Способ дифференциации штаммов legionella pneumophila путем молекулярно-генетического типирования

Изобретение относится к области биотехнологии. Сущность изобретения заключается в том, что из ДНК исследуемого штамма L. pneumophila выявляют четыре общих INDEL-гена, имеющих делеции определенного размера, а именно IND- А9Р84_02210, А9Р84_08285, А9Р84_03850 и А9Р84_07165, с последующей их амплификацией с помощью сконструированных специфических праймеров, выявляющих два альтернативных аллеля: к гену IND- А9Р84_02210 - праймеры TTCCCCTTATTTAAATGACACCA и AAGCATAATAGGCGGGAAGA, с длиной амплифицированного фрагмента 80 п.н. или 110 п.н., к гену IND- А9Р84_08285 - праймеры CAGAAGACAAAGCGGAATCTG и TGAGGCCGAGTTTCTTGACT, с длиной амплифицированного фрагмента 62 п.н. или 74 п.н., к гену IND- А9Р84 03850 - праймеры CAGGTATCTGCCACGAATCA и TGGTTGTTGTCCATTTGACTG, с длиной амплифицированного фрагмента 63 п.н. или 75 п.н., к гену IND- А9Р84_07165 - праймеры TGGGTATTAAGCAATACGCAAG и AACAGAAACACCATTTATGCTTTG, с длиной амплифицированного фрагмента 84 п.н. или 96 п.н., при этом учет результатов дифференциации проводят визуально после электрофореза в 8% полиакриламидном геле в присутствии маркера молекулярных масс ДНК, причем для каждого штамма устанавливают уникальный INDEL-генотип по четырем INDEL-генам, а путем сравнения выявленных INDEL-генотипов устанавливают общее или различное происхождение исследуемых штаммов L. pneumophila. Изобретение позволяет типировать штаммы возбудителей инфекционных заболеваний, которые используются при микробиологическом и молекулярно-генетическом мониторинге штаммов L. pneumophila, циркулирующих на различных территориях, с целью их дифференциации. 2 з.п. ф-лы, 4 табл., 2 ил., 3 пр.

 

Предлагаемое изобретение относится к области медицинской микробиологии, а именно к способам молекулярно-генетического типирования штаммов возбудителей инфекционных заболеваний, которые используются при микробиологическом и молекулярно-генетическом мониторинге штаммов L. pneumophila, циркулирующих на различных территориях, с целью их дифференциации.

В последние годы в различных странах мира отмечается рост заболеваемости легионеллезной инфекции. В связи с этим с 1995 г. под эгидой ВОЗ и Европейской рабочей группы по легионеллезу действует Международная система мониторинга легионеллеза путешественников (travel-associated legionellosis). Эта система позволила выявить более 10 тысяч случаев легионеллеза в 65 странах. Частота ежегодно регистрируемых летальных случаев варьирует от 6 до 15% (1, 2).

Нозокомиальные случаи легионеллеза могут быть вызваны разными серотипами L. pneumophila (не SG1) и другими видами легионелл (L. longbeachae, L. bozemanii и т.д., всего около 50 видов), отличным от L. pneumophila. В общеевропейском исследовании 1335 случаев легионеллеза показано, что 35,9% от числа случаев нозокомиального легионеллеза вызваного L. pneumophila не SG1 (3).

Таким образом, легионеллезная инфекция является актуальной медицинской проблемой и, несмотря на широкий арсенал различных методов лабораторной диагностики (ИФА, ИХА, РИФ (МФА), ПЦР), существует ограниченное количество методов типирования легионелл. На данный момент наиболее распространенными можно считать: использование панелей моноклональных антител, сиквенс-типирование (например сравнение секвенированных фрагментов шести генов: flaA, pilE, asd, mip, mompS и pro A) VNTR-типирование (4).

Известен способ INDEL-типирования штаммов Vibrio cholerae (5), основанный на определении «вставок-делеций» (INsertion-DELetion) в различных генах, что позволяет выявлять индивидуальные различия между штаммами. В виду наличия всего лишь двух аллелей («вставка» и «делеция») указанный метод гораздо проще остальных методов типирования.

