Аптамеры, специфические в отношении tlr-4, и их применение



Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
Аптамеры, специфические в отношении tlr-4, и их применение
C12N15/115 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2709718:

АПТАТАРХЕТС, С.Л. (ES)

Изобретение относится к биотехнологии. Описан ДНК аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, имеющий по меньшей мере 70% идентичности последовательности с SEQ ID NO: 1 или SEQ ID NO: 2. Также описан комплекс, обладающий способностью к специфическому связыванию и ингибированию TLR-4, содержащий аптамер и функциональную группу, выбранную из группы, состоящей из детектируемого реагента, лекарственного средства и наночастицы. Представлен способ детекции TLR-4 в образце in vitro, включающий i) приведение указанного образца в контакт с аптамером по любому из пп. 1–4 или комплексом по любому из пп. 9–14, и ii) выделение указанного аптамера или комплекса, не связанного с TLR-4, iii) детекцию присутствия аптамера или комплекса, связанного с TLR-4, присутствующим в указанном образце. Представлена фармацевтическая композиция для лечения патологии, характеризующейся увеличением экспрессии TLR-4, содержащая терапевтически эффективное количество по меньшей мере одного аптамера по любому из пп. 1–4 или по меньшей мере одного комплекса по любому из пп. 9–14, необязательно в комбинации с одним или более фармацевтически приемлемым носителем, вспомогательным веществом или растворителем. Изобретение расширяет арсенал ингибиторов TLR-4. 5 н. и 19 з.п. ф-лы, 10 ил., 6 пр.

 

Область техники

В настоящем изобретении предложены аптамеры нуклеиновых кислот, обладающие способностью к специфическому связыванию и ингибированию TLR-4, и их применение.

Уровень техники

К настоящему времени известно, что центральная нервная система (ЦНС) отвечает как на бактериальные инфекции, так и на повреждение головного мозга посредством высокоорганизованного врожденного иммунного ответа. Врожденная иммунная система способна распознавать высококонсервативные молекулярные паттерны через, в том числе, Toll-подобные рецепторы (TLR).

TLR4 стал первым TLR, описанным у млекопитающих. Для указанного TLR были описаны такие экзогенные лиганды, как липополисахарид (ЛПС) грамотрицательных бактерий, липотейхоевая кислота (ЛТК) грамположительных бактерий или белок F респираторно-синцитиального вируса. Кроме того, наиболее важные эндогенные лиганды представлены HMBG1, HSP-60 эндогенного происхождения или происходящим из Chlamydia pneumoniae, HPS-70, фибронектином, фибриногеном, гиалуроновой кислотой и т.п.; все указанные лиганды получают при повреждении тканей, повреждении клеток и/или из кровеносных сосудов хозяина. TLR4 вовлечен в значительное количество широко распространенных патологий, таких как, в том числе, инсульт или цереброваскулярное заболевание, острый инфаркт миокарда, сепсис, атеросклероз, рассеянный склероз, ревматоидный артрит, дегенеративное заболевание сетчатки глаза и наркотическая зависимость.

Вовлеченность врожденного иммунитета и, в частности, TLR, в различные патологии стимулировала растущий интерес к разработке агонистов и антагонистов указанных рецепторов. Соответственно, были разработаны агонисты для возможного лечения раковых заболеваний, аллергических заболевания, инфекций и для применения в качестве коадъювантов для вакцин. Кроме того, проводятся исследования антагонистов TLR при сепсисе, атеросклерозе, хронической боли и колите; фактически, известно несколько антагонистов, эриторан (фаза III), ибудиласт (Av411; фаза II) и антитела NI-0101 (доклиническая фаза), изучение которых в настоящее время проводится при указанных патологиях.

В патентном документе WO 2006/138681 описан способ ингибирования делеции активированных в печени Т-клеток путем введения ингибитора TLR-4, среди которых значатся TLR-4-специфические аптамеры.

Roger и др. (Roger et al., 2009, Proc Natl Acad Sci USA 106:2348-52) описывают антитела, специфические в отношении внеклеточного домена TLR4. Указанные антитела обеспечивают защиту от летального сепсиса, вызванного грамотрицательными бактериями, у мышей. Также предполагается терапевтическая эффективность указанных антител против TLR4, с учетом того, что лечение является эффективным при введении антител в пределах 4 часов после воздействия эндотоксина и в пределах 13 часов после возникновения инфекции, вызванной Escherichia coli.

Соответственно, в данной области техники существует потребность в новых молекулах, обладающих способностью к специфическому связыванию и ингибированию TLR-4 и подходящих для применения в качестве терапевтических агентов.

Краткое описание изобретения

Согласно первому аспекту настоящее изобретение относится к аптамеру нуклеиновой кислоты, обладающему способностью к специфическому связыванию и ингибированию TLR-4, и содержащему последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или к его функционально эквивалентному варианту.

Согласно другому аспекту настоящее изобретение относится к комплексу, содержащему аптамер согласно настоящему изобретению и функциональную группу.

Согласно другому аспекту настоящее изобретение относится к применению аптамера согласно настоящему изобретению или комплекса согласно настоящему изобретению для детекции TLR-4.

Согласно другому аспекту настоящее изобретение относится к in vitro применению аптамера согласно настоящему изобретению или комплекса согласно настоящему изобретению для ингибирования TLR-4.

Согласно другому аспекту настоящее изобретение относится к in vitro способу детекции TLR-4 в образце, включающему

i) приведение указанного образца в контакт с аптамером согласно настоящему изобретению или комплексом согласно настоящему изобретению,

ii) выделение указанного аптамера или комплекса, не связанного с TLR-4, и

iii) детекцию присутствия аптамера или комплекса, связанного с TLR-4, присутствующим в указанном образце.

Согласно другому аспекту настоящее изобретение относится к in vitro способу ингибирования TLR-4 в образце, который включает приведение в контакт образца, содержащего TLR-4, с аптамером согласно настоящему изобретению или комплексом согласно настоящему изобретению, в условиях, подходящих для ингибирования TLR-4.

Согласно другому аспекту настоящее изобретение относится к аптамеру согласно настоящему изобретению для применения при лечении патологии, характеризующейся увеличением экспрессии TLR4 и/или увеличением активации TLR-4.

Согласно другому аспекту настоящее изобретение относится к фармацевтической композиции, содержащей по меньшей мере один аптамер согласно настоящему изобретению или по меньшей мере один комплекс согласно настоящему изобретению, необязательно в комбинации с одним или более фармацевтически приемлемым носителем, вспомогательным веществом или растворителем.

Краткое описание чертежей

Фиг. 1. Распознавание белка TLR-4 аптамерами, выбранными с применением ELONA. Рекомбинантный белок TLR-4 человека (6xHIS-TLR-4) культивировали в концентрации 100 нг/лунку в 96-луночных микротитрационных планшетах и инкубировали при 4°С в течение 16 часов. Затем в каждую лунку добавляли по 20 пмоль каждого из аптамеров, меченых дигоксигенином, и планшет инкубировали в течение 1 часа при 37°С. Наконец, планшет инкубировали с конъюгированными с пероксидазой антителами к дигоксигенину и проявляли с применением ABTS. Анти-Li Н2А ДНК-аптамер использовали в качестве положительного контроля ( et al., 2013, PLoS ONE 8: e78886). Все эксперименты осуществляли в трех повторностях.

Фиг. 2. Вторичные структуры аптамеров TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4), предсказанные с применением программы mFold. Гуанины, которые могут входить в состав предсказанных G-квадруплексных структур, выделены прямоугольниками в программе QGRS Mapper.

Фиг. 3. Связывание аптамеров TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4) с рекомбинантным hTLR-4 (А) и с белком TLR-4, экспрессируемым в клетках (В). Все эксперименты выполняли в трех повторностях.

Фиг. 4. Антагонистический эффект аптамеров TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4) на клетки HEK-Blue hTLR4 и антагонист LPS-RS-UP (2 нг/мкл; 20 нг) в качестве контроля. Наносили аптамеры в конечных концентрациях 0,2; 2; 20 и 200 нМ или контрольный антагонист LPS-RS-UP (2 нг/мкл; 20 нг). Агонист LPS-EK-UP (0,02 нг/мкл) (А) или лизаты клеток HEK293 (молекулярный паттерн, ассоциированный с повреждениями; DAMP) (В) использовали в качестве контрольных агонистов; активность секретированной щелочной фосфатазы (SEAP) измеряли через 24 часа с применением субстрата QUANTI-Blue™ при 630 нм. Данные выражают в виде процента активности SEAP относительно контрольных клеток. Все эксперименты выполняли в трех повторностях; на фигуре представлено среднее значение для 7-9 разных экспериментов. Статистическая значимость (*Р<0,05, **Р<0,01 и ***Р<0,001).

Фиг. 5. Эффект аптамеров TLRApt#4F-T (SEQ ID NO: 2) и TLRApt#4F (SEQ ID NO: 4) на макрофаги, стимулированные в присутствии 500 нг/мл ЛПС. Высвобождение нитритов исследовали с применением реакции Грисса через 24 ч после добавления аптамеров. Образцы анализировали в двух повторностях. Различия анализировали с применением однофакторного дисперсионного анализа ANOVA, а затем критерия Бонферрони. Результат представляет собой среднее для трех экспериментов в двух повторностях. Статистическая значимость (***Р<0,001). Условные обозначения: 38х (AG) представляет собой олигонуклеотид с последовательностью SEQ ID NO: 7, которая является неспецифической последовательностью, неспособной принимать какую-либо вторичную структуру; Ингибитор: соединение 11, производное гиспанолона ( et al., 2008, Toxicol Appl Pharmacol 228:179-89).

Фиг. 6. Вторичные структуры аптамеров TLRApt#1R-T (SEQ ID NO: 1) и TLRApt#4F-T (SEQ ID NO: 2), предсказанные с применением программы mFold. Гуанины, которые могут входить в состав предсказанных G-квадруплексных структур выделены прямоугольниками в программе QGRS Mapper.

Фиг. 7. Эффект внутрибрюшинной инъекции 1 нмоль аптамеров TLRApt#1R-T (SEQ ID NO: 1), TLRApt#4F-T (SEQ ID NO: 2) и TLRApt#4F (SEQ ID NO: 4), или 38x(AG) (SEQ ID NO: 7), или основы (ФСБ + 1 мМ Mg2+) на уменьшение зоны инфаркта у использованных в экспериментах животных. У взрослых самцов мышей C57BL/10ScSn (дикого типа (WT); здоровые) и C57BL/10ScNJ (нокаутные, отсутствует функциональный TLR4), индуцировали фокальную церебральную ишемию путем окклюзии средней мозговой артерии (МСАО) с помощью лигатуры. Мышей анестезировали изофлураном и через 24 часа после МСАО оценивали размер инфаркта с помощью МРТ. Изображения, подсвеченные при Т2 (T2WI), получали на BIOSPEC ВМТ 47/40, работающем при 4,7 Т (Bruker-Medical, Эттлинген, Германия; аппарат МРТ, Многопрофильный институт Мадридского университета Комплутенсе); зону повреждения количественно определяют с применением Image J 1.41 (NIH, Бетесда, Вашингтон). Статистическая значимость (*Р<0,05). Условные обозначения: 1RT, TLRApt#1R-T; 4FT, TLRApt#4F-T; 4F, TLRApt#4F.

Фиг. 8: Кривая зависимости ответа от дозы. Эффект внутрибрюшинной инъекции разных количеств аптамеров TLRApt#4F-T (SEQ ID NO: 2) и TLRApt#4F (SEQ ID NO: 4) или основа (ФСБ + 1 мМ Mg2 +) на уменьшение зоны инфаркта у использованных в экспериментах животных. У взрослых самцов мышей C57BL/10ScSn (дикого типа (WT); здоровых) индуцировали фокальную церебральную ишемию путем окклюзии средней мозговой артерии с помощью лигатуры. Мышей анестезировали изофлураном и через 24 часа после МСАО оценивали размер инфаркта с помощью МРТ. Изображения, подсвеченные при Т2 (T2WI), были получены на BIOSPEC ВМТ 47/40, работающем при 4,7 Т (Bruker-Medical, Эттлинген, Германия; аппарат МРТ, Многопрофильный институт Мадридского университета Комплутенсе) и зону повреждения количественно определяют с помощью Image J 1.41 (NIH, Бетесда, Вашингтон). Статистическая значимость (*Р<0,05).

Фиг. 9: Проточно-цитометрический анализ. (А) Линии клеток человека HEK293 (левая панель) и 293-hTLR4A (правая панель) инкубировали с 20 нМ мечеными Alexa fluor 488 аптамерами в течение 30 минут при комнатной температуре. Клетки промывали 2 мл ФСБ и ресуспендировали в 1 мл ФСБ для анализа. На всех фигурах по оси ординат отмечена частота наблюдения событий (или число клеток), а по оси абсцисс отмечена интенсивность флуоресценции (FL1). Черная заливка: автофлуоресценция; черная линия: аптамер TLRApt#1R-T (SEQ ID NO: 31); серая линия: аптамер TLRApt#4F-T (SEQ ID NO: 42). (В) Линию клеток человека 293-hTLR4A активируют LPS-EK-UP и затем инкубируют в течение 30 мин с 20 нМ мечеными Alexa Fluor 488 аптамерами в течение 30 минут при комнатной температуре. Клетки промывают 2 мл ФСБ и ресуспендировали в 1 мл ФСБ для анализа. На всех фигурах по оси ординат отмечена частота наблюдения событий (или число клеток), а по оси абсцисс отмечена интенсивность флуоресценции (FL1). Черная заливка: автофлуоресценция; черная линия: аптамер TLRApt#1R-T (SEQ ID NO: 31); серая линия, аптамер TLRApt#4F-T (SEQ ID NO: 42).

Фиг. 10: Анализ времени полужизни аптамеров in vitro. 300 нг аптамеров в укладке инкубировали с 2 единицами λ-экзонуклеазы или ДНКазы I на протяжении нескольких периодов времени при 37°С. После этого образцы разделяли на 3% агарозном геле, полосы визуализировали с применением GelRed и количественно определяли с применением программного обеспечения Image Studio Digits V3.1.

Подробное описание изобретения

Авторы настоящего изобретения выбрали и охарактеризовали две молекулы, которые, за счет свойственных им последовательностей, при определенных показателях pH, температуры и концентрации солей могут формировать трехмерные структуры, что придает им способность к специфическому распознаванию белка TLR-4 и модуляции его активности. Указанные молекулы могут ингибировать клеточный ответ, опосредованный рецептором TLR-4 in vivo, и уменьшать размер инфаркта головного мозга в моделях ишемического инсульта на животных, что предполагает их потенциальную терапевтическую роль.

Аптамер, специфический в отношении TLR-4

Согласно первому аспекту настоящее изобретение относится к аптамеру нуклеиновой кислоты, обладающему способностью к специфическому связыванию и ингибированию TLR-4, здесь и далее в настоящем документе называемому «аптамером согласно настоящему изобретению и содержащему последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 (CCGGCACGGGACAAGGCGCGGGACGGCGTAGATCAGGTCGACACC) и SEQ ID NO: 2 (GGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGTTGGCCCTAAATACGAG), или его функционально эквивалентному варианту.

Термин «аптамер» в контексте настоящего изобретения относится к однонитевым цепям нуклеиновых кислот, принимающим специфическую третичную структуру, позволяющую им связываться с молекулярными мишенями с высокими специфичностью и аффинностью, сопоставимыми со специфичностью и аффинностью моноклональных антител, за счет взаимодействий, отличных от стандартного спаривания оснований по Уотсону-Крику.

Термин «нуклеиновая кислота» в контексте настоящего изобретения относится в любому типу нуклеиновой кислоты, например, ДНК и РНК, и к ее вариантам, таким как пептидная нуклеиновая кислота (ПНК), закрытая нуклеиновая кислота (ЗНК), а также к их комбинациям, модификациям, в том числе модифицированным нуклеотидам, и т.п. Термины «нуклеиновая кислота» и «олигонуклеотид» и «полинуклеотид» используются в контексте настоящего изобретения взаимозаменяемо. Нуклеиновые кислоты могут быть очищены из природных источников, получены с применением систем рекомбинантной экспрессии и, необязательно, очищены, химически синтезированы и т.п. В соответствующих случаях, например, в случае химически синтезированных молекул, нуклеиновые кислоты могут содержать аналоги нуклеозидов, например, аналоги, содержащие химически модифицированные основания или сахара, модификации остова и т.п. Если не указано иное, последовательности нуклеиновых кислот приводятся в направлении 5'-3'.

Термин «TLR-4» в контексте настоящего изобретения относится к мембранному Toll-подобному рецептору 4. Рецептор TLR-4 может также называться ARMD10, CD284, TLR4 или hTOLL. Рецептор TLR-4 человека был зарегистрирован в GenBank под номером доступа О00206.2 27th мая 2014 года, и его кодирует ген TLR4. Он состоит из 839 аминокислот, где остатками 1-23 представлена сигнальная последовательность, остатками 24-631 представлен внеклеточный домен, остатками 632-652 представлен трансмембранный домен и остатками 653-839 представлен цитоплазматический домен.

Согласно конкретному варианту реализации указанный аптамер может специфически связываться с внеклеточным доменом TLR-4 (аминокислоты 24-631).

Настоящим изобретением предусмотрен аптамер, содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 (CCGGCACGGGACAAGGCGCGGGACGGCGTAGATCAGGTCGACACC) и SEQ ID NO: 2 (GGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGTTGGCCCTAAATACGAG), или его функционально эквивалентный вариант.

Настоящее изобретение также предусматривает аптамеры согласно настоящему изобретению, состоящие из таких нуклеиновых кислот, как ДНК и РНК, а также вариантов и аналогов нуклеиновых кислот, и их комбинаций, модификаций, в том числе, без ограничения, модифицированных остовов нуклеиновых кислот, замещающих связей, модифицированных нуклеотидов и аналогов рибозы или дезоксирибозы, модифицированных нуклеотидов и т.п., обладающие способностью к специфическому связыванию и ингибированию TLR-4, составляющими по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 91%, по меньшей мере 92%, по меньшей мере 93%, по меньшей мере 94%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, по меньшей мере 99%, или по меньшей мере 100% способности к специфическому связыванию и ингибированию TLR-4 аптамера, имеющего последовательность SEQ ID NO: 1 или SEQ ID NO: 2. Неограничивающие примеры вариантов и аналогов нуклеиновых кислот включают, без ограничения, ПНК, ЗНК и ТНК.

Термин «вариант нуклеиновой кислоты» или «аналог нуклеиновой кислоты» в контексте настоящего изобретения относится к вариантам и аналогам нуклеиновых кислот, включая, без ограничений, модифицированные остовы нуклеиновых кислот, замещающие связи, модифицированные нуклеотиды, и аналоги рибозы или дезоксирибозы. Например, варианты нуклеиновых кислот в соответствии с настоящим изобретением могут содержать структуры с синтетическими аналогами типичного фосфодиэфирного остова. Они включают, без ограничения, фосфотиоат, фосфородитиоат, метилфосфонат, фосфорамидат, алкиловый фосфотриэфир, сульфамат, 3'-тиоацеталь, метилен(метилимино), 3'-N-карбамат, морфолинкарбамат и пептидные нуклеиновые кислоты (ПНК), метилфосфонатные связи или чередующиеся метилфосфонатные, фосфодиэфирные и бензилфосфонатные связи.

Варианты нуклеиновых кислот могут также содержать одну или большее количество «замещающих» связей в общепринятом в данной области техники смысле. Некоторые из указанных замещающих связей являются неполярными и вносят вклад в обеспечение способности аптамера к проникновению через мембраны. Указанные «замещающие» связи определены в настоящем документе как стандартные альтернативные связи, такие как фосфотиоат или фосфорамидат, и их синтезируют согласно описанию в общедоступных публикациях. Альтернативные варианты связывающих групп включают, без ограничения, варианты реализации, включающие фрагмент формулы P(O)S, («тиоат»), P(S)S («дитиоат»), P(O)NR'2, P(O)R', P(O)OR6, СО, или CONR'2, где R' представляет собой Н (или соль) или алкильную группу, содержащую 1-12 атомов углерода, и R6 представляет собой алкильную группу, содержащую 1-9 атомов углерода, которая связывается со смежными нуклеотидами через -S- или -О-. Дитиоатные связи описаны в заявке на патент США №248517. Настоящее изобретение также предусматривает применение замещающих связей, в том числе межнуклеотидных связей не на основе фосфора, таких как 3'-тиоформацетальные, (-S-CH2-O-), формацетальные (-О-СН2-О-) и 3'-аминные межнуклеотидные связи (-NH-CH2-CH2-), описанные в заявках на патент США №690786 и №763130. Одна или большее количество замещающих связей могут применяться в аптамерах согласно настоящему изобретению с целью дополнительного облегчения связывания с TLR-4 или для повышения стабильности аптамеров при воздействии нуклеазами, а также для обеспечения проникающей способностью. Все связи в составе одного аптамера не обязательно должны быть идентичными, и, соответственно, настоящим изобретением охвачены аптамеры, все связи в которых идентичны, а также аптамеры с варьирующим составом связей.

