крайнем 3'-положении праймера. В случае аллель-специфических ПЦР-праймеров используется различительная способность фермента ДНК-полимеразы к специфическому удлинению правильно спаренных оснований, но с ограничением тем, что, когда имеет место событие неправильного удлинения ДНК-полимеразой, редкий аллельный нуклеотид, который был частью праймера, становится включенным в матрицу, и впоследствии циклы амплификации становятся неспецифическими. Аллель-специфические ПЦР-праймеры являются специфическими только до первого события неправильной амплификации. Для аллель-специфического детектирования с использованием не являющихся аллель-специфическими праймеров требуется точный контроль температуры денатурации и рестрикционный анализ небольших последовательностей. Аллель-специфическое детектирование с использованием не являющихся аллель-специфическими праймеров обладает низкой чувствительность к мутациям и является более уязвимым к введенным полимеразой ошибкам.

Таким образом, необходима композиция олигонуклеотидов в качестве не являющегося аллель-специфическим праймера и аллель-специфического блокатора с увеличенной аллель-специфической амплификацией и повышенной чувствительностью к мутациям. Следовательно, разработка новых подходов, подходящих для обнаружения небольшого количества мишени в большом избытке варианта, является предпосылкой для диагностических применений. Таким образом, настоящим изобретением обеспечивается композиция олигонуклеотидов в качестве не являющегося аллель-специфическим праймера и аллель-специфического блокатора для обеспечения более точного и эффективного средства для применений в виде диагностирования заболеваний, таких как диагностирование рака и т.п.

Краткое изложение сущности изобретения

Настоящее изобретение относится к структуре перекрывания олигонуклеотида в качестве не являющегося аллель-специфическим праймера и олигонуклеотида в качестве аллель-специфического блокатора для аллель-специфической амплификации.

Настоящим изобретением обеспечивается композиция олигонуклеотидов, включающая блокатор и олигонуклеотид в качестве первого праймера. Олигонуклеотид в качестве блокатора включает первую последовательность, содержащую нейтральную по отношению к мишени подпоследовательность и блокаторную вариабельную подпоследовательность. Однако в некоторых случаях олигонуклеотид в качестве блокатора может не включать блокаторную вариабельную подпоследовательность, если детектируемая нуклеиновая кислота-мишень предназначена для обнаружения вставки. Блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах нейтральной по отношению к мишени подпоследовательностью и неразрывна с нейтральной по отношению к мишени подпоследовательностью. Олигонуклеотид в качестве первого праймера является достаточным для вызова ферментативного удлинения; в данном описании олигонуклеотид в качестве первого праймера включает вторую последовательность. Вторая последовательность перекрывается с 5'-концом нейтральной по отношению к мишени подпоследовательности на протяжении по крайней мере 5 нуклеотидов, так что вторая последовательность включает перекрывающуюся подпоследовательность и неперекрывающуюся подпоследовательность. Вторая последовательность не включает какую-либо последовательность, гомологичную блокаторной вариабельной подпоследовательности.

Настоящее изобретение, кроме того, относится к способу амплификации последовательности-мишени. Способ включает получение образца, содержащего одну или более копий первой нуклеиновой кислоты, имеющей вариант последовательности, и по крайней мере одну копию второй нуклеиновой кислоты; в данном описании вторая нуклеиновая кислота имеет последовательность-мишень. Каждая из последовательности-мишени и варианта последовательности включает гомологичную подпоследовательность и вариабельную подпоследовательность. Вариабельная подпоследовательность, кроме того, включает по крайней мере один нуклеотид. Кроме того, вариабельная подпоследовательность последовательности-мишени является мишень-специфической подпоследовательностью, а вариабельная подпоследовательность варианта последовательности не является мишень-специфической подпоследовательностью.

После получения образца олигонуклеотид в качестве блокатора вводят в образец. Олигонуклеотид в качестве блокатора включает первую последовательность, содержащую нейтральную по отношению к мишени подпоследовательность и блокаторную вариабельную подпоследовательность. Нейтральная по отношению к мишени подпоследовательность комплементарна части гомологичной подпоследовательности, а блокаторная вариабельная подпоследовательность комплементарна не являющейся мишень-специфической подпоследовательности. Кроме того, блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах нейтральной по отношению к мишени подпоследовательностью и неразрывна с нейтральной по отношению к мишени подпоследовательностью.

После этого олигонуклеотид в качестве первого праймера вводят в образец. Олигонуклеотид в качестве первого праймера является достаточным для вызова ферментативного удлинения. Олигонуклеотид в качестве первого праймера включает вторую последовательность, которая является комплементарной второй части гомологичной подпоследовательности. Кроме того, вторая последовательность перекрывается с 5'-концом нейтральной по отношению к мишени подпоследовательности на протяжении по крайней мере 5 нуклеотидов, так что вторая последовательность включает перекрывающуюся подпоследовательность и неперекрывающуюся подпоследовательность. Вторая последовательность не включает какую-либо последовательность, комплементарную вариабельной подпоследовательности.

На следующей стадии ДНК-полимеразу, нуклеозидтрифосфаты и один или более реагентов, необходимых для полимеразной амплификации нуклеиновых кислот, вводят в образец; и вызывают реакцию в образце в условиях, достаточных для достижения амплификации нуклеиновых кислот.

Преимуществом настоящего изобретения являются подходы, соответствующие аллель-специфическим праймерам и/или превышающие их, с увеличенной чувствительностью к мутациям.

Другим преимуществом настоящего изобретения является простой 2-стадийный протокол теплового цикла со значительной устойчивость к температурным отклонениям (8οС).

Еще одно преимущество настоящего изобретения заключается в обеспечении недорогих реагентов в виде ДНК-праймеров и блокаторов без сложных модификаций остовов или нуклеотидов.

Еще одним преимуществом настоящего изобретения является совместимость с высококачественными ферментами.

Еще одно преимущество настоящего изобретения заключается в том, что аллель-специфический блокатор связывается сильнее с вариантом, чем с мишенью, так что не являющийся аллель-специфическим праймер успешнее вытесняет блокаторы, связанные с мишенью, по сравнению с блокаторами, связанными с вариантом. Преимущество использования не являющихся аллель-специфическими праймеров заключается в том, что ложно амплифицированные варианты имеют следствием продукты амплификации (ампликоны), несущие вариант последовательности, а не последовательность-мишень. Таким образом, специфичность усугубляется при каждом цикле.

Это краткое изложение приводится, чтобы предварить раскрытие, представить некоторые аспекты, преимущества и новые признаки изобретения в упрощенной форме, которые дополнительно описаны ниже в подробном описании. Это краткое изложение не предназначено для определения ключевых признаков или существенных признаков заявленного предмета изобретения, а также не предназначено для использования для ограничения объема заявленного предмета изобретения.

Краткое описание чертежей

Вышеприведенное краткое изложение, а также последующее подробное описание иллюстративных вариантов осуществления, будет лучше понято при чтении вместе с прилагаемыми чертежами. С целью иллюстрации настоящего изобретения приводимые в качестве примера конструкции настоящего изобретения продемонстрированы на чертежах. Однако изобретение не ограничивается конкретными способами и средствами, описанными здесь.

На фиг. 1 продемонстрирован в схематическом виде не являющийся аллель-специфическим праймер и аллель-специфический блокатор для аллель-специфической амплификации в соответствии с настоящим изобретением.

На фиг. 2 продемонстрирована в схематическом виде термодинамическая разработка праймера и блокатора в соответствии с настоящим изобретением.

На фиг. 3 продемонстрирован в схематическом виде расчет значений ΔGο, исходя из последовательности в соответствии с настоящим изобретением. Фиг. 3 раскрывает SEQ ID NO: 1, 33, 1, 34, 2, 33, 2 и 34, соответственно, в порядке появления.

На фиг. 4 продемонстрировано в схематическом виде детектирование редкой аллели в геномной ДНК человека в соответствии с примером 1. Фиг. 4 раскрывает SEQ ID NO: 3-4, 35, 32, 36 и 32, соответственно, в порядке появления.

На фиг. 5 продемонстрирована в схематическом виде устойчивость к редким температурным отклонениям в соответствии с примером 2. Фиг. 5 раскрывает SEQ ID NO: 5-6 и 37-38, соответственно, в порядке появления.

На фиг. 6А продемонстрирована в схематическом виде увеличенная гибкость конструкции праймера в ​​соответствии с примером 3.

На фиг. 6В продемонстрированы в схематическом виде последовательности нуклеиновых кислот 4 наборов пар праймеров и блокаторов, которые амплифицируют SNP rs3789806 у человека в соответствии с примером 3. Фиг. 6B раскрывает SEQ ID NO: 5-12 и 39-40, соответственно, в порядке появления.

На фиг. 7А продемонстрировано в схематическом виде моделирования эффектов ΔGοrxn1 с фиксированным ΔΔGο=2 ккал/моль в соответствии с примером 4.

На фиг. 7В(I) продемонстрирована в схематическом виде экспериментальная проверка на rs4939827 SMAD7 в соответствии с примером 4. Фиг. 7В(I) раскрывает SEQ ID NO: 3, 13-16, 4, 17 и 35-36, соответственно, в порядке появления.

На фиг. 7В(II) продемонстрирована в схематическом виде экспериментальная проверка на rs4939827 SMAD7 в соответствии с примером 4. Фиг. 7В(II) раскрывает SEQ ID NO: 3, 18-23, 36 и 35, соответственно, в порядке появления.

На фиг. 8 продемонстрирован в схематическом виде блокатор с 3' негомологичным участком в соответствии с примером 5. Фиг. 8 раскрывает SEQ ID NO: 5, 24 и 37-38, соответственно, в порядке появления.

На фиг. 9A продемонстрировано в схематическом виде мультиплексирование с использованием зондов TaqMan® в соответствии с примером 6.

На фиг. 9B продемонстрировано в схематическом виде мультиплексирование с использованием зондов TaqMan® в соответствии с примером 6.

На фиг. 10 продемонстрированы в схематическом виде протекторы для праймера и блокатора в соответствии с примером 7.

На фиг. 11А продемонстрировано в схематическом виде детектирование делеции (rs200841330 STAG2) в соответствии с примером 8. Фиг. 11А раскрывает SEQ ID NO: 25-26 и 41-42, соответственно, в порядке появления.

На фиг. 11B продемонстрировано в схематическом виде детектирование вставки (rs200841330 STAG2) в соответствии с примером 8. Фиг. 11B раскрывает SEQ ID NO: 25, 43, 42, и 41, соответственно, в порядке появления.

На фиг. 12 продемонстрирован в схематическом виде расположенный 5ʹ блокатор в соответствии с примером 9. Фиг. 12 раскрывает SEQ ID NO: 27-28 и 44-45, соответственно, в порядке появления.

На фиг. 13 продемонстрирована в схематическом виде специфическая амплификация ДНК, кодирующей рибосомальную РНК грибов, в соответствии с примером 10.

На фиг. 14 продемонстрирована в схематическом виде Dual NASP в соответствии с примером 11. Фиг. 14 раскрывает SEQ ID NO: 29, 10, 46-49, и 30-31, соответственно, в порядке появления.