Однако, данные об использовании INDEL-маркеров для типирования легионелл отсутствуют, в связи с этим возникла необходимость в разработке нового способа, позволяющего достоверно, быстро и с невысокой себестоимостью осуществлять дифференциацию штаммов L. pneumophila, выделенных в различных регионах, областях и странах.

За прототип выбран способ VNTR-типирование (6), который заключается в выделении ДНК из исследуемой культуры, постановки ПЦР со специфическими праймерами к 10 VNTR-локусам (Lpms1_b, Lpms3, Lpms13, Lpms17, Lpms19_b, Lpms31, Lpms33, Lpms34, Lpms35 и Lpms37) L. pneumophila, учет продуктов ПЦР проводили в 2%-4% агарозном геле его окрашивали 0,5-1,0 мкг/мл бромистым этидием в течение 15-30 минут, промывали водой и фотографировали при ультрафиолетовом освещении, после этого части фрагментов (Lpms31 и Lpms37) требовался капиллярный электрофорез или секвенирования для однозначного определения типа.

Однако данный способ имеет ряд недостатков. Для проведения исследования необходим сложный и дорогостоящий импортный ДНК-секвенатор, а само проведение анализа требует использования дорогостоящих импортных расходных материалов, и сложной процедуры интерпретации полученных результатов с помощью дорогостоящего программного обеспечения. Эти обстоятельства приводит к крайне высокой стоимости анализа, его большой продолжительности во времени (несколько дней) и полной зависимости исследователя от поставок производителем расходных материалов из-за рубежа.

Технической задачей предполагаемого изобретения является разработка нового способа позволяющего достоверно, быстро и с невысокой себестоимостью осуществлять дифференциацию штаммов L. pneumophila, выделенных в различных регионах, областях и странах.

Поставленная задача достигается тем, что в известном способе дифференциации штаммов L. pneumophila путем молекулярно-генетического типирования, включающем выделение ДНК из исследуемого штамма L. pneumophila, постановку ПЦР со специфическими праймерами и учет реакции с помощью электрофореза, из ДНК исследуемого штамма L. pneumophila выявляют четыре общих INDEL-генов, имеющих делеции определенного размера а именно IND- А9Р84_02210, А9Р84_08285, А9Р84_03850 и А9Р84_07165, с последующей их амплификацией с помощью сконструированных специфических праймеров, выявляющих два альтернативных аллеля:

к гену IND- А9Р84_02210 - праймеры TTCCCCTTATTTAAATGACACCA и AAGCATAATAGGCGGGAAGA, с длиной амплифицированного фрагмента 80 п.н. или 110 п.н.,

к гену IND- А9Р84_08285 - праймеры CAGAAGACAAAGCGGAATCTG и TGAGGCCGAGTTTCTTGACT, с длиной амплифицированного фрагмента 62 п.н. или 74 п.н.,

к гену IND- А9Р84_03850 - праймеры CAGGTATCTGCCACGAATCA и TGGTTGTTGTCCATTTGACTG, с длиной амплифицированного фрагмента 63 п.н. или 75 п.н.,

к гену IND- А9Р84_07165 - праймеры TGGGTATTAAGCAATACGCAAG и AACAGAAACACCATTTATGCTTTG, с длиной амплифицированного фрагмента 84 п.н. или 96 п.н.,

при этом учет результатов дифференциации проводят визуально после электрофореза в 8% полиакриламидном геле в присутствии маркера молекулярных масс ДНК, причем для каждого штамма устанавливают уникальный INDEL-генотип по четырем INDEL-генам, а путем сравнения выявленных INDEL-генотипов устанавливают общее или различное происхождение исследуемых штаммов L. pneumophila.

При этом ПЦР проводят в объеме 10 мкл и реакционная смесь содержит:

1,5 MMMg-буфер,

0,2 мМ смеси дНТФ, 1,0 мкМ смеси праймеров (по 0,5 мкМ каждого праймера),

25 нг ДНК-матрицы,

1 ед. ДНК-полимеразы, оставшийся объем - вода, при этом в качестве матрицы используют геномную ДНК, объемом 5 мкл, которую получают из разных штаммов Legionella pneumophila.

