Новые эукариотические клетки и способы их получения для рекомбинантной экспрессии представляющего интерес продукта



Новые эукариотические клетки и способы их получения для рекомбинантной экспрессии представляющего интерес продукта
Новые эукариотические клетки и способы их получения для рекомбинантной экспрессии представляющего интерес продукта
Новые эукариотические клетки и способы их получения для рекомбинантной экспрессии представляющего интерес продукта
Новые эукариотические клетки и способы их получения для рекомбинантной экспрессии представляющего интерес продукта
Новые эукариотические клетки и способы их получения для рекомбинантной экспрессии представляющего интерес продукта
Новые эукариотические клетки и способы их получения для рекомбинантной экспрессии представляющего интерес продукта
Новые эукариотические клетки и способы их получения для рекомбинантной экспрессии представляющего интерес продукта
Новые эукариотические клетки и способы их получения для рекомбинантной экспрессии представляющего интерес продукта
Новые эукариотические клетки и способы их получения для рекомбинантной экспрессии представляющего интерес продукта
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2712507:

НОВАРТИС АГ (CH)

Изобретение относится к новым эукариотическим клеткам, подходящим для рекомбинантного продуцирования представляющего интерес продукта, где геном клетки-хозяина модифицируют для ингибирования функция белка FAM60A в указанной клетке, например, посредством снижения или блокирования функциональной экспрессии гена FAM60A, что приводит к повышению ее стабильности. Кроме того, настоящее изобретение относится к технологиям рекомбинантного продуцирования, в которых используются такие клетки-хозяева. Изобретение позволяет повысить уровень продуцирования полипептида. 5 н. и 12 з.п. ф-лы, 9 ил., 12 табл., 6 пр.

 

Область, к которой относится изобретение

Настоящее изобретение относится к области технологии рекомбинантной экспрессии. Настоящее изобретение, inter alia, относится к модифицированным эукариотическим клеткам, способным к повышенному продуцированию представляющего интерес продукта, а также к использованию в методах рекомбинантной экспрессии. Кроме того, настоящее изобретение относится к способам, которые позволяют предварительно, еще в процессе отбора, идентифицировать эукариотические клетки, которые экспрессируют рекомбинантный продукт с повышенной стабильностью исходя из профиля экспрессии эукариотических клеток. Предпочтительной эукариотической клеткой является клетка млекопитающего.

Предшествующий уровень техники

Рынок биофармацевтических средств продолжает быстро расширяться, поскольку биофармацевтические средства приобретают все более важное значение в современной медицине. В настоящее время, все возрастающее число биофармацевтических средств продуцируется с использованием эукариотических клеток, а в частности, таких как клетки млекопитающих. Таким образом, эффективное и крупномасштабное продуцирование биофармацевтических средства в клетках млекопитающих имеет исключительно важное значение. Генерирование клеточных линий, продуцирующих представляющий интерес терапевтический белок, занимает значительную часть времени, необходимого для доставки любого биофармацевтического материала в клинику. Кроме того, также важно учесть стоимость приготовления биофармацевтических средств и других рекомбинантных продуктов, поскольку для их продуцирования необходимо получить рекомбинантные эукариотические клеточные линии со стабильной экспрессией, а в частности клеточные линии млекопитающих.

Для эффективного продуцирования биофармацевтических средств, а в частности, в промышленном масштабе, были приложены огромные усилия на разработку способа отбора клона в целях идентификации высокопродуктивных клонов, обладающих способностью к стабильной экспрессии и к росту в течение короткого периода времени. Однако, даже если в результате такого скрининга будут идентифицированы клоны с высоким уровнем экспрессии, то эти исходные клоны часто теряют свои преимущественные экспрессионные свойства, и со временем, будет наблюдаться снижение уровня экспрессии. Такое постепенное снижение уровня экспрессии рекомбинантного белка в клеточных клонах в процессе длительного субкультивирования является общей проблемой при продуцировании многих клеточных линий, таких как клеточные линии CHO, и этот процесс называется нестабильностью. Такая нестабильность серьезно препятствует успешному осуществлению способа промышленного продуцирования рекомбинантных полипептидов. Причинами нестабильности продуцирования могут быть утрата рекомбинантных генных копий из-за генетической нестабильности клеток-хозяев и эпигенетического сайленсинга трансгенных последовательностей. Кроме того, было обнаружено, что степень нестабильности может варьироваться в зависимости от конкретных факторов, то есть, от типа отдельного представляющего интерес экспрессируемого продукта. Нестабильность эукариотических клеточных линий составляет от 25% и почти до 90%. Поэтому для идентификации в популяции клеток и даже среди клеточных клонов, эфффективно экспрессирующих представляющий интерес белок, сначала следует выбрать клетки и, соответственно, клеточные клоны с высоким выходом этого белка, которые также обладают высокой стабильностью при продуцировании в процессе длительного культивирования, а поэтому, они не будут постепенно терять способность к экспрессии рекомбинантного белка. Такие клоны также называются «стабильными» клонами. В процессе длительного культивирования, стабильные клоны не должны терять более, чем 30%, а предпочтительно, 25% от своей первоначальной продуктивности в течение 8-12 недель, например, 10 недель. Продуктивность определяют как волюметрическую продуктивность, которая выражается в количестве белка на объем (например, г/л) за определенный период культивирования, и соответственно, как удельную клеточную продуктивность, которая представляет собой определенное количество экспрессированного белка на клетку в день (например, пг/клетку/день). Для исключения вероятности того, что клеточный клон, отобранный для последующего крупномасштабного продуцирования, будет иметь предрасположенность к нестабильности, а следовательно, будет иметь низкий титр в процессе длительного культивирования, обычно проводят тщательные анализы на стабильность в течение периода времени от нескольких недель до нескольких месяцев для удаления клеточных клонов, которые становятся нестабильными в течение этого периода времени, и для идентификации стабильных клонов. Следовательно, генерирование рекомбинантных клеточных клонов в целях продуцирования терапевтических белков и других рекомбинантных полипептидов, продуцируемых в больших объемах, обычно включает избыточный и длительный скрининг отдельных клонов для идентификации клеточных клонов с высоким уровнем экспрессии, которые также обладают экспрессионной стабильностью, необходимой для крупномасштабного продуцирования. Такая практика скрининга для удаления нестабильных клонов и идентификации стабильных клонов увеличивает время проведения биотехнологических процессов. Даже если используется система отбора с высокой жесткостью, которая благоприятствует выживанию клеток с высоким уровнем экспрессии в этих условиях отбора, то в популяции выживших клеток достаточно трудно найти подходящий продуктивный клон, который имел бы высокий уровень экспрессии и, при этом, сохранял бы хороший рост и стабильность.

Целью настоящего изобретения является повышение уровня рекомбинантного продуцирования представляющего интерес продукта в эукариотических клетках, таких как, в частности, клетки млекопитающих. В частности, целью настоящего изобретения является получение новой эукариотической клеточной линии, которая, после ее стабильной трансфекции полинуклеотидом, кодирующим представляющий интерес продукт, будет экспрессировать этот продукт с повышенной стабильностью. В частности, целью настоящего изобретения является получения рекомбинантной эукариотической клетки с пониженным риском значительной потери продуктивность в процесс длительного культивирования. Кроме того, целью настоящего изобретения является разработка усовершенствованного способа рекомбинантного продуцирования представляющего интерес продукта с использованием стабильно трансфецированных эукариотических клеток, а в частности, клеток млекопитающих. Более того, одной из целей настоящего изобретения является разработка способов анализа, позволяющих идентифицировать стабильные и нестабильные клеточные клоны на ранней стадии развития.

Описание сущности изобретения

Настоящее изобретение основано inter alia на неожиданном обнаружении того факта, что модификация генома эукариотической клетки для ингибирования функции белка FAM60A в указанной клетке, например, путем снижения или блокирования функциональной экспрессии гена FAM60A, позволяет значительно повысить стабильность экспрессии представляющего интерес рекомбинантного продукта в указанных клетках. Таким образом, был идентифицирован ключевой ген FAM60A, который влияет на стабильность рекомбинантной экспрессии. Ингибирование функции FAM60A в клетках позволяет значительно повысить уровень рекомбинантного продуцирования представляющего интерес продукта благодаря повышению стабильности экспрессии. Как показано в примерах, с использованием новых эукариотических клеток, описанных в настоящей заявке, после отбора были получены рекомбинантные клеточные клоны, обладающие значительно более высокой стабильностью. Заметное снижение стабильности экспрессии в процессе длительного культивирования наблюдается реже в случае использования соответствующих клеток-хозяев и, если даже такое снижение наблюдается, то оно приводит к менее резкому снижению продуктивности клеток по сравнению с продуктивностью клеток, в которых геном не был модифицирован для ингибирования функции белка FAM60A в этой клетке. После стабильной трансфекции число стабильных клонов увеличивается. Поэтому анализы на стабильность, проводимые для идентификации клеток-хозяев, которые не теряют свою стабильность или менее предрасположены к потере такой стабильности в процессе длительного культивирования, могут быть проведены в течение более короткого периода времени, либо вообще могут не проводиться. Это является важным преимуществом, поскольку такой способ позволяет сократить время, необходимое для получения стабильно экспрессирующих клеточных клонов, которые экспрессируют представляющий интерес рекомбинантный продукт с высоким выходом в течение длительного периода времени, и которые, соответственно, являются подходящими для крупномасштабного продуцирования. Следовательно, настоящее изобретение позволяет значительно снизить затраты на скрининг и вносит важный вклад в уже имеющиеся успехи в данной области.

В соответствии со своим первым аспектом, настоящее изобретение относится к получению выделенной эукариотической клетке, в которой геном эукариотической клетки модифицируют так, чтобы в ней ингибировалась функция белка FAM60A, где указанная клетка содержит интегрированный в ее геном гетерологичный полинуклеотид, кодирующий представляющий интерес продукт. Функция белка FAM60A в указанной клетке может ингибироваться, например, путем снижения или блокирования функциональной экспрессии эндогенного гена FAM60A, например, путем сайленсинга гена, делеции гена или мутации гена, приводящих к экспрессии нефункционального или менее функционального белка. Другие варианты также описаны в настоящей заявке.

В соответствии со своим вторым аспектом, настоящее изобретение относится к способу отбора клетки-хозяина, которая рекомбинантно экспрессирует представляющий интерес продукт, где указанный способ включает:

(a) получение эукариотических клеток в качестве клеток-хозяев согласно первому аспекту изобретения, и

(b) отбор одной или более клеток-хозяев, экспрессирующих представляющий интерес продукт.

В соответствии со своим третьим аспектом, настоящее изобретение относится к способу рекомбинантного продуцирования представляющего интерес продукта, где указанный способ включает использование эукариотической клетки согласно первому аспекту изобретения в качестве клетки-хозяина для рекомбинантной экспрессии представляющего интерес продукта. Представляющий интерес продукт кодируется гетерологичным полинуклеотидом, который стабильно интергрирован в геном эукариотической клетки согласно первому аспекту изобретения. Как описано выше, эти новые эукариотические клетки, благодаря их стабильности экспрессии, являются особенно подходящими для использования в качестве клеток-хозяев в целях рекомбинантного продуцирования представляющего интерес продукта.

В соответствии со своим четвертым аспектом, настоящее изобретение относится к способу продуцирования эукариотической клетки, подходящей для рекомбинантного продуцирования представляющего интерес продукта, где указанный способ включает ингибирование функции белка FAM60A в эукариотической клетке посредством модификации генома указанной клетки и стабильной трансфекции указанной клетки по меньшей мере одним экспрессионным вектором, содержащим полинуклеотид, кодирующие представляющий интерес продукт. Функция FAM60A может быть ингибирована, например, путем снижения или блокирования функциональной экспрессии гена FAM60A в указанной клетке.

В соответствии со своим пятым аспектом, настоящее изобретение относится к способу анализа эукариотических клеток на возможность их использования в качестве клеток-хозяев для стабильной экспрессии представляющего интерес рекомбинантного продукта, где указанный способ включает прямой или опосредованный анализ на ингибирование функции белка FAM60A в указанных клетках. Этот способ может быть преимущественно применен, например, в комбинации со способом согласно четвертому аспекту изобретения для идентификации полученной эукариотической клетки, в которой ингибируется функция белка FAM60A. Кроме того, этот способ может быть применен в качестве аналитического метода, позволяющего идентифицировать стабильные и нестабильные клеточные клоны, экспрессирующие представляющий интерес продукт, на ранней стадии отбора.

В соответствии со своим шестым аспектом, настоящее изобретение относится к применению выделенной эукариотической клетки для рекомбинантной экспрессии представляющего интерес продукта, где в указанной клетке, геном эукариотической клетки модифицируют для ингибирования функции белка FAM60A.

Другие цели, признаки, преимущества и аспекты настоящего изобретения будут очевидны для специалиста исходя из нижеследующего описания и прилагаемой формулы изобретения. Однако, следует отметить, что хотя нижеследующее описание, прилагаемая формула изобретения и конкретные примеры представляют собой предпочтительные варианты осуществления изобретения, однако, они приводятся лишь в целях иллюстрации. Для специалиста в данной области соверешенно очевидно, что в настоящее изобретение могут быть внесены различные изменения и модификации, не входящие за рамки существа и объема изобретения.

Краткое описание графического материала

На фиг. 1 схематически представлена теломерная область хромосомы 8 клеток яичника китайского хомячка (CHO) и генов, локализованных в указанной теломерной области. Геномная область, проиллюстрированная на этой фигуре, представляет собой конструкцию, полученную путем совмещения каркасов с номерами 6 и 25 на хромосоме 8. Общее представление генов и предполагаемых генов на хромосоме 8 клеток CHO может быть получено с использованием файла аннотации банка генов в комплекте с руководством Brinkrolf et al. (Nature Biotechnology Volume 31, 694-695 (2013); см. банк генов: APMK00000000, версия APMK01000000, описанная в данной публикации). Кроме того, в Пекинском Институте Геномики (Beijing Genomics Institute) также имеется описание данной области (Xu et al., Nature Biotechnology, Volume 29, number 8, 735-741 (2011); см. Банк генов: AFTD00000000, версия AFTD01000000). Примечания, которые отмечены * на фиг. 1, взяты из файла банка генов AFTD01000000.

Соответствующий общий вид теломерной области мышиной хромосомы 6 может быть получен, например, из базы даных Ensembl. Мышиная хромосома 6 имеет структуру, соответствующую структуре хромосомы 8 китайского хомячка. Представленная ниже строка базы данных Ensembl относится к теломерной области мышиной хромосомы 6, содержащей ген C12orf35 (обозначенный здесь 2810474O19Rik):

http://www.ensembl.org/Mus_musculus/Location/View?db=core;g=ENSMUSG00000039985;r=6:148921035-148046467.

В представленной ниже таблице 1 даны аббревиатуры и альтернативные названия (альтернативные имена) генов и кодируемых продуктов, указанных на фиг. 1, и где это необходимо, даны соответствующие аннотации для мышиных генов и генов китайского хомячка (согласно руководству Brinkrolf et al., 2013 и/или Xu et al., 2011). В таблице 1 также приводится список альтернативных названий, используемых, например, для обозначения различных видов. Если в настоящем описании приводится название конкретного белка или гена, то оно также означает и охватывает любые альтернативные имена указанного белка или гена, используемого, например, для характеризации соответствующего гена или белка других видов. В частности, настоящее изобретение охватывает гомологи и ортологи, имеющие одинаковые функции.

Таблица 1
Аббревиатуры и альтернативные названия (альтернативные имена) продуктов, кодируемых генами, локализованными в хромосоме 8 китайского хомячка или в мышиной хромосоме 6
Аббревиатура В общедоступной аннотации генного продукта китайского хомячка, этот генный продукт указан как В общедоступной аннотации мышиного генного продукта, этот генный продукт указан как Альтернативные имена (см. www.genecards.org)
Ccdc91 Белок 91, содержащий суперспира-лизованный домен Белок 91, содержащий суперспира-
лизованный домен
Белок 91, содержащий суперспирализованный домен
P56
Партнер по связыванию с GGA
Вспомогательный белок P56
DKFZp779L1558
FLJ11088
Белок 91, содержащий суперспирализованный домен
Партнер по связыванию с GGA
GGABP
Far2 Жирный ацил-CoA-редуктаза 1, изоформа 1 Жирный ацил-CoA-редуктаза 2 Жирный ацил-CoA-редуктаза 2
MLSTD1
SDR10E2
Белок 1, содержащий домен мужской стерильности
EC 1.2.1.N2
FLJ10462
Белок 1, содержащий домен мужской стерильности
Жирный ацил-CoA-редуктаза 2
Короткая цепь
Член 2 семейства дегидрогеназ/редуктаз 10E
Ergic2 Белок 2 промежуточ-ного компартмен-та эндоплазма-тического ретикулума-аппарата Гольджи ERGIC и белок 2 аппарата Гольджи ERGIC и белок 2 аппарата Гольджи
PTX1
Erv41
Cd002
Белок CD14
Белок 2 промежуточного компартмента эндоплазматического ретикулума-аппарата Гольджи
ERV41
CDA14
RPS4Y2 Рибосомный белок S4 40S, подобный изоформе X Рибосомный белок S4, Y-связанный белок 2 Рибосомный белок S4, Y-связанный белок 2
RPS4Y2P
Рибосомный белок S4, Y-связанный белок 2
Псевдоген
Рибосомный белок S4 40S, Y
Рибосомный белок S4 40S, Y
Рибосомный белок S4 40S, Y-изоформа 2
Tmtc1 Трансмембранный белок 1 и белок 1, содержащий TPR-повторы Трансмембранный белок 1 и белок 1, содержащий тетратрикопептидные повторы Трансмембранный белок 1 и белок 1, содержащий TPR-повторы
OLF
ARG99
FLJ31400
FLJ41625
TMTC1A
Трансмембранный белок 1А и белок 1А, содержащий тетратрикопептидные повторы
Трансмембранный белок 1 и белок 1, содержащий TPR-повторы
Zfp 1 Белок 1, содержащий домен «цинковый палец» HIT Белок «цинковый палец» ZFP1
ZNF475
Белок «цинковый палец» 475
FLJ34243
Белок «цинковый палец» 1
Гомолог белка «цинковый палец» 1 (мышиный)
Zfp-1
Гомолог белка «цинковый палец» 1
IPO8 Импортин-8-подобный белок Импортин-8 Импортин 8
RANBP8
RAN-связывающий белок 8
Ran-связывающий белок 8
IMP8
Imp8
Импортин-8
RanBP8
Caprin2 Каприн-2-подобный белок Член 2 семейства капринов Член 2 семейства капринов
C1QDC1
EEG1
RNG140
Каприн-2
Цитоплазматический белок 2, ассоциированный с активацией/пролиферацией
Белок, ассоциированный с резистентностью ко множеству лекарственных средств против рака желудка
Белок 1, содержащий домен C1q
Гранулярный белок 140, кодируемый РНК
FLJ11391
FLJ22569
Белок 1, содержащий домен C1q
EEG-1
KIAA1873
Белок EEG-1
FAM60A FAM60A- подобный белок Белок 60 семейства белков со сходными последовательностями, член А Белок 60 семейства белков со сходными последовательностями, член А
C12orf14
TERA
Гомолог белка Tera
Открытая рамка считывания 14 хромосомы 12
Белок FAM60A
Dennd5b 5B-подобный белок, содержащий домен Denn Белок 5B, содержащий домен DENN/MADD Белок 5B, содержащий домен DENN/MADD
Rab6IP1-подобный белок
MGC24039
Белок 5B, содержащий домен DENN
METTL20 Метилтранс-феразо-подобный белок 20 4833442J19Rik METTL20
C12orf72
DKFZp451L235
MGC50559
Открытая рамка считывания 72 хромосомы 12
Метилтрансферазо-подобный белок 20
EC 2.1.1.
AMN1 Предполагаемый AMN1- подобный белок Антагонист продукта конечной фазы митоза 1 с сетчатой структурой Гомолог антагониста продукта конечной фазы митоза 1 с сетчатой структурой (S. Cerevisiae)
Гомолог белка AMN1
Белок, подобный опиоидному рецептору фактора роста Белок, подобный опиоидному рецептору фактора роста
C12orf35 Гомолог неохарактери-зованного белка C12orf35 Вероятный ортолог открытой рамки считывания 35 хромсомы 12 H. sapiens (C12orf35); 2810474O19Rik KIAA1551,
C12orf35
FLJ10652,
FLJ20696
Открытая рамка считывания 35 хромосомы 12
Неохарактеризованный белок C12orf35
Неохарактеризованный белок KIAA1551
Bicd 1 Предполагае-мый бикаудальный белок D Гомолог 1 бикаудального белка D Гомолог 1 бикаудального белка D (Дрозофилы)
Bic-1
Гомолог 1 бикаудального белка D (Дрозофилы)
BICD
Гомолог 1 бикаудального белка D (Дрозофилы), напоминающий цитоскелет
Гомолог 1 бикаудального белка D

На фиг. 2 показаны относительные уровни экспрессии генов, локализованных в теломерной области хромосомы 8 в клеточной линии CHO, а именно, TMTC1 (1), RPS4Y2 (2), IPO8 (3), CAPRIN2 (4), FAM60A (5), Dennd5b (6), METTL 20 (7), AMN1 (8), C12orf35 (9), Bicd1 (10).

На фиг. 3 показаны результаты тестов на стабильность, проводимых в течение 7/8 недель для трех различных клеточных клонов (клонов СНО дикого типа и двух FAM60A-дефицитных клонов s16 и s23, происходящих от указанных клеток дикого типа) после стабильной трансфекции экспрессионным вектором, кодирующим антитело в качестве представляющего интерес продукта: (1) показаны результаты теста на стабильность, проводимого с использованием родительских клеток дикого типа (происходящих от CHO-K1); (2) показаны результаты теста на стабильность, проводимого с использованием FAM60A-дефицитного клона s16; (3) показаны результаты теста на стабильность, проводимого с использованием FAM60A-дефицитного клона s23. Исходя из этих результатов можно сделать вывод, что стабильность экспрессии значительно возрастает в клеточных клонах, происходящих от FAM60A-дефицитных клеток (см. (2) и (3)). При использовании FAM60A-дефицитных клеток для рекомбинантной экспрессии, число стабильных клонов значительно увеличивалось. Таким образом, ингибирование функции FAM60A в клетке-хозяине, в данном случае путем «нокаута» гена, приводило к значительному повышению стабильности экспрессии.

На фиг. 4A-L показаны FACS-профили, полученные после снижения уровня экспрессии различных генов-мишеней, локализованных в теломерной области хромосомы 8 клеток китайского хомячка (CHO), с использованием киРНК. Клетки, которые были стабильно трансфецированы экспрессионным вектором и экспрессировали кодируемое антитело в качестве представляющего интерес продукта, были флуоресцентно окрашены для детектирования уровня рекомбинантно экспрессируемого антитела. Чем выше интенсивность FACS-профиля, тем выше уровень экспрессии антитела в окрашенной клетке. Левый пик представляет собой FACS-профиль, соответствующий родительской клеточной линии (нетрансфецированной, а поэтому не экспрессирующей антитело), которая была включена для сравнения. Две других кривых были построены по данным, полученным для клеточного клона, который был стабильно трансфецирован и рекомбинантно экспрессировал антитело. Этот клеточный клон был трансфецирован либо киРНК, используемой в качестве негативного контррля (темная кривая; отсутствие влияния на экспрессию любого гена), либо киРНК, которая снижает уровень экспрессии гена-мишени (светло-серая кривая). Если сайленсинг гена-мишени не влияет на рекомбинантную экспрессию антитела, то кривые для флуоресценции киРНК-контроля и киРНК-мишени перекрываются и не изменяются. Если сайленсинг гена-мишени приводит к повышению уровня экспрессии рекомбинантно экспрессируемого антитела, то интенсивность соответствующего FACS-профиля повышается и наблюдается сдвиг кривой вправо. A: ген Mettl20_1, 125 пмоль, 24,9%; B: ген C12orf35_1, 125 пмоль, 30,6%; C: ген C12orf35_2, 150 пмоль, 31,7%; D: ген Caprin2_6, 100 пмоль, 53,3%; E: FAM60A_3, 150 пмоль, 48%; F: Ipo8_1, 125 пмоль, 20,3%; G: Ipo8_2, 150 пмоль, 57,5%; H: Ipo8_3, 150 пмоль, 21,5%; I: Dennd5b_2, 100 пмоль, 36,9%; J: Amn1_4, 125 пмоль, 30,8%; K: TMTC1_1, 150 пмоль, 60,6%; L: TMTC1_2, 150 пмоль, 53,4% (процентные величины соответствуют уровню экспрессии мРНК гена-мишени, определяемому путем сравнения киРНК с контрольной киРНК). На фиг. 4B и C показано, что ингибирование гена C12orf35 приводит к значительному повышению экспрессии рекомбинантного антитела и, тем самым, к повышению продуктивности, на что указывает явный сдвиг FACS-профиля вправо (см. светло-серую кривую справа, также помеченную стрелкой). Поэтому, в соответствии с одним из вариантов осуществления изобретения, функцию продукта экспрессии гена C12orf35 дополнительно ингибируют в клетке-хозяине для увеличения выхода продукта.

На фиг. 5 и 6 показаны уровни экспрессии мРНК, кодирующей легкую и тяжелую цепи антител двух различных моделей представляющих интерес полипептидов (антитело 1 и 2) в различных клонах и пулах в каждом случае после снижения уровня экспрессии гена C12orf35 в клетках CHO под действием РНКи. Уровни мРНК, кодирующей цепи антител, повышаются в том случае, если уровень экспрессии гена C12orf35 снижается посредством сайленсинга гена. Таким образом, неожиданно было обнаружено, что снижение уровня экспрессии C12orf35 приводит к повышению уровней мРНК, кодирующей HC и LC.

На фиг. 7 показано, что после сайленсинга гена C12orf35 с использованием киРНК были получены значительно более высокие титры удельной экспрессии (вычисляемые на дни культивирования 3, 4, 5 и 6).

На фиг. 8 показано, что 46 самых высокопродуктивных клонов (черные), происходящих от клеточной линии CHO, в которой теломерная область, содержащая ген C12orf35 на хромосоме 8 (плечо q), была делетирована (C8DEL), имеют более высокие титры по сравнению с 45 самыми высокопродуктивными клонами, полученными от родительской клеточной линии, которая, как было протестировано, является позитивной по IPO8 (серая).

На фиг. 9 показаны FACS-профили стабильно трансфецированных клеточных пулов C8DEL после отбора с использованием системы фолатный рецептор/DHFR. Концентрация MTX возрастала от A до E (A: без MTX; B: 1 нМ MTX; C: 5 нМ MTX; D: 10 нМ MTX; E: 50 нМ MTX). Экспрессия рекомбинантного антитела была детектирована по интенсивности флуоресценции. При 50 нМ MTX, в полученном пуле присутствовали преимущественно высокопродуктивные клетки, как показал FACS-анализ. Профиль полученного пула очень напоминал профиль клеточного клона. Эти данные подтвердили, что описанный здесь метод является чрезвычайно эффективным для повышения уровня экспрессии рекомбинантной клетки-хозяина.

Подробное описание настоящего изобретения

Настоящее изобретение основано inter alia на неожиданном обнаружении того факта, что эукариотические клетки, в которых наблюдается ингибирование функции белка FAM60A, например, посредством снижения или блокирования функциональной экспрессии эндогенного гена FAM60A в указанной клетке, например, в результате делеции указанного гена или введения мутаций в кодирующую последовательность, обладают способностью, после стабильной трансфекции, экспрессировать представляющий интерес рекомбинантный продукт со значительно более высокой стабильностью. Как показано в примерах для клеток млекопитающих, соответствующим образом модифицированные клетки неожиданно обнаруживают очень стабильную экспрессию в процессе длительного культивирования, что позволяет сократить время на проведение анализов на стабильность для идентификации стабильных клонов, или даже вообще не проводить такие анализы. В популяции успешно трансфецированных клеток-хозяев, число клеток-хозяев с пониженной стабильностью экспрессии в течение длительного культивирования значительно снижается при использовании соответствующим образом модифицированных эукариотических клеток. Таким образом, эти модифицированные эукариотические клетки, благодаря их высокой стабильности, являются особенно подходящими для их использования в качестве клеток-хозяев в методах рекомбинантного продуцирования и для рекомбинантного продуцирования представляющего интерес продукта. Настоящее изобретение основано на неожиданном обнаружении того факта, что ген FAM60A оказывает значительное влияние на стабильность рекомбинантной экспрессии в эукариотических клетках-хозяевах, поэтому оно также относится к новым способам отбора и продуцирования и к ассоциированным с ними технологиями, которые позволяют повышать уровень рекомбинантного продуцирования представляющего интерес продукта. Следовательно, настоящее изобретение вносит важный вклад в уже имеющиеся разработки в данной области.

Отдельные аспекты изобретения, а также подходящие и предпочтительные варианты его осуществления более подробно описаны ниже.

A. Модифицированные эукариотические клетки

В соответствии со своим первым аспектом, настоящее изобретение относится к выделенной эукариотической клетке, где геном эукариотической клетки модифицируют для ингибирования функции белка FAM60A, и где указанная клетка содержит интегрированный в ее геном гетерологичный полинуклеотид, кодирующий представляющий интерес продукт. Как показано в примерах для клеток млекопитающих, эти модифицированные клетки обнаруживают значительно более высокую стабильность представляющего интерес продукта по сравнению с немодифицированными клетками, в которых не ингибируется функция FAM60A. Число клеток со стабильной экспрессией в популяции трансфецированных клеток увеличивается, как было показано в предпочтительном варианте осуществления изобретения, в котором в качестве эукариотической клетки используются клетки млекопитающего. Повышенная стабильность экспрессии позволяет сократить или даже вообще не затрачивать время на проведение исследований на стабильность клеточных клонов с высоким уровнем экспрессии. Дополнительные преимущества также описаны ниже и будут очевидны из примеров. Таким образом, использование этих преимуществ новых эукариотических клеточных линий для рекомбинантного продуцирования представляющего интерес продукта позволяет не прилагать значительных усилий на скрининг для идентификации клеток или клеточных клонов с высоким уровнем экспрессии и высокой стабильностью, а в частности, позволяет сократить время на получение клеточных клонов, подходящих для крупномасштабного продуцирования представляющего интерес продукта. Таким образом, эти модифицированные эукариотические клеточные линии имеют ценные преимущества, позволяющие использовать эти клетки в качестве клеток-хозяев в методах рекомбинантного продуцирования.

FAM60A представляет собой субъединицу SIN3-гистон-деацетилазного (HDAC) комплекса (SIN3/HDAC-комплекса), который функционирует как репрессор транскрипции (Munoz et al., 2012, THE Journal of Biological Chemistry VOL. 287, NO. 39, pp. 32346-32353; Smith et al., 2012, Mol. Cell Proteomics 11 (12):1815-1828). Гистон-деацетилазы (HDAC) катализируют удаление ацетильных групп из гистонов. Ацетилирование гистонов на лизинах представляет собой основной механизм модуляции конформации хроматина. Ацетилирование гистона стимулирует образование релаксированного транскрипционно активного хроматина, а деацетилирвоание, катализируемое гистон-деацетилазами (HDAC), благоприятствует образованию хроматина в «молчащей» неактивной форме. Анализ баз данных выявил присутствие по меньшей мере одного ортолога FAM60A у большинства многоклеточных, но не в нематодах. Ген FAM60A является консервативным у многоклеточных и может присутствовать в полностью секвенированных геномах всех позвоночных и большинства беспозвоночных. Так, например, у человека, крыс, мышей и коров была обнаружена 100% идентичность последовательностей белка FAM60A. Исследования, проводимые для оценки сходства последовательностей гомологов FAM60A, показали, что в геноме присутствует преимущественно только один репрезентативный член этого семейства. Однако имеется несколько исключений. Как описано в публикации Smith et al., 2012, белок FAM60A имеет уникальную последовательность, в которой отсутствуют все известные домены белка. Кроме того, в публикации Smith et al., 2012, указано, что не было обнаружено какой-либо гомологии последовательностей этого белка с последовательностями других известных человеческих белков. Сравнение последовательностей белков FAM60A различных видов показало, что белок FAM60A обычно включает три области: (1) N-конец, содержащий сегменты, которые являются в высокой степени консервативными у всех позвоночных; (2) промежуточную область, которая является в высокой степени консервативной у позвоночных, а у беспозвоночных, она состоит из неконсервативных спейсеров различной длины; (3) C-конец, содержащий сегменты, которые являются в высокой степени консервативными у всех позвоночных. Таким образом, наиболее консервативными являются N- и C-концевые области FAM60A.