Подробное описание изобретения

Настоящее изобретение будет описано применительно к конкретным вариантам осуществления и со ссылкой на некоторые чертежи, но настоящее изобретение не ограничивается ими, а только формулой изобретения. Представленные чертежи являются только схемами и не являются ограничивающими. На чертежах, размеры некоторых элементов могут быть чрезмерно увеличены или искажены и не представлены в масштабе для иллюстративных целей. По месту элементы изобретения обозначаются как «а» или «an» при первом приведении и обозначаются как «the» или «указанные» в случае второго или последующих приведений, если что-нибудь еще не оговорено.

И вот настоящее изобретение будет подробнее описано здесь позже со ссылкой на сопровождающие чертежи, на которых продемонстрированы некоторые, но не все варианты осуществления настоящего изобретения. Действительно, настоящее изобретение может быть осуществлено во многих различных формах и не должно рассматриваться как ограниченное вариантами осуществления, изложенными здесь, скорее эти варианты осуществления предоставлены для того, чтобы это описание удовлетворяло всем юридическим требованиям.

Определение

Если не указано иное, все технические и научные термины, используемые здесь, имеют значение, одинаковое с тем, в котором они обычно понимаются специалистом со средним уровнем компетентности в данной области техники.

Используемый здесь термин «олигонуклеотид в качестве блокатора» относится к по крайней мере одной непрерывной цепи длиной от приблизительно 12 до приблизительно 100 нуклеотидов и, если это здесь указано, может, кроме того, включать функциональную группу или нуклеотидную последовательность на своем 3'-конце, которая предотвращает ферментативное удлинение во время процесса амплификации, такого как полимеразная цепная реакция.

Используемый здесь термин «олигонуклеотид в качестве праймера» относится к молекуле, включающей по крайней мере одну непрерывную цепь длиной от приблизительно 12 до приблизительно 100 нуклеотидов и достаточной для обеспечения ферментативного удлинения во время процесса амплификации, такого как полимеразная цепная реакция.

Используемый здесь термин «нейтральная по отношению к мишени подпоследовательность» относится к последовательности нуклеотидов, которая комплементарна последовательности как в нуклеиновой кислоте-мишени, так и варианта нуклеиновой кислоты. Например, желаемая последовательность нуклеиновой кислоты, которая является мишенью для амплификации (нуклеиновой кислотой-мишенью), может существовать в образце с молекулой нуклеиновой кислоты, имеющей в основном гомологичную последовательность с нуклеиновой кислотой-мишенью, за исключением вариабельного участка, (вариантом нуклеиновой кислоты), при этом такой вариабельный участок в некоторых случаях имеет отличие только в одном нуклеотиде от нуклеиновой кислоты-мишени. В этом примере нейтральная по отношению к мишени подпоследовательность является комплементарной по крайней мере части гомологичной последовательности, общей для двух нуклеиновых кислот, но не вариабельному участку. Таким образом, используемый здесь термин «блокаторная вариабельная подпоследовательность» относится к нуклеотидной последовательности олигонуклеотида в качестве блокатора, которая комплементарна вариабельному участку варианта нуклеиновой кислоты.

Используемый здесь термин «перекрывающаяся подпоследовательность» относится к нуклеотидной последовательности из по крайней мере 5 нуклеотидов олигонуклеотида в качестве праймера, которая гомологична части последовательности олигонуклеотида в качестве блокатора, используемого в композиции, описываемой здесь. Перекрывающаяся подпоследовательность олигонуклеотида в качестве праймера может быть гомологична любой части нейтральной по отношении к мишени подпоследовательности олигонуклеотида в качестве блокатора, или 5​', или 3' от блокаторной вариабельной подпоследовательности. Таким образом, термин «неперекрывающаяся подпоследовательность» относится к последовательности олигонуклеотида в качестве праймера, которая не является перекрывающейся подпоследовательностью.

Используемый здесь термин «последовательность-мишень» относится к нуклеотидной последовательности нуклеиновой кислоты, которая несет нужную аллель, такую как однонуклеотидный полиморфизм, которая должна быть амплифицирована, идентифицирована или иным образом изолирована. Используемый здесь термин «вариант последовательности» относится к нуклеотидной последовательности нуклеиновой кислоты, которая не несет нужную аллель. Например, в некоторых случаях вариант последовательности несет аллель дикого типа, тогда как последовательность-мишень несет мутантную аллель. Таким образом, в некоторых случаях вариант последовательности и последовательность-мишень происходят из общего локуса в геноме, так что каждая из последовательностей может быть по существу гомологичной за исключением участка, несущего нужную аллель, нуклеотид или группу нуклеотидов, которая отличается между двумя последовательностями.

Настоящее изобретение относится к композиции олигонуклеотидов. В одном варианте осуществления настоящего изобретения композиции олигонуклеотидов включает олигонуклеотид в качестве не являющегося аллель-специфическим праймера и олигонуклеотид в качестве аллель-специфического блокатора для аллель-специфической амплификации.

В другом варианте осуществления настоящего изобретения композиции олигонуклеотидов включает олигонуклеотид в качестве блокатора и олигонуклеотид в качестве первого праймера. Олигонуклеотид в качестве блокатора включает первую последовательность, содержащую нейтральную по отношению к мишени подпоследовательность и блокаторную вариабельную подпоследовательность. Блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах нейтральной по отношению к мишени подпоследовательностью и неразрывна с нейтральной по отношению к мишени подпоследовательностью. Другими словами, блокаторная вариабельная подпоследовательность может делить нейтральную по отношению к мишени подпоследовательность на две части, часть, находящуюся 3' от блокаторной вариабельной подпоследовательности, и часть, находящуюся 5' от нее. Олигонуклеотид в качестве первого праймера является достаточным для вызова ферментативного удлинения; в данном описании олигонуклеотид в качестве первого праймера включает вторую последовательность. Вторая последовательность перекрывается с нейтральной по отношению к мишени подпоследовательностью на протяжении по крайней мере 5 нуклеотидов, так что вторая последовательность включает перекрывающуюся подпоследовательность и неперекрывающуюся подпоследовательность. Вторая последовательность не включает блокаторную вариабельную подпоследовательность. Таким образом, олигонуклеотид в качестве праймера можно охарактеризовать как не являющийся аллель-специфическим праймер. Перекрывающийся участок может быть гомологичен части нейтральной по отношению к мишени подпоследовательности олигонуклеотида в качестве блокатора или с 5'-стороны от блокаторной вариабельной подпоследовательности, или с 3'-стороны от блокаторной вариабельной подпоследовательности. Как показано на фиг. 1, перекрывающаяся подпоследовательность олигонуклеотида в качестве праймера гомологична нейтральной по отношению к мишени подпоследовательности блокатора с 5'-стороны от блокаторной вариабельной подпоследовательности (обозначенной как «C» на блокаторе). Здесь, нейтральная по отношению к мишени подпоследовательность представляет собой части блокатора по обе стороны от блокаторной вариабельной подпоследовательности С. На фиг. 12 показан один пример, в котором перекрывающаяся подпоследовательность праймера гомологична части нейтральной по отношению к мишени подпоследовательности блокатора, которая находится 3' от блокаторной вариабельной подпоследовательности C.

В еще одном варианте осуществления настоящего изобретения, олигонуклеотид в качестве блокатора, кроме того, включает функциональную группу или некомплементарный участок последовательности на 3'-конце или вблизи него, которая предотвращает ферментативное удлинение. В одном случае функциональную группу олигонуклеотида в качестве блокатора выбирают, но без ограничения, из группы, состоящей из 3-углеродного спейсера или дидезоксинуклеотида.

Вторая последовательность создает стандартную свободную энергию гибридизации (ΔGοPT), а первая последовательность создает стандартную свободную энергию гибридизации (ΔGοBT), которая удовлетворяет следующему условию:

+2 ккал/моль≥ΔGοPT-ΔGοBT≥-8 ккал/моль

Неперекрывающаяся подпоследовательность создает стандартную свободную энергию гибридизации (ΔGο3), которая удовлетворяет следующему условию:

-4 ккал/моль≥ΔGο3≥-12 ккал/моль

В одном случае вторая последовательность перекрывается с 5'-концом нейтральной по отношению к мишени подпоследовательности на протяжении от приблизительно 5 нуклеотидов до приблизительно 40 нуклеотидов. В другом случае вторая последовательность перекрывается с 5'-концом нейтральной по отношению к мишени подпоследовательности на протяжении от приблизительно 7 нуклеотидов до приблизительно 30 нуклеотидов.

В одном случае концентрация олигонуклеотида в качестве блокатора в приблизительно 2 - приблизительно 10000 раз выше концентрации олигонуклеотида в качестве первого праймера. В другом случае концентрация олигонуклеотида в качестве блокатора в приблизительно 5 - приблизительно 1000 раз выше концентрации олигонуклеотида в качестве первого праймера.

В еще одном варианте осуществления настоящего изобретения композиция олигонуклеотидов, кроме того, включает олигонуклеотид в качестве второго праймера, достаточный для вызова ферментативного удлинения. Олигонуклеотид в качестве второго праймера включает третью последовательность, которая не перекрывается с первой последовательностью или второй последовательностью, является нейтральной по отношению к мишени и достаточной для использования с олигонуклеотидом в качестве первого праймера для амплификации участка нуклеиновой кислоты, используя полимеразную цепную реакцию.

В еще одном варианте осуществления настоящего изобретения композиция олигонуклеотидов, кроме того, включает олигонуклеотид в качестве второго блокатора. Олигонуклеотид в качестве второго блокатора включает четвертую последовательность, содержащую вторую нейтральную по отношении к мишени подпоследовательность и вторую блокаторную вариабельную подпоследовательность. Вторая блокаторная вариабельная подпоследовательность имеет ту же последовательность, что и не являющаяся мишень-специфической подпоследовательность нуклеиновой кислоты-мишени, учитывая, что она, как правило, предназначена для связывания антисмысловой последовательности мишени. Вторая блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах второй нейтральной по отношению к мишени подпоследовательностью и неразрывна со второй нейтральной по отношению к мишени подпоследовательностью. Третья последовательность перекрывается с 5'-концом второй нейтральной по отношению к мишени подпоследовательности на протяжении по крайней мере 5 нуклеотидов, так что третья последовательность включает вторую перекрывающуюся подпоследовательность и вторую неперекрывающуюся подпоследовательность.

В еще одном варианте осуществления настоящего изобретения олигонуклеотид в качестве второго блокатора, кроме того, включает вторую функциональную группу или второй некомплементарный участок последовательности на 3'-конце или вблизи него, которая предотвращает ферментативное удлинение. В одном случае вторую функциональную группу олигонуклеотида в качестве второго блокатора выбирают, но без ограничения, из группы, состоящей из 3-углеродного спейсера или дидезоксинуклеотида.

Третья последовательность создает стандартную свободную энергию гибридизации (ΔGοPT2), а четвертая последовательность создает стандартную свободную энергию гибридизации (ΔGοBT2), которая удовлетворяет следующему условию:

+2 ккал/моль≥ΔGοPT2-ΔGοBT2≥-8 ккал/моль

Вторая неперекрывающаяся подпоследовательность создает стандартную свободную энергию гибридизации (ΔGο6), которая удовлетворяет следующему условию:

-4 ккал/моль≥ΔGο6≥-12 ккал/моль

В одном случае третья последовательность перекрывается с 5'-концом второй нейтральной по отношению к мишени подпоследовательности на протяжении от приблизительно 5 нуклеотидов до приблизительно 40 нуклеотидов. В другом случае третья последовательность перекрывается с 5'-концом второй нейтральной по отношению к мишени подпоследовательности на протяжении от приблизительно 7 нуклеотидов до приблизительно 30 нуклеотидов.