Кроме того ПЦР проводят с соблюдением режимов:

1 этап - денатурация при 94°С - 35 с;

2 этап - отжиг при 60°С - 25 с;

3 этап - синтез при 72°С - 35 с (40 циклов);

Обоснование выбора праймеров

С помощью программного обеспечения, разработанного авторами (ФКУЗ Ростовский-на-Дону противочумный институт Роспотребнадзора) было проанализировано более 3005 генов L. pneumophila в базе данных GenBank. В процессе компьютерного анализа нуклеотидных последовательностей штаммов L. pneumophila в базе данных GenBank авторы идентифицировали ряд INDEL-генов, отличающихся по размеру у штаммов L. pneumophila различного происхождения, и имеющих только два альтернативных варианта размера ампликона. В результате было выделено 4 общих гена, имеющих делеции определенного размера, а именно:

IND- А9Р84_02210, А9Р84_08285, А9Р84_03850 и А9Р84_07165 (см. таблицу 1).

С помощью программного обеспечения PrimerМи BLAST NCBI к варьирующим участкам указанных генов А9Р84_02210, А9Р84_08285, А9Р84_03850 и А9Р84_07165 были сконструированы специфические праймеры.

Набор значений размера фрагментов для каждого штамма по каждому из четырех INDEL-генов является его индивидуальной характеристикой и позволяет дифференцировать один штамм от другого и определять их происхождениеспомощыо кластерного анализа.

Способ осуществляется следующим образом

Перед постановкой способа дифференциации штаммов L. pneumophila выделяют ДНК исследуемой культуры. Бактериальную суспензию исследуемого штамма в дистиллированной воде вносят в микропробирку объемом 1,5 мл, после чего проводят обеззараживание материала и выделение ДНК согласно МУ 1.3.2569-09 (7). Затем в ПЦР проводят амплификацию выделенной ДНК со специфическими праймерами:

к гену IND- А9Р84_02210 - праймеры TTCCCCTTATTTAAATGACACCA и AAGCATAATAGGCGGGAAGA, с длиной амплифицированного фрагмента 80 п.н. или 110 п.н.,

к гену IND- А9Р84_08285 - праймеры CAGAAGACAAAGCGGAATCTG и TGAGGCCGAGTTTCTTGACT, с длиной амплифицированного фрагмента 62 п.н. или 74 п.н.,

к гену IND- А9Р84_03850 - праймеры CAGGTATCTGCCACGAATCA и TGGTTGTTGTCCATTTGACTG, с длиной амплифицированного фрагмента 63 п.н. или 75 п.н.,

к гену IND- А9Р84_07165 - праймеры TGGGTATTAAGCAATACGCAAG и AACAGAAACACCATTTATGCTTTG, с длиной амплифицированного фрагмента 84 п.н. или 96 п.н.,

Условия проведения реакции амлификации

Амплификацию проводят по следующей схеме: денатурация при 94°С - 35 с, отжиг при 60°С - 25 с, синтез при 72°С - 35 с (40 циклов).

Реакционную смесь объемом 10 мкл готовят из расчета: 1,5 MMMg-буфер, 0,2 мМ смеси дНТФ, 1,0 мкМ смеси праймеров (по 0,5 мкМ каждого праймера) 25 нг ДНК-матрицы, 1 ед.. ДНК-полимеразы, оставшийся объем - вода. В качестве матрицы используют геномную ДНК (объемом 5 мкл), полученную из разных штаммов L. pneumophila. Учет результатов амплификации проводят с помощью электрофореза в 8% полиакриламидном гелев присутствии маркера молекулярных масс ДНК.

При этом учет результатов типирования проводят визуально после электрофореза, причем для каждого штамма устанавливают уникальный INDEL-генотип по четырем INDEL-генам, а путем сравнения выявленных NDEL-генотипов между собой и с известными генотипами идентификационной таблицы 1, устанавливают общее или различное происхождение исследуемых штаммов L. pneumophila, что дает возможность дифференцировать один штамм от другого.