Как описано выше, исследования показали, что FAM60A ассоциируется с SIN3/HDAC-комплексами в эукариотических клетках различных типов, а в частности, клетках млекопитающих. Однако до настоящего времени информация о функциях FAM60A почти отсутствовала. Недавно проведенные функциональные исследования (см. Smith et al., 2012) показали, что FAM60A может ингибировать экспрессию гена и регулировать специфическую субсерию генов. В публикации Smith et al., 2012, имеется сообщение о роли FAM60A в регуляции пути передачи сигнала TGF-бета, который играет ведущую роль в таких процессах, как прогрессирование рака, метастазирование, миграция клеток и надзор за иммунной системой. Также имеются данные, указывающие на то, что FAM60A действует как транскрипционный репрессор компонентов пути передачи сигнала TGF-бета, где функция FAM60A, очевидно, играет определенную роль в комплексе SIN3-HDAC. Истощение FAM60A в различных раковых клеточных линиях, достигаемое с использованием киРНК против FMA60A, приводит к изменению обычной морфологии раковых клеток. Кроме того, было обнаружено, что уровни белка FAM60A периодически изменяются за период клеточного цикла в клетках U2OS (Munoz et al., 2012). Эксперименты по ингибированию FAM60A, проводимые с использованием киРНК FAM60A в человеческих клетках остеосаркомы U2OS, показали, что FAM60A ограничивает экспрессию гена циклина D1. Вопреки существующим научным данным, очень неожиданным оказалось обнаружение того факта, что ингибирование функции белка FAM60A в эукариотических клетках, а предпочтительно, в клетках млекопитающих, приводит к значительному повышению стабильности экспрессии гетерологичного гена в указанной клетке, но, при этом, не оказывает какого-либо негативного влияния на другие свойства клетки, играющие важную роль в рекомбинантной экспрессии. Такая корреляция между действием белка FAM60A и стабильностью экспрессии в процессе длительного культивирования клеток оказалась весьма неожиданной.

Как было описано, ген FAM60A эндогенно экспрессировался у многоклеточных, а в частности, у млекопитающих, таких как человек, мышь, крыса и хомячок, и аминокислотные последовательности FAM60A являются в высокой степени консервативными у млекопитающих, а также у позвоночных. Модифицированная эукариотическая клетка согласно первому аспекту изобретения происходит от эукариотической клетки, эндогенно экспрессирующей FAM60A. Для простоты, белок FAM60A, а также ген FAM60A, кодирующий белок FAM60A, обозначаются здесь прописными буквами, даже несмотря на то, что для некоторых видов используется другое обозначение гена и/или белка. В списке последовательностей представлены репрезентативные аминокислотные последовательности известных и/или предсказанных белков FAM60A позвоночных различных видов, а именно, Homo sapiens (SEQ ID NO:1), Rattus norvegicus (SEQ ID NO:2), Mus musculus (SEQ ID NO:3), Cricetulus griseus (SEQ ID NO:4), Gallus gallus (SEQ ID NO:5), Pan troglodytes (SEQ ID NO:6), Pongo abelii (SEQ ID NO:7) и Bos taurus (SEQ ID NO:8). Предсказанная кДНК FAM60A Cricetulus griseus представлена в SEQ ID NO:9 (кодирующая последовательность в положениях 14-679; см. также эталонную последовательность NCBI: XM_003505482.1). Белок FAM60A или ген FAM60A у различных видов могут иметь различные обозначения, и их неограничивающие альтернативные названия (альтернативные имена) также перечислены выше в таблице 1. Используемый здесь термин «FAM60A» также охватывает любые гомологи и ортологи FAM60A, которые имеют такую же функцию, как и FAM60A. В соответствии с одним из вариантов осуществления изобретения, используемый здесь термин «FAM60A», в частности, означает белок, который по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% гомологичен одной или более аминокислотным последовательностям, представленным в SEQ ID NO:1-8. В соответствии с одним из вариантов осуществления изобретения, вышеуказанные процентные величины означают идентичность, а не гомологию полипептидов. Гомология, а в частности, идентичность белка по отношению к сравниваемому белку, может быть вычислена по всей длине этого белка. Соответствующий белок, предпочтительно, имеет такую же функцию, как и белок, имеющий аминокислотную последовательность, представленную в SEQ ID NO:1 или в одной или более SEQ ID NO:2-8, а предпочтительно, в SEQ ID NO:4. Белок FAM60A не был подробно описан в литературе. Таким образом, крайне неожиданным является тот факт, что стабильность экспрессии рекомбинантной клетки-хозяина может быть повышена в том случае, если геном клетки-хозяина будет модифицирован так, чтобы это приводило к ингибированию функции эндогенного белка FAM60A в клетке, и это может быть достигнуто, например, путем снижения или блокирования функциональной экспрессии гена FAM60A в указанной клетке. Было неожиданно обнаружено, что FAM60A влияет на стабильность экспрессии представляющего интерес рекомбинантного продукта.

Ген FAM60A, кодирующий белок FAM60A, может быть модифицирован, как описано в настоящей заявке, в целях ингибирования функции FAM60A в клетке. Это может быть достигнуто, например, с применением методов генной инженерии, таких как методы нокаута гена. Генная последовательность генома млекопитающих различных видов является известной и описана, например, для Homo sapiens (NCBI Gene-ID: 58516); Rattus norvegicus (NCBI Gene-ID: 686611); Mus musculus (NCBI Gene-ID: 56306); Bos Taurus (NCBI Gene-ID: 538649) и т.п. Варианты транскрипта могут существовать в различных формах, в зависимости от вида, и в различных количествах. Так, например, человеческий ген FAM60A экспрессирует 3 предполагаемых изоформы транскрипта, которые отличаются последовательностями UTR, но кодируют один и тот же белок.

Настоящее изобретение относится inter alia к модифицированным эукариотическим клеткам, таким как, предпочтительно, клетки млекопитающих, где геном эукариотической клетки модифицируют в целях ингибирования функции белка FAM60A, который эндогенно экспрессируется соответствующей немодифицированной эукариотической клеткой. Такая модификация, приводит к повышению числа стабильно экспрессирующих клеток в клеточной популяции, стабильно трансфецированной экспрессионным вектором, содержащим полинуклеотид, кодирующий представляющий интерес продукт.

Существует несколько возможностей модификации генома клетки для ингибирования функции белка FAM60A в указанной клетке. Функция FAM60A может быть ингибирована, например, на генном уровне или на белковом уровне. Функция FAM60A может быть ингибирована, например, путем модификации структуры/последовательности, транскрипции, трансляции и/или взаимодействия с другими компонентами, образующими комплекс SIN3/HDAC. Неограничивающие варианты описаны ниже.

В соответствии с одним из вариантов осуществления изобретения, функция белка FAM60A ингибируется благодаря снижению или блокированию функциональной экспрессии гена FAM60A в указанной клетке. Как показано в примерах, модификация экспрессии гена FAM60A, например, посредством нокаута гена или снижения уровня экспрессии, является очень эффективным средством для получения модифицированных клеток, которые экспрессируют представляющий интерес рекомбинантный продукт с повышенной стабильностью.

Снижение или блокирование функциональной экспрессии гена FAM60A может быть достигнуто различными способами. Функциональная экспрессия может быть понижена, например, путем снижения уровня экспрессии гена FAM60A или путем блокирования функции FAM60A или с применением комбинации таких методов. В соответствии с одним из вариантов осуществления изобретения, клетку модифицируют так, чтобы функциональная экспрессия гена FAM60A снижалась или блокировалась посредством «отключения» («нокаута») гена, мутации гена, делеции гена, сайленсинга гена или комбинации любых этих методов. В соответствии с одним из вариантов осуществления изобретения, функциональная экспрессия гена FAM60A в клетке снижается или блокируется посредством «нокаута» гена. «Нокаут» гена представляет собой генетический метод, который позволяет получить неактивный ген путем подавления его функции. Так, например, в кодирующую последовательность может быть встроена нуклеиновая кислота, что будет приводить к подавлению функции гена. Кроме того, полноразмерный ген FAM60A или его часть могут быть делетированы, что будет приводить к блокированию экспрессии белка в соответствующей модифицированной клетке или к экспрессии нефункционального белка в этой клетке. Другим вариантом является введение одной или более нокаут-мутаций в кодирующую последовательность, что будет приводить к продуцированию нефункционального продукта или менее функционального продукта экспрессии. Так, например, могут быть введены одна или более мутаций со сдвигом рамки считывания, что будет приводить к продуцированию нефункционального или менее функционального продукта экспрессии. Альтернативно или дополнительно, в кодирующую последовательность могут быть введены один или более стоп-кодонов так, чтобы это приводило к продуцированию усеченного, нефункционального белка или менее функционального белка. Кроме того, могут быть модифицированы сайты сайленсинга. Следовательно, в соответствии с одним из вариантов осуществления изобретения, ген FAM60A имеет одну или более мутаций, способствующих образованию нефункционального продукта или менее функционального продукта экспрессии. В соответствии с одним из вариантов осуществления изобретения, одну или более мутаций вводят в экзон 1 гена FAM60A. В соответствии с одним из вариантов осуществления изобретения, благодаря введению одной или более мутаций, в продукте экспрессии отсутствует вся область или часть N-концевой или С-концевой области FAM60A. Другими вариантами являются, но не ограничиваются ими, введение одной или более мутаций в промотор, в 5'- и/или 3'-UTR или в другие регуляторные элементы. В соответствии с одним из вариантов осуществления изобретения, промоторная функция гена FAM60A подавляется, например, путем введения в промотор делеции или путем введения конструкции между промотором и сайтом инициации транскрипции. Способы достижения «нокаута» гена для подавления или блокирования экспрессии гена-мишени хорошо известны специалистам, а поэтому подробно не описаны в настоящей заявке. Тем не менее некоторые неограничивающие примеры таких методов приводятся ниже.

В соответствии с одним из вариантов осуществления изобретения, ген FAM60A функционально блокируют методом генной инженерии. Примерами являются, но не ограничиваются ими, редактирование генома, например, редактирование генома с использованием сконструированных нуклеаз (GEEN). Такой метод представляет собой метод генной инженерии, в котором ДНК встраивают, заменяют или удаляют из генома с помощью искусственно сконструированных нуклеаз или «молекулярных ножниц». Эти нуклеазы создают специфические двухцепочечные разрывы (DSB) в нужных положениях генома и используют клеточные эндогенные механизмы для репарации индуцированного разрыва благодаря природным процессам гомологичной рекомбинации (HR) и негомологичного присоединения по концам (NHEJ). Существуют по меньшей мере четыре семейства сконструированных нуклеаз, которые могут быть использованы в этих целях, а именно, нуклеазы «цинковый палец» (ZFN), эффекторные нуклеазы, подобные активатору транскрипции (TALEN), CRISPR и сконструированные хоминг-эндонуклеазы, реконструированные с использованием мегануклеаз. Технология TALEN была также применена, как описано в примерах, для получения модифицированных клеток млекопитающих, в которых ген FAM60A был блокирован с последующим ингибированием функции белка FAM60A в указанных клетках.

В соответствии с одним из вариантов осуществления изобретения, если в геноме эукариотической клетки присутствует по меньшей мере одна копия и, необязательно, большее число копий гена FAM60A, то все эти копии были модифицированы, например, блокированы, делетированы или каким-либо другим способом ингибированы для снижения или ослабления, а следовательно, элиминации функции белка FAM60A в эукариотической клетке. Таким образом, в соответствии с одним из вариантов осуществления изобретения, в геноме эукариотической клетки, по меньшей мере одна копия гена FAM60A была делетирована или функционально инактивирована в геноме эукариотической клетки. Так, например, в одну копию или более копий гена C12orf35 могут быть встроены одна или более мутаций для получения нефункционального или менее функционального продукта экспрессии или для блокирования или снижения экспрессии in toto, а следовательно, для ингибирования функции FAM60A в эукариотической клетке. Поэтому ген FAM60A, по существу, инактивирован в геноме. В соответствии с одном из вариантов осуществления изобретения, все копии гена FAM60A являются соответствующим образом модифицированными в эукариотической клетке, которая, предпочтительно, представляет собой клетку млекопитающего.

В соответствии с одним из вариантов осуществления изобретения, эукариотическими клетками являются клетки многоклеточных, клетки позвоночных или, предпочтительно, клетки млекопитающих. В соответствии с одним из вариантов осуществления изобретения, часть хромосомы в указанной клетке является делетированной, где такая делетированная часть содержит ген FAM60A. В соответствии с одним из вариантов осуществления изобретения, часть хромосомы, содержащая ген FAM60A, была делетирована во всех хромосомах, включающих копию гена FAM60A, если присутствует более чем одна копия. Таким образом, все копии гена FAM60A в этом геноме были делетированы.

В соответствии с одним из вариантов осуществления изобретения, часть теломерной области хромосомы была делетирована, где указанная делетированная часть содержит ген FAM60A. В соответствии с предпочтительным вариантом осуществления изобретения, модифицированной клеткой является клетка грызуна. В соответствии с одним из вариантов осуществления изобретения, указанной клеткой является клетка хомячка, такая как клетка CHO, и по меньшей мере часть теломерной области хромосомы 8 в геноме этой клетки была делетирована, где указанная делетированная часть содержит ген FAM60A. Значение термина «FAM60A» объясняется выше, и неограничивающие альтернативные названия гомологов и ортологов, которые также входят в объем указанного термина, представлены в таблице 1. В соответствии с одним из вариантов осуществления изобретения, такая делеция имеется в плече q хромосомы 8 клетки хомячка, а в частности, клетки китайского хомячка, содержащей ген FAM60A. Как показано в примерах, клетка СНО, содержащая соответствующую делецию в теломерной области хромосомы 8, является особенно подходящей для ее использования в качестве клетки-хозяина для рекомбинантной экспрессии. После стабильной трансфекции экспрессионным вектором, эти клетки приобретают значительно более высокую продуктивность по сравнению с клетками, в которых указанная часть в теломерной области хромосомы 8 не была делетирована. Кроме того, количество и соответствующее соотношение стабильно экспрессирующих клеток в популяции трансфецированных клеток значительно повышается. Значительное снижение титра в процессе длительного культивирования наблюдается довольно редко. Таким образом, стабильность рекомбинантной экспрессии значительно повышается в таких клетках хомячка, в которых отсутствует указанная часть теломерной области хромосомы 8. Другие важные преимущества подробно описаны в примерах, где клетки СНО, в которых соответствующая часть теломерной области хромосомы 8 была детектирована посредством разрыва хромосомы, были дополнительно охарактеризованы. Эти преимущественные свойства делают такие клетки хомячка особенно подходящими для их использования в промышленном продуцировании в качестве клеточных линий. Альтернативно, модифицированной клеткой грызуна может быть мышиная клетка, где по меньшей мере часть теломерной области хромосомы 6 была делетирована в геноме, и где указанная делетированная часть содержит ген FAM60A. Теломерная область мышиной хромосомы 6 имеет большое сходство с теломерной областью хромосомы 8 хомячка.

В соответствии с одним из вариантов осуществления изобретения, по меньшей мере часть теломерной области хромосомы является делетированной или отсутствует в обеих хромосомах пары хромосом 8 хомячка (или пары хромосом 6 в случае мышиных клеток), где эти делетированные области включают ген FAM60A.

В соответствии с одним из вариантов осуществления изобретения, по меньшей мере часть теломерной области хромосомы делетирована в одной хромосоме пары хромосом 8 хомячка (или пары хромосом 6 в случае мышиных клеток), где указанная делетированная часть содержит ген FAM60A, и где экспрессия гена FAM60A в другой хромосоме, если присутствует дополнительная копия, была снижена или блокирована. Подходящие способы снижения или блокирования экспрессии гена известны специалистам, и неограничивающие примеры этих способов также описаны в настоящей заявке. В соответствии с одним из вариантов осуществления изобретения, такая делеция имеется в плече q хромосомы 8 хомячка, а в частности, китайского хомячка.

В соответствии с одним из вариантов осуществления изобретения, делетированная область хромосомы содержит ген FAM60A и дополнительно один или более или все гены, выбранные из группы, состоящей из генов Bicd1, Amn1, метилтрансферазо-подобного белка 20, Dennd5b, FAM60A, Caprin2 и Ipo8. В соответствии с одним из вариантов осуществления изобретения, все вышеупомянутые гены были делетированы. В соответствии с одним из вариантов осуществления изобретения, делетированная область хромосомы дополнительно содержит по меньшей мере часть полноразмерного гена Tmtc1 или весь этот ген. В клетках хомячка, таких как клетки СНО, эти гены также локализованы в теломероной области хромосомы 8. В соответствии с одним из вариантов осуществления изобретения, эта делетированная область хромосомы, если она присутствовала, также содержала ген RPS4Y2. Теломерная область хромосомы 8 генома китайского хомячка, в которой находятся вышеупомянутые гены, схематически представлена на фиг. 1. Как показано в примерах, клетки СНО, имеющие соответствующую делецию в теломерной области хромосомы 8 (плечо q), обладают конкретными преимущественными свойствами, такими как высокий выход и стабильность экспрессии. В мышиных клетках, вышеупомянутые гены присутствуют в теломерной области хромосомы 6. Неограничивающие альтернативные названия вышеупомянутых отдельных генов и/или кодируемых белков, включая гомологи и ортологи, также представлены выше в таблице 1, и эти соответствующие гены входят в объем значений терминов, употребляемых выше для отдельных генов.

В соответствии с одним из вариантов осуществления изобретения, делеция гена C12orf35 обусловлена хромосомным разрывом. Хромосомный разрыв может быть индуцирован, например, путем обработки клеток млекопитающих токсическим агентом, который стимулирует хромосомный разрыв, таким как, например, MTX, афидиколин или гигромицин. Другими методами индуцирования хромосомных разрывов являются, но не ограничиваются ими, облучение, лучевая обработка, мутагенез, обработка канцерогенными веществами и блеомицином. Хромосомные разрывы могут также происходить спонтанно в процессе трансфекции, например, электропорации. Методы индуцирования хромосомных разрывов также известны специалистам, а поэтому здесь не приводится их подробного описания. После индуцирования хромосомного разрыва, клетки, имеющие нужную точку разрыва (приводящего к делеции гена FAM60A), могут быть идентифицированы, например, путем анализа ДНК или с применением способа согласно пятому аспекту настоящего изобретения. Так, например, профиль экспрессии обработанных клеток может быть проанализирован для того, чтобы определить, экспрессируются ли ген FAM60A или гены, расположенные со стороны центромеры по отношению к гену FAM60A, и наблюдается ли снижение уровня экспрессии генов или эти гены вообще не экспрессируются. Так, например, в случае мышиных клеток или клеток хомячка может быть проведен анализ для того, чтобы определить, экспрессируется ли в этих клетках ген FAM60A, и альтернативно или дополнительно может быть проведен анализ для того, чтобы определить, экспрессируется ли в этих клетках один или более генов, выбранных из группы, состоящей из генов метилтрансферазо-подобного белка 20, Dennd5b, FAM60A, Caprin2, Ipo8, Tmtc1 или генов, которые локализуются в теломерной области вышеупомянутых генов (где, в данном контексте, слово «теломерный» означает расположение в направлении теломерного конца), и/или для того, чтобы определить, наблюдается ли снижение или блокирование экспрессии. Если точка индуцированного разрыва расположена со стороны центромеры по отношению к соответствующему(им) гену(ам) (где, в этом контексте, слово «центромерный» означает расположение также в хромосоме, но на значительном удалении от теломерного конца), то теломерный конец, содержащий указанные гены, является делетированным, что приводит к блокированию или снижению уровня их экспрессии (если экспрессируются другие копии имеющихся генов). Как показано на фиг. 1, ген FAM60A расположен со стороны теломеры по отношению к вышеупомянутым генам, то есть, он расположен ближе к теломерному концу. Таким образом, если вышеупомянутые гены были делетированы посредством хромосомного разрыва, то делетированная область также включает ген FAM60A. Таким образом, вышеупомянутые гены могут быть действительно использованы в качестве маркеров, которые позволяют, в основном, опосредованно определить, может ли индуцированный хромосомный разрыв приводить к делеции хромосомной части, включающей ген FAM60A. Кроме того, было обнаружено, что даже несмотря на локализацию гена Bicd1 со стороны теломеры по отношению к гену FAM60A, этот ген Bicd1 может быть использован в качестве маркера для того, чтобы определить, может ли индуцированный хромосомный разрыв приводить к делеции гена FAM60A. Было обнаружено, что если ген Bicd1 в клетках СНО был делетирован посредством хромосомного разрыва, то такая делеция также обычно включает ген FAM60A. С помощью анализа экспрессионных свойств нескольких сотен клонов было подтверждено, что вышеупомянутые гены действительно могут быть использованы в качестве маркеров для дифференциации клеточных клонов с высокой и стабильной экспрессией от клеточных клонов с низкой и нестабильной экспрессией. Относительная экспрессия вышеупомянутых генов в клетках CHO показана на фиг. 2. Как показано на фиг. 2, гены Ipo8 (3), FAM60A (5) и C12orf35 (9) имеют относительно высокий уровень экспрессии по сравнению с экспрессией других генов, которые локализуются в теломерной области хромосомы 8 в нормальных клетках СНО, таких как клетки CHO-K1, которые не имеют делеции в теломерной области хромосомы 8. Таким образом, при проведении данного анализа предпочтительно использовать один или более вышеупомянутых генов, поскольку это упрощает детектирование блокирования или снижения уровня экспрессии. Неограничивающие альтернативные названия вышеупомянутых отдельных генов и кодируемых белков, включая гомологи и ортологи, также приводятся выше в таблице 1, и эти соответствующие гены входят в объем значений терминов, употребляемых выше для отдельных генов.

В соответствии с одним из вариантов осуществления изобретения, точка разрыва на хромосоме 8 расположена со стороны центромеры по отношению к гену FAM60A, со стороны центромеры по отношению к гену Caprin2, со стороны центромеры по отношению к гену Ipo8 или со стороны центромеры по отношению к гену RPS4Y2. Было обнаружено, что точка разрыва на хромосоме 8 генома хомячка часто расположена со стороны центромеры по отношению к гену Ipo8. В соответствии с одним из вариантов осуществления изобретения, точка разрыва на хромосоме 8 расположена в гене Tmtc1, и указанный ген либо не экспрессируется, либо экспрессируется на низком уровне. В соответствии с одним из вариантов осуществления изобретения, ген Ergic2, который расположен со стороны центромеры по отношению к гену Tmtc1, не делетирован на хромосоме 8. Таким образом, в соответствии с этим вариантом осуществления изобретения, точка разрыва присутствует со стороны теломеры по отношению к гену Ergic 2 (где, в данном контексте, слово «теломерный» означает расположение в направлении ближе к теломерному концу), и этот ген Ergic 2 не делетирован.

В соответствии с одним из вариантов осуществления изобретения, геном клетки модифицируют в целях снижения или блокирования функциональной экспрессии гена FAM60A. На функциональную экспрессию гена FAM60A можно воздействовать различными способами, например, путем модификации промотора и/или энхансера гена FAM60A так, чтобы транскрипт продуцировался на более низком уровне или вообще не продуцировался, или методами сайленсинга генов, такими как транскрипционный или посттранскрипционный сайленсинг генов. В соответствии с одним из вариантов осуществления изобретения, выделенная эукариотическая клетка имеет одну или более мутаций в промоторной области гена FAM60A. Так, например, промоторная область может быть модифицирована так, чтобы промотор был менее функциональным или нефункциональным, причем, такой промотор может быть полностью элиминирован. Альтернативно или дополнительно, может быть присоединена полинуклеотидная последовательность, кодирующая полипептид, включая стоп-кодон, между промотором и старт-кодоном гена FAM60A, что будет приводить к экспрессии другого полипептида, а не FAM60A. Соответствующие методы хорошо известны специалистам, а поэтому в их подробном описании нет необходимости.

Снижение функциональной экспрессии гена может достигать такого уровня, при котором экспрессия этого гена может даже полностью прекращаться. Посттранскрипционный сайленсинг гена может быть достигнут с использованием, например, антисмысловых молекул или молекул, опосредующих интерференцию РНК. Неограничивающие примеры такого сайленсинга вкратце описаны ниже.

Антисмысловые полинуклеотиды могут быть сконструированы так, чтобы они специфически связывались с РНК, что будет приводить к образованию гибридов РНК-ДНК или РНК-РНК с прекращением обратной транскрипции или трансляции матричной РНК. Было получено множество форм антисмысловых молекул, и эти молекулы могут принадлежать к широкой категории фермент-зависимых антисмысловых молекул или стерически блокирующих антисмысловых молекул. Фермент-зависимая антисмысловая молекула включает формы, зависящие от активности РНКазы Н, и эти формы способствуют разложению мРНК-мишени, включая одноцепочечую ДНК, РНК и фосфортиоатную антисмысловую молекулу. Антисмысловые полинуклеотиды обычно продуцируются в клетке посредством экспрессии из антисмысловой конструкции, содержащей антисмысловую цепь в качестве транскрибируемой цепи. Трансрасщепляемыми каталитическими РНК (рибозимами) являются молекулы РНК, обладающие эндорибонуклеазной активностью. Рибозимы могут быть специально сконструированы так, чтобы они связывались с конкретной мишенью, или так, чтобы они расщепляли любые молекулы РНК по сайт-специфичесому механизму в остове клеточной РНК. Такое событие расщепления делает мРНК нестабильной и блокирует экспрессию белка. Геном эукариотической клетки может быть модифицирован так, чтобы соответствующая антисмысловая молекула экспрессировалась, например, перманентно.

Другим подходящим способом снижения функциональной экспрессии гена FAM60A на посттранскрипционном уровне является метод на основе интерференции РНК (РНКи). Методы сайленсинга генов посредством РНКи хорошо известны специалистам, а поэтому в их подробном описании нет необходимости. Специалистам известно несколько вариантов и типов соединений киРНК, которые могут быть использованы для снижения уровня экспрессии гена FAM60A. Подходящие киРНК, нацеленные на выбранные/идентифицированные последовательности-мишени генов-мишеней на уровне РНК могут быть идентифицированы с помощью соответствующих компьютерных технологий, в которых применяются определенные алгоритмы проектирования. В соответствии с одним из вариантов осуществления изобретения, РНКи-индуцирующее соединение экспрессируется вектором, который был стабильно трансфецирован в эукариотическую клетку и, таким образом, был интегрирован в геном эукариотической клетки. В случае киРНК, это может быть достигнуто, например, путем введения петли между двумя цепями, что будет приводить к продуцированию одного транскрипта, который затем может процессироваться в функциональную киРНК в эукариотической клетке. В таких кластерах для транскрипции обычно используются промотор РНК-полимеразы 3 (например, U6 или H1), который обычно регулирует транскрипцию небольших ядерных РНК (кшРНК). Было высказано предположение, что полученный кшРНК-транскрипт, происходящий от вектора, затем процессируется ферментом дайсером с образованием двухцепочечных молекул киРНК, предпочтительно, имеющих характерные 3'-выступающие концы. В соответствии с одним из вариантов осуществления изобретения, такой кшРНК-продуцирующий вектор стабильно интегрируют в геном эукариотической клетки. Этот вариант осуществления изобретения является предпочтительным, поскольку ингибирование гена FAM60A обусловлено продуцированием киРНК, которое является постоянным, достаточно стабильным и не транзиентным, и такое ингибирование позволяет получить клетки-хозяева млекопитающего с повышенной стабильностью экспрессии. Затем, клетки, содержащие соответствующий кшРНК-продуцирующий вектор, могут быть трансфецированы экспрессионным вектором, содержащим полинуклеотид, кодирующий представляющий интерес продукт. Альтернативно, могут быть применены стратегии котрансфекции, в которых вектор, генерирующий кшРНК, котрансфецируют экспрессионным вектором, содержащим полинуклеотид, кодирующий представляющий интерес продукт.

Транскрипционный сайленсинг гена может включать, например, эпигенетические модификации. В соответствии с одним из вариантов осуществления изобретения, уровень функциональной экспрессии гена FAM60A снижается посредством эпигенетического сайленсинга. Кроме того, последовательность гена FAM60A может быть модифицирована для снижения времени полужизни мРНК FAM60A. Это также приводит к ослаблению функции белка FAM60A в клетке.

В соответствии с одним из вариантов осуществления изобретения, функциональная экспрессия гена FAM60A снижается или блокируется посредством нацеливания на регуляторный элемент, участвующий в регуляции экспрессии гена FAM60A. Так, например, может быть осуществлен таргетинг фактора транскрипции, промотора (см. также выше), энхансера, UTR и других регуляторных элементов, например, посредством нокаута, делеции, ингибирования или любой другой модификации, которые инактивируют или снижают активность указанного регуляторного элемента, что приводит к блокированию или снижению функциональной экспрессии гена FAM60A и тем самым к ингибированию функции эндогенного FAM60A в указанной клетке.

В соответствии с одним из вариантов осуществления изобретения, геном эукариотической клетки модифицируют для ингибирования функции FAM60A посредством гетерологичной экспрессии мутантного FAM60A, который является нефункциональным или менее функциональным, чем эндогенно экспрессируемый белок FAM60A. В этом варианте осуществления изобретения, выделенная эукариотическая клетка содержит, помимо гетерологичного полинуклеотида, кодирующего представляющий интерес полипептид, другой гетерологичный полинуклеотид, кодирующий мутантный FAM60A. Посредством сверхэкспрессии соответствующего нефункционального или менее функционального мутанта FAM60A может быть создан доминантно-негативный фенотип. Другим вариантом ингибирования, а следовательно, снижения функции FAM60A в клетке является гетерологичная экспрессия белка, такого как антитело, которое нейтрализует FAM60A, а поэтому ингибирует функцию FAM60A в клетке. В соответствии с одним из вариантов осуществления изобретения, функцию FAM60A в клетке ингибируют путем снижения или блокирования функциональной экспрессии молекул, которые функционально взаимодействуют с FAM60A, например, посредством снижения или блокирования функциональной экспрессии одного или более членов SIN3/HDAC-комплекса. Такие варианты также ингибируют функцию FAM60A, поскольку один или более партнеров по связыванию, которые являются необходимыми для сообщения белку FAM60A биологической функции, не присутствуют в функциональной форме в результате снижения или блокирования функциональной экспрессии.

В соответствии с одним из вариантов осуществления изобретения, экспрессии гена FAM60A снижается по меньшей мере в 3 раза, по меньшей мере в 5 раз, по меньшей мере в 10 раз, по меньшей мере в 20 раз, по меньшей мере в 30 раз, по меньшей мере в 40 раз, по меньшей мере в 50 раз, по меньшей мере в 60 раз, по меньшей мере в 70 раз, по меньшей мере в 75 раз, по меньшей мере в 80 раз, по меньшей мере в 90 раз, по меньшей мере в 100 раз или по меньшей мере в 125 раз, по меньшей мере в 250 раз, по меньшей мере в 500 раз, по меньшей мере в 750 раз, по меньшей мере в 1000 раз, по меньшей мере в 1250 раз, по меньшей мере в 1500 раз, по меньшей мере в 1750 раз, по меньшей мере в 2000 раз, по меньшей мере в 2500 раз, по меньшей мере в 3000 раз или по меньшей мере в 3500 раз. Экспрессия может быть определена, например, с помощью ОТ-ПЦР в реальном времени или с применением других чувствительных методов детектирования РНК. В данном варианте, такое снижение экспрессии может быть достигнуто, тогда как в случае немодифицированной исходной клетки, экспрессия эндогенного гена FAM60A не снижается. В соответствии с одним из вариантов осуществления изобретения, экспрессия гена FAM60A составляет 0,05% или менее, 0,04% или менее, 0,03% или менее, 0,02% или менее, 0,01% или менее, 0,005% или менее или 0,0025% или менее по сравнению с экспрессией РНК 18S (принимаемой за 100%) в той же самой клетке. В соответствии с одним из вариантов осуществления изобретения, экспрессия гена FAM60A может быть даже еще более низкой, например, она может составлять 0,001% или менее, 0,0005% или менее или даже 0,0002% или менее по сравнению с экспрессией РНК 18S (принимаемой за 100%) в той же самой клетке.

