Штамм гриба penicillium verruculosum mx-73 продуцент модифицированной ксиланазы е с повышенной термостабильностью, ферментный препарат на его основе для использования в пищевой и кормовой промышленности и способ его получения

Группа изобретений относится к биотехнологии, а также пищевой промышленности и сельскохозяйственной биотехнологии. Предложены штамм Penicillium verruculosum MX-73 (BKM F-4813D)-продуцент модифицированной эндо-1,4-β-ксиланазы, способ получения ферментного препарата с повышенным содержанием эндо-1,4-β-ксиланазы, ферментный препарат с повышенным содержанием эндо-1,4-β-ксиланазы для применения в хлебопекарной промышленности в качестве пищевой добавки и применение указанного ферментного препарата для применения в кормопроизводстве для моногастричных животных и птицы. Способ получения ферментного препарата эндо-1,4-β-ксиланазы предусматривает глубинное культивирование штамма–продуцента Penicillium verruculosum на питательной среде, содержащей KH2PO4, (NH4)2SO4, MgSO4x7H2O, CaCl2x2H2O, дрожжевой экстракт, МКЦ, пшеничные отруби с последующим отделением культуральной жидкости, ультрафильтрацией с пределом отсечения 10 кДа и высушиванием. Полученный ферментный препарат может быть использован в хлебопекарной промышленности в качестве пищевой добавки для улучшения свойств теста, а также в кормопроизводстве для разрушения некрахмальных полисахаридов в кормах для моногастричных животных и птицы. 4 н.п. ф-лы, 3 ил., 3 табл., 4 пр.

 

Группа изобретений относится к области биотехнологии, а именно, к созданию и производству комплексного ферментного препарата (ФП), содержащего высокоактивные и термостабильные ферменты. Группа изобретений может быть использована в хлебопекарной и кормовой промышленностях.

Основным негативным фактором растительного сырья, использующегося как в пищевой (в первую очередь в хлебопечении), так и в кормовой промышленности, является наличие пентозанов (ксиланов) - некрахмальных полисахаридов (НПС). Применение ФП ксиланаз, способных к эффективной деструкции пентозанов, обеспечивает эффективность их применения в различных отраслях промышленности.

Качество хлебобулочных изделий зависит от качества сырья, в первую очередь от хлебопекарных свойств муки. В настоящее время около 70% муки, использующейся в хлебопечении, имеет пониженные качественные показатели [Дремучева Г.Ф., Карчевская О.Е., Киндра Н.А., Бессонова Н.Г. Исследование хлебопекарных свойств пшеничной муки, перерабатываемой хлебопекарными предприятиями в 2015 г. / Материалы докладов Международной конференции «Хлебопекарное производство - 2015» / Международная промышленная академия 30 ноября - 2 декабря 2015 г. - М.: 2015. - 122 с.]. Для решения проблем, связанных с хлебопекарными свойствами муки, применяют различные пищевые добавки. Наиболее эффективным способом решения технологических задач, связанных с производством широкого спектра хлебобулочных изделий высокого качества, является применение в качестве пищевой добавки ФП.

Среди ФП, применяемых в хлебопекарной отрасли, широкое распространение получили эндо-ксиланазы и протеазы [Пищевые ингредиенты в производстве хлебобулочных и мучных изделий. - М.: Дели плюс, 2013. - 527 с.].

Пшеничная мука типа 550 (2-й тип) содержит приблизительно 2,5% слизистых веществ (НПС) [ржаная мука типа 1050 (4-й тип) - около 7%], которые способны связывать влагу в количестве в 10 раз превышающем их собственную массу. При расщеплении ксиланазами пентозанов (ксилана или арабиноксилана) из нерастворимых ксиланов с высокой молекулярной массой образуются более мелкие, растворимые в воде молекулы, что сопровождается высвобождением связанной воды и снижением вязкости.

Считается, что ксиланы с клейковиной образуют структурный каркас, который тем прочнее, чем больше в нем задействовано ксиланов. Кроме того, в ходе клейстеризации, вызванной окислительной реакцией, ксиланы соединяются между собой боковыми группами. Происходит усиленная фиксация воды, которая уже не может быть использована клейковиной для образования теста необходимой эластичности, что является одной причиной понижения объемного выхода хлеба. Поэтому темные сорта пшеничной муки и смеси пшеничной муки с ржаной дают меньший объемный выход, который можно существенно увеличить за счет введения ксиланаз. [Поппер Л. Ферментная обработка муки. // Хлебопродукты. 2009. №6. С. 46-49.; M.S. Butt et al. Xylanases in Baking Industry // Food Technol. Biotechnol. 2008. V. 46 (1). P. 22-31.].

Известно, что эндо-β-1,4-ксиланазы (КФ 3.2.1.8), катализирующие неупорядоченный гидролиз ксилозидных связей между остатками D-ксилозы в основной цепи ксиланов, широко применяются в кормовой промышленности для разрушения НПС злаковых культур, используемых в кормлении моногастричных животных и птицы. НПС не перевариваются в желудочно-кишечном тракте в связи с тем, что в их организме не вырабатываются соответствующие ферменты [Патент РФ №2653429 C1 от 08.05.2018, Бюл. №13]. Таким образом, ферменты, включенные в корм, дополняют ферментную систему птицы и моногастричных животных, обеспечивают переваривание НПС, и, в результате, способствуют улучшению использования питательных веществ рациона, а также улучшению здоровья животных и птицы. Экономические преимущества применения ФП в качестве кормовых добавок заключаются в увеличении доступности питательных веществ корма и в результате - в снижении его расхода на производство продукции. Преимуществом их использования также является возможность потребления более дешевых видов растительного сырья в качестве корма [Волчок А.А., Короткова О.Г., Кондратьева Е.Г., Крюков B.C., Синицына О.А., Синицын А.П., Шашков И.А. // Активность глюканаз и ксиланаз кормовых ферментных препаратов в ЖКТ птицы. // Птицеводство. 2018. №4. С. 39-45.].

