Синтетические олигонуклеотидные праймеры и способ выявления днк вируса ачс методом петлевой изотермической амплификации

Изобретение относится к ветеринарной вирусологии, а именно к молекулярной диагностике. Разработаны олигонуклеотидные праймеры для выявления ДНК вируса африканской чумы свиней: F3 р22 GTTTTACGGATACTGCTGC, В3 р22 CCTTACCATATTTAAGAACCGG, FIP р22 TGGGGGCTATGGGATTCACT-AAGAATTTGGAAAAACACGGC, BIP р22 TGTGTGAAAAATATTGTTCATGGGG-ACATAACATGTTCCCTCCTT, LoopB р22 CCGATGACTGTACAGGTTGGG. Предложен также способ выявления ДНК вируса африканской чумы свиней из биологического материала с помощью модифицированной ПЦР, а именно петлевой изотермической амплификации (LAMP). Предлагаемое изобретение позволяет быстро и с высокой степенью достоверности выявлять присутствие ДНК вируса АЧС при помощи петлевой изотермической амплификации при исследовании образцов широкого спектра патологического и биологического материала в полевых условиях и лабораториях. 2 н.п. ф-лы, 4 табл., 2 пр.

 

Изобретение относится к области ветеринарной вирусологии и биотехнологии, в частности, к выявлению ДНК вируса африканской чумы свиней в полевых условиях, научно-исследовательских учреждениях и лабораториях, с помощью модификации полимеразной цепной реакции (ПЦР), а именно в петлевой изотермической амплификации.

Африканская чума свиней (АЧС) - вирусная болезнь домашних и диких свиней, характеризующаяся геморрагическим синдромом, контагиозностью и высокой летальностью, протекающая в сверхострой, острой, подострой, хронической и инаппарантной формах.

Вирус обладает высокой степенью патогенности (смертность среди животных достигает 100%). Разработанные методы лечения и специфической профилактики болезни малоэффективны и приводит к появлению хронической формы болезни, а затем к новым вспышкам инфекции в острой форме. Распространение АЧС наносит огромные экономические потери, складывающиеся из затрат на проведение ветеринарно-санитарных и карантинных мероприятий, убоя всего естественно восприимчивого поголовья на территории очага инфекции, а также затрат, связанных с ограничениями в международной торговле, накладываемыми на неблагополучную страну [1, 11].

Возбудитель африканской чумы свиней - крупный ДНК-содержащий вирус семейства Asfarviridae. Диаметр вириона около 200 нм. Суперкапсидная оболочка приобретается вирусом в ходе почкования из клетки зрелого вируса и является модифицированной клеточной мембраной.

Особенности морфологии вируса африканской чумы свиней обуславливают его высокую устойчивость и длительную сохранность в окружающей среде. Вирус АЧС может переноситься и распространяться с контаминированными пищевыми отходами, зараженными дикими кабанами, а также клещами рода Ornithodoros [8, 10].

Заболевание является эндемичным для многих стран Южной Африки. В 2007 г. вирус АЧС был занесен в Кавказский регион, изначально в Грузию, затем в Армению, Азербайджан и во многие регионы Российской Федерации (РФ). С начала 2014 г. вспышки африканской чумы свиней постоянно регистрируются в странах восточной Европы (Польша, Литва, Латвия, Эстония) [5].

Несмотря на многолетней опыт и имеющиеся подробные рекомендации по лабораторной диагностике, идентификация вируса АЧС традиционными методами (по его биологическим свойствам) требует значительных затрат и времени. В связи с этим разработка специфичных и чувствительных экспресс-методов для обнаружения генома вируса африканской чумы свиней в полевых условиях является актуальной задачей.

Для лабораторной диагностики для выявления генома возбудителя АЧС Всемирной организацией здравоохранения животных (МЭБ) рекомендуются:

- классическая ПЦР с детекцией продуктов амплификации в агарозном геле;

- ПЦР в режиме реального времени (ПЦР-РВ).