В любом из вышеуказанных вариантов осуществления длина каждого из олигонуклеотида в качестве праймера и олигонуклеотида в качестве блокатора может составлять от приблизительно 12 нуклеотидов до приблизительно 100 нуклеотидов. В любом из вышеуказанных вариантов осуществления длина каждого из олигонуклеотида в качестве праймера и олигонуклеотида в качестве блокатора может составлять от приблизительно 15 нуклеотидов до приблизительно 90 нуклеотидов. В любом из вышеуказанных вариантов осуществления длина каждого из олигонуклеотида в качестве праймера и олигонуклеотида в качестве блокатора может составлять от приблизительно 20 нуклеотидов до приблизительно 80 нуклеотидов. В любом из вышеуказанных вариантов осуществления длина каждого из олигонуклеотида в качестве праймера и олигонуклеотида в качестве блокатора может составлять от приблизительно 20 нуклеотидов до приблизительно 70 нуклеотидов. В любом из вышеуказанных вариантов осуществления длина каждого из олигонуклеотида в качестве праймера и олигонуклеотида в качестве блокатора может составлять от приблизительно 20 нуклеотидов до приблизительно 60 нуклеотидов. В любом из вышеуказанных вариантов осуществления длина каждого из олигонуклеотида в качестве праймера и олигонуклеотида в качестве блокатора может составлять 21, 22, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 или 50 нуклеотидов.

В одном случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 2 - приблизительно 10000 раз выше концентрации олигонуклеотида в качестве второго праймера. В другом случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 5 - приблизительно 1000 раз выше концентрации олигонуклеотида в качестве второго праймера. В другом случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 10 - приблизительно 900 раз выше концентрации олигонуклеотида в качестве второго праймера. В другом случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 20 - приблизительно 800 раз выше концентрации олигонуклеотида в качестве второго праймера. В другом случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 30 - приблизительно 700 раз выше концентрации олигонуклеотида в качестве второго праймера. В другом случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 40 - приблизительно 600 раз выше концентрации олигонуклеотида в качестве второго праймера. В другом случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 50 - приблизительно 500 раз выше концентрации олигонуклеотида в качестве второго праймера. В другом случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 60 - приблизительно 400 раз выше концентрации олигонуклеотида в качестве второго праймера. В другом случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 70 - приблизительно 300 раз выше концентрации олигонуклеотида в качестве второго праймера. В другом случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 80 - приблизительно 200 раз выше концентрации олигонуклеотида в качестве второго праймера. В другом случае концентрация олигонуклеотида в качестве второго блокатора в приблизительно 90 - приблизительно 100 раз выше концентрации олигонуклеотида в качестве второго праймера.

В еще одном варианте осуществления настоящего изобретения композиция олигонуклеотидов, кроме того, включает реагент, необходимый для полимеразной цепной реакции.

В еще одном варианте осуществления настоящего изобретения композиция олигонуклеотидов, кроме того, включает множество нуклеозидтрифосфатов.

В еще одном варианте осуществления настоящего изобретения композиция олигонуклеотидов, кроме того, включает ДНК-полимеразу или РНК-полимеразу.

В еще одном варианте осуществления настоящего изобретения композиция олигонуклеотидов, кроме того, включает реагент, необходимый для полимеразной цепной реакции, множество нуклеозидтрифосфатов, ДНК-полимеразу.

В еще одном варианте осуществления настоящего изобретения блокаторная вариабельная подпоследовательность представляет собой один нуклеотид.

Настоящее изобретение, кроме того, относится к способу амплификации последовательности-мишени. Способ включает стадии (а) получения образца, содержащего одну или более копий первой нуклеиновой кислоты, имеющей вариант последовательности, и по крайней мере одну копию второй нуклеиновой кислоты; в данном описании вторая нуклеиновая кислота имеет последовательность-мишень. Каждая из последовательности-мишени и варианта последовательности имеет гомологичную подпоследовательность и вариабельную подпоследовательность. Вариабельная подпоследовательность, кроме того, включает по крайней мере один нуклеотид, но может включать 2-5 нуклеотидов. Кроме того, вариабельная подпоследовательность последовательности-мишени представляет собой мишень-специфическую подпоследовательность, а вариабельная подпоследовательности варианта последовательности не является мишень-специфической подпоследовательностью.

Способ, кроме того, включает стадию (b) введения олигонуклеотида в качестве блокатора в образце; в данном описании олигонуклеотид в качестве блокатора включает первую последовательность, содержащую нейтральную по отношению к мишени подпоследовательность и блокаторную вариабельную подпоследовательность. Нейтральная по отношению к мишени подпоследовательность комплементарна части гомологичной подпоследовательности, а блокаторная вариабельная подпоследовательность комплементарна не являющейся мишень-специфической подпоследовательности. Кроме того, блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах нейтральной по отношению к мишени подпоследовательностью и неразрывна с нейтральной по отношению к мишени подпоследовательностью.

Способ, кроме того, включает стадию (c) введения олигонуклеотида в качестве первого праймера в образец. Олигонуклеотид в качестве первого праймера является достаточным для вызова ферментативного удлинения. Олигонуклеотид в качестве первого праймера включает вторую последовательность. Кроме того, вторая последовательность является комплементарной второй части гомологичной подпоследовательности и может перекрываться с 5'-концом нейтральной по отношению к мишени подпоследовательности на протяжении по крайней мере 5 нуклеотидов, так что вторая последовательность включает перекрывающуюся подпоследовательность и неперекрывающуюся подпоследовательность. Вторая последовательность не включает какую-либо последовательность, комплементарную вариабельной подпоследовательности.

Способ, кроме того, включает стадию (d) введения в образец ДНК-полимеразы, нуклеозидтрифосфатов и одного или более реагентов, необходимых для полимеразной амплификации нуклеиновых кислот; и затем (е) вызова реакции в образце в условиях, достаточных для достижения амплификации нуклеиновых кислот.

В одном варианте осуществления настоящего изобретения олигонуклеотид в качестве блокатора, кроме того, включает функциональную группу или некомплементарный участок последовательности на 3'-конце или вблизи него, которая предотвращает ферментативное удлинение. В одном случае функциональную группу выбирают, но без ограничения, из группы, состоящей из 3-углеродного спейсера или дидезоксинуклеотида.

Вторая последовательность создает стандартную свободную энергию гибридизации (ΔGοPT), а первая последовательность создает стандартную свободную энергию гибридизации (ΔGοBT), которая удовлетворяет следующему условию:

+2 ккал/моль≥ΔGοPT-ΔGοBT≥-8 ккал/моль

Неперекрывающаяся подпоследовательность создает стандартную свободную энергию гибридизации (ΔGο3), которая удовлетворяет следующему условию:

-4 ккал/моль≥ΔGο3≥-12 ккал/моль

В одном случае вторая последовательность перекрывается с 5'-концом нейтральной по отношению к мишени подпоследовательности блокатора на протяжении от приблизительно 5 нуклеотидов до приблизительно 40 нуклеотидов (т.е. является «перекрывающейся подпоследовательностью»). Другими словами, вторая последовательность включает перекрывающуюся подпоследовательность, которая является гомологичной 5 нуклеотидам - приблизительно 40 нуклеотидам нейтральной по отношению к мишени подпоследовательности блокатора, которая находится с 5'-стороны от блокаторной вариабельной подпоследовательности блокатора. В другом случае вторая последовательность перекрывается с 5'-концом нейтральной по отношению к мишени подпоследовательности на протяжении от приблизительно 7 нуклеотидов до приблизительно 30 нуклеотидов. В еще одном случае вторая последовательность включает перекрывающуюся подпоследовательность, которая является гомологичной части нейтральной по отношению к мишени подпоследовательности блокатора, которая находится с 3'-стороны от блокаторной вариабельной подпоследовательности блокатора.

В одном случае концентрация олигонуклеотида в качестве блокатора, вводимого в образец, в приблизительно 2 - приблизительно 10000 раз выше концентрации олигонуклеотида в качестве первого праймера, вводимого в образец. В другом случае концентрация олигонуклеотида в качестве блокатора, вводимого в образец, в приблизительно 5 - приблизительно 1000 раз выше концентрации олигонуклеотида в качестве первого праймера, вводимого в образец. В другом случае концентрация олигонуклеотида в качестве блокатора, вводимого в образец, в приблизительно 10 - приблизительно 500 раз выше концентрации олигонуклеотида в качестве первого праймера, вводимого в образец. В другом случае концентрация олигонуклеотида в качестве блокатора, вводимого в образец, в приблизительно 20 - приблизительно 250 раз выше концентрации олигонуклеотида в качестве первого праймера, вводимого в образец. В другом случае концентрация олигонуклеотида в качестве блокатора, вводимого в образец, в приблизительно 40 - приблизительно 125 раз выше концентрации олигонуклеотида в качестве первого праймера, вводимого в образец. В другом случае концентрация олигонуклеотида в качестве блокатора, вводимого в образец, в приблизительно 50 - приблизительно 100 раз выше концентрации олигонуклеотида в качестве первого праймера, вводимого в образец. В другом случае концентрация олигонуклеотида в качестве блокатора, вводимого в образец, в приблизительно 300 - приблизительно 400 раз выше концентрации олигонуклеотида в качестве первого праймера, вводимого в образец. В другом случае концентрация олигонуклеотида в качестве блокатора, вводимого в образец, в приблизительно 500 - приблизительно 600 раз выше концентрации олигонуклеотида в качестве первого праймера, вводимого в образец.

В другом варианте осуществления настоящего изобретения ДНК-полимераза является термостабильной ДНК-полимеразой.

В еще одном варианте осуществления настоящего изобретения, способ, кроме того, включает условия, достаточные для достижения амплификации нуклеиновых кислот путем подвергания образца по крайней мере 10 циклам. В каждом цикле осуществляются по крайней мере 2 различных температурных воздействия, одно воздействие температуры, составляющей по крайней мере 85οС, и одно воздействие температуры, составляющей не более 75οС.

В еще одном варианте осуществления настоящего изобретения способ, кроме того, включает стадию введения в образец фермента, выбираемого из группы, состоящей из делающего одноцепочечный разрыв фермента, рекомбиназы, геликазы, РНКазы, обратной транскриптазы или любой их комбинации.

В еще одном варианте осуществления настоящего изобретения способ, кроме того, включает стадию введения олигонуклеотида в качестве второго праймера в образец. Олигонуклеотид в качестве второго праймера включает третью последовательность. Кроме того, третья последовательность не перекрывается с вариабельной подпоследовательностью. Кроме того, третья последовательность является нейтральной по отношению к мишени и достаточной для использования с олигонуклеотидом в качестве первого праймера для амплификации участка нуклеиновой кислоты, содержащего последовательность-мишень.

