Новые бактерии и ассоциации микроорганизмов для снижения эмиссии аммиака и/или метана в органических удобрениях или почвах

Изобретение относится к ассоциации микроорганизмов для снижения эмиссии аммиака и/или метана в почве или удобрении и ее применению. Предложенная ассоциация микроорганизмов депонирована в CBS под депозитарным номером NR CBS 134115. Ассоциацию применяют в способе уменьшения уровня аммиака и/или метана в органическом удобрении или почве. Указанная ассоциация может быть использована в составе органического удобрения или композиции, содержащей сахарид. Изобретение обеспечивает эффективное снижения эмиссии аммиака и/или метана в почве или удобрении. 6 н. и 2 з.п. ф-лы, 1 ил., 2 табл., 3 пр.

 

Данное изобретение относится к новым бактериям, ассоциациям микроорганизмов, включающим эти бактерии и их применению для снижения эмиссии аммиака и/или метана в органических удобрениях.

Органические удобрения - это органический материал, который может использоваться в качестве субстанции, улучшающей плодородие почвы, в сельском хозяйстве. Органическое удобрение улучшает плодородие почвы, добавляя в нее органические и питательные вещества, например азот, которые захватываются находящимися в почве бактериями. Органические удобрения содержат азот (N) в органической и неорганической формах. В органической форме азот недоступен для использования в росте сельскохозяйственных культур до тех пор, пока не произойдет его минерализация - превращение в ионы аммония (NH4+). В виде ионов аммония азот легко потребляется и усваивается растениями, однако некоторая его доля захватывается в состав микроорганизменной биомассы и превращается нитрифицирующими бактериями в нитрат-ионы (NO3-), которые теряются в результате вымывания или денитрификации с последующим рассеянием в атмосфере. В органических удобрениях из ионов аммония образуется аммиак (NH3), который, будучи летучим, при внесении удобрения в почву теряется в атмосфере. Азот, ушедший в атмосферу, не доступен для использования в производстве сельскохозяйственных культур. Кроме того, эмиссия аммиака (NH3) из отходов животноводства вызывает нежелательные эффекты в окружающей среде. Помимо обладающего нежелательными эффектами аммиака органические удобрения содержат также метан (СН4). Известно, что метан наряду с другими газами дает вклад в парниковый эффект и что выбросы его в атмосферу следует сокращать.

Таким образом, имеется потребность в продукте, который можно было бы добавлять в органические удобрения для улучшения их качества путем обеспечения увеличения количества питательных веществ, например азота, доступных для использования сельскохозяйственными культурами.

Имеется потребность в продукте, который, будучи добавлен в органические удобрения, обеспечивал бы улучшение урожайности сельскохозяйственных растений.

Кроме того, имеется потребность в продукте, добавляемом в органические удобрения, который способствовал бы снижению эмиссии аммиака и/или метана в органическом удобрении или в почве.

Задачей данного изобретения является, помимо прочего, предложить ассоциацию микроорганизмов, которую можно было бы добавлять в органические удобрения для улучшения их качества.

Другая задача данного изобретения - предложить ассоциацию микроорганизмов, способную воздействовать на органическое удобрение таким образом, чтобы в нем уменьшалась эмиссия аммиака и/или метана.

Еще одна задача данного изобретения - предложить ассоциацию микроорганизмов, которую можно использовать для улучшения органического удобрения таким образом, чтобы возрастала доступность азота для растений.

Еще одна задача данного изобретения - предложить ассоциацию микроорганизмов, которую можно было бы добавлять в почву для улучшения ее плодородия.

Еще одна задача данного изобретения - предложить бактерии, образующие часть ассоциации микроорганизмов, способной обеспечить решение указанных выше задач.

Эта задача в числе прочих задач данного изобретения решается, по меньшей мере частично (если не полностью), при помощи бактерий или ассоциаций микроорганизмов, заявленных в прилагаемой формуле изобретения.

