Оптимальные локусы маиса

Авторы патента:


Изобретение относится к области биохимии, в частности к способу получения трансгенной клетки растения маиса. Также раскрыт способ получения трансгенного растения маиса. Изобретение позволяет получить трансгенную клетку, обладающую улучшенной экспрессией трансгена. 2 н. и 7 з.п. ф-лы, 23 ил., 14 табл., 7 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

По настоящей заявке испрашивается приоритет согласно 35 U.S.C. §119(e) Предварительной патентной заявки США; No. 61/899541, поданной 4 ноября 2013 года, и Предварительной патентной заявки США; No. 61/899575, поданной 4 ноября 2013 года, полное содержание которых включено в настоящую заявку в качестве ссылки.

ССЫЛКА НА СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ, ПРЕДОСТАВЛЕННЫЙ В ЭЛЕКТРОННОЙ ФОРМЕ

Официальная копия списка последовательностей предоставлена в электронной форме через EFS-Web в качестве списка последовательностей в формате ASCII под названием «232296_SEQ LIST_ST25.txt», созданного 28 октября 2014 года и имеющего размер 12,3 мегабайт, и поданного одновременно с описанием. Список последовательностей, содержащийся в этом документе в формате ASCII, является частью описания и включен в настоящее описание в качестве ссылки в полном объеме.

ССЫЛКА НА ПЕРЕЧЕНЬ ТАБЛИЦ, ПРЕДОСТАВЛЕННЫЙ В ЭЛЕКТРОННОЙ ФОРМЕ

Официальная копия перечня таблиц предоставлена в электронной форме через EFS-Web в качестве перечня таблиц в формате.PDF с названием файла «Table3», созданного 04 ноября 2013 года и имеющего размер 8 мегабайт, и поданного одновременно с настоящим описанием. Перечень таблиц, содержащийся в этом документе в формате.PDF, является частью описания и включен в настоящее описание в качестве ссылки в полном объеме.

УРОВЕНЬ ТЕХНИКИ

Геном многочисленных типов однодольных растений был успешно трансформирован трансгенами в ранних 1990-х годах. На протяжении последних двадцати лет были разработаны многочисленные методологии для трансформации генома однодольных растений, например, где трансген стабильно встраивается в геном однодольных растений, таких как растения маиса. Эта эволюция способов трансформации однодольных растений привела к возможности успешно встраивать трансген, содержащий агрономический признак, в геном однодольных растений, таких как растения маиса. Внесение признаков устойчивости к насекомым и признаков толерантности к гербицидам в однодольные растения в поздние 1990-е годы предоставило производителям новую и удобную технологическую инновацию для борьбы с насекомыми и широким спектром сорняков, которая не имела себе равных в сельскохозяйственных способах культивирования. В настоящее время трансгенные однодольные растения, например, растения маиса, являются коммерчески доступными по всему миру и новые трансгенные продукты, такие как кукуруза Enlist™, предлагают усовершенствованные решения для все возрастающей проблемы сорняков. Использование трансгенных однодольных растений, подобных растениям маиса, в современной агрономической практике невозможно, однако возможно их использование для разработки и улучшения способов трансформации.

Однако современные способы трансформации основаны на случайном встраивании трансгенов в геном однодольных растений. Зависимость от случайного встраивания генов в геном имеет несколько недостатков. Трансгенные события могут случайно интегрировать в транскрибируемые последовательности генов, тем самым, прерывая экспрессию эндогенных признаков и изменяя рост и развитие растения. Кроме того, трансгенные события могут беспорядочно интегрировать в положениях генома, которые являются подверженными сайленсингу генов, что приводит к уменьшению или полному ингибированию экспрессии трансгена либо в первом, либо в последующих поколениях трансгенных растений. Наконец, случайная интеграция трансгенов в геном растений требует значительных усилий и затрат для идентификации положения трансгенного события и селекции трансгенных событий, которые функционируют намеченным образом без агрономических последствий для растения. Для определения точного положения интегрированного трансгена для такого трансгенного события, например, в растении маиса, необходимо постоянно разрабатывать новые анализы. Случайных характер способов трансформации растений приводит к «эффекту положения» интегрировнного трансгена, который препятствует эффективности и продуктивности способов трансформации.

Направленная модификация генома является давней и труднодостижимой целью как прикладных, так и фундаментальных исследований. Нацеливание генов и пакетов генов в конкретные положения в геноме однодольных растений, таких как растения маиса, может повысить качество трансгенных событий, снизить стоимость осуществления трансгенных событий и обеспечить новые способы получения трансгенных растительных продуктов, такие как последовательное пакетирование генов. В целом, нацеливание трансгенов в конкретные геномные области, вероятно, является коммерчески целесообразным. В последние несколько лет были достигнуты значительные достижения в направлении разработки способов и композиций для нацеливания на геномную ДНК и расщепления ее специфическими нуклеазами (например, нуклеазы с цинковыми пальцами (ZFN), мегануклеазы, подобные активаторам транскрипции эффекторные нуклеазы (TALEN) и нуклеаза, ассоциированная с кластерными регулярно расположенными короткими палиндромными повторами/CRISPR (CRISPR/Cas) со сконструированной crRNA/tracr РНК), для индукции направленного мутагенеза, индукции направленных делеций клеточных последовательностей ДНК и облегчения направленной рекомбинации экзогенного донорного ДНК-полинуклеотида в заданном геномном локусе. См., например, публикацию патентов США No. 20030232410; 20050208489; 20050026157; 20050064474; и 20060188987, и международную Патентную публикацию No. WO 2007/014275, полное содержание которых включено в качестве ссылки в полном объеме для всех целей. В публикации патента США No. 20080182332 описано применение неканонических нуклеаз с цинковыми пальцами (ZFN) для направленной модификации геномов растений, и в публикации патента США No. 20090205083 описана опосредуемая ZFN направленная модификация геномного локуса EPSP растений. Современные способы направленного встраивания экзогенной ДНК, как правило, включают совместную трансформацию ткани растения донорным ДНК-полинуклеотидом, содержащим по меньшей мере один трансген, и сайт-специфической нуклеазой (например, ZFN), которая разработанв для связывания и расщепления конкретного геномного локуса активно транскрибируемой кодирующей последовательности. Это приводит к стабильному встраиванию донорного ДНК-полинуклеотида в расщепленный геномный локус, что приводит к направленной вставке гена в конкретный геномный локус, содержащий активно транскрибируемую кодирующую последовательность.

Альтернативным способом является нацеливание трансгена на предварительно выбранные внегенные локусы-мишени в геноме однодольных растений, таких как растения маиса. В последние годы было разработано и применено к клеткам растений несколько технологий для направленной доставки трансгена в геном однодольных растений, таких как растения маиса. Однако значительно меньше известно о характеристиках геномных участков, которые пригодны для нацеливания. Исторически в качестве локусов для нацеливания используют не являющиеся необходимыми гены и участки встраивания (вирусных) патогенов в геномах. Количество таких участков в геномах является довольно ограниченным и, таким образом, существует необходимость в идентификации и характеризации оптимальных для нацеливания геномных локусов, которые можно использовать для нацеливания донорных полинуклеотидных последовательностей. В дополнение к возможности нацеливания, ожидают, что оптимальные геномные локусы будут представлять собой нейтральные участки, которые могут способствовать экспрессии трансгена и применению в разведении. Существует необходимость в композициях и способах, определяющих критерии для идентификации оптимальных внегенных локусов в геноме однодольных растений, таких как растения маиса, для направленной интеграции трансгенов.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Один из вариантов осуществления по настоящему описанию относится к способам идентификации оптимальных участков в геноме маиса для вставки экзогенных последовательностей. В литературе существуют документы, которые позволяют предпологать, что хромосомные области растений являются пригодными для нацеливания и поддерживают экспрессию. Авторы настоящего изобретения разработали набор критериев для идентификации областей природных геномных последовательностей маиса, которые являются оптимальными участками для сайт-специфической направленной вставки. Более конкретно, в соответствии с одним из вариантов осуществления, оптимальный локус должен являться внегенным, пригодным для нацеливания, поддерживающим экспрессию гена, агрономически нейтральным и обладающим признаками рекомбинации. Как описано в настоящем документе, авторы настоящего изобретения открыли ряд локусов в геноме маиса, которые соответствуют этим критериям и таким образом, представляют собой оптимальные участки для вставки экзогенных последовательностей.

В соответствии с одним из вариантов осуществления в настоящем документе описана рекомбинантная последовательность маиса, где рекомбинантная последовательность содержит внегенную геномную последовательность маиса по меньшей мере 1 т.п.о. и представляющую интерес ДНК, где внегенную геномную последовательность маиса модифицируют для вставки представляющей интерес ДНК. В одном из вариантов осуществления природная внегенная последовательность маиса является гипометилированной, поддающейся экспрессии, демонстрирует признаки рекомбинации и является локализованной в близком положении от генной области в геноме маиса. В одном из вариантов осуществления внегенная последовательность имеет длину в диапазоне от приблизительно 1 т.п.о. до приблизительно 8,3 т.п.о. В одном из вариантов осуществления представляющая интерес ДНК содержит экзогенные последовательности ДНК, включая, например, регуляторные последовательности, участки рестрикционного расщепления, кодирующие РНК области или кодирующие белок области. В одном из вариантов осуществления представляющая интерес ДНК содержит экспрессирующую генную кассету, содержащую один или несколько трансгенов.

В соответствии с одним из вариантов осуществления представлена рекомбинантная последовательность, содержащая оптимальную внегенную геномную последовательность маиса от приблизительно 1 т.п.о. до приблизительно 9 т.п.о., и представляющая интерес ДНК внегенная геномная последовательность маиса обладает 1, 2, 3, 4 или 5 из следующих свойств или характеристик:

a) имеет известную или прогнозируемую кодирующую последовательностью маиса в пределах 40 т.п.о. указанной геномной последовательности маиса;

b) имеет последовательность, содержащую 2 т.п.о. выше и/или 1 т.п.о. ниже известного гена маиса в пределах 40 т.п.о. от одного конца указанной геномной последовательности маиса;

c) не содержит более 1% ДНК метилирования в геномной последовательности маиса;

d) не содержит последовательность 1 т.п.о., обладающую более чем 40% идентичностью последовательности с любой другой последовательностью в геноме маиса; и

e) демонстрирует признаки рекомбинации с частотой рекомбинации более 0,00041 сМ/млн.п.о.

В соответствии с одним из вариантов осуществления представлены растение маиса, часть растения маиса или клетка растения маиса, содержащие представляющую интерес ДНК, вставленную в идентифицированную и нацеленную внегенную геномную последовательность маиса из растения маиса, части растения маиса или клетки растения маиса. В одном из вариантов осуществления внегенная геномная последовательность маиса из растения маиса, части растения маиса или клетки растения маиса является гипометилированной, поддающейся экспрессии, демонстрирует признаки рекомбинации и является локализованной в ближнем положении от генной области в геноме маиса. В одном из вариантов осуществления внегенная геномная последовательность маиса из растения маиса, части растения маиса или клетки растения маиса имеет длину от приблизительно 1 т.п.о. до приблизительно 9 т.п.о., является гипометилированной и обладает 1, 2, 3, 4 или 5 из следующих свойств или характеристик:

a) имеет известную или прогнозируемую кодирующую последовательностью маиса в пределах 40 т.п.о. указанной геномной последовательности маиса;

b) имеет последовательность, содержащую 2 т.п.о. выше и/или 1 т.п.о. ниже известного гена маиса в пределах 40 т.п.о. от одного конца указанной геномной последовательности маиса;

c) не содержит более 1% ДНК метилирования в геномной последовательности маиса;

d) не содержит последовательность 1 т.п.о., обладающую более чем 40% идентичностью последовательности с любой другой последовательностью в геноме маиса; и

e) демонстрирует признаки рекомбинации с частотой рекомбинации более 0,00041 сМ/млн.п.о.

В одном из вариантов осуществления представлен способ получения трансгенной клетки растения, содержащей представляющую интерес ДНК, нацеленную на внегенную геномную последовательность маиса, где способ включает:

a) выбор оптимального внегенного геномного локуса маиса;

b) введение сайт-специфической нуклеазы в клетку растения, где сайт-специфическая нуклеаза расщепляет указанную внегенную последовательность;

c) введение представляющей интерес ДНК в клетку растения;

d) нацеливание представляющей интерес ДНК на указанную внегенную последовательность, где расщепление указанной внегенной последовательности стимулирует интеграцию полинуклеотидной последовательности в указанную внегенную последовательность; и

e) отбор трансгенных клеток растений, содержащих представляющую интерес ДНК, нацеленную на указанную внегенную последовательность.

В соответствии с одним из вариантов осуществления выбранная внегенная последовательность обладает 2, 3, 4, 5, 6, 7 или 8 из следующих характеристик:

a) внегенная последовательность не содержит метилированный полинуклеотид;

b) внегенная последовательность обладает частотой рекомбинации в геноме маиса 0,00041-62,42 сМ/млн.п.о.;

c) внегенная последовательность обладает уровнем занятости нуклеосомами 0-0,962 в геноме маиса;

d) внегенная последовательность разделяет менее 40% идентичности последовательности с любой другой последовательностью 1 т.п.о., содержащейся в геноме маиса;

e) внегенная последовательность обладает значением относительного расположения с отношением геномного расстояния от центромеры хромосомы маиса 0,00373-0,99908;

f) внегенная последовательность обладает процентным содержанием гуанина/цитозина в диапазоне 25,17-68,3%;

g) внегенная последовательность локализована вблизи генной последовательности; и,

h) область 1 млн.п.о. геномной последовательности маиса, содержащая указанную внегенную последовательность, содержит одну или несколько внегенных последовательностей.

Вариант осуществления по настоящему описанию относится к способам идентификации внегенной геномной последовательности маиса, включающим стадии:

a) идентификации геномных последовательностей маиса длиной по меньшей мере 1 т.п.о., которые не обладают более чем 1% уровнем метилирования для получения первого пула последовательностей;

b) исключения любых геномных последовательностей маиса, кодирующих транскрипты маиса, из первого пула последовательностей;

c) исключения любых геномных последовательностей маиса, которые не обладают признаками рекомбинации, из первого пула последовательностей;

d) исключения любых геномных последовательностей маиса, которые содержат последовательность 1 т.п.о., разделяющую 40% или более высокую идентичность последовательности с другой последовательностью 1 т.п.о., содержащейся в геноме маиса, из первого пула последовательностей;

e) исключения любых геномных последовательностей маиса, не имеющих известного гена маиса в пределах 40 т.п.о. от идентифицированной последовательности, из первого пула последовательностей; и

f) идентификации оставшихся геномных последовательностей маиса в пуле последовательностей как внегенные геномные последовательности маиса. После идентификации последовательностей, с ними можно проводить манипуляции с использованием рекомбинантных способов, для нацеливания вставки последовательностей нуклеиновой кислоты, не обнаруженной в локусах нативного генома.

В соответствии с одним из вариантов осуществления, любые геномные последовательности маиса, не имеющие известного гена маиса, или по меньшей мере 2 т.п.о. выше или 1 т.п.о. ниже последовательности известного гена, локализованных в пределах 40 т.п.о. от геномной последовательности маиса, исключают из пула внегенных геномных последовательностей маиса.

В соответствии с одним из вариантов осуществления, любые геномные последовательности маиса, не имеющие гена, экспрессирующего белок маиса, локализованного в пределах 40 т.п.о. от геномной последовательности маиса, исключают из пула внегенных геномных последовательностей маиса.

В соответствии с одним из вариантов осуществления в настоящем документе описана очищенная полинуклеотидная последовательность маиса, где очищенная последовательность содержит внегенную геномную последовательность маиса из по меньшей мере 1 т.п.о. В одном из вариантов осуществления внегенная последовательность маиса является гипометилированной, поддающейся экспрессии, демонстрирует признаки рекомбинации и является локализованной в ближнем положении от генной области в геноме маиса. В одном из вариантов осуществления внегенная последовательность имеет длину в диапазоне от приблизительно 1 т.п.о. до приблизительно 4,3 т.п.о. В одном из вариантов осуществления представляющая интерес ДНК содержит экзогенные последовательности ДНК, включая, например, регуляторные последовательности, участки рестрикционного расщепления, кодирующие РНК области или кодирующие белок области. В одном из вариантов осуществления представляющая интерес ДНК содержит экспрессирующую генную кассету, содержащую один или несколько трансгенов.

В соответствии с одним из вариантов осуществления представлена очищенная полинуклеотидная последовательность маиса, содержащая оптимальную внегенную геномную последовательность маиса от приблизительно 1 т.п.о. до приблизительно 4,3 т.п.о. и представляющую интерес ДНК где внегенная геномная последовательность маиса обладает 1, 2, 3, 4 или 5 из следующих свойств или характеристик:

a) имеет известную или прогнозируемую кодирующую последовательностью маиса в пределах 40 т.п.о. от указанной геномной последовательности маиса;

b) имеет последовательность, содержащую 2 т.п.о. выше и/или 1 т.п.о. ниже известного гена маиса в пределах 40 т.п.о. от одного конца указанной геномной последовательности маиса;

c) не содержит метилированный полинуклеотид;

d) не содержит последовательность 1 т.п.о., обладающую более чем 40% идентичностью последовательности с любой другой последовательностью в геноме маиса; и

e) демонстрирует признаки рекомбинации с частотой рекомбинации более 0,00041 сМ/млн.п.о.

В соответствии с одним из вариантов осуществления, представлена очищенная полинуклеотидная последовательность маиса, содержащая выбранную внегенную последовательность. Выбранная внегенная последовательность обладает 2, 3, 4, 5, 6, 7 или 8 из следующих характеристик:

a) внегенная последовательность не содержит метилированный полинуклеотид;

b) внегенная последовательность обладает частотой рекомбинации в геноме маиса 0,00041-62,42 сМ/млн.п.о. сМ/млн.п.о.;

c) внегенная последовательность обладает уровнем занятости нуклеосомами в геноме маиса 0-0,962;

d) внегенная последовательность разделяет менее 40% идентичности последовательности с любой другой последовательностью 1 т.п.о., содержащейся в геноме маиса;

e) внегенная последовательность обладает значением относительного расположения с отношением геномного расстояния от центромеры хромосомы маиса 0,00373-0,99908;

f) внегенная последовательность обладает процентным содержанием гуанина/цитозина в диапазоне 25,17-68,3%;

g) внегенная последовательность локализована вблизи генной последовательности; и,

h) область 1 млн.п.о. геномной последовательности маиса, содержащая указанную внегенную последовательность, содержит одну или несколько внегенных последовательностей.

В соответствии с одним из вариантов осуществления, любые геномные последовательности маиса, не демонстрирующие признаков рекомбинации с частотой рекомбинации более 0,00041 сМ/млн.п.о. исключают из пула внегенных геномных последовательностей маиса.

В соответствии с одним из вариантов осуществления выбранная внегенная последовательность обладает следующими характеристиками:

a) внегенная последовательность не содержит более 1% метилирования ДНК в последовательности

b) внегенная последовательность обладает значением относительного расположения с отношением геномного расстояния от центромеры хромосомы маиса 0,0984-0,973;

c) внегенная последовательность обладает процентным содержанием гуанина/цитозина в диапазоне 34,38-61,2%; и,

d) внегенная последовательность имеет длину от приблизительно 1 т.п.о. до приблизительно 4,9 т.п.о.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

Фиг. 1. иллюстрирует образец снимка экрана графика колебаний для профиля метилирования ДНК тканей корней и побегов, полученных из хромосомы номер 1 Zea mays c.v. B73.

Фиг. 2. иллюстрирует распределение длины последовательностей полученных гипометилированных геномных положений в геноме Zea mays c.v. B73.

На фиг. 3. представлен трехмерный график 5286 оптимальных локусов маиса. Статистический способ анализа главных компонентов (PCA) использовали для кластеризации набора из 5286 идентифицированных оптимальных геномных локусов на 32 отдельных кластера на основании значений их признаков (см. Пример 1). В ходе процесса PCA получено пять главных компонентов (PC), где три лучших PC включали приблизительно 90% общей изменчивости набора данных. Эти три лучших PCA использовали для графического представления 32 кластеров в трехмерном графике, как показано на фиг. 3.

На фиг. 4. представлено схематическое изображение, указывающее на хромосомное распределение 81 оптимальных геномных локусов и их относительные положения на хромосомах маиса.

На фиг. 5. представлен график, показывающий перекрывание 72 оптимальных геномных локусов в базах данных геномов Zea mays c.v. B104 и c.v.Hi-II, выбранных для валидации нацеливания.

На фиг. 6. представлено схематическое изображение, показывающее локализацию на хромосомах Zea mays 72 оптимальных геномных локусов, выбранных для валидации нацеливания.

На фиг. 7. представлена карта плазмиды pDAB111845 (SEQ ID NO:5418). Пронумерованные элементы (т.е., 5, 7, 8, 9, 10, 11, 12, 15, 16, 25 и 26) соответствуют последовательностям связывания нуклеазы с цинковыми пальцами длиной приблизительно от 20 до 35 пар оснований, узнаваемым и расщепляемым соответствующими нуклеазными белками с цинковыми пальцами. Эти последовательности связывания цинковых пальцев и аннотированная «последовательность UZI» (которая представляет собой область матрицы размером 100-150 п.о., содержащую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующие последовательности) содержат универсальную донорную кассету.

На фиг. 8. представлена последовательность универсального донорного полинуклеотида для интеграции посредством негомологичного соединения концов (NHEJ). Представлены два предложенных вектора, где представляющая интерес ДНК (ДНК X) содержит один или несколько (т.е., «1-N») участков связывания цинковых пальцев (ZFN BS) на любом конце представляющей интерес ДНК. Вертикальными стрелками показаны уникальные участки рестрикции, и горизонтальными стрелками показаны потенциальные участки праймеров для ПЦР.

На фиг. 9. представлена последовательность универсального донорного полинуклеотида для интеграции посредством направляемой гомологией репарации (HDR). Представляющая интерес ДНК (ДНК X) содержит две области гомологичных последовательностей (HA), фланкирующие представляющую интерес ДНК с участками связывания нуклеазы с цинковыми пальцами (ZFN) с разных сторон последовательностей ДНК X и HA. Вертикальными стрелками показаны уникальные участки рестрикции, и горизонтальными стрелками показаны потенциальные участки праймеров для ПЦР.

На фиг. 10A-10C. проиллюстрированы конструкции, использованные для нацеливания и валидации интеграции универсальной донорной полинуклеотидной системы в оптимальных геномных локусах Zea mays. Фиг. 10A) Пространственный дизайн ZFN с локализацией пар ZFN, как показано ранее в pDAB111845 на фигуре 5. Пары ZFN отмечены нумерацией и соответствуют специфическим последовательностям связывания ZFN, специфически узнаваемым белками ZFN для связывания и расщепления. Фиг. 10B) Конфигурация экспрессирующей белок ZFN конструкции. Экспрессирующая ZFN конструкция содержит конститутивный промотор растений (Zm Ubi1), используемый для управления экспрессией белка ZFN. Белок ZFN содержит последовательность ядерной локализации (NLS), белки с цинковыми пальцами (ZFP-L и ZFP-R, где L обозначает связывающий белок ZFN «левой руки», и R обозначает связывающий белок ZFN «правой руки»), эндонуклеазу Fok-1 (Fok1) и самогидролизующийся 2A (2A). Фиг. 10C) Универсальный донорный полинуклеотид для опосредованного NHEJ нацеливания на оптимальные геномные локусы Zea mays. Z1-Z6 представляют участки связывания ZFN, специфические для оптимальных геномных локусов-мишеней Zea mays. Количество участков ZFN может меняться от 3 до 6. Вертикальными стрелками показаны уникальные участки рестрикции, и горизонтальными стрелками показаны потенциальные участки праймеров для ПЦР. Универсальная донорная полинуклеотидная система представляет собой короткую (110 п.о.) последовательность, которая является общей для доноров, используемых для интеграции в оптимальные геномные локусы Zea mays.

Фиг. 11. Карта плазмиды pDAB8393.

Фиг. 12. Активность расщепления ZFN в мишенях выбранных геномных локусов Zea mays. Активность расщепления представлена как количество последовательностей с инделами (вставками и делециями) в участке расщепления ZFN на 1 миллион прочтений высокого качества.

Фиг. 13. Валидация мишеней в выбранных геномных локусах Zea mays с использованием способа анализа быстрого нацеливания (RTA) на основе NHEJ.

Фиг. 14 и 14B. Плазмидные конструкции, трансформированные в Zea mays посредством случайной интеграции, включающие события, использованные для анализа фланкирующей последовательности и исследований экспрессии трансгена. На фиг. 14 представлена вставка pDAB105817, фрагмент 1871 п.о.; на фиг. 14B представлена вставка фрагмента 6128 п.о. из pEPS105817.

Фиг. 15. Карта плазмиды pDAB111846 (SEQ ID NO:5419). Пронумерованные элементы (т.е., 1, 2, 5, 6, 11, 12, 15, 16, 21, 22, 29 и 30) соответствуют последовательностям связывания нуклеазы с цинковыми пальцами длиной приблизительно от 20 до 35 пар оснований, узнаваемым и расщепляемым соответствующими нуклеазными белками с цинковыми пальцами. Эти последовательности связывания цинковых пальцев и аннотированная «последовательность UZI» (которая представляет собой область матрицы размером 100-150 п.о., содержащую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующие последовательности) содержат универсальную донорную кассету.

Фиг. 16. Карта плазмиды of pDAB117415 (SEQ ID NO:5420). Пронумерованные элементы (т.е., ZFN51 и ZFN52) соответствуют последовательностям связывания нуклеазы с цинковыми пальцами длиной приблизительно от 20 до 35 пар оснований, узнаваемым и расщепляемым соответствующими нуклеазными белками с цинковыми пальцами. Эти последовательности связывания цинковых пальцев и аннотированная «последовательность UZI» (которая представляет собой область матрицы размером 100-150 п.о., содержащую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующие последовательности) содержат универсальную донорную кассету. Кроме того, в эту плазмидную конструкцию включена «область перекрывания 104113», которая представляет собой последовательности, обладающие гомологией с плазмидным вектором для высокопроизводительной сборки универсальных донорных кассет в плазмидном векторе (т.е., посредством сборки Гибсона).

Фиг. 17. Карта плазмиды pDAB117416 (SEQ ID NO:5421). Пронумерованные элементы (т.е., ZFN54 и ZFN53) соответствуют последовательностям связывания нуклеазы с цинковыми пальцами длиной приблизительно от 20 до 35 пар оснований, узнаваемым и расщепляемым соответствующими нуклеазными белками с цинковыми пальцами. Эти последовательности связывания цинковых пальцев и аннотированная «последовательность UZI» (которая представляет собой область матрицы размером 100-150 п.о., содержащую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующие последовательности) содержат универсальную донорную кассету. Кроме того, в эту плазмидную конструкцию включена «область перекрывания 104113», которая представляет собой последовательности, обладающие гомологией с плазмидным вектором для высокопроизводительной сборки универсальных донорных кассет в плазмидном векторе (т.е., посредством сборки Гибсона).

Фиг. 18. Карта плазмиды pDAB117417 (SEQ ID NO:5422). Пронумерованный элемент (т.е., ZFN55) соответствуют последовательностям связывания нуклеазы с цинковыми пальцами длиной приблизительно от 20 до 35 пар оснований, узнаваемым и расщепляемым соответствующими нуклеазными белками с цинковыми пальцами. Эти последовательности связывания цинковых пальцев и аннотированная «последовательность UZI» (которая представляет собой область матрицы размером 100-150 п.о., содержащую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующие последовательности) содержат универсальную донорную кассету. Кроме того, в эту плазмидную конструкцию включена «область перекрывания 104113», которая представляет собой последовательности, обладающие гомологией с плазмидным вектором для высокопроизводительной сборки универсальных донорных кассет в плазмидном векторе (т.е., посредством сборки Гибсона).

Фиг. 19. Карта плазмиды pDAB117419 (SEQ ID NO:5423). Пронумерованные элементы (т.е., ZFN59 и ZFN60) соответствуют последовательностям связывания нуклеазы с цинковыми пальцами длиной приблизительно от 20 до 35 пар оснований, узнаваемым и расщепляемым соответствующими нуклеазными белками с цинковыми пальцами. Эти последовательности связывания цинковых пальцев и аннотированная «последовательность UZI» (которая представляет собой область матрицы размером 100-150 п.о., содержащую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующие последовательности) содержат универсальную донорную кассету. Кроме того, в эту плазмидную конструкцию включена «область перекрывания 104113», которая представляет собой последовательности, обладающие гомологией с плазмидным вектором для высокопроизводительной сборки универсальных донорных кассет в плазмидном векторе (т.е., посредством сборки Гибсона).

Фиг. 20. Карта плазмиды pDAB117434 (SEQ ID NO:5424). Пронумерованные элементы (т.е., ZFN66, ZFN67, ZFN68 и ZFN69) соответствуют последовательностям связывания нуклеазы с цинковыми пальцами длиной приблизительно от 20 до 35 пар оснований, узнаваемым и расщепляемым соответствующими нуклеазными белками с цинковыми пальцами. Эти последовательности связывания цинковых пальцев и аннотированная «последовательность UZI» (которая представляет собой область матрицы размером 100-150 п.о., содержащую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующие последовательности) содержат универсальную донорную кассету. Кроме того, в эту плазмидную конструкцию включена «область перекрывания 104113», которая представляет собой последовательности, обладающие гомологией с плазмидным вектором для высокопроизводительной сборки универсальных донорных кассет в плазмидном векторе (т.е., посредством сборки Гибсона).

Фиг. 21. Карта плазмиды pDAB117418 (SEQ ID NO:5425). Пронумерованные элементы (т.е., ZFN56, ZFN57, и ZFN58) соответствуют последовательностям связывания нуклеазы с цинковыми пальцами длиной приблизительно от 20 до 35 пар оснований, узнаваемым и расщепляемым соответствующими нуклеазными белками с цинковыми пальцами. Эти последовательности связывания цинковых пальцев и аннотированная «последовательность UZI» (которая представляет собой область матрицы размером 100-150 п.о., содержащую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующие последовательности) содержат универсальную донорную кассету. Кроме того, в эту плазмидную конструкцию включена «область перекрывания 104113», которая представляет собой последовательности, обладающие гомологией с плазмидным вектором для высокопроизводительной сборки универсальных донорных кассет в плазмидном векторе (т.е., посредством сборки Гибсона).

Фиг. 22. Карта плазмиды pDAB117420 (SEQ ID NO:5426). Пронумерованные элементы (т.е., ZFN61 и ZFN62) соответствуют последовательностям связывания нуклеазы с цинковыми пальцами длиной приблизительно от 20 до 35 пар оснований, узнаваемым и расщепляемым соответствующими нуклеазными белками с цинковыми пальцами. Эти последовательности связывания цинковых пальцев и аннотированная «последовательность UZI» (которая представляет собой область матрицы размером 100-150 п.о., содержащую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующие последовательности) содержат универсальную донорную кассету. Кроме того, в эту плазмидную конструкцию включена «область перекрывания 104113», которая представляет собой последовательности, обладающие гомологией с плазмидным вектором для высокопроизводительной сборки универсальных донорных кассет в плазмидном векторе (т.е., посредством сборки Гибсона).

Фиг. 23. Карта плазмиды pDAB117421 (SEQ ID NO:5427). Пронумерованные элементы (т.е., пара 3 PPL17, пара 1 PPL17 и пара 2 PPL17) соответствуют последовательностям связывания нуклеазы с цинковыми пальцами длиной приблизительно от 20 до 35 пар оснований, узнаваемым и расщепляемым соответствующими нуклеазными белками с цинковыми пальцами. Эти последовательности связывания цинковых пальцев и аннотированная «последовательность UZI» (которая представляет собой область матрицы размером 100-150 п.о., содержащую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующие последовательности) содержат универсальную донорную кассету. Кроме того, в эту плазмидную конструкцию включена «область перекрывания 104113», которая представляет собой последовательности, обладающие гомологией с плазмидным вектором для высокопроизводительной сборки универсальных донорных кассет в плазмидном векторе (т.е., посредством сборки Гибсона).

ПОДРОБНОЕ ОПИСАНИЕ

ОПРЕДЕЛЕНИЯ

При описании и составлении формулы изобретения используют следующую терминологию в соответствии с определениями, приведенными ниже.

Термин «приблизительно», как применяют в настоящем документе, означает больше или меньше, чем указанное значение или диапазон значений на 10 процентов, но не предназначен для отнесения какого-либо значения или диапазона значений только к этому более широкому определению. Каждое значение или диапазон значений, которым предшествует термин «приблизительно», предназначены также для включения варианта осуществления указанного абсолютного значения или диапазона значений.

Как применяют в настоящем документе, термин «растение» включает целое растение и любого потомка, клетку, ткань или часть растения. Термин «части растений» включают любую часть(части) растения, включая, в качестве неограничивающих примеров: семена (включая зрелые семена и незрелые семена); черенки растений; клетку растения; культуру клеток растений; орган растения (например, пыльцу, зародыши, цветки, плоды, побеги, листья, корни, стебли и эксплантаты). Ткань растения или орган растения могут представлять собой семя, протопласт, каллюс или любую другую группу клеток растений, которые организованы в структурную или функциональную единицу. Культура клеток или тканей растений может являться способной к регенерации растения, обладающего физиологическими и морфологическими характеристиками растения, из которого получена клетка или ткань, и к регенерации растения, обладающего по существу таким же генотипом, что и родительское растение. В отличие от этого, некоторые клетки растения не способны регенерировать с образованием растений. Регенерирующие клетки в культуре клеток или тканей растений могут представлять собой зародыши, протопласты, клетки меристемы, каллюс, пыльцу, листья, пыльники, корни, верхушки корней, метелки, цветки, зерна, початки, стержни початков, пленки или ножки.

Части растений включают пожинаемые части и части, пригодные для размножения потомков растений. Части растений, пригодные для размножения, включают в качестве неограничивающих примеров: семя; плод; черенок; проросток; клубень и корневище. Пожинаемая часть растения может представлять собой любую пригодную часть растения, включая в качестве неограничивающих примеров: цветок; пыльцу; семя; клубень; лист; стебель; плод; семя и корень.

Клетка растения представляет собой структурную и физиологическую единицу растения. Клетки растения, как применяют в настоящем документе, включают протопласты и протопласты с клеточной стенкой. Клетка растения может находиться в форме выделенной единичной клетки или агрегата клеток (например, ломкий каллюс и культивируемая клетка) и может являться частью более высокоорганизованной единицы (например, ткань растения, орган растения и растение). Таким образом, клетка растения может представлять собой протопласт, образующую гаметы клетку, или клетку или коллекцию клеток, которые могут регенерировать в целое растение. По существу, семя, которое содержит множество клеток растений и способно регенерировать в целое растение, считают «частью растения» в вариантах осуществления в настоящем документе.

Термин «протопласт», как применяют в настоящем документе, относится к клетке растения, из которой клеточная стенка полностью или частично удалена, и в которой липидная бислойная мембрана обнажена. Как правило, протопласт представляет собой выделенную клетку растения без клеточной стенки, которая обладает способностью к регенерации в клеточную культуру или целое растение.

Как применяют в настоящем документе, термины «нативный» или «природный» определяют состояние, обнаруженное в природе. «Нативная последовательность ДНК» представляет собой последовательность ДНК, встречающуюся в природе, которая продуцирована естественными путями или традиционными способами скрещивания, но не получена способами генной инженерии (например, с использованием способов молекулярной биологии/трансформации).

Как применяют в настоящем документе, «эндогенная последовательность» определяет нативную форму полинуклеотида, гена или полипептида в его природном положении в организме или в геноме организма.

Термин «выделенный», как применяют в настоящем документе, означает извлеченный из его природного окружения.

Термин «очищенный», как применяют в настоящем документе, относится к выделению молекулы или соединения в форме, по существу свободной от примесей, обычно ассоциированных с молекулой или соединением в нативном или природном окружении, и означает увеличение чистоты в результате отделения от других компонентов первоначальной композиции. Термин «очищенная нуклеиновая кислота» используют в настоящем документе для описания последовательности нуклеиновой кислоты, которая отделена от других соединений, включая, но без ограничения, полипептиды, липиды и углеводы.

Термины «полипептид», «пептид» и «белок» используют взаимозаменяемо для обозначения полимера из аминокислотных остатков. Термин применим также к полимерам аминокислот, в которых одна или несколько аминокислот являются химическими аналогами или модифицированными производными соответствующих встречающихся в природе аминокислот.

Как применяют в настоящем документе, «оптимальные геномные локусы однодольных растений», «оптимальные внегенные локусы однодольных растений», «оптимальные внегенные локусы» или «оптимальные геномные локусы (OGL)» используют взаимозаменяемо для обозначения нативной последовательности ДНК, обнаруженной в ядерном геноме однодольного растения, которая обладает следующими свойствами: является внегенной, гипометилированной, является поддающейся нацеливанию и локализована вблизи генной области, где геномная область вокруг оптимальных геномных локусов однодольных растений обладает признаками рекомбинации.

Как применяют в настоящем документе, «оптимальные геномные локусы маиса», «оптимальные внегенные локусы маиса», «оптимальные внегенные локусы» или «оптимальные геномные локусы (OGL)» используют взаимозаменяемо для обозначения нативной последовательности ДНК, обнаруженной в ядерном геноме растения маиса, которая обладает следующими свойствами: является внегенной, гипометилированной, является поддающейся нацеливанию и локализована вблизи генной области, где геномная область вокруг оптимальных геномных локусов маиса обладает признаками рекомбинации.

Как применяют в настоящем документе, «внегенная последовательность однодольных растений» или «внегенная геномная последовательность однодольных растений» представляет собой нативную последовательность ДНК, обнаруженную в ядерном геноме однодольного растения, имеющую длину по меньшей мере 1 т.п.о. и лишенную каких-либо открытых рамок считывания, генных последовательностей или регуляторных последовательностей генов. Более того, внегенная последовательность однодольных растений не содержит какой-либо последовательности интрона (т.е. интроны исключены из определения внегенной последовательности). Внегенная последовательность не может быть транскрибирована или транслирована в белок. Многие геномы растений содержат внегенные области. Вплоть до 95% генома могут являться внегенными, и эти области могут содержать в основном повторяющуюся ДНК.

Как применяют в настоящем документе, «внегенная последовательность маиса» или «внегенная геномная последовательность маиса» представляет собой нативную последовательность ДНК, встречающуюся в ядерном геноме растения маиса, имеющую длину по меньшей мере 1 т.п.о. и лишенную каких-либо открытых рамок считывания, генных последовательностей или регуляторных последовательностей генов. Более того, внегенная последовательность маиса не содержит какой-либо последовательности интрона (т.е. интроны исключены из определения внегенной последовательности). Внегенная последовательность не может быть транскрибирована или транслирована в белок. Многие геномы растений содержат внегенные области. Вплоть до 95% генома могут являться внегенными, и эти области могут содержать в основном повторяющуюся ДНК.

Как применяют в настоящем документе, «генную область» определяют как полинуклеотидную последовательность, которая содержит открытую рамку считывания, кодирующую РНК и/или полипептид. Генная область также может охватывать любые поддающиеся идентификации соседние 5′ и 3′-некодирующие нуклеотидные последовательности, вовлеченные в регуляцию экспрессии открытой рамки считывания вплоть до приблизительно на 2 т.п.о. выше кодирующей области и на 1 т.п.о. ниже кодирующей области, но возможно еще выше или ниже. Кроме того, генная область включает любые интроны, которые могут присутствовать в генной области. Кроме того, генная область может содержать одну последовательность гена или множество последовательностей генов, между которыми располагаются короткие участки (менее 1 т.п.о.) внегенных последовательностей.

Как применяют в настоящем документе «представляющую интерес нуклеиновую кислоту», «представляющую интерес ДНК» или «донор» определяют как последовательность нуклеиновой кислоты/ДНК, которая выбрана для сайт-специфического нацеленного встраивания в геном однодольного растения или маиса. Представляющая интерес нуклеиновая кислота может иметь любую длину, например, от 2 до 50000 нуклеотидов (или любое целое число между ними или выше), предпочтительно, длину приблизительно от 1000 до 5000 нуклеотидов (или любое целое число между ними). Представляющая интерес нуклеиновая кислота может содержать одну или несколько экспрессирующих генных кассет, которые дополнительно содержат активно транскрибируемые и/или транслируемые генные последовательности. В отличие от этого, представляющая интерес нуклеиновая кислота может содержать полинуклеотидную последовательность, которая не содержит функциональную экспрессирующую генную кассету или целый ген (например, может просто содержать регуляторные последовательности, такие как промотор), или может не содержать какие-либо идентифицируемые элементы экспрессии генов или какую-либо активно транскрибируемую генную последовательность. Представляющая интерес нуклеиновая кислота необязательно может содержать аналитический домен. При вставке представляющей интерес нуклеиновой кислоты в геном однодольного растения или маиса, например, встроенные последовательности обозначают как «встроенную представляющую интерес ДНК». Кроме того, представляющая интерес нуклеиновая кислота может представлять собой ДНК или РНК, может являться линейной или кольцевой, и может являться одноцепочечной или двухцепочечной. Ее можно доставлять в клетку в качестве голой нуклеиновой кислоты, в качестве комплекса с одним или несколькими средствами для доставки (например, липосомы, полоксамеры, T-цепь, инкапсулированная в белки, и т.д.), или она содержится в бактериальном или вирусном носителе для доставки, например, таком как Agrobacterium tumefaciens, или аденовирус, или аденоассоциированный вирус (AAV), соответственно.

Как применяют в настоящем документе термин «аналитический домен» определяет последовательность нуклеиновой кислоты, которая содержит функциональные элементы, способствующие направленной вставке последовательностей нуклеиновой кислоты. Например, аналитический домен может содержать специально разработанные участки для ферментов рестрикции, участки связывания цинковых пальцев, сконструированные посадочные площадки или сконструированные платформы для интеграции трансгенов, и он может содержать или может не содержать регуляторные элементы генов или открытую рамку считывания. См., например, публикацию патента США NO 20110191899, полное содержание которого включено в настоящее описание в качестве ссылки.

Как применяют в настоящем документе, термин «выбранная последовательность однодольного растения» обозначает нативную последовательность геномной ДНК однодольного растения, выбранную для анализа для определения того, отвечает ли последовательность требованиям оптимальных внегенных геномных локусов однодольных растений.

Как применяют в настоящем документе термин «выбранная последовательность маиса» обозначает нативную геномную последовательность ДНК маиса, выбранную для анализа для определения того, отвечает ли последовательность требованиям оптимальных внегенных геномных локусов маиса.

Как применяют в настоящем документе, термин «гипометилирование» или «гипометилированный», в отношении последовательности ДНК определяет состояние уменьшенного метилирования нуклеотидных остатков ДНК в данной последовательности ДНК. Как правило, уменьшенное метилирование относится к количеству метилированных остатков аденина или цитозина относительно среднего уровня метилирования, встречающегося в внегенных последовательностях, присутствующих в геноме маиса или однодольного растения.

Как применяют в настоящем документе, «поддающаяся нацеливанию последовательность» представляет собой полинуклеотидную последовательность, которая является достаточно уникальной в ядерном геноме, чтобы обеспечить сайт-специфическую направленную вставку представляющей интерес нуклеиновой кислоты в одну конкретную последовательность.

Как применяют в настоящем документе, термин «неповторяющаяся» последовательность определяют как последовательность длиной по меньшей мере 1 т.п.о., которая обладает менее чем 40% идентичностью с любой другой последовательностью в геноме однодольного растения или в геноме Zea mays. Расчет идентичности последовательности можно проводить с использованием любого стандартного способа, известного специалистам в данной области, включая, например, сканирование выбранной геномной последовательности против генома однодольного растения, например, генома Zea mays c.v. B73, с использованием поиска гомологии на основе BLAST™ с использованием программного обеспечения NCBI BLAST™ (версия 2.2.23) с настройками параметров по умолчанию (Stephen F. Altschul et al (1997), «Gapped BLAST and PSI-BLAST: a new generation of protein database search programs», Nucleic Acids Res. 25:3389-3402). Например, по мере того как анализировали выбранные последовательности маиса (из генома Zea mays c.v. B73), первый идентифицированный положительный результат такого поиска в BLAST™ представлял собой последовательность однодольного растения, например, саму последовательность Zea mays c.v. B73. Идентифицировали второй положительный результат BLAST™ для каждой выбранной последовательности маиса, и перекрывание выравнивания (представленное как процент выбранной последовательности маиса, охватываемой положительным результатом BLAST™) для положительного результата использовали в качестве показателя уникальности выбранной последовательности маиса в геноме однодольного растения, т.е., в геноме Zea mays. Эти значения перекрывания выравнивания для второго положительного результата BLAST™ лежали в диапазоне от минимум 0% до максимум 39,98% идентичности последовательностей. Любые последовательности, выравниваемые с более высокими уровнями идентичности последовательностей, не рассматривали.

Термин «вблизи генной области», при применении по отношению к внегенной последовательности, определяет положение внегенной последовательности относительно генной области. В частности, анализировали количество генных областей в окружении в пределах 40 т.п.о. (т.е. в пределах 40 т.п.о. от любого конца выбранной последовательности оптимального геномного локуса маиса). Этот анализ проводили посредством анализа аннотирующей информации генов и локализации известных генов в геноме известных однодольных растений, которая извлечена из базы данных для однодольных растений, например, Maize Genome Database. Для каждого из 5286 оптимальных внегенных геномных локусов маиса, определяли окно 40 т.п.о. вокруг оптимальной последовательности геномного локуса, и подсчитывали количество аннотированных генов с положениями, перекрывающими это окно. Количество генных областей в окружении 40 т.п.о. лежало в диапазоне от минимум 1 гена до максимум 9 генов.

Термин «известная кодирующая последовательность однодольных растений», как применяют в настоящем документе, относится к любой полинуклеотидной последовательности, идентифицированной из любой базы данных геномов однодольных растений, включая Maize Genomic Database (доступную на www.maizegdb.org and Monaco, M., et al., Maize Metabolic Network Construction and Transcriptome Analysis. doi:10,3835/plantgenome2012,09,0025; Posted online 23 Jan. 2013), которая содержит открытую рамку считывания, либо до, либо после процессинга интронных последовательностей, и транскрибируется в мРНК и необязательно транслируется в белковую последовательность, при помещении под контроль соответствующих генетических регуляторных элементов. Известная кодирующая последовательность однодольных растений может представлять собой последовательность кДНК или геномную последовательность. В некоторых случаях известная кодирующая последовательность однодольных растений может являться аннотированой как функциональный белок. В других случаях известная кодирующая последовательность однодольных растений может не являться аннотированной.

Термин «известная кодирующая последовательность маиса», как применяют в настоящем документе, относится к любой полинуклеотидной последовательности, идентифицированной из Maize Genomic Database (доступной на www.maizegdb.org and Monaco, M., et al., Maize Metabolic Network Construction and Transcriptome Analysis. doi:10,3835/plantgenome2012,09,0025; Posted online 23 Jan. 2013), которая содержит открытую рамку считывания, либо до, либо после процессинга интронных последовательностей, и транскрибируется в мРНК и необязательно транслируется в белковую последовательность при помещении под контроль соответствующих генетических регуляторных элементов. Известная кодирующая последовательность маиса может представлять собой последовательность кДНК или геномную последовательность. В некоторых случаях известная кодирующая последовательность маиса может являться аннотированной как функциональный белок. В других случаях известная кодирующая последовательность маиса может не являться аннотированной.

Термин «прогнозируемая кодирующая последовательность однодольного растения», как применяют в настоящем документе, относится к любым полинуклеотидным последовательностям маркеров экспрессируемой последовательности (EST), описанным в базе данных геномов однодольных растений, например, в базе данных Maize Genomic Database. EST идентифицируют из библиотек кДНК, сконструированных с использованием олиго(dT)-праймеров для прямого синтеза первой цепи посредством обратной транскриптазы. Полученные EST представляют собой данные однократных прочтений секвенирования размером менее 500 п.о., полученные либо с 5′-конца, либо с 3′-конца вставки кДНК. Множество EST можно выравнивать до одного контига. Идентифицированные последовательности EST загружают в базу данных геномов однодольных растений, например, Maize Genomic Database, и можно проводить их поиск биоинформатическими способами для прогнозирования соответствующих геномных полинуклеотидных последовательностей, содержащих кодирующую последовательность, которая транскрибируется в мРНК и необязательно транслируется в белковую последовательность при помещении под контроль соответствующих генетических регуляторных элементов.

Термин «прогнозируемая кодирующая последовательность маиса», как применяют в настоящем документе, относится к любым полинуклеотидным последовательностям маркеров экспрессируемой последовательности (EST), описанным в Maize Genomic Database. EST идентифицируют из библиотек кДНК, сконструированных с использованием олиго(dT)-праймеров для прямого синтеза первой цепи посредством обратной транскриптазы. Полученные EST представляют собой данные однократных прочтений секвенирования размером менее 500 п.о., полученные либо с 5′-конца, либо с 3′-конца вставки кДНК. Множество EST можно выравнивать до одного контига. Идентифицированные последовательности EST загружают в Maize Genomic Database, и можно проводить их поиск биоинформатическими способами для прогнозирования соответствующих геномных полинуклеотидных последовательностей, содержащих кодирующую последовательность, которая транскрибируется в мРНК и необязательно транслируется в белковую последовательность при помещении под контроль соответствующих генетических регуляторных элементов.

Термин «признак рекомбинации», как применяют в настоящем документе, относится к частоте мейотической рекомбинации между любой парой геномных маркеров однодольных растений, например, Zea mays, на протяжении области хромосомы, содержащей выбранную последовательность маиса. Частоты рекомбинации рассчитывают на основании отношения генетического расстояния между маркерами (в сантиморганах (cM)) к физическому расстоянию между маркерами (в миллионах пар оснований (млн.п.о.)). Чтобы выбранная последовательность маиса обладала признаками рекомбинации, выбранная последовательность маиса должна иметь по меньшей мере одно событие рекомбинации между двумя маркерами, фланкирующими выбранную последовательность маиса, как детектируют с использованием высокоразрешающего набора данных маркеров из множества картированных популяций. (См., например, Jafar Mammadov, Wei Chen, Anastasia Chueva, Karthik Muthuraman, Ruihua Ren, David Meyer, and Siva Kumpatla. 2011. Distribution of Recombinant Frequencies across the Maize Genome. 52nd Annual Maize Genetics Conference).

Как применяют в настоящем документе, термин «значение относительного расположения» представляет собой расчетное значение, определяющее расстояние геномного локуса от его соответствующей хромосомной центромеры. Для каждой выбранной последовательности маиса измеряют геномное расстояние от нативного положения выбранной последовательности маиса до центромеры хромосомы, на которой она расположена (в п.о.). Относительное положение выбранной последовательности маиса на хромосоме представляют как отношение ее геномного расстояния до центромеры к длине конкретного плеча хромосомы (измеренной в п.о.), на котором она расположена. Эти значения относительного расположения для набора данных оптимальных внегенных геномных локусов маиса лежат в диапазоне от минимального отношения геномных расстояний 0,00373 до максимального отношения геномных расстояний 0,99908.

Термин «экзогенная последовательность ДНК», как применяют в настоящем документе, представляет собой любую последовательность нуклеиновой кислоты, которая извлечена из ее нативного положения и встроена в новое положение, с изменением последовательностей, фланкирующих последовательность нуклеиновой кислоты, которая была перемещена. Например, экзогенная последовательность ДНК может содержать последовательность из другого вида.

«Связывание» относится к специфическому для последовательности взаимодействию между макромолекулами (например, между белком и нуклеиновой кислотой). Не все компоненты связывающего взаимодействия должны являться специфическими для последовательности (например, контактируют с фосфатными остатками в остове ДНК), при условии, что взаимодействие в целом является специфическим для последовательности. Такие взаимодействия, как правило, характеризуют посредством константы диссоциации (Kd). «Аффинность» относится к прочности связывания: увеличенная аффинность связывания коррелирует с более низкой константой связывания (Kd).

«Связывающий белок» представляет собой белок, способный связываться с другой молекулой. Связывающий белок может связываться, например, с молекулой ДНК (ДНК-связывающий белок), молекулой РНК (РНК-связывающий белок) и/или с молекулой белка (белок-связывающий белок). В случае белок-связывающего белка, он может связываться сам с собой (с формированием гомодимеров, гомотримеров и т.д.) и/или он может связываться с одной или несколькими молекулами другого белка или белков. Связывающий белок может иметь более одного типа активности связывания. Например, белки с цинковыми пальцами обладают активностью связывания ДНК, активностью связывания РНК и активностью связывания белка.

Как применяют в настоящем документе, термин «цинковые пальцы» определяет области аминокислотной последовательности в связывающем домене ДНК-связывающего белка, структура которых стабилизирована посредством координации ионом цинка.