Аналогичным образом, варианты нуклеиновых кислот в соответствии с настоящим изобретением могут также содержать аналоговые формы рибозы или дезоксирибозы, хорошо известные в данной области техники, в том числе, без ограничения, сахара, замещенные по 2', такие как 2'-O-метил-рибоза, 2'-фтор-рибоза или 2'-азидо-рибоза, карбоциклические аналоги, α-аномерные сахара, эпимерные сахара, такие как арабиноза, ксилозы или ликсозы, пиранозные сахара, фуранозные сахара и седогептулозы. Указанные нуклеиновые кислоты могут также включать треозо-нуклеиновую кислоту (ТНК; также называются альфа- треофуранозильными олигонуклеотидами) (см., например, Schong et al., Science 2000, November 17, 290 (5495): 1347-1351). В частности, замена в положении 2' остатка фуранозы особенно важна в отношении увеличения стабильности.

Термин «нуклеотид» в контексте настоящего изобретения относится к мономерам, из которых состоят нуклеиновые кислоты. Нуклеотиды образованы пентозой, азотистым основанием и фосфатной группой, и связаны фосфодиэфирными связями. Нуклеотиды, входящие в состав ДНК и РНК, различаются пентозой, которая представлена дезоксирибозой и рибозой, соответственно. Азотистые основания, в свою очередь, делят на пуриновые азотистые основания, представленные аденином (А) и гуанином (G), и пиримидиновые азотистые основания, представленные тимином (Т), цитозином (С) и урацилом (U). Тимин встречается только в ДНК, а урацил встречается только в РНК. Настоящее изобретение предусматривает применение модифицированных нуклеотидов в аптамере согласно настоящему изобретению. Термин «модифицированный нуклеотид» в контексте настоящего изобретения относится к аналогам известных природных нуклеотидов, обладающим аналогичными или лучшими связывающими характеристиками. Аналоги пуринов и пиримидинов хорошо известны в данной области техники и включают, без ограничения, азиридинилцитозин, 4-ацетилцитозин, 5-фторурацил, 5-бромурацил, 5-карбоксиметиламинометил-2-тиоурацил, 5-карбоксиметиламинометилурацил, инозин, N6-изопентениладенин, 1-метиладенин, 1-метилпсевдоурацил, 1-метилгуанин, 1-метилинозин, 2,2-диметилгуанин, 2-метиладенин, 2-метилгуанин, 3-метилцитозин, 5-метилцитозин, N6-метиладенин, 7-метилгуанин, 5-метиламинометилурацил, 5-метоксиаминометил-2-тиоурацил, бета-D-маннозилкеозин, 5-метоксиурацил, 2-метилтио-N-6-изопентениладенин, сложный метиловый эфир урацил-5-оксиуксусной кислоты, псевдоурацил, кеозин, 2-тиоцитозин, 5-метил-2-тиоурацил, 2-тиоурацил, 4-тиоурацил, 5-метилурацил, урацил-5-оксиуксусную кислоту, и 2,6-диаминопурин. Помимо перечисленных выше модифицированных нуклеотидов не содержащие пурин или пиримидин остатки нуклеотидов также могут быть охвачены настоящим изобретением.

Помимо перечисленных выше вариантов, входящие в настоящее изобретение варианты нуклеиновых кислот также включают ПНК, ЗНК и цепи 5'-5' или 3'-3'. Термин «пептидная нуклеиновая кислота», или «ПНК» в контексте настоящего изобретения относится к олигонуклеотиду, остов которого состоит из повторяющихся единиц N-(2-аминоэтил)-глицина, связанных пептидными связями, при этом указанные разные азотистые основания связаны с основной цепью метиленовой связью (-СН2-) и карбонильной группой (-(С=O)-). Термин «закрытая нуклеиновая кислота», или «ЗНК» в контексте настоящего изобретения относится к модифицированному РНК-нуклеотиду, фрагмент рибозы которого модифицирован дополнительной связью, соединяющей кислород в положении 2' с углеродом в положении 4', «запирая» рибозу в 3'-эндо-конформации. Термин «5'-5' цепь» или «3'-3' цепь» в контексте настоящего изобретения относится к олигонуклеотидам, в составе которых нуклеотид на 3'- или 5'-конце, соответственно, инвертирован.

В настоящем документе термин «функционально эквивалентный вариант» относится к аптамерам с последовательностями, по существу аналогичными SEQ ID NO: 1 или SEQ ID NO: 2, сохраняющими способность к специфическому связыванию и ингибированию TLR-4. Функционально эквивалентный вариант аптамера согласно настоящему изобретению может представлять собой последовательность нуклеиновой кислоты, происходящую из последовательности SEQ ID NO: 1 или последовательности SEQ ID NO: 2, включающую добавление, замену или модификацию одного или большего количества нуклеотидов. Согласно иллюстративному примеру функционально эквивалентные варианты аптамера согласно настоящему изобретению включают последовательности, содержащие 1 добавленный нуклеотид, 2 добавленных нуклеотида, 3 добавленных нуклеотида, 4 добавленных нуклеотида, 5 добавленных нуклеотидов, 10 добавленных нуклеотидов, 15 добавленных нуклеотидов, 20 добавленных нуклеотиды, 25 добавленных нуклеотидов, 30 добавленных нуклеотидов, 35 добавленных нуклеотидов, 40 добавленных нуклеотидов, 45 добавленных нуклеотидов, 50 добавленных нуклеотидов, 60 добавленных нуклеотидов, 70 добавленных нуклеотидов, 80 добавленных нуклеотидов, 90 добавленных нуклеотидов, 100 добавленных нуклеотидов, 150 добавленных нуклеотидов, 200 добавленных нуклеотидов, по меньшей мере 500 добавленных нуклеотидов, по меньшей мере 1000 нуклеотидов или более на 5'-конце последовательности SEQ ID NO: 1 или SEQ ID NO: 2, и/или содержащие 1 добавленный нуклеотид, 2 добавленных нуклеотида, 3 добавленных нуклеотида, 4 добавленных нуклеотида, 5 добавленных нуклеотидов, 10 добавленных нуклеотидов, 15 добавленных нуклеотидов, 20 добавленных нуклеотидов, 25 добавленных нуклеотидов, 30 добавленных нуклеотидов, 35 добавленных нуклеотидов, 40 добавленных нуклеотидов, 45 добавленных нуклеотидов, 50 добавленных нуклеотидов, 60 добавленных нуклеотидов, 70 добавленных нуклеотидов, 80 добавленных нуклеотидов, 90 добавленных нуклеотидов, 100 добавленных нуклеотидов, 150 добавленных нуклеотидов, 200 добавленных нуклеотидов, по меньшей мере 500 добавленных нуклеотидов, по меньшей мере 1000 нуклеотидов или более на 3'-конце последовательности SEQ ID NO: 1 или SEQ ID NO: 2, и сохраняющие способность к специфическому связыванию и ингибированию TLR-4, составляющую по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 91%, по меньшей мере 92%, по меньшей мере 93%, по меньшей мере 94%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, по меньшей мере 99% или по меньшей мере 100% способности к специфическому связыванию и ингибированию TLR-4.

Настоящее изобретение также включает аптамеры, содержащие последовательности нуклеотидов, отличающиеся идентичностью последовательностей, составляющей по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 91%, по меньшей мере 92%, по меньшей мере 93%, по меньшей мере 94%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, или по меньшей мере 99% относительно последовательности SEQ ID NO: 1 или SEQ ID NO: 2, и сохраняющие способность к специфическому связыванию и ингибированию TLR-4, составляющую по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 91%, по меньшей мере 92%, по меньшей мере 93%, по меньшей мере 94%, по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, по меньшей мере 99%, или по меньшей мере 100% способности к специфическому связыванию и ингибированию TLR-4.

Термины «идентичность», «идентичный» или «процент идентичности» в контексте двух или большего числа нуклеиновых кислот относятся к двум или большему числу последовательностей или субпоследовательностей, идентичных или содержащих заданный процент идентичных нуклеотидов или остатков аминокислот при сравнении и выравнивании (с введением пропусков, при необходимости) для достижения максимального соответствия, без учета каких-либо консервативных замен аминокислот, которые считают идентичными при оценке идентичности последовательностей. Процент идентичности может быть измерен с применением программного обеспечения для сравнения последовательностей или алгоритмов или путем визуального исследования. В данной области техники известны различные алгоритмы и программное обеспечение, подходящие для применения при выравнивании последовательностей аминокислот или нуклеотидов. Одним из таких неограничивающих примеров алгоритма для выравнивания последовательностей является алгоритм, описанный в источнике: Karlin et al., 1990, Proc. Natl. Acad. Sci., 87:2264-8, с модификациями по: Karlin et al., 1993, Proc. Natl. Acad. Sci., 90:5873-7, включенный в программы NBLAST и XBLAST (Altschul et al., 1991, Nucleic Acids Res., 25:3389-402). Согласно определенным вариантам реализации могут применяться Gapped BLAST согласно описанию в Altschul et al., 1997, Nucleic Acids Res. 25:3389-402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266:460-80), ALIGN, ALIGN-2 (Genentech, Южный Сан-Франциско, Калифорния) или Megalign (DNASTAR) представляют собой дополнительное общедоступное программное обеспечение, подходящее для применения при выравнивании последовательностей. Согласно определенным вариантам реализации процент идентичности двух последовательностей нуклеотидов определяют с применением программы GAP в пакете программного обеспечения GCG (например, с использованием матрицы NWSgapdna.CMP и штрафа за введение пропуска, составляющего 40, 50, 60, 70 или 90, и штрафа за удлинения пропуска, составляющего 1, 2, 3, 4, 5 или 6). Согласно определенным альтернативным вариантам реализации может применяться программа GAP пакета программного обеспечения GCG, включающая алгоритм Нидлмана и Вунша (Needleman and Wunsch, J. Mol. Biol. 48:444-53 (1970)) для определения процента идентичности двух последовательностей аминокислот (например, с применением либо матрицы Blossum 62, либо РАМ250, и штрафа за введение пропуска, составляющего 16, 14, 12, 10, 8, 6 или 4, и штрафа за удлинение пропуска, составляющего 1, 2, 3, 4, 5). Как вариант, согласно определенным вариантам реализации процент идентичности последовательностей нуклеотидов или аминокислот определяют с применением алгоритма Майерса и Миллера (Myers and Miller, CABIOS, 4:11-7 (1989)). Например, процент идентичности может быть определен с применением программы ALIGN (версия 2.0) и РАМ 120 с таблицей остатков, штрафа за продление пропуска, составляющего 12, и штрафа за пропуск в последовательности, составляющего 4. Подходящие параметры для максимального выравнивания в конкретной программе для выравнивания могут быть определены специалистом в данной области техники. Согласно определенным вариантам реализации используют параметры по умолчанию программного обеспечения для выравнивания. Согласно определенным вариантам реализации процент идентичности «X» первой последовательности аминокислот и второй последовательности аминокислот вычисляют как 100×(Y/Z), где Y представляет собой число остатков аминокислот, соответствующих идентичным совпадениям при выравнивании указанных первой и второй последовательностей (путем визуального исследования или конкретной программы для выравнивания последовательностей), a Z представляет собой общее число остатков второй последовательности. В том случае, если вторая последовательность длиннее первой последовательности, процент идентичности может быть определен только для области перекрывания указанных первой и второй последовательностей. В указанном случае также может применяться приведенная выше формула, однако значение Z будет представлять длину области, где перекрываются первая и вторая последовательности, при этом длина указанной области по существу будет равна длине первой последовательности.

Согласно неограничивающему примеру, наличие определенного процента идентичности конкретного полинуклеотида (например, составляющей по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, и согласно некоторым вариантам реализации по меньшей мере 95%, 96%, 97%, 98% или 99%) референсной последовательности может, согласно определенным вариантам реализации, быть определено с применением программы Bestfit (пакет для анализа последовательностей Wisconsin Package, версия 8 для Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). В программе Bestfit используется алгоритм локальной гомологии Смита и Уотермана (Smith and Waterman, Advances in Applied Mathematics 2:482-9 (1981)), для нахождения сегмента максимальной гомологии двух последовательностей. При применении Bestfit или любой другой программы для выравнивания последовательностей для определения того, является ли конкретная последовательность, например, на 95% идентичной референсной последовательности в соответствии с настоящим изобретением, параметры выбирают таким образом, чтобы рассчитать процент идентичности всей полноразмерной референсной последовательности нуклеотидов, при этом в гомологичной последовательности допускаются пропуски, составляющие до 5% от общего числа нуклеотидов референсной последовательности.

Согласно некоторым вариантам реализации две нуклеиновые кислоты согласно настоящему изобретению по существу идентичны, что означает, что они характеризуются по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, и согласно некоторым вариантам реализации по меньшей мере 95%, 96%, 97%, 98%, 99% идентичности последовательностей нуклеотидов или остатков аминокислот, при сравнении и выравнивании для достижения максимального соответствия, по оценке с применением алгоритма сравнения последовательностей или путем визуального исследования. Идентичность может наблюдаться на протяжении области последовательностей, имеющей длину, составляющую по меньшей мере приблизительно 10, приблизительно 20, приблизительно 40-60 остатков или соответствующую любому целочисленному значению в указанных интервалах, и может наблюдаться на протяжении более области, имеющей длину более 60-80 остатков, например, по меньшей мере приблизительно 90-100 остатков; согласно некоторым вариантам реализации сравниваемые последовательности по существу идентичны на протяжении полной длины, например, кодирующей области последовательности нуклеотидов.

Термин «специфическое связывание» или «специфическое связывание с TLR-4» в контексте настоящего изобретения относится к нековалентной физической связи между двумя молекулами, аптамером согласно настоящему изобретению и рецептором TLR-4. Связывание между аптамером согласно настоящему изобретению и рецептором TLR-4 считают специфическим в том случае, если сила связывания между ними по меньшей мере в 10 раз, по меньшей мере в 15 раз, по меньшей мере в 20 раз, по меньшей мере в 25 раз, по меньшей мере в 50 раз, по меньшей мере в 75 раз или по меньшей мере в 100 раз превышает силу связывания между аптамером согласно настоящему изобретению и нерелевантной молекулой. Связывание между аптамером согласно настоящему изобретению и рецептором TLR-4 также считают специфическим в том случае, если равновесная константа диссоциации Kd составляет 10-3 М или менее, 10-4 М или менее, 10-5 М или менее, 10-6 М или менее, 10-7 М или менее, 10-8 М или менее, 10-9 М или менее, 10-10 М или менее, 10-11 М или менее, или 10-12 М или менее в используемых условиях, например, в физиологических условиях, условиях культивирования клеток или условиях, обеспечивающих выживание клеток.

Способность аптамера согласно настоящему изобретению к специфическому связыванию с TLR-4 может быть определена с применением ряда анализов, доступных в данной области техники. Предпочтительно, способность аптамера согласно настоящему изобретению к специфическому связыванию с TLR-4 определяют посредством анализов связывания in vitro, например, ферментного олигонуклеотидного анализа (ELONA), ферментного аптамерного сорбентного анализа (ELASA), осаждения и количественной ПЦР (кПЦР), или с помощью флуоресцентных техник, таких как аптагистохимия, аптацитохимия, флуоресцентная микроскопия или проточная цитометрия. Аналогичным образом, как способность к специфическому связыванию с TLR-4, так и аффинность аптамера в отношении TLR-4 могут быть определены посредством техник, хорошо известных специалистам в данной области техники, таких как анализ на сдвиг подвижности в геле, поверхностный плазмонный резонанс (ППР), кинетический капиллярный электрофорез и флуоресцентный анализ связывания. Вкратце, флуоресцентный анализ связывания состоит из инкубации магнитных шариков, покрытых TLR-4 с аптамером согласно настоящему изобретению в разных концентрациях (например, от 0 до 100 нМ) и меченых (например, карбоксифлуоресцеином, FAM), и последующих элюции и детекции связанных аптамеров; константы диссоциации (Kd) рассчитывают с применением нелинейного аппроксимационного анализа.

Термин «ингибирование TLR-4» в контексте настоящего изобретения относится к блокированию или снижению активности TLR-4, т.е. передаче опосредованного рецептором TLR-4 сигнала. Считается, что активность TLR-4 ингибирована ингибиторным агентом или антагонистом, если его активность составляет по меньшей мере 95%, по меньшей мере 90%, по меньшей мере 85%, по меньшей мере 80%, по меньшей мере 75%, по меньшей мере 70%, по меньшей мере 65%, по меньшей мере 60%, по меньшей мере 55%, по меньшей мере 50%, по меньшей мере 45%, по меньшей мере 40%, по меньшей мере 35%, по меньшей мере 30%, по меньшей мере 25%, по меньшей мере 20%, по меньшей мере 15%, по меньшей мере 10%, по меньшей мере 5%, по меньшей мере 1% или менее от активности TLR-4 в присутствии его естественного агониста ЛПС.

Способность аптамера согласно настоящему изобретению к ингибированию TLR-4 может быть определена путем проведения ряда анализов, доступных в данной области техники. Предпочтительно, способность к ингибированию TLR-4 аптамера согласно настоящему изобретению определяют путем анализа in vitro на клетках, экспрессирующих рекомбинантный TLR-4 и репортерный ген, экспрессия которого связана с активацией рекомбинантного TLR-4. Для специалиста в данной области техники будут очевидны несколько вариантов указанного способа, в зависимости от использованных клеток и рекомбинантного гена. Пример указанного анализа включен в примеры реализации настоящего изобретения (раздел «Материалы и методы» и пример 2). Другие доступные техники включают определение уровней воспалительных цитокинов, таких как ИЛ-1, ИЛ-8, ФНО-альфа и ИЛ-12, высвобождаемых клетками, экспрессирующими TLR-4.

Согласно конкретному варианту реализации аптамер согласно настоящему изобретению состоит из 30-200 нуклеотидов, предпочтительно из 35-150 нуклеотидов, более предпочтительно из 40-100 нуклеотидов, и еще более предпочтительно из 45-80 нуклеотидов.

Согласно другому конкретному варианту реализации аптамер согласно настоящему изобретению включает последовательность, выбранную из группы, состоящей из SEQ ID NO: 3 (GTTGCTCGTATTTAGGGCCACCGGCACGGGACAAGGCGCGGGACGGCGTAGATCAGGTCGACACCAGTCTTCATCCGC) и SEQ ID NO: 4 (GCGGATGAAGACTGGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGTTGGCCCTAAATACGAGCAAC). Последовательность SEQ ID NO: 3 представляет собой функционально эквивалентный вариант SEQ ID NO: 1, а последовательность SEQ ID NO: 4 представляет собой функционально эквивалентный вариант SEQ ID NO: 2.

Согласно конкретному варианту реализации указанная нуклеиновая кислота представляет собой ДНК. Согласно другому конкретному варианту реализации указанная нуклеиновая кислота представляет собой РНК. Согласно другому конкретному варианту реализации указанная нуклеиновая кислота представляет собой ПНК. Согласно другому конкретному варианту реализации указанная нуклеиновая кислота представляет собой ЗНК. Согласно другому конкретному варианту реализации указанная нуклеиновая кислота представляет собой ТНК.

Согласно другому конкретному варианту реализации указанный TLR-4 представляет собой TLR-4, выбранный из группы, образованной TLR-4 мыши, крысы, кролика, свиньи, кошки, собаки, лошади, примата и человека. Согласно предпочтительному варианту реализации указанный TLR-4 представляет собой TLR-4 человека.

Получение аптамера согласно настоящему изобретению может проводиться с применением стандартных для данной области техники способов. Неограничивающие примеры техник для получения аптамеров включают ферментативные техники, такие как транскрипция, системы рекомбинантной экспрессии и стандартный твердофазный (или жидкофазный) химический синтез, все из которых коммерчески доступны. В соответствующих случаях, например, когда аптамер согласно настоящему изобретению включает варианты нуклеиновых кислот, такие как описанные выше, аналоги нуклеотидов, такие как аналоги, содержащие химически модифицированные основания или сахара, модификации остова и т.п., аптамер согласно настоящему изобретению получают с применением химического синтеза. Как вариант, в том случае, когда длина указанных аптамеров составляет 200 нуклеотидов или более, предпочтительной для получения аптамеров техникой будет экспрессия. Аптамеры, полученные с применением указанной или любых из вышеперечисленных техник могут необязательно быть очищены с применением способов, хорошо известных в данной области техники.