Конкретно, эта задача решается, по меньшей мере частично (если не полностью), при помощи бактерий, содержащих частичную последовательность ДНК, кодирующую рибосомную РНК 16S, более чем на 85% идентичную последовательности, представленной SEQ ID NO: 1, или комплементарной ей последовательности. Автор данного изобретения обнаружил новых бактерий, входящих в состав ассоциации микроорганизмов. Эти бактерии в составе ассоциации микроорганизмов и включающая их ассоциация обеспечивают улучшение качества органического удобрения, а именно меньшую эмиссию аммиака и/или метана по сравнению с органическим удобрением без добавления такой ассоциации.

Частичную последовательность ДНК, кодирующую рибосомную 16S-PHK, можно обнаружить, используя метод секвенирования, описанный в работе Hall, L., Doerr, К.Α., Wohlfiel, S.L., Roberts, G.D., 2003. Evaluation of the MicroSeq system for identification of mycobacteria by 16S ribosomal DNA sequencing and its integration into a routine clinical mycobacteriology laboratory, J. Clinic. Microbiol. 4, 1447-1453, которая полностью включается в настоящий документ путем отсылки. К бактериальной суспензии был применен метод полимеразной цепной реакции (ПЦР) со следующими праймерами (последовательности приведены в направлении 5'→3') 16S500F (tggagagtttgatcctggctcag) и 16S500R (taccgcggctgctggcac).

Под степенью идентичности последовательностей (в процентах) в настоящем документе понимается число одинаковых последовательно расположенных нуклеотидов или аминокислотных остатков выровненных последовательностей по всей длине сравниваемых последовательностей, деленное на все число нуклеотидов или аминокислотных остатков в тих последовательностях и умноженное на 100. Например, в последовательности, на 80% идентичной последовательности SEQ ID No. 1, которая состоит из 550 аминокислотных остатков, при выравнивании 440 последовательно расположенных аминокислотных остатков одинаковы с SEQ ID No. 1, т.е. 440/550×100=80%.

Данное изобретение относится к ранее не известным бактериям. Филогенетическое древо строили на основании данных ПЦР-риботипирования, используя алгоритм UPGMA (метод не взвешенного попарного среднего) по программе Bionumerics (производство Applied Maths). Было обнаружено, что бактерии, у которых последовательность ДНК, кодирующая рибосомную 16S-PHK, содержала SEQ ID NO: 1, принадлежат к роду Bacteriodetes. В одном из своих воплощений данное изобретение относится к бактериям, Bacteriodetes sp.

В другом своем воплощении данное изобретение относится к бактериям, которые депонированы в Centraal Bureau voor Schimmelcultures (CBS) под регистрационным номером CBS 134116 27 декабря 2012 согласно Будапештскому договору о международном признании депонирования микроорганизмов для целей патентной процедуры, причем CBS 134116 является представителем Bacteriodetes.

В еще одном воплощении данного изобретения у предлагаемых бактерий имеется последовательность, которая по меньшей мере на 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% идентична последовательности, представленной SEQ ID NO: 1. В одном из предпочтительных воплощений данного изобретения у предлагаемых бактерий имеется последовательность, которая по меньшей мере на 99,7; 99,8; 99,9; 100% идентична последовательности, представленной SEQ ID NO: 1.

В одном из своих аспектов данное изобретение относится к ассоциации микроорганизмов, включающей описанные выше бактерии. Эта ассоциация может также содержать дрожжи рода Candida, предпочтительно вида Candida boidinii С. и/или Candida ethanolica , Stros & , и/или может также содержать бактерии Lactobacillus rhamnosus/casei, Acetobacter pasteurianus/lovaiensus и/или Rhodococcus facians/yunnanensis.

Ассоциация микроорганизмов по данному изобретению может также содержать другие молочнокислые и уксуснокислые бактерии.

В одном из воплощений данного изобретения предлагаемая ассоциация микроорганизмов содержит один или более видов бактерий, выбираемых из группы, состоящей из Lactobacillus rhamnosus, Lactobacillus casei, Lactobacillus ghanensis, Lactobacillus paracasei, Bacillus subtilis sensu stricto, Bacillus amyloliquefaciens, Bacillus atrophaeus, Bacillus vallismorits, Bacillus mojavensis, Bacillus tequilensis, Bacillus siamensis, и Bacillus methylotrophicus. В одном из предпочтительных воплощений данного изобретения предлагаемая ассоциация микроорганизмов включает все эти бактерии.