«ДНК-связывающий белок с цинковыми пальцами» (или связывающий домен) представляет собой белок или домен в более крупном белке, который связывает ДНК специфическим для последовательности образом через один или несколько цинковых пальцев, представляющих собой области аминокислотной последовательности в связывающем домене, структура которых стабилизирована координационной связью с ионом цинка. Термин «ДНК-связывающий белок с цинковыми пальцами» часто сокращенно обозначают как белок с цинковыми пальцами или ZFP. Связывающие домены цинковых пальцев можно «конструировать» для связывания с предопределенной нуклеотидной последовательностью. Неограничивающими примеры способов конструирования белков с цинковыми пальцами являются дизайн и отбор. Сконструированный белок с цинковыми пальцами представляет собой белок, не встречающийся в природе, дизайн/состав которого принципиально является результатом использования рациональных критериев. Рациональные критерии для дизайна включают применение правил замены и компьютеризованных алгоритмов обработки информации в базе данных, хранящей информацию о дизайне существующих ZFP и данные о связывании. См., например, патенты США No. 6140081; 6453242; 6534261 и 6794136; см. также WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 и WO 03/016496.

«ДНК-связывающий домен TALE» или «TALE» представляет собой полипептид, содержащий один или несколько доменов/единиц повтора TALE. Домены повторов вовлечены в связывание TALE с узнаваемой им последовательностью ДНК-мишени. Одна «единица повтора» (обозначенная также как «повтор»), как правило, имеет длину 33-35 аминокислот и обладает по меньшей мере некоторой гомологией последовательности с другими последовательностями повтора TALE во встречающемся в природе белке TALE. См., например, публикацию патента США No. 20110301073, полное содержание которого включено в настоящий документ в качестве ссылки.

Система нуклеаз CRISPR (короткие палиндромные повторы, расположенные кластерами, равномерно удаленными друг от друга)/Cas (ассоциированная с CRISPR). В кратком изложении, «ДНК-связывающий домен CRISPR» представляет собой молекулу РНК с короткой цепью, которая совместно с ферментом CAS может избирательно узнавать, связывать и расщеплять геномную ДНК. Систему CRISPR/Cas можно конструировать для внесения двухцепочечного разрыва (DSB) в желаемую мишень в геноме, и на репарацию DSB можно влиять с использованием ингибиторов репарации для обеспечения репарации с пониженной точностью. См., например, Jinek et al (2012) Science 337, p. 816-821, Jinek et al, (2013), eLife 2:e00471, и David Segal, (2013) eLife 2:e00563).

Связывающие домены цинковых пальцев, CRISPR и TALE можно «конструировать» для связывания с предопределенной нуклеотидной последовательностью, например посредством конструирования (изменения одной или нескольких аминокислот) спирального участка узнавания природного цинкового пальца. Подобным образом, TALE можно «конструировать» для связывания с предопределенной нуклеотидной последовательностью, например, посредством конструирования аминокислот, вовлеченных в связывание ДНК (область повтора двух вариабельных остатков или область RYD). Таким образом, сконструированные ДНК-связывающие белки (цинковые пальцы или TALE) представляют собой белки, не встречающиеся в природе. Неограничивающими примерами способов конструирования ДНК-связывающих белков являются дизайн и отбор. Сконструированный ДНК-связывающий белок представляет собой белок, не встречающийся в природе, дизайн/состав которого в основном является результатом использования рациональных критериев. Рациональные критерии для дизайна включают применение правил замены и компьютеризованных алгоритмов обработки информации в базе данных, хранящей информацию о дизайне существующих ZFP и/или TALE, и данные о связывании. См., например, патенты США 6140081; 6453242 и 6534261; также см. WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 и WO 03/016496 и Патентные публикации США No. 20110301073, 20110239315 и 20119145940.

«Выбранный» белок с цинковыми пальцами, CRISPR или TALE представляет собой белок, не обнаруженный в природе, получение которого является результатом в основном эмпирического процесса, такого как фаговый дисплей, ловушка взаимодействий или гибридный отбор. См. например, патенты США No. 5789538; US 5925523; US 6007988; US 6013453; US 6200759; WO 95/19431; WO 96/06166; WO 98/53057; WO 98/54311; WO 00/27878; WO 01/60970 WO 01/88197 и WO 02/099084 и Патентные публикации США No. 20110301073, 20110239315 и 20119145940.

«Рекомбинация» относится к процессу обмена генетической информацией между двумя полинуклеотидами, включая, но без ограничения, фиксацию донора посредством соединения негомологичных концов (NHEJ) и гомологичной рекомбинации. Для целей настоящего описания «гомологичная рекомбинация (HR)» относится к специализированной форме такого обмена, который происходит, например, в процессе репарации двухцепочечных разрывов в клетках посредством механизмов направляемой гомологией репарации. Этот процесс требует гомологии нуклеотидных последовательностей, использует «донорную» молекулу в качестве матрицы для репарации молекулы-«мишени» (т.е. нуклеотидной последовательности, молекулы, подвергнутой двухцепочечному разрыву) и является известным под разными названиями как «конверсия генов без кроссинговера» или «конверсия коротких участков генов», поскольку он приводит к переносу генетической информации от донора к мишени. Без намерения быть связанными какой-либо конкретной теорией, такой перенос может вовлекать коррекцию несоответствующих оснований в гетеродуплексной ДНК, фомирующейся между имеющей разрывы мишенью и донором, и/или «зависимую от синтеза гибридизацию цепей», в которой донор используют для повторного синтеза генетической информации, которая становится частью мишени, и/или родственные процессы. Такая специализированная HR часто приводит к изменению последовательности молекулы-мишени, так что часть или вся последовательность донорного полинуклеотида включена в полинуклеотид-мишень. Для направляемой HR интеграции, донорная молекула содержит по меньшей мере 2 области гомологии с геномом («плечи гомологии») длиной по меньшей мере 50-100 пар оснований. См., например, публикацию патента США No. 20110281361.

В способах по изобретению одна или несколько направленных нуклеаз, как описано в настоящем документе, вносят двухцепочечный разрыв в последовательность-мишень (например, клеточный хроматин) в предопределенном участке, и «донорный» полинуклеотид, обладающий гомологией с нуклеотидной последовательностью в области разрыва для опосредуемой HR интеграции или не обладающий гомологией с нуклеотидной последовательностью в области разрыва для опосредуемой NHEJ интеграции, можно вводить в клетку. Показано, что присутствие двухцепочечного разрыва облегчает интеграцию донорной последовательности. Донорная последовательность может быть физически интегрирована или, альтернативно, донорный полинуклеотид используют в качестве матрицы для репарации разрыва посредством гомологичной рекомбинации, приводящей к введению всей или части нуклеотидной последовательности в качестве донора в клеточный хроматин. Таким образом, первая последовательность в клеточном хроматине может быть изменена и, в конкретных вариантах осуществления может быть конвертирована в последовательность, присутствующую в донорном полинуклеотиде. Таким образом, применение терминов «заменить» или «замена» можно понимать как представляющее замену одной нуклеотидной последовательности на другую (т.е., замену последовательности в информационном смысле), и оно не обязательно требует физической или химической замены одного полинуклеотида другим. В любом из способов, описанных в настоящем документе, можно использовать дополнительные пары белков с цинковыми пальцами, CRISPRS или TALEN для дополнительного двухцепочечного расщепления дополнительных участков-мишеней в клетке.

Любые из способов, описанных в настоящем документе, можно использовать для вставки донора любого размера и/или частичной или полной инактивации одной или нескольких последовательностей-мишеней в клетке посредством направленной интеграции донорной последовательности, нарушающей экспрессию представляющих интерес гена(генов). Представлены также линии клеток с частично или полностью инактивированными генами.

Более того, способы направленной интеграции, как описано в настоящем документе, также можно использовать для интеграции одной или нескольких экзогенных последовательностей. Экзогенная последовательность нуклеиновой кислоты может содержать, например, один или несколько генов или молекул кДНК, или любой тип кодирующий или некодирующей последовательности, так же как один или несколько контрольных элементов (например, промоторов). Кроме того, экзогенная последовательность нуклеиновой кислоты (трансген) может продуцировать одну или несколько молекул РНК (например, короткие шпилечные РНК (кшРНК), ингибирующие РНК (РНКи), микроРНК (мкРНК) и т.д.) или белок.

«Расщепление», как применяют в настоящем документе, определяет разрыв фосфатно-сахарного остова молекулы ДНК. Расщепление можно инициировать множеством способов, включая, но без ограничения, ферментативный или химический гидролиз фосфодиэфирной связи. Возможно как одноцепочечное расщепление, так и двухцепочечное расщепление, и двухцепочечное расщепление может происходить в результате двух отдельных событий одноцепочечного расщепления. Расщепление ДНК может приводить к образованию либо тупых концов, либо ступенчатых концов. В определенных вариантах осуществления слитые полипептиды используют для направленного расщепления двухцепочечной ДНК. «Домен расщепления» содержит одну или несколько полипептидных последовательностей, которые обладают каталитической активностью расщепления ДНК. Домен расщепления может содержаться в одной полипептидной цепи или активность расщепления может являться результатом ассоциации двух (или более) полипептидов.

«Полудомен расщепления» представляет собой полипептидную последовательность, которая, в сочетании с вторым полипептидом (либо идентичным, либо отличающимся) формирует комплекс, обладающий активностью расщепления (предпочтительно, активностью двухцепочечного расщепления). Термины «первый и второй полудомены расщепления» «+ и - полудомены расщепления» и «правый и левый полудомены расщепления» используют взаимозаменяемо для обозначения пар полудоменов расщепления расщепления, которые димеризуются.

«Сконструированный полудомен расщепления» представляет собой полудомен расщепления, модифицированный так, чтобы формировать облигатные гетеродимеры с другим полудоменом расщепления (например, другим сконструированным полудоменом расщепления). См., также Публикации Патентов США No. 2005/0064474, 20070218528, 2008/0131962 и 2011/0201055, полное содержание которых включено в настоящий документ в качестве ссылки.

«Участок-мишень» или «последовательность-мишень» относится к части нуклеиновой кислоты, с которой связывается связывающая молекула при условии существования подходящих условий для связывания.

Нуклеиновые кислоты включают ДНК и РНК, могут являться одноцепочечными и двухцепочечными; могут являться линейными, разветвленными или кольцевыми; и могут иметь любую длину. Нуклеиновые кислоты включают нуклеиновые кислоты, способные формировать дуплексы, а также формирующие триплексы нуклеиновые кислоты. См., например, патенты США No. 5176996 и 5422251. Белки включают, но без ограничения, ДНК-связывающие белки, факторы транскрипции, ремоделирующие хроматин факторы, белки, связывающие метилированную ДНК, полимеразы, метилазы, деметилазы, ацетилазы, деацетилазы, киназы, фосфатазы, интегразы, рекомбиназы, лигазы, топоизомеразы, гиразы и хеликазы.

«Продукт экзогенной нуклеиновой кислоты» включает как полинуклеотидные, так и полипептидные продукты, например, продукты транскрипции (полинуклеотиды, такие как РНК) и продукты трансляции (полипептиды).

«Слитая» молекула представляет собой молекулу, в которой две или более молекулы субъединиц связаны, например, ковалентно. Молекулы субъединиц могут представлять собой молекулы одного и того же типа, или они могут представлять собой молекулы различных химических типов. Примеры первого типа слитых молекул включают, но без ограничения, слитые белки (например, слитый белок между ДНК-связывающим доменом ZFP и доменом расщепления) и слитые нуклеиновые кислоты (например, нуклеиновая кислота, кодирующая слитый белок, описанный выше). Примеры второго типа слитых молекул включают, но без ограничения, слитую молекулу между формирующей триплекс нуклеиновой кислотой и полипептидом, и слитую молекулу между связывающую малую бороздку молекулой и нуклеиновой кислотой. Экспрессия слитого белка в клетке может происходить в результате доставки слитого белка в клетку или доставки полинуклеотида, кодирующего слитый белок, в клетку, где полинуклеотид транскрибируется и транскрипт транслируется, для получения слитого белка. Транс-сплайсинг, расщепление полипептида и лигирование полипептида могут быть также вовлечены в экспрессию белка в клетке. Способы доставки полинуклеотида и полипептида в клетки представлены в другом месте в этом описании.

Для целей настоящего изобретения «ген» включает область ДНК, кодирующую продукт гена (см. ниже), так же как все области ДНК, регулирующие получение продукта гена, вне зависимости от того, являются или нет такие регуляторные последовательности соседними с кодирующими и/или транскрибируемыми последовательностями. Соответственно, ген включает промоторные последовательности, терминаторы, регуляторные последовательности для трансляции, такие как участки связывания рибосом и внутренние участки связывания рибосом, энхансеры, сайленсеры, инсуляторы, пограничные элементы, точки начала репликации, участки присоединения матрикса и контрольные области локусов, но не обязательно ограничивается ими.

«Экспрессия гена» относится к переводу информации, содержащейся в гене, в продукт гена. Продукт гена может представлять собой прямой продукт транскрипции гена (например, мРНК, тРНК, рРНК, антисмысловую РНК, интерферирующую РНК, рибозим, структурную РНК или любой другой тип РНК) или белок, полученный посредством трансляции мРНК. Продукты генов также включают РНК, модифицированные посредством таких процессов, как кэпирование, полиаденилирование, метилирование и редактирование, и белки, модифицированные, например, посредством метилирования, ацетилирования, фосфорилирования, убиквитинилирования, АДФ-рибозилирования, миристилирования и гликозилирования.

Идентичность последовательностей: как применяют в настоящем документе, термины «идентичность последовательностей» или «идентичность» в контексте двух последовательностей нуклеиновых кислот или полипептидов относятся к остаткам в двух последовательностях, которые являются одинаковыми при выравнивании для максимального соответствии на протяжении определенного окна сравнения.

Как применяют в настоящем документе, термин «процент идентичности последовательностей» относится к значению, определенному посредством сравнения двух оптимально выровненных последовательностей (например, последовательностей нуклеиновых кислот или аминокислотных последовательностей) на протяжении окна сравнения, где часть последовательности в окне сравнения может содержать вставки или делеции (т.е. пропуски) по сравнению с эталонной последовательностью (которая не содержит вставок или делеций) для оптимального выравнивания двух последовательностей. Процент рассчитывают посредством определения количества положений, в которых идентичные остатки нуклеиновой кислоты или аминокислотные остатки встречаются в обеих последовательностях, с получением числа совпадающих положений, деления этого количества совпадающих положений на общее количество положений в окне сравнения и умножения результата на 100 с получением процента идентичности последовательностей.

Способы выравнивания последовательностей для сравнения хорошо известны в данной области. Различные программы и алгоритмы выравнивания описаны, например, в: Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. U.S.A. 85:2444; Higgins and Sharp (1988) Gene 73:237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8:155-65; Pearson et al. (1994) Methods Mol. Biol. 24:307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174:247-50. Подробное обсуждение способов выравнивания последовательностей и расчета гомологии можно обнаружить, например, в Altschul et al. (1990) J. Mol. Biol. 215:403-10. Basic Local Alignment Search Tool (BLAST™; Altschul et al. (1990)) от National Center for Biotechnology Information (NCBI) доступен из нескольких источников, включая National Center for Biotechnology Information (Bethesda, MD) и Интернет, для применения совместно с несколькими программами анализа последовательностей. Описание того, как определять идентичность последовательностей с использованием этой программы, доступно через Интернет в разделе «help» для BLAST™. Для сравнения последовательностей нуклеиновых кислот можно использовать функцию «Blast 2 sequences» программы BLAST™ (Blastn) с использованием параметров по умолчанию. Для последовательностей нуклеиновых кислот с более высоким сходством с эталонными последовательности показывают возрастающую процентную идентичность при оценке этим способом.

Специфически гибридизующийся/специфически комплементарный: как применяют в настоящем документе, термины «специфически гибридизующийся» или «специфически комплементарный» представляют собой термины, которые указывают на достаточную степени комплементарности, чтобы происходило стабильное и специфическое связывание между молекулой нуклеиновой кислоты и молекулой нуклеиновой кислоты-мишенью. Гибридизация между двумя молекулами нуклеиновой кислоты вовлекает формирование антипараллельное выравнивание последовательностей двух молекул нуклеиновой кислоты. Затем эти две молекулы способны образовывать водородные связи с соответствующими основаниями на противоположной цепи с образованием дуплексной молекулы, которая, если является достаточно стабильной, поддается обнаружению с использованием способов, хорошо известных в данной области. Молекула нуклеиновой кислоты не должна быть на 100% комплементарной ее последовательности-мишени, чтобы поддаваться специфической гибридизации. Однако значение комплементарности последовательностей, которая должна существовать для того, чтобы гибридизация была специфической, зависит от используемых условий гибридизации.

Условия гибридизации, приводящие к определенным степеням строгости, меняют в зависимости от характера выбранного способа гибридизации и состава и длины гибридизующихся последовательностей нуклеиновых кислот. Как правило, температура гибридизации и ионная сила (особенно, концентрация Na+ и/или Mg++) буфера для гибридизации обеспечивают строгость гибридизации, хотя на строгость влияет также время отмывки. Расчеты, относящиеся к условиям гибридизации, требуемым для достижения конкретных степеней строгости, известны специалистам в данной области и рассмотрены, например, в Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, chs. 9 and 11; и Hames and Higgins (eds.) Nucleic Acid Hybridization, IRL Press, Oxford, 1985. Дополнительную подробную инструкцию и руководство в отношении гибридизации нуклеиновых кислот можно обнаружить, например, в Tijssen, «Overview of principles of hybridization and the strategy of nucleic acid probe assays», в Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2, Elsevier, NY, 1993; и Ausubel et al., Eds., Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-Interscience, NY, 1995.

Как применяют в настоящем документе, «строгие условия» охватывают условия, в которых гибридизация происходит, только если существует менее 20% несоответствий между гибридизуемой молекулой и последовательностью в молекуле нуклеиновой кислоты-мишени. «Строгие условия» включают дополнительные конкретные уровни строгости. Таким образом, как применяют в настоящем документе, условия «умеренной строгости» представляют собой условия, в которых молекулы с более чем 20% несоответствием последовательностей не будут гибридизоваться; условия «высокой строгости» представляют собой условия, в которых последовательности с более чем 10% несоответствием оснований не будут гибридизоваться; и условия «очень высокой строгости» представляют собой условия, в которых последовательности с более чем 5% несоответствием оснований не будут гибридизоваться. Ниже представлены репрезентативные неограничивающие условия гибридизации.

Условия высокой строгости (детектируют последовательности, разделяющие по меньшей мере 90% идентичности последовательностей): гибридизация в 5x буфере SSC (где буфер SSC содержит детергент, такой как SDS, и дополнительные реагенты, такие как ДНК спермы лосося, EDTA и т.д.) при 65°C в течение 16 часов; отмывка дважды в 2x буфере SSC (где буфер SSC содержит детергент, такой как SDS, и дополнительные реагенты, такие как ДНК спермы лосося, EDTA и т.д.) при комнатной температуре в течение 15 минут каждый раз; и отмывка дважды в 0,5x буфере SSC (где буфер SSC содержит детергент, такой как SDS, и дополнительные реагенты, такие как ДНК спермы лосося, EDTA и т.д.) при 65°C в течение 20 минут каждый раз.

Условия умеренной строгости (детектируют последовательности, разделяющие по меньшей мере 80% идентичности последовательностей): гибридизация в 5-6x буфере SSC (где буфер SSC содержит детергент, такой как SDS, и дополнительные реагенты, такие как ДНК спермы лосося, EDTA и т.д.) при 65-70°C в течение 16-20 часов; отмывка дважды в 2x буфере SSC (где буфер SSC содержит детергент, такой как SDS, и дополнительные реагенты, такие как ДНК спермы лосося, EDTA и т.д.) при комнатной температуре в течение 5-20 минут каждый раз; и отмывка дважды в 1x буфере SSC (где буфер SSC содержит детергент, такой как SDS, и дополнительные реагенты, такие как ДНК спермы лосося, EDTA и т.д.) при 55-70°C в течение 30 минут каждый раз.

Нестрогие контрольные условия (гибридизуются последовательности, разделяющие по меньшей мере 50% идентичности последовательностей): гибридизация в 6x буфере SSC (где буфер SSC содержит детергент, такой как SDS, и дополнительные реагенты, такие как ДНК спермы лосося, EDTA и т.д.) при температуре от комнатной температуры до 55°C в течение 16-20 часов; отмывка по меньшей мере дважды в 2x-3x SSC (где буфер SSC содержит детергент, такой как SDS, и дополнительные реагенты, такие как ДНК спермы лосося, EDTA и т.д.) от комнатной температуры до 55°C в течение 20-30 минут каждый раз.

Как применяют в настоящем документе, термин «по существу гомологичный» или «существенная гомология» в отношении непрерывной последовательности нуклеиновой кислоты, относится к непрерывным нуклеотидным последовательностям, которые гибридизуются в строгих условиях с эталонной последовательностью нуклеиновой кислоты. Например, последовательности нуклеиновой кислоты, которые по существу гомологичны эталонной последовательности нуклеиновой кислоты, представляют собой последовательности нуклеиновой кислоты, которые гибридизуются в строгих условиях (например, условиях умеренной строгости, указанных выше) с эталонной последовательностью нуклеиновой кислоты. По существу гомологичные последовательности могут обладать по меньшей мере 80% идентичностью последовательностей. Например, по существу гомологичные последовательности могут обладать приблизительно от 80% до 100% идентичностью последовательностей, например, приблизительно 81%; приблизительно 82%; приблизительно 83%; приблизительно 84%; приблизительно 85%; приблизительно 86%; приблизительно 87%; приблизительно 88%; приблизительно 89%; приблизительно 90%; приблизительно 91%; приблизительно 92%; приблизительно 93%; приблизительно 94% приблизительно 95%; приблизительно 96%; приблизительно 97%; приблизительно 98%; приблизительно 98,5%; приблизительно 99%; приблизительно 99,5% и приблизительно 100%. Свойство существенной гомологии является тесно связанным со специфической гибридизацией. Например, молекула нуклеиновой кислоты поддается специфической гибридизации, когда существует достаточная степень комплементарности, чтобы избегать неспецифического связывания нуклеиновой кислоты с не являющимися мишенью последовательностями в условиях, где является желательным специфическое связывание, например, в строгих условиях гибридизации.

В некоторых случаях «гомологичный» можно использовать для обозначения взаимосвязи первого гена и второго гена из-за происхождения от общей предковой последовательности ДНК. В таких случаях термин «гомолог» указывает на взаимосвязь между генами, разобщенными процессом видообразования (см. ортолог) или на взаимосвязь между генами, разобщенными событием генетической дупликации (см. паралог). В других случаях «гомологичный» можно использовать для обозначения уровня идентичности последовательностей между одной или несколькими полинуклеотидными последовательностями, в таких случаях одна или несколько полинуклеотидных последовательностей не обязательно происходят из общей предковой последовательности ДНК. Специалистам в данной области известно о взаимозаменяемом применении термина «гомологичный» и понятно, как надлежит использовать этот термин.

Как применяют в настоящем документе, термин «ортолог» (или «ортологичный») относится к гену в двух или более видах, который эволюционировал из общей предковой нуклеотидной последовательности и может сохранять одну и ту же функцию в двух или более видах.

Как применяют в настоящем документе, термин «паралогичный» относится к генам, которые являются родственными посредством дупликации в геноме. Ортологи сохранят одну и ту же функцию в ходе эволюции, в то время как у паралогов развиваются новые функции, даже если эти новые функции не связаны с исходной функцией гена.

Как применяют в настоящем документе, две последовательности нуклеиновых кислот называют обладающими «полной комплементарностью», когда каждый нуклеотид последовательности, читаемой в направлении от 5' к 3', является комплементарным каждому нуклеотиду другой последовательности, читаемой в направлении от 3' к 5'. Нуклеотидная последовательность, комплементарная эталонной нуклеотидной последовательности, обладает последовательностью, идентичной обратной комплементарной последовательности для эталонной нуклеотидной последовательности. Эти термины и описания хорошо определены в данной области и понятны специалистам в данной области.

Специалистам в данной области хорошо известно, что при определении процентной идентичности последовательностей между аминокислотными последовательностями идентичность аминокислот в данном положении, обеспечиваемая выравниванием, может отличаться без влияния на желательные свойства полипептидов, содержащих выровненные последовательности. В этих случаях в процентную идентичность последовательностей можно вносить поправку для учета сходства между консервативно замененными аминокислотами. Эти поправки являются хорошо известными и общепринятыми для специалистов в данной области. См., например, Myers and Miller (1988), Computer Applications in Biosciences 4:11-7. Статистические способы известны в данной области, и их можно использовать для анализа 5286 идентифицированных оптимальных геномных локусов.

В качестве одного из вариантов осуществления, идентифицированные оптимальные геномные локусы, содержащие 5286 индивидуальных оптимальных последовательностей геномных локусов, можно анализировать с использованием критерия F-распределения. В теории вероятности и статистике F-распределение представляет собой непрерывное распределение вероятности. Критерий F-распределения представляет собой критерий статистической значимости, который имеет F-распределение и используется при сравнении статистических моделей, приведенных в соответствие с набором данных, для идентификации модели наилучшего соответствия. F-распределение является непрерывным распределением вероятности и также известно как F-распределение Снедекора или распределение Фишера-Снедекора. F-распределение часто предстает как нулевое распределение статистики критерия, особенно в дисперсионном анализе. F-распределение представляет собой скошенное вправо распределение. F-распределение является асимметричным распределением, которое обладает минимальным значением 0, но не имеет максимального значения. Кривая достигает пика недалеко от 0 справа, а затем постепенно приближается к горизонтальной оси по мере увеличения значения F. F-распределение приближается к горизонтальной оси, но никогда действительно не достигает ее. Следует понимать, что в других вариантах осуществления, специалист в данной области может выводить и использовать варианты этого уравнения или действительно отличающиеся уравнения, и они являются применимыми для анализа 5286 индивидуальных последовательностей оптимальных геномных локусов.

Функционально связанный: первая нуклеотидная последовательность является «функционально связанной» с второй нуклеотидной последовательностью, когда первая нуклеотидная последовательность находится в функциональной взаимосвязи с второй нуклеотидной последовательностью. Например, промотор является функционально связанным с кодирующей последовательностью, если промотор влияет на транскрипцию или экспрессию кодирующей последовательности. В случае рекомбинантной продукции функционально связанные нуклеотидные последовательности, как правило, являются соседними и, когда необходимо соединить две кодирующие белок области, находятся в одной и той же рамке считывания. Однако нуклеотидные последовательности не должны являться соседними, чтобы являться функционально связанными.

Термин «функционально связанный», при использовании в отношении регуляторной последовательности и кодирующей последовательности, означает, что регуляторная последовательность влияет на экспрессию связанной с ней кодирующей последовательности. «Регуляторные последовательности», «регуляторные элементы» или «контрольные элементы» относятся к нуклеотидным последовательностям, влияющим на время и уровень/величину транскрипции, процессинга или стабильности РНК, или трансляции ассоциированной с ними кодирующей последовательности. Регуляторные последовательности могут включать промоторы; лидерные последовательности трансляции; интроны; энхансеры; структуры стебель-петля; связывающие репрессор последовательности; последовательности терминации; узнающие полиаденилирование последовательности и т.д. Конкретные регуляторные последовательности могут быть расположены выше и/или ниже кодирующей последовательности, функционально связанной с ними. Также, конкретные регуляторные последовательности, функционально связанные с кодирующей последовательностью, могут быть расположены на ассоциированной с ними комплементарной цепи двухцепочечной молекулы нуклеиновой кислоты.

При использовании в отношении двух или более аминокислотных последовательностей, термин «функционально связанный» означает, что первая аминокислотная последовательность находится в функциональной взаимосвязи по меньшей мере с одной из дополнительных аминокислотных последовательностей.

Описанные способы и композиции включают слитые белки, содержащие домен расщепления, функционально связанный с ДНК-связывающим доменом (например, ZFP), где ДНК-связывающий домен посредством связывания с последовательностью в оптимальном геномном локусе однодольного растения или маиса, направляет активность домена расщепления в участок вблизи этой последовательности и, таким образом, индуцирует двухцепочечный разрыв в оптимальном геномном локусе. Как указано в другом месте этого описания, домен цинковых пальцев можно конструировать для связывания практически с любой желательной последовательностью. Соответственно, один или несколько ДНК-связывающих доменов можно конструировать для связывания с одной или несколькими последовательностями в оптимальном геномном локусе. Экспрессия слитого белка, содержащего ДНК-связывающий домен и домен расщепления, в клетке влияет на расщепление в участке-мишени или вблизи участка-мишени.

ВАРИАНТЫ ОСУЩЕСТВЛЕНИЯ

Нацеливание трансгенов и пакетов трансгенов в конкретные положения в геноме однодольных растений, таких как растение Zea mays, может улучшить качество трансгенных событий, снизить стоимость, ассоциированную с осуществлением трансгенных событий, и предоставить новые способы получения трансгенных растительных продуктов, таких как последовательное пакетирование генов. В целом, нацеливание трансгсенов в конкретные участки генома, вероятно, будет коммерчески выгодным. За последние несколько лет достигнуты значительные результаты в отношении разработки сайт-специфических нуклеаз, таких как ZFN, CRISPR и TALEN, которые могут способствовать встраиванию донорных полинуклеотидов в заранее выбранные участки в растительных и других геномах. Однако значительно меньше известно о признаках геномных участков, которые пригодны для нацеливания. Исторически в качестве локусов для нацеливания используют не являющиеся необходимыми гены и участки интграции (вирусных) патогенов в геномах. Количество таких участков в геномах является довольно ограниченным и, таким образом, существует необходимость в идентификации и характеризации оптимальных геномных локусов, которые можно использовать для нацеливания донорных полинуклеотидных последовательностей. Ожидают, что в дополнение к возможности нацеливания, оптимальные геномные локусы будут представлять собой нейтральные участки, которые могут способствовать экспрессии трансгена и применению в разведении.

Заявители осознали, что являются желательными дополнительные критерии для участков вставки и объединили эти критерии для идентификации и выбора оптимальных участков в геноме однодольных растений, таком как геном маиса, для вставки экзогенных последовательностей. Для целей нацеливания выбранный участок для вставки должен быть уникальным и находящимся в не повторяющейся области генома однодольного растения, такого как геном Zea mays. Подобным образом, оптимальный геномный участок для встраивания должен обладать минимальными нежелательными фенотипическими эффектами и должен поддаваться событиям рекомбинации для облегчения интрогрессии в агрономические элитные линии с использованием традиционных способов разведения. Для идентификации геномных локусов, удовлетворяющих перечисленным критериям, геном однодольного растения, такой как геном Zea mays, сканировали с использованием специализированного биоинформатического способа и наборов данных геномного масштаба для идентификации новых геномных локусов, обладающих характеристиками, которые являются благоприятными для интеграции донорной полинуклеотидной последовательности и последующей экспрессии вставленной кодирующей последовательности.

I. Идентификация внегенных геномных локусов маиса

В соответствии с одним вариантом осуществления представлен способ идентификации оптимальной внегенной геномной последовательности маиса для вставки экзогенных последовательностей. Способ включает стадии первоначальной идентификации геномных последовательностей однодольных растений из маиса длиной по меньшей мере 1 т.п.о., которые являются гипометилированными. В одном варианте осуществления гипометилированная геномная последовательность имеет длину 1, 1,5, 2, 2,5, 3, 3,5, 4, 4,5, 5, 5,5, 6, 6,5, 7, 7,5, 8, 8,5, 9, 10, 11, 12, 13, 14, 15, 16 или 17 т.п.о. В одном варианте осуществления гипометилированная геномная последовательность имеет длину от приблизительно 1 до приблизительно 4 т.п.о. и в следующем варианте осуществления имеет длину приблизительно 2 т.п.о. Последовательность считают гипометилированной, если она обладает метилированием ДНК в пределах последовательности менее 1%. В одном варианте осуществления статус метилирования определяю на основании присутствия 5-метилцитозина в одном или нескольких CpG-динуклеотидов, CHG- или CHH-тринуклеотидов в выбранной последовательности маиса относительно количества всех остатков цитозина, встречающихся в соответствующих CpG-динуклеотидах, CHG- или CHH-тринуклеотидах в нормальном контрольном образце ДНК. Метилирование CHH обозначает 5-метилцитозин с двумя последующими нуклеотидами, которые могут не являться гуанином, и метилирование CHG относится к 5-метилцитозину, предшествующему основанию аденина, тимина или цитозина с последующим гуанином. Более конкретно, в одном варианте осуществления выбранная последовательность маиса имеет менее 1, 2 или 3 метилированных нуклеотидов на 500 нуклеотидов выбранной последовательности маиса. В одном варианте осуществления выбранная последовательность маиса имеет менее одного, двух или трех остатков 5-метилцитозина в CpG-динуклеотидах на 500 нуклеотидов выбранной последовательности маиса. В одном варианте осуществления выбранная последовательность маиса имеет длину от 1 до 4 т.п.о. и содержит последовательность размером 1 т.п.о., лишенную остатков 5-метилцитозина. В одном варианте осуществления выбранная последовательность маиса имеет длину 1, 1,5, 2, 2,5, 3, 3,5, 4, 4,5, 5, 5,5, 6, 6,5, 7, 7,5, 8 или 8,5 т.п.о. и содержит 1 или 0 метилированных нуклеотидов по всей ее длине. В одном варианте осуществления выбранная последовательность маиса имеет длину 1, 1,5, 2, 2,5, 3, 3,5, 4, 4,5, 5, 5,5, 6, 6,5, 7, 7,5, 8 или 8,5 т.п.о. и не содержит остатков 5-метилцитозина в CpG-динуклеотидах по всей ее длине. В соответствии с одним вариантом осуществления метилирование выбранной последовательности маиса может меняться в зависимости от ткани-источника. В таких вариантах осуществление уровни метилирования, используемые для определения того, является ли последовательность гипометилированной, представляют среднее значение метилирования в последовательностях, выделенных из двух или более тканей (например, из корня и побега).

В дополнение к требованию, чтобы оптимальный геномный участок являлся гипометилированным, выбранная последовательность маиса также должна являться внегенной. Соответственно, все гипометилированные геномные последовательности подвергают дальнейшему скринингу для исключения гипометилированных последовательностей, содержащих генную область. Это включает любые открытые рамки считывания независимо от того, кодирует ли транскрипт белок. Гипометилированные геномные последовательности, которые включают генные области, включая любые поддающиеся идентификации соседние 5′- и 3′-некодирующие нуклеотидные последовательности, вовлеченные в регуляцию экспрессии открытой рамки считывания, и любые интроны, которые могут присутствовать в геномной области, исключены из оптимального внегенного геномного локуса маиса по настоящему изобретению.

Оптимальные внегенные геномные локусы маиса также должны представлять собой последовательности, демонстрирующие признаки рекомбинации. В одном варианте осуществления выбранная последовательность маиса должна представлять собой последовательность, в которой детектировано по меньшей мере одно событие рекомбинации между двумя маркерами, фланкирующими выбранную последовательность маиса, как детектировано с использованием высокоразрешающего набора данных маркеров, полученных для множества картированных популяций. В одном варианте осуществления пару маркеров, фланкирующих геномную последовательность однодольных растений из маиса размером 0,5, 1, 1,5 млн.п.о., содержащую выбранную последовательность маиса, используют для расчета частоты рекомбинации для выбранной последовательности маиса. Частоты рекомбинации между каждой парой маркеров (измеряемые в сантиморганах (cM)) для геномного физического расстояния между маркерами (в млн.п.о.)) должны превышать 0 cM/млн.п.о. В одном варианте осуществления частота рекомбинации для геномной последовательности однодольных растений размером 1 млн.п.о., такой как геномная последовательность маиса, содержащая выбранную последовательность маиса, лежит в диапазоне от приблизительно 0,00041 до приблизительно 4,0. В одном варианте осуществления частота рекомбинации для геномной последовательности однодольных растений размером 1 млн.п.о. из маиса, содержащая выбранную последовательность маиса, лежит в диапазоне от приблизительно 0,5 до приблизительно 5,0. В одном варианте осуществления оптимальные геномные локусы представляют собой локусы, где в выбранной последовательности маиса детектированы события рекомбинации.

Оптимальные внегенные геномные локусы маиса также являются поддающейся нацеливанию последовательностью, т.е. последовательностью, которая относительно уникальна в геноме однодольного растения маиса, так что ген, нацеленный на выбранную последовательность маиса, будет встраиваться только в одно положение в геноме однодольного растения маиса. В одном варианте осуществления вся длина оптимальной геномной последовательности разделяет менее 30%, 35% или 40% идентичности последовательности с другой последовательностью сходной длины, содержащейся в геноме однодольного растения маиса. Соответственно, в одном варианте осуществления выбранная последовательность маиса не может содержать последовательность размером 1 т.п.о., разделяющую более 25%, 30%, 35% или 40% идентичности последовательности с другой последовательностью размером 1 т.п.о., содержащейся в геноме однодольного растения маиса. В следующем варианте осуществления выбранная последовательность маиса не может содержать последовательность размером 500 п.о., разделяющую более 30%, 35% или 40% идентичностью последовательности с другой последовательностью размером 500 п.о., содержащейся в геноме однодольного растения маиса. В одном варианте осуществления выбранная последовательность маиса не может содержать последовательность размером 1 т.п.о., разделяющую более 40% идентичности последовательности с другой последовательностью размером 1 т.п.о., содержащейся в геноме однодольного растения, такого как маис.

Оптимальные внегенные геномные локусы маиса также находятся вблизи генной области. Более конкретно, выбранная последовательность маиса должна быть расположена вблизи генной области (например, генная область должна быть расположена в пределах 40 т.п.о. от геномной последовательности, фланкирующей и соседней с любым из концов выбранной последовательности маиса, как обнаружено в нативном геноме). В одном варианте осуществления генная область расположена в пределах 10, 20, 30 или 40 т.п.о. соседней геномной последовательности, расположенной с любой стороны от выбранной последовательности маиса, как обнаружено в нативном геноме однодольного растения маиса. В одном варианте осуществления две или более генных области расположены в пределах 10, 20, 30 или 40 т.п.о. соседней геномной последовательности, фланкирующей два конца выбранной последовательности маиса. В одном варианте осуществления 1-9 генных областей расположены в пределах 10, 20, 30 или 40 т.п.о. соседней геномной последовательности, фланкирующей два конца выбранной последовательности маиса. В одном варианте осуществления две или более генных области расположены в пределах 20, 30 или 40 т.п.о. геномной последовательности, содержащей выбранную последовательность маиса. В одном варианте осуществления 1-9 генных областей расположены в пределах 40 т.п.о. геномной последовательности, содержащей выбранную последовательность маиса. В одном варианте осуществления генная область, расположенная в пределах 10, 20, 30 или 40 т.п.о. соседней геномной последовательности, фланкирующей выбранную последовательность маиса, содержит известный ген генома однодольного растения, такого как растение маиса.

В соответствии с одним вариантом осуществления представлены модифицированные внегенные геномные локусы маиса, где локусы имеют длину по меньшей мере 1 т.п.о., являются внегенными, не содержат метилированных остатков цитозина, обладают частотой рекомбинации более 0,00041 cM/млн.п.о. на протяжении геномной области размером 1 млн.п.о., охватывающей геномные локусы однодольных растений, такие как геномные локусы маиса, и последовательность размером 1 т.п.о. геномных локусов однодольных растений разделяет менее 40% идентичности последовательности с любой другой последовательностью размером 1 т.п.о., содержащейся в геноме однодольного растения, где внегенные геномные локусы однодольных растений модифицированы посредством вставки представляющей интерес ДНК в внегенные геномные локусы однодольных растений, например, внегенные геномные локусы маиса.

В соответствии с одним из вариантов осуществления представлен способ идентификации оптимальных внегенных геномных локусов однодольных растений, включая, внегенные геномные локусы маиса. В некоторых вариантах осуществления способ включает первоначальный скрининг генома однодольного растения маиса для получения первого пула выбранных последовательностей маиса, которые имеют минимальную длину 1 т.п.о. и являются гипометилированными, необязательно где геномная последовательность обладает менее 1% метилирования или где геномная последовательность лишена каких-либо метилированных остатков цитозина. Этот первый пул выбранных последовательностей маиса можно подвергать дальнейшему скринингу для исключения локусов, не удовлетворяющих требованиям для оптимальных внегенных геномных локусов маиса. Геномные последовательности однодольных растений, например, геномные последовательности маиса, которые кодируют транскрипты, разделяют более 40% или выше идентичности последовательности с другой последовательностью сходной длины, не демонстрируют признаков рекомбинации и не обладают известной открытой рамкой считывания в пределах 40 т.п.о. от выбранной последовательности маиса, исключают из первого пула последовательностей, оставляя второй пул последовательностей, которые определяют как оптимальные внегенные локусы маиса. В одном варианте осуществления любые выбранные последовательности маиса, которые не имеют известного гена маиса, или последовательности, содержащей область на 2 т.п.о. выше и/или 1 т.п.о. ниже известного гена, в пределах 40 т.п.о. от одного конца указанной внегенной последовательности, исключают из первого пула последовательностей. В одном варианте осуществления любые выбранные последовательности маиса, которые не содержат известного гена, экспрессирующего белок, в пределах 40 т.п.о. выбранной последовательности маиса, исключают. В одном варианте осуществления любые выбранные последовательности маиса, которые не обладают частотой рекомбинации выше 0,00041 cM/млн.п.о., исключают.

С использованием этих критериев отбора заявители идентифицировали выбранные оптимальные геномные локусы маиса, служащие оптимальными внегенными геномными локусами маиса, последовательности которых описаны как SEQ ID NO: 1-SEQ ID NO: 5286. Настоящее изобретение охватывает также природные варианты или модифицированные производные идентифицированных оптимальных внегенных геномных локусов маиса, где варианты или производные локусов включают последовательность, которая отличается от любой из последовательностей SEQ ID NO: 1-SEQ ID NO: 5286 на 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 нуклеотидов. В одном варианте осуществления оптимальные внегенные геномные локусы маиса для применения в соответствии с настоящим описанием включают последовательности, выбранные из SEQ ID NO: 1-SEQ ID NO: 5286, или последовательности, которые обладают 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью последовательности с последовательностью, выбранной из SEQ ID NO: 1-SEQ ID NO: 5286.

В другом варианте осуществления однодольные растения для применения в соответствии с настоящим описанием включают любое растение, выбранное из группы, состоящей из растения кукурузы, растения пшеницы или растения риса. Однодольные растения, которые можно использовать, включают в качестве неограничивающих примеров, кукурузу (Zea mays), рис (Oryza sativa), рожь (Secale cereale), сорго (Sorghum bicolor, Sorghum vulgare), просо (например, просо жемчужное (Pennisetum glaucum), просо посевное (Panicum miliaceum), просо итальянское (Setaria italica), просо пальчатое (Eleusine coracana)), пшеницу (Triticum aestivum), сахарный тростник (Saccharum spp.), овес (Avena), ячмень (Hordeum), ананас (Ananas comosus), банан (Musa spp.), пальмы, декоративные растения и травы.

В другом варианте осуществления оптимальные внегенные геномные локусы маиса для применения в соответствии с настоящим описанием включают последовательности, выбранные из любого сорта растений маиса или кукурузы. В следующем варианте осуществления оптимальные внегенные геномные локусы маиса для применения в соответствии с настоящим описанием включают последовательности, выбранные из инбредных растений желтозерной кукурузы. Соответственно, инбредное растение желтозерной кукурузы включает инбредные растения зубовидной или кремнистой желтозерной кукурузы, включая ее агрономически элитные сорта. В следующем варианте осуществления оптимальные внегенные геномные локусы маиса для применения в соответствии с настоящим описанием включают последовательности, выбранные из поддающихся трансформации линий кукурузы. В одном варианте осуществления репрезентативные поддающиеся трансформации линии кукурузы включают: Hi-II, B73, B104, Mo 17, W22, A188, H99 и их производные. Специалисту в данной области понятно, что в результате филогенетической дивергенции различные типы линий кукурузы не содержат идентичных геномных последовательности ДНК, и что в геномных последовательностях могут присутствовать полиморфизмы или аллельные варианты. В одном варианте осуществления настоящее изобретение охватывает такой полиморфизм или аллельные варианты идентифицированных оптимальных внегенных геномных локусов маиса, где полиморфизмы или аллельные варианты содержат последовательность, которая отличается от любой из последовательностей SEQ ID NO: 1 - SEQ ID NO: 5286 на 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 нуклеотидов. В следующем варианте осуществления настоящее изобретение охватывает такие полиморфизмы или аллельные варианты идентифицированных оптимальных внегенных геномных локусов маиса, где последовательности, содержащие полиморфизмы или аллельные варианты, обладают 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью последовательности с любой из последовательностей SEQ ID NO: 1 - SEQ ID NO: 5286.

Идентифицированные оптимальные геномные локусы, содержащие 5286 индивидуальных последовательностей, могут быть категоризированы на различные подгруппы посредством дальнейшего анализа с использованием способа многофакторного анализа. Программы для многофакторного статистического анализа используют для выявления скрытой структуры (размерности) набора переменных. Можно использовать ряд различных типов многофакторных алгоритмов, например, набор данных можно анализировать с использованием множественного регрессионного анализа, логистического регрессионного анализа, дискриминантного анализа, многофакторного дисперсионного анализа (MANOVA), факторного анализа (включая как обычный факторный анализ, так и анализ главных компонентов), кластерного анализа, многомерного масштабирования, анализа соответствий, анализа совмещения, канонического анализа, канонической корреляции и моделирования структурными уравнениями.

В соответствии с одним вариантом осуществления оптимальные внегенные геномные локусы маиса далее анализируют с использованием многофакторного анализа данных, такого как анализ главных компонентов (PCA). В настоящем документе дано только краткое описание, больше информации можно обнаружить в H. Martens, T. Naes, Multivariate Calibration, Wiley, N.Y., 1989. PCA оценивает базовую размерность (скрытые переменные) данных и дает обзор доминирующих профилей и основных тенденций в данных. В одном варианте осуществления оптимальные внегенные геномные локусы маиса можно сортировать на кластеры с использованием статистического способа анализа главных компонентов (PCA). PCA представляет собой математический способ с использованием ортогонального преобразования для конвертирования набора наблюдений для возможно коррелированных переменных в набор значений линейно некоррелированных переменных, называемых главными компонентами. Количество главных компонентов меньше или равно количеству исходных переменных. Это преобразование определяют таким образом, что первый главной компонент имеет наибольшую возможную дисперсию (т.п. ответственен за максимальную возможную вариабельность данных), и каждый последующий компонент в свою очередь имеет наиболее высокую возможную дисперсию при условии, что он является ортогональным для предшествующих компонентов (т.е. не коррелированным с ними). Гарантировано, что главные компоненты являются независимыми, если набор данных совокупно обладает нормальным распределением. PCA является чувствительным к относительному масштабированию исходных переменных. Примеры применения PCA для кластеризации набора элементов на основе признаков элементов включают: Ciampitti, I. et al., (2012) Crop Science, 52(6); 2728-2742, Chemometrics: A Practical Guide, Kenneth R. Beebe, Randy J. Pell, и Mary Beth Seasholtz, Wiley-Interscience, 1 edition, 1998, патент США No. 8385662 и Европейский патент No. 2340975.

В соответствии с одним вариантом осуществления анализ главных компонентов (PCA) проводили для 5286 оптимальных геномных локусов маиса с использованием следующих 10 признаков для каждого идентифицированного оптимального геномного локуса маиса:

1. Длина гипометилированной области в окружении оптимальных геномных локусов (OGL) маиса

a. Полногеномные профили метилирования ДНК тканей корней и побегов получали с использованием данных параллельного секвенирования Illumina/Solexa 1G после расщепления геномной ДНК чувствительным к метилированию рестрикционным ферментом (Wang et al., (2009) Genome-Wide and Organ-Specific Landscapes of Epigenetic Modifications and Their Relationships to mRNA and Small RNA Transcriptomes in Maize. Plant Cell 21(4): 1053-1069). Картирование последовательностей в геноме показало присутствие метилирования ДНК в картированных положениях, и для отрезков хромосом без картированных последовательностей показано отсутствие метилирования (гипометилирование). Длину гипометилированной области в окружении каждого из OGL рассчитывали с использованием описанных профилей метилирования. 2. Частота рекомбинации в области 1 млн.п.о. в окружении OGL

a. Для каждого OGL идентифицировали пару маркеров с каждой стороны OGL в пределах окна размером 1 млн.п.о. Частоту рекомбинаций между каждой парой маркеров на хромосоме рассчитывали на основании отношения генетического расстояния между маркерами (в сантиморганах (cM)) к геномному физическому расстоянию между маркерами (в млн.п.о.).

3. Уровень уникальности последовательности OGL

a. Для каждого OGL нуклеотидную последовательность OGL сканировали против генома однодольного растения, например, генома Zea mays c.v. B73, с использованием поиска гомологии на основе BLAST. Поскольку эти последовательности OGL идентифицированы из генома однодольного растения, например, генома Zea mays c.v. B73 genome, первый положительный результат в BLAST, идентифицированный посредством этого поиска, представляет собой саму последовательность OGL. Идентифицировали второй положительный результат BLAST для каждого OGL, и перекрывание выравнивания для положительного результата использовали в качестве меры уникальности последовательности OGL в геноме однодольного растения, такого как Zea mays.

4. Расстояние от OGL до ближайшего соседнего гена

a. Аннотирующую информацию о генах и положение известных генов в геноме однодольных растений, например, в геноме Zea mays c.v. B73, извлекали из известной базы данных геномов однодольных растений, например, Maize Genome database (www.maizegdb.org). Для каждого OGL идентифицировали наиболее близкий аннотированный ген выше или ниже в окружении и измеряли расстояние между последовательностью OGL и геном (в п.о.).

5. GC% в окружении OGL

a. Для каждого OGL анализировали нуклеотидную последовательность для оценки количества присутствующих гуаниновых и цитозиновых оснований. Это количество представлено как процент от длины последовательности каждого OGL и является мерой GC%.

6. Количество генов в окружении OGL в пределах 40 т.п.о.

a. Аннотирующую информацию о генах и локализацию известных генов в геноме однодольных растений, например, в геноме Zea mays c.v. B73, получали из базы данных геномов однодольных растений, например, Maize Genome database (www.maizegdb.org). Для каждого OGL определяли окно размером 40 т.п.о. вокруг OGL и подсчитывали количество аннотированных генов в областях, перекрывающих это окно.

7. Средняя экспрессия генов в окружении OGL в пределах 40 т.п.о.

a. Уровень экспрессии транскриптов генов однодольных растений измеряли посредством анализа данных профилирования транскриптома, полученных для тканей корней и побегов однодольного растения, например, Zea mays c.v. B73, с использованием способа RNAseq. Для каждого OGL, идентифицировали аннотированные гены в геноме однодольного растения, например, в геноме Zea mays c.v. B73, которые присутствовали в окружении OGL в пределах 40 т.п.о. Уровни экспрессии для каждого из генов в этом окне получали из профилей транскриптома и рассчитывали средний уровень экспрессии генов.

8. Уровень занятости нуклеосомами в окружении OGL

a. Определение уровня занятости нуклеосомами для конкретной нуклеотидной последовательности обеспечивает информацию о хромосомных функциях и геномном контексте последовательности. Статистический пакет NuPoP™ обеспечивает удобный для пользователя программный инструмент для прогнозирования занятости нуклеосомами и карты наиболее вероятного расположения нуклеосом для геномных последовательностей любого размера (Xi, L., Fondufe-Mittendor, Y., Xia, L., Flatow, J., Widom, J. and Wang, J.-P., Predicting nucleosome positioning using a duration Hidden Markov Model, BMC Bioinformatics, 2010, doi:10.1186/1471-2105-11-346). Для каждого OGL, нуклеотидную последовательность вводили в программное обеспечение NuPoP™ и вычисляли показатель занятости нуклеосомами.

9. Относительное положение на хромосоме (близость к центромере)

a. Информацию о положении центромеры на каждой из хромосом однодольного растения, например, хромосом маиса, и длине плеч хромосомы извлекали из геномной базы данных однодольных растений, например, Soybean Genome Database (www.soybase.org). Для каждого OGL измеряли геномное расстояние от последовательности OGL до центромеры хромосомы, на которой он расположен (в п.о.). Относительное положение OGL в хромосоме представляют как отношение его геномного расстояния до центромеры к длине конкретного плеча хромосомы, на котором он расположен.

10. Количество OGL в области 1 млн.п.о. в окружении OGL

a. Для каждого OGL, определяют геномное окно размером 1 млн.п.о. вокруг положения OGL и подсчитывают количество OGL в наборе данных для OGL однодольных растений размером 1 т.п.о., геномное положение которых перекрывается с этим окном.