По сравнению с вышеперечисленными методами, использование модифицированной ПЦР - петлевой изотермической амплификации или LAMP (Loop-mediated isothermal amplification) позволяет существенно сократить время и ресурсы, и проводить исследования в полевых условиях.

Для стран, эндемичных по африканской чуме свиней, важна скорость постановки диагноза, а применение метода петлевой изотермической амплификации позволит оперативно, непосредственно на месте, проводить диагностические исследования этим методом, поскольку для постановки реакции используются портативные приборы, работающие на аккумуляторах.

Метод LAMP, предложенный японским ученым Цугунори Нотоми (Tsugunori Notomi) в 2000 году [9], основывался на использовании праймеров к шести различным участкам целевой области генома.

Впоследствии, метод был усовершенствован путем добавления еще одной пары праймеров - петлевых праймеров [4]. При их использовании наработка продукта идет с петель в обе стороны, а не в одну, как в оригинальном методе.

Известен способ, разработанный Wang J. с соавторами, по выявлению ДНК вируса АЧС метом изотермической рекомбиназной полимеразной амлификациии (РПА). Праймеры в данном наборе подобраны на ген B646L, кодирующий основной капсидный белок р72. Но в данном варианте, разработанная РПА предназначена только для анализа свежеотобранного материала - крови, выделений из носа после простой процедуры лизиса (без экстракции) и линейной амплификации. Недостатком данного метода является также то, что возможна лишь частичная его оптимизация [3].

Известен набор, разработанный сотрудниками TwistDx Ltd, Кембридж, Великобритания для диагностики АЧС методом РПА, праймеры в которой так же подобраны на области гена B646L [2].

Наиболее близким аналогом предлагаемого метода по сути и назначению является метод петлевой изотермической амплификации, разработанный Heather Е. James и др. [6]. В данной работе праймеры подобраны к последовательности гена, кодирующего белок вируса АЧС - топоизомераза II. Отличие данного метода от разработанного нами заключается в использованном участке генома вируса АЧС. Выбранный нами участок, ген KP177R, кодирующий белок р22, в отличии от гена, кодирующего топоизомеразу II, имеет копию на другом конце генома вируса АЧС, что может привести к повышению специфичности реакции и ее чувствительности.

Задачей настоящего изобретения являлась разработка высокочувствительного, экономичного и экспрессного способа выявлять присутствие ДНК вируса АЧС при помощи петлевой изотермической амплификации с целью устранения вышеуказанных недостатков.

Данная задача была решена благодаря созданию олигонуклеотидных праймеров, а также подбору условий для проведения петлевой изотермической амплификации, обеспечивающей получение результата в короткие сроки (в течение 40 минут) и при незначительных материальных затратах, снижая до минимума манипуляции при исследовании образцов крови и тканевых экссудатов в полевых условиях и лабораториях.

Сущность изобретения заключается в новом подходе обнаружения ДНК вируса АЧС с помощью проведения модифицированной ПЦР - петлевой изотермической амплификации (метод LAMP), и с использованием разработанных олигонуклеотидных праймеров (F3 р22, В3 р22, FIP р22, BIP р22, LoopB р22), фланкирующих специфический фрагмент генома вируса АЧС. Представленный метод включает последовательности олигонуклеотидных праймеров, имеющих следующую нуклеотидный состав:

F3 р22 GTTTTACGGATACTGCTGC

В3 р22 CCTTACCATATTTAAGAACCGG

FIP р22 TGGGGGCTATGGGATTCACT-AAGAATTTGGAAAAACACGGC

BIP р22 TGTGTGAAAAATATTGTTCATGGGG-ACATAACATGTTCCCTCCTT

LoopB р22 CCGATGACTGTACAGGTTGGG

При помощи указанных олигонуклеотидов (F3 р22, В3 р22, FIP р22, BIP р22, LoopB р22) проводят петлевую изотермическую амплификацию, позволяющую обнаружить геном вируса АЧС. При наличии в исследуемых образцах ДНК вируса АЧС в ходе петлевой изотермической амплификации синтезируются зигзагообразные продукты, содержащие фрагменты генома данного вируса.