Стоит, однако, отметить, что применяемые на практике ФП ксиланаз не обладают необходимыми свойствами: достаточной термостабильностью, высокой удельной активностью, а также устойчивостью по отношению к белковым ингибиторам злаков (последние оказывают негативное действие на ксиланазы при гидролизе ксиланов, содержащихся в зерне злаков [Гусаков А.В. // Биохимия. 2010. Т. 75. №10. С. 1331.]). В этом смысле повышение термостабильности промышленных ксиланаз является одной из актуальных задач, решение которой важно как для пищевой промышленности, так и для сельского хозяйства.

Обнаружено, что эндо-1,4-β-ксиланаза Ε (КсилЕ) из P.canescens, принадлежащая 10-й семье гликозид-гидролаз, является весьма перспективным ферментом для использования в качестве добавки к комбикормам на основе злаков, поскольку она устойчива к действию белковых ингибиторов, присутствующих в злаках, таких как рожь, пшеница, ячмень, а также обеспечивает глубокую степень гидролиза арабиноксилана [Ю.А. Денисенко, Д.А. Мерзлое, А.В. Гусаков, А.В. Чекушина, А.П. Синицын. // Сравнительная характеристика ксиланаз XylA И XylE из гриба Penicillium canescens. // Вестн. Моск. Ун-та. Сер. 2. Химия. 2015. Т. 56. №6. С. 348-353, Патент РФ №2653429 C1 от 08.05.2018, Бюл. №13]. Однако, в настоящее время требования к свойствам индивидуальных ферментов расширяются, и одним из необходимых условий является стабильность ферментов при высокой температуре.

Таким образом, создание продуцента термостабильной, высокоактивной и неингибируемой КсилЕ из P.canescens, а также получение ферментного препарата на его основе, осуществляющего эффективный гидролиз некрахмального полисахарида, ксилана, и имеющего возможность применения в хлебопекарной и кормовой промышленностях, является актуальной и перспективной задачей.

Одним из современных методов повышения термостабильности является биоинженерия ферментов с использованием сайт-направленного мутагенеза. Данный метод был успешно применен к увеличению термостабильности ксиланазы А P.canescens [Denisenko Υ.Α., Gusakov A.V., Rozhkova A.M., Osipov D.O., Zorov I.N., Matys V.Y., Uporov I.V., Sinitsyn A.P. Site-directed mutagenesis of GH10 xylanase A from Penicillium canescens for determining factors affecting the enzyme thermostability, International Journal of Biological Macromolecules, 2017, v. 104, p. 665-671]. Аналогичный подход был применен к модификации КсилЕ P.canescens.

Мицелиальный гриб Penicillium verruculosum PV2007 (ВКМ F-3972D) обладает гидролитическим комплексом внеклеточных ферментов, способным к эффективной биоконверсии растительных полисахаридов. В этот комплекс входят целлобиогидролазы, эндоглюканазы и β-глюкозидаза. На основе реципиентного штамма P.verruculosum 537 (ΔniaD) создана экспрессионная система [Патент RU 2378372 С2, опубликовано 10.01.2010, Бюл. №1], что позволяет использовать данный гриб как основу для получения рекомбинантных штаммов - продуцентов ферментов для практического применения в различных областях промышленности и сельского хозяйства [Skomarovsky, А.А., Gusakov, A.V., Okunev, O.N., Solov'eva, I.V., Bubnova, T.V., Kondrat'eva, E.G., Synitsyn, A.P. // Applied Biochemistry and Microbiology. 2005. Vol. 41. P. 182-184; Martins, L.F., Kolling, D., Camassola, M., Dillon, A.J., Ramos, L.P. // Bioresource Technology. 2008. Vol. 99. P. 1417-1424; Gusakov A.V., Sinitsyn A.P. // Biofuels. 2012. Vol. 3(4). Р. 463-477].

Кроме того, создание нового рекомбинантного штамма P.verruculosum с высоким уровнем экспрессии гетерологичной модифицированной КсилЕ P.canescens позволит увеличить выход целевого фермента, снизив тем самым стоимость конечного продукта.

Таким образом, создание нового штамма-продуцента термостабильной модифицированной КсилЕ Ε P.canescens и получение ФП на его основе, который будет эффективен при хлебопечении и кормлении сельскохозяйственных животных и птицы, является важной и актуальной задачей современной биотехнологии.

Техническая задача, на решение которой направлена группа изобретений, состоит в введении 2-х мутаций в ген xylE, кодирующий модифицированную форму КсилЕ, и получении сухого ФП на основе нового рекомбинантного штамма P.verruculosum МХ-73 (ВКМ F-4813D), являющегося продуцентом гетерологичной мутантной КсилЕ Р.canescens, относящаяся к 10-й семье гликозид-гидролаз (КФ 3.2.1.8, мол. масса 40 кДа) для применения в хлебопечении в качестве пищевой добавки для улучшения свойств теста и качества хлеба за счет гидролиза водонерастворимых арабиноксиланов до водорастворимых высокомолекулярных арабиноксиланов, а также для использования в качестве кормовой добавки для животных и птицы.

