Способы и продукты для экспрессии белков в клетках



Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
Способы и продукты для экспрессии белков в клетках
C12N15/1024 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)
C07K2319/80 - Пептиды (пептиды в пищевых составах A23, например получение белковых композиций для пищевых составов A23J, препараты для медицинских целей A61K; пептиды, содержащие бета-лактамовые кольца, C07D; циклические дипептиды, не содержащие в молекуле любого другого пептидного звена, кроме образующего их кольцо, например пиперазин-2,5-дионы, C07D; алкалоиды спорыньи циклического пептидного типа C07D519/02; высокомолекулярные соединения, содержащие статистически распределенные аминокислотные единицы в молекулах, т.е. при получении предусматривается не специфическая, а случайная последовательность аминокислотных единиц, гомополиамиды и блоксополиамиды, полученные из аминокислот, C08G 69/00; высокомолекулярные продукты, полученные из протеинов, C08H 1/00; получение

Владельцы патента RU 2711249:

ФЭКТОР БАЙОСАЙЕНС ИНК. (US)

Настоящее изобретение относится к биоинженерии. Предложена композиция, содержащая нуклеиновую кислоту, кодирующую ген-редактирующий белок, включающий домен нуклеазы и ДНК-связывающий домен, содержащий повторы с аминокислотной последовательностью LTPvQVVAIAwxyzGHGG, где “v” представляет собой Q, D или E, “w” – S или N, “xy” - HD, NG, NS, NI, NN или N, а “z” - GGKQALETVQRLLPVLCQD или GGKQALETVQRLLPVLCQA. Также представлены способ in vitro изменения последовательности молекулы ДНК-мишени; набор для изменения последовательности молекулы ДНК-мишени и вектор, содержащий нуклеиновую кислоту, кодирующую вышеупомянутый белок. Ген-редактирующий белок имеет увеличенную длину повторов по сравнению с повторами в составе эффекторной нуклеазы, подобной активатору транскрипции (TALEN), что обеспечивает увеличение эффективности редактирования генов. 4 н. и 37 з.п. ф-лы, 16 ил., 13 табл., 68 пр.

 

ПРИОРИТЕТ

Настоящая заявка заявляет приоритет по предварительной заявке США №61/721302, поданной 1 ноября 2012 г., предварительной заявке США №61/785404, поданной 14 марта 2013 г. и предварительной заявке США №61/842874, поданной 3 июля 2013 г., содержание которых включено в данный документ в полном объеме посредством ссылки. Настоящая заявка относится к заявке США №13/465490, поданной 7 мая 2012 г., международной заявке № PCT/US2012/067966, поданной 5 декабря 2012 г. и заявке США №13/931251, поданной 28 июня 2013 г., содержание которых включено в данный документ в полном объеме.

ОБЛАСТЬ ТЕХНИКИ

Настоящее изобретение относится в частности к нуклеиновым кислотам, кодирующим белки, терапевтическим средствам, содержащим нуклеиновые кислоты, кодирующие белки, способам индукции экспрессии клетками белков с помощью нуклеиновых кислот, способам, наборам и устройствам для трансфекции, редактирования генов и репрограммирования клеток и клеткам, организмам и терапевтическим средствам, полученным с использованием этих способов, наборов и устройств.

ОПИСАНИЕ ТЕКСТОВОГО ФАЙЛА, ПОДАННОГО В ЭЛЕКТРОННОМ ВИДЕ

Содержание текстового файла, поданного в электронном виде, включено в данный документ в полном объеме посредством ссылки: копия перечня последовательностей в машиночитаемом формате (название файла: FABI_005_02WO_SeqList_ST25.txt; дата записи: 30 октября 2013 г.; размер файла: 255 КБ).

УРОВЕНЬ ТЕХНИКИ

Синтетические РНК и терапевтические средства на основе РНК

Рибонуклеиновая кислота (РНК) повсеместно распространена как в прокариотических, так и в эукариотических клетках, в которых она кодирует генетическую информацию в форме матричной РНК, связывает и транспортирует аминокислоты в форме транспортной РНК, собирает белки из аминокислот в форме рибосомальной РНК и выполняет многочисленные другие функции, включая регуляцию экспрессии генов в формах микроРНК и длинной некодирующей РНК. РНК может быть получена синтетически с помощью способов, включающих прямой химический синтез и транскрипцию in vitro, и может вводиться пациентам в терапевтических целях.

Репрограммирование клеток и клеточные терапии

Клетки могут быть репрограммированы путем воздействия на них специфических внеклеточных стимулов и/или путем эктопической экспрессии специфических белков, микроРНК и т.д. Несмотря на то, что ранее было описано несколько способов репрограммирования, большинство из них основано на эктопической экспрессии, требующей введения экзогенной ДНК, что сопряжено с риском мутаций. Сообщалось о способах репрограммирования, не использующих ДНК, основанных на прямой доставке белков репрограммирования. Однако эти способы являются слишком неэффективными и ненадежными для коммерческого применения. В дополнение к этому, были описаны способы репрограммирования на основе РНК (См., например, Angel. MIT Thesis. 2008. 1-56; Angel et al. PLoS ONE. 2010. 5,107; Warren et al. Cell Stem Cell. 2010. 7,618-630; Angel. MIT Thesis. 2011. 1-89 и Lee et al. Cell. 2012. 151,547-558; содержания которых включены в данный документ посредством ссылок). Однако существующие способы репрограммирования на основе РНК являются медленными, ненадежными и неэффективными, если выполняются на зрелых клетках, требуют многократных трансфекций (что приводит к значительным затратам и возможности ошибки), могут репрограммировать только ограниченное количество типов клеток, могут репрограммировать клетки только в ограниченное количество типов клеток, требуют использования иммуносупрессантов и требуют использования многих компонентов человеческого происхождения, включая сывороточный альбумин человека (HSA), получаемый из крови, и фидеры из фибробластов человека. Многочисленные недостатки ранее описанных способов репрограммирования на основе РНК делают их неподходящими как для исследований, так и для терапевтического применения.

Редактирование генов

Несколько встречающихся в природе белков содержат ДНК-связывающие домены, которые могут распознавать специфические последовательности ДНК, к примеру, цинковые пальцы (ZF) и эффекторы, подобные активаторам транскрипции (TALE). Гибридные белки, содержащие один или более таких ДНК-связывающих доменов и домен расщепления эндонуклеазы FokI, могут быть использованы для внесения двухцепочечного разрыва в целевой участок ДНК в клетке (См., например, опубликованную патентную заявку США 2012/0064620, опубликованную патентную заявку США 2011/0239315, патент США №8470973, опубликованную патентную заявку США 2013/0217119, патент США №8420782, опубликованную патентную заявку США 2011/0301073, опубликованную патентную заявку США 2011/0145940, патент США №8450471, патент США №8440431, патент США №8440432 и опубликованную патентную заявку США 2013/0122581; содержание которых включено в данный документ посредством ссылки). Однако, используемые в настоящее время способы редактирования генов клеток неэффективны и сопряжены с риском неконтролируемого мутагенеза, что делает их неподходящими как для исследований, так и для терапевтического применения. Способы редактирования генов соматических клеток, не использующие ДНК, ранее не изучались, и не существует способов одновременного или последовательного редактирования генов и репрограммирования соматических клеток. К тому же ранее не изучались способы прямого редактирования генов клеток в организме пациентов (т.е. in vivo), а разработка таких способов ограничена недостатком приемлемых мишеней, неэффективной доставкой, неэффективной экспрессией ген-редактирующего белка/белков, неэффективным редактированием генов с помощью экспрессированного ген-редактирующего белка/белков, в частности, из-за слабого связывания ДНК-связывающих доменов, чрезмерных нецелевых эффектов, в частности, из-за непрямой димеризации домена расщепления FokI и слабой специфичности ДНК-связывающих доменов, а также других факторов. Наконец, ранее не изучалось применение редактирования генов в рамках антибактериальной, противовирусной и противораковой терапий.

Соответственно, остается необходимость в улучшенных композициях и способах экспрессии белков в клетках.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

В настоящем изобретении предложены, в частности, композиции, способы, продукты и устройства для индукции экспрессии клетками белков, способы, продукты и устройства для получения таких композиций, способов, продуктов и устройств, а также композиции и продукты, включая клетки, организмы и терапевтические средства, получаемые с использованием таких композиций, способов, продуктов и устройств. В отличие от ранее описанных способов, некоторое варианты реализации настоящего изобретения не включают воздействие на клетки экзогенной ДНК или аллогенных веществ или веществ животного происхождения, делая продукты, получаемые в соответствии со способами настоящего изобретения, пригодными для применения в терапевтических целях.

В некоторых аспектах изобретения предложены синтетические молекулы РНК с низкой токсичностью и высокой трансляционной эффективностью. В одном аспекте изобретения предложена среда для культивирования клеток для высокоэффективной трансфекции, репрограммирования и редактирования генов клеток. Другие аспекты изобретения относятся к способам получения синтетических молекул РНК, кодирующих белки репрограммирования. Другие дополнительные аспекты изобретения относятся к способам получения синтетических молекул РНК, кодирующих ген-редактирующие белки.

В одном аспекте в изобретении предложены высокоэффективные ген-редактирующие белки, содержащие сконструированные домены расщепления нуклеаз. В другом аспекте в изобретении предложены белки, редактирующие с высокой точностью гены, содержащие сконструированные домены расщепления нуклеаз. Другие аспекты изобретения относятся к высокоэффективным ген-редактирующим белкам, содержащим сконструированные ДНК-связывающие домены. Другие дополнительные аспекты изобретения относятся к белкам, редактирующим с высокой точностью гены, содержащим сконструированные ДНК-связывающие домены. Другие дополнительные аспекты изобретения относятся к ген-редактирующим белкам, содержащим сконструированные последовательности повторов. Некоторые аспекты изобретения относятся к способам изменения последовательности ДНК клетки путем трансфекции клетки или индукции экспрессии клеткой ген-редактирующего белка. Другие аспекты изобретения относятся к способам изменения последовательности ДНК клетки, которая находится в культуре in vitro. Другие дополнительные изобретения аспекты относятся к способам изменения последовательности ДНК клетки, которая находится в условиях in vivo.

В некоторых аспектах в данном изобретении предлагаются способы лечения рака, включающие введение пациенту терапевтически эффективного количества ген редактирующего белка или нуклеиновой кислоты, кодирующей ген-редактирующий белок. В одном аспекте изобретения ген-редактирующий белок способен изменять последовательность ДНК гена, ассоциированного с раковым заболеванием. В другом аспекте изобретения ген, ассоциированный с раковым заболеванием, представляет собой ген BIRC5. Другие аспекты относятся к терапевтическим средствам, содержащим нуклеиновые кислоты и/или клетки, и способы использования терапевтических средств, содержащих нуклеиновые кислоты и/или клетки, для лечения, к примеру, диабета 1 типа, сердечной недостаточности, включая ишемическую или дилатационную кардиомиопатию, макулярной дегенерации, болезни Паркинсона, муковисцидоза, серповидноклеточной анемии, талассемии, анемии Фанкони, тяжелого комбинированного иммунодефицита, наследственной сенсорной нейропатии, пигментной ксеродермы, болезни Хантингтона, мышечной дистрофии, амиотрофического латерального склероза, болезни Альцгеймера, рака и инфекционных заболеваний, включая гепатит и ВИЧ/СПИД. В некоторых аспектах изобретения нуклеиновая кислота содержит синтетическую РНК. В других аспектах изобретения нуклеиновую кислоту доставляют в клетки с помощью вируса. В некоторых аспектах изобретения вирус представляет собой репликационно-компетентный вирус. В других аспектах изобретения вирус представляет собой репликационно-некомпетентный вирус.

Подробности реализации данного изобретения изложены ниже в сопроводительном описании. Несмотря на то, что при осуществлении или проверке настоящего изобретения могут использоваться подобные или эквивалентные описанным в данном документе материалы и способы, здесь описаны типовые способы и материалы. Другие признаки, объекты и преимущества данного изобретения будут очевидными из данного описания и формулы изобретения. В описании и приложенных пунктах формулы изобретения единственные формы слов включают множественные, если только в контексте четко не указано иное. Если не указано иное, все технические и научные термины, использованные в данном документе, имеют то же значение, которое обычно подразумевается средним специалистом в данной области, к которой относится это изобретение.

ПОДРОБНОЕ ОПИСАНИЕ ФИГУР

ФИГ. 1А иллюстрирует РНК, кодирующую указанные белки и содержащую аденозин, 50% гуанозина, 50% 7-дезазагуанозина, 70% уридина, 30% 5-метилуридина и 5-метилцитидин, разделенные в денатурирующем агарозном геле, содержащем формальдегид.

ФИГ. 1В иллюстрирует РНК, кодирующую указанные белки и содержащую аденозин, 50% гуанозина, 50% 7-дезазагуанозина, 50% уридина, 50% 5-метилуридина и 5-метилцитидин, разделенные в денатурирующем агарозном геле, содержащем формальдегид.

ФИГ. 2 иллюстрирует первичные неонатальные фибробласты человека, репрограммированные в ходе пяти трансфекций с помощью РНК, кодирующей белки репрограммирования. Клетки фиксировали и окрашивали для выявления белка Oct4. Ядра клеток докрашивали с помощью красителя Hoechst 33342.

ФИГ. 3А иллюстрирует первичные фибробласты взрослого человека.

ФИГ. 3В иллюстрирует первичные фибробласты взрослого человека, показанные на ФИГ. 3А, репрограммированные в ходе семи трансфекций с помощью РНК, кодирующей белки репрограммирования. Стрелки указывают колонии репрограммированных клеток.

ФИГ. 3С иллюстрирует большую колонию репрограммированных первичных фибробластов взрослого человека.

ФИГ. 4А иллюстрирует локализацию пары TALEN, нацеленную на ген CCR5 человека. Одинарные линии указывают на сайты связывания TALEN. Двойные линии указывают на расположении мутации Δ32.

ФИГ. 4В иллюстрирует синтетическую РНК, кодирующую пару TALEN на ФИГ. 4А, разделенную в денатурирующем агарозном геле, содержащем формальдегид.

ФИГ. 4С иллюстрирует результаты анализа SURVEYOR, определившего функциональность РНК по ФИГ. 4В на фибробластах кожи человека (GM00609). Вид полос фрагментов размером 760 п. н. и 200 п. н. для образца, полученного из клеток, трансфецированных РНК, указывает на успешное прохождение редактирования генов. Процентное значение под каждой дорожкой указывает на эффективность редактирования генов (процентное значение редактированных аллелей).

ФИГ. 4D иллюстрирует график в виде линейного профиля дорожек «Нег» и «TALENs» на ФИГ. 4С. Цифры указывают интегрированную интенсивность трех полос по сравнению собщей интегрированной интенсивностью.

ФИГ. 4Е иллюстрирует результаты анализа SURVEYOR, выполненного как показано на ФИГ. 4С, что также включает данные для образца, полученного из клеток, которых трансфецировали РНК дважды (дорожка, обозначенная «2х»).

ФИГ. 4F иллюстрирует одновременное редактирование генов и репрограммирование первичных клеток человека (GM00609) с помощью синтетической РНК. На изображениях показаны репрезентативные колонии репрограммированных клеток.

ФИГ. 4G иллюстрирует результаты прямого секвенирования гена CCR5 из репрограммированных клеток с редактированными генами, полученными как показано на ФИГ. 4F. Четыре из девяти проанализированных полос содержали делецию между сайтами связывания TALEN, указывающую на эффективное прохождение редактирования генов.

ФИГ. 5 иллюстрирует результаты анализа SURVEYOR, выполненного как показано на ФИГ. 4С, за исключением использования РНК, нацеленной на ген MYC человека и содержащей канонические нуклеотиды («A, G, U, C») или неканонические нуклеотиды («A, 7dG, 5mU, 5mC»). Темные полосы размером 470 п. н. и 500 п. н. указывают на прохождение высокоэффективного редактирования генов.

ФИГ. 6 иллюстрирует результаты анализа SURVEYOR, выполненного, как показано на ФИГ. 4С, за исключением использования РНК, нацеленной на ген BIRC5 человека и содержащей канонические нуклеотиды («A, G, U, C») или неканонические нуклеотиды («A, 7dG, 5mU, 5mC»). Темная полоса размером 710 п. н. указывает на прохождение высокоэффективного редактирования генов.

ФИГ. 7А иллюстрирует клетки HeLa (карцинома шейки матки), трансфецированные с помощью РНК, нацеленной на ген BIRC5 (молекулы RiboSlice). Клетки трансфецировали с помощью одной РНК («2х Survivin L») или равных количеств каждого представителя пары РНК («Survivin L+R») с одинаковым общим количеством РНК, доставленным в каждом случае. Как показано на правом изображении, клетки, трансфецированные парой РНК увеличились, выявили фрагментированные ядра и значительно уменьшили пролиферацию, продемострировав сильную противораковую активность молекул RiboSlice.

ФИГ. 7В иллюстрирует клетки HeLa, трансфецированные РНК, нацеленной на ген BIRC5, как показано на ФИГ. 7А. Впоследствии клетки фиксировали и окрашивали для выявления белка сурвивина. Ядра клеток докрашивали с помощью красителя Hoechst 33342. Большие фрагментированные ядра клеток, трансфецированных молекулами RiboSlice, показаны стрелками.

ФИГ. 8 иллюстрирует первичные фибробласты взрослого человека, репрограмированные с использованием синтетической РНК. Стрелками указаны компактные колонии клеток, которые проявляют морфологические признаки, свойственные прохождению репрограммирования.

ФИГ. 9 иллюстрирует синтетическую РНК, кодирующую указанные ген-редактирующие белки, разделенные в денатурирующем агарозном геле, содержащем формальдегид.

ФИГ. 10А иллюстрирует результаты анализа SURVEYOR, определившего эффективность РНК из ФИГ. 9 на дермальных фибробластах человека. Клетки подвергли лизису приблизительно через 48 ч после трансфекции. Полосы, соответствующие продуктам расщепления, полученные в результате успешного редактирования генов, показаны звездочками. Обозначения дорожек показаны в форме «X.Y», где X относится к экзону, из которого амплифицировалась ДНК, а Y относится к паре ген-редактирующих белков. К примеру, обозначение «1.1» относится к паре ген-редактирующих белков, нацеленных на участок экзона 1, ближайшего к инициирующему кодону. Обозначение «X.N» относится к нетрансфецированным клеткам.

ФИГ. 10В иллюстрирует результаты анализа SURVEYOR, определившего токсичность РНК из ФИГ. 9 на дермальных фибробластах человека. Клетки подвергли лизису приблизительно через 11 дней после трансфекции. Дорожки и полосы обозначены, как указано на ФИГ. 10А. Вид полос, обозначенных звездочками, демонстрирует, что трансфецированные клетки сохраняют высокую степень жизнеспособности.

ФИГ. 11 иллюстрирует результаты исследования in vivo, разработанного для испытания безопасности РНК, кодирующей ген-редактирующие белки. График показывает среднюю массу тела четырех групп мышей (по 10 животных в каждой группе), включая одну необработанную группу, одну группу, получившую только один носитель, одну группу, обработанную молекулами RiboSlice путем проведения внутриопухолевой инъекции, и одну группу, обработанную молекулами RiboSlice путем внутривенной инъекции. Во всех обработанных группах животным ввели 5 доз через день с 1 по 9 день. За животными наблюдали до 17 дня. Отсутствие статистически значимой разницы между средними массами тела этих четырех групп продемонстрировали безопасность молекул RiboSlice in vivo.

ФИГ. 12А иллюстрирует результаты анализа SURVEYOR, определившего эффективность ген-редактирующих белков, содержащих различные последовательности повторов длиной 36 аминокислот. Дермальные фибробласты человека подвергли лизису приблизительно через 48 ч после трансфекции с помощью РНК, кодирующей ген-редактирующие белки, содержащие указанные последовательности повторов. Полоса, соответствующая продукту расщепления, полученному в результате успешного редактирования генов, показана звездочкой. Обозначения дорожек относятся к аминокислотам на С-конце последовательности повтора. Обозначение «Нег.» относится к нетрансфецированным клеткам.

ФИГ. 12В иллюстрирует результаты анализа SURVEYOR, определившего эффективность ген-редактирующих белков, в которых каждая вторая последовательность повтора имеет длину 36 аминокислот. Дермальные фибробласты человека подвергли лизису приблизительно через 48 ч после трансфекции с помощью РНК, кодирующей ген-редактирующие белки, содержащие указанные последовательности повторов. Полоса, соответствующая продукту расщепления, полученному в результате успешного редактирования генов, показана звездочкой. Обозначения дорожек относятся к аминокислотам на С-конце последовательностей повторов. Обозначение «Нег.» относится к нетрансфецированным клеткам.

ФИГ. 13А иллюстрирует результаты исследования, разработанного для испытания in vivo безопасности и эффективности молекул RiboSlice AAV репликационно-некомпетентного вируса, несущего нуклеиновые кислоты, кодирующие ген-редактирующие белки. Данный график показывает среднюю массу тела трех групп мышей, имеющих подкожные опухоли, содержащие клетки глиомы человека, включая одну необработанную группу, (контроль без обработки, «NTC», n=6), одну группу, обработанную AAV, кодирующим зеленый флуоресцентный белок (GFP) («GFP», n=2) путем внутриопухолевой инъекции и одну группу, обработанную молекулами RiboSlice AAV, кодирующими ген-редактирующие белки, нацеленные на ген BIRC5 («RiboSlice», n=2) путем проведения внутриопухолевой инъекции. Животным из группы, получавшей GFP, вводили дозы на 1 день, а для группы, получавшей RiboSlice - на 1 и 15 дни. За животными наблюдали до 25 дня. Отсутствие статистически значимой разницы между средними массами тела этих трех групп продемонстрировали безопасность молекул RiboSlice AAV in vivo.

ФИГ. 13В иллюстрирует нормализованные объемы опухолей животных данного исследования, показанного на ФИГ. 13А. Замедленное увеличение нормализованного объема опухоли в группе, обработанной молекулами RiboSlice AAV, по сравнению как с группой NTC, так и с группой GFP, демонстрирует эффективность молекул RiboSlice AAV in vivo.

ФИГ. 14 иллюстрирует результаты анализа SURVEYOR, определившего эффективность ген-редактирующих белков, как показано на ФИГ. 12В. Обозначение «RiboSlice» относится к ген-редактирующим белкам, в которых каждая вторая последовательность повтора имеет длину 36 аминокислот. Обозначение «д.т.» относится к нетрансфецированным клеткам.

ФИГ. 15 иллюстрирует РНК, кодирующую указанные белки и содержащую аденозин, 50% гуанозина, 50% 7-дезазагуанозина, 60% уридина, 40% 5-метилуридина и 5-метилцитидин, разделенные в денатурирующем агарозном геле, содержащем формальдегид.

ФИГ. 16 иллюстрирует результаты анализа, определившего интеграцию репарационной матрицы в ген АРР. Вид полос размером 562 п. н. и 385 п. н. для образца, полученного из клеток, трансфецированных РНК и репарационной матрицей, указывает на успешную интеграцию рестрикционного сайта PstI. Обозначение «-» относится к нерасщепленному образцу, «+» относится к образцу, обработанному рестрикционной нуклеазой PstI.

Определения

Термином «молекула» обозначают молекулярный объект (молекулу, ион, комплекс и т.п.).

Термином «молекула РНК» обозначают молекулу, которая содержит РНК.

Термином «синтетическая молекула РНК» обозначают молекулу РНК, которая образуется вне клетки или которая образуется внутри клетки с использованием методов биоинженерии, неограничивающими примерами которой являются молекула РНК, которая образуется в процессе реакции транскрипции in vitro, молекула РНК, которая образуется с помощью прямого химического синтеза или молекула РНК, которая образуется в клетке E. coli, сконструированной методами генной инженерии.

Термином «трансфекция» обозначают процесс приведения клетки в контакт с молекулой, при котором данная молекула интернализуется клеткой.

Термином «при трансфекций» обозначают процесс во время или после трансфекций.

Термином «реагент для трансфекций» обозначают вещество или смесь веществ, которые ассоциируют с молекулой и облегчают доставку молекулы и/или интернализацию данной молекулы клеткой, неограничивающим примером которой является катионный липид, заряженный полимер или проникающий в клетку пептид.

Термином «трансфекция на основе реагента» обозначают трансфекцию с использованием реагента для трансфекций.

Термином «среда для культивирования клеток» обозначают среду, которая может использоваться для культивирования клеток, неограничивающим примером которой является среда Игла в модификации Дульбекко (DMEM) или DMEM + 10% эмбриональной бычьей сыворотки (FBS).

Термином «среда для комплексообразования» обозначают среду, к которой добавлены реагент для трансфекций и молекула, которая должна быть трансфецирована, и в которой реагент для трансфекций ассоциирован с молекулой, которая должна быть трансфецирована.

Термином «среда для трансфекций» обозначают среду, которая может использоваться для трансфекций, неограничивающими примерами которой являются среда Игла в модификации Дульбекко (DMEM) или DMEM/F12.

Термином «рекомбинантный белок» обозначают белок или пептид, который не образуется в организме животных или людей. Неограничивающие примеры включают трансферрин человека, который образуется в бактериях, фибронектин человека, который образуется в культуре клеток мыши in vitro, и сывороточный альбумин человека, который образуется в рисе.

Термином «липидный носитель» обозначают вещество, которое может повысить растворимость в водном растворе липида или липидорастворимой молекулы, неограничивающими примерами которого являются сывороточный альбумин человека или метил-бета-циклодекстрин.

Термином «белок Oct4» обозначают белок, кодируемый геном POU5F1, или его природный или сконструированный вариант, представителя семейства белков, ортолог, фрагмент или гибридную конструкцию, неограничивающими примерами которого являются белок Oct4 человека (SEQ ID NO: 8), белок Oct4 мыши, белок Oct1, белок, кодируемый псевдогеном 2 POU5F1, ДНК-связывающий домен белка Oct4 или гибридный белок Oct4-GFP. В некоторых вариантах реализации изобретения белок Oct4 содержит аминокислотную последовательность, которая обладает по меньшей мере 70% идентичности с последовательностью SEQ ID NO: 8 или, в других вариантах реализации изобретения, по меньшей мере 75%, 80%, 85%, 90% или 95% идентичности с SEQ ID NO: 8. В некоторых вариантах реализации изобретения белок Oct4 содержит аминокислотную последовательность, имеющую от 1 до 20 аминокислотных инсерций, делеций или замен (в совокупности) по сравнению с последовательностью SEQ ID NO: 8. Или в других вариантах реализации изобретения белок Oct4 содержит аминокислотную последовательность, имеющую от 1 до 15 или от 1 до 10 аминокислотных инсерций, делеций или замен (в совокупности) по сравнению с последовательностью SEQ ID NO: 8.