Проведенные исследования доказывают, что использование разработанного способа молекулярно-генетического типирования штаммов L. pneumophila по структуре INDEL-генов позволяет выявлять штаммы с различными аллельными вариантами INDEL-генов.

Пример 1.

В эксперименте использованы штаммы L. pneumophila из коллекции Ростовского-на-Дону научно-исследовательского противочумного института, выделенные в Ростовской области. Бактерии L. pneumophila (штаммы 15, 21, 23, 24, 25, 26, 15978/1, 39152) суспендировали в 100 мкл деионизованной воды, не содержащей нуклеаз. Далее проводили выделение ДНК согласно МУ 1.3.2569-09 (7). Для постановки полимеразной цепной реакции используют праймеры к гену А9Р84_02210 TTCCCCTTATTTAAATGACACCA и AAGCATAATAGGCGGGAAGA, с длиной амплифицированного фрагмента 80 п.н. или 110 п.н.; и праймеры к гену А9Р84_08285 CAGAAGACAAAGCGGAATCTG и TGAGGCCGAGTTTCTTGACT, с длиной амплифицированного фрагмента 62 п.н. или 74 п.н.

В реакционную ПЦР смесь добавляли по 1 микролитру специфических праймеров, 1 микролитр термостабильной ДНК-полимеразы и вносили 5 микролитров супернатанта ДНК. Общий объем реакционной смеси составляет 10 микролитров. Смесь перемешивали на вортексе и амплифицировали при условиях: денатурация при 94°С - 35 с, отжиг при 60°С - 25 с, синтез при 72°С - 35 с (40 циклов). Учет результатов амплификации проводятся помощью электрофореза в 8% полиакриламидном геле в присутствии маркера молекулярных масс ДНК (фото 1). На фото 1 видим: электрофорез продуктов амплификации INDEL-генов А9Р84_02210 и А9Р84_08285.

На фото 1 - нумерация от 1-8 соответствуют номерам штаммов: 1-15, 2-21, 3-23, 4-24, 5-25, 6-26, 7-15978/1, 8 - 39152. М - маркерная ДНК.

Вывод: анализ продуктов амплификации INDEL-гена А9Р84_02210. показывает, что два из восьми изученных штаммов (№25 и 15978/1) не имеют аллель А9Р84_02210, один штамм (39152) 80 п.н., а пять - аллель 110 п.н. Анализ продуктов амплификации INDEL-гена А9Р84_08205 показывает, что два штамма (15978/1, 39152) имеют одинаковый аллель 62 п.н., а шесть штаммов 74 п.н.

Следовательно дифференцируют эти штаммы и выделяют четыре группы различные по наличию/ отсутствию делеций, что подтверждает различия между группами этих штаммов и является их индивидуальной характеристикой, а для более полной характеристики штаммов потребуются дополнительные исследования по другим INDEL-генам. Данные по размерам аллелей для каждого штамма заносят в таблицу 2, аналогично идентификационной таблице 1.

Пример 2.

Из коллекции Ростовского-на-Дону научно-исследовательского противочумного института были взяты штаммы L. pneumophila (№15, 21, 23, 24, 25, 26, 15978/1, 39152). Бактерии L. pneumophila суспендировали в 100 мкл деионизованной воды, не содержащей нуклеаз. Далее проводили выделение ДНК согласно МУ 1.3.2569-09 (7).

Для постановки полимеразной цепной реакции используют праймеры к гену А9Р84_03850 CAGGTATCTGCCACGAATCA и TGGTTGTTGTCCATTTGACTG, с длиной амплифицированного фрагмента 63 п.н. или 75 п.н.; праймеры к гену А9Р84_07165 TGGGTATTAAGCAATACGCAAG и AACAGAAACACCATTTATGCTTTG, с длиной амплифицированного фрагмента 84 п.н. или 96 п.н.