В соответствии с одним из вариантов осуществления изобретения, выделенная эукариотическая клетка, которая, предпочтительно, представляет собой клетку млекопитающего, происходит от популяции эукариотических клеток, которые были модифицированы в целях ингибирования функции белка FAM60A в указанных клетках, где указанные клетки содержат стабильно интегрированный в их геном гетерологичный полинуклеотид, кодирующий представляющий интерес продукт, и где, в среднем, по меньшей мере 40%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85% или по меньшей мере 90% клеток, происходящих от указанной популяции, теряет не более, чем 30%, а предпочтительно, не более, чем 25% титра экспрессии представляющего интерес продукта в течение периода времени по меньшей мере 8 недель, предпочтительно, 10 недель, а более предпочтительно, 12 недель. Как показано в примерах, после трансфекции и идентификации стабильно трансфецированных клеток, количество клеток, которые не обнаруживают постепенную потерю продуктивности в процессе длительного культивирования, увеличивается в том случае, если описанные здесь модифицированные клетки, то есть, более стабильные клеточные клоны были получены от выбранной популяции клеток. Стабильность может быть протестирована, например, путем культивирования отдельных клеток, происходящих от указанной популяции и используемых в качестве клеточных клонов, с последующим определением титра в течение указанного периода времени. Стабильность может быть протестирована с помощью анализов, описанных в примерах. Как объясняется выше, степень стабильности может варьироваться в различных экспериментах, в зависимости от типа экспрессируемого белка и, например, от оптимизации кодонов. Однако, в случае модифицированных эукариотических клеток согласно изобретению, во всех анализах, проводимых в данных исследованиях, наблюдалось значительное увеличение числа стабильно экспрессирующих клонов по сравнению с немодифицированными клетками дикого типа. В некоторых экспериментах, число клеточных клонов, которые стабильно экспрессируют представляющий интерес продукт, составляло 80% или даже выше в процессе длительного культивирования в течение периода времени от 8 до 12 недель. Поэтому число клеток со стабильной экспрессией, присутствующих в популяции успешно трансфецированных клеток-хозяев, значительно увеличивалось. Поэтому риск выбора нестабильного клона, который постепенно теряет свою продуктивность в процессе длительного культивирования, для промышленного продуцирования, значительно снижается. Это важное преимущество позволяет значительно сократить время проведения анализов на стабильность, которые обычно осуществляют для исключения нестабильных клонов, или даже вообще не проводить такие анализы.

В соответствии с одним из вариантов осуществления изобретения осуществляют дополнительное ингибирование функции продукта экспрессии одного или более генов, выбранных из группы, состоящей из генов Bicd1, Amn1, метилтрансферазо-подобного белка 20, Dennd5b, FAM60A, Caprin2, Ipo8, RPS4Y2 и Tmtc1 или одного или более генов, расположенных со стороны теломеры по отношению к вышеупомянутым генам. Неограничивающие альтернативные названия вышеупомянутых отдельных генов и/или кодируемых белков, включая гомологи и ортологи, также приводятся выше в таблице 1, и эти соответствующие гены, кодирующие соответствующие белки, входят в объем значений терминов, употребляемых выше для отдельных генов. Аналогичным образом, ингибирование такой функции может быть достигнуто, например, путем снижения или блокирования функциональной экспрессии соответствующих генов. Подходящие технологии и варианты описаны выше для гена FAM60A, и эти технологии и варианты могут быть применены для любых других генов-мишеней. Как описано выше, указанные гены расположены в теломерной области хромосомы 8 китайского хомячка и в мышиной хромосоме 6. Если часть указанной теломерной области была делетирована, например, путем индуцирования хромосомного разрыва, как описано выше, то такая делетированная область обычно содержит один или более вышеупомянутых генов.

В соответствии с предпочтительным вариантом осуществления изобретения, в указанной клетке, в которой ингибируется функция FAM60A, также ингибируется функция продукта экспрессии гена C12orf35, предпочтительно, посредством снижения или блокирования функциональной экспрессии гена FAM60A. Было также неожиданно обнаружено, что ингибирование функции продукта экспрессии гена C12orf35, в эукариотической клетке, например, посредством снижения или блокирования функциональной экспрессии указанного эндогенного гена, приводит к значительному повышению уровня экспрессии представляющего интерес рекомбинантного продукта. Таким образом, был идентифицирован другой ключевой ген, который влияет на рекомбинантную экспрессию. Как было показано в примерах, мнгибирование функции продукта экспрессии гена C12orf35 в эукариотических клеток приводит к значительному повышению уровня экспрессии. Следовательно, ингибирование функции FAM60A и C12orf35 является особенно предпочтительным, поскольку были получены эукариотические клетки-хозяева, обладающие улучшенными свойствами, такими как стабильная экспрессия и высокий выход, а следовательно, особенно предпочтительными свойствами, такими как повышенный уровень продуцирования представляющего интерес рекомбинантного продукта. Как описано в настоящей заявке, эукариотической клеткой, предпочтительно, является клетка млекопитающего.

Ген C12orf35 эндогенно экспрессируется в эукариотических клетках, таких как, например, клетки млекопитающих, а именно, человека, мыши и хомячка. Продукт экспрессии гена C12orf35 представляет собой довольно крупный белок. В списке последовательностей представлены репрезентативные аминокислотные последовательности или предполагаемые аминокислотные последовательности белка, кодируемого эндогенным геном млекопитающх различных видов, таких как хомячки (SEQ ID NO:10 и 11), человек (SEQ ID NO:12 и 13), мыши (SEQ ID NO:14), крупный рогатый скот (SEQ ID NO:15) и дикие кабаны (SEQ ID NO:16). CDS (кодирующая последовательность ДНК) гена C12orf35 китайского хомячка представлена как SEQ ID NO:17. Кроме того, был секвенирован фрагмент 5'UTR (см. SEQ ID NO: 18) и 3'UTR (см. SEQ ID NO: 19) мРНК C12orf35 китайского хомячка. Ген C12orf35 также называется C12orf35-подобным геном или гомологом C12orf35 у хомячка или 2810474O19Rik у мышей. Информация об этом гене, о кодирующей последовательности и о предсказанном белке C12orf35 также приводится для Cricetulus griseus в базе данных NCBI: XM_003512865, которая вводится в настоящее описание посредством ссылки. Человеческий ген также обозначается KIAA1551. Белкам или генам других видов могут быть присвоены и другие названия, и такие неограничивающие альтернативные названия (альтернативные имена) также представлены выше в таблице 1. В соответствии с этим, используемый здесь термин «ген C12orf35», в частности, включает любой эндогенный ген, кодирующий белок, последовательность которого по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% гомологична или идентична одной или более аминокислотным последовательностям, представленным в SEQ ID NO:10-16, или аминокислотным последовательностям белка, кодируемого последовательностью SEQ ID NO:17. Белок, кодируемый таким геном, предпочтительно, имеет такую же функцию, как и белок, имеющий аминокислотную последовательность, представленную в SEQ ID NO:10, или одну или более аминокислотных последовательностей, представленных в SEQ ID NO:11-16, или белок, кодируемый SEQ ID NO:17. Указанный ген может быть модифицирован, как описано в настоящей заявке для ингибирования функции продукта экспрессии, экспрессируемого немодифицированной клеткой. В литературе нет подробного описания белка, экспрессируемого геном C12orf35. Используемые здесь термины «белок C12orf35» или «продукт экспрессии эндогенного гена C12orf35» и аналогичные термины включают любой белок, имеющий последовательность, которая по меньшей мере на 50%, по меньшей мере на 60%, по меньшей мере на 70%, по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% гомологична или идентична одной или более аминокислотным последовательностям, представленным в SEQ ID NO:10-16, или аминокислотным последовательностям белка, кодируемого последовательностью SEQ ID NO:17. Гомология, а в частности, идентичность белка по отношению к сравниваемому белку может быть вычислена по всей длине. В соответствии с одним из вариантов осуществления изобретения, экспрессия гена C12orf35 снижается по меньшей мере в 3 раза, по меньшей мере в 5 раз, по меньшей мере в 10 раз, по меньшей мере в 20 раз, по меньшей мере в 30 раз, по меньшей мере в 40 раз, по меньшей мере в 50 раз, по меньшей мере в 60 раз, по меньшей мере в 70 раз, по меньшей мере в 75 раз, по меньшей мере в 80 раз, по меньшей мере в 90 раз, по меньшей мере в 100 раз или по меньшей мере в 125 раз, по меньшей мере в 250 раз, по меньшей мере в 500 раз, по меньшей мере в 750 раз, по меньшей мере в 1000 раз, по меньшей мере в 1250 раз, по меньшей мере в 1500 раз, по меньшей мере в 1750 раз или по меньшей мере в 2000 раз. Это может быть определено, например, с помощью ОТ-ПЦР в реальном времени или с применением других чувствительных методов детектирования РНК. В данном варианте, такое снижение экспрессии может быть достигнуто, тогда как в случае немодифицированной исходной клетки, экспрессия эндогенного гена C12orf35 не снижается. В соответствии с одним из вариантов осуществления изобретения, экспрессия гена C12orf35 составляет 0,05% или менее, 0,0475% или менее, 0,045% или менее, 0,0425% или менее, 0,04% или менее, 0,0375% или менее, 0,035% или менее, 0,0325% или менее, 0,03% или менее, 0,0275% или менее, 0,025% или менее, 0,0225% или менее, 0,02% или менее, 0,0175% или менее, 0,015% или менее по сравнению с экспрессией 18S РНК (принимаемой за 100%) в той же самой клетке. В соответствии с одним из вариантов осуществления изобретения, экспрессия гена C12orf35 может быть даже еще более низкой, например, она может составлять 0,001% или менее, 0,0001% или менее или даже 0,00001 или менее по сравнению с экспрессией 18S РНК (принимаемой за 100%) в той же самой клетке. Функциональную экспрессию гена C12orf35 снижают так, чтобы это приводило к повышению уровня экспрессии представляющего интерес рекомбинантного продукта, если указанная модифицированная эукариотическая клетка была трансфецирована экспрессионным вектором, кодирующии представляющий интерес продукт по сравнению с соответствующей клеткой, в которой функциональная экспрессия гена C12orf35 не снижалась или не блокировалась. В соответствии с одним из вариантов осуществления изобретения, экспрессия представляющего интерес рекомбинантного продукта по меньшей мере в 1,5 раза, по меньшей мере в 1,75 раза, по меньшей мере в 2 раза, по меньшей мере в 2,5 раза, по меньшей мере в 3 раза, по меньшей мере в 4 раза или по меньшей мере в 5 раз превышает экспрессию в соответствующей клетке, в которой функциональная экспрессия гена C12orf35 не снижалась или не блокировалась. В соответствии с некоторыми вариантами осуществления изобретения, уровни экспрессии по меньшей мере в 8 раз, по меньшей мере в 10 раз или по меньшей мере в 15 раз превышают уровни экспрессии в соответствующей клетке, в которой экспрессия гена C12orf35 не снижалась или не блокировалась. Так, например, уровни экспрессии были определены после отбора с использованием G418, и эти уровни в 35 раз превышали уровни экспрессии в соответствующей клетке, в которой экспрессия гена C12orf35 не снижалась или не блокировалась. Уровень экспрессии рекомбинантного продукта может быть определен, например, с помощью анализов, описанных в примерах.

Эукариотическая клетка происходит от видов, в которых ген FAM60A обычно экспрессируется эндогенно. Примеры приводятся ниже. Как объяснялось выше (см. также Smith et al., 2012), FAM60A эндогенно экспрессируется в эукариотических клетках, например, во всех клетках многоклеточных, а в частности, позвоночных, а также в клетках беспозвоночных и во всех клетках млекопитающих. Используемый здесь термин «выделенный», как очевидно, относится к эукариотической клетке, которая не содержится в живом организме, таком как организм животного или человека. Как описано в настоящей заявке, клеткой может быть клеточная культура, клеточная линия, клеточный клон и т.п. Примеры также приводятся ниже. Как описано выше, указанную эукариотическую клетку модифицируют в целях ингибирования функции FAM60A в указанной клетке, например, посредством снижения или блокирования функции FAM60A по сравнению с соответствующей немодифицированной эукариотической клеткой, которая эндогенно экспрессирует FAM60A. Такое ингибирование, предпочтительно, достигается путем снижения или блокирования функциональной экспрессии гена FAM60A в клетке. Неограничивающие варианты описаны выше. Для получения клеточных линий-продуцентов с одинаковыми и предсказанными свойствами, геном эукариотической клетки, предпочтительно, модифицируют для достижения такого ингибирования. Подходящие варианты описаны выше. Затем, соответствующии образом модифицированная эукариотическая клетка может быть стабильно трансфецирована экспрессионным вектором, содержащим полинуклеотид, кодирующий представляющий интерес продукт, с получением эукариотических клеток согласно первому аспекту изобретения, содержащих интегрированный в их геном гетерологияный полинуклеотид, кодирующий представляющий интерес продукт. Эукариотической клеткой предпочтительно является клетка позвоночных, а более предпочтительно, клетка млекопитающих. Таким образом, все описанные здесь варианты, относящиеся к эукариотическим клеткам, по существу, могут относиться к предпочтительному варианту, в котором используются клетки млекопитающих. Эукариотическая клетка может быть, например, выбрана из группы, состоящей из клеток грызунов, клеток человека и клеток обезьяны. Предпочтительными эукариотическими клетками являются клетки грызунов, такие как, например, клетки хомячка или мыши. Эти клетки могут быть выбраны из группы, состоящей из клеток китайского хомячка, таких как клетка CHO, клеток BHK, клеток NS0, клеток C127, мышиных фибробластов 3T3 и клеток SP2/0. Особенно предпочтительными являются клетки CHO, например, клетка CHO, такая как CHO-K1, CHO-S, CHO-K1SV, CHO-SSF3, CHO-DG44, CHO-DUXB11 или клеточная линия, происходящая от этих клеток. Как показано в примерах, нокаут гена FAM60A в клетках CHO позволяет получить популяцию клеток CHO, в которых присутствует большее число стабильно трансфецированных клеток, которые обладают повышенной стабильностью. Ген FAM60A также экспрессируется в человеческих клетках. Таким образом, в соответствии с одним из вариантов осуществления изобретения, клетка млекопитающего происходит от человеческой клетки, которая может быть, например, выбрана из группы, состоящей из клеток HEK293, клеток MCF-7, клеток PerC6, клеток CAP, гемопоэтических клеток и клеток HeLa. Другой альтернативой являются клетки обезьян, которые, например, могут быть выбраны из группы, состоящей из клеток COS, клеток COS-1, клеток COS-7 и клеток Vero. В соответствии с одним из вариантов осуществления изобретения, эукариотическую клетку, которой предпочтительно является клетка млекопитающего, получают в виде клеточного клона или клеточной линии.

Эукариотическая клетка, в которой геном был модифицирован для ингибирования функции FAM60A в указанной клетке, и которая не содержит гетерологичного полинуклеотида, кодирующего представляющий интерес продукт, гетерологичного полинуклеотида, кодирующего селективный маркер, и/или гетерологичного полинуклеотида, кодирующего репортерный полипептид, которые экспрессируются в указанной клетке, а в частности, секретируются указанной клеткой, может быть использована в качестве исходного материала для получения эукариотических клеток согласно изобретению. Соответствующая «пустая» модифицированая эукариотическая клетка может быть использована, например, в качестве клонирующей клеточной линии в методах рекомбинантного продуцирования. Соответствующая клетка может быть стабильно трансфецирована гетерологичным полинуклеотидом, кодирующим представляющий интерес продукт, например, с использованием соответствующего экспрессионного вектора. Такие «пустые» эукариотические клетки, в которых ингибируется функция FAM60A, и в которых не экспрессируется, а в частности, не секретируется рекомбинантный продукт, могут быть трансфецированы различными экспрессионными векторами в зависимости от типа представляющего интерес продукта, который, как предполагается, был рекомбинантно продуцирован. Таким образом, указанная эукариотическая клеточная линия может быть использована для различных целей, то есть для продуцирования различных представляющих интерес продуктов, а в частности, представляющих интерес серетируемых полипептидов.

Эукариотическая клетка согласно первому аспекту изобретения содержит гетерологичный полинуклеотид, кодирующий представляющий интерес продукт, стабильно интегрированный в ее геном. Представляющий интерес продукт представляет собой рекомбинантный продукт, который, предположительно, экспрессируется эукариотической клеткой в большом количестве. Предпочтительным представляющим интерес продуктом является полипептид. В соответствии с предпочтительным вариантом осуществления изобретения, представляющий интерес полипептид секретируется клеткой. Кроме того, эукариотическая клетка может также содержать гетерологичный полинуклеотид, кодирующий селективный маркер, и/или гетерологичный полинуклеотид, кодирующий репортер. Это позволяет облегчить отбор клеток-хозяев, которые были успешно трансфецированы, а поэтому экспрессируют представляющий интерес продукт. Кроме того, эукариотическая клетка может содержать несколько полинуклеотидов, кодирующих различные селективные маркеры и/или репортерные полипептиды.

Используемые здесь термины «гетерологичный полинуклеотид» или «гетерологичная нуклеиновая кислота» и аналогичные термины означают, в частности, полинуклеотидную последовательность, которая была введена в эукариотическую клетку, например, с помощью рекомбинантной технологии, такой как трансфекция. Термин «полинуклеотид» означает, в частности, полимер, который состоит из нуклеотидов, обычно связанных друг с другом посредством дезоксирибозы или рибозы, и который представляет собой ДНК и РНК в зависимости от контекста описания. Термин «полинуклеотид» охватывает полинуклеотиды любого размера.

Экспрессионный вектор может быть использован для введения гетерологичных полинуклеотидов. Полинуклеотиды могут содержаться в экспрессионном кластере. Полинуклеотид(ы), кодирующий(ие) представляющий интерес продукт, и полинуклеотид(ы), кодирующий(ие) селективный маркер или репортерный полипептид, могут быть локализованы на одном и том же или на различных экспрессионных векторах. Введение в эукариотическую клетку может быть достигнуто, например, путем введения подходящего экспрессионного вектора, содержащего полинуклеотид, кодирующий представляющий интерес продукт, в клетки-хозяева. Экспрессионный вектор, предпочтительно, интегрируют в геном клетки-хозяина (стабильная трансфекция). Как показано в примерах, описанные здесь новые эукариотические клетки являются предпочтительными для стабильной трансфекции, поскольку число клонов с повышенной стабильностью возрастает. Стабильная трансфекция также является стандартной для генерирования клеточных клонов с высоким уровнем экспрессии, продуцирующих представляющий интерес продукт, такой как представляющий интерес полипептид, который может быть получен промышленным способом. Это особенно важно для получения представляющих интерес терапевтических или диагностических полипептидов. Некоторые подходящие методы введения гетерологичной нуклеиновой кислоты, такой как экспрессионный вектор, в эукариотические клетки, такие как клетки-хозяева млекопитающих, известны специалистам, а поэтому нет необходимости в их подробном описании. Соответствующими методами являются, но не ограничиваются ими, трансфекция, опосредуемая фосфатом кальция, электропорация, липофекция, биобаллистические методы переноса генов и методы переноса генов, опосредуемые полимером, и т.п. Для переноса гетерологичного полинуклеотида в геном клетки-хозяина, помимо традиционных методов на основе рандомизированной интеграции, могут быть также применены методы на основе рекомбинации. Поскольку эти методы хорошо известны специалистам, то нет необходимости в их подробном описании. Неограничивающие варианты конструирования подходящих векторов также описаны ниже и входят в объем настоящего изобретения.

Экспрессионные векторы, используемые для достижения экспрессии представляющего интерес рекомбинантного продукта, обычно содержат элементы регуляции транскрипции, подходящие для инициации транскрипции, такие как, например, промоторы, энхансеры, сигналы полиаденилирования, сигналы транзиторного прерывания или терминации транскрипции, которые обычно представляют собой элементы экспрессионного кластера. Если нужным продуктом является полипептид, то подходящие элементы регуляции трансляции, предпочтительно, вводят в вектор, например, в 5'-нетранслируемые области, что приводит к образованию 5'-кэп-структур, подходящих для рекрутинга рибосом и стоп-кодонов, терминирующих трансляцию. Полученные транскрипты имеют функциональные элементы трансляции, которые облегчают экспрессию белка (то есть, трансляцию) и обеспечивают соответствующую терминацию трансляции. Функциональная экспрессионная единица, способная «правильно» индуцировать экспрессию встроенного полинуклеотида, также называется «экспрессионным кластером». Способ конструирования экспрессионного кластера, обеспечивающего экспрессию в эукариотической клетке, такой как, предпочтительно, клетка млекопитающего, хорошо известен специалистам.

Полинуклеотид(ы), кодирующий(е) представляющий интерес продукт, и полинуклеотиды, кодирующие селективный(е) маркер(ы) и/или репортерный(е) полипептид(ы), описанные в настоящей заявке, предпочтительно, содержатся в экспрессионных кластерах. При этом подходящими являются несколько вариантов. Так, например, каждый из указанных полинуклеотидов может содержаться в отдельном экспрессионном кластере. Этот кластер также называется моноцистронным кластером. В объем настоящего изобретения также входят по меньшей мере два соответствующих полинуклеотида, содержащихся в одном экспрессионном кластере. В соответствии с одним из вариантов осуществления изобретения, по меньшей мере один элемент, такой как внутренний сайт связывания с рибосомой (IRES), функционально расположен между полинуклеотидами, которые экспрессируются в одном и том же экспрессионном кластере. Следовательно, в данном случае гарантируется получение отдельных продуктов трансляции из указанного транскрипта. Соответствующие методы экспрессии на основе IRES и другие би- и полицистронные системы хорошо известны специалистам, а поэтому нет необходимости в их подробном описании.

Как описано выше, экспрессионный вектор может содержать по меньшей мере один промотор и/или промотор/энхансер, который служит в качестве элемента экспрессионного кластера. Промоторы могут быть подразделены на два класса, а именно, промоторы, которые функционируют конститутивно, и промоторы, которые регулируются посредством индукции или дерепрессии. Оба этих промотора являются подходящими для их применения в настоящем изобретении. Сильными конститутивными промоторами, которые индуцируют экспрессию в клетках многих типов, являются, но не ограничиваются ими, главный поздний промотор аденовируса, предранний промотор человеческого цитомегаловируса, промотор SV40 и промотор вируса саркомы Рауса, а также мышиный промотор 3-фосфоглицерат-киназы, EF1a. В соответствии с одним из вариантов осуществления изобретения, промотор и/или энхансер получают из CMV и/или SV40. Промоторы транскрипции могут быть выбраны из группы, состоящей из промотора SV40, промотора CMV, промотора EF1-альфа, промотора RSV, промотора BROAD3, мышиного промотора вируса саркомы Рауса 26, промотора pCEFL и промотора β-актина. При этом могут быть также использованы и другие промоторы, при условии, что они будут индуцировать экспрессию представляющего интерес продукта в эукариотической клетке, которая, предпочтительно, представляет собой клетку млекопитающего.

Кроме того, экспрессионный кластер может содержать по меньшей мере один интрон. Обычно интроны расположены у 5'-конца открытой рамки считывания, но они могут быть также расположены и у 3'-конца. Указанный интрон может быть расположен между промоторным(ми) и/или промоторным(ми)/энхансерным(ми) элементом(ами) и 5'-концом открытой рамки считывания полинуклеотида, кодирующего экспрессируемый представляющий интерес продукт. Некоторые подходящие интроны известны специалистам и могут быть использованы в настоящем изобретении.

Представляющим интерес продуктом может быть любой биологический продукт, способный продуцироваться посредством транскрипции, трансляции или любого другого события экспрессии генетической информации, кодируемой полинуклеотидом, кодирующим представляющий интерес продукт. Представляющий интерес продукт может быть выбран из группы, состоящей из полипептидов и нуклеиновых кислот, а в частности, РНК. Указанным продуктом может быть фармацевтически или терапевтически активные соединения или тестируемые средства, используемые в анализах и т.п. Предпочтительно, представляющим интерес продуктом является полипептид. Любой представляющий интерес полипептид может быть экспрессирован способом согласно изобретению. Термин «полипептид» означает молекулу, содержащую полимер из аминокислот, связанных друг с другом пептидной(ыми) связью(связями). Полипептидами являются полипептиды любой длины, включая белки (например, имеющие более чем 50 аминокислот) и пептиды (например, имеющие 2-49 аминокислот). Полипептидами являются белки и/или пептиды, имеющие любую активность, любую функцию или любой размер, и такими полипептидами могут быть, например, ферменты (например, протеазы, киназы, фосфатазы), рецепторы, транспортные белки, бактерицидные и/или эндотоксин-связывающие белки, структурные полипептиды, мембраносвязанные полипептиды, гликопротеины, глобулярные белки, иммунные полипептиды, токсины, антибиотики, гормоны, факторы роста, факторы крови, вакцины или т.п. Полипептид может быть выбран из группы, состоящей из пептидных гормонов, интерлейкинов, тканевых активаторов плазминогена, цитокинов, иммуноглобулинов, а в частности, антител или функциональных фрагментов антител или их вариантов и Fc-гибридных белков. Представляющий интерес полипептид, который экспрессируют с применением описанных здесь способов, может также представлять собой субъединицу или домен полипептида, такой как, например, тяжелая цепь или легкая цепь антитела или его функционального фрагмента или производного. Термины «представляющий интерес продукт» или «представляющий интерес полипептид» могут означать отдельную субъединицу или отдельный домен или конечный белок, состоящий из соответствующих субъединиц или доменов в зависимости от контекста описания изобретения. В предпочтительном варианте осуществления изобретения, представляющим интерес полипептидом является молекула иммуноглобулина, а более предпочтительно, антитело или его субъединица или домен, такие как, например, тяжелая или легкая цепь антитела. Используемый здесь термин «антитело», в частности, означает белок, содержащий по меньшей мере две тяжелых цепи и две легких цепи, связанных дисульфидными связями. Термин «антитело» включает природные антитела, а также рекомбинантные формы антител, например, гуманизованные антитела, полностью человеческие антитела и химерные антитела. Каждая тяжелая цепь обычно состоит из вариабельной области тяжелой цепи (VH) и константной области тяжелой цепи (CH). Каждая легкая цепь обычно состоит из вариабельной области легкой цепи (VL) и константной области легкой цепи (CL). Однако, термин «антитело» также включает и антитела других типов, такие как однодоменные антитела, антитела с тяжелой цепью, то есть состоящие только из одной или более, а в частности, из двух тяжелых цепей, и наноантитела, то есть антитела, состоящие только из одного мономерного вариабельного домена. Как обсуждалось выше, полинуклеотид, кодирующий представляющий интерес полипептид, может также кодировать одну или более субъединиц или доменов антитела, например, тяжелую или легкую цепь или их функциональный фрагмент или производное, используемые здесь в качестве представляющего интерес полипептида. Указанные субъединицы или домены могут экспрессироваться из одного и того же или из различных экспрессионных кластеров. Термин «функциональный фрагмент или производное» антитела, в частности, означает полипептид, происходящий от антитела и способный связываться с одним и тем же антигеном, а в частности, с тем же самым эпитопом, с которым связывается антитело. Было показано, что антигенсвязывающая функция антитела может обеспечиваться фрагментами полноразмерного антитела или его производных. Примерами фрагментов или производных антитела являются: (i) Fab-фрагменты, одновалентные фрагменты, состоящие из вариабельной области и первого константного домена каждой тяжелой и легкой цепи; (ii) F(ab)2-фрагменты, двухвалентные фрагменты, содержащие два Fab-фрагмента, связанных дисульфидным мостиком в шарнирной области; (iii) Fd-фрагменты. состоящие из вариабельной области и первого константного домена CH1 тяжелой цепи; (iv) Fv-фрагменты, состоящие из вариабельной области тяжелой и легкой цепи одной ветви антитела; (v) scFv-фрагменты, Fv-фрагменты, состоящие из одной полипептидной цепи; (vi) (Fv)2-фрагменты, состоящие из двух Fv-фрагментов, ковалентно связанных друг с другом; (vii) вариабельный домен тяжелой цепи; и (viii) мультиантитела, состоящие из вариабельной области тяжелой цепи и вариабельной области легкой цепи, ковалентно связанных друг с другом так, что ассоциация вариабельных областей тяжелой цепи и легкой цепи может быть только межмолекулярной, а не внутримолекулярной. В соответствии с одним из вариантов осуществления изобретения, эукариотическая клетка секретирует представляющий интерес полипептид в среду для культивирования клеток. В соответствии с одним из вариантов осуществления изобретения, представляющим интерес полипептидом не является SIN3A, либо этот полипептид не содержит SIN3A. В соответствии с одним из вариантов осуществления изобретения, представляющим интерес полипептидом не является FAM60A, либо этот полипептид не содержит FAM60A.

Эукариотическая клетка может содержать, а может и не содержать эндогенный полинуклеотид, который, соответственно, идетичен полинуклеотиду, кодирующему представляющий интерес продукт. В соответствии с одним из вариантов осуществления изобретения, эукариотическая клетка не содержит эндогенного гена, соответствующего представляющему интерес продукту.

Как описано выше, в некоторых вариантах осуществления изобретения, эукариотическая клетка содержит по меньшей мере один гетерологичный полипептид, кодирующий селеоктивный маркер, и/или гетерологичный полинуклеотид, кодирующий репортерный полипептид, а также гетерологичный полинуклеотид, кодирующий представляющий интерес продукт.

«Селективный маркер» позволяет осуществлять отбор клеток-хозяев, экспрессирующих указанный селективный маркер, в подходящих условиях селективного культивирования. Селективный маркер содержит носитель, который в условиях отбора обеспечивает выживание и/или рост клеток. Таким образом, клетки-хозяева, успешно трансфецированные экспрессионным вектором, могут быть отобраны в соответствующих условиях отбора. Обычно, селективный маркерный ген сообщает резистентность к селективному агенту, такому как лекарственное средство, например, антибиотик или другой токсический агент, или компенсирует метаболический или катаболический дефект в клетке-хозяине. Таким маркером может быть маркер позитивного или негативного отбора. Для отбора успешно трансфецированных клеток-хозяев может быть использована культуральная среда в целях культивирования клеток-хозяев, содержащих селективный агент, позволяющий проводить отбор на используемый селективный маркер. В других вариантах осуществления изобретения, селективный маркер обеспечивает выживание и пролиферацию клетки-хозяина в отсутствии соединения или при низком количестве соединения, играющего важную роль в выживании и/или пролиферации клеток-хозяев, не содержащих селективного маркера. При культивировании клеток-хозяев в среде, не содержащей этого главного соединения в концентрации, достаточной для выживания и/или пролиферации клетки-хозяина, или содержащей низкое количество указанного главного соединения, выживать и/или пролиферироваться могут только клетки-хозяева, экспрессирующие селективный маркер. В соответствии с одним из вариантов осуществления изобретения, селективным маркером является маркер резистентности, кодирующий белок, который сообщает резистентность к указанному лекарственному средству в условиях отбора. В литературе описан ряд селективных маркерных генов (см., например, WO 92/08796, WO 94/28143, WO2004/081167, WO2009/080759, WO2010/097240). Так, например, может быть использован по меньшей мере один селективный маркер, сообщающий резистентность к одному или более антибиотикам. В соответствии с одним из вариантов осуществления изобретения, селективным маркером может быть амплифицируемый селективный маркер. Амплифицируемый селективный маркер позволяет проводить отбор вектора, содержащего клетки-хозяева, и может стимулировать амплификацию гена указанного вектора в клетках-хозяевах. Селективные маркерные гены обычно используют вместе с эукариотическими клетками, такими как, в частности, клетки млекопитающего, и такими генами являются гены аминогликозид-фосфотрансферазы (APH), гигромицин-фосфотрансферазы (hyg), дигидрофолатредуктазы (DHFR), тимидинкиназы (tk), глутаминсинтетазы и аспарагинсинтетазы, и гены, кодирующие резистентность к неомицину (G418), пуромицину, гигромицину, зеоцину, оубаину, бластицидину, гистидинолу D, блеомицину, флеомицину и микофеноловой кислоте. В соответствии с одним из вариантов осуществления изобретения, фолатный рецептор используется в качестве селективного маркера в комбинации с описанными здесь новыми эукариотическими клетками (см., например, WO2009/080759), которыми, предпочтительно, являются клетки млекопитающих. В соответствии с одним из вариантов осуществления изобретения, эукариотическая клетка, в зависимости от поглощения фолата, содержит гетерологичный полинуклеотид, кодирующий фолатный рецептор, используемый в качестве селективного маркера, и/или гетерологичный полинуклеотид, кодирующий дигидрофолатредуктазу (DHFR), используемую в качестве селективного маркера. Этот вариант также подробно описан ниже вместе со способом отбора согласно второму аспекту изобретения. Эукариотическая клетка может эндогенно экспрессировать DHFR и фолатный рецептор.