Термином «белок Sox2» обозначают белок, кодируемый геном SOX2, или его природный или сконструированный вариант, представитель семейства, ортолог, фрагмент или гибридную конструкцию, неограничивающими примерами которого являются белок Sox2 человека (SEQ ID NO: 9), белок Sox2 мыши, ДНК-связывающий домен белка Sox2 или гибридный белок Sox2-GFP. В некоторых вариантах реализации изобретения белок Sox2 содержит аминокислотную последовательность, которая обладает по меньшей мере 70% идентичности с последовательностью SEQ ID NO: 9 или, в других вариантах реализации изобретения, по меньшей мере 75%, 80%, 85%, 90% или 95% идентичности с SEQ ID NO: 9. В некоторых вариантах реализации изобретения белок Sox2 содержит аминокислотную последовательность, имеющую от 1 до 20 аминокислотных инсерций, делеций или замен (в совокупности) по сравнению с последовательностью SEQ ID NO: 9. Или в других вариантах реализации изобретения белок Sox2 содержит аминокислотную последовательность, имеющую от 1 до 15 или от 1 до 10 аминокислотных инсерций, делеций или замен (в совокупности) по сравнению с последовательностью SEQ ID NO: 9.

Термином «белок Klf4» обозначают белок, кодируемый геном KLF4, или его природный или сконструированный вариант, представитель семейства, ортолог, фрагмент или гибридную конструкцию, неограничивающими примерами которого являются белок Klf4 человека (SEQ ID NO: 10), белок Klf4 мыши, ДНК-связывающий домен белка Klf4 или гибридный белок Klf4-GFP. В некоторых вариантах реализации изобретения белок Klf4 содержит аминокислотную последовательность, которая обладает по меньшей мере 70% идентичности с последовательностью SEQ ID NO: 10 или, в других вариантах реализации изобретения по меньшей мере 75%, 80%, 85%, 90% или 95% идентичности с SEQ ID NO: 10. В некоторых вариантах реализации изобретения белок Klf4 содержит аминокислотную последовательность, имеющую от 1 до 20 аминокислотных инсерций, делеций или замен (в совокупности) по сравнению с последовательностью SEQ ID NO: 10. Или в других вариантах реализации изобретения белок Klf4 содержит аминокислотную последовательность, имеющую от 1 до 15 или от 1 до 10 аминокислотных инсерций, делеций или замен (в совокупности) по сравнению с последовательностью SEQ ID NO: 10.

Термином «белок с-Мус» обозначают белок, кодируемый геном MYC, или его природный или сконструированный вариант, представитель семейства, ортолог, фрагмент или гибридную конструкцию, неограничивающими примерами которого являются белок с-Мус человека (SEQ ID NO: 11), белок с-Мус мыши, белок 1-Мус, белок с-Мус (Т58А), ДНК-связывающий домен белка с-Мус или гибридный белок с-Myc-GFP. В некоторых вариантах реализации изобретения белок с-Мус содержит аминокислотную последовательность, которая обладает по меньшей мере 70% идентичности с последовательностью SEQ ID NO: 11 или, в других вариантах реализации изобретения, по меньшей мере 75%, 80%, 85%, 90% или 95% идентичности с SEQ ID NO: 11. В некоторых вариантах реализации изобретения белок с-Мус содержит аминокислотную последовательность, имеющую от 1 до 20 аминокислотных инсерций, делеций или замен (в совокупности) по сравнению с последовательностью SEQ ID NO: 11. Или в других вариантах реализации изобретения белок с-Мус содержит аминокислотную последовательность, имеющую от 1 до 15 или от 1 до 10 аминокислотных инсерций, делеций или замен (в совокупности) по сравнению с последовательностью SEQ ID NO: 11.

Термином «репрограммирование» обозначают процесс, вызывающий изменение фенотипа клетки, неограничивающими примерами которого являются процесс, вызывающий дифференциацию предшественника β-клеток в зрелую β-клетку, процесс, вызывающий дедифференциацию фибробласта в плюрипотентную стволовую клетку, процесс, вызывающий трансдифференциацию кератиноцита в стволовую клетку сердечной мышцы или процесс, вызывающий рост аксона нейрона.

Термином «фактор репрограммирования» обозначают молекулу, которая, в случае контакта клетки с молекулой и/или экспрессии этой молекулы клеткой, может сама по себе или в комбинации с другими молекулами приводить к репрограммированию, неограничивающим примером которой является белок Oct4.

Термином «фидер» обозначают клетку, которая может использоваться для кондиционирования среды или, в иных случаях, для поддержки роста других клеток в культуре.

Термином «кондиционирование» обозначают обеспечение контакта одного или более фидеров со средой.

Термином «жирная кислота» обозначают молекулу, которая содержит алифатическую цепь из по меньшей мере двух атомов углерода, неограничивающими примерами которой являются линолевая кислота, α-линоленовая кислота, каприловая кислота, лейкотриен, простагландин, холестерин, глюкокотикоид, резолвин, протектин, тромбоксан, липоксин, марезин, сфинголипид, триптофан, N-ацетилтриптофан или их соль, метиловый эфир или производное.

Термином «короткоцепочечная жирная кислота» обозначают жирную кислоту, которая содержит алифатическую цепь размером от двух до 30 атомов углерода.

Термином «альбумин» обозначают белок, легкорастворимый в воде, неограничивающим примером которого является сывороточный альбумин человека.

Термином «ассоциированная молекула» обозначают молекулу, которая нековалентно связана с другой молекулой.

Термином «ассоциированный молекулярный компонент альбумина» обозначают одну или более молекул, которые связаны с полипептидом альбумина, неограничивающими примерами которого являются липиды, гормоны, холестерин, ионы кальция и т.п., которые связываются с полипептидом альбумина.

Термином «обработанный альбумин» обозначают альбумин, который обработан, чтобы редуцировать, удалить, заместить или иным образом инактивировать ассоциированный молекулярный компонент альбумина, неограничивающими примерами которого являются сывороточный альбумин человека, который инкубируют при повышенной температуре, сывороточный альбумин человека, который приводят в контакт с каприлатом натрия, или сывороточный альбумин человека, который приводят в контакт с пористым материалом.

Термином «ионообменная смола» обозначают материал, который при контакте с содержащим ионы раствором может замещать один или более ионов одним или более ионами, неограничивающим примером которого является материал, который может замещать один или более ионов кальция одним или более ионами натрия.

Термином «половая клетка» обозначают сперматозоид или яйцеклетку.

Термином «плюрипотентная стволовая клетка» обозначают клетку, которая может дифференцироваться в клетки всех трех зародышевых слоев (эндодерму, мезодерму и эктодерму) in vivo.

Термином «соматическая клетка» обозначают клетку, которая не является плюрипотентной стволовой клеткой или половой клеткой, неограничивающим примером которой является клетка кожи.

Термином «глюкозочувствительная инсулин-продуцирующая клетка» обозначают клетку, которая при воздействии на нее определенной концентрации глюкозы может продуцировать и/или секретировать некоторое количество инсулина, которое отличается (в меньшую или большую сторону) от количества инсулина, которое данная клетка продуцирует и/или секретирует при воздействии на нее различных концентраций глюкозы, неограничивающим примером которой является β-клетка.

Термином «гемопоэтическая клетка» обозначают клетку крови или клетку, которая может дифференцироваться в клетку крови, неограничивающим примером которой является гемопоэтическая стволовая клетка или лейкоцит.

Термином «клетка сердечной мышцы» обозначают клетку миокарда или клетку, которая может дифференцироваться в клетку миокарда, неограничивающими примерами которой являются стволовая клетка сердечной мышцы или кардиомиоцит.

Термином «клетка сетчатки» обозначают клетку сетчатки или клетку, которая может дифференцироваться в клетку сетчатки, неограничивающим примером которой является пигментированная эпителиальная клетка сетчатки.

Термином «клетка кожи» обозначают клетку, которая обычно находится в коже, неограничивающими примерами которой являются фибробласт, кератиноцит, меланоцит, адипоцит, мезенхимальная стволовая клетка, адипозная стволовая клетка или клетка крови.

Термином «агонист сигнального пути Wnt» обозначают молекулу, которая может выполнять одну или более биологических функций одного или более представителей семейства белков Wnt, неограничивающими примерами которой являются белки Wnt1, Wnt2, Wnt3, Wnt3a или 2-амино-4-[3,4-(метилендиокси)бензиламино]-6-(3-метоксифенил)пиримидин.

Термином «агонист сигнального пути IL-6» обозначают молекулу, которая может выполнять одну или более биологических функций белка IL-6, неограничивающими примерами которой являются белок IL-6 или рецептор IL-6 (также известные как растворимый рецептор IL-6, IL-6R, IL-6R альфа и т.д.).

Термином «агонист сигнального пути TGF-β» обозначают молекулу, которая может выполнять одну или более биологических функций одного или более представителей суперсемейства белков TGF-β, неограничивающими примерами которой являются белки TGF-β1, TGF-β3, Активин А, ВМР-4 или Нодал.

Термином «иммуносупрессант» обозначают вещество, которое может подавлять одно или более проявлений иммунной системы и которое обычно отсутствует в организме млекопитающего, неограничивающими примерами которого являются B18R или дексаметазон.

Термином «одноцепочечный разрыв» обозначают участок одноцепочечной или двухцепочечной ДНК, в котором одна или более ковалентных связей, соединяющих нуклеотиды, были разрушены в одной из одной или двух цепей.

Термином «двухцепочечный разрыв» обозначают участок двухцепочечной ДНК, в котором одна или более ковалентных связей, соединяющих нуклеотиды, были разрушены в каждой из двух цепей.

Термином «нуклеотид» обозначают нуклеотид или его фрагмент или производное, неограничивающими примерами которого являются нуклеотидное основание, нуклеозид, нуклеотидтрифосфат и т.п.

Термином «нуклеозид» обозначают нуклеотид или его фрагмент или производное, неограничивающими примерами которого являются нуклеотидное основание, нуклеозид, нуклеотидтрифосфат и т.п.

Термином «редактирование генов» обозначают процесс изменения последовательности ДНК клетки, неограничивающим примером которого является процесс трансфекции клетки белком, который вызывает мутацию в ДНК клетки.

Термином «ген-редактирующий белок» обозначают белок, который может сам по себе или в комбинации с одной или более других молекул изменять последовательность ДНК клетки, неограничивающими примерами которого являются эффекторная нуклеаза, подобная активатору транскрипции (TALEN), нуклеаза цинкового пальца, мегануклеаза, никаза, белок, ассоциированный с регулярно расположенными группамис короткими палиндромными повторами, регулярно расположенными группами (CRISPR), или их природный или сконструированный вариант, представитель семейства, ортолог, фрагмент или гибридная конструкция.

Термином «репарационная матрица» обозначают нуклеиновую кислоту, содержащую участок с по меньшей мере приблизительно 70% гомологии с последовательностью, которая находится в пределах 10 т.п.н. от сайта-мишени ген-редактирующего белка.

Термином «последовательность повтора» обозначают аминокислотную последовательность, которая присутствует в белке более чем в одной копии, в пределах по меньшей мере приблизительно 10% гомологии, неограничивающим примером которой является мономерный повтор эффектора, подобного активатору транскрипции.

Термином «ДНК-связывающий домен» обозначают участок молекулы, который способен связываться с молекулой ДНК, неограничивающими примерами которого являются белковый домен, содержащий один или более цинковых пальцев, белковый домен, содержащий одну или более последовательностей повтора эффектора, подобного активатору транскрипции (TAL) или связывающий карман малой молекулы, которая способна связываться с молекулой ДНК.

Термином «сайт связывания» обозначают последовательность нуклеиновой кислоты, которая может быть распознана ген-редактирующим белком, ДНК-связывающим белком, ДНК-связывающим доменом или их биологически активным фрагментом или вариантом, или последовательность нуклеиновой кислоты, к которой ген-редактирующий белок, ДНК-связывающий белок, ДНК-связывающий домен или их биологически активный фрагмент или вариант имеет высокую аффинность, неограничивающим примером которой является последовательность ДНК размером около 20 пар оснований в экзоне 1 гена BIRC5 человека.

Термином «мишень» обозначают нуклеиновую кислоту, которая содержит сайт связывания.

Другие определения изложены в заявке США №13/465490, предварительной заявке США №61/664494, предварительной заявке США №61/721302, международной заявке №PCT/US12/67966, предварительной заявке США №61/785404 и предварительной заявке США №61/842874, содержание которых включено в данный документ в полном объеме посредством ссылок.

В настоящее время известно, что неканонические нуклеотиды, участвующие в механизме деметилирования 5-метилцитидина, при включении в синтетическую РНК могут увеличивать эффективность трансляции белка с этой синтетической РНК, и могут снижать токсичность этой синтетической РНК. Такие неканонические нуклеотиды включают, к примеру: 5-метилцитидин, 5-гидроксиметилцитидин, 5-формилцитидин и 5-карбоксицитидин (называемый также «цитидин-5-карбоновой кислотой»). Следовательно, некоторые варианты реализации изобретения относятся к нуклеиновым кислотам. В одном варианте реализации изобретения нуклеиновая кислота является синтетической молекулой РНК. В другом варианте реализации изобретения нуклеиновая кислота содержит один или более неканонических нуклеотидов. В одном варианте реализации изобретения нуклеиновая кислота содержит один или более неканонических нуклеотидов, участвующих в механизме деметилирования 5-метилцитидина. В другом варианте реализации изобретения нуклеиновая кислота содержит по меньшей мере один из нуклеотидов: 5-метилцитидин, 5-гидроксиметилцитидин, 5-формилцитидин и 5-карбоксицитидин или их производные. В дополнительных вариантах реализации изобретения нуклеиновая кислота содержит по меньшей мере один из нуклеотидов: псевдоуридин, 5-метилпсевдоуридин, 5-метилуридин, 5-метилцитидин, 5-гидроксиметилцитидин, N4-метилцитидин, N4-ацетилцитидин и 7-дезазагуанозин или их производные.

Механизм деметилирования 5-метилцитидина

Некоторые варианты реализации изобретения относятся к белку. Другие варианты реализации изобретения относятся к нуклеиновой кислоте, кодирующий белок. В одном варианте реализации изобретения белок представляет собой целевой белок. В другом варианте реализации изобретения белок выбирается из: белка репрограммирования и белка, ген-редактирующего. В одном варианте реализации изобретения нуклеиновая кислота является плазмидой. В другом варианте реализации изобретения нуклеиновая кислота представлена в виде вируса или вирусного вектора. В дополнительном варианте реализации изобретения вирус или вирусный вектор является репликационно-некомпетентным. В еще одном дополнительном варианте реализации изобретения вирус или вирусный вектор является репликационно-компетентным. В одном варианте реализации изобретения вирус или вирусный вектор включает по меньшей мере один из вирусов: аденовирус, ретровирус, лентивирус, вирус герпеса, адено-ассоциированный вирус или их природный или сконструированный вариант, а также сконструированный вирус.

Было также обнаружено, что определенные комбинации неканонических нуклеотидов могут быть особенно эффективными для увеличения эффективноститрансляции белка с синтетической РНК и снижения токсичности синтетической РНК, к примеру, в комбинациях: 5-метилуридин и 5-метилцитидин, 5-метилуридин и 7-дезазагуанозин, 5-метилцитидин и 7-дезазагуанозин, 5-метилуридин, 5-метилцитидин и 7-дезазагуанозин, и 5-метилуридин, 5-гидроксиметилцитидин и 7-дезазагуанозин. Следовательно, некоторые варианты реализации изобретения относятся к нуклеиновой кислоте, содержащей по меньшей мере два нуклеотида из: 5-метилуридина, 5-метилцитидина, 5-гидроксиметилцитидина и 7-дезазагуанозина или их одно или более производных. Другие варианты реализации изобретения относятся к нуклеиновой кислоте, содержащей по меньшей мере три нуклеотида из: 5-метилуридина, 5-метилцитидина, 5-гидроксиметилцитидина и 7-дезазагуанозина или их одно или более производных. Другие варианты реализации изобретения относятся к нуклеиновой кислоте, содержащей все нуклеотиды: 5-метилуридин, 5-метилцитидин, 5-гидроксиметилцитидин и 7-дезазагуанозин или их одно или более производных. В одном варианте реализации изобретения нуклеиновая кислота содержит один или более остатков 5-метилуридина, один или более остатков 5-метилцитидина и один или более остатков 7-дезазагуанозина или один или более остатков 5-метилуридина, один или более остатков 5-гидроксиметилцитидина и один или более остатков 7-дезазагуанозина.

Дополнительно было обнаружено, что молекулы синтетических РНК, содержащие определенные доли некоторых неканонических нуклеотидов и их комбинаций, могут проявлять особенно высокую трансляционную эффективность и низкую токсичность. Следовательно, некоторые варианты реализации изобретения относятся к нуклеиновой кислоте, содержащей по меньшей мере один нуклеотид из: одного или более остатков уридина, одного или более остатков цитидина и одного или более остатков гуанозина, и содержащей один или более неканонических нуклеотидов. В одном варианте реализации изобретения в пределах между около 20% и около 80% остатков уридина являются остатками 5-метилуридина. В другом варианте реализации изобретения в пределах между около 30% и около 50% остатков уридина являются остатками 5-метилуридина. В дополнительном варианте реализации изобретения около 40% остатков уридина являются остатками 5-метилуридина. В одном варианте реализации изобретения в пределах между около 60% и около 80% остатков цитидина являются остатками 5-метилцитидина. В другом варианте реализации изобретения в пределах между около 80% и около 100% остатков цитидина являются остатками 5-метилцитидина. В дополнительном варианте реализации изобретения около 100% остатков цитидина являются остатками 5-метилцитидина. В еще одном дополнительном варианте реализации изобретения в пределах между около 20% и около 100% остатков цитидина являются остатками 5-гидроксиметилцитидина. В одном варианте реализации изобретения в пределах между около 20% и около 80% остатков гуанозина являются остатками 7-дезазагуанозина. В другом варианте реализации изобретения в пределах между около 40% и около 60% остатков гуанозина являются остатками 7-дезазагуанозина. В дополнительном варианте реализации изобретения около 50% остатков гуанозина являются остатками 7-дезазагуанозина. В одном варианте реализации изобретения в пределах между около 20% и около 80% или между около 30% и около 60%, или около 40% остатков цитидина являются остатками N4-метилцитидина и/или N4-ацетилцитидина. В другом варианте реализации изобретения каждый остаток цитидина является остатком 5-метилцитидина. В дополнительном варианте реализации изобретения около 100% остатков цитидина являются остатками 5-метилцитидина и/или остатками 5-гидроксиметилцитидина, и/или остатками N4-метилцитидина и/или остатками N4-ацетилцитидина, и/или одним или более их производных. В еще одном дополнительном варианте реализации изобретения около 40% остатков уридина являются остатками 5-метилцитидина, в пределах между около 20% и около 100% остатков цитидина являются остатками N4-метилцитидина и/или N4-ацетилцитидина и около 50% остатков гуанозина являются остатками 7-дезазагуанозина. В одном варианте реализации изобретения около 40% остатков уридина являются остатками 5-метилуридина и около 100% остатков цитидина являются остатками 5-метилцитидина. В другом варианте реализации изобретения около 40% остатков уридина являются остатками 5-метилуридина и около 50% остатков гуанозина являются остатками 7-дезазагуанозина. В дополнительном варианте реализации изобретения около 100% остатков цитидина являются остатками 5-метицитидина и около 50% остатков гуанозина являются остатками 7-дезазагуанозина. В одном варианте реализации изобретения около 40% остатков уридина являются остатками 5-метилуридина и около 100% остатков цитидина являются остатками 5-метилцитидина и около 50% остатков гуанозина являются остатками 7-дезазагуанозина. В другом варианте реализации изобретения около 40% остатков уридина являются остатками 5-метилуридина и в пределах между около 20% и 100% остатков цитидина являются остатками 5-метилгидроксицитидина и около 50% остатков гуанозина являются остатками 7-дезазагуанозина. В некоторых вариантах реализации изобретения менее чем 100% остатков цитидина являются остатками 5-метилцитидина. В других вариантах реализации изобретения менее чем 100% остатков цитидина являются остатками 5-гидроксиметилцитидина. В одном варианте реализации изобретения каждый остаток уридина в синтетической молекуле РНК являются остатком псевдоуридина или остатком 5-метилпсевдоуридина. В другом варианте реализации изобретения около 100% остатков уридина являются остатками псевдоуридина и/или остатками 5-метилпсевдоуридина. В дополнительном варианте реализации изобретения около 100% остатков уридина являются остатками псевдоуридина и/или остатками 5-метилпсевдоуридина, около 100% остатков цитидина являются остатками 5-метицитидина и около 50% остатков гуанозина являются остатками 7-дезазагуанозина.

Другие неканонические нуклеотиды, которые могут использоваться вместо или в комбинации с 5-метилуридином включают без ограничения: псевдоуридин и 5-метилпсевдоуридин (называемый также «1-метилпсевдоуридин», называемый также «N1-метилпсевдоуридин») или их одно или более производных. Другие неканонические нуклеотиды, которые могут использоваться вместо или в комбинации с 5-метилцитидином и/или 5-гидроксиметилцитидином включают без ограничения: псевдоцитидин, 5-метилпсевдоизоцитидин, 5-гидроксиметилцитидин, 5-формилцитидин, 5-карбоксицитидин, N4-метилцитидин, N4-ацетилцитидин или их одно или более производных. В некоторых вариантах реализации изобретения, к примеру, когда выполняется только одна трансфекция или когда клетки, которых трансфецируют, не очень чувствительны к ассоциированной с трансфекцией токсичностью или передаче сигнала естественного иммунитета, данные доли неканонических нуклеотидов могут быть снижены. Уменьшение доли содержания неканонических нуклеотидов может быть целесообразным, в частности, благодаря тому, что снижение доли неканонических нуклеотидов может уменьшить стоимость данной нуклеиновой кислоты. В некоторых ситуациях, например, когда требуется минимальная иммуногенность целевой нуклеиновой кислоты, доли неканонических нуклеотидов могут быть увеличены.

В процессе реакции транскрипции in vitro при наличии как канонических, так и неканонических нуклеотидов ферменты, такие как РНК-полимераза Т7, могут включать преимущественно канонические нуклеотиды. В результате на выходе реакции транскрипции in vitro в условиях содержания определенной доли неканонического нуклеотида может образовываться РНК, содержащая разную, часто более низкую долю неканонического нуклеотида, чем доля неканонического нуклеотида, который присутствует в реакционной смеси. Вследствие этого в некоторых вариантах реализации изобретения упоминание доли включения нуклеотидов (например, «50% 5-метилуридина») может касаться как нуклеиновых кислот, содержащих указанную долю нуклеотида, так и нуклеиновых кислот, синтезированных в реакционной смеси, содержащей указанную долю нуклеотида (или производного нуклеотида, например, нуклеотидтрифосфата), даже если на выходе такой реакции может синтезироваться нуклеиновая кислота, содержащая разные доли нуклеотида, чем доля, в которой данный неканонический нуклеотид присутствовал в реакционной смеси. В дополнение к этому разные нуклеотидные последовательности могут кодировать один и тот же белок при использовании альтернативных кодонов. Вследствие этого, в некоторых вариантах реализации изобретения упоминания доли включения нуклеотидов могут касаться как нуклеиновых кислот, содержащих указанную долю нуклеотида, так и нуклеиновых кислот, кодирующих один и тот же белок, в виде отличающихся нуклеиновых кислот, причем отличающаяся нуклеиновая кислота содержит указанную долю данного нуклеотида.

Последовательность ДНК клетки может быть изменена путем приведения клетки в контакт с ген-редактирующим белком или путем индукции экспрессии клеткой ген-редактирующего белка. Однако, ранее описанные ген-редактирующие белки обладают такими недостатками, как низкая эффективность связывания и избыточная нецелевая активность, которая может вызывать нежелательные мутации в ДНК клетки, что серьезно ограничивает их использование в терапевтических целях, при которых появление нежелательных мутаций в клетках пациента может привести к развитию рака. В настоящее время известно, что ген-редактирующие белки, которые содержат домен расщепления эндонуклеазы StsI (SEQ ID NO: 1) могут проявлять значительно более низкую нецелевую активность, чем ранее описанные ген-редактирующие белки, при этом обеспечивая высокий уровень целевой активности. Для других новых сконструированных белков также было обнаружено, что они могут проявлять высокую целевую активность, низкую нецелевую активность, обладать малым размером, растворимостью и другими требуемыми свойствами, если они используются в виде домена нуклеазы ген-редактирующего белка: StsI-HA (SEQ ID NO: 2), StsI-HA2 (SEQ ID NO: 3), StsI-UHA (SEQ ID NO: 4), StsI-UHA2 (SEQ ID NO: 5), StsI-HF (SEQ ID NO: 6) и StsI-UHF (SEQ ID NO: 7). Белки StsI-HA, StsI-HA2 (с высокой активностью), StsI-UHA и StsI-UHA2 (с очень высокой активностью) могут проявлять более высокую целевую активность по сравнению как с диким типом StsI, так и с диким типом FokI, в частности, из-за наличия специфических аминокислотных замен в пределах N-концевого участка в положениях 34 и 61, тогда как белки StsI-HF (с высокой точностью действия) и StsI-UHF (с очень высокой точностью действия) могут проявлять более низкую нецелевую активность по сравнению как с диким типом StsI, так и с диким типом FokI, в частности, из-за наличия специфических аминокислотных замен в пределах C-концевого участка в положениях 141 и 152. Следовательно, некоторые варианты реализации изобретения относятся к белку, который содержит домен нуклеазы. В одном варианте реализации изобретения домен нуклеазы содержит один или более доменов из: домена расщепления эндонуклеазы FokI (SEQ ID NO: 53), домена расщепления эндонуклеазы StsI (SEQ ID NO: 1), StsI-HA (SEQ ID NO: 2), StsI-HA2 (SEQ ID NO: 3), StsI-UHA (SEQ ID NO: 4), StsI-UHA2 (SEQ ID NO: 5), StsI-HF (SEQ ID NO: 6) и StsI-UHF (SEQ ID NO: 7) или их биологически активного фрагмента или варианта.