Изобретение может быть использовано в ветеринарии, клинической и лабораторной диагностике для выявления ДНК вируса АЧС в образцах крови, пробах органов от инфицированных животных и вируссодержащем материале.

Техническим результатом изобретения является: расширенный спектр биологического материала (внутренние органы, сыворотка крови, цельная кровь, культура клеток), пригодного для проведения исследований без необходимости использования широкого спектра амплификаторов; сокращение времени для проведения массовых исследований проб на наличие генома вируса африканской чумы свиней.

В основе предложенного способа лежит образование специфического продукта, представляющего собой смесь петлеобразных петлевых нуклеотидных структур, варьирующих по длине и структуре петель. Синтез целевого продукта начинается со специфичного связывания сконструированных праймеров с участком гена, кодирующего белок р22 в геноме вируса АЧС.

Для разработки праймеров из базы данных GenBank были получены полногеномные нуклеотидные последовательности гена р22 отечественных изолятов, а также изолятов Benin97/1, OURT 88/3, L60, NHV, Ken06, BA71V, Е75 вирусов АЧС. Последовательности выравнены с помощью программы «BioEdit 7.0».

Праймеры для LAMP рассчитывались в программе PrimerExplorer V. 4. согласно руководству с учетом использования восьми участков гена. Рассчитаны 20 комплектов праймеров (FIP, BIP, F3, В3) и проведен их анализ с учетом таких параметров, как 5'- и 3-'концевая стабильность праймеров, размер фрагмента, GC-состав праймеров и положение праймеров относительно друг друга.

В результате проведенного анализа был отобран 1 комплект праймеров. В завершении процесса подбора праймеров в программе PrimerExplorer V.4. на основе полученных результатов рассчитан и петлевой праймер (Bloop).

Основная характеристика рассчитанных олигонуклеотидов представлена в таблице 1.

По сравнению с ПЦР, где используется только одна пара праймеров, предложенный метод LAMP более специфичен, потому что используемые пары праймеров, гомологичны не двум, а шести участкам целевой молекулы ДНК. Кроме того, регистрировать накопление продукта можно даже визуально по помутнению пробы, которое вызвано появлением осадка пирофосфата магния, выпадающего в ходе реакции.

В реакции используется Bst-полимераза, которая, в отличие от Taq-полимеразы, обладает способностью разделять цепи ДНК без нагрева пробы до 95°С. За счет указанного свойства Bst-полимеразы и двух из сконструированных праймеров происходит разделение цепей ДНК при одной температуре, вследствие чего отсутствует необходимость в термоциклировании и использовании для этого сложного оборудования. В процессе петлевой изотермической амплификации происходит образование специфичных петлевых структур с выпадением осадка пирофосфата магния, являющегося побочным продуктом реакции. Результат может быть учтен визуально по выпадающему осадку пирофосфата магния и/или изменению окраски реакционной смеси, а также при добавлении интеркалирующего красителя - с помощью прибора с флуоресцентной детекцией [9].

Дополнительным преимуществом метода LAMP является незначительное влияние на ход реакции наличия биологических примесей, как правило, ингибирующих ПЦР. Исследуемый образец можно вносить в реакционную смесь без предварительной очистки вирусной ДНК [7].

Метод LAMP прост в исполнении, дешев (в отличие от других методов изотермической амплификации) и, в случае турбидиметрического или колориметрического учета результатов реакции, не требует использования дорогостоящего оборудования с гибридизационно-флуоресцентной детекцией.

Для проведения петлевой изотермической амплификации в отдельной пробирке готовят реакционную смесь на необходимое количество образцов (N), в число которых входит отрицательный контроль выделения (ОКВ), отрицательный контроль реакции (ОК) и положительный контроль реакции (ПК). Объем смеси для одной пробы составляет 20 мкл, содержащих:

- смесь праймеров 6,5 мкл;
- 10х Thermopol буфер 2,5 мкл;
- 100 мМ р-р сульфата магния 1,5 мкл;
- 10 мМ р-р дезоксинуклеозидтрифосфатов 3,5 мкл;
- деионизированная вода 4 мкл;
- флуоресцентный краситель SYBR Green 1 мкл;
- Bst ДНК-полимераза 1 мкл.