В одном из воплощений данного изобретения предлагаемая ассоциация микроорганизмов улучшает органические удобрения и снижает эмиссию аммиака и/или метана по сравнению с органическими удобрениями, в которые не добавлена ассоциация микроорганизмов по данному изобретению. Под органическим удобрением понимаются экскременты животных, и оно может быть полужидким, например навозной жижей.

В одном из воплощений данного изобретения предлагаемая ассоциация микроорганизмов улучшает почву и снижает эмиссию аммиака и/или метана по сравнению с почвой, в которую не добавлена ассоциация микроорганизмов по данному изобретению. Под почвой понимается рыхлый тонкий слой неорганических частиц, покрывающий поверхность земли, например почва, покрывающая сельскохозяйственные угодья, где выращиваются сельскохозяйственные культуры.

В другом своем воплощении данное изобретение относится к ассоциации микроорганизмов, депонированной в Centraal Bureau for Schimmelcultures (CBS) под регистрационным номером СВS134115.

В другом воплощении данного изобретения предлагаемая ассоциация микроорганизмов также содержит сахариды, предпочтительно моносахариды и/или дисахариды. Считается, что сахариды создают среду для бактерий и дрожжей, обеспечивающую такой состав ассоциации (такое соотношение бактерий и дрожжей), что в органическом удобрении снижается образование аммиака и/или метана. Предполагается, что эта ассоциация микроорганизмов создает в органическом удобрении среду, не благоприятную для бактерий, продуцирующих аммиак.

В еще одном воплощении данного изобретения указанные сахариды происходят из сахарного тростника или сахарной свеклы и предпочтительно являются тростниково-сахарной мелассой.

В другом своем аспекте данное изобретение относится к применению последовательности SEQ ID NO: 1 для выявления или идентификации бактерий, имеющих эту нуклеотидную последовательность или последовательность, по меньшей мере на 85% идентичную последовательности SEQ ID NO: 1.

В другом своем аспекте данное изобретение относится к ассоциации микроорганизмов, содержащей микроорганизмы, обеспечивающие уменьшение эмиссии аммиака (NH3) и/или метана в органических удобрениях, как те, которые могут быть обнаружены в ассоциации микроорганизмов, депонированной в коллекции CBS под регистрационным номером CBS 134115.

В другом своем аспекте данное изобретение относится к применению бактерий по данному изобретению или ассоциации микроорганизмов по данному изобретению для снижения содержания азота в органических удобрениях. Такое применение может реализоваться, например, путем разбрызгивания раствора, содержащего бактерии или ассоциацию микроорганизмов по данному изобретению, по органическому удобрению. Это можно осуществить, используя способ и продукт, описанные в заявке на патент Нидерландов №2009019, которая полностью включается в настоящий документ путем отсылки.

Органическое удобрение по данному изобретению - это предпочтительно органическое удобрение животного происхождения (навоз), например фекалии свиней, коров, домашней птицы или лошадей.

В другом своем аспекте данное изобретение относится к применению бактерий по данному изобретению или ассоциации микроорганизмов по данному изобретению для снижения содержания азота в почве. Такое применение может реализоваться, например, путем разбрызгивания раствора, содержащего бактерии или ассоциацию микроорганизмов по данному изобретению, по почве.

В другом своем аспекте данное изобретение относится к способу уменьшения эмиссии аммиака и/или метана в органических удобрениях, включающему добавление бактерий или ассоциации микроорганизмов по данному изобретению в органическое удобрение и инкубацию указанных бактерий или ассоциации микроорганизмов в течение промежутка времени, достаточного для того, чтобы уменьшилось образование аммиака и/или метана в данном органическом удобрении.

В другом своем аспекте данное изобретение относится к способу уменьшения эмиссии аммиака и/или метана в почве, включающему добавление бактерий или ассоциации микроорганизмов по данному изобретению в почву и инкубацию указанных бактерий или ассоциации микроорганизмов в течение промежутка времени, достаточного для того, чтобы уменьшилось образование аммиака и/или метана в данной почве.