В настоящее время было также обнаружено, что сконструированные ген-редактирующие белки, которые содержат ДНК-связывающие домены, содержащие некоторые новые последовательности повторов, могут проявлять более низкую нецелевую активность, чем ранее описанные ген-редактирующие белки, при этом обеспечивая высокий уровень целевой активности. Некоторые из этих сконструированных ген-редактирующих белков могут обеспечить несколько преимуществ над ранее описанными ген-редактирующими белками, включая, к примеру, увеличенную гибкость линкерного участка, соединяющего последовательности повторов, что может приводить к повышенной эффективности связывания. Следовательно, некоторые варианты реализации изобретения относятся к белку, содержащему множество последовательностей повторов. В одном варианте реализации изобретения по меньшей мере одна из последовательностей повторов содержит данную аминокислотную последовательность: GabG, где каждый из символов «a» и «b» представляет любую аминокислоту. В одном варианте реализации изобретения белок представляет собой ген-редактирующий белок. В другом варианте реализации изобретения одна или более последовательностей повторов присутствуют на ДНК-связывающем домене. В дополнительном варианте реализации изобретения каждый символ «a» и «b» независимо выбирают из группы: H и G. В еще одном дополнительном варианте реализации изобретения символы «a» и «b» являются, соответственно, аминокислотами H и G. В одном варианте реализации изобретения данная аминокислотная последовательность размещена в пределах около 5 аминокислот на С-конце последовательности повтора. В другом варианте реализации изобретения данная аминокислотная последовательность размещена на С-конце последовательности повтора. В некоторых вариантах реализации изобретения один или более остатков G в аминокислотной последовательности GabG замещен одной или более аминокислот, отличных от G, к примеру, А, H или GG. В одном варианте реализации изобретения последовательность повтора имеет длину в пределах между приблизительно 32 и приблизительно 40 аминокислотами или между приблизительно 33 и приблизительно 39 аминокислотами или между приблизительно 34 и 38 аминокислотами, или между приблизительно 35 и приблизительно 37 аминокислотами, или приблизительно 36 аминокислот, или более чем приблизительно 32 аминокислоты, или более чем приблизительно 33 аминокислоты, или более чем приблизительно 34 аминокислоты, или более чем приблизительно 35 аминокислот. Другие варианты реализации изобретения относятся к белку, содержащему один или более доменов эффектора, подобного активатору транскрипции. В одном варианте реализации изобретения по меньшей мере один из доменов эффектора, подобного активатору транскрипции, содержит последовательность повтора. Другие варианты реализации изобретения относятся к белку, содержащему множество последовательностей повторов, образованных вставкой одной или более аминокислот между по меньшей мере двумя последовательностями повторяющегося домена эффектора, подобного активатору транскрипции. В одном варианте реализации изобретения одна или более аминокислот вставлены на расстояние приблизительно 1 или приблизительно 2, или приблизительно 3, или приблизительно 4, или приблизительно 5 аминокислот от С-конца по меньшей мере одной последовательностью повтора. Другие варианты реализации изобретения относятся к белку, содержащему множество последовательностей повторов, причем приблизительно каждая вторая последовательность повтора имеет длину отличающуюся от длины последовательности повтора непосредственно предшествующего или следующего за данной последовательностью повтора. В одном варианте реализации изобретения каждая вторая последовательность повтора имеет длину приблизительно 36 аминокислот. В другом варианте реализации изобретения каждая вторая последовательность повтора имеет длину 36 аминокислот. Другие варианты реализации изобретения относятся к белку, содержащему множество последовательностей повторов, причем данное множество последовательностей повторов содержит по меньшей мере две последовательности повторов, которые состоят в длину из по меньшей мере 36 аминокислот и, при этом, по меньшей мере две из этих последовательностей повторов, которые состоят в длину из по меньшей мере 36 аминокислот, разделены по меньшей мере одной последовательностью повторов, которая состоит в длину из меньше чем 36 аминокислот. Некоторые варианты реализации изобретения относятся к белку, который содержит одну или более последовательностей, выбранных из, к примеру, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59 и SEQ ID NO: 60.

Другие варианты реализации изобретения относятся к белку, который содержит ДНК-связывающий домен. В некоторых вариантах реализации изобретения ДНК-связывающий домен содержит множество последовательностей повторов. В одном варианте реализации изобретения множество последовательностей повторов обеспечивает высокую специфичность распознавания сайта связывания на молекуле ДНК-мишени. В других вариантах реализации изобретения по меньшей мере две последовательности повторов обладают по меньшей мере около 50%, или около 60%, или около 70%, или около 80%, или около 90%, или около 95%, или около 98%, или около 99% гомологии друг к другу. В дополнительном варианте реализации изобретения по меньшей мере одна из последовательностей повторов содержит один или более участков, способных связываться с сайтом связывания на молекуле ДНК-мишени. В еще одном дополнительном варианте реализации изобретения сайт связывания содержит определенную последовательность в длину в пределах от приблизительно 1 до приблизительно 5 оснований. В одном варианте реализации изобретения ДНК-связывающий домен содержит цинковый палец. В другом варианте реализации изобретения ДНК-связывающий домен содержит эффектор, подобный активатору транскрипции (TALE). В дополнительном варианте реализации изобретения множество последовательностей повторов включает по меньшей мере одну последовательность повтора, обладающую по меньшей мере около 50%, или около 60%, или около 70%, или около 80%, или около 90%, или около 95%, или около 98% или около 99% гомологии с последовательностью TALE. В еще одном дополнительном варианте реализации изобретения ген-редактирующий белок содержит белок, ассоциированный с короткими палиндромными повторами, регулярно расположенными группами (CRISPR). В одном варианте реализаций изобретения ген-редактирующий белок содержит последовательность внутриядерной локализации. В другом варианте реализации изобретения данная последовательность внутриядерной локализации содержит аминокислотную последовательность PKKKRKV. В одном варианте реализации изобретения ген-редактирующий белок содержит последовательность внутримитохондриальной локализации. В другом варианте реализации изобретения последовательность внутримитохондриальной локализации содержит аминокислотную последовательность LGRVIPRKIASRASLM. В одном варианте реализации изобретения ген-редактирующий белок содержит линкер. В другом варианте реализации изобретения линкер соединяет ДНК-связывающий домен с доменом нуклеазы. В дополнительном варианте реализации изобретения линкер состоит в длину в пределах между приблизительно 1 и приблизительно 10 аминокислотами. В некоторых вариантах реализации изобретения линкер состоит в длину из около 1, около 2, или около 3, или около 4, или около 5, или около 6, или около 7, или около 8, или около 9 или 10 аминокислот. В одном варианте реализации изобретения ген-редактирующий белок способен вносить одноцепочечный или двухцепочечный разрыв в молекуле ДНК-мишени.

Определенные варианты реализации изобретения относятся к способу модификации генома клетки, причем данный способ включает введение в клетку молекулы нуклеиновой кислоты, кодирующей не встречающийся в природе гибридный белок, содержащий искусственный повторяющийся домен эффектора, подобного активатору транскрипции (TAL), включающий одну или более единиц повторов длиной 36 аминокислот и домен эндонуклеазы, причем данный повторяющийся доменсконструирован для распознавания заданной нуклеотидной последовательности и, при этом, данный гибридный белок распознает эту заданную нуклеотидную последовательность. В одном варианте реализации изобретения клетка является эукариотической клеткой. В другом варианте реализации изобретения клетка является клеткой животного. В дополнительном варианте реализации изобретения клетка является клеткой млекопитающего. В еще одном дополнительном варианте реализации изобретения клетка является клеткой человека. В одном варианте реализации изобретения клетка является клеткой растения. В другом варианте реализации изобретения клетка является прокариотической клеткой. В некоторых вариантах реализации изобретения гибридный белок приводит к эндонуклеолитическому расщеплению нуклеиновой кислоты клетки, благодаря чему модифицируется геном клетки.

Другие варианты реализации изобретения относятся к молекуле нуклеиновой кислоты, кодирующей не встречающийся в природе гибридный белок, содержащий искусственный повторяющийся домен эффектора, подобного активатору транскрипции (TAL), включающий одну или более единиц повторов длиной 36 аминокислот и обладающий эндонуклеазной активностью, причем данный повторяющийся домен сконструирован для распознавания заданной нуклеотидной последовательности и, при этом, данный гибридный белок распознает эту заданную нуклеотидную последовательность. В одном варианте реализации изобретения единицы повторов отличаются не более чем приблизительно семью аминокислотами. В другом варианте реализации изобретения каждая из единиц повторов содержит аминокислотную последовательность LTPXQVVAIAS, в которой аминокислота X может быть Ε или Q, и аминокислотную последовательность LTPXQVVAIAS за которой на карбоксильном кольце следует одна или две аминокислоты, которые определяют распознавание одного нуклеотида аденина, цитозина, гуанина и тимина. В одном варианте реализации изобретения нуклеиновая кислота кодирует от около 1,5 до около 28,5 единиц повторов. В другом варианте реализации изобретения нуклеиновая кислота кодирует около 11,5; около 14,5 около 17,5 или около 18,5 единиц повторов. В дополнительном варианте реализации изобретения заданная нуклеотидная последовательность является участком промотора. Некоторые варианты реализации изобретения относятся к вектору, содержащему молекулу или последовательность нуклеиновой кислоты. В одном варианте реализации изобретения вектор является вирусным вектором. В другом варианте реализации изобретения вирусный вектор включает один из вирусов: аденовирус, ретровирус, лентивирус, вируса герпес, адено-ассоциированный вирус или их природный или сконструированный вариант, а также сконструированный вирус.

Некоторые варианты реализации изобретения относятся к молекуле нуклеиновой кислоты, кодирующей не встречающийся в природе гибридный белок, содержащий первый участок, который распознает заданную нуклеотидную последовательность, и второй участок, обладающий эндонуклеазной активностью, причем первый участок содержит искусственный повторяющийся домен эффектора TAL, несущий одну или более единиц повторов длиной около 36 аминокислот, которые отличаются друг от друга не более чем семью аминокислотами, причем данный повторяющийся домен сконструирован для распознавания этой заданной нуклеотидной последовательности. В одном варианте реализации изобретения первый участок содержит аминокислотную последовательность LTPXQVVAIAS, где аминокислота X может быть Ε или Q. В другом варианте реализации изобретения за аминокислотной последовательностью LTPXQVVAIAS, кодирующей в не встречающийся в природе гибридный белок, непосредственно следует аминокислотная последовательность выбранная из: HD, NG, NS, NI, NN и N. В дополнительном варианте реализации изобретения данный гибридный белок обладает рестрикционной эндонуклеазной активностью. Некоторые варианты реализации изобретения относятся к молекуле нуклеиновой кислоты, кодирующей белок, который содержит одну или более последовательностей, выбранных из: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60.

В одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxyzHG, где символ «v» является аминокислотой D или Е, «w» является S или N, «х» является Ν, H или I, «y» является любой аминокислотой или не является аминокислотой, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG или GKQALETVQRLLPVLCQAHG. В другом варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxyzHG, где «v» является D или Е, «w» является S или N, «х» является Ν, H или I, «y» выбирается из аминокислот: D, А, I, Ν, Н, K, S и G, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG или GKQALETVQRLLPVLCQAHG. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxyzHG, где «v» является D или Е, «w» является S или N, «х» является любой аминокислотой, отличной от Ν, H и I, «y» является любой аминокислотой или не является аминокислотой, a «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG или GKQALETVQRLLPVLCQAHG. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwIyzHG, где «v» является D или Е, «w» является S или N, «y» является любой аминокислотой, отличной G, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG или GKQALETVQRLLPVLCQAHG. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwIAzHG, где «v» является D или Е, «w» является S или N, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG или GKQALETVQRLLPVLCQAHG. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxyzHG, где «v» является D или Е, «w» является S или N, «х» является S, Τ или Q, «y» является любой аминокислотой или не является аминокислотой, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG или GKQALETVQRLLPVLCQAHG. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxyzHG, где «v» является D или Е, «w» является S или N, «х» является S, Τ или Q, «y» выбирается из аминокислот: D, А, I, Ν, Н, K, S и G, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQDHG, GGKQALETVQRLLPVLCQAHG, GKQALETVQRLLPVLCQDHG или GKQALETVQRLLPVLCQAHG. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwx, где «v» является D или Е, «w» является S или N, а «x» является S, Τ или Q. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxy, где «v» является D или Е, «w» является S или N, «х» является S, Τ или Q, а «y» выбирается из D, А, I, Ν, Н, K, S и G. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxyzGHGG, где «v» является Q, D или Ε, «w» является S или Ν, «x» является Ν, Η или I, «y» является любой аминокислотой или не является аминокислотой, a «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD или GKQALETVQRLLPVLCQA. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxyzGHGG, где «v» является Q, D или Е, «w» является S или N, «х» является Ν, H или I, «y» выбирается из D, А, I, Ν, Н, K, S и G, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD или GKQALETVQRLLPVLCQA. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxyzGHGG, где «v» является Q, D или Е, «w» является S или N, «х» является любой аминокислотой, отличной от Ν, H и I, «y» является любой аминокислотой или не является аминокислотой, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD или GKQALETVQRLLPVLCQA. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwlyzGHGG, где «v» является Q, D или Е, «w» является S или N, «y» является любой аминокислотой, отличной G, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD или GKQALETVQRLLPVLCQA. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwIAzGHGG, где «v» является Q, D или Е, «w» является S или N, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD или GKQALETVQRLLPVLCQA. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxyzGHGG, где «v» является Q, D или Е, «w» является S или N, «x» является S, Τ или Q, «y» является любой аминокислотой или не является аминокислотой, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD или GKQALETVQRLLPVLCQA. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxyzGHGG, где «v» является Q, D или Е, «w» является S или N, «х» является S, Τ или Q, «y» выбирается из D, А, I, Ν, Н, K, S и G, а «z» представляет собой последовательности GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD или GKQALETVQRLLPVLCQA. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwx, где «v» является Q, D или Е, «w» является S или N, а «х» является S, Τ или Q. В еще одном варианте реализации изобретения последовательность повтора содержит последовательность LTPvQVVAIAwxy, где «v» является Q, D или Е, «w» является S или N, «х» является S, Τ или Q, а «y» выбирается из D, А, I, Ν, Н, K, S и G.

Некоторые фрагменты домена расщепления эндонуклеазы, включая фрагменты, усеченные на N-конце, фрагменты, усеченные на С-конце, фрагменты, которые имеют внутренние делеций, и фрагменты, в которых скомбинированы N-концевые, C-концевые и/или внутренние делеций, могут обладать частью или всей каталитической активностью целого домена расщепления эндонуклеазы. Определение того, может ли фрагмент обладать частью или всей каталитической активностью целого домена, может быть проведено, к примеру, синтезом ген-редактирующего белка, который содержит данный фрагмент, в соответствии со способами настоящего изобретения, путем индукции экспрессии клетками данного ген-редактирующего белка в соответствии со способами настоящего изобретения, и измерением эффективности редактирования генов. Таким образом, измерение эффективности редактирования генов может использоваться для определения того, может ли любой специфический фрагмент обладать частью или полной каталитической активностью целого домена расщепления эндонуклеазы. Следовательно, некоторые варианты реализации изобретения относятся к биологически активному фрагменту домена расщепления эндонуклеазы. В одном варианте реализации изобретения домен расщепления эндонуклеазы выбирают из FokI, StsI, StsI-HA, StsI-HA2, StsI-UHA, StsI-UHA2, StsI-HF и StsI-UHF или их природного или сконструированного варианта или биологически активного фрагмента.

Некоторые фрагменты ДНК-связывающего домена или последовательности повтора, включая фрагменты, усеченные на N-конце, фрагменты, усеченные на С-конце, фрагменты, которые имеют внутренние делеций и фрагменты, в которых скомбинированы N-концевые, C-концевые и/или внутренние делеций, могут обладать частью или всей связывающей активностью целого ДНК-связывающего домена или последовательности повтора. Примеры фрагментов ДНК-связывающих доменов или последовательностей повторов, которые могут обладать частью или всей активностью связывания целой последовательности повтора, включают белки, подобные белку TALE бактерии Ralstonia solanacearum (RTL). Определение того, может ли фрагмент обладать частью или всей активностью связывания целого ДНК-связывающего домена или последовательности повтора, может быть проведено, к примеру, синтезом ген-редактирующего белка, который содержит данный фрагмент, в соответствии со способами настоящего изобретения, путем индукции экспрессии клетками данного ген-редактирующего белка в соответствии со способами настоящего изобретения, и измерением эффективности редактирования генов. Таким образом, измерение эффективности редактирования генов может использоваться для определения того, может ли обладать любой специфический фрагмент частью или полной активностью связывания целого ДНК-связывающего домена или последовательности повтора. Следовательно, некоторые варианты реализации изобретения относятся к биологически активному фрагменту ДНК-связывающего домена или последовательности повтора. В одном варианте реализации изобретения фрагмент обеспечивает высокую специфичность распознавания сайта связывания на молекуле ДНК-мишени. В другом варианте реализации изобретения фрагмент содержит последовательность, которая кодирует белок, подобный белку TALE бактерии Ralstonia solanacearum, или его биологически активный фрагмент.

Определенные варианты реализации изобретения относятся к композиции, содержащей нуклеиновую кислоту, для изменения последовательности ДНК клетки, причем данная нуклеиновая кислота кодирует ген-редактирующий белок. Другие варианты реализации изобретения относятся к композиции, содержащей смесь нуклеиновых кислот, для изменения последовательности ДНК клетки, причем данная смесь нуклеиновых кислот содержит: первую нуклеиновую кислоту, которая кодирует первый ген-редактирующий белок, и вторую нуклеиновую кислоту, которая кодирует второй ген-редактирующий белок. В одном варианте реализации изобретения сайт связывания первого ген-редактирующего белка и сайт связывания второго ген-редактирующего белка присутствует в одной и той же молекуле ДНК-мишени. В другом варианте реализации изобретения сайт связывания первого ген-редактирующего белка и сайт связывания второго ген-редактирующего белка разделены менее чем около 50 основаниями, или менее чем около 40 основаниями, или менее чем около 30 основаниями или менее чем около 20 основаниями, или менее чем около 10 основаниями, или в пределах между около 10 основаниями и около 25 основаниями или около 15 основаниями. В одном варианте реализации изобретения домен нуклеазы первого ген-редактирующего белка и домен нуклеазы второго ген-редактирующего белка способны образовывать димер. В другом варианте реализации изобретения данный димер способен создавать одноцепочечный или двухцепочечный разрыв в молекуле ДНК-мишени. В одном варианте реализации изобретения композиция является терапевтической композицией. В другом варианте реализации изобретения композиция содержит репарационную матрицу. В дополнительном варианте реализации изобретения репарационная матрица является одноцепочечной молекулой ДНК или двухцепочечной молекулой ДНК.

Другие варианты реализации изобретения относятся к продукту производства для синтеза белка или нуклеиновой кислоты, кодирующей белок. В одном варианте реализации изобретения продукт является нуклеиновой кислотой. В другом варианте реализации изобретения белок содержит ДНК-связывающий домен. В дополнительном варианте реализации изобретения нуклеиновая кислота содержит нуклеотидную последовательность, кодирующую ДНК-связывающий домен. В одном варианте реализации изобретения белок содержит домен нуклеазы. В другом варианте реализации изобретения нуклеиновая кислота содержит нуклеотидную последовательность, кодирующую домен нуклеазы. В одном варианте реализации изобретения белок содержит множество последовательностей повторов. В другом варианте реализации изобретения нуклеиновая кислота содержит множество последовательностей повторов. В дополнительном варианте реализации изобретения домен нуклеазы выбирают из белков: FokI, StsI, StsI-HA, StsI-HA2, StsI-UHA, StsI-UHA2, StsI-HF и StsI-UHF или их природного или сконструированного варианта или биологически активного фрагмента. В одном варианте реализации изобретения нуклеиновая кислота содержит промотор РНК-полимеразы. В другом варианте реализации изобретения промотор РНК-полимеразы является промотором Т7 или промотором SP6. В дополнительном варианте реализации изобретения нуклеиновая кислота содержит вирусный промотор. В одном варианте реализации изобретения нуклеиновая кислота содержит нетранслируемый участок. В другом варианте реализации изобретения нуклеиновая кислота является матрицей транскрипции в условиях in vitro.

Некоторые варианты реализации изобретения относятся к способу индукции экспрессии клеткой белка. Другие варианте реализации изобретения относятся к способам изменения последовательности ДНК клетки, включающие трансфекцию клетки с помощью ген-редактирующего белка или индукцию экспрессии клеткой ген-редактирующего белка. Другие варианты реализации изобретения относятся к способу снижения экспрессии целевого белка в клетке. В одном варианте реализации изобретения индуцируют экспрессию клеткой ген-редактирующего белка, причем ген-редактирующий белок способен создавать одноцепочечный или двухцепочечный разрыв в молекуле ДНК-мишени. В другом варианте реализации изобретения одноцепочечный или двухцепочечный разрыв приводит к инактивации гена. Другие варианты реализации изобретения относятся к способу образования неактивного белка, белка со сниженной активностью или доминантно-негативной формы белка. В одном варианте реализации изобретения белок представляет собой сурвивин. Другие варианты реализации изобретения относятся к способу репарации одной или более мутаций клетки. В одном варианте реализации изобретения приводят в контакт клетку с репарационной матрицей. В другом варианте реализации изобретения репарационная матрица является молекулой ДНК. В дополнительном варианте реализации изобретения репарационная матрица не содержит сайт связывания ген-редактирующего белка. В еще одном дополнительном варианте реализации изобретения репарационная матрица кодирует аминокислотную последовательность, которая кодируется последовательностью ДНК, которая содержит сайт связывания ген-редактирующего белка.

Другие варианты реализации изобретения относятся к способу лечения пациента, включающему введение пациенту терапевтически эффективного количества белка или нуклеиновой кислоты, кодирующей белок. В одном варианте реализации изобретения лечение приводит к одному или более случаев облегчения симптомов у пациента. Некоторые варианты реализации изобретения относятся к способу лечения пациента, который включает: а. извлечение клетки из организма пациента, b. индукцию экспрессии клеткой ген-редактирующего белка путем трансфекции клетки с помощью нуклеиновой кислоты, кодирующей ген-редактирующий белок, с. репрограммирование клетки и е. введение клетки в организм пациента. В одном варианте реализации изобретения клетка репрограммируется в менее дифференцированное состояние. В другом варианте реализации изобретения клетку репрограммируют путем трансфекции клетки одной или более синтетических молекул РНК, кодирующих один или более белков репрограммирования. В дополнительном варианте реализации изобретения клетка является дифференцированной. В еще одном дополнительном варианте реализации изобретения клетка является дифференцированной в одну из клеток: клетку кожи, глюкозочувствительную инсулин-продуцирующую клетку, гемопоэтическую клетку, клетку сердечной мышцы, клетку сетчатки, клетку почки, нервную клетку, стромальную клетку, жировую клетку, костную клетку, мышечную клетку, ооцит или сперматозоид. Другие варианты реализации изобретения относятся к способу лечения пациента, который включает: а. извлечение гемопоэтической клетки или стволовой клетки из организма пациента, b. индукцию экспрессии клеткой ген-редактирующего белка путем трансфекции клетки с помощью нуклеиновой кислоты, кодирующей ген-редактирующий белок и с. введение полученной клетки в организм пациента.

Было обнаружено, что среда для культивирования клеток, содержащая преимущественно или содержащая: среду DMEM/F12, аскорбиновую кислоту, инсулин, трансферрин, селенит натрия, этаноламин, основный фактор роста фибробластов и трансформирующий ростовой фактор-бета, является достаточной для поддержания in vitro плюрипотентных стволовых клеток, включая плюрипотентные стволовые клетки человека. Следовательно, некоторые варианты реализации изобретения относятся к среде для культивирования клеток, содержащей преимущественно или содержащей: среду DMEM/F12, аскорбиновую кислоту, инсулин, трансферрин, селенит натрия, этаноламин, основный фактор роста фибробластов и трансформирующий ростовой фактор-бета. В одном варианте реализации изобретения аскорбиновая кислота присутствует в концентрации около 50 мкг/мл. В другом варианте реализации изобретения инсулин присутствует в концентрации около 10 мкг/мл. В дополнительном варианте реализации изобретения трансферрин присутствует в концентрации около 5,5 мкг/мл. В еще одном дополнительном варианте реализации изобретения селенит натрия присутствует в концентрации около 6,7 мкг/мл. В еще одном дополнительном варианте реализации изобретения этаноламин присутствует в концентрации около 2 мкг/мл. В еще одном дополнительном варианте реализации изобретения основный фактор роста фибробластов присутствует в концентрации около 20 нг/мл. В еще одном дополнительном варианте реализации изобретения трансформирующий ростовой фактор-бета присутствует в концентрации около 2 нг/мл. В одном варианте реализации изобретения аскорбиновая кислота представляет собой 2-фосфат-аскорбиновую кислоту. В другом варианте реализации изобретения трансформирующий ростовой фактор-бета представляет собой трансформирующий ростовой фактор-бета 1 или трансформирующий ростовой фактор-бета 3. В одном варианте реализации изобретения среда для культивирования клеток используется для культивирования плюрипотентных стволовых клеток. В другом варианте реализации изобретения плюрипотентные стволовые клетки представляют собой плюрипотентные стволовые клетки человека. В дополнительном варианте реализации изобретения среда для культивирования клеток используется для культивирования клеток во время или после репрограммирования. В одном варианте реализации изобретения среда для культивирования клеток не содержит компонентов животного происхождения. В другом варианте реализации изобретения среду для культивирования клеток производят в соответствии с производственным стандартом. В дополнительном варианте реализации изобретения производственным стандартом является GMP. В одном варианте реализации изобретения клетки контактируют с молекулой клеточной адгезии. В другом варианте реализации изобретения молекулу клеточной адгезии выбирают из: фибронектина и витронектина или их биологически активного фрагмента. В дополнительном варианте реализации изобретения клетки контактируют с фибронектином и витронектином. В еще одном дополнительном варианте реализации молекула клеточной адгезии является рекомбинантной.