Технический результат от предлагаемой группы изобретений состоит в: 1) получении нового рекомбинантного штамма, являющегося основой для получения модифицированного ферментного препарата ксиланазы Ε с повышенной термостабильностью; 2) разработке способа получения ферментного препарата, который позволяет получать сухую форму ферментного препарата с модифицированной эндо-1,4-β-ксиланазы Ε Penicillium canescens; 3) в ферментном препарате с повышенным содержанием модифицированной эндо 1,4-β-ксиланазы Ε Penicillium canescens для получения водорастворимой фракции арабиноксиланов, перераспределению воды между структурными компонентами, улучшению непрерывной трехмерной структуры клейковины, что положительно отражается на стабильности теста, улучшает газоудерживающую способность, подъем тестовых заготовок в начальный период выпечки, качество хлеба и структуру мякиша за счет обработки новым ферментным препаратом; 4) применении ферментного препарата с повышенным содержанием модифицированной эндо 1,4-β-ксиланазы Ε Penicillium canescens для применения в кормовой промышленности в качестве кормовой добавки в условиях термошока при 80°С без существенной потери ксиланазной активности в течение 1,5 мин.

Сущность группы изобретений заключается в:

- получении рекомбинантного штамма P.verruculosum МХ-73 (BKM F-4813D), который при выращивании на ферментационной среде на основе микрокристаллической целлюлозы (МКЦ), обеспечивает получение ФП комплексного действия, включающего термостабильную высокоактивную гетерологичную КсилЕ P.canescens. Общая активность культуральной жидкости (КЖ) по окончании ферментации в лабораторном 1-л ферментере составляет 1900 ед/мл по ксилану березы (рН 5,0, 50°С).

- способе получения ФП предусматривает глубинное культивирование штамма-продуцента P.verruculosum МХ-73 (ВКМ F-4813D) на среде, содержащей МКЦ, пшеничные отруби и дрожжевой экстракт с последующей распылительной сушкой КЖ и доведении ферментативной активности препарата до 54000 ед/г по ксилану бука.

- ферментном препарате ФП с высокой активностью целевой КсилЕ с повышенной термостабильностью используемом для улучшения свойств теста и качества хлеба.

- в применении нового комплексного ФП в процессах пеллетизации кормов в условиях термошока при 80°С.

Изобретение реализуется следующим образом:

Штамм P.verruculosum МХ-73 (ВКМ F-4813D) получен из исходного штамма P.verruculosum PV2007 (ВКМ F-3972D) путем трансформации плазмидой pCBHI-XYLE-mut2 с последующей селекцией на агаризованной среде с 10 мМ NaNO3.

Культурально-морфологические и микроскопические особенности штамма P.verruculosum МХ-73 (ВКМ F-4813D):

Растет на агаризованных средах (среда Чапека с дрожжевым автолизатом, Мальц-агар, глюкозо-картофельный агар, сусло-агар) при t 26-30°С в течение 7-10 суток, рН 4.5-5.0.

На среде Чапека с дрожжевым экстрактом при культивировании гриба при 25°С на 7 сутки колонии достигают 24-30 мм в диаметре, складчатые, поверхность сильно радиально складчатая, плотная, тонкая, ростовая зона врастает в агар, имеет ширину 1.5-2.0 мм. Мицелий светло-желтоватый, шерстистый, центр колонии выпуклый, конидиогенез слабый, серо-зеленоватого оттенка. Экссудата и растворимого пигмента нет. Обратная сторона светлая, в центре колонии - палево-оранжевая. При температуре 37°С колонии диаметром 5 мм, мицелий светлый, конидиообразования нет. При температуре 5°С роста нет.

При микроскопировании штамм имеет конидиеносцы двухярусные, терминальные, бивертициллятные, гладкие длиной около 150 мкм, шириной 2-3 мкм. Метулы расходящиеся размером 10-13 × 2,5-3,0 мкм, фиалиды ампуллиформные размером 7-8 × 2,8-3,0 мкм. Конидии округлые, шероховатые размером 3,0-3,5 мкм.

При культивировании в глубинных условиях с использованием растворимых субстратов (глюкоза, фруктоза, лактоза) образуется рыхлый разветвленный мицелий со слабой пеллетизацией, удельная начальная скорость роста мицелия составляла 0,35 ч-1, в конце культивирования 0,1 ч-1.

Физиолого-биохимические признаки штамма:

Мезофилен. Оптимальная температура роста мицелия 32°С (29-34°С), оптимум для образования целлюлаз 28°С (26-29°С). Оптимальные значения рН роста и секреции целлюлаз 3,5-5,0. Рост мицелия наблюдается и при рН 2,5, но при этом наблюдается очень слабое образование целлюлаз и других карбогидраз.

Является прототрофом. Способен быстро ассимилировать глюкозу, глицерин, галактозу, D-маннозу, D-маннит, трегалозу, сорбозу и сорбит, медленнее - D-ксилозу, L- и D-арабинозу, L-рамнозу и рибозу. Слабо ассимилирует: D-глюкозамин, дезоксирибозу, дезоксигалактозу, 2-дезокси-D-глюкозу и 5-тио-D-глюкозу.

Использует неорганический и органический азот, хорошо ассимилирует нитратную и аммонийную формы азота.