В реакционную ПЦР смесь добавляли по 1 микролитру специфических праймеров, 1 микролитр термостабильной ДНК-полимеразы и вносили 5 микролитров супернатанта ДНК. Общий объем реакционной смеси составляет 10 микролитров. Смесь перемешивали на вортексе и амплифицировали при условиях: денатурация при 94°С - 35 с, отжиг при 60°С - 25 с, синтез при 72°С - 35 с (40 циклов). Учет результатов амплификации проводятся помощью электрофореза в 8% полиакриламидном геле в присутствии маркера молекулярных масс ДНК (фото 2). На фото 2 видим: электрофорез продуктов амплификации INDEL-генов А9Р84_03850 и А9Р84_07165 (см. фото 2).

На фото 2 - нумерация от 1-8 соответствуют номерам штаммов: 1-15, 2-21, 3-23, 4-24, 5-25, 6-26, 7-15978/1, 8-39152. М - маркерная ДНК.

Вывод: анализ продуктов амплификации INDEL-гена А9Р84_03850 показывает, что два (штаммы №15978/1 и 39152) из восьми изученных штаммов имеют аллель 63 п.н. а шесть 75 п.н. Анализ продуктов амплификации INDEL-гена А9Р84_07165 показывает, что один (штамм №25) из восьми изученных штаммов имеет аллель 84 п.н., оставшиеся семь - 96 п.н.

Следовательно дифференцируют эти штаммы по двум локусам и выделяют три группы различные по наличию/ отсутствию делеций, что подтверждает различия между группами этих штаммов и является их индивидуальной характеристикой, а для более полной характеристики штаммов потребуются дополнительные исследования по другим INDEL-генам. Данные по размерам аллелей для каждого штамма заносят в таблицу 3, аналогично идентификационной таблице 1.

Пример 3.

Используя компьютерное моделирование полимеразной цепной реакции (ПЦР) был осуществлен анализ полных геномных секвенсов 58-и штаммов L. pneumophila взятых из базы данных Национального центра биотехнологической информации США (http://www.ncbi.nlm.nih.gov/genome), с помощью программы Virtual PCR.

Таким образом стало возможным все 58 штаммов объединить в 10 групп по наличию или отсутствию делеций в ампликонах (см. таблицу 4). В результате анализа таблицы 4, видно что данным методом можно дифференцировать штаммы L. pneumophila один от другого, давать более точную генетическую характеристику и определять их происхождение, что важно при проведении расследований вспышек легионеллеза и мониторинга за этим возбудителем.

Использование предполагаемого изобретения позволяет достоверно и быстро за счет подбора праймеров унифицировать и создать набор значений размера фрагментов аллелей для каждого штамма L. pneumophila по каждому из четырех INDEL-генов, которые являются его индивидуальной характеристикой и позволяют дифференцировать один штамм от другого и определять их происхождение.

Источники информации

1. Тартаковский И.С., Кожевникова Г.М., Груздева О.А. Международные стандарты выявления и мониторинга легионеллеза путешественников, их значение для современной профилактической медицины. Материалы IV Ежегодного всероссийского конгресса по инфекционным болезням (Москва, 26--28 марта 2012 г.). Инфекционные болезни. 2012; 10 (прил. 1).

2. European Guidelines for control and prevention of travel associated legionellosis. EWGLI. London. 2002.5. Legionella and the prevention of legionellosis. WHO; Geneva: 2007.

3. Helbig J.H, Bernander S., Castellani Pastoris M. et. al. Pan-European Study on Culture-Proven Legionnaires' Disease: Distribution of Legionella pneumophila Serogroups and Monoclonal Subgroups. Eur J Clin Microbiol Infect Dis. 2002. №21. P. 710-716. DOI 10.1007/s 10096-002-0820-3.

4. Gaia V., Fry N.K., Afshar B. et al. Consensus Sequence-Based Scheme for Epidemiological Typing of Clinical and Environmental Isolates of Legionella pneumophila. J. Clin, microbiol. 2005, 43(5): 2047-2052

5. A.C. Водопьянов, CO. Водопьянов, И.П. Олеников, Б.Н. Мишанькин, В.Д. Кругликов, И.В. Архангельская, Д.А. Зубкова, М.И. Ежова / INDEL- и VNTR-типирование штаммов Vibrio cholerae, выделенных в 2013 г. из объектов окружающей среды на территории Российской Федерации / Журнал "Здоровье населения и среда обитания" 2015. №5 (266). С. 41-44.