В определенных ситуациях, например, при получении терапевтических средств, может быть целесообразным заменить компоненты животного происхождения компонентами неживотного происхождения, в частности, для того, чтобы снизить риск контаминации вирусами и/или другими патогенами, передающимися животными. Было обнаружено, что синтетический холестерин, включая полусинтетический холестерин растительного происхождения, может быть заменен в среде для трансфекций холестерином животного происхождения без снижения эффективности трансфекций или повышения ассоциированной с трансфекцией токсичностью. Следовательно, некоторые варианты реализации изобретения относятся к среде для трансфекций, содержащей синтетический или полусинтетический холестерин. В одном варианте реализации изобретения полусинтетический холестерин является растительного происхождения. В другом варианте реализации изобретения среда для трансфекции не содержит холестерин животного происхождения. В дополнительном варианте реализации среда для трансфекции является средой для репрограммирования. Другие варианты реализации изобретения относятся к среде для комплексообразования. В одном варианте реализации изобретения среда для комплексообразования имеет pH более чем 7; или более чем около 7,2; или более чем около 7,4; или более чем около 7,6; или более чем около 7,8; или более чем около 8,0; или более чем около 8,2; или более чем около 8,4; или более чем около 8,6; или более чем около 8,8; или более чем около 9,0. В другом варианте реализации изобретения среда для комплексообразования содержит трансферрин. В дополнительном варианте реализации изобретения среда для комплексообразования содержит среду DMEM. В дополнительном варианте реализации изобретения среда для комплексообразования содержит среды DMEM/F12. Другие варианты реализации изобретения относятся к способу образования комплексов реагента для трансфекции - нуклеиновой кислоты. В одном варианте реализации изобретения реагент для трансфекции инкубирируют в среде для комплексообразования. В другом варианте реализации изобретения инкубирование осуществляется перед стадией смешивания. В дополнительном варианте реализации изобретения стадия инкубирования длится в пределах между приблизительно 5 секундами и приблизительно 5 минутами или между приблизительно 10 секундами и приблизительно 2 минутами, или между приблизительно 15 секундами и приблизительно 1 минутой, или между приблизительно 30 секундами и приблизительно 45 секундами. В одном варианте реализации изобретения реагент для трансфекции выбирают из Таблицы 1. В другом варианте реализации изобретения клетка реагент для трансфекции представляет собой липид или липидоподобное вещество. В дополнительном варианте реализации изобретения реагент для трансфекции содержит катион. В еще одном дополнительном варианте реализации изобретения катион является мультивалентным катионом. В еще одном дополнительном варианте реализации изобретения реагент для трансфекции является Ν1-[2-((1S)-1-[(3-аминопропил)амино]-4-[ди(3-аминопропил)амино]бутилкарбоксамидо)этил]-3,4-ди[олеилокси]-бензамид (также называемый MVL5) или его производным.

Некоторые варианты реализации изобретения относятся к способу индукции экспрессии клеткой белка путем приведения клетки в контакт с нуклеиновой кислотой. В одном варианте реализации изобретения клетка является клеткой млекопитающего. В другом варианте реализации изобретения клетка является клеткой человека или клеткой грызуна. Другие варианты реализации изобретения относятся к клетке, получаемой одним или более способов настоящего изобретения. В одном варианте реализации изобретения клетка находится в организме пациента. В другом варианте реализации изобретения клетку выделяют из организма пациента. Другие варианты реализации изобретения относятся к скринингу библиотеке, содержащей клетку, получаемую с использованием одного или более способов настоящего изобретения. В одном варианте реализации изобретения скрининг библиотеку используют для по меньшей мере одной из задач: скрининга токсичности, включающего: скрининг кардиотоксичности, скрининг нейротоксичности и скрининг гепатотоксичности, скрининга эффективности, высокопроизводительного скрининга, многопараметрического скрининга и других видов скрининга.

Другие варианты реализации изобретения относятся к набору, содержащему нуклеиновую кислоту. В одном варианте реализации изобретения набор содержит реагент для доставки (также называемый «реагент для трансфекции»). В другом варианте реализации изобретения набор является набором для репрограммирования. В дополнительном варианте реализации изобретения набор является набором для редактирования генов. Другие варианты реализации изобретения относятся к набору для получения нуклеиновых кислот. В одном варианте реализации изобретения набор содержит по меньшей мере два из следующих нуклеотидов: псевдоуридинтрифосфат, 5-метилуридинтрифосфат, 5-метилцитидинтрифосфат, 5-гидроксиметилцитидинтрифосфат, N4-метилцитидинтрифосфат, N4-ацетилцитидинтрифосфат и 7-дезазагуанозинтрифосфат или одно или более их производных. Другие варианты реализации изобретения относятся к терапевтическому средству, содержащему нуклеиновую кислоту. В одном варианте реализации изобретения терапевтическое средство является фармацевтической композицией. В другом варианте реализации изобретения фармацевтическую композицию готовят в виде состава. В дополнительном варианте реализации изобретения состав содержит водную суспензию липосом. Типовые компоненты липосом изложены в Таблице 1, приведены в качестве примера и не являются ограничивающими. В одном варианте реализации изобретения липосомы включают одну или более цепей полиэтиленгликоля (ПЭГ). В другом варианте реализации изобретения ПЭГ представляет собой ПЭГ2000. В дополнительном варианте реализации изобретения липосомы включают 1,2-дистеароил-sn-глицеро-3-фофсофэтаноламин (DSPE) или его производное. В одном варианте реализации изобретения терапевтические средства включают один или более лигандов. В другом варианте реализации изобретения терапевтическое средство содержит по меньшей мере один из факторов: андроген, CD30 (TNFRSF8), проникающий в клетку пептид, CXCR, эстроген, эпидермальный фактор роста, EGFR, HER2, фолат, инсулин, инсулиноподобный фактор роста I, интерлейкин-13, интегрин, прогестерон, стромальный фактор 1, тромбин, витамин D и трансферрин или их биологически активный фрагмент или вариант. Другие варианты реализации изобретения относятся к терапевтическому средству, содержащему клетки, полученные одним или более способов настоящего изобретения. В одном варианте реализации изобретения терапевтическое средство вводят пациенту для лечения по меньшей мере одного из заболеваний: диабета 1 типа, сердечной недостаточности, включая ишемическую или дилатационную кардиомиопатию, макулярной дегенерации, болезни Паркинсона, муковисцидоза, серповидноклеточной анемии, талассемии, анемии Фанкони, тяжелого комбинированного иммунодефицита, наследственной сенсорной нейропатии, пигментной ксеродермы, болезни Хатингтона, мышечной дистрофии, амиотрофического латерального склероза, болезни Альцгеймера, рака и инфекционных заболеваний, включая гепатит и ВИЧ/СПИД.

Некоторые варианты реализации изобретения относятся к нуклеиновой кислоте, содержащей 5'-кэп структуру, выбранную из структур: Кэп 0, Кэп 1, Кэп 2 и Кэп 3 или их производных. В одном варианте реализации изобретения нуклеиновая кислота содержит один или более нетранслируемых участков (НТУ). В другом варианте реализации изобретения нуклеиновая кислота содержит один или более НТУ, которые увеличивают стабильность нуклеиновой кислоты. В дополнительном варианте реализации изобретения один или более НТУ содержат 5'-НТУ альфа-глобина или бета-глобина. В еще одном дополнительном варианте реализации изобретения один или более НТУ содержат 3'-НТУ альфа-глобина или бета-глобина. В еще одном дополнительном варианте реализации изобретения синтетическая молекула РНК содержит 5'-НТУ альфа-глобина или бета-глобина и 3'-НТУ альфа-глобина или бета-глобина. В одном варианте реализации изобретения 5'-НТУ содержит последовательность Козак, которая в основном схожа с консенсусной последовательностью Козак. В другом варианте реализации изобретения нуклеиновая кислота содержит хвост 3'-поли(А). В дополнительном варианте реализации изобретения хвост 3'-поли(А) имеет длину в пределах между приблизительно 20 нуклеотидами и приблизительно 250 нуклеотидами или между приблизительно 120 нуклеотидами и приблизительно 150 нуклеотидами В дополнительном варианте реализации изобретения хвост 3'-поли(А) имеет длину около 20 нуклеотидов, или около 30 нуклеотидов, или около 40 нуклеотидов, или около 50 нуклеотидов, или около 60 нуклеотидов, или около 70 нуклеотидов, или около 80 нуклеотидов, или около 90 нуклеотидов, или около 100 нуклеотидов, или около ПО нуклеотидов, или около 120 нуклеотидов, или около 130 нуклеотидов, или около 140 нуклеотидов, или около 150 нуклеотидов, или около 160 нуклеотидов, или около 170 нуклеотидов, или около 180 нуклеотидов, или около 190 нуклеотидов, или около 200 нуклеотидов, или около 210 нуклеотидов, или около 220 нуклеотидов, или около 230 нуклеотидов, или около 240 нуклеотидов, или около 250 нуклеотидов.

Другие варианты реализации изобретения относятся к способу репрограммирования клетки. В одном варианте реализации изобретения клетку репрограммируют путем приведения клетки в контакт с одной или более нуклеиновых кислот. В одном варианте реализации изобретения приводят в контакт клетку с множеством нуклеиновых кислот, кодирующих по меньшей мере один из белков: белок Oct4, белок Sox2, белок Klf4, белок с-Мус, белок Lin28 или их биологически активный фрагмент, вариант или производное. В другом варианте реализации изобретения приводят в контакт клетку с множеством нуклеиновых кислот, кодирующих множество белков, включая: белок Oct4, белок Sox2, белок Klf4, белок с-Мус или один или более их биологически активных фрагментов, вариантов или производных. Другие варианты реализации изобретения относятся к способу редактирования генов клетки. В одном варианте реализации изобретения проводят редактирование генов путем приведения клетки в контакт с одной или более нуклеиновых кислот.

Для исследования действия биологических процессов обычно используют модели на животных. В некоторых ситуациях, например, при исследовании заболевания человека, может быть целесообразным использование модели на животном, содержащем модифицированный геном, в частности, потому что такая модель на животном более полно имитирует фенотип заболевания человека. Следовательно, некоторые варианты реализации изобретения относятся к способу создания организм, несущего одну или более генетических модификаций (также называемых «мутациями», также называемых «редакциями генов»). В одном варианте реализации изобретения одну или более генетических модификаций создают путем трансфекций клетки одной или более нуклеиновых кислот, кодирующих один или более ген-редактирующих белков. В другом варианте реализации изобретения одна или более нуклеиновых кислот включает синтетическую молекулу РНК. В одном варианте реализации изобретения один или более ген-редактирующих белков включает по меньшей мере один из белков: нуклеазу цинкового пальца, белок TALEN, белок, ассоциированный ассоциированный с короткими палиндромными повторами, регулярно расположенными группами (CRISPR), нуклеазу, мегануклеазу, никазу или их биологически активный фрагмент или вариант. В одном варианте реализации изобретения клетка является плюрипотентной клеткой. В другом варианте реализации изобретения клетка является эмбриональной стволовой клеткой. В дополнительном варианте реализации изобретения клетка является эмбрионом. В еще одном дополнительном варианте реализации изобретения клетка является одной из: клетки животного, клетки растения, дрожжевой клетки и бактериальной клетки. В одном варианте реализации изобретения клетка является клеткой грызуна. В другом варианте реализации изобретения клетка является клеткой человека. В некоторых вариантах реализации изобретения клетку трансфецируют одной или более нуклеиновых кислот, кодирующих один или более ген-редактирующих белков, и одной или более нуклеиновых кислот, кодирующих одну или более репарационных матриц. В одном варианте реализации изобретения клетка вводится в бластоцисту. В другом варианте реализации изобретения клетка вводится ложнобеременной самке. В дополнительном варианте реализации изобретения определяют наличие или отсутствие генетической модификации у потомства. В еще одном дополнительном варианте реализации определение проводят методом прямого секвенирования. В одном варианте реализации изобретения организм является организмом домашнего скота, к примеру, свиньей, коровой и т.п. В другом варианте реализации изобретения организм является домашним животным, к примеру, собакой, кошкой, рыбкой и т.п.

В некоторых ситуациях, например, при модификации генома клетки-мишени путем добавления последовательности нуклеиновой кислоты, может быть целесообразным вставить данную последовательность нуклеиновой кислоты в локализацию безопасной гавани, в частности, для снижения рисков, связанных с прохождением случайной вставки. Следовательно, некоторые варианты реализации изобретения относятся к способу вставки последовательности нуклеиновой кислоты в локализацию безопасной гавани. В другом варианте реализации изобретения клетка является клеткой человека, а локализация безопасной гавани является локусом AAVS1. В другом варианте реализации изобретения клетка является клеткой грызуна, а локализация безопасной гавани является локусом Rosa26. В одном варианте реализации изобретения дополнительно приводят в контакт клетку с одной или более нуклеиновых кислот, кодирующих одну или более репарационных матриц. Другие варианты реализации изобретения относятся к набору для изменения последовательности ДНК клетки. В одном варианте реализации изобретения клетка является клеткой человека, а молекула ДНК-мишени содержит нуклеотидную последовательность, которая кодирует локус AAVS1. В другом варианте реализации изобретения клетка является клеткой грызуна, а молекула ДНК-мишени содержит нуклеотидную последовательность, которая кодирует локус Rosa26. Другие варианты реализации изобретения относятся к способу создания репортерной клетки путем приведения данной клетки в контакт с одной или более нуклеиновых кислот, кодирующих один или более ген-редактирующих белков, и одной или более нуклеиновых кислот, кодирующих одну или более репарационных матриц. В одном варианте реализации изобретения одна или более репарационных матриц содержат ДНК. В другом варианте реализации изобретения одна или более репарационных матриц кодируют один или более флуоресцентных белков. В дополнительном варианте реализации изобретения одна или более репарационных матриц кодируют по меньшей мере часть участка промотора гена.

В некоторых ситуациях, например, при создании библиотеки клеток с редактированными генами, может быть целесообразным для увеличения эффективности редактирования генов, в частности, для уменьшения стоимости определения свойств клеток. В настоящее время известно, что эффективность редактирования генов может быть увеличена путем многократного приведения клетки в контакт с синтетической РНК, кодирующей один или более ген-редактирующих белков. Следовательно, некоторые варианты реализации изобретения относятся к способу редактирования генов клетки путем многократного приведения данной клетки в контакт с одной или более нуклеиновых кислот, кодирующих один или более ген-редактирующих белков. В одном варианте реализации изобретения в течение пяти последовательных дней по меньшей мере дважды клетку приводят в контакт. В другом варианте реализации изобретения дважды приводят в контакт клетку с интервалом около 24 часов и около 48 часов.

При заболевании раком выживание и пролиферация злокачественных клеток может происходить, в частности, из-за наличия специфических генетических дефектов, которые в основном отсутствуют в организме пациента. В настоящее время известно, что ген-редактирующие белки могут применяться для целевого нарушения механизмов выживания и механизмов, связанных с пролиферацией, и при таком применении ген-редактирующие белки и нуклеиновые кислоты, кодирующие ген-редактирующие белки, могут заменять сильные противораковые терапевтические средства. Следовательно, некоторые варианты реализации изобретения относятся к противораковым терапевтическим средствам. В одном варианте реализации изобретения терапевтическое средство представляет собой терапевтическую композицию, которая ингибирует выживание и/или предупреждает, замедляет или иным образом ограничивает пролиферацию клетки. В другом варианте реализации изобретения клетка является раковой клеткой. В дополнительном варианте реализации изобретения терапевтическое средство содержит один или более ген-редактирующих белков или нуклеиновую кислоту, которая кодирует один или более ген-редактирующих белков. В еще одном дополнительном варианте реализации изобретения один или более ген-редактирующих белков нацелено на одну или более последовательностей, которые способствуют выживанию и/или пролиферации клетки. Такие последовательности включают без ограничения: связанные с апоптозом гены, включая семейство генов ингибитора апоптоза (IAP) (См., например, Таблицу 2 и Таблицу 2 предварительной заявки США №61/721302, содержание которой включено в данный документ посредством ссылки), такие как BIRC5; связанные с поддержанием функционирования теломер последовательности, такие как ген теломеразной обратной транскриптазы (TERT) и теломеразный РНК-компонент (TERC); влияющие на ангиогенез последовательности, такие как ген VEGF и другие ассоциированные с раковыми заболеваниями гены, включая: BRAF, BRCA1, BRCA2, CDKN2A, CTNNB1, EGFR, семейство МУС, семейство RAS, PIK3CA, PIK3R1, PKN3, ТР53, PTEN, RET, SMAD4, KIT, MET, APC, RBI, семейство VEGF, TNF и гены семейства рибонуклеотидредуктазы. Типовые последовательности-мишени ген-редактирующих белков для гена BIRC5 изложены в Таблице 3 и в Таблице 3 предварительной заявки США №61/721302, содержание которой включено в данный документ посредством ссылки, приведены в качестве примера и не являются ограничивающими. В одном варианте реализации изобретения по меньшей мере одна из одной и более последовательностей присутствует как в злокачественных так и в незлокачественных клетках. В другом варианте реализации изобретения по меньшей мере одна из одной и более последовательностей присутствует в повышенном количестве в злокачественных клетках. В другом варианте реализации изобретения по меньшей мере одна из одной и более последовательностей присутствует в повышенном количестве в незлокачественных клетках. В одном варианте реализации изобретения терапевтическая композиция дополнительно содержит нуклеиновую кислоту, кодирующую одну или более репарационных матриц. В другом варианте реализации изобретения один или более ген-редактирующих белков индуцируют экспрессию клеткой неактивной или доминантно-негативной формы белка. В дополнительном варианте реализации изобретения белок является представителем семейства IAP. В еще одном дополнительном варианте реализации белок является сурвивином.

Другие варианты реализации изобретения относятся к способу лечения рака, который включает введение пациенту терапевтически эффективного количества ген-редактирующего белка или нуклеиновой кислоты, кодирующей один или более ген-редактирующих белков. В одном варианте реализации изобретения лечение приводит к уменьшению или остановке роста раковых клеток в организме пациента. В другом варианте реализации изобретения лечение приводит к задержке прогрессировать или к ремиссии рака. В одном варианте реализации изобретения молекула ДНК-мишени содержит ген BIRC5. В другом варианте реализации изобретения молекула ДНК-мишени содержит последовательность, выбранную из: SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 и SEQ ID NO: 15. В дополнительном варианте реализации изобретения множество соседних сайтов связывания являются на по меньшей мере около 50%, или по меньшей мере около 60%, или по меньшей мере около 70%, или по меньшей мере около 80%, или по меньшей мере около 90%, или по меньшей мере около 95%, или по меньшей мере около 98%, или по меньшей мере около 99% гомологичными одной или более последовательностей, перечисленных в Таблице 3, Таблице 4, Таблице 3 предварительной заявки США №61/721302, содержание которой включено в данный документ посредством ссылки, Таблице 1 предварительной заявки США №61/785404, содержание которой включено в данный документ посредством ссылки, или Таблице 1 предварительной заявки США №61/842874, содержание которой включено в данный документ посредством ссылки. В некоторых ситуациях ген-редактирутощий белок с усеченным N-концевым доменом может применяться для предотвращения рестрикции первого основания Т последовательности сайта связывания. В некоторых вариантах реализации изобретения рак является глиомой. В одном варианте реализации изобретения пациент предварительно прошел хирургическую и/или лучевую терапию и/или одновременно проходит хирургическую и/или лучевую терапию. В другом варианте реализации изобретения введение проводится одним или более вариантов из: интратекальной инъекции, внутричерепной инъекции, внутривенной инъекции, перфузии, подкожной инъекции, внутрибрюшинной инъекции, инфузии в воротную вену и поступления при местном нанесении.

Некоторые варианты реализации изобретения относятся к способу лечения рака, который включает: а. отбор из организма пациента биопсией материала, содержащего одну или более раковых клеток, b. определение в одной или более раковых клеток последовательности ассоциированного с раковым заболеванием генетического маркера и с. введение пациенту терапевтически эффективного количества ген-редактирующего белка или нуклеиновой кислоты, кодирующей ген-редактирующий белок, при этом последовательность молекулы ДНК-мишени является на по меньшей мере около 50% или около 60% или около 70% или около 80% или около 90% или около 95% или около 98% или около 99% гомологичной последовательности ассоциированного с раковым заболеванием генетического маркера. В одном варианте реализации изобретения данный способ дополнительно включает сравнение последовательности одного или более ассоциированных с раковым заболеванием генетических маркеров из одной или более раковых клеток с последовательностью таких же ассоциированных с раковым заболеванием генетических маркеров из одной или более нераковых клеток, выбор ассоциированного с раковым заболеванием генетического маркера, имеющего последовательность, которая отличается у одной и более раковых клеток и у одной или более нераковых клеток, при этом данная последовательность молекулы ДНК-мишени или сайта связывания является на по меньшей мере около 50% или около 60% или около 70% или около 80% или около 90% или около 95% или около 98% или около 99% гомологичной последовательности выбранного ассоциированного с раковым заболеванием генетического маркера.

Многие раковые клетки экспрессируют сурвивин, представителя семейства белков ингибиторов апоптоза (IAP), который у людей кодируется геном BIRC5. Применение РНК интерференции для снижения экспрессии определенных молекул мРНК, включая мРНК сурвивина, может временно ингибировать рост определенных раковых клеток. Однако, предыдущие способы использования РНК интерференции для снижения экспрессии мРНК сурвивина дают временный эффект и приводят только к кратковременному повышению среднего значения времени до наступления смертельного исхода на моделях животных. В настоящее время обнаружено, что индукция экспрессии клеткой одного или более ген-редактирующих белков, которые нацелены на ген BIRC5, может привести к разрушению гена BIRC5, может индуцировать в клетке экспрессию и/или секрецию нефункционального варианта белка сурвивина, может индуцировать в клетке экспрессию и/или секрецию доминантно-негативного варианта белка сурвивина, может инициировать в клетке или соседних клетках активацию одного или более механизмов апоптоза, может замедлять или останавливать рост данной клетки или соседних клеток, может приводить к гибели данной клетки или соседних клеток, может ингибировать прогрессирование ракового заболевания и может приводить к ремиссии у больного раком пациента. Следовательно, некоторые варианты реализации изобретения относятся к ген-редактирующемубелку, который нацелен на ген BIRC5. В одном варианте реализации изобретения ген-редактирующий белок связывается с одним или более участков гена BIRC5. В другом варианте реализации изобретения ген-редактирующий белок связывается с одним или более участков последовательности, выбранной из: SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 и SEQ ID NO: 15. В дополнительном варианте реализации изобретения ген-редактирующий белок связывается с одной или более последовательностей, выбранных из: SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 и SEQ ID NO: 27. В еще одном дополнительном варианте реализации изобретения ген-редактирующий белок связывается с одной или более последовательностей нуклеиновых кислот, которые кодируют SEQ ID NO: 34 или ее биологически активный фрагмент, вариант или аналог. В еще одном дополнительном варианте реализации изобретения ген-редактирующий белок связывается с одной или более последовательностей, выбранных из Таблицы 3, Таблицы 4, Таблицы 3 предварительной заявки США №61/721302, содержание которой включено в данный документ посредством ссылки, Таблицы 1 предварительной заявки США №61/785404, содержание которой включено в данный документ посредством ссылки, Таблицы 1 предварительной заявки США №61/842874, содержание которой включено в данный документ посредством ссылки, или с одной или более последовательностей, которые являются на по меньшей мере около 50%, или по меньшей мере около 60%, или по меньшей мере около 70%, или по меньшей мере около 80%, или по меньшей мере около 90%, или по меньшей мере около 95%, или по меньшей мере около 98%, или по меньшей мере около 99% гомологичными одной или более последовательностей, выбранных из Таблицы 3, Таблицы 4, Таблицы 3 предварительной заявки США №61/721302, содержание которой включено в данный документ посредством ссылки, Таблицы 1 предварительной заявки США №61/785404, содержание которой включено в данный документ посредством ссылки, или Таблицы 1 предварительной заявки США №61/842874, содержание которой включено в данный документ посредством ссылки. В одном варианте реализации изобретения ген-редактирующий белок создает один или более одноцепочечных или двухцепочечных разрывов ДНК клетки. В другом варианте реализации изобретения один или более одноцепочечных или двухцепочечных разрывов образуются в гене BIRC5. В дополнительном варианте реализации изобретения один или более одноцепочечных или двухцепочечных разрывов образуются в одном или более экзонов гена BIRC5. В еще одном дополнительном варианте реализации изобретения один или более одноцепочечных или двухцепочечных разрывов образуются в последовательности, выбранной из: SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 и SEQ ID NO: 15. В еще одном дополнительном варианте реализации изобретения один или более одноцепочечных или двухцепочечных разрывов образуются в пределах последовательности, которая кодирует домен ингибитора апоптоза (также называемого «IAP», «домен IAP», «повтор IAP», «белковый повтор бакуловирусного ингибитора апоптоза», «BIR» и т.д.). В еще одном дополнительном варианте реализации изобретения ген-редактирующий белок связывается с одной или более последовательностей, выбранных из Таблицы 5, Таблицы 2 предварительной заявки США №61/785404, содержание которой включено в данный документ посредством ссылки, Таблицы 2 предварительной заявки США №61/842874, содержание которой включено в данный документ посредством ссылки, или с одной или более последовательностей, которые являются на по меньшей мере около 50%, или по меньшей мере около 60%, или по меньшей мере около 70%, или по меньшей мере около 80%, или по меньшей мере около 90%, или по меньшей мере около 95%, или по меньшей мере около 98% гомологичными одной или более последовательностей, выбранных из Таблицы 5, Таблицы 2 предварительной заявки США №61/785404, содержание которой включено в данный документ посредством ссылки, или Таблицы 2 предварительной заявки США №61/842874, содержание которой включено в данный документ посредством ссылки. В еще одном варианте реализации изобретения ген-редактирующий белок связывается с последовательностью, которая кодирует один или более генов, выбранных из Таблицы 2, Таблицы 5, Таблицы 6, Таблицы 7, Таблицы 4 предварительной заявки США №61/721302, содержание которой включено в данный документ посредством ссылки, Таблицы 2 предварительной заявки США №61/785404, содержание которой включено в данный документ посредством ссылки, или Таблицы 2 предварительной заявки США №61/842874, содержание которой включено в данный документ посредством ссылки.