«Репортерный полипептид» позволяет идентифицировать клетку, экспрессирующую указанный репортерный полипептид, исходя из детектирующих признаков (например, по флуоресценции). Репортерные гены обычно не сообщают клеткам-хозяевам способность к выживанию. Однако, экспрессия репортерного полипептида может быть использована для дифференциации клеток, экспрессирующих репортерный полипептид, и клеток, которые не экспрессируют этот полипептид. Следовательно, с использованием такого репортерного гена можно также проводить отбор успешно трансфецированных клеток-хозяев. Подходящими репортерными полипептидами являются, но не ограничиваются ими, например, белок, флуоресцирующий в зеленом диапазоне спектра (GFP), YFP, CFP и люцифераза. В соответствии с одним из вариантов осуществления изобретения, репортерный полипептид обладает свойствами, позволяющими проводить отбор с помощью проточной цитометрии.

Как описано выше, экспрессионный вектор, содержащий полинуклеотид, кодирующий представляющий интерес продукт, может также включать более, чем один селективный маркер и/или репортерный ген. Кроме того, один или более полинуклеотидов, кодирующих селективный(е) маркер(ы), и/или один или более полинуклеотидов, кодирующих репортерный(е) полипептид(ы), могут также присутствовать на одном или более различных экспрессионных векторах, которые были котрнасфецированы экспрессионным вектором, содержащим полинуклеотид, кодирующие представляющий интерес продукт. Такие стратегии котрансфекции, которые также позволяют проводить отбор, хорошо известны специалистам.

Экспрессионный вектор или комбинация по меньшей мере двух экспрессионных векторов, содержащихся в эукариотической клетке, может дополнительно содержать другие векторые элементы. Так, например, может присутствовать по меньшей мере один дополнительный полинуклеотид, кодирующий другой представляющий интерес продукт. Как указывалось выше, и как очевидно из описанных здесь примеров, относящихся к полипептидам, которые могут быть экспрессированы способами согласно изобретению, конечный полипептид, продуцируемый, а предпочтительно, секретируемый клеткой-хозяином, может также представлять собой белок, состоящий из нескольких отдельных субъединиц или доменов. Предпочтительным примером соответствующего белка является молекула иммуноглобулина, а в частности, антитело, содержащее, например, тяжелую и легкую цепи. Специалистам известно несколько вариантов продуцирования соответствующего белка, состоящего из различных отдельных субъединиц или доменов, и подходящих векторных конструкций. В соответствии с одним из вариантов осуществления изобретения, две или более субъединиц или два или более доменов указанного белка экспрессируются из одного экспрессионного кластера. В этом варианте осуществления изобретения, один длинный транскрипт получают из соответствующего экспрессионного кластера, содержащего кодирующие области из отдельных субъединиц или доменов белка. В соответствии с одним из вариантов осуществления изобретения, по меньшей мере один элемент IRES (внутренний сайт связывания с рибосомой) функционально расположен между кодирующими областями отдельных субъединиц или доменов, а за секреторной лидерной последовательностью расположены кодирующие области. Следовательно, в данном случае гарантируется получение отдельных продуктов трансляции из указанного транскрипта и конечного белка, который может подвергнут соответствующему фолдингу и секреции. Соответствующие методы известны специалистам, а поэтому нет необходимости в их подробном описании.

В некоторых вариантах осуществления изобретения, относящихся к экспрессии антител, еще более предпочтительно, чтобы отдельные субъединицы или домены экспрессировались из различных экспрессионных кластеров. В соответствии с одним из вариантов осуществления изобретения, экспрессионным кластером, используемым для экспрессии представляющего интерес продукта, является моноцистронный экспрессионный кластер. Все экспрессионные кластеры, содержащиеся в экспрессионном векторе или в комбинации экспрессионных векторов, могут быть моноцистронными. В соответствии с одним из вариантов осуществления изобретения, каждый экспрессионный кластер, сконструированный для экспрессии представляющего интерес продукта, включает полинуклеотид, кодирующий одну субъединицу или один домен белка, который экспрессируется как представляющий интерес полипептид. Так, например, в случае антител, один экспрессионный кластер может кодировать легкую цепь антитела, а другой экспрессионный кластер может кодировать тяжелую цепь антитела. После экспрессии отдельных субъединиц или доменов из отдельных экспрессионных кластеров, конечный белок, такой как антитело, подвергается укладке из указанных субъединиц или доменов и секретируется клеткой-хозяином. Этот вариант является особенно подходящим для экспрессии молекул иммуноглобулина, таких как антитела. В этом случае, первый гетерологичный полинуклеотид, кодирующий представляющий интерес продукт, кодирует, например, тяжелую или легкую цепь молекулы иммуноглобулина, а второй гетерологичный полинуклеотид, кодирующий представляющий интерес продукт, кодирует другую цепь молекулы иммуноглобулина. В соответствии с одним из вариантов осуществления изобретения, экспрессионный вектор или комбинация по меньшей мере двух экспрессионных векторов, используемых для трансфекции клетки-хозяина млекопитающего, содержит по меньшей мере один экспрессионный кластер, включающий полинуклеотид, кодирующий тяжелую цепь молекулы иммуноглобулина или ее функциональный фрагмент, и по меньшей мере один экспрессионный кластер, включающий полинуклеотид, кодирующий легкую цепь молекулы иммуноглобулина или ее функциональный фрагмент. Указанные полинуклеотиды могут быть расположены на одном и том же или на различных экспрессионных векторах в том случае, если используется комбинация по меньшей мере двух экспрессионных векторов. После экспрессии указанных полинуклеотидов в трансфецированной клетке-хозяине, функциональная молекула иммуноглобулина продуцируется, а предпочтительно, секретируется такой клеткой-хозяином. Как показано в примерах, используемые здесь новые клетки и клеточные линии, в которых геном клетки-хозяина был модифицирован в целях ингибирования функции FAM60A в указанной клетке, предпочтительно, благодаря снижению или блокированию функциональной экспрессии указанного гена, являются особенно подходящими для экспрессии белков, что обусловлено их более высокой стабильностью. Кроме того, в некоторых вариантах осуществления изобретения, а в частности, в случае дополнительного ингибирования функции гена FAM60A в клетке, выход продукта экспрессии также повышается. Следовательно, описанные здесь новые эукариотические клеточные линии имеют конкретные преимущества, позволяющие использовать эти клетки для рекомбинантной экспрессии полипептидов, включая белки, состоящие из нескольких субъединиц или доменов, таких как, например, антитела. Другие преимущества также описаны в примерах.

B. Способ отбора

В соответствии со своим вторым аспектом, настоящее изобретение относится к способу отбора клетки-хозяина, которая рекомбинантно экспрессирует представляющий интерес продукт, где указанный способ включает:

(a) получение эукариотических клеток в качестве клеток-хозяев согласно первому аспекту изобретения; и

(b) отбор одной или более клеток-хозяев, экспрессирующих представляющий интерес продукт.

Эукариотические клетки-хозяева согласно первому аспекту изобретения, включая подходящие и предпочтительные варианты осуществления изобретения, а также их преимущества подробно описаны выше в соответствующих разделах настоящей заявки. Как описано выше, в качестве клеток-хозяев предпочтительно используются клетки позвоночных, а в частности, клетки млекопитающих. Преимущественные свойства указанных эукариотических клеток облегчают, например, отбор и, тем самым, идентификацию подходящих продуцирующих клонов. Кроме того, при использовании описанных здесь эукариотических клеток, благодаря значительному увеличению числа высокопродуктивных клеток в популяции трансфецированных клеток, для идентификации подходящих продуцирующих клонов потребуется меньшее число клонов, необходимых для анализа и скрининга на их продуктивные свойства. Это позволит сэкономить время, а также провести большее число параллельных исследований. Кроме того, как показано в примерах, число и, соответственно, процент клеток с высоким уровнем экспрессии будет возрастать после проведения стадий стабильной трансфекции и отбора. Такие экспрессирующие клетки, также называемые клеточными пулами, продуцируют значительное количество представляющего интерес продукта. Таким образом, указанные клеточные пулы, содержащие клетки с высоким уровнем экспрессии, могут быть, например, использованы для продуцирования представляющего интерес полипептида за короткий период времени. Следовательно, представляющий интерес продукт будет продуцироваться в соответствующих клетках достаточно быстро.

В соответствии с одним из вариантов осуществления изобретения, стадия (a) способа отбора согласно второму аспекту изобретения включает трансфекцию эукариотических клеток, геном которых был модифицирован в целях ингибирования функции белка FAM60A в указанных клетках, гетерологичным полинуклеотидом, кодирующим представляющий интерес продукт, и тем самым, получение эукариотических клеток, содержащих гетерологичный полинуклеотид, кодирующий представляющий интерес продукт, стабильно интегрированный в геном. Как описано выше, клетки млекопитающих, предпочтительно, используются в качестве эукариотических клеток-хозяев. Полинуклеотид, кодирующий представляющий интерес продукт, может присутствовать в экспрессионном векторе, который затем вводят в эукариотическую клетку.

Стадия отбора (b) может представлять собой многостадийный способ отбора, включающий несколько стадий для отбора и, тем самым, для идентификации клеток-хозяев, экспрессирующих представляющий интерес продукт с высоким выходом. Так, например, стадия (b) может включать одну или более стадий отбора для идентификации клеток, которые были успешно трансфецированы, а также одну или более дополнительных стадий для отбора клеток с высоким уровнем экспрессии из пула успешно трансфецированных клеток. Соответствующая стратегия отбора зависит от конструкции экспрессионного вектора, используемого доя введения полинуклеотида, кодирующего представляющий интерес продукт, а в частности, от типа используемого(ых) маркера(ов) и/или репортера(ов) для отбора. Неограничивающие варианты осуществления изобретения описаны ниже.

Как описано выше, эукариотические клетки-хозяева могут содержать по меньшей мере один гетерологичный полинуклеотид, кодирующий селективный маркер. Полинуклеотид, кодирующий селективный маркер, может быть введен в клетку-хозяина вместе с полинуклеотидом, кодирующим представляющий интерес продукт, с использованием того же самого или другого котрансфецированного экспрессионного вектора. Затем стадия (b) включает культивирование множества указанных клеток-хозяев в условиях, обеспечивающих давление отбора клеток-хозяев для идентификации успешно трансфецированных клеток-хозяев, например, в подходящей селективной среде. Используемый здесь термин «селективная среда», в частности, означает среду для культивирования клеток, подходящую для отбора клеток-хозяев, экспрессирующих селективный маркер. Эта среда может включать, например, агент для отбора, такой как токсическое лекарственное средство, позволяющее идентифицировать успешно трансфецированные клетки-хозяева. Альтернативно, в селективной среде, главное соединение может отсутствовать, либо его концентрация может быть снижена. В соответствии с одним из вариантов осуществления изобретения, клетки-хозяева, которые не были успешно трансфецированы, а следовательно, не экспрессировали селективный(е) маркер(ы) или экспрессировали этот маркер на низком уровне, не могли пролиферировать или погибали в условиях селективного культивирования. В противоположность этому, клетки-хозяева, которые были успешно трансфецированы экспрессионным(и) вектором(ами), и которые экспрессировали селективный(е) маркер(ы) (и соответственно, совместно введенный представляющий интерес продукт) с достаточно высоким выходом, были резистентными к давлению отбора или почти не подвергались давлению отбора, а поэтому могли пролиферировать, что приводило к размножению клеток-хозяев, которые не были успешно трансфецированы, или в геноме которых присутствовал «неподходящий» сайт интеграции. В соответствии с одним из вариантов осуществления изобретения, селективный маркер выбран из группы, состоящей из маркеров резистентности к антибиотикам, маркеров резистентности к лекарственным средствам и метаболических маркеров. Подходящие примеры селективных маркеров и стратегий отбора описаны выше в соответствии с первым аспектом изобретения, и соответствующие условия отбора отдельных селективных маркеров также хорошо известны специалистам. Неограничивающие, но предпочтительные варианты осуществления изобретения кратко описаны ниже.

Как показано в примерах, одно из преимуществ описанных здесь новых эукариотических клеток, в частности, таких как клеточная линия CHO, имеющая делецию в теломерной области хромосомы 8, которая включает ген C12orf35, заключается в том, что уже после одной стандартной стадии отбора, такой как, например, отбор с использованием G418/neo, процент высокопродуктивных клеток значительно увеличивается. Так, например, при трансфекции нормальных клеточных линий CHO, которые не были соответствующим образом модифицированы, в большинстве случаев, 60% или даже до 80% этих клеток, сохранивших свою жизнеспособность после отбора с использованием G418/neo, являются непродуктивными. Однако, при использовании новых эукариотических клеток клеточных линий согласно изобретению, число непродуктивных клеток или клеток с низкой продуктивностью значительно снижалось. Это позволяет осуществлять эффективный отбор в стадии (b) с помощью лишь одного селективного маркера и проводить лишь одну стадию отбора, такую как, например, отбор с использованием G418/neo, если это необходимо. Этот способ ускоряет отбор, и тем самым позволяет сократить время, необходимое для получения трансфецированных клеток, которые экспрессируют представляющий интерес продукт. Кроме того, поскольку число высокопродуктивных клеток возрастает, то совершенно очевидно, что даже без проведения селективного отбора на высокопродуктивные клетки могут быть получены популяции клеток с высокоэффективными клонами и, при этом, за очень короткое время. Следовательно, даже из таких пулов может быть получен представляющий интерес продукт. Таким образом, в случае, когда, например, необходимо очень быстро получить лишь небольшое количество белка, например, для исследования или проведения анализа, такая система экспресс-отбора, которая позволяет очень быстро получить клетки или пулы клеток с хорошей продуктивностью, имеет очень большие преимущества.

Однако, если необходимо еще больше повысить продуктивность, то предпочтительно провести несколько стадий отбора (b). Это особенно желательно в случае, когда необходимо получить клональную клеточную линию для продуцирования представляющего интерес продукта в больших количествах, а в частности, в промышленном производстве.

Как было описано выше, экспрессионный вектор или экспрессионные векторы, вводимые в описанные здесь клетки, могут содержать два или более генов селективных маркеров, и стадии отбора на различные селективные маркеры могут быть осуществлены одновременно или последовательно для выявления клеток-хозяев, успешно трансфецированных экспрессионным(и) вектором(ами) и экспрессирующих представляющий интерес продукт с высоким выходом. Селективная среда, используемая для культивирования, может содержать селективные агенты для всех используемых селективных маркеров. В другом варианте осуществления изобретения, культивирование может быть осуществлено сначала в селективной среде, содержащей только селективный(е) агент(ы) для одного гена или субсерии генов используемых селективных маркеров, а затем могут быть добавлены один или более селективных агентов для остальных генов селективных маркеров. В другом варианте осуществления изобретения, клетки-хозяева культивируют в первой селективной среде, содержащей только селективный(е) агент(ы) для одного векторного гена или субсерии векторных генов используемых селективных маркеров, а затем эти клетки культивируют во второй селективной среде, содержащей один или более селективных агентов для остальных генов селективных маркеров. В соответствии с одним из вариантов осуществления изобретения, вторая селективная среда не содержит селективного(ых) агента(ов), используемого(ых) в первой селективной среде.

В соответствии с одним из вариантов осуществления изобретения, эукариотические клетки, полученные в стадии (a), содержат гетерологичный полинуклеотид, кодирующий дигидрофолатредуктазу (DHFR), используемую в качестве селективного маркера, а стадия (b) включает проведение отбора на DHFR. В соответствующей стадии отбора обычно используют селективную среду, содержащую ингибитор DHFR. Некоторые подходящие ферменты DHFR и, соответственно, гены DHFR известны специалистам и могут быть использованы в качестве селективного маркера. Термин «DHFR» означает: DHFR дикого типа, а также ферменты DHFR, имеющие одну или более модификаций в аминокислотной последовательности (например, делеций, замен или добавлений) по сравнению с аминокислотной последовательностью соответствующего фермента DHFR дикого типа; гибридные белки, содержащие фермент DHFR и ферменты DHFR, которые были модифицированы для сообщения им дополнительной структуры и/или функции, а также функциональные фрагменты вышеуказанных ферментов, которые обладают по меньшей мере одной из функций фермента DHFR. Такие варианты хорошо известны специалистам, а поэтому нет необходимости в их подробном описании. Так, например, фермент DHFR может быть использован в качестве селективного маркера, который является более или менее чувствительным к антифолатам, таким как MTX, по сравнению с ферментом DHFR дикого типа и/или ферментом DHFR, эндогенно экспрессируемым клеткой-хозяином, если указанная клетка экспрессирует такой фермент. Соответствующие ферменты DHFR хорошо известны специалистам и описаны, например, в EP 0246049 и в других документах. Фермент DHFR может происходить из любых источников, при условии, что он является функциональным при его использовании в настоящем изобретении, то есть совместимым с используемой клеткой-хозяином млекопитающего. Так, например, мутантный мышиный DHFR, обладающий значительной резистентностью к MTX, широко используется в качестве доминантно-селективного маркера в эукариотических клетках. Фермент DHFR может быть использован в качестве селективного маркера, который является менее восприимчивым к ингибитору DHFR, такому как MTX, чем фермент DHFR, эндогенно экспрессируемый в DHFR+ (плюс)-клетке-хозяине, то есть, в клетке-хозяине, которая содержит функциональный эндогенный ген DHFR. В соответствии с одним из вариантов осуществления изобретения, интрон или его фрагмент расположены у 3'-конца открытой рамки считывания гена DHFR. Интрон, используемый в DHFR-экспрессирующем кластере, находится перед менее крупным нефункциональным вариантом гена DHFR (Grillari et al., 2001, J. Biotechnol. 87, 59-65). Таким образом, уровень экспрессии гена DHFR снижается, что приводит к дополнительному повышению жесткости отбора. Альтернативные методы использования интрона для снижения уровня экспрессии гена DHFR описаны в EP0724639 и могут быть также применены в настоящем изобретении.

Термин «ингибитор DHFR», в частности, означает соединение, которое ингибирует активность дигидрофолатредуктазы (DHFR). Соответствующий ингибитор может, например, конкурировать с субстратом DHFR за связывание с DHFR. Подходящими ингибиторами DHFR являются, например, антифолаты, такие как метотраксат (MTX). Таким образом, в соответствии с одним из вариантов осуществления изобретения, стадия (b) включает проведение стадии отбора на DHFR путем культивирования множества указанных клеток-хозяев в селективной культуральной среде, содержащей по меньшей мере один ингибитор DHFR, такой как, предпочтительно, антифолат. Соответствующие условия отбора известны специалистам. В соответствии с одним из вариантов осуществления изобретения, в стадии (b) используется селективная культуральная среда, содержащая антифолат в концентрации 1500 нМ или менее, 1250 нМ или менее, 1000 нМ или менее, 750 нМ или менее, 500 нМ или менее, 250 нМ или менее, 200 нМ или менее, 150 нМ или менее, 125 нМ или менее, 100 нМ или менее или 75 нМ или менее. Жесткость условий отбора может быть определена с использованием концентрации указанного ингибитора в селективной культуральной среде (где указанная концентрация может также постепенно повышаться). Предпочтительные интервалы значений концентраций антифолата могут быть выбраны из 500 нМ - 0,1 нМ, 350 нМ - 1 нМ, 200 нМ - 2,5 нМ, 150 нМ - 5 нМ, 100 нМ - 7,5 нМ и 75 нМ - 10 нМ. В соответствии с одним из вариантов осуществления изобретения, селективная культуральная среда содержит MTX в качестве антифолата. Для проведения DHFR-отбора, а в частности, если такой отбор осуществляют в комбинации с лимитирующей концентрацией фолата, то при использовании описанных здесь новых эукариотических клеток, MTX может быть взят в низких концентрациях.

В соответствии с одним из вариантов осуществления изобретения, клетки-хозяева согласно изобретению, используемые в стадии (a), содержат гетерологичный полинуклеотид, кодирующий переносчик фолата, в качестве селективного маркера. Система отбора на основе переносчика фолата, если она используется в комбинации с эукариотическими клетками, действие которых зависит от поглощения фолата, такими как клетки млекопитающих, имеет ряд преимуществ. Переносчик фолата позволяет переносить по меньшей мере один фолат из культуральной среды в клетку-хозяина, которая, предпочтительно, является клеткой млекопитающего. В соответствии с одним из вариантов осуществления изобретения, переносчик фолата представляет собой или содержит восстановленный носитель фолата (RFC). RFC представляет собой повсеместно экспрессируемый мембранный гликопротеин, который служит в качестве основного переносчика восстановленных фолатов, таких как 5-метил-THF и 5-формил-THF, в клетку. Однако, RFC обладает очень слабой активностью по отношению к окисленному фолату, то есть к фолиевой кислоте. Следовательно, клетки, которые не экспрессируют RFC, или из которых был удален геномный локус RFC, могут служить в качестве реципиентов для трансфекции селективного маркерного гена RFC в условиях, при которых восстановленные фолаты, такие как 5-формил-THF, будут постепенно удаляться из культуральной среды, что позволяет идентифицировать клетки, экспрессирующие повышенные уровни этого переносчика фолата и, соответственно, представляющего интерес продукта. Подходящие условия отбора, в которых используется RFC в качестве селективного маркера, известны специалистам и описаны, например, в WO2006/059323.

В соответствии с одним из вариантов осуществления изобретения, который также подробно описан ниже и в разделе «Примеры», переносчиком фолата, используемым в качестве селективного маркера, является фолатный рецептор. Система отбора на основе фолатного рецептора имеет ряд преимуществ. Так, например, в этом случае, для отбора необязательно использовать токсические вещества (даже если они могут быть использованы), и кроме того, эндогенный фолатный рецептор клетки-хозяина необязательно должен быть ингибирован. Кроме того, такая система экспрессии особенно хорошо функционирует в комбинации с описанной здесь новыми клетками, которыми, предпочтительно, являются клетки млекопитающего.

Используемый здесь термин «фолатный рецептор» означает фолатный рецептор, который является функциональным, а поэтому обладает способностью переносить фолат или его производное в эукариотическую клетку или способствовать поглощению такого фолата или его производного эукариотической клеткой. Предпочтительно, указанный рецептор обладает способностью осуществлять однонаправленный перенос фолата или его производного в эукариотическую клетку или однонаправленное поглощение такого фолата или его производного эукариотической клеткой. Кроме того, используемый здесь фолатный рецептор является мембраносвязанным. Таким образом, описанные здесь фолатные рецепторы представляют собой функциональные мембраносвязанные фолатные рецепторы. Заякоривание на мембране может быть достигнуто, например, посредством трансмембранного якоря или GPI-якоря. GPI-якорь является предпочтительным, поскольку он соответствует природной структуре мембраносвязанного фолатного рецептора. Фолатные рецепторы (FR) представляют собой высокоаффинные фолат-связывающие гликопротеины. Эти рецепторы кодируются тремя отдельными генами, FR альфа, FR бета и FR гамма. FR альфа и FR бета представляют собой гликопротеины клеточной поверхности, заякоренные на гликозилфосфотидилинозите (GPI), а FR-гамма не содержит GPI-якоря и представляет собой секретированный белок. Однако, этот рецептор может быть генетически модифицирован так, чтобы он включал трансмембранный якорь или GPI-якорь. Такая модифицированная форма FR-гамма, которая включает мембранный якорь, также рассматривается как мембраносвязанный фолатный рецептор, если он обладает способностью осуществлять перенос фолата или его производного в эукариотическую клетку или поглощение такого фолата или его производного эукариотической клеткой. Термин «фолатный рецептор» также включает мембраносвязанные мутанты фолатных рецепторов дикого типа, способных поглощать фолат, и гибридные белки, содержащие соответствующий фолатный рецептор.

Используемый здесь фолатный рецептор может происходить от фолатного рецептора любого вида, при условии, что он явлется функциональным при его использовании в настоящем изобретении, то есть, совместимым с используемой клеткой-хозяином, и при экспрессии этого рецептора в трансформированной клетке-хозяине, он переносит фолат, а в частности, фолиевую кислоту из культуральной среды в клетку-хозяина, действие которой зависит от поглощения фолата. Вообще говоря, фолатный рецептор, который вводится в клетку-хозяина в качестве селективного маркера, может быть гомологичным или гетерологичным по отношению к эндогенному фолатному рецептору клетки-хозяина (если в ней присутствует эндогенный фолатный рецептор, что предпочтительно). Если этот рецептор является гомологичным, то он может происходить от клетки того же самого вида, к которому принадлежит клетка-хозяин, а предпочтительно, клетка-хозяин млекопитающего. Если этот рецептор является гетерологичным, то он может происходить от клетки другого вида. Так, например, человеческий фолатный рецептор может быть использован в качестве селективного маркера для клетки-хозяина грызунов, например, клетки хомячка, такой как клетка CHO. Предпочтительно использовать фолатный рецептор, происходящий от млекопитающего, например, от грызуна, такого как мышь, крыса или хомячок, или более предпочтительно, от человека. Мембраносвязанный фолатный рецептор, используемый в качестве селективного маркера, может быть выбран из группы, состоящей из фолатного рецептора альфа, фолатного рецептора бета и фолатного рецептора гамма. В соответствии с одним из вариантов осуществления изобретения, в качестве селективного маркера используют человеческий фолатный рецептор альфа.

Мембраносвязанный фолатный рецептор, используемый в качестве переносчика фолата, является предпочтительным, поскольку в этом случае могут быть использованы клетки, которые эндогенно экспрессируют свои собственные фолатные рецепторы, и в которых происходит процессинг фолиевой кислоты посредством фолатного рецептора. Подходящие мембраносвязанные фолатные рецепторы, которые могут быть использованы в качестве селективных маркеров для эукариотических клеток, действие которых зависит от поглощения фолата, таких как клетки млекопитающих, и подходящие условия отбора также описаны в заявке WO 2009/080759, которая вводится в настоящее описание посредством ссылки. В соответствии с одним из вариантов осуществления изобретения, используемый зрелый человеческий фолатный рецептор альфа дикого типа содержит нижеследующую аминокислотную последовательность, представленную в SEQ ID NO: 20 (однобуквенный код, в направлении от N-конца до C-конца).

Фолатный рецептор альфа обычно заякорен на клеточной мембране посредством GPI-якоря. Сигнальная последовательность GPI-якоря не представлена в SEQ ID NO: 20. В соответствии с одним из вариантов осуществления изобретения, фолатный рецептор альфа, который происходит от SEQ ID NO: 20 или содержит SEQ ID NO: 20, включает GPI-заякоривающий сигнал у С-конца. При этом может быть использован любой подходящий GPI-заякоривающий сигнал. Природная сигнальная последовательность GPI-якоря человеческого фолатного рецептора альфа представлена в SEQ ID NO: 21 (однобуквенный код, в направлении от N-конца до C-конца).

Альтернативно, заякоривание на мембране может быть достигнуто с использованием мембранного якоря, например, трансмембранного якоря. В этом варианте осуществления изобретения, фолатный рецептор содержит мембранный якорь у С-конца. Подходящие якори известны специалистам. Фолатный рецептор альфа, который происходит от SEQ ID NO: 20 или содержит SEQ ID NO: 20, может иметь лидерную последовательность у N-конца. При этом может быть использована любая подходящая лидерная последовательность, которая будет обеспечивать функциональную экспрессию фолатного рецептора.

Полноразмерная аминокислотная последовательность, включающая природную лидерную последовательность (у N-конца) и природную сигнальную последовательность GPI-якоря (у С-конца) человеческого фолатного рецептора альфа дикого типа представлена в SEQ ID NO: 22 (однобуквенный код, в направлении от N-конца до C-конца).

В соответствии с одним из вариантов осуществления изобретения, мембраносвязанный фолатный рецептор имеет или содержит аминокислотную последовательность SEQ ID NO: 20 или 22 или функциональный вариант вышеуказанной последовательности, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 98% или по меньшей мере на 99% гомологична или идентична последовательности SEQ ID NO: 20 или 22, является мембраносвязанной и способна обеспечивать поглощение фолиевой кислоты клеткой.

При использовании эукариотической клетки, функция которой зависит от поглощения фолата, например, клетки-хозяина млекопитающего, содержащей гетерологичный полинуклеотид, кодирующий переносчик фолата, а предпочтительно, фолатный рецептор, стадия (b) включает проведение стадии отбора, где множество указанных клеток-хозяев культивируют в селективной культуральной среде, содержащей фолат в лимитирующей концентрации. Используемый здесь термин «лимитирующая концентрация фолата», в частности, означает концентрацию фолата(ов) в селективной культуральной среде, которая обеспечивает давление отбора на клетку-хозяина. В таких условиях отбора, расти и пролиферовать могут только те клетки-хозяева, в которые был включен экспрессионный вектор, и которые, тем самым, экспрессируют переносчик фолата в качестве селективного маркера. В соответствии с этим, фолаты не содержатся в избытке в селективной культуральной среде, и такое ограниченное количество фолата(ов) в культуральной среде обеспечивает давление отбора на клетки-хозяева. Фолат, содержащийся в селективной культуральной среде в лимитирующей концентрации, способен поглощаться клеткой-хозяином и процессироваться в этой клетке, а в частности, в клетках-хозяевах, которые имеют переносчик фолата, используемый в качестве селективного маркера. Фолаты, а в частности, производные фолата, которые не процессируются или не могут процессироваться в клетке-хозяине, не вносят свой вклад в давление отбора, что усложняет отбор клеток-хозяев, в которые был включен переносчик фолата в качестве селективного маркера, а поэтому, в этих клетках не обеспечивается лимитирующая концентрация фолата. Однако при этом могут присутствовать соответствующие фолаты, такие как, например, антифолаты, и их присутствие даже является предпочтительным в том случае, если осуществляют отбор в комбинации с DHFR как описано ниже. Фолат, присутствующий с селективной культуральной среде в лимитирующей концентрации, может представлять собой, например, окисленный фолат или восстановленный фолат или его производное. Окисленные фолаты, такие как фолиевая кислота, а также восстановленные производные фолиевой кислоты, известные как восстановленные фолаты или тетрагидрофолаты (THF), принадлежат к группе витаминов B-9, которые представляют собой основные кофакторы и/или коферменты, участвующие в биосинтезе пуринов, тимидилата и некоторых аминокислот в эукариотических клетках, функция которых зависит от поглощения фолата, таких как клетки млекопитающих. Кофакторы THF являются особенно подходящими для репликации ДНК и следовательно, для пролиферации клеток. Предпочтительным фолатом, который содержится в селективной культуральной среде в лимитирующей концентрации, является фолиевая кислота. Подходящие интервалы концентраций, обеспечивающие лимитирующую концентрацию фолата, приводятся ниже.