Комплекс согласно настоящему изобретению

Как будет понятно специалисту в данной области техники, такие признаки, как малый размер, стабильность и простота получения аптамера согласно настоящему изобретению позволяют получать указанный аптамер в связанном с второй молекулой виде. В частности, это целесообразно в тех случаях, когда вторая молекула представляет собой функциональную группу. В результате связывания аптамера согласно настоящему изобретению и функциональной группы формируется комплекс, отличающийся комбинацией функций обеих составляющих, т.е. комплекс, обладающий способностью к специфическому связыванию и ингибированию TLR-4, а также активностью, связанной с функциональной группой.

Соответственно, согласно другому аспекту настоящее изобретение относится к комплексу, здесь и далее в настоящем документе называемому «комплексом согласно настоящему изобретению», содержащему аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4, содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу.

Термин «аптамер» был подробно раскрыт в разделе определений и в описании аптамера, специфического в отношении TLR-4 (выше); его определения и особенности также относятся и к комплексу согласно настоящему изобретению.

Термин «функциональная группа» в контексте настоящего изобретения относится к соединениям, подходящим для реализации по меньшей мере одной функции. Указанная функция включает, без ограничения, способность к специфическому связыванию с TLR-4 или с другими рецепторами TLR, способность к ингибированию TLR-4 или других рецепторов TLR, способность выступать в качестве прямо или непрямо детектируемого соединения, способность к индукции клеточной смерти, способность к транспортировке терапевтического средства и т.п. Как будет понятно специалисту в данной области техники, функциональная группа, таким образом, может быть связана с одной или несколькими функциями. Неограничивающие примеры функциональных групп включают детектируемые реагенты и лекарственные средства. Указанные функциональные группы функционируют в качестве агентов для визуализации, лекарственных средств и т.п.

Соответственно, согласно конкретному варианту реализации указанная функциональная группа выбрана из детектируемого реагента, лекарственного средства и наночастицы.

Согласно другому конкретному варианту реализации указанная функциональная группа представляет собой детектируемый реагент. Термины «детектируемый реагент», «агент для визуализации» и «агент для контрастирования» используются в настоящем документе взаимозаменяемо и относятся к биосовместимому соединению, применение которого способствует различению различных частей изображения за счет повышения «контраста» между казанными различными областями изображения. Термин «агенты для контрастирования», соответственно, охватывает агенты, которые используются для повышения качества изображения, которое, тем не менее, может быть получено и в отсутствие такого агента (как, например, в случае МРТ), а также агенты, необходимые для получения изображения (как, например, в случае ядерной визуализации). Подходящие агенты для контрастирования включают, без ограничения, агенты для контрастирования для визуализации радионуклидов, для компьютерной томографии (КТ), для Раман-спектроскопии, для магнитно-резонансной визуализации (МРТ) и для оптической визуализации.

Детектируемые реагенты для визуализации радионуклидов, включая радиофармацевтические средства, обычно метят излучателями позитронов, такими как 11С, 13N, 15O, 18F, 82Rb, 62Cu, 64Cu, и 68Ga86Y, 124I, 213Bi и 211At. Радиофармацевтические средства для ОЭКТ обычно метят такими излучателями позитронов, как как 94mTc, 201Tl и 67Ga. Способы визуализации радионуклидов (позитронно-эмиссионная томография, (ПЭТ); однофотонная эмиссионная компьютерная томография (ОЭКТ)) представляют собой диагностические техники кросс-секционной визуализации для картирования локализации и концентрации меченых радионуклидами радиоизотопных индикаторов. ПЭТ и ОЭКТ могут применяться для локализации и характеризации радионуклида путем оценки метаболической активности. ПЭТ и ОЭКТ обеспечивают получение информации на клеточном уровне, например, о жизнеспособности клеток. В случае ПЭТ излучатель позитронов вводят пациенту, за которым может осуществляться наблюдение по мере прохождения вещества по организму. Согласно некоторым вариантам реализации настоящего изобретения комплекс согласно настоящему изобретению применяют для ПЭТ или ОЭКТ визуализации in vivo. К ПЭТ весьма близка однофотонная эмиссионная компьютерная томография, или ОЭКТ. Основное различие между ними состоит в том, что вместо испускающего позитроны вещества в ОЭКТ используется радиоактивный индикатор, испускающий низкоэнергетические фотоны. Другие неограничивающие примеры радионуклидов включают изотопы, излучающие гамма-частицы, такие как 99mTc, 123I и 111In, которые могут применяться для радиосцинтиграфии с применением гамма-камер или компьютерной однофотонной эмиссионной томографии, а также излучатели бета-частиц, такие как 131I, 90Y, 99mTc, 177Lu и 67Cu". Специалисту в данной области техники будет понятно, что радионуклиды могут также применяться в терапевтических целях.

Детектируемые реагенты для КТ-визуализации включают, например, йодированные или бромированные контрастные среды. Примеры указанных агентов включают иоталамат, иогексил, диатризоат, иопамидол, этиодол и иопаноат. Гадолиниевые агенты также, как сообщалось, подходят для применения в качестве агентов для контрастирования при КТ. Например, гадопентатные агенты использовались в качестве агентов для контрастирования при КТ. Компьютерная томография (КТ) предусмотрена настоящим изобретением в качестве способа визуализации. КТ позволяет построить трехмерное изображение любой части организма посредством получения серий рентгеновских снимков, иногда более тысячи, под различными углами с последующим компьютерным комбинированием. Компьютер запрограммирован таким образом, чтобы отображать двухмерные срезы под любым углом и на любой глубине. При проведении КТ внутривенная инъекция рентгеноконтрастного агента для контрастирования, такого как описанные в настоящем документе, может облегчать идентификацию и разграничение масс мягких тканей в тех случаях, когда исходные КТ-изображения не несут диагностической информации.

Детектируемые реагенты для оптической визуализации включают, например, флуоресцеин, производное флуоресцеина, индоцианиновый зеленый, краситель Oregon Green, производное Oregon Green, родаминовый зеленый, производное родаминового зеленого, эозин, эритрозин, краситель Texas Red, производное Texas Red, малахитовый зеленый, сульфосукцинимидиловый сложный эфир с наночастицами золота (Nanogold), краситель Cascade Blue, производное кумарина, нафталин, производное пиридилоксазола, краситель Cascade Yellow, краситель дапоксил и ряд других флуоресцентных соединений, таких как Cy3, Cy2, Cy5, семейство флуоресцентных меток Alexa Fluor® (Molecular Probes, Inc.), карбоксифлуоресцеин (FAM) и флуоресцеин-изотиоцианат (ФИТЦ).

Согласно другому предпочтительному варианту реализации детектируемый реагент представляет собой белок. Термин «белок» в контексте настоящего изобретения относится к макромолекулам, состоящим из одной или большего количества аминокислотных цепей. Белки отвечают за выполнение разнообразных клеточных функций, что основано на их способности специфически связывать другие молекулы. Белки могут быть связаны с другими белками, а также с молекулами субстрата малого размера. Неограничивающие примеры белков, подходящих для целей настоящего изобретения, включают, без ограничения, ферменты, флуоресцентные белки, люминесцентные белки и антигены.

Согласно более предпочтительному варианту реализации указанный белок представляет собой фермент. Термин «фермент» в контексте настоящего изобретения относится к белку, функционирующему в качестве высокоселективного катализатора, увеличивающего как скорость, так и специфичность метаболической реакции, в отношении которой он является специфическим. Неограничивающие примеры ферментов, подходящие для применения в настоящем изобретении, включают, без ограничения, пероксидазу хрена (HRP) и щелочную фосфатазу. Как будет понятно специалисту в данной области техники, подходящие для применения в настоящем изобретении ферменты являются непрямо детектируемыми благодаря способности катализировать модификацию субстрата с получением соединения, детектируемого с применением колориметрии, хемилюминесценции или флуориметрии. Примеры подходящих субстратов включают, без ограничения, n-нитрофенилфосфат (PNPP), 2,2'-азинобис[3-этилбензотиазолин-6-сульфоновую кислоту] (ABTS), о-фенилендиамин (OPD), и 3,3',5,5'-тетраметилбензидин (ТМВ).

Биолюминесцентные белки или фотобелки являются частным случаем окислительных ферментов, способных осуществлять химическую реакцию с участием специфических простетических групп, в результате чего наблюдается световое излучение, не требующее предварительного возбуждения. Неограничивающие примеры биолюминесцентных белков включают люциферазу светлячков, люциферазу Renilla и экворин.

Согласно еще одному более предпочтительному варианту реализации указанный белок представляет собой флуоресцентный белок. Термин «флуоресцентный белок» в контексте настоящего изобретения относится к белку, обладающему способностью испускать свет при возбуждении на подходящей для возбуждения длине волны. Неограничивающие примеры флуоресцентных белков, которые могут использоваться для комплекса согласно настоящему изобретению, включают, без ограничения, GFP, GFPuv, BFP, CFP, YFP, EBFP2, mCerulean, mCerulean3, mVenus, mTurquoise, T-Sapphire, цитрин, amFP486, zFP506, zFP538, drFP, DsRed, mCherry, dTomate, mTFP1, TagRFP-T, mKO2, mRuby, mKate, mAmetrine, REACh, R-фикоэритрин (R-PE) и аллофикоцианин (АРС).

Согласно еще одному более предпочтительному варианту реализации указанная белок представляет собой люминесцентный белок. Термин «люминесцентный белок» в контексте настоящего изобретения относится к белку, способному испускать свет при возбуждении на подходящей для возбуждения длине волны. Неограничивающие примеры флуоресцентных белков, которые могут использоваться для комплекса согласно настоящему изобретению, включают, без ограничения, белки, включенные в таблицу 1, в сочетании с соответствующими длинами волн возбуждения и эмиссии.

Согласно еще одному более предпочтительному варианту реализации указанный белок представляет собой антиген. Термин «антиген» в контексте настоящего изобретения относится к молекуле, которая индуцирует иммунный ответ в организме. Соответственно, антиген может применяться для получения распознающего и специфически связывающего его антитела. Неограничивающие примеры антигенов включают, в том числе, опухолевые антигены, такие как карциноэмбриональный антиген (КЭА), HER2, простатический специфический мембранный антиген (ПСА) и тканевый активатор плазминогена и его рекомбинантный варианты, такие как Activase®, а также бактериальные антигены, аллергены и т.п. Как будет понятно специалисту в данной области техники, подходящие для применения в настоящем изобретении антигены являются непрямо детектируемыми благодаря тому, что они могут распознаваться антителом.

Согласно другому предпочтительному варианту реализации указанный детектируемый реагент представляет собой гаптен. Термин «гаптен» в контексте настоящего изобретения относится к группе химических соединений с молекулами малого размера (<10000 Да), которые являются антигенными, однако неспособны сами по себе индуцировать специфическую иммунную реакцию. Химическое связывание гаптена с большим иммуногенным белком, называемым носителем, приводит к получению конъюгата иммуногенного носителя с гаптеном, способного индуцировать специфическую иммунную реакцию. Неограничивающие примеры витаминов включают биотин (витамин В7), дигоксигенин, динитрофенол (DNP) и нитро-йодфенол (NIP). Согласно более предпочтительному варианту реализации указанный витамин представляет собой биотин. Термин «биотин» в контексте настоящего изобретения относится к водорастворимому и растворимому в спиртах термически стабильному витамину, также называемому витамином Н и витамином В7, характеризующемуся специфическим связыванием с авидином с максимальным описанным на сегодняшний день сродством: Kd=10-15 М. Как будет понятно специалисту в данной области техники, биотин является непрямо детектируемым благодаря способности к специфическому распознаванию авидином или его вариантами, такими как стрептавидин и нейтравидин.

Согласно другому конкретному варианту реализации указанная функциональная группа представляет собой лекарственное средство. Термин «лекарственное средство» в контексте настоящего изобретения относится к химическому веществу, применяемому для лечения, исцеления или предотвращения заболевания или состояния, такого как патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4. Термин «патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4», описан подробно в контексте медицинского применения настоящего изобретения, и его определение и особенности включены в настоящий документ посредством ссылки.

Специалисту в данной области техники будет понятно, какие конкретные агенты показаны для лечения заболевания. Почти все агенты, показанные при лечении патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, могут быть включены в комплекс согласно настоящему изобретению, хотя предпочтительными, в частности, являются антагонисты TLR-4 и противовоспалительные агенты. Хотя в контексте настоящего изобретения могут применяться многочисленные типы лекарственных средств, согласно предпочтительному варианту реализации настоящее изобретение предусматривает выбор лекарственного средства из группы, включающей, без ограничений, антагонисты TLR-4, такие как налоксон, налтрексон, ЛПС, ибудиласт, пропентофиллин, амитриптилин, кетотифен, циклобензаприн, миансерин и имипрамин; антитромбоцитарные лекарственные средства, такие как аспирин и клопидогрел; антикоагулянты, такие как гепарин, аценокумарол, варфарин, дабигатран и ривароксабан; и антиоксиданты, такие как эдаравон. Уже упоминавшиеся в контексте детектируемых реагентов тканевой активатор плазминогена и его рекомбинантные варианты могут аналогичным образом рассматриваться как лекарственные средства благодаря тромболитическому действию.

Настоящим изобретением предусмотрено лекарственное средство, представляющее собой нуклеиновую кислоту. Соответственно, согласно предпочтительному варианту реализации указанное лекарственное средство представляет собой нуклеиновую кислоту. Нуклеиновые кислоты, подходящие для применения в качестве лекарственных средств в контексте комплекса согласно настоящему изобретению, включают антисмысловую РНК, антисмысловую ДНК и малую интерферирующую РНК, обладающие способностью обеспечивать сайленсинг экспрессии генов, вовлеченных в патологию, характеризующуюся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, в том числе, без ограничения, генов NFKB1, RIPK3, IFNB1, LY96 (MD-2), IRF3, TLR3, TIRAP (Mal), TICAM1 (TRIF), RIPK1, TRAF6, CD14, TRAM, IKBKG (IKK-гамма), IFNA1 и TLR4. Термин «антисмысловая РНК» в контексте настоящего изобретения относится к одноцепочечной РНК, нуклеотидная последовательность которой комплементарна целевой информационной РНК, и, соответственно, влияющей на экспрессию соответствующего гена. Термин «антисмысловая ДНК» в контексте настоящего изобретения относится к одноцепочечной ДНК, нуклеотидная последовательность которой комплементарна целевой информационной РНК, и, соответственно, влияющей на экспрессию или обеспечивающей сайленсинг соответствующего гена. Термин «малая интерферирующая РНК» или «миРНК» в контексте настоящего изобретения относится к двуцепочечной РНК, имеющей длину от 20 до 25 нуклеотидов, высокоспецифической в отношении последовательности нуклеотидов целевой информационной РНК и, соответственно, влияющей на экспрессию соответствующего гена.

Настоящим изобретением предусмотрено лекарственное средство, представляющее собой пептид. Соответственно, согласно предпочтительному варианту реализации указанное лекарственное средство представляет собой пептид. Термин «пептид» в контексте настоящего изобретения относится к короткой цепи аминокислот, связанных пептидными связями. Указанный пептид содержит по меньшей мере 2 аминокислоты, по меньшей мере 3 аминокислоты, по меньшей мере 4 аминокислоты, по меньшей мере 5 аминокислот, по меньшей мере 10 аминокислот, по меньшей мере 15 аминокислот, по меньшей мере 20 аминокислот, по меньшей мере 30 аминокислот, по меньшей мере 40 аминокислот, по меньшей мере 50 аминокислот, по меньшей мере 60 аминокислот или по меньшей мере 70 аминокислот. Подходящими для целей настоящего изобретения являются, в том числе, пептиды, обладающие способностью к связыванию мишени и индуцированию или ингибированию клеточной сигнализации. Термин «связывающий мишень пептид» в контексте настоящего изобретения относится к пептиду, содержащему связывающую мишень область. Термин «сигнальный пептид» в контексте настоящего изобретения относится к пептиду, обладающему способностью к запуску клеточной сигнализации, как, например, пептидные агонисты клеточных рецепторов. Последовательности аминокислот, подходящие для связывания целевых молекул (молекул-мишеней), включают консенсусные последовательности молекулярного распознавания, хорошо известные в данной области техники.

Согласно другому конкретному варианту реализации функциональная группа представляет собой наночастицу. Термин «наночастица» в контексте настоящего изобретения относится к коллоидным системам частиц в форме сфер, стержней, многогранников и т.п., или аналогичных форм, с размером менее чем 1 микрометр (мкм), которые обнаруживаются в виде отдельных частиц или в составе организованных структур (димеры, тримеры, тетраэдры и т.п.), диспергированных в текучих средах (водном растворе). Согласно конкретному варианту реализации наночастицы, подходящие для реализации настоящего изобретения, имеют размер менее 1 мкм, обычно от 1 до 999 нанометров (нм), как правило, от 5 до 500 нм, предпочтительно от приблизительно 10 до 150 нм. Согласно конкретному варианту реализации наночастицы согласно настоящему изобретению, как правило, имеют средний размер частиц в диапазоне от 2 до 50 нм, предпочтительно от 5 до 20 нм, более предпочтительно 13 нм. Средний размер частиц представляет собой максимальную среднюю протяженность частиц, при этом следует понимать, что частицы не обязательно имеют сферическую форму. Форма указанных наночастиц может варьировать в широком диапазоне; предпочтительно, указанные наночастицы принимают любую оптически эффективную форму, например, сфер, стержней, звезд, кубов, многогранников, или любой другой вариант формы, а также образуют связанные комплексы из нескольких частиц; согласно конкретному варианту реализации наночастицы для реализации настоящего изобретения имею сферическую или по существу сферическую форму. Указанная форма может соответствующим образом оцениваться с применением стандартных техник световой или электронной микроскопии.

Наночастицы, подходящие для применения в настоящем изобретении, включают полимерные наночастицы, липидные наночастицы и наночастицы металлов.

Полимерные наночастицы образованы полимерной матрицей, которая присоединен к аптамеру. Неограничивающие примеры биосовместимых полимеров, которые могут подходить для применения в полимерных наночастицах в соответствии с настоящим изобретением, включают полиэтилены, поликарбонаты, полиангидриды, полигидроксикислоты, полипропилфумараты, поликапролактоны, полиамиды, полиацетали, полиэфиры, сложные полиэфиры, поли(ортоэфиры), полицианоакрилаты, поливиниловые спирты, полиуретаны, полифосфазены, полиакрилаты, полиметакрилаты, полицианоакрилаты, полимочевины, полистирены или полиамины, полиглутамат, декстран, полиангидриды, полиуретаны, полиметакрилаты, полиакрилаты или полицианоакрилаты, полидиоксанон (ПДО), полигидроксиалканоат, полигидроксибутират, поли(глицерин себацат), полигликолид, полилактид, PLGA, поликапролактон или их комбинации.

Как вариант, наночастицы согласно настоящему изобретению могут представлять собой липидные наночастицы, такие как липосома или мицелла. Образование мицелл и липосом, например, из везикулообразующих липидов, известно в данной области техники. Везикулообразующие липиды относятся к липидам, спонтанно образующим липидные бислои при температурах выше температурного диапазона перехода из фазы геля в фазу жидких кристаллов. Такие липиды, как правило, обладают определенными свойствами, обеспечивающими спонтанное образование бислоев, например, почти идентичными площадями сечения гидрофобных и гидрофильных частей, что обеспечивает упаковку с формированием ламеллярной фазы. Липиды, способные к стабильному встраиванию в липидные бислои, например, холестерин и различные аналоги холестерина, могут быть встроены в липидный бислой при образовании бислоя. Указанные везикулообразующие липиды предпочтительно представляют собой липиды, содержащие две углеводородных цепи, как правило, ацильные цепи, и концевую группу, полярную или неполярную. Существуют различные синтетические везикулообразующие липиды и встречающиеся в природе везикулообразующие липиды, в том числе фосфолипиды, такие как фосфатидилхолин, фосфатидилэтаноламин, фосфатидная кислота, фосфатидилинозитол и сфингомиелин, где длина двух углеводородных цепей составляет, как правило, приблизительно 14-22 атомов углерода, насыщенные либо отличающиеся варьирующей степенью ненасыщенности. Вышеописанные липиды и фосфолипиды, ацильные цепи которых отличаются варьирующей степенью насыщенности, могут быть получены коммерческим путем или в соответствии с опубликованными способами. Другие подходящие липиды включают фосфолипиды, сфинголипиды, гликолипиды и стеролы, такие как холестерин.

Термин «липосома» относится к везикулам, состоящим из одного или большего количества концентрически организованных липидных бислоев, инкапсулирующих водную фазу. Водная фаза, как правило, содержит соединение, предназначенное для доставки в целевой сайт. После достижения целевого сайта липосома сливается с плазматическими мембранами целевых клеток, т.е. клеток, экспрессирующих TLR-4, с высвобождением таким образом указанного соединения в цитозоль. Как вариант, липосома подвергается эндоцитозу или иным образом захватывается целевыми клетками в составе содержимого транспортной везикулы (например, эндосомы или фагосомы). После того, как липосома оказывается внутри транспортной везикулы, она либо разлагается, либо сливается с мембраной везикулы, высвобождая содержимое. Доступны различные известные специалисту в данной области техники способы получения липосом, такие как обработка ультразвуком, экструзия, высокое давление/гомогенизация, микрофлюидизация, детергентный диализ, кальций-индуцированное слияние малых липосомных носителей и другие способы слияния, хорошо известные в данной области техники.