В некоторых вариантах реализации изобретения молекула ДНК-мишени содержит ген, которых сверхэкспрессируется при раке. Типовые гены, которые сверхэкспрессируются при раке включают без ограничения: ABL1, BIRC5, BLK, ВТК, представителей семейства CDK, EGFR, ERBB2, FAS, FGR, FLT4, FRK, FYN, НСК, HIF1A, HRAS, HSP90AA1, HSP90AA1, HSPA4, KDR, KIF11, KIF11, KIF20A, KIF21A, KIF25, KIT, KRAS, LCK, LYN, МАРК1, MET, MYC, MYH1, MYOIG, NRAS, NTRK1, PDGFB, PDGFRA, PDGFRB, PKN3, PLK1, RAF1, RBI, RET, RRM1, RRM2, SRC, TNF, ТРМ2, TYR03, VEGFA, VEGFB, VEGFC, YES1 и ZAP70. В некоторых вариантах реализации изобретения молекула ДНК-мишени содержит ген, выбранный из: ABL1, BIRC5, BLK, ВТК, представителя семейства CDK, EGFR, ERBB2, FAS, FGR, FLT4, FRK, FYN, НСК, HIF1A, HRAS, HSP90AA1, HSP90AA1, HSPA4, KDR, KIF11, KIF11, KIF20A, KIF21A, KIF25, KIT, KRAS, LCK, LYN, МАРК 1, MET, MYC, MYH1, MYOIG, NRAS, NTRK1, PDGFB, PDGFRA, PDGFRB, PKN3, PLK1, RAF1, RBI, RET, RRM1, RRM2, SRC, TNF, TPM2, TYR03, VEGFA, VEGFB, VEGFC, YES1 и ZAP70 или их фрагмента или варианта. В других вариантах реализации изобретения молекула ДНК-мишени содержит ген, которых мутировал в раковый. Типовые гены, которые мутировали в раковые включают без ограничения: AIM1, АРС, BRCA1, BRCA2, CDKN1B, CDKN2A, FAS, представителей семейства FZD, HNF1A, НОРХ, KLF6, MEN1, MLH1, NTRK1, PTEN, RARRES1, RBI, SDHB, SDHD, SFRP1, представителей семейства ST, TNF, ТР53, ТР63, ТР73, VBP1, VHL, представителей семейства WNT, BRAF, CTNNB1, PIK3CA, PIK3R1, SMAD4 и YPEL3. В некоторых вариантах реализации изобретения молекула ДНК-мишени содержит ген, выбранный из: AIM1, АРС, BRCA1, BRCA2, CDKN1B, CDKN2A, FAS, представителя семейства FZD, HNF1A, HOPX, KLF6, MEN1, MLH1, NTRK1, PTEN, RARRES1, PB1, SDHB, SDHD, SFRP1, представителя семейства ST, TNF, TP53, TP63, TP73, VBP1, VHL, представителя семейства WNT, BRAF, CTNNB1, PIK3CA, PIK3R1, SMAD4 и YPEL3 или их фрагмента или варианта. В одном варианте реализации изобретения способ дополнительно включает введение пациенту терапевтически эффективного количества репарационной матрицы.

Мутации определенных генов могут увеличивать вероятность того, что клетка станет раковой. Однако, в некоторых ситуациях, инактивация ассоциированного с раковым заболеванием гена в нераковых клетках может иметь отрицательный результат, например, если целесообразным является получение немутировавшей формы ассоциированного с раковым заболеванием гена. В настоящее время обнаружено, что ген-редактирующие белки могут применяться для специфической инактивации, частичной или полной, мутировавших форм генов. Типовые ассоциированные с раковыми заболеваниями мутации включают без ограничения: ALK (F1174, R1275), APC (R876, Q1378, R1450), BRAF (V600), CDKN2A (R58, R80, Н83, D84, Е88, D108G, WHO, PI 14), CTNNB1 (D32, S33, G34, S37, Т41 или S45), EGFR (G719, Т790, L858), EZH2 (Y646), FGFR3 (S249, Y373), FLT3 (D835), GNAS (R201), HRAS (G12, G13, Q61), IDH1 (R132), JAK2 (V617), KIT (D816), KRAS (G12, G13), NRAS (G12, G13, Q61), PDGFRA (D842), PIK3CA (E542, E545, H1047), PTEN (R130) и TP53 (R175, H179, G245, R248, R249, R273, W282). Следовательно, некоторые варианты реализации изобретения относятся к ген-редактирующемубелку, который связывается с ассоциированной с заболеванием мутацией. В одном варианте реализации изобретения ген-редактирующий белок связывается с ДНК, содержащей специфическую мутацию с большей аффинностью, чем с ДНК, которая не содержит данную мутацию. В другом варианте реализации изобретения заболевание представляет собой рак.

Нейродегенеративные заболевания, включая болезнь Альцгеймера, болезнь Паркинсона и деменцию с тельцами Леви, характеризуются прогрессирующей потерей функционирования и/или гибелью клеток центральной и/или периферической нервных систем. Прогрессирование заболевания может сопровождаться накоплением обогащенных белком бляшек, которые могут содержать белок α-синуклеин (кодируемый у людей геном SNCA). В результате исследователи стремятся разработать лекарственные средства, которые могут разрушить эти бляшки, например, с помощью антитела, которое связывается с бляшкой и маркирует ее для разрушения иммунной системой. Однако, во многих случаях разрушение бляшек дает слабый эффект или не оказывает влияния на симптомы пациента или прогрессирование болезни. В настоящее время обнаружено, что отсутствие успеха существующих видов терапии, которые нацелены на уничтожение ассоциированных с заболеванием бляшек, происходит, в частности, из-за неспособности нервной системы восстанавливать повреждения клеток, которые происходят на ранних стадиях образования бляшек. Дополнительно было обнаружено, что индукция экспрессии клеткой одного или более ген-редактирующих белков, которые нацелены на ген SNCA, может привести к разрушению гена SNCA, может индуцировать экспрессию клеткой устойчивого к образованию бляшек варианта белка α-синуклеина, может замедлить или остановить рост нейродегенеративных ассоциированных с заболеваниями бляшек, может защищать клетку и соседние клетки от повреждающего действия нейродегенеративных ассоциированных с заболеваниями бляшек, может замедлить или остановить прогрессирование нейродегенеративных заболеваний, включая болезнь Альцгеймера, болезнь Паркинсона и деменцию с тельцами Леви, и может привести к ослаблению симптомов и/или улучшению функционирования пациентов с нейродегенеративными заболеваниями, включая болезнь Альцгеймера, болезнь Паркинсона и деменцию с тельцами Леви. Другие нейродегенеративные заболевания включают, например, потерю зрения, включая слепоту, потерю слуха, включая глухоту, нарушения равновесия, потерю вкуса и/или запаха и другие сенсорные нарушения. Следовательно, некоторые варианты реализации изобретения относятся к ген-редактирующемубелку, который нацелен на ген SNCA. В одном варианте реализации изобретения ген-редактирующий белок связывается с одним или более участков гена SNCA. В другом варианте реализации изобретения ген-редактирующий белок связывается с одной или более последовательностей нуклеиновых кислот, которые кодируют SEQ ID NO: 51 или ее биологически активный фрагмент, вариант или аналог. Другие варианты реализации изобретения относятся к способу лечения нейродегенеративного заболевания, включающий введение пациенту терапевтически эффективного количества ген-редактирующего белка или нуклеиновой кислоты, кодирующей ген-редактирующий белок, причем данный ген-редактирующий белок способен связываться с нуклеотидной последовательностью, которая кодирует белок, образующий ассоциированные с заболеванием бляшки, и данный способ приводит к уменьшению ассоциированных с заболеванием бляшек в организме пациента и/или задержке или остановке прогрессирования заболевания. В одном варианте реализации изобретения нуклеотидная последовательность содержит ген SNCA. В другом варианте реализации изобретения нуклеотидная последовательность кодирует а-синуклеин. В дополнительном варианте реализации изобретения нейродегенеративное заболевание выбирают из: болезни Паркинсона, болезни Альцгеймера и деменции.

Некоторые варианты реализации изобретения относятся к способу идентификации болезнетворного токсического вещества, включающему трансфекцию клетки ген-редактирующим белком или нуклеиновой кислотой, кодирующей ген-редактирующий белок, для изменения последовательности ДНК клетки, причем данная измененная последовательность ДНК обеспечивает восприимчивость к заболеванию; приведение клетки в контакт с предполагаемым болезнетворным токсическим веществом и оценку степени, с которой данная клетка проявляет фенотип, ассоциированный с данным заболеванием. В одном варианте реализации изобретения заболевание является нейродегенеративным заболеванием, аутоиммунным заболеванием, респираторным заболеванием, репродуктивным нарушением или раком. Другие варианты реализации изобретения относятся к способу оценки безопасности терапевтической субстанции, включающему трансфекцию клетки ген-редактирующим белком или нуклеиновой кислотой, кодирующей ген-редактирующий белок, для изменения последовательности ДНК клетки, причем данная измененная последовательность ДНК обеспечивает восприимчивость к одному или более токсических воздействий терапевтической субстанции; приведение клетки в контакт с данной терапевтической субстанцией и измерение одного или более токсических воздействий данной терапевтической субстанции на эту клетку. Другие варианты реализации изобретения относятся к способу оценки эффективности терапевтической субстанции, включающему трансфекцию клетки ген-редактирующим белком или нуклеиновой кислотой, кодирующей ген-редактирующий белок, для изменения последовательности ДНК клетки, причем данная измененная последовательность ДНК вызывает проявление клеткой одного или более ассоциированных с заболеваниями фенотипов; приведение клетки в контакт с данной терапевтической субстанцией и измерение степени, с которой снижается проявление одного или более ассоциированных с заболеваниями фенотипов.

В некоторых вариантах реализации изобретения у пациента диагностируют протеопатию. Типовые протеопатии и гены, ассоциированные с протеопатиями, представлены в Таблице 6, включены в качестве примера и не являются ограничивающими. В одном варианте реализации изобретения протеопатия выбрана из: амилоидоза АА (вторичного), болезни Александера, болезни Альцгеймера, амиотрофического латерального склероза, артериального медиального амилоидоза, амилоидоза ΑpοΑΙ, амилоидоза ApoAII, амилоидоза ApoAIV, фибриногенного амилоидоза, предсердечного амилоидоза, церебральной аутосомно-доминантной артериопатии с подкорковыми инфарктами и лейкоэнцефалопатией, церебральной β-амилоидной ангиопатией, диализного амилоидоза, семейной амилоидной кардиомиопатии, семейной амилоидной полинейропатии, семейного амилоидоза (финского типа), семейной британской деменции, семейной датской деменции, лобно-височной лобарной дегенерации, наследственной церебральной амилоидной ангиопатии, наследственной решетчатой дегенерации роговицы, болезни Хантингтона, миозита/миопатии с включенными тельцами, лизоцимного амилоидоза, медуллярной карциномы щитовидной железы, одонтогенного опухолевого амилоидоза (Пинборга), болезни Паркинсона, пролактиномы гипофиза, прионных заболеваний, легочного альвеолярного протеиноза, дегенерации ганглиозных клеток сетчатки при глаукоме, пигментной дистрофии сетчатки с мутациями родопсина, старческого системного амилоидоза, серпинопатий, синуклеинопатий, тауопатий, диабета II типа, деменции боксеров (хронической травматической энцефалопатии), лобно-височной деменции, лобно-височной лобарной дегенерации, ганглиоцитомы, ганглиоглиомы, болезни Галлервордена-Шпатца, свинцовой энцефалопатии, липофусциноза, болезни Литико-Бодига, менингиоангиоматоза, прогрессирующего надъядерного паралича, подострого склерозирующего панэнцефалита, спутанно-преобладающей деменции и туберозного склероза. В других вариантах реализации изобретения молекула ДНК-мишени содержит ген, выбранный из: ΑΡΟΑ1, АРОА2, АРОА4, АРР, В2М, CALCA, CST3, FGA, FGB, FGG, FUS, GFAP, GSN, ΗΤΤ, IAPP, ΙΤΜ2Β, LYZ, МАРТ, MFGE8, NOTCH3, NPPA, ODAM, PRL, PRNP, RHO, представителя семейства SAA, представителя семейства SERPIN, SFTPC, SNCA, представителя семейства SOD, TARDBP, TGFBI и TRR или их фрагмента или варианта. В дополнительном варианте реализации изобретения молекула ДНК-мишени кодирует ген, выбранный из Таблицы 6 или его фрагмент, а у пациента диагностируют соответствующее заболевание, указанное в Таблице 6.

Типовые тауопатии включают, но не ограничиваются болезнью Альцгеймера, болезнью Паркинсона и болезнью Хантингтона Другие примеры тауопатий включают: деменцию боксеров (хроническая травматическая энцефалопатия), лобно-височную деменцию, лобно-височную лобарную дегенерацию, ганглиоцитому, ганглиоглиому, болезнь Галлервордена-Шпатца, свинцовую энцефалопатию, липофусциноз, болезнь Литико-Бодига, менингиоангиоматоз, прогрессирующий надъядерный паралич, подострый склерозирующий панэнцефалит, спутанно-преобладающую деменцию и туберозный склероз. В некоторых вариантах реализации изобретения у пациента диагностируют тауопатию. В одном варианте реализации изобретения тауопатия выбрана из: болезни Альцгеймера, болезни Паркинсона и болезни Хантингтона. В другом варианте реализации изобретения тауопатия выбрана из: деменции боксеров (хроническая травматическая энцефалопатия), лобно-височной деменции, лобно-височной лобарной дегенерации, ганглиоцитомы, ганглиоглиомы, болезни Галлервордена-Шпатца, свинцовой энцефалопатии, липофусциноза, болезни Литико-Бодига, менингиоангиоматоза, прогрессирующего надъядерного паралича, подострого склерозирующего панэнцефалита, спутанно-преобладающей деменции и туберозного склероза.

Аутоиммунные заболевания, включающие без ограничения волчанку, множественный склероз (MS), амиотрофический латеральный склероз (ALS) и реакцию отторжение трансплантанта, характеризуются симптомами, вызванными, в частности, одним или более элементов иммунной системы, атакующих неинфицированные и нераковые изогенные клетки и/или ткани. Следовательно, некоторые варианты реализации изобретения относятся к способу лечения аутоиммунного заболевания. В одном варианте реализации изобретения аутоиммунное заболевание выбрано из: волчанки, множественного склероза (MS), амиотрофического латерального склероза (ALS) и реакции отторжение трансплантанта. В другом варианте реализации изобретения молекула ДНК-мишени кодирует полипептидную последовательность, которая может распознаваться иммунной системой хозяина.

Инфекционные агенты могут содержать последовательности нуклеиновых кислот, которые отсутствуют в организме хозяина. В настоящее время известно, что ген-редактирующие белки могут применяться для удаления, снижения количества или иного изменения, полностью или частично, инфекционных агентов и/или последствий инфекции, и при таком применении ген-редактирующие белки и нуклеиновые кислоты, кодирующие ген-редактирующие белки, могут заменять сильные противораковые терапевтические средства. Возбудители инфекций, которых можно лечить таким способом, включают без ограничения: вирусы, бактерии, плесневые грибы, дрожжи и паразиты. Следовательно, некоторые варианты реализации изобретения относятся к способу индукции экспрессии клеткой ген-редактирующего белка, который нацелен на одну или более последовательностей, ассоциированных с возбудителями инфекций. В одном дополнительном варианте реализации изобретения клетка является одной из клеток: бактериальной клетки, клетки плесневого гриба, дрожжевой клетки и клетки паразита. В другом варианте реализации изобретения клетка является клеткой млекопитающего. В дополнительном варианте реализации изобретения клетка является клеткой человека. Другие варианты реализации изобретения относятся к терапевтической композиции, содержащей нуклеиновую кислоту, которая кодирует один или более ген-редактирующих белков, которые нацелены на одну или более последовательностей, связанных с возбудителями инфекций. Некоторые варианты реализации изобретения относятся к способу индукции экспрессии клеткой ген-редактирующего белка, который нацелен на одну или более последовательностей, связанных с восприимчивостью или устойчивостью к инфекции. Другие варианта реализации изобретения относятся к терапевтической композиции, содержащей нуклеиновую кислоту, которая кодирует один или более ген-редактирующих белков, которые нацелены на одну или более последовательностей, связанных с восприимчивостью или устойчивостью к инфекции. В одном варианте реализации изобретения клетку трансфецируют нуклеиновой кислотой, кодирующей один или более ген-редактирующих белков, и нуклеиновой кислотой, кодирующей одну или более репарационных матриц. В другом варианте реализации изобретения репарационная матрица содержит ген устойчивости или его биологически активный фрагмент или вариант. В дополнительном варианте реализации изобретения репарационная матрица содержит последовательность, вызывающую РНКи (интерференцию РНК). В еще одном дополнительном варианте реализации изобретения последовательность, вызывающая РНКи, является кшРНК (короткая шпилечная РНК). Другие варианты реализации изобретения относятся к способу лечения инфекционного заболевания, который включает введение пациенту терапевтически эффективного количества ген-редактирующего белка или нуклеиновой кислоты, кодирующей ген-редактирующего белок, причем данный ген-редактирующий белок способен связываться с одной и более нуклеотидных последовательностей, которые имеются у возбудителя инфекции.

В настоящее время известно, что соотношение событий негомологичных соединений концов к событиям гомологичных рекомбинаций может изменяться путем изменения экспрессии и/или функционирования одного или более компонентов механизма репарации ДНК. Неограничивающие примеры генов, которые кодируют компоненты механизма репарации ДНК, включают без ограничения: ген Artemis, BLM, CtIP, ДНК-ПК, ДНК-ПКс, EXO1, FEN1, Ku70, Ku86, LIGIII, LIGIV, MRE11, NBS1, PARP1, RAD50, RAD54B, XLF, XRCC1, XRCC3 и XRCC4. Следовательно, некоторые варианты реализации изобретения относятся к способу изменения экспрессии и/или функционирования одного или более компонентов механизма репарации ДНК. В некоторых вариантах реализации изобретения данная экспрессия и/или функционирование увеличивается. В других вариантах реализации изобретения экспрессия и/или функционирование уменьшается. ДНК-зависимая протеинкиназа (ДНК-ПК) является компонентом механизма репарации ДНК при негомологичном соединении концов. В настоящее время обнаружено, что репарация посредством гомологичной рекомбинации может быть увеличена путем изменения экспрессии ДНК-ПК. В одном варианте реализации изобретения приводят в контакт клетку с ингибитором ДНК-ПК. Типовые ингибиторы ДНК-ПК включают без ограничения: соединение 401 (2-(4-морфолинил)-4Н-пиримидо[2,1-а]изохинолин-4-он), DMNB, IC87361, LY294002, NU7026, NU7441, OK-1035, PI 103 гидрохлорид, ванилин и вортманнин.

Генетические мутации могут влиять на длину белкового продукта, к примеру, путем вставки терминирующего кодона и/или разрушения открытой рамки считывания. Некоторые заболевания, включая мышечную дистрофию Дюшенна, могут быть вызваны образованием усеченных белков и/или белков со сдвигом рамки считывания. В настоящее время обнаружено, что ген-редактирующие белки могут применяться для лечения заболеваний, которые связаны с образованием одного или более усеченных белков и/или белков со сдвигом рамки считывания. В одном варианте реализации изобретения ген-редактирующий белок создает двухцепочечный разрыв в пределах около 1 т.п.н. или около 0,5 т.п.н. или около 0,1 т.п.н. экзона, содержащего мутацию, способствующую развитию заболевания. В другом варианте реализации изобретения ген-редактирующий белок является коэкспрессируемым с последовательностью ДНК, содержащей одну или более последовательностей дикого типа. В некоторых вариантах реализации изобретения ДНК является одноцепочечной. В других вариантах реализации изобретения ДНК является двухцепочечной. Заболевания, вызванные экспрессией усеченных белков, могут излечиваться пропуском экзонов. В настоящее время обнаружено, что ген-редактирующие белки могут применяться для индукции пропуска экзонов. В одном варианте реализации изобретения ген-редактирующий белок создает двухцепочечный разрыв в пределах около 1 т.п.н. или около 0,5 т.п.н. или в около 0,1 т.п.н. экзона, который необходимо пропустить. В другом варианте реализации изобретения ген-редактирующий белок создает двухцепочечный разрыв в пределах около 1 т.п.н. или около 0,5 т.п.н. или около 0,1 т.п.н. интрона перед (по направлению считывания) экзоном, который необходимо пропустить. В другом варианте реализации изобретения ген-редактирующий белок создает двухцепочечный разрыв в пределах около 1 т.п.н. или около 0,5 т.п.н. или около 0,1 т.п.н. сайта сплайс-акцептора интрона перед (по направлению считывания) экзоном, который необходимо пропустить.

Нуклеиновые кислоты, включая липосомальные составы, содержащие нуклеиновые кислоты, при доставке in vivo, могут накапливаться в печени и/или селезенке. В настоящее время известно, что нуклеиновые кислоты, кодирующие ген-редактирующие белки, могут модулировать экспрессию генов в печени и селезенке, и нуклеиновые кислоты при таком применении могут заменять сильные терапевтические средства для лечения заболеваний печени и селезенки. Следовательно, некоторые варианты реализации изобретения относятся к способу лечения заболевания печени и селезенки путем доставки в организм пациента нуклеиновой кислоты, кодирующей один или более ген-редактирующих белков. Другие варианты реализации изобретения относятся к терапевтической композиции, содержащей нуклеиновую кислоту, кодирующую один или более ген-редактирующих белков для лечения заболевания печени и/или селезенки. Заболевания и патогенные состояния печени и/или селезенки, которые могут излечиваться таким способом, включают без ограничения: гепатит, индуцированное алкоголем заболевание печени, индуцированное лекарствами заболевание печени, вирусную инфекцию Эпштейна-Барр, аденовирусную инфекцию, цитомегаловирусную инфекцию, токсоплазмоз, пятнистую лихорадку Скалистых гор, неалкогольную жировую дистрофию печени, гемохроматоз, болезнь Вильсона, болезнь Жильбера и рак печени и/или селезенки. Другие примеры последовательностей (включая гены, семейства генов и локусы), которые могут быть мишенью для ген-редактирующих белков, при использовании способов настоящего изобретения, изложены в Таблице 7, приведены в качестве примера и не являются ограничивающими.

Некоторые варианты реализации изобретения относятся к комбинированной терапии, включающей применение одной или более терапевтических композиций настоящего изобретения и одного или более дополнительных видов терапий. Типовые виды дополнительных терапии изложены в Таблице 8 и в Таблице 5 предварительной заявки США №61/721302, содержание которой включено в данный документ посредством ссылки, приведены в качестве примера и не являются ограничивающими.

Фармацевтические препараты могут дополнительно включать реагенты доставки (также называемые «агентами для трансфекции») и/или вспомогательные вещества. Фармацевтически приемлемые реагенты для доставки, вспомогательные вещества и способы их получения и применения, включая способы получения и введения фармацевтических препаратов пациентам (также именуемые «субъекты») хорошо известны в данной области техники и изложены во многочисленных публикациях, включая, к примеру, опубликованную заявку патента США №2008/0213377; которая включена в данный документ в полном объеме посредством ссылки.

К примеру, представленные композиции могут быть получены в форме фармацевтически приемлемых солей. Такие соли включают перечисленные, например, в публикациях J. Pharma. Sci. 66, 2-19 (1977) и The Handbook of Pharmaceutical Salts; Properties, Selection, and Use. P. H. Stahl and C. G. Wermuth (eds.), Verlag, Zurich (Switzerland) 2002, которые включены в данный документ в полном объеме посредством ссылки. Неограничивающие примеры фармацевтически приемлемых солей включают: сульфат, цитрат, ацетат, оксалат, хлорид, бромид, йодид, нитрат, бисульфат, фосфат, кислый фосфат, изоникотинат, лактат, салицат, кислый цитрат, тартрат, олеат, таннат, пантотенат, битартрат, аскорбат, сукцинат, малеат, гентизинат, фумарат, глюконат, глюкаронат, сахарат, формиат, бензоат, глутамат, метансульфонат, этансульфонат, бензолсульфонат, п-толуолсульфонат, камфорсульфонат, памоат, фенилацетат, трифторацетат, акрилат, хлорбензоат, динитробензоат, гидроксибензоат, метоксибензоат, метилбензоат, о-ацетоксибензоат, нафталин-2-бензоат, изобутират, фенилбутират, α-гидроксибутират, бутин-1,4-дикарбоксилат, гексин-1,4-дикарбоксилат, капрат, каприлат, циннамат, гликолят, гептаноат, гиппурат, малат, гидроксималеат, малонат, манделат, мезилат, никотинат, фталат, терафталат, пропиолат, пропионат, фенилпропионат, себацинат, суберат, п-бромбензолсульфонат, хлорбензолсульфонат, этилсульфонат, 2-гидроксиэтилсульфонат, метилсульфонат, нафталин- 1-сульфонат, нафталин-2-сульфонат, нафталин-1,5-сульфонат, ксилолсульфонат, соли винной кислоты, соли гидроксидов щелочных металлов, таких как натрий, калий и литий; соли гидроксидов щелочноземельных металлов, таких как кальций и магний; соли гидроксидов других металлов, таких как алюминий и цинк; соли аммиака и органических аминов, таких как незамещенные или гидроксизамещенные моно-, ди- или триалкиламины, дициклогексиламин; трибутиламин; пиридин; N-метил, N-этиламин; диэтиламин; триэтиламин; моно-, бис- или трис-(2-OH-низшие алкиламины), такие как моно-, бис- или трис-(2-гидроксиэтил)амин, 2-гидрокси-трет-бутиламин или трис-(гидроксиметил)метиламин, Ν,Ν-ди-низший алкил-N-(гидроксил-низший алкил)-амины, такие как N,N-диметил-N-(2-гидроксиэтил)амин или три-(2-гидроксиэтил)амин; N-метил-D-глюкамин и соли амнокислот, таких как аргинин, лизин и тому подобные.

Представленные фармацевтические композиции могут содержать вспомогательные вещества, такие как вода и масла, включая полученные из нефти, животного, растительного или синтетического происхождения, такие как масло арахиса, масло сои, минеральное масло, кунжутное масло и тому подобные. Фармацевтические вспомогательные вещества могут быть представлены, например, солью, аравийской камедью, желатином, крахмальной пастой, тальком, кератином, коллоидным кремнеземом, мочевиной и подобными веществами. Кроме того, могут использоваться вспомогательные, загущающие, смазывающие и окрашивающие агенты. В одном варианте реализации изобретения фармацевтически приемлемые вспомогательные вещества при введении пациенту являются стерильными. Подходящие фармацевтические вспомогательные вещества также включают: крахмал, глюкозу, лактозу, сахарозу, желатин, солод, рис, муку, мел, силикагель, натрия стеарат, глицерина моностеарат, тальк, натрия хлорид, сухое обезжиренное молоко, глицерин, пропиленгликоль, воду, этанол и тому подобные. Любой агент, описанный в данном документе, если требуется, может также содержать минимальные количества смачивающих или эмульгирующих агентов или буферных агентов для поддержания pH.