При приготовлении смеси необходимо избегать попадания прямого солнечного света, т.к. это приводит к разрушению флуоресцентных красителей. Реакционную смесь перемешивают, покачивая пробирки и центрифугируют, после чего распределяют по 20 мкл в соответствующее число пробирок (количество проб с учетом контрольных образцов + 1 шт.). В последнюю очередь вносят 5 мкл ДНК. Общий объем реакции составляет 25 мкл.

Пробирки помещают в термостат или амплификатор (например, «Rotorgene 6000» (Corbett Research, Австралия)) с программой протекания реакции, приведенной в таблице 2. Время реакции составляет 40 минут.

В случае использования прибора с флуоресцентной детекцией и добавлении интеркалирующего красителя, флуоресценцию измеряют при 63°С на канале Green. Длительность одного цикла составляет 30 секунд, поскольку сигнал регистрируется на шаге амплификации каждые 30 секунд. Результаты интерпретируют, анализируя кривые накопления флуоресцентного сигнала для каждой пробы с помощью программного обеспечения прибора. Пробы считаются положительными, если в пробе есть значение Ct. Пробы считаются отрицательными, если значения Ct не определяются. Все значения Ct (пороговой линии) учитываются только для сигналов, поднявшихся выше фонового уровня шума и имеющих вид экспоненциальных кривых.

Результаты не подлежат учету, если:

- отсутствует положительный сигнал в пробе с положительным контролем реакции. Это может свидетельствовать о неправильно выбранной программе амплификации и о других ошибках, допущенных на этапе постановки реакции. В таком случае необходимо провести реакцию еще раз.

- появляется любое значение Ct в таблице результатов для отрицательного контроля выделения и для отрицательного контроля реакции на канале Green. Это свидетельствует о наличии контаминации реактивов или образцов. Поэтому результаты анализа по всем пробам считаются недействительными. Требуется повторить анализ всех проб, а также предпринять меры по выявлению и ликвидации источника контаминации.

Кроме того, результаты реакции могут быть учтены по изменению окраски реакционной смеси и турбидиметрически.

В случае визуального учета реакции с помощью турбидиметрии, результат считается положительным, если выпадает белый осадок пирофосфата магния. Если проба остается прозрачной, результат считается отрицательным.

При колориметрическом учете результатов реакции, цвет реакционной смеси положительной пробы меняется на зеленый; результат считается отрицательным, если цвет реакционной смеси остается без изменений (желтый).

Результат считается достоверным только в случае прохождения положительного контроля реакции (ПК) и отсутствия амплификации специфичного продукта для отрицательного контроля реакции (ОК) и отрицательного контроля выделения ДНК (ОКВ).

Использование сконструированных синтетических олигонуклеотидных праймеров позволяет проводить амплификацию фрагмента генома только вируса африканской чумы свиней.

Сущность предлагаемого изобретения пояснена примерами его использования, которые не ограничивают объем изобретения.

Пример 1. Определение специфичности петлевой изотермической амплификации для выявления генома вируса АЧС.

Для оценки специфичности метода использовали 6 проб, содержащих ДНК вируса АЧС и 5 проб содержащих ДНК гетерологичных вирусов, вызывающих болезни свиней с аналогичными клиническими признаками (вирусы: классической чумы свиней (КЧС), болезни Ауески (БА), репродуктивно-респираторного синдрома свиней (РРСС), ротавирусной инфекции свиней (РВИС), трансмиссивного гастроэнтерита свиней (ТГС)), а также 1 пробу содержащую ДНК Е. coli. Результаты интерпретировали по наличию или отсутствию Ct в соответствующей графе. Результаты представлены в таблице 3.

Петлевую изотермическую амплификацию и регистрацию результатов проводили по программе, описанной выше.