Результаты или значения для оценки признаков и свойств каждого оптимального внегенного геномного локуса маиса далее описаны в таблице 3 примера 2. Полученный набор данных использовали в статистическом методе PCA для кластеризации 5286 идентифицированных оптимальных внегенных геномных локусов маиса на кластеры. В процессе кластеризации после оценки «p» главных компонентов оптимальных геномных локусов, следовало отнесение оптимальных геномных локусов к одному из 32 кластеров в «p»-мерном евклидовом пространстве. Каждую ось «p» делили на «k» интервалов. Оптимальные геномные локусы, отнесенные к одному интервалу, группировали вместе в кластеры. С использованием этого анализа каждую ось PCA делили на два интервала, которые были выбраны на основе предшествующей информации, касающейся количества кластеров, необходимых для экспериментальной валидации. Весь анализ и визуализацию полученных кластеров проводили с использованием программного обеспечения Molecular Operating Environment™ (MOE) от Chemical Computing Group Inc. (Montreal, Quebec, Canada). Способ PCA использовали для кластеризации набора из 5286 оптимальных геномных локусов маиса в 32 отдельных кластера на основе их характерных значений, описанных выше.

В ходе процесса PCA получено пять главных компонентов (PC), причем наилучшие три PC включали приблизительно 90% от всех вариаций в наборе данных (таблица 4). Эти три PC использовали для графического представления 32 кластеров в трехмерном графике (см. фиг. 3). После завершения процесса кластеризации из каждого кластера выбирали один репрезентативный оптимальный геномный локус. Это осуществляли посредством выбора оптимального геномного локуса внутри каждого кластера, который был наиболее близким к центроиду этого кластера, с использованием вычислительных способов (таблица 4). Положения на хромосомах 32 репрезентативных геномных локусов являются равномерно распределенными на хромосомах маиса, как показано на фиг. 4.

В одном варианте осуществления представлена выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса, выбранная из любого кластера, описанного в таблице 6 из примера 2. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 1. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 2. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 3. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 4. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 5. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 6. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 7. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 8. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 9. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 10. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 11. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 12. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 13. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 14. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 15. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 16. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 17. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 18. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 19. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 20. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 21. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 22. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 23. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 24. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 25. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 26. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 27. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 28. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 29. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 30. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 31. В одном из вариантов осуществления выделенная или очищенная последовательность оптимальных внегенных геномных локусов маиса представляет собой геномную последовательность, выбранную из кластера 32.

В соответствии с одним из вариантов осуществления представлены модифицированные оптимальные внегенные геномные локусы маиса, где оптимальные внегенные геномные локусы маиса модифицированы и содержат одну или несколько нуклеотидных замен, делеций или вставок. В одном из вариантов осуществления оптимальные внегенные геномные локусы маиса модифицированы посредством вставки представляющей интерес ДНК, необязательно, сопровождаемой дополнительными нуклеотидными дупликациями, делециями или вставками последовательностей геномных локусов.

В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из любого кластера, описанного в таблице 6 из примера 2. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 2. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 3. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 4. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 5. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 6. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 7. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 8. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 9. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 10. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 11. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 12. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 13. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 14. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 15. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 16. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 17. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 18. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 19. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 20. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 21. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 22. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 23. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 24. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 25. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 26. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 27. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 28. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 29. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 30. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 31. В одном из вариантов осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 32.

В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или 31. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 или 29. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 или 28. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 или 27. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 или 26. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, или 25. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, или 24. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 или 23. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 или 22. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 или 21. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 или 19. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 или 18. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 или 17. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 или 16. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 или 15. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 или 14. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 или 13. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 или 12. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 или 11. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, или 9. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7 или 8. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6 или 7. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, или 6. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4 или 5. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3 или 4. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2 или 3. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1 или 2.

В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или 32.

В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 25, 26, 27, 28, 29, 30, 31 или 32.В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 32.

В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, или 32.

В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 или 27. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 9, 10, 11, 12, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 15, 16, 17, 18, 25, 26, 27, 28, 29, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 21, 22, 23, 24, 30, 31 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 или 32. В дополнительном варианте осуществления оптимальный внегенный геномный локус маиса, подлежащий модификации, представляет собой геномную последовательность, выбранную из кластера 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 или 31.

В одном из вариантов осуществления оптимальные внегенные геномные локусы маиса выбраны из геномных последовательностей loci_59517_G1 (SEQ ID NO: 1), loci_159525_G1 (SEQ ID NO: 199), loci_9811_G1 (SEQ ID NO: 365), loci_7507_G1 (SEQ ID NO: 543), loci_178978_G1 (SEQ ID NO: 687), loci_285621_G1 (SEQ ID NO: 875), loci_221721_G1 (SEQ ID NO: 1089), loci_83937_G1 (SEQ ID NO: 1233), loci_37146_G1 (SEQ ID NO: 1369), loci_156393_G1 (SEQ ID NO: 1571), loci_343678_G1 (SEQ ID NO: 1795), loci_60209_G1 (SEQ ID NO: 1980), loci_282323_G1 (SEQ ID NO: 2171), loci_64542_G1 (SEQ ID NO: 2349), loci_162531_G1 (SEQ ID NO: 2557), loci_337001_G1 (SEQ ID NO: 2693), loci_66202_G1 (SEQ ID NO: 2855), loci_185454_G1 (SEQ ID NO: 3004), loci_239863_G1 (SEQ ID NO: 3151), loci_257541_G1 (SEQ ID NO: 3289), loci_217939_G1 (SEQ ID NO: 3455), loci_326869_G1 (SEQ ID NO: 3586), loci_31710_G1 (SEQ ID NO: 3731), loci_81941_G1 (SEQ ID NO: 3849), loci_198387_G1 (SEQ ID NO: 3981), loci_197372_G1 (SEQ ID NO: 4192), loci_106202_G1 (SEQ ID NO: 4401), loci_232228_G1 (SEQ ID NO: 4529), loci_244324_G1 (SEQ ID NO: 4646), loci_157315_G1 (SEQ ID NO: 4836), loci_137489_G1 (SEQ ID NO: 5046) и loci_31764_G1 (SEQ ID NO: 5162).

В одном из вариантов осуществления оптимальные внегенные геномные локусы маиса выбраны из геномных последовательностей loci_59517_G1 (SEQ ID NO: 1), loci_25001_G1 (SEQ ID NO: 100), loci_112632_G1 (SEQ ID NO: 203), loci_28905_G1 (SEQ ID NO: 295), loci_129164_G1 (SEQ ID NO: 384), loci_204726_G1 (SEQ ID NO: 424), loci_2425_G1 (SEQ ID NO: 451), loci_122036_G1 (SEQ ID NO: 547), loci_5735_G1 (SEQ ID NO: 671), loci_178978_G1 (SEQ ID NO: 687), loci_288388_G1 (SEQ ID NO: 781), loci_60310_G1 (SEQ ID NO: 843), loci_285621_G1 (SEQ ID NO: 875), loci_243330_G1 (SEQ ID NO: 967), loci_127038_G1 (SEQ ID NO: 1107), loci_262784_G1 (SEQ ID NO: 1147), loci_344662_G1 (SEQ ID NO: 1190), loci_153894_G1 (SEQ ID NO: 1252), loci_28771_G1 (SEQ ID NO: 1300), loci_1098_G1 (SEQ ID NO: 1371), loci_97772_G1 (SEQ ID NO: 1569), loci_156393_G1 (SEQ ID NO: 1571), loci_236662_G1 (SEQ ID NO: 1663), loci_139485_G1 (SEQ ID NO: 1822), loci_301175_G1 (SEQ ID NO: 1906), loci_152337_G1 (SEQ ID NO: 2003), loci_202616_G1 (SEQ ID NO: 2027), loci_203704_G1 (SEQ ID NO: 2033), loci_282323_G1 (SEQ ID NO: 2171), loci_262782_G1 (SEQ ID NO: 2256), loci_64542_G1 (SEQ ID NO: 2349), loci_236455_G1 (SEQ ID NO: 2428), loci_162531_G1 (SEQ ID NO: 2557), loci_301774_G1 (SEQ ID NO: 2632), loci_344663_G1 (SEQ ID NO: 2649), loci_337001_G1 (SEQ ID NO: 2693), loci_204637_G1 (SEQ ID NO: 2731), loci_238100_G1 (SEQ ID NO: 2753), loci_66202_G1 (SEQ ID NO: 2855), loci_264359_G1 (SEQ ID NO: 2934), loci_282653_G1 (SEQ ID NO: 3086), loci_80282_G1 (SEQ ID NO: 3139), loci_291068_G1 (SEQ ID NO: 3230), loci_56395_G1 (SEQ ID NO: 3270), loci_200497_G1 (SEQ ID NO: 3334), loci_232222_G1 (SEQ ID NO: 3357), loci_43577_G1 (SEQ ID NO: 3428), loci_5607_G1 (SEQ ID NO: 3435), loci_114664_G1 (SEQ ID NO: 3457), loci_228254_G1 (SEQ ID NO: 3497), loci_120993_G1 (SEQ ID NO: 3593), loci_53137_G1 (SEQ ID NO: 3702), loci_31710_G1 (SEQ ID NO: 3731), loci_344664_G1 (SEQ ID NO: 3815), loci_81941_G1 (SEQ ID NO: 3849), loci_321514_G1 (SEQ ID NO: 3939), loci_198387_G1 (SEQ ID NO: 3981), loci_301180_G1 (SEQ ID NO: 4113), loci_197372_G1 (SEQ ID NO: 4192), loci_348776_G1 (SEQ ID NO: 4350), loci_244439_G1 (SEQ ID NO: 4458), loci_348258_G1 (SEQ ID NO: 4487), loci_232228_G1 (SEQ ID NO: 4529), loci_322501_G1 (SEQ ID NO: 4610), loci_244324_G1 (SEQ ID NO: 4646), loci_97232_G1 (SEQ ID NO: 4832), loci_157315_G1 (SEQ ID NO: 4836), loci_282499_G1 (SEQ ID NO: 4953), loci_155031_G1 (SEQ ID NO: 5060), loci_301773_G1 (SEQ ID NO: 5110), loci_283161_G1 (SEQ ID NO:5213), loci_55524_G1 (SEQ ID NO: 5264), loci_127268_G1 (SEQ ID NO:2709), loci_136086_G1 (SEQ ID NO: 4425), loci_232484_G1 (SEQ ID NO: 2053), loci_3733_G1 (SEQ ID NO:1923), loci_168286_G1 (SEQ ID NO:571), loci_128078_G1 (SEQ ID NO:560), loci_265551_G1 (SEQ ID NO:463) и loci_137693_G1 (SEQ ID NO:387).

В одном из вариантов осуществления в оптимальные внегенные геномные локусы маиса нацеливают представляющую интерес ДНК, где представляющую интерес ДНК интегрируют внутри или вблизи участков-мишеней для нуклеаз с цинковыми пальцами. В соответствии с одним из вариантов осуществления, иллюстративные участки-мишени для цинковых пальцев из выбранных оптимальных геномных локусов маиса представлены в таблице 8. В соответствии с одним из вариантов осуществления, интеграция представляющей интерес ДНК происходит внутри или вблизи иллюстративных участков-мишеней: 111879ZFN5 и 111879ZFN7; 111885ZFN1 и 111885ZFN2; SIG115737_31v1 и SIG115737_32v1; SIG120523_11v1 и SIG120523_12v1; SIG115246_5 и SIG115246_6; SIG115636_1v1 и SIG115636_2v1; SIG120417_11v1 и SIG120417_12v1; SIG120621_15v1 и SIG120621_16v1; SIG12078_11v1 и SIG12078_12v1; и, SIG157315_1v1 и SIG157315_2v1, ZFN_ _1 и ZFN_binding_2, ZFN_binding_3 и ZFN_binding_4, ZFN_binding_5 и ZFN_binding_6, ZFN_binding_7 и ZFN_binding_8, ZFN_binding_9 и ZFN_binding_10, ZFN_binding_11 и ZFN_binding_12, ZFN_binding_13 и ZFN_binding_14, ZFN_binding_15 и ZFN_binding_16, ZFN_binding_17 и ZFN_binding_18, ZFN_binding_19 и ZFN_binding_20, ZFN_binding_21 и ZFN_binding_22, ZFN_binding_23 и ZFN_binding_24, ZFN_binding_25 и ZFN_binding_26, ZFN_binding_27 и ZFN_binding_28, ZFN_binding_29 и ZFN_binding_30, ZFN_binding_31 и ZFN_binding_32, ZFN_binding_33 и ZFN_binding_34, ZFN_binding_35 и ZFN_binding_36, ZFN_binding_37 и ZFN_binding_38, ZFN_binding_39 и ZFN_binding_40, ZFN_binding_41 и ZFN_binding_42, ZFN_binding_43 и ZFN_binding_44, ZFN_binding_45 и ZFN_binding_46, ZFN_binding_47 и ZFN_binding_48, ZFN_binding_49 и ZFN_binding_50, ZFN_binding_51 и ZFN_binding_52, ZFN_binding_53 и ZFN_binding_54, ZFN_binding_55 и ZFN_binding_56, ZFN_binding_57 и ZFN_binding_58, ZFN_binding_59 и ZFN_binding_60, ZFN_binding_61 и ZFN_binding_62, ZFN_binding_63 и ZFN_binding_64, ZFN_binding_65 и ZFN_binding_66, ZFN_binding_67 и ZFN_binding_68, ZFN_binding_69 и ZFN_binding_70, ZFN_binding_71 и ZFN_binding_72, ZFN_binding_73 и ZFN_binding_74, ZFN_binding_75 и ZFN_binding_76, ZFN_binding_77 и ZFN_binding_78, ZFN_binding_79 и ZFN_binding_80, ZFN_binding_81 и ZFN_binding_82, ZFN_binding_83 и ZFN_binding_84, ZFN_binding_85 и ZFN_binding_86, ZFN_binding_87 и ZFN_binding_88, ZFN_binding_89 и ZFN_binding_90, ZFN_binding_91 и ZFN_binding_92, ZFN_binding_93 и ZFN_binding_94, ZFN_binding_95 и ZFN_binding_96, ZFN_binding_97 и ZFN_binding_98, ZFN_binding_99 и ZFN_binding_100, ZFN_binding_101 и ZFN_binding_102, ZFN_binding_103 и ZFN_binding_104, ZFN_binding_105 и ZFN_binding_106, ZFN_binding_107 и ZFN_binding_108, ZFN_binding_109 и ZFN_binding_110, ZFN_binding_111 и ZFN_binding_112, ZFN_binding_113 и ZFN_binding_114, ZFN_binding_115 и ZFN_binding_116, ZFN_binding_117 и ZFN_binding_118, ZFN_binding_119 и ZFN_binding_120, ZFN_binding_121 и ZFN_binding_122, ZFN_binding_123 и ZFN_binding_124, ZFN_binding_125 и ZFN_binding_126, ZFN_binding_127 и ZFN_binding_128, ZFN_binding_129 и ZFN_binding_130, ZFN_binding_131 и ZFN_binding_132.

В соответствии с одним из вариантов осуществления нуклеаза с цинковыми пальцами связывается с участком-мишенью цинковых пальцев и расщепляет уникальные геномные полинуклеотидные участки-мишени маиса, при этом представляющая интерес ДНК интегрирует внутри или вблизи геномных полинуклеотидных участков-мишеней маиса. В одном варианте осуществления интеграция представляющей интерес ДНК в участок-мишень цинковых пальцев может приводить к реорганизации. В соответствии с одним из вариантов осуществления, реорганизация может включать делеции, вставки, инверсии и повторы. В одном варианте осуществления интеграция представляющей интерес ДНК происходит вблизи участка-мишени цинковых пальцев. В соответствии с одним аспектом этого варианта осуществления, интеграция ДНК происходит вблизи участка-мишени цинковых пальцев, и может происходить в пределах 1,5 т.п.о., 1,25 т.п.о., 1,0 т.п.о., 0,75 т.п.о., 0,5 т.п.о. или 0,25 т.п.о. от участка-мишени цинковых пальцев. Вставка в геномную область вблизи участка-мишени цинковых пальцев известна в данной области, см. публикацию Патента США No. 2010/0257638 A1 (полное содержание которого включено в настоящий документ в качестве ссылки).

В соответствии с одним из вариантов осуществления выбранная внегенная последовательность обладает следующими характеристиками:

a) внегенная последовательность не имеет более 1% метилирования ДНК в последовательности;

b) внегенная последовательность обладает значением относительного расположения с соотношением геномных расстояний от центромеры хромосомы однодольных растений, например, центромеры хромосомы маиса, от 0,0984 до 0,973;

c) внегенная последовательность обладает процентным содержанием гуанина/цитозина в диапазоне от 34,38 до 61,2%; и

d) внегенная последовательность имеет длину от приблизительно 1 т.п.о. до приблизительно 4,9 т.п.о.

II. Рекомбинантные производные идентифицированных оптимальных внегенных геномных локусов маиса

В соответствии с одним вариантом осуществления, после идентификации геномных локусов однодольного растения, такого как маис, в качестве в высокой степени желательного положения для вставки полинуклеотидных донорных последовательностей, одну или несколько представляющих интерес нуклеиновых кислот можно вставлять в идентифицированный геномный локус. В одном варианте осуществления представляющая интерес нуклеиновая кислота содержит экзогенные последовательности генов или другие желательные полинуклеотидные донорные последовательности. В другом варианте осуществления после идентификации геномных локусов однодольного растения, такого как маис, в качестве в высокой степени желательного положения для вставки полинуклеотидных донорных последовательностей, одну или несколько представляющих интерес нуклеиновых кислот из оптимальных внегенных геномных локусов маиса необязательно можно делетировать, вырезать или удалять с последующей интеграцией представляющей интерес ДНК в идентифицированный геномный локус. В одном варианте осуществления вставка представляющей интерес нуклеиновой кислоты в оптимальные внегенные геномные локусы маиса, включает удаление, делецию или вырезание экзогенных последовательностей генов или других желательных полинуклеотидных донорных последовательностей.

Кроме того, настоящее изобретение относится к способам и композициям для направленной интеграции в выбранный геномный локус маиса с использованием ZFN и полинуклеотидной донорной конструкции. В способах вставки представляющей интерес последовательности нуклеиновой кислоты в оптимальные внегенные геномные локусы маиса, если не указано иначе, используют общепринятые технологии молекулярной биологии, биохимии, анализа структуры хроматина, культивирования клеток, рекомбинантной ДНК и родственных областей, известных в данной области. Эти способы полностью описаны в литературе. См., например, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, второе издание, Cold Spring Harbor Laboratory Press, 1989, и третье издание 2001 года; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987, и периодические переиздания; серию METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolfe, CHROMATIN STRUCTURE AND FUNCTION, третье издание, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, «Chromatin» (P. M. Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego, 1999; и METHODS IN MOLECULAR BIOLOGY, Vol. 119, «Chromatin Protocols» (P. B. Becker, ed.) Humana Press, Totowa, 1999.

Способы вставки нуклеиновых кислот в геном маиса

В соответствии с настоящим изобретением можно использовать любые хорошо известные способы введения полинуклеотидных донорных последовательностей и последовательностей нуклеаз в качестве конструкции ДНК в клетки-хозяева. Они включают применение трансфекции с фосфатом кальция, способ с полибреном, слияние протопластов, способ с PEG, электропорацию, ультразвуковые способы (например, сонопорацию), способ с липосомами, микроинъекцию, способ с голой ДНК, способ с плазмидными векторами, способ с вирусными векторами, как эписомными, так и интегрирующими, и любой из других хорошо известных способов введения клонированной геномной ДНК, кДНК, синтетической ДНК или другого чужеродного генетического материала в клетку-хозяина (см., например, Sambrook et al., выше). Необходимо только, чтобы конкретный способ вставки нуклеиновой кислоты являлся способным успешно вводить по меньшей мере один ген в клетку-хозяина, способную экспрессировать выбранный белок.

Как отмечено выше, конструкции ДНК можно вводить в геном желательного вида растения различными общепринятыми способами. Обзор таких способов см., например, в Weissbach & Weissbach Methods for Plant Molecular Biology (1988, Academic Press, N.Y.) Section VIII, pp. 421-463; и Grierson & Corey, Plant Molecular Biology (1988, 2d Ed.), Blackie, London, Ch. 7-9. Конструкцию ДНК можно вносить напрямую в геномную ДНК клетки растения с использованием таких способов, как электропорация и микроинъекция протопластов клеток растений, посредством встряхивания с волокнами из карбида кремния (см., например, Патенты США 5302523 и 5464765), или конструкции ДНК можно вводить напрямую в ткань растения с использованием биолистических способов, таких как бомбардировка частицами с ДНК (см., например, Klein et al. (1987) Nature 327:70-73). Альтернативно, конструкцию ДНК можно вводить в клетку растений посредством трансформации наночастицами (см., например, публикацию Патента США No. 20090104700, полное содержание которой включена в настоящее описание в качестве ссылки). Альтернативно, конструкции ДНК можно комбинировать с подходящими пограничными/фланкирующими областями T-ДНК и вставлять в общепринятый вектор-хозяин Agrobacterium tumefaciens. Способы опосредуемой Agrobacterium tumefaciens трансформации, включая обезоруживание и применение бинарных векторов, подробно описаны в научной литературе. См., например Horsch et al. (1984) Science 233:496-498, и Fraley et al. (1983) Proc. Nat'l. Acad. Sci. USA 80:4803.

Кроме того, перенос генов можно осуществлять с использованием не относящихся к Agrobacterium бактерий, или вирусов, таких как Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, вирус X картофеля, вирус мозаики цветной капусты и вирус мозаики прожилок маниоки, и/или вирус табачной мозаики, См., например, Chung et al. (2006) Trends Plant Sci. 11(1):1-4. Функции вирулентности хозяина Agrobacterium tumefaciens могут направлять вставку T-цепи, содержащей конструкцию и соседний маркер, в ДНК клетки растения, когда клетка растения инфицирована бактериями с использованием бинарного вектора T-ДНК (Bevan (1984) Nuc. Acid Res. 12:8711-8721) или методики совместного культивирования (Horsch et al. (1985) Science 227:1229-1231). Как правило, систему трансформации Agrobacterium используют для конструирования двудольных растений (Bevan et al. (1982) Ann. Rev. Genet 16:357-384; Rogers et al. (1986) Methods Enzymol. 118:627-641). Систему трансформации Agrobacterium можно также использовать для трансформации, так же как для переноса ДНК в однодольные растения и клетки растений. См. патент США No. 5591616; Hernalsteen et al. (1984) EMBO J 3:3039-3041; Hooykass-Van Slogteren et al. (1984) Nature 311:763-764; Grimsley et al. (1987) Nature 325:1677-179; Boulton et al. (1989) Plant Mol. Biol. 12:31-40; и Gould et al. (1991) Plant Physiol. 95:426-434.

Альтернативные способы переноса и трансформации генов включают, но без ограничения, трансформацию протопластов посредством опосредуемого кальцием, полиэтиленгликолем (PEG) или электропорацией захвата голой ДНК (см. Paszkowski et al. (1984) EMBO J 3:2717-2722, Potrykus et al. (1985) Molec. Gen. Genet. 199:169-177; Fromm et al. (1985) Proc. Nat. Acad. Sci. USA 82:5824-5828; и Shimamoto (1989) Nature 338:274-276), и посредством электропорации тканей растений (D'Halluin et al. (1992) Plant Cell 4:1495-1505). Дополнительные способы трансформации клеток растений включают микроинъекцию, опосредуемый карбидом кремния захват ДНК (Kaeppler et al. (1990) Plant Cell Reporter 9:415-418) и бомбардировку микрочастицами (см. Klein et al. (1988) Proc. Nat. Acad. Sci. USA 85:4305-4309; и Gordon-Kamm et al. (1990) Plant Cell 2:603-618).

В одном варианте осуществления представляющая интерес нуклеиновая кислота, введенная в клетку-хозяина для направленной вставки в геном, содержит гомологичные фланкирующие последовательности на одном или обоих концах представляющей интерес нацеленной нуклеиновой кислоты. В таком варианте осуществления гомологичные фланкирующие последовательности обладают достаточными уровнями идентичности последовательности с геномной последовательностью однодольного растения, например, геномной последовательностью маиса, для поддержания гомологичной рекомбинации между ней и геномной последовательностью, гомологией с которой она обладает. Идентичность последовательностей из приблизительно 25, 50, 100, 200, 500, 750, 1000, 1500 или 2000 нуклеотидов или более, лежащая в диапазоне от 70% до 100%, между донорной и геномной последовательностями (или из любого целого числа между 10 и 200 нуклеотидами, или более) может способствовать гомологичной рекомбинации между ними.

В другом варианте осуществления представляющая интерес нацеленная нуклеиновая кислота лишена гомологичных фланкирующих последовательностей и представляющая интерес нацеленная нуклеиновая кислота разделяет от низких до очень низких уровней идентичности последовательности с геномной последовательностью.

В других вариантах осуществления направленной рекомбинации, и/или замены, и/или изменения последовательности в представляющей интерес области клеточного хроматина, хромосомную последовательность изменяют посредством гомологичной рекомбинации с экзогенной «донорной» нуклеотидной последовательностью. Такую гомологичную рекомбинацию стимулируются присутствием двухцепочечного разрыва в клеточном хроматине, если присутствуют последовательности, гомологичные области разрыва. Двухцепочечные разрывы в клеточном хроматине также могут стимулировать клеточные механизмы соединения негомологичных концов. В любых из способов, описанных в настоящем документе, первая нуклеотидная последовательность («донорная последовательность») может содержать последовательности, которые являются гомологичными, но не идентичными, геномным последовательностям в представляющей интерес области, тем самым стимулируя гомологичную рекомбинацию для вставки неидентичной последовательности в представляющую интерес область. Таким образом, в определенных вариантах осуществления участки донорной последовательности, гомологичные последовательностям в представляющей интерес области, обладают идентичностью последовательности приблизительно от 80, 85, 90, 95, 97,5 до 99% (или любого целого числа между ними) с геномной последовательностью, которую заменяют. В других вариантах осуществления гомология между донорной и геномной последовательностью превышает 99%, например, если только 1 нуклеотид отличается между донорной и геномной последовательностями из более чем 100 последовательных пар оснований.

В определенных случаях негомологичная часть донорной последовательности может содержать последовательности, не присутствующие в представляющей интерес области, так что в представляющую интерес область вносят новые последовательности. В этих случаях негомологичная последовательность, как правило, фланкирована последовательностями из 50-2000 пар оснований (или любого целого числа между ними) или любым количеством пар оснований, превышающим 2000, которые гомологичны или идентичны последовательностям в представляющей интерес области. В других вариантах осуществления донорная последовательность является негомологичной первой последовательности, и ее вставляют в геном посредством механизмов негомологичной рекомбинации.

В соответствии с одним вариантом осуществлением нуклеазу с цинковыми пальцами (ZFN) используют для внесения двухцепочечного разрыва в заданный геномный локус для облегчения вставки представляющей интерес нуклеиновой кислоты. Выбор участка-мишени в выбранном геномном локусе для связывания доменом с цинковыми пальцами можно проводить, например, в соответствии со способами, описанными в Патенте США 6453242, содержание которого включено в настоящее описание, где также описаны способы конструирования белков с цинковыми пальцами (ZFP) для связывания с выбранной последовательностью. Специалистам в данной области очевидно, что для выбора участка-мишени можно использовать также простое визуальное исследование нуклеотидной последовательности. Таким образом, любые средства для выбора участка-мишени можно использовать в способах, описанных в настоящем документе.

Для ДНК-связывающих доменов ZFP участки-мишени обычно состоят из множеств соседних субучастков-мишеней. Субучасток-мишень относится к последовательности, обычно либо к нуклеотидному триплету, либо к нуклеотидному квадруплету, который может перекрываться на один нуклеотид с соседним квадруплетом, связываемым индивидуальным цинковым пальцем. См., например, WO 02/077227, содержание которой включено в настоящее описание в качестве ссылки. Участок-мишень, как правило, имеет длину по меньшей мере 9 нуклеотидов и, соответственно, связывается связывающим доменом с цинковыми пальцами, содержащим по меньшей мере три цинковых пальца. Однако также является возможным связывание, например, связывающего домена с 4 пальцами с участком-мишенью из 12 нуклеотидов, связывающего домена с 5 пальцами с участком-мишенью из 15 нуклеотидов, или связывающего домена с 6 пальцами с участком-мишенью из 18-нуклеотидов. Очевидно, что настоящее описание предусматривает также связывание более крупных связывающих доменов (например, с 7, 8, 9 пальцами и более) с более длинными участками-мишенями.

В соответствии с одним вариантом осуществления, участок-мишень не обязательно представляет собой участок из множества тройных нуклеотидов. В случаях, когда происходят перекрестные взаимодействия цепей (см., например, патент США 6453242 и WO 02/077227), один или несколько индивидуальных цинковых пальцев связывающего домена с множеством цинковых пальцев могут связываться с перекрывающимися квадруплетными субучастками. В результате белок с тремя цинковыми пальцами может связывать последовательность из 10 нуклеотидов, где десятый нуклеотид является частью квадруплета, связываемого концевым пальцем, белок с четырьмя пальцами может связывать последовательность из 13 нуклеотидов, где тринадцатый нуклеотид является частью квадруплета, связываемого концевым пальцем, и т.д.

Длина и характер аминокислотных линкерных последовательностей между индивидуальными цинковыми пальцами в связывающем домене с множеством пальцев также влияют на связывание с последовательностью-мишенью. Например, присутствие так называемого «неканонического линкера», «длинного линкера» или «структурированного линкера» между соседними цинковыми пальцами в связывающем домене с множеством пальцев может позволить этим пальцам связывать субучастки, которые не являются непосредственно соседними. Неограничивающие примеры таких линкеров описаны, например, в патентах США No. 6479626 и WO 01/53480. Соответственно, один или несколько субучастков в участке-мишени связывающего домена с цинковыми пальцами могут быть отделены друг от друга 1, 2, 3, 4, 5 или более нуклеотидами. Одним из неограничивающих примеров является связывающий домен с четырьмя пальцами, который связывается с участком-мишенью из 13 нуклеотидов, содержащим, последовательно, два соседних субучастка из 3-нуклеотидов, промежуточный нуклеотид и два соседних триплетных субучастка.

В то время как ДНК-связывающие полипептиды, идентифицированные в белках, существующих в природе, как правило, связываются с определенной нуклеотидной последовательностью или мотивом (например, консенсусной последовательностью узнавания), в данной области существуют и известны способы модификации многих таких ДНК-связывающих полипептидов так, чтобы они узнавали отличающуюся нуклеотидную последовательность или мотив. ДНК-связывающие полипептиды включают, в качестве неограничивающих примеров: ДНК-связывающие домены с цинковыми пальцами; лейциновые молнии; ДНК-связывающие домены UPA; GAL4; TAL; LexA; репрессор Tet; LacR и рецептор стероидных гормонов.

В некоторых примерах ДНК-связывающий полипептид представляет собой цинковый палец. Индивидуальные мотивы цинковых пальцев можно разрабатывать для нацеливания и специфического связывания с любым из большого диапазона участков ДНК. Канонические полипептиды с цинковыми пальцами Cys2His2 (а также неканонические Cys3His) связывают ДНК путем вставки α-спирали в большую бороздку двойной спирали ДНК-мишени. Узнавание ДНК цинковым пальцем является модульным; каждый палец контактирует в основном с тремя последовательно расположенными парами оснований в мишени, и узнавание опосредуют несколько ключевых остатков в полипептиде. Посредством включения нескольких ДНК-связывающих доменов с цинковыми пальцами в нацеливающую эндонуклеазу, специфичность связывания ДНК у нацеливающей эндонуклеазы можно дополнительно увеличивать (и, таким образом, также можно увеличивать специфичность любых сообщаемых ею эффектов регуляции генов). См., например, Urnov et al. (2005) Nature 435:646-51. Таким образом, один или несколько ДНК-связывающих полипептидов с цинковыми пальцами можно конструировать и использовать таким образом, чтобы нацеливающая эндонуклеаза, введенная в клетку-хозяина, взаимодействовала с последовательностью ДНК, которая является уникальной в геноме клетки-хозяина. Предпочтительно, белок с цинковыми пальцами не является встречающимся в природе, а является сконструированным для связывания выбранного участка-мишени. См., например, Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416; Патенты США No. 6453242; 6534261; 6599692; 6503717; 6689558; 7030215; 6794136; 7067317; 7262054; 7070934; 7361635; 7253273; и публикации патентов США No. 2005/0064474; 2007/0218528; 2005/0267061, полное содержание всех из которых включено в настоящее описание в качестве ссылки.

Сконструированный связывающий домен с цинковыми пальцами может обладать новой специфичностью связывания по сравнению со встречающимся в природе белком с цинковыми пальцами. Способы конструирования включают, но без ограничения, рациональный дизайн и различные типы отбора. Рациональный дизайн включает, например, использование баз данных, содержащих триплетные (или квадруплетные) нуклеотидные последовательности и индивидуальные аминокислотные последовательности цинковых пальцев, в которых каждая триплетная или квадруплетная нуклеотидная последовательность ассоциирована с одной или несколькими аминокислотными последовательностями цинковых пальцев, которые связывают конкретную триплетную или квадруплетную последовательность. См., например, Патенты США того же заявителя 6453242 и 6534261, полное содержание которых включено в настоящее описание в качестве ссылки.

Альтернативно ДНК-связывающий домен может происходить из нуклеазы. Например, известны последовательности узнавания эндонуклеаз хоминга и мегануклеаз, таких как I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII и I-TevIII,. См. также Патент США No. 5420032; Патент США No. 6833252; Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al. (1989) Gene 82:115-118; Perler et al. (1994) Nucleic Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimble et al. (1996) J. Mol. Biol. 263:163-180; Argast et al. (1998) J. Mol. Biol. 280:345-353 и каталог New England Biolabs. Кроме того, специфичность связывания ДНК эндонуклеазами хоминга и мегануклеазами можно конструировать для связывания с неприродными участками-мишенями. См., например, Chevalier et al. (2002) Molec. Cell 10:895-905; Epinat et al. (2003) Nucleic Acids Res. 31:2952-2962; Ashworth et al. (2006) Nature 441:656-659; Paques et al. (2007) Current Gene Therapy 7:49-66; публикацию патента США No. 20070117128.

В качестве другой альтернативы, ДНК-связывающий домен может происходить из белка с лейциновой молнией. Лейциновые молнии представляют собой класс белков, вовлеченных в белок-белковые взаимодействия во многих эукариотических регуляторных белках, которые являются важными факторами транскрипции, ассоциированными с экспрессией генов. Лейциновая молния относится к общему структурному мотиву, разделяемому этими факторами транскрипции среди нескольких царств, включая животных, растения, дрожжи и т.д. Лейциновая молния образована двумя полипептидами (гомодимер или гетеродимер), которые связываются с конкретными последовательностями ДНК, где остатки лейцина равномерно распределены в α-спирали, так что остатки лейцина двух полипептидов оканчиваются на одной и той же поверхности спирали. Специфичность связывания ДНК лейциновых молний можно использовать в ДНК-связывающих доменах, описанных в настоящем документе.

В некоторых вариантах осуществления ДНК-связывающий домен представляет собой сконструированный домен из эффектора TAL, происходящего из патогена растений Xanthomonas (см., Miller et al. (2011) Nature Biotechnology 29(2):143-8; Boch et al, (2009) Science 29 Oct 2009 (10.1 126/science.117881) и Moscou and Bogdanove, (2009) Science 29 Oct 2009 (10.1 126/science.1178817; и публикации патентов США No. 20110239315, 20110145940 и 20110301073).

Система нуклеаз CRISPR (короткие палиндромные повторы, расположенные кластерами, равномерно удаленными друг от друга)/Cas (ассоциированная с CRISPR) представляет собой недавно сконструированную систему нуклеаз на основе бактериальной системы, которую можно использовать для геномной инженерии. Оно основана на части адаптивного иммунного ответа многих бактерий и архей. Когда вирус или плазмида проникает в бактерию, фрагменты проникающей ДНК конвертируются в РНК CRISPR (crRNA) посредством «иммунного» ответа. Затем эта crRNA связывается через область частичной комплементарности с другим типом РНК, называемым tracrRNA, направляя нуклеазу Cas9 в область, гомологичную crRNA в ДНК-мишени, называемую «протоспейсером». Cas9 расщепляет ДНК с образованием тупых концов в DSB в участках, определяемых 20-нуклеотидной направляющей последовательностью, содержащейся в транскрипте crRNA. Для сайт-специфического узнавания и расщепления ДНК Cas9 требует как crRNA, так и tracrRNA. Эта система в настоящее время сконструирована так, что crRNA и tracrRNA могут быть объединены в одну молекулу («единую направляющую РНК»), и эквивалентную crRNA часть единой направляющей РНК можно конструировать так, чтобы она направляла нуклеазу Cas9 для нацеливания на любую желательную последовательность (см. Jinek et al (2012) Science 337, p. 816-821, Jinek et al, (2013), eLife 2:e00471, и David Segal, (2013) eLife 2:e00563). Таким образом, систему CRISPR/Cas можно конструировать для внесения двухцепочечного разрыва DSB) в желательную мишень в геноме, и на репарацию DSB можно влиять посредством использования ингибиторов репарации для обеспечения увеличения репарации с пониженной точностью.

В определенных вариантах осуществления белок Cas может представлять собой «функциональное производное» встречающегося в природе белка Cas. «Функциональное производное» полипептида с нативной последовательностью представляет собой соединение, имеющее качественное биологическое свойство, общее с полипептидом с нативной последовательностью. «Функциональные производные» включают, но без ограничения, фрагменты нативной последовательности, и производные полипептида с нативной последовательностью и его фрагменты при условии, что они обладают биологической активностью, общей с соответствующим полипептидом с нативной последовательностью. Биологическая активность, предусматриваемая в настоящем документе, представляет собой способность функционального производного гидролизовать ДНК-субстрат на фрагменты. Термин «производное» охватывает как варианты аминокислотной последовательности полипептида, его ковалентные модификации, так и слитые конструкции. Подходящие производные полипептида Cas или его фрагмента включают, но без ограничения, мутанты, слитые конструкции, ковалентные модификации белка Cas или его фрагмента. Белок Cas, который включает белок Cas или его фрагмент, так же как производные белка Cas или его фрагмента, можно получать из клетки или синтезировать химически или посредством комбинирования этих двух способов. Клетка может представлять собой клетку, которая естественным образом продуцирует белок Cas, или клетку, которая естественным образом продуцирует белок Cas и модифицирована способами инженерии для продукции эндогенного белка Cas на более высоком уровне экспрессии или для продукции белка Cas с экзогенно введенной нуклеиновой кислоты, которая кодирует Cas, который является таким же или отличается от эндогенного Cas. В некоторых случаях клетка естественным образом не продуцирует белок Cas и является генетически модифицированной для продукции белка Cas. Белок Cas функционирует в клетках млекопитающих (и предположительно в клетках растений) посредством совместной экспрессии нуклеазы Cas с направляющей РНК. Для облегчения опосредуемого Cas расщепления генома можно использовать две формы направляющих РНК, как описано в Le Cong, F., et al., (2013) Science 339(6121):819-823.

В других вариантах осуществления ДНК-связывающий домен может являться ассоциированным с доменом расщепления (нуклеазным доменом). Например, можно модифицировать эндонуклеазы хоминга по специфичности их связывания ДНК при сохранении нуклеазной функции. Кроме того, белки с цинковыми пальцами также можно сливать с доменом расщепления с образованием нуклеазы с цинковыми пальцами (ZFN). Часть домена расщепления в слитых белках, описанных в настоящем документе, можно получать из любой эндонуклеазы или экзонуклеазы. Иллюстративные эндонуклеазы, из которых может происходить домен расщепления, включают, но без ограничения, эндонуклеазы рестрикции и эндонуклеазы хоминга. См., например, каталог 2002-2003, New England Biolabs, Beverly, MA; и Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388. Известны дополнительные ферменты, расщепляющие ДНК, (например, нуклеаза S1; нуклеаза золотистой фасоли; панкреатическая ДНКаза I; нуклеаза микрококков; эндонуклеаза HO дрожжей; также см. Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). Известны неограничивающие примеры эндонуклеаз хоминга и мегануклеаз, включающие I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII и I-TevIII. Также см. Патент США No. 5420032; Патент США No. 6833252; Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al. (1989) Gene 82:115-118; Perler et al. (1994) Nucleic Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimble et al. (1996) J. Mol. Biol. 263:163-180; Argast et al. (1998) J. Mol. Biol. 280:345-353 и каталог New England Biolabs. Один или несколько из этих ферментов (или их функциональных фрагментов) можно использовать в качестве источника доменов расщепления и полудоменов расщепления.

Рестрикционные эндонуклеазы (рестрикционные ферменты) присутствуют во многих видах и являются способными к специфическому для последовательности связыванию с ДНК (в участке узнавания), и расщеплению ДНК внутри или вблизи участка связывания. Конкретные рестрикционные ферменты (например, типа IIS) расщепляют ДНК в участках, удаленных от участка узнавания, и имеют отдельные домены связывания и расщепления. Например, фермент FokI типа IIS катализирует двухцепочечное расщепление ДНК на расстоянии 9 нуклеотидов от его участка узнавания на одной цепи и на расстоянии 13 нуклеотидов от его участка узнавания на другой цепи. См., например, Патенты США 5356802; 5436150 и 5487994; а также Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem. 269:31.978-31.982. Таким образом, в одном варианте осуществления слитые белки содержат домен расщепления (или полудомен расщепления) по меньшей мере из одного рестрикционного фермента типа IIS и один или несколько связывающих доменов с цинковыми пальцами, которые могут являться или могут не являться сконструированными.

Иллюстративным рестрикционным ферментом типа IIS, домен расщепления которого является отделяемым от связывающего домена, является FokI. Этот конкретный фермент является активным в форме димера. Bitinaite et al. (1998) Proc. Natl Acad. Sci. USA 95: 10.570-10.575. Соответственно, для целей по настоящему описанию часть фермента FokI, используемую в описанных слитых белках, рассматривают как полудомен расщепления. Таким образом, для направленного двухцепочечного расщепления и/или направленной замены клеточных последовательностей с использованием слитых белков с цинковыми пальцами-fokI можно использовать два слитых белка, каждый из которых содержит полудомен расщепления FokI, чтобы восстановить каталитически активный домен расщепления. Альтернативно, можно использовать также одну полипептидную молекулу, содержащую связывающий домен с цинковыми пальцами и два полудомена расщепления FokI. Параметры направленного расщепления и направленного изменения последовательности с использованием слитых белков с цинковыми пальцами-FokI представлены в другом месте настоящего описания.

Домен расщепления или полудомен расщепления может представлять собой любую часть белка, которая сохраняет активность расщепления или которая сохраняет способность к мультимеризации (например, димеризации) для формирования функционального домена расщепления. Иллюстративные ферменты рестрикции типа IIS описаны в международной публикации WO 2007/014275, полное содержание которой включено в настоящее описание.

Для повышения специфичности расщепления можно также модифицировать домены расщепления. В конкретных вариантах осуществления используют варианты полудоменов расщепления, где эти варианты минимизируют или предотвращают гомодимеризацию полудоменов расщепления. Неограничивающие примеры таких модифицированных полудоменов расщепления подробно описаны в WO 2007/014275, полное содержание которой включено в настоящее описание в качестве ссылки. В конкретных вариантах осуществления домен расщепления содержит сконструированный полудомен расщепления (также обозначаемый как мутант домена димеризации), который минимизирует или предотвращает гомодимеризацию. Такие варианты осуществления известны специалистам в данной области и описаны, например, в публикациях Патентов США No. 20050064474; 20060188987; 20070305346 и 20080131962, полное содержание всех из которых включено в настоящее описание в качестве ссылки. Все аминокислотные остатки в положениях 446, 447, 479, 483, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537 и 538 FokI являются мишенями для влияния на димеризацию полудоменов расщепления FokI.

Дополнительные сконструированные полудомены расщепления FokI, которые формируют облигатные гетеродимеры, также можно использовать в ZFN, описанных в настоящем документе. Иллюстративные сконструированные полудомены расщепления Fok I, формирующие облигатные гетеродимеры, включают пару, в которой первый полудомен расщепления включает мутации аминокислотных остатков в положениях 490 и 538 Fok I, и второй полудомен расщепления включает мутации аминокислотных остатков 486 и 499. В одном варианте осуществления мутация в положении 490 заменяет Glu (E) на Lys (K); мутация в положении 538 заменяет Iso (I) на Lys (K); мутация в положении 486 заменяет Gln (Q) на Glu (E); и мутация в положении 499 заменяет Iso (I) на Lys (K). Конкретно, сконструированные полудомены расщепления, описанные в настоящем документе, получали посредством введения мутаций в положения 490 (EK) и 538 (IK) одного полудомена расщепления с получением сконструированного полудомена расщепления, обозначенного «E490K:I538K», и посредством введения мутаций в положения 486 (QE) и 499 (IL) другого полудомена расщепления с получением сконструированного полудомена расщепления, обозначенного «Q486E:I499L». Сконструированные полудомены расщепления, описанные в настоящем документе, представляют собой облигатно гетеродимерные мутанты, в которых неправильное расщепление минимизировано или исключено. См., например, публикацию Патента США No. 2008/0131962, полное содержание которой включено в качестве ссылки для всех целей. В конкретных вариантах осуществления сконструированный полудомен расщепления содержит мутации в положениях 486, 499 и 496 (пронумерованы относительно FokI дикого типа), например, мутации, заменяющие остаток Gln (Q) дикого типа в положении 486 на остаток Glu (E), остаток Iso (I) дикого типа в положении 499 на остаток Leu (L) и остаток Asn (N) дикого типа в положении 496 на остаток Asp (D) или Glu (E) (также обозначены как домены «ELD» и «ELE», соответственно). В других вариантах осуществления сконструированный полудомен расщепления содержит мутации в положениях 490, 538 и 537 (пронумерованы относительно FokI дикого типа), например, мутации, заменяющие остаток Glu (E) дикого типа в положении 490 на остаток Lys (K), остаток Iso (I) дикого типа в положении 538 на остаток Lys (K), и остаток His (H) дикого типа в положении 537 на остаток Lys (K) или остаток Arg (R) (также обозначены как домены «KKK» и «KKR», соответственно). В других вариантах осуществления сконструированный полудомен расщепления содержит мутации в положениях 490 и 537 (пронумерованы относительно FokI дикого типа), например, мутации, заменяющие остаток Glu (E) дикого типа в положении 490 на остаток Lys (K) и остаток His (H) дикого типа в положении 537 на остаток Lys (K) или остаток Arg (R) (также обозначены как домены «KIK» и «KIR», соответственно). (См. публикацию патента США No. 20110201055). В других вариантах осуществления сконструированный полудомен расщепления содержит мутации «Sharkey» и/или «Sharkey'» (см. Guo et al, (2010) J. Mol. Biol. 400(1):96-107).

Сконструированные полудомены расщепления, описанные в настоящем документе, можно получать с использованием любого подходящего способа, например, посредством сайт-направленного мутагенеза полудоменов расщепления дикого типа (Fok I), как описано в публикациях патентов США No. 20050064474; 20080131962 и 20110201055. Альтернативно, нуклеазы можно собирать in vivo в участке-мишени нуклеиновой кислоты с использованием так называемого способа «расщепленных ферментов» (см., например, Публикацию патента США No. 20090068164). Компоненты таких расщепленных ферментов либо можно экспрессировать на отдельных экспрессирующих конструкциях, либо можно соединять в одной открытой рамке считывания, где индивидуальные компоненты разделены, например, посредством последовательности саморасщепляющегося пептида 2A или IRES. Компоненты могут представлять собой индивидуальные связывающие домены с цинковыми пальцами или домены связывающего нуклеиновую кислоту домена мегануклеазы.

Можно проводить скрининг нуклеаз по активности перед использованием, например, в системе на основе хромосомы дрожжей, как описано в WO 2009/042163 и 20090068164. Конструкции для экспрессии нуклеаз можно можно легко разрабатывать с использованием способов, известных в данной области. См., например, публикации патентов США 20030232410; 20050208489; 20050026157; 20050064474; 20060188987; 20060063231 и международную публикацию WO 07/014275. Экспрессия нуклеазы может происходить под контролем конститутивного промотора или индуцируемого промотора, например, промотора галактокиназы, который является активированным (дерепрессированным) в присутствии рафинозы и/или галактозы и репрессированным в присутствии глюкозы.

Расстояние между участками-мишенями относится к количеству нуклеотидов или пар нуклеотидов, встроенных между двумя участками-мишенями при измерении от ближайших друг к другу краев последовательностей. В конкретных вариантах осуществления, в которых расщепление зависит от связывания двух слитых молекул домен с цинковыми пальцами/полудомен расщепления для разделения участков-мишеней, два участка-мишени могут находиться на противоположных цепях ДНК. В других вариантах осуществления оба участка-мишени находятся на одной цепи ДНК. Для направленного интеграции в оптимальный геномный локус одну или несколько ZFP конструируют для связывания участка-мишени внутри или вблизи предопределенного участка расщепления, и слитый белок, содержащий сконструированный ДНК-связывающий домен и домен расщепления, экспрессируют в клетке. При связывании части слитого белка, содержащей цинковые пальцы, с участком-мишенью, ДНК расщепляется доменом расщепления, предпочтительно посредством двухцепочечного разрыва, вблизи участка-мишени.

Присутствие двухцепочечного разрыва в оптимальном геномном локусе облегчает интеграцию экзогенных последовательностей посредством гомологичной рекомбинации. Таким образом, в одном варианте осуществления полинуклеотид, содержащий представляющую интерес последовательность нуклеиновой кислоты, подлежащую вставке в намеченный геномный локус, включает одну или несколько областей гомологии в заданном геномном локусе для облегчения гомологичной рекомбинации.

В дополнение к слитым молекулам, описанным в настоящем документе, направленная замена выбранной геномной последовательности также вовлекает введение донорной последовательности. Полинуклеотидную донорную последовательность можно вводить в клетку до, во время или после экспрессии слитого белка(белков). В одном варианте осуществления донорный полинуклеотид обладает достаточной гомологией с оптимальным геномным локусом для поддержания гомологичной рекомбинации между ним и геномной последовательностью оптимального геномного локуса, с которой он имеет гомологию. Гомология последовательностей, составляющая приблизительно 25, 50, 100, 200, 500, 750, 1000, 1500, 2000 нуклеотидов или более между донорной и геномной последовательностью, или любое целое число между 10 и 2000 нуклеотидами или более, может способствовать гомологичной рекомбинации. В конкретных вариантах осуществления плечи гомологии имеют длину менее 1000 пар оснований. В других вариантах осуществления плечи гомологии имеют длину менее 750 пар оснований. В одном варианте осуществления, донорные полинуклеотидные последовательности могут содержать молекулу вектора, содержащую последовательности, которые не являются гомологичными представляющей интерес области в клеточном хроматине. Донорная полинуклеотидная молекула может содержать несколько прерывающихся областей гомологии с клеточным хроматином. Например, для направленной вставки последовательностей, в норме не присутствующих в представляющей интерес области, указанные последовательности могут присутствовать в донорной молекуле нуклеиновой кислоты и являться фланкированными областями гомологии с последовательностью в представляющей интерес области. Донорный полинуклеотид может представлять собой ДНК или РНК, может являться одноцепочечным или двухцепочечным, и его можно вводить в клетку в линейной или кольцевой форме. См., например, публикации патентов США No. 20100047805; 20110281361 и 20110207221 и заявку США No. 13/889162. При введении в линейной форме концы донорной последовательности можно защищать (например, от экзонуклеолитической деградации) способами, известными специалистам в данной области. Например, один или несколько дидезоксинуклеотидных остатков добавляют на 3'-конец линейной молекулы, и/или самокомплементарные олигонуклеотиды лигируют по одному или обоим концам. См., например, Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889. Дополнительные способы защиты экзогенных полинуклеотидов от деградации включают, но без ограничения, добавление концевой аминогруппы(аминогрупп) и использование модифицированных межнуклеотидных связей, например, таких как фосфоротиоаты, фосфорамидаты, и остатков O-метилрибозы или дезоксирибозы.

В соответствии с одним вариантом осуществления представлен способ получения трансгенного однодольного растения, такого как трансгенное растение маиса, где представляющая интерес ДНК вставлена в оптимальный внегенный геномный локус маиса. Способ включает стадии:

a. выбора оптимального внегенного локуса маиса в качестве мишени для вставки представляющей интерес нуклеиновой кислоты;

b. введения сайт-специфической нуклеазы в клетку однодольного растения, такую как клетка растения маиса, где сайт-специфическая нуклеаза расщепляет внегенную последовательность;

c. введения представляющей интерес ДНК в клетку растения; и

d. отбора трансгенных клеток растений, содержащих представляющую интерес ДНК, нацеленную на указанную внегенную последовательность.