6. Christine Pourcel, Paolo Visca, Baharak Afshar, Silvia D'Arezzo, Gilles Vergnaud, and Norman K. Fry / Identification of Variable-Number Tandem-Repeat (VNTR) Sequences in Legionella pneumophila and Development of an Optimized Multiple-Locus VNTR Analysis Typing Scheme / J Clin Microbiol. 2007 April; 45(4): 1190-1199, doi: 10.1128/JCM.02078-06

7. Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности: Методические указания. МУ 1.3.2569-09. - М.: Федеральная служба по надзору в сфере защиты прав потребителей и благополучия человека, 2009. - 35 с.

1. Способ дифференциации штаммов Legionella pneumophila путем молекулярно-генетического типирования, включающий выделение ДНК из исследуемого штамма L. pneumophila, постановку ПЦР со специфическими праймерами и учет реакции с помощью электрофореза, отличающийся тем, что из ДНК исследуемого штамма L. pneumophila выявляют четыре общих INDEL-гена, имеющих делеции определенного размера, а именно IND-А9Р84_02210, А9Р84_08285, А9Р84_03850 и А9Р84_07165, с последующей их амплификацией с помощью сконструированных специфических праймеров, выявляющих два альтернативных аллеля:

к гену IND- А9Р84_02210 - праймеры TTCCCCTTATTTAAATGACACCA и AAGCATAATAGGCGGGAAGA, с длиной амплифицированного фрагмента 80 п.н. или 110 п.н.,

к гену IND- А9Р84_08285 - праймеры CAGAAGACAAAGCGGAATCTG и TGAGGCCGAGTTTCTTGACT, с длиной амплифицированного фрагмента 62 п.н. или 74 п.н.,

к гену IND- А9Р84_03850 - праймеры CAGGTATCTGCCACGAATCA и TGGTTGTTGTCCATTTGACTG, с длиной амплифицированного фрагмента 63 п.н. или 75 п.н.,

к гену IND- А9Р84_07165 - праймеры TGGGTATTAAGCAATACGCAAG и AACAGAAACACCATTTATGCTTTG, с длиной амплифицированного фрагмента 84 п.н. или 96 п.н.,

при этом учет результатов дифференциации проводят визуально после электрофореза в 8% полиакриламидном геле в присутствии маркера молекулярных масс ДНК, причем для каждого штамма устанавливают уникальный INDEL-генотип по четырем INDEL-генам, а путем сравнения выявленных INDEL-генотипов устанавливают общее или различное происхождение исследуемых штаммов L. pneumophila.

2. Способ по п. 1, отличающийся тем, что ПЦР проводят в объеме 10 мкл, и реакционная смесь содержит:

1,5 MMMg-буфер,

0,2 мМ смеси дНТФ,

1,0 мкМ смеси праймеров (по 0,5 мкМ каждого праймера),

25 нг ДНК-матрицы,

1 ед. ДНК-полимеразы,

оставшийся объем - вода,

при этом в качестве матрицы используют геномную ДНК объемом 5 мкл, которую получают из разных штаммов Legionella pneumophila.

3. Способ по п. 1, отличающийся тем, что ПЦР проводят с соблюдением режимов:

1 этап - денатурация при 94°С - 35 с;

2 этап - отжиг при 60°С - 25 с;

3 этап - синтез при 72°С - 35 с (40 циклов).



 

Похожие патенты:

Изобретение относится к биотехнологии. Описана композиция олигонуклеотидов для амплификации последовательности-мишени.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ проведения ПЦР в режиме реального времени для генотипирования крупного рогатого скота по аллелям 337C/G гена fshr (rs43745234), состоит в том, что используются:прямой праймер прямой праймер 5'-GAATTGAAAAGGCCAACAACC-3',обратный праймер 5'-CACCAGAATACAGAAGTTCTTACAGA-3',FSHR337C - аллель-специфичный флуоресцентно-меченый зонд-5'-FAM-CATCGACCCTGATGCC BHQ1-3',FSHR337G - аллель-специфичный флуоресцентно-меченый зонд5'-VIC-CATCGACGCTGATGC-BHQ1-3'.Изобретение позволяет повысить надежность детекции аллелей 337C/G (rs43745234) гена fshr, упростить анализ и сократить время его проведения до 1,5 часов.