В еще одном варианте осуществления настоящего изобретения способ, кроме того, включает стадию введения олигонуклеотида в качестве второго блокатора в образец. Олигонуклеотид в качестве второго блокатора включает четвертую последовательность; в данном описании четвертая последовательность содержит вторую нейтральную по отношению к мишени подпоследовательность и вторую блокаторную вариабельную подпоследовательность. Кроме того, вторая блокаторная вариабельная подпоследовательность является последовательностью, комплементарной блокаторной вариабельной подпоследовательности. Кроме того, вторая блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах второй нейтральной по отношению к мишени подпоследовательностью и неразрывна со второй нейтральной по отношению к мишени подпоследовательностью. Кроме того, третья последовательность перекрывается с 5'-концом второй нейтральной по отношению к мишени подпоследовательности на протяжении по крайней мере 5 нуклеотидов, так что третья последовательность включает вторую перекрывающуюся подпоследовательность и вторую неперекрывающуюся подпоследовательность.

В еще одном варианте осуществления настоящего изобретения олигонуклеотид в качестве второго блокатора, кроме того, включает вторую функциональную группу или второй некомплементарный участок последовательности на 3'-конце или вблизи него, которая предотвращает ферментативное удлинение. В одном случае вторую функциональную группу выбирают, но без ограничения, из группы, состоящей из 3-углеродного спейсера или дидезоксинуклеотида.

Третья последовательность создает стандартную свободную энергию гибридизации (ΔGοPT2), а четвертая последовательность создает стандартную свободную энергию гибридизации (ΔGοBT2), которая удовлетворяет следующему условию:

+2 ккал/моль≥ΔGοPT2-ΔGοBT2≥-8 ккал/моль

Вторая неперекрывающаяся подпоследовательность создает стандартную свободную энергию гибридизации (ΔGο6), которая удовлетворяет следующему условию:

-4 ккал/моль≥ΔGο6≥-12 ккал/моль

В одном случае третья последовательность перекрывается с 5'-концом второй нейтральной по отношению к мишени подпоследовательности на протяжении от приблизительно 5 нуклеотидов до приблизительно 40 нуклеотидов. В другом случае третья последовательность перекрывается с 5'-концом второй нейтральной по отношению к мишени подпоследовательности на протяжении от приблизительно 7 нуклеотидов до приблизительно 30 нуклеотидов.

В одном случае концентрация олигонуклеотида в качестве второго блокатора, вводимого в образец, в приблизительно 2 - приблизительно 10000 раз выше концентрации олигонуклеотида в качестве второго праймера, вводимого в образец. В другом случае концентрация олигонуклеотида в качестве второго блокатора, вводимого в образец, в приблизительно 5 - приблизительно 1000 раз выше концентрации олигонуклеотида в качестве второго праймера, вводимого в образец.

В еще одном варианте осуществления настоящего изобретения способ амплификации последовательности-мишени, кроме того, включает стадию извлечения аликвоты из образца и повторения стадий с (b) по (e) включительно, определенных выше.

На фиг. 1 продемонстрирован в схематическом виде не являющийся аллель-специфическим праймер и аллель-специфический блокатор для аллель-специфической амплификации. Смесь реагентов в виде нуклеиновых кислот включает два вида олигонуклеотидов, праймер (олигонуклеотид в качестве праймера) и вариант специфического блокатора (олигонуклеотид в качестве блокатора), которые действуют вместе для обеспечения надежной амплификации разведенной мишени в сочетании с методом полимеразной амплификации. Блокатор может быть модифицирован на 3'-конце в результате неудлиняемой модификации, такой как дидезоксинуклеотид или 3-углеродный линкер. Последовательности праймера и блокатора сконструированы рационально на основе термодинамики их гибридизации с последовательностью нуклеиновой кислоты-мишенью и вариантом последовательности нуклеиновой кислоты. В некоторых вариантах осуществления блокатор присутствует в значительно большей концентрации, чем праймер, так что подавляющее большинство мишени и варианты последовательностей нуклеиновых кислот связываются с блокатором до связывания с праймером. Праймер связывается временно с молекулами блокатор-мишень или блокатор-вариант и обладает возможностью вытеснения блокатора при связывании с мишенью или вариантом. Поскольку последовательность блокатора является специфической в отношении варианта мишени, его вытеснение с варианта является менее термодинамически выгодным, чем его вытеснение с мишени. Соответственно, не являющийся аллель-специфическим праймер амплифицирует последовательность-мишень с более высоким выходом/эффективностью, чем он амплифицирует вариант последовательности. Не являющаяся аллель-специфической природа праймера означает, что ложно амплифицированный вариант последовательности несет вариант аллели, а не аллель-мишень, так что последующие циклы амплификации также демонстрируют смещение амплификации в пользу мишени.

Высокая концентрация вариант-специфического блокатора приводит к более высокой вероятности сначала связывания блокатора как с мишенью, так и вариантом, до того, как праймер имеет возможность связываться. Праймер инициирует связывание, и с комплексом мишень-блокатор, и с комплексом вариант-блокатор, с помощью уникального участка, не перекрывающегося с блокатором, и впоследствии, возможно, вытесняет блокатор посредством процесса замещения цепи без участия фермента.

На фиг. 2 продемонстрирована в схематическом виде термодинамическая разработка праймера и блокатора. Последовательности праймера и блокатора рационально сконструированы для достижения желательной термодинамики реакций. Здесь, праймер, блокатор, мишень и варианты последовательностей нуклеиновых кислот подразделены на участки, включающие следующие друг за другом нуклеотиды, обозначенные цифрами с 1 по 8 включительно на фиг. 2. Стандартная свободная энергия гибридизации между праймером и мишенью (ΔGοPT) и стандартная свободная энергия гибридизации между блокаторм и мишенью (ΔGοBT) удовлетворяют условию:

+2 ккал/моль≥ΔGοPT-ΔGοBT≥-8 ккал/моль

Системы, включающие праймер и блокатор, которые удовлетворяют вышеуказанному неравенству, порождают большое различие в выходах реакции гибридизации между праймером, связываемым с мишенью, и праймером, связываемым с вариантом, в каждом цикле, что приводит к мишень-специфической амплификации.

Процесс замещения цепи без участия фермента опирается на относительную термодинамику связывания праймера по сравнению со связыванием блокатора. Блокатор гибридизуется активнее с вариантом (со стандартной свободной энергией связывания ΔGοBV), чем с мишенью (со стандартной свободной энергии связывания ΔGοBT, ΔGοBT>ΔGοBV, так как более отрицательное значение ΔGο указывает на большую активность). В другом варианте осуществления настоящего изобретения праймер гибридизуется в равной степени активно с вариантом (со стандартной свободной энергии связывания ΔGοPV), как и с мишенью (со стандартной свободной энергией связывания ΔGοPT, ΔGοPV=ΔGοPT).

Реакция вытеснения праймером блокатора при связывании с мишенью, BT+P⌠PT+B, имеет стандартную свободную энергию ΔGοrxn1=ΔGοPT-ΔGοBT, которая является более отрицательной (более выгодной), чем таковая реакции вытеснения праймером блокатора при связывании с вариантом, BV+P⌠PV+B, которая имеет стандартную свободную энергию ΔGοrxn2=ΔGοPV-ΔGοBV. Для хорошей работы настоящего изобретения, праймер и блокатор обычно должны быть сконструированы так, чтобы ΔGοrxn1≤0 и ΔGοrxn2≥0. Однако, поскольку относительные концентрации блокатора и праймера могут влиять на равновесное распределение и эффективную термодинамику реакции, рекомендации, касающиеся ΔGοrxn1 и ΔGοrxn2, не являются абсолютными.

На фиг. 3 продемонстрирован в схематическом виде расчет значений ΔGο, исходя из последовательности. Существуют различные соглашения в отношении расчета ΔGο взаимодействий различных участков; на фиг. 3 продемонстрированы примерные расчеты энергии, основанные на модели ближайших соседей. Термины ΔGο1-5, ΔGο4-7 и ΔGο4-8, кроме того, включают стандартную свободную энергию инициации гибридизации (ΔGοinit), а также дополнительный стэкинг, соседствующий с шестым участком. Стандартные свободные энергии, ΔGο, рассчитанные с использованием других методов, могут привести к тем же значениям ΔGοPT, ΔGοPV, ΔGοBT и ΔGοBV, хотя термодинамика отдельных участков (например, ΔGο3-6) может отличаться. Иллюстративные примеры предназначены для демонстрации метода расчета ΔGο, используемого в настоящем изобретении, и, как предполагается, не указывают на последовательности для анализа; перечисленные последовательности могут быть слишком короткими, чтобы стабильно связываться. Расчет ΔGοPT, ΔGοPV, ΔGοBT и ΔGοBV, исходя из последовательности праймера, последовательности блокатора, последовательности-мишени, варианта последовательности, рабочей температуры и рабочих буферных условий, известны специалистам в данной области техники.

На фиг. 4 продемонстрирован зонд и конструкция блокатора настоящего изобретения и подпоследовательности вокруг локуса гена SMAD7 из двух человеческих депонированных образцов NA18537 и NA18562. Конструкция набора праймер/блокатор разработана для специфической амплификации А-варианта однонуклеотидного полиморфизма (SNP) SMAD7. Блокатор в соответствии с замыслом полностью комплементарен варианту матрицы, несущему G-вариант SNP SMAD7, и функционализован на 3'-конце с помощью 3-углеродного линкера (С3), который предотвращает ферментативное удлинение с помощью ДНК-полимеразы Taq. Обратный праймер связывается с последовательность, находящейся 3' от прямого праймера, и не является специфическим для той или другой аллели. Для объяснения терминологии, используемой для описания различных подпоследовательностей праймера и блокатора, олигонуклеотиды могут быть описаны следующим образом. Олигонуклеотид в качестве блокатора включает нейтральную по отношению к мишени подпоследовательность, которая включает последовательность, находящуюся 5' и 3' от цитозинового нуклеотида, который представлен вне совмещения с остальной частью последовательности - цитозиновый нуклеотида в этом случае представляет собой блокаторную вариабельную подпоследовательность блокатора. Перекрывающаяся подпоследовательность олигонуклеотида в качестве праймера включает последовательность, которая является гомологичной последовательности блокатора с 5'-стороны от блокаторной вариабельной подпоследовательности (цитозина).

На фиг. 5 продемонстрирована эффективность пары праймер-блокатор, мишенью которой является SNP rs3789806 (C/G) C-аллель у человека, при температуре отжига/удлинения в диапазоне от 56οC до 66οC.

На фиг. 6A и фиг. 6B представлены конструкции праймеров с большим проектным полем во избежание нежелательных взаимодействий.

На фиг. 7A и фиг. 7В продемонстрировано управления поведением аллель-специфической ПЦР с помощью расчета ΔGοrxn1. Моделирование, представленное на фиг. 7A, позволяют предположить, что, когда праймер и блокатор сконструированы так, что ΔGοrxn1 является более положительной, значения ΔCq больше. Однако при более положительных значениях ΔGοrxn1 амплификация мишени также замедляется, что приводит к большему значению Cq. Моделирование предполагает фиксированное значение ΔΔGο=2 ккал/моль. Верхние подграфы показывают предсказываемые эффекты различных значений ΔGοrxn1 (звездочки) и ΔGοrxn2 (точки) на выходы реакции гибридизации. Нижние подграфы показывают кривую смоделированной амплификации мишени и варианта для каждой пары праймера и блокатора. Во всех представленных случаях отношение концентраций блокатора к праймеру составляет 20:1. На фиг. 7В(I) и фиг. 7В(II) представлены экспериментальные результаты эффектов ΔGοrxn1 на избирательность амплификации. Различные значения ΔGοrxn1 были достигнуты посредством удлинения или укорочения 3ʹ-конца блокиратора. Как и следовало ожидать, более положительное значение ΔGοrxn1 приводит к большему значению Cq и для мишени, и для варианта. Авторы настоящего изобретения отмечали оптимальную промежуточную ΔGοrxn1, приводящую к наибольшему значению ΔCq и относительно небольшому отставанию Cq (Cq<28) для мишени. В отличие от моделирования, ΔCq не увеличивалась монотонно с ΔGοrxn1. Образование димеров праймера и неспецифическая амплификация порождает предельный уровень Cq.