В различных вариантах реализации изобретения композиции, описанные в данном документе, могут вводиться в эффективной дозе, к примеру, от около 1 мг/кг до около 100 мг/кг, от около 2,5 мг/кг до около 50 мг/кг или от около 5 мг/кг до около 25 мг/кг. Точное определение того, какой должна быть эффективная доза, может основываться на факторах индивидуальных для каждого пациента, включая его вес, возраст и вид заболевания. Дозировки могут быть легко установлены средними специалистами в данной области техники согласно этого описания и знаний в данной области. Например, дозы могут быть определены согласно ссылке Physicians' Desk Reference, 66th Edition, PDR Network; 2012 Edition (Декабрь 27, 2011), содержание которой включено в полном объеме посредством ссылки.

Активные композиции настоящего изобретения могут включать классические фармацевтические препараты. Введение таких композиций согласно настоящему изобретению может осуществляться посредством любого обычного пути насколько данная ткань-мишень является доступной посредством такого пути введения. Этот путь включает оральный, назальный или буккальный. В альтернативном варианте, введение может осуществляться внутрикожной, подкожной, внутримышечной, внутрибрюшинной или внутривенной инъекцией, или прямой инъекцией в раковую ткань. Агенты, описанные в данном документе, также могут вводиться с помощью катетерных систем. Такие композиция обычно следует вводить как фармацевтически приемлемые композиции, описанные в данном документе.

При разработке состава, растворы могут вводиться способом, совместимым с дозированным составом в таком количестве, которое является терапевтически эффективным. Составы могут легко вводиться в виде различных дозированных форм, таких как инъекционные растворы, капсулы с регулируемым высвобождением и им подобных. Для парентерального введения, например, в виде водного раствора, раствор, как правило, подходящим образом забуферяют, а жидкий растворитель предварительно готовят изотоническим, например, с помощью достаточного количества соли или глюкозы. Такие водные растворы могут применяться, например, для внутривенного, внутримышечного, подкожного или внутрибрюшинного введения. Преимущественно применяют стерильные водные среды, как известные специалистам в данной области техники, особенно в свете настоящего раскрытия.

Типичные пациенты или субъекты относятся к любым позвоночным включая без ограничения: людей и других приматов {например, шимпанзе и других высших обезьян и видов обезьян), сельскохозяйственных животных {например, крупный рогатый скот, овцы, свиньи, козы и лошади), домашних млекопитающих животных {например, собаки и кошки), лабораторных животных {например, грызуны, такие как мыши, крысы и морские свинки) и птиц {например, домашние, дикие и охотничьи птицы, такие как куры, индейки и другие куриные, утки, гуси и тому подобные). В некоторых вариантах реализации изобретения субъектом является млекопитающее. В некоторых вариантах реализации изобретения субъектом является человек.

Это изобретение дополнительно проиллюстрировано следующими не исключающими другое применение примерами.

ПРИМЕРЫ

Пример 1. Синтез РНК

РНК, кодирующая белки человека Oct4, Sox2, Klf4, с-Мус-2 (Т58А) и Lin28 или TALEN, нацеленная на гены человека ХРА, CCR5, TERT, MYC и BIRC5, и содержащая различные комбинации канонических и неканонических нуклеотидов, синтезировали на матрицах ДНК с использованием набора Т7 для синтеза РНК с большим выходом и набора с системой кэпирования осповакцины с помощью 2'-O-метилтрансферазы кэппирования РНК (полученные в компании New England Biolabs Inc.), в соответствии с инструкциями производителя и ранее описанные в изобретениях настоящих изобретателей (заявка США 13/465490 (сейчас патент США №8497124), предварительная заявка США №61/637570, предварительная заявка США №61/664494, международная заявка №PCT/US12/67966, предварительная заявка США №61/785404, заявка США №13/931251 и предварительная заявка США №61/842874, содержание которых включено в данный документ в полном объеме посредством ссылки) (Таблица 9, ФИГ. 1А, ФИГ. 1В и ФИГ. 15). Полученную РНК далее разбавляли водой без нуклеазной активности до концентрации между 100 нг/мкл и 200 нг/мкл. В некоторых экспериментах добавляли ингибитор РНКазы (Superase⋅In, Life Technologies Corporation) в концентрации 1 мкл/100 мкг РНК. Растворы РНК хранили при 4°С. Для экспериментов по репрограммированию препараты РНК, кодирующие белки Oct4, Sox2, Klf4, с-Мус-2 (Т58А) и Lin28, смешивали в молекулярном соотношении 3:1:1:1:1.

Пример 2. Трансфекция клеток с помощью синтетической РНК

Для проведения трансфекции в 6-луночных планшетах сначала отдельно разбавляли 2 мкг РНК и 6 мкл реагента для трансфекции (Lipofectamine RNAiMAX, Life Technologies Corporation) в среде для комплексообразования (Opti-MEM, Life Technologies Corporation или DMEM/F12 + 10 мкг/мл инсулина + 5,5 мкг/мл трансферрина + 6,7 нг/мл селенита натрия + 2 мкг/мл этаноламина) до получения суммарного объема в каждой лунке 60 мкл. Затем смешивалиразбавленную РНК и реагент для трансфекции и инкубировали в течение 15 мин при комнатной температуре, в соответствии с инструкциями производителя реагента для трансфекции. После этого добавляли комплексы к культуре клеток. В каждую лунку 6-луночного планшета, которая уже содержала 2 мл среды для трансфекции на лунку, добавляли между 30 мкл и 240 мкл комплексов. Планшеты осторожно встряхивали для распределения комплексов по всему объему лунок. Перед замещением среды свежей средой для трансфекции (2 мл/лунку) клетки инкубировали с комплексами 4 часа в течение ночи. Объемы масштабировали для проведения трансфекции в 24-луночных и 96-луночных планшетах. В альтернативном варианте, в пределах между 0,5 мкг и 5 мкг РНК и в пределах 2-3 мкл реагента для трансфекции (Lipofectamine 2000, Life Technologies Corporation) на мкг РНК сначала по отдельности разбавляли в среде для комплексообразования (Opti-MEM, Life Technologies Corporation или DMEM/F12 + 10 мкг/мл инсулина + 5,5 мкг/мл трансферрина + 6,7 нг/мл селенита натрия+2 мкг/мл этаноламина) до получения суммарного объема в каждой лунке между 5 мкл и 100 мкл. Затем смешивали разбавленную РНК и реагент для трансфекции и инкубировали в течение 10 мин при комнатной температуре. После этого добавляли комплексы к культуре клеток. В каждую лунку 6-луночного планшета, которая уже содержала 2 мл среды для трансфекции на лунку, добавляли между 10 мкл и 200 мкл комплексов. В некоторых экспериментах вместо среды для трансфекции использовали среды DMEM + 10% FBS или DMEM + 50% FBS. Планшеты осторожно встряхивали для распределения комплексов по всему объему лунок. Клетки инкубировали с комплексами 4 часа в течение ночи. В некоторых экспериментах среду замещали свежей средой для трансфекции (2 мл/лунку) через 4 ч или 24 ч после трансфекции.

Пример 3. Токсичность и способность обеспечивать трансляцию белков синтетической РНК, содержащей неканонические нуклеотиды

Первичные фибробласты человека трансфецировали в соответствии с Примером 2 с помощью РНК, синтезированной в соответствии с Примером 1. Клетки фиксировали и красили через 20-24 ч после трансфекции с использованием антител против белка Oct4. Относительную токсичность РНК определили путем оценки плотности клеток во время фиксации.

Пример 4. Состав среды для трансфекции

Среду для культивирования клеток разрабатывали для обеспечения эффективной трансфекции клеток с помощью нуклеиновых кислот и эффективного репрограммирования («среда для трансфекции»):

DMEM/F12 + 15 мМ ГЭПЭС + 2 мМ L-аланил-L-глютамина + 10 мкг/мл инсулина + 5,5 мкг/мл трансферрина + 6,7 нг/мл селенита натрия + 2 мкг/мл этаноламина + 50 мкг/мл гидрата сесквимагниевой соли 2-фосфат-L-аскорбиновой кислоты + 4 мкг/мл холестерина + 1 мкМ гидрокортизона + 25 мкг/мл моноолеата полиоксиэтиленсорбитана + 2 мкг/мл ацетата D-альфа-токоферола + 20 нг/мл bFGF + 5 мг/мл обработанного сывороточного альбумина человека.

Вариант этой среды разрабатывали для обеспечения устойчивого длительного культивирования разнообразных типов клеток, включая плюрипотентные стволовые клетки («поддерживающая среда»).

DMEM/F12 + 2 мМ L-аланил-L-глютамина + 10 мкг/мл инсулина + 5,5 мкг/мл трансферрина + 6,7 нг/мл селенита натрия + 2 мкг/мл этаноламина + 50 мкг/мл гидрата сесквимагниевой соли 2-фосфат-L-аскорбиновой кислоты + 2 мкг/мл ацетата D-альфа-токоферола + 20 нг/мл bFGF + 2 нг/мл TGF-β1.

Если не указано иное, во всех описанных в данном документе Примерах, в качестве среды для трансфекции использовали среду, в которой обработанный сывороточный альбумин человека получен путем добавления 32 мМ раствора октаноата натрия, с последующим нагреванием при 60°С в течение 4 ч и с последующей обработкой ионообменной смолой (AG501-X8(D), Bio-Rad Laboratories Inc.) в течение 6 ч при комнатной температуре, с последующей обработкой покрытым декстраном активированным углем (С6241, Sigma-Aldrich Co. LLC.) в течение ночи при комнатной температуре, с последующим центрифугированием, фильтрованием и доведением до концентрации 10% раствора водой без нуклеазной активности, с последующим добавлением в среду других компонентов. Если не указано иное, в экспериментах по репрограммированию клетки высеяли на планшеты без покрытия в среде DMEM + 10%-20% сыворотки или на покрытые фибронектином и витронектином планшеты в среду для трансфекции. Если не указано иное, среду для трансфекции не кондиционировали. Принимают во внимание, что состав среды для трансфекции может быть адаптирован в соответствии с потребностями специфических типов клеток, которые необходимо культивировать. Дополнительно принимают во внимание, что обработанный сывороточный альбумин человека может быть заменен другим обработанным альбумином, например, обработанным сывороточным альбумином быка без отрицательного влияния на функциональные свойства среды. Дополнительно принимают во внимание, что вместо или в дополнение L-аланил-L-глютамина могут использоваться другие источники глутамина, к примеру, L-глутамин, вместо или в дополнение ГЭПЭС могут использоваться другие буферные системы, к примеру, фосфат, бикарбонат и т.п., вместо или в дополнение селениту натрия могут использоваться другие формы селена, к примеру, селенистая кислота, вместо или в дополнение гидрата сесквимагниевой соли 2-фосфат-L-аскорбиновой кислоты и ацетата D-альфа-токоферола могут использоваться другие антиоксиданты, к примеру, L-аскорбиновая кислота, вместо или в дополнение моноолеата полиоксиэтиленсорбитана могут использоваться другие сурфактанты, к примеру, Плюроник F-68 и/или Плюроник F-127, вместо или в дополнение среды DMEM/F12 могут использоваться другие основные среды, к примеру, MEM, DMEM и т.п., а другие компоненты среды для культивирования могут изменяться с течение времени, к примеру, путем использования среды без TGF-β от 0 дня до 5 дня и с дальнейшим использованием среды, содержащей 2 нг/мл TGF-β, после 5 дня культивирования без отрицательного влияния на функциональные свойства среды. Дополнительно принимают во внимание, что могут добавляться другие ингредиенты, к примеру, жирные кислоты, лизофосфатидиловая кислота, лизосфингомиелин, сфингозин-1-фосфат, другие сфинголипиды, ингибиторы ROCK, включая соединение Y-27632 и тиазовивин, представители семейства белков TGF-β/NODAL, IL-6, представители семейства белков Wnt и т.д., в соответствующих концентрациях без отрицательного влияния на функциональные свойства среды, а в среду в соответствующих концентрациях могут добавляться другие ингредиенты, известные как повышающие или ингибирующие рост специфических типов клеток и/или агонисты и/или антагонисты белков или других молекул, известных как повышающие или ингибирующие рост специфических типов клеток, при использовании для таких типов клеток без отрицательного влияния на функциональные свойства среды, к примеру, сфингозин-1-фосфат для плюрипотентных стволовых клеток. Настоящее изобретение в равной степени относится к ингредиентам, которые добавляют в виде очищенных соединений, ингредиентам, которые добавляют как часть смесей определенного состава, ингредиентам, которые добавляют как часть комплекса или смесей неопределенного состава, например, животные или растительные масла, и ингредиентам, которые добавляют путем проведения биологических процессов, например, при кондиционировании. Концентрации компонентов могут изменяться в пределах перечисленных значений, которые будут очевидными для специалистов в данной области техники без отрицательного влияния на функциональные свойства среды. Вариант среды без содержания компонентов животного происхождения получали при использовании рекомбинантных вариантов всех белковых ингредиентов и вариантов всех остальных компонентов неживотного происхождения, включая полусинтетический холестерин растительного происхождения (Avanti Polar Lipids Inc.).

Пример 5. Репрограммирование фибробластов человека с помощью синтетической РНК, содержащей неканонические нуклеотиды

Первичные неонатальные фибробласты человека высеяли в 6-луночные планшеты, покрытые рекомбинантным фибронектином человека и рекомбинантным витронектином человека (каждый разведен в среде DMEM/F12 до концентрации 1 мкг/мл, 1 мл/лунку, и инкубирован при комнатной температуре в течение 1 ч) в плотности 10000 клеток/лунку в среде для трансфекции. На следующий день клетки трансфецировали как описано в Примере 2, с помощью РНК, содержащей нуклеотиды А, 0,5 7dG, 0,5 5mU и 5mC, и дозе РНК 0,5 мкг/лунку в 1 день, 0,5 мкг/лунку во 2 день, 2 мкг/лунку в 3 день, 2 мкг/лунку в 4 день и 4 мкг/лунку в 5 день. Небольшие колонии клеток, проявившие морфологические признаки, соответствующие прохождению репрограммирования, стали видимыми не ранее 5 дня. На 6 день среду заменили поддерживающей средой. Клетки окрасили с использованием антител против белка Oct4. Ос14-положительные колонии клеток, проявившие морфологические признаки, соответствующие прохождению репрограммирования, были видимыми на всей поверхности лунки (ФИГ. 2).

Пример б. Репрограммирование первичных фибробластов взрослого человека с помощью синтетической РНК в условиях без фидера, без проведения пересевов, без применения иммуносупрессантов и без кондиционирования среды

Лунки 6-луночного планшета покрывали смесью рекомбинантного фибронектина человека и рекомбинантного витронектина человека (1 мкг/мл в среде DMEM/F12, 1 мл/лунку) в течение 1 ч при комнатной температуре. Первичные фибробласты взрослого человека высевали в покрытые лунки в среду для трансфекций при плотности 10000 клеток/лунку. Клетки культивировали при 37°С, 5% СО2 и 5% О2. Начиная со следующего дня, клетки ежедневно трансфецировали в соответствии с Примером 2 в течение 5 дней с помощью РНК, синтезированной в соответствии с Примером 1. Суммарное количество РНК, трансфецированной в каждый из 5 дней, составило, соответственно, 0,5 мкг, 0,5 мкг, 2 мкг, 2 мкг и 4 мкг. Начиная с проведения четвертой трансфекций, среду заменяли два раза в день. Через день после последней трансфекций среду заменяли средой для трансфекций с добавкой 10 мкМ соединения Y-27632. Компактные колонии с морфологическими признаками прохождения репрограммирования были видимые в каждой трансфецированной лунке на 4 день (ФИГ. 8).

Пример 7. Эффективная, быстрая деривация и репрограммирование клеток из ткани кожи взрослого человека, полученной при биопсии

Дермальную пункционную биопсию полной толщины проводили на здоровом добровольце возрастом 31 год, в соответствии с утвержденным протоколом. Вкратце, область кожи на верхней стороне левой ладони анестезировали местным введением 2,5% раствора лидокаина. Зону дезинфицировали 70% изопропанолом и проводили дермальную пункционную биопсию полной толщины с использованием пробойника диаметром 1,5 мм. Ткань промывали фосфатно-солевым буферным раствором (PBS), переносили в пробирку объемом 1,5 мл, содержащую 250 мкл TrypLE Select CTS (Life Technologies Corporation) и инкубирировали при 37°C в течение 30 мин. Потом ткань переносили в пробирку объемом 1,5 мл, содержащую 250 мкл среды DMEM/F12-CTS (Life Technologies Corporation) + 5 мг/мл коллагеназы и инкубировали при 37°С в течение 2 ч. Пинцетом удаляли эпидермис и механическим способом ресуспендировали ткань. Дважды промывали клетки средой DMEM/F12-CTS. Тому же добровольцу также проводили флеботомию и венозную кровь собирали в пробирки Vacutainer SST (Becton, Dickinson and Company). Сыворотку выделяли в соответствии с инструкциями производителя. Изогенную среду для покрытия готовили смешиванием среды DMEM/F12-CTS + 2 мМ L-аланил-L-глутамина (Sigma-Aldrich Co. LLC.) + 20% сыворотки человека. Клетки образца дермальной ткани высевали в покрытую фибронектином лунку 6-луночного планшета в изогенную среду для покрытия. Множество клеток с морфологическими признаками фибробластов присоединялось к поверхности лунки и они начинали распространяться на 2 день (ФИГ. 3А). Клетки обрабатывали и замораживали в среде Synth-a-Freeze (Life Technologies Corporation).

Клетки пересевали на 6-луночные планшеты при плотности 5000 клеток/лунку. На следующий день среду заменяли средой для трансфекции и клетки трансфецировали как описано в Примере 2 с помощью РНК, содержащей нуклеотиды А, 0,5 7dG, 0,4 5mU и 5mC, и при дозе РНК 0,5 мкг/лунку в 1 день, 0,5 мкг/лунку во 2 день, 2 мкг/лунку в 3 день, 2 мкг/лунку в 4 день и 2 мкг/лунку в 5 день. Некоторые клетки получали дополнительные трансфекции дозой 2 мкг/лунку в 6 и 7 дни. В дополнение к этому, некоторые клетки получали 2 нг/мл TGF-β1, начиная с 4 дня. На 6 день среду заменяли поддерживающей средой. Колонии клеток, проявившие морфологические признаки, соответствующие прохождению репрограммирования, стали видимыми между 5 и 10 днями (ФИГ. 3В). Колонии быстро росли и многие проявляли морфологические признаки, сходные с колониями эмбриональных стволовых клеток. (ФИГ. 3С). Колонии собирали и высевали в лунки, покрытые рекомбинантным фибронектином человека и рекомбинантным витронектином человека (каждый разведен в среде DMEM/F12 до концентрации 1 мкг/мл, 1 мл/лунку, инкубировали при комнатной температуре в течение 1 ч). Колонии быстро росли и были пересеяны для установления линий.

Пример 8. Синтез молекул RiboSlice, нацеленных на ген CCR5

Пары молекул RiboSlice, нацеленные на следующие последовательности: L1: TCATTTTCCATACAGTCAGT, L2: TTTTCCATACAGTCAGTATC, R1: TGACTATCTTTAATGTCTGG и R2: TATCTTTAATGTCTGGAAAT синтезировали в соответствии с Примером 1 (ФИГ. 4А и ФИГ. 4В). Эти пары нацеливались на сайты размером 20 п. н. в пределах гена CCR5 человека на смысловой (L1 и L2) или антисмысловой цепи (R1 и R2). Были получены следующие пары: L1 и R1, R1 и R2, L2 и R1 и L2 и R2.

Пример 9. Измерение эффективности редактирования гена CCR5 с помощью мисматч-детектирующей нуклеазы

Первичные фибробласты человека высевали в 6-луночные планшеты, покрытые рекомбинантным фибронектином человека и рекомбинантным витронектином человека (каждый разведен в среде DMEM/F12 до концентрации 1 мкг/мл, 1 мл/лунку, и инкубирован при комнатной температуре в течение 1 ч) в плотности 10000 клеток/лунку в среде для трансфекции. На следующий день клетки трансфецировали как описано в Примере 2 с помощью РНК, синтезированной в соответствии с Примером 8. Через два дня после трансфекции выделяли и очищали геномную ДНК. Участок в пределах гена CCR5 амплифицировали методом ПЦР с использованием праймеров F: AGCTAGCAGCAAACCTTCCCTTCA и R: AAGGACAATGTTGTAGGGAGCGCA. Проводили гибридизацию 150 нг амплифицированного методом ПЦР продукта со 150 нг эталонной ДНК в растворе 10 мМ Трис-Cl + 50 мМ KCl + 1,5 мМ MgCl2. Гибридизированную ДНК обрабатывали с помощью мисматч-детектирующей эндонуклеазы (SURVEYOR nuclease, Transgenomic Inc.) и полученные продукты анализировали методом электрофореза в агарозном геле (ФИГ. 4С и ФИГ. 4D).

Пример 10. Высокоэффективное редактирование генов путем повторной трансфекции с помощью молекул RiboSlice

Первичные фибробласты человека высевали на планшеты как описано в Примере 9. На следующий день клетки трансфецировали как описано в Примере 2 с помощью РНК, синтезированной в соответствии с Примером 8. На следующий день клетки в одной из лунок трансфецировали второй раз. Через два дня после второй трансфекции измеряли эффективность редактирования генов как описано в Примере 9 (ФИГ. 4Е).

Пример 11. Репрограммирование фибробластов человека путем редактирования гена CCR5 с помощью молекул RiboSlice в условиях без ДНК, без фидера, без применения иммуносупрессантов и кондиционирования

Первичные фибробласты человека высевали на планшеты как описано в Примере 9. На следующий день клетки трансфецировали как описано в Примере 2 с помощью РНК, синтезированной в соответствии с Примером 8. Приблизительно через 48 часов клетки репрограммировали в соответствии с Примером 5 с использованием РНК, синтезированной в соответствии с Примером 1. Большие колонии клеток с морфологическими характеристиками репрограммирования стали видимыми как описано в Примере 5 (ФИГ. 4F). Колонии собирали для установления линий. Клеточные линии подвергали прямому секвенированию для подтверждения успешного редактирования генов (ФИГ. 4G).

Пример 12. Персонализированная клеточная заместительная терапия, включающая применение репрограммированных редактированием генов клеток, для лечения ВИЧ/СПИД

Клетки кожи пациента получают как ген-редактированные и репрограммированные гемопоэтическими клетками в соответствии с ранее описанными изобретениями настоящих изобретателей (предварительная заявка США №13/465490, предварительная заявка США №61/637570 и предварительная заявка США №61/664494) и/или Примером 11. Потом клетки с помощью ферментов снимают с поверхности сосуда для культивирования и выделяют клетки CD34+/CD90+/Lin- или CD34+/CD49f+/Lin-. В главную воротную вену пациента с помощью инфузии вводят в пределах между приблизительно 1 X 103 и приблизительно 1 X 105 клеток. Гемопоэтические клетки помещали в костномозговую полость и делали пересадку.

Пример 13. Получение эмбриональных стволовых клеток крысы с инактивированным геном АРР

Эмбриональные стволовые клетки крысы высевали на 6-луночные планшеты при плотности 10000 клеток/лунку в среду для стволовых клеток крыс. На следующий день клетки трансфецировади, как описано в Примере 2 с помощью 0,5 мкг/лунку молекул RiboSlice, синтезированных в соответствии с Примером 1, нацеленных на следующие последовательности: L: TTCTGTGGTAAACTCAACAT и R: TCTGACTCCCATTTTCCATT (0,25 мкг L и 0,25 мкг R).

Пример 14. Получение крыс с нокаутом гена АРР с использованием эмбриональных стволовых клеток крысы с инактивированным геном АРР

Проводили редактирование генов в эмбриональных стволовых клетках крысы в соответствии с Примером 13 и микроинъекцией вводили клетки в бластоцисты крыс.

Потом введенные микроинъекцией бластоцисты переносили ложнобеременной самке крысы.

Пример 15. Получение эмбрионов крыс с инактивированным геном АРР для получения потомства крыс с нокаутом гена АРР

Пару молекул RiboSlice, нацеленных на следующие последовательности: L: TTCTGTGGTAAACTCAACAT и R: TCTGACTCCCATTTTCCATT, синтезировали в соответствии с Примером 1. Молекулы RiboSlice в концентрации 5 мкг/мл инъецировали в пронуклеус или цитоплазму эмбриона крысы на стадии 1 клетки. Потом эмбрион переносили ложнобеременной самке крысы.

Пример 16. Трансфекция клеток с помощью синтетической РНК, содержащей неканонические нуклеотиды, и ДНК, кодирующей репарационную матрицу

Для проведения трансфекции в 6-луночных планшетах сначала отдельно разбавляли 1 мкг РНК, кодирующей ген-редактирующий белок, нацеленный на экзон 16 гена АРР человека, 1 мкг одноцепочечной репарационной матрицы ДНК, содержащей сайт рестрикции PstI, который отсутствует в клетках-мишенях, и 6 мкл реагента для трансфекции (Lipofectamine RNAiMAX, Life Technologies Corporation) в среде для комплексообразования (Opti-MEM, Life Technologies Corporation) до получения суммарного объема 120 мкл. Затем смешивали разбавленную РНК, репарационную матрицу и реагент для трансфекции и инкубировали в течение 15 мин при комнатной температуре, в соответствии с инструкциями производителя реагента для трансфекции. Добавляли комплексы к культуре клеток. В каждую лунку 6-луночного планшета, которая уже содержала 2 мл среды для трансфекции на лунку, добавляли приблизительно 120 мкл комплексов. Планшеты осторожно встряхивали для распределения комплексов по всему объему лунок. Перед замещением среды свежей средой для трансфекции (2 мл/лунку) клетки инкубировали с комплексами 4 часа в течение ночи. На следующий день среду меняли на среду DMEM + 10% FBS. Через два дня после трансфекции выделяли и очищали геномную ДНК. Участок в пределах гена АРР амплифицировали методом ПЦР и амплифицированный продукт расщепляли ферментом PstI и анализировали методом гель-электрофореза (ФИГ. 16).