Полимерные и липидные наночастицы могут дополнительно включать покрытие амфифильным соединением, окружающим полимерный материал, образующее оболочку для частицы или маскирующий материал, который может придавать частицам способность избегать распознавания компонентами иммунной системы и увеличивать время полужизни частиц в кровотоке.

Как вариант, наночастицы согласно настоящему изобретению могут представлять собой наночастицы металла. Термин «наночастица металла» относится к наночастице, содержащей металл и демонстрирующей оптическое свойство, известное как явление поверхностного плазмона, т.е. плазмонный металл. Указанное явление включает коллективные колебания свободных электронов на поверхности металла, что дает полосу поглощения, расположенную в видимой области ультрафиолетового спектра (типичную для металла и размера наночастиц) на длине волны, обеспечивающей соблюдение условия резонанса для указанных электронов. Поверхностный плазмон металла может быть определен путем любого спектроскопического метода, известного из уровня техники, такого как спектроскопия поверхностного плазмонного резонанса (ППР), при которой на атомы металлов воздействуют электромагнитным лучом, или флуоресцентная спектроскопия поверхностного плазмонного резонанса (SPFS), основанная на детекции изменения показателя преломления атомов металла при воздействии на них пучком фотонов. Согласно определению в настоящем документе «плазмонный металл» представляет собой металл, характеризующийся наблюдаемым оптическим свойством, известным как явление поверхностного плазмона. Изменение плазмонного ответа, в частности, очевидно в тех случаях, когда несколько наночастиц расположены близко одна к другой, при условии, что это приводит к сопряжению соответствующих ближних полей с получением нового поверхностного плазмона. Согласно предпочтительному варианту реализации указанный металл выбран из группы, состоящей из золота, серебра, меди, алюминия, платины, железа, кобальта, палладия и их комбинаций.

Согласно предпочтительному варианту реализации наночастица металла представляет собой наночастицу со структурой ядро/оболочка, которая содержит металлическое ядро и пористую оболочку. Примеры наночастиц металлов со структурой ядро/оболочка включают магнитные наночастицы мезопористого диоксида кремния, хорошо известные в данной области техники. Соответственно, согласно конкретному предпочтительному варианту реализации указанная наночастица представляет собой магнитную наночастицу мезопористого диоксида кремния.

Указанные наночастицы могут быть функционализованы путем добавления поверхностного покрытия. Для биологического применения поверхностное покрытие должно быть полярным, что обеспечивает водорастворимость и предотвращение агрегации частиц. В сыворотке или на клеточной поверхности высокозаряженные покрытия способствуют неспецифическому связыванию, тогда как полиэтиленгликоль, связанный с концевыми гидроксильными или метоксигруппами, препятствует неспецифическим взаимодействиям.

Аптамеры могут быть соединены с наночастицами в идеальном случае ковалентной связью, предпочтительно на поверхности наночастиц. Предпочтительно, аптамеры должны присутствовать в контролируемом количестве на наночастицу.

Связывание аптамера согласно настоящему изобретению и функциональной группы для получения комплекса согласно настоящему изобретению может осуществляться с применением техник конъюгации, хорошо известных специалисту в данной области техники. Результат представляет собой ковалентную связь между аптамером согласно настоящему изобретению и функциональной группой. Конъюгация может включать связывание первичных аминов на 3'- или 5'-концах аптамера согласно настоящему изобретению с функциональной группой во время химического синтеза аптамера. Как вариант, конъюгация может осуществляться посредством стандартных реакций перекрестного сшивания, что обеспечивает преимущество, заключающееся в значительно большей химической реакционной способности первичных алкил-аминных меток относительно ариламинов собственно нуклеотидов. Способы конъюгации хорошо известны в данной области техники и основаны на применении реагентов для перекрестного сшивания. Реагенты для перекрестного сшивания содержат по меньшей мере две реакционноспособные группы, нацеленные на такие группы, как первичные амины, сульфгидрилы, альдегиды, карбоксилы, гидроксилы, азиды и т.п., в молекуле для конъюгации. Агенты для перекрестного сшивания различаются химической специфичностью, длиной спейсерных групп, составом спейсерных групп, расщепляющим спейсерным фрагментом и структурой. Например, конъюгация комплексов согласно настоящему изобретению может проводиться прямо или через соединяющий фрагмент, через одну или большее количество нефункциональных групп в аптамере и/или функциональную группу, например, аминогруппу, карбоксильные, фенильные, тиольные или гидроксильные группы. Более избирательные связи могут быть получены посредством применения гетеробифункционального линкера. Возможно использование стандартных линкеров, таких как диизоцианаты, диизотиоцианаты, сложные бис(гидроксисукцинимид) эфиры, карбодиимиды, сложные малеимид-гидроксисукцинимидные эфиры, глутаральдегид и т.п., или гидразинов и гидразидов, таких как гидразид 4-(4-N-малеимидофенил)масляной кислоты (МРВН).

Другой подход состоит в мечении аптамеров во время синтеза путем ПЦР с применением праймеров, меченых, например, флуорофором. Для достижения указанной цели существуют различные коммерческие разработки, доступные специалисту в данной области техники.

Дополнительно, согласно конкретному варианту реализации, в котором функциональная группа представляет собой радионуклид, связывание аптамера согласно настоящему изобретению и указанного радионуклида может проводиться путем химической координационной связи, при этом атомы аптамера вовлеченные в связывание, являются донорами электронов для радионуклида. Координационные реакции хорошо известны в данной области техники и зависят от радионуклида и реакционноспособной группы, включенной в аптамер.

Применение настоящего изобретения in vitro

А. Применение для детекции TLR-4 in vitro

Настоящее изобретение также предусматривает применение in vitro аптамера нуклеиновой кислоты, обладающего способностью к специфическому связыванию и ингибированию TLR-4 и содержащего последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентного варианта, и комплекса, содержащего аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу, для детекции TLR-4.

Соответственно, согласно другому аспекту настоящее изобретение относится к применению in vitro аптамера нуклеиновой кислоты, обладающего способностью к специфическому связыванию и ингибированию TLR-4 и содержащего последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентного варианта, для детекции TLR-4.

Соответственно, способность аптамера согласно настоящему изобретению к специфическому связыванию с TLR-4 может быть использована для непрямой детекции TLR-4 при помощи аптамера согласно настоящему изобретению. Специалисту в данной области техники будет понятно, что для достижения указанной цели необходима последующая детекция указанного аптамера. Техники детекции аптамеров хорошо известны в данной области техники и включают, например, применение антител или зондов, специфических в отношении аптамера. Соответственно, после связывания аптамера согласно настоящему изобретению с TLR-4 применяют антитело или зонд, специфический(ое) в отношении аптамера, который(ое), в свою очередь, может быть помечен(о) детектируемым реагентом, или детектирован непрямо посредством вторичного антитела или зонда. Используемая для детекции TLR-4 техника, соответственно, зависит от типа детектируемого реагента, и может представлять собой технику, например, на основе флуориметрии, колориметрии или радиоактивности.

Термин «зонд» или «зонд для гибридизации» в контексте настоящего изобретения относится к фрагменту ДНК или РНК вариабельной длины, обычно от 10 до 1000 оснований, используемому для детекции присутствия одноцепочечных нуклеиновых кислот (ДНК или РНК), комплементарных последовательности в составе зонда. Указанный зонд гибридизуется с целевой одноцепочечной нуклеиновой кислотой, последовательность оснований которой обеспечивает спаривание оснований за счет комплементарности зонда и целевой нуклеиновой кислоты. Для детекции гибридизации зонда с целевой последовательностью указанный зонд метят детектируемым реагентом, таким как, в том числе, радионуклид, флуорофор или дигоксигенин.

Детекция TLR-4 аптамером согласно настоящему изобретению может проводиться посредством анализов связывания in vitro, например, ферментного олигонуклеотидного анализа (ELONA), ферментного аптамерного сорбентного анализа (ELASA), осаждения и количественной ПЦР (кПЦР), анализа на сдвиг подвижности в геле, вестерн-блоттинга, поверхностного плазмонного резонанса (ППР), кинетического капиллярного электрофореза, флуоресцентного анализа связывания, аптагистохимии, аптацитохимии, флуоресцентной микроскопии или проточной цитометрии.

Согласно другому конкретному варианту реализации настоящего изобретения in vitro детекцию TLR-4 осуществляют с применением способа, выбранного из группы, состоящей из ELONA, аптацитохимии, аптагистохимии и проточной цитометрии.

Термин «ELONA», или «ферментный олигонуклеотидный анализ» в контексте настоящего изобретения относится к технике, аналогичной ферментному иммуносорбентному анализу (ELISA), где антитело, используемое для детекции представляющей интерес молекулы, в данном случае TLR-4, заменено на специфический в отношении указанной молекулы аптамер для детекции. ИФА ELISA основан на применении антигенов или антитела, меченого, например, ферментами, таким образом, что комплексы, образуемые целевым антигеном и меченым антителом, представляют собой ферментативно активные комплексы. Поскольку один из компонентов, в указанном случае - антиген, иммобилизован на носителе, комплексы антиген : антитело иммобилизованы на носителе и могут, соответственно, быть детектированы путем добавления субстрата, специфического в отношении указанного фермента. В случае ELONA, аптамер для детекции может быть ковалентно связан с ферментом или может быть собственно детектирован вторичным антителом, специфическим в отношении аптамера, конъюгированного с ферментом. Указанный фермент катализирует преобразование специфического субстрата с получением видимого сигнала. Указанная техника может быть модифицирована с заменой фермента на другой детектируемый реагент, такой как флуорофор. Термины ELONA и ELASA, или ферментный аптамерный сорбентный анализ, используются в настоящем документе взаимозаменяемо. Согласно предпочтительному варианту реализации детекцию TLR-4 осуществляют посредством ELONA.

Аналогичным образом, термины «аптацитохимия» и «аптагистохимия» в контексте настоящего изобретения относятся к аналогичным иммуноцитохимии и иммуногистохимии техникам детекции TLR-4 на клетках и гистологических препаратах, соответственно, при этом антитело, используемое для детекции представляющей интерес молекулы, в данном случае TLR-4, заменяют на аптамер, специфический в отношении указанной молекулы. Аптамер для детекции может быть ковалентно связан с ферментом, или может быть собственно детектирован вторичным антителом, специфическим в отношении аптамера, который конъюгирован с ферментом. Указанный фермент катализирует преобразование специфического субстрата для получения видимого сигнала. Указанная техника может быть модифицирована путем замены фермента на другой детектируемый реагент, такой как флуорофор. Согласно предпочтительному варианту реализации детекцию TLR-4 осуществляют посредством аптацитохимии. Согласно другому предпочтительному варианту реализации детекцию TLR-4 осуществляют посредством аптагистохимии.

Специалисту в данной области техники будет понятно, что указанные техники (ELONA, аптацитохимия, аптагистохимия), как вариант, могут быть адаптированы для замены антитела для детекции на зонд, специфический в отношении аптамера.

Термин «проточная цитометрия» в контексте настоящего изобретения относится к технике клеточного анализа, задействующей измерение флуоресценции и светорассеяния, свойственных клеткам при прохождении через световой луч. Помимо светорассеяния, можно оценить, какие клетки содержат антигены, комплементарные используемым аптамерам, если перед проведением анализа указанные клетки приводили в контакт с аптамерами, мечеными флуоресцентными молекулами. Детекцию флуоресценции осуществляют с помощью проточных цитофлюориметров (известных как «цитометры», или «FACS» (клеточный сортер с активацией флуоресценции)). Указанная техника, аналогично ранее описанным, изначально была разработана для применения с флуоресцентно мечеными антителами, однако легко может быть адаптирована для применения с аптамером согласно настоящему изобретению.

Как будет понятно специалисту в данной области техники, комплекс, содержащий аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и детектируемый реагент, в частности, предпочтителен для детекции TLR-4, поскольку указанный детектируемый реагент позволяет детектировать аптамер, содержащийся в комплексе, при его связывании с TLR-4. Используемая для детекции TLR-4 техника зависит от типа детектируемого реагента, и может представлять собой технику на основе, например, флуориметрии, колориметрии или радиоактивности.

Соответственно, согласно другому аспекту настоящее изобретение относится к комплексу, содержащему аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу для детекции TLR-4.

Согласно конкретному варианту реализации указанная функциональная группа представляет собой детектируемый реагент.

Согласно другому конкретному варианту реализации применения in vitro согласно настоящему изобретению, детекцию TLR-4 осуществляют с применением способа, выбранного из группы, состоящей из ELONA, аптацитохимии, аптагистохимии и проточной цитометрии.

Термины «аптамер», «TLR-4», «функционально эквивалентный вариант», «комплекс», «функциональная группа», «детектируемый реагент», «ELONA», «аптацитохимия», «аптагистохимия» и «проточная цитометрия» были подробно описаны выше; их определения и особенности включены в настоящий документ посредством ссылки.

Учитывая, что ELISA, техники иммуноцитохимии, иммуногистохимии и проточной цитометрии хорошо известны в данной области техники, специалист в данной области техники сможет выполнить модификации, необходимые для замены антитела на аптамер или комплекс согласно настоящему изобретению, без необходимости прибегать к излишним экспериментам.

В. Применение in vitro для ингибирования TLR-4

Согласно описанию выше, аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, может ингибировать активность TLR-4, уменьшая уровни провоспалительных цитокинов, высвобождаемых в результате его активации. Настоящее изобретение также предусматривает применение in vitro аптамера нуклеиновой кислоты, обладающего способностью к специфическому связыванию и ингибированию TLR-4 и содержащего последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентного варианта, и комплекса, содержащего аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу, для ингибирования TLR-4.

Соответственно, согласно другому аспекту настоящее изобретение относится к применению in vitro аптамера нуклеиновой кислоты, обладающего способностью к специфическому связыванию и ингибированию TLR-4 и содержащего последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентного варианта, для ингибирования TLR-4.

Согласно другому аспекту настоящее изобретение относится к применению in vitro комплекса, содержащего аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу, для ингибирования TLR-4.

In vitro способы согласно настоящему изобретению

А. Способы детекции TLR-4 in vitro

Согласно другому аспекту настоящее изобретение относится к способу детекции TLR-4 в образце in vitro, здесь и далее в настоящем документе «первый способ детекции TLR-4 in vitro согласно настоящему изобретению», включающему

i) приведение образца в контакт с аптамером нуклеиновой кислоты, обладающим способностью к специфическому связыванию и ингибированию TLR-4 и содержащим последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентным вариантом,

ii) выделение аптамера, не связанного с TLR-4, и

iii) детекцию присутствия аптамера, связанного с TLR-4, присутствующим в указанном образце.

На первом этапе первый способ детекции in vitro согласно настоящему изобретению включает приведение образца в контакт с аптамером нуклеиновой кислоты, обладающим способностью к специфическому связыванию и ингибированию TLR-4 и содержащим последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентным вариантом.

Термины «аптамер», «TLR-4» и «функционально эквивалентный вариант» были подробно описаны выше; их определения и особенности включены в настоящий документ посредством ссылки.

Термин «образец» или «биологический образец» в контексте настоящего изобретения относится к культуре клеток или к выделенному биологическому материалу, полученному от субъекта. Указанный биологический образец может содержать любой биологический материал, подходящий для детекции требуемого биомаркера, и может содержать клетки и/или неклеточный материал, полученный(ые) от субъекта. Указанный образец может быть выделен из любой подходящей ткани или биологической жидкости, такой как, например, кровь, плазма, сыворотка, моча, спинномозговая жидкость (СМЖ), сердце, головной мозг. Образцы, используемые для детекции TLR-4, предпочтительно представляют собой биологические жидкости.

Как вариант, указанные образцы представлены образцами биожидкостей. Термины «биологическая жидкость» и «биожидкость» используются в настоящем документе взаимозаменяемо и относятся к жидкостям биологического происхождения на водной основе. Биожидкость может быть получена из любого источника (например, крови, плазмы, сыворотки, мочи, желчи, спинномозговой жидкости, жидкой части стекловидного тела или внутриглазной жидкости, или любого секрета организма), экссудата (например, жидкости, полученной из абсцесса или любого другого сайта инфекции или воспаления), или жидкости, полученной из сустава (например, нормального сустава или сустава, пораженного таким заболеванием, как ревматоидный артрит). Биожидкости, используемые для детекции TLR-4, представлены предпочтительно образцами крови, плазмы, сыворотки или спинномозговой жидкости.

Аптамер согласно настоящему изобретению наносят на образец в буфере, подходящем для обеспечения связывания аптамера с молекулами TLR-4, которые могут присутствовать в образце. Неограничивающие примеры буферов, подходящих для обеспечения связывания аптамера согласно настоящему изобретению и TLR-4, включают ФСБ, ТБС, фосфатный буфер и цитратный буфер. Предпочтительно, указанные буферы содержат 1 мМ MgCl2. Требуемое для детекции присутствующих в образце молекул TLR-4 количество аптамера зависит как от размера, так и от количества присутствующего TLR-4, и может легко быть определено с применением способов оптимизации, общепринятых в данной области техники. Ориентировочно, концентрация аптамера составляет по меньшей мере 1 фМ, по меньшей мере 10 фМ, по меньшей мере 100 фМ, по меньшей мере 1 пМ, по меньшей мере 10 пМ, по меньшей мере 100 пМ, по меньшей мере 1 нМ, по меньшей мере 10 нМ, по меньшей мере 100 нМ, по меньшей мере 1 мкМ, по меньшей мере 10 мкМ, по меньшей мере 100 мкМ или более. Предпочтительно, концентрация аптамера составляет от 100 фМ до 1 мкМ, более предпочтительно от 1 пМ до 100 нМ, и еще более предпочтительно от 100 пМ до 1 нМ.

Аптамер инкубируют с образцом при подходящей температуре и на протяжении времени, достаточного для обеспечения связывания аптамера с молекулами TLR-4, которые могут присутствовать в образце. Температура предпочтительно составляет от 20°С до 37°С. Ориентировочно, аптамер инкубируют с образцом на протяжении по меньшей мере 5 минут, по меньшей мере 10 минут, по меньшей мере 15 минут, по меньшей мере, 20 минут, по меньшей мере 30 минут, по меньшей мере 60 минут, по меньшей мере 120 минут или более.

После связывания аптамера с молекулами TLR-4, которые могут присутствовать в образце, на втором этапе указанный образец промывают для удаления молекул аптамера, не связавшихся с TLR-4.

На третьем этапе детектируют присутствие аптамера, связанного с TLR-4, присутствующим в указанном образце. Поскольку аптамер согласно настоящему изобретению сам по себе не является детектируемой молекулой, этап детекции представляет собой этап непрямой детекции с применением второй детектируемой молекулы, которая специфически связывается с указанным аптамером. Детекция аптамера, связанного с TLR-4, может проводиться с применением практически любого известного антитела или реагента, который с высоким сродством связывается с аптамером согласно настоящему изобретению. Тем не менее, применение антитела, специфического в отношении аптамера, например, поликлональной сыворотки, супернатанта гибридомы, моноклональных или гуманизированных антител и их фрагментов, предпочтительно. Указанное антитело, специфическое в отношении аптамера, подходящим образом метят детектируемым реагентом. Термин «детектируемый реагент» был подробно описан выше; его определение и особенности включены в настоящий документ посредством ссылки. Указанный реагент может быть детектирован посредством флуориметрии или колориметрии с применением аппаратов, подходящих для указанного типа реагентов и типа образца, известных специалистам в данной области техники. Например, образец с аптамером, связанным с содержащимися в нем молекулами TLR-4, инкубируют с антителом, специфическим в отношении аптамера, который конъюгирован с ферментом, в условиях, аналогичных условиям инкубации с аптамером, и детектируют комплексы TLR-4-аптамер-антитело с добавлением субстрата, преобразуемого указанным ферментом в детектируемый продукт, например, посредством флуориметрии с помощью флуоресцентного микроскопа или посредством колориметрии в спектрофотометре. Как вариант, детекция может осуществляться аналогичным образом с применением зонда, специфического в отношении аптамера, подходящим образом меченого детектируемым реагентом.

Специалисту в данной области техники будет понятно, что первый in vitro способ согласно настоящему изобретению может осуществляться как часть техник детекции, таких как ELONA, ELASA, осаждение и кПЦР, анализ на сдвиг подвижности в геле, вестерн-блоттинг, поверхностный плазмонный резонанс, кинетический капиллярный электрофорез, флуоресцентный анализ связывания, аптагистохимия, аптацитохимия, флуоресцентная микроскопия или проточная цитометрия.