Кинетическое моделирование процесса ПЦР представлено следующим образом:

Tfn+1=Tfn+Pn•[Pn/(Pn+Bn)+Y(ΔG°rxn1)•Bn/(Pn+Bn)]•Trn

Trn+1=Trn+Rn•Tfn

Vfn+1=Vfn+Pn•[Pn/(Pn+Bn)+Y(ΔG°rxn2)•Bn/(Pn+Bn)]•Vrn

Vrn+1=Vrn+Rn•Vfn

где Tfn представляет собой нормализованную концентрацию прямой цепи мишени в цикле n, Trn представляет собой нормализованную концентрацию обратной цепи мишени в цикле n, Vfn представляет собой нормализованную концентрацию прямой цепи варианта в цикле n, Vrn представляет собой нормализованную концентрацию обратной цепи варианта в цикле n, Pn представляет собой нормализованную концентрацию прямого праймера в цикле n, Bn представляет собой нормализованную концентрацию блокатора в цикле n, Rn представляет собой нормализованную концентрацию обратного праймера в цикле n, и Y (ΔGο) является выходом реакции гибридизация в реакции замещения с учетом стандартной свободной энергии реакции ΔGο. Результаты моделирования представлены на фиг. 7А.

На фиг. 8 продемонстрирован блокатор с негомологичной последовательности на 3'-конце, а не с неудлиняемой химической функционализацией. Поскольку негомологичные последовательности не связываются с 3'-участком ни мишени, ни варианта, негомологичный участок эффективно предотвращает ферментативное удлинение. Значения Cq и ΔCq для мишени схожи с теми, которые приведены в примере 1, что указывает на то, что, как и функциональные группы, такие как 3-углеводный спейсер или дидезоксинуклеотид, негомологичная последовательность на 3'-конце может эффективно предотвращать ферментативное удлинение. Здесь fP, rP и B представляют собой прямой праймер, обратный праймер и блокатор (для прямого праймера), соответственно.

При стандартной блокировке ПЦР, только прямой праймер настроен на амплификацию последовательности-мишени; обратный праймер амплифируют как мишень, так и вариант примерно равно. Специфичность амплификацию может быть дополнительно увеличена (примерно с квадратичным увеличением чувствительности к мутациям), если как прямой, так и обратный праймеры были настроены на амплификацию только последовательности-мишени. Для достижения двойной мишень-специфической амплификации, прямой и обратный праймеры в соответствии с замыслом должны быть разделены небольшим расстоянием, так что они перекрываются с вариант-специфическим блокатором. В пределе, праймер-связывающие участки разделены одним нуклеотидом, наименование которого отличается между мишенью и вариантом. Прямой и обратный вариант-специфические блокаторы частично комплементарны друг друга, поскольку они связываются с комплементарными цепями мишени, и оба охватывают участок вариации. Блокаторы сконструированы так, что, несмотря на их частичную комплементарность, в условиях эксплуатации, большинство молекул блокатора не гибридизуются друг с другом.

На каждой из фиг. 9А и фиг. 9В показано, что системы праймер-блокатор, разработанные для SNP BRAF rs3789806 и IL23R RS 1884444 человека, были мультиплексированы в одной и той же реакции. Зонды TaqMan®, направленные на соответствующую последовательность, находящуюся 3ʹ от участков связывания блокатора, были разработаны и использованы в качестве механизма считывания.

На фиг. 10 показано, что неспецифическое связывание праймера или блокатора с другими праймерами, блокаторами или матрицами, приводит к неспецифической амплификации. Нижняя панель представляет конструкцию протектора, который подавляет неспецифическое связывание праймера и блокатора. Олигонуклеотиды в качестве протекторов являются частично комплементарными последовательностям праймера и блокатора. Присутствие стехиометрического избытка протекторов имеет следствием то, что как праймер, так и блокатор являются частично двухцепочечными. Блокатор имеет новый участок 11, последовательность которого не является комплементарной участку 5 в последовательности нуклеиновой кислоты, а протектор имеет новый участок 10, последовательность которого является комплементарной участку 11.

На каждой из фиг. 11А и фиг. 11В показаны конструкции праймера и блокатора для детектирования делеции и вставки. Праймер не является мишень-специфическим, этот метод может также использоваться для детектирования делеции или вставки с неопределенным числом оснований или неопределенным положением.

На фиг. 12 продемонстрировано худшее осуществление настоящего изобретения путем размещения праймера 3' от положения SNP, а блокатора 5' от праймера. Это осуществление создает специфичность гибридизации только в первом цикле, поэтому ΔCq меньше, чем в случае предпочтительной конструкции.

На фиг. 13 продемонстрирована избирательная амплификация подпоследовательностей 18S ДНК грибов из 3 патогенных видов грибов в большом избытке гомологичной ДНК человека. Поскольку подпоследовательности 18S грибов и гомологичная им человеческая подпоследовательность различаются по множеству участков, авторы настоящего изобретения разработали соответствующие виды блокатора как для прямого праймера, так и обратного праймера для максимизации специфичности амплификации.

На фиг. 14 представлено использование мишень-специфической амплификации как для прямого, так и для обратного праймера, используя два набора блокаторов, специфических для варианта аллели, по одному для каждого праймера. Блокаторы частично комплементарны друг другу, но в условиях эксплуатации преимущественно не гибридизуются друг с другом. Блокаторы и праймеры сконструированы так, что прямой праймер не может удлиняться от обратного блокатора, а обратный праймер не может удлиняться от прямого блокатора. На фиг. 14 представлены предварительные экспериментальные результаты.

Комбинации праймера и блокатора могут быть применены к другим анализам ферментативной амплификации нуклеиновых кислот, в том числе, но без ограничения, реакции амплификации с использованием делающего одноцепочечные разрывы фермента (NEAR), петлевой изотермической амплификации (LAMP) и амплификации по типу катящегося кольца (RCA).

Настоящее изобретение особенно подходит для обнаружения небольшого количества мишени в большом избытке варианта. Для применений в виде диагностики рака настоящего изобретения вариант может относиться к последовательности ДНК дикого типа, а мишень может относиться к раковой последовательности ДНК. Для применений в виде диагностики инфекционных заболеваний настоящего изобретения вариант может относиться к последовательности ДНК патогена, а мишень может относиться к гомологичной последовательности ДНК человека.

Примеры

Пример 1

На фиг. 4 представлен пример 1 настоящего изобретения для зонда и конструкции блокатора и подпоследовательностей вокруг локуса гена SMAD7 из двух человеческих депонированных образцов NA18537 и NA18562. Однонуклеотидные полиморфизмы (SNP) rs4939827 (C/T) в локусе гена SMAD7 у здоровых людей были выбраны для проверок обоснованности концепции. T-аллель в качестве мишени и С-аллель в качестве варианта были произвольно определены. Образцы депонированной геномной ДНК человека NA18562 (гомозиготной по С-аллели) и NA18537 (гомозиготной по Т-аллели) были приобретены у Coriell®, и соответствующие нуклеотидные последовательности были получены с веб-сайта 1000 Genomes. Для предотвращения нежелательной полимеризации, блокатор был модифицирован с помощью С3 спейсера на 3'-конце. Экспериментальные результаты количественной ПЦР (кПЦР) отличили 0,1% мишень (99,9% вариант) от 0% мишени (100% варианта). Содержащий 0,1% мишени образец был приготовлен путем смешивания 0,1% NA18537 с 99,9% NA18562. Средняя разница в количественной оценке цикла (ΔCq) между 100% вариантом и 100% мишенью составляла 14,8, а между 100% вариантом (обозначенным как «WT» на графике) и 0,1% мишенью составляла 4,2. Все эксперименты проводились в 96-луночном планшете в устройстве для кПЦР Bio-Rad CFX96™. В каждой лунке, 200 нМ праймера, 2 мкМ блокатора и 20 нг геномной ДНК человека смешивали в Bio-Rad iTaq™ SYBR® Green Supermix. После процесса инициации в течение 3 мин при 95οС выполняли 65 циклов, каждый состоящий из стадии денатурации при 95οС в течение 10 секунд и стадии отжига/удлинения при 60οС в течение 30 секунд. В примерах экспериментов, продемонстрированных на фиг. 5-12, использовали аналогичный протокол.

Таблица 1

Ген SNP Блокатор Цифры Cq
NA18537 NA18562 ΔCq
BRAF rs3789806
G или C
- 23,2 23,4 0,2
C 38,5 25,3 13,2
G 30,1 42,7 12,6
EGF rs11568849
C или A
- 22,5 22,3 0,2
A 34,7 26,3 8,4
C 24,7 39,33 14,6
IL23R rs1884444
G или T
- 22,2 22,4 0,2
T 36,1 24 12,1
G 28,3 35,4 7,1
ALK rs2246745
A или T
- 22,6 22,3 0,3
A 23,2 33 9,8
T 33,2 24,1 9,1

В таблице 1 приведены результаты аллель-специфических амплификаций для четырех наборов пар SNP в образцах геномной ДНК человека NA18562 и NA18537, взятых из базы данных 1000 Genomes. Для каждой пары SNP, конструкции праймера и блокатора для каждого варианта аллели были разработаны и испытаны. Наименования оснований, указанные в колонке «Блокатор», указывают на аллель, которая подавлялась (вариант), а «-» означает, что не добавляли блокатор. Во всех случаях отмечали большие значения ΔCq между двумя аллелями, в диапазоне от 7,1 до 14,6. Все эксперименты проводились в трех повторах, используя 400 нМ каждого праймера и 4 мкМ блокатора в Bio-Rad iTaq™ SYBR® Green Supermix. Эффективность термодинамически управляемых конструкций без какой-либо эмпирической оптимизации последовательностей праймеров и блокаторов или экспериментальных условий продемонстрирована с помощью результатов.

Пример 2

На фиг. 5 представлен пример 2 настоящего изобретения для эффективности пары праймер-блокатор, мишенью которой является SNP rs3789806(C/G) C-аллель у человека, при температуре отжига/удлинения в диапазоне от 56οC до 66οC. Пример 2 продемонстрировал хорошую аллель-специфическую амплификацию от 56οC до 66οC и указал на устойчивость к температурным отклонениям, составляющим по крайней мере 8οC. Использовали 400 нМ каждого праймера и 4 мкМ блокатора, а другие экспериментальные условия, отличные от температуры отжига/удлинения, были такими же, как описано в примере 1.

Пример 3

На фиг. 6A и фиг. 6B представлен пример 3 настоящего изобретения. Конструкции праймеров, продемонстрированные в настоящем изобретении, обеспечивали большее проектное поле во избежание нежелательных взаимодействий. Последовательности нуклеиновых кислот из четырех наборов пар праймеров и блокаторов, каждая из которых специфически амплифицирует SNP rs3789806 C-аллель у человека, продемонстрировали ΔCq>11. Использовали 400 нМ каждого праймера и 4 мкМ блокатора, а другие экспериментальные условия были такими же, как описано в примере 1.