В соответствии с одним вариантом осуществления представлен способ получения трансгенного протопласта клетки однодольного растения, такого как трансгенный протопласт клетки маиса, где представляющая интерес ДНК вставлена в оптимальный внегенный геномный локус маиса. Способ включает стадии:

a. выбора оптимального внегенного локуса маиса в качестве мишени для вставки представляющей интерес нуклеиновой кислоты;

b. введения сайт-специфической нуклеазы в протопласт клетки маиса, где сайт-специфическая нуклеаза расщепляет внегенную последовательность;

c. введения представляющей интерес ДНК в протопласт клетки маиса; и

d. отбора трансгенного протопласта клетки маиса, содержащего представляющую интерес ДНК, нацеленную на указанную внегенную последовательность.

В одном варианте осуществления сайт-специфическая нуклеаза выбрана из группы, состоящей из нуклеазы с цинковыми пальцами, нуклеазы CRISPR, нуклеазы TALEN или мегануклеазы, и, более конкретно, в одном варианте осуществления сайт-специфическая нуклеаза представляет собой нуклеазу с цинковыми пальцами. В соответствии с одним вариантом осуществления представляющую интерес ДНК интегрируют в указанную внегенную последовательность способом направляемой гомологией репарации. Альтернативно в некоторых вариантах осуществления представляющую интерес ДНК интегрируют в указанную внегенную последовательность способом соединения негомологичных концов. В дополнительных вариантах осуществления представляющую интерес ДНК интегрируют в указанную внегенную последовательность посредством не описанного ранее способа интеграции. В одном варианте осуществления способ включает выбор оптимального внегенного геномного локуса маиса для направленной вставки представляющей интерес ДНК, обладающего 2, 3, 4, 5, 6, 7, или 8 из следующих характеристик:

a. внегенная последовательность имеет длину по меньшей мере 1 т.п.о. и не обладает более 1% метилирования ДНК в последовательности

b. внегенная последовательность обладает частотой рекомбинации 0,00041-62,42 сМ/млн.п.о. в геноме однодольного растения, таком как геном маиса;

c. внегенная последовательность обладает уровнем занятости нуклеосомами 0-0,962 в геноме однодольного растения, таком как геном маиса;

d. внегенная последовательность разделяет менее 40% идентичности последовательности с любой другой последовательностью 1 т.п.о., содержащейся в геноме однодольного растения, таком как геном маиса;

e. внегенная последовательность обладает значением относительного расположения с отношением геномного расстояния от центромеры хромосомы однодольного растения, такой как центромеры хромосомы маиса, 0,00373-0,99908;

f. внегенная последовательность обладает процентным содержанием гуанина/цитозина в диапазоне 25,17-68,3%;

g. внегенная последовательность локализована вблизи генной последовательности; и

h. область 1 млн.п.о. геномной последовательности однодольного растения, такой как геномная последовательность маиса, содержащая указанную внегенную последовательность, содержит одну или несколько дополнительных внегенных последовательностей. В одном варианте осуществления оптимальный внегенный локус маиса выбран из локусов кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 3, 4, 5, 6, 7, 8, 9, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32.

Доставка

Донорные молекулы, описанные в настоящем документе, интегрируют в геном клетки посредством направленных не зависимых от гомологии и/или зависимых от гомологии способов. Для такого направленной интеграции геном расщепляют в желательном положении (или положениях) с использованием нуклеазы, например, слитой конструкции ДНК-связывающего домена (например, связывающего домена с цинковыми пальцами, эффекторного домена CRISPR или TAL, сконструированного для связывания с участком-мишенью внутри или вблизи предопределенного участка расщепления) и нуклеазного домена (например, домена расщепления или полудомена расщепления). В конкретных вариантах осуществления два слитых белка, каждый из которых содержит ДНК-связывающий домен и полудомен расщепления, экспрессируются в клетке и связываются с участками-мишенями, которые расположены рядом таким образом, что восстанавливается функциональный домен расщепления, и ДНК расщепляется вблизи участков-мишеней. В одном варианте осуществления расщепление происходит между участками-мишенями двух ДНК-связывающих доменов. Один или оба из ДНК-связывающих доменов могут являться сконструированными. Также см. Патент США No. 7888121; публикацию Патента США 20050064474 и международные публикации патентов WO05/084190, WO05/014791 и WO 03/080809.

Нуклеазы, как описано в настоящем документе, можно вводить в форме полипептидов и/или полинуклеотидов. Например, два полинуклеотида, каждый из которых содержит последовательности, кодирующие один из указанных выше полипептидов, можно вводить в клетку, и когда полипептиды экспрессируются, и каждый связывается со своей последовательностью-мишенью, расщепление происходит внутри или вблизи последовательности-мишени. Альтернативно, один полинуклеотид, содержащий последовательности, кодирующие оба слитых полипептида, вводят в клетку. Полинуклеотиды могут представлять собой ДНК, РНК, или любые модифицированные формы или аналоги ДНК и/или РНК.

После внесения двухцепочечного разрыва в представляющую интерес область, интеграцию трансгена осуществляют в представляющую интерес область направленным образом независимыми от гомологии способами (например, соединением негомологичных концов (NHEJ)) после линеаризации двухцепочечной донорной молекулы, как описано в настоящем документе. Двухцепочечный донор предпочтительно линеаризуют in vivo с помощью нуклеазы, например одной или нескольких из тех же нуклеаз, что использовали для внесения в геном двухцепочечного разрыва, или отличающихся нуклеаз. Синхронизированное расщепление хромосомы и донора в клетке может ограничивать деградацию донорной ДНК (по сравнению с линеаризацией донорной молекулы перед введением в клетку). Участки-мишени нуклеаз, используемые для линеаризации донора, предпочтительно не прерывают последовательность(последовательности) трансгсена(трансгсенов).

Трансген можно интегрировать в геном в направлении, ожидаемом для простого лигирования выступающих концов, образованных нуклеазой (обозначено как «прямая» ориентация или «AB») или в альтернативном направлении (обозначено как «обратная» ориентация или «BA»). В конкретных вариантах осуществления интеграцию трансгена осуществляют после точного лигирования выступающих концов донора и хромосомы. В других вариантах осуществления интеграция трансгена в ориентации либо BA, либо или AB, приводит к делеции нескольких нуклеотидов.

С использованием таких способов, как эти, можно осуществлять стабильную трансформацию клеток практически любого вида. В некоторых вариантах осуществления трансформирующая ДНК интегрирует в геном клетки-хозяина. В случае многоклеточного вида, трансгенные клетки можно регенерировать в трансгенный организм. Любой из этих способов можно использовать Для получения трансгенного растения, например, содержащего одну или несколько донорных полинуклеотидных последовательностей в геноме трансгенного растения.

В некоторых вариантах осуществления доставку нуклеиновых кислот в клетку растения можно осуществлять любым способом, известным специалистам в данной области, включая, в качестве неограничивающих примеров: трансформацию протопластов (см., например, патент США 5508184); опосредуемый обезвоживанием/ингибированием захват ДНК (см., например, Potrykus et al. (1985) Mol. Gen. Genet. 199:183-8); электропорацию (см., например, патент США 5384253); встряхивание с волокнами из карбида кремния (см., например, Патенты США 5302523 и 5464765); опосредуемую Agrobacterium трансформацию (см., например, Патенты США 5563055, 5591616, 5693512, 5824877, 5981840 и 6384301); ускорение покрытых ДНК частиц (см., например, Патенты США 5015580, 5550318, 5538880, 6160208, 6399861 и 6403865) и использование наночастиц, наноносителей и проникающих в клетку пептидов (WO201126644A2; WO2009046384A1; WO2008148223A1) в способах доставки ДНК, РНК, пептидов и/или белков, или комбинаций нуклеиновых кислот и пептидов в клетки растений.

Наиболее широко используемый способ введения экспрессирующего вектора в растения основан на природной системе трансформации Agrobacterium. A. tumefaciens и A. rhizogenes представляют собой патогенные для растений бактерии почвы, которые генетически трансформируют клетки растений. Плазмиды Ti и Ri A. tumefaciens и A. rhizogenes, соответственно, содержат гены, ответственные за генетическую трансформацию растений. Плазмиды Ti (индуцирующие опухоли) содержат большой фрагмент, известный как T-ДНК, переносимый в трансформированные растения. Другой фрагмент плазмиды Ti, область vir, является ответственным за перенос T-ДНК. Область T-ДНК ограничена левой и правой границами, каждая из которых состоит из концевых повторяющихся нуклеотидных последовательностей. В некоторых модифицированных бинарных векторах индуцирующие опухоль гены делетируют и функции области vir используют для переноса чужеродной ДНК, ограниченной последовательностями границ T-ДНК. T-область также может содержать, например, селективный маркер для эффективного выделения трансгенных растений и клеток, и участок множественного клонирования для вставки последовательностей для переноса такой нуклеиновой кислоты, кодирующей слитый белок по изобретению.

Таким образом, в некоторых вариантах осуществления вектор для трансформации растений получен из плазмиды Ti A. tumefaciens (см., например, Патенты США No. 4536475, 4693977, 4886937 и 5501967; и Европейский патент EP 0 122 791) или плазмиды Ri A. rhizogenes. Дополнительные векторы для трансформации растений включают, в качестве неограничивающих примеров, векторы, описанные в Herrera-Estrella et al. (1983) Nature 303:209-13; Bevan et al. (1983), выше; Klee et al. (1985) Bio Technol. 3: 637-42; и в Европейском патенте EP 0 120 516, и векторы, полученные из любого из вышеописанных. Другие бактерии, такие как Sinorhizobium, Rhizobium и Mesorhizobium, которые в природе взаимодействуют с растениями, можно модифицировать, чтобы опосредовать перенос генов в ряд разнообразных растений. Эти ассоциированные с растениями симбиотические бактерии можно делать компетентными для переноса генов путем введения как обезоруженной плазмиды Ti, так и подходящего бинарного вектора.

Представляющая интерес нуклеиновая кислота

Полинуклеотидные донорные последовательности для направленной вставки в геномный локус однодольного растения, такого как растение маиса, как правило, имеют длину в диапазоне от приблизительно 10 до приблизительно 5000 нуклеотидов. Однако можно использовать существенно более длинные нуклеотиды, вплоть до 20000 нуклеотидов, включая последовательности длиной приблизительно 5, 6, 7, 8, 9, 10, 11 и 12 т.п.о. Кроме того, донорные последовательности могут содержать векторную молекулу, содержащую последовательности, которые не являются гомологичными заменяемой области. В одном варианте осуществления представляющая интерес нуклеиновая кислота включает одну или несколько областей, разделяющих гомологию с геномными локусами-мишенями. Как правило, гомологичная область(области) представляющей интерес нуклеиновой кислоты обладают по меньшей мере 50% идентичностью последовательности с геномной последовательностью, с которой желательна рекомбинация. В определенных вариантах осуществления гомологичная область(области) представляющей интерес нуклеиновой кислоты обладает 60%, 70%, 80%, 90%, 95%, 98%, 99% или 99,9% идентичностью последовательности с последовательностями, локализованными в геномном локусе-мишени. Однако может присутствовать любое значение идентичности последовательностей от 1% до 100%, в зависимости от длины представляющей интерес нуклеиновой кислоты.

Представляющая интерес нуклеиновая кислота может содержать несколько прерывающихся областей последовательности, разделяющих относительно высокую идентичность последовательности с клеточным хроматином. Например, для направленного встраивания последовательностей, обычно не присутствующих в геномном локусе-мишени, в донорной молекуле могут присутствовать уникальные последовательности, и они могут быть фланкированы областями последовательностей, разделяющими относительно высокую идентичность последовательности с последовательностью, присутствующей в геномном локусе-мишени.

Представляющую интерес нуклеиновую кислоту также можно вставлять в геномный локус-мишень, чтобы она служила резервуаром для последующего применения. Например, первую последовательность нуклеиновой кислоты, содержащую последовательности, гомологичные внегенной области генома однодольного растения, такого как растение маиса, но содержащую представляющую интерес нуклеиновую кислоту (необязательно, кодирующую ZFN под контролем индуцируемого промотора), можно вставлять в геномный локус-мишень. Затем в клетку вводят вторую последовательность нуклеиновой кислоты для индукции встраивания представляющей интерес ДНК в оптимальный внегенный геномный локус однодольного растения, такого как растение маиса. Либо первая последовательность нуклеиновой кислоты содержит ZFN, специфичную к оптимальному внегенному геномному локусу маиса, а вторая последовательность нуклеиновой кислоты содержит представляющую интерес последовательность ДНК, либо наоборот. В одном варианте осуществления ZFN расщепляет как оптимальный внегенный геномный локус маиса, так и представляющую интерес нуклеиновую кислоту. Затем полученный двухцепочечный разрыв в геноме может стать участком интеграции для представляющей интерес нуклеиновой кислоты, высвободившейся из оптимального геномного локуса. Альтернативно экспрессию ZFN, уже локализованной в геноме, можно индуцировать после введения представляющей интерес ДНК для индукции двухцепочечного разрыва в геноме, который затем может стать участком интеграции для введенной представляющей интерес нуклеиновой кислоты. Таким образом, эффективность направленной интеграции представляющей интерес ДНК в любую представляющую интерес область можно улучшать, поскольку способ не основан на одновременном захвате обеих нуклеиновых кислот, кодирующих ZFN и представляющую интерес ДНК.

Представляющую интерес нуклеиновую кислоту можно также вставлять в оптимальный внегенный геномный локус маиса, чтобы она служила в качестве участка-мишени для последующих вставок. Например, в локус можно вставлять представляющую интерес нуклеиновую кислоту, содержащую последовательности ДНК, которые содержат участки узнавания для дополнительных конструкций ZFN. Затем можно получать дополнительные конструкции ZFN и экспрессировать их в клетках, так чтобы расщеплялась представляющую интерес исходную нуклеиновую кислоту и модифицировать посредством репарации или гомологичной рекомбинации. Таким образом, может происходить многократное встраивание представляющей интерес нуклеиновой кислоты в оптимальный внегенный геномный локус однодольного растения, такого как растение маиса.

Иллюстративные экзогенные последовательности, которые можно вставлять в оптимальный внегенный геномный локус маиса, включают, но без ограничения, любую кодирующую полипептид последовательность (например, кДНК), промотор, энхансер и другие регуляторные последовательности (например, последовательности интерферирующих РНК, кшРНК, экспрессирующие кассеты, эпитопные метки, маркерные гены, участки узнавания ферментов расщепления и различные типы экспрессирующих конструкций. Такие последовательности можно легко получать с использованием стандартных молекулярно-биологических способов (клонирование, синтез и т.д.) и/или они являются коммерчески доступными.

Для экспрессии ZFN последовательности, кодирующие слитые белки, как правило, субклонируют в экспрессирующий вектор, содержащий промотор для контроля транскрипции. Пригодные прокариотические и эукариотические промоторы хорошо известны в данной области и описаны, например, в Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed. 1989; 3rd ed., 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); и Current Protocols in Molecular Biology (Ausubel et al., выше). Бактериальные экспрессирующие системы для экспрессии ZFN доступны, например, в E. coli, Bacillus sp. и Salmonella (Palva et al., Gene 22:229-235 (1983)). Наборы для таких экспрессирующих систем являются коммерчески доступными. Эукариотические экспрессирующие системы для клеток млекопитающих, дрожжей и насекомых хорошо известны специалистам в данной области и также являются коммерчески доступными.

Конкретный экспрессирующий вектор, используемый для переноса генетического материала в клетку, выбирают в соответствии с предполагаемым применением слитых белков, например, экспрессией в растениях, животных, бактериях, грибах, простейших и т.д. (см. экспрессирующие векторы, описанные ниже). Стандартные экспрессирующие векторы для бактерий и животных известны в данной области и подробно описаны, например, в публикации Патента США 20050064474A1 и международных публикациях патентов WO 05/084190, WO 05/014791 и WO 03/080809.

Стандартные способы трансфекции можно использовать для получения линий клеток бактерий, растений, млекопитающих, дрожжей или насекомых, которые экспрессируют большие количества белков, которые затем можно очищать с использованием стандартных способов (см., например, Colley et al., J. Biol. Chem. 264:17619-17622 (1989); Guide to Protein Purification, Methods in Enzymology, vol. 182 (Deutscher, ed., 1990)). Трансформацию эукариотических и прокариотических клеток проводят стандартными способами (см., например, Morrison, J. Bact. 132:349-351 (1977); Clark-Curtiss & Curtiss, Methods in Enzymology 101:347-362 (Wu et al., eds., 1983).

Описанные способы и композиции можно использовать для вставки полинуклеотидных донорных последовательностей в заданное положение, такое как один из оптимальных внегенных геномных локусов маиса. Это является полезным, поскольку экспрессия введенного трансгена в геноме однодольного растения, например, в геноме маиса, принципиально зависит от участка его интеграции. Таким образом, гены, кодирующие толерантность к гербицидам, устойчивость к насекомым, питательные вещества, антибиотики или терапевтические молекулы, можно встраивать посредством направленной рекомбинации.

В одном варианте осуществления нуклеиновую кислоту вставки комбинируют или подвергают «пакетированию» с кодирующими гены последовательностями, которые обеспечивают дополнительную устойчивость или толерантность к глифосату или другому гербициду и/или обеспечивают устойчивость к выбранным насекомым или заболеваниям и/или повышение пищевой ценности, и/или улучшенные агрономические характеристики, и/или белки или другие продукты, пригодные для использования в продуктах питания, кормах, промышленности, фармацевтике или других применениях. «Пакетирование» двух или более представляющих интерес последовательностей нуклеиновых кислот в геноме растения можно проводить, например, посредством общепринятого разведения растений с использованием двух или более трансгенных событий, трансформации растения конструкцией, содержащей представляющие интерес последовательности, повторной трансформации трансгенного растения или добавления новых признаков посредством направленной интеграции путем гомологичной рекомбинации.

Такие представляющие интерес полинуклеотидные донорные последовательности включают, но без ограничения, примеры, приведенные ниже:

1. Гены или кодирующие последовательности (например иРНК), придающие устойчивость к вредителям или заболеваниям

(A) Гены устойчивости к заболеваниям растений. Защита растений часто активируется посредством специфического взаимодействия между продуктом гена устойчивости к заболеванию (R) в растении и продуктом соответствующего гена авирулентности (Avr) в патогене. Сорт растений можно трансформировать клонированным геном устойчивости для конструирования растений, которые являются устойчивыми к конкретным патогенным штаммам. Примеры таких генов включают ген Cf-9 томата для устойчивости к Cladosporium fulvum (Jones et al., 1994 Science 266:789), ген Pto томата, кодирующий протеинкиназу, для устойчивости к Pseudomonas syringae pv. tomato (Martin et al., 1993 Science 262:1432), и ген RSSP2 Arabidopsis для устойчивости к Pseudomonas syringae (Mindrinos et al., 1994 Cell 78:1089).

(B) Белок Bacillus thuringiensis, его производное или синтетический полипептид, смоделированный на его основе, такой как нуклеотидная последовательность гена δ-эндотоксина Bt (Geiser et al., 1986 Gene 48:109) и растительный инсектицидный ген (VIP) (см., например, Estruch et al. (1996) Proc. Natl. Acad. Sci. 93:5389-94). Более того, молекулы ДНК, кодирующие гены δ-эндотоксина, можно закупать в American Type Culture Collection (Rockville, Md.), под номерами доступа ATCC 40098, 67136, 31995 и 31998.

(C) Лектин, такой как нуклеотидные последовательности нескольких генов связывающих маннозу лектинов Clivia miniata (Van Damme et al., 1994 Plant Molec. Biol. 24:825).

(D) Связывающий витамин белок, такой как авидин и гомологи авидина, которые можно использовать в качестве ларвицидов против насекомых-вредителей. См. патент США No. 5659026.

(E) Ингибитор фермента, например, ингибитор протеазы или ингибитор амилазы. Примеры таких генов включает ингибитор цистеиновой протеазы риса (Abe et al., 1987 J. Biol. Chem. 262:16793), ингибитор протеазы табака I (Huub et al., 1993 Plant Molec. Biol. 21:985) и ингибитор α-амилазы (Sumitani et al., 1993 Biosci. Biotech. Biochem. 57:1243).

(F) Специфичный к насекомым гормон или феромон, такой как экдистероид и ювенильный гормон, их вариант, миметик на их основе, или их антагонист или агонист, как например, бакуловирусная экспрессия клонированной эстеразы ювенильного гормона, инактиватора ювенильного гормона (Hammock et al., 1990 Nature 344:458).

(G) Специфичный для насекомых пептид или нейропептид, который при экспрессии нарушает физиологию находящегося под его воздействием паразита (J. Biol. Chem. 269:9). Примеры таких генов включают рецептор диуретического гормона насекомых (Regan, 1994), аллостатин, идентифицированный в Diploptera punctata (Pratt, 1989), и специфичные для насекомых паралитические нейротоксины (патент США No. 5266361).

(H) Специфичный для насекомых яд, продуцируемый в природе змеями, пчелами и т.д., такой как инсектотоксический пептид скорпиона (Pang, 1992 Gene 116:165).

(I) Фермент, ответственный за избыточное накопление монотерпенов, сесквитерпенов, стероидов, гидроксамовой кислоты, фенилпропаноидного производного или другой небелковой молекулы с инсектицидной активностью.

(J) Фермент, вовлеченный в модификацию, включая посттрансляионную модификацию, биологически активной молекулы; например, гликолитический фермент, протеолитический фермент, липолитический фермент, нуклеаза, циклаза, трансаминаза, эстераза, гидролаза, фосфатаза, киназа, фосфорилаза, полимераза, эластаза, хитиназа и глюканаза, как природные, так и синтетические. Примеры таких генов включают ген callas (опубликованная заявка PCT WO93/02197), кодирующие хитиназу последовательности (которые можно получать, например, из ATCC под номерами доступа 3999637 и 67152), хитиназу анкилостоматид табака (Kramer et al., 1993 Insect Molec. Biol. 23:691) и ген полиубиквитина ubi4-2 петрушки (Kawalleck et al., 1993 Plant Molec. Biol. 21:673).

(K) Молекула, стимулирующая передачу сигнала. Примеры таких молекул включают нуклеотидные последовательности для клонов кДНК кальмодулина золотистой фасоли (Botella et al., 1994 Plant Molec. Biol. 24:757) и нуклеотидную последовательность клона кДНК кальмодулина маиса (Griess et al., 1994 Plant Physiol. 104:1467).

(L) Пептид с гидрофобным моментом. См. патенты США No. 5659026 и 5607914; в последнем из которых объяснены синтетические противомикробные пептиды, которые сообщают устойчивость к заболеваниям.

(M) Мембранная пермеаза, формирователь каналов или блокатор каналов, такой как аналог литического пептида цекропина-β (Jaynes et al., 1993 Plant Sci. 89:43), который сообщает трансгенным растениям табака устойчивость к Pseudomonas solanacearum.

(N) Вирусный инвазивный белок или происходящий из него комплексный токсин. Например, накопление белков оболочки вируса в трансформированных клетках растений сообщает устойчивость к вирусной инфекции и/или развитию заболевания, вызванного вирусом, из которого происходит ген белка оболочки, так же как родственными вирусами. Опосредуемую белком оболочки устойчивость сообщают трансформированным растениям против вируса мозаики люцерны, вируса мозаики огурца, вируса полосатости табака, вируса X картофеля, вируса Y картофеля, вируса гравировки табака, вируса погремковости табака и вируса табачной мозаики. См., например, Beachy et al. (1990) Ann. Rev. Phytopathol. 28:451.

(O) Специфичное для насекомых антитело или иммунотоксин, происходящий из него. Таким образом, антитело, нацеленное на критическую метаболическую функцию в кишечнике насекомого, инактивирует фермент, на который оно воздействует, вызывая гибель насекомого. Например, в Taylor et al. (1994) Abstract #497, Seventh Int'l. Symposium on Molecular Plant-Microbe Interactions показана инактивация фермента трансгенного табака посредством продукции одноцепочечных фрагментов антител.

(P) Вирус-специфическое антитело. См., например, Tavladoraki et al. (1993) Nature 266:469, где показано, что трансгенные растения, экспрессирующие рекомбинантные гены антител, защищены от вирусной атаки.

(Q) Останавливающий развитие белок, продуцируемый в природе патогеном или паразитом. Таким образом, эндо-α-1,4-D полигалактуроназы грибов способствуют колонизации грибов и высвобождению питательных веществ растений посредством солюбилизирующей клеточную стенки растений гомо-α-1,4-D-галактуроназы (Lamb et al., 1992) Bio/Technology 10:1436. Клонирование и характеризация гена, который кодирует белок, ингибирующий эндополигалактуроназу, описаны Toubart et al. (1992 Plant J. 2:367).

(R) Останавливающий развитие белок, продуцируемый в природе растением, такой как инактивирующий рибосомы ген ячменя, который обеспечивает увеличенную устойчивость к вызываемому грибами заболеванию (Longemann et al., 1992). Bio/Technology 10:3305.

(S) РНК-интерференция, при которой молекулу РНК используют для ингибирования экспрессии гена-мишени. Молекула РНК в одном примере является частично или полностью двухцепочечной, запуская ответ сайленсинга, вызывающий расщепление дцРНК на малые интерферирующие РНК, которые затем включаются в нацеливающий комплекс, разрушающий гомологичные мРНК. См., например, Fire et al., Патент США 6506559; Graham et al. Патент США 6573099.

2. Гены, сообщающие устойчивость к гербицидам

(A) Гены, кодирующие устойчивость или толерантность к гербициду, который ингибирует конус нарастания или меристему, такой как гербицид на основе имидазалинона, сульфонанилида или сульфонилмочевины. Иллюстративные гены в этой категории кодируют мутантную ацетолактатсинтазу (ALS) (Lee et al., 1988 EMBOJ. 7:1241), известную также как фермент синтаза ацетогидроксикислот (AHAS) (Miki et al., 1990 Theor. Appl. Genet. 80:449).

(B) Один или несколько дополнительных генов, кодирующих устойчивость или толерантность к глифосату, сообщаемую мутантной синтазой EPSP и генами aroA, или метаболической инактивацией посредством таких генов, как DGT-28, 2mEPSPS, GAT (глифосатацетилтрансфераза) или GOX (глифосатоксидаза) и другие фосфоносоединения, такие как глюфосинат (гены pat, bar и dsm-2) и арилоксифеноксипропионовые кислоты и циклогександионы (гены, кодирующие ингибитор ACCазы). См., например, Патент США No. 4940835, в котором описана нуклеотидная последовательность формы EPSP, которая может сообщать устойчивость к глифосату. Молекулу ДНК, кодирующую мутантный ген aroA, можно получать под номером доступа ATCC 39256, и нуклеотидная последовательность мутантного гена описана в патенте США No. 4769061. В Европейской патентной заявке No. 0 333 033 и Патенте США No. 4975374 описаны нуклеотидные последовательности генов глутаминсинтазы, которые сообщают устойчивость к гербицидам, таким как L-фосфинотрицин. Нуклеотидная последовательность гена фосфинотрицинацетилтрансферазы представлена в Европейской заявке No. 0 242 246. В De Greef et al. (1989) Bio/Technology 7:61 описано получение трансгенных растений, которые экспрессируют химерные гены bar, кодирующие активность фосфинотрицинацетилтрансферазы. Иллюстративными генами, сообщающими устойчивость к арилоксифеноксипропионовым кислотам и циклогександионам, таким как сетоксидим и галоксифоп, являются гены Accl-S1, Accl-S2 и Accl-S3, описанные Marshall et al. (1992) Theor. Appl. Genet. 83:435.

(C) Гены, кодирующие устойчивость или толерантность к гербициду, который ингибирует фотосинтез, такому как триазин (гены psbA и gs+) и бензонитрил (ген нитрилазы). В Przibilla et al. (1991) Plant Cell 3:169 описано применение плазмид, кодирующих мутантные гены psbA, для трансформации Chlamydomonas. Нуклеотидные последовательности для генов нитрилазы описаны в Патенте США No. 4810648, и молекулы ДНК, содержащие эти гены, доступны под номерами доступа ATCC 53435, 67441 и 67442. Клонирование и экспрессия ДНК, кодирующей глутатион-S-трансферазу, описано в Hayes et al. (1992) Biochem. J. 285:173.

(D) Гены, кодирующие устойчивость или толерантность к гербициду, которые связываются с гидроксифенилпируватдиоксигеназами (HPPD), ферментами, катализирующими реакцию преобразования пара-гидроксифенилпирувата (HPP) в гомогентизат. Они включают гербициды, такие как изоксазолы (EP418175, EP470856, EP487352, EP527036, EP560482, EP682659, Патент США No. 5424276), в частности, изоксафлутол, который является селективным гербицидом маиса, дикетонитрилы (EP496630, EP496631), в частности, 2-циано-3-циклопропил-1-(2-SO2CH3-4-CF3-фенил)пропан-1,3-дион и 2-циано-3-циклопропил-1-(2-SO2CH3-4-2,3Cl2-фенил)пропан-1,3-дион, трикетоны (EP625505, EP625508, патент США No. 5506195), в частности, сулькотрион и пиразолинаты. Ген, который продуцирует избыток HPPD в растениях, может обеспечивать толерантность или устойчивость к таким гербицидам, включая, например, гены, описанные в патентах США No. 6268549 и 6245968, и публикации патентной заявки США No. 20030066102.

(E) Гены, которые кодируют устойчивость или толерантность к феноксиауксиновым гербицидам, таким как 2,4-дихлорфеноксиуксусная кислота (2,4-D), и которые могут также сообщать устойчивость или толерантность к арилоксифеноксипропионатным (AOPP) гербицидам. Примеры таких генов включают ген зависимого от α-кетоглутарата фермента диоксигеназы (aad-1), описанный в патенте США No. 7838733.

(F) Гены, которые кодируют устойчивость или толерантность к феноксиауксиновым гербицидам, таким как 2,4-дихлорфеноксиуксусная кислота (2,4-D), и которые также могут сообщать устойчивость или толерантность к пиридилоксиауксиновым гербицидам, таким как флуроксипир или триклопир. Примеры таких генов включают ген зависимого от α-кетоглутарата фермента (aad-12), описанный в WO 2007/053482 A2.

(G) Гены, кодирующие устойчивость или толерантность к дикамбе (см., например, публикацию Патента США No. 20030135879).

(H) Гены, обеспечивающие устойчивость или толерантность к гербицидам, ингибирующим протопорфириногеноксидазу (PPO) (см. Патент США No. 5767373).

(I) Гены, обеспечивающие устойчивость или толерантность к триазиновым гербицидам (таким как атразин) и производным мочевины (таким как диурон), которые связываются с коровыми белками реакционных центров фотосистемы II (PS II) (См. Brussian et al., (1989) EMBO J. 1989, 8(4): 1237-1245.

3. Гены, которые сообщают полезный признак или вносят вклад в полезный признак

(A) Модифицированный метаболизм жирных кислот, например, путем трансформации маиса или Brassica антисмысловым геном или стеароил-ACP-десатуразой для увеличения содержания стеариновой кислоты в растении (Knultzon et al., 1992) Proc. Nat. Acad. Sci. USA 89:2624.

(B) Сниженное содержание фитатов

(1) Введение кодирующего фитазу гена, такого как ген фитазы Aspergillus niger (Van Hartingsveldt et al., 1993 Gene 127:87), усиливает расщепление фитатов, увеличивая содержание свободного фосфата в трансформированном растении.

(2) Можно вводить ген, который снижает содержание фитатов. В маисе этого можно достигать, например, путем клонирования, а затем повторного введения ДНК, ассоциированной с одним аллелем, ответственным за мутанты маиса, характеризующиеся низкими уровнями фитиновой кислоты (Raboy et al., 1990 Maydica 35:383).

(C) Модифицированный углеводный состав, достигаемый, например, посредством трансформации растений геном, кодирующим фермент, который изменяет характер ветвления крахмала. Примеры таких ферментов включают ген фруктозилтрансферазы Streptococcus mucus (Shiroza et al., 1988) J. Bacteriol. 170:810, ген левансахаразы Bacillus subtilis (Steinmetz et al., 1985 Mol. Gen. Genel. 200:220), α-амилазы Bacillus licheniformis (Pen et al., 1992 Bio/Technology 10:292), гены инвертазы томата (Elliot et al., 1993), ген амилазы ячменя (Sogaard et al., 1993 J. Biol. Chem. 268:22480) и фермент ветвления крахмала эндосперма маиса II (Fisher et al., 1993 Plant Physiol. 102:10450).

III. Рекомбинантные конструкции

Как описано в настоящем документе, настоящее изобретение относится к рекомбинантным геномным последовательностям, содержащим оптимальную внегенную геномную последовательность маиса размером по меньшей мере 1 т.п.о. и представляющую интерес ДНК, где вставленная представляющая интерес ДНК вставлена в указанную внегенную последовательность. В одном варианте осуществления представляющая интерес ДНК представляет собой аналитический домен, ген или кодирующую последовательность (например, иРНК), которая сообщает устойчивость к паразитам или заболеванию, гены, которые сообщают устойчивость к гербициду, или гены, которые сообщают полезный признак или вносят вклад в полезный признак, и оптимальная внегенная геномная последовательность маиса обладает 1, 2, 3, 4, 5, 6, 7 или 8 из следующих характеристик:

a. внегенная последовательность имеет длину от приблизительно 1 т.п.о. до приблизительно 8,3 т.п.о. и не содержит метилированный полинуклеотид;

b. внегенная последовательность обладает частотой рекомбинации от 0,00041 до 62,42 cM/млн.п.о. в геноме однодольного растения, такого как растение маиса;

c. внегенная последовательность проявляет уровень занятости нуклеосомами от 0 до 0,962 в геноме однодольного растения, такого как геном маиса;

d. внегенная последовательность обладает менее чем 40% идентичностью последовательности с любой другой последовательностью, содержащейся в геноме однодольного растения, таком как геном маиса;

e. внегенная последовательность обладает значением относительного расположения, равным отношением от 0,00373 до 0,99908, для геномного расстояния от центромеры хромосомы однодольного растения, такой как центромера хромосомы маиса;

f. внегенная последовательность обладает процентным содержанием гуанина/цитозина в диапазоне от 25,17 до 68,3%;

g. внегенная последовательность расположена вблизи генной последовательности, содержащей известную или прогнозируемую кодирующую последовательность однодольного растения, такую как кодирующая последовательность маиса, в пределах 40 т.п.о. непрерывной геномной ДНК, содержащей нативную внегенную последовательность; и,

h. внегенная последовательность расположена в области геномной последовательности однодольного растения размером 1 млн.п.о., такой как геномная последовательность маиса, которая содержит по меньшей мере вторую внегенную последовательность. В одном варианте осуществления оптимальная внегенная геномная последовательность маиса далее охарактеризована как имеющая генную область, содержащую от 1 до 9 известных или прогнозируемых кодирующих последовательностей однодольных растений, таких как кодирующие последовательности маиса, в пределах 40 т.п.о. непрерывной геномной ДНК, содержащей нативную внегенную последовательность. В одном варианте осуществления оптимальный внегенный локус маиса выбран из локусов кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 3, 4, 5, 6, 7, 8, 9, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 или 32.

IV. Трансгенные растения

Также в соответствии с одним вариантом осуществления настоящего изобретения представлены трансгенные растения, содержащие рекомбинантные оптимальные внегенные локусы маиса. Такие трансгенные растения можно получать с использованием способов, известных специалистам в данной области.

Трансформированную клетку, каллюс, ткань или растение однодольного растения (такие как клетка, каллюс, ткань или растение маиса) можно идентифицировать и выделять посредством отбора или скрининга сконструированного растительного материала по признакам, кодируемым маркерными генами, присутствующими на трансформирующей ДНК. Например, отбор можно проводить посредством выращивания сконструированного растительного материала на средах, содержащих ингибирующее количество антибиотика или гербицида, к которым трансформирующая генная конструкция сообщает устойчивость. Кроме того, трансформированные клетки также можно идентифицировать посредством скрининга по активности любых генов видимых маркеров (например, гены желтого флуоресцентного белка, зеленого флуоресцентного белка, красного флуоресцентного белка, бета-глюкуронидазы, люциферазы, B или C1), которые могут присутствовать в рекомбинантных конструкциях нуклеиновых кислот. Такие способы отбора и скрининга хорошо известны специалистам в данной области.

Физические и биохимические способы также можно использовать для идентификации трансформантов растений или клеток растений, содержащих вставленные генные конструкции. Эти способы включают, но без ограничения: 1) саузерн-анализ или амплификацию ПЦР для детекции и определения структуры вставки рекомбинантной ДНК; 2) нозерн-блоттинг, защиту от РНКазы S1, удлинение праймера или амплификацию ПЦР с использованием обратной транскриптазы для обнаружения и исследования транскриптов РНК генных конструкций; 3) ферментные анализы для обнаружения активности фермента или рибозима, где такие продукты генов кодированы генной конструкцией; 4) электрофорез белков в геле, способы вестерн-блоттинга, иммунопреципитацию или твердофазные иммуноферментные анализы (ELISA), где продуктами генной конструкции являются белки. Дополнительные способы, такие как гибридизация in situ, окрашивание ферментом и иммунное окрашивание, также можно использовать для детекции присутствия или экспрессии рекомбинантной конструкции в конкретных органах и тканях. Способы проведения всех этих анализов хорошо известны специалистам в данной области.

Эффекты манипуляции с генами с использованием способов, описанных в настоящем документе, можно наблюдать, например, с использованием нозерн-блоттинга РНК (например, мРНК), выделенной из представляющих интерес тканей. Как правило, если мРНК присутствует или количество мРНК увеличивается, можно предположить, что соответствующий трансген экспрессируется. Можно использовать другие способы измерения активности гена и/или кодируемого полипептида. Можно использовать различные типы ферментных анализов, в зависимости от используемого субстрата и способа детекции увеличения или уменьшения количества продукта реакции или побочного продукта. Кроме того, уровни экспрессированного полипептида можно измерять иммунохимически, т.е. с использованием ELISA, RIA, EIA и других анализов на основе антител, хорошо известных специалистам в данной области, таких как анализы с электрофоретической детекцией (либо посредством окрашивания, либо можно использовать вестерн-блоттинга). В качестве одного неограничивающего примера детекция белков AAD-12 (арилоксиалканоатдиоксигеназы; см. WO 2011/066360) и PAT (фосфинотрицин-N-ацетил-трансферазы (PAT)) с использованием анализа ELISA описана в публикации Патента США No. 20090093366, полное содержание которой включено в настоящее описание в качестве ссылки. Трансген может селективно экспрессироваться в некоторых тканях растения или на некоторых стадиях развития, или трансген может экспрессироваться по существу во всех тканях растений, по существу на протяжении всего их жизненного цикла. Однако применим также любой комбинаторный способ экспрессии.

Специалисту в данной области понятно, что после стабильного включения экзогенной полинуклеотидной донорной последовательности в трансгенные растения и подтверждения ее функциональности, ее можно вводить в другие растения посредством полового скрещивания. Можно использовать любой из ряда стандартных способов разведения, в зависимости от вида, подлежащего скрещиванию.

Настоящее изобретение также охватывает семена трансгенных растений, описанных выше, где семя обладает трансгеном или генной конструкцией. Кроме того, настоящее изобретение охватывает потомство, клоны, клеточные линии или клетки трансгенных растений, описанных выше, где указанное потомство, клон, клеточная линия или клетка обладают трансгеном или генной конструкцией.

Трансформированные клетки растений, полученные любыми из описанных выше способов трансформации, можно культивировать для регенерации целого растения, обладающего трансформированным генотипом и, таким образом, желательным фенотипом. Такие способы регенерации основаны на манипуляции определенными фитогормонами в среде для роста культуры тканей, как правило, на основе биоцидного и/или гербицидного маркера, который введен вместе с желательными нуклеотидными последовательностями. Регенерация растений из культивируемых протопластов описана в Evans, et al., «Protoplasts Isolation and Culture», Handbook of Plant Cell Culture, pp. 124-176, Macmillian Publishing Company, New York, 1983; и Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Регенерацию также можно осуществлять из каллюса, эксплантатов, органов, пыльцы, зародышей или частей растений. Такие способы регенерации описаны в общем в Klee et al. (1987) Ann. Rev. of Plant Phys. 38:467-486.

Трансгенное растение или растительный материал, содержащие нуклеотидную последовательность, кодирующую полипептид, в некоторых вариантах осуществления могут обладать одной или несколькими из следующих характеристик: экспрессия полипептида в клетке растения; экспрессия части полипептида в пластиде клетки растения; импорт полипептида из цитозоля клетки растения в пластиду клетки; специфическая для пластид экспрессия полипептида в клетке растения; и/или локализация полипептида в клетке растения. Такое растение, кроме того, может обладать одним или несколькими желательными признаками, отличными от экспрессии кодируемого полипептида. Такие признаки могут включать, например: устойчивость к насекомым, другим вредителям и возбудителям заболеваний; толерантность к гербицидам; повышенную стабильность, выход и срок хранения; устойчивость к условиям окружающей среды; фармацевтическую продукцию; продукцию промышленных продуктов и повышение питательной ценности.

В соответствии с одним вариантом осуществления представлен трансгенный протопласт однодольного растения, содержащий рекомбинантный оптимальный внегенный локус однодольного растения. Более конкретно, представлен протопласт однодольного растения, содержащий представляющую интерес ДНК, вставленную в оптимальные внегенные геномные локусы протопластов однодольных растений, где указанные внегенные геномные локусы однодольных растений имеют длину от приблизительно 1 т.п.о. до приблизительно 8,3 т.п.о. и лишены каких-либо метилированных нуклеотидов. В одном варианте осуществления трансгсенный протопласт однодольного растения содержит представляющую интерес ДНК, вставленную в оптимальный внегенный геномный локус однодольного растения, где представляющая интерес ДНК содержит аналитический домен и/или открытую рамку считывания. В одном варианте осуществления вставленная представляющая интерес ДНК кодирует пептид, и в следующем варианте осуществления представляющая интерес ДНК содержит по меньшей мере одну кассету для экспрессии гена, содержащую трансген.

В соответствии с одним вариантом осуществления представлен трансгенный протопласт маиса, содержащий рекомбинантный оптимальный внегенный локус маиса. Более конкретно, представлен протопласт маиса, содержащий представляющую интерес ДНК, вставленную в оптимальные внегенные геномные локусы протопластов однодольных растений, где указанные внегенные геномные локусы маиса имеют длину от приблизительно 1 т.п.о. до приблизительно 8,3 т.п.о. и лишены каких-либо метилированных нуклеотидов. В одном варианте осуществления трансгсенный протопласт маиса содержит представляющую интерес ДНК, вставленную в оптимальный внегенный геномный локус маиса, где представляющая интерес ДНК содержит аналитический домен и/или открытую рамку считывания. В одном варианте осуществления вставленная представляющая интерес ДНК кодирует пептид, и в следующем варианте осуществления представляющая интерес ДНК содержит по меньшей мере одну кассету для экспрессии гена, содержащую трансген.

В соответствии с одним вариантом осуществления представлено трансгенное однодольное растение, часть однодольного растения или клетка однодольного растения, содержащие рекомбинантный оптимальный внегенный локус однодольного растения. Более конкретно, представлено однодольное растение, часть однодольного растения или клетка однодольного растения, содержащие представляющую интерес ДНК, встапвленную в оптимальные внегенные геномные локусы однодольного растения, части однодольного растения или клетки однодольного растения, где указанные внегенные геномные локусы однодольного растения имеют длину от приблизительно 1 т.п.о. до приблизительно 8,5 т.п.о. и лишены каких-либо метилированных нуклеотидов. В одном варианте осуществления трансгенное однодольное растение, часть однодольного растения или клетка однодольного растения содержат представляющую интерес ДНК, вставленную в оптимальный внегенный геномный локус однодольного растения, где представляющая интерес ДНК содержит аналитический домен и/или открытую рамку считывания. В одном варианте осуществления встроенная представляющая интерес ДНК кодирует пептид, а в следующем варианте осуществления - трансген.

В соответствии с одним вариантом осуществления представлено трансгенное растение маиса, часть растения маиса или клетка растения маиса, содержащие рекомбинантный оптимальный внегенный локус маиса. Более конкретно, представлено растение маиса, часть растения маиса или клетка растения маиса, содержащие представляющую интерес ДНК, встапвленную в оптимальные внегенные геномные локусы маиса, части растения маиса или клетки растения маиса, где указанные внегенные геномные локусы маиса имеют длину от приблизительно 1 т.п.о. до приблизительно 8,5 т.п.о. и лишены каких-либо метилированных нуклеотидов. В одном варианте осуществления трансгенное растение маиса, часть растения маиса или клетка растения маиса содержат представляющую интерес ДНК, вставленную в оптимальный внегенный геномный локус маиса, где представляющая интерес ДНК содержит аналитический домен и/или открытую рамку считывания. В одном варианте осуществления встроенная представляющая интерес ДНК кодирует пептид, а в следующем варианте осуществления представляющая интерес ДНК содержит по меньшей мере одну кассету для экспрессии гена, содержащую трансген.

В соответствии с вариантом осуществления 1, представлена рекомбинантная последовательность, где указанная рекомбинантная последовательность содержит

внегенную геномную последовательность маиса из по меньшей мере 1 т.п.о., где указанная внегенная последовательность является гипометилированной, поддающейся нацеливанию, является локализованной вблзи генной области в геноме маиса и демонстрирует признаки рекомбинации; и

представляющую интерес ДНК, где представляющая интерес ДНК вставлена в указанную внегенную последовательность. В соответствии с вариантом осуществления 2, представлена рекомбинантная последовательность из варианта осуществления 1, где указанная внегенная последовательность обладает следующими характеристиками:

a. уровень метилирования указанной внегенной последовательности составляет 1% или менее;

b. указанная внегенная последовательность разделяет менее 40% идентичности последовательности с любой другой последовательностью, содержащейся в геноме Zea mays;

c. указанная внегенная последовательность локализована в пределах области 40 т.п.о. от известной или прогнозируемой экспрессируемой кодирующей последовательности маиса; и

d. указанная внегенная последовательность обладает частотой рекомбинации в геноме маиса более 0,00041 сМ/млн.п.о. В соответствии с вариантом осуществления 3, представлена рекомбинантная последовательность из варианта осуществления 1 или 2, где указанная внегенная последовательность обладает максимальной длиной 8,3 т.п.о. В соответствии с вариантом осуществления 4, представлена рекомбинантная последовательность из любого из вариантов осуществления 1-3, где указанная внегенная последовательность обладает 1% или менее метилирования нуклеотидов. В соответствии с вариантом осуществления 5, представлена рекомбинантная последовательность из любого из вариантов осуществления 1-4, где указанная внегенная последовательность имеет длину 1 т.п.о. - 8,3 т.п.о. и не содержит метилированных остатков цитозина. В соответствии с вариантом осуществления 6, представлена рекомбинантная последовательность из любого из вариантов осуществления 1-5, где указанная внегенная последовательность не выравнивается с более чем 40% идентичностью последовательности с любой другой последовательностью в геноме Zea mays. В соответствии с вариантом осуществления 7, представлена рекомбинантная последовательность из любого из вариантов осуществления 1-5, где указанная внегенная последовательность демонстрирует признаки рекомбинации с частотой рекомбинации более 0,00041 сМ/млн.п.о. В соответствии с вариантом осуществления 8, представлена рекомбинантная последовательность из любого из вариантов осуществления 1-5, где область 40 т.п.о. нативного генома маиса, содержащая указанную внегенную последовательность, содержит также по меньшей мере одну известную или прогнозируемую кодирующую последовательность маиса, или последовательность, содержащую 2 т.п.о. выше и/или 1 т.п.о. ниже последовательности известного гена маиса. В соответствии с вариантом осуществления 9, представлена рекомбинантная последовательность из любого из вариантов осуществления 1-8, где указанная известная или прогнозируемая кодирующая последовательность маиса экспрессирует белок маиса. В соответствии с вариантом осуществления 10, представлена рекомбинантная последовательность из любого из вариантов осуществления 1-9, где указанная внегенная последовательность не содержит метилированный полинуклеотид. В соответствии с вариантом осуществления 11, представлена рекомбинантная последовательность из любого из вариантов осуществления 1-10, где один конец указанной внегенной последовательности находится в пределах 40 т.п.о. от экспрессируемого эндогенного гена. В соответствии с вариантом осуществления 12, представлена рекомбинантная последовательность из любого из вариантов осуществления 1-11, где указанная рекомбинантная последовательность содержит представляющую интерес ДНК, содержащую аналитический домен. В одном из вариантов осуществления представляющая интерес ДНК из варианта осуществления 12 не кодирует пептид. В одном из вариантов осуществления представляющая интерес ДНК кодирует пептид, необязательно, в варианте осуществления 15, представляющая интерес ДНК содержит экспрессирующую генную кассету, содержащую ген устойчивости к инсектицидам, ген устойчивости к гербицидам, ген эффективности усвоения азота, ген эффективности усвоения воды, ген пищевой ценности, ген связывающего ДНК белка и ген селективного маркера.

В соответствии с вариантом осуществления 16, представлена рекомбинантная последовательность из варианта осуществления 1, где указанная рекомбинантная последовательность обладает следующими характеристиками:

a. указанная внегенная последовательность содержит менее 1% метилирования ДНК;

b. указанная внегенная последовательность обладает частотой рекомбинации в геноме маиса 0,00041-62,42 сМ/млн.п.о.;

c. указанная внегенная последовательность обладает уровнем занятости нуклеосомами в геноме маиса 0-0,962;

d. указанная внегенная последовательность разделяет менее 40% идентичности последовательности с любой другой последовательностью, содержащейся в геноме маиса;

e. указанная внегенная последовательность обладает значением относительного расположения с отношением геномного расстояния от центромеры хромосомы маиса 0,00373-0,99908;

f. указанная внегенная последовательность обладает процентным содержанием гуанина/цитозина в диапазоне 25,17-68,3%;

g. указанная внегенная последовательность локализована вблизи генной последовательности; и,

h. указанная внегенная последовательность локализована в области 1 млн.п.о. геномной последовательности маиса, содержащей одну или несколько дополнительных внегенных последовательностей. В варианте осуществления 17 представлены растение маиса, часть растения маиса или клетка растения маиса, содержащие рекомбинантную последовательность из любого из вариантов осуществления 1-16. В соответствии с вариантом осуществления 18, представлены растение маиса, часть растения маиса или клетка растения маиса из варианта осуществления 17, где указанная известная или прогнозируемая кодирующая последовательность маиса экспрессируется на уровне, лежащем в диапазоне от 0,00369 до 2233,06. В соответствии с вариантом осуществления 19, представлены растение маиса, часть растения маиса или клетка растения маиса из варианта осуществления 17 или 18 с рекомбинантной последовательностью из вариантов осуществления 1-16, где указанная представляющая интерес ДНК и/или указанная внегенная последовательность модифицированы посредством вставки указанной представляющей интерес ДНК в указанную внегенную последовательность.

В соответствии с вариантом осуществления 32, представлена рекомбинантная поддающаяся нацеливанию внегенная геномная последовательность маиса, содержащая:

внегенную последовательность из по меньшей мере 1 т.п.о., выбранную из группы, состоящей из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 или последовательности, разделяющей 99% идентичности последовательности с последовательностью, выбранной из группы, состоящей из кластера 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 и соответствующих комплементарных им последовательностей, где указанные кластеры получены по статистическому алгоритму PCA, включающему значения PCA, определенные в таблице 6; и

представляющую интерес ДНК, вставленную в указанную внегенную последовательность. В соответствии с вариантом осуществления 33 представлена поддающаяся нацеливанию внегенная геномная последовательность маиса из варианта осуществления 32, где указанная представляющая интерес ДНК содержит аналитический домен. В соответствии с вариантом осуществления 34, представлена поддающаяся нацеливанию внегенная геномная последовательность маиса из любого из вариантов осуществления 32 или 33, где указанная представляющая интерес ДНК кодирует пептид. В соответствии с вариантом осуществления 35, представлена поддающаяся нацеливанию внегенная геномная последовательность маиса из любого из варианта осуществления 32-34, где указанная представляющая интерес ДНК содержит экспрессирующую генную кассету, содержащую трансген. В соответствии с вариантом осуществления 36, представлена поддающаяся нацеливанию внегенная геномная последовательность маиса из любого из вариантов осуществления 32-35, где указанная представляющая интерес ДНК содержит сайт-специфический участок расщепления, где, необязательно, указанный сайт-специфический участок расщепления расщепляется нуклеазой, включая, например, нуклеазу с цинковыми пальцами, нуклеазу CRISPR, TALEN, эндонуклеазу хоминга или мегануклеазу. В соответствии с вариантом осуществления 39, представлена поддающаяся нацеливанию внегенная геномная последовательность маиса из любого из вариантов осуществления 32-36, где вставка указанной представляющей интерес ДНК в указанную внегенную последовательность приводит к модификации указанной представляющей интерес ДНК и/или указанной внегенной последовательности.