Как вариант, аптамер согласно настоящему изобретению может быть связан с функциональной группой, входящей в состав комплекса согласно настоящему изобретению. Соответственно, согласно другому аспекту настоящее изобретение относится к способу детекции TLR-4 в образце in vitro, здесь и далее в настоящем документе «второй in vitro способ детекции TLR-4 согласно настоящему изобретению», включающему

i) приведение образца в контакт с комплексом, содержащим аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу,

ii) выделение указанного аптамера или комплекса, не связанного с TLR-4, и

iii) детекцию присутствия комплекса, связанного с TLR-4, присутствующим в указанном образце.

Термины «аптамер», «TLR-4», «функционально эквивалентный вариант» и «образец» были подробно описаны выше, и их определения и особенности включены в настоящий документ посредством ссылки. Аналогичным образом, особенности первого и второго этапов первого способа детекции in vitro согласно настоящему изобретению также относятся ко второму способу детекции in vitro согласно настоящему изобретению, и также включены в настоящий документ посредством ссылки.

Третий этап второго способа детекции in vitro согласно настоящему изобретению включает детекцию присутствия комплекса согласно настоящему изобретению, связанного с TLR-4, присутствующим в указанном образце. Детекция комплекса согласно настоящему изобретению может проводиться с применением практически любого известного антитела или реагента, который с высоким сродством связывается с аптамером согласно настоящему изобретению или с функциональной группой. Детекция аптамера согласно настоящему изобретению была описана подробно в контексте первого in vitro способа детекции согласно настоящему изобретению. Аналогичным образом, детекция функциональной группы может также проводиться с применением практически любого известного антитела или реагента, который связывается с высоким сродством с указанной функциональной группой. По указанной причине при применении второго способа детекции in vitro согласно настоящему изобретению целесообразно, в частности, чтобы функциональная группа представляла собой детектируемый реагент.

Согласно конкретному варианту реализации функциональная группа представляет собой детектируемый реагент, выбранный из группы, образованной радионуклидами, флуорофорами, белками и гаптенами.

Термины «радионуклид», «флуорофор», «детектируемый белок» и «гаптен» были подробно описаны выше, и их определения и особенности включены в настоящий документ посредством ссылки.

Как будет понятно специалисту в данной области техники, предусмотренные настоящим изобретением детектируемые реагенты могут быть разделены на прямо детектируемые реагенты, такие как радионуклиды или флуорофоры, и непрямо детектируемые реагенты, такие как белки или гаптены.

Согласно предпочтительному варианту реализации указанный детектируемый реагент представляет собой радионуклид, и детекцию осуществляют путем детекции радиации, испускаемой указанным радионуклидом. Указанная радиация зависит от типа радионуклида, и может представлять собой излучение α-частиц, β-частиц или γ-излучение. Подходящие для разных радионуклидов техники такой детекции хорошо известны. Например, излучение, испускаемое 123I, может быть детектировано с помощью гамма-камеры.

Согласно другому предпочтительному варианту реализации указанный детектируемый реагент представляет собой флуорофор, и детекцию осуществляют путем детекции флуоресценции, испускаемой указанным флуорофором. Применение флуорофора требует предварительного возбуждения на длине волны в пределах его спектра возбуждения, что вызывает излучение на другой длине волны. Длины волн возбуждения и излучения флуорофоров, предусмотренных настоящим изобретением, являются частью уровня техники. Испускаемая флуоресценция может быть детектирована, например, посредством техник флуориметрии с применением флуоресцентного спектрофотометра или флуоресцентного микроскопа.

Согласно другому предпочтительному варианту реализации указанная детектируемый реагент представляет собой белок. Указанный белок может быть детектирован в зависимости от типа используемого белка. Например:

- фермент требует добавления специфического субстрата, который детектируют с применением колориметрии, хемолюминесценции или флуориметрии;

- флуоресцентный белок, например, флуорофор, требует возбуждения на длине волны, подходящей для детекции с применением флуориметрии (например, на длине волны из приведенных в таблице 1);

- требуется антитело или другая молекула для специфического распознавания антигена или гаптена. Для детекции указанное(ая) антитело или молекула, специфическое(ая) в отношении антигена/гаптена должно(а) быть помечена(о), например, ферментом, и детекция зависит от типа метки.

Специалисту в данной области техники будет понятно, что второй способ in vitro согласно настоящему изобретению может применяться в качестве части техник детекции, таких как ELONA, ELASA, осаждение и кПЦР, анализ на сдвиг подвижности в геле, вестерн-блоттинг, поверхностный плазмонный резонанс, кинетический капиллярный электрофорез, флуоресцентный анализ связывания, аптагистохимия, аптацитохимия, флуоресцентная микроскопия или проточная цитометрия.

Согласно конкретному варианту реализации детекцию TLR-4 осуществляют с применением флуоресценции.

В. Способы ингибирования TLR-4 in vitro

Согласно другому аспекту настоящее изобретение относится к in vitro способу ингибирования TLR-4 в образце, здесь и далее в настоящем документе «первый способ ингибирования TLR-4 in vitro согласно настоящему изобретению», который включает приведение в контакт образца, содержащего TLR-4 с аптамером нуклеиновой кислоты, обладающим способностью к специфическому связыванию и ингибированию TLR-4 и содержащим последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентным вариантом, в условиях, подходящих для ингибирования TLR-4.

Термины «аптамер», «TLR-4», «функционально эквивалентный вариант», «ингибирование TLR-4» и «образец» были подробно описаны выше, и их определения и особенности включены в настоящий документ посредством ссылки.

Согласно конкретному варианту реализации TLR-4 образца содержится в живых клетках.

Первый способ ингибирования TLR-4 in vitro согласно настоящему изобретению включает приведение в контакт образца, содержащего TLR-4 с аптамером согласно настоящему изобретению в условиях, подходящих для ингибирования TLR-4. С указанной целью аптамер согласно настоящему изобретению наносят на образец, и он должен связаться с TLR-4.

Термин «условия, подходящие для ингибирования TLR-4» в контексте настоящего изобретения относится к условиям инкубации, обеспечивающим связывание аптамера согласно настоящему изобретению с TLR-4 и его последующее ингибирование. Указанные условия включают буферную композицию, в составе которой аптамер согласно настоящему изобретению наносят на образец, количество аптамера, время инкубации и температуру инкубации. Неограничивающие примеры буферов, подходящих для обеспечения связывания аптамера согласно настоящему изобретению с TLR-4 и его ингибирования, включают ФСБ, ТБС, фосфатный буфер и нитратный буфер. Предпочтительно, указанные буферы содержат 1 мМ MgCl2. Количество аптамера, необходимое для детекции молекул TLR-4, присутствующих в образце, зависит как от размера образца, так и от количества содержащегося в нем TLR-4, и может быть легко определено посредством способов оптимизации, общеизвестных в данной области техники. Ориентировочно, концентрация аптамера составляет по меньшей мере 1 фМ, по меньшей мере 10 фМ, по меньшей мере 100 фМ, по меньшей мере 1 пМ, по меньшей мере 10 пМ, по меньшей мере 100 пМ, по меньшей мере 1 нМ, по меньшей мере 10 нМ, по меньшей мере 100 нМ, по меньшей мере 1 мкМ, по меньшей мере 10 мкМ, по меньшей мере 100 мкМ или более. Предпочтительно, концентрация аптамера составляет от 100 фМ до 1 мкМ, более предпочтительно от 1 пМ до 100 нМ, и еще более предпочтительно от 100 пМ до 1 нМ.

Аптамер инкубируют с образцом при подходящей температуре и на протяжении времени, достаточного для обеспечения связывания аптамера с молекулами TLR-4, которые могут присутствовать в образце. Температура предпочтительно составляет от 20°С до 37°С, более предпочтительно - 37°С. Ориентировочно, аптамер инкубируют с образцом на протяжении по меньшей мере 5 минут, по меньшей мере 10 минут, по меньшей мере 15 минут, по меньшей мере 20 минут, по меньшей мере 30 минут, по меньшей мере 60 минут, по меньшей мере 120 минут или более.

Согласно другому аспекту настоящее изобретение относится к способу ингибирования TLR-4 в образце in vitro, здесь и далее в настоящем документе «второй способ ингибирования TLR-4 in vitro согласно настоящему изобретению», который включает приведение в контакт образца, содержащего TLR-4 с комплексом, содержащим аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу, в условиях, подходящих для ингибирования TLR-4.

Термины «аптамер», «TLR-4», «функционально эквивалентный вариант», «ингибирование TLR-4», «образец» и «условия, подходящие для ингибирования TLR-4» были подробно описаны выше, и их определения и особенности включены в настоящий документ посредством ссылки.

Варианты медицинского применения согласно настоящему изобретению

Авторы настоящего изобретения продемонстрировали, что аптамер согласно настоящему изобретению способен блокировать или ингибировать объем инфаркта в модели инсульта у использованных в экспериментах животных, согласно описанию в примере 4. Соответственно, способность аптамера согласно настоящему изобретению к специфическому связыванию и ингибированию TLR-4 делает его полезным с терапевтической точки зрения. Очевидно, что терапевтический эффект, достигаемый при применении аптамера согласно настоящему изобретению, может быть дополнен функциональной группой, обладающей терапевтической активностью, согласно описанию в контексте комплекса согласно настоящему изобретению. Соответственно, настоящее изобретение предусматривает варианты медицинского применения аптамера согласно настоящему изобретению и комплекса согласно настоящему изобретению.

А. Варианты медицинского применения аптамера согласно настоящему изобретению

Согласно другому аспекту настоящее изобретение относится к аптамеру нуклеиновой кислоты, обладающему способностью к специфическому связыванию и ингибированию TLR-4 и содержащему последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентному варианту, для применения в медицине.

Согласно другому аспекту настоящее изобретение относится к аптамеру нуклеиновой кислоты, обладающему способностью к специфическому связыванию и ингибированию TLR-4 и содержащему последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентному варианту, для применения при получении лекарственного средства для лечения патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4.

Как вариант, настоящее изобретение может быть реализовано в виде применения аптамера нуклеиновой кислоты, обладающего способностью к специфическому связыванию и ингибированию TLR-4 и содержащего последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентного варианта, для применения при лечении патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4.

Как вариант, настоящее изобретение может быть реализовано в виде способа лечения in vivo патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4 у субъекта, включающего введение указанному субъекту терапевтически эффективного количества аптамера нуклеиновой кислоты, обладающего способностью к специфическому связыванию и ингибированию TLR-4 и содержащего последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентного варианта, указанному субъекту.

Согласно настоящему изобретению, аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, специфически связывается с TLR-4 на поверхности целевой клетки. При приведении аптамера согласно настоящему изобретению в контакт с TLR-4 он ингибирует активность последнего, что приводит к снижению или прерыванию высвобождения провоспалительных цитокинов, таких как ИЛ-1, ИЛ-8, ФНО-альфа и ИЛ-12.

Термин «аптамер» был описан подробно в разделе определений и при описании аптамера, специфического в отношении TLR-4 (выше); его определения и особенности аналогичным образом применимы и в контексте комплекса согласно настоящему изобретению.

Термин «лечение», или «терапия» в контексте настоящего изобретения относится к клиническому вмешательству с целью предотвращения, излечения, замедления, уменьшения степени серьезности или уменьшения одного или более симптомов патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, или с целью увеличения продолжительности периода выживаемости пациента относительно ожидаемого в отсутствие такого лечения.

Термин «целевая клетка» в контексте настоящего изобретения относится к конкретной клетке, которая экспрессирует TLR-4, включая, в том числе, клетки миелоидного происхождения, такие как моноциты, макрофаги, клетки микроглии, гранулоциты и незрелые дендритные клетки, а также клетки других линий, такие как нейроны, и т.п. Согласно конкретному варианту реализации указанная целевая клетка представляет собой моноцит или макрофаг. Согласно другому конкретному варианту реализации указанная целевая клетка представляет собой клетку микроглии. Согласно другому конкретному варианту реализации указанная целевая клетка представляет собой гранулоцит. Согласно другому конкретному варианту реализации указанная целевая клетка представляет собой незрелую дендритную клетку. Согласно другому конкретному варианту реализации указанная целевая клетка представляет собой нейрон.

Согласно конкретному варианту реализации указанная целевая клетка представляет собой клетку млекопитающего. Согласно другому предпочтительному варианту реализации указанная клетка млекопитающего представляет собой клетку человека.

Термин «субъект» или «индивидуум» относится к представителю вида млекопитающих, и включает, не ограничиваясь перечисленными, домашних животных и приматов, в том числе человека; предпочтительно, он является субъектом мужского или женского пола, любого возраста или расы.

Термин «терапевтически эффективное количество» в контексте настоящего изобретения относится к количеству аптамера согласно настоящему изобретению необходимому для достижения предотвращения, излечения, замедления, уменьшения степени серьезности или уменьшения одного или более наблюдаемых симптомов патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4.

Термин «патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4» в контексте настоящего изобретения относится к патологии, при которой клетки, которые экспрессируют TLR-4, демонстрируют повышение экспрессии TLR-4 и/или увеличение активации TLR-4, и/или патологии, при которой наблюдается увеличение количества клеток, которые экспрессируют TLR-4, по сравнению с нормальными или референсными физиологическими условиями или референсными значениями, и в которую прямо или непрямо вовлечены указанные клетки, независимо от того, отвечает ли за данное заболевание TLR-4. Учитывая, что активация TLR-4 запускает сигнальный каскад, приводящий к высвобождению воспалительных цитокинов, таких как ИЛ-1, ИЛ-8, ФНО-альфа и ИЛ-12, обуславливающих воспаление и повреждение клеток, указанная патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, может также характеризоваться воспалительной компонентой.

Согласно конкретному варианту реализации указанная патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4 выбрана из группы, состоящей, в том числе, из инсульта, острого инфаркта миокарда, сепсиса, атеросклероза, рассеянного склероза, ревматоидного артрита, дегенеративного заболевания сетчатки глаза и наркотической зависимости.

Согласно предпочтительному варианту реализации указанная патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, представляет собой инсульт. Термин «инсульт», или «цереброваскулярное заболевание», или «церебральный инфаркт», или «апоплексия» в контексте настоящего изобретения относится к патологии, характеризующейся неврологическим дефицитом, вызванным значительным, аномально резким снижением мозгового кровообращения (ишемический инсульт), или кровотечением, вызванным разрывом сосуда головного мозга (геморрагический инсульт). При ишемическом инсульте кровоснабжение прекращается из-за внезапного мгновенного прекращения кровотока в результате окклюзии любой из артерий, снабжающий головной мозг, что приводит к возникновению зоны инфаркта. Окклюзия артерий обычно обусловлена атеросклерозом или эмболом (церебральной эмболией), происходящим из другой локализации, в основном из сердечной или других артерий. При геморрагическом инсульте происходит разрыв кровеносного сосуда в головном мозге, лишая крови область мозга, которая зависит от этой артерии. Кроме этого, вытекающая кровь сдавливает структуры головного мозга, в том числе другие кровеносные сосуды, что увеличивает пораженный участок за счет вторичной по отношению к внутримозговому кровоизлиянию ишемии.

Согласно предпочтительному варианту реализации указанная патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4 представляет собой острый инфаркт миокарда. Термин «острый инфаркт миокарда», или «инфаркт», или «сердечный приступ» в контексте настоящего изобретения относится к патологии, характеризующейся недостаточным кровоснабжением, сопровождающимся повреждением тканей, в области сердца, вызванной обструкцией одной из коронарных артерий. Ишемия или дефицит поступления кислорода в результате такой обструкции приводит к стенокардии, которая в случае достаточно скорой реканюляции не вызывает гибели сердечной ткани, однако при продолжении аноксии происходит повреждение миокарда и в конечном итоге наступает некроз, т.е. инфаркт.

Согласно предпочтительному варианту реализации указанная патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, представляет собой сепсис. Термин «сепсис» или «септицемия» в контексте настоящего изобретения относится к синдрому системной воспалительной реакции (SIRS), обычно вызываемого серьезной инфекцией. Указанная реакция организма возникает в ответ на присутствие патогенных микроорганизмов в любой ткани или жидкости организма, и вызывается действием самой иммунной системы, которая высвобождает провоспалительные вещества, запускающие SIRS. Она характеризуется присутствием по меньшей мере двух из следующих показателей: лихорадка, гипертермия, тахипноэ, тахикардия и лейкоцитоз.

Согласно предпочтительному варианту реализации указанная патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, представляет собой атеросклероз. Термин «атеросклероз» в контексте настоящего изобретения относится к синдрому или патологии, характеризующейся отложением и инфильтрацией липидных веществ в стенках артерий средней и большой толщины. Клетки артериальной стенки интерпретируют указанное отложение как инвазию и активируют циркулирующие моноциты иммунной системы, которые проникают в стенку артерии, превращаются в макрофаги и начинают фагоцитировать частицы ЛНП, запуская воспалительный процесс. Воспаление, в свою очередь, приводит к увеличению числа и миграции гладкомышечных клеток стенки, которые постепенно вызывают сужение диаметра артерии. Указанное специфическое утолщение называется атероматозной бляшкой. Это наиболее распространенная форма артериосклероза. Заболевания, приводящие к атеросклеротическому синдрому и характеризующиеся вовлеченностью артерий с формированием атероматозных бляшек, и, соответственно, обструкцией кровотока или ишемией, в зависимости от артерии вовлеченного органа, представлены:

- Ишемической болезнью сердца, в самых серьезных случаях представленной острым инфарктом миокарда.

- Цереброваскулярным заболеванием центральной нервной системы в форме инсульта или церебрального тромбоза, или внутримозгового кровоизлияния.

- Перемежающейся хромотой, в самых серьезных случаях представленной острой артериальной ишемией нижних конечностей.

- Эректильная дисфункция, основная причина импотенции у людей в возрасте старше 40 лет.

- Ишемическим колитом, который представляет собой зону воспаления (раздражения и отека), вызванного нарушением кровотока в артериях толстой кишки (в толстом кишечнике).

- Аневризмой аорты, в самом серьезном случае представленной расслоением аорты.

Согласно предпочтительному варианту реализации указанная патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, представляет собой рассеянный склероз. Термин «рассеянный склероз» в контексте настоящего изобретения относится к патологии, характеризующейся возникновением хронических демиелинизирующих нейродегенеративных поражений центральной нервной системы. Их причины в настоящее время неизвестны, хотя была продемонстрирована вовлеченность различных аутоиммунных механизмов. У пациентов с рассеянным склерозом лимфоциты проходят через гематоэнцефалический барьер, воздействуя на миелин, в тоже самое время происходит воспалительный процесс, поддерживаемый макрофагами и клетками нейроглии.

Согласно предпочтительному варианту реализации указанная патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, представляет собой ревматоидный артрит. Термин «ревматоидный артрит» в контексте настоящего изобретения относится к системной аутоиммунной воспалительной патологии, характеризующейся стимуляцией персистирующего синовита суставов, приводящего к их прогрессирующему разрушению, приводящего к деформации и функциональным нарушениям различной степени. Указанный процесс начинается с вступления в действие гуморальных и клеточных факторов, в частности, CD4 Т-клеток, которые продуцируют молекулы - медиаторы воспаления, привлекают и активируют периферические клетки крови, вызывая пролиферацию и активацию синовиоцитов, инвазирующих и разрушающих суставный хрящ, субхондральную кость, сухожилия и связки.

Согласно предпочтительному варианту реализации указанная патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, представляет собой дегенеративное заболевание сетчатки глаза. Термин «дегенеративное заболевание сетчатки глаза» в контексте настоящего изобретения относится к заболеванию или расстройству, характеризующемуся дегенерацией сетчатки, которая может быть результатом воспаления сетчатки. Опосредованная TLR-4 активация микроглии, как было показано, вносит вклад в процесс воспаления сетчатки. Основные дегенеративные заболевания сетчатки глаза включают:

- Возрастную макулярную дегенерацию (ВМД), которая приводит к утрате зрения в центре поля зрения (макулы)) из-за повреждения сетчатки. Встречается «сухая» и «влажная» форма: при сухой (неэкссудативной) форме клеточный дебрис, называемый друзами, накапливается между сетчаткой и хороидом, вызывая атрофию и рубцевание сетчатки; при влажной (экссудативной) форме, более тяжелой, кровеносные сосуды прорастают из хороида позади сетчатки, что может приводить к просачиванию экссудата и жидкости и также вызывать кровоизлияние.