Пример 4

На фиг. 7А, фиг. 7В(I) и фиг. 7В(II), представлен пример 4 настоящего изобретения для управления поведением аллель-специфической ПЦР с помощью расчета ΔGοrxn1. Моделирование, представленное на фиг. 7A, позволило предположить, что, когда праймер и блокатор сконструированы так, что ΔGοrxn1 была более положительной, значения ΔCq были больше. Однако при более положительных значениях ΔGοrxn1 амплификация мишени также замедлялась и приводила к большему значению Cq. Моделирование допускалось при фиксированном значении ΔΔGο=2 ккал/моль. Верхние подграфы предсказывали эффекты различных значений ΔGοrxn1 (звездочки) и ΔGοrxn2 (точки) на выходы реакции гибридизации. Нижние подграфы предсказывали кривую смоделированной амплификации мишени и варианта для каждой пары праймера и блокатора. Во всех представленных случаях отношение концентраций блокатора к праймеру составляло 20:1. На фиг. 7В(I) и фиг. 7В(II) представлены экспериментальные результаты эффектов ΔGοrxn1 на избирательность амплификации. Различные значения ΔGοrxn1 были достигнуты посредством удлинения или укорочения 3ʹ-конца блокиратора. Как и следовало ожидать, более положительное значение ΔGοrxn1 приводило к большему значению Cq и для мишени, и для варианта. Оптимальная промежуточная ΔGοrxn1 приводила к наибольшему значению ΔCq и относительно небольшому отставанию Cq (Cq<28) для мишени. В отличие от моделирования, ΔCq не увеличивалась монотонно с ΔGοrxn1, поскольку образование димеров праймера и неспецифическую амплификацию порождал предельный уровень Cq. Использовали 200 нМ каждого праймера и 2 мкМ блокатора, а другие экспериментальные условия были такими же, как описано в примере 1.

Пример 5

На фиг. 8 представлен пример 5 настоящего изобретения для блокатора с негомологичной последовательности на 3'-конце, а не с неудлиняемой химической функционализацией. Поскольку негомологичные последовательности не связываются с 3'-участком ни мишени, ни варианта, негомологичный участок эффективно предотвращает ферментативное удлинение. Использовали 400 нМ каждого праймера и 4 мкМ блокатора, а другие экспериментальные условия были такими же, как описано в примере 1. Значения Cq и ΔCq были схожи с теми, которые продемонстрированы на фиг. 4, что указывает на то, что, как и функциональные группы, такие как 3- углеводный спейсер или дидезоксинуклеотид, негомологичная последовательность на 3'-конце эффективно предотвращает ферментативное удлинение. На фиг. 8, fP, rP и B представляют собой прямой праймер, обратный праймер и блокатор (для прямого праймера), соответственно.

Пример 6

На фиг. 9А и фиг. 9B представлен пример 6 настоящего изобретения. Для осуществления ПЦР в режиме реального времени с использованием не являющегося аллель-специфическим праймера и аллель-специфического блокатора настоящего изобретения, также был необходим обратный праймер, который не был аллель-специфическим. SYBR® Green Supermix и TaqMan® использовались в экспериментах, и результаты существенно не отличались между ними. Системы праймер-блокатор, разработанные для SNP BRAF rs3789806 и IL23R RS 1884444 человека, были мультиплексированы в одной и той же реакции. Зонды TaqMan®, направленные на соответствующую последовательность, находящуюся 3ʹ от участков связывания блокатора, были разработаны и использованы в качестве механизма считывания. Зонд TaqMan® для ампликонов BRAF rs3789806 был модифицирован с помощью флуорофора FAM, гасителя Iowa Black FQ и внутреннего гасителя ZEN, а зонд TaqMan® для ампликонов IL23R rs884444 был модифицирован с помощью флуорофора Cy5 и гасителя Iowa Black RQ. На фиг. 9А показаны результаты амплификации - мультиплексированного детектирования BRAF rs3789806 G-аллели и IL23R RSL 884444 Т-аллели. Наименования оснований указывали на то, какую аллель подавляют блокаторы (вариант). На фиг. 9В продемонстрировано мультиплексированное детектирование BRAF rs3789806 C-аллели и IL23R RSL 884444 G-аллели. В каждом эксперименте, образец геномной ДНК смешивали с 400 нМ каждого праймера, 4 мкМ каждого блокатора и 200 нМ каждого зонда TaqMan® в Bio-Rad iQ Supermix. Протокол кПЦР был таким же, как указано в примере 1.

Пример 7

На фиг. 10 представлен пример 7 настоящего изобретения для неспецифического связывания праймера или блокаторов с другими праймерами, блокаторами или матрицами. Пример 7 привел к неспецифической амплификации. Нижняя панель представила конструкцию протектора, который подавляет неспецифическое связывание праймера и блокатора. Блокатор имел новый участок 11, последовательность которого не была комплементарной участку 5 в последовательности нуклеиновой кислоты, а протектор имел новый участок 10, последовательность которого была комплементарной участку 11.

Пример 8

На фиг. 11A и фиг. 11В представлен пример 8 настоящего изобретения для конструкций праймера и блокатора для детектирования делеции и вставки. Del rs200841330 использовали для демонстрации результатов проверки обоснованности концепции. Использовали 400 нМ каждого праймера и 4 мкМ блокатора, а другие экспериментальные условия были такими же, как описано в примере 1. Поскольку праймер не является мишень-специфическим, этот метод может также использоваться для детектирования делеции или вставки с неопределенным числом оснований или неопределенным положением.

Пример 9

На фиг. 12 представлен пример 9 настоящего изобретения при размещении праймера 3' от положения SNP, а блокатора 5' от праймера. Пример 9 создавал специфичность гибридизации только в первом цикле, поэтому ΔCq была меньше, чем в случае предпочтительной конструкции. Концентрация праймера составляла 400 нМ, а концентрация блокатора составляла 4 мкМ. Экспериментальные условия были такими же, как указано в примере 1.

Пример 10

На фиг. 13 представлен пример 10 настоящего изобретения для избирательной амплификации подпоследовательностей 18S ДНК грибов из 3 патогенных видов грибов в большом избытке гомологичной ДНК человека. Поскольку подпоследовательности 18S грибов и гомологичная им человеческая подпоследовательность различаются по множеству участков, были разработаны соответствующие виды блокатора как для прямого праймера, так и обратного праймера для максимизации специфичности амплификации. Фрагменты gBlock (проверенная в отношении последовательности двухцепочечная ДНК размером 400 п.о., IDT) из подпоследовательностей 18S из 3-х видов грибов и консенсусная последовательность для человека использовались в экспериментах. 60000 копий (0,1%), 60 копий (0,0001%) и 0 копий (100% человеческие) каждого фрагмента gBlock ДНК гриба смешивали по отдельности с 60000000 копиями ДНК человека. Во всех случаях были обнаружены редкие последовательности вплоть до 1 части в 1 миллион. Использовали 200 нМ каждого праймера и 1 мкМ каждого блокатора, а другие экспериментальные условия были такими же, как указано в примере 1.

Пример 11

На фиг. 14 представлен пример 11 настоящего изобретения. На фиг. 14 представлено использование аллель-специфической амплификации как для прямого, так и для обратного праймера; использовались два набора блокаторов, специфических для варианта аллели, по одному для каждого праймера. Блокаторы были частично комплементарны друг другу, но в условиях эксплуатации преимущественно не поддерживали гибридизацию друг с другом. Блокаторы и праймеры были сконструированы так, что прямой праймер не может удлиняться от обратного блокатора, а обратный праймер не может удлиняться от прямого блокатора. На фиг. 14 представлены предварительные экспериментальные результаты.

Вышеизложенное описание конкретных вариантов осуществления настоящего изобретения было представлено с целью иллюстрации и описания. Приводимый в качестве примера вариант осуществления был выбран и описан для наилучшего объяснения принципов изобретения и его практического применения, чтобы тем самым дать возможность другим специалистам в данной области техники наилучшим образом использовать изобретение, и различные варианты осуществления с различными модификациями подходят для конкретного предполагаемого применения.

1. Композиция олигонуклеотидов для амплификации последовательности-мишени, включающая

олигонуклеотид в качестве блокатора, включающий функциональную группу или некомплементарный участок последовательности на 3'-конце или вблизи него, которая предотвращает ферментативное удлинение, где олигонуклеотид в качестве блокатора включает первую последовательность, включающую нейтральную по отношению к мишени подпоследовательность и блокаторную вариабельную подпоследовательность, где блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах нейтральной по отношению к мишени подпоследовательностью и неразрывна с нейтральной по отношению к мишени подпоследовательностью,

олигонуклеотид в качестве первого праймера, который является достаточным для вызова ферментативного удлинения; где олигонуклеотид в качестве первого праймера включает вторую последовательность, где вторая последовательность перекрывается с нейтральной по отношению к мишени подпоследовательностью олигонуклеотида в качестве блокатора на протяжении по крайней мере 5 нуклеотидов, так что вторая последовательность включает перекрывающуюся подпоследовательность и неперекрывающуюся подпоследовательность, и где вторая последовательность не включает блокаторную вариабельную подпоследовательность,

где вторая последовательность создает стандартную свободную энергию гибридизации (ΔGοPT), а первая последовательность создает стандартную свободную энергию гибридизации (ΔGοBT), которая удовлетворяет следующему условию: +2 ккал/моль≥ΔGοPT-ΔGοBT≥-8 ккал/моль,

где концентрация олигонуклеотида в качестве блокатора в приблизительно 2 - приблизительно 10000 раз выше концентрации олигонуклеотида в качестве первого праймера.

2. Композиция олигонуклеотидов по п. 1, где функциональная группа включает 3-углеродный спейсер или дидезоксинуклеотид.

3. Композиция олигонуклеотидов по п. 1, где перекрывающаяся последовательность включает часть 5'-конца нейтральной по отношению к мишени подпоследовательности, где указанная часть составляет от приблизительно 5 нуклеотидов до приблизительно 40 нуклеотидов.

4. Композиция олигонуклеотидов по п. 1, где перекрывающаяся последовательность включает часть 5'-конца нейтральной по отношению к мишени подпоследовательности, где указанная часть составляет от приблизительно 7 нуклеотидов до приблизительно 30 нуклеотидов.

5. Композиция олигонуклеотидов по п. 1, где неперекрывающаяся подпоследовательность создает стандартную свободную энергию гибридизации (ΔGο3), которая удовлетворяет следующему условию:

-4 ккал/моль≥ΔGο3≥-12 ккал/моль

6. Композиция олигонуклеотидов по п. 1, где концентрация олигонуклеотида в качестве блокатора в приблизительно 5 - приблизительно 1000 раз выше концентрации олигонуклеотида в качестве первого праймера.

7. Композиция олигонуклеотидов по п. 1, дополнительно включающая олигонуклеотид в качестве второго праймера, достаточный для вызова ферментативного удлинения, где олигонуклеотид в качестве второго праймера включает третью последовательность, где третья последовательность не перекрывается с первой последовательностью или второй последовательностью и где третья последовательность является нейтральной по отношению к мишени и достаточной для использования с олигонуклеотидом в качестве первого праймера для амплификации участка нуклеиновой кислоты, используя полимеразную цепную реакцию.