Пример 17. Вставка трансгена в эмбриональные стволовые клетки крысы в локализацию безопасной гавани

Эмбриональные стволовые клетки крысы высевали на 6-луночные планшеты при плотности 10000 клеток/лунку в среду для стволовых клеток крыс. На следующий день клетки трансфецировали, как описано в Примере 13, с помощью молекул RiboSlice, нацеленных на следующие последовательности: L: TATCTTCCAGAAAGACTCCA и R: ТТСССТТСССССТТСТТССС, синтезированных в соответствии Примером 1, и с помощью репарационной матрицей, содержащей трансген, фланкированный двумя участками, каждый из которых содержит около 400 оснований гомологичных участку, окружающему локус крысы Rosa26.

Пример 18. Гуманизированная линия клеток крыс LRRK2

Эмбриональные стволовые клетки крысы высевали на планшет и трансфецировали, как описано в Примере 13, с помощью молекул RiboSlice, нацеленных на следующие последовательности: L: TTGAAGGCAAAAATGTCCAC и R: TCTCATGTAGGAGTCCAGGA, синтезированные в соответствии с Примером 1. Через два дня после трансфекции клетки трансфецировали в соответствии с Примером 17, при этом трансген содержал ген LRRK2 человека и, выборочно, часть или весь участок промотора гена LRRK2 человека.

Пример 19. Вставка трансгена в фибробласты человека в локализацию безопасной гавани

Первичные фибробласты человека высевали на планшеты как описано в Примере 9. На следующий день клетки трансфецировали, как описано в Примере 2, с помощью молекул RiboSlice, нацеленных на следующие последовательности: L: TTATCTGTCCCCTCCACCCC и R: TTTTCTGTCACCAATCCTGT, синтезированных в соответствии Примером 1, и с помощью репарационной матрицы, содержащей трансген, фланкированный двумя участками, каждый из которых содержал около 400 оснований гомологичных участку, окружающему локус человека AAVS1.

Пример 20. Вставка последовательности РНКи в локализацию безопасной гавани

Первичные фибробласты человека высевали на планшеты и трансфецировали в соответствии с Примером 19, при этом трансген содержал последовательность, кодирующую кшРНК, перед которой расположен промотор PolIII.

Пример 21. Редактирование гена Myc с помощью молекул RiboSlice

Первичные фибробласты человека высевали на 6-луночные планшеты при плотности 50000 клеток/лунку в среду DMEM + 10% FBS. Через два дня среду заменили средой для трансфекций. Через четыре часа клетки трансфецировали, как описано в Примере 2, с помощью 1 мкг/лунку молекул RiboSlice, нацеленных на следующие последовательности: L: TCGGCCGCCGCCAAGCTCGT и R: TGCGCGCAGCCTGGTAGGAG, синтезированных в соответствии с Примером 1. На следующий день эффективность редактирования генов измеряли, как описано в Примере 9, с использованием следующих праймеров: F: TAACTCAAGACTGCCTCCCGCTTT и R: AGCCCAAGGTTTCAGAGGTGATGA (ФИГ. 5).

Пример 22. Противораковая терапия, включающая применение молекул RiboSlice, нацеленных на ген Мус

Клетки карциномы шейки матки HeLa высевали на 6-луночные планшеты при плотности 50000 клеток/лунку в среду DMEM без фолата + 2 мМ L-аланил-L-глутамина + 10% FBS. На следующий день среду заменяли средой для трансфекций. На следующий день клетки трансфецировали как описано в Примере 21.

Пример 23. Редактирование гена BIRC5 с помощью молекул RiboSlice

Первичные фибробласты человека высевали на 6-луночные планшеты при плотности 50000 клеток/лунку в среду DMEM + 10% FBS. Через два дня среду заменяли средой для трансфекций. Через четыре часа клетки трансфецировали, как описано в Примере 2, с помощью 1 мкг/лунку молекул RiboSlice, нацеленных на следующие последовательности: L: TTGCCCCCTGCCTGGCAGCC и R: TTCTTGAATGTAGAGATGCG, синтезированных в соответствии с Примером 1. На следующий день эффективность редактирования генов измерили, как описано в Примере 9, с использованием следующих праймеров: F: GCGCCATTAACCGCCAGATTTGAA и R: TGGGAGTTCACAACAACAGGGTCT (ФИГ. 6).

Пример 24. Противораковая терапия, включающая применение молекул RiboSlice, нацеленных на ген BIRC5

Клетки карциномы шейки матки HeLa высевали на 6-луночные планшеты при плотности 50000 клеток/лунку в среду DMEM без фолата + 2 мМ L-аланил-L-глутамина + 10% FBS. На следующий день среду заменяли средой для трансфекции. На следующий день клетки трансфецировали как описано в Примере 23 (ФИГ. 7А и ФИГ. 7В).

Пример 25. Культивирование линий раковых клеток

В культуре размножали линии раковых клеток HeLa (карцинома шейки матки), MDA-МВ-231 (рак молочной железы), НСТ 116 (рак толстой кишки), U87 MG (глиома) и U-251 (глиома). Клетки культивировали в среде DMEM + 10% FBS или DMEM + 50% FBS и поддерживали при 37°С, 5% СО2 и при обычном содержании О2 или при 5% О2. Клетки росли быстро во всех условиях и их обычным способом пересевали каждые 2-5 дней, используя раствор трипсина в HBSS.

Пример 26. Процесс разработки и алгоритм использования молекул RiboSlice - ген-редактирующей РНК

Аннотированная последовательность ДНК гена BIRC5 была найдена в базе NCBI с помощью утилиты eFetch и сценария python. Такой же сценарий python использовали для идентификации последовательностей ДНК, кодирующих белок, в пределах каждого из четырех экзонов гена BIRC5. Потом данный сценарий проверял эти последовательности и 40 оснований, фланкирующих каждую сторону, для элементов последовательностей, удовлетворяющих следующие условия: (i) один элемент существует на первичной цепи, остальные на комплементарной цепи, (и) каждый элемент начинается с Τ и (iii) элементы разделены не более чем 12 основаниями и не более чем 20 основаниями. Потом каждому элементу присваивали показатель, представляющий вероятность его связи с другими элементами в пределах генома человека с помощью использования системы Qblast (NCBI). Этот показатель рассчитывался как сумма обратных значений девяти наименьших Е-значений, исключая совпадение с целевой последовательностью. Пару показателей рассчитывли с помощью сложения показателей отдельных элементов.

Пример 27. Синтез РНК (RiboSlice), кодирующей ген-редактирующие белки

РНК, кодирующую ген-редактирующие белки, разработали в соответствии с Примером 26, и синтезировали в соответствии с Примером 1 (Таблица 10, ФИГ. 9). Полученную РНК разбавляли водой без нуклеазной активности до концентрации между 200 нг/мкл и 500 нг/мкл и хранили при 4°С.

Пример 28. Анализ активности молекул RiboSlice, нацеленных на ген BIRC5

Первичные фибробласты взрослого человека трансфецировали в соответствии с Примером 2 с помощью 6 пар молекул RiboSlice, нацеленных на ген BIRC5, разработанных в соответствии с Примером 26 и синтезированных в соответствии с Примером 27. Через два дня после трансфекции выделяли и очищали геномную ДНК. Для измерения эффективности редактирования генов проводили гибридизацию 150 нг амплифицированного методом ПЦР продукта со 150 нг эталонной ДНК в растворе 10 мМ Трис-Cl + 50 мМ KCl + 1,5 мМ MgCl2. Гибридизированную ДНК обрабатывали с помощью мисматч-детектирующей эндонуклеазы SURVEYOR (Transgenomic Inc.) и полученные продукты анализировали методом электрофореза в агарозном геле (ФИГ. 10А). Все шесть испытанных пар молекул RiboSlice эффективно редактировали ген BIRC5, что было демонстрировано видом полос предполагаемых размеров (звездочки на ФИГ. 10А).

Пример 29. Анализ ингибирования митоза молекулами RiboSlice, нацеленными на ген BIRC5

В первичных фибробластах взрослого человека провели редактирование генов в соответствии с Примером 28, после чего, их размножили в культуре. Через 11 дней выделяли и очищали геномную ДНК, а эффективность редактирования генов измеряли как описано в Примере 28 (ФИГ. 10В). Ни одна из испытанных пар молекул RiboSlice не ингибировала пролиферацию фибробластов, что показано видом полос предполагаемых размеров (звездочки на ФИГ. 10В) из геномной ДНК, выделенной из пролиферирующих клеток, демонстрируя низкую токсичность этих молекул RiboSlice для нормальных фибробластов.

Пример 30. Анализ противораковой активности молекул RiboSlice, нацеленных на ген BIRC5

Первичные фибробласты взрослого человека и клетки карциномы шейки матки, культивированные в соответствии с Примером 25, трансфецировали с помощью пар молекул RiboSlice в соответствии с Примером 28. Пролиферация фибробластов вскоре замедлялась из-за токсичности, связанной с реагентом для трансфекции, но восстанавливалась в пределах 2 дней после трансфекции. В противоположность этому, пролиферация клеток HeLa существенно замедлялась и в трансфецированных лунках наблюдали множество увеличенных клеток с фрагментированными ядрами. Через 2-3 дня множество клеток выявляли морфологические признаки, свойственные апоптозу, демонстрируя сильную противораковую активность молекул RiboSlice, нацеленных на ген BIRC5.

Пример 31. Исследование безопасности молекул RiboSlice in vivo

40 самкам мышей линии NCr nu/nu подкожно инъецировали 5×106 опухолевых клеток MDA-MB-231 в 50% Matrigel (BD Biosciences). Инъекционный объем клеток составлял 0,2 мл/мышь. В начале исследования возраст мышей составлял 8-12 недель. Проводили распределение по парным совпадениям и разделили животных на 4 группы по 10 животных в каждой, когда средний объем опухолей достиг 100-150 мм3 - начинали лечение. Массу тела в первые 5 дней измеряли каждый день, затем до конца исследования - два раза в неделю. Лечение заключалось во введении препарата RiboSlice BIRC5-1.2 в комплексе с носителем (Lipofectamine 2000, Life Technologies Corporation). Для приготовления дозирующего раствора для каждой группы 308 мкл буфера для комплексообразования (Opti-MEM, Life Technologies Corporation) переносили пипеткой в каждую из двух стерильных пробирок объемом 1,5 мл без РНКазной активности. В одну из двух пробирок добавляли 22 мкл препарата RiboSlice BIRC5-1.2 (500 нг/мл) и содержимое пробирки перемешивали пипетированием. Во второю пробирку добавляли 22 мкл носителя. Содержимое второй пробирки перемешивали, потом переносили в первую пробирку и перемешивали содержимое первой пробирки пипетированием для образования комплексов. Комплексы инкубировали при комнатной температуре в течение 10 мин. Во время инкубации наполняли шприцы. Животным делали инъекции внутривенно или внутрь опухоли в суммарной дозе 1 мкг РНК/животное в общем объеме 60 мкл/животное. Всего проводили 5 обработок, инъекции выполняли через день. Дозы не корректировали к массе тела. За животными наблюдали в течение 17 дней. Не было обнаружено статистически значимого снижения средней массы тела (ФИГ. 11; препарат RiboSlice BIRC5-1.2 обозначен как «ZK1»), что демонстрирует безопасность in vivo ген-редактирующей РНК - RiboSlice.

Пример 32. Анализ противораковой активности молекул RiboSlice, нацеленных на ген BIRC5, на модели глиомы

Клетки глиомы линии U-251, культивированные в соответствии с Примером 25, трансфецировали с помощью пар молекул RiboSlice в соответствии с Примером 28. Ответ клеток глиомы на лечение был сходным с клетками HeLa: пролиферация существенно замедлялась и в трансфецированных лунках наблюдали множество увеличенных клеток с фрагментированными ядрами. Через 2-3 дня множество клеток выявляли морфологические признаки, свойственные апоптозу, демонстрируя сильную противораковую активность на модели глиомы молекул RiboSlice, нацеленных на ген BIRC5.

Пример 33. Скрининг реагентов для доставки нуклеиновых кислот в клетки

Скринингу для определения эффективности трансфекции и токсичности in vitro подвергали реагенты для доставки, включая полиэтиленимин (PEI), различные коммерческие реагенты для трансфекции на основе липидов, реагенты для трансфекции на основе пептидов (N-TER, Sigma-Aldrich Co. LLC.) и несколько реагентов для трансфекции на основе липидов и стеринов. Были созданы комплексы реагентов для доставки с препаратом RiboSlice BIRC5-1.2 и комплексы перенесли в клетки HeLa, культивировавшиеся в соответствии с Примером 25. Токсичность оценивали путем анализа плотности клеток через 24 ч после трансфекции. Эффективность трансфекции оценивали анализом морфологических изменений, как описано в Примере 30. Испытанные реагенты проявляли широкий диапазон уровней токсичности и эффективности трансфекции. Реагенты, содержащие более высокое соотношение сложноэфирных связей, проявляли более низкую токсичность, чем реагенты, содержащие более низкое соотношение или не содержащие сложноэфирные связи.

Пример 34. Высококонцентрированный липосомальный препарат RiboSlice

Высококонцентрированный липосомальный препарат RiboSlice готовили смешиванием 1 мкг РНК с концентрацией 500 нг/мл с 3 мкл среды для комплексообразования (Opti-MEM, Life Technologies Corporation) и 2,5 мкл реагента для трансфекции (Lipofectamine 2000, Life Technologies Corporation) на мкг РНК с 2,5 мкл среды для комплексообразования. После этого разбавленную РНК и реагент для трансфекции смешивали и инкубировали в течение 10 мин при комнатной температуре для образования высококонцентрированного липосомального препарата RiboSlice. В альтернативном варианте, использовали реагент для трансфекции, содержащий сурфактант DOSPA или DOSPER.

Пример 35. Исследование эффективности молекул RiboSlice in vivo - подкожная модель глиомы

40 самкам мышей линии NCr nu/nu подкожно инъецировали 1×107 опухолевых клеток U-251. Инъекционный объем клеток составлял 0,2 мл/мышь. В начале исследования возраст мышей составлял 8-12 недель. Проводили распределение по парным совпадениям и разделяли животных на 4 группы по 10 животных в каждой, когда средний объем опухоли достигал 35-50 мм3 - начали лечение. Массу тела в первые 5 дней измеряли каждый день, затем до конца исследования - два раза в неделю.

Проводили измерения штангенциркулем два раз в неделю и рассчитывали объем опухоли. Лечение заключалось во введении препарата RiboSlice BIRC5-2.1 в комплексе с носителем (Lipofectamine 2000, Life Technologies Corporation). Для приготовления дозирующего раствора 294 мкл буфера для комплексообразования (Opti-MEM, Life Technologies Corporation) переносили пипеткой в пробирку, содержащую 196 мкл препарата RiboSlice BIRC5-2.1 (500 нг/мкл) и содержимое пробирки перемешивали с помощью пипетирования. В пробирку, содержащую 245 мкл носителя, переносили пипеткой 245 мкл буфера для комплексообразования. Содержимое второй пробирки перемешали, потом переносили в первую пробирку и перемешивали содержимое первой пробирки пипетированием для образования комплексов. Комплексы инкубировали при комнатной температуре в течение 10 мин. Во время инкубации наполняли шприцы. Животным делали внутриопухолевые инъекции в суммарной дозе 2 мкг или 5 мкг РНК/животное в общем объеме 20 мкл или 50 мкл/животное. Всего проводили 5 обработок, инъекции выполняли через день. Дозы не корректировали к массе тела. За животными наблюдали в течение 25 дней.

Пример 36. Синтез молекул RiboSlice с высокой активностью и высокой точностью воздействия на транскрипционной матрице in vitro

Транскрипционная матрица для проведения реакции in vitro, кодирующая промотор РНК-полимеразы бактериофага Т7, 5'-нетранслируемый участок, сильную последовательность Козак, N-концевой домен TALE, 18 последовательностей повторов, была разработана в соответствии с Примером 26, C-концевой домен TALE и домен нуклеазы, содержащий последовательность StsI (SEQ ID NO: 1), последовательность StsI-HA (SEQ ID NO: 2), последовательность StsI-HA2 (SEQ ID NO: 3), последовательность StsI-UHA (SEQ ID NO: 4), последовательность StsI-UHA2 (SEQ ID NO: 5), последовательность StsI-HF (SEQ ID NO: 6) или последовательность StsI-HF2 (SEQ ID NO: 7), что синтезируют с помощью стандартных методик клонирования и молекулярной биологии, или, в альтернативном варианте, синтезируют путем прямого химического синтеза, к примеру, с помощью методики сборки фрагментов генов (например, gBlocks, Integrated DNA Technologies Inc.).

Пример 37. Синтез ген-редактирующих РНК - молекул RiboSlice с высокой активностью и высокой точностью воздействия Молекулы RiboSlice с высокой активностью и молекулы RiboSlice с высокой точностью воздействия синтезируют в соответствии с Примером 27, используя транскрипционные матрицы для проведения реакции in vitro в соответствии с Примером 36.

Пример 38. Получение репликационно-некомпетентного вируса, кодирующего молекулы RiboSlice, для лечения протеопатии

Нуклеотидную последовательность, содержащую молекулы RiboSlice, нацеленные на последовательность ДНК, которая кодирует последовательность бляшкообразующего белка, встраивали в вектор экспрессии млекопитающих, содержащий геном репликационно-некомпетентного вируса, и трансфецируют в пакующую клеточную линию для продукции репликационно-некомпетентного вируса. Собирают супернатант культуры и фильтруют его, используя фильтр с размером пор 0,45 мкм для удаления дебриса.

Пример 39. Получение репликационно-компетентного онколитического вируса, кодирующего молекулы RiboSlice, для лечения рака

Нуклеотидную последовательность, содержащую молекулы RiboSlice, нацеленные на ген BIRC5, встраивают в вектор экспрессии млекопитающих, содержащий геном репликационно-компетентного вируса, и трансфецируют в пакующую клеточную линию для продукции репликационно-компетентного вируса. Собирают супернатант культуры и фильтруют его в соответствии с Примером 38.

Пример 40. Исследование эффективности молекул RiboSlice in vivo - ортотопическая модель глиомы, итратекальный путь введения

40 самкам мышей линии NCr nu/nu инъецируют внутрь черепа 1×105 опухолевых клеток U-251. Инъекционные объем клеток составляет 0,2 мл/мышь. В начале исследования возраст мышей составляет 8-12 недель. Через 10 дней животных делят на 4 группы из 10 животных в каждой и начинают лечение. Массу тела в первые 5 дней измеряют каждый день, затем до конца исследования - два раза в неделю. Лечение заключается во введении препарата RiboSlice BIRC5-2.1 в комплексе с носителем (Lipofectamine 2000, Life Technologies Corporation). Для приготовления дозированного раствора 294 мкл буфера для комплексообразования (Opti-MEM, Life Technologies Corporation) перенесят пипеткой в пробирку, содержащую 196 мкл препарата RiboSlice BIRC5-2.1 (500 нг/мкл), и содержимое пробирки перемешивают с помощью пипетирования. В пробирку, содержащую 245 мкл носителя, переносят пипеткой 245 мкл буфера для комплексообразования. Содержимое второй пробирки перемешивают, потом переносят в первую пробирку и перемешивают с содержимым первой пробирки пипетированием для образования комплексов. Комплексы инкубируют при комнатной температуре в течение 10 мин. Во время инкубации наполняют шприцы. Животным интратекально инъецируют суммарную дозу 1-2 мкг РНК/животное в общем объеме 10-20 мкл/животное. Всего проводят 5 обработок, инъекции выполняют через день. Дозы не корректируют к массе тела. За животными наблюдают в течение 60 дней.

Пример 41. Лечение глиомы с помощью препаратов RiboSlice - в/в перфузия

Пациенту с диагнозом глиома вводят 1 мг высококонцентрированного липосомального препарата RiboSlice BIRC5-2.1, приготовленного в соответствии с Примером 34, путем в/в инфузии в течение 1 ч 3 раза в неделю на протяжении 4 недель. В случае, когда начальный объем опухоли превышает 500 мм3, перед началом лечения препаратом RiboSlice объем опухоли уменьшают хирургически или, выборочно, лучевой терапией и/или химиотерапией. Пациенту выборочно вводят TNF-α и/или 5-ФУ, используя стандартный режим дозирования как в случае комбинированной терапии.

Пример 42. Лечение глиомы с помощью молекул RiboSlice - репликационно-компетентный онколитический вирус

Пациенту с помощью интратекальной или внутричерепной инъекции вводят 1 мл реплицирующихся вирусных частиц (1000 КОЕ/мл), полученных в соответствии с Примером 39.

Пример 43. Лечение болезни Паркинсона с помощью молекул RiboSlice, нацеленных на ген SNCA

Пациенту с диагнозом болезнь Паркинсона с помощью интратекальной или внутричерепной инъекции вводят 50 мкг молекул RiboSlice, нацеленных на ген SNCA.

Пример 44. Лечение болезни Альцгеймера с помощью молекул RiboSlice, нацеленных на ген АРР

Пациенту с диагнозом болезнь Альцгеймера с помощью интратекальной или внутричерепной инъекции вводят 50 мкг молекул RiboSlice, нацеленных на ген АРР.

Пример 45. Лечение диабета II типа с помощью молекул RiboSlice, нацеленных на ген IAPP

Пациенту с диагнозом диабет II типа с помощью внутривенной, внутрибрюшинной инъекции или инъекции в воротную вену, вводят 5 мг молекул RiboSlice, нацеленных на ген IAPP.

Пример 46. Персонализированная противораковая терапия препаратом iRiboSlice

Пациенту с диагнозом рак проводят биопсию. Из материала биопсии выделяют и очищают геномную ДНК и определяют последовательность ДНК (последовательность полного генома, последовательность экзома или последовательность одного или более ассоциированных с раковым заболеванием генов). Пару молекул RiboSlice, нацеленных на индивидуальную генную последовательность пациента (препарат iRiboSlice), разрабатывают в соответствии с Примером 26 и синтезируют в соответствии с Примером 27. Пациенту вводят персонализированный препарат iRiboSlice, используя подходящий для данной локализации и типа рака путь введения.

Пример 47. Смеси молекул RiboSlice для генетически смешанных/устойчивых к лечению видов рака

Пациенту с диагнозом генетически смешанный и/или устойчивых к лечению рак вводят смесь пар молекул RiboSlice, нацеленную на множество ассоциированные с раковым заболеванием гены и/или множество последовательностей одного или более ассоциированных с раковым заболеванием генов.

Пример 48. Препарат mito-RiboSlice для лечения митохондриального заболевания

Пациенту с диагнозом митохондриальное заболевание с помощью внутримышечной инъекции вводят 2 мг молекул RiboSlice, нацеленных на ассоциированную с заболеванием последовательность и содержащую последовательность внутримитохондриальной локализации.

Пример 49. Лечение болезни глаз с помощью глазных капель RiboSlice

Пациенту с диагнозом заболевание роговицы или конъюнктивы вводят препарат RiboSlice, приготовленный в виде 0,5% изотонического раствора.

Пример 50. Лечение болезни кожи с помощью препарата RiboSlice для местного применения

Пациенту с диагнозом заболевание кожи вводят препарат RiboSlice, приготовленный в виде 1% крема/мази для местного применения, содержащей один или более стабилизаторов, которые предупреждают деградацию РНК.

Пример 51. Лечение заболевания легких или респираторной болезни с помощью аэрозольного состава RiboSlice

Пациенту с диагнозом заболевание легких или респираторная болезнь вводят препарат RiboSlice приготовленный в виде 0,5% аэрозольного спрея.

Пример 52. Лечение инфекционного заболевания с помощью молекул RiboSlice, нацеленных на последовательность ДНК, присутствующую в инфекционном агенте

Пациенту с диагнозом инфекционное заболевание вводят молекулы RiboSlice, нацеленные на последовательность, присутствующую в специфическом инфекционном агенте, которым инфицирован пациент, используя подходящий для локализации и типа инфекции путь введения и подходящую для пути введения и тяжести заболевания дозу.

Пример 53. Редактирование генов в зиготах человека для оплодотворения in vitro

Половую клетку человека, зиготу или бластоцисту на ранней стадии трансфецируют с помощью молекул RiboSlice, нацеленных на ген, который кодирует ассоциированную с заболеванием мутацию или мутацию, связанную с нежелательным признаком. Проводят анализ генома и полученную клетку готовят для проведения оплодотворения in vitro.

Пример 54. Выбор домена расщепления для повышения активности и точности действия ген-редактирующих белков

Панель пар молекул RiboSlice, каждая из которых нацелена на разные домены расщепления, разрабатывают в соответствии с Примером 26 и синтезируют в соответствии с Примером 27. Определяют активность пар молекул RiboSlice как описано в Примере 28.

Пример 55. Клетки с редактированными генами для скрининга токсических веществ, вызывающих болезнь Паркинсона

В первичных фибробластах взрослого человека проводят редактирование генов в соответствии с Примером 28, используя молекулы RiboSlice, нацеленные на ген SNCA (Таблица 11), и репарационные матрицы, для получения клеток с мутациями SNCA А30Р, Е46К и А53Т. Проводят репрограммирование и дифференциацию клеток для получения дофаминергических нейронов. Данные нейроны используют в высокопроизводительном скрининг-анализе токсических веществ, агрегирующих α-синуклеин, для определения токсических веществ, которые могут способствовать развитию болезни Паркинсона.

Пример 56. Клетки с редактированными генами для скрининга токсических веществ, вызывающих рак

В первичных фибробластах взрослого человека проводят редактирование генов в соответствии с Примером 28, используя молекулы RiboSlice, нацеленные на ген ТР53 (Таблица 12), и репарационные матрицы, для получения клеток с мутациями ТР53 P47S, R72P и V217M. Проводят репрограммирование и дифференциацию клеток для получения гепатоцитов. Данные гепатоциты используют в высокопроизводительном скрининг-анализе токсических веществ, вызывающих трансформацию клеток in vitro, для определения токсических веществ, которые могут способствовать развитию рака.

Пример 57. Разработка и синтез РНК (RiboSlice), кодирующей ген-редактирующие белки

РНК, кодирующие ген-редактирующих белки, разработанные в соответствии с Примером 26, синтезировали в соответствии с Примером 27 (Таблица 13). Каждый ген-редактирующий белок содержал ДНК-связывающий домен, включающий домен повтора эффектора, подобного активатору транскрипции (TAL), содержащий последовательности повторов длиной 35-36 аминокислот, как указано в Таблице 13. Идентификационные номера последовательностей предоставлены для последовательностей повторов длиной 36 аминокислот. Обозначение «18» в названии матрицы указывает, что 18я последовательность повтора имеет длину 36 аминокислот. Обозначение «ЕО» в названии матрицы указывает, что каждая следующая последовательность повтора имеет длину 36 аминокислот. Аминокислоты, следующие за обозначением «18» или «ЕО», указывают аминокислоты на С-конце последовательности(ей) повтора длиной 36 аминокислот. Обозначение «StsI» указывает, что домен нуклеазы содержал домен расщепления StsI. Матрицы без обозначения «StsI» содержали домен расщепления FokI.