- болезнь Штаргардта, или желтопятнистую абиотрофию сетчатки, представляющую собой врожденную форму ювенильной макулярной дегенерацию, которая приводит к прогрессирующей потере зрения, обычно до точки практической слепоты. Симптомы обычно проявляются в возрасте 6-13 лет (в среднем приблизительно в 16-18 лет). Симптомы, как правило, развиваются к возрасту 20 лет, и включают волнистое видение, слепые пятна, размытость, нарушения цветового зрения и трудности с адаптацией к тусклому освещению.

- Пигментный ретинит (ПР), который представляет собой врожденное дегенеративное заболевание глаз, вызывающее выраженное нарушение зрения из-за прогрессирующей дегенерации клеток палочковых фоторецепторов. Вначале, на ранних стадиях ПР, пациенты отмечают нарушения периферического и сумеречного зрения в результате сокращения числа палочковых фоторецепторов. Вслед за прогрессирующей дегенерацией палочек позже возникают аномалии смежного пигментного эпителия сетчатки и повреждение колбочковых фоторецепторных клеток. По мере постепенного ухудшения периферического зрения у пациентов развивается прогрессирующее «туннельное зрение» и, в конечном итоге, слепота.

- Другие генетические заболевания, такие как хороидеремия, врожденный амавроз Лебера, ювенильный ретиносхизис, синдром Ушера и синдром Барде-Бидля.

Согласно конкретному предпочтительному варианту реализации указанное дегенеративное заболевание сетчатки глаза выбрано из группы, состоящей из ВМД, болезни Штаргардта, ПР, хороидеремии, врожденного амавроза Лебера, ювенильного ретиносхизиса, синдрома Ушера и синдрома Барде-Бидля. Согласно более предпочтительному варианту реализации указанное дегенеративное заболевание сетчатки глаза представляет собой МД. Согласно еще одному более предпочтительному варианту реализации указанное дегенеративное заболевание сетчатки глаза представляет собой болезнь Штаргардта. Согласно еще одному более предпочтительному варианту реализации указанное дегенеративное заболевание сетчатки глаза представляет собой ПР. Согласно еще одному более предпочтительному варианту реализации указанное дегенеративное заболевание сетчатки глаза представляет собой хороидеремию. Согласно еще одному более предпочтительному варианту реализации указанное дегенеративное заболевание сетчатки глаза представляет собой врожденный амавроз Лебера. Согласно еще одному более предпочтительному варианту реализации указанное дегенеративное заболевание сетчатки глаза представляет собой синдром Ушера. Согласно еще одному более предпочтительному варианту реализации указанное дегенеративное заболевание сетчатки глаза представляет собой синдром Барде-Бидля.

Согласно предпочтительному варианту реализации указанная патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, представляет собой наркотическую зависимость. Термин «наркотическая зависимость» или «зависимость от лекарственного средства» в контексте настоящего изобретения относится к расстройству или патологии, вызываемой частым применением вызывающих привыкание веществ, называемых лекарственными средствами/наркотиками. В соответствии с ICD-10 (Всемирная организация здравоохранения, 2005), для постановки такого диагноза зависимость от лекарственного средства должна отвечать трем или более из следующих критериев, которые относятся к аспектам, связанным как с физической зависимостью, так и с психологической зависимостью, в течение 12-месячного периода:

- сильная тяга к употреблению вещества,

- трудности с контролем указанного употребления,

- абстинентный синдром при прекращении или снижении употребления,

- толерантность,

- прогрессирующая утрата других интересов, кроме употребления вещества,

- увеличение времени, которое тратится на деятельность, связанную с получением вещества или времени для восстановления после его действия,

- продолжение употребления указанного вещества, несмотря на понимание его явных пагубных эффектов.

Для введения субъекту аптамера нуклеиновой кислоты, обладающего способностью к специфическому связыванию и ингибированию TLR-4 и содержащего последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентного варианта, указанный аптамер вводят в состав подходящей фармацевтической композиции. Указанные фармацевтические композиции подробно описаны ниже.

В. Варианты медицинского применения комплекса согласно настоящему изобретению

Комплексы в соответствии с настоящим изобретением, содержащие аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу согласно настоящему изобретению, могут содержать, в качестве функциональной группы, лекарственное средство, подходящее для лечения патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4. Таким образом, достигается двойная цель: (i) ингибирование активности TLR-4 и (ii) направление лекарственного средства специфическим образом в сайт его действия.

Соответственно, согласно другому аспекту настоящее изобретение относится к комплексу, содержащему аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу для применения в медицине.

Согласно другому аспекту настоящее изобретение относится к комплексу, содержащему аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2 или roe функционально эквивалентный вариант, и функциональную группу для применения при получении лекарственного средства для лечения патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4.

Как вариант, настоящее изобретение может быть реализовано в виде применения комплекса, содержащего аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу для применения при лечении патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4.

Как вариант, настоящее изобретение может быть реализовано в виде способа лечения патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4 у субъекта, включающего введение указанному субъекту терапевтически эффективного количества комплекса, содержащего аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу, указанному субъекту.

Согласно настоящему изобретению комплекс, содержащий аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и лекарственное средство, специфически связывается с TLR-4 на поверхности целевой клетки. При контакте аптамера согласно настоящему изобретению с TLR-4, он ингибирует активность последнего, что приводит к снижению или прерыванию высвобождения провоспалительных цитокинов, таких как ИЛ-1, ИЛ-8, ФНО-альфа и ИЛ-12, а указанное лекарственное средство выполняет свою функцию на клетке или в окружении указанной клетки.

Термины «аптамер», «TLR-4», «функционально эквивалентный вариант», «комплекс», «функциональная группа», «лекарственного средства», «лечение», «терапевтически эффективное количество», «субъект», «целевая клетка» и «патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4» были подробно описаны выше, и их определения и особенности включены в настоящий документ посредством ссылки.

Подходящие лекарственные средства, которые могут применяться в качестве функциональных групп в комплексах, содержащих аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4, включают, без ограничения, антагонисты TLR-4, такие как налоксон, налтрексон, ЛПС, ибудиласт, пропентофиллин, амитриптилин, кетотифен, циклобензаприн, миансерин и имипрамин; антитромбоцитарные лекарственные средства, такие как аспирин и клопидогрел; антикоагулянты, такие как гепарин, аценокумарол, варфарин, дабигатран и ривароксабан; и антиоксиданты, такие как эдаравон; тканевый активатор плазминогена и его рекомбинантные варианты; нуклеиновые кислоты, обладающие способностью обеспечивать сайленсинг экспрессии генов, вовлеченных в патологию, характеризующуюся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4, такие как антисмысловая РНК, антисмысловая ДНК и малая интерферирующая РНК; пептиды, такие как сигнальные пептиды и целевые связывающие пептиды.

Фармацевтические композиции

Для введения нуждающемуся в этом субъекту аптамера нуклеиновой кислоты, обладающего способностью к специфическому связыванию и ингибированию TLR-4 и содержащего последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентного варианта, или комплекса, содержащего аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу, указанные аптамеры и комплексы могут быть введены в состав подходящих фармацевтических композиций.

Согласно другому аспекту настоящее изобретение относится к фармацевтической композиции, здесь и далее в настоящем документе «первой фармацевтической композиции согласно настоящему изобретению», содержащей по меньшей мере один аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант.

Согласно конкретному варианту реализации первая фармацевтическая композиция согласно настоящему изобретению дополнительно содержит один или большее количество фармацевтически приемлемых носителей, вспомогательных веществ или растворителей.

Согласно другому аспекту настоящее изобретение относится к фармацевтической композиции, здесь и далее в настоящем документе «второй фармацевтической композиции согласно настоящему изобретению», содержащей по меньшей мере один комплекс, содержащий аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, и функциональную группу.

Согласно конкретному варианту реализации вторая фармацевтическая композиция согласно настоящему изобретению дополнительно содержит один или большее количество фармацевтически приемлемых носителей, вспомогательных веществ или растворителей.

Предложенные в настоящем изобретении фармацевтические композиции могут вводиться субъекту для лечения патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4.

Термины «аптамер», «TLR-4», «функционально эквивалентный вариант», «комплекс», «функциональная группа», «лекарственное средство», «лечение», «субъект» и «патология, характеризующаяся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4» были подробно описаны выше, и их определения и особенности включены в настоящий документ посредством ссылки.

Термин «фармацевтически приемлемый носитель», или «фармацевтически приемлемое вспомогательное вещество», или «фармацевтически приемлемый растворитель» в контексте настоящего изобретения включает все растворители, дисперсионные среды, покрытия, антибактериальные и фунгицидные агенты, замедляющих абсорбцию и обеспечивающих изотоничность агентов и т.п., совместимых с фармацевтическим введением. Применение таких носителей и основ в фармацевтически активных веществах хорошо известно в данной области техники. За исключением случаев, когда какой-либо стандартный носитель несовместим с активным соединением, предусмотрено его применение в композициях согласно настоящему изобретению. Приемлемые основы, вспомогательные вещества или приемлемые стабилизаторы нетоксичны для субъекта в применяемых дозах и концентрациях, и включают буферы, такие как фосфат, цитрат и другие органические кислоты; антиоксиданты, в том числе аскорбиновую кислоту и метионин; консерванты (такие как октадецилдиметилбензил хлорид аммония, хлорид гексаметония, хлорид бензалкония, хлорид бензетония; фенол, бутил или бензиловый спирт; алкилпарабены, такие как метил- или пропилпарабен; катехол; резорцин; циклогексанол; 3-пентанол, и м-крезол); полипептиды с низкой молекулярной массой (менее чем приблизительно 10 аминокислот); белки, такие как сывороточный альбумин, желатин или иммуноглобулины; гидрофильные полимеры, такие как поливинилпирролидон; аминокислоты, такие как глицин, глутамин, аспарагин, гистидин, аргинин или лизин; моносахариды, дисахариды и другие углеводы, в том числе глюкозу, маннозу или декстрины; хелатирующие агенты, такие как ЭДТК; сахара, такие как сахароза, маннит, трегалоза или сорбит; солеобразующие противоионы, такие как натрий; комплексы с металлами (например, комплексы Zn с белком); и/или неионогенные поверхностно-активные вещества, такие как TWEEN™, плюроники (PLURONICS™) или полиэтиленгликоль (ПЭГ).

В предложенную в настоящем изобретении фармацевтическую композицию могут также быть включены дополнительные активные соединения. Соответственно, согласно конкретному варианту реализации предложенная в настоящем изобретении фармацевтическая композиция может также содержать более чем одно активное соединение, необходимое при определенных представляющих интерес показаниях, предпочтительно обладающие дополнительной активностью активные соединения, которые не оказывают взаимного неблагоприятного действия. Например, может быть желательным дополнительное включение химиотерапевтического агента, цитокина, анальгезирующего агента, противовоспалительного агента или иммунодепрессивного агента. Эффективное количество указанных других активных агентов зависит, в том числе, от терапевтического количества аптамеров или комплексов, присутствующих в фармацевтической композиции, природы и серьезности подлежащей лечению патологии, субъекта и т.п.

Согласно одному варианту реализации указанный аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, или комплекс согласно настоящему изобретению вводят в составы с основами, защищающими указанные продукты от быстрого выведения из организма, например, в составы для контролируемого высвобождения, в том числе имплантаты и микроинкапсулированные системы доставки. Могут применяться биоразлагаемые и биосовместимые полимеры, такие как этиленвинилацетат, полиангидриды, полигликолевая кислота, коллаген, полиортоэфиры и полимолочная кислота. Способы получения таких составов будут очевидны для специалистов в данной области техники. Они могут быть получены в соответствии со способами, известными специалистам в данной области техники, например, согласно описанию в патенте США 4522811.

Предложенные в настоящем изобретении фармацевтические композиции могут вводиться субъекту любым подходящим способом, например, парентерально.

Термин «парентеральный» в контексте настоящего изобретения включает внутривенное, внутрибрюшинное, внутримышечное или подкожное введение. Обычно предпочтительна внутривенная форма парентерального введения.

Кроме того, может быть целесообразным введение предложенных в настоящем изобретении фармацевтических композиций путем импульсной инфузии, например, с уменьшающимися дозами аптамера или комплекса согласно настоящему изобретению. Предпочтительно, дозировка обеспечивается путем инъекций, более предпочтительно, внутривенных или подкожных инъекций, отчасти в зависимости от того, является введение краткосрочным или длительным.

Согласно другому конкретному варианту реализации предложенные в настоящем изобретении фармацевтические композиции могут быть адаптированы для парентерального введения путем добавления стерильных растворов, суспензий или лиофилизированных продуктов в подходящей лекарственной форме. Подходящие для инъекционного применения фармацевтические композиции включают стерильные водные растворы или дисперсии или стерильные порошки для получения стерильных растворов для инъекций или дисперсий. Подходящие основы для внутривенного введения включают физиологический солевой раствор, бактериостатическую воду, CremophorEM (BASF, Парсиппани, Нью-Джерси) или забуференный фосфатом солевой раствор (ФСБ). Во всех случаях указанная композиция должна быть стерильной и текучей, что способствует инъекционному введению. Она должна быть стабильной в условиях получения и хранения и защищена от загрязняющего действия микроорганизмов, таких как бактерии и грибы. Указанная основа может представлять собой растворитель или дисперсионную среду, который(ая) содержит, например, воду, этанол, фармацевтически приемлемый полиатомный спирт, такой как глицерин, пропиленгликоль, жидкий полиэтиленгликоль и подходящие смеси перечисленного. Подходящая текучесть может поддерживаться, например, посредством применения покрытия, такого как лецитин, посредством поддержания размера частиц, необходимого в случае дисперсии, и применения поверхностно-активных веществ. Предотвращение действия микроорганизмов может быть обеспечено с применением различных антибактериальных и фунгицидных агентов, например, парабенов, хлорбутанола, фенола, аскорбиновой кислоты, тимеросала и т.п. Во многих случаях предпочтительно включение в композицию обеспечивающих изотоничность агентов, например, сахаров, полиатомных спиртов, таких как маннит, сорбит и хлорид натрия. Может быть обеспечена пролонгированная абсорбция инъецируемых композиций путем включения в композицию замедляющего абсорбцию агента, например, моностеарата алюминия и/или желатина.

Стерильные растворы для инъекций могут быть получены путем добавления требуемого количества активного соединения (например, аптамера или комплекса согласно настоящему изобретению) в подходящем растворителе к одному из ранее перечисленных ингредиентов или их комбинации, при необходимости, с последующей стерилизацией путем фильтрации. Обычно дисперсии получают путем включения активного соединения в стерильную основу, которая содержит основную дисперсионную среду и другие требуемые ингредиенты из ранее перечисленных. В случае стерильных порошков для получения стерильных растворов для инъекций предпочтительные способы получения представлены вакуумной сушкой и сублимационной сушкой, обеспечивающими получение порошка с активным ингредиентом и любым дополнительным требуемым ингредиентом из ранее профильтрованного содержащего их стерильного раствора.

Согласно конкретному варианту реализации указанную фармацевтическую композицию вводят внутривенно. Могут применяться подходящие вспомогательные вещества, такие как объемообразующие агенты, буферные агенты или поверхностно-активные вещества. Указанные составы получают с применением стандартных способов, таких как описанные или включенные в фармакопеи Испании и США и аналогичные референсные публикации.

Целесообразно, в частности, получение фармацевтических композиций, а именно, композиций для парентерального введения, в виде единичных лекарственных форм для облегчения дозированного введения и однородности. «Единичная лекарственная форма» в настоящем документе относится к физически дискретным единицам, подходящим для применения в качестве единиц дозы для введения субъекту, лечение которого проводится, при этом каждая единица содержит заранее заданное рассчитанное количество активного соединения (аптамера или комплекса согласно настоящему изобретению) для получения требуемого терапевтического эффекта в сочетании с требуемой фармацевтической основой. Технические характеристики единичных лекарственных форм согласно настоящему изобретению обусловлены уникальными свойствами активного соединения и конкретного терапевтического эффекта, который необходимо обеспечить, и напрямую зависят от них, и ограничениями, присущими технике получения составов с такими активными соединениями для лечения субъектов.

Активные соединения (аптамер или комплекс согласно настоящему изобретению), как правило, вводят один или более раз в сутки, например, 1, 2, 3 или 4 раз в сутки, при этом типичная общая суточная доза находится в интервале от 0,0001 до 1,000 мг/кг массы тела/сутки, предпочтительно от приблизительно 0,001 до приблизительно 100 мг/кг массы тела/сутки, более предпочтительно от приблизительно 0,01 до 10 мг/кг массы тела/сутки. Составы с фармацевтическими композициями могут быть получены таким образом, чтобы содержать требуемое количество, например, терапевтически эффективное количество аптамера или комплекса согласно настоящему изобретению.

Предложенные в настоящем изобретении фармацевтические композиции могут быть заключены в контейнер, упаковку или диспенсер совместно с инструкциями по введению.

Способы визуализации согласно настоящему изобретению

Согласно другому аспекту настоящее изобретение относится к применению комплекса согласно настоящему изобретению для визуализации in vivo клетки, ткани или органа, которые экспрессируют TLR4, при этом указанный комплекс содержит один или большее количество аптамеров согласно настоящему изобретению и функциональную группу, которая представляет собой детектируемый фрагмент.

Подходящие детектируемые фрагменты для применения в способах визуализации in vivo согласно настоящему изобретению были описаны выше в контексте комплекса согласно настоящему изобретению и включают, без ограничения, радионуклид, флуорофор, контрастную среду, белок и гаптен.

Настоящее изобретение описано ниже на примерах, которые являются исключительно иллюстративными и никоим образом не ограничивают объем настоящего изобретения.

ПРИМЕРЫ

Материалы и методы

Библиотека аптамеров

Для скрининга аптамеров, специфических в отношении TLR-4, авторы настоящего изобретения использовали библиотеку аптамеров RND40, поставляемую IBA GmbH (Геттинген, Германия). Исходная библиотека RND40 теоретически составлена 1024 одноцепочечными ДНК (оцДНК) олигонуклеотидами с фиксированной последовательностью из 18 нуклеотидов на концах, каждый из которых гибридизуется с соответствующими праймерами для ПЦР-амплификации, и центральной областью, состоящей из 40 оснований, образующих случайную последовательность. В ходе проведенного скрининга использовались 1013 олигонуклеотидов из указанной библиотеки.

Рекомбинантный 6HIS-hTLR-4

Белок, соответствующий внеклеточному домену белка TLR-4 человека, аминокислоты 24-631, с присоединенной к С-концу 6-гистидиновой меткой, получали рекомбинантным способом путем бакуловирусной экспрессии.

Клетки

Клетки HEK293T и HEK293T/TLR-4 получали от Invivogen (Сан-Диего, Калифорния, США).

Скрининг с использованием клеток HEK-293T-TLR4/HEK-293T

В каждом раунде скрининга 8-10 × 105 клеток HEK-293Т высевали в трех повторностях в лунки планшетов Р6 за 24 ч до проведения скрининга, и инкубировали при 37°С, 5% СО2. Затем добавляли 1 нмоль аптамеров из библиотеки RND40 (или из популяции, выделенной в ходе предшествующего раунда скрининга) в 100 мкл ФСБ, предварительно денатурированных при 95°С в течение 10 мин с последующим инкубированием при 4°С в течение 10 мин; добавляли и наносили на клетки 300 мкл среды DMEM (модифицированная по способу Дульбекко среда Игла) с добавлением 10% фетальной бычьей сыворотки, 100 Ед/мл пенициллина, 100 мкг/мл стрептомицина и 25 мкг/мл амфотерицина. Через 1 ч инкубации при 37°С, 5% СО2 культуральную среду с несвязанными аптамерами удаляли, клетки двукратно промывали ФСБ и выделяли в 500 мкл ФСБ центрифугированием при 1500 об/мин. Клетки центрифугировали для удаления супернатанта и присоединенные к клеткам аптамеры амплифицировали посредством ПЦР для получения достаточного количества для следующего раунда скрининга.

Обратный скрининг на клетках HEK-293Т из библиотеки RND40 аптамеров выполняли во время предварительного получения исходной популяции RND40 и через каждые 3 раунда скрининга, на популяции, выделенной в предыдущем раунде скрининга. С указанной целью 8-10×105 клеток HEK-293Т высевали в трех повторностях в лунки планшетов Р6 за 24 ч до скрининга и инкубировали при 37°С, 5% СО2. Затем добавляли 1 нмоль аптамеров из библиотеки RND40 (или из популяции, выделенной в ходе предыдущего раунда скрининга) в 100 мкл ФСБ, предварительно денатурированных при 95°С в течение 10 мин с последующим инкубированием при 4°С в течение 10 мин; добавляли и наносили на клетки 300 мкл среды DMEM (модифицированная по способу Дульбекко среда Игла) с добавлением 10% фетальной бычьей сыворотки, 100 Ед/мл пенициллина, 100 мкг/мл стрептомицина и 25 мкг/мл амфотерицина. Через 1 ч инкубации при 37°С, 5% СО2 извлекали культуральную среду с несвязанными аптамерами для использования в раундах скрининга на TLR-4.