Штамм P.verruculosum МХ-73 (ВКМ F-4813D) отличается от исходного наличием продукции термостабильной модифицированной и высокоактивной КсилЕ, в связи с этим увеличением общей активности по ксилану в 4,3 раз (сравнивала с 12500 ед у В1-537 №3-321.2) по сравнению с исходным штаммом-реципиентом.

В предлагаемом изобретении метод определения ксиланазной, бета- глюканазной и КМЦ-азной активностей основан на измерении скорости образования восстанавливающих Сахаров (ВС) методом Шомоди-Нельсона при гидролизе полисахаридных субстратов (ксилана из древесины березы, бета-глюкана ячменя и КМЦ, соответственно). За единицу активности принимается такое количество фермента, которое приводит к образованию 1 мкмоль ВС в минуту при рН 5,0 и 50°С [Синицын А.П., Гусаков А.В., Черноглазое В.А. Биоконверсия лигноцеллюлозных материалов. - М.: МГУ, 1995. - 144 с].

Новый ФП, полученный на основе рекомбинантного штамма P.verruculosum МХ-73 (ВКМ F-4813D), обладает улучшенными эксплуатационными характеристиками за счет введения 2-х мутаций в ген xylE, кодирующий мутантную форму КсилЕ, имеющую высокую эндо-β-1,4-ксиланазную активность и увеличенную термостабильность в сравнении с исходным штаммом P.verruculosum PV2007 (ВКМ F-3972D).

Новый ФП, полученный на основе КЖ мутантного штамма P.verruculosum МХ-73 (ВКМ F-4813D), продуцента термостабильной высокоактивной КсилЕ, будет иметь высокую рентабельность применения в хлебопечении за счет обеспечения высокой целевой активности, и устойчивости ферментной системы к действию повышенных температур, необходимых условий для гидролиза НПС зерновой составляющей мучных смесей. А также будет иметь широкое применение в качестве кормовой добавки за счет возможности использования его при пеллетизации без существенной потери основной ксиланазной активности.

Возможность использования группы изобретений иллюстрируется примерами, которые не ограничивают объем и сущность притязаний, связанных с ними.

Пример 1. Белковая инженерия КсилЕ и введение точечных мутаций в ген xylE.

Было проведено сравнение аминокислотных последовательностей различных ксиланаз, относящихся к 10-ому семейству гликозид-гидролаз (GH10) из различных грибных источников, а именно, ксиланазы A (PcXylA, GenBank AN: AAV65488.1) и КсилЕ (PcXylE, GenBank AN: ACP27611.1) из

умеренно термофильного гриба Chrysosporium lucknowense и наиболее термостабильной ксиланазы А (TaXynA, GenBank AN: AWO67305.1) из Thermoascus aurantiacus (Рисунок 1).

На основании компьютерного моделирования 3D-структур эндо-ксиланаз из гриба P.canescens и приведенных данных по сравнению аминокислотных последовательностей различных ксиланаз было сделано следующее предположение: Замена остатка ароматической аминокислоты на заряженный положительно (Y133R) и замена аспартата на более длинный (за счет еще одной –С-С-связи) глутамат (D247E) без изменения заряда приведет к образованию солевого мостика. Таким образом, в КсилЕ целесообразно сделать двойную мутацию Y133R и D247E; при этом должен образоваться солевой мостик, который имеется в термостабильной TaXynA (места предполагаемых мутаций отмечены звездочкой на фиг. 1.

Для введения мутаций в ген xylE, были использованы олигонуклеотиды, приведенные в Таблице 1.

Таблица 1- Структура олигонуклеотидов для введения мутаций в xylE ген

Название Структура олигонуклеотида (5`→3`)
XylE-LIC5 CAAACAGAAGCAACCGACACAATGCGTCCATCCCTAGTGATCGCGGCCTTG
XylE-LIC3 GAGGAGAAGCCCGGTCTAGCACACACTGCAAGGCTTTCCCTCG
Y133R-fwd ACGTCGCTGTCGCTCTTGGGATGTGGTCAAC
Y133R-rev ACATCCCAAGAGCGACAGCGACGTCCGAAGT
D247E-fwd AGGCCAACCTGGAAGTTGCTGTCACGGAGCT
D247E-rev TGACAGCAACTTCCAGGTTGGCCTTGATGT

Амплификация ПЦР-продуктов проводилась в термоциклере MyCycler (BioRad, США). В качестве матрицы в общем случае была взята геномная ДНК штамма P.canescens, предварительно выделенная из 2-х дневного мицелия гриба с помощью набора "DNeasy Plant Mini Kit (QIAGEN, Германия). Получение полноразмерного гена с 1-ой или 2-мя точечными мутациями проводилась в два этапа методом модифицированной гнездовой ПЦР. На первом этапе были получены отдельные фрагменты с использованием форвардных олигонуклеотидов и олигонуклеотида XylE-LIC3 и реверсных олигонуклеотидов и олигонуклеотида XylE-LIC5. Полученные фрагменты были выделены из 1% агарозного геля с использованием набора GelExtraction KIT (QIAGEN, Германия) и смешаны попарно в качестве матриц для получения полноразмерного гена xylE ПЦР-методом с использованием крайних праймеров XylE-LIC3 и XylE-LIC5, которые содержали сайты независимого лигирования для последующего лигирования полноразмерного гена с мутацией в вектор pUC-CBHI. Полноразмерные ПЦР-продукты (размер 1168 п.о.) и ранее полученный линеаризованный вектор pUC-CBHI были обработаны Т4 ДНК полимеразой (Thermo Fisher Scientific Inc., Waltham, MA, USA) в присутствии dAТP и dTTP (Thermo Fisher Scientific Inc., Waltham, MA, USA), соответственно. Условия проведения реакции были следующими: 22–30 мин, 80–30 мин. Обработанные продукты были лигированы в вектор pUC-CBHI в соотношении 50 нг вектора с 150 нг вставки. Затем смесь инкубировали в течение 1 часа при 22°С без добавления лигазы, после этого такой смесью были трансформированы бактериальные компетентные клетки штамма E. coli MachI (Invitrogene, Carlsbad, CA, USA) по стандартному протоколу трансформации [J. Sambrook, D. Russell, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 2001]. Таким образом, были получены бактериальные колонии, способные расти на среде с ампициллином, благодаря гену Amp в составе полученной плазмидной конструкции. Для получения плазмиды pXYLE с немутированным геном использовались олигонуклеотиды XylE-LIC3 и XylE-LIC5. Схема клонирования была аналогичной.