Система отбора с использованием переносчика фолата основана на ограниченной доступности фолата, а предпочтительно, фолиевой кислоты в среде для культивирования клеток. Клетки-хозяева, в которые не был(и) успешно встроен(ы) экспрессионный(е) вектор(ы), и которые, тем самым, не экспрессировали переносчик фолата, а предпочтительно, фолатный рецептор, в достаточном количестве, погибали или плохо размножались в селективных условиях культивирования, по сравнению с клетками-хозяевами, в которые был(и) успешно встроен(ы) экспрессионный(е) вектор(ы). Как показано в примерах, отбор на основе фолатного рецептора, осуществляемый на описанных здесь новых эукариотических клетках, позволяет ускорить проведение такого отбора и скрининга, а также получения эукариотических клеточных клонов, сверхэкспрессирующих высокие уровни представляющих интерес рекомбинантных продуктов, таких как полипептиды.

Селективная культуральная среда, используемая в стадии (b), и соответственно, в субстадии стадии (b), для отбора посредством фолатного рецептора, используемого в качестве селективного маркера, может включать фолат, а в частности, фолиевую кислоту в концентрации, выбранной из:

(a) приблизительно 5000 нМ - 0,1 нМ;

(b) приблизительно 2500 нМ - 0,1 нМ;

(c) приблизительно 1500 нМ - 0,1 нМ;

(d) приблизительно 1000 нМ - 0,1 нМ;

(e) приблизительно 750 нМ - 0,1 нМ;

(f) приблизительно 500 нМ - 0,1 нМ;

(g) приблизительно 250 нМ - 0,2 нМ; предпочтительно, приблизительно 250 нМ - 1 нМ или приблизительно 250 нМ - 2,5 нМ;

(h) приблизительно 150 нМ - 0,3 нМ; предпочтительно, приблизительно 150 нМ - 1 нМ или приблизительно 150 нМ - 2,5 нМ;

(i) приблизительно 100 нМ - 0,5 нМ; предпочтительно, приблизительно 100 нМ - 1 нМ или приблизительно 100 нМ - 2,5 нМ;

(j) приблизительно 75 нМ - 0,6 нМ, предпочтительно, приблизительно 75 нМ - 1 нМ или приблизительно 75 нМ - 2,5нМ;

(k) приблизительно 50 нМ - 1 нМ; предпочтительно, приблизительно 50 нМ - 2,5 нМ или приблизительно 50нМ - 5нМ;

(l) приблизительно 35 нМ - 0,75 нМ; и

(m) приблизительно 25 нМ - 1 нМ или приблизительно 25 нМ - 2,5 нМ, приблизительно 20 нМ - 3 нМ, приблизительно 15 нМ - 4 нМ или 10 нМ - 5 нМ.

Концентрации и интервалы концентраций, описанные выше, являются особенно подходящими для быстрого роста суспензионной культуры клеток млекопитающих, таких как клетки CHO, которые представляют собой предпочтительный вариант для промышленного продуцирования клеточных линий. Однако, различные клеточные линии могут обладать различными свойствами поглощения фолиевой кислоты. Тем не менее, подходящие концентрации могут быть легко определены экспериментально самим специалистом. Фолатом, содержащимся в селективной культуральной среде, предпочтительно, является фолиевая кислота, и в соответствии с одним из вариантов осуществления изобретения, фолиевой кислотой является только тот фолат, который содержится в селективной культуральной среде в лимитирующей концентрации.

В соответствии с одним из вариантов осуществления изобретения, клетки-хозяева, полученные в стадии (a), содержат гетерологичный полинуклеотид, кодирующий переносчик фолата в качестве первого селективного маркера, и гетерологичный полинуклеотид, кодирующий второй селективный маркер, который процессирует субстрат с образованием фолата, производного фолата и/или продукта, который может быть получен путем процессинга фолата. Так, например, вторым селективным маркером может быть дигидрофолатредуктаза (DHFR) или фермент, действующий после DHFR или в комбинации с DHFR, такой как тимидилатсинтаза (TS) и серингидроксиметилтрансфераза (SHMT). Предпочтительно, мембраносвязанный фолатный рецептор используется в качестве первого селективного маркера, а вторым селективным маркером является дигидрофолатредуктаза (DHFR). В соответствии с этим вариантом осуществления изобретения, стадия (b) включает культивирование клеток-хозяев в селективной культуральной среде, содержащей фолат, а предпочтительно, фолиевую кислоту в лимитирующей концентрации, и по меньшей мере один ингибитор DHFR, такой как, например, MTX. Как показано в примерах, в результате использования описанных здесь новых эукариотических клеточных линий, число высокопродуктивных клеток со стабильной экспрессией в пуле значительно возрастает, что упрощает получение подходящих клеточных клонов для крупномасштабного продуцирования из указанного клеточного пула. При этом понадобится меньшее количество клеточных клонов, что снизит затраты на скрининг. Подходящие варианта фолатного рецептора и DHFR, а также подходящие условия отбора и концентрации описаны выше в разделе, относящемся к этим вариантам. Указанные концентрации и варианты концентраций фолата и антифолата, описанных выше, могут быть представлены в комбинации. В одном из вариантов осуществления изобретения, концентрация фолата, ссотавляющая приблизительно 0,1 нМ - 150 нМ, 1 нМ - 125 нМ, 5 нМ - 100 нМ или 7,5 нМ - 75 нМ, указана вместе с концентрацией антифолата, составляющей 0,1 нМ - 150 нМ, 1 нМ - 12 5нМ, 2,5 нМ - 100 нМ, 5 нМ - 75 нМ или 7,5 нМ - 5,0 нМ в селективной культуральной среде. Как описано выше, фолиевая кислота, предпочтительно, используется в качестве фолата, а MTX используется в качестве антифолата.

Использование соответствующей комбинации фолатного рецептора и DHFR в качестве селективного маркера в стадии (b), то есть, условий отбора с использованием обоих маркеров одновременно в соответствующей селективной культуральной среде, позволяет создать очень жесткую систему отбора, обеспечивающую эффективное обогащение популяции трансфецированных клеток-хозяев высокопродуктивными клетками. Жизнеспособность клеток-хозяев значительно повышается в селективных условиях в том случае, если оба селективных маркера экспрессировались на высоком уровне. Таким образом, эукариотические клетки, функция которых зависит от поглощения фолата, такие как клетки млекопитающих, могут быть отобраны по увеличению уровня экспрессии представляющего интерес продукта. Такая концепция применения фолатного рецептора в качестве селективного маркера в комбинации с дополнительным селективным маркером, участвующим в метаболизме фолата, таким как, предпочтительно, DHFR, описана в заявке WO 2010/097240, которая вводится в настоящее описание посредством ссылки. Как показано в примерах, высокая жесткость системы отбора согласно этому варианту осуществления изобретения, может быть, предпочтительно, применена вместе с использованием описанных здесь новых клеток, а в частности, клеток млекопитающих. С применением такой комбинации можно снизить число слабых продуцентов и получить более гомогенную популяцию высокопродуктивных клеток после отбора. Этот способ inter alia упрощает клонирование высокопродуктивных клеток из одной клетки. Кроме того, с использованием такой комбинации можно значительно снизить концентрацию MTX, необходимую для DHFR-отбора.

В соответствии с одним из вариантов осуществления изобретения, стадию (b) осуществляют в два или более раундов отбора, где эти два или более раундов отбора основаны на одном и том же приниципе или на различных принципах отбора. Так, например, если помимо фолатного рецептора и/или DHFR используют дополнительный селективный маркер, то сначала может быть проведен отбор в условиях, подходящих для этого дополнительного селективного маркера (например, на этапе предварительного отбора), либо такой отбор может быть проведен одновременно с отбором в условиях, подходящих для фолатного рецептора и/или DHFR. Так, например, в случае использования гена неомицин-фосфотрансферазы (neo) в качестве дополнительного селективного маркера, в стадии (b) может быть сначала проведено культивирование клеток в среде, содержащей, например, G418, для отбора клеток, в которые был введен экспрессионный вектор или комбинация по меньшей мере двух экспрессионных векторов, а затем может быть осуществлена стадия отбора на селективной культуральной среде, содержащей лимитирующую концентрацию фолата и ингибитора второго селективного маркера, такого как, например, MTX, в случае, если в качестве второго селективного маркера используется DHFR.

В соответствии с одним из вариантов осуществления изобретения, в стадии (b) осуществляют отбор на основе проточной цитометрии. Стадия отбора на основе проточной цитометрии, а в частности, на основе клеточного сортинга с активацией флуоресценции (FACS), имеет преимущество, заключающееся в том, что большое число клеток может быть подвергнуто быстрому скринингу на нужный выход продукта экспрессии.

В соответствии с одним из вариантов осуществления изобретения, указанный отбор на основе проточной цитометрии осуществляют одновременно с проведением, а предпочтительно, после проведения одной или более стадий отбора с использованием одного или более селективных маркерных генов. Таким образом, клеточные клоны с высоким уровнем экспрессии могут быть идентифицированы в популяции успешно трансфецированных клеток и отделены от этих клеток.

В соответствии с одним из вариантов осуществления изобретения, клетки с высоким уровнем экспрессии идентифицируют путем детектирования экспрессии коэкспрессированного репортерного полипептида, такого как, например, белок, флуоресцирующий в зеленом диапазоне спектра (GFP), CFP, YFP, люцифераза или другой широко распространенный репортерный полипептид, который может быть детектирован с помощью проточной цитометрии. В соответствии с этим вариантом осуществления изобретения, стадия (a) включает получение множества клеток-хозяев, содержащих по меньшей мере один гетерологичный полинуклеотид, кодирующий репортер, а стадия (b) включает идентификацию клеток-хозяев, экспрессирующих репортер, исходя по меньшей мере из одного свойства указанного репортерного полипептида, с помощью проточной цитометрии. При таком отборе с использованием репортера, экспрессия гена-репортера коррелирует с экспрессией представляющего интерес продукта. Репортерный полипептид может присутствовать внутри клетки, что является показателем экспрессии этого полипептида в указанной клетке. В соответствии с одним из вариантов осуществления изобретения, экспрессия репортерного полипептида тесно ассоциирована с экспрессией представляющего интерес продукта, которым является полипептид. Так, например, репортерный полипептид и представляющий интерес полипептид могут экспрессироваться как отдельные полипептиды, происходящие от одного экспрессионного кластера, однако, эти полипептиды разделены элементом IRES (внутренним сайтом связывания с рибосомой). Кроме того, репортерный полипептид и представляющий интерес полипептид могут экспрессироваться как гибридный белок. В соответствии с одним из вариантов осуществления изобретения, в кластере, экспрессирующем представляющий интерес полипептид, полинуклеотид, кодирующий представляющий интерес полипептид, разделен по меньшей мере одним стоп-кодоном, происходящим от полинуклеотида, кодирующего репортер. Гибридный белок, содержащий репортерный полипептид, экспрессируется только в том случае, если трансляция прочитывается по всему стоп-кодону. Поскольку считывание стоп-кодона происходит лишь до определенной степени, что может быть обусловлено числом и конструкцией стоп-кодона и условиями культивирования, то некоторая часть представляющего интерес полипептида продуцируется как гибридный белок, содержащий репортерный полипептид, который может быть детектирован с помощью проточной цитометрии. Применение соответствующей стратегии позволяет установить взаимосвязь между экспрессией репортерного полипептида и экспрессией представляющего интерес полипептида. Принцип получения гибридных белков посредством считывания стоп-кодона будет также объяснен ниже в варианте, в котором гибридный белок (необязательно содержащий репортер) представлен на клеточной поверхности и, например, окрашен детектирующим соединением. Для экспрессии представляющего интерес секретируемого полипептида, полипептид, кодирующий мембранный якорь, может быть также встроен между стоп-кодоном и полинуклеотидом, кодирующим репортер, или ниже полинуклеотида, кодирующего репортер. Наличие мембранного якоря будет гарантировать сохранение ассоциации репортерного полипептида с экспрессирующей клеткой. Таким образом, репортерный полипептид, содержащийся в гибридном белке, сообщает экспрессирующим клеткам селективный признак, который может быть определен с помощью проточной цитометрии. Представляющий интерес полипептид экспрессируется в культуральной среде. Например, чем выше флуоресценция репортерного полипептида, тем больше количество продуцируемого гибридного белка и, соответственно, выше уровень экспрессии представляющего интерес полипептида. Соответствующий метод описан, например, в заявке WO 03/014361, которая вводится посредством ссылки.

В соответствии с одним из вариантов осуществления изобретения, стадия (b) включает:

(i) проведение по меньшей мере одного раунда отбора в условиях отбора для одного или более селективных маркеров, экспрессируемых трансфецированными клетками-хозяевами; и

(ii) проведение отбора на основе проточной цитометрии.

Одна или более дополнительных стадий отбора могут быть осуществлены, но необязательно, до или после проведения стадии (i) и/или стадии (ii).

В соответствии с одним из вариантов осуществления изобретения, отбор на основе проточной цитометрии включает отбор множества клеток-хозяев, экспрессирующих представляющий интерес полипептид с желаемым выходом, исходя из присутствия или количества представляющего интерес полипептида. Предпочтительно, представляющим интерес полипептидом является секретируемый полипептид. В соответствии с одним из вариантов осуществления изобретения, представляющий интерес полипептид детектируют на клеточной поверхности с использованием детектирующего соединения, которое связывается с представляющим интерес полипептидом. В соответствии с одним из вариантов осуществления изобретения, представляющий интерес секретируемый полипептид детектируют по его прохождению через клеточную мембрану и, соответственно, по транзиентной ассоциации с плазматической мембраной в процессе секреции полипептида. Соответствующая система отбора на основе проточной цитометрии описана, например, в заявке WO03/099996, которая вводится посредством ссылки.

В соответствии с одним из вариантов осуществления изобретения, часть представляющего интерес экспрессируемого полипептида присоединена к мембранному якорю и, таким образом, экспрессируется как мембраносвязанный гибридный полипептид. Таким образом, часть полипептида представлена на клеточной поверхности как гибридный полипептид и может быть окрашена детектирующим соединением. Для проведения отбора такого типа не требуется репортерного полипептида, хотя он все же может быть использован. Представляющий интерес полипептид жестко заякорен на экспрессирующей клетке благодаря присутствию мембранного якоря. Поскольку количество продуцируемого гибридного полипептида коррелирует с общим уровнем экспрессии в клетке, то клетки-хозяева могут быть отобраны с помощью проточной цитометрии исходя из количества гибридного полипептида, представленного на клеточной поверхности посредством мембранного якоря. Это ускоряет отбор высокопродуктивных клеток-хозяев. Для эффективного отбора с помощью проточной цитометрии, а предпочтительно, FACS, в целях экспрессии представляющего интерес полипептида преимущественно используются специально сконструированные экспрессионные кластеры. Таким образом, в соответствии с одним из вариантов осуществления изобретения, полинуклеотид, кодирующий представляющий интерес полипептид, содержится в экспрессионном кластере, который был сконструирован так, чтобы часть экспрессируемого представляющего интерес полипептида включала мембранный якорь. Представляющий интерес полипептид, присоединенный к мембранному якорю, также называется гибридным полипептидом или гибридным белком. Для достижения нужного результата существует несколько вариантов.

В соответствии с одним из вариантов осуществления изобретения, клетки-хозяева, полученные в стадии (a), содержат:

(i) гетерологичный экспрессионный кластер, включающий:

aa) полинуклеотид, кодирующий представляющий интерес полипептид;

bb) по меньшей мере один стоп-кодон, расположенный ниже полинуклеотида, кодирующего представляющий интерес полипептид, и

cc) дополнительный полинуклеотид, расположенный ниже стоп-кодона, кодирующего мембранный якорь и/или сигнал для мембранного якоря; и

(ii) по меньшей мере один гетерологичный экспрессионный кластер, включающий полинуклеотид, кодирующий селективный маркер;

а отбор, проводимый в стадии (b), включает:

(i) культивирование указанных клеток-хозяев в условиях отбора по меньшей мере для одного селективного маркера и экспрессию представляющего интерес полипептида, где по меньшей мере часть представляющего интерес полипептида экспрессируется как гибридный полипептид, содержащий мембранный якорь, и где указанный гибридный полипептид представлен на поверхности указанной клетки-хозяина;

(ii) проведение отбора на основе проточной цитометрии, включающего отбор множества клеток-хозяев, экспрессирующих представляющий интерес полипептид с нужным выходом, исходя из присутствия или количества гибридного полипептида, представленного на клеточной поверхности, с помощью проточной цитометрии.

Транскрипция полинуклеотида, кодирующего представляющий интерес полипептид, содержащийся в вышеописанном экспрессионном кластере, приводит к образованию транскрипта, содержащего, в следующем порядке, по меньшей мере:

aa) полинуклеотид, где трансляция указанного полинуклеотида приводит к образованию представляющего интерес полипептида;

bb) по меньшей мере один стоп-кодон, расположенный ниже указанного полинуклеотида;

cc) полинуклеотид, расположенный ниже указанного стоп-кодона, кодирующего мембранный якорь и/или сигнал для мембранного якоря.

По меньшей мере часть транскрипта транслируется в гибридный полипептид, содержащий представляющий интерес полипептид и мембранный якорь, посредством трансляционного считывания по меньшей мере одного стоп-кодона. Действие такой конструкции экспрессионного кластера, используемого в этом варианте осуществления изобретения, заключается в том, что благодаря трансляционному считыванию («ликового» стоп-кодона), определенная часть представляющего интерес полипептида продуцируется как гибридный полипептид, содержащий мембранный якорь. Таким образом, по меньшей мере часть транскрипта транслируется в гибридный полипептид, содержащий представляющий интерес полипептид и мембранный якорь, посредством трансляционного считываания по меньшей мере одного стоп-кодона. Трансляционное считывание может происходить естественым путем благодаря выбору стоп-кодона/модели сигнала терминации трансляции или может быть индуцировано путем адаптации условий культивирования, например, с использованием агента-супрессора терминации. Считывание на таком уровне приводит к получению гибридных полипептидов в определенном соотношении. Эти гибридные полипептиды включают мембранный якорь, который жестко заякоривает гибридные полипептиды на клеточной поверхности. В результате, гибридный полипептид может быть представлен на клеточной поверхности, и клетки, содержащие высокие уровни гибридного полипептида, заякоренного на мембране, могут быть отобраны с помощью проточной цитометрии, а предпочтительно, FACS. Таким образом, могут быть отобраны клетки-хозяева, экспрессирующие представляющий интерес полипептид с высоким выходом. Подробное описание и предпочтительные варианты технологии на основе считывания стоп-кодона приводятся в заявках WO2005/073375 и WO 2010/022961, которые во всей своей полноте вводятся в настоящее описание посредством ссылки.

В соответствии с одним из вариантов осуществления изобретения, экспрессионный кластер дополнительно включает (iv) полинуклеотид, кодирующий репортерный полипептид, такой как, например, GFP. Указанный полинуклеотид, кодирующий репортеный полипептид, расположен ниже стоп-кодона. После считывания стоп-кодона гибридного полипептида, содержащего репортер, проводят отбор с помощью проточной цитометрии исходя из свойств репортерного полипептида, например, по его флуоресценции. Подробное описание указанного варианта уже приводится выше и вводится далее посредством ссылки. Предпочтительно, полинуклеотид, кодирующий репортеный полипептид, расположен ниже полинуклеотида, кодирующего мембранный якорь.

В соответствии с альтернативным вариантом осуществления изобретения, часть представляющего интерес полипептида экспрессируют в виде гибридного полипептида, представленного на клеточной поверхности, с применением технологий, описанных в WO2007/131774. В настоящем описании, по меньшей мере две различных зрелых мРНК (мРНК-представляющего интерес полипептида и мРНК-представляющего интерес полипептида-якоря) получают из экспрессионного кластера, кодирующего представляющий интерес полипептид, посредством транскрипции и процессинга транскрипта. Трансляция мРНК-представляющего интерес полипептида приводит к получению представляющего интерес полипептида. Трансляция мРНК-представляющего интерес полипептида-якоря приводит к получению гибридного полипептида, содержащего представляющий интерес полипептид и мембранный якорь. В результате, такой гибридный полипептид может быть снова представлен на клеточной поверхности, и клетки, содержащие высокие уровни гибридного полипептида, заякоренного на мембране, могут быть отобраны с помощью проточной цитометрии, а предпочтительно, FACS. Затем снова могут быть отобраны клетки-хозяева, имеющие высокий уровень экспрессии. В соответствии с одним из вариантов осуществления изобретения, экспрессионный кластер дополнительно включает полинуклеотид, кодирующий репортерный полипептид, такой как, например, GFP. Указанный полинуклеотид, кодирующий репортеный полипептид, расположен ниже интрона. Таким образом, может быть получен гибридный полипептид, содержащий репортерный полипептид, что позволяет проводить отбор с помощью проточной цитометрии исходя из свойств репортеного полипептида, например, по его флуоресценции. Предпочтительно, полинуклеотид, кодирующий репортеный полипептид, расположен ниже полинуклеотида, кодирующего мембранный якорь. Таким образом, репортер расположен внутри клетки-хозяина.

Описанные выше репрезентативные варианты показали, что часть представляющего интерес полипептида экспрессируется как гибридный полипептид, который представлен на поверхности клеток-хозяев, и что клетки, имеющие высокие уровни гибридных полипептидов, заякоренных на мембране (что является показателем высокого уровня секретируемого полипептида), могут быть отобраны, например, с помощью проточной цитометрии, а в частности, клеточного сортинга с активацией флуоресценции (FACS). В настоящей заявке описаны различные варианты. Так, например, если репортерный полипептид содержится в гибридном полипептиде, то клетки-хозяева с высоким уровнем экспрессии могут быть отобраны исходя из свойств репортерного полипептида, например, по его флуоресценции. Кроме того, могут быть использованы соответствующим образом меченные детектирующие соединения, краткое описание которых приводится ниже.

В соответствии с одним из вариантов осуществления изобретения, стадия (b) включает отбор множества эукариотических клеток-хозяев, экспрессирующих представляющий интерес полипептид с нужным выходом, исходя из присутствия или количества гибридного полипептида, представленного на клеточной поверхности, с помощью проточной цитометрии, где указанный способ включает контактирование клеток-хозяев с детектирующим соединением, связывающимся с гибридным полипептидом, представленным на клеточной поверхности, и отбор множества клеток-хозяев, экспрессирующих представляющий интерес полипептид с нужным выходом, исходя из присутствия или количества связанного детектирующего соединения с помощью проточной цитометрии. Таким образом, клетки могут контактировать соответствующим образом меченным детектирующим соединением, которое связывается с гибридным белком, например, с частью, соответствующей представляющему интерес полипептиду. Детектирующее соединение, используемое для связывания с гибридным полипептидом, может иметь по меньшей мере одно из нижеследующий свойств: указанное соединение может быть меченным, а в частности, флуоресцентно меченным, может представлять собой антиген, молекулу иммуноглобулина или его связывающий фрагмент, либо указанное соединение может представлять собой белок А, G-белок или белок L. Детектирующим соединением, используемым для связывания с гибридным полипептидом на клеточной поверхности, может быть, например, молекула иммуноглобулина или ее фрагмент, такие как антитело или фрагмент антитела, распознающий гибридный полипептид. При этом могут быть детектированы почти все доступные части гибридного полипептида, в результате чего такая часть, соответствующая представляющему интерес полипептиду, может секретироваться одновременно с гибридным полипептидом в растворимой форме. В целях проведения детектирования и отбора, указанное детектирующее соединение, используемое для связывания с гибридным полипептидом, может быть помечено. Меченное детектирующее соединение, которое связывается с гибридным полипептидом, представленным на клеточной поверхности, становится меткой, окрашивающей, соответственно, клеточную поверхность. Чем больше количество гибридного полипептида, экспрессируемого клеткой-хозяином, тем выше уровень связывания меченного детектирующего соединения и более интенсивным является окрашивание. Этот способ имеет определенное преимущество, заключающееся в том, что отбор клеток-хозяев на основе проточной цитометрии может быть легко осуществлен, поскольку в данном случае может быть определено не только присутствие, но также и количество связанного детектирующего соединения. Для отбора высокопродуктивных клеток-хозяев, эти клетки-хозяева могут быть взяты из популяции клеток-хозяев, которые были наиболее эффективно и, соответственно, интенсивно окрашены детектирующим соединением. Такая метка является подходящей для отбора на основе проточной цитометрии, а в частности, FACS-отбора. Флуоресцентная метка является предпочтительной, поскольку она может быть легко детектирована с помощью проточной цитометрии.

В соответствии с одним из вариантов осуществления изобретения, экспрессионный кластер конструируют так, чтобы было получено приблизительно ≤50%, ≤25%, ≤15%, ≤10%, ≤5%, ≤2,5%, ≤1,5%, ≤1% или менее, чем ≤0,5% гибридного полипептида. Остальная часть продуцируется в виде секретируемого полипептида в форме, не содержащей мембранного якоря.

Мембранный якорь может представлять собой мембранный якорь любого вида, при условии, что он будет обладать способностью заякоривать представляющий интерес полипептид на клеточной мембране и визуализировать гибридный полипептид на клеточной поверхности. Подходящие варианты осуществления изобретения включают, но не ограничиваются ими, GPI-якорь или трансмембранный якорь. Трансмембранный якорь является предпочтительным, поскольку он обеспечивает тесное связывание гибридного полипептида с клеточной поверхностью и позволяет избежать «слущивания» гибридного белка с поверхности клеток. Особенно предпочтительно, а в частности, в случае экспрессии антител в виде представляющего интерес полипептида, использовать трансмембранный якорь, связывающийся с иммуноглобулином. Другие мембранные якори и предпочтительные варианты трансмембранного якоря, связывающегося с иммуноглобулином, описаны в заявках WO2007/131774, WO2005/073375 и WO 2010/022961.

В соответствии с одним из вариантов осуществления изобретения, клетки-хозяева экспрессируют молекулу иммуноглобулина, такую как антитело, которое представляет собой представляющий интерес полипептид. Полинуклеотид, кодирующий тяжелую цепь молекулы иммуноглобулина, и полинуклеотид, кодирующий легкую цепь молекулы иммуноглобулина, могут присутствовать в одном и том же экспрессионном кластере или, предпочтительно, в отдельных экспрессионных кластерах, как описано выше в соответствии с первым аспектом изобретения. При использовании описанной выше конструкции экспрессионного кластера, где часть представляющего интерес полипептида продуцируется в виде заякоренного на мембране гибридного полипептида посредством трансляционного считывания или альтернативного сайленсинга, такая конструкция может быть применена для экспрессии тяжелой цепи антитела.

В соответствии с одним из вариантов осуществления изобретения, два или более раундов отбора на основе проточной цитометрии могут быть осуществлены в стадии (b) для отбора клеток-хозяев с высоким уровнем экспрессии и обогащения популяции этими клетками-хозяевами.

В одном из вариантов осуществления изобретения, клетки-хозяева, экспрессирующие представляющий интерес полипептид в большом количестве, на что указывает высокий уровень сигнала, подвергают сортингу на клеточном сортере с активацией флуоресценции (FACS). FACS-сортинг является предпочтительным, поскольку он позволяет осуществлять быстрый скрининг большого числа клеток-хозяев и идентификацию клеток, экспрессирующих представляющий интерес полипептид с высоким выходом, а также обогащение популяции этими клетками. Этот вариант является особенно подходящим в том случае, если клетки отбирают на основе экспрессии гибридного белка, описанного выше. Эти клетки, обнаруживающие самую высокую интенсивность флуоресценции, могут быть идентифицированы и выделены с помощью FACS. Была обнаружена позитивная и статистически значимая корреляция между флуоресценцией, определенной с помощью FACS, и количеством продуцируемого полипептида. Следовательно, FACS-сортинг может быть применен не только для качественного анализа клеток, экспрессирующих представляющий интерес полипептид, но фактически и для количественного анализа этих клеток-хозяев, экспрессирующих представляющий интерес полипептид на высоком уровне. Таким образом, наилучшие клетки-продуценты могут быть отобраны/обогащены в стадии (b).

В соответствии с одним из вариантов осуществления изобретения, клетки, экспрессирующие представляющий интерес полипептид с нужным выходом, например, выше определенного порогового значения и/или максимум 15%, максимум 10%, максимум 5% или максимум 2% клеток-хозяев, отбирают в виде пула. Так, например, несколько клеток с высоким уровнем экспрессии, например, по меньшей мере 10, по меньшей мере 20, по меньшей мере 30, по меньшей мере 50, по меньшей мере 100, по меньшей мере 200, по меньшей мере 300, по меньшей мере 500, по меньшей мере 1000 или по меньшей мере 5000 клеток с высоким уровнем экспрессии могут быть отобраны в стадии (b) и подвергнуты сортингу с получением клеточного пула. Этот клеточный пул, содержащий множество различных клеток с различным уровнем экспрессии, также называется клеточным пулом с высоким уровнем экспрессии. Указанный клеточный пул, содержащий различные отдельные клетки с различным уровнем экспрессии, может быть использован в целях получения отдельных клеточных клонов для крупномасштабного продуцирования представляющего интерес полипептида.

В соответствии с одним из вариантов осуществления изобретения, эукариотическими клетками, полученными в стадии (a), являются клетки млекопитающих, предпочтительно, клетки грызунов, а более предпочтительно, клетки хомячка, такие как клетки CHO. Подходящие и предпочтительные варианты описаны выше в соответствии с первым аспектом изобретения и вводятся в настоящее описание посредством ссылки. Как описано выше, в соответствии с одним из вариантов осуществления изобретения, в указанных клетках СНО отсутствует часть теломерной области хромосомы 8, где указанная отсутствующая часть содержит ген FAM60A. Альтернативные варианты осуществления изобретения также описаны выше. Эти клетки обладают особенно ценными свойствами, такими как повышенная продуктивность и стабильность. В соответствии с одним из вариантов осуществления изобретения, способ согласно второму аспекту изобретения включает стадию анализа на снижение или блокирование экспрессии гена FAM60A. Такой анализ может быть осуществлен после отбора, а в частности, после DHFR-отбора. Такой аналитический метод описан выше в первом аспекте изобретения, а также ниже вместе со способом согласно пятому аспекту изобретения и вводится в настоящее описание посредством ссылки.

Другие предпочтительные варианты осуществления изобретения, а в частности, варианты, относящиеся к эукариотическим клеткам согласно первому аспекту изобретения, и представляющие собой, предпочтительно, клетки млекопитающих, экспрессионный вектор или комбинацию экспрессионных векторов, подробно описаны выше. Эти варианты вводятся в настоящее описание посредством ссылки.

Клетки, полученные способом отбора согласно второму аспекту изобретения, могут быть выделены и культивированы в виже отдельных клеток. Однако, популяцию, обогащенную различными клетками-хозяевами, то есть, клеточный пул, можно также использовать в дальнейшем. Полученные клетки-хозяева могут быть также подвергнуты дополнительному качественному или количественному анализу, либо они могут быть использованы, например, при получении клональной клеточной линии для продуцирования белка. Клональная клеточная линия может быть выделена из выбранной клетки-хозяина, которая стабильно экспрессирует представляющий интерес продукт с высоким выходом.

Таким образом, в соответствии с одним из вариантов осуществления изобретения, отобранные клетки культивируют с получением клеточных клонов, а в частности, в форме клональных клеточных культур. Клональной клеточной культурой является клеточная культура, происходящая от одного единственного предшественника. В клональной клеточной культуре, все клетки являются клонами. Предпочтительно, все клетки в клеточной культуре имеют одинаковую или почти одинаковую генетическую информацию. В некоторых вариантах осуществления изобретения, для оценки продуктивности определяют количество или концентрацию представляющего интерес полипептида в клеточной культуре. Так, например, титр может быть определен путем анализа супернатанта культуры. В соответствии с одним из вариантов осуществления изобретения, после оценки продуктивности каждого отдельного клона осуществляют ранжирование титра для отбора самых высокопродуктивных клонов в качестве клонов-продуцентов. Кроме того, исследование на стабильность может быть осуществлено с использованием полученных клеточных клонов. Однако, как показано в примерах, описанные здесь новые клетки, взятые в качестве клеток-хозяев, используются после отбора рекомбинантных клеточных клонов, обладающих достаточно высокой стабильностью. Таким образом, в соответствующих клетках-хозяевах, потеря стабильности экспрессии наблюдается редко, но если она все же наблюдается, то она приводит лишь к менее резкому снижению продуктивности по сравнению с продуктивностью клеток, в которых была снижена или блокирована функциональная экспрессия гена FAM60A. Следовательно, анализы на стабильность могут быть проведены за более короткий период времени, либо они могут вообще не проводиться, что является важным преимуществом, поскольку это позволяет сократить время, необходимое для получения стабильно экспрессирующих клеточных клонов, которые могут быть использованы для крупномасштабного продуцирования представляющего интерес продукта.