Пробирки поместили в амплификатор «Rotorgene 6000» (Corbett Research, Австралия)) с программой протекания реакции, приведенной в таблице 2. Время реакции составило 40 минут. Флуоресценцию измеряли при 63°С на канале Green. Длительность одного цикла составляет 30 секунд, поскольку сигнал регистрируется на шаге амплификации каждые 30 секунд. Результаты интерпретировали, анализируя кривые накопления флуоресцентного сигнала для каждой пробы с помощью программного обеспечения прибора.

Результаты интерпретировали на основании наличия или отсутствия значения Ct. Значение Ct варьировало от 24,09 до 38,97 у проб содержащих ДНК вируса АЧС. С помощью метода петлевой изотермической амплификации выявлены все положительные образцы, в то время как образцы, содержащие ДНК других возбудителей, были отрицательные.

Пример 2. Определение чувствительности петлевой изотермической амплификации для выявления генома вируса АЧС.

Для определения аналитической чувствительности метода были приготовлены 5 десятикратных разведений ДНК изолята вируса АЧС. Результаты представлены в таблице 4.

Чувствительность предложенного метода составляет 1 lg ГАдЕ, что составляет 10-15 ГАдЕ50.

Таким образом, изобретение может быть использовано в ветеринарной практике для выявления генетического материала вируса африканской чумы свиней в биологических образцах при проведении скрининговых исследований, для решения научно-исследовательских задач по мониторингу распространения АЧС. Использование специфических праймеров и метод петлевой изотермической амплификации позволяет выявить генетический материал вируса АЧС при проведении массовых исследований проб.

Источники информации, принятые во внимание при составлении описания изобретения:

1. Африканская чума свиней: монография. - Макаров В.В. - М.: РУДН, 2011. - 268 с

2. Презентация Тревора Дрю на международном ветеринарном конгрессе 2015 г.

3. A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus., Wang J, Wang J Geng Y, Yuan W., Can J Vet Res. 2017 Oct; 81(4): 308-312

4. Accelerated reaction by loop-mediated isothermal amplification using loop primers. - Nagamine K., Hase Т., Notomi T. (2002).. Molecular and cellular probes 16, 223-229.

5. African swine fever: an epidemiological update - J.M., Mur L., B. // Transboundary and emerging diseases. - 2012. - T. 59. - №. s1. - C. 27-35

6. Detection of African swine fever virus by loop-mediated isothermal amplification. - Heather E. James, K. Ebert, R. McGonigle, Scott M. Reid, Neil Boonham, Jennifer A. Tomlinson, Geoffrey H. Hutchings, Mick Denyer, Chris A.L. Oura, Juliet P. Dukes, Donald P. King

7. Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP). - Shirato K., Yano Т., Senba S., Akachi S., Kobayashi Т., Nishinaka Т., Matsuyama S. (2014). Virology journal 11, 139

8. Genomic analysis of highly virulent isolate of African swine fever virus. - Chapman DAG, Darby AC, Da Silva M, Upton C, Radford AD, Dixon LK. Emerg Infect Dis. 2011.

9. Loop-mediated isothermal amplification of DNA. - Notomi Т., Okayama H., Masubuchi H., Yonekawa Т., Watanabe K., Amino N., Hase T. (2000). Nucleic acids research 28, E63.

10. Pathogenesis of African swine fever in domestic pigs and European wild boar - Blome S., Gabriel C, Beer M. // Virus research. - 2013. - T. 173. - №. 1. - C. 122-130.

11. Purification and properties of African swine fever virus - Carrascosa A.L. et al. // Journal of virology. - 1985. - T. 54. - №. 2. - C. 337-344.