Другим аспектом данного изобретения является применение органического удобрения по данному изобретению в качестве органического средства улучшения плодородия почвы.

Ассоциация микроорганизмов по данному изобретению или бактерии в составе этой ассоциации дают вклад в уменьшение эмиссии аммиака. Считается, что больше азота находится в форме, которая может использоваться растениями, например сельскохозяйственными растениями. Обнаружено, что ассоциация микроорганизмов и бактерии по данному изобретению можно использовать для улучшения органических удобрений или почвы и что помимо снижения уровня аммиака достигается улучшение удобрения или почвы в отношение повышения ее плодородия.

Преимущества и конкретные воплощения, описанные в настоящем документе для нескольких аспектов данного изобретения, действительны и для других его аспектов. Далее данное изобретение описывается подробно в приведенных ниже примерах его предпочтительных воплощений.

Фигура 1

Дендрограмма, построенная в результате кластерного анализа на основании парного сходства обнаруженных бактерий, относящихся к типу Bacteroidetes (фиг. 1А) (CBS 134116). Числа вверху рисунка показывают сходство количественно по оценке путем кластеризации с использованием метода не взвешенного попарного среднего (UPGMA).

Пример 1

Определение эмиссии аммиака в органическом удобрении (навозе со свинофермы)

Определение эмиссии аммиака проводили в двух хлевах для свиней. В одном из них использовали приспособление, описанное в заявке на патент Нидерландов №2009019, для обработки свиной навозной жижи. В свинарнике 1 по выделяемому свиньями навозу разбрызгивали ассоциацию микроорганизмов, депонированную в CBS под регистрационным номером CBS 134115. В свинарнике 2 навоз не обрабатывали указанной ассоциацией.

В каждом из свинарников содержалось 80 особей; измерения проводили в течение 12 недель. В свинарнике 1 ежедневно на протяжении 12 недель разбрызгивали композицию, содержащую указанную ассоциацию микроорганизмов. Эмиссию аммиака определяли в течение 24 часов в соответствии с требованиями Института стандартизации Нидерландов (NEN) 2826 (NEN 2826, 1999: Luchtkwaliteit. Uitworp door stationaire puntbronnen. Monsterneming en bepaling van het gehalte aan gasvormig ammoniak): образцы забирали, используя сосуд для промывки газа, содержащий жидкий абсорбент. Определение аммиака осуществляли поглотительным методом и химическим анализом «мокрым» путем.

Образцы собирали на протяжении нескольких недельных циклов содержания животных и в течение нескольких месяцев года.

В таблице 1 представлены результаты, полученные при определении эмиссии аммиака. В том навозе, который обрабатывали ассоциацией микроорганизмов, депонированной в CBS под регистрационным номером CBS 134115, было обнаружено уменьшение эмиссии аммиака в среднем на 35% по сравнению с навозом в свинарнике 2. Измерения проводили в разные времена года (летом, осенью и зимой), а также на различных стадиях роста животных (суммарно 12 недель, каждый двухнедельный период считался за одну стадию). Эксперимент был организован так, что в двух указанных свинарниках количество животных, их возраст и масса тела были одинаковыми.

Пример 2

Определение эмиссии метана в органическом удобрении (навозе со свинофермы)

Организация эксперимента была такой же, как описано в примере 1. Определение метана проводили в течение 24 часов в образцах, используя респирационный метод в соответствии с требованиями Института стандартизации Нидерландов (NEN-EN).

На двух различных фермах было обнаружено снижение уровня метана в среднем на 19%.

В таблице 2 представлены результаты определения метана, полученные на одной из двух ферм в свинарнике 1, где к органическому удобрению (навозу) добавляли ассоциацию микроорганизмов по данному изобретению, в сравнении со свинарником 2 (контроль), где такой обработки не проводилось.

Пример 3

Идентификация ассоциации микроорганизмов

Образец ассоциации микроорганизмов, депонированной в CBS под регистрационным номером NR CBS 134115, был проанализирован с целью идентифицировать ее компоненты. Анализ был проведен идентификационной службой Бельгийской координированной коллекции микроорганизмов (BCCM™/LMG, Гент, Бельгия).