Изобретение относится к биотехнологии. Описано множество праймеров для использования в конструировании профиля ДНК человека, содержащее два набора праймеров.
Изобретение относится к биотехнологии, а именно к офтальмологии и фармакогенетике, и может быть использовано при подборе терапии у пациентов с экссудативной («влажной») и «сухой» формах возрастной макулярной дегенерации (ВМД).

Изобретение относится к биотехнологии, в частности к способу тестирования собаки для определения предрасположенности собаки к накоплению меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из: (a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287; (b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a), и/или (c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Изобретение относится к биотехнологии, в частности к способу тестирования собаки для определения предрасположенности собаки к накоплению меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из: (a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287; (b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a), и/или (c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Изобретение относится к биотехнологии и определению респираторных заболеваний с помощью молекулярных маркеров в качестве средства прогнозирования развития случаев респираторных инфекций.

Изобретение относится к биотехнологии и определению респираторных заболеваний с помощью молекулярных маркеров в качестве средства прогнозирования развития случаев респираторных инфекций.

Изобретение относится к области биотехнологии, конкретно к способу отбора стабильной продуцирующей антитело под контролем промотора CMV человека с SEQ ID NO: 1 клетки яичника китайского хомячка СНО-К1.

Изобретение относится к биотехнологии, предоставлены специально сконструированные синтетические микро-РНК, направленные к BCL11A для экспрессии РНК-полимеразой II, и способы их применения для лечения гемоглобинопатий, таких как серповидноклеточная анемия или талассемия посредством увеличения уровней экспрессии фетального гемоглобина.7 н.

Изобретение относится к области биотехнологии. Сущность изобретения заключается в том, что из ДНК исследуемого штамма L. pneumophila выявляют четыре общих INDEL-гена, имеющих делеции определенного размера, а именно IND- А9Р84_02210, А9Р84_08285, А9Р84_03850 и А9Р84_07165, с последующей их амплификацией с помощью сконструированных специфических праймеров, выявляющих два альтернативных аллеля: к гену IND- А9Р84_02210 - праймеры TTCCCCTTATTTAAATGACACCA и AAGCATAATAGGCGGGAAGA, с длиной амплифицированного фрагмента 80 п.н. или 110 п.н., к гену IND- А9Р84_08285 - праймеры CAGAAGACAAAGCGGAATCTG и TGAGGCCGAGTTTCTTGACT, с длиной амплифицированного фрагмента 62 п.н. или 74 п.н., к гену IND- А9Р84 03850 - праймеры CAGGTATCTGCCACGAATCA и TGGTTGTTGTCCATTTGACTG, с длиной амплифицированного фрагмента 63 п.н. или 75 п.н., к гену IND- А9Р84_07165 - праймеры TGGGTATTAAGCAATACGCAAG и AACAGAAACACCATTTATGCTTTG, с длиной амплифицированного фрагмента 84 п.н. или 96 п.н., при этом учет результатов дифференциации проводят визуально после электрофореза в 8 полиакриламидном геле в присутствии маркера молекулярных масс ДНК, причем для каждого штамма устанавливают уникальный INDEL-генотип по четырем INDEL-генам, а путем сравнения выявленных INDEL-генотипов устанавливают общее или различное происхождение исследуемых штаммов L. pneumophila. Изобретение позволяет типировать штаммы возбудителей инфекционных заболеваний, которые используются при микробиологическом и молекулярно-генетическом мониторинге штаммов L. pneumophila, циркулирующих на различных территориях, с целью их дифференциации. 2 з.п. ф-лы, 4 табл., 2 ил., 3 пр.

Наверх