C. Способ продуцирования представляющего интерес продукта

В соответствии со своим третьим аспектом, настоящее изобретение относится к способу продуцирования представляющего интерес рекомбинантного продукта, где указанный способ включает использование эукариотической клетки согласно первому аспекту изобретения в качестве клетки-хозяина для рекомбинантной экспрессии представляющего интерес продукта.

Как описано выше, полученные здесь новые эукариотические клетки являются особенно подходящими в качестве продуктивных клеток-хозяев для рекомбинантного продуцирования представляющего интерес продукта, такого как представляющий интерес полипептид. Подходящие и предпочтительные примеры указанных эукариотических клеток, в которых ингибируется функциия продукта экспрессии белка FAM60A, предпочтительно, посредством снижения или блокирования функциональной экспрессии гена FAM60A, а также подходящие и предпочтительные примеры представляющего интерес продукта более подробно описаны выше и вводятся в настоящее описание посредством ссылки. Как указывается выше, эукариотической клеткой, предпочтительно, является клетка позвоночного, а более предпочтительно, клетка млекопитающего. Особенно предпочтительным вариантом является вариант, в котором ингибируется функция FAM60A и продукты экспрессии гена C12orf35 посредством снижения или блокирования функциональной экспрессии гена C12orf35, поскольку было обнаружено, что в этом случае, выход продукта может быть значительно более высоким. путем ингибирования функции белка FAM60A, а также белка C12orf35 могут быть получены эукариотические клетки-хозяева, а предпочтительно, клетки-хозяева млекопитающих, обладающие улучшенными свойствами, такими как более длительная стабильность, а также выход продукта, а следовательно, имеющие ключевые признаки, играющие важную роль в крупномасштабном продуцировании представляющего интерес продукта, а в частности, представляющего интерес полипептида.

Эукариотическая клетка-хозяин, которой, предпочтительно, является клетка млекопитающего, содержит стабильно интегрированный в ее геном полинуклеотид, кодирующий представляющий интерес продукт. Введение указанного полинуклеотида может быть достигнуто путем стабильной трансфекции, описанной выше. Отбор успешно трансфецированных клеток может быть осуществлен способом согласно второму аспекту изобретения.

В соответствии с одним из вариантов осуществления изобретения, указанный способ включает:

(a) культивирование клеток-хозяев согласно первому аспекту изобретения в условиях, подходящих для экспрессии представляющего интерес продукта;

(b) выделение представляющего интерес продукта из указанной клеточной культуральной среды и/или из указанных клеток-хозяев; и

(c) необязательную обработку представляющего интерес выделенного продукта.

В соответствии с одним из вариантов осуществления изобретения, указанные клетки-хозяева культивируют в бессывороточной среде. Представляющий интерес экспрессированный продукт может быть получен путем дизрупции клеток-хозяев. Предпочтительно, представляющим интерес продуктом является полипептид. Указанный полипептид, предпочтительно, экспрессируется, например, секретируется в культуральную среду и может быть выделен из этой среды. Для этих целей, в представляющий интерес полипептид вводят соответствующий лидерный пептид. Лидерные последовательности и конструкции экспрессионных кластеров, используемые для достижения секреции, хорошо известны специалистам. Также может быть использована комбинация соответствующих способов. Таким образом, полипептиды, такие как белки, могут быть эффективно продуцированы/выделены с высоким выходом.

Представляющий интерес продукт, которым, предпочтительно, является представляющий интерес полипептид, может быть выделен, а затем очищен, обработан и/или модифицирован известными методами. Так, например, полипептид может быть выделен из питательной среды стандартными методами, включая, но не ограничиваясь ими, центрифугирование, фильтрацию, ультрафильтрацию, экстракцию или преципитацию. Другие стадии обработки, такие как стадии очистки, могут быть осуществлены различными известными методами, включая, но не ограничиваясь ими, хроматографию (например, ионообменную хроматографию, аффинную хроматографию, гидрофобную хроматографию, хроматофокусирование и эксклюзионную хроматографию), электрофорез (например, препаративное изоэлектрическое фокусирование), дифференциальную солюбилизацию (например, преципитацию сульфатом аммония) или экстракцию. Кроме того, выделенный и очищенный представляющий интерес продукт может быть также обработан, например, приготовлен в виде композиции, такой как фармацевтическая композиция.

D. Способ продуцирования эукариотической клетки

В соответствии со своим четвертым аспектом, настоящее изобретение относится к способу продуцирования эукариотической клетки, подходящей для рекомбинантного продуцирования представляющего интерес продукта, где указанный способ включает ингибирование функции белка FAM60A в эукариотической клетке посредством модификации генома указанной клетки и стабильной трансфекции указанной клетки по меньшей мере одним экспрессионным вектором, содержащим полинуклеотид, кодирующие представляющий интерес продукт. Подходящие и предпочтительные варианты для достижения этой цели описаны выше для эукариотических клеток согласно первому аспекту изобретения и вводятся в настоящее описание посредством ссылки. Неограничивающие варианты осуществления изобретения кратко описаны ниже.

В соответствии с одним из вариантов осуществления изобретения, указанный способ включает модификацию генома эукариотической клетки для снижения или блокирования функциональной экспрессии гена FAM60A в указанной клетке и, тем самым, ингибирования функции белка FAM60A в указанной клетке. Подходящие способы описаны выше для эукариотических клеток согласно первому аспекту изобретения и вводятся в настоящее описание посредством ссылки.

Так, например, может быть осуществлен нокаут гена FAM60A. В соответствии с одним из вариантов осуществления изобретения, такой нокаут гена может быть осуществлен во всех копиях гена FAM60A, если присутствует более, чем одна копия. В соответствии ген FAM60A является делетипованным. Все копии гена FAM60A в геноме могут быть делетированы, если присутствует более, чем одна копия. В соответствии с одним из вариантов осуществления изобретения, указанный способ включает делецию части хромосомы, где такая делетированная часть содержит ген FAM60A. Делетированная часть может соответствовать теломерной области. Однако из-за генетической реаранжировки, указанная область может также присутствовать в другой области хромосомы. Такая делеция может быть индуцирована, например, с использованием агента, индуцирующего хромосомные разрывы. В описании настоящей заявки, клетки могут быть повторно обработаны таким агентом с получением клеток, в которых функциональная экспрессия гена FAM60A была снижена или блокирована, например, в результате делеции всех копий указанного гена благодаря индуцированным хромосомным разрывам.

В соответствии с одним из вариантов осуществления изобретени, эукариотической клеткой является клетка многоклеточных, предпочтительно, клетка позвоночных, а еще более предпочтительно, клетка млекопитающего. В соответствии с одним из вариантов осуществления изобретения, клеткой млекопитающего является клетка грызуна. Предпочтительно, клеткой грызуна является клетка хомячка, такая как клетка СНО, происходящая от CHO-K1. В соответствии с одним из вариантов осуществления изобретения, указанный способ включает делецию по меньшей мере части теломерной области хромосомы 8 в клетке хомячка, где указанная делетированная часть содержит ген FAM60A. Как показано в примерах, клетки СНО, имеющие соответствующую делецию в теломерной области хромосомы 8, а в данном случае в плече q, обладают ценными экспрессионными свойствами, а поэтому они являются особенно подходящими в качестве клеток-хозяев для рекомбинантного продуцирования. В соответствии с одним из вариантов осуществления изобретения, делетированная теломерная область содержит ген FAM60A, и один или более генов или все гены, выбранные из группы, состоящей из генов Caprin2, Ipo8 и RPS4Y2. В соответствии с одним из вариантов осуществления изобретения, делетированная область дополнительно включает по меньшей мере часть гена Tmtc1 или весь этот ген. В соответствии с одним из вариантов осуществления изобретения, указанный способ включает делецию по меньшей мере соответствующей части теломерной области в обеих хромосомах хромосомной пары 8. Неограничивающие альтернативные названия вышеупомянутых отдельных генов и кодируемых ими белков, а также гомологов и ортологов отдельных генов и/или кодируемых ими белков, входящих в объем настоящего изобретения, представлены выше в таблице 1.

Как описано выше, теломерная область мышиной хромосомы 6 соответствует теломерной области хромосомы 8 китайского хомячка. Таким образом, вышеприведенное описание теломерной области хромосомы 8 хомячка соответствует описанию теломерной области мышиной мышиной хромосомы 6.

В соответствии с одним из вариантов осуществления изобретения, указанный способ включает индуцирование хромосомного разрыва в теломерной области хромосомы 8 генома хомячка (или хромосомы 6 мышиного генома), где разрыв на хромосоме 8 (или на хромосоме 6 мышиного генома) расположен со стороны центромеры по отношению к гену Fam60a, со стороны центромеры по отношению к гену Caprin2, со стороны центромеры по отношению к гену Ipo8 или со стороны центромеры по отношению к гену RPS4Y2. Таким образом, все гены, которые присутствуют в теломере, то есть, гены, расположенные ближе к теломерному концу, были делетированы. Неограничивающие альтернативные названия вышеупомянутых отдельных генов, а также гомологов и ортологов и соответствующих генов и кодируемых ими белков, входящих в объем настоящего изобретения, представлены выше в таблице 1. В соответствии с одним из вариантов осуществления изобретения, полученные клетки, содержащие хромосомный разрыв в теломерной области, имеют одно или более из нижеследующих свойств:

(а) точка разрыва расположена со стороны центромеры по отношению к гену Ipo8;

(b) точка разрыва расположена в гене Tmtc1.

Как обсуждалось выше, все гены, расположенные со стороны теломеры по отношению к точке разрыва, то есть расположены в направлении теломерного конца, содержатся в делетированной области. Эта область включает ген FAM60A. Методы идентификации соответствующих клеток млекопитающих, имеющих такую точку разрыва, описаны выше, а также в разделе, относящемся к пятому аспекту изобретения. В соответствии с одним из вариантов осуществления изобретения, ген Ergic2 не является делетированным.

В соответствии с одним из вариантов осуществления изобретения, клетка CHO, предпочтительно, происходящая от клеточной линии K1, используется для продуцирования эукариотической клеточной линии, в которой ингибируется функция продукта экспрессии гена FAM60A, предпочтительно, благодаря снижению или блокированию функциональной экспрессии гена FAM60A. В соответствии с одним из вариантов осуществления изобретения, теломерная область на плече q хромосомы 8, содержащей ген FAM60A, является делетированной. В литературе существует подробное описание способа получения данного результата, подходящие варианты которого также приводятся в настоящей заявке, и это описание вводится в настоящее описание посредством ссылки. Особенно предпочтительным вариантом является вариант, в котором, в указанной клетке, кроме того, ингибируется функция продукта экспрессии гена C12orf35, например, благодаря снижению или блокированию функциональной экспрессии гена C12orf35, поскольку было обнаружено, что стабильность экспрессии может быть значительно повышена. Поэтому, в соответствии с одним из вариантов осуществления изобретения, способ согласно четвертому аспекту изобретения дополнительно включает ингибирование функции продукта экспрессии гена C12orf35 в указанной клетке. Способы получения таких результатов, предпочтительно, посредством снижения или блокирования функциональной экспрессии гена C12orf35 описаны выше и вводятся в настоящее описание посредством ссылки. Клетки-хозяева млекопитающих, которые были модифицированы для ингибирования функции FAM60A и C12orf35 в указанных клетках, обладают особенно ценными экспрессионными свойствами. Таким образом, были получены клетки-хозяева млекопитающих, обладающие улучшеннными свойствами, такими как длительная стабильность, а также высокий выход продукта, и следовательно, имеющие ключевые признаки, играющие важную роль в крупномасштабном продуцировании представляющего интерес продукта, а в частности, представляющего интерес полипептида.

В соответствии с одним из вариантов осуществления изобретения, способ согласно четвертому аспекту изобретения включает введение в эукариотическую клетку, в которой ингибируется или блокируется экспрессия гена FAM60A, по меньшей мере одного полинуклеотида, кодирующего представляющий интерес продукт, а предпочтительно, по меньшей мере одного полинуклеотида, кодирующего селективный маркер. В соответствии с одним из вариантов осуществления изобретения, полинуклеотид, кодирующий представляющий интерес продукт, и полинуклеотид, кодирующий селективный маркер, расположены в одних и тех же или в различных экспрессионных векторах. Подходящие и предпочтительные варианты также описаны выше, и это описание вводится в настоящее описание посредством ссылки. Экспрессионный(е) вектор(ы) интегрируется(ются) в геном клетки-хозяина, так, чтобы это обеспечивало стабильную трансфекцию клетки. Клетки-хозяева, которые были успешно трансфецированы и экспрессировали представляющий интерес продукт, могут быть отобраны способом согласно второму аспекту изобретения. Эти клетки вводятся в настоящее описание посредством ссылки.

E. Способ анализа эукариотических клеток

В соответствии со своим пятым аспектом, настоящее изобретение относится к способу анализа эукариотических клеток на возможность их использования в качестве клеток-хозяев для рекомбинантной экспрессии представляющего интерес продукта, где указанный способ включает прямой или опосредованный анализ ингибирования функции продукта экспрессии гена FAM60A в указанных клетках. Как описано выше, эукариотической клеткой, предпочтительно, является клетка млекопитающего.

Этот способ анализа может быть преимущественно применен, например, в комбинации со способом согласно четвертому аспекту изобретения для идентификации продуцирования эукариотической клетки, в которой ингибируется функция белка FAM60A. Кроме того, указанный способ может быть применен, например, для дифференциации стабильных или нестабильных клонов в процессе отбора/скрининга. Кроме того, в некоторых вариантах осуществления изобретения, указанный способ может быть также применен, например, для дифференциации высоко- и низкопродуктивных клонов. С применением этого способа анализа, на ранней стадии процесса отбора могут быть идентифицированы клоны, обладающие ценными экспрессионными свойствами. Это повышает вероятность отбора большего количества стабильных и высокопродуктивных клонов. Поэтому, такой способ анализа имеет важное значение в проведении последующих разработок и усовершенствования технологии рекомбинантной экспрессии, поскольку он сокращает время, необходимое для идентификации подходящего продуктивного клона.

В соответствии с предпочтительным вариантом осуществления изобретения, указанный способ включает анализ на снижение или блокирование функциональной экспрессии гена FAM60A в указанных клетках. Анализ на снижение или блокирование функциональной экспрессии гена FAM60A может быть осуществлен прямо или опосредованно. Неограничивающие варианты этого способа описаны ниже. Возможность применения такого способа анализа также зависит от способа модификации клеток для снижения или блокирования функциональной экспрессии эндогенного гена FAM60A.

Так, например, при осуществлении нокаута гена FAM60A для снижения или блокирования экспрессии гена FAM60A можно амплифицировать соответствующую часть ДНК и секвенировать амплифицированную ДНК для подтверждения того, что был осуществлен нокаут гена FAM60A. Если функциональная экспрессия гена FAM60A была снижена или блокирована путем полной или частичной делеции указанного гена, то можно детектировать делецию на уровне ДНК, например, с применением подходящих методов детектирования на основе амплификации в целях идентификации указанной делеции (такие методы известны специалистам).

В соответствии с одним из вариантов осуществления изобретения, профиль экспрессии эукариотических клеток анализируют для идентификации снижения или блокирования функциональной экспрессии гена FAM60A. Так, например, указанный анализ может включать проведение качественной или количественной ПЦР с ОТ (обратной транскриптазой) для детектирования присутствия или отсутствия мРНК FAM60A, а также для определения количества или длины мРНК FAM60A. Это может быть осуществлено, например, с помощью прямого анализа, поскольку данный анализ позволяет непосредственно детектировать транскрипт гена FAM60A. Непрямые анализы, в которых статус экспрессии гена FAM60A может быть определен непрямым методом путем анализа профиля экспрессии генов, отличающихся от гена FAM60A, где, соответственно, указанный анализ не позволяет непосредственно анализировать ген FAM60A или его транскрипт, также являются подходящими для достижения данной цели и таким образом, входят в объем определения термина «анализ на снижение или блокирование функциональной экспрессии гена FAM60A». Такой непрямой анализ может быть применен, например, в том случае, если хромосомная часть, содержащая ген FAM60A (и другие гены), была делетирована в результате хромосомного разрыва, как описано ниже. Для проведения количественного анализа может быть осуществлено сравнение со стандартом (например, с немодифицированной соответствующей клеткой).

В соответствии с одним из вариантов осуществления изобретения проводят дополнительный прямой или непрямой анализ на ингибирование функции белка FAM60A в указанных клетках. Такой анализ может быть проведен путем определения снижения или блокирования функциональной экспрессии гена C12orf35 в указанных клетках. Этот анализ может быть осуществлен с соответствующими необходимыми изменениями (mutatis mutandis) как описано для гена FAM60A. Данный анализ обсуждается выше.

В соответствии с одним из вариантов осуществления изобретения, перед проведением анализа, клетки обрабатывают агентом, который индуцирует хромосомные разрывы, для делеции части хромосомы, содержащей ген FAM60A. Как описано выше, все копии гена FAM60A могут быть делетированы. Затем может быть проведен анализ для того, чтобы определить, приводит ли обработка указанным агентом к делеции части хромосомы, включающей ген FAM60A. Клетки обрабатывают агентом, индуцирующим хромосомный разрыв, в соответствующей концентрации, стимулирующей хромосомный разрыв. В данном случае, такая обработка может включать несколько раундов. Хромосомный разрыв может быть индуцирован в процессе отбора, если такой отбор включает использование агента, индуцирующего хромосомные разрывы, в достаточно высокой концентрации. Неограничивающим примером подходящего агента является, например, MTX. В этом случае, клетка может содержать гетерологичный полинуклеотид, кодирующий DHFR в качестве селективного маркера, который является невосприимчивым к MTX-обработке. Однако, как обсуждается выше, могут быть также использованы и другие агенты, такие как, например, гигромицин, как описано в примерах.

После обработки клеток для индуцирования хромосомных разрывов, полученные клетки могут быть проанализированы способом согласно этому аспекту изобретения, для того, чтобы определить, может ли обработка указанным агентом приводить к делеции части хромосомы, включающей ген FAM60A. Для этой цели подходящими являются различные варианты. В соответствии с одним из вариантов осуществления изобретения проводят анализ профиля экспрессии обработанных клеток. Так, например, можно проанализировать экспрессию гена FAM60A или одного или более генов, расположенных со стороны центромеры по отношению к гену FAM60A (то есть, еще дальше от теломерного конца по направлению к центру хромосомы). Так, например, в случае мышиных клеток или клеток китайского хомячка может быть проанализирована экспрессия гена FAM60A и, соответственно, в случае детектирования мРНК (например, в прямом анализе) и альтернативно или дополнительно, может быть проведен анализ для того, чтобы определить, могут ли один или более генов, выбранных из группы, состоящей из генов Caprin2, Ipo8, Tmtc1 или генов, которые расположены со стороны теломеры по отношению к вышеупомянутым генам, экспрессироваться указанной клеткой (например, это может быть определено с помощью непрямого анализа). Неограничивающие альтернативные названия вышеупомянутых отдельных генов также указаны выше в таблице 1, и соответствующие гены входят в объем значений терминов, определяемых выше для отдельных генов и кодируемых ими продуктов. Если индуцированный разрыв расположен со стороны центромеры по отношению к соответствующему(им) гену(ам), то гены, которые блокируют или снижают экспрессию, были делетированы (если присутствуют другие копии экспрессируемого гена). Как видно на фиг. 1, ген FAM60A расположен со стороны теломеры по отношению к вышеупомянутым генам. Таким образом, если вышеупомянутые гены были делетировны, то такая делетированная область также включает ген FAM60A. Таким образом, вышеупомянутые гены могут быть эффективно использованы в качестве маркеров в непрямом анализе, для того, чтобы определить, приводит ли индуцированный хромосомный разрыв к делеции гена FAM60A и, тем самым, к снижению или блокированию экспрессии гена FAM60A. Таким образом, анализ на снижение или блокирование экспрессии гена FAM60A необязательно должен быть проведен прямым методом, например, с использованием мРНК FAM60A, и такие непрямые методы также входят в объем способа согласно пятому аспекту изобретения. Кроме того, было обнаружено, что даже в случае расположения гена со стороны телоомеры по отношению к гену FAM60A (то есть, в направлении теломерного конца), гены C12orf35 и Bicd1 также могут быть использованы в качестве маркеров для того, чтобы определить, может ли индуцированный хромосомный разрыв приводить к делеции гена FAM60A. При проведении анализа клеток китайского хомячка, таких как клетки СНО, было обнаружено, что если ген Bicd1 или C12orf35 был делетирован в результате хромосомного разрыва, то делетированная теломерная область также обычно включает FAM60A. С помощью анализа экспрессионных свойств нескольких сотен клонов было обнаружено, что вышеупомянутые гены могут быть эффективно использованы в качестве маркеров для дифференциации клеточных клонов с высокой и стабильной экспрессией и клеточных клонов с низкой и нестабильной экспрессией. Относительный уровень экспрессии вышеупомянутых генов в клетках СНО показан на фиг. 2.

В соответствии с одним из вариантов осуществления изобретения, способ согласно пятому аспекту изобретения применяется для анализа клеток хомячка, а предпочтительно, клеток СНО, где указанный способ включает анализ на снижение уровня экспрессии гена FAM60A в указанных клетках путем оценки снижения или блокирования экспрессии одного или более генов, расположенных в теломерной области хромосомы 8 и выбранных из группы, состоящей из гена Tmtc1 и генов, расположенных со стороны теломеры по отношению к гену Tmtc1 в указанных клетках. Как описано выше, соответствующие клетки, которые, после обработки агентом, индуцирующим хромосомный разрыв, больше не экспрессируют ген Tmtc1 и/или гены, расположенные со стороны телоомеры по отношению к гену Tmtc1, обычно имеют делецию в теломерной области хромосомы 8, которая содержит указанные гены, а в частности, ген FAM60A. Генетический материал, расположенный со стороны теломеры по отношению к точке разрыва, отсутствует.

В соответствии с одним из вариантов осуществления изобретения, выбранные клетки-хозяева, обладающие описанными выше свойствами, трансфецируют экспрессионным вектором, содержащим по меньшей мере один полинуклеотид, кодирующий представляющий интерес продукт, а предпочтительно, по меньшей мере один селективный маркер. Подходящие варианты описаны выше в комбинации с другими аспектами изобретения, которые также описаны выше.

В соответствии с одним из вариантов осуществления изобретения, перед проведением анализа способом согласно пятому аспекту изобретения, эукариотические клетки трансфецируют по меньшей мере одним гетерологичным полинуклеотидом, кодирующим представляющий интерес продукт, и по меньшей мере одним гетерологичным полинуклеотидом, кодирующим селективный маркер, а затем проводят по меньшей мере одну стадию отбора для идентификации успешно трансфецированных клеток-хозяев. Подходящие варианты подробно описаны выше. В соответствии с одним из вариантов осуществления изобретения, стадия отбора включает использование агента для отбора, который индуцирует хромосомные разрывы. В этом варианте осуществления изобретения, селективным маркером может быть DHFR, а селективным агентом может быть MTX. Альтернативно, селективным агентом может быть гигромицин, а селективным маркером может быть ген, сообщающий резистентность к гигромицину, такой как, например, ген hph. В тех случаях, когда указанный способ осуществляют во время или после проведения стадии отбора, способ согласно пятому аспекту изобретения может быть применен в качестве аналитического средства для идентификации клеток в выбранной популяции, в которых наблюдается снижение или блокирование экспрессии гена FAM60A. Как описано выше, такое снижение или блокирование может быть индуцировано условиями отбора или может поддерживаться в таких условиях, например, если индуцирование хромосомного разрыва приводит к делеции гена FAM60A, где указанный способ согласно пятому аспекту изобретения позволяет идентифицировать такие клетки, например, по профилю их экспрессии. Это позволяет идентифицировать такие клетки или клеточные клоны, которые, благодаря профилю их экспрессии, а в частности, благодаря снижению или блокированию экспрессии гена FAM60A, являются особеннно подходящими для продуцирования рекомбинантной клеточной линии продуцента, поскольку, как и ожидалось, представляющий интерес продукт с высоким уровнем экспрессии остается стабильным. В частности, поскольку ген FAM60A отсутствует, то также отсутствует ген C12orf35, что приводит к значительному повышению выхода продукта экспрессии, как описано в настоящей заявке. Как описано выше, в случае клеток хомячка, таких как клетки СНО, в которых ген FAM60A расположен в теломерной области хромосомы 8, предпочтительно, чтобы клетки, в которых отсутствует теломерная область хромосомы 8, а предпочтительно, плеча q, имели пониженный уровень экспрессии гена FAM60A или вообще не экспрессировали этот ген. Такой аналитический метод может быть проведен после выделения клеточных клонов из клеток, содержащихся в популяции клеток с высоким уровнем экспрессии. В соответствии с одним из вариантов осуществления изобретения, множество клеточных клонов анализировали для дифференциации стабильных и нестабильных клеточных клонов и/или высоко- и низкопродуктивных клеточных клонов.

В соответствии с одним из вариантов осуществления изобретения, способ согласно пятому аспекту изобретения включает отбор по меньшей мере одной клетки, в которой ингибируется функция продукта экспрессии гена FAM60A, предпочтительно, посредством снижения или блокирования функциональной экспрессии гена FAM60A, где указанные клетки используют для рекомбинантной экспрессии представляющего интерес продукта, а предпочтительно, представляющего интерес полипептида. Клетки, обладающие соответствующими свойствами, являются особенно подходящими для рекомбинантной экспрессии как показано в примерах. Другие варианты соответствующих клеток также более подробно описаны выше. Как описано выше, в качестве эукариотических клеток-хозяев предпочтительно использовать клетки позвоночных, а наиболее предпочтительно, клетки млекопитающих.

F. Применение модифицированных эукариотических клеток для рекомбинантного продуцирования представляющего интерес продукта

В соответствии со своим шестым аспектом, настоящее изобретение относится к применению выделенной эукариотической клетки для рекомбинантной экспрессии представляющего интерес продукта, где геном эукариотической клетки модифицируют для ингибирования функции белка FAM60A в указанной клетке. Подробное описание соответствующих эукариотических клеток-хозяев и вариантов, подходящих для достижения ингибирования функции продукта белка FAM60A в указанных клетках, предпочтительно, посредством снижения или блокирования функциональной экспрессии гена FAM60A, приводится выше в разделах, относящихся к данным вариантам. Неограничивающие варианты осуществления изобретения кратко описаны ниже.

Эукариотическая клетка может быть выбрана из клеток многоклеточных, позвоночных или млекопитающих. Предпочтительной эукариотической клеткой является клетки млекопитающего, такая как клетка грызуна. Предпочтительными являются клетки СНО. Геном эукариотической клетки может быть модифицирован, как подробно описано выше. В соответствии с одним из вариантов осуществления изобретения, функция белка C12orf35 была дополнительно ингибирована в указанной клетке, предпочтительно, посредством снижения или блокирования функциональной экспрессии эндогенного гена C12orf35. Подробное описание этого варианта и его преимуществ приводится выше и вводится посредством ссылки.

В соответствии с одним из вариантов осуществления изобретения, представляющим интерес продуктом является полипептид. Предпочтительно, представляющий интерес полипептид, после его экспрессии в эукариотической клетке, секретируется в клеточную культуральную среду. Подробное описание представляющего интерес полипептида приводится выше и вводится посредством ссылки. Для экспрессии представляющего интерес продукта, эукариотическая клетка-хозяин может быть стабильно трансфецирована экспрессионным вектором, содержащим полинуклеотид, кодирующий представляющий интерес полипептид. Подробное описание этого варианта приводится выше и вводится посредством ссылки. Предпочтительно, в качестве эукариотических клеток-хозяев используется эукариотическая клетка-хозяин согласно первому аспекту изобретения. Указанные клетки подробно описаны выше и вводятся в настоящее описание посредством ссылки.

Описанные здесь численные интервалы являются инклюзивными и включают числа, определяющие границы интервала. Представленные здесь заголовки разделов не рассматриваются как ограничение объема различных аспектов или вариантов осуществления изобретения, которые во всей своей полноте вводятся в настоящее описание посредством ссылки. В соответствии с одним из вариантов осуществления изобретения, описанный здесь объект изобретения, содержащий некоторые элементы, также означает объект изобретения, состоящий из соответствующих элементов. В частности, описанные здесь полинуклеотиды, содержащие некоторые последовательности, могут также состоять из соответствующих последовательностей. При этом предпочтительно, чтобы описанные здесь предпочтительные варианты были выбраны из конкретных объектов изобретения, входящих в состав соответствующей комбинации предпочтительных вариантов, и объединены с этими объектами, к которым также относится настоящее изобретение.

В настоящей заявке испрашивается приоритет предварительной заявки на патент США № 61/919313, поданной 20 декабря 2013, которая во всей своей полноте вводится в настоящее описание посредством ссылки.

Примеры

Нижеследующие примеры приводятся в целях иллюстрации настоящего изобретения и не должны рассматриваться как ограничение его объема. В частности, в этих примерах описаны предпочтительные варианты осуществления изобретения.

Пример 1: Нокаут FAM60A в клетках CHO с использованием технологии TALEN

Два клеточных клона, полученных на основе клеток CHO, происходящих от клеточной линии CHO-K1, были созданы так, чтобы они содержали нокаут-мутацию гена FAM60A. Для создания FAM60A-мутантных клеток была применена технология TALEN, то есть, технология с использованием эффекторных нуклеаз, подобных активатору транскрипции (Transcription Activator-Like Effector Nucleases). Для нокаута гена FAM60A, мишенью является кодирующая область (предположительно, экзон 1) гена FAM60A. Клетки CHO-K1, используемые в качестве родительской клетки, содержат только одну копию FAM60A. Таким образом, одной нокаут-мутации на клетку достаточно для ингибирования функции FAM60A в указанной клетке.

1. Конструирование/продуцирование и применение нуклеаз TALEN, которые являются специфичными к FAM60A

Таргетингу была подвергнута нижеследующая последовательность экзона геномной ДНК гена FAM60A в родительской клеточной линии CHO:

atgtttggttttcacaagccaaagatgtaccgaagtatagagggctgctgtatctgcagagccaagtcctccagctctcggttcacggacagtaaacgttatgaaaaggacttccagagctgttttgg (SEQ ID NO: 23).

Нуклеотиды TALEN-связывающих сайтов отмечены жирным шрифтом. Были сконструированы две последовательности TAL Fok I, нацеленные на кодирующую последовательность FAM60, представленную выше (SEQ ID NO: 23). TALEN TAL-L нацелена на помеченные 25 нуклеотидов и связывается с этими нуклеотидами на 5' (прямой) ДНК-цепи, а TALEN TAL-R нацелена на помеченные 25 нуклеотидов и связывается с этими нуклеотидами на 3' (обратной) ДНК-цепи гена FAM60A как показано выше для SEQ ID NO: 23 (см. таблицу 2, где также показаны дополнительные праймерные последовательности, которые были использованы для идентификации нокаут-генов). Эти два связывающих сайта разделены 16 нуклеотидами разрезающего сайта. Были получены плазмиды, кодирующие две последовательности TALENS, TAL-L и TAL-R.