- - отсутствие сигнала, проба отрицательна

«-» - отсутствие сигнала, проба отрицательна

«К» - отрицательный контроль реакции

1. Набор синтетических олигонуклеотидных праймеров, состоящий из праймеров комплементарных умеренно консервативной области гена, кодирующего белок р22, имеющих следующий нуклеотидный состав:

2. Способ выявления ДНК вируса африканской чумы свиней из биологического материала с использованием олигонуклеотидных праймеров по п. 1 с помощью петлевой изотермической амплификации, состоящей из 2 этапов: инкубация пробирок при 63°С в течение 40 минут и учет результатов реакции с помощью программного обеспечения прибора, при этом образец считается положительным на наличие ДНК вируса АЧС, если присутствует значение Ct, образец считается отрицательным на наличие ДНК вируса, если значение Ct отсутствует, однако в случае, если отсутствует положительный сигнал в пробе с положительным контролем реакции и появляется любое значение Ct для отрицательного контроля выделения и для отрицательного контроля реакции, необходимо повторить реакцию с целью подтвердить или опровергнуть наличие ДНК искомого вируса в исследуемой пробе; кроме того, в случае визуального учета реакции при турбидиметрии и колориметрии результат считается положительным на наличие ДНК вируса АЧС, если выпадает белый осадок пирофосфата магния или если цвет реакционной смеси меняется на зеленый; образец считается отрицательным на наличие ДНК вируса, если проба остается прозрачной или цвет реакционной смеси остается без изменений (желтым).



 

Похожие патенты:

Группа изобретений относится к области биотехнологии. Предложены система и способ секвенирования синтезом (SBS).

Изобретение относится к области биотехнологии и медицины. Предложен способ поиска молекулярных маркеров патологического процесса для дифференциальной диагностики, мониторинга и таргетной терапии.

Изобретение относится к области биотехнологии и медицины. Предложен способ поиска молекулярных маркеров патологического процесса для дифференциальной диагностики, мониторинга и таргетной терапии.

Изобретение относится к области биотехнологии, конкретно к способу получения иммобилизованной библиотеки фрагментов ДНК нуклеиновой кислоты-мишени со штрихкодами с использованием иммобилизованных на носителе транспозомных комплексов для захвата специфических фрагментов ДНК.

Изобретение относится к области биотехнологии и медицины. Предложен способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-РНК, включающий выделение тотальной РНК из тканевых проб глиом и перифокальной зоны, обратную транскрипцию, с последующей амплификацией в режиме реального времени RT-PCR, отличающийся тем, что используют высокоспецифичные праймеры для генетических локусов EGFR, MSI1, PSMC4, ТВР, RPLO, и микро-РНК hsa-miR-92-1-5р, hsa-miR-126-5p, hsa-miR-7-5p, анализируют полученные данные и вычисляют коэффициент относительной экспрессии Е с использованием трех высокоспецифичных референсных генов: PSMC4, ТВР, RPLO и двух референсных высокоспецифичных микро-РНК: hsa-miR-126-5р, hsa-miR-7-5p, сравнивают полученные значения Е в опухолевой ткани с контрольными и при значениях EEGFR<0,5 или EEGFR>1,5, EMSI1<0,5 или EMSI1>1,5, Ehsa-miR-92a-1-5p<0,5 или Ehsa-miR-92a-1-5p>1,5 хотя бы по одному локусу у пациента диагностируется глиома высокой степени злокачественности III, IV; отсутствие изменений экспрессии указанных локусов относительно контроля свидетельствует о соответствии опухоли II степени злокачественности.
Изобретение относится к медицине. На прегравидарном этапе у пациенток группы риска, которая выделена по анамнестическим данным, определяют полиморфизмы генов фолатного цикла и PAI-1.

Изобретение относится к области биотехнологии. Сущность изобретения заключается в том, что из ДНК исследуемого штамма L.

Изобретение относится к биотехнологии. Описана композиция олигонуклеотидов для амплификации последовательности-мишени.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ проведения ПЦР в режиме реального времени для генотипирования крупного рогатого скота по аллелям 337C/G гена fshr (rs43745234), состоит в том, что используются:прямой праймер прямой праймер 5'-GAATTGAAAAGGCCAACAACC-3',обратный праймер 5'-CACCAGAATACAGAAGTTCTTACAGA-3',FSHR337C - аллель-специфичный флуоресцентно-меченый зонд-5'-FAM-CATCGACCCTGATGCC BHQ1-3',FSHR337G - аллель-специфичный флуоресцентно-меченый зонд5'-VIC-CATCGACGCTGATGC-BHQ1-3'.Изобретение позволяет повысить надежность детекции аллелей 337C/G (rs43745234) гена fshr, упростить анализ и сократить время его проведения до 1,5 часов.