В соответствии с вариантом осуществления 40, представлена очищенная внегенная геномная последовательность маиса из по меньшей мере 1 т.п.о., где указанная внегенная последовательность является гипометилированной, поддающейся нацеливанию, расположенной вблизи генной области в геноме маиса, и демонстрирующей признаки рекомбинации. В соответствии с вариантом осуществления 41, представлена очищенная последовательность из варианта осуществления 40, где указанная внегенная последовательность обладает следующими характеристиками:

a. уровень метилирования указанной внегенной последовательности составляет 1% или менее;

b. указанная внегенная последовательность разделяет менее 40% идентичности последовательности с любой другой последовательностью, содержащейся в геноме Zea mays;

c. указанная внегенная последовательность локализована в области 40 т.п.о. от известной или прогнозируемой экспрессируемой кодирующей последовательности маиса; и

d. указанная внегенная последовательность обладает частотой рекомбинации в геноме маиса более 0,00041 сМ/млн.п.о. В соответствии с вариантом осуществления 42, представлена очищенная внегенная геномная последовательность маиса из любого из вариантов осуществления 40-41, где указанная внегенная последовательность обладает максимальной длиной 8,3 т.п.о. В соответствии с вариантом осуществления 43, представлена очищенная последовательность из любого из вариантов осуществления 40-42, где указанная последовательность обладает следующими характеристиками:

a. указанная внегенная последовательность содержит менее 1% метилирования ДНК в ее нативной локализации;

b. указанная внегенная последовательность, в ее нативной локализации, обладает частотой рекомбинации в геноме маиса 0,00041-62,42 сМ/млн.п.о.;

c. указанная внегенная последовательность обладает уровнем занятости нуклеосомами в геноме маиса 0-0,962, в ее нативной локализации;

d. указанная внегенная последовательность разделяет менее 40% идентичности последовательности с любой другой последовательностью, содержащейся в геноме маиса;

e. указанная внегенная последовательность обладает значением относительного расположения с отношением геномного расстояния от центромеры хромосомы маиса 0,00373-0,99908, в ее нативной локализации;

f. указанная внегенная последовательность обладает процентным содержанием гуанина/цитозина в диапазоне 25,17-68,3%;

g. указанная внегенная последовательность локализована в пределах 40 т.п.о. от известной или прогнозируемой кодирующей последовательности маиса, или последовательности, содержащей область 2 т.п.о. выше и 1 т.п.о. ниже известного гена, в ее нативной локализации; и

h. указанная внегенная последовательность локализована в области 1 млн.п.о. геномной последовательности маиса, содержащей одну или несколько дополнительных внегенных последовательностей, в ее нативной локализации.

ПРИМЕРЫ

Пример 1: Идентификация поддающихся нацеливанию геномных локусов в Zea mays

Геном Zea mays подвергали скринингу с помощью биоинформатического подхода с использованием конкретных критериев для выбора оптимальных геномных локусов для нацеливания полинуклеотидного донора. Конкретные критерии, используемые для выбора геномных локусов, разрабатывали с учетом аспектов оптимальной экспрессии трансгена в геноме растения, аспектов оптимального связывания геномной ДНК сайт-специфическим ДНК-связывающим белком и требований по разработке трансгенного растительного продукта. Для идентификации и отбора геномных локусов базы геномных и эпигеномных данных для генома Zea mays сканировали с использованием биоинформатического способа. Скрининг баз геномных и эпигеномных данных привел к выбору локусов, удовлетворяющих следующим критериям: 1) гипометилированные и превышающие 1 т.п.о. в длину; 2) поддающиеся нацеливанию через опосредуемую сайт-специфической нуклеазой интеграцию полинуклеотидного донора; 3) агрономически нейтральные или внегенные; 4) области, с которых можно экспрессировать интегрированный трансген; и 5) области с рекомбинацией в локусе/вокруг локуса. Соответственно, с использованием этих конкретных критериев идентифицировано всего 5286 геномных локусов (SEQ ID NO: 1-SEQ ID NO: 5286). Эти конкретные критерии дополнительно подробно описаны ниже.

Гипометилирование

Геном Zea mays сканировали для выбора оптимальных геномных локусов, превышающих 1 т.п.о., обладающих гипометилированной ДНК. Уровни метилирования ДНК по всему геному тканей корней и побегов, выделенных из Zea mays c.v. B73, получали посредством биоинформатического способа с использованием данных параллельного секвенирования Illumina/Solexa 1G. Данные получали для геномной ДНК, выделенной из вышеописанных тканей растения Zea mays согласно способу, описанному Wang et al., (2009) Genome-Wide and Organ-Specific Landscapes of Epigenetic Modifications and Their Relationships to mRNA and Small RNA Transcriptomes in Maize. Plant Cell 21(4): 1053-1069). Эти данные доступны в NCBI Genbank, номер доступа; GEO:GSE1 5286. Необработанные прочтения секвенирования собирали и картировали в эталонном геноме Zea mays c.v. B73 с использованием программного обеспечения для картирования Bismark, как описано в Krueger F, Andrews SR (2011) Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications (Bioinformatics 27: 1571-1572).

Уровень метилирования для каждого основания цитозина в геноме вычисляли как процент от количества метилированных считанных последовательностей, картирующих конкретное положение остатка цитозина, к общему количеству считанных последовательностей, картирующих это положение. Ниже представлено гипотетическое объяснение того, каким образом уровни метилирования рассчитывали для каждого основания в геноме Zea mays. Например, можно рассмотреть случай, когда существует цитозиновое основание в положении 100 эталонной последовательности хромосомы 1 Zea mays c.v. B73. Если существует всего 20 считанных последовательностей, картирующих остаток цитозина в положении 100, и 10 из этих считанных последовательностей являются метилированными, тогда уровень метилирования для основания цитозина в положении 100 хромосомы 1 оценивают как 50%. Соответственно, рассчитывали профиль уровня метилирования для всех пар оснований геномной ДНК, полученной из ткани корней и побегов Zea mays. Считанные последовательности, которые нельзя было правильно картировать в уникальных положениях в геноме Zea mays, соответствовали повторяющимся последовательностям, которые широко распространены в геноме Zea mays, и как известно в данной области, являются преимущественно метилированными.

С использованием вышеописанного способа измеряли уровни метилирования для генома Zea mays c.v. B73. По существу области генома Zea mays, содержащие данные о наличии метилирования, показали, что эти области генома Zea mays являлись метилированными. Напротив, области генома Zea mays, в которых отсутствовали данные о наличии метилирования, показали, что эти области генома Zea mays являлись неметилированными. Области генома Zea mays из тканей побегов и корней, которые являлись неметилированными и не содержали каких-либо данных о наличии метилирования, считали «гипометилированными» областями. Чтобы сделать профили метилирования в корнях и побегах доступными для визуализации, для каждой из хромосом Zea mays c.v. B73 строили графики колебаний (http://useast.ensembl.org/info/website/upload/wig.html). Образец снимка экрана графика колебаний для профиля метилирования ДНК тканей корней и побегов, полученных из хромосомы номер 1 Zea mays c.v. B73, показан на фигуре 1.

Профили метилирования, идентифицированные для тканей корней и побегов Zea mays c.v. B73, как описано выше, объединяли с получением консенсусного профиля метилирования и использовали для идентификации гипометилированных областей в геноме Zea mays c.v. B73. Полученный геномный консенсусный профиль метилирования Zea mays сканировали для идентификации геномных положений без признаков метилирования, т.е. не содержащих данных о картировании метилирования. Идентифицировали фрагменты геномной ДНК длиннее 100 п.о., которые являлись гипометилированными. Конкретную длину каждой из этих гипометилированных областей рассчитывали посредством определения общего количества пар оснований между двумя геномными областями, демонстрирующими признаки метилирования. В таблице 1 обобщены идентифицированные гипометилированные области. Кроме того, распределение длины гипометилированных областей генома Zea mays c.v. B73 показано на фигуре 2.

Таблица 1
Профиль гипометилирования генома Zea mays c.v. B73
Общий размер генома Zea mays c.v. B73 ~2,1×109 п.о.
Общая объединенная длина гипометилированной области ~663 млн.п.о. (31,5% генома Zea mays c.v. B73)
Количество гипометилированных областей более 100 п.о. 1564310
Количество гипометилированных областей более 1 т.п.о. 130917
Количество гипометилированных областей более 2 т.п.о. 47045
Количество гипометилированных областей более 10 т.п.о. 206
Минимальная длина гипометилированной области 100 п.о.
Максимальная длина гипометилированной области 90202 п.о.

Эти гипометилированные области генома Zea mays c.v. B73 далее характеризовали для идентификации и выбора конкретных геномных локусов, поскольку свободный от метилирования контекст этих областей указывал на присутствие открытого хроматина. Таким образом, все последующие анализы проводили на идентифицированных гипометилированных областях.

Возможность нацеливания

Гипометилированные участки, идентифицированные в Zea mays c.v. B73, далее анализировали для определения того, какие участки являлись поддающимися нацеливанию посредством опосредуемого сайт-специфической нуклеазой интеграции полинуклеотидного донора. В данной области известно, что геном Zea mays содержит длинные участки высокоповторяющейся ДНК которые являются метилированными и имеют высокие уровни дупликации последовательности. Аннотирующую информацию об известных повторяющихся областях в геноме Zea mays получали из Maize Genome Database (доступной на http://www.maizegdb.org/, и Lawrence, CJ et al (2008) MaizeGDB: The Maize Model Organism Database for Basic, Translational, and Applied Research. Int J Plant Genomics. 2008:496957).

Соответственно, гипометилированные участки, идентифицированные выше, подвергали скринингу для удаления каких-либо участков, выравнивающихся с известными повторяющимися областями, аннотированными в геноме маиса. Оставшиеся гипометилированные участки, прошедшие этот первый скрининг, затем сканировали с использованием поиска гомологии на основе BLAST™ в базе данных генома маиса посредством запуска программного обеспечения NCBI BLAST™ (версия 2.2.23) с использованием настроек с параметрами по умолчанию (Stephen F. Altschul et al (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402). В результате скрининга BLAST™, любые гипометилированные участки, обладающие значительным совпадением где-либо в геноме, с охватом выравнивания последовательностей более 40%, исключали из дальнейшего анализа.

Агрономически нейтральные или внегенные локусы

Гипометилированные участки, идентифицированные в Zea mays c.v. B73 далее анализировали для определения того, какие участки являлись агрономически нейтральными или внегенными. Таким образом, гипометилированные участки, описанные выше, подвергали скринингу для удаления каких-либо участков, перекрывающих или содержащих любую из известных или прогнозируемых эндогенных кодирующих последовательностей Zea mays c.v. B73. Для этой цели аннотирующие данные известных генов и информацию о данных картирования маркеров экспрессируемой последовательности (EST) получали из Maize Genomic Database (доступной на www.maizegdb.org и Monaco, M., et al., Maize Metabolic Network Construction and Transcriptome Analysis. doi:10.3835/plantgenome2012.09.0025; Posted online 23 Jan. 2013). Рассматривали также любую геномную область непосредственно на 2 т.п.о. выше и на 1 т.п.о. ниже открытой рамки считывания. Эти вышележащие и нижележащие области могут содержать известные или неизвестные консервативные регуляторные элементы, которые необходимы для функции гена. Гипометилированные участки, ранее описанные выше, анализировали по присутствию известных генов (включая области 2 т.п.о. выше и 1 т.п.о. ниже) и EST. Любые гипометилированные участки, которые выравнивались или перекрывались с известными генами (включая области 2 т.п.о. выше и 1 т.п.о. ниже) или EST, исключали из последующего анализа.

Экспрессия

Гипометилированные участки, идентифицированные в Zea mays c.v. B73, далее анализировали для определения того, какие участки находятся вблизи экспрессируемого гена маиса. Уровень экспрессии транскриптов генов Zea mays измеряли посредством анализа данных профилирования транскриптома, полученных для тканей корней и побегов Zea mays c.v. B73, с использованием способа RNAseq™, как описано в Wang et al., (2009) Genome-Wide and Organ-Specific Landscapes of Epigenetic Modifications and Their Relationships to mRNA and Small RNA Transcriptomes in Maize. Plant Cell. 21(4): 1053-1069. Для каждого гипометилированного участка проводили анализ для идентификации любых аннотированных генов, присутствующих в пределах области 40 т.п.о. вблизи гипометилированного участка, и среднего уровня экспрессии аннотированного гена(генов), расположенных вблизи гипометилированного участка. Гипометилированные участки, расположенные более чем на 40 т.п.о. от аннотированного гена с отличным от нуля средним уровнем экспрессии, определяли как не являющиеся расположенными близко к экспрессируемому гену Zea mays и исключали из дальнейших анализов.

Рекомбинация

Гипометилированные участки, идентифицированные в Zea mays c.v. B73, далее анализировали для определения того, какие участки имеют признаки рекомбинации и могут облегчать интрогрессию оптимальных геномных локусов в другие линии Zea mays посредством общепринятого скрещивания. Разнообразные генотипы Zea mays обычно скрещивают в процессе общепринятого разведения для разработки новых и усовершенствованных линий Zea mays, обладающих признаками, представляющими агрономический интерес. Таким образом, агрономические признаки, которые передаются путем интрогрессии в оптимальные геномные локусы в линии Zea mays посредством опосредуемой растением трансформации трансгеном, должны являться способными к дальнейшей интрогрессии в другие линии Zea mays, особенно элитные линии, посредством мейотической рекомбинации в процессе общепринятой селекции растений. Гипометилированные участки, описанные выше, подвергали скринингу для идентификации и отбора участков, обладающих некоторым уровнем мейотической рекомбинации. Любые гипометилированные участки, которые присутствовали в хромосомных областях, охарактеризованных как «холодные области» рекомбинации, идентифицировали и исключали. В Zea mays эти холодные области определяли с использованием набора данных о высоко разрешающих маркерах, полученных для множества популяций для картирования (Jafar Mammadov, Wei Chen, Anastasia Chueva, Karthik Muthuraman, Ruihua Ren, David Meyer, and Siva Kumpatla. 2011. Distribution of Recombinant Frequencies across the Maize Genome. 52nd Annual Maize Genetics Conference).

Частоту мейотической рекомбинации между любой парой геномных маркеров Zea mays на хромосоме рассчитывали на основании соотношения генетического расстояния между маркерами (в сантиморганах (cM)) и физического расстояния между маркерами (в миллионах пар оснований (млн.п.о.)). Например, если генетическое расстояние между парой маркеров составляло 1 cM, и физическое расстояние между парой маркеров составляло 2 млн.п.о., тогда определяли, что рассчитанная частота рекомбинации составляет 0,5 cM/млн.п.о. Для каждого гипометилированного участка, идентифицированного выше, выбирали пару маркеров на расстоянии по меньшей мере 1 млн.п.о. и вычисляли частоту рекомбинации. Этот способ использовали для рассчета частоты рекомбинации в гипометилированных участках. Любые гипометилированные участки с частотой рекомбинации 0,00041 cM/млн.п.о. идентифицировали и исключали из дальнейшего анализа. Остальные гипометилированные области, имеющие частоту рекомбинации более 0,000410 cM/млн.п.о., выбирали для дальнейшего анализа.

Идентификация оптимальных геномных локусов

Использование критериев отбора, описанных выше, привело к идентификации всего 52885 оптимальных геномных локусов из генома Zea mays. В таблице 2 обобщены длины идентифицированных оптимальных геномных локусов. Эти оптимальные геномные локусы обладают следующими характеристиками: 1) гипометилированные геномные локусы длиной более 1 т.п.о.; 2) геномные локусы, поддающиеся нацеливанию посредством опосредуемой сайт-специфической нуклеазой интеграции полинуклеотидного донора; 3) геномные локусы, которые являются агрономически нейтральными или внегенными; 4) геномные локусы, с которых может экспрессироваться трансген; и 5) признаки рекомбинации в геномных локусах. Из всех оптимальных геномных локусов, описанных в таблице 2, только оптимальные геномные локусы, которые имели размер более 1 т.п.о., далее анализировали и использовали для нацеливания донорной полинуклеотидной последовательности. Последовательности этих оптимальных геномных локусов описаны в качестве SEQ ID NO: 1-SEQ ID NO: 5286. В совокупности, эти оптимальные геномные локусы представляют собой положения в геноме Zea mays, на которые можно нацеливать донорную полинуклеотидную последовательность, как дополнительно продемонстрировано в настоящем документе ниже.

Таблица 2
Перечень диапазона размеров оптимальных геномных локусов, идентифицированных в геноме Zea mays, которые являются гипометилированными, демонстрируют признаки рекомбинации, поддаются нацеливанию, являются агрономически нейтральными или внегенными, и находятся вблизи экспрессируемого эндогенного гена
Количество оптимальных геномных локусов более 100 п.о. 52885
Количество оптимальных геномных локусов более 1 т.п.о. 5286
Количество оптимальных геномных локусов более 2 т.п.о. 770
Количество оптимальных геномных локусов более 4 т.п.о. 16

Пример 2: F-распределение и анализ главных компонентов для кластеризации оптимальных геномных локусов из Zea mays

5286 идентифицированных оптимальных геномных локусов (SEQ ID NO: 1-SEQ ID NO: 5286) далее анализировали с использованием статистических способов анализа F-распределения и анализа главных компонентов для определения репрезентативной выборки и кластеров для группировки оптимальных геномных локусов.

Анализ F-распределения

Идентифицированные 5286 оптимальных геномных локусов статистически анализировали с использованием статистического анализа непрерывного распределения вероятностей. В качестве варианта осуществления статистического анализа непрерывного распределения вероятностей, проводили тест F-распределения для определения репрезентативного количества оптимальных геномных локусов. Анализ критерия F-распределения проводили с использованием уравнений и способов, известных специалистам в данной области. Для более подробного руководства, анализ критерия F-распределения, как описано в K.M Remund, D. Dixon, DL. Wright and LR. Holden. Statistical considerations in seed purity testing for transgenic traits. Seed Science Research (2001) 11, 101-119, включенной в настоящее описание в качестве ссылки, является неограничивающим примером теста F-распределения. Тест F-распределения предполагает случайный выбор оптимальных геномных локусов, чтобы любые неприменимые локусы были равномерно распределены среди 5286 оптимальных геномных локусов, и это количество отобранных оптимальных геномных локусов составляло 10% или менее от общей выборки из 5286 оптимальных геномных локусов.

Анализ F-распределения показал, что 72 из 5286 оптимальных геномных локусов обеспечили репрезентативное количество для 5286 оптимальных геномных локусов с доверительным интервалом 95%. Соответственно, анализ F-распределения показал, что если бы тестировали 72 оптимальных геномных локуса и все они являлись поддающимися нацеливанию с помощью донорной полинуклеотидной последовательности, тогда эти результаты указывали бы на то, что 96% или более из 5286 оптимальных геномных локусов являются положительными с 95% доверительным интервалом. Наилучшей оценкой для валидации общего процента из 5286 оптимальных геномных локусов, было бы то, что 100% из 72 тестированных оптимальных геномных локусов являются поддающимися нацеливанию. Соответственно, 96% фактически является нижней границей истинного процента, валидированного при доверительном интервале 95%. Эта нижняя граница основана на 0,95 квантиле F-распределения для 95% доверительного интервала (Remund K, Dixon D, Wright D, и Holden L. Statistical considerations in seed purity testing for transgenic traits. Seed Science Research (2001) 11, 101-119).

Анализ главных компонентов

Затем осуществляли статистический способ анализа главных компонентов (PCA) для дальнейшей оценки и визуализации сходств и отличий в наборе данных, содержащем 5286 идентифицированных оптимальных геномных локусов, чтобы позволить отбор различных локусов для валидации нацеливания. PCA вовлекает математический алгоритм, который преобразует большее число коррелированных переменных в меньшее число некоррелированных переменных, называемых главными компонентами.

PCA выполняли для 5286 идентифицированных оптимальных геномных локусов посредством получения набора поддающихся расчету признаков или свойств, которые можно использовать для описания 5286 идентифицированных оптимальных геномных локусов. Каждый признак поддается численному расчету и определен специально для охвата геномного и эпигеномного контекста 5286 идентифицированных оптимальных геномных локусов. Идентифицирован набор из 10 признаков для каждого оптимального геномного локуса Zea mays, и он более подробно описан ниже.

1. Длина оптимальных геномных локусов

a. Длина оптимальных геномных локусов в этом наборе данных лежала в диапазоне от минимум 1000 п.о. до максимум 8267 п.о.

2. Частота рекомбинации в области 1 млн.п.о. вокруг оптимальных геномных локусов

a. В маисе частоту рекомбинации для положения на хромосоме определяли с использованием внутреннего высокоразрешающего набора данных о маркерах, полученного для множества популяций для картирования (Jafar Mammadov, Wei Chen, Anastasia Chueva, Karthik Muthuraman, Ruihua Ren, David Meyer, and Siva Kumpatla. 2011. Distribution of Recombinant Frequencies across the Maize Genome. 52nd Annual Maize Genetics Conference).

b. Частоты рекомбинации между любыми парами маркеров на хромосоме вычисляли, исходя из отношения генетического расстояния между маркерами (в сантиморганах (cM)) к физическому расстоянию между маркерами (в млн.п.о.). Например, если генетическое расстояние между парой маркеров составляет 1 cM, и физическое расстояние между той же парой маркеров составляет 2 млн.п.о., рассчитанная частота рекомбинации составляет 0,5 cM/млн.п.о. Для каждого оптимального геномного локуса выбирали пару маркеров на расстоянии по меньшей мере 1 млн.п.о. и рассчитывали частоту рекомбинации этим способом. Эти значения рекомбинации лежали в диапазоне от минимум 0,00041 cM/млн.п.о. до максимум 62,42 cM/млн.п.о.

3. Уровень уникальности последовательности оптимальных геномных локусов

a. Для каждого оптимального геномного локуса нуклеотидную последовательность оптимальных геномных локусов сканировали против генома Zea mays c.v. B73 с использованием поиска гомологии на основе BLAST™ с использованием программного обеспечения NCBI BLAST™+ (версии 2.2.23) с использованием настроек с параметрами по умолчанию (Stephen F. Altschul et al (1997), «Gapped BLAST and PSI-BLAST: a new generation of protein database search programs», Nucleic Acids Res. 25: 3389-3402). Поскольку эти оптимальные последовательности геномных локусов идентифицированы из генома Zea mays c.v. B73, первый положительный результат, идентифицированный в таком поиске, представляет собой саму последовательность Zea mays c.v. B73. Идентифицировали второй положительный результат BLAST™ для каждой последовательности оптимального геномного локуса, и охват выравнивания (представленный как процент оптимальных геномных локусов, охватываемых положительным результатом BLAST™) для положительного результата использовали в качестве показателя уникальности последовательности оптимального геномного локуса в геноме Zea mays. Эти значения охвата выравнивания для второго положительного результата BLAST™ лежали в диапазоне от минимум 0% до максимум 39,98% идентичности последовательностей. Любые последовательности, которые выравнивались при более высоких уровнях идентичности последовательностей, не рассматривали.

4. Расстояние от оптимальных геномных локусов до наиболее близкорасположенного гена в окружении

a. Аннотирующую информацию о генах и локализации известных генов в геноме Zea mays получали из Maize Genome Database (доступной на www.maizegdb.org, и Monaco, M., et al., Maize Metabolic Network Construction and Transcriptome Analysis. doi:10.3835/plantgenome2012.09.0025; Posted online 23 Jan. 2013). Для каждого оптимального геномного локуса идентифицировали наиболее близкий аннотированный ген, учитывая как вышележащие, так и нижележащие положения, и измеряли расстояние между последовательностью оптимального геномного локуса и геном (в п.о.). Например, если оптимальный геномный локус локализован на хромосоме 1 от положения 500 до положения 1500, и наиболее близкорасположенный ген к этому оптимальному геномному локусу локализован на хромосоме 1 от положения 2000 до положения 3000, расстояние от оптимальных геномных локусов до этого наиболее близкорасположенного гена вычисляют как 500 п.о. Эти значения для всего набора данных для 5286 оптимальных геномных локусов лежали в диапазоне от минимум 1001 п.о. до максимум 34809 п.о.

5. % GC в последовательности оптимальных геномных локусов

a. Для каждого оптимального геномного локуса анализировали нуклеотидную последовательность для оценки количества присутствующих остатков гуанина и цитозина. Это количество представляли в качестве процента от длины последовательности каждого оптимального геномного локуса, и оно обеспечивает измерение для % GC. Эти значения % GC для набора данных для оптимальных геномных локусов маиса лежат в диапазоне от 25,17% до 68,3%.

6. Количество генов в пределах 40 т.п.о. в окружении последовательностей оптимальных геномных локусов

a. Аннотирующую информацию о гене и локализацию известных генов в геноме Zea mays c.v. B73 получали из Maize Genome Database. Для каждой из 5286 последовательностей оптимальных геномных локусов определяли окно размером 40 т.п.о. вокруг последовательности оптимальных геномных локусов и подсчитывали количество аннотированных генов с положениями, перекрывающими это окно. Эти значения лежали в диапазоне от минимум 1 гена до максимум 9 генов в окружении 40 т.п.о.

7. Средняя экспрессия генов в окружении 40 т.п.о. вокруг оптимальных геномных локусов

a. Уровень экспрессии транскриптов генов маиса измеряли посредством анализа доступных данных профилирования транскриптома, полученных для тканей корней и побегов Zea mays c.v. B73 с использованием технологии RNAseq™ (Mortazavi, A. et al., Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods. 5, 621-628 (2008); Wang et al., Genome-Wide and Organ-Specific Landscapes of Epigenetic Modifications and Their Relationships to mRNA and Small RNA Transcriptomes in Maize. Plant Cell. 2009 April; 21(4): 1053-1069). Аннотирующую информацию о генах и локализацию известных генов в геноме Zea mays c.v. B73 получали из Maize Genome Database. Для каждого оптимального геномного локуса идентифицировали аннотированные гены в геноме Zea mays c.v. B73, которые присутствовали в окружении 40 т.п.о. вокруг оптимальных геномных локусов. Уровни экспрессии для каждого из генов получали из профилей транскриптома, описанных в указанных выше литературных источниках, и рассчитывали средний уровень экспрессии генов. Значения экспрессии всех генов в геноме Zea mays значительно меняются. Минимальное значение экспрессии составляло 0, и макимальное значение экспрессии составляло 2511,397, со средним значением экспрессии 18,489 и медианным значением экспрессии 3,604. Средние значения экспрессии для набора данных для всех из 5286 оптимальных геномных локусов лежало в диапазоне от миниммума 0,00369 до максимума 2233,06.

8. Уровень занятости нуклеосомами вокруг оптимальных геномных локусов

a. Определение уровня занятости нуклеосомами для конкретной нуклеотидной последовательности обеспечивает информацию о хромосомных функциях и геномном контексте последовательности. Статистический пакет NuPoP™ использовали для прогнозирования занятости нуклеосомами и карты наиболее вероятного расположения нуклеосом для геномных последовательностей любого размера (Xi, L., Fondufe-Mittendor, Y., Xia, L., Flatow, J., Widom, J. and Wang, J.-P., Predicting nucleosome positioning using a duration Hidden Markov Model, BMC Bioinformatics, 2010, doi:10.1186/1471-2105-11-346). Для каждого из 5286 оптимальных геномных локусов нуклеотидную последовательность предоставляли для анализа с использованием программного обеспечения NuPoP™ и рассчитывали показатель занятости нуклеосомами. Эти показатели занятости нуклеосомами для набора данных для оптимальных геномных локусов маиса лежали в диапазоне от минимума 0 до максимума 0,962.

9. Относительное расположение в хромосоме (близость к центромере)

a. Центромера представляет собой область на хромосоме, которая связывает две сестринских хроматиды. Участки хромосомы с любой стороны центромеры известны как плечи хромосом. Геномные положения центромер на всех 10 хромосомах маиса идентифицировали в опубликованной эталонной последовательности Zea mays c.v. B73 (Schnable, P., et al., (2009) The B73 maize genome: complexity, diversity and dynamics. Science, 326(5956): 1112-1115). Информацию о положении центромеры в каждой из хромосом Zea mays и длине плеч хромосомы получали из Maize Genome Database. Для каждого оптимального геномного локуса измеряли геномное расстояние от последовательности оптимального геномного локуса до центромеры хромосомы, на которой она расположена (в п.о.). Относительное расположение оптимального геномного локуса на хромосоме представляют как соотношение его геномного расстояния до центромеры к длине конкретного плеча хромосомы, на которой он расположен. Эти значения относительного расположения для набора данных для оптимальных геномных локусов маиса лежали в диапазоне отношений геномных расстояний от минимум 0,00373 до максимум 0,99908.

10. Количество оптимальных геномных локусов в области 1 млн.п.о.

a. Для каждого оптимального геномного локуса определяли геномное окно размером 1 млн.п.о. вокруг положения оптимальных локусов и рассчитывали количество других дополнительных оптимальных геномных локусов, присутствующих в этой области или перекрывающих ее, включая рассматриваемые оптимальные геномные локусы. Количество оптимальных геномных локусов в 1 млн.п.о. лежало в диапазоне от минимума 1 до максимума 22.

Все из 5286 оптимальных геномных локусов анализировали с использованием признаков и свойств, описанных выше. Результаты или значения для признаков и атрибутов каждого геномного локуса дополнительно описаны в таблице 3 (включенной в настоящее описание в качестве ссылки в форме отдельного электронного файла). Полученный набор данных использовали в статистическом способе PCA для кластеризации 5286 идентифицированных оптимальных геномных локусов на кластеры. В процессе кластеризации после оценки «p» главных компонентов оптимальных геномных локусов, следовало отнесение оптимальных геномных локусов к одному из 32 кластеров в «p»-мерном евклидовом пространстве. Каждую ось «p» делили на «k» интервалов. Оптимальные геномные локусы, отнесенные к одному интервалу, группировали вместе с формированием кластеров. С использованием этого анализа каждую ось PCA делили на два интервала, которые были выбраны на основе предшествующей информации, касающейся количества кластеров, требуемых для экспериментальной валидации. Весь анализ и визуализацию полученных кластеров проводили с использованием программного обеспечения Molecular Operating Environment™ (MOE) от Chemical Computing Group Inc. (Montreal, Quebec, Canada).

Способ PCA использовали для кластеризации набора из 5286 оптимальных геномных локусов на 32 отдельных кластера на основе их характерных значений, описанных выше. В процессе PCA получено пять главных компонентов (PC), причем наилучшие три PC включали приблизительно 90% от всех вариаций в наборе данных (таблица 4). Эти три PCA использовали для графического представления 32 кластеров в трехмерном графике (фигура 3). После завершения процесса кластеризации из каждого кластера выбирали один репрезентативный оптимальный геномный локус. Это осуществляли посредством выбора отдельного оптимального геномного локуса внутри каждого кластера, который был наиболее близким к центроиду этого кластера (таблица 4). Положения на хромосомах 32 репрезентативных геномных локусов являются равномерно распределенными на 10 хромосомах маиса и не смещены в направлении какого-либо конкретного геномного положения, как показано на фигуре 4.

Таблица 4
Описание 32 репрезентативных оптимальных геномных локусов маиса, идентифицированных по PCA
Наименование оптимальных геномных локусов Положение в геноме Длина (п.о.) Номер кластера SEQ ID NO:
optimal_loci_59517_G1 chr2:43352132..43353146 1015 1 1
optimal_loci_159525_G1 chr4:172518643..172519712 1070 2 199
optimal_loci_9811_G1 chr1:52159463..52161841 2379 3 365
optimal_loci_7507_G1 chr1:39334848..39337271 2424 4 543
optimal_loci_178978_G1 chr5:35776311..35777560 1250 5 687
optimal_loci_285621_G1 chr8:118321357..118322528 1172 6 875
optimal_loci_221721_G1 chr6:91309097..91311722 2626 7 1089
optimal_loci_83937_G1 chr2:192746622..192748862 2241 8 1233
optimal_loci_37146_G1 chr1:223833176..223834563 1388 9 1369
optimal_loci_156393_G1 chr4:154313884..154315253 1370 10 1571
optimal_loci_343678_G1 chr10:113837795..113839503 1709 11 1795
optimal_loci_60209_G1 chr2:47513705..47515145 1441 12 1980
optimal_loci_282323_G1 chr8:100763204..100764398 1195 13 2171
optimal_loci_64542_G1 chr2:72203716..72205045 1330 14 2349
optimal_loci_162531_G1 chr4:189896984..189899332 2349 15 2557
optimal_loci_337001_G1 chr10:77188319..77190007 1689 16 2693
optimal_loci_66202_G1 chr2:83483805..83484909 1105 17 2855
optimal_loci_185454_G1 chr5:80270170..80271254 1085 18 3004
optimal_loci_239863_G1 chr7:14997553..14999296 1744 19 3151
optimal_loci_257541_G1 chr7:125978470..125980969 2500 20 3289
optimal_loci_217939_G1 chr6:67227678..67228708 1031 21 3455
optimal_loci_326869_G1 chr10:12348441..12349499 1059 22 3586
optimal_loci_31710_G1 chr1:194939396..194943360 3965 23 3731
optimal_loci_81941_G1 chr2:181418576..181421181 2606 24 3849
optimal_loci_198387_G1 chr5:164712378..164713567 1190 25 3981
optimal_loci_197372_G1 chr5:158680601..158681681 1081 26 4192
optimal_loci_106202_G1 chr3:85647138..85648635 1498 27 4401
optimal_loci_232228_G1 chr6:144719567..144723469 3903 28 4529
optimal_loci_244324_G1 chr7:40299412..40300584 1173 29 4646
optimal_loci_157315_G1 chr4:158710709..158711983 1275 30 4836
optimal_loci_137489_G1 chr4:29898267..29899725 1459 31 5046
optimal_loci_31764_G1 chr1:195178584..195182163 3580 32 5162

Окончательный отбор 72 геномных локусов для нацеливания полинуклеотидной донорной последовательности

Всего 72 геномных локуса идентифицировано и выбрано для нацеливания донорной полинуклеотидной последовательности из 5286 геномных локусов, которые были кластеризованы в 32 отдельных кластера. Для каждого из 32 кластеров выбирали репрезентативный геномный локус (наиболее близкий к центроиду кластера, как описано выше в таблице 4) и дополнительный локус внутри каждого кластера. Дополнительные оптимальные геномные локусы выбирали посредством первого скрининга всех 5286 выбранных оптимальных геномных последовательностей против полногеномной базы данных, состоящей из данных о геномных последовательностях ДНК как для Zea mays c.v. Hi-II (линия для скрининга по нацеливанию), так и для Zea mays c.v. B104 (линия для трансформации) для определения перекрывания (как много оптимальных геномных локусов присутствовали в обоих геномах) и процента идентичности последовательностей в геноме обеих линий. Дополнительные оптимальные геномные локусы с 100% перекрыванием (с выравниванием полной длины последовательности оптимальных локусов между обоими геномами) и 100% идентичностью в базах данных обоих геномов Hi-II и B104, выбирали для валидации нацеливания (фигура 5). Сравнительно небольшое количество репрезентативных геномных локусов обладали идентичностью последовательности, составляющей менее 100% перекрывания и идентичности в базах данных обоих геномов Hi-II and B104 (фигура 5). Другие критерии, такие как размер геномных локусов, степень уникальности, % содержание GC и распределение оптимальных геномных локусов на хромосомах, также принимали во внимание при выборе дополнительных геномных локусов. Положение 72 выбранных оптимальных локусов на хромосомах и конкретная геномная конфигурация каждого оптимального геномного локуса Zea mays показаны на фигуре 6 и в таблице 5, соответственно.

Таблица 5
Описание отобранных оптимальных геномных локусов маиса, выбранных для валидации нацеливания. Из этих оптимальных геномных локусов, перечисленных в этой таблице, 72 оптимальных геномных локусов маиса являются репрезентативными для всех идентифицированных 5286 отобранных оптимальных геномных локусов маиса
Наименование оптимальных геномных локусов Положение в геноме Длина (п.о.) Номер кластера SEQ ID NO:
optimal_loci_59517_G1 chr2:43352132..43353146 1015 1 1
optimal_loci_25001_G1 chr1:151371224..151372260 1037 1 100
optimal_loci_112632_G1 chr3:128098856..128100257 1402 2 203
optimal_loci_28905_G1 chr1:177037718..177038919 1202 2 295
optimal_loci_129164_G1 chr3:221246027..221247542 1516 3 384
optimal_loci_204726_G1 chr5:200665730..200670667 4938 3 424
optimal_loci_2425_G1 chr1:12810845..12814490 3646 3 451
optimal_loci_122036_G1 chr3:184608166..184609697 1532 4 547
optimal_loci_5735_G1 chr1:29190279..29192844 2566 4 671
optimal_loci_178978_G1 chr5:35776311..35777560 1250 5 687
optimal_loci_288388_G1 chr8:133290442..133291481 1040 5 781
optimal_loci_60310_G1 chr2:47967092..47968271 1180 5 843
optimal_loci_285621_G1 chr8:118321357..118322528 1172 6 875
optimal_loci_243330_G1 chr7:34630402..34631577 1176 6 967
optimal_loci_127038_G1 chr3:210603611..210605198 1588 7 1107
optimal_loci_262784_G1 chr7:155767046..155769049 2004 7 1147
optimal_loci_344662_G1 chr10:119131667..119133955 2289 7 1190
optimal_loci_153894_G1 chr4:139979597..139981225 1629 8 1252
optimal_loci_28771_G1 chr1:176062139..176063611 1473 8 1300
optimal_loci_1098_G1 chr1:5582601..5583834 1234 9 1371
optimal_loci_97772_G1 chr3:30209253..30210607 1355 9 1569
optimal_loci_156393_G1 chr4:154313884..154315253 1370 10 1571
optimal_loci_236662_G1 chr6:165975716..165977010 1295 10 1663
optimal_loci_139485_G1 chr4:42804231..42805751 1521 11 1822
optimal_loci_301175_G1 chr9:20325171..20326621 1451 11 1906
optimal_loci_152337_G1 chr4:130033092..130035481 2390 12 2003
optimal_loci_202616_G1 chr5:188822901..188824814 1914 12 2027
optimal_loci_203704_G1 chr5:194836270..194840217 3948 12 2033
optimal_loci_282323_G1 chr8:100763204..100764398 1195 13 2171
optimal_loci_262782_G1 chr7:155759080..155760097 1018 13 2256
optimal_loci_64542_G1 chr2:72203716..72205045 1330 14 2349
optimal_loci_236455_G1 chr6:164795991..164797027 1037 14 2428
optimal_loci_162531_G1 chr4:189896984..189899332 2349 15 2557
optimal_loci_301774_G1 chr9:23468085..23470278 2194 15 2632
optimal_loci_344663_G1 chr10:119143167..119144795 1629 15 2649
optimal_loci_337001_G1 chr10:77188319..77190007 1689 16 2693
optimal_loci_204637_G1 chr5:200298202..200301414 3213 16 2731
optimal_loci_238100_G1 chr7:4899227..4900708 1482 16 2753
optimal_loci_66202_G1 chr2:83483805..83484909 1105 17 2855
optimal_loci_264359_G1 chr7:163504241..163505487 1247 17 2934
optimal_loci_282653_G1 chr8:102704765..102705924 1160 18 3086
optimal_loci_80282_G1 chr2:173420834..173421870 1037 18 3139
optimal_loci_291068_G1 chr8:148277606..148279985 2380 19 3230
optimal_loci_56395_G1 chr2:24801482..24803132 1651 19 3270
optimal_loci_200497_G1 chr5:176879526..176881345 1820 20 3334
optimal_loci_232222_G1 chr6:144700575..144702126 1552 20 3357
optimal_loci_43577_G1 chr1:256469704..256472666 2963 20 3428
optimal_loci_5607_G1 chr1:28613065..28615113 2049 20 3435
optimal_loci_114664_G1 chr3:140106950..140108061 1112 21 3457
optimal_loci_228254_G1 chr6:126085629..126086823 1195 21 3497
optimal_loci_120993_G1 chr3:179419306..179420357 1052 22 3593
optimal_loci_53137_G1 chr2:7304197..7305496 1300 22 3702
optimal_loci_31710_G1 chr1:194939396..194943360 3965 23 3731
optimal_loci_344664_G1 chr10:119144946..119146850 1905 23 3815
optimal_loci_81941_G1 chr2:181418576..181421181 2606 24 3849
optimal_loci_321514_G1 chr9:140776147..140777584 1438 24 3939
optimal_loci_198387_G1 chr5:164712378..164713567 1190 25 3981
optimal_loci_301180_G1 chr9:20328932..20330129 1198 25 4113
optimal_loci_197372_G1 chr5:158680601..158681681 1081 26 4192
optimal_loci_348776_G1 chr10:142097590..142098803 1214 26 4350
optimal_loci_244439_G1 chr7:41068791..41070248 1458 27 4458
optimal_loci_348258_G1 chr10:139297032..139298517 1486 27 4487
optimal_loci_232228_G1 chr6:144719567..144723469 3903 28 4529
optimal_loci_322501_G1 chr9:146078534..146080201 1668 28 4610
optimal_loci_244324_G1 chr7:40299412..40300584 1173 29 4646
optimal_loci_97232_G1 chr3:27463016..27464143 1128 29 4832
optimal_loci_157315_G1 chr4:158710709..158711983 1275 30 4836
optimal_loci_282499_G1 chr8:101771408..101772767 1360 30 4953
optimal_loci_155031_G1 chr4:146991391..146993137 1747 31 5060
optimal_loci_301773_G1 chr9:23465509..23467762 2254 31 5110
optimal_loci_283161_G1 chr8:105321958..105323571 1614 32 5213
optimal_loci_55524_G1 chr2:20099003..20100485 1483 32 5264
optimal_loci_127268_G1 chr3:211767898..211770046 2149 16 2709
optimal_loci_136086_G1 chr4:22531506..22534989 3484 27 4425
optimal_loci_232484_G1 chr6:146122164..146125580 3417 12 2053
optimal_loci_203075_G1 chr5:191370802..191374627 3826 12 2030
optimal_loci_3733_G1 chr1:19232372..19235997 3626 11 1923
optimal_loci_168286_G1 chr4:219987223..219990695 3473 4 573
optimal_loci_128078_G1 chr3:215482594..215485640 3047 4 560
optimal_loci_265551_G1 chr7:170127188..170130734 3547 3 463
optimal_ loci_137693_G1 chr4:31118968..31122359 3392 3 387

В геноме Zea mays идентифицирован большой набор из 5286 геномных положений в качестве оптимальных геномных локусов для нацеливания донорной полинуклеотидной последовательности с использованием способов точной инженерии генома. Использован способ статистического анализа для группировки 5286 выбранных геномных локусов на 32 кластера со сходным геномным контекстом и для идентификации подгруппы из 72 выбранных геномных локусов, репрезентативных для набора из 5286 выбранных геномных локусов. 72 репрезентативных локуса подтверждены в качестве оптимальных геномных локусов посредством нацеливания донорной полинуклеотидной последовательности. Посредством проведения статистического анализа PCA для числовых значений, полученных для десяти наборов признаков или атрибутов, описанных выше, десять признаков или атрибутов рассчитывали в качестве компонентов PCA с меньшими размерностями. По существу, компоненты PCA сводили к пяти размерностям, которые являются репрезентативными для десяти признаков или атрибутов, описанных выше (таблица 6). Каждый компонент PCA эквивалентен комбинации десяти признаков или атрибутов, описанных выше. Из этих компонентов PCA, содержащих пять размерностей, как рассчитано с использованием статистического анализа PCA, определены 32 кластера.

Таблица 6
Пять компонентов PCA (PCA1, PCA2, PCA3, PCA4 и PCA5), которые определяют каждый из 32 кластеров и последовательности (SEQ ID NO: 1-SEQ ID NO: 5286), которые составляют каждый кластер. Эти пять размерностей являются репрезентативными для десяти признаков или атрибутов, описанных выше, которые использовали для идентификации оптимальных геномных локусов. Представлены минимальные (Min), средние, медианные и максимальные (Max) значения для каждого компонента PCA
Кластер 1 (SEQ ID NO:1 -- SEQ ID NO:198) Кластер 2 (SEQ ID NO:199 -- SEQ ID NO:364) Кластер 3 (SEQ ID NO:365 -- SEQ ID NO:542) Кластер 4 (SEQ ID NO: 543-- SEQ ID NO:686) Кластер 5 (SEQ ID NO:687-- SEQ ID NO:874) Кластер 6 (SEQ ID NO:875 -- SEQ ID NO:1088) Кластер 7 (SEQ ID NO:1089 -- SEQ ID NO:1232) Кластер 8 (SEQ ID NO:1233 -- SEQ ID NO:1368) Кластер 9 (SEQ ID NO:1369-- SEQ ID NO:1570) Кластер 10 (SEQ ID NO:1571 -- SEQ ID NO:1794) Кластер 11 (SEQ ID NO: 1795 -- SEQ ID NO:1979) Кластер 12 (SEQ ID NO: 1980 -- SEQ ID NO:2170) Кластер 13 (SEQ ID NO: 2171-- SEQ ID NO:2348)
PCA1 Min -0,38899 -0,93177 -0,39537 -0,93241 -0,39582 -0,93174 -0,38719 -0,93217 -0,38101 -0,93175 -0,39194 -0,93253 -0,38415
Среднее 0,73994 -0,70291 0,797903 -0,72366 0,696097 -0,70419 0,759996 -0,69832 0,799943 -0,71434 0,770295 -0,73093 0,655148
Медиана 0,444732 -0,72051 0,581978 -0,72065 0,41229 -0,72032 0,468691 -0,71729 0,546926 -0,72051 0,347427 -0,72075 0,31035
Max 3,016652 -0,40085 3,06313 -0,40153 3,823763 -0,40276 3,007282 -0,40162 4,260435 -0,41456 3,072388 -0,402 3,054517
PCA2 Min 0,200459 0,211002 -9,82023 -5,15632 0,200591 0,233367 -4,04364 -4,90205 0,204949 0,205064 -5,36888 -6,75555 0,206839
Среднее 0,607958 0,651683 -0,77754 -0,94886 0,62733 0,640492 -0,7257 -0,69802 0,613344 0,639532 -1,0031 -1,01406 0,618082
Медиана 0,616048 0,69582 -0,4007 -0,60703 0,654722 0,662685 -0,5115 -0,48357 0,642703 0,673247 -0,52447 -0,66079 0,639485
Max 0,941211 0,950602 0,188311 0,193638 0,933845 0,95102 0,194718 0,193615 0,950028 0,956661 0,197865 0,193687 0,950172
PCA3 Min -0,19912 -0,19998 -0,19915 -0,19817 -0,3145 -0,32531 -0,30392 -0,31372 -0,19958 -0,19843 -0,19868 -0,19755 -0,31583
Среднее 0,251544 0,348751 0,153077 0,230562 -0,26578 -0,28236 -0,25128 -0,26153 0,244656 0,257424 0,121116 0,22983 -0,2653
Медиана -0,02809 -0,04129 -0,02763 -0,01853 -0,26978 -0,28873 -0,2537 -0,26577 -0,02402 -0,02638 -0,05745 -0,02841 -0,26895
Max 6,481119 34,90501 11,24551 10,67521 -0,20057 -0,20094 -0,20105 -0,20248 5,739189 11,2077 3,384549 16,92247 -0,20086
PCA4 Min -0,39542 -0,39731 -0,39369 -0,39886 -0,37619 -0,37126 -0,39716 -0,39684 -1,25027 -1,22084 -1,21449 -1,13853 -1,24332
Среднее 1,030652 0,94334 0,839835 0,728573 1,088658 1,125488 0,837988 0,867379 -0,881 -0,83045 -0,8525 -0,80304 -0,87789
Медиана 0,956571 0,843296 0,664549 0,334136 1,025711 1,062969 0,491677 0,598316 -0,87578 -0,82491 -0,84403 -0,81514 -0,89279
Max 2,82969 2,82634 2,890302 2,848484 2,875967 2,891137 2,869785 2,792003 -0,41074 -0,40079 -0,43247 -0,41111 -0,4172
PCA5 Min -0,19722 -0,19899 -0,18939 -0,1958 -0,1959 -0,1976 -0,19078 -0,19095 -0,19058 -0,18616 -0,19615 -0,18815 -0,196
Среднее 0,692886 0,757261 0,642033 0,698495 0,682658 0,693974 0,661659 0,618725 0,84803 0,77689 0,822063 0,791532 0,824284
Медиана 0,537914 0,609134 0,438724 0,587864 0,500322 0,514611 0,457563 0,432322 0,775864 0,59967 0,802156 0,730284 0,795933
Max 2,938322 4,205435 2,765824 2,808973 4,140417 2,995524 3,446519 2,717293 2,760305 2,593518 2,351784 2,947057 2,67123

Кластер 14 (SEQ ID NO: 2349 -- SEQ ID NO:2556) Кластер 15
(SEQ ID NO: 2557-- SEQ ID NO:2692)
Кластер 16 (SEQ ID NO: 2693 -- SEQ ID NO:2854) Кластер 17 (SEQ ID NO: 2854-- SEQ ID NO:3003) Кластер 18 (SEQ ID NO: 3004-- SEQ ID NO:3150) Кластер 19 (SEQ ID NO: 3151-- SEQ ID NO:3288) Кластер 20 (SEQ ID NO: 3289-- SEQ ID NO:3455) Кластер 21 (SEQ ID NO: 3456-- SEQ ID NO:3585) Кластер 22
(SEQ ID NO: 3586-- SEQ ID NO:3730)
PCA1 Min -1,03449 -0,3984 -0,93226 -0,4 -0,93176 -0,3845 -0,93215 -0,39456 -0,93174
Среднее -0,70636 0,519692 -0,72131 0,788093 -0,72141 0,822434 -0,7062 0,648476 -0,71986
Медиана -0,72054 0,149839 -0,72068 0,474147 -0,72052 0,469551 -0,72007 0,373243 -0,72054
Max -0,40125 2,973061 -0,4106 3,076914 -0,4042 3,022389 -0,40471 2,902287 -0,41693
PCA2 Min 0,206354 -4,6237 -4,17636 0,201471 0,200304 -12,4583 -5,15079 0,202767 0,202637
Среднее 0,613673 -0,71726 -0,89472 0,585603 0,656596 -0,99953 -0,84736 0,618663 0,60694
Медиана 0,642803 -0,38947 -0,58265 0,600619 0,671923 -0,69949 -0,41126 0,650056 0,588239
Max 0,955582 0,178297 0,199158 0,947875 0,957912 0,189554 0,199151 0,949085 0,95292
PCA3 Min -0,3256 -0,30535 -0,31509 -0,19941 -0,19977 -0,19819 -0,19983 -0,31601 -0,32437
Среднее -0,27114 -0,2528 -0,26165 0,635893 0,335092 0,188191 0,219518 -0,27138 -0,27931
Медиана -0,27173 -0,25626 -0,26456 -0,04339 0,008014 -0,04381 -0,04394 -0,27672 -0,29129
Max -0,20023 -0,20007 -0,20018 34,91703 8,740083 7,182482 13,78985 -0,20023 -0,20086
PCA4 Min -1,17361 -1,13483 -1,21844 -0,39205 -0,38758 -0,39849 -0,39561 -0,36964 -0,38206
Среднее -0,85262 -0,83671 -0,8048 0,614565 0,833197 0,600433 0,604744 0,646062 0,758589
Медиана -0,87973 -0,86109 -0,8269 0,451215 0,567642 0,449885 0,359338 0,523269 0,57825
Max -0,4226 -0,43388 -0,41083 2,809658 3,04613 2,884778 2,972785 2,6186 2,974322
PCA5 Min -0,19829 -0,19924 -0,19297 -1,79801 -2,53365 -2,6192 -2,44086 -2,6779 -2,62344
Среднее 0,810572 0,736591 0,728155 -0,72144 -0,84754 -0,80889 -0,82297 -0,72856 -0,70873
Медиана 0,764994 0,693731 0,657955 -0,72833 -0,77132 -0,70957 -0,77948 -0,59442 -0,57736
Max 2,416623 2,278981 2,616655 -0,20335 -0,20762 -0,20218 -0,20251 -0,20116 -0,20382

Кластер 23 (SEQ ID NO: 3731 -- SEQ ID NO:3848) Кластер 24 (SEQ ID NO: 3849-- SEQ ID NO:3980) Кластер 25 (SEQ ID NO: 3981-- SEQ ID NO:4191) Кластер 26 (SEQ ID NO: 4192-- SEQ ID NO:4400) Кластер 27 (SEQ ID NO: 4401-- SEQ ID NO:4528) Кластер 28 (SEQ ID NO: 4529-- SEQ ID NO:4645) Кластер 29 (SEQ ID NO: 4646-- SEQ ID NO:4835) Кластер 30 (SEQ ID NO: 4836-- SEQ ID NO:5045) Кластер 31 (SEQ ID NO: 5046-- SEQ ID NO:5161) Кластер 32 (SEQ ID NO:5162 - SEQ ID NO:5286)
PCA1 Min -0,39968 -0,93205 -0,38484 -0,93175 -0,36299 -0,93202 -0,39541 -0,93174 -0,38676 -0,93219
Среднее 0,569528 -0,7112 0,89369 -0,71148 0,847871 -0,6997 0,733638 -0,71468 0,713562 -0,72235
Медиана 0,307897 -0,71444 0,656779 -0,7205 0,473467 -0,71199 0,522102 -0,72051 0,378272 -0,72062
Max 2,76172 -0,40915 3,044789 -0,40213 6,206739 -0,40329 2,997077 -0,40188 2,942702 -0,40344
PCA2 Min -4,50821 -4,32937 0,205796 0,217611 -3,95614 -4,39001 0,203336 0,213622 -3,27891 -4,31097
Среднее -0,777 -0,77438 0,615151 0,627195 -0,58233 -0,66813 0,642413 0,668567 -0,54379 -0,6389
Медиана -0,41811 -0,59493 0,63135 0,641379 -0,23895 -0,27959 0,691753 0,727605 -0,27039 -0,39873
Max 0,196954 0,180603 0,941307 0,956251 0,199442 0,199682 0,947101 0,955864 0,197573 0,197193
PCA3 Min -0,30606 -0,31336 -0,19852 -0,19834 -0,19909 -0,19493 -0,31606 -0,32335 -0,30162 -0,31598
Среднее -0,25642 -0,26736 0,171006 0,21757 0,20907 0,183239 -0,26663 -0,28001 -0,25672 -0,27043
Медиана -0,26139 -0,27169 -0,03015 -0,02662 -0,03223 -0,06903 -0,27011 -0,28811 -0,25858 -0,27998
Max -0,20052 -0,20409 4,462448 7,171082 7,193004 6,524651 -0,20077 -0,20004 -0,20218 -0,20128
PCA4 Min -0,39748 -0,39925 -0,7756 -0,74818 -0,78247 -0,75487 -0,79614 -0,74639 -0,78065 -0,74365
Среднее 0,668717 0,649507 -0,63225 -0,6052 -0,61175 -0,59977 -0,62563 -0,61235 -0,62339 -0,59687
Медиана 0,41274 0,413211 -0,63785 -0,61495 -0,61728 -0,60438 -0,63223 -0,61292 -0,63546 -0,6038
Max 2,854384 2,911189 -0,40047 -0,40417 -0,40476 -0,41372 -0,41488 -0,40099 -0,40756 -0,40546
PCA5 Min -2,18571 -2,49096 -2,21238 -2,21096 -2,21537 -2,20254 -2,39722 -2,17311 -2,11438 -2,35552
Среднее -0,85226 -0,79404 -0,8952 -0,956 -0,91416 -0,91719 -0,96664 -0,96062 -0,95439 -0,98418
Медиана -0,79315 -0,76484 -0,83735 -0,91891 -0,92024 -0,83148 -0,90166 -0,94788 -0,90938 -0,885
Max -0,20566 -0,20015 -0,20978 -0,20039 -0,22084 -0,20408 -0,2077 -0,21493 -0,20199 -0,22725

Пример 3: Дизайн цинковых пальцев для связывания геномных локусов в Zea mays

Белки с цинковыми пальцами, направленные против идентифицированных последовательностей ДНК репрезентативных геномных локусов, конструировали, как описано ранее. См., например, Urnov et al., (2005) Nature 435:646-551. Иллюстративная последовательность-мишень и узнающие спирали представлены в таблице 7 (дизайн областей узнающих спиралей) и в таблице 8 (участки-мишени). В таблице 8 нуклеотиды в участке-мишени, контактирующие с узнающими спиралями ZFP, указаны заглавными буками, и не контактирующие нуклеотиды указаны строчными буквами. Участки-мишени нуклеазы с цинковыми пальцами (ZFN) конструировали для всех из описанных выше 72 отобранных оптимальных геномных локусов. Многочисленные конструкции ZFP разработаны и тестированы для идентификации пальцев, которые связываются с наибольшим уровнем эффективности с 72 различными репрезентативными участками-мишенями геномных локусов, которые идентифицированы в Zea mays и отобраны, как описано выше. Конкретные узнающие спирали ZFP (таблица 7), которые связываются с наиболее высоким уровнем эффективности с последовательностями узнавания цинковых пальцев, использовали для нацеливания и интеграции донорной последовательности в геноме Zea mays.