Брали асептически аликвоты (несколько капель) образца и равномерно высевали на следующие среды:

- LMG nr. 66 (MRS); инкубировали в анаэробных условиях при температуре 37°С в течение 1 суток;

- LMG nr. 37 (RCM); инкубировали в анаэробных условиях при температуре ?°С в течение 1 суток;

- LMG nr. 13; инкубировали в аэробных условиях при температуре 28°С в течение 1 суток;

- LMG nr. 185 (TSA); инкубировали в аэробных условиях при температуре 28°С в течение 2 суток.

На разных средах наблюдались колонии различных типов; их очищали для дальнейшего анализа.

К четырем из этих очищенных колоний (t1, t2, t6 и t7) был применен метод генетического фингерпринтинга по технологии с использованием полиморфизма длин амплифицированных фрагментов (AFLP™). Метод AFLP позволяет охарактеризовать геном по вариабельности размеров фрагментов, образующихся в результате амплификации с помощью полимеразной цепной реакции (ПЦР) рестрицированной ДНК (Vos et al., Nucleic Acids Research 23: 4407-4414 (1995)). При этом использовали комбинацию праймеров Е01/Т11 (Keygene).

Путем кластерного анализа паттернов фингерпринтов ДНК, полученных методом AFLP™, в сравнении с референсными фингерпринтами групп молочнокислых бактерий (включая бифидобактерии) полученные культуры были идентифицированы следующим образом: Lactobacillus rhamnosus (t1), Lactobacillus casei (t2), Lactobacillus ghanensis (t6) и Lactobacillus paracasei (t7). Следует отметить, что по литературным данным типовой штамм Lactobacillus casei принадлежит к виду Lactobacillus zeae. Однако согласно установлению юридической комиссии Международного комитета по систематике прокариот название Lactobacillus zeae использовать не следует (Int. J. Syst. Evol. Microbiol. 58: 1764-1765, (2008)).

Применительно к двум из очищенных колоний (t3 и t4) был проведен анализ частичной последовательности ДНК, кодирующей рибосомную 16S-PHK. Тотальную ДНК получали по протоколу из работы Niemann et al. (J. Appl. Microbiol. 82: 477-484 (1997). Фрагмент гена рибосомной 16S-PHK (соответствующий положениям 8-1541 по нумерации для Escherichia coli) амплифицировали путем ПЦР с использованием консервативных праймеров. Продукт ПЦР очищали с помощью набора NucleoFast® 96 PCR Clean-up kit (производство Macherey-Nagel, Германия). Для секвенирования использовали набор BigDye® XTerminatorT Purification Kit (производство Applied Biosystems, США). Для сборки последовательности применяли пакет программ BioNumerics (производство Applied Maths, Бельгия).

Проводили филогенетический анализ с использованием пакета программ Bionumerics (Applied Maths, Бельгия) после включения консенсусной последовательности выравнивания последовательностей малой рибосомной субъединицы, взятых из международной базы данных нуклеотидных последовательностей Европейской молекулярно-биологической лаборатории (EMBL).

Строили матрицу сходства без учета пропусков (штраф за «гэп» 0%) и неизвестных оснований и определяли степень гомологии. Таким образом для нескольких достоверно описанных видов рода Bacillus была обнаружена степень сходства ≥97%, значимая для возможной видовой идентификации. Однако высокая степень сходства последовательностей (99,1-100% по частичной последовательности), полученная для всех достоверно описанных видов группы B.subtilis (ряда близко родственных бактерий, в настоящее время включающих В. subtilis sensu stricto, В. amyloliquefaciens, В. atrophaeus, В. vallismorits, В. mojavensis, В. tequilensis, В. siamensi, и В. methylotrophicus), говорит о том, что одна из указанных выше очищенных культур (t3) принадлежит к виду этой группы. В случае других культур степень сходства ≥97%, значимая для возможной видовой идентификации, была обнаружена с несколькими достоверно описанными видами рода Lactobacillus. Однако высокая степень сходства последовательностей (99,6-99,7% по частичной последовательности), полученная для типовых штаммов L. casei (99,7%) и L. zeae (99,6%), говорит о том, что данная культура (t4) принадлежит к одному из этих видов, а именно к L. casei.