Изобретение относится к биотехнологии. Описано множество праймеров для использования в конструировании профиля ДНК человека, содержащее два набора праймеров.

Изобретение относится к биотехнологии. Описан выделенный вирус, который является членом пестивирусов, для диагностики и лечения заболевания, вызванного пестивирусом, отличающийся тем, что а) вирус является возбудителем врожденного тремора группы А-II у свиней, а б) вирус имеет вирусный геном, содержащий ген, кодирующий оболочечный белок Erns, ген, кодирующий оболочечный белок E2, и ген, кодирующий оболочечный белок E1, при этом нуклеотидная последовательность гена Erns имеет уровень идентичности, составляющий по меньшей мере 80% по отношению к нуклеотидной последовательности, как показано в SEQ ID NO:1, и/или нуклеотидная последовательность гена E2 имеет уровень идентичности, составляющий по меньшей мере 80% по отношению к нуклеотидной последовательности, представленной в SEQ ID NO:3, и/или нуклеотидная последовательность гена Е1 имеет уровень идентичности, составляющий по меньшей мере 80% по отношению к нуклеотидной последовательности, как показано в SEQ ID NO:5.

Группа изобретений относится к области биотехнологии. Предложены система и способ секвенирования синтезом (SBS).

Изобретение относится к области биотехнологии и медицины. Предложен способ поиска молекулярных маркеров патологического процесса для дифференциальной диагностики, мониторинга и таргетной терапии.

Изобретение относится к области биотехнологии, конкретно к способу получения иммобилизованной библиотеки фрагментов ДНК нуклеиновой кислоты-мишени со штрихкодами с использованием иммобилизованных на носителе транспозомных комплексов для захвата специфических фрагментов ДНК.

Изобретение относится к биотехнологии. Описана композиция олигонуклеотидов для амплификации последовательности-мишени.

Изобретение относится к биотехнологии. Описано множество праймеров для использования в конструировании профиля ДНК человека, содержащее два набора праймеров.
Изобретение относится к биотехнологии, а именно к офтальмологии и фармакогенетике, и может быть использовано при подборе терапии у пациентов с экссудативной («влажной») и «сухой» формах возрастной макулярной дегенерации (ВМД).

Изобретение относится к биотехнологии, в частности к способу тестирования собаки для определения предрасположенности собаки к накоплению меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из: (a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287; (b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a), и/или (c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Изобретение относится к биотехнологии и определению респираторных заболеваний с помощью молекулярных маркеров в качестве средства прогнозирования развития случаев респираторных инфекций.

Изобретение относится к области биотехнологии, конкретно к способу отбора стабильной продуцирующей антитело под контролем промотора CMV человека с SEQ ID NO: 1 клетки яичника китайского хомячка СНО-К1.

Изобретение относится к ветеринарной вирусологии, а именно к молекулярной диагностике. Разработаны олигонуклеотидные праймеры для выявления ДНК вируса африканской чумы свиней: F3 р22 GTTTTACGGATACTGCTGC, В3 р22 CCTTACCATATTTAAGAACCGG, FIP р22 TGGGGGCTATGGGATTCACT-AAGAATTTGGAAAAACACGGC, BIP р22 TGTGTGAAAAATATTGTTCATGGGG-ACATAACATGTTCCCTCCTT, LoopB р22 CCGATGACTGTACAGGTTGGG. Предложен также способ выявления ДНК вируса африканской чумы свиней из биологического материала с помощью модифицированной ПЦР, а именно петлевой изотермической амплификации. Предлагаемое изобретение позволяет быстро и с высокой степенью достоверности выявлять присутствие ДНК вируса АЧС при помощи петлевой изотермической амплификации при исследовании образцов широкого спектра патологического и биологического материала в полевых условиях и лабораториях. 2 н.п. ф-лы, 4 табл., 2 пр.

Наверх