Таблица 7
Дизайн цинковых пальцев для выбранных геномных локусов Zea mays (N/A обозначает «не применимо»). Следует отметить, что узнающие спирали ZFP, обозначенные звездочкой (*), разработаны для нацеливания и интеграции донорной последовательности, однако интеграция донора в эти геномные локусы не была завершена
Номер pDAB Номер ZFP F1 F2 F3 F4 F5 F6
111879 111879 ZFN5 SEQ ID NO:5287 QSGDLTR SEQ ID NO:5288RKDQLVA SEQ ID NO:5289 RSDDLTR SEQ ID NO:5290 TSSNRKT SEQ ID NO:5291 RSDTLSE SEQ ID NO:5292 ARSTRTN
111879 ZFN7 SEQ ID NO:5293 RSDSLSV SEQ ID NO:5294DRSNRKT SEQ ID NO:5295QSSHLTR SEQ ID NO:5296 RSDALAR SEQ ID NO:5297 RSDDLTR SEQ ID NO:5298 DPSALRK
111885 111885 ZFN1 SEQ ID NO:5299 RSDNLSQ SEQ ID NO:5300 ASNDRKK SEQ ID NO:5301 ERGTLAR SEQ ID NO:5302 RSDHLSR SEQ ID NO:5303 ERGTLAR SEQ ID NO:5304 QSGHLSR
111885 ZFN2 SEQ ID NO:5305 RSANLAR SEQ ID NO:5306 DRSDLSR SEQ ID NO:5307 RSDTLSQ SEQ ID NO:5308RSADLSR SEQ ID NO:5309 DRSNLSR SEQ ID NO:5310 NSRNLRN
117404 SIG115737_31v1 SEQ ID NO:5311 RSDSLSV SEQ ID NO:5312 DRSHLAR SEQ ID NO:5313 DRSNLSR SEQ ID NO:5314 RRSDLKR SEQ ID NO:5315 RSDTLSE SEQ ID NO:5316 QNATRIN
SIG115737_32v1 SEQ ID NO:5317 QSGSLTR SEQ ID NO:5318 QSGDLTR SEQ ID NO:5319 RSDVLSE SEQ ID NO:5320 TRNGLKY N/A N/A
117408 SIG120523_11v1 SEQ ID NO:5321 RSDNLSR SEQ ID NO:5322 DNSNRKT SEQ ID NO:5323QNAHRKT SEQ ID NO:5324 QKATRIT SEQ ID NO:5325 DRSHLTR SEQ ID NO:5326 RSDDRKK
SIG120523_12v1 SEQ ID NO:5327 ASKTRTN SEQ ID NO:5328 QSGSLTR SEQ ID NO:5329 LRHHLTR SEQ ID NO:5330 QSAHLKA N/A N/A
117400 SIG115246_5 SEQ ID NO:5331 QSGDLTR SEQ ID NO:5332 ASHNLRT SEQ ID NO:5333 DRSNLTR SEQ ID NO:5334 QSSDLSR SEQ ID NO:5335 DAGNRNK N/A
SIG115246_6 SEQ ID NO:5336 DRSDLSR SEQ ID NO:5337 RSDNLTR SEQ ID NO:5338 DRSHLSR SEQ ID NO:5339 TSGNLTR SEQ ID NO:5340 QSSDLSR N/A
117402 SIG115636_1v1 SEQ ID NO:5341 QSSDLSR SEQ ID NO:5342 HRSTRNR SEQ ID NO:5343 RSDDLTR SEQ ID NO:5344 DRSNLKA SEQ ID NO:5345 DRSHLTR SEQ ID NO:5346 QRSTLKS
SIG115636_2v1 SEQ ID NO:5347 RSDALSR SEQ ID NO:5348 RSDDLTR SEQ ID NO:5349 DRSHLTR SEQ ID NO:5350 TSSNRKT SEQ ID NO:5351 RSDTLSE SEQ ID NO:5352 DRSHLAR
117406 SIG120417_11v1 SEQ ID NO:5353 DRSARTR SEQ ID NO:5354 QSGHLSR SEQ ID NO:5355 QSGNLAR SEQ ID NO:5356 RSDVLST SEQ ID NO:5357 RYAYLTS SEQ ID NO:5358 RRWTLVG
SIG120417_12v1 SEQ ID NO:5359 RSDNLSQ SEQ ID NO:5360 ASNDRKK SEQ ID NO:5361 QSGDLTR SEQ ID NO:5362 LKDTLRR SEQ ID NO:5363 QSGNLAR N/A
117411 SIG120621_15v1 SEQ ID NO:5364 QSGDLTR SEQ ID NO:5365 MQNYLSR SEQ ID NO:5366 RSDHLSE SEQ ID NO:5367 QNANRKT SEQ ID NO:5368 RSADLTR N/A
SIG120621_16v1 SEQ ID NO:5369 RSDNLSE SEQ ID NO:5370 QSANRTK SEQ ID NO:5371 RSDALSR SEQ ID NO:5372 DRSALAR SEQ ID NO:5373 RSDHLSE SEQ ID NO:5374 DSQNRIK
117413 SIG12078_11v1 SEQ ID NO:5375 QSGDLTR SEQ ID NO:5376 DKGNLTK SEQ ID NO:5377 RSADLTR SEQ ID NO:5378 DRSHLAR SEQ ID NO:5379 RSDTLSE SEQ ID NO:5380 DRSNRKT
SIG12078_12v1 SEQ ID NO:5381 DRSNLSR SEQ ID NO:5382 LRQDLKR SEQ ID NO:5383 RSDHLSE SEQ ID NO:5384 DRSALAR SEQ ID NO:5385 DRSALSR SEQ ID NO:5386 NRRGRWS
117429 SIG157315_1v1 SEQ ID NO:5387 RPYTLRL SEQ ID NO:5388 HRSSLRR SEQ ID NO:5389 RSDSLLR SEQ ID NO:5390 WLSSLSA SEQ ID NO:5391 QSGDLTR SEQ ID NO:5392 DRSHLAR
SIG157315_2v1 SEQ ID NO:5393 DRSNLSR SEQ ID NO:5394 LKQHLNE SEQ ID NO:5395 LRHHLTR SEQ ID NO:5396 QSGNLHV SEQ ID NO:5397 TSGHLSR N/A
124802 SEQ ID NO:5495 QSSDLSR SEQ ID NO:5496 QSGNLAR SEQ ID NO:5497 DRSNRTT SEQ ID NO:5498 DNSNRIK N/A N/A
SEQ ID NO:5499 QSSDLSR SEQ ID NO:5500 RTDALRG SEQ ID NO:5501 RSDHLSE SEQ ID NO:5502 SYRSRWG SEQ ID NO:5503 DRSALAR N/A
121900 SIGPPL05_1 SEQ ID NO:5504 RSDTLSE SEQ ID NO:5505 QSGDLTR SEQ ID NO:5506 TSGNLTR SEQ ID NO:5507 DRSALAR N/A N/A
SIGPPL05_2 SEQ ID NO:5508 RSDSLSV SEQ ID NO:5509 QSGDLTR SEQ ID NO:5510 DRSNLSR SEQ ID NO:5511 RQDSRSQ SEQ ID NO:5512 RSDHLSA SEQ ID NO:5513 QHGSLAS
124810 SIGPPL06_9 SEQ ID NO:5514 RSANLAR SEQ ID NO:5515 RSDHLTT SEQ ID NO:5516 RSANLAR SEQ ID NO:5517 TNQNRIT N/A N/A
SIGPPL06_10 SEQ ID NO:5518 QSGNLAR SEQ ID NO:5519 QSNQLAV SEQ ID NO:5520 QNAHRKT SEQ ID NO:5521 RSDDLSK SEQ ID NO:5522 RSDTRKT N/A
121902 SIGPPL07_1 SEQ ID NO:5523 QSSHLTR SEQ ID NO:5524 QSSDLTR SEQ ID NO:5525 RSDDLTR SEQ ID NO:5526 QSSDLRR SEQ ID NO:5527 TSGSLSR SEQ ID NO:5528 TSSNRAV
SIGPPL07_2 SEQ ID NO:5529 RSDHLSR SEQ ID NO:5530 DRSARNS SEQ ID NO:5531 RSDTLSE SEQ ID NO:5532 SRCWRRK N/A N/A
123802 ZmPPL18SIG_5 SEQ ID NO:5533 TSGNLTR SEQ ID NO:5534 LKQMLAV SEQ ID NO:5535 QSSNLAR SEQ ID NO:5536 RSDNLTR SEQ ID NO:5537 RSDNLST SEQ ID NO:5538 QSGHLSR
ZmPPL18SIG_6 SEQ ID NO:5539 RSDNLAR SEQ ID NO:5540 QKKDRSY SEQ ID NO:5541 RSDVLSR SEQ ID NO:5542 DSRDRKN N/A N/A
123805 ZmSIGPPL19_1 SEQ ID NO:5543 RSAHLSR SEQ ID NO:5544 QSANRTK SEQ ID NO:5545 QSSDLSR SEQ ID NO:5546 QSSDLSR SEQ ID NO:5547 QWSTRKR N/A
ZmSIGPPL19_2 SEQ ID NO:5548 QSSDLSR SEQ ID NO:5549 QSAHRKN SEQ ID NO:5550 RSDNLST SEQ ID NO:5551 DSSTRKT SEQ ID NO:5552 RSDHLSR SEQ ID NO:5553 DRSNRKT
121992 ZmPPL20v2_1 SEQ ID NO:5554 QSSDLSR SEQ ID NO:5555 QAGNLSK SEQ ID NO:5556 DRSNLSR SEQ ID NO:5557 LKQHLTR N/A N/A
ZmPPL20v2_2 SEQ ID NO:5558 DRSNLSR SEQ ID NO:5559 QSGDLTR SEQ ID NO:5560 QSSDLSR SEQ ID NO:5561 QAGNLSK SEQ ID NO:5562 QNAHRKT N/A
118643 SIGPPL09_1 SEQ ID NO:5563 RSDHLSQ SEQ ID NO:5564 QNAHRIT SEQ ID NO:5565 RSDDLTR SEQ ID NO:5566 QRSTLSS SEQ ID NO:5567 TSGNLTR SEQ ID NO:5568 DRSNLTR
SIGPPL09_2 SEQ ID NO:5569 TSGNLTR SEQ ID NO:5570 RSDDLTR SEQ ID NO:5571 QSGDLTR SEQ ID NO:5572 MQNYLSR SEQ ID NO:5573 QSGNLAR SEQ ID NO:5574 DQSGLAH
118648 SIGPPL10_5 SEQ ID NO:5575 rsdnlst SEQ ID NO:5576 drsalar SEQ ID NO:5577 lkqhltr SEQ ID NO:5578 rrddlrn SEQ ID NO:5579 rsddltr SEQ ID NO:5580 drsnlka
SIGPPL10_6 SEQ ID NO:5581 rsdtlse SEQ ID NO:5582 qsgdltr SEQ ID NO:5583 qsgdltr SEQ ID NO:5584 drsvlrr SEQ ID NO:5585 rsdnlar SEQ ID NO:5586 drsnltr
118650 SIGPPL21_1 SEQ ID NO:5587 DRSHLTR SEQ ID NO:5588 QSGDLTR SEQ ID NO:5589 QSGDLTR SEQ ID NO:5590 RSDNLSE SEQ ID NO:5591 KRGNRAK N/A
SIGPPL21_2 SEQ ID NO:5592 ERGTLAR SEQ ID NO:5593 RSDALAR SEQ ID NO:5594 RSDALSR SEQ ID NO:5595 DRSALAR SEQ ID NO:5596 ERGTLAR SEQ ID NO:5597 DRSALAR
118654 SIGPPL22_3 SEQ ID NO:5598 QSSDLSR SEQ ID NO:5599 RSDHLSR SEQ ID NO:5600 RSDTLSQ SEQ ID NO:5601 QKATRIT SEQ ID NO:5602 RSDALAR N/A
SIGPPL22_4 SEQ ID NO:5603 RSDNLSV SEQ ID NO:5604 DRSHLAR SEQ ID NO:5605 RSDTLSR SEQ ID NO:5606 QSADRTK SEQ ID NO:5607 TSGHLSR N/A
118656 SIGPPL23_1 SEQ ID NO:5608 QRSNLVR SEQ ID NO:5609 DRSHLAR SEQ ID NO:5610 RSDTLSE SEQ ID NO:5611 RMYTLSK SEQ ID NO:5612 DRSALSR SEQ ID NO:5613 RSDDLTR
SIGPPL23_2 SEQ ID NO:5614 RSDALTQ SEQ ID NO:5615 DRSDLSR SEQ ID NO:5616 RRTDLRR SEQ ID NO:5617 RSDNLAR SEQ ID NO:5618 QRSPLPA N/A
118659 SIGPPL24_4 SEQ ID NO:5619 RSDSLSA SEQ ID NO:5620 QNAHRKT SEQ ID NO:5621 ERGTLAR SEQ ID NO:5622 RSDNLTR SEQ ID NO:5623 TSGNLTR SEQ ID NO:5624 QRSHLSD
SIGPPL24_3 SEQ ID NO:5625 QSGDLTR SEQ ID NO:5626 QRSNLNI SEQ ID NO:5627 RSDNLAR SEQ ID NO:5628 DRSVLHR SEQ ID NO:5629 DRSDLSR SEQ ID NO:5630 RQDTLRS
118660 SIGPPL25_2 SEQ ID NO:5631 RSDALSR SEQ ID NO:5632 QSGSLTR SEQ ID NO:5633 RSDALSV SEQ ID NO:5634 DSSHRTR SEQ ID NO:5635 QSGDLTR SEQ ID NO:5636 QSGHLSR
SIGPPL25_1 SEQ ID NO:5637 RSDNLAR SEQ ID NO:5638 HRNTLLG SEQ ID NO:5639 TSGSLSR SEQ ID NO:5640 RSDHLTT SEQ ID NO:5641 QSGDLTR SEQ ID NO:5642 RPYTLRL
118767 SIGPPL26_1 SEQ ID NO: 5643 RSADLTR SEQ ID NO: 5644 RSDALAR SEQ ID NO: 5645 RSDTLSQ SEQ ID NO: 5646 RSDDRKK SEQ ID NO: 5647 TSGSLSR N/A
SIGPPL26_2 SEQ ID NO: 5648 RSDTLSA SEQ ID NO: 5649 RSADRKK SEQ ID NO: 5650 QRSNLVR SEQ ID NO: 5651 DRSHLAR SEQ ID NO: 5652 RSDALSV N/A
118769 SIGPPL27_1 SEQ ID NO: 5653 DRSNLSR SEQ ID NO: 5654 QSGNLAR SEQ ID NO: 5655 RSDHLTQ SEQ ID NO: 5656 QSGDLTR SEQ ID NO: 5657 LRHQLKS N/A
SIGPPL27_2 SEQ ID NO: 5658 RSADLTR SEQ ID NO: 5659 QSGDLTR SEQ ID NO: 5660 DRSHLSR SEQ ID NO: 5661 TSGNLTR SEQ ID NO: 5662 RSDHLSA SEQ ID NO: 5663 TTRYRNR
118663 SIGPPL28_1 SEQ ID NO: 5664 QSSDLSR SEQ ID NO: 5665 QSGSLTR SEQ ID NO: 5666 QSGHLSR SEQ ID NO: 5667 TSGNLTR SEQ ID NO: 5668 QSGHLSR N/A
SIGPPL28_2 SEQ ID NO: 5669 QSGNLAR SEQ ID NO: 5670 DISNRSK SEQ ID NO: 5671 DRSDLSR SEQ ID NO: 5672 RRTDLRR SEQ ID NO: 5673 TSGSLTR N/A
118668 SIGPPL29_5 SEQ ID NO: 5674 DRSHLSR SEQ ID NO: 5675 TSGNLTR SEQ ID NO: 5676 DRSNLSR SEQ ID NO: 5677 FPGSRTR SEQ ID NO: 5678 RNDDRKK N/A
SIGPPL29_6 SEQ ID NO: 5679 TSGSLSR SEQ ID NO: 5680 QLNNLKT SEQ ID NO: 5681 RSDVLST SEQ ID NO: 5682 ASGNLLN SEQ ID NO: 5683 RSDNLSR SEQ ID NO: 5684 DNSNRKT
118669 SIGPPL30_1 SEQ ID NO: 5685 RSDTLSQ SEQ ID NO: 5686 ASANRTK SEQ ID NO: 5687 QSSNLAR SEQ ID NO: 5688 DSSDRKK SEQ ID NO: 5689 RSDHLST SEQ ID NO: 5690 QSGHLSR
SIGPPL30_2 SEQ ID NO: 5691 RSDHLSA SEQ ID NO: 5692 SYWSRTV SEQ ID NO: 5693 DRSALSR SEQ ID NO: 5694 DRSHLAR SEQ ID NO: 5695 RSDNLTR N/A
118670 SIGPPL31_1 SEQ ID NO: 5696 DRSDLSR SEQ ID NO: 5697 DRSNRNK SEQ ID NO: 5698 RSDVLSE SEQ ID NO: 5699 RNFSLTM SEQ ID NO: 5700 RSDALAR N/A
SIGPPL31_2 SEQ ID NO: 5701 QSGALAR SEQ ID NO: 5702 QSSDLSR SEQ ID NO: 5703 RRDILHQ SEQ ID NO: 5704 RSADLTR SEQ ID NO: 5705 QSGDLTR N/A
118673 SIGPPL32_5 SEQ ID NO: 5706 QSGALAR SEQ ID NO: 5707 DRSNLSR SEQ ID NO: 5708 LKQHLTR SEQ ID NO: 5709 RSDNLST SEQ ID NO: 5710 RSDHLSR N/A
SIGPPL32_6 SEQ ID NO: 5711 QSSDLSR SEQ ID NO: 5712 HRSNLNK SEQ ID NO: 5713 DRSNLSR SEQ ID NO: 5714 DASNLRQ SEQ ID NO: 5715 TSSNLSR N/A
118674 SIGPPL33_1 SEQ ID NO: 5716 RSDSLLR SEQ ID NO: 5717 CREYRGK SEQ ID NO: 5718 TSGHLSR SEQ ID NO: 5719 RSDVLSA SEQ ID NO: 5720 RNDHRIN NA
SIGPPL33_2 SEQ ID NO: 5721 QSGSLTR SEQ ID NO: 5722 RSDNLRE SEQ ID NO: 5723 QSGSLTR SEQ ID NO: 5724 RLDNRTA SEQ ID NO: 5725 RSDVLSN SEQ ID NO: 5726 DRSTRIT
118676 SIGPPL34_1 SEQ ID NO: 5727 RSDSLLR SEQ ID NO: 5728 WLSSLSA SEQ ID NO: 5729 ERGTLAR SEQ ID NO: 5730 TSGSLTR SEQ ID NO: 5731 RSDTLSE SEQ ID NO: 5732 QSGHLSR
SIGPPL34_2 SEQ ID NO: 5733 QSGNLAR SEQ ID NO: 5734 DISNRSK SEQ ID NO: 5735 RSDHLSR SEQ ID NO: 5736 HRYHRLS N/A N/A
118677 SIGPPL35_1 SEQ ID NO: 5737 QSGSLTR SEQ ID NO: 5738 DRSHLAR SEQ ID NO: 5739 DRSALSR SEQ ID NO: 5740 RSDALAR SEQ ID NO: 5741 QSSDLSR SEQ ID NO: 5742 HKYHLRS
SIGPPL35_2 SEQ ID NO: 5743 RSDHLSE SEQ ID NO: 5744 RKDARIT SEQ ID NO: 5745 ERGTLAR SEQ ID NO: 5746 RSDALTQ SEQ ID NO: 5747 DRSHLTR SEQ ID NO: 5748 RSDHLTT
118680 SIGPPL36_1 SEQ ID NO: 5749 TSGSLSR SEQ ID NO: 5750 QMHHLKT SEQ ID NO: 5751 TSSNLSR SEQ ID NO: 5752 QSGALAR SEQ ID NO: 5753 RSDDLTR N/A
SIGPPL36_2 SEQ ID NO: 5754 DRSALSR SEQ ID NO: 5755 RSDHLSR SEQ ID NO: 5756 DRSARTR SEQ ID NO: 5757 QSGHLSR SEQ ID NO: 5758 RSDHLSE SEQ ID NO: 5759 ARSTRTN
118683 SIGPPL37_1 SEQ ID NO: 5760 RSANLAR SEQ ID NO: 5761 RNDDRKK SEQ ID NO: 5762 DRSHLTR SEQ ID NO: 5763 DRSNLTR N/A N/A
SIGPPL37_2 SEQ ID NO: 5764 TSGSLSR SEQ ID NO: 5765 DSSDRKK SEQ ID NO: 5766 QSGDLTR SEQ ID NO: 5767 DRSHLTR SEQ ID NO: 5768 DRSHLAR N/A
118685 SIGPPL38_1 SEQ ID NO: 5769 RSDHLSA SEQ ID NO: 5770 TKSNRTK SEQ ID NO: 5771 DRSNLTR SEQ ID NO: 5772 RSDDLTR SEQ ID NO: 5773 QKSSLRT N/A
SIGPPL38_2 SEQ ID NO: 5774 RREDLIT SEQ ID NO: 5775 TSSNLSR SEQ ID NO: 5776 DRSALSR SEQ ID NO: 5777 RSDDRKT SEQ ID NO: 5778 RSDTLSE SEQ ID NO: 5779 HRRSRWG
123833 ZmSIGPPL39_1 SEQ ID NO: 5780 RSDNLSA SEQ ID NO: 5781 RNNDRKT SEQ ID NO: 5782 QSGDLTR SEQ ID NO: 5783 RSDDLTR SEQ ID NO: 5784 QSSDLSR SEQ ID NO: 5785 HKYHLRS
ZmSIGPPL39_2 SEQ ID NO: 5786 TNQNRIT SEQ ID NO: 5787 HRSSLRR SEQ ID NO: 5788 DSSTRKT SEQ ID NO: 5789 QSATRTK SEQ ID NO: 5790 QSSDLSR SEQ ID NO: 5791 HRKSLSR
118771 SIGPPL40_1 SEQ ID NO: 5792 QSSDLSR SEQ ID NO: 5793 QSTHRNA SEQ ID NO: 5794 RSDHLTQ SEQ ID NO: 5795 DRSDLSR SEQ ID NO: 5796 RSDNLTR N/A
SIGPPL40_2 SEQ ID NO: 5797 QSGDLTR SEQ ID NO: 5798 DRSHLTR SEQ ID NO: 5799 QSGSLTR SEQ ID NO: 5800 DRSNLSR SEQ ID NO: 5801 QSGNLAR N/A
121943 ZmSIGPPL41_7 SEQ ID NO: 5802 DRSALSR SEQ ID NO: 5803 RSDALTQ SEQ ID NO: 5804 RSDSLLR SEQ ID NO: 5805 RSDALTQ SEQ ID NO: 5806 RSDNLST SEQ ID NO: 5807 DNSNRIN
ZmSIGPPL41_8 SEQ ID NO: 5808 RSDNLST SEQ ID NO: 5809 RSDNRTK SEQ ID NO: 5810 RSDVLST SEQ ID NO: 5811 WSSSRAA SEQ ID NO: 5812 QSGSLTR SEQ ID NO: 5813 TSSNRKT
121946 ZmSIGPPL42_7 SEQ ID NO: 5814 QSSHLTR SEQ ID NO: 5815 RSDALTQ SEQ ID NO: 5816 ERGTLAR SEQ ID NO: 5817 RNDDRKK N/A N/A
ZmSIGPPL42_8 SEQ ID NO: 5818 QSGSLTR SEQ ID NO: 5819 TSSNRKT SEQ ID NO: 5820 RSDNLSV SEQ ID NO: 5821 QNANRIT SEQ ID NO: 5822 ERGTLAR SEQ ID NO: 5823 RSDDLTR
121949 ZmSIGPPL43_3 SEQ ID NO: 5824 RSDNLSE SEQ ID NO: 5825 RHSALSA SEQ ID NO: 5826 QSSDLSR SEQ ID NO: 5827 QSYNRFV SEQ ID NO: 5828 ERGTLAR SEQ ID NO: 5829 TSGSLTR
ZmSIGPPL43_4 SEQ ID NO: 5830 ERGTLAR SEQ ID NO: 5831 RSDDLTR SEQ ID NO: 5832 RSDHLSE SEQ ID NO: 5833 RNQHRKN SEQ ID NO: 5834 DRSHLAR N/A
121952 ZmSIGPPL44_1 SEQ ID NO: 5835 QSGNLAR SEQ ID NO: 5836 QGANLIK SEQ ID NO: 5837 RSDSLSV SEQ ID NO: 5838 DRSDLSR SEQ ID NO: 5839 QSGHLSR N/A
ZmSIGPPL44_2 SEQ ID NO: 5840 TSGSLSR SEQ ID NO: 5841 QSGSLTR SEQ ID NO: 5842 RSAHLSR SEQ ID NO: 5843 RSDALST SEQ ID NO: 5844 DRSTRTK N/A
121959 ZmSIGPPL45_7 SEQ ID NO: 5845 RSDDLSK SEQ ID NO: 5846 QSATRTK SEQ ID NO: 5847 RSDALTQ SEQ ID NO: 5848 DRSHLTR SEQ ID NO: 5849 TSSNRKT N/A
ZmSIGPPL45_8 SEQ ID NO: 5850 DRSALSR SEQ ID NO: 5851 TSSNRKT SEQ ID NO: 5852 RSADLTR SEQ ID NO: 5853 RSDDLTR SEQ ID NO: 5854 RSDVLST SEQ ID NO: 5855 DCRNRWR
121963 ZmSIGPPL46_7 SEQ ID NO: 5856 QSSDLSR SEQ ID NO: 5857 QSGSLTR SEQ ID NO: 5858 QSSDLSR SEQ ID NO: 5859 RSDNLST SEQ ID NO: 5860 RSDNRTK N/A
ZmSIGPPL46_8 SEQ ID NO: 5861 QSSDLSR SEQ ID NO: 5862 AASNRSK SEQ ID NO: 5863 DRSHLSR SEQ ID NO: 5864 DRSHLAR SEQ ID NO: 5865 RSDTLSA SEQ ID NO: 5866 RSADRKK
121971 ZmSIGPPL48_7 SEQ ID NO: 5867 RSDNLST SEQ ID NO: 5868 DRSNRKT SEQ ID NO: 5869 RSDALAR SEQ ID NO: 5870 RSDNLST SEQ ID NO: 5871 DRSALAR N/A
ZmSIGPPL48_8 SEQ ID NO: 5872 DRSDLSR SEQ ID NO: 5873 DRSNRNK SEQ ID NO: 5874 QSSDLSR SEQ ID NO: 5875 WRSSLRQ SEQ ID NO: 5876 RSDHLSQ SEQ ID NO: 5877 TRSPLTT
121972 ZmSIGPPL49_1 SEQ ID NO: 5878 TRDHLST SEQ ID NO: 5879 RSDARTN SEQ ID NO: 5880 RSDHLSE SEQ ID NO: 5881 QSNHRKT SEQ ID NO: 5882 RSDALAR N/A
ZmSIGPPL49_2 SEQ ID NO: 5883 ERGTLAR SEQ ID NO: 5884 RSDALTQ SEQ ID NO: 5885 RSDSLSV SEQ ID NO: 5886 DRSALAR SEQ ID NO: 5887 QSSNLAR SEQ ID NO: 5888 QSADRTK
124097 ZmSIGPPL50_5 SEQ ID NO: 5889 RSDHLSA SEQ ID NO: 5890 QSGDLTR SEQ ID NO: 5891 QSSDLSR SEQ ID NO: 5892 RSDNLAR SEQ ID NO: 5893 FREGLYK N/A
ZmSIGPPL50_6 SEQ ID NO: 5894 TSGNLTR SEQ ID NO: 5895 LKQMLAV SEQ ID NO: 5896 ERGTLAR SEQ ID NO: 5897 RSDHLSR SEQ ID NO: 5898 QSSHLTR SEQ ID NO: 5899 QSSDLTR
123818 ZmPPL51_7 SEQ ID NO: 5900 RSDTLSE SEQ ID NO: 5901 HRRSRWG SEQ ID NO: 5902 RSDDLSV SEQ ID NO: 5903 TSSNRTK N/A N/A
ZmPPL51_8 SEQ ID NO: 5904 RSDTLSQ SEQ ID NO: 5905 QRDHRIK SEQ ID NO: 5906 DRSNLSR SEQ ID NO: 5907 TSGNLTR SEQ ID NO: 5908 RSDSLLR SEQ ID NO: 5909 WLSSLSA
118705 SIGPPL52_5 SEQ ID NO: 5910 DRSNLSR SEQ ID NO: 5911 LRQNLIM SEQ ID NO: 5912 QNAHRKT SEQ ID NO: 5913 QSGALAR SEQ ID NO: 5914 QSGHLSR N/A
SIGPPL52_6 SEQ ID NO: 5915 QSGNLAR SEQ ID NO: 5916 LAYDRRK SEQ ID NO: 5917 RSDVLSE SEQ ID NO: 5918 RNFSLTM SEQ ID NO: 5919 RSADLTR SEQ ID NO: 5920 DSSDRKK
118711 SIGPPL54_5 SEQ ID NO: 5921 RSDNLAR SEQ ID NO: 5922 DQSYRRT SEQ ID NO: 5923 RSDNLSE SEQ ID NO: 5924 TSSNRKT N/A N/A
SIGPPL54_6 SEQ ID NO: 5925 TSGSLSR SEQ ID NO: 5926 RKELLRS SEQ ID NO: 5927 RPYTLRL SEQ ID NO: 5928 HRSSLRR SEQ ID NO: 5929 DRSTRTK SEQ ID NO: 5930 RSDYLAK
118718 ZmSIGPPL57_1 SEQ ID NO: 5931 QSSDLSR SEQ ID NO: 5932 QSTHRNA SEQ ID NO: 5933 RSADLTR SEQ ID NO: 5934 RSDDLTR SEQ ID NO: 5935 DRSNLSR SEQ ID NO: 5936 QSGNLAR
ZmSIGPPL57_2 SEQ ID NO: 5937 QSGHLAR SEQ ID NO: 5938 DRSHLAR SEQ ID NO: 5939 RSANLAR SEQ ID NO: 5940 QSANRTK SEQ ID NO: 5941 RSDHLTQ N/A
118722 ZmSIGPPL58_3 SEQ ID NO: 5942 QSSDLSR SEQ ID NO: 5943 RSDHLTQ SEQ ID NO: 5944 DRSALAR SEQ ID NO: 5945 RSDYLAK SEQ ID NO: 5946 QSGDLTR N/A
ZmSIGPPL58_4 SEQ ID NO: 5947 RSDNLSQ SEQ ID NO: 5948 QRQHRKT SEQ ID NO: 5949 DQSNLRA SEQ ID NO: 5950 RPYTLRL SEQ ID NO: 5951 QSSNLAR SEQ ID NO: 5952 RSDNLTT
118726 SIGPPL59_5 SEQ ID NO: 5953 QSGHLAR SEQ ID NO: 5954 QRVALQA SEQ ID NO: 5955 ERGTLAR SEQ ID NO: 5956 QSGDLTR SEQ ID NO: 5957 RSDDLTR N/A
SIGPPL59_6 SEQ ID NO: 5958 QSSDLSR SEQ ID NO: 5959 HRSNLNK SEQ ID NO: 5960 RSADLTR SEQ ID NO: 5961 TNQNRIT SEQ ID NO: 5962 RSDALAR N/A
118728 ZmSIGPPL60_3 SEQ ID NO: 5963 DSSALIN SEQ ID NO: 5964 TSSNLSR SEQ ID NO: 5965 RSDHLSR SEQ ID NO: 5966 YGWYRHK SEQ ID NO: 5967 TSGHLSR SEQ ID NO: 5968 RSDNLTR
ZmSIGPPL60_4 SEQ ID NO: 5969 QSGHLAR SEQ ID NO: 5970 QRTNLVE SEQ ID NO: 5971 DRSTRTK SEQ ID NO: 5972 QSGNLHV SEQ ID NO: 5973 RSDHLTQ N/A
118732 SIGPPL61_5 SEQ ID NO: 5974 RSDNLST SEQ ID NO: 5975 RSDNRTK SEQ ID NO: 5976 RSDNLAR SEQ ID NO: 5977 QKVNLMS SEQ ID NO: 5978 QSGALAR N/A
SIGPPL61_6 SEQ ID NO: 5979 QSGDLTR SEQ ID NO: 5980 TQGYLRK SEQ ID NO: 5981 RSDNLAR SEQ ID NO: 5982 DSSGLTH SEQ ID NO: 5983 RNDDRKK N/A
118733 ZmSIGPPL62_1 SEQ ID NO: 5984 DRSDLSR SEQ ID NO: 5985 RRDYLRT SEQ ID NO: 5986 RSDTLSE SEQ ID NO: 5987 NNRDRTK SEQ ID NO: 5988 RSDTLSE SEQ ID NO: 5989 QSGDLTR
ZmSIGPPL62_2 SEQ ID NO: 5990 QSSDLSR SEQ ID NO: 5991 QSTHRNA SEQ ID NO: 5992 RSDDLSK SEQ ID NO: 5993 RSDALAR N/A N/A
118735 SIGPPL62_5 SEQ ID NO: 5994 RSANLAR SEQ ID NO: 5995 RSDDLTR SEQ ID NO: 5996 RSDALST SEQ ID NO: 5997 DRSTRTK SEQ ID NO: 5998 QSGNLAR SEQ ID NO: 5999 QSTPLFA
SIGPPL62_6 SEQ ID NO: 6000 QSGHLAR SEQ ID NO: 6001 ERIALVR SEQ ID NO: 6002 RSDHLSE SEQ ID NO: 6003 RSAHLSR SEQ ID NO: 6004 RSDNLSV N/A
118739 ZmSIGPPL64_1 SEQ ID NO: 6005 RSDTLSE SEQ ID NO: 6006 QSHNRTK SEQ ID NO: 6007 DRSHLTR SEQ ID NO: 6008 DRSALAR SEQ ID NO: 6009 TSGSLTR N/A
ZmSIGPPL64_2 SEQ ID NO: 6010 LRHHLTR SEQ ID NO: 6011 QSYARTL SEQ ID NO: 6012 RSDNLST SEQ ID NO: 6013 RSDDLTR SEQ ID NO: 6014 RSAHLSR SEQ ID NO: 6015 RSDNLTR
118742 SIGPPL65_1 SEQ ID NO: 6016 RSDDLSK SEQ ID NO: 6017 DRSNRKT SEQ ID NO: 6018 DRSNLSR SEQ ID NO: 6019 QRTHLRD SEQ ID NO: 6020 QSGHLSR N/A
SIGPPL65_2 SEQ ID NO: 6021 QSSDLSR SEQ ID NO: 6022 QSGNRTT SEQ ID NO: 6023 DRSNLTR SEQ ID NO: 6024 QSGHLAR SEQ ID NO: 6025 QRTNLVE N/A
118745 ZmSIGPPL66_1 SEQ ID NO: 6026 QSGDLTR SEQ ID NO: 6027 RRDPLIN SEQ ID NO: 6028 QSGDLTR SEQ ID NO: 6029 RSDSLSR SEQ ID NO: 6030 DKSNRIK N/A
ZmSIGPPL66_2 SEQ ID NO: 6031 QSSDLSR SEQ ID NO: 6032 QSGDLTR SEQ ID NO: 6033 QSSDLSR SEQ ID NO: 6034 TSGNLTR SEQ ID NO: 6035 QTSDRNK N/A
124081 ZmSIGPPL67_3 SEQ ID NO: 6036 QSGSLTR SEQ ID NO: 6037 RNDDRKK SEQ ID NO: 6038 RSDSLSA SEQ ID NO: 6039 QNAHRKT SEQ ID NO: 6040 QNAHRKT N/A
ZmSIGPPL67_4 SEQ ID NO: 6041 QSGDLTR SEQ ID NO: 6042 DKGNLTK SEQ ID NO: 6043 QSSDLSR SEQ ID NO: 6044 QSAHRKN SEQ ID NO: 6045 QSSDLSR N/A
125361 SEQ ID NO: 6046 RSDALSR SEQ ID NO: 6047 QSGSLTR SEQ ID NO: 6048 QSGSLTR SEQ ID NO: 6049 QSGSLTR SEQ ID NO: 6050 TSGHLSR SEQ ID NO: 6051 DRSHLAR
SEQ ID NO: 6052 QSGDLTR SEQ ID NO: 6053 RSDHLSR SEQ ID NO: 6054 RSDHLST SEQ ID NO: 6055 RSDHLSR N/A N/A
118753 SIGPPL69_5 SEQ ID NO: 6056 QSSDLSR SEQ ID NO: 6057 RSDYLRK SEQ ID NO: 6058 QSGDLTR SEQ ID NO: 6059 LRQTLNS SEQ ID NO: 6060 QSGHLSR N/A
SIGPPL69_6 SEQ ID NO: 6061 RSDTLSV SEQ ID NO: 6062 DNSTRIK SEQ ID NO: 6063 RSDNLST SEQ ID NO: 6064 DNSNRIN SEQ ID NO: 6065 TSSNLSR N/A
124878 SEQ ID NO: 6066 RSDVLSA SEQ ID NO: 6067 QNATRIN SEQ ID NO: 6068 RSDVLSE SEQ ID NO: 6069 QSGNLAR SEQ ID NO: 6070 RSDNLSV N/A
SEQ ID NO: 6071 QSADRTK SEQ ID NO: 6072 DRSNLTR SEQ ID NO: 6073 RSDNLSE SEQ ID NO: 6074 KRCNLRC N/A N/A
123829 ZmSIGPPL71_5 SEQ ID NO: 6075 DRSNLSR SEQ ID NO: 6076 DSSARNT SEQ ID NO: 6077 TSGNLTR SEQ ID NO: 6078 DRSNLTR SEQ ID NO: 6079 DRSNLSR SEQ ID NO: 6080 QRSNLDS
ZmSIGPPL71_6 SEQ ID NO: 6081 QSGNLAR SEQ ID NO: 6082 QKVNRAG SEQ ID NO: 6083 RSDNLSV SEQ ID NO: 6084 QRNHRTT SEQ ID NO: 6085 QKATRIT N/A
118761 ZmSIGPPL72_3 SEQ ID NO: 6086 QSGALAR SEQ ID NO: 6087 LRHNLRA SEQ ID NO: 6088 DRSTRTK SEQ ID NO: 6089 HRSARKR SEQ ID NO: 6090 RSDHLSE SEQ ID NO: 6091 TSSDRTK
ZmSIGPPL72_4 SEQ ID NO: 6092 RSDSLSR SEQ ID NO: 6093 DKSNRIK SEQ ID NO: 6094 RSDDLTR SEQ ID NO: 6095 DRSHLTR SEQ ID NO: 6096 DRSNLTR N/A
121904 SIGPPL74_1 SEQ ID NO: 6097 RSDNLST SEQ ID NO: 6098 RQWSLRI SEQ ID NO: 6099 TSGHLSR SEQ ID NO: 6100 QSSDLSR SEQ ID NO: 6101 RSDDLTR N/A
SIGPPL74_2 SEQ ID NO: 6102 RSANLAR SEQ ID NO: 6103 RLDNRTA SEQ ID NO: 6104 QSGHLAR SEQ ID NO: 6105 DSSNREA N/A N/A
121905 ZmSIGPPL75_1 SEQ ID NO: 6106 RSDALSR SEQ ID NO: 6107 RSDNLTR SEQ ID NO: 6108 RSADLTR SEQ ID NO: 6109 RSDNLTR N/A N/A
ZmSIGPPL75_2 SEQ ID NO: 6110 RSDNLSV SEQ ID NO: 6111 RSDTRTE SEQ ID NO: 6112 TSGSLSR SEQ ID NO: 6113 QSGNLAR SEQ ID NO: 6114 RSADLTR N/A
121917 SIGPPL76_2 SEQ ID NO: 6115 TSGSLSR SEQ ID NO: 6116 RSDHLTT SEQ ID NO: 6117 RSDDLTR SEQ ID NO: 6118 QRSTLSS SEQ ID NO: 6119 ERGTLAR SEQ ID NO: 6120 QSGHLSR
SIGPPL76_1 SEQ ID NO: 6121 RSDHLSQ SEQ ID NO: 6122 DNASRIR SEQ ID NO: 6123 RSDNLST SEQ ID NO: 6124 AQWTRAC SEQ ID NO: 6125 RSDHLSE SEQ ID NO: 6126 DKANRTR
121918 ZmSIGPPL77_2 SEQ ID NO: 6127 QSSDLSR SEQ ID NO: 6128 LRHNLRA SEQ ID NO: 6129 RSDTLST SEQ ID NO: 6130 DRSSRIK N/A N/A
ZmSIGPPL77_1 SEQ ID NO: 6131 QSGALAR SEQ ID NO: 6132 RSDNLTR SEQ ID NO: 6133 RSDNLST SEQ ID NO: 6134 DRSNLTR SEQ ID NO: 6135 DRSDLSR SEQ ID NO: 6136 DSSTRRR
121909 SIGPPL78_1 SEQ ID NO: 6137 DRSALAR SEQ ID NO: 6138 DRSALSR SEQ ID NO: 6139 DRSHLAR SEQ ID NO: 6140 RSDNLST SEQ ID NO: 6141 RSDARAN N/A
SIGPPL78_2 SEQ ID NO: 6142 RSDHLST SEQ ID NO: 6143 DSSNRIK SEQ ID NO: 6144 QSGALAR SEQ ID NO: 6145 RSDDLTR SEQ ID NO: 6146 QSGSLTR N/A
121912 SIGPPL79_1 SEQ ID NO: 6147 DRSHLSR SEQ ID NO: 6148 DRSHLAR SEQ ID NO: 6149 QSSDLSR SEQ ID NO: 6150 QSGDLTR SEQ ID NO: 6151 RSDNLSE SEQ ID NO: 6152 HSNARKT
SIGPPL79_2 SEQ ID NO: 6153 RSDALSV SEQ ID NO: 6154 DSSHRTR SEQ ID NO: 6155 QSGDLTR SEQ ID NO: 6156 ASHNLRT SEQ ID NO: 6157 RSDHLST SEQ ID NO: 6158 TSANLSR
121981 ZmSIGPPL80_3 SEQ ID NO: 6159 DRSDLSR SEQ ID NO: 6160 DRSNLTR SEQ ID NO: 6161 RSDSLLR SEQ ID NO: 6162 RLDWLPM SEQ ID NO: 6163 RSADLTR SEQ ID NO: 6164 TSGNLTR
ZmSIGPPL80_4 SEQ ID NO: 6165 RSDNLSQ SEQ ID NO: 6166 DRSNRTK SEQ ID NO: 6167 DSSDRKK SEQ ID NO: 6168 RSDHLSE SEQ ID NO: 6169 QSASRKN N/A
124091 ZmSIGPPL81_3 SEQ ID NO: 6170 RSDVLST SEQ ID NO: 6171 STAALSY SEQ ID NO: 6172 QSANRTT SEQ ID NO: 6173 QNAHRKT SEQ ID NO: 6174 QSSDLSR N/A
ZmSIGPPL81_4 SEQ ID NO: 6175 QRNHRTT SEQ ID NO: 6176 DRSNLTR SEQ ID NO: 6177 TSGNLTR SEQ ID NO: 6178 QSNQLRQ SEQ ID NO: 6179 RSDALTQ N/A
127268* SEQ ID NO: 6620
DRSAL AR
SEQ ID
NO: 6621 DYYGR
HG
SEQ ID NO: 6622
DRSHL AR
SEQ ID NO: 6623 YRSSLK E SEQ ID NO: 6624 TSGNLT R N/A
SEQ ID NO: 6625
HHHVL VQ
SEQ ID NO: 6626
QNATR TK
SEQ ID NO: 6627 DRSTRT К SEQ ID NO: 6628
RRDNL HS
SEQ ID NO: 6629
QKATR TT
SEQ ID NO:6630 HRSSLRR
120993* SEQ ID NO: 6631 QSSDLS R SEQ ID NO: 6632
QWSTR KR
SEQ ID NO: 6633 RSDVLS E SEQ ID NO: 6634
QTVHR NS
SEQ ID NO: 6635 RSDTLS E SEQ ID NO: 6636 FRGSLT W
SEQ ID NO: 6637 RSDNLS T SEQ ID NO: 6638 RSTHRT
о
SEQ ID NO: 6639 RSDNLS V SEQ ID NO: 6640 QKATRI N SEQ ID NO: 6641 DRSNLT R N/A
228254"' SEQ ID NO: 6642 QSGNLAR SEQ ID NO: 6643 CRQNLAN SEQ ID NO: 6644 DRSNLSR SEQ ID NO: 6645 DGRNLRH SEQ ID NO: 6646 RSDHLST SEQ ID NO: 6647 RSDNLTR
SEQ ID NO: 6648 DRSNRTT SEQ ID NO: 6649 QNATRIN SEQ ID NO: 6650 QSGNLAR SEQ ID NO: 6651 HKLSLSI SEQ ID NO: 6652 DRSDLSR SEQ ID NO: 6653 YRSNLVR
200497"' SEQ ID NO: 6654 DRSALSR SEQ ID NO: 6655 QSGSLTR SEQ ID NO: 6656 RSDNLTR SEQ ID NO: 6657 RQDCLSL SEQ ID NO: 6658 RNDNRKT N/A
SEQ ID NO: 6659 QSGNLAR SEQ ID NO: 6660 DQSGLAH SEQ ID NO: 6661 QSANRTK SEQ ID NO: 6662 DRSDLS R SEQ ID NO: 6663 RSHHL KA N/A
66202* SEQ ID NO: 6664 QSGNLAR SEQ ID NO: 6665 QSGSLTR SEQ ID NO: 6666 DRSALSR SEQ ID NO: 6667 QSGSLTR SEQ ID NO: 6668 QSGNLAR N/A
SEQ ID NO: 6669 QSGNLAR SEQ ID NO: 6670 WRISLAA SEQ ID NO: 6671 RSDNLSE SEQ ID NO: 6672 RSQHRKT SEQ ID NO: 6673 QSSDLSR N/A
5607"' SEQ ID NO: 6674 RSANLAR SEQ ID NO: 6675 RSDHLTT SEQ ID NO: 6676 RSDNLSE SEQ ID NO: 6677 DRSHLAR SEQ ID NO: 6678 QSAHRKN SEQ ID NO: 6679 LKHHLTD
SEQ ID NO: 6680 TSGNLTR SEQ ID NO: 6681 DRSNLTR SEQ ID NO: 6682 RSDNLSQ SEQ ID NO: 6683 RKADRTK SEQ ID NO: 6684 SGNLTR SEQ ID NO: 6685
DSSNLAT