Для дальнейшего анализа асептически брали аликвоту образца и делали серийные (десятикратные) разведения в физиологическом растворе. Аликвоты (0,1 мл) равномерно рассевали на среду TSA (LMG nr. 185) и инкубировали в аэробных условиях при температуре 28°С в течение 3 суток.

В итоге обнаружили еще один тип колоний (t8), который был очищен для дальнейшего исследования путем анализа частичной последовательности ДНК, кодирующей рибосомную 16S-PHK, как описано выше. В результате была установлена степень сходства ≥97%, значимая для возможной видовой идентификации, с несколькими достоверно описанными видами рода Lactobacillus. Однако высокая степень сходства последовательностей (99,6-99,9% по частичной последовательности), полученная для типовых штаммов обоих подвидов L. paracasei, говорит о том, что данная культура (t8) принадлежит к этому виду.

1. Ассоциация микроорганизмов, которая депонирована в CBS под депозитарным номером NR CBS 134115, для снижения эмиссии аммиака и/или метана в почве или удобрении.

2. Применение ассоциации микроорганизмов по п. 1 для уменьшения эмиссии аммиака и/или метана в органических удобрениях или почве.

3. Применение по п. 2, в котором органическое удобрение является навозом животных.

4. Органическое удобрение, содержащее ассоциацию по п. 1.

5. Способ уменьшения уровня аммиака и/или метана в органическом удобрении или почве, включающий этапы добавления ассоциации по п. 1 в органическое удобрение или почву и инкубации указанной ассоциации микроорганизмов в течение времени, достаточного для уменьшения образования аммиака и/или метана в этом органическом удобрении или почве.

6. Применение удобрения по п. 4 в качестве органического средства для улучшения плодородия почвы путем обеспечения повышенного количества азота при одновременном снижении эмиссии аммиака и/или метана в органическом удобрении или почве по сравнению с органическим удобрением или почвой, в которые консорциум не добавлен.

7. Композиция, содержащая ассоциацию микроорганизмов по п. 1 и сахарид, предпочтительно моносахарид, для снижения эмиссии аммиака и/или метана в почве или удобрении.

8. Композиция по п. 7, в которой сахарид происходит из сахарного тростника или сахарной свеклы и предпочтительно является тростниково-сахарной мелассой.



 

Похожие патенты:

Изобретения относятся к биотехнологии. Предложены реакционная смесь для получения по меньшей мере одного высшего спирта в водной среде, способ получения по меньшей мере одного высшего спирта в водной среде, применение указанной реакционной среды для получения по меньшей мере одного высшего спирта.

Изобретение относится к микробиологии, в частности к способам физической стерилизации в лабораториях и ветеринарных клиниках. Предложен способ обработки культуры Staphylococcus aureus кислородсодержащим газом из портативного озонатора.

Изобретение относится к санитарной и клинической микробиологии. Питательная среда для выделения бактерий Pseudomonas aeruginosa содержит панкреатический гидролизат рыбной муки, калий сернокислый, магний сернокислый 7-водный, калий фосфорнокислый однозамещенный, калий фосфорнокислый двузамещенный, фенозан-кислоту, бутилгидрокситолуол, N-цетилпиридиний хлористый 1 водный (ЦГГХ), натрий углекислый, агар бактериологический и дистиллированную воду при заданном содержании компонентов.

Изобретение относится к области биотехнологии, микробиологии, экологии, охране окружающей среды. Предложен микробный препарат для утилизации углеводородных загрязнений в водной среде при температуре от +20 до -2,5°С и солености 30±10 г/л.

Изобретение относится к птицеводству и может быть использовано при выращивании цыплят-бройлеров. Способ сохранения продуктивных качеств и жизнеспособности цыплят-бройлеров предусматривает введение в состав рациона птицы комплекса СибМОС ПРО в дозе 1,5 кг/т корма и введение фитобиотика Концентрат витаминный хвойный в воду в дозе 1 мл/л воды.
Изобретение относится к микробиологии. Питательная среда для культивирования Yersinia pestis EV, содержащая пермеат из ретентанта ферментативного гидролизата кукурузной патоки жидкой, разбавленный дистиллированной водой до показания аминного азота 0,12%, натрий хлористый, натрий фосфорнокислый 2-замещенный 12-водный, натрий сернистокислый, агар микробиологический и дистиллированную воду при заданном содержании компонентов.