Скрининг полученных клонов осуществляли с помощью ПЦР. Для этого использовали клетки E. coli в качестве матрицы, BIOTAQ™ Red DNA Polymerase (Bioline Reagents Ltd, UK) и концевые олигонуклеотиды XylE-LIC3 и XylE-LIC5. Реакцию проводили при следующих условиях: 1,5 мин при 95°С (первичная денатурация); 30 последующих циклов – 1 мин при 95°С (денатурация в цикле), 2 мин при 50°С, 1 мин при 72°С (синтез); 10 мин при 72°С, 10 мин при 4°С. Полученные продукты были исследованы с помощью 1%-ного агарозного гель-электрофореза в буфере TBE. Было показано, что эффективность клонирования составила 100%. Таким образом были получены плазмиды pXYLE, pXYLE-Y133R, pXYLE-D247E, pXYLE-Y133R/D247E.

Секвенирование плазмид показало наличие мутаций в искомых областях полинуклеотидной последовательности при отсутствии инсерций, делеций или дополнительных мутаций в остальной части гена xylE.

Пример 2. Получение рекомбинантных штаммов P.verruculosum MX-18, P.verruculosum MX-73, P.verruculosum MX-313 и P.verruculosum XylE.

Четыре плазмиды, полученные в Примере 1 были трансформированы в реципиентный штамм P.verruculosum 537 (ΔniaD) совместно с плазмидой pSTA10 в соотношении 3:1 (мкг каждой ДНК) по стандартной методике [Sambrook, J., and Russell, D.W. (2001) Molecular cloning:a laboratory manual, Cold Spring Harbor Laboratory Press, N.Y.; A.Y. Aleksenko, N.A. Makarova, I.V. Nikolaev, A.J. Clutterbuck, Integrative and replicative transformation of Penicillium canescens with a heterologous nitrate-reductase gene, Curr. Genet. 28 (1995) 474-478]. В результате трансформации было получено более 20 рекомбинантных штаммов для каждой трансформации. Трансформанты были культивированы в колбах на стандартной среде культивирования следующего состава (г/л): KH2PO4 - 15, (NH4)2SO4 - 5, MgSO4×7H2O - 0,3, CaCl2×2H2O - 0,3, дрожжевой экстракт - 10, МКЦ - 40, пшеничные отруби-10. В результате первичного скрининга были отобраны 4 клона, по одному из каждой серии, с наибольшей ферментативной активностью по ксилану.

Культивирование четырёх отобранных клонов проводили в ферментере объемом 3 л, оснащенном барботером для подачи воздуха в аппарат и турбинной мешалкой на среде 1 следующего состава:

Среда 1 (г/л):

Глюкоза – 40

МКЦ – 40

Дрожжевой экстракт – 10

Пшеничные отруби – 10

KH2PO4 – 15

(NH4)2SO4 – 5

CaCl2 – 0,3

MgSO4*7H2O – 0,3

Культивирование проводили 144 ч, при рН не ниже 4,5 и 32°С. Образцы КЖ отбирали каждые сутки, начиная с 72 ч культивирования, центрифугировали и измеряли основные КМЦ-азную, ксиланазную активности и активность по β-глюкану.

По окончании ферментации грибную биомассу удаляли путём центрифугирования (4000 об/мин в течение 20 мин на центрифуге Avanti JXN-26, «Beckman coulter», США), свободную от клеток КЖ концентрировали с помощью ультрафильтрации (с пределом отсечения 10 кДа), ультраконцентрат сушили на распылительной сушилке (Buchi MiniSpray Dryer B-290, условия: Твх=135°С, Твых=55-65°С, степень аспирации 70%, скорость потока 0,5 л КЖ в час ) с получением сухих ФП, которые представляли собой желто-коричневый легко растворимый в водной среде порошок. Таким образом были получены 4 сухих ФП, ферментативная активность которых по отношению к различным субстратам и содержание белка ФП, полученных при культивировании в ферментерах с помощью рекомбинантных штаммов, по сравнению с контрольным ФП, полученным с помощью штамма-реципиента, предсиавлены в Таблице 2. ФП препараты MX-73 и MX-313 обладали высокой активностью по ксилану - 54000 и 84000 ед/г препарата, соответственно. При этом ксиланазная активность ФП на основе исходного штамма-реуипиента составляла всего 12500 ед/г.

Проводили масс-спектрометрический (МС) анализ образцов целевых белков для подтверждения аминокислотных замен. Данные МС показали присутствие пептидов, характерных для трех мутантных форм КсилЕ Y133R (MX-18, 15-20 пептидов), D247E (MX-313, 14-18 пептидов), Y133R/D247E (MX-73, 23 пептида).