Пример 58. Анализ активности молекул RiboSlice, нацеленных на ген BIRC5

Активность молекул RiboSlice, синтезированных в соответствии с Примером 57, проанализировали в соответствии с Примером 28 (ФИГ. 12А, ФИГ. 12В и ФИГ. 14). Высокоэффективное редактирование генов наблюдали в клетках, экспрессирующих ген-редактирующие белки, содержащие одну или более последовательностей повторов длиной 36 аминокислот. Эффективность редактирования генов была наибольшей в клетках, экспрессирующих ген-редактирующие белки, содержащие одну или более последовательностей повторов, содержащих аминокислотную последовательность: GHGG.

Пример 59. Исследование безопасности и эффективности молекул RiboSlice AAV in vivo - подкожная модель глиомы, внутриопухолевый путь доставки

У животных вызывали образование опухолей, содержащих клетки глиомы человека U-251, в соответствии с Примером 35. В соответствии со стандартной методикой получали вирус AAV с серотипом 2, кодирующий GFP, RiboSlice BIRC5-2.1L и RiboSlice BIRC5-2.1R (система экспрессии AAV-2 без хелпера, Cell Biolabs Inc.). Исходный штамм вируса хранили при 4°С (краткосрочно) или при -80°С (долговременно). Животные получали внутриопухолевые инъекции 160 мкл препарата GFP AAV в 1 день или 80 мкл препарата RiboSlice AAV BIRC5-2.1L + 80 мкл препарата RiboSlice AAV BIRC5-2.1R в 1 и 15 день. За животными наблюдали в течение 25 дней. Не было обнаружено статистически значимого снижения средней массы тела (ФИГ. 13А), что демонстрирует безопасность in vivo препарата RiboSlice AAV. Рост опухоли ингибировался группой молекул RiboSlice AAV (ФИГ. 13В), что демонстрирует эффективность in vivo молекул RiboSlice AAV.

Пример 60. Лечение рака с помощью препаратов RiboSlice AAV

Пациенту с помощью интратекальной или внутричерепной инъекции вводят 1 мл вирусных частиц RiboSlice AAV, полученных в соответствии с Примером 59. При необходимости введение дозы повторяют. В случае, когда у пациента начальный объем опухоли превышает 500 мм3, перед началом лечения препаратом RiboSlice AAV объем опухоли уменьшают хирургически или, выборочно, лучевой терапией и/или химиотерапией. Пациенту, выборочно, вводят TNF-α и/или 5-ФУ, используя стандартный режим дозирования как в случае комбинированной терапии.

Пример 61. Персонализированная противораковая терапия препаратом iRiboSlice AAV

Пациенту с диагнозом рак проводят биопсию. Из материала биопсии выделяют и очищают геномную ДНК и определяют последовательность ДНК (последовательность полного генома, последовательность экзома или последовательность одного или более ассоциированных с раковым заболеванием генов). Пару молекул RiboSlice, нацеленных на индивидуальную генную последовательность пациента (препарат ¡RiboSlice), разрабатывают в соответствии с Примером 26 и синтезируют в соответствии с Примером 59. Пациенту вводят персонализированный препарат iRiboSlice AAV, используя подходящий для данной локализации и типа рака путь введения.

Пример 62. Липосомалъный состав и инкапсулирование нуклеиновых кислот

Готовят липосомы, используя следующий состав: 3,2 мг/мл N-(карбонил-этоксиполиэтиленгликоль 2000)-1,2-дистеароил-sn-глицеро-3-фосфоэтаноламина (MPEG2000-DSPE), 9,6 мг/мл полностью гидрогенизированного фосфатидилхолина, 3,2 мг/мл холестерина, 2 мг/мл сульфата аммония и гистидин в качестве буферного вещества. pH поддерживают с помощью гидроксида натрия, а изотоничность поддерживается с помощью сахарозы. Для образования липосом липиды смешивают в органическом растворителе, высушивают, гидратируют перемешиванием и сортируют по размеру экструзией через поликарбонатный фильтр со средним размером пор 800 нм. Нуклеиновые кислоты инкапсулируют объединением 10 мкг липосомального состава на 1 мкг нуклеиновой кислоты и инкубируют при комнатной температуре в течение 5 минут.

Пример 63. Липосомальный состав, нацеленный на фолат

Готовят липосомы в соответствии с Примером 62 с добавлением в липидную смесь 0,27 мг/мл 1,2-дистеароил-sn-глицеро-3-фосфоэтаноламин-N-(фолат(полиэтиленгликоля)-5000] (FA-MPEG5000-DSPE).

Пример 64. Противораковая терапия, включающая применение липосомального препарата RiboSlice, нацеленного на ген BIRC5

Липосомы с инкапсулированными парами молекул RiboSlice, синтезированными в соответствии с Примером 23, готовят в соответствии с Примером 62 или Примером 63. Полученные липосомы вводят путем инъекции или внутривенной инфузии и ежедневно проводят мониторинг ответа опухоли на лечение и уровней интерферонов в плазме.

Пример 65. Противораковая терапия, включающая применение липосомального препарата RiboSlice, нацеленного на ассоциированный с раковым заболеванием ген

Липосомы с инкапсулированными молекулами RiboSlice, нацеленными на ассоциированный с раковым заболеванием ген и синтезированными в соответствии с Примером 1, готовят в соответствии с Примером 62 или Примером 63. Полученные липосомы вводят путем инъекции или внутривенной инфузии и ежедневно проводят мониторинг ответа опухоли на лечение и уровней интерферонов в плазме.

Пример 66. Терапия, включающая применение липосомальной РНК, кодирующей белок

Липосомы с инкапсулированной синтетической РНК, кодирующую терапевтический белок и синтезированную в соответствии с Примером 1, готовят в соответствии с Примером 62 или Примером 63. Полученные липосомы вводят путем инъекции или внутривенной инфузии.

Пример 67. Комбинированная противораковая терапия, включающая применение молекул RiboSlice, нацеленных на ген BIRC5, и TNF-α

Пациентам проводят изолированную перфузию конечностей (ILP) с применением фактора некроза опухолей альфа (TNF-α) и липосом с инкапсулированными молекулами RiboSlice, нацеленными на ген BIRC5 (см. Пример 64). После нагревания конечности липосомы инъецируют в артериальную линию экстракорпорального контура ILP в течение приблизительно 5 минут и продолжают перфузию еще 85 минут. Через 1-2 дня повторяют проведение ILP с применением TNF-α, инъецируемого в артериальную линию экстракорпорального контура ILP в течение 3-5 минут, и продолжают перфузию еще 60 минут. Ежедневно проводят мониторинг ответа опухоли на лечение и уровней интерферонов в плазме.

Пример 68. Комбинированная противораковая терапия, включающая применение молекул RiboSlice, нацеленных на ген BIRC5, и фторурацила (5-ФУ)

В 1 день в течение 60 минут пациенты получают внутривенную инфузию липосом с инкапсулированными молекулами RiboSlice, нацеленными на ген BIRC5 (см. Пример 64), с последующим проведением внутривенной инфузии 5-ФУ на 2 и 3 день. Ежедневно проводят мониторинг ответа опухоли на лечение и уровней интерферонов в плазме.

ЭКВИВАЛЕНТЫ ИЗОБРЕТЕНИЯ

Специалистами в данной области техники будет понятно или должно быть установлено, что использование более подробной информации относительно обычных экспериментов, многочисленных эквивалентов специальных вариантов реализации изобретения, в частности, описано в данном документе. Такие эквиваленты изобретения подразумеваются охваченными объемом следующих пунктов формулы изобретения.

ВКЛЮЧЕНИЕ ПОСРЕДСТВОМ ССЫЛКИ

Все патенты и патентные публикации, приведенные в данном документе, включены в настоящий документ в полном объеме посредством ссылок.

1. Композиция для создания одноцепочечного или двухцепочечного разрыва в последовательности молекулы ДНК-мишени в соматической клетке и/или в клетке, не являющейся клеткой человека, при этом композиция содержит в эффективном количестве нуклеиновую кислоту, кодирующую ген-редактирующий белок, при этом ген-редактирующий белок содержит:

(a) ДНК-связывающий домен; и

(b) домен нуклеазы; где:

ДНК-связывающий домен содержит множество последовательностей повторов и по меньшей мере одна из последовательностей повторов имеет 36 аминокислот в длину и содержит аминокислотную последовательность LTPvQVVAIAwxyzGHGG, где:

"v" является Q, D или E,

"w" является S или N,

"xy"является HD, NG, NS, NI, NN или N, и

"z" представляет собой GGKQALETVQRLLPVLCQD или GGKQALETVQRLLPVLCQA, где множество последовательностей повторов содержит между около 1,5 повторов последовательностей и около 28,5 последовательностей повторов, где число последовательностей повторов является достаточным, чтобы обеспечить высокую специфичность распознавания сайта связывания на молекуле ДНК-мишени,

где одноцепочечный или двухцепочечный разрыв приводит к инактивации гена, образованию неактивного белка, белка со сниженной активностью или доминантно-негативной формы белка, репарации мутации в гене или обеспечивает пропуск экзона.

2. Композиция по п. 1, где домен нуклеазы способен образовывать димер с доменом нуклеазы другого белка.

3. Композиция по п. 1, где домен нуклеазы содержит каталитический домен FokI или StsI.

4. Композиция по п. 3, где StsI выбирают из StsI, StsI-HA, StsI-HA2, StsI-UHA, StsI-UHA2, StsI-HF и StsI-UHF или его биологически активного фрагмента.

5. Композиция по любому из пп. 1-4, где композиция способна снижать экспрессию одного или более пептидов, кодируемых молекулой ДНК-мишени.

6. Композиция по любому из пп. 1-5, где композиция способна образовывать ген, который кодирует нефункциональный белок.

7. Композиция по любому из пп. 1-6, где композиция способна образовывать ген, который кодирует доминантно-негативный белок.

8. Композиция по любому из пп. 1-7, где домен нуклеазы содержит каталитический домен белка, содержащего аминокислотную последовательность, выбранную из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 и SEQ ID NO: 53.

9. Композиция по любому из пп. 1-8, где нуклеиновая кислота дополнительно содержит последовательность внутриядерной локализации.

10. Композиция по п. 9, отличающаяся тем, что последовательность внутриядерной локализации содержит аминокислотную последовательность PKKKRKV.

11. Композиция по любому из пп. 1-8, где нуклеиновая кислота дополнительно содержит последовательность внутримитохондриальной локализации.

12. Композиция по п. 11, где последовательность внутримитохондриальной локализации содержит аминокислотную последовательность LGRVIPRKIASRASLM.

13. Композиция по любому из пп. 1-12, отличающаяся тем, что ДНК-связывающий домен и домен нуклеазы разделены линкером.

14. Композиция по п. 13, где линкер имеет длину в пределах между приблизительно 1 и приблизительно 10 аминокислотами.

15. Композиция по любому из пп. 1-14, где нуклеиновая кислота содержит синтетическую молекулу РНК.

16. Композиция по любому из пп. 1-14, где нуклеиновая кислота содержит один или более неканонических нуклеотидов.

17. Композиция по п. 16, где неканонические нуклеотиды выбирают из 5-метилуридина, 5-гидроксиуридина, псевдоуридина, 5-метилпсевдоуридина, 5-гидроксипсевдоуридина, 5-метилцитидина и 5-гидроксицитидина.

18. Композиция по любому из пп. 1-17, где ген-редактирующий белок дополнительно содержит по меньшей мере одну последовательность повтора, содержащую аминокислотную последовательность: LTPvQVVAIAwxyzGHGG, где "v" представляет собой E, "w" представляет собой S, "x" представляет собой N, "y" представляет собой I или S, и "z" представляет собой GGKQALETVQRLLPVLCQA.

19. Композиция по любому из пп. 1-17, где ген-редактирующий белок дополнительно содержит по меньшей мере одну последовательность повтора, содержащую аминокислотную последовательность: LTPvQVVAIAwxyzGHGG, где "v" представляет собой E, "w" представляет собой S, "x" представляет собой N, "y" представляет собой I, и "z" представляет собой GGKQALETVQRLLPVLCQA.

20. Композиция по любому из пп. 1-17, где ген-редактирующий белок дополнительно содержит по меньшей мере одну последовательность повтора, содержащую аминокислотную последовательность: LTPvQVVAIAwIyzGHGG, где "v" представляет собой E, "w" представляет собой S, "y" представляет собой I и "z" представляет собой GGKQALETVQRLLPVLCQA.

21. Композиция по любому из пп. 1-17, где ген-редактирующий белок дополнительно содержит по меньшей мере одну последовательность повтора, содержащую аминокислотную последовательность: LTPvQVVAIAwxyzGHGG, где "v" представляет собой Q, D или E, "w" представляет собой S или N, "x" представляет собой N, "y" означает I или S, и "z" представляет собой GGKQALETVQRLLPVLCQD или GGKQALETVQRLLPVLCQA.

22. Композиция по любому из пп. 1-17, где ген-редактирующий белок дополнительно содержит по меньшей мере одну последовательность повтора, содержащую аминокислотную последовательность: LTPvQVVAIAwxyzGHGG, где "v" представляет собой Q, D или E, "w" представляет собой S или N, "x" представляет собой N, "y" выбирают из: D, N и G, и "z" представляет собой GGKQALETVQRLLPVLCQD или GGKQALETVQRLLPVLCQA.

23. Композиция по любому из пп. 1-17, где ген-редактирующий белок дополнительно содержит по меньшей мере одну последовательность повтора, содержащую аминокислотную последовательность: LTPvQVVAIAwxyzGHGG, где "v" представляет собой Q, D или E, "w" представляет собой S или N, "x" представляет собой H, "y" выбирают из: D, I, N и G, и "z" представляет собой GGKQALETVQRLLPVLCQD или GGKQALETVQRLLPVLCQA.

24. Композиция по любому из пп. 1-23, где число последовательностей повторов составляет около 11,5, около 14,5, около 17,5, около 18,5 или примерно 20.

25. Способ in vitro изменения последовательности молекулы ДНК-мишени в соматической клетке и/или в клетке, не являющейся клеткой человека, включающий контактирование композиции по любому из пп. 1-24 с соматической клеткой и/или клеткой, не являющейся клеткой человека.

26. Способ по п. 25, где ген-редактирующий белок приводит к эндонуклеолитическому расщеплению молекулы ДНК-мишени в соматической клетке, клетке и/или клетке, не являющейся клеткой человека, благодаря чему модифицируется геном соматической клетки и/или клетки, не являющейся клеткой человека.

27. Способ по п. 26, где соматическая клетка и/или клетка, не являющаяся клеткой человека, представляет собой клетку млекопитающего.

28. Способ по п. 27, где соматическая клетка представляет собой клетку человека.

29. Способ по п. 27 или 28, где соматическая клетка и/или клетка, не являющаяся клеткой человека, дополнительно контактируют с нуклеиновой кислотой, кодирующей ген человека или его фрагмент.

30. Способ по п. 29, где ген человека или его фрагмент вставлен в геном соматической клетки и/или клетки, не являющейся клеткой человека.

31. Способ по п. 29 или 30, где клетка представляет собой соматическую клетку человека, ген-редактирующий белок нацелен на один или более генов человека, или где, когда клетка является клеткой, не являющейся клеткой человека, ген-редактирующий белок нацелен на один или более эндогенных ортологов гена человека.

32. Способ по п. 31, где один или более эндогенных ортологов инактивированы.

33. Способ по любому из пп. 29-32, где клетка, не являющаяся клеткой человека, дополнительно дифференцируется в клетку кожи, глюкозочувствительную инсулин-продуцирующую клетку, гемопоэтическую клетку, клетку сердечной мышцы, клетку сетчатки, клетку почки, нервную клетку, стромальную клетку, жировую клетку, костную клетку или мышечную клетку.

34. Способ по любому из пп. 29-33, где соматическую клетку и/или клетку, не являющуюся клеткой человека, культивируют в формате, совместимом с высокопроизводительным скринингом.

35. Способ по п. 34, где данный формат представляет собой многолуночный планшет.

36. Способ по любому из пп. 26-29, дополнительно включающий стадию имплантации соматической клетки и/или клетки, не являющейся клеткой человека, в бластоцисту или матку организма, не являющегося человеком.

37. Способ по п. 36, где организм, не являющийся человеком, выбирают из крысы, мыши, кролика, морской свинки, примата, свиньи, коровы, курицы, козы, осла, кошки, собаки и данио-рерио.

38. Набор для изменения последовательности молекулы ДНК-мишени в соматической клетке и/или в клетке, не являющейся клеткой человека, содержащий композицию по любому из пп. 1-24.

39. Вектор, содержащий нуклеиновую кислоту, кодирующую ген-редактирующий белок, охарактеризованный в любом из пп. 1-24 для изменения последовательности молекулы ДНК-мишени в соматической клетке и/или клетке, не являющейся клеткой человека.

40. Вектор по п. 39, где данный вектор представляет собой вирусный вектор.

41. Вектор по п. 40, где вирусный вектор включает один или более вирусов из: аденовируса, ретровируса, лентивируса, вируса герпеса, аденоассоциированного вируса и сконструированного вируса.



 

Похожие патенты:

Настоящее изобретение относится к области биотехнологии, конкретно к получению пептидных антираковых агентов, и может быть использовано в медицине в лечении или уменьшении интенсивности онкологического заболевания.

Изобретение относится к области биотехнологии, конкретно к получению выделенной клетки млекопитающего, подходящей для рекомбинантной экспрессии интересующего полипептида, где клетку млекопитающего изменяют для ухудшения функции эндогенной протеазы матриптазы посредством нокаута, мутации, делеции или сайленсинга гена матриптазы.

Изобретение относится к области биотехнологии. Представлены вариант субтилазы, содержащий замены S9E+Q206L+L262E, и другие изменения.

Изобретение относится к области биотехнологии, в частности к микроорганизму для продуцирования O-ацетилгомосерина с высокой эффективностью и к способу получения O-ацетилгомосерина и L-метионина с использованием этого микроорганизма.

Изобретение относится к области биотехнологии. Предложено моющее или чистящее средство, содержащее комбинацию протеазы и α-амилазы.

Группа изобретений относится к биотехнологии. Модифицированная сульфамидаза включает полипептид, состоящий из аминокислотной последовательности, приведенной в SEQ ID NO 1, или полипептид, имеющий по меньшей мере 95% идентичности последовательности с аминокислотной последовательностью, приведенной в SEQ ID NO 1.

Изобретение относится к биотехнологии. Способ получения ботулотоксина, включает: (а) обработку культуры продуцирующего ботулотоксин штамма кислотой с образованием осадка, содержащего ботулотоксин с последующей нейтрализацией рН осадка, (b) получение раствора для анионообменной хроматографии, содержащего буфер с использованием методов мембранной фильтрации и мембранной хроматографии и (c) очистку ботулотоксина с помощью анионообменной хроматографии, при этом ДНКазу и РНКазу не используют в указанном способе.

Изобретение относится к области биотехнологии, конкретно к стевиол-гликозиду ребаудиозида Z1, и может быть использовано в пищевой промышленности. Предложен способ получения композиции стевиол-гликозидов с применением рекомбинантных полипептидов, обладающих УДФ-гликозилтрансферазной активностью, включая 1,2-19-O-глюкоза-гликозилирующую активность и 1,2-13-O-глюкоза-гликозилирующую активность.

Изобретение относится к области биотехнологии. Мутантная рекомбинантная термостабильная фитаза PhyCf-t, зрелая часть которой имеет аминокислотную последовательность, приведенную в перечне последовательностей под номером SEQ ID NO: 3, начиная с 23 аминокислотного остатка, отличается от последовательности фитазы PhyCf из Citrobacter freundii заменой аминокислотного остатка лизина в положении 46, соответствующего в зрелой части белка положению 24, на аминокислотный остаток метионина, и заменой аминокислотного остатка лизина в положении 138, соответствующего в зрелой части белка положению 116, на аминокислотный остаток глутаминовой кислоты.

Изобретение относится к биотехнологии. Описан полипептид для нацеливания на выделяющийся фосфатидилсерин (PtdS) клеточной мембраны, который включает: (а) домен гамма-карбоксиглутаминовой кислоты белка S, представленный в SEQ ID NO: 1, или последовательности, по меньшей мере на 95% гомологичной ей, который не содержит домен протеазы или гормон-связывающий домен; и (б) белок S EGF домена.

Группа изобретений относится к генной инженерии и может быть использована для экспрессии нуклеазы Cas9 в промышленно ценных штаммах Debaryomyces hansenii. Предложена генетическая конструкция pDhCas9sgRNA с SEQ ID NО.1 на основе системы редактирования генома CRISPR/Cas9, которая кодирует нуклеазу Cas9, специфически импортируемую в клетки Debaryomyces hansenii.

Изобретение относится к области биотехнологии, конкретно к способу получения препаратов рекомбинантной нуклеазы семейства Cas системы CRISPR/Cas в клетках штамма Escherichia coli Rosetta-gami B (DE3) и их дальнейшей очистке.

Изобретение относится к биотехнологии. Описан способ модификации целевого геномного локуса в клетке млекопитающего, включающий в себя: введение в клетку нуклеазного агента, который осуществляет одно- или двухцепочечный разрыв в пределах целевого геномного локуса; введение в клетку первого большого нацеливающего вектора (LTVEC), который имеет длину по меньшей мере 10 т.п.н.

Настоящее изобретение относится к области биотехнологии, молекулярной биологии и медицины. Описан фермент нуклеаза PaCas9 и применение данного фермента нуклеазы.

Изобретение относится к биотехнологии. Описана нуклеиновая кислота, кодирующая адаптированную рекомбиназу, где адаптированная рекомбиназа способна к рекомбинированию асимметричных последовательностей-мишеней SEQ ID NO:1 внутри длинного концевого повтора провирусной ДНК множества штаммов ВИЧ-1, причем аминокислотная последовательность адаптированной рекомбиназы имеет по меньшей мере 95% идентичности последовательности с последовательностью в соответствии с SEQ ID NO:10, причем указанная адаптированная рекомбиназа содержит определенные аминокислотные замены по сравнению с SEQ ID NO:6: V7L, P12S, P15L, M30V, H40R, M44V, S51T, Y77H, K86N, Q89L, G93A, S108G, C155G, A175S, A249V, R259D, E262R, T268A, D278G, P307A, N317T, I320S.

Изобретение относится к биотехнологии. Описаны способы для модулирования экспрессии целевой нуклеиновой кислоты в клетке, включающие применение множества ортогональных белков Cas9 для того, чтобы одновременно и независимо регулировать соответствующие гены или одновременно и независимо редактировать соответствующие гены.

Изобретение относится к биотехнологии. Описана система CRISPR-Cas для редактирования генома в эукариотической клетке, содержащая: белок Cas9, содержащий по меньшей мере одну последовательность ядерной локализации, и химерную РНК (chiRNA) системы CRISPR-Cas, содержащую: (a) направляющую последовательность, способную гибридизироваться с целевой последовательностью в эукариотической клетке, (b) парную tracr-последовательность, способную гибридизоваться с tracr-последовательностью, и (c) tracr-последовательность, где (a), (b) и (c) расположены в 5’-3’ ориентации, где одна или несколько из направляющей, tracr- и парной tracr-последовательностей модифицированы для повышения стабильности и где необязательно белок Cas9 образует комплекс с химерной РНК (chiRNA) системы CRISPR-Cas.

Настоящее изобретение относится к биотехнологии. Предложены композиции и системы, содержащие векторы, включающие полинуклеотидные последовательности, кодирующие компоненты комплекса CRISPR-Cas типа II, а также набор, содержащий одну из таких композиций или систем.

Изобретение относится к биотехнологии. Описан способ генетического изменения эукариотической клетки.

Изобретение относится к биотехнологии. Описана сконструированная не встречающаяся в природе векторная система, содержащая один или несколько векторов, содержащихa) первый регуляторный элемент, функционально связанный с нуклеотидной последовательностью, кодирующей одну или несколько направляющих РНК системы CRISPR-Cas, которые способны гибридизоваться с целевыми последовательностями в геномных локусах молекул ДНК, кодирующих один или несколько продуктов генов, b) второй регуляторный элемент, функционально связанный с нуклеотидной последовательностью, кодирующей белок Cas, где белок Cas представляет собой белок Cas9 и содержит один или несколько NLS,где компоненты (a) и (b) находятся в одном и том же или разных векторах системы,вследствие чего направляющие РНК осуществляют нацеливание на геномные локусы молекул ДНК, кодирующих один или несколько продуктов генов, в эукариотической клетке, а белок Cas способен расщеплять геномные локусы молекул ДНК, кодирующих один или несколько продуктов генов, вследствие чего экспрессия одного или нескольких продуктов генов изменяется в эукариотической клетке; и где белок Cas и направляющие РНК не встречаются вместе в естественных условиях.

Группа изобретений относится к генной инженерии и может быть использована для экспрессии нуклеазы Cas9 в промышленно ценных штаммах Debaryomyces hansenii. Предложена генетическая конструкция pDhCas9sgRNA с SEQ ID NО.1 на основе системы редактирования генома CRISPR/Cas9, которая кодирует нуклеазу Cas9, специфически импортируемую в клетки Debaryomyces hansenii.

Настоящее изобретение относится к биоинженерии. Предложена композиция, содержащая нуклеиновую кислоту, кодирующую ген-редактирующий белок, включающий домен нуклеазы и ДНК-связывающий домен, содержащий повторы с аминокислотной последовательностью LTPvQVVAIAwxyzGHGG, где “v” представляет собой Q, D или E, “w” – S или N, “xy” - HD, NG, NS, NI, NN или N, а “z” - GGKQALETVQRLLPVLCQD или GGKQALETVQRLLPVLCQA. Также представлены способ in vitro изменения последовательности молекулы ДНК-мишени; набор для изменения последовательности молекулы ДНК-мишени и вектор, содержащий нуклеиновую кислоту, кодирующую вышеупомянутый белок. Ген-редактирующий белок имеет увеличенную длину повторов по сравнению с повторами в составе эффекторной нуклеазы, подобной активатору транскрипции, что обеспечивает увеличение эффективности редактирования генов. 4 н. и 37 з.п. ф-лы, 16 ил., 13 табл., 68 пр.

Наверх