Скрининг с растворимым белком hTLR-4

Для каждого раунда скрининга использовали библиотеку RND40, обогащенную в ходе предыдущего раунда скрининга. 1 нмоль аптамеров инкубировали с 7 мкг 6xHIS-hTLR-4 (в соотношении 10 молекул аптамера на 1 молекулу hTLR-4), в буфере для аптамеров (20 мМ Tris-HCl, pH 7,4, 1 мМ MgCl2, 150 мМ NaCl, 5 мМ KCl), при 37°С в течение 1 часа при перемешивании. Затем добавляли смолу NTA-Ni (QIAGEN, Германия) и инкубировали при 4°С в течение 1 часа для захвата белка. После трехкратного промывания буфером для аптамера, связанные последовательности амплифицировали с помощью ПЦР для получения достаточного количества для следующего раунда скрининга.

Обратный скрининг осуществляют в тех же условиях, что и скрининг, но в отсутствие белка TLR-4, связанного со смолой.

Амплификация выбранных аптамеров

Выбранные аптамеры ресуспендировали в объеме 20 мкл дистиллированной воды и амплифицировали посредством ПЦР с применением праймеров, соответствующих последовательностям SEQ ID NO: 5 (GCGGATGAAGACTGGTGT) и SEQ ID NO: 6 (GTTGCTCGTATTTAGGGC) в условиях 0,8 мкМ/праймер SEQ ID NO: 5, 0,8 мкМ/праймер SEQ ID NO: 6, 200 мМ дНТФ, 2 мМ MgCl2, 10 Ед полимеразы Taq (Biotools, Испания) в конечном объеме 200 мкл в соответствии со следующей программой амплификации: 2 мин при 95°С; 15 циклов по 30 секунд при 95°С, 30 секунд при 56°С и 30 секунд при 72°С; и наконец, 5 минут при 72°С.

ELONA

Определяли, распознают ли выбранные аптамеры белок TLR-4. С указанной целью в 96-луночный микротитрационный планшет добавляли по 100 нг/лунку рекомбинантного 6xHIS-TLR-4 и инкубировали при 4°С в течение 16 часов. Затем индивидуальные аптамеры, меченые дигоксигенином по 5'-концу, разводили до концентрации 5 мкг/мл, денатурировали в течение 10 мин при 95°С и охлаждали в течение 10 мин на льду. Затем в каждую лунку добавляли 20 пмоль каждого из аптамеров в 100 мкл (200 нМ) буфера для аптамеров, и планшет инкубировали в течение 1 часа при 37°С. Наконец, планшет инкубировали с конъюгированными с пероксидазой антителами к дигоксигенину и проявляли с применением ABTS. Анти-LiH2A ДНК-аптамер использовали в качестве положительного контроля ( et al., 2013, PLoS ONE 8: e78886).

Анализ связывания аптамеров с рекомбинантным hTLR-4

Для анализа способности каждого из идентифицированных аптамеров к связыванию с hTLR-4 осуществляли эксперименты, в ходе которых hTLR-4 связывали со смолой Ni-NTA, предварительно уравновешенной, посредством гистидиновой метки. Затем комплексы смолы и белка, содержащие 1 пмоль TLR4, инкубировали с 1 пмоль аптамеров TLRApt#1R (SEQ ID NO: 3), TLRApt#2F, TLRApt#3R и TLRApt#4F (SEQ ID NO: 4), ранее структурированных путем термоденатурации при 95°С в течение 10 мин и последующей ренатурации при 4°С в течение 10 мин. После инкубации в течение 10 мин при 37°С комплексы промывали и аптамеры выделяли с применением 150 мМ имидазола, растворенного в ФСБ с 1 мМ MgCl2. Количество аптамера, связанного с hTLR-4, определяли посредством количественной ПЦР (кПЦР) с применением праймеров с последовательностями SEQ ID NO: 5 и SEQ ID NO: 6 в термоциклере IQ5 (BioRad).

Анализы связывания аптамеров с TLR-4, экспрессируемым в клетках

Для анализа способности идентифицированных аптамеров к связыванию с белком TLR-4, экспрессируемым в клетках НЕК-293, по 20 пмоль каждого из аптамеров TLRApt#1R (SEQ ID NO: 3), TLRApt#2F, TLRApt#3R и TLRApt#4F (SEQ ID NO: 4) добавляли в культуру клеток HEK-293-TLR4, высеянных с плотностью 20000 клеток/лунку в 96-луночные микротитрационные планшеты с плотностью 2×104 клеток/лунку, за 2 дня до начала анализа. После инкубации в течение 30 минут при 37°С, 5% СО2, клетки промывали, аптамеры выделяли с применением 150 мМ имидазола, растворенного в ФСБ с 1 мМ MgCl2, и проводили кПЦР для определения значений Ct.

Анализ активности рецептора hTLR-4

Для проведения указанного анализа использовали клетки HEK-Blue hTLR4 (Invivogen, референсный номер: hkb-htlr4), экспрессирующие рецептор TLR-4 человека, наряду с белками MD2 и CD14, которые активируются при связывании их агониста, липополисахарида Escherichia coli K12 (LPS-EK). Для детекции активации TLR-4 указанная линия клеток содержит репортерный ген SEAP (секретируемой эмбриогенной щелочной фосфатазы), контролируемый промотором NF-kB, таким образом, он экспрессируется в ответ на индукцию TLR-4 указанного сигнального пути NF-kB. Фермент SEAP секретируется в культуральную среду, и за счет добавления и метаболизирования его коммерческого субстрата QUANTI-Blue™ (Invivogen, Сан-Диего, Калифорния, США) вызывает изменение цвета среды с красного на синий. Кроме того, контрольную молекулу-агонист LPS-EK UP (липополисахарид Е. coli K12, ультрачистый) и антагонист LPS-RS UP (липополисахарид R. sphaeroides, ультрачистый) растворяют в 1 мМ MgCl2 в стерильном ФСБ в концентрациях 0,02 нг/мкл и 2 нг/мкл, соответственно. Аптамеры получают в концентрациях, составляющих 0,1; 1; 10 и 100 нг/мкл в 1 мМ Cl2Mg в стерильном ФСБ, денатурируют при 95°С в течение 10 мин и структурируют при 4°С в течение 10 мин.

Для указанного анализа клетки HEK Blue-hTLR4 высевали в 96-луночные культуральные планшеты по 2×104 клеток/лунку в 200 мкл полной среды DMEM с добавлением (1x) HEK-Blue™ Selection. Через 24 часа или 48 ч инкубации, после достижения 70-80% конфлюентности клеток, среду извлекали и добавляли 170 мкл свежей среды. В контрольные лунки добавляют по 30 мкл буфера SELEX. В остальные лунки добавляли по 20 мкл ультра-чистого LPS-EK (Invivogen, США) в концентрации 20 нг/мл (конечная концентрация 0,1 нг/мл) или 20 мкл лизата 1,5-2,5×107 клеток HEK293 на мл (молекулярный паттерн, ассоциированный с повреждениями; DAMP) в качестве молекул агониста. Через 1 ч инкубации в лунки добавляли 10 мкл аптамера, разведенного до подходящих концентраций в буфере SELEX для получения конечных концентраций, указанных на фигурах. Ультра-чистый LPS-RS (Invivogen, США) в концентрации 200 нг/мл использовали в качестве контрольного антагониста. Активность секретируемой эмбриональной щелочной фосфатазы (SEAP) измеряли через 24 часа с применением субстрата QUANTI-Blue™ (Invivogen) при 630 нм.

Эффект аптамеров на макрофаги

Перитонеальные макрофаги высевали в 12-луночные планшеты с плотностью 1×106 клеток/мл. Макрофаги стимулировали в присутствии 500 нг/мл ЛПС, и через 1 ч добавляли аптамер до конечной концентрации, составляющей 20 нМ и 200 нМ. Высвобождение нитритов измеряли с применением реакции Грисса через 24 ч. Образцы анализировали в двух повторностях.

Модель инсульта на животных

Использовали взрослых самцов мышей C57BL массой 28-30 г. Мышей C57BL/10ScNJ (ранее называвшихся C57BL/10ScCr) и C57BL/10ScSn получали из Лаборатории Джексона (The Jackson Laboratory, Бар-Харбор, Мэн, США). У мышей линии C57BL/10ScNJ не экспрессируется функциональный TLR4 из-за делеции гена TLR4; у мышей линии C57BL/10ScSn не выражены какие-либо мутации гена TLR4 и их используют в качестве контрольной группы. Использовали 4 дефицитных по TLR4 мышей (C57BL/10ScNJ) на группу и 4 контрольных мышей (C57BL/10ScSn) на группу. Все экспериментальные протоколы соответствовали указаниям « de Bienestar Animal» (Комитета по благополучию животных) Университета Комплутенсе (согласно европейским директивам 86/609/ЕЕС и 32/2007/ЕС). Животных содержали при обычных температуре и влажности и 12-часовом светотемновом цикле со свободным доступом к пище и воде.

Индукцию фокальной церебральной ишемии осуществляли посредством окклюзии средней мозговой артерии (МСАО) в соответствии с описанием в источнике: Caso et al., 2007 (Caso et al., 2007, Circulation 115:1599-608). Вкратце, постоянную фокальную церебральную ишемию индуцируют лигатурой общей сонной артерии (ССА) и дистальной ипсилатеральной окклюзии средней мозговой артерии (МСА). Для выполнения лигатуры ССА делают боковой надрез на шее для доступа к указанной артерии и перекрывают ее наложением постоянной лигатуры. Для окклюзии МСА выполняют надрез на расстоянии 1 см от перпендикулярной линии, соединяющей боковой кантус левого глаза, и удаляют наружный слуховой проход и височную мышцу. Просверливают отверстие для доступа к МСА, на которую накладывают лигатуру для ее окклюзии. После хирургического вмешательства, закрытия разрезов и дезинфекции животных возвращают в клетки со свободным доступом к воде и пище. Во время операции контролируют основные показатели жизнедеятельности животных.

Повреждение головного мозга оценивали посредством магнитно-резонансной визуализации. Вкратце, мышей анестезировали изофлураном и через 24 часа после МСАО оценивали размер инфаркта с помощью МРТ. Изображения, подсвеченные на Т2 (T2WI), получали на BIOSPEC ВМТ 47/40, работающем при 4,7 Т (Bruker-Medical, Эттлинген, Германия; аппарат МРТ, Многопрофильный институт Мадридского университета Комплутенсе).

Проточно-цитометрический анализ

Все проточно-цитометрические анализы осуществляли на проточном цитометре модели FACScan (Becton Dickinson Immunocytometry systems). Связывание аптамеров с TLR4 на клеточной поверхности анализировали, высевая клетки HEK293 или HEK Blue-hTLR4 в 24-луночные культуральные планшеты с плотностью 2×105 клеток/лунку в 200 мкл полной среды DMEM с добавлением буфера HEK-Blue™ Selection. Затем клетки обрабатывают или не обрабатывают активатором TLR-4 LPS-EK-UP (0,4 нг/лунку) в течение 30 минут, и мечеными Alexa Fluor 488 аптамерами (20 нМ) в буфере ФСБ объемом 50 мкл, содержащем 1 мМ MgCl2 и 1 мг/мл БСА в течение 30 минут при комнатной температуре в темноте. Затем клетки промывали 2 мл того же буфера, суспендировали в 0,5 мл буфера и проводили их проточно-цитометрический анализ.

Расщепление нуклеазами

Осуществляли укладку 300 нг аптамеров в буфере SELEX путем нагревания до 95°С и охлаждения на льду. После повторной укладки аптамер инкубировали с 2 Ед λ-экзонуклеазы или ДНКазы I (Fermentas) в реакционном объеме 10 мкл в течение 10 мин, 30 мин, 1 ч, 2 ч и 4 ч при 37°С. Затем образцы разделяли на 3% агарозном геле. Полосы визуализировали с применением GelRed (Biotium) и количественно определяли с помощью программного обеспечения Image Studio Digits V3.1.

ПРИМЕР 1: Скрининг аптамеров, специфических в отношении TLR-4

Для скрининга аптамеров, специфических в отношении TLR-4, авторы настоящего изобретения использовали библиотеку аптамеров RND40, поставляемую IBA GmbH (Геттинген, Германия). Исходная библиотека RND40 состоит из олигонуклеотидов (оцДНК) с фиксированной последовательностью на концах из 18 нуклеотидов на концах, каждый из которых гибридизуется с соответствующими праймерами для ПЦР-амплификации, и центральной областью, состоящую из 40 оснований, образующих случайную последовательность.

Исходную библиотеку RND40, содержащую 1013 аптамеров, обогащали по аптамерам, специфическим в отношении hTLR-4. В качестве предварительного этапа перед скринингом TLR-4 выполняли «обратный скрининг» библиотеки на поверхности или матрице, где представлена целевая молекула (магнитная смола, клетки той же линии, что и экспрессирующие целевой белок, и т.п.).

ПРИМЕР 2: Характеризация выбранных аптамеров

Выбранные аптамеры идентифицировали через 6 раундов скрининга в соответствии со следующими стратегиями:

a) Посредством клонирования популяции аптамеров в плазмиду с целью получения индивидуальных аптамеров, с последующим секвенированием по Сэнгеру.

b) Посредством массивного секвенирования популяции полученных аптамеров, с идентификацией аптамеров, встречающихся максимальное число раз.

Наиболее часто встречающиеся последовательности химически синтезировали в IBA GmbH (Геттинген, Германия), и аффинность и активность каждого из аптамеров исследовали в ходе анализов связывания с рекомбинантным белком hTLR-4 или TLR-4 из клеток НЕК-293, посредством ELONA, анализов связывания аптамеров с рекомбинантным белком TLR-4 и с TLR-4, экспрессируемым в клетках, анализов активности рецептора hTLR-4.

Результаты анализов ELONA (фиг. 1) ясно показывают, что аптамеры, которые более эффективно связываются с рекомбинантным белком hTLR-4, представлены аптамерами TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4). С применением такого же анализа идентифицировали аптамеры TLRApt#2F и TLRApt#3R. На фиг.2 показаны наиболее вероятные последовательности и вторичные структуры выбранных аптамеров TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4), полученные с применением программного обеспечения mFold (Zuker М., 2003, Nucleic Acids Res 31:3406-15).

Способность к связыванию аптамеров с hTLR-4 определяли путем инкубации аптамеров со смолой Ni-NTA со связанным hTLR-4, выделения и последующей кПЦР-амплификации связанных аптамеров. Полученные результаты показывают, что все выбранные аптамеры способны связывать рекомбинантный белок hTLR-4 (фиг. 3А). В указанных экспериментах более низкое значение Ct указывает на большее количество аптамера, связанного с hTLR-4.

Для анализа способности идентифицированных аптамеров к связыванию с белком TLR-4, экспрессируемым в клетках НЕК-293, 20 пмоль (500 нг) аптамеров TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4) добавляли в культуру клеток НЕК-293-TLR4. После инкубации в течение 30 минут при 37°С, 5% СО2 клетки промывали и выделяли, и проводили кПЦР для вычисления значений Ct. В указанных экспериментах более низкое значение Ct указывает на большее количество аптамера, связанного с клетками. Полученные результаты показывают, что выбранные аптамеры TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4) (фиг. 3В) связываются с большим сродством.

Для определения концентрации каждого из аптамеров, при которой достигается максимальный антагонистический эффект, строили кривые зависимости ответа от дозы при применении в качестве агониста LPS-EK-UP (фиг. 4А) или лизатов клеток HEK293 (молекулярный паттерн, ассоциированный с повреждениями; DAMP) (фиг. 4В). На основании полученных результатов можно заключить, что концентрации, при которых наблюдается наилучший эффект, составляют 20 нМ для агониста LPS-EK-UP и 200 нМ для DAMP.

Эффект аптамеров на макрофаги показан на фиг. 5. Аптамеры TLRApt#4F (SEQ ID NO: 4) и TLRApt#4F-T (SEQ ID NO: 2) ингибировали высвобождение нитрита после стимуляции макрофагов ЛПС. В указанных экспериментах аптамер TLRApt#4F (SEQ ID NO: 4), по-видимому, проявляет более высокую активность, чем TLRApt#4F-T (SEQ ID NO: 2) при равных концентрациях.

ПРИМЕР 3: Оптимизация аптамеров-антагонистов TLR-4 для повышения их активности и стабильности в моделях на животных

Аптамеры, продемонстрировавшие способность к ингибированию рецептора TLR-4, были модифицированы посредством удаления из последовательности конкретных областей с целью повышения стабильности и/или устойчивости к нуклеазам. С указанной целью проводили исследование вторичной структуры разных аптамеров с применением программы mFold (источник: Zuker М., 2003, упомянутый выше), а способность аптамеров к формированию G-квадруплексных структур анализировали с помощью программы QGRS Mapper (Kikin et al., 2006, Nucleic Acids Res 34:W676-W682). Соответственно, конструировали и синтезировали аптамеры TLRApt#1R-T (SEQ ID NO: 1) и TLRApt#4F-T (SEQ ID NO: 2), соответствующие идентифицированным в ходе первых скринингов (фиг. 6).

ПРИМЕР 4: Эффект аптамеров-антагонистов TLR-4 в модели инсульта на животных

Оценивали способность новых специфических в отношении TLR-4 аптамеров, оптимизированных для блокирования воспалительного ответа, запускаемого после эпизода инсульта в модели инсульта на животных, уменьшать повреждение головного мозга.

С указанной целью использовали взрослых самцов мышей, дефицитных по TLR-4 (C57BL/10ScNJ) и контрольных мышей, экспрессирующих TLR-4 (C57BL/10ScSn), у которых индуцировали фокальную церебральную ишемию посредством окклюзии средней мозговой артерии (МСАО). Полученные для мышей с нормальной экспрессией TLR4 (контрольные мыши) результаты демонстрируют, что аптамеры вызывают уменьшение размера пораженной инфарктом области, в случае аптамера TLRApt#4F-T (SEQ ID NO: 2) статистически значимое. Кроме того, полученные для дефицитных по TLR-4 мышей результаты показывают отсутствие эффекта аптамера TLRApt#4F-T (SEQ ID NO: 2), по сравнению с получаемым при введении мышам основы (фиг. 7). Указанные данные ясно показывают, что эффект аптамера TLRApt#4F-T (SEQ ID NO: 2) опосредован TLR-4.

В другой серии экспериментов у взрослых самцов мышей C57BL/10ScSn (дикого типа (WT); здоровые) индуцировали фокальную церебральную ишемию и затем проводили лечение посредством внутрибрюшинного инъецирования разных количеств аптамеров TLRApt#4F-T (SEQ ID NO: 2) и TLRApt#4F (SEQ ID NO: 4), или основы (ФСБ + 1 мМ Mg2+). Полученные результаты показывают, что аптамеры вызывают более значительное уменьшение размера пораженной инфарктом зоны в дозе 1 нмоль аптамера на животное, и что указанное уменьшение статистически значимо (фиг. 8).

ПРИМЕР 5: Проточная цитометрия

Проточно-цитометрические анализы осуществляли с применением линии клеток HEK293, трансфицированной TLR4 человека, 293-hTLR4A. Исходную линию клеток HEK293 человека с отсутствующим TLR4 человека использовали в качестве контроля. В указанном эксперименте аптамеры метили Alexa Fluor 488. На фиг. 9А видно выраженное связывание меченых Alexa Fluor 488 аптамеров с клетками 293-hTLR4A (правая панель), но не с клетками НК293, в которых отсутствует TLR4 человека (левая панель). Кроме того, наблюдается связывание ApTLR#4F-T (SEQ ID NO: 2) с мишенью с большим сродством по сравнению с ApTLR#1R-T (SEQ ID NO: 1). Далее, сравнивали результаты окрашивания клеток с применением выбранных аптамеров после активации (или без активации) клеток hTLR4-Blue-HEK. Как и ожидалось, после активации аптамеры связывали TLR4 на уровне, аналогичном наблюдаемому для неактивированных клеток (фиг. 9В).

ПРИМЕР 6: Вычисление времени полужизни с применением расщепления нуклеазами

Время полужизни аптамеров измеряли in vitro в присутствии λ-экзонуклеазы или ДНКазы I (фиг. 10). Результаты показывают, что указанные 4 аптамера устойчивы к λ-экзонуклеазе, тогда как под действием ДНКазы I наблюдается зависимое от времени разложение четырех указанных аптамеров. Соответственно, аптамер ApTLR#1R-T (SEQ ID NO: 1) наиболее чувствителен и полностью разлагается через 5 минут инкубации в присутствии ДНКазы I. И напротив, аптамеры ApTLR#4F (SEQ ID NO: 4) и ApTLR#4F-T (SEQ ID NO: 2) сохраняют устойчивость даже через 2 ч инкубации с ДНКазой I.