Таблица 2
Последовательности TALEN, нацеленные на нокаут-ген FAM60A, и праймерные последовательности
TAL-L TGTACCGAAGTATAGAGGGCTGCTG (SEQ ID NO:24)
TAL-R TGTCCGTGAACCGAGAGCTGGAGGA
(SEQ ID NO: 25)
Праймер 1: GTCCCAGCACTCATGAGGAT
(SEQ ID NO: 26)
Праймер 2: CCTCCTAGCTCCAGGTATTT
(SEQ ID NO:27)
Праймер 3: GAGGACTTGGCTCTGCAGAT
(SEQ ID NO: 28)
Праймер 4: TTCCACAGAGCACAGCCGAT
(SEQ ID NO: 29)

Часть геномной последовательности ДНК гена FAM60A, которая включает кодирующую последовательность-мишень, представленную в SEQ ID NO: 23, и которая также простирается за пределы праймер-связывающих сайтов для праймеров 1, 2 и 4, расположенных в интронных областях, показана как SEQ ID NO: 30.

2. Трансфекция плазмидой TALEN

Трансфекцию осуществляли в соответствии со стандартным протоколом трансфекции, включающим электропорацию с использованием родительских клеток CHO в экспоненциальной фазе роста с жизнеспособностью выше 95% и с использованием 5 мкг каждой из плазмид TALEN.

3. Cel-I-анализ и клеточный сортинг

Cel-l-анализ осуществляли согласно руководству SAFC Biosciences. Cel-I-анализ представляет собой стандартный анализ для определения эффективности разрезания. Вкратце, после культивирования в течение нескольких дней, геномную ДНК выделяли из клеток и проводили ПЦР с использованием праймеров 1 и 2 (см. таблицу 2). Продукт амплификации денатурировали, а затем оставляли для ренатурации. После этого добавляли нуклеазу S и энхансер нуклеазы S, а затем инкубировали. Гидролизованный продукт анализировали. Если наблюдалась TALEN-активность, то присутствовали две менее крупные полосы, что указывает на наличие TALEN-активности в этой области генома, и следовательно, подтверждает нокаут гена FAM60A в клетках анализируемого клеточного пула. Из позитивных клеточных пулов в 96-луночных планшетах были отобраны отдельные клетки путем лимитирующего разведения.

4. Стратегия скрининга

Геномную ДНК (гДНК) экстрагировали из каждого клона в 96-луночных планшетах. гДНК анализировали стандартным методом для идентификации нокаут-клонов с помощью ПЦР-анализа. Для этой цели использовали праймеры 3 и 4 (см. таблицу 2). В случае мутации в разрезающей области, праймер 3 не связывается и ПЦР-продукт не образуется. ПЦР-продукты, полученные после ПЦР с использованием праймеров 1 и 2 гДНК (см. выше) позитивных клонов, были секвенированы для анализа введенной мутации.

Были получены два клеточных клона с нокаут-мутацией: FAM60A_ko_s16 (s16) с делецией 14 нуклеотидов и FAM60A-ko_s23 (s23) с делецией 5 нуклеотидов. Мутированные последовательности клеточных клонов представлены в таблице 3. Каждая из делеций приводит к сдвигу рамки считывания. Из-за сдвига рамки считывания в таргетированной последовательности FAM60A, стоп-кодоны присутствуют в рамке считывания (в таблице 3, эти нуклеотиды выделены курсивом и подчеркнуты). Таким образом, предполагается, что аномально короткий и менее функциональный или нефункциональный продукт экспрессии FAM60A экспрессируется полученными клонами с нокаутом FAM60A.

Таблица 3
Последовательность ДНК предполагаемого экзона 1 FAM60A в клетках CHO дикого типа (клетках WT, то есть, происходящих от CHO-K1) и в двух клеточных клонах с нокаутом (s16 и s23), происходящих от указанных клеток WT. Нуклеотиды TALEN-связывающих сайтов помечены жирным шрифтом, а нуклеотиды ранних стоп-кодонов отмечены курсивом и подчеркнуты
WT atgtttggttttcacaagccaaagatgtaccgaagtatagagggctgctgtatt
gcagagccaagtcctccagctctcggttcacggacagtaaacgttatgaaaaga
cttccagagctgttttgg (SEQ ID NO: 23)
s16 (del14) atgtttggttttcacaagccaaagatgtaccgaagtatagagggctgctgtatc
tccagctctcggttcacggacagtaaacgttatgaaaaggacttccagagctgt
ttgg (SEQ ID NO: 31)
s23: (del5) atgtttggttttcacaagccaaagatgtaccgaagtatagagggctgctgtatt
gccaagtcctccagctctcggttcacggacagtaaacgttatgaaaaggacttc
agagctgttttgg (SEQ ID NO: 32)

5. Анализ на стабильность

Была получена родительская клеточная линия дикого типа (WT), от которой происходят клоны с нокаутом FAM60A, и эти полученные клетки с нокаутом FAM60A были стабильно трансфецированы экспрессионным вектором, кодирующим представляющее интерес антитело в качестве полипептида. Трансфецированный экспрессионный вектор содержал экспрессионный кластер, включающий полинуклеотид, кодирующий неомицин-фосфотрансферазу в качестве селективного маркера, и экспрессионный кластер, кодирующий DHFR в качестве селективного маркера, экспрессионный кластер, включающий полинуклеотид, кодирующий легкую цепь антитела, и экспрессионный кластер, включающий полинуклеотид, кодирующий тяжелую цепь антитела, так, чтобы все антитело экспрессировалось указанным экспрессионным вектором. Все экспрессионные кластеры в экспрессионных векторах были ориентированы в одном и том же направлении. Экспрессионный кластер, используемый для тяжелой цепи, был сконструирован так, чтобы часть тяжелой цепи экспрессировалась посредством считывания стоп-кодона в виде гибридного полипептида, содержащего мембранный якорь. Этот гибридный белок представлен на клеточной поверхности, что упрощает FACS-анализ (см. описание). Трансфецированные клетки были выбраны для рекомбинантной экспрессии путем отбора с использованием G418 и MTX (1 мкМ). Из отобранных пулов каждой стабильно трансфецированной клеточной линии (CHO WT, s16 и s23) были взяты клеточные клоны, которые экспрессировали представляющий интерес продукт с высоким выходом, и эти клоны были культивированы в течение нескольких недель (7 недель для родительской клеточной линии СНО WT (45 клонов) и 8 недель для клеток с FAM60A-нокаутом (13 клонов для s16 и 18 клонов для s23)) для анализа на стабильную экспрессию в течение длительного периода культивирования. Для гарантии того, что клеточные линии-продуценты могут быть применены для промышленного продуцирования в биореакторах большого объема, были также проведены исследования на стабильность в течение 12 недель, а в частности, дополнительный анализ на стабильную экспрессию в течение 12-недельного культивирования. Клоны были классифицированы как нестабильные, если они утрачивали более, чем 25% от первоначального волюметрического титра экспрессии в течение всего периода анализа на стабильность. При обычном уровне вариабельности, некоторые клоны давали титры чуть выше или ниже предельного значения в 25%. Более высокое содержание нестабильных клонов в течение 7/8 недель по сравнению с 12 неделями культивирования родительской клеточной линии можно объяснить вариабельностью анализа на продуктивность клонов, которая была близка к пороговому значению 25%.

В таблице 4 сравниваются результаты анализов на стабильность для клеточных линий. Как можно видеть из таблицы, процент клонов со стабильным волюметрическим титром значительно выше для клонов, происходящих от клеточной линии с нокаутом FAM60A, по сравнению с клонами, происходящими от клеточной линии дикого типа. Это указывает на то, что ингибирование функции эндогенного FAM60A в клетках, достигаемое путем нокаута гена, значительно повышает стабильность в процессе длительного культивирования. Отношение стабильных клонов к нестабильным клонам значительно повышается при использовании клеток согласно изобретению, полученных так, чтобы более стабильные клоны сохраняли свои предпочтительные высокопродуктивные свойства в процессе длительного культивирования. Антитело, которое было рекомбинантно экспрессировано, как описано в этом примере, не является оптимизированным по кодонам и присутствует в родительской клеточной линии с очень высокой степенью нестабильности. Из-за такой высокой нестабильности, этот вариант был выбран для сравнения, поскольку он продемонстрировал значительную эффективность, которая была достигнута при осуществлении настоящего изобретения даже вопреки имеющимся трудностям, связанным с высокой степенью нестабильности немодифицированной клеточной линии дикого типа. Однако, как обсуждается выше, в других вариантах, степень нестабильности родительской клеточной линии CHO дикого типа является не такой высокой. Однако, во всех проанализированных случаях, использование клеток-хозяев согласно изобретению, в которых ингибируется функция FAM60A, по сравнению с немодифицированной клеточной линией дикого типа, позволяет достичь значительного увеличения количества стабильных клеток. Степень стабильности может достигать 60% или более, 70% или более, 80% или более, 85% или более или даже 90% или более, в зависимости от выбранного варианта. При использовании клеток согласно изобретению, которые, например, имеют нокаут гена FAM60A, или где часть теломерной области, содержащая ген FAM60A, утрачивается в результате хромосомного разрыва, нестабильные клоны встречаются гораздо реже независимо от анализируемого варианта, но даже если они и встречаются, то потеря их волюметрической продуктивности является менее выраженной, чем у соответствующих клеток, в которых не ингибируется функция FAM60A. Следовательно, в результате увеличения процента стабильных клонов, полученных после трансфекции и отбора, использование клеток согласно изобретению позволяет значительно сократить время проведения исследований на стабильность или даже вообще не проводить такие исследования. Исследования на стабильность клонов с нокаутом FAM60A подтвердили ценность результатов, которые были получены с применением технологии согласно изобретению.

Таблица 4
Результаты исследования на стабильность
Клеточная линия Стабильные клоны Нестабильные клоны Стабильные клоны Нестабильные клоны
7/8 недель 12 недель
Родительская клеточная линия (7 и 12 недель) 13,3% 86,7% 24,3% 75,7%
Клеточная линия с нокаутом FAM60A s16 (8 и 12 недель) 61,5% 38,5% 61,5% 38,5%
Клеточная линия с нокаутом FAM60A s23 (8 и 12 недель) 44,4% 55,6% 47,1% 52,9%

Результаты, представленные на фиг. 3, также продемонстрировали важные преимущества, которые были достигнуты благодаря ингибированию функции FAM60A в клетках, а в данном случае, благодаря нокауту гена.

Пример 2: Снижение уровня экспрессии гена C12orf35 посредством интерференции РНК (РНКи) в клетках CHO приводит к увеличению выхода продукта экспрессии

Как описано выше, особенно предпочтительно дополнительно ингибировать функцию продукта экспрессии гена C12orf35 в эукариотической клетке, в которой ингибируется функция белка FAM60A. Подходящие методы достижения такого ингибирования описаны выше и включают, но не ограничиваются ими, снижение или блокирования функциональной экспрессии эндогенного гена C12orf35. Было обнаружено, что ингибирование функции продукта экспрессии гена C12orf35 в эукариотической клетке, такой как, предпочтительно, клетка млекопитающего, приводит к неожиданному значительному увеличению уровня экспрессии представляющего интерес рекомбинантного полипептида из соответствующих клеток. Такой благоприятный эффект, а именно, высокий уровень экспрессии, может быть достигнут при снижении уровня функциональной экспрессии гена C12orf35, как описано в этом примере 2.

Для того, чтобы продемонстрировать, что снижение уровня экспрессии гена C12orf35 приводит к повышению волюметрической или удельной продуктивности, были сконструированы киРНК, направленные против различных генов-мишеней, расположенных в теломерной области хромосомы 8 анализируемого генома китайского хомячка (CHO-K1). Были сконструированы киРНК, направленные против генов-мишеней, перечисленных ниже в таблице 5:

Таблица 5
киРНК против различных генов-мишеней
Ген-мишень Смысловая последовательность Антисмысловая последовательность
METTL20_1
(4833442J19Rik)
CCCUGAUGUUGUUAGAGGATT (SEQ ID NO: 33) UCCUCUAACAACAUCAGGGTT
(SEQ ID NO: 44)
C12orf35_1 CAUCCAGACAAAUCUUACATT
(SEQ ID NO: 35)
UGUAAGAUUUGUCUGGAUGTG
(SEQ ID NO: 36)
C12orf35_2 CCAGAAAGAUAAAUCUACATT
(SEQ ID NO: 37)
UGUAGAUUUAUCUUUCUGGTA
(SEQ ID NO: 38)
Caprin2_6 UGACCUGCCCUGAAAGAAATT
(SEQ ID NO: 39)
UUUCUUUCAGGGCAGGUCAGT
(SEQ ID NO: 40)
FAM60A GCUUCCAGCUCUAACAGAATT
(SEQ ID NO: 41)
UUCUGUUAGAGCUGGAAGCCA
(SEQ ID NO: 42)
IPO8_1 GACCCGAACUUUGACCCUATT
(SEQ ID NO: 43)
UAGGGUCAAAGUUCGGGUCTG
(SEQ ID NO: 44)
IPO8_2 CGGAGACUCUUCAAAUUGATT
(SEQ ID NO: 45)
UCAAUUUGAAGAGUCUCCGGA
(SEQ ID NO: 46)
IPO8_3 GCCUGAUUGAAGACGAGGATT
(SEQ ID NO: 47)
UCCUCGUCUUCAAUCAGGCTT
(SEQ ID NO: 48)
Dennd5b_2 GGGUCUCCCUUAUUCAAGATT
(SEQ ID NO: 49)
UCUUGAAUAAGGGAGACCCTG
(SEQ ID NO: 50)
Amn1_4 GCUGCUUAAGUAUUACUGATT
(SEQ ID NO: 51)
UCAGUAAUACUUAAGCAGCCA
(SEQ ID NO: 52)
TMTC1_1 GUAUACCUGUGAUAAAACATT
(SEQ ID NO: 53)
UGUUUUAUCACAGGUAUACAT
(SEQ ID NO: 54)
TMTC1_2 CGGUGAAUGUCAUUCUACATT
(SEQ ID NO: 55)
UGUAGAAUGACAUUCACCGCA
(SEQ ID NO: 56)
киРНК, используемая в качестве негативного контроля (отсутствие влияния на экспрессию означает киРНК-контроль) Негативная по сайленсеру контрольная киРНК #5 (50 мкМ) (Ambion, Cat#AM4642)

Используемые киРНК были идентифицированы с помощью ОТ-ПЦР в реальном времени для подтверждения снижения уровня экспрессии генов-мишеней посредством сайленсинга генов. Экспрессия гена была нормализована по РНК 18S. Экспрессия гена, наблюдаемая после трансфекции киРНК, используемой в качестве негативного контроля, была принята за 100%. Относительное снижение экспрессии гена-мишени проиллюстрировано ниже в таблице 6, где представлены две различных киРНК, направленных против гена-мишени C12orf35:

Таблица 6
Концентрация Экспрессия гена (киРНК 1) Экспрессия гена (киРНК 2)
100 пмоль Приблизительно 28% Приблизительно 37%
125 пмоль Приблизительно 25% Приблизительно 38%
150 пмоль Приблизительно 35% Приблизительно 30%

Кроме того, было подтверждено, что киРНК против мишени, используемая в данном эксперименте, не ингибирует рост трансфецированных клеток. Кроме того, анализ BLAST (Basic Local Alignment Search Tool), основанный на имеющихся данных о геноме китайского хомячка, не указывал на какие-либо побочные эффекты.

Были трансфецированы нижеследующиме клеточные линии: клеточная линия CHO, происходящая от CHO-K1, была использована в качестве родительской клеточной линии. Указанная клеточная линия экспрессирует вышеописанные гены, как показано на фиг. 2. Эта родительская клеточная линия не была трансфецирована экспрессионным вектором и служила в качестве контроля. Клетки CHO (клоны и пулы), происходящие от указанной родительской клеточной линии, которая содержит экспрессионный вектор, кодирующий антитело в качестве представляющего интерес белка, стабильно интегрированного в геном, использовали для определения функции киРНК. Экспрессионный вектор, содержащийся в указанном клеточном клоне, включал селективные маркерные гены и тяжелую цепь антитела и легкую цепь антитела, которые были экспрессированы из различных экспрессионных кластеров. Экспрессионный кластер, используемый для тяжелой цепи, был сконструирован так, чтобы часть тяжелой цепи экспрессировалась в результате считывания стоп-кодона в качестве гибридного полипептида, содержащего мембранный якорь. Гибридный белок был представлен на клеточной поверхности, что упрощает проведение FACS-анализа (см. описание). Указанные клетки CHO экспрессировали вышеупомянутую киРНК против генов-мишеней по аналогии с родительской клеточной линией, как было определено с использованием микромассивов для нескольких сотен клонов и пулов. Клон CHO, который рекомбинантно экспрессировал антитело, был использован для того, чтобы определить, может ли ингибирование одного или более из вышеупомянутых генов-мишеней приводить к повышению уровня экспрессии представляющего интерес полипептида. В этом случае может наблюдаться увеличение волюметрической продуктивности антитела указанным клеточным клоном, которое может детектироваться с помощью FACS-анализа.

Клон CHO, содержащий экспрессионный вектор, стабильно интегрированный в геном, трансфецировали либо киРНК-контролем (не влияющим на экспрессию гена), либо одной из вышеупомянутых киРНК, направленных против генов-мишеней. После трансфекции киРНК был проведен анализ для того, чтобы определить, может ли снижение уровня экспрессии гена-мишени приводить к повышению уровня экспрессии антитела. Inter alia, трансфецированные клетки окрашивали флуоресцентным детектирующим соединением и анализировали с помощью FACS для определения уровня экспрессии антитела. Чем больше количество продуцируемого антитела, тем выше интенсивность окрашивания представленного гибридного белка меченным соединением, и соответственно, тем интенсивнее флуоресцентный сигнал, детектируемый с помощью FACS. Поэтому, чем выше интенсивность FACS-пррофиля, тем выше уровень экспрессии антитела.

Результаты для различных тестируемых киРНК представлены на фиг. 4A-L. Левый пик на этих профилях соответствует сигналу, полученному для родительской клеточной линии, которая не экспрессирует антитело. На двух других кривых представлены результаты, полученные для антитело-экспрессирующего клеточного клона, который был трансфецирован либо киРНК, используемой в качестве негативного контроля (не влияющего на экспрессию), либо тестируемой киРНК, которая снижает уровень экспрессии гена-мишени. Если тестируемая киРНК и, соответственно, ингибирование гена-мишени не влияют на экспрессию антитела (то есть, не повышают волюметрическую продуктивность), то полученная кривая флуоресценции для киРНК, используемсой в качестве негативного контроля, и кривая флуоресценции для киРНК, направленной против мишени, перекрываются и, по существу, являются идентичными. Этот случай, по существу, относится ко всем тестируемым генам-мишеням на клональном уровне, за исключением гена C12orf35. Однако для FAM60A наблюдается небольшой сдвиг на уровне пула, что, вероятно, обусловлено повышением стабильности экспрессии (данные не приводятся).

Как можно видеть по результатам для киРНК, направленных против C12orf35 (см. фиг. 4B и C), пики флуоресценции, полученные для киРНК, используемой в качестве негативного контроля, и киРНК, направленной против гена C12orf35, четко отделены от пиков, полученных для сайленсинга гена C12orf35 посредством РНКи. Флуоресцентный пик, полученный для клеточного клона, трансфецированного киРНК, направленной против гена C12orf35, имеет явный сдвиг вправо (показано стрелками), что указывает на значительное повышение интенсивности флуоресценции. Такое наблюдаемое повышение интенсивности флуоресценции можно объяснить более высоким уровнем экспрессии антитела в результате присутствия большего количества гибридного белка, окрашенного на клеточной поверхности. Поэтому, этот эксперимент явно показал, что ингибирование функциональной экспрессии гена C12orf35 непосредственно приводит к значительному повышению уровня рекомбинантной экспрессии антитела (повышению выхода антитела). Такой же заметный сдвиг FACS-профилей наблюдался при использовании указанных киРНК против C12orf35 во всех трех концентрациях. Более длительное снижение экспрессии гена C12orf35 посредством интерференции РНК может быть достигнуто, например, в случае стабильной интеграции в экспрессионный вектор, который экспрессирует РНКи-индуцирующий транскрипт, например, как описано в настоящей заявке. Кроме того, снижение или блокирование экспрессии гена C12orf35 может быть достигнуто посредством нокаута гена или делеции/мутации гена, а в соответствии с одним из вариантов осуществления изобретения, посредством делеции части теломерной области хромосомы 8 в клетках хомячка, таких как клетки СНО, описанные в настоящей заявке. Кроме того, как описано в настоящей заявке, снижение или блокирование функции продукта экспрессии может быть также достигнуто, например, путем введения одной или более мутаций, приводящих к продуцированию нефункционального или менее функционального белка.

Достигнутое повышение уровня экспрессии представляющего интерес рекомбинантного полипептида было также подтверждено с помощью анализа уровней экспрессии мРНК тяжелой и легкой цепей (которые экспрессировались из отдельных экспрессионных кластеров, см. выше). Эти результаты представлены для двух различных представляющих интерес полипептидов (антитела 1 и 2) на фиг. 5 и 6. Эти данные нормализовали по киРНК, используемой в качестве негативного контроля (125 пмоль). Было обнаружено, что снижение уровня экспрессии гена C12orf35 приводит к значительному повышению уровней мРНК тяжелой и легкой цепей экспрессируемого антитела. В противоположность этому, снижение уровня экспрессии других тестируемых генов-мишеней не влияет на уровень экспрессии мРНК тяжелой и легкой цепей. Таким образом, снижение уровня экспрессии гена C12orf35 приводит к значительному увеличению уровня мРНК представляющего интерес рекомбинантного полипептида. Кроме того, было обнаружено, что другие введенные гены, такие как селективные маркеры, ингибируются в случае сайленсинга гена C12orf35. Эксперимент, в котором эффект сайленсинга гена оценивали в течение всего периода времени, начиная со дня 3, показал, что киРНК1 (см. киРНК C12orf35_1 в таблице 7) действует в течение более длительного периода времени, чем киРНК2 (см. киРНК C12orf35_2 в таблице 7). Кроме того, число и титры клеток определяли в течение всего эксперимента, и было обнаружено, что ингибирование C12orf35 приводит к значительному повышению удельной продуктивности (см. фиг. 7).

Кроме того, экспрессию гена C12orf35 по сравнению с экспрессией РНК 18S анализировали в антитело-экспрессирующем клоне после ингибирования под действием киРНК 1 и 2 и сравнивали с различными контролями. Результаты представлены ниже в таблице 7:

Таблица 7
18S C12orf35 Тяжелая цепь Легкая цепь
киРНК C12orf35_1 97% 0,0129% 0,8517% 3,4639%
киРНК C12orf35_2 91% 0,0186% 1,0643% 2,9623%
киРНК-контроль 93% 0,0617% 0,3098% 0,9195%
Необработанные клетки 100% 0,0782% 0,2713% 0,7840%
Клетки, обработанные липофектамином 114% 0,0648% 0,2633% 0,8019%

Пример 3: Получение клеточной линии CHO, имеющей делецию в теломерной области хромосомы 8, в которой делетированы ген FAM60A и ген C12orf35

Была получена новая клеточная линия CHO (C8DEL), имеющая делецию в теломерной области плеча q хромосомы 8. Делеция была индуцирована хромосомным разрывом. Такая делетированная часть содержит ген FAM60A, а также, среди прочих, ген C12orf35, который расположен со стороны теломеры по отношению к гену FAM60A (см. фиг. 1). Указанная новая клеточная линия была получена из родительской клеточной линии, происходящей от CHO-K1. Указанную клеточную линию с хромосомным разрывом в хромосоме 8 получали следующим образом. Родительские клетки СНО культивировали при плотности 2E5 клеток/мл в культуральной среде, содержащей 0,5 мкМ, 1 мкМ или 2 мкМ MTX. Через шесть дней, жизнеспособность клеток составляла приблизительно 30-40%. Клетки центрифугировали при 180×g в течение 5 минут и культивировали в культуральной среде без MTX до тех пор, пока жизнеспособность клеток не превышала 95% (приблизительно 21 день). Эту процедуру повторяли еще два раза. Моноклеточные клоны получали из клеточных пулов. Всего был культивирован 561 клеточный клон, после чего выделяли ДНК с использованием набора для ПЦР «Extract-N-Amp Blood PCR Kit». Затем проводили ПЦР-скриниг с использованием праймеров, делетирующих ген Ipo8. Три из 561 клона были «IPO8-негативными», что указывало на отсутствие теломерной области хромосомы 8, включающей ген Ipo8. Ген Ipo8 расположен со стороны центромеры по отношению к гену FAM60A (см. фиг. 1). Таким образом, если ген Ipo8 был делетирован в результате хромосомного разрыва, то все гены, расположенные со стороны теломеры по отношению к гену Ipo8 (и соответственно также к гену C12orf35 и гену FAM60A), были также делетированы. Эти три клона были размножены и дополнительно проанализированы. Один из этих клонов называется клеточной линией «C8DEL». Точка разрыва теломерной области хромосомы 8 клеточной линии C8DEL может быть определена с помощью ПЦР. Точку разрыва определяли между двумя ПЦР, называемыми PCR20 и 28:

PCR20: прямой 5'-ACC AGT GAA TAA TCG TGT TT-3' (SEQ ID NO: 57), обратный 5'-CTA TGA GTC AAT GTC CCA AG-3' (SEQ ID NO: 58);

PCR28: прямой 5'-CAC ACA CAA CCT CCT AAC AAC CC-3' (SEQ ID NO: 59), обратный 5'-TTC CGC ACC GAC TCA GTT CT-3' (SEQ ID NO: 60)

Точка разрыва находится в гене Tmtc1. Кроме того, было продемонстрировано, что идентифицированная точка разрыва клеточной линии C8DEL сохраняется в течение нескольких недель культивирования (как было определено с помощью ПЦР). Трансфекция этиой новой эукариотической клеточной линии экспрессионным вектором, кодирующим представляющий интерес продукт, повышала вероятность вероятности отбора стабильно продуцирующих клонов с высоким уровнем экспрессии, как описано ниже. Трансфекция и MTX-обработка клеточной линии C8DEL не оказывала какого-либо значительного влияния на точку разрыва (то есть, не наблюдалось какой-либо потери генетического материала), на что указывал анализ трансфецированных клонов.

Пример 4: Анализ свойств клеточной линии C8DEL

Клеточную линию C8DEL анализировали на ее эффективность в отношении рекомбинантной экспрессии представляющего интерес полипептида и сравнивали с родительской клеточной линией, от которой происходит клеточная линия C8DEL. Как описано выше, указанная родительская клеточная линия не содержит соответствующую делецию в теломерной области хромосомы 8.

4.1. Анализ на продуктивность

Волюметрическую продуктивность C8DEL оценивали по сравнению с родительской клеточной линией, от которой она происходит. Была осуществлена стабильная, а также транзиентная трансфекция.

Стабильная трансфекция

Культивирование клеток, трансфекцию и скрининг осуществляли в шейкерных колбах с использованием суспензии растущих клеток CHO в культуральной среде определенного химического состава. Клетки трансфецировали путем электропорации различными экспрессионными векторами, кодирующими различные антитела и терапевтические белки. Используемые экспрессионные векторы содержали экспрессионный кластер, включающий полинуклеотид, кодирующий неомицин-фосфотрансферазу в качестве селективного маркера, и экспрессионный кластер, кодирующий DHFR в качестве селективного маркера. Экспрессионные векторы, используемые для экспрессии антител, также содержали экспрессионный кластер, включающий полинуклеотид, кодирующий легкую цепь антитела, и экспрессионный кластер, включающий полинуклеотид, кодирующий тяжелую цепь антитела, так, чтобы все антитело экспрессировалось указанным экспрессионным вектором. Экспрессионные векторы, используемые для экспрессии полипептида, не являющегося антителом, содержали экспрессионный кластер, включающий полинуклеотид, который, помимо селективного маркера, кодировал указанный полипептид. Все экспрессионные кластеры, содержащиеся в экспрессионных векторах, были ориентировны в одном и том же направлении. Этот вектор является подходящим для FACS-отбора, и подробное описание такого вектора приводится выше.

В зависимости от жизнеспособности клеток, первую стадию отбора начинали через 24-48 часов после трансфекции путем добавления селективной среды с G418 в клетки. После достижения жизнеспособности клеток выше 80%, проводили вторую стадию отбора путем пропускания клеток через среду, содержащую 500 нМ MTX или 1 мкM MTX.

Волюметрическую продуктивность выбранных клеточных популяций анализировали после проведения стадии отбора с использованием G418 или MTX путем культивирования быстро растущих периодических культур в шейкерных колбах в среде с G418 или MTX. Объем периодической культуры с G418 составлял 30 мл (125 мл-колба), а объем периодической культуры с подпиткой и с MTX составлял 100 мл (500 мл-колба). Периодические культуры с G418 высевали при 1E5 капиллярных объемов (к.о.)/мл в шейкерной колбе и культивировали в шейкерном сосуде (без увлажнения) при 150 об./мин и в атмосфере 10% CO2. Периодические культуры с подпиткой высевали при 4E5 к.о./мл. В начале анализа, жизнеспособность клеток составляла >90%. Титр определяли на 14-й день. Титры антител в супернатанте клеточной культуры определяли с помощью ВЭЖХ на белке А через 14 дней после начала культивирования.

После первой стадии отбора (отбора с использованием G418) очень большое увеличение волюметрического титра (в 12-35 раз) было детектировано для стабильно трансфецированных пулов C8DEL, но не для стабильно трансфецированных родительских пулов. После второй стадии отбора (отбора с использованием MTX), пулы периодической культуры с подпиткой C8DEL экспрессировали в 4-7 раз большее количество представляющего интерес полипептида по сравнению с трансфецированными родительскими клетками, где указанный полипептид представлен 2 антителами (антителом 1 и антителом 2). Волюметрические титры C8DEL в культуре с G418 и MTX (в периодической культуре с подпиткой) по сравнению с родительской клеточной линией CHO, не содержащей делеции в теломерной области хромосомы 8, являются репрезентативными для двух экспериментов с антителами, данные которых представлены ниже в таблицах 8.a и 8.b. В таблицах 8.a и 8.b представлены волюметрические титры пула клеток C8DEL (экспрессирующих антитело) в периодической культуре с подпиткой, содержащей G418 и MTX, по сравнению с пулами родительских клеток (представлены в среднем 4 пула/среду).

Таблица 8.a
Титры пула, экспрессирующего, например, антитело 1
Клеточная линия Титр пула после отбора с использованием G418 Титр пула после отбора с использованием G418 и MTX
Родительская клеточная линия, происходящая от CHO-K1 0,2 г/л 0,62 г/л
C8DEL 0,78 г/л 4,41 г/л
Таблица 8.b:Титры пула, экспрессирующего, например, антитело 2
Клеточная линия Титр пула после отбора с использованием G418 Титр пула после отбора с использованием G418 и MTX
Родительская клеточная линия, происходящая от CHO-K1 0,02 г/л 0,32 г/л
C8DEL 0,2 г/л 1,21 г/л

Результаты подтвердили, что делеция в теломерной области хромосомы 8, включающей ген FAM60A и ген C12orf35, коррелирует с более высокой волюметрической продуктивностью. Что касается волюметрического титра пула, то клеточная линия C8DEL по своим свойствам уже превосходила родительскую линию, не содержащую соответствующей делеции в теломерной области хромосомы 8. Результаты, полученные для киРНК в примере 2, показали, что волюметрическое увеличение титра, вероятно, обусловлено утратой гена C12orf35, расположенного на отсутствующей теломерной части.