Пример 3. Изучение термостабильности модифицированной КсилЕ при 70°С и в условиях термошока при 80°С.

Для изучения термостабильности модифицированной КсилЕ целевой фермент был выделен в гомогенном виде в три стадии по приведённой ниже схеме с использованием хроматографа AKTA purifier:

1. Гель-проникающая хроматография (колонка BioGel P2, буфер 0,02 М Bis-Tris/HCl; pH 6.80) для обессоливания растворов ФП.

2. Фракционирование обессоленного ФП с помощью анионообменной хроматографии (колонка Sourse 15Q 10 мл, элюент 0,01 М Bis-Tris/HCl; pH 6.8) в градиенте NaCl от 0 до 0,4 М.

3. Доочистка фракций, содержащих КсилЕ, с помощью гидрофобной хроматографии (колонка Sourse 15Iso 1 мл, элюент 50 mМ NaAc; pH 5.0) в градиенте сульфата аммония от 1,7 до 0 М.

Таким образом были выделены в гомогенном виде модифицированные формы КсилЕ из ФП на основе рекомбинантных штаммов P.verruculosum MX-18, P.verruculosum MX-73, P.verruculosum MX-313 и P.verruculosum XylE.

Термостабильность гомогенных ферментов определяли при 70°С (20 мин) и 80°C (3 мин), внося предварительно разбавленный до необходимого объема раствор фермента (в Na-Ac-буфере 0,1 М рН 5.0) в предварительно прогретую, установленную в термостат пробирку. По прошествии определенного промежутка времени пробирку помещали в ледяную баню, охлаждали до комнатной температуры и определяли ксиланазную активность раствора по ксилану бука. Данные по термостабильности гомогенных ферментов приведены на Фиг 2 и 3.

Модифицированная форма (МФ) КсилЕ MX-73 Y133R/D247E с двумя аминокислотными заменами, обозначенная на Фиг.2 треугольными символами, была более стабильна, чем другие МФ и чем исходная немутированная форма фермента, обозначенная пунктирной линией. Например, по истечении 20 минут инкубации активность мутантной формы КсилЕ MX-73 имела на 30% более высокую остаточную активность при температуре 70°C по сравнению с исходной дикой формой фермента (Фиг. 2). МФ КсилЕ, содержащие одиночные аминокислотные замены Y133R и D247E и обозначенные на Фиг. 2 квадратными и круглыми символами, соответственно, не показали увеличения термостабильности относительно немутированной формы фермента КсилЕ.

Наибольшую практическую значимость имеет изучение термостабильности новых форм модифицированной КсилЕ в условиях термошока при 80°С, поскольку данная температура достигается в процессе пеллетизации кормов и большинство ферментных препаратов теряет свою активность именно на этой стадии [Короткова О.Г., Синицына О.А., Кондратьева Е.Г., Кержнер М.А., Мосеев П.А., Синицын А.П. // Сравнительный анализ активности кормовых ферментных препаратов, предназначенных для деструкции некрахмальных полисахаридов // Птицеводство. 2016. №5. C. 8-13].

Активность МФ КсилЕ MX-73 с двойной аминокислотной заменой Y133R/D247E после 1 мин инкубации при 80°С сохранялась на уровне 94% (обозначено треугольниками на Фиг. 3), при этом активность немутированной КсилЕ падала за тоже время до 50-60%. После 3 мин инкубации активность МФ КсилЕ MX-73 находилась на уровне 34% от исходной, что на 20% больше по сравнению с активностью немутированной КсилЕ (Фиг. 3, пунктирная линия). МФ, содержащие одиночные аминокислотные замены Y133R и D247E, выделенные из ФП P.verruculosum MX-18 и P.verruculosum MX-313, теряли свою активность за 1 мин инкубации при 80°С на 9 и 15% быстрее, чем немутированная КсилЕ.

Таким образом, новая модифицированная ксиланаза Е, выделенная из секретируемой жидкости штамма P.verruculosum MX-73 (BKM F-4813D), и содержащая две аминокислотные замены Y133R/D247, обладает увеличенной термостабильностью при высоких температурах (до 30%) по сравнению с другими МФ КсилЕ и по сравнению с рекомбинантным немутированным ферментом.

Пример 4. Применение нового ФП P. verruculosum MX-73 (BKM F-4813D) при приготовлении хлеба.

Проводили исследование влияния ФП P. verruculosum MX-73 (BKM F-4813D) на качество хлеба при однофазном способе приготовления теста из пшеничной хлебопекарной муки высшего сорта с удовлетворительной крепкой клейковиной.

ФП P. verruculosum MX-73 (BKM F-4813D) с активностью КсилЕ 54000 ед./г и бета-глюканазы 700 ед./г вносили на стадии приготовления замеса теста. Контрольную пробу теста готовили без добавления ФП, опытную – с внесением нового комплексного ФП в количестве 0,004% от массы муки. Тесто замешивали из 100 кг пшеничной муки, 4,0 кг прессованных хлебопекарных дрожжей, 1,5 кг поваренной пищевой соли и 55,0 кг питьевой воды в течение 10 мин и оставляли на брожение в течение 50 мин. Затем тесто деляли на куски массой 350 г, округляли и подвергали предварительной расстойке в течение 2 мин. Округленные куски теста формовали и направляли в расстойный шкаф для окончательной расстойки. Хлеб выпекали при температуре 230°С в течение 22 мин. Показатели качества хлеба представлены в таблице 3.