8. Композиция олигонуклеотидов по п. 7, дополнительно включающая олигонуклеотид в качестве второго блокатора, включающий вторую функциональную группу или второй некомплементарный участок последовательности на 3'-конце или вблизи него, которая предотвращает ферментативное удлинение, где олигонуклеотид в качестве второго блокатора включает четвертую последовательность, включающую вторую нейтральную по отношении к мишени подпоследовательность и вторую блокаторную вариабельную подпоследовательность, где вторая блокаторная вариабельная подпоследовательность является последовательностью, комплементарной блокаторной вариабельной подпоследовательности, где вторая блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах второй нейтральной по отношению к мишени подпоследовательностью и неразрывна со второй нейтральной по отношению к мишени подпоследовательностью, где третья последовательность перекрывается со второй нейтральной по отношению к мишени подпоследовательностью на протяжении по крайней мере 5 нуклеотидов, так что третья последовательность включает вторую перекрывающуюся подпоследовательность и вторую неперекрывающуюся подпоследовательность, и где третья последовательность не включает вторую блокаторную вариабельную подпоследовательность.

9. Композиция олигонуклеотидов по п. 8, где вторая функциональная группа включает 3-углеродный спейсер или дидезоксинуклеотид.

10. Композиция олигонуклеотидов по п. 8, где вторая перекрывающаяся последовательность включает часть 5'-конца второй нейтральной по отношению к мишени подпоследовательности, где указанная часть составляет от приблизительно 5 нуклеотидов до приблизительно 40 нуклеотидов.

11. Композиция олигонуклеотидов по п. 8, где вторая перекрывающаяся последовательность включает часть 5'-конца второй нейтральной по отношению к мишени подпоследовательности, где указанная часть составляет от приблизительно 7 нуклеотидов до приблизительно 30 нуклеотидов.

12. Композиция олигонуклеотидов по п. 8, где третья последовательность создает стандартную свободную энергию гибридизации (ΔGοPT2), а четвертая последовательность создает стандартную свободную энергию гибридизации (ΔGοBT2), которая удовлетворяет следующему условию:

+2 ккал/моль≥ΔGοPT2-ΔGοBT2≥-8 ккал/моль

13. Композиция олигонуклеотидов по п. 8, где вторая неперекрывающаяся подпоследовательность создает стандартную свободную энергию гибридизации (ΔGο6), которая удовлетворяет следующему условию:

-4 ккал/моль≥ΔGο6≥-12 ккал/моль

14. Композиция олигонуклеотидов по п. 8, где концентрация олигонуклеотида в качестве второго блокатора в приблизительно 2 - приблизительно 10000 раз выше концентрации олигонуклеотида в качестве второго праймера.

15. Композиция олигонуклеотидов по п. 8, где концентрация олигонуклеотида в качестве второго блокатора в приблизительно 5 - приблизительно 1000 раз выше концентрации олигонуклеотида в качестве второго праймера.

16. Композиция олигонуклеотидов по любому из пп. 1-15, дополнительно включающая реагент, необходимый для полимеразной цепной реакции.

17. Композиция олигонуклеотидов по любому из пп. 1-15, дополнительно включающая множество нуклеозидтрифосфатов.

18. Композиция олигонуклеотидов по любому из пп. 1-15, дополнительно включающая ДНК-полимеразу.

19. Композиция олигонуклеотидов по любому из пп. 1-15, дополнительно включающая реагент, необходимый для полимеразной цепной реакции, множество нуклеозидтрифосфатов, ДНК-полимеразу.

20. Композиция олигонуклеотидов по любому из пп. 1-15, где блокаторная вариабельная подпоследовательность представляет собой один нуклеотид.

21. Комбинация для амплификации последовательности-мишени, включающая

олигонуклеотид в качестве блокатора, включающий функциональную группу или некомплементарный участок последовательности на 3'-конце или вблизи него, которая предотвращает ферментативное удлинение, где олигонуклеотид в качестве блокатора включает первую последовательность, включающую нейтральную по отношению к мишени подпоследовательность и блокаторную вариабельную подпоследовательность, где блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах нейтральной по отношению к мишени подпоследовательностью и неразрывна с нейтральной по отношению к мишени подпоследовательностью,

олигонуклеотид в качестве первого праймера, который является достаточным для вызова ферментативного удлинения; где олигонуклеотид в качестве первого праймера включает вторую последовательность, где вторая последовательность перекрывается с нейтральной по отношению к мишени подпоследовательностью олигонуклеотида в качестве блокатора на протяжении по крайней мере 5 нуклеотидов, так что вторая последовательность включает перекрывающуюся подпоследовательность и неперекрывающуюся подпоследовательность, и где вторая последовательность не включает блокаторную вариабельную подпоследовательность,

где вторая последовательность создает стандартную свободную энергию гибридизации (ΔGοPT), а первая последовательность создает стандартную свободную энергию гибридизации (ΔGοBT), которая удовлетворяет следующему условию: +2 ккал/моль≥ΔGοPT-ΔGοBT≥-8 ккал/моль.

22. Композиция олигонуклеотидов по п. 21, где функциональная группа включает 3-углеродный спейсер или дидезоксинуклеотид.

23. Композиция олигонуклеотидов по п. 21, где перекрывающаяся последовательность включает часть 5'-конца нейтральной по отношению к мишени подпоследовательности, где указанная часть составляет от приблизительно 5 нуклеотидов до приблизительно 40 нуклеотидов.

24. Композиция олигонуклеотидов по п. 21, где перекрывающаяся последовательность включает часть 5'-конца нейтральной по отношению к мишени подпоследовательности, где указанная часть составляет от приблизительно 7 нуклеотидов до приблизительно 30 нуклеотидов.

25. Композиция олигонуклеотидов по п. 21, где неперекрывающаяся подпоследовательность создает стандартную свободную энергию гибридизации (ΔGο3), которая удовлетворяет следующему условию:

-4 ккал/моль≥ΔGο3≥-12 ккал/моль

26. Композиция олигонуклеотидов по любому из пп. 21-25, где блокаторная вариабельная подпоследовательность представляет собой один нуклеотид.

27. Способ амплификации последовательности-мишени, включающий стадии

(а) получения образца, содержащего одну или более копий первой нуклеиновой кислоты, включающей вариант последовательности, и возможно содержащего по крайней мере одну копию второй нуклеиновой кислоты, включающей последовательность-мишень, где каждая из последовательности-мишени и варианта последовательности включает гомологичную подпоследовательность и вариабельную подпоследовательность, где вариабельная подпоследовательность включает по крайней мере один нуклеотид и где вариабельная подпоследовательность последовательности-мишени представляет собой мишень-специфическую подпоследовательность, а вариабельная подпоследовательности варианта последовательности не является мишень-специфической подпоследовательностью;

(b) введения олигонуклеотида в качестве блокатора в образце, где олигонуклеотид в качестве блокатора включает первую последовательность, включающую нейтральную по отношению к мишени подпоследовательность и блокаторную вариабельную подпоследовательность, где нейтральная по отношению к мишени подпоследовательность комплементарна части гомологичной подпоследовательности, а блокаторная вариабельная подпоследовательность комплементарна не являющейся мишень-специфической подпоследовательности, где блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах нейтральной по отношению к мишени подпоследовательностью и неразрывна с нейтральной по отношению к мишени подпоследовательностью;

(c) введения олигонуклеотида в качестве первого праймера в образец, где олигонуклеотид в качестве первого праймера является достаточным для вызова ферментативного удлинения, где олигонуклеотид в качестве первого праймера включает вторую последовательность, где вторая последовательность является комплементарной второй части гомологичной подпоследовательности, где вторая последовательность перекрывается с нейтральной по отношению к мишени подпоследовательностью на протяжении по крайней мере 5 нуклеотидов, так что вторая последовательность включает перекрывающуюся подпоследовательность и неперекрывающуюся подпоследовательность, где вторая последовательность не включает какую-либо последовательность, комплементарную вариабельной подпоследовательности, где вторая последовательность создает стандартную свободную энергию гибридизации (ΔGοPT), а первая последовательность создает стандартную свободную энергию гибридизации (ΔGοBT), которая удовлетворяет следующему условию: +2 ккал/моль≥ΔGοPT-ΔGοBT≥-8 ккал/моль, где концентрация олигонуклеотида в качестве блокатора в приблизительно 2 - приблизительно 10000 раз выше концентрации олигонуклеотида в качестве первого праймера;

(d) введения в образец ДНК-полимеразы, нуклеозидтрифосфатов и одного или более реагентов, необходимых для полимеразной амплификации нуклеиновых кислот; и

(е) вызова реакции в образце в условиях, достаточных для достижения амплификации нуклеиновых кислот.

28. Способ по п. 27, в котором олигонуклеотид в качестве блокатора включает функциональную группу или некомплементарный участок последовательности на 3'-конце или вблизи него, которая предотвращает ферментативное удлинение.

29. Способ по п. 28, в котором функциональная группа включает 3-углеродный спейсер или дидезоксинуклеотид.

30. Способ по п. 27, в котором ДНК-полимераза является термостабильной ДНК-полимеразой.

31. Способ по п. 30, в котором условия, достаточные для достижения амплификации нуклеиновых кислот, включают подвергание образца по крайней мере 10 циклам, где в каждом цикле осуществляются по крайней мере 2 различных температурных воздействия, одно воздействие температуры, составляющей по крайней мере 85οС, и одно воздействие температуры, составляющей не более 75οС.

32. Способ по п. 27, дополнительно включающий стадию введения в образец фермента, выбираемого из группы, состоящей из делающего одноцепочечный разрыв фермента, рекомбиназы, геликазы, РНКазы, обратной транскриптазы или любой их комбинации.

33. Способ по п. 27, в котором перекрывающаяся последовательность включает часть 5'-конца нейтральной по отношению к мишени подпоследовательности, где указанная часть составляет от приблизительно 5 нуклеотидов до приблизительно 40 нуклеотидов.

34. Способ по п. 27, в котором перекрывающаяся последовательность включает часть 5'-конца нейтральной по отношению к мишени подпоследовательности, где указанная часть составляет от приблизительно 7 нуклеотидов до приблизительно 30 нуклеотидов.

35. Способ по п. 27, в котором неперекрывающаяся подпоследовательность создает стандартную свободную энергию гибридизации (ΔGο3), которая удовлетворяет следующему условию:

-4 ккал/моль≥ΔGο3≥-12 ккал/моль.

36. Способ по п. 27, в котором концентрация олигонуклеотида в качестве блокатора, вводимого в образец, в приблизительно 5 - приблизительно 1000 раз выше концентрации олигонуклеотида в качестве первого праймера, вводимого в образец.

37. Способ по п. 27, дополнительно включающий стадию введения олигонуклеотида в качестве второго праймера в образец, где олигонуклеотид в качестве второго праймера включает третью последовательность, где третья последовательность не перекрывается с вариабельной подпоследовательностью и где третья последовательность является нейтральной по отношению к мишени и достаточной для использования с олигонуклеотидом в качестве первого праймера для амплификации участка нуклеиновой кислоты, включающего последовательность-мишень.