Таблица 8
Участки-мишени для цинковых пальцев в выбранных геномных локусах Zea mays
ID локуса Наименование Номер pDAB Номер ZFP и участки связывания (5'→3') SEQ ID NO:
optimal loci_ 204637 OGL1 111879 111879ZFN5:ctACTCCGTATGCGAAGGCAcg 5398
111879ZFN7: taTTCGCGGTGGGACACTTGat 5399
optimal_loci_204726 OGL2 111885 111885ZFN1: ccGGAGCCGGGGCCTCCCAGgc 5400
111885ZFN2: atCGCGACGCGACGcGACGAGac 5401
optimal_loci_156393 OGL 12 117404 SIG115737_31v1: TGCATGCGCAGTA 5402
SIG115737_32v1: ACACCGGCGCACGGCACG 5403
optimal_loci_198387 OGL 15 117408 SIG120523_11v1: AGAGGTGTAACC 5404
SIG120523_12v1: TCGGGCACAAGAAACGAG 5405
optimal_loci_31710 OGL 08 117400 SIG115246_5: TACGCTGACAATGCA 5406
SIG115246_6: CCAGCTGATGGAGAGGAC 5407
optimal_loci_64542 OGL 11 117402 SIG115636_1v1: AGAGCAGGCGAG 5408
SIG115636_2v1: AGCAAAGTGAGTAGTT 5409
optimal_loci_197372 OGL14 117406 SIG120417_11v1: TGGATGGAAGGAATC 5410
SIG120417_12v1: GAAGCTACATCCCAG 5411
optimal_loci_232228 OGL 16 117411 SIG120621_15v1: TACGCGCAACGGAACGCA 5412
SIG120621_16v1: CACCGGTGTCGTGTAACAG 5413
optimal_loci_285621 OGL17 117413 SIG12078_11v1: CCCGGACGACGCCGAG 5414
SIG12078_12v1: GACATGGCACGCGCATCGAG 5415
optimal_loci_157315 OGL 13 117429 SIG157315_1v1: GCATGTGTGGTTTTG 5416
SIG157315_2v1: GGTCAAGGTAGTGAC 5417
optimal_loci_43577 OGL04 124802 ZFN_binding_1:
AGCTTCAATAGTA
6180
ZFN_binding_2:
GTCTTCCGGTTGGCT
6181
optimal_loci_301774 OGL05 121900 ZFN_binding_3:
GTCGATGCACCG
6182
ZFN_binding_4:
CTAAGGATGGACGCAGTG
6183
optimal_loci_232222 OGL06 124810 ZFN_binding_5:
CATGAGAGGGAT
6184
ZFN_binding_6:
ATGTCGTAGAAAAGAA
6185
optimal_loci_203704 OGL07 121902 ZFN_binding_7:
CATGTTCGCTGCGGCTGGA
6186
ZFN_binding_8:
AGTCCGCTCGGG
6187
optimal_loci_59517 OGL09 118643 ZFN_binding_9:
GACGATCTAGCGAGAAGG
6188
ZFN_binding_10:
ATCGAAGAACGCAGCGGAT
6189
optimal_loci_25001 OGL10 118648 ZFN_binding_12:
CACGCGCCGGGTGTCTAG
6190
ZFN_binding_13:
GACGAGCACCGCCCCACCG
6191
optimal_loci_112632 OGL18 123802 ZFN_binding_14:
CGGGTACTGGGAAAGGAG
6192
ZFN_binding_15:
GAGCGTCCTGATTGACATG
6193
optimal_loci_28905 OGL19 123805 ZFN_binding_16:
ACGGTGCATCAAGCTTAAG
6194
ZFN_binding_17:
CAAGGGACCTAGTGAGCT
6195
optimal_loci_129164 OGL20 121992 ZFN_binding_18:
GGTGACTAAGCT
6196
ZFN_binding_19:
AGATAAGCTGCAGAC
6197
optimal_loci_2425 OGL21 118650 ZFN_binding_20:
GAGCAGGCAGGCAGGC
6198
ZFN_binding_21:
GTCGTCGTCGTGCGTGGCC
6199
optimal_loci_122036 OGL22 118654 ZFN_binding_22:
GTGGCAACGGGGGCT
6200
ZFN_binding_23:
GGTTCAGCGGGCTAG
6201
optimal_loci_5735 OGL23 118656 ZFN_binding_24:
GCGGTCTTGCCGGGCGAA
6202
ZFN_binding_25:
CTAGAGGCGCCCATG
6203
optimal_loci_178978 OGL24 118659 ZFN_binding_26:
ACGGACAGCCGAGAAAGCA
6204
ZFN_binding_27:
CGAGATCGAGGCCAGATCG
6205
optimal_loci_288388 OGL25 118660 ZFN_binding_28:
TTGCCATGGGTTATTGAG
6206
ZFN_binding_29:
GGAGCATGGCCAGGTAGTG
6207
optimal_loci_60310 OGL26 118767 ZFN_binding_30:
CCAGTTCCGACGAGTGGCG
6208
ZFN_binding_31:
GGCCTGGGCGAACGCCGCCG
6209
optimal_loci_243330 OGL27 118769 ZFN_binding_32:
AGTGCAAGGGAAGAC
6210
ZFN_binding_33:
AGGAGGGATGGAGCAGCG
6211
optimal_loci_127038 OGL28 118663 ZFN_binding_34:
GGAGATAGGAGTAGCT
6212
ZFN_binding_35:
GTTGCGCCCTACGAA
6213
optimal_loci_262784 OGL29 118668 ZFN_binding_36:
TCGGTTGACCGATGGC
6214
ZFN_binding_37:
AACGAGCCATATGCAAGTT
6215
optimal_loci_344662 OGL30 118669 ZFN_binding_38:
GGATGGCTCCGAATGATATG
6216
ZFN_binding_39:
GAGGGCGTCTTGAGG
6217
optimal_loci_153894 OGL31 118670 ZFN_binding_40:
GTGTTGCTGTACGAC
6218
ZFN_binding_41:
GCAGCGAACGGCTGTA
6219
optimal_loci_28771 OGL32 118673 ZFN_binding_42:
GGGTAGGGGTGACGTA
6220
ZFN_binding_43:
GATCACGACATATCCA
6221
optimal_loci_1098 OGL33 118674 ZFN_binding_44:
TGGGTGGGTTTGCGTG
6222
ZFN_binding_45:
CCCATGCAGGTAAAGGTA
6223
optimal_loci_97772 OGL34 118676 ZFN_binding_46:
GGACTGGGTGCCTGTGTG
6224
ZFN_binding_47:
CGTGGGTACGAA
6225
optimal_loci_236662 OGL35 118677 ZFN_binding_48:
CGTGCTGTGGTCTGGCGTA
6226
ZFN_binding_49:
TGGGGCTATGGCCATGGGG
6227
optimal_loci_139485 OGL36 118680 ZFN_binding_50:
GCGGTACGATAGTGTT
6228
ZFN_binding_51:
ACTCGGGGAGTCGGGGTC
6229
optimal_loci_301175 OGL37 118683 ZFN_binding_52:
GACGGATCGGAG
6230
ZFN_binding_53:
GGCGGATGCATCCGTT
6231
optimal_loci_152337 OGL38 118685 ZFN_binding_54:
ATAGCGGACCGATCGG
6232
ZFN_binding_55:
ATCCCGGCCGGTCGATTCG
6233
optimal_loci_202616 OGL39 123833 ZFN_binding_56:
cgtgcttgcggcaccgcag
6234
ZFN_binding_57:
gccgctgcacccgttcat
6235
optimal_loci_282323 OGL40 118771 ZFN_binding_58:
GAGGACAGGCGAGCT
6236
ZFN_binding_59:
GAAGACGTAGGCGCA
6237
optimal_loci_262782 OGL41 121943 ZFN_binding_60:
CACAAGATGGTGATGGTC
6238
ZFN_binding_61:
CATGTATGTATGTAGTAG
6239
optimal_loci_236455 OGL42 121946 ZFN_binding_62:
TCGGCCATGGGA
6240
ZFN_binding_63:
GCGGCCAAAAAGCATGTA
6241
optimal_loci_162531 OGL43 121949 ZFN_binding_64:
GGTGCCAAAGCCATGCAG
6242
ZFN_binding_65:
GGCTGGCGGGCGGCC
6243
optimal_loci_344663 OGL44 121952 ZFN_binding_66:
GGAGACTCGATAAGAA
6244
ZFN_binding_67:
GCCATGTGGGGTAGTT
6245
optimal_loci_337001 OGL45 121959 ZFN_binding_68:
CATGGCATGGCATCG
6246
ZFN_binding_69:
CACATGCGCGGCGCATGTC
6247
optimal_loci_238100 OGL46 121963 ZFN_binding_70:
TAGTAGGCTAGTAGCT
6248
ZFN_binding_71:
ACGCCGCGGCGGCTTGCGCT
6249
optimal_loci_264359 OGL48 121971 ZFN_binding_72:
ATCTAGGTGCAACTAG
6250
optimal_loci_282653 OGL49 121972 ZFN_binding_73:
GTGAAACGGATGTGT
6251
ZFN_binding_74:
TCAGAATATCATGATGGCC
6252
optimal_loci_80282 OGL50 124097 ZFN_binding_75:
TGCGAGCGCTGCATGG
6253
ZFN_binding_76:
GCTGGAGGGGCCAATGAT
6254
optimal_loci_291068 OGL51 123818 ZFN_binding_77:
TATCCGATCCCG
6255
ZFN_binding_78:
TGTGTGGATGACGAAACG
6256
optimal_loci_56395 OGL52 118705 ZFN_binding_79:
GGAGTAAGAAATGAC
6257
ZFN_binding_80:
TCCGCGTTGCTGTCTGAA
6258
optimal_loci_114664 OGL54 118711 ZFN_binding_81:
TATCAGCTCGAG
6259
ZFN_binding_82:
TAGACCTGTTTTGATGGTT
6260
optimal_loci_53137 OGL57 118718 ZFN_binding_83:
GAAGACGGCGGCGAGAGCT
6261
ZFN_binding_84:
AGGGAAGAGAGGAGGA
6262
optimal_loci_344664 OGL58 118722 ZFN_binding_85:
GCACAGATCAGGGCT
6263
ZFN_binding_86:
AAGGATTTGCACAGACAG
6264
optimal_loci_81941 OGL59 118726 ZFN_binding_87:
GCGGCAGCCATAGGA
6265
ZFN_binding_88:
GTGCATGCGTATCCA
6266
optimal_loci_321514 OGL60 118728 ZFN_binding_89:
GAGGGTCTTGGGGTGATATC
6267
ZFN_binding_90:
AGGAAAGCCCAAGGA
6268
optimal_loci_301180 OGL61 118732 ZFN_binding_91:
GTACAAGAGTAGTAG
6269
ZFN_binding_92:
TCGATCGAGGGCGCA
6270
optimal_loci_348776 OGL62 118733 ZFN_binding_93:
CCACCGTCTCCGTAGGCC
6271
ZFN_binding_94:
GTGTCGAGAGCT
6272
optimal_loci_244439 OGL63 118735 ZFN_binding_95:
ATAGAAAACCATGGCGGAG
6273
ZFN_binding_96:
AAGGGGCGGCAACGGA
6274
optimal_loci_348258 OGL64 118739 ZFN_binding_97:
GTTGTCGGATAACCG
6275
ZFN_binding_98:
GAGGGGGAGTAGCTAGGT
6276
optimal_loci_322501 OGL65 118742 ZFN_binding_99:
GGACGAGACCAAATCG
6277
ZFN_binding_100:
CAAGGAGACAAAGCT
6278
optimal_loci_244324 OGL66 118745 ZFN_binding_101:
TACGTGGCAATTGGCA
6279
ZFN_binding_102:
TCAGATGCTGCAGCT
6280
optimal_loci_97232 OGL67 124081 ZFN_binding_103:
AGAAGATCGATCGGTA
6281
ZFN_binding_104:
GCTTGAGCTCACGCA
6282
optimal_loci_282499 OGL68 125361 ZFN_binding_105:
CACTACTACTACTACCGCC
6283
ZFN_binding_106:
GGGTGGGGGGCA
6284
optimal_loci_155031 OGL69 118753 ZFN_binding_107:
GGACCTACAATAGGCA
6285
ZFN_binding_108:
GATCACAAGACCAAG
6286
optimal_loci_301773 OGL70 124878 ZFN_binding_109:
CATTGTCAGTTCCTT
6287
ZFN_binding_110:
CAGCAGGACTCT
6288
optimal_loci_283161 OGL71 123829 ZFN_binding_111:
AAGACAGACGATGTC
6289
ZFN_binding_112:
ACAAAAAAGCAAGAA
6290
optimal_loci_55524 OGL72 118761 ZFN_binding_113:
TCACGGTGTTACCCATGTA
6291
ZFN_binding_114:
GACGGATGCGTACGTG
6292
optimal_loci_127268 OGL73 124086 ZFN_binding_131:
GTTGTTATTCAAACA
6293
ZFN_binding_132:
CACAAGTAATGTGGA
6294
optimal_loci_136086 OGL74 121904 ZFN_binding_115:
GCGGCTGGTTTGCAG
6295
ZFN_binding_116:
CACGGACAGGAG
6296
optimal_loci_232484 OGL75 121905 ZFN_binding_117:
GAGGCGGAGGTG
6297
ZFN_binding_118:
AGGGCGGAAGTTACGGAG
6298
optimal_loci_20307/ OGL76 121917 ZFN_binding_119:
GGAGCCCCCAGCGTGGGTT
6299
ZFN_binding_120:
GACCGGTCAGTAGGTCAAG
6300
optimal_loci_3733 OGL77 121918 ZFN_binding_121:
TTCACGTCATGCT
6301
ZFN_binding_122:
GCCGACGACTAGGAGGTA
6302
optimal_loci_168286 OGL78 121909 ZFN_binding_123:
CTGTAGGGCGTCGTC
6303
ZFN_binding_124:
GTAGCGGTACTACTGG
6304
optimal_loci_128078 OGL79 121912 ZFN_binding_125:
ATCCAGGCAGCTGGCGGC
6305
ZFN_binding_126:
GATTGGAATGCAGGCCCG
6306
optimal_loci_265551 OGL80 121981 ZFN_binding_127:
GATGCGTCTGGTGTGACGAC
6307
ZFN_binding_128:
ACACAGTCCTACTAG
6308
optimal_loci_137693 OGL81 124091 ZFN_binding_129:
GCTCGAAAACTTATG
6309
ZFN_binding_130:
ATGAAAGATGACCGA
6310
optimal_loci_228254 OGL55 n/a TTCATGGTTGTTACCACTCatnnnatGATCCCTTTGAAGTAAAC 6686
optimal_loci_66202 OGL47 n/a TTCTACGATTACTTCtannctGCTAGTCAGATTGAA 6687
optimal_loci_120993 OGL56 n/a TGATGCAAGGTGGCGTAAAggnnggGACATAAAGAGGCAG 6688
optimal_loci_200497 OGL53 n/a GATTACCTCCACCTTttnnctAGGCCCTAATATCGAA 6689
optimal_loci_5607 OGL03 n/a ATCCCTCTATCCTTCACGaanngaAACGATCTCGAAGGACGAT 6690

Репрезентативные конструкции цинковых пальцев для геномных локусов Zea mays вставляли в векторы для экспрессии цинковых пальцев, кодирующие белок, обладающий по меньшей мере одним пальцем со структурой CCHC. См. публикацию Патента США No. 2008/0182332. В частности, последний палец в каждом белке обладал остовом CCHC для узнающей спирали. Неканонические последовательности, кодирующие цинковые пальцы, сливали с нуклеазным доменом рестрикционного фермента типа IIS FokI (аминокислоты 384-579 последовательности из Wah et al., (1998) Proc. Natl. Acad. Sci. USA 95:10564-10569) через линкер ZC из четырех аминокислот и сигнал ядерной локализации opaque-2, полученный из Zea mays, для формирования нуклеаз с цинковыми пальцами (ZFN). См. Патент США No. 7888121. Цинковые пальцы для различных функциональных доменов выбирали для применения in vivo. Из многочисленных ZFN, которые были сконструированы, продуцированы и протестированы для связывания с предполагаемым геномным участком-мишенью, ZFN, описанные в таблице 8 выше, идентифицированы как обладающие активностью in vivo, и были охарактеризованы как способные эффективно связывать и расщеплять уникальные геномные полинуклеотидные участки-мишени Zea mays in planta.

Сборка конструкции ZFN

Плазмидные векторы, содержащие экспрессирующие ген ZFN конструкции, идентифицированные, как описано ранее, конструировали и получали с использованием квалификации и способов, общеизвестных в данной области (см., например, Ausubel или Maniatis). Каждую кодирующую ZFN последовательность сливали с последовательностью, кодирующей сигнал ядерной локализации opaque-2 (Maddaloni et al. (1989) Nuc. Acids Res. 17(18):7532), расположенный выше нуклеазы с цинковыми пальцами. Неканонические кодирующие цинковые пальцы последовательности сливали с нуклеазаным доменом рестрикционного фермента FokI типа IIS (аминокислоты 384-579 последовательности из Wah et al. (1998) Proc. Natl. Acad. Sci. USA 95:10564-10569). Экспрессию слитых белков контролировали сильным конститутивным промотором из гена убиквитина Zea mays (включающим 5'-нетранслируемую область (UTR) (Toki et al., (1992) Plant Physiology 100; 1503-07). Экспрессирующая кассета включала также 3'-UTR (содержащую терминатор транскрипции и участок полиаденилирования) из гена пероксидазы 5 Zea mays (Per5) (публикация Патента США No. 2004/0158887). Кодирующую самогидролизующийся 2A нуклеотидную последовательность из вируса Thosea asigna (Szymczak et al., (2004) Nat Biotechnol. 22:760-760) добавляли между двумя слитыми белками нуклеаз с цинковыми пальцами, клонированными в конструкцию.

Плазмидные векторы собирали с использованием способа IN-FUSION™ Advantage (Clontech, Mountain View, CA). Рестрикционные эндонуклеазы получали из New England BioLabs (Ipswich, MA), и ДНК-лигазу T4 (Invitrogen, Carlsbad, CA) использовали для лигирования ДНК. Выделение плазмид проводили с использованием набора для выделения плазмид NUCLEOSPIN® (Macherey-Nagel Inc., Bethlehem, PA) или набора для выделения плазмид Midi (Qiagen), следуя инструкциям производителей. Фрагменты ДНК выделяли с использованием набора для выделения из геля QIAQUICK™ (Qiagen) после электрофореза в агарозном геле с Трис-ацетатом. Скрининг колоний после всех реакций лигирования первоначально проводили посредством расщепления минипрепарата ДНК. Плазмидную ДНК избранных клонов секвенировали у коммерческого исполнителя секвенирования (Eurofins MWG Operon, Huntsville, AL). Данные о последовательности составляли и анализировали с использованием программного обеспечения SEQUENCHER™ (Gene Codes Corp., Ann Arbor, MI).

Плазмиды конструировали и подтверждали посредством расщепления рестрикционным ферментом и секвенирования ДНК.

Клонирование цинковых пальцев посредством автоматизированного процесса

Подгруппу векторов для нуклеаз с цинковыми пальцами клонировали с использованием автоматизированной конвейерной системы для конструирования ДНК. В целом, автоматизированная конвейерная система обеспечила векторные конструкции с идентичной архитектурой ZFN, как описано ранее. Каждый мономер цинкового пальца, придающий ZFN специфичность связывания ДНК, был разделен на 2-3 уникальных последовательности в области аминокислотного мотива KPF. Как 5'-, так и 3'-концы фрагментов ZFN были модифицированы включением участка узнавания BsaI (GGTCTCN) и образующихся в результате выступающих концов. Выступающие концы были размещены так, чтобы сборная конструкция из 6-8 частей могла обеспечить только желаемый полноразмерный экспрессирующийся клон. Модифицированные фрагменты ДНК синтезировали de novo (Synthetic Genomics Incorporated, La Jolla, CA). Во всех конструкциях ZFN для маиса использовали один остов для маиса pDAB118791. Он содержал промотор ZmUbi1 и NLS Opaque2, а также домен FokI и 3'-UTR ZmPer5. Домен, клонированный между NLS Opaque 2 и FokI, представлял собой ген SacB из Bacillus subtilis, фланкированный BsaI. Когда для предполагаемых событий лигирования проводили посев на среды, содержащие сахарозу, кассета SacB выступала в качестве агента отрицательной селекции, снижающего или устраняющего контаминацию остовом вектора. Вторая часть, многократно использованная во всех конструкциях, представляла собой pDAB117462. Этот вектор содержит первый мономерный домен Fok1, последовательность статтера t2A и 2-й мономер NLS Opaque2, все из которых были фланкированы участками BsaI.

С использованием этих материалов в качестве библиотеки частей ДНК ZFN, система Freedom Evo 150® (TECAN, Mannedorf, Швейцария) осуществляла добавление 75-100 нг каждой плазмидной ДНК или синтезированного фрагмента из пробирок, кодируемых 2D-штрих-кодом, в планшет для ПЦР (ThermoFisher, Waltham, MA). В реакционную смесь добавляли BsaI (NEB, Ipswich, MA) и ДНК-лигазу T4 (NEB, Ipswich, MA), дополненные бычьим сывороточным альбумином (NEB, Ipswich, MA) и буфером для ДНК-лигазы T4 (NEB, Ipswich, MA). Проводили циклические реакции (25X) с инкубациями в течение 3 минут при 37°C и 4 минут при 16°C в термоциклере C1000 Touch (BioRad, Hercules CA). Лигированный материал подвергали трансформации и скринингу в клетках Top10 (Life Technologies Carlsbad, CA) вручную или с использованием устройства для сбора колоний Qpix460 и LabChip GX® (Perkin Elmer, Waltham, MA). Для правильно расщепляемых колоний проводили подтверждение последовательностей для трансформации растений.

Сборка универсальных донорных конструкций

Для обеспечения быстрого исследования большого количества локусов-мишеней, разрабатывали и конструировали новую гибкую универсальную последовательность донорной системы. Универсальная донорная полинуклеотидная последовательность являлась совместимой с высокопроизводительными способами конструирования векторов и анализа. Универсальная донорная система состояла по меньшей мере из трех модульных доменов: вариабельный связывающий домен ZFN, невариабельный аналитический домен и домен с определяемыми пользователем признаками, и простого плазмидного остова для увеличения количества вектора. Невариабельная универсальная донорная полинуклеотидная последовательность являлась общей для всех доноров и позволяла разработку конечного набора анализов, которые можно использовать для всех участков-мишеней Zea mays, таким образом, обеспечивая единообразие оценки нацеливания и уменьшение количества циклов анализа. Модульная природа этих доменов обеспечивала высокопроизводительную сборку донора. Кроме того, универсальная донорная полинуклеотидная последовательность обладает другими уникальными признаками, нацеленные на упрощение последующего анализа и улучшение интерпретации результатов. Она содержит асимметричную последовательность участка рестрикции, позволяеющую расщепление продуктов ПЦР до диагностически прогнозируемых размеров. Последовательности, содержащие вторичные структуры с ожидаемой проблематичностью для амплификации ПЦР, удаляли. Универсальная донорная полинуклеотидная последовательность имела малый размер (менее 3,0 т.п.о.). Наконец, универсальная донорная полинуклеотидная последовательность была сконструирована на высококопийном остове pUC19, который позволяет объединение большого количества тестируемых ДНК по времени.

В качестве варианта осуществления иллюстративная плазмида, содержавшая универсальную донорную полинуклеотидную последовательность, представлена как SEQ ID NO:5418 и фигура 7. В дополнительном варианте осуществления универсальная донорная полинуклеотидная последовательность представлена как: pDAB11846, SEQ ID NO:5419, фигура 15; pDAB117415, SEQ ID NO:5420, фигура 16; pDAB117416, SEQ ID NO:5421, фигура 17; pDAB117417, SEQ ID NO:5422, фигура 18; pDAB117419, SEQ ID NO:5423, фигура 19; pDAB117434 SEQ ID NO:5424, фигура 20; pDAB117418, SEQ ID NO:5425, фигура 21; pDAB117420, SEQ ID NO:5426, фигура 22; и pDAB117421, SEQ ID NO:5427, фигура 23. В другом варианте осуществления можно конструировать дополнительные последовательности, содержащие универсальную донорную полинуклеотидную последовательность с функциональной экспрессирующейся кодирующей последовательностью или нефункциональной (лишенной промотора) экспрессирующейся кодирующей последовательностью.

В другом варианте осуществления, универсальная донорная полинуклеотидная последовательность представляет собой небольшую модульную донорную систему размером 2-3 т.п.о., доставляемую в форме плазмиды. Она представляет собой минимальный донор, содержащий любое количество участков связывания ZFN, короткую матричную область размером 100-150 п.о., обозначенную «ДНК X» или «последовательность UZI» (SEQ ID NO:5428), несущую участки рестрикции и последовательности ДНК для конструирования праймеров или кодирующих последовательностей, и простой плазмидный остов (фигура 8). Целая плазмида вставлялась посредством NHEJ после двухцепочечных разрывов ДНК в соответствующем участке связывания ZFN; участки связывания ZFN можно включать тандемно. Этот вариант осуществления универсальной донорной полинуклеотидной последовательности являлся наиболее пригодным для быстрого скрининга участков-мишеней и ZFN, и последовательности, которые трудно амплифицировать, были минимизированы в доноре.

В следующем варианте осуществления универсальная донорная полинуклеотидная последовательность составлена по меньшей мере из 4 модулей и несет участки связывания ZFN, плечи гомологии, ДНК X либо только с аналитическим фрагментом размером приблизительно 100 п.о., либо с кодирующими последовательностями. Этот вариант осуществления универсальной донорной полинуклеотидной последовательности являлся пригодным для проверки опосредуемой HDR вставки гена в различные участки-мишени с использованием нескольких ZFN (фигура 9).

Универсальную донорную полинуклеотидную последовательность можно использовать со всеми нацеливающими молекулами с определенными ДНК-связывающими доменами с двумя способами направленной вставки донора (NHEJ/HDR). По существу, когда универсальную донорную полинуклеотидную последовательность совместно доставляли с соответствующей конструкцией для экспрессии ZFN, донорный вектор и геном маиса расщепляли в одном конкретном положении, определяемом связыванием конкретной ZFN. После линеаризации донор можно включать в геном посредством NHEJ или HDR. Затем можно использовать определенные аналитические факторы в конструировании векторов для определения цинкового пальца, который максимизирует эффективное осуществление направленной интеграции. (фигура 10).

Пример 4: Способы трансформации Zea mays

Перед доставкой в протопласты Zea mays c.v. Hi-II, плазмидную ДНК для каждой конструкции ZFN получали из культур E. coli с использованием системы Pure Yield PLASMID Maxiprep® (Promega Corporation, Madison, WI) или набора PLASMID Maxi Kit® (Qiagen, Valencia, CA) в соответствии с инструкциями производителей.

Выделение протопластов

Суспензию клеток Zea mays c.v. Hi-II поддерживали по расписанию поддержания в течение 3,5 суток, 4 мл объема осажденных клеток (PCV) из клеток собирали и переносили в 50-мл стерильные конические пробирки (Fisher Scientific), содержащие по 20 мл раствора ферментов (0,6% пектолиаза™, 6% целлюлаза™ («Onozuka» R10; Yakult Pharmaceuticals, Japan), 4 мМ MES (pH 5,7), 0,6 М маннит, 15 мМ MgCl2). Пробирки с культурой закрывали крышкой и заворачивали в PARAFILM™, и помещали на качалку с платформой (Thermo Scientific, качалка с платформой Vari Mix) с установкой скорости на 10 для инкубации в течение 16-18 часов при комнатной температуре до высвобождения протопластов. После инкубации каплю культуры клеток проверяли под микроскопом для проверки качества расщепления, и расщепленные клетки фильтровали через сито для клеток 100 мкм, промывали 10 мл среды W5 [2мМ MES (pH 5,7), 205 мМ NaCl, 167 мМ CaCl2, 6,7 мМ KCl], с последующей фильтрацией через сита для клеток 70 мкм и 40 мкм. Сита 100 мкм и 40 мкм промывали 10 мл среды W5. Фильтрованные протопласты вместе со средой для промывки собирали в 50 мл пробирку для центрифугирования, и конечный объем составлял приблизительно 40 мл. Затем 8 мл «тяжелого градиентного раствора» [500 мМ сахароза, 1 мМ CaCl2, 5 мМ MES (pH 6,0)] медленно добавляли на дно раствора протопластов/фермента, центрифугировали на центрифуге с качающимся бакет-ротором в течение 15 минут при 300-350×g. После центрифугирования приблизительно 7-8 мл из полосы протопластов отбирали, промывали 25 мл W5 и центрифугировали в течение 15 минут при 180-200×g. Затем протопласты ресуспендировали в 10 мл раствора MMG [4 мМ MES (pH 5,7), 0,6 M маннит, 15 мМ MgCl2]. Протопласты подсчитывали с использованием гемоцитометра или проточного цитометра и разводили до 1,67 миллионов на мл с использованием MMG.

Трансформация протопластов, полученных из суспензионной культуры Zea mays c.v. HI-II, с использованием PEG

Приблизительно по 0,5 миллионов протопластов (300 мкл в растворе MMG) переносили в 2 мл пробирки и смешивали с 40 мкл ДНК, и инкубировали при комнатной температуре в течение 5-10 минут. Затем добавляли 300 мкл свежеприготовленного раствора PEG [36% PEG 4000, 0,3 М маннит, 0,4 М CaCl2], и смесь инкубировали при комнатной температуре 15-20 минут с периодическим перемешиванием посредством переворачивания. После инкубации медленно добавляли 1 мл W5 для промывки и осторожно перемешивали, и протопласты осаждали посредством центрифугирования при 180-200×g в течение 15 минут. Осадок ресуспендировали в 1 мл среды WI [4 мм MES (pH 5,7), 0,6 М маннит, 20 мМ KCl], и содержащую протопласты пробирку заворачивали в алюминиевую фольгу и инкубировали при комнатной температуре ночь в течение приблизительно 16 часов.

Трансформация ZFN и донором

Для каждого из выбранных геномных локусов из таблицы 5 протопласты Zea mays трансфицировали контрольной конструкцией для экспрессии гена yfp, ZFN отдельно, донором отдельно и смесью ZFN и донора в соотношении 1:10 (по массе). Общее количество ДНК для трансфекции 0,5 миллиона протопластов составляло 80 мкг. Все обработки проводили в 3 или 6 повторах. Контрольная конструкция для экспрессии гена yfp представляла собой pDAB8393 (фигура 11), содержащую экспрессирующие генные кассеты промотор убиквитина 1 Zea mays - последовательность, кодирующая желтый флуоресцентный белок - 3'UTR Per5 Zea mays и промотор актина 1 риса - последовательность, кодирующая pat - 3'UTR липазы Zea mays. Для обеспечения соответствующего общего количества ДНК для трансфекции, либо сперму лосося, либо плазмиду, содержащую ген yfp, использовали в качестве наполнителя при необходимости. В типичном эксперименте по нацеливанию, проводили трансфекцию с 4 мкг ZFN отдельно или с 36 мкг донора, и соответствующее количество ДНК спермы лосося или плазмид pUC19 добавляли для доведения общего количества ДНК до 80 мкг. Включение плазмиды, экспрессирующей ген yfp, в качестве наполнителя позволяет оценку качества трансфекции среди множества локусов и повторных обработок.

Пример 5: Расщепление геномных локусов в Zea mays посредством нуклеазы с цинковыми пальцами

Трансфицированные ZFN протопласты Zea mays c.v. Hi-II собирали через 24 часа после трансфекции посредством центрифугирования при 1600 об/мин в 2 мл пробирках EPPENDORF™, и супернатант полностью удаляли. Геномную ДНК экстрагировали из осадков протопластов с использованием QIAGEN PLANT DNA EXTRACTION KIT™ (Qiagen, Valencia, CA). Выделенную ДНК ресуспендировали в 50 мкл воды и концентрацию определяли с использованием NANODROP® (Invitrogen, Grand Island, NY). Целостность ДНК оценивали путем разделения образцов электрофорезом в геле из 0,8% агарозы. Все образцы нормализовали (20-25 нг/мкл) для амплификации ПЦР, чтобы получить ампликоны для секвенирования (Illumina, Inc., SanDiego, CA). Праймеры для ПЦР со штрих-кодами для амплификации областей, охватывающих каждую тестируемую последовательность узнавания ZFN из обработанных и контрольных образцов, конструировали и закупали из IDT (Coralville, IA, очищенные ВЭЖХ). Оптимальные условия амплификации идентифицировали посредством градиентной ПЦР с использованием 0,2 мкМ соответствующих праймеров со штрих-кодами ACCUPRIME PFX SUPERMIX™ (Invitrogen, Carlsbad, CA) и 100 нг матричной геномной ДНК в реакционной смеси объемом 23,5 мкл. Параметры циклов представляли собой первоначальную денатурацию при 95°C (5 мин), с последующими 35 циклами денатурации (95°C, 15 с), отжига (55-72°C, 30 с), удлинения (68°C, 1 мин) и конечного удлинения (68°C, 7 мин). Продукты амплификации анализировали в 3,5% агарозных гелях с TAE, и соответствующую температуру отжига для каждой комбинации праймеров определяли и использовали для амплификации ампликонов из контрольных и обработанных ZFN образцов, как описано выше. Все ампликоны очищали в 3,5% агарозных гелях с TAE, элюировали в воде, и концентрации определяли с использованием NANODROP™. Для секвенирования нового поколения 100 нг ампликона ПЦР из обработанных ZFN и соответствующих не обработанных контрольных протопластов маиса объединяли вместе и секвенировали с использованием секвенирования нового поколения Ilumina (NGS).

Анализировали активность расщепления соответствующих ZFN в каждом из выбранных оптимальных геномных локусов Zea mays. Короткие ампликоны, охватывающие участки расщепления ZFN, из обработанных ZFN и контрольных протопластов амплифицировали с геномной ДНК и подвергали NGS Illumina. Индуцированное ZFN расщепление или двухцепочечный разрыв ДНК устраняли с помощью клеточного пути репарации NHEJ посредством вставки или делеции нуклеотидов (инделов) в участке расщепления, и присутствие инделов в участке расщепления, таким образом, являлось показателем активности ZFN, и его определяли посредством NGS. Активность расщепления специфичных для мишени ZFN оценивали как количество последовательностей с инделами на 1 миллион высококачественных последовательностей с использованием программного обеспечения для анализа NGS (публикация патента 2012-0173153, анализ данных последовательностей ДНК). (фигура 12). Активность в диапазоне в 5-100 раз выше контрольной наблюдали для выбранных геномных локусов-мишеней Zea mays и далее подтверждали посредством выравнивания последовательностей, которое демонстрировало разнообразные отпечатки инделов в каждом участке расщепления ZFN. Эти данные позволяют предполагать, что выбранные геномные локусы Zea mays были подвержены расщеплению ZFN. Дифференциальная активность в отношении каждой мишени отражала состояние ее хроматина и подверженность расщеплению, а также эффективность экспрессии каждой ZFN.

Пример 6: Быстрый анализ нацеливания в отношении интеграции полинуклеотидного донора

Валидацию нацеливания универсальной донорной полинуклеотидной последовательности на выбранные геномные локусы-мишени Zea mays посредством вставки донора, опосредуемого соединением негомологичных концов (NHEJ), проводили с использованием полупромышленного способа анализа с использованием способа анализа для быстрого тестирования. Для каждого выбранного геномного локуса-мишени Zea mays тестировали 3-6 типов дизайна ZFN, и нацеливание оценивали путем измерения опосредуемого ZFN расщепления с использованием способов секвенирования нового поколения (фигура 12) и встраивания донора с использованием внутренней-внешней ПЦР участков стыковки (фигура 13). Выбранные геномные локусы Zea mays, которые были положительными в обоих анализах, идентифицированы в качестве поддающегося нацеливанию локуса.

Анализ встраивания донора посредством ZFN с использованием быстрого тестирования

Для определения того, можно ли осуществлять нацеливание на геномные локусы-мишени Zea mays для вставки донора, конструкцию ZFN и универсальную донорную полинуклеотидную конструкцию совместно доставляли в протопласты маиса, которые инкубировали в течение 24 часов перед экстракцией геномной ДНК для анализа. Если экспрессируемая ZFN являлась способной расщеплять участок связывания-мишень как в выбранных геномных локусах-мишенях Zea mays, так и в доноре, то линеаризованный донор затем мог встраиваться в расщепленный участок-мишень в геноме маиса посредством пути соединения негомологичных концов (NHEJ). Подтверждение направленного встраивания в выбранные геномные локусы-мишени Zea mays проводили на основе способа «внутренней-внешней» ПЦР, где «внутренний» праймер узнает последовательность в нативном оптимальном геномном локусе, и «внешний» праймер связывается с последовательностью в донорной ДНК. Праймеры конструировали таким образом, что, только когда донорная ДНК встраивалась в выбранный геномный локус-мишень Zea mays, в анализе с использованием ПЦР получали продукт амплификации ожидаемого размера. Анализ с использованием внутренней-внешней ПЦР проводили как в 5'-, так и в 3'-концах точки стыковки вставки. Праймеры, использованные для анализа интегрированных полинуклеотидных донорных последовательностей, представлены в таблице 9.

Встраивание донора посредством ZFN в локусы-мишени с использованием гнездовой «внутренней-внешней» ПЦР

Все амплификации ПЦР проводили с использованием набора TAKARA EX TAQ HS™ (Clonetech, Mountain View, CA). Первую внутреннюю-внешнюю ПЦР проводили в конечном реакционном объеме 20 мкл, содержащем 1X буфер TAKARA EX TAQ HS™, 0,2 мМ dNTP, 0,2 мкМ «внешний» праймер, 0,05 мкМ «внутренний» праймер (сконструированный из универсальной донорной кассеты, описанной выше), 0,75 единиц полимеразы TAKARA EX TAQ HS™ и 10 нг экстрагированной ДНК протопластов маиса. Затем реакцию проводили с использованием программы ПЦР, состоящей из 94°C в течение 2 мин, 20 циклов при 98°C в течение 12 с и 68°C в течение 2 мин, с последующими 72°C в течение 10 мин и поддержанием при 4°C. Конечные продукты ПЦР разделяли в агарозном геле вместе с 1KB PLUS DNA LADDER™ (Life Technologies, Grand Island, NY) для визуализации.

Гнездовую внутреннюю-внешнюю ПЦР проводили в конечном объеме 20 мкл, содержащем 1X буфер TAKARA EX TAQ HS™, 0,2 мМ dNTP, 0,2 мкМ «внешний» праймер (таблица 9), 0,1 мкМ «внутренний» праймер (сконструированный из универсальной донорной кассеты, описанной выше, таблица 10), 0,75 единицы полимеразы TAKARA EX TAQ HS™ и 1 мкл первого продукта ПЦР. Затем реакцию проводили с использованием программы ПЦР, состоящей из 94°C в течение 2 мин, 31 цикла при 98°C в течение 12 с, 66°C в течение 30 с и 68°C в течение 45 с, с последующими 72°C в течение 10 мин и поддержанием при 4°C. Конечные продукты ПЦР разделяли в агарозном геле вместе с 1KB PLUS DNA LADDER™ (Life Technologies, Grand Island, NY) для визуализации.