Внесение нового ФП P. verruculosum МХ-73 (ВКМ F-4813D) в количестве 0,004% от массы муки способствовало получению более эластичного и более устойчивого в брожении теста. Новый ФП обеспечивал более светлый с более тонкостенной и равномерной пористостью мякиш, повышал удельный объема хлеба на 23,5%, а пористость мякиша - на 6%. Формоустойчивость увеличивалась на 6,4% по сравнению с контролем.

ШТАММ ГРИБА PENICILLIUM VERRUCULOSUM МХ-73 ПРОДУЦЕНТ МОДИФИЦИРОВАННОЙ КСИЛАНАЗЫ Е С ПОВЫШЕННОЙ ТЕРМОСТАБИЛЬНОСТЬЮ И ФЕРМЕНТНЫЙ ПРЕПАРАТ НА ЕГО ОСНОВЕ ДЛЯ ИСПОЛЬЗОВАНИЯ В ПИЩЕВОЙ И КОРМОВОЙ ПРОМЫШЛЕННОСТИ

Таблица 2 - Ферментативная активность по отношению к различным субстратам и содержание белка ФП, полученных при культивировании в ферментерах с помощью рекомбинантных штаммов, по сравнению с контрольным ФП (контроль, полученным с помощью штамма-реципиента)

ШТАММ ГРИБА PENICILLIUM VERRUCULOSUM МХ-73 ПРОДУЦЕНТ МОДИФИЦИРОВАННОЙ КСИЛАНАЗЫ Е С ПОВЫШЕННОЙ ТЕРМОСТАБИЛЬНОСТЬЮ И ФЕРМЕНТНЫЙ ПРЕПАРАТ НА ЕГО ОСНОВЕ ДЛЯ ИСПОЛЬЗОВАНИЯ В ПИЩЕВОЙ И КОРМОВОЙ ПРОМЫШЛЕННОСТИ

Таблица 3.- Показатели качества хлеба при однофазном способе приготовления теста из пшеничной хлебопекарной муки высшего сорта с удовлетворительной крепкой клейковиной, выработанного с внесением ФП МХ-73 и контроля (без ФП)

Прирост к контролю, % - +23,5
Формоустойчивость, (Н/Д) 0,31 0,33
Прирост к контролю, % - +6,4
Внешний вид:
форма Правильная
поверхность корки Гладкая
Состояние мякиша:
цвет Белый Белый, более светлый
равномерность цвета Равномерный
эластичность Хорошая
липкость Отсутствует
Пористость:
по крупности Средняя Мелкая
по равномерности Неравномерная Равномерная
по толщине стенок пор Тонкостенная Более тонкостенная
Вкус Свойственный данному виду изделия
Запах Свойственный данному виду изделия
Комкуемость мякиша при разжевывании Отсутствует
Крошковатость Не крошащийся

1. Рекомбинантный штамм мицелиального гриба Penicillium verruculosum МХ-73, депонированный во Всероссийской коллекции микроорганизмов под номером ВКМ F-4813D, продуцент модифицированной эндо-1,4-β-ксиланазы Ε Penicillium canescens.

2. Способ получения ферментного препарата с повышенным содержанием модифицированной эндо-1,4-β-ксиланазы Ε Penicillium canescens, состоящий в глубинном культивировании штамма-продуцента P.verruculosum МХ-73 (ВКМ F-4813D) на среде следующего состава (г/л): KH2PO4 - 15, (NH4)2SO4 - 5, MgSO4×7H2O - 0,3, CaCl2×2H2O - 0,3, дрожжевой экстракт - 10, МКЦ - 40, пшеничные отруби - 10, с последующим отделением культуральной жидкости от биомассы гриба-продуцента, ультрафильтрацию с пределом отсечения 10 кДа и высушивание препарата на распылительной сушке при условиях: Твх=135°С, Твых=55-65°С, степень аспирации 70%, скорость потока 0,5 л КЖ в час.

3. Ферментный препарат с повышенным содержанием модифицированной эндо 1,4-β-ксиланазы Ε Penicillium canescens, полученный способом по п. 2, и используемый в хлебопекарной промышленности в качестве пищевой добавки для улучшения свойств теста.

4. Применение ферментного препарата с повышенным содержанием модифицированной эндо 1,4-β-ксиланазы Ε Penicillium canescens, полученного способом по п. 2, в кормопроизводстве для разрушения некрахмальных полисахаридов в кормах для моногастричных животных и птицы.



 

Похожие патенты:
Изобретение относится к биотехнологии. Предложен способ количественного мониторинга бактериальных эндоспор в водной среде бумажных и картонных фабрик.

Изобретение относится к биотехнологии. Штамм микромицета Trichoderma atrobrunneum, обладающий антибактериальной активностью в отношении Bacillus anthracis, депонирован в ВКПМ под регистрационным номером ВКПМ F-1434.

Изобретение может быть использовано в биотехнологии для производства противобактериального антибиотика ИНА 5812. Антибиотик ИНА 5812 по химическому строению является оригинальным линейно-циклическим гликопептидным соединением, активным в отношении грамположительных патогенов in vitro и высокоэффективным в опытах in vivo при экспериментальном лечении стафилококкового сепсиса у белых мышей.

Изобретение относится к санитарной микробиологии. Питательная среда для выделения бактерий Pseudomonas aeruginosa из водных объектов содержит мясо-пептонный агар, глюкозу, глицерин и сульфат меди (CuSO4×5H2O) при заданном содержании компонентов.