38. Способ по п. 37, дополнительно включающий стадию введения олигонуклеотида в качестве второго блокатора в образец, где олигонуклеотид в качестве второго блокатора включает четвертую последовательность, включающую вторую нейтральную по отношению к мишени подпоследовательность и вторую блокаторную вариабельную подпоследовательность, где вторая блокаторная вариабельная подпоследовательность является последовательностью, комплементарной блокаторной вариабельной подпоследовательности, где вторая блокаторная вариабельная подпоследовательность фланкирована на ее 3'- и 5'-концах второй нейтральной по отношению к мишени подпоследовательностью и неразрывна со второй нейтральной по отношению к мишени подпоследовательностью, где третья последовательность перекрывается со второй нейтральной по отношению к мишени подпоследовательностью на протяжении по крайней мере 5 нуклеотидов, так что третья последовательность включает вторую перекрывающуюся подпоследовательность и вторую неперекрывающуюся подпоследовательность.

39. Способ по п. 38, в котором олигонуклеотид в качестве второго блокатора включает вторую функциональную группу или второй некомплементарный участок последовательности на 3'-конце или вблизи него, которая предотвращает ферментативное удлинение.

40. Способ по п. 39, в котором вторую функциональную группу выбирают из группы, состоящей из 3-углеродного спейсера или дидезоксинуклеотида.

41. Способ по п. 38, в котором вторая перекрывающаяся последовательность включает часть 5'-конца второй нейтральной по отношению к мишени подпоследовательности, где указанная часть составляет от приблизительно 5 нуклеотидов до приблизительно 40 нуклеотидов.

42. Способ по п. 38, в котором вторая перекрывающаяся последовательность включает часть 5'-конца второй нейтральной по отношению к мишени подпоследовательности, где указанная часть составляет от приблизительно 7 нуклеотидов до приблизительно 30 нуклеотидов.

43. Способ по п. 38, в котором третья последовательность создает стандартную свободную энергию гибридизации (ΔGοPT2), а четвертая последовательность создает стандартную свободную энергию гибридизации (ΔGοBT2), которая удовлетворяет следующему условию:

+2 ккал/моль≥ΔGοPT2-ΔGοBT2≥-8 ккал/моль

44. Способ по п. 38, в котором вторая неперекрывающаяся подпоследовательность создает стандартную свободную энергию гибридизации (ΔGο6), которая удовлетворяет следующему условию:

-4 ккал/моль≥ΔGο6≥-12 ккал/моль

45. Способ по п. 38, в котором концентрация олигонуклеотида в качестве второго блокатора, вводимого в образец, в приблизительно 2 - приблизительно 10000 раз выше концентрации олигонуклеотида в качестве второго праймера, вводимого в образец.

46. Способ по п. 38, в котором концентрация олигонуклеотида в качестве второго блокатора, вводимого в образец, в приблизительно 5 - приблизительно 1000 раз выше концентрации олигонуклеотида в качестве второго праймера, вводимого в образец.

47. Способ по п. 27, включающий, после стадии (е), стадию извлечения аликвоты из образца и повторения стадий с (b) по (e) включительно.



 

Похожие патенты:

Изобретение относится к биотехнологии. Описано множество праймеров для использования в конструировании профиля ДНК человека, содержащее два набора праймеров.
Изобретение относится к биотехнологии, а именно к офтальмологии и фармакогенетике, и может быть использовано при подборе терапии у пациентов с экссудативной («влажной») и «сухой» формах возрастной макулярной дегенерации (ВМД).

Изобретение относится к биотехнологии, в частности к способу тестирования собаки для определения предрасположенности собаки к накоплению меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из: (a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287; (b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a), и/или (c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Изобретение относится к биотехнологии и определению респираторных заболеваний с помощью молекулярных маркеров в качестве средства прогнозирования развития случаев респираторных инфекций.

Изобретение относится к области биотехнологии, конкретно к способу отбора стабильной продуцирующей антитело под контролем промотора CMV человека с SEQ ID NO: 1 клетки яичника китайского хомячка СНО-К1.

Изобретение относится к биотехнологии, предоставлены специально сконструированные синтетические микро-РНК, направленные к BCL11A для экспрессии РНК-полимеразой II, и способы их применения для лечения гемоглобинопатий, таких как серповидноклеточная анемия или талассемия посредством увеличения уровней экспрессии фетального гемоглобина.7 н.

Данное изобретение относится к медицине. Предложены способы и применение ингибитора СЕТР, а именно дальцетрапиба, для лечения субъекта с острым коронарным синдромом, где субъект имеет нуклеотидные полиморфизмы в гене аденилатциклазы типа 9 (ADCY9) в хромосоме 16.

Изобретение относится к биотехнологии, и представляет собой способы противодействия онкогенной активности FGF19 у субъекта и, в конкретных вариантах осуществления, способы предотвращения или лечения заболевания, нарушения или состояния, такого как FGF19-зависимое заболевание, нарушение или состояние, или его симптомов.

Изобретение относится к биотехнологии. Описаны молекулярные детерминанты ответа раковой опухоли на иммунотерапию, а также системы и инструменты для идентификации и/или характеристики раковых опухолей, склонных отвечать на иммунотерапию.
Изобретение относится к области медицины, в частности к онкологии. Предложен способ комбинированного лечения немелкоклеточного рака легкого (НМРЛ) IB - III стадии.

Изобретение относится к области биотехнологии. Описана композиция для экспрессии полипептида в клетке млекопитающего, содержащая эффективное количество множества липидных наночастиц, содержащих полинуклеотид, кодирующий указанный полипептид.

Изобретение относится к биотехнологии. Описаны способы для модулирования экспрессии целевой нуклеиновой кислоты в клетке, включающие применение множества ортогональных белков Cas9 для того, чтобы одновременно и независимо регулировать соответствующие гены или одновременно и независимо редактировать соответствующие гены.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая соединение, специфически ингибирующее экспрессию нуклеиновой кислоты аро(а) и/или белка аро(а), композиция для лечения, предупреждения или замедления прогрессирования заболевания, связанного с повышенной экспрессией аро(а) и/или повышенной экспрессией Lp(a), содержащая терапевтически эффективное количество соединения, cпособ предупреждения, лечения, облегчения или замедления прогрессирования заболевания, связанного с повышенной экспрессией аро(а) и/или повышенной экспрессией Lp(a), включающий введение животному вышеуказанного соединения или композиции.

Изобретение относится к биотехнологии, а именно к средствам молекулярной диагностики. Разработаны олигонуклеотидные праймеры и флуоресцентно-меченные зонды для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита КРС с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени:полевой изолят ЗУД КРС:f- 5'- TAGAAAATGGATGTACCACAAATACAG 3',r 5' -TTGTTACAACTCAAATCGTTAGGTG-3',зонд 5' -ACCACCTAATGATAGTGTTTATGATTTACC-3;каприпоксвирусы:f - 5' ATGAAACCAATGGATGGGATA 3',r - 5' CGAAATGAAAAACGGTATATGGA 3',зонд - 5' ATGAGCCATCCATTTTCCAA 3'4;вакцинный штамм ЗУД КРС:f- 5'-TGTTTCCATTCTCCACTGCT-3',r - 5' -TACTTACTAAAAAATGGGCGCА-3',зонд - 5'-TCGCTGACATCGTTAGTCCАСТС-3'.Предложен способ дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита (нодулярного дерматита) КРС с дополнительной детекцией генома каприпоксвирусов с помощью ПЦР в режиме реального времени при одинаковом термическом профиле с использованием этих праймеров и зондов, и тест-система ПЦР в режиме реального времени для его проведения.

Изобретение относится к биотехнологии. Изобретение может быть использовано в разработке и оптимизации ПЦР и ОТ-ПЦР систем, применяемых для выявления нуклеиновых кислот, в том числе при диагностике генетических, вирусных и других заболеваний.

Изобретение относится к области биотехнологии и медицине. Предложено соединение, сопряженное с тремя N-ацетилгалактозаминовыми лигандами.

Изобретение относится к хиральному реагенту формулы (I') для получения производного нуклеозид 3'-фосфорамидита формул (Va') или (Vb'), которые могут использоваться в химической промышленности для синтеза олигонуклеотидов: где G1 представляет собой H или группу формулы (II), G2 представляет собой группу формул (III) или (V), или G1 и G2 вместе образуют группу формулы (IV), ,,,,где G21 - G23 представляют собой H или нитрогруппу, G31 - G33 представляют собой С1-4 алкил или С6-14 арил, G41 - G46 представляют собой Н, G51 - G53 представляют собой H или С1-3 алкил.

Изобретение относится к биотехнологии. Описано средство на основе двухцепочечной рибонуклеиновой кислоты (дцРНК) для ингибирования экспрессии серпина c1, где указанное средство на основе дцРНК содержит смысловую цепь и антисмысловую цепь, где указанная антисмысловая цепь содержит область комплементарности, которая содержит по меньшей мере 19 последовательно расположенных нуклеотидов, отличающихся не более чем на 3 нуклеотида от нуклеотидной последовательности 5’-UUGAAGUAAAUGGUGUUAACCAG-3’(SEQ ID NO: 562), где указанная смысловая цепь независимо имеет длину по меньшей мере 19 нуклеотидов и где лиганд, включающий одно или более производных N-ацетилгалактозамина (GalNAc), конъюгирован с 3’-концом указанной смысловой цепи указанного средства на основе дцРНК.

Изобретение относится к медицине, а именно к неврологии, и может быть использовано для уменьшения экспрессии мутантного гена хантингтина (mHTT) для уменьшения или предотвращения образования агрегатов Htt у субъекта с болезнью Хантингтона (БХ).

Изобретение относится к области медицинской микробиологии, а именно к способам молекулярно-генетического типирования штаммов возбудителей инфекционных заболеваний, которые используются при микробиологическом и молекулярно-генетическом мониторинге штаммов H.pylori, циркулирующих на различных территориях, с целью их дифференциации.

Изобретение относится к биотехнологии. Описана композиция олигонуклеотидов для амплификации последовательности-мишени. Композиция включает олигонуклеотид в качестве блокатора, включающий функциональную группу или некомплементарный участок последовательности на 3-конце или вблизи него, которая предотвращает ферментативное удлинение. При этом олигонуклеотид в качестве блокатора включает первую последовательность, включающую нейтральную по отношению к мишени подпоследовательность и блокаторную вариабельную подпоследовательность, где блокаторная вариабельная подпоследовательность фланкирована на ее 3- и 5-концах нейтральной по отношению к мишени подпоследовательностью и неразрывна с нейтральной по отношению к мишени подпоследовательностью. Олигонуклеотид в качестве первого праймера является достаточным для вызова ферментативного удлинения. Олигонуклеотид в качестве первого праймера включает вторую последовательность, где вторая последовательность перекрывается с нейтральной по отношению к мишени подпоследовательностью олигонуклеотида в качестве блокатора на протяжении по крайней мере 5 нуклеотидов, так что вторая последовательность включает перекрывающуюся подпоследовательность и неперекрывающуюся подпоследовательность, и вторая последовательность не включает блокаторную вариабельную подпоследовательность, вторая последовательность создает стандартную свободную энергию гибридизации, а первая последовательность создает стандартную свободную энергию гибридизации, которая удовлетворяет следующему условию: +2 ккалмоль≥ΔGοPT-ΔGοBT≥-8 ккалмоль. При этом концентрация олигонуклеотида в качестве блокатора в приблизительно 2 - приблизительно 10000 раз выше концентрации олигонуклеотида в качестве первого праймера. Изобретение расширяет арсенал средств для амплификации. 3 н. и 44 з.п. ф-лы, 14 ил., 1 табл., 11 пр.

Наверх