Изобретение относится к микробиологии и предназначено для моделирования дормантного статуса М. tuberculosis в условиях in vitro.

Изобретение относится к биотехнологии. Предлагается штамм микроводорослей Chlorella vulgaris, депонированный в Федеральном государственном бюджетном учреждении науки Институт физиологии растений им.
Изобретение относится к микробиологии, в частности к бактериологии. Штамм Escherichia coli O144:Н45, характеризующийся отсутствием генов, кодирующих факторы патогенности, специфичных для Shigella spp.

Изобретения относятся к биотехнологии. Предложены реакционная смесь для получения по меньшей мере одного высшего спирта в водной среде, способ получения по меньшей мере одного высшего спирта в водной среде, применение указанной реакционной среды для получения по меньшей мере одного высшего спирта.

Изобретение относится к микробиологии, в частности к способам физической стерилизации в лабораториях и ветеринарных клиниках. Предложен способ обработки культуры Staphylococcus aureus кислородсодержащим газом из портативного озонатора.

Изобретение относится к области биотехнологии, в частности к аттенуированной бактерии Bordetella pertussis, содержащей мутации в регуляторной и кодирующей областях оперона ptx и кодирующей области гена dnt, для использования в качестве вакцины против коклюша.

Изобретение относится к санитарной и клинической микробиологии. Питательная среда для выделения бактерий Pseudomonas aeruginosa содержит панкреатический гидролизат рыбной муки, калий сернокислый, магний сернокислый 7-водный, калий фосфорнокислый однозамещенный, калий фосфорнокислый двузамещенный, фенозан-кислоту, бутилгидрокситолуол, N-цетилпиридиний хлористый 1 водный (ЦГГХ), натрий углекислый, агар бактериологический и дистиллированную воду при заданном содержании компонентов.
Изобретение относится к области биотехнологии. Изобретение представляет собой вакцину против чумы, парвовирусного энтерита, ботулизма и псевдомоноза.

Изобретение относится к области биотехнологии, микробиологии, экологии, охране окружающей среды. Предложен микробный препарат для утилизации углеводородных загрязнений в водной среде при температуре от +20 до -2,5°С и солености 30±10 г/л.

Изобретение относится к медицине и биотехнологии. Предложен способ получения бруцелезного антигена.
Изобретение относится к микробиологии. Питательная среда для культивирования Yersinia pestis EV, содержащая пермеат из ретентанта ферментативного гидролизата кукурузной патоки жидкой, разбавленный дистиллированной водой до показания аминного азота 0,12%, натрий хлористый, натрий фосфорнокислый 2-замещенный 12-водный, натрий сернистокислый, агар микробиологический и дистиллированную воду при заданном содержании компонентов.

Изобретение относится к микробиологии и предназначено для моделирования дормантного статуса М. tuberculosis в условиях in vitro.

Изобретение относится к сельскому хозяйству и экологии и может быть использовано в промышленном животноводстве, преимущественно в свиноводстве для снижения эмиссии запахообразующих веществ из производственных помещений для содержания животных и производства органо-минеральных удобрений на основе свиного навоза, отходной серной кислоты и фосфоритной муки.

Изобретение относится к ассоциации микроорганизмов для снижения эмиссии аммиака иили метана в почве или удобрении и ее применению. Предложенная ассоциация микроорганизмов депонирована в CBS под депозитарным номером NR CBS 134115. Ассоциацию применяют в способе уменьшения уровня аммиака иили метана в органическом удобрении или почве. Указанная ассоциация может быть использована в составе органического удобрения или композиции, содержащей сахарид. Изобретение обеспечивает эффективное снижения эмиссии аммиака иили метана в почве или удобрении. 6 н. и 2 з.п. ф-лы, 1 ил., 2 табл., 3 пр.

Наверх