Выводы

- Аптамеры TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4) были выбраны на основании специфичности в отношении внеклеточного домена рецептора TLR-4, который распознает рецептор TLR-4 человека как в растворимой рекомбинантной форме (in vitro), так и в интегрированной в мембрану клеток HEK293 форме (in vivo).

- Аптамеры TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4) демонстрируют антагонистический эффект рецептора TLR-4.

- Аптамеры TLRApt#1R-T (SEQ ID NO: 1) и TLRApt#4F-T (SEQ ID NO: 2) были получены в усеченной форме, сохраняющей антагонистическую активность исходных аптамеров TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4), соответственно.

- Аптамер TLRApt#4F-T (SEQ ID NO: 2) способен уменьшать зону поражения инфарктом в модели инсульта на животных.

- Аптамеры TLRApt#1R (SEQ ID NO: 3) и TLRApt#4F (SEQ ID NO: 4), выбранные ввиду специфичности в отношении внеклеточного домена рецептора TLR4, распознают рецептор TLR-4 человека как в рекомбинантной растворимой форме (in vitro), так и в интегрированной в мембрану клеток HEK293 форме (in vivo).

1. Аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, имеющий по меньшей мере 70% идентичности последовательности с SEQ ID NO: 1 или SEQ ID NO: 2.

2. Аптамер по п. 1, отличающийся тем, что указанная последовательность выбрана из группы, состоящей из SEQ ID NO: 3 и SEQ ID NO: 4.

3. Аптамер по любому из пп. 1 или 2, отличающийся тем, что указанная нуклеиновая кислота представляет собой ДНК.

4. Аптамер по любому из пп. 1–3, отличающийся тем, что указанный TLR-4 представляет собой TLR-4 человека.

5. Аптамер по любому из пп. 1–4 для применения при лечении патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4.

6. Аптамер для применения по п. 5, отличающийся тем, что указанная патология, характеризующаяся увеличением экспрессии и/или увеличением активации TLR-4, выбрана из группы, состоящей из инсульта, острого инфаркта миокарда, сепсиса, атеросклероза, рассеянного склероза, ревматоидного артрита, дегенеративного заболевания сетчатки глаза и наркотической зависимости. 7. Аптамер для применения по п. 6, отличающийся тем, что указанная патология, характеризующаяся увеличением экспрессии и/или увеличением активации TLR-4, представляет собой инсульт. 8. Аптамер для применения по п. 6, отличающийся тем, что указанная патология, характеризующаяся увеличением экспрессии и/или увеличением активации TLR-4, представляет собой дегенеративное заболевание сетчатки глаза, выбранное из группы, состоящей из возрастной макулярной дегенерации, болезни Штаргардта, пигментного ретинита, хороидеремии, врожденного амавроза Лебера, ювенильного ретиносхизиса, синдрома Ушера и синдрома Барде-Бидля. 9. Комплекс, обладающий способностью к специфическому связыванию и ингибированию TLR-4, содержащий аптамер по любому из пп. 1–4 и функциональную группу, выбранную из группы, состоящей из детектируемого реагента, лекарственного средства и наночастицы.

10. Комплекс по п. 9, отличающийся тем, что указанная функциональная группа представляет собой детектируемый реагент.

11. Комплекс по п. 9, отличающийся тем, что указанная функциональная группа представляет собой лекарственное средство.

12. Комплекс по п. 9, отличающийся тем, что указанная функциональная группа представляет собой наночастицу.

13. Комплекс по п. 12, отличающийся тем, что указанная наночастица представляет собой наночастицу металла.

14. Комплекс по п. 13, отличающийся тем, что указанная наночастица металла представляет собой магнитную наночастицу мезопористого диоксида кремния.

15. Комплекс по любому из пп. 9–14 для применения при лечении патологии, характеризующейся увеличением экспрессии TLR-4 и/или увеличением активации TLR-4.

16. Комплекс для применения по п. 15, отличающийся тем, что указанная патология, характеризующаяся увеличением экспрессии и/или увеличением активации TLR-4, выбрана из группы, состоящей из инсульта, острого инфаркта миокарда, сепсиса, атеросклероза, рассеянного склероза, ревматоидного артрита, дегенеративного заболевания сетчатки глаза и наркотической зависимости.

17. Комплекс для применения по п. 16, отличающийся тем, что указанная патология, характеризующаяся увеличением экспрессии и/или увеличением активации TLR-4, представляет собой инсульт.

18. Комплекс для применения по п. 16, отличающийся тем, что указанная патология, характеризующаяся увеличением экспрессии и/или увеличением активации TLR-4, представляет собой дегенеративное заболевание сетчатки глаза, выбранное из группы, состоящей из возрастной макулярной дегенерации, болезни Штаргардта, пигментного ретинита, хороидеремии, врожденного амавроза Лебера, ювенильного ретиносхизиса, синдрома Ушера и синдрома Барде-Бидля.

19. Способ детекции TLR-4 в образце in vitro, включающий

i) приведение указанного образца в контакт с аптамером по любому из пп. 1–4 или комплексом по любому из пп. 9–14, и

ii) выделение указанного аптамера или комплекса, не связанного с TLR-4,

iii) детекцию присутствия аптамера или комплекса, связанного с TLR-4, присутствующим в указанном образце.

20. Способ по п. 19, отличающийся тем, что детекцию осуществляют с применением флуоресценции.

21. Способ по п. 19 или 20, отличающийся тем, что указанный образец представляет собой биологический образец, полученный от субъекта.

22. Способ по п. 21, отличающийся тем, что указанный субъект представляет собой человека.

23. Фармацевтическая композиция для лечения патологии, характеризующейся увеличением экспрессии TLR-4, содержащая терапевтически эффективное количество по меньшей мере одного аптамера по любому из пп. 1–4 или по меньшей мере одного комплекса по любому из пп. 9–14, необязательно в комбинации с одним или более фармацевтически приемлемым носителем, вспомогательным веществом или растворителем.

24. Применение комплекса по любому из пп. 9–14 для визуализации in vivo клетки, ткани или органа, которые экспрессируют TLR4.



 

Похожие патенты:
Изобретение относится к области биотехнологии. Изобретение представляет собой способ, заключающийся в применении специфичных олигонуклеотидных последовательностей с регистрацией результатов ЦПР в режиме реального времени с использованием метода анализа кривых плавления (HRM).

Изобретение относится к биотехнологии, иммунологии и вирусологии. Описано иммунобиологическое средство на основе рекомбинантного аденовируса человека 5-го серотипа или рекомбинантного аденовируса человека 26-го серотипа, содержащее оптимизированную под экспрессию в клетках млекопитающих консенсусную последовательность полного протективного антигена S вируса БВРС на основании последовательностей генов белка S современных штаммов вируса БВРС 2015-2017 гг.

Изобретение относится к области биотехнологии, конкретно к способу получения иммобилизованной библиотеки фрагментов ДНК нуклеиновой кислоты-мишени со штрихкодами с использованием иммобилизованных на носителе транспозомных комплексов для захвата специфических фрагментов ДНК.

Изобретение относится к области биотехнологии и медицины. Предложен способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-РНК, включающий выделение тотальной РНК из тканевых проб глиом и перифокальной зоны, обратную транскрипцию, с последующей амплификацией в режиме реального времени RT-PCR, отличающийся тем, что используют высокоспецифичные праймеры для генетических локусов EGFR, MSI1, PSMC4, ТВР, RPLO, и микро-РНК hsa-miR-92-1-5р, hsa-miR-126-5p, hsa-miR-7-5p, анализируют полученные данные и вычисляют коэффициент относительной экспрессии Е с использованием трех высокоспецифичных референсных генов: PSMC4, ТВР, RPLO и двух референсных высокоспецифичных микро-РНК: hsa-miR-126-5р, hsa-miR-7-5p, сравнивают полученные значения Е в опухолевой ткани с контрольными и при значениях EEGFR<0,5 или EEGFR>1,5, EMSI1<0,5 или EMSI1>1,5, Ehsa-miR-92a-1-5p<0,5 или Ehsa-miR-92a-1-5p>1,5 хотя бы по одному локусу у пациента диагностируется глиома высокой степени злокачественности III, IV; отсутствие изменений экспрессии указанных локусов относительно контроля свидетельствует о соответствии опухоли II степени злокачественности.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ, заключающийся в применении специфичных олигонуклеотидных последовательностей с регистрацией результатов ЦПР в режиме реального времени с использованием метода анализа кривых плавления (HRM).

Изобретение относится к области биотехнологии. Изобретение представляет собой способ проведения ПЦР в режиме реального времени для генотипирования крупного рогатого скота по аллелям 337C/G гена fshr (rs43745234), состоит в том, что используются:прямой праймер прямой праймер 5'-GAATTGAAAAGGCCAACAACC-3',обратный праймер 5'-CACCAGAATACAGAAGTTCTTACAGA-3',FSHR337C - аллель-специфичный флуоресцентно-меченый зонд-5'-FAM-CATCGACCCTGATGCC BHQ1-3',FSHR337G - аллель-специфичный флуоресцентно-меченый зонд5'-VIC-CATCGACGCTGATGC-BHQ1-3'.Изобретение позволяет повысить надежность детекции аллелей 337C/G (rs43745234) гена fshr, упростить анализ и сократить время его проведения до 1,5 часов.

Изобретение относится к биотехнологии, в частности к генетической инженерии, и представляет собой сконструированную in vitro рекомбинантную плазмидную ДНК, содержащую две копии синтетического гена гранулоцитарно-макрофагального колониестимулирующего фактора (ГМ-КСФ) человека, штамм Escherichia coli SG20050/p280_2GM - продуцент указанного полипептида и способ получения полипептида со свойствами ГМ-КСФ.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложена частица рекомбинантного аденоассоциированного вируса (rAAV) для применения в лечении мукополисахаридоза I типа (MPS I), имеющая AAV-капсид и имеющая упакованный в него 5’ инвертированный концевой повтор (ITR), ген альфа-L-идуронидазы человека (hIDUA) под контролем регуляторных последовательностей, которые контролируют его экспрессию, и 3’ ITR AAV, где упомянутый ген hIDUA имеет последовательность, показанную в SEQ ID NO: 1, которая кодирует функциональную альфа-L-идуронидазу человека, а также композиция и применение.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложена рекомбинантная молекула нуклеиновой кислоты для получения аланина в рекомбинантном микроорганизме Е.

Изобретение относится к области биотехнологии. Изобретение представляет собой генетическую конструкцию, несущую оптимизированный по представленности кодонов, GC-составу, наличию полиА участков и структуре образуемой мРНК ген консенсусного гликопротеина (белка G) вируса бешенства.

Настоящее изобретение относится к новому режиму дозирования для введения 3-[5-амино-4-(3-цианобензоил)пиразол-1-ил]-N-циклопропил-4-метилбензамида или его фармацевтически приемлемого производного, а именно при лечении острых обострений воспалительного заболевания.

Изобретение относится к фармацевтической промышленности, а именно к способу получения ректальных пантовых суппозиториев. Способ получения ректальных пантовых суппозиториев для лечения мужских урологических и проктологических заболеваний, выбранных из воспалительных процессов в прямой кишке, трещин заднего прохода, простатита и аденомы предстательной железы, состоящих из масла какао, ланолина, пантогематогена сухого, прополиса, витамина РР, витамина Е, гуминовых кислот, экстракта красного корня, обладающего противовоспалительным эффектом, и экстракта крапивы, обладающего противовоспалительным эффектом, при определенных соотношениях компонентов, заключающийся в том, что в реактор с включенной мешалкой при 60°С подают масло какао и ланолин, перемешивают в течении 1 часа до полного растворения компонентов с получением основы, в полученную основу добавляют пантогематоген сухой, прополис, витамин РР, витамин Е, гуминовые кислоты и постоянно перемешивают при температуре 40°С в течение 0,5 часа до полного растворения компонентов смеси, в полученную смесь добавляют экстракт красного корня и экстракт крапивы при перемешивании и температуре при 40°С, смесь выливают в контурную ячейковую упаковку.

Изобретение относится к новым соединениям общей формулы I или их фармацевтически приемлемой соли. Соединения обладают свойствами ингибитора Trk и могут быть использованы для лечения TRK-опосредованного заболевания, выбранного из группы, состоящей из папиллярной карциномы щитовидной железы, рака поджелудочной железы, рака легких, рака толстой кишки, карциномы молочной железы, нейробластомы, боли, кахексии, дерматита и астмы, В соединении формулы I Формула IR1 представляет собой фенильное кольцо, замещенное одним или несколькими заместителями, независимо выбранными из группы, состоящей из фтора, метокси и этокси; R2 представляет собой Н; X выбран из группы, состоящей из -CH2- и -CH(Z)-, где Z представляет собой галоген; и Q выбран из группы, состоящей из -CH=CR3C(O)NR4R5, -C≡CC(O)NR4R5 и ; где R3 представляет собой H, где -NR4R5 либо образует 4-7-членное гетероциклическое кольцо или не образует кольцевую структуру, причем гетероциклическое кольцо представляет собой 4-7-членное гетероциклоалкильное кольцо, где когда -NR4R5 образует 4-7-членное гетероциклическое кольцо, то 4-7-членное гетероциклическое кольцо включает необязательное второй гетероатом, выбранный из N или O в дополнение к азоту в -NR4R5, и оно необязательно замещено одним или несколькими заместителями, независимо выбранными из группы, состоящей из линейного C1-C6 алкила, разветвленного C1-C6 алкила, гидроксила, где когда -NR4R5 не образует кольцевую структуру, то R4 выбирают из группы, состоящей из водорода, линейного C1-C6 алкила и разветвленного C1-C6 алкила, линейного C1-C6 гидроксиалкила и разветвленного C1-C6 гидроксиалкила, и R5 выбирают из H, метила, этила, изопропила, циклопропила, трет-бутила, метоксиэтила и гидроксиэтила, где каждый Y1, Y2, Y3 и Y4 независимо выбран из группы, состоящей из -CH, N, O, S, -CR6 и -NR6, при условии, что три из Y1, Y2, Y3 и Y4 выбраны из N или NR6, или один из Y1, Y2, Y3 и Y4 представляет собой O или S, и один или два из Y1, Y2, Y3 и Y4 представляют собой N или NR6, где R6 выбран из группы, состоящей из водорода, линейного С1-С4 алкила, разветвленного С1-С4 алкила, 5-членного гетероарильного кольца, имеющего 2 атома азота в кольце, 5-7-членного гетероциклоалкильного кольца, имеющего 1-2 атома азота и/или кислорода в кольце, 3-7-членного циклоалкильного кольца, -NHCO-(фенильное кольцо) и -CH2CO-(6-членное гетероциклическое кольцо, имеющее 1-2 гетероатома, выбранных из азота и кислорода);или R1 представляет собой пиридиновое кольцо, замещенное по меньшей мере одним заместителем, выбранным из группы, состоящей из фтора и метокси; R2 представляет собой Н; X выбран из группы, состоящей из -CH2- и -CH(Z)-, где Z представляет собой галоген; и Q выбран из группы, состоящей из -CH=CR3C(O)NR4R5, -CCC(O)NR4R5 и , где R3 представляет собой H, где -NR4R5 либо образует 4-7-членное гетероциклическое кольцо или не образует кольцевую структуру, причем гетероциклическое кольцо представляет собой 4-7-членное гетероциклоалкильное кольцо, где когда -NR4R5 образует 4-7-членное гетероциклическое кольцо, то 4-7-членное гетероциклическое кольцо включает необязательный второй гетероатом, выбранный из N или O, в дополнение к азоту в -NR4R5, и оно необязательно замещено одним или несколькими заместителями, независимо выбранными из группы, состоящей из линейного C1-C6 алкила, разветвленного C1-C6 алкила, гидроксила, где когда -NR4R5 не образует кольцевой структуры, то R4 выбирают из группы, состоящей из водорода, линейного C1-C6 алкила и разветвленного C1-C6 алкила, линейного C1-C6 гидроксиалкила и разветвленного C1-C6 гидроксиалкила, и R5 выбран из группы, состоящей из H, метила, этила, изопропила, циклопропила, трет-бутила, метоксиэтила и гидроксиэтила, при условии, что R4 и R5 не являются одновременно водородом, где каждый Y1, Y2, Y3 и Y4 независимо выбран из группы, состоящей из -CH, N, O, S, -CR6 и -NR6, при условии, что три из Y1 , Y2, Y3 и Y4 выбраны из N или NR6, или один из Y1, Y2, Y3 и Y4 представляет собой O или S, и один или два из Y1, Y2, Y3 и Y4 представляют собой N или NR6, где R6 выбран из группы, состоящей из водорода, линейного С1-С4 алкила, разветвленного С1-С4 алкила, 5-членного гетероарильного кольца с 2 атомами азота в кольце, 5-7-членного гетероциклоалкильного кольца, имеющего от 1 до 2 атомов азота и/или кислорода в цикле, 3-7-членного циклоалкильного кольца, -NHCO-(фенильное кольцо) и -CH2CO-(6-членное гетероциклическое кольцо, имеющее 1-2 гетероатома, выбранных из азота и кислорода); или соединение представляет собой (R,E)-4-(3-(5-(2-(2,5-дифторфенил)пирролидин-1-ил)пиразоло[1,5-a]пиримидин-3-ил)акрилоил)пиперазин-2-он (химическое соединение 51) или (E)-3-(5-((R)-2-(2,5-дифторфенил)пирролидин-1-ил)пиразоло[1,5-a]пиримидин-3-ил)-1-(3-(2-гидроксипропан-2-ил)пиперазин-1-ил)проп-2-ен-1-он (химическое соединение 52).

Изобретение относится к новым соединениям - пара-толуолсульфонату и ди(пара-толуолсульфонату 1-{2-[4-(2-амино-5-хлор-3-пиридинил)фенокси]-5-пиримидинил}-3-[2-(метилсульфонил)-5-(трифторметил)фенил]мочевины и их кристаллическим формам.
Группа изобретений относится к области медицины и касается вариантов фармацевтических композиций для парентерального капельного введения, предназначенных для купирования болевого синдрома при состояниях, не связанных с онкологией.

Изобретение относится к области органической химии, а именно к N-[(3-фтор-4-метоксипиридин-2-ил)метил]-3-(метоксиметил)-1-({4-[(2-оксопиридин-1-ил)метил]фенил}метил)пиразол-4-карбоксамиду указанной ниже структуры или к его фармацевтически приемлемой соли или сольвату.

Заявлены соединения Формулы I или их фармацевтически приемлемые соли, их содержащая фармацевтическая композиция, способы лечения и применение этих соединений для получения лекарственного средства для лечения заболеваний, опосредованных фактором D комплемента.

Изобретение относится к области медицины, в частности к лекарственным средствам, и может быть использовано при изготовлении геля с антиревматическим действием для местного лечения суставов.

Группа изобретений относится к области органической химии, а именно к способу получения новых индивидуальных соединений класса триазаспиро[4,4]нонентрионов, которые могут быть использованы в качестве исходных продуктов для синтеза новых гетероциклических систем и в фармакологии.

Группа изобретений относится к области органической химии, а именно к 3-(2-арил-2,4-дигидрокси-1-(2-гидроксиэтил)-5-оксо-2,5-дигидро-1H-пиррол-3-ил)хиноксалин-2(1H)-онам общей формулы , где Ar=Ph (а), 4-CH3C6H4 (б).

Изобретение относится к биотехнологии. Описан ДНК аптамер нуклеиновой кислоты, обладающий способностью к специфическому связыванию и ингибированию TLR-4 и содержащий последовательность, выбранную из группы, состоящей из SEQ ID NO: 1 и SEQ ID NO: 2, или его функционально эквивалентный вариант, имеющий по меньшей мере 70 идентичности последовательности с SEQ ID NO: 1 или SEQ ID NO: 2. Также описан комплекс, обладающий способностью к специфическому связыванию и ингибированию TLR-4, содержащий аптамер и функциональную группу, выбранную из группы, состоящей из детектируемого реагента, лекарственного средства и наночастицы. Представлен способ детекции TLR-4 в образце in vitro, включающий i) приведение указанного образца в контакт с аптамером по любому из пп. 1–4 или комплексом по любому из пп. 9–14, и ii) выделение указанного аптамера или комплекса, не связанного с TLR-4, iii) детекцию присутствия аптамера или комплекса, связанного с TLR-4, присутствующим в указанном образце. Представлена фармацевтическая композиция для лечения патологии, характеризующейся увеличением экспрессии TLR-4, содержащая терапевтически эффективное количество по меньшей мере одного аптамера по любому из пп. 1–4 или по меньшей мере одного комплекса по любому из пп. 9–14, необязательно в комбинации с одним или более фармацевтически приемлемым носителем, вспомогательным веществом или растворителем. Изобретение расширяет арсенал ингибиторов TLR-4. 5 н. и 19 з.п. ф-лы, 10 ил., 6 пр.

Наверх