Изобретение относится к фотобиотехнологии. Предложен штамм микроводоросли Bracteacoccus aggregatus (syn.

Изобретение относится к ассоциации микроорганизмов для снижения эмиссии аммиака и/или метана в почве или удобрении и ее применению. Предложенная ассоциация микроорганизмов депонирована в CBS под депозитарным номером NR CBS 134115.

Изобретения относятся к биотехнологии. Предложены реакционная смесь для получения по меньшей мере одного высшего спирта в водной среде, способ получения по меньшей мере одного высшего спирта в водной среде, применение указанной реакционной среды для получения по меньшей мере одного высшего спирта.

Изобретение относится к микробиологии, в частности к способам физической стерилизации в лабораториях и ветеринарных клиниках. Предложен способ обработки культуры Staphylococcus aureus кислородсодержащим газом из портативного озонатора.

Изобретение относится к санитарной и клинической микробиологии. Питательная среда для выделения бактерий Pseudomonas aeruginosa содержит панкреатический гидролизат рыбной муки, калий сернокислый, магний сернокислый 7-водный, калий фосфорнокислый однозамещенный, калий фосфорнокислый двузамещенный, фенозан-кислоту, бутилгидрокситолуол, N-цетилпиридиний хлористый 1 водный (ЦГГХ), натрий углекислый, агар бактериологический и дистиллированную воду при заданном содержании компонентов.

Изобретение относится к области биотехнологии, микробиологии, экологии, охране окружающей среды. Предложен микробный препарат для утилизации углеводородных загрязнений в водной среде при температуре от +20 до -2,5°С и солености 30±10 г/л.

Изобретение относится к области биотехнологии. Предложено моющее или чистящее средство, содержащее комбинацию протеазы и α-амилазы.

Изобретение относится к области биохимии, в частности к генетически модифицированной клетке-хозяину млекопитающего, которая содержит первую нуклеиновую кислоту, кодирующую экзогенную фукозидазу, и вторую нуклеиновую кислоту, кодирующую эндогликозидазу, а также способ ее получения.

Изобретение относится к области биохимии, в частности к генетически модифицированной клетке-хозяину млекопитающего, которая содержит первую нуклеиновую кислоту, кодирующую экзогенную фукозидазу, и вторую нуклеиновую кислоту, кодирующую эндогликозидазу, а также способ ее получения.
Изобретение относится к производству фармацевтических субстанций ферментов, а именно к способу получения гиалуронидазы из животного сырья - семенников крупного рогатого скота (КРС).

Изобретение относится к микробиологии и биотехнологии. Предложен рекомбинантный штамм дрожжей Pichia pastoris ВКПМ Y-4394, продуцирующий ксиланазу.

Изобретение относится к микробиологии и биотехнологии. Предложен рекомбинантный дрожжей Komagataella kurtzmanii ВКПМ Y-4464, продуцирующий β-глюканазу.

Изобретение относится к микробиологии и биотехнологии. Предложен рекомбинантный штамм дрожжей Pichia pastoris ВКПМ Y-4463, продуцирующий β-глюканазу.

Изобретение относится к области биотехнологии и решает задачу получения в промышленных объемах высокоочищенной ферментативно активной рекомбинантной β-1,4-галактозидазы BgaA, пригодной для использования на стадии ремоделирования для получения терапевтически функциональных препаратов гликопротеинов с заданными свойствами, для разработки инструментов для высокочувствительного анализа гликановых цепей гликопротеинов тканей растений, животных и микроорганизмов.

Изобретение относится к области биотехнологии. Предложены штамм Trichoderma reesei ВКМ F-4789D, способ получения кормового комплексного ферментного препарата и способ повышения кормовой ценности зерновых и зернобобовых смесей.

Изобретение относится к области биотехнологии. Предложены штамм Trichoderma reesei ВКМ F-4789D, способ получения кормового комплексного ферментного препарата и способ повышения кормовой ценности зерновых и зернобобовых смесей.

Изобретение относится к биотехнологии. Штамм микромицета Trichoderma atrobrunneum, обладающий антибактериальной активностью в отношении Bacillus anthracis, депонирован в ВКПМ под регистрационным номером ВКПМ F-1434.

Группа изобретений относится к биотехнологии, а также пищевой промышленности и сельскохозяйственной биотехнологии. Предложены штамм Penicillium verruculosum MX-73 -продуцент модифицированной эндо-1,4-β-ксиланазы, способ получения ферментного препарата с повышенным содержанием эндо-1,4-β-ксиланазы, ферментный препарат с повышенным содержанием эндо-1,4-β-ксиланазы для применения в хлебопекарной промышленности в качестве пищевой добавки и применение указанного ферментного препарата для применения в кормопроизводстве для моногастричных животных и птицы. Способ получения ферментного препарата эндо-1,4-β-ксиланазы предусматривает глубинное культивирование штамма–продуцента Penicillium verruculosum на питательной среде, содержащей KH2PO4, 2SO4, MgSO4x7H2O, CaCl2x2H2O, дрожжевой экстракт, МКЦ, пшеничные отруби с последующим отделением культуральной жидкости, ультрафильтрацией с пределом отсечения 10 кДа и высушиванием. Полученный ферментный препарат может быть использован в хлебопекарной промышленности в качестве пищевой добавки для улучшения свойств теста, а также в кормопроизводстве для разрушения некрахмальных полисахаридов в кормах для моногастричных животных и птицы. 4 н.п. ф-лы, 3 ил., 3 табл., 4 пр.

Наверх