Таблица 9
Список всех «внешних» праймеров для анализа оптимальных геномных локусов с использованием гнездовой внутренней-внешней ПЦР
OGL1 Первая ПЦР 5'-end APL02-5PriF1 SEQ ID NO:5430 CGCCACAAATCTGAACCAGCA
Spec-PriR1 SEQ ID NO:5431 CCACGATCGACATTGATCTGGCTA
3'-конец APL02-3PriR1 SEQ ID NO:5432 GCGACATATCAGGCCAACAGG
Uzi-PriF1 SEQ ID NO:5433
GGGATATGTGTCCTACCGTATCAGG
Гнездовая ПЦР 5'-конец APL02-5nstPriF1 SEQ ID NO:5434 CCAGCATACAGTTAGGGCCCA
Spec-nstPriR1 SEQ ID NO:5435 GTTGCCTTGGTAGGTCCAGC
3'-конец APL02-3nstPriR1 SEQ ID NO:5436 CGAAAACTCAGCATGCGGGAA
Uzi-nstPriF1 SEQ ID NO:5437 GAGCCATCAGTCCAACACTGC
OGL2 Первая ПЦР 5'-конец APL01-5PriF1 SEQ ID NO:5438
ACAGGCGTACAGCAACACCA
3'-конец APL01-3PriR1 SEQ ID NO:5439 GACCCTATGGTGTTGGATCCCA
Гнездовая ПЦР 5'-конец APL01-5nstPriF1 SEQ ID NO:5440 CGGGAGCTAGGCAACAAATCG
3'-конец APL01-3nstPriR1 SEQ ID NO:5441 TCTGACTAAACGGGTGGATGCTG
OGL8 Первая ПЦР 5'-конец OGL08-5nstPriF2 SEQ ID NO:5442 CGGATCAGTTGATTCGCTCACTTTCA
3'-конец OGL08-3PriR SEQ ID NO:5443 GCCGAAAAGCAGCAACTGGAA
Гнездовая ПЦР 5'-конец OGL08-5nstPriF SEQ ID NO:6619 GATTGCTACGCAGACCGCCTA
3'-конец OGL08-3nstPriR SEQ ID NO:5444 CACTATTCCTCCGGCATGCAG
OGL11 Первая ПЦР 5'-конец OGL11-5PriF SEQ ID NO:5445 TGACCTATTGATCGGTCGGCTC
3'-конец OGL11-3PriR2 SEQ ID NO:5446 TGCCTTGAATCTCAGGGATGCA
Гнездовая ПЦР 5'-конец OGL11-5nstPriF SEQ ID NO:5447 GCCGAAGCTAACTAGCGGACA
3'-конец OGL11-3nstPriR2 SEQ ID NO:5448 CATGGAGTAGCAGCTGTGCTG
OGL12 Первая ПЦР 5'-конец OGL12-5PriF SEQ ID NO:5449 GAAAAGCAGTCACCGGCTCTG
3'-конец OGL12-3PriR SEQ ID NO:5450 CCATGGACATGAATTCGGCACG
Гнездовая ПЦР 5'-конец OGL12-5nstPriF SEQ ID NO:5451 CTTTTGCACCACGGAGCAGAC
3'-конец OGL12-3nstPriR SEQ ID NO:5452 GCTAGCAAAACTTTGAAGCTCGCTC
OGL13 Первая ПЦР 5'-конец OGL13-5PriF SEQ ID NO:5453 GAGGTCCCTTACGGGTCATCG
3'-конец OGL13-3PriR SEQ ID NO:5454 ACCAGGTCTATCTTGCGCAGAC
Гнездовая ПЦР 5'-конец OGL13-5nstPriF SEQ ID NO:5455 AATAGCGTGGTCGGGTCCTAG
3'-конец OGL13-3nstPriR SEQ ID NO:5456 ACGAACGATCCAAGGTGCAGT
OGL14 Первая ПЦР 5'-конец OGL14-5PriF SEQ ID NO:5457 TAGAGACGAGGACTCTGGGCT
3'-конец OGL14-3PriR SEQ ID NO:5458 AAGTCCAACATGGGCACAACC
Гнездовая ПЦР 5'-конец OGL14-5nstPriF SEQ ID NO:5459 CCTCGTTAAGGGTGCAGGTTG
3'-конец OGL14-3nstPriR SEQ ID NO:5460 CCAAGTCAGCTTCTAAGCCATCAAAC
OGL15 Первая ПЦР 5'-конец OGL15-5PriF SEQ ID NO:5461 AACCCTAGACTTCTGCCTGGTG
3'-конец OGL15-3PriR SEQ ID NO:5462 GCTCACTTACGAGCAGATCCCA
Гнездовая ПЦР 5'-конец OGL15-5nstPriF SEQ ID NO:5463 GGTGCACGCATGTTCTCATGT
3'-конец OGL15-3nstPriR SEQ ID NO:5464 TGTTTACCGCAGCCATGCTTG
OGL16 Первая ПЦР 5'-конец OGL16-5PriF SEQ ID NO:5465 GTTGTATACGGCATCCATCCGCT
3'-конец OGL16-3PriR SEQ ID NO:5466 GAATGAAACTGGTGGTCTGCTCC
Гнездовая ПЦР 5'-конец OGL16-5nstPriF SEQ ID NO:5467 CCGACGAGGTACAAGTAGCAGG
3'-конец OGL16-3nstPriR SEQ ID NO:5468 CCCGTAGTCCAGATTCTTGTGGT
OGL17 Первая ПЦР 5'-конец OGL17-5PriF SEQ ID NO:5469 GTCGTTTGTTCGGAAGGGGAG
3'-конец OGL17-3PriR SEQ ID NO:5470 CGTAGTTGTCCGGCATGTCCT
Гнездовая ПЦР 5'-конец OGL17-5nstPriF SEQ ID NO:5471 TGTATCCCTTCGGTGAGCACG
3'-конец OGL17-3nstPriR SEQ ID NO:5472 TGAATCGACTCGCTGACAGGTG
OGL04 Первая ПЦР 5'-конец OGL04-5PriF SEQ ID NO: 6311 CAACCAGAAACGTCCTGCACTG
Spec-PriR1 SEQ ID NO: 6312 CCACGATCGACATTGATCTGGCTA
3'-конец OGL04-3PriR SEQ ID NO: 6313 AAATCCAAGCCACGTACGCAC
UnivDonor-3PriF1 SEQ ID NO: 6314 GTTTCATCAAGCCTTACGGTCACC
Гнездовая ПЦР 5'-конец OGL04-5nstPriF SEQ ID NO: 6315 ACACCAATTGCCCATTTGGCA
Spec-nstPriR2 SEQ ID NO: 6316 GCTGGCGATGAGCGAAATGTAG
3'-конец OGL04-3nstPriR SEQ ID NO: 6317 TTGGTTAGCAGCACGGATGGA
UnivDonor-3PriF2 SEQ ID NO: 6318 CAGCAACGTCGGTTCGAGATG
OGL05 Первая ПЦР 5'-конец OGL05-1-5PriF SEQ ID NO: 6319 ATGCCACTTTCGAAGAGAGGACG
3'-конец OGL05-1-3PriR2 SEQ ID NO: 6320 CATCTCCAACGTCATCGGCAC
Гнездовая ПЦР 5'-конец OGL05-1-5nstPriF SEQ ID NO: 6321 GGGAAACAGATTCGTCAGCTTGC
3'-конец OGL05-1-3nstPriR SEQ ID NO: 6322 GCCTATCCAGTGGCGGATACA
OGL06 Первая ПЦР 5'-конец OGL06-5PriF SEQ ID NO: 6323 CTTGCTCTACAACTCTGCCCCA
Spec-PriR1 SEQ ID NO: 6324 CCACGATCGACATTGATCTGGCTA
3'-конец OGL06-3PriR SEQ ID NO: 6325 AGTCGGTACCTGCAAGCTACG
UnivDonor-3PriF1 SEQ ID NO: 6326 GTTTCATCAAGCCTTACGGTCACC
Гнездовая ПЦР 5'-конец OGL06-5nstPriF SEQ ID NO: 6327 TGGATTTGAGGCCAACTGCAC
Spec-nstPriR2 SEQ ID NO: 6328 GCTGGCGATGAGCGAAATGTAG
3'-конец OGL06-3nstPriR SEQ ID NO: 6329 TCTGCATTGTTGGGATCGACCA
UnivDonor-3PriF2 SEQ ID NO: 6330 CAGCAACGTCGGTTCGAGATG
OGL07 Первая ПЦР 5'-конец OGL07-1-5nstPriF SEQ ID NO: 6331 ACGATCGCAGGTTATCCTCGC
3'-конец OGL07-1-3PriR SEQ ID NO: 6332 CTTGTCGGTTGCTGTGTGGAC
Гнездовая ПЦР 5'-конец OGL07-1-5nstPriF SEQ ID NO: 6333 AACACGGATGGCCTGCAATG
3'-конец OGL07-1-3nstPriR SEQ ID NO: 6334 GCATGGGCGTACGTCACTTG
OGL09 Первая ПЦР 5'-конец OGL09-5PriF SEQ ID NO: 6335 ACCCAGAATCTCTGGTTCCGT
3'-конец OGL09-3PriR SEQ ID NO: 6336 CAGGAAGCTCTGCATCTGCG
Гнездовая ПЦР 5'-конец OGL09-5nstPriF SEQ ID NO: 6337 AGTCTTTGATGTAAACGTCTTGCCT
3'-конец OGL09-3nstPriR SEQ ID NO: 6338 GCATGGAAACACCAGGTCGA
OGL10 Первая ПЦР 5'-конец OGL10-5PriF SEQ ID NO: 6339 GCAGCGAATAGGAATGCGAGAC
3'-конец OGL10-3PriR SEQ ID NO: 6340 TAACCTTGTTTCGCTGACTCCC
Гнездовая ПЦР 5'-конец OGL10-5nstPriF SEQ ID NO: 6341 CTTCTTCTACCTACACGCACCAG
3'-конец OGL10-3nstPriR SEQ ID NO: 6342 GATCCGTTTCCTCACTCTCGC
OGL18 Первая ПЦР 5'-конец OGL18-5PriF SEQ ID NO: 6343 AGGTGAATCTTCCGTGGCTGT
3'-конец OGL18-3PriR SEQ ID NO: 6344 CCATAATCAGTGTGACTGGTGGCT
Гнездовая ПЦР 5'-конец OGL18-5nstPriF SEQ ID NO: 6345 CGGATCTAAGGTGCCCTGTCT
3'-конец OGL18-3nstPriR SEQ ID NO: 6346 GTCTAGCTCATGGAAGTGGGAGG
OGL19 Первая ПЦР 5'-конец OGL19-5PriF SEQ ID NO: 6347 GACTTCTAAGCCCCAAGGCCTA
3'-конец OGL19-3PriR2 SEQ ID NO: 6348 AGATCTTTTGGCTCCCTCTCACC
Гнездовая ПЦР 5'-конец OGL19-5nstPriF SEQ ID NO: 6349 GTGCTTCGAGGGCTCAAGGTA
3'-конец OGL19-3nstPriR2 SEQ ID NO: 6350 ATTGCTCACCCCATCCCCTT
OGL20 Первая ПЦР 5'-конец OGL20-5PriF SEQ ID NO: 6351 GGCTATGACCCGGACACTACC
3'-конец OGL20-3PriR SEQ ID NO: 6352 CAGTTGGGCGTCAAGTTAGTTCAG
Гнездовая ПЦР 5'-конец OGL20-5nstPriF SEQ ID NO: 6353 AAGTCCACAAGGATCTGACCACG
3'-конец OGL20-3nstPriR SEQ ID NO: 6354 TGAAACTTTGGTTCAGTCTGCTCG
OGL21 Первая ПЦР 5'-конец OGL21-5PriF SEQ ID NO: 6355 TATGTCCAAGCCACGAGAAGC
3'-конец OGL21-3PriR SEQ ID NO: 6356 ACTGCAGGTACTACTGGTACGC
Гнездовая ПЦР 5'-конец OGL21-5nstPriF SEQ ID NO: 6357 GCTACAGTATAGCAGGAGCAGC
3'-конец OGL21-3nstPriR SEQ ID NO: 6358 GTCCTACTATACGCTGCCGC
OGL22 Первая ПЦР 5'-конец OGL22-5PriF SEQ ID NO: 6359 CAATCCTTCTGAGCTGCACCG
3'-конец OGL22-3PriR SEQ ID NO: 6360 GGTGTCAATGACCTCACGAGC
Гнездовая ПЦР 5'-конец OGL22-5nstPriF SEQ ID NO: 6361 CCGTACCAAACAGGCAAGCAG
3'-конец OGL22-3nstPriR SEQ ID NO: 6362 GATCGCCCATATGCTTGGATTCAC
OGL23 Первая ПЦР 5'-конец OGL23-5PriF SEQ ID NO: 6363 GGATTAGGACGGCTGACTGGT
3'-конец OGL23-3PriR SEQ ID NO: 6364 GTTGCTTTGTTTGCGTGCTCC
Гнездовая ПЦР 5'-конец OGL23-5nstPriF SEQ ID NO: 6365 TTAAAGTGCTAGCTGACTGACCGA
3'-конец OGL23-3nstPriR SEQ ID NO: 6366 GGCCCATGCCTTAGGTTGAC
OGL24 Первая ПЦР 5'-конец OGL24-5PriF SEQ ID NO: 6367 ACTGAGACTGGGAGTCTGGGA
3'-конец OGL24-3PriR SEQ ID NO: 6368 CGCCGTCCGACTGTTATTACC
Гнездовая ПЦР 5'-конец OGL24-5nstPriF SEQ ID NO: 6369 CTTCGGCCTTGGATTGGATCAC
3'-конец OGL24-3nstPriR SEQ ID NO: 6370 ACAACGCAGATCCCTAGAATCCA
OGL25 Первая ПЦР 5'-конец OGL25-5PriF SEQ ID NO: 6371 GGGATCTCTTGTCACCAAATCAGC
3'-конец OGL25-3PriR SEQ ID NO: 6372 TTGACAGTGAGACATGGGAGTACC
Гнездовая ПЦР 5'-конец OGL25-5nstPriF SEQ ID NO: 6373 TGCCTGCATTGCATCGATCTG
3'-конец OGL25-3nstPriR SEQ ID NO: 6374 AGTACCCACTGTCACTGCACG
OGL26 Первая ПЦР 5'-конец OGL26-5PriF SEQ ID NO: 6375 ATCTTCACCAAGTATCCCACACCT
3'-конец OGL26-3PriR2 SEQ ID NO: 6376 GCTGTGTTAGTATCGTCGAAGGCT
Гнездовая ПЦР 5'-конец OGL26-5nstPriF SEQ ID NO: 6377 TCAAACCTCACCTGATGTATCGCT
3'-конец OGL26-3nstPriR2 SEQ ID NO: 6378 CGAACCTCCAATTTATCGGCAATCG
OGL27 Первая ПЦР 5'-конец OGL27-5PriF SEQ ID NO: 6379 AAGTCCCTAGAGCCCTCATGC
3'-конец OGL27-3PriR SEQ ID NO: 6380 GAGAGTTAGGAGGGAGCATGGC
Гнездовая ПЦР 5'-конец OGL27-5nstPriF SEQ ID NO: 6381 GTGTCCGAGATAGGTCGTGTCC
3'-конец OGL27-3nstPriR SEQ ID NO: 6382 TTGAACTTGGGCATGAGTGGGA
OGL28 Первая ПЦР 5'-конец OGL28-5PriF SEQ ID NO: 6383 GTCGGCTGTGCGTTATGAGAC
3'-конец OGL28-3PriR SEQ ID NO: 6384 GATTAATCGGTTATCGGTGGACGC
Гнездовая ПЦР 5'-конец OGL28-5nstPriF SEQ ID NO: 6385 ACGGACAGATCACAGATCGGG
3'-конец OGL28-3nstPriR SEQ ID NO: 6386 CCTTAATCCGGTTTGGTGAACCC
OGL29 Первая ПЦР 5'-конец OGL29-5PriF SEQ ID NO: 6387 GCTTACACCGATGCAGGGGTA
3'-конец OGL29-3PriR SEQ ID NO: 6388 GGTTGACATCGGAATTCGTGCC
Гнездовая ПЦР 5'-конец OGL29-5nstPriF SEQ ID NO: 6389 TGAAAGAGAGCGGCCCAACTAC
3'-конец OGL29-3nstPriR SEQ ID NO: 6390 TTAATGCTGGCCTCTCCTGCA
OGL30 Первая ПЦР 5'-конец OGL30-5PriF SEQ ID NO: 6391 ATGAAGAGCACCAGCTACCCC
3'-конец OGL30-3PriR SEQ ID NO: 6392 GGAAGATGGAACCACATGCCC
Гнездовая ПЦР 5'-конец OGL30-5nstPriF SEQ ID NO: 6393 GGCTACAAAACCCAAGAGGGG
3'-конец OGL30-3nstPriR SEQ ID NO: 6394 CCCTTTCATGCAACGATCAGGC
OGL31 Первая ПЦР 5'-конец OGL31-5PriF SEQ ID NO: 6395 TGTTCAGTTGGTAAGTCGTCGCT
3'-конец OGL31-3PriR SEQ ID NO: 6396 GTTCTTGGAGAGTGATTGTCGGC
Гнездовая ПЦР 5'-конец OGL31-5nstPriF SEQ ID NO: 6397 CTTCACCTCAAGGGAAGCAAGC
3'-конец OGL31-3nstPriR SEQ ID NO: 6398 GGTGAAACTGAGCTGGGAATTGG
OGL32 Первая ПЦР 5'-конец OGL32-5PriF SEQ ID NO: 6399 GATCCACAACCACATTCAACAAGGT
3'-конец OGL32-3PriR SEQ ID NO: 6400 TGATCAAACTAGAGGCCTGATGACG
Гнездовая ПЦР 5'-конец OGL32-5nstPriF SEQ ID NO: 6401 GGACAAATGACATGTAACCCACTCC
3'-конец OGL32-3nstPriR SEQ ID NO: 6402 ATGACGACAGCGTGTTTGTGG
OGL33 Первая ПЦР 5'-конец OGL33-5PriF SEQ ID NO: 6403 AGCTCCACTTCCAGTAGTCCTG
3'-конец OGL33-3PriR SEQ ID NO: 6404 CGGATAGCGTCCACAAACGAG
Гнездовая ПЦР 5'-конец OGL33-5nstPriF SEQ ID NO: 6405 AATCATGCGGCTGTCGAAAGG
3'-конец OGL33-3nstPriR SEQ ID NO: 6406 GCGATAAGAAAGCATCCTGCGG
OGL34 Первая ПЦР 5'-конец OGL34-5PriF SEQ ID NO: 6407 ACTGTACCACCGAAAGACGACC
3'-конец OGL34-3PriR SEQ ID NO: 6408 CCCGTCTCACTGTGGATCTATGTC
Гнездовая ПЦР 5'-конец OGL34-5nstPriF SEQ ID NO: 6409 AAAGACGACCAAACAGTCCTGC
3'-конец OGL34-3nstPriR SEQ ID NO: 6410 GAGTCAACGTGTCAGTGTCACC
OGL35 Первая ПЦР 5'-конец OGL35-5PriF SEQ ID NO: 6411 AGGTGTAGTCCTGCTCTGTCTG
3'-конец OGL35-3PriR SEQ ID NO: 6412 AACTGAAGACACTGACGACATCCA
Гнездовая ПЦР 5'-конец OGL35-5nstPriF SEQ ID NO: 6413 TAGGGCGCTAGGCATGTACTC
3'-конец OGL35-3nstPriR SEQ ID NO: 6414 GTGGCCTTCTAGGTACACTAGGG
OGL36 Первая ПЦР 5'-конец OGL36-5PriF SEQ ID NO: 6415 GCAACCAACTTTGTCGGATGCT
3'-конец OGL36-3PriR SEQ ID NO: 6416 AAAGCTCACCTCACAGCACGA
Гнездовая ПЦР 5'-конец OGL36-5nstPriF SEQ ID NO: 6417 TCATAGATTTCGCGTGGTTGAACTG
3'-конец OGL36-3nstPriR SEQ ID NO: 6418 ACTCTGCAGCCATGAATTCCAC
OGL37 Первая ПЦР 5'-конец OGL37-5PriF SEQ ID NO: 6419 GAGAAACCGAGGGATCGGAACA
3'-конец OGL37-3PriR SEQ ID NO: 6420 ACATGTACGTGTGCGAGAGTCG
Гнездовая ПЦР 5'-конец OGL37-5nstPriF SEQ ID NO: 6421 AGTACGACTGGAATCCAACGCG
3'-конец OGL37-3nstPriR SEQ ID NO: 6422 CTCTCCCTAGCTCGACGCTTG
OGL38 Первая ПЦР 5'-конец OGL38-5PriF SEQ ID NO: 6423 GTAGCACTGCACCGTTCATGC
3'-конец OGL38-3PriR SEQ ID NO: 6424 ACTCTCCTTCCCTCGACGGTA
Гнездовая ПЦР 5'-конец OGL38-5nstPriF SEQ ID NO: 6425 AGGAGATGAAGGCTTTGTCCCC
3'-конец OGL38-3nstPriR SEQ ID NO: 6426 GCAAACCTGCATGGTTGATGC
OGL39 Первая ПЦР 5'-конец OGL39-5PriF SEQ ID NO: 6427 TTGGGTTTGTGCACCACACTC
3'-конец OGL39-3PriR SEQ ID NO: 6428 GCTTCTGGAAAAACGCCAGCA
Гнездовая ПЦР 5'-конец OGL39-5nstPriF SEQ ID NO: 6429 ATTCCTTGCGCTCCGTACGAA
3'-конец OGL39-3nstPriR SEQ ID NO: 6430 CTTTGCATTGCAGGCACGGTTA
OGL40 Первая ПЦР 5'-конец OGL40-5PriF SEQ ID NO: 6431 CCGAGGTTAAATCCACAGGCG
3'-конец OGL40-3PriR SEQ ID NO: 6432 GCGCATTTCCTTGCCCTCAAA
Гнездовая ПЦР 5'-конец OGL40-5nstPriF SEQ ID NO: 6433 GTTCACAGGTACGACAGCAGC
3'-конец OGL40-3nstPriR SEQ ID NO: 6434 TACGTTGCCACCAAAAGAGCC
OGL41 Первая ПЦР 5'-конец OGL41-5PriF SEQ ID NO: 6435 AGCAGGCTACTGTGGTCAGG
3'-конец OGL41-3PriR SEQ ID NO: 6436 CGATTGCATACAGCAGGTGCC
Гнездовая ПЦР 5'-конец OGL41-5nstPriF SEQ ID NO: 6437 GGCAGGTTTTGAAGGACCCC
3'-конец OGL41-3nstPriR SEQ ID NO: 6438 ACGAGCAATGCAGTGAAGGGT
OGL42 Первая ПЦР 5'-конец OGL42-5PriF SEQ ID NO: 6439 TGAGAACGAAACCCGTCAAGCA
3'-конец OGL42-3PriR SEQ ID NO: 6440 CACGTCGATCAAACGGCGAG
Гнездовая ПЦР 5'-конец OGL42-5nstPriF SEQ ID NO: 6441 CGTCAAGCATGCAGAAAGGCT
3'-конец OGL42-3nstPriR SEQ ID NO: 6442 CCCCTAATCCGCACCGTGTA
OGL43 Первая ПЦР 5'-конец OGL43-5PriF SEQ ID NO: 6443 CCTGTTCCTTCTCCCGAATGC
3'-конец OGL43-3PriR SEQ ID NO: 6444 GGTACAAAGTGAAAAGGGCCGG
Гнездовая ПЦР 5'-конец OGL43-5nstPriF SEQ ID NO: 6445 GTGCAATCAAGCCTTGCCCAT
3'-конец OGL43-3nstPriR SEQ ID NO: 6446 GAAGTGATGGTCCCTGCCAC
OGL44 Первая ПЦР 5'-конец OGL44-5PriF SEQ ID NO: 6447 GGCTCTAACACATGGTGAGGC
3'-конец OGL44-3PriR SEQ ID NO: 6448 AATCATGGTCCTAGTTGTAGCCCC
Гнездовая ПЦР 5'-конец OGL44-5nstPriF SEQ ID NO: 6449 ACTAGGATGAGGGAGCCAATGG
3'-конец OGL44-3nstPriR SEQ ID NO: 6450 CTATGGAGATGCCTCCCACCAT
OGL45 Первая ПЦР 5'-конец OGL45-5PriF SEQ ID NO: 6451 GAAGAGCTCGGCATCGGAGAT
3'-конец OGL45-3PriR SEQ ID NO: 6452 TCCCAAAACGAACTGTGTGCG
Гнездовая ПЦР 5'-конец OGL45-5nstPriF SEQ ID NO: 6453 TGGCTAGAGCGACCTTGTTCG
3'-конец OGL45-3nstPriR SEQ ID NO: 6454 TCGAGATCAGGCATCCACACC
OGL46 Первая ПЦР 5'-конец OGL46-5PriF SEQ ID NO: 6455 CCAAAGTATTTGGTGGGATTCTCGC
3'-конец OGL46-3PriR SEQ ID NO: 6456 CTGCAACAAGTGAAAAGCGCC
Гнездовая ПЦР 5'-конец OGL46-5nstPriF SEQ ID NO: 6457 GGATTCTCGCTTTTTCCCACCAAG
3'-конец OGL46-3nstPriR SEQ ID NO: 6458 TACATCGATCCAGCTCGTGCTG
OGL47 Первая ПЦР 5'-конец OGL47-5PriF SEQ ID NO: 6459 CGGAACACTAAAACGGGGACATG
Spec-PriR1 SEQ ID NO: 6460 CCACGATCGACATTGATCTGGCTA
3'-конец OGL47-3PriR SEQ ID NO: 6461 TCTTCCTGGCAAGCACTAGGAAC
UnivDonor-3PriF1 SEQ ID NO: 6462 GTTTCATCAAGCCTTACGGTCACC
Гнездовая ПЦР 5'-конец OGL47-5nstPriF SEQ ID NO: 6463 ACCGAGTAAGGGCTTGTTCGG
Spec-nstPriR2 SEQ ID NO: 6464 GCTGGCGATGAGCGAAATGTAG
3'-конец OGL47-3nstPriR SEQ ID NO: 6465 TCTCCAGCAACCCCTAGATGC
UnivDonor-3PriF2 SEQ ID NO: 6466 CAGCAACGTCGGTTCGAGATG
OGL48 Первая ПЦР 5'-конец OGL48-5PriF SEQ ID NO: 6467 GCAGTGACACTATAGCCACGTGT
3'-конец OGL48-3PriR SEQ ID NO: 6468 GCCCAATCAATTGTCCCTGGAC
Гнездовая ПЦР 5'-конец OGL48-5nstPriF SEQ ID NO: 6469 TGCTACCCAATGGTGTGGACTT
3'-конец OGL48-3nstPriR SEQ ID NO: 6470 AATGCCCATTCGGTTGAACCC
OGL49 Первая ПЦР 5'-конец OGL49-5PriF SEQ ID NO: 6471 TCTGATGATCGGGTTGAGGCC
3'-конец OGL49-3PriR SEQ ID NO: 6472 CCTCCGGAATCATTTCCCGTTG
Гнездовая ПЦР 5'-конец OGL49-5nstPriF SEQ ID NO: 6473 GTGCTGATCTGGTTGTGGGTC
3'-конец OGL49-3nstPriR SEQ ID NO: 6474 CGGAACAATTCCTGGGCACAA
OGL50 Первая ПЦР 5'-конец OGL50-5PriF SEQ ID NO: 6475 AGCTATGGTTAACGGGAATGCCA
Spec-PriR1 SEQ ID NO: 6476 CCACGATCGACATTGATCTGGCTA
3'-конец OGL50-3PriR SEQ ID NO: 6477 TCTAGCGAGAGGTGGTCAGGT
UnivDonor-3PriF1 SEQ ID NO: 6478 GTTTCATCAAGCCTTACGGTCACC
Гнездовая ПЦР 5'-конец OGL50-5nstPriF SEQ ID NO: 6479 GCTGAAATTGCTGCATCATGGC
Spec-nstPriR1 SEQ ID NO: 6480 GTTGCCTTGGTAGGTCCAGC
3'-конец OGL50-3nstPriR SEQ ID NO: 6481 AGCTGCTACATCTGTGGTCGG
UnivDonor-3PriF2 SEQ ID NO: 6482 CAGCAACGTCGGTTCGAGATG
OGL51 Первая ПЦР 5'-конец OGL51-5PriF SEQ ID NO: 6483 CCTTCACAGTACTTGAACTGCTGCA
3'-конец OGL51-3PriR SEQ ID NO: 6484 CACTCACATGGTGCGTTCCG
Гнездовая ПЦР 5'-конец OGL51-5nstPriF SEQ ID NO: 6485 TGTATGCCTCGTCATCGAGGG
3'-конец OGL51-3nstPriR SEQ ID NO: 6486 AGGGGAATGACCAGGAGCAG
OGL52 Первая ПЦР 5'-конец OGL52-5PriF SEQ ID NO: 6487 TCACGTACTGACCACAGAACACC
3'-конец OGL52-3PriR SEQ ID NO: 6488 GAATATGCTCCACGCGCATCTC
Гнездовая ПЦР 5'-конец OGL52-5nstPriF SEQ ID NO: 6489 GCTGACTCTAAAACCGCCTTGTG
3'-конец OGL52-3nstPriR SEQ ID NO: 6490 GATCCGGCTTGTTCGCTTGAC
OGL53 Первая ПЦР 5'-конец OGL53-5PriF SEQ ID NO: 6491 AACCATAGTGGCTCGCCAGT
3'-конец OGL53-3PriR SEQ ID NO: 6492 AATCGCACTAGGTCAGCATGGT
Гнездовая ПЦР 5'-конец OGL53-5nstPriF SEQ ID NO: 6493 GATCATGTCGTTAGCCTCCAACCA
3'-конец OGL53-3nstPriR SEQ ID NO: 6494 GTGAAGACTCGAGCTTGGCCT
OGL54 Первая ПЦР 5'-конец OGL54-5PriF2 SEQ ID NO: 6495 CAACAAGCTGGTTTGCAGGGT
3'-конец OGL54-3PriR SEQ ID NO: 6496 TAACCCCCTTAGAGATGCACATGC
Гнездовая ПЦР 5'-конец OGL54-5nstPriF2 SEQ ID NO: 6497 ACCCCAGCAAATTGGACGATCT
3'-конец OGL54-3nstPriR SEQ ID NO: 6498 TAGATCGATGAAACCGGTCGATGTG
OGL55 Первая ПЦР 5'-конец OGL55-5PriF SEQ ID NO: 6499 GACCAACCATTTGTTGCCCCT
3'-конец OGL55-3PriR SEQ ID NO: 6500 CACGTCTTTGTAGCGACTGTCCA
Гнездовая ПЦР 5'-конец OGL55-5nstPriF SEQ ID NO: 6501 TCCGAAAACTCAAGCATGCCC
3'-конец OGL55-3nstPriR SEQ ID NO: 6502 GTGGTGAACTTCCCTCTAGACCC
OGL56 Первая ПЦР 5'-конец OGL56-5PriF2 SEQ ID NO: 6503 TGGAAAAACGTAGATGTGCTTGCC
3'-конец OGL56-3PriR2 SEQ ID NO: 6504 CAAGCTCTTTGATCGTGGTTGACG
Гнездовая ПЦР 5'-конец OGL56-5nstPriF2 SEQ ID NO: 6505 GCAGTAAACCTAGTGATGCTGCCT
3'-конец OGL56-3nstPriR2 SEQ ID NO: 6506 ATGCTTGGTCAACGTGCCAC
OGL57 Первая ПЦР 5'-конец OGL57-5PriF2 SEQ ID NO: 6507 CGGTGAATGCAAGCTGGATCAC
3'-конец OGL57-3PriR2 SEQ ID NO: 6508 GCACTTGTGCTATCCGCCAG
Гнездовая ПЦР 5'-конец OGL57-5nstPriF2 SEQ ID NO: 6509 CTTTTGGTGGCGGAGATCAGG
3'-конец OGL57-3nstPriR2 SEQ ID NO: 6510 TGGAGGAGGAAATCTCTGCTATTCGT
OGL58 Первая ПЦР 5'-конец OGL58-5PriF SEQ ID NO: 6511 ACAGTGGACTCCCTCGCAAG
3'-конец OGL58-3PriR2 SEQ ID NO: 6512 GTAAGCTTCCTCGACACCTCCA
Гнездовая ПЦР 5'-конец OGL58-5nstPriF SEQ ID NO: 6513 TCTGAAGCACAGTTTAGCCGCA
3'-конец OGL58-3nstPriR2 SEQ ID NO: 6514 GTGGTTATCTGTAGCTTGAGCACTGA
OGL59 Первая ПЦР 5'-конец OGL59-5PriF2 SEQ ID NO: 6515 TGTGTTCCTTCTCCATGCACCT
3'-конец OGL59-3PriR2 SEQ ID NO: 6516 CCTTGTCACGGAGACTCTCGG
Гнездовая ПЦР 5'-конец OGL59-5nstPriF2 SEQ ID NO: 6517 TCACATGCCTCAACTGGAGCA
3'-конец OGL59-3nstPriR2 SEQ ID NO: 6518 TGGAAGGGCAAAACTGAGCC
OGL60 Первая ПЦР 5'-конец OGL60-5PriF SEQ ID NO: 6519 GCGACCTTTTCATTGTTGGAGTAGG
3'-конец OGL60-3PriR SEQ ID NO: 6520 TACCACACCATCGAGCCGTC
Гнездовая ПЦР 5'-конец OGL60-5nstPriF SEQ ID NO: 6521 ACGATTCAGTAGGTAGGGTGCCT
3'-конец OGL60-3nstPriR SEQ ID NO: 6522 ACCCATTTCGAGCTGCCTGT
OGL61 Первая ПЦР 5'-конец OGL61-5PriF SEQ ID NO: 6523 CCATGCAGATGTCGAGGCAAC
3'-конец OGL61-3PriR SEQ ID NO: 6524 TACTGCCTTCTGAACCGTCGG
Гнездовая ПЦР 5'-конец OGL61-5nstPriF SEQ ID NO: 6525 TGTTTAGCTACATCCACGGGCAT
3'-конец OGL61-3nstPriR SEQ ID NO: 6526 ACTGCAATGACAAGGCACATCC
OGL62 Первая ПЦР 5'-конец OGL62-5PriF SEQ ID NO: 6527 GCACGTCGTTAGTGATCGAGCT
3'-конец OGL62-3PriR SEQ ID NO: 6528 GTTGTCAACGAAGCCCGTCTAATTG
Гнездовая ПЦР 5'-конец OGL62-5nstPriF SEQ ID NO: 6529 CCTGCAGTTAACGCAGACGTG
3'-конец OGL62-3nstPriR SEQ ID NO: 6530 CTAGACCGTACTATTGTGCTGTGAAG
OGL63 Первая ПЦР 5'-конец OGL63-5PriF SEQ ID NO: 6531 TCCTTACTGGCCCCTAGTCCA
3'-конец OGL63-3PriR SEQ ID NO: 6532 CTCCCACGAGCGACTAGCTAC
Гнездовая ПЦР 5'-конец OGL63-5nstPriF SEQ ID NO: 6533 TGCAACTATGGACTTGGCCACA
3'-конец OGL63-3nstPriR SEQ ID NO: 6534 CCTCACGAATAAAAGCACCCCC
OGL64 Первая ПЦР 5'-конец OGL64-5PriF SEQ ID NO: 6535 AGTCTACGTGGCATACAACCCC
3'-конец OGL64-3PriR SEQ ID NO: 6536 GAAACTTGGACCTTGCTGTCGG
Гнездовая ПЦР 5'-конец OGL64-5nstPriF SEQ ID NO: 6537 AGGTCTCGAACAAACTCCCTATGC
3'-конец OGL64-3nstPriR SEQ ID NO: 6538 CCATTCCATGAAGACCGACTCCA
OGL65 Первая ПЦР 5'-конец OGL65-5PriF SEQ ID NO: 6539 ACCAAATCCGTTTGCTTTCACCG
3'-конец OGL65-3PriR SEQ ID NO: 6540 CTCTGACAGATACCACGTTCGCT
Гнездовая ПЦР 5'-конец OGL65-5nstPriF SEQ ID NO: 6541 CACCGTTTCACGAAGCTGCA
3'-конец OGL65-3nstPriR SEQ ID NO: 6542 ACCGAAATCTGCGCGCTAGTT
OGL66 Первая ПЦР 5'-конец OGL66-5PriF SEQ ID NO: 6543 ACAGAAGAGGTTGCGGAGTAACG
3'-конец OGL66-3PriR SEQ ID NO: 6544 AAACAAAATCGTATCGCCGAGCAG
Гнездовая ПЦР 5'-конец OGL66-5nstPriF SEQ ID NO: 6545 TACTTGGACCGGCCTCTACCT
3'-конец OGL66-3nstPriR SEQ ID NO: 6546 AACCTTGCAACAGCCCCAAAT
OGL67 Первая ПЦР 5'-конец OGL67-5PriF SEQ ID NO: 6547 AGGTAATACCAGTGAGCCGAC
Spec-PriR1 SEQ ID NO: 6548 CCACGATCGACATTGATCTGGCTA
3'-конец OGL67-3PriR SEQ ID NO: 6549 CACTCTGTACTGGGAGAGGG
UnivDonor-3PriF1 SEQ ID NO: 6550 GTTTCATCAAGCCTTACGGTCACC
Гнездовая ПЦР 5'-конец OGL67-5nstPriF SEQ ID NO: 6551 ATAATGCAGCGCTTGCAGAT
Spec-nstPriR2 SEQ ID NO: 6552 GCTGGCGATGAGCGAAATGTAG
3'-конец OGL67-3nstPriR SEQ ID NO: 6553 CTCAATTCCATGTGCAACCAAAC
UnivDonor-3PriF2 SEQ ID NO: 6554 CAGCAACGTCGGTTCGAGATG
OGL68 Первая ПЦР 5'-конец OGL68-5PriF SEQ ID NO: 6555 GTGGTGATACCGTCGTCTCTCC
3'-конец OGL68-3PriR SEQ ID NO: 6556 CACTTTGTCCCTGCTCGGTTC
Гнездовая ПЦР 5'-конец OGL68-5nstPriF SEQ ID NO: 6557 GAAACAAGCCATTGATTGTGCCCA
3'-конец OGL68-3nstPriR SEQ ID NO: 6558 GTCGACTCACAACGCTTCCC
OGL69 Первая ПЦР 5'-конец OGL69-5PriF SEQ ID NO: 6559 AGTACAACACTGAGACGTGGGC
3'-конец OGL69-3PriR SEQ ID NO: 6560 ACTAGGATTGCTAGGGAGCACGAA
Гнездовая ПЦР 5'-конец OGL69-5nstPriF SEQ ID NO: 6561 AGATTGCAGGGCACTTGAGGT
3'-конец OGL69-3nstPriR SEQ ID NO: 6562 ACAGGATTACAAGCCCAAACCCA
OGL70 Первая ПЦР 5'-конец OGL70-5PriF SEQ ID NO: 6563 TTCTTCAGGCGGCATCGCATA
Spec-PriR1 SEQ ID NO: 6564 CCACGATCGACATTGATCTGGCTA
3'-конец OGL70-3PriR SEQ ID NO: 6565 TAGTAGCCGACAATGTGGCCC
UnivDonor-3PriF1 SEQ ID NO: 6566 GTTTCATCAAGCCTTACGGTCACC
Гнездовая ПЦР 5'-конец OGL70-5nstPriF SEQ ID NO: 6567 CGCTCAGGAAATCCTTGATGCC
Spec-nstPriR2 SEQ ID NO: 6568 GCTGGCGATGAGCGAAATGTAG
3'-конец OGL70-3nstPriR SEQ ID NO: 6569 GTGAACGACGGCAACAAGCT
UnivDonor-3PriF2 SEQ ID NO: 6570 CAGCAACGTCGGTTCGAGATG
OGL71 Первая ПЦР 5'-конец OGL71-5PriF SEQ ID NO: 6571 GAGGTCCCTTACGGGTCATCG
3'-конец OGL71-3PriR SEQ ID NO: 6572 ACCAGGTCTATCTTGCGCAGAC
Гнездовая ПЦР 5'-конец OGL71-5nstPriF SEQ ID NO: 6573 AATAGCGTGGTCGGGTCCTAG
3'-конец OGL71-3nstPriR SEQ ID NO: 6574 ACGAACGATCCAAGGTGCAGT
OGL72 Первая ПЦР 5'-конец OGL72-5PriF SEQ ID NO: 6575 CCAATGGACGACAGCGGTTAG
3'-конец OGL72-3PriR SEQ ID NO: 6576 ACGAGAACAAGCCACTCTTGCT
Гнездовая ПЦР 5'-конец OGL72-5nstPriF SEQ ID NO: 6577 CAACCGGAGAACGGATAGCCT
3'-конец OGL72-3nstPriR SEQ ID NO: 6578 TGAAGATTTCCCTACCGTCGCC
OGL73 Первая ПЦР 5'-конец OGL73-5PriF1 SEQ ID NO: 6579 AGTACTGGGGACGTTCACCG
3'-конец OGL73-3PriR1 SEQ ID NO: 6580 CGACAAGAACCCGGTACATGC
Гнездовая ПЦР 5'-конец OGL73-5PriF2 SEQ ID NO: 6581 AGAGCTGAAACTGATCGCGGT
3'-конец OGL73-3PriR2 SEQ ID NO: 6582 GACAGAGTCCGATCCCTGCT
OGL74 Первая ПЦР 5'-конец OGL74-5PriF SEQ ID NO: 6583 GCCACACGGATTTTGCGTATCA
3'-конец OGL74-3PriR SEQ ID NO: 6584 CTTTTGTCGGTCCTGCCACTG
Гнездовая ПЦР 5'-конец OGL74-5nstPriF SEQ ID NO: 6585 AGCAACGTAGGGTCACGGAC
3'-конец OGL74-3nstPriR SEQ ID NO: 6586 GAGGAGTCTTCGATGCCACGA
OGL75 Первая ПЦР 5'-конец OGL75-5PriF SEQ ID NO: 6587 GAAAGCACCAGGTCGTATCTTGC
3'-конец OGL75-3PriR SEQ ID NO: 6588 CGCACAATCTTCGCTTCAAACCA
Гнездовая ПЦР 5'-конец OGL75-5nstPriF SEQ ID NO: 6589 GCATTGCTCTTCAGGAGGTACGT
3'-конец OGL75-3nstPriR SEQ ID NO: 6590 CAGCTGTGCAAGTCCGACTG
OGL76 Первая ПЦР 5'-конец OGL76-5PriF SEQ ID NO: 6591 TCTCCATACCTGCACTGGGTG
3'-конец OGL76-3PriR SEQ ID NO: 6592 ACGTGCTCTCAGCAACATCCA
Гнездовая ПЦР 5'-конец OGL76-5nstPriF SEQ ID NO: 6593 CGTCCAAACAGGCTAGACAGC
3'-конец OGL76-3nstPriR SEQ ID NO: 6594 TGCCTTTTGCGTCAACGGTG
OGL77 Первая ПЦР 5'-конец OGL77-5PriF SEQ ID NO: 6595 CCATCCAGATCGCGGTTGTC
3'-конец OGL77-3PriR SEQ ID NO: 6596 TACGAGTTCACGCCATTGCGT
Гнездовая ПЦР 5'-конец OGL77-5nstPriF SEQ ID NO: 6597 GTCTCCTCTTTGACGGTTGCG
3'-конец OGL77-3nstPriR SEQ ID NO: 6598 TCGATCCACACTCGCATGCA
OGL78 Первая ПЦР 5'-конец OGL78-5PriF SEQ ID NO: 6599 GTGGACCAGTGTAAAGCCCG
3'-конец OGL78-3PriR SEQ ID NO: 6600 TCCCTAGTGCCAGGACCTGA
Гнездовая ПЦР 5'-конец OGL78-5nstPriF SEQ ID NO: 6601 ACACCAAATGTCCGGTAGCGA
3'-конец OGL78-3nstPriR SEQ ID NO: 6602 CGACGATTCTCCATTGGCCG
OGL79 Первая ПЦР 5'-конец OGL79-5PriF SEQ ID NO: 6603 GCTAGAAACGCTGAACAGCAGC
3'-конец OGL79-3PriR SEQ ID NO: 6604 CGGGTTTAGAATCCACAAGCCG
Гнездовая ПЦР 5'-конец OGL79-5nstPriF SEQ ID NO: 6605 GACAAAAGCTGCCATCAACGCT
3'-конец OGL79-3nstPriR SEQ ID NO: 6606 CCCGATATGGACAGGTCAGCT
OGL80 Первая ПЦР 5'-конец OGL80-5PriF SEQ ID NO: 6607 AAAGGCGACACACACCTTTGC
3'-конец OGL80-3PriR SEQ ID NO: 6608 AGACAGCCATCCTCACTCGC
Гнездовая ПЦР 5'-конец OGL80-5nstPriF SEQ ID NO: 6609 TTTGGTGCAGAGGCCGAGAA
3'-конец OGL80-3nstPriR SEQ ID NO: 6610 AAGTAGCCAGGCAGACAACCA
OGL81 Первая ПЦР 5'-конец OGL81-5PriF SEQ ID NO: 6611 CTAGGCAGGGTGGCATGAAAG
Spec-PriR1 SEQ ID NO: 6612 CCACGATCGACATTGATCTGGCTA
3'-конец OGL81-3PriR SEQ ID NO: 6613 ACCATCAGAGGTTGTGAAGGCA
UnivDonor-3PriF SEQ ID NO: 6614 CAAATTCCCACTAAGCGCTCGG
Гнездовая ПЦР 5'-конец OGL81-5nstPriF SEQ ID NO: 6615 AAGGGCAACTTCATGGTTCAACC
Spec-nstPriR1 SEQ ID NO: 6616 GTTGCCTTGGTAGGTCCAGC
3'-конец OGL81-3nstPriR SEQ ID NO: 6617 ACCAGTAAATCCACAACCCATGGT
UnivDonor-3nstPriF SEQ ID NO: 6618 GTAAAGGTGAGCAGAGGCACG
OGL03 Первая ПЦР 5'-конец OGL03-5PriF SEQ ID NO: 6691
TATATGGTGGCCAATGGACGATGG
3'-конец OGL03-3PriR SEQ ID NO: 6692 CCACAGGAGCAAGCAGTGAC
Гнездовая ПЦР 5'-конец OGL03-5nstPriF SEQ ID NO: 6693 CGCATCTTTGGGGGTAGTGG
3'-конец OGL03-3nstPriR SEQ ID NO: 6694 AGTACCCAGTTGGTCTCGCC

Таблица 10
Список всех «внутренних» праймеров для анализа оптимальных геномных локусов с использованием гнездовой внутренней-внешней ПЦР
Все реакции 5'- конец Spec-PriR1 SEQ ID NO:5473 CCACGATCGACATTGATCTGGCTA
Первая ПЦР 3'-конец Uzi-PriF1 SEQ ID NO:5474 GGGATATGTGTCCTACCGTATCAGG
Гнездовая ПЦР 5'-конец Spec-nstPriR1 SEQ ID NO:5475 GTTGCCTTGGTAGGTCCAGC
3'-конец Uzi-nstPriF1 SEQ ID NO:5476 GAGCCATCAGTCCAACACTGC

Таблица 11
Праймеры для анализа активности расщепления ZFN
OGL 1 Контроль/ZFN 111879 SEQ ID NO:5477 TGGCACTAATCTCACCGGCT
SEQ ID NO:5478 AGTCTTAGAAGTACGCTACCGT
OGL 2 Контроль/ZFN 111885 SEQ ID NO:5479 TACTTGGCTTCGGCGGCGA
SEQ ID NO:5480 GGGTGACTTTTACGCGTCTCG
OGL 11 Контроль/ZFN 117402 SEQ ID NO:5481 GGTCACGACGCATGGCCTAA
SEQ ID NO:5482 AGGATGCATGGATCACCGTC
OGL 12 Контроль/ZFN 117404 SEQ ID NO:5483 GCTCTGTTGTGCAGCCGTAC
SEQ ID NO:5484 CGTTGCAGATACCACAGTGTAC
OGL 13 Контроль/ZFN 117429 SEQ ID NO:5485 GCTAGTAGCTGTTTACACGGCGTCT
SEQ ID NO:5486 AGGTCGAGACAACCAAGTAGAG
OGL 14 Контроль/ZFN 117406 SEQ ID NO:5487 ACAGGACATCGAGCTTGCAT
SEQ ID NO:5488 CAGAAGAAAGGCATCAACTCATG
OGL 15 Контроль/ZFN 117408 SEQ ID NO:5489 CTCTTTCACCTCTACTTTTACTTCAG
SEQ ID NO:5490 ATTGAACCGTTGTCAAAGCCA
OGL 16 Контроль/ZFN 117411 SEQ ID NO:5491 CACAGCGTCAGGGCGGTAAC
SEQ ID NO:5492 GGCACGCACCTGTCACTGAC
OGL 17 Контроль/ZFN 117413 SEQ ID NO:5493 GTACGCGCCCGGGAACTCCT
SEQ ID NO:5494 CCTGCGGCCCACGTGCATCT

Использование анализа посредством внутренней-внешней ПЦР в системе нацеливания на протопласты являлось особенно затруднительным, поскольку для трансфекции использовали большие количества плазмидной ДНК, и большое количество ДНК оставалось в системе нацеливания на протопласты, а затем экстрагировалось с клеточной геномной ДНК. Остаточная плазмидная ДНК может разбавлять относительную концентрацию геномной ДНК и снижать общую чувствительность обнаружения, а также может являться существенной причиной неспецифических, аберрантных реакций ПЦР. Индуцируемая ZFN вставка донора на основе NHEJ обычно происходит либо в прямой, либо в обратной ориентации. При анализе ДНК посредством внутренней-внешней ПЦР для встраивания в прямой ориентации часто выявляют ложноположительные полосы, возможно, вследствие общих областей гомологии вокруг участка связывания ZFN в мишени и доноре, которые могут привести к гибридизации праймеров и удлинению невстроенной донорной ДНК в процессе амплификации. Ложноположительных результатов не наблюдали в анализах, исследующих продукты вставки в обратной ориентации, и таким образом, весь анализ направленной интеграции донора проводили для изучения обратной вставки донора в RTA. Для дальнейшего увеличения специфичности и уменьшения фона, также использовали способ гнездовой ПЦР. В способе гнездовой ПЦР использовали вторую реакцию ПЦР, амплифицирующую более короткую область внутри первого продукта амплификации первой реакции ПЦР. С применением асимметричных количеств «внутренних» и «внешних» праймеров далее оптимизировали ПЦР участков стыковки для быстрого анализа нацеливания в выбранные геномные локусы.

Результаты анализа внутренней-внешней ПЦР визуализировали в агарозном геле. Для всех выбранных геномных локусов Zea mays, приведенных в таблице 12, «обработка ZFN+донор» обеспечивала полосу близкого к ожидаемому размера на 5'- и 3'-концах. Обработка контрольной ZFN или донором отдельно приводила к отрицательным результатам ПЦР, что позволяет предполагать, что способ специфически оценивал интеграцию донора в участке-мишени по меньшей мере 72 оптимальных внегенных геномных локусов маиса. Все обработки проводили в 3-6 повторах, и присутствие ожидаемого продукта ПЦР в множестве реплик (>2 на обоих концах) использовали для подтверждения нацеливания. Вставка донора посредством NHEJ часто приводит к побочным продуктам с более низкой интенсивностью, которые образовывались вследствие процессинга линеаризованных концов в участках ZFN мишени и/или донора. Кроме того, обнаружено, что различные ZFN приводили к различным уровням эффективности направленной интеграции, где некоторые из ZFN обеспечивали устойчивые высокие уровни встраивания донора, некоторые ZFN обеспечивали менее устойчивые уровни интеграции донора, а другие ZFN приводили к отсутствию интеграции. В целом, для каждого из выбранных геномных локусов-мишеней Zea mays, которые тестировали, продемонстрирована направленная интеграция в репрезентативные геномные локусы-мишени Zea mays посредством одной или нескольких ZFN, что подтверждает, что каждый из этих локусов поддавался нацеливанию. Более того, каждый из выбранных геномных локусов-мишеней Zea mays являлся пригодным для точной трансформации генами. Валидацию этих выбранных геномных локусов-мишеней Zea mays повторяли несколько раз с получением каждый раз сходных результатов, таким образом, подтверждая воспроизводимость процесса валидации, который включает дизайн и конструирование плазмид, трансформацию протопластов, обработку образцов и анализ образцов.

Заключение

Донорную плазмиду и одну ZFN, сконструированную для специфического расщепления выбранных геномных локусов-мишеней Zea mays, трансфицировали в протопласты Zea mays c.v. Hi-II и через 24 часа собирали клетки. Анализ геномной ДНК, выделенной из контрольных, обработанных ZFN и обработанных ZFN с донором протопластов, посредством внутренней-внешней ПЦР участков стыковки, показал направленную вставку универсального донорного полинуклеотида в результате расщепления геномной ДНК посредством ZFN (таблица 12). Эти исследования показывают, что универсальную донорную полинуклеотидную систему можно использовать для оценки нацеливания в эндогенные участки и для скрининга ZFN-кандидатов. Наконец, быстрый анализ нацеливания на основе протопластов и новые системы универсальных донорных полинуклеотидов обеспечивают быстрый способ скрининга геномных мишеней и ZFN для попыток точной инженерии генома в растениях. Способы можно расширять до оценки сайт-специфического расщепления и встраивания донора в геномных мишенях в любой представляющей интерес системе с использованием любой нуклеазы, которая индуцирует двухцепочечные и одноцепочечные разрывы ДНК.

Таблица 12
Проиллюстрированы результаты интеграции универсальной донорной полинуклеотидной последовательности в выбранные геномные локусы-мишени Zea mays. Как обозначено * ниже, вставка донора в OGL73 подтверждена только посредством реакции ПЦР для 5'-последовательности участка стыковки
Наиме-нование ID Положение Отнесе-ние к кластеру ZFN
(pDAB#)
Донор (pDAB#) Поддающийся нацеливанию локус (Да/Нет)
OGL01 optimal_loci_204637_G1 chr5:200298202..200301414 16 111879 111845 Да
OGL02 optimal_loci_204726_G1 chr5:200665730..200670667 03 111885 111846 Да
OGL08 optimal_loci_31710 chr1:194939396..194943360 23 117400 117415 Да
OGL11 optimal_loci_64542 chr2:72203716..72205045 14 117402 117416 Да
OGL12 optimal_loci_156393 chr4:154313884..154315253 10 117404 117417 Да
OGL15 preffered_loci_198387 chr5:164712378..164713567 25 117408 117419 Да
OGL13 optimal_loci_157315 chr4:158710709..158711983 30 117429 117434 Да
OGL14 optimal_loci_197372 chr5:158680601..158681681 26 117406 117418 Да
OGL16 optimal_loci_232228 chr6:144719567..144723469 28 117411 117420 Да
OGL17 optimal_loci_285621 chr8:118321357..118322528 06 117413 117421 Да
OGL04 optimal_loci_43577 chr1:256469704..256472666 20 124802 124812 Да
OGL05 optimal_loci_301774 chr9:23468085..23470278 15 121900 121926 Да
OGL06 optimal_loci_232222 chr6:144700575..144702126 20 124810 124813 Да
OGL07 optimal_loci_203704 chr5:194836270..194840217 12 121902 121930 Да
OGL09 optimal_loci_59517 chr2:43352132..43353146 1 118643 118697 Да
OGL10 optimal_loci_25001 chr1:151371224..151372260 1 118648 118686 Да
OGL18 optimal_loci_112632 chr3:128098856..128100257 2 123802 123810 Да
OGL19 optimal_loci_28905 chr1:177037718..177038919 2 123805 123809 Да
OGL20 optimal_loci_129164 chr3:221246027..221247542 3 121992 123808 Да
OGL21 optimal_loci_2425 chr1:12810845..12814490 3 118650 118697 Да
OGL22 optimal_loci_122036 chr3:184608166..184609697 4 118654 118688 Да
OGL23 optimal_loci_5735 chr1:29190279..29192844 4 118656 118689 Да
OGL24 optimal_loci_178978 chr5:35776311..35777560 5 118659 118690 Да
OGL25 optimal_loci_288388 chr8:133290442..133291481 5 118660 118697 Да
OGL26 optimal_loci_60310 chr2:47967092..47968271 5 118767 118787 Да
OGL27 optimal_loci_243330 chr7:34630402..34631577 6 118769 118787 Да
OGL28 optimal_loci_127038 chr3:210603611..210605198 7 118663 118697 Да
OGL29 optimal_loci_262784 chr7:155767046..155769049 7 118668 118691 Да
OGL30 optimal_loci_344662 chr10:119131667..119133955 7 118669 118692 Да
OGL31 optimal_loci_153894 chr4:139979597..139981225 8 118670 118693 Да
OGL32 optimal_loci_28771 chr1:176062139..176063611 8 118673 118694 Да
OGL33 optimal_loci_1098 chr1:5582601..5583834 9 118674 118695 Да
OGL34 optimal_loci_97772 chr3:30209253..30210607 9 118676 118696 Да
OGL35 optimal_loci_236662 chr6:165975716..165977010 10 118677 118697 Да
OGL36 optimal_loci_139485 chr4:42804231..42805751 11 118680 118697 Да
OGL37 optimal_loci_301175 chr9:20325171..20326621 11 118683 118764 Да
OGL38 optimal_loci_152337 chr4:130033092..130035481 12 118685 118765 Да
OGL39 optimal_loci_202616 chr5:188822901..188824814 12 123833 123809 Да
OGL40 optimal_loci_282323 chr8:100763204..100764398 13 118771 118787 Да
OGL41 optimal_loci_262782 chr7:155759080..155760097 13 121943 121983 Да
OGL42 optimal_loci_236455 chr6:164795991..164797027 14 121946 121984 Да
OGL43 optimal_loci_162531 chr4:189896984..189899332 15 121949 121985 Да
OGL44 optimal_loci_344663 chr10:119143167..119144795 15 121952 121986 Да
OGL45 optimal_loci_337001 chr10:77188319..77190007 16 121959 121987 Да
OGL46 optimal_loci_238100 chr7:4899227..4900708 16 121963 121988 Да
OGL48 optimal_loci_264359 chr7:163504241..163505487 17 121971 121990 Да
OGL49 optimal_loci_282653 chr8:102704765..102705924 18 121972 121991 Да
OGL50 optimal_loci_80282 chr2:173420834..173421870 18 124097 124295 Да
OGL51 optimal_loci_291068 chr8:148277606..148279985 19 123818 123831 Да
OGL52 optimal_loci_56395 chr2:24801482..24803132 19 118705 121201 Да
OGL54 optimal_loci_114664 chr3:140106950..140108061 21 118711 118792 Да
OGL57 optimal_loci_53137 chr2:7304197..7305496 22 118718 118794 Да
OGL58 optimal_loci_344664 chr10:119144946..119146850 23 118722 121208 Да
OGL59 optimal_loci_81941 chr2:181418576..181421181 24 118726 121209 Да
OGL60 optimal_loci_321514 chr9:140776147..140777584 24 118728 121210 Да
OGL61 optimal_loci_301180 chr9:20328932..20330129 25 118732 121211 Да
OGL62 optimal_loci_348776 chr10:142097590..142098803 26 118733 121212 Да
OGL63 optimal_loci_244439 chr7:41068791..41070248 27 118735 118795 Да
OGL64 optimal_loci_348258 chr10:139297032..139298517 27 118739 121214 Да
OGL65 optimal_loci_322501 chr9:146078534..146080201 28 118742 121215 Да
OGL66 optimal_loci_244324 chr7:40299412..40300584 29 118745 121216 Да
OGL67 optimal_loci_97232 chr3:27463016..27464143 29 124081 124866 Да
OGL68 optimal_loci_282499 chr8:101771408..101772767 30 125361 125366 Да
OGL69 optimal_loci_155031 chr4:146991391..146993137 31 118753 121218 Да
OGL70 optimal_loci_301773 chr9:23465509..23467762 31 124878 123880 Да
OGL71 optimal_loci_283161 chr8:105321958..105323571 32 123829 123832 Да
OGL72 optimal_loci_55524 chr2:20099003..20100485 32 118761 121221 Да
OGL 73 optimal_loci_127268 chr3:211767898..211770046 16 124086 124298 Да*
OGL74 optimal_loci_137693 chr4:31118968..31122359 3 121904 121927 Да
OGL75 optimal_loci_232484 chr6:146122164..146125580 12 121905 121927 Да
OGL76 optimal_loci_203075 chr5:191370802..191374627 12 121917 121927 Да
OGL77 optimal_loci_3733 chr1:19232372..19235997 11 121918 121928 Да
OGL78 optimal_loci_168286 chr4:219987223..219990695 4 121909 121930 Да
OGL79 optimal_loci_128078 chr3:215482594..215485640 4 121912 121929 Да
OGL80 optimal_loci_265551 chr7:170127188..170130734 3 121981 121936 Да
OGL81 optimal_loci_136086 chr4:22531506..22534989 27 124091 124298 Да

Пример 7: Экспрессия полинуклеотидной донорной последовательности внутри геномных локусов Zea mays

Случайным образом интегрированные события трансформации маиса получали посредством трансформации плазмидами pDAB105817 и pEPS1027, содержащими трансген aad-1, описанный в Патенте США No. 7838733. (фигура 14). Получили большое количество событий и 1027 стабильных событий анализировали для определения того, содержало ли какое-либо из событий случайным образом интегрированный трансген в выбранных геномных локусах-мишенях Zea mays, способом анализа геномного фланкирования, описанного в Патентной заявке США No. 2012/0258867. Таким образом, хромосомная локализация интегрированного трансгена в 223 событиях картирована в геноме Zea mays. Данные, таблица 13, указывают на то, что для хромосомной локализации интегрированных трансгенов показана интеграция внутри гипометилированных областей (45-73%) и в транскрипционных единицах (промотор/ген/3'UTR) ниже областей по меньшей мере 1 т.п.о. (60%).

Таблица 13
Геномный и эпигеномный контекст 1027 картированных событий
Количество событий, картированных с высокой достоверностью Количество событий, картированных с низкой достоверностью Общее количество событий
Количество 107 116 223
Гипометилированные области 100 п.о. 102 61 163
Гипометилированные области 2 т.п.о. 68 27 95
Основная часть гена 45 26 71
2 т.п.о. выше 32 11 43
1 т.п.о. ниже 16 3 19
Повтор 9 62 71
Всего в генах/повторах 88 98 186

Картированные события далее анализировали с использованием критериев прогнозирования оптимальных локусов, описанных в примерах 1 и 2 (гипометилированные области, уникальные области, внегенные, без повторов, вблизи генов в окружении 40 т.п.о., с признаками активной экспрессии в корнях/побегах, с признаками рекомбинации) и несколько случайным образом интегрированных событий идентифицировали в выбранных геномных локусах-мишенях Zea mays (таблица 14). Например, нацеливание внутри выбранных геномных локусов-мишеней Zea mays optimal_loci_232222 и optimal_loci_127268 показано с использованием анализа быстрого тестирования и посредством нацеливания in planta, соответственно.

Средняя длина экспериментальных выбранных геномных локусов-мишеней Zea mays составляла приблизительно 1 т.п.о., и различные степени экспрессии aad-1 наблюдали в каждом из выбранных геномных локусов-мишеней Zea mays (таблица 14). Анализ средней экспрессии aad-1 проводили на стадии трансформации растения Ti посредством анализа ПЦР с детекцией в реальном времени выделенного материала трансгенного листа. Таким образом, события случайной интеграции в геноме Zea mays являлись способными к экспрессии трансгена внутри экспериментальных выбранных геномных локусов-мишеней Zea mays.

Таблица 14
Экспрессия трансгена aad-1 при случайной интеграции в оптимальные геномные локусы. Показана локализация, длина и экспрессия РНК для маркерного гена aad-1 в локусе
ID события Наименование оптимальных геномных локусов SEQ ID NO: Положение Длина Среднее T/R для экспрессии РНК AAD1
G3_PL2863_1027-nstPri3 optimal_loci_43565 655 chr1:256293759..256295777 2018 22,687
H4_PL2783_1027-nstPri3 optimal_loci_164397 4552 chr4:199185401..199186813 1413 32,825
B6_PL2955_1027-nstPri3 optimal_loci_232222 3357 chr6:144700575..144702126 1553 3,1805
E7_PL3018_1027-nstPri3 optimal_loci_125749 19 chr3:204456962..204458140 1179 0,5185
E4_PL2955_1027-nstPri3 optimal_loci_7953 1777 chr1:41279823..41280909 1087 4,0805
A7_PL2746_1027-nstPri3 optimal_loci_205643 2037 chr5:205773760..205775465 1705 1,3761
F4_PL2978_1027-nstPri3 optimal_loci_201819 2726 chr5:184470152..184471958 1807 0,56075
B8_PL2955_1027-nstPri3 optimal_loci_42519 1929 chr1:250905847..250908881 3035 0,4591
B104/pDAB105817{1}015.001-1 optimal_loci_127268 2709 chr3:211767898..211770046 2149 1,54

OGL ID Длина OGL Частота
Рекомби-
нации в
области 1
млн.п.о.
вокруг OGL
Уровень
уникальности
последо-
вательностей
OGL
Расстояние
от OGL до
ближайшего
гена в его
окружении
% GC в
последо-
вательности
OGL
Кол-во генов в соседних
40 т.п.о. вокруг
OGL
Средняя экспрессия генов в
соседних 40 т.п.о. вокруг OGL
Уровень занятости
нуклео-
сомами
вокруг OGL
Относительное расположение
на хромосоме (близость к центромере)
Кол-во
OGL в области 1 млн.п.о. вокруг
OGL
optimal _loci_141_G1 1151 1,762917 19,72 10615 39,53 3 0,994628114 0,247 0,995110469 4
optimal _loci_144_G1 1629 1,762917 0 12985 50,58 3 0,994628114 0,5 0,995059769 4
optimal _loci_168_G1 1078 1,61634 0 3093 47,3 4 20,09560715 0,514 0,992690193 4
optimal _loci_195_G1 1028 0,982617 22,37 1001 38,61 1 11,29280113 0,215 0,99229317 4
optimal _loci_444_G1 2593 0,544453 35,75 3651 35,48 1 1,556021429 0,134 0,982865573 2
optimal _loci_445_G1 1330 0,544453 10,6 1249 36,39 1 1,556021429 0,3 0,982847701 2
optimal _loci_535_G1 3121 1,93197 5,31 1001 49,05 3 11,12779061 0,481 0,978366615 5
optimal _loci_557_G1 1067 2,481339 0 15992 42,36 1 5,776709427 0,248 0,977298936 6
optimal _loci_625_G1 1014 3,355066 0 1001 38,46 3 5,876923554 0,293 0,975005915 6
optimal _loci_628_G1 1222 3,373899 0 3314 50,4 3 5,876923554 0,354 0,974898973 6
optimal _loci_638_G1 2038 3,27174 2,36 4972 49,31 2 1,383591852 0,41 0,974701719 6
optimal _loci_650_G1 2412 3,2379 0 7154 55,3 1 10,90270876 0,731 0,974398058 5
optimal _loci_827_G1 2368 2,89912 0 4237 50,8 2 0,077566736 0,607 0,966860052 11
optimal _loci_856_G1 1067 2,704681 0 2086 48,92 1 3,231810412 0,412 0,966178497 13
optimal _loci_857_G1 2350 3,352892 0 1001 37,7 1 3,231810412 0,062 0,966125952 13
optimal _loci_858_G1 1387 3,368528 0 3960 37,05 1 3,231810412 0,05 0,966111101 14
optimal _loci_861_G1 1387 3,33734 0 7121 43,47 1 3,231810412 0,469 0,966087582 14
optimal _loci_877_G1 3205 3,441965 3,65 1001 52,38 2 33,88506673 0,579 0,965772954 15
optimal _loci_897_G1 1158 4,28108 5,79 2359 39,03 3 1,600327134 0,213 0,964815848 16
optimal _loci_899_G1 1474 4,28108 34,26 4878 38,67 3 1,600327134 0,31 0,964794754 16
optimal _loci_908_G1