Транзиентная трансфекция

Клетки C8DEL и родительские клеточные линии, культивированные к культуральной среде, были транзиентно трансфецированы с тремя повторностями экспрессионными плазмидами, кодирующими либо eGFP, либо гибридный белок Fc-белок, используемый в качестве представляющей интерес модели. В качестве реагента для трансфекции использовали полиэтиленимин (PEI). Титр белка-модели в супернатане среды измеряли с помощью ВЭЖХ на белке А через 3 и 6 дней после трансфекции. Экспрессия белка-модели в C8DEL была приблизительно в 3 раза выше. Процент eGFP-экспрессирующих клеток измеряли через 48 часов после трансфекции с помощью проточной цитометрии, где нетрансфецированные клетки использовали в качестве негативного контроля. Клетки, уровень флуоресценции которых более чем на 99% превышал уровень флуоресценции клеток, используемых в качестве негативного контроля, рассматривались как «трансфецированные». Клетки, уровень флуоресценции которых более чем в 1000 раз превышал уровень флуоресценции клеток, используемых в качестве негативного контроля, рассматривались как «в высокой степени флуоресцентные». При использовании клеточной линии C8DEL, число в высокой степени флуоресцентных клеток в 2-3 раза превышало число родительских клеточных линий, от которых происходили клетки C8DEL.

В этом примере показано, что повышенная волюметрическая продуктивность может быть также достигнута путем транзиентной трансфекции клеточной линии C8DEL, в которой часть теломерной области хромосомы 8 теряется в результате хромосомного разрыва.

4.2. Анализ на стабильность

Стабильность 46 клонов, происходящих от C8DEL, и 37 клонов, происходящих от родительской клеточной линии (которые, как показал анализ, были IPO8-позитивными, а поэтому в них присутствовала теломерная область хромосомы 8), анализировали после стабильной трансфекции. Все клоны рекомбинантно экспрессировали то же самое антитело в качестве представляющего интерес продукта и были классифицированы как стабильные, если они не утрачивали более чем 25% титра антител (волюметрического) через 12 недель. 76% анализируемых клонов, происходящих от родительской клеточной линии, утрачивали более, чем 25% титра (волюметрического) через 12 недель культивирования. При этом только 24% анализируемых клонов были классифицированы как стабильные. Таким образом, степень нестабильности была высокой. Для сравнения, 67% клонов C8DEL были классифицированы как стабильные, и только 33% были нестабильными, как показано в таблице 9:

Таблица 9
Результаты исследования на стабильность
Клеточная линия Стабильные клоны Нестабильные клоны
Родительская клеточная линия (12 недель) 24% 76%
C8DEL (делеция гена FAM60A в результате хромосомного разрыва) (12 недель) 67% 33%

P-величина 0,0002 была вычислена с применением критерия χ2 с поправкой Йетса, что указывает на то, что клоны, происходящие от C8DEL, обнаруживали значительно более выраженную тенденцию к стабильному продуцированию продукта. Таким образом, для клеточной линии C8DEL было выявлено значительно большее число стабильно продуцирующих клонов. Этот эксперимент в совокупности с нокаут-экспериментами, описанными в примере 5, еще раз подтвердил, что клетки хомячка, такие как клетки СНО, в которых была делетирована часть теломерной области хромосомы 8, также содержащая ген FAM60A, обладают превосходной стабильностью. Таким образом, использование такой клеточной линии для рекомбинантной экспрессии повышает шанс идентифицировать рекомбинантные клетки, обладающие высокой продуктивностью и хорошей стабильностью. Кроме того, была проналализирована волюметрическая продуктивность указанных клонов (см. 4.3.).

4.3. Дополнительные анализы свойств C8DEL

Свойства клеточной линии CHO, имеющей делецию в теломерной области хромосомы 8, где указанная делеция содержит ген FAM60A, а также ген C12orf35, были проанализированы в дополнительных экспериментах, которые продемонстрировали другие преимущества указанной клеточной линии.

Для отбора высокопродуктивных клеток требуется клонирование по меньшей мере одной клетки

После клонирования одной клетки, большую часть составляли высокопродуктивные клоны клеточной линии C8DEL с преимущественными свойствами. Было обнаружено, что пулы C8DEL имеют большее число высокопродуктивных клеток (что приводит к увеличению волюметрического титра пула) по сравнению с родительской клеточной линией, происходящей от CHO-K1. После клонирования одной клетки из пула C8DEL с применением FACS-технологии, было отобрано значительно большее число клонов, экспрессирующих большие количества антител, по сравнению с пулами, происходящими от родительской клеточной линии. В таблице 10 показано, что большинство клонов, происходящих от родительской клеточной линии, имели волюметрический «титр в 96 лунках» 0-20 мг/л. В противоположность этому, большинство клонов, происходящих от клеточной линии C8DEL, имели средний волюметрический титр 80-100 мг/л, что значительно превышает предыдущие значения. Одним из преимуществ использования пулов C8DEL является меньшее число клонов, достаточное для получения сравнимого количества высокопродуктивных и стабильных клонов. Это позволяет значительно снизить затраты на скрининг.

Таблица 7
Титр в 96 лунках (мг/л) Родительская клеточная линия C8DEL
0-20 80,3% 0,8%
20-40 6,1% 3,1%
40-60 5,4% 5,3%
60-80 6,1% 28,2%
80-100 1,4% 32,1%
100-120 0,0% 17,6%
120-140 0,7% 7,6%
140-160 0,0% 3,1%
160-180 0,0% 1,5%
180-200 0,0% 0,8%

С использованием клеточной линии C8DEL в качестве клеточной линии-продуцента можно получить не только большое количество высокопродуктивных клонов, но также увеличить волюметрический титр отдельных клонов C8DEL. Результаты, полученные в примере 2, показали, что такое увеличение выхода продукта, вероятно, обусловлено делецией гена C12orf35. На фиг. 8 показан волюметрический титр 45 самых высокопродуктивных клонов, происходящих от родительской клеточной линии CHO-K1 (все они являются Ipo8-позитивными), и клона C8DEL, экспрессирующего антитело (результаты анализа на стабильность указанных показаны в разделе 4.2). Как уже указывалось, средний волюметрический титр клонов, происходящих от клеточной линии C8DEL, был выше по сравнению с родительской клеточной линией, и кроме того, клоны, продуцирующие самые высокие уровни антител, происходили от клеточной линии C8DEL.

Пригодность для культивирования в биореакторе

Были проведены дополнительные тесты для оценки клеточной линии C8DEL по сравнению с родительской клеточной линией, происходящей от CHO-K1, inter alia, в целях определения ее пригодности для промышленного продуцирования. Культивирование в биореакторе показало, что клеточная линия C8DEL является подходящей для промышленного продуцирования. Клеточная линия C8DEL, культивированная в биореакторах, имела плотность популяции жизнеспособных клеток, достаточную для крупномасштабного продуцирования. Кроме того, было обнаружено, что жизнеспособность клеточной линии C8DEL превышает жизнеспособность родительской клеточной линии. В целом, клеточная линия C8DEL является подходящей для промышленного продуцирования, и ее жизнеспособность превышает жизнеспособность родительской клеточной линии, от которой она происходит. Жизнеспособность клеточной линии C8DEL сохраняется в течение более длительного периода времени и на более высоком уровне.

Увеличение периода времени, начиная с трансфекции до стабильного продуцирования пула

Другим преимуществом клеточной линии C8DEL является более быстрое восстановление клеток после отбора с использованием MTX. Восстановление пулов после инкубирования с MTX осуществляется на 7-8 дней раньше, чем для родительской клеточной линии, в которой часть теломерной области хромосомы 8, содержащей ген FAM60A, не была делетирована. В целом, было обнаружено, что разрушение клетки было значительно меньше в случае клеток согласно изобретению.

Пример 5: Отбор с использованием фолатного рецептора в качестве селективного маркера

Клеточную линию C8DEL использовали в различных экспериментах вместе с рецептором фолиевой кислоты в качестве селективного маркера, и применение указанной комбинированной системы отбора имеет конкретные преимущества. В частности, такой комбинированный отбор с использованием фолатного рецептора и DHFR в качестве селективных маркеров является предпочтительным. В данном случае, трансфецированные клетки содержат человеческий фолатный рецептор альфа и DHFR в качестве селективных маркеров и экспрессируют антитело. При отборе родительской клеточной линии с использованием очень небольших количеств фолиевой кислоты (50 нМ фолиевой кислоты (FA)/50 нМ MTX) возникают определенные проблемы, связанные с жесткостью отбора (клетки не всегда восстанавливаются), и в таких условиях жесткости, комбинация C8DEL и фолатного рецептора, используемого в качестве селективного маркера, является очень эффективной и способствует значительному увеличению волюметрического титра. В таблице 11 указаны различия волюметрических титров для родительской клеточной линии и для C8DEL, а также указано дальнейшее увеличение волюметрического титра, которое может быть достигнуто в стадии отбора с использованием фолатного рецептора в качестве селективного маркера в комбинации с небольшими количествами фолиевой кислоты вместо 500 нМ MTX. Таким образом, использование описанных здесь клеток млекопитающих, в которых снижается или блокируется экспрессия гена FAM60A и гена C12orf35, в комбинации с системой отбора с использованием фолатного рецептора/DHFR, позволяет проводить отбор в очень жестких условиях, которые не требуют введения больших количеств токсических агентов.

Таблица 11
Клеточная линия Условия отбора Титр пула (mAb г/л), периодическая культура в шейкерной колбе
Родительская клеточная линия, происходящая от CHO-K1 0,8 г/л G418/500 нМ MTX Приблизительно 0,07
C8DEL 0,8 г/л G418/500 нМ MTX Приблизительно 0,83
C8DEL 50 нМ FA/50 нМ MTX Приблизительно 1,61

Кроме того, клетки C8DEL были трансфецированы (подвергнуты нуклеофекции) экспрессионным вектором, содержащим экспрессионный кластер, включающий полинуклеотид, кодирующий человеческий фолатный рецептор альфа, и экспрессионный кластер, включающий полинуклеотид, кодирующий DHFR. Таким образом, оба селективных маркера FR-альфа и DHFR находились на одном и том же экспрессионном векторе. Кроме того, экспрессионный вектор, содержал экспрессионный кластер, включающий полинуклеотид, кодирующий легкую цепь антитела, и экспрессионный кластер, включающий полинуклеотид, кодирующий тяжелую цепь антитела. Экспрессионный кластер для тяжелой цепи антитела был сконструирован так, чтобы часть тяжелой цепи экспрессировалась посредством считывания стоп-кодона в виде заякоренного на мембране гибрида, что облегчает FACS-отбор (см. выше). Было протестировано пять различных условий отбора с использованием 100 нМ фолиевой кислоты (FA) и различных концентраций MTX. Состав селективной среды систематизирован в нижеследующей таблице 12. После отбора, отобранные клеточные пулы переносили в полную среду и культивировали в шейкерных колбах в виде периодических культур. На 13-й день культивирования были взяты образцы культуральной среды и проанализированы на содержание антитела с помощью ВЭЖХ на белке A. Эти результаты также показаны в таблице 12.

Таблица 12
Условия отбора Приблизительная концентрация антитела [г/л]
100 нМ FA/без MTX 0,13
100 нМ FA/1 нМ MTX 0,12
100 нМ FA/5 нМ MTX 0,46
100 нМ FA/10 нМ MTX 1,44
100 нМ FA/50 нМ MTX 1,57

Как можно видеть из таблицы, концентрация MTX, составляющая по меньшей мере 5 нМ, является предпочтительной для отбора. Повышение жесткости условий отбора также приводит к увеличению волюметрического пула титра. Таким образом, волюметрическая продуктивность антитела значительно повышается. Кроме того, по сравнению со стандартными условиями отбора с использованием МТХ, в процессе указанного отбора могут быть использованы значительно более низкие концентрации MTX. Это является важным преимуществом, если учесть, что МТХ представляет собой токсический агент. Кроме того, был проведен анализ для того, чтобы определить, как условия жесткости отбора влияют на волюметрические титры пула и на время отбора. Было обнаружено, что повышение жесткости отбора путем увеличения концентрации MTX увеличивает время восстановления. Таким образом, жесткость отбора может быть скорректирована в зависимости от различных целей применения (время зависит от волюметрического титра).

Кроме того, анализ пулов, полученных после отбора с использованием фолиевой кислоты/МТХ на поверхностную экспрессию антитела с помощью FACS, показал, что использование этой системы отбора в комбинации с новой клеточной линией приводит к значительному увеличению числа высокопродуктивных клеток в клеточном пуле, на что указывают профили флуоресценции, проиллюстрированные на фиг. 9A-E. Концентрация MTX была увеличена от A до E (A: без MTX; B: 1 нМ MTX; C: 5 нМ MTX; D: 10 нМ MTX; E: 50 нМ MTX). При увеличении концентрации MTX, число клеточных клонов с высоким уровнем экспрессии в клеточном пуле повышалось, на что указывает увеличение размера пика с правой стороны (более высокая интенсивность флуоресценции коррелирует с более высоким уровнем экспрессии антитела). Использование 50 нМ фолиевой кислоты в комбинации с 10 нМ MTX (см. фиг. 9D) уже приводит к получению клеточного пула, содержащего преимущественно высокопродуктивные клеточные клоны (один доминантный пик с правой стороны). Кроме того, при увеличении концентрации MTX до 50 нМ (см. фиг. 9E), в полученном пуле будут содержаться почти исключительно высокопродуктивные клетки. Эти результаты являются достойными внимания, поскольку с использованием клеточной линии C8DEL в комбинации с системой отбора фолатный рецептор/DHFR можно получить профиль пула, который, как показал FACS-анализ, будет больше напоминать профиль пула клеточного клона (содержащего генетически идентичные клетки), чем профиль клеточного пула (содержащего генетически отличающиеся клетки). Очевидно, что делеция гена C12orf35, имеющаяся в делетированной теломерной области клеточной линии C8DEL, будет приводить к значительному повышению волюметрической продуктивности, а поэтому большинство клеток в клеточных пулах, полученных после отбора с использованием фолиевой кислоты/МТХ в соответствующих условиях, будут представлять собой высокопродуктивные клетки в соответствии с FACS-профилями.

Кроме того, было обнаружено, что при культивировании стабильно трансфецированных клонов, полученных из клеточной линии C8DEL (ген FAM60A был делетирован, см. выше), в селективной среде (50 нМ фолиевой кислоты, 10 нМ MTX), стабильность будет составлять до 80%, а в перспективе, она может достигнуть почти 100%. Достаточно высокая стабильность также достигалась в полуселективной среде, которая содержала только ограниченную концентрацию фолиевой кислоты (50нМ), и не содержала MTX. В этом случае, стабильность такой клеточной линии составляла до 87%. В некоторых экспериментах, стабильность составляла почти 100%.

Пример 6: Способ подтверждения идентификации высокопродуктивных и стабильных продуцентов исходя из профиля экспрессии

Был разработан аналитический ОТ-ПЦР-анализ в реальном времени для предсказания продуктивности и стабильности клона на ранеей стадии исследования. ОТ-ПЦР-анализ в реальном времени был проведен для четырех генов: C12orf35, Dennd5b, FAM60A и Ipo8 (все эти гены расположены в теломерной области на плече q хромосомы 8). После отбора и получения клона было проанализировано несколько сотен клонов, стабильно экспрессирующих антитело в качестве представляющего интерес полипептида на присутствие и уровень экспрессии этих четырех генов в теломерной области хромосомы 8 и на выход продукта экспрессии. Наблюдалась четкая корреляция между стабильностью, волюметрической продуктивностью и потерей теломерной области хромосомы 8. Было проведено исследование для определения корреляции между стабильностью и присутствием теломерной области хромосомы 8. Клоны были классифицированы как стабильные, если они не утрачивали более, чем 25% волюметрического титра через 12 недель. Существует значительная корреляция между утратой теломерной области хромосомы 8 и стабильностью клона (p-величина 4,67E-06 была вычислена с применением критерия χ2). Впоследствии, такая потеря теломерной области на хромосоме 8 может быть использована в качестве средства для предсказания стабильности. Анализ на присутствие или отсутствие теломерной области хромосомы 8, проводимый посредством ОТ-ПЦР в реальном времени, повышает вероятность отбора большего числа стабильных клонов в экспериментальном проекте.

Кроме того, путем анализа нескольких сотен клонов, в которых отсутствует часть теломерной области хромосомы 8, было обнаружено, что в имеющейся теломерной области хромосомы 8 может быть индуцировано несколько точек разрыва. В большинстве проанализированных случаев, точки разрыва расположены со стороны центромеры по отношению к гену Ipo8. Точки разрыва были также детектированы между FAM60A и Ipo8. Во всех случаях делетированная область содержит ген C12orf35 (который расположен со стороны теломеры по отношению к гену, кодирующему метилтрансферазо-подобный белок 20), что ассоциируется с высокой волюметрической продуктивностью.

1. Выделенная клетка-хозяин млекопитающего для рекомбинантного продуцирования представляющего интерес продукта, где геном клетки млекопитающего модифицируют так, чтобы функция белка FAM60A ингибировалась в указанной клетке в результате снижения или блокирования функциональной экспрессии гена FAM60A посредством нокаута гена, мутации гена, делеции гена, сайленсинга гена или любой их комбинации, где белок FAM60A имеет последовательность, которая по меньшей мере на 75% идентична одной или более аминокислотным последовательностям, представленным в SEQ ID NO:1, 2, 3, 4, 6, 7 и 8, и где указанная клетка содержит интегрированный в ее геном по меньшей мере один гетерологичный полинуклеотид, кодирующий представляющий интерес продукт, содержащийся в экспрессионном кластере, где представляющим интерес продуктом является полипептид, и где ингибирование функции белка FAM60A повышает стабильность экспрессии представляющего интерес продукта в указанной клетке.

2. Выделенная клетка-хозяин млекопитающего по п.1, где клетка млекопитающего имеет одно или более из нижеследующих свойств:

а) ген FAM60A имеет одну или более мутаций, способствующих образованию нефункционального или низкофункционального продукта экспрессии;

b) по меньшей мере одна копия гена FAM60A делетирована или функционально инактивирована в геноме клетки млекопитающего;

с) часть хромосомы является делетированной, где делетированная часть содержит ген FAM60A.

3. Выделенная клетка-хозяин млекопитающего по п.1, где клетка млекопитающего имеет одно или более из нижеследующих свойств:

а) клеткой млекопитающего является клетка грызуна;

b) клеткой млекопитающего является клетка хомячка;

c) клеткой млекопитающего является клетка СНО;

d) клетка млекопитающего представляет собой клеточный клон или клеточную линию;

e) клетка млекопитающего экспрессирует эндогенный DHFR и фолатный рецептор.

4. Выделенная клетка-хозяин млекопитающего по п.2с), где:

а) клеткой млекопитающего является клетка хомячка, и по меньшей мере часть теломерной области хромосомы 8 является делетированной, где указанная делетированная часть содержит ген FAM60A; или

b) клеткой млекопитающего является мышиная клетка, и по меньшей мере часть теломерной области хромосомы 6 является делетированной, где указанная делетированная часть содержит ген FAM60A.

5. Выделенная клетка-хозяин млекопитающего по п.4, где выделенная клетка-хозяин млекопитающего обладает одним или более из нижеследующих свойств:

i) делетированная теломерная область содержит ген FAM60A и один или более генов, выбранных из генов Caprin2 и Ipo8;

ii) делеция индуцируется хромосомным разрывом, и точка разрыва расположена со стороны центромеры по отношению к гену Ipo8;

iii) делеция индуцируется хромосомным разрывом, и точка разрыва расположена со стороны центромеры по отношению к гену Ipo8 в гене Tmtc1;

iv) по меньшей мере часть теломерной области делетирована в обеих хромосомах соответствующей хромосомной пары, где делетированные части содержат ген FAM60A.

6. Выделенная клетка-хозяин млекопитающего по п. 1, где эндогенный белок FAM60A представляет собой белок, имеющий последовательность, которая по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентична одной или более аминокислотным последовательностям, представленным в SEQ ID NO:1, 2, 3, 4, 6, 7 и 8, и/или

где в указанной клетке также ингибируется функция продукта экспрессии гена C12orf35, где ген C12orf35 представляет собой ген, кодирующий белок, имеющий последовательность, которая по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентична одной или более аминокислотным последовательностям, представленным в SEQ ID NO:10-16, или белок, кодируемый последовательностью SEQ ID NО:17.

7. Выделенная клетка-хозяин млекопитающего по п. 1, где клетка млекопитающего содержит стабильно интегрированный в ее геном по меньшей мере один гетерологичный полинуклеотид, кодирующий представляющий интерес продукт, и по меньшей мере один гетерологичный полинуклеотид, кодирующий селективный маркер или репортерный полипептид, где указанные гетерологичные полинуклеотиды присутствуют в одном и том же экспрессионном векторе или в различных экспрессионных векторах.

8. Выделенная клетка-хозяин млекопитающего по п. 1, имеющая одно или более из нижеследующих свойств:

а) клетка млекопитающего секретирует указанный представляющий интерес полипептид в клеточную культуральную среду; и/или

b) представляющим интерес продуктом является полипептид, выбранный из терапевтического полипептида и диагностического полипептида.

9. Выделенная клетка-хозяин млекопитающего по 1, происходящая от популяции соответствующих клеток, где, в среднем, по меньшей мере 40%, а предпочтительно, по меньшей мере 50% клеток, происходящих от указанной популяции соответствующих клеток, не теряют более чем 30%, предпочтительно, 25% своего титра (волюметрического) экспрессии за период времени 8 недель, предпочтительно, 10 недель, а еще более предпочтительно, 12 недель.

10. Способ отбора клетки-хозяина, которая рекомбинантно экспрессирует представляющий интерес продукт, где представляющим интерес продуктом является полипептид, и где указанный способ включает:

(a) получение клеток млекопитающего по одному или нескольким пп. 1-9, в качестве клеток-хозяев; и

(b) отбор одной или более клеток-хозяев, экспрессирующих представляющий интерес продукт.

11. Способ по п.10, имеющий одну или более из следующих характерных особенностей:

а) указанные клетки-хозяева, используемые в стадии (a), дополнительно содержат по меньшей мере один гетерологичный полинуклеотид, кодирующий селективный маркер, а стадия (b) включает культивирование указанного множества клеток-хозяев в условиях отбора, подходящих для селективного маркера;

b) указанные клетки-хозяева, используемые в стадии (a), включают по меньшей мере два гетерологичных полинуклеотида, каждый из которых кодирует селективный маркер, где первым селективным маркером является фолатный рецептор, а вторым селективным маркером является DHFR, и где стадия (b) включает культивирование указанного множества клеток-хозяев в селективной культуральной среде, содержащей фолат в лимитирующей концентрации и ингибитор DHFR;

c) гетерологичные полинуклеотиды вводят в клетки млекопитающего путем трансфекции одним или более экспрессионными векторами;

d) стадия (b) включает проведение множества стадий отбора;

e) стадия (b) включает проведение отбора на основе проточной цитометрии;

f) выбранные клетки-хозяева рекомбинантно экспрессируют молекулу иммуноглобулина.

12. Способ рекомбинантного продуцирования представляющего интерес продукта, где представляющим интерес продуктом является полипептид, и где указанный способ включает использование клетки-хозяина млекопитающего по одному или нескольким пп. 1-9 в качестве клетки-хозяина для рекомбинантной экспрессии представляющего интерес продукта, и где указанный способ также включает:

(a) культивирование клеток-хозяев по одному или нескольким пп.1-9 в условиях для экспрессии представляющего интерес продукта; и

(b) выделение представляющего интерес продукта из клеточной культуральной среды и/или из указанных клеток-хозяев.

13. Способ по п.12, который также включает:

(c) обработку выделенного представляющего интерес продукта.

14. Способ по п.12, имеющий одну или более из следующих характерных особенностей:

a) клеткой млекопитающего является клетка грызуна;

b) представляющим интерес продуктом является полипептид, выбранный из терапевтического полипептида и диагностического полипептида;

c) представляющим интерес продуктом является полипептид, а клетка-хозяин секретирует представляющий интерес полипептид в клеточную культуральную среду; и/или

d) для получения продукта используется клетка-хозяин млекопитающего, в которой также ингибируется функция продукта экспрессии гена C12orf35, где ген C12orf35 представляет собой ген, кодирующий белок, имеющий последовательность, которая по меньшей мере на 75% гомологична или идентична одной или более аминокислотным последовательностям, представленным в SEQ ID NO:10-16, или белок, кодируемый последовательностью SEQ ID NО:17.

15. Способ продуцирования клетки-хозяина млекопитающего для рекомбинантного продуцирования представляющего интерес продукта по одному или нескольким пп. 1-9, включающий модификацию генома клетки млекопитающего для ингибирования функции белка FAM60A в указанной клетке и стабильную трансфекцию указанной клетки по меньшей мере одним экспрессионным вектором, включающим полинуклеотид, кодирующий представляющий интерес продукт, который присутствует в экспрессионном кластере, где представляющим интерес продуктом является полипептид.

16. Способ анализа клеток млекопитающего на возможность их использования в качестве клеток-хозяев для рекомбинантной экспрессии представляющего интерес продукта, где указанный способ включает прямой или непрямой анализ на ингибирование функции FAM60A в указанных клетках, где белок FAM60A по меньшей мере на 75% идентичен одной или более аминокислотным последовательностям, представленным в SEQ ID NO:1, 2, 3, 4, 6, 7 и 8,

где указанный способ также включает отбор по меньшей мере одной клетки, где функциональная экспрессия FAM60A ингибируется в указанной клетке в результате снижения или блокирования функциональной экспрессии гена FAM60A посредством нокаута гена, мутации гена, делеции гена, сайленсинга гена или любой их комбинации, осуществляемых для рекомбинантной экспрессии представляющего интерес продукта, и где ингибирование функции белка FAM60A повышает стабильность экспрессии представляющего интерес продукта в указанной клетке.

17. Способ по п.16, имеющий одну или более из следующих характерных особенностей, где:

а) прямой анализ включает анализ на снижение или блокирование функциональной экспрессии гена FAM60A в указанных клетках;

b) перед проведением анализа клетки млекопитающего обрабатывают агентом, индуцирующим хромосомный разрыв, и где указанный анализ проводят для того, чтобы определить, может ли обработка указанным агентом приводить к делеции части хромосомы, включающей ген FAM60A;

с) перед проведением анализа клетки млекопитающего трансфецируют гетерологичным полинуклеотидом, кодирующим представляющий интерес продукт, и гетерологичным полинуклеотидом, кодирующим селективный маркер, где перед проведением анализа осуществляют по меньшей мере одну стадию отбора для идентификации успешно трансфецированных клеток-хозяев;

d) указанный способ включает проведение дополнительного прямого или непрямого анализа на ингибирование функции продукта экспрессии эндогенного гена C12orf35 в указанных клетках, где ген C12orf35 представляет собой ген, кодирующий белок, имеющий последовательность, которая по меньшей мере на 75%, по меньшей мере на 80%, по меньшей мере на 85%, по меньшей мере на 90%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98% или по меньшей мере на 99% идентична одной или более аминокислотным последовательностям, представленным в SEQ ID NO:10-16, или белок, кодируемый SEQ ID NО:17;

е) клетками являются клетки грызуна;

f) клетками являются клетки хомячка, где указанный способ включает анализ на блокирование или снижение экспрессии одного или более генов, расположенных в теломерной области хромосомы 8 и выбранных из группы, состоящей из гена Tmtc1 и генов, расположенных со стороны теломеры по отношению к гену Tmtc1, где данный анализ позволяет осуществить анализ на снижение или блокирование экспрессии гена FAM60A в указанных клетках;

g) множество клеточных клонов анализируют для дифференциации стабильных и нестабильных клеточных клонов, где один или более клеточных клонов отбирают в качестве продуктивного клона, в котором снижается или блокируется функциональная экспрессия гена FAM60A;

h) множество клеточных клонов анализируют для дифференциации стабильных и нестабильных клеточных клонов и высокопродуктивных и низкопродуктивных клеточных клонов, где один или более клеточных клонов, в которых снижается или блокируется функциональная экспрессия гена FAM60A, отбирают в качестве продуктивного клона.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к способам получения рекомбинантного полипептида нейротрофина посредством расщепления прополипептида нейротрофина IgA-протеазой, где эндогенный сайт ферментативного расщепления между просегментом и полипептидом нейротрофина заменен сайтом расщепления IgA-протеазой.

Изобретение относится к области биотехнологии, конкретно к получению выделенной клетки млекопитающего, подходящей для рекомбинантной экспрессии интересующего полипептида, где клетку млекопитающего изменяют для ухудшения функции эндогенной протеазы матриптазы посредством нокаута, мутации, делеции или сайленсинга гена матриптазы.

Изобретение относится к способу получения нового пептидного противогрибкового антибиотика эмерициллипсина А, продуцируемого штаммом Emericellopsis alkalina F -1428, с противогрибковой активностью в отношении С.glabrata 1402м, Aspergillus ochraceus 497м 2015, а также Bipolaris hawaiiensis 988м 2015 и Aspergillus terreus 1133м 2011, обладающих природной резистентностью ко всем применяемым в химиотерапии антибиотикам - азолам.

Изобретение относится к микробиологической промышленности и может быть использовано для получения белковой биомассы. Предлагается штамм бактерий Methylococcus capsulatus, депонированный во Всероссийской коллекции микроорганизмов ИБФМ им.

Изобретение относится к ферментативному синтезу L-нуклеиновых кислот в присутствии полимеразы. Предложен способ добавления одного или нескольких L-нуклеотидов к 3’-концу L-нуклеиновой кислоты, включающий стадию проведения реакции одного или нескольких L-нуклеотидов с L-нуклеиновой кислотой в присутствии полимеразы, где указанная полимераза способна добавлять один или несколько L-нуклеотидов к 3’-концу указанной L-нуклеиновой кислоты, при этом указанная полимераза состоит из аминокислотной последовательности, причём аминокислоты указанной аминокислотной последовательности представляют собой D-аминокислоты.
Изобретение относится к микробиологической промышленности, в частности к штамму дрожжей Metschnikowia pulcherrima ВКПМ Y-4339 - продуценту микробного белка и этанола. Предложенный штамм Metschnikowia pulcherrima ВКПМ Y-4339 неприхотливый к культивированию и хранению, обладает невысокой температурой размножения, обеспечивает высокий прирост биомассы при получении микробного белка, а также высокий выход этанола..

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков, и может быть использовано для получения рекомбинантного фолликулостимулирующего гормона человека (рчФСГ).

Изобретение относится к клеточным технологиям и может быть использовано для рекомбинантного получения фолликулостимулирующего гормона (ФСГ) человека. Клеточную линию huFSHKKc6 получают путем трансформации клеток huFSHIK экспрессионной плазмидой длиной 7719 п.о., состоящей из гена устойчивости PuroR с SV40 polyA, укороченного 3'LTR HIV-1, гена устойчивости AmpR, промотора AmpR, ориджина репликации SV40 и pBR322, промотора NP гена р53 человека, pgk - конститутивного промотора гена фосфоглицераткиназы, синтетической нуклеотидной последовательности, кодирующей полноразмерную альфа-субъединицу ФСГ человека, сигнала терминации трансляции, состоящего из 3 пар оснований и консенсусной сигнальной последовательности Козак.

Группа изобретений относится к области биотехнологии. Предложен способ получения рекомбинантного белка и его выделения (варианты).

Изобретение относится к пептидам для улучшения памяти, способности к обучению и когнитивных способностей. Подтверждено, что пептид с C-концевой областью, заканчивающейся GAG, обладает эффектом улучшения памяти.

Настоящее изобретение относится к области иммунологии. Предложены выделенная молекула нуклеиновой кислоты, кодирующая анти-CD19 химерный антигенный рецептор, выделенная молекула анти-CD19 химерный антигенный рецептор, а также гуманизированный анти-CD19-связывающий домен.

Группа изобретений относится к области биотехнологии. Предложен устройство и способ самоотбора относительно высокоподвижных морфологически нормальных сперматозоидов с высокой целостностью ДНК из неочищенной или необработанной семенной жидкости.

Изобретение относится к области биотехнологии, а именно к увеличению количества плюрипотентных клеток в популяции неэмбриональных дифференцированных соматических клеток и восстановлению нервной функции у субъекта с неврологическим повреждением.

Изобретение относится к области биохимии, в частности к способу модификации целевого геномного локуса на Y-хромосоме в мышиной эмбриональной стволовой клетке (ЭС). При этом способ предусматривает: обеспечение мышиной ЭС клетки, содержащей целевой геномный локус на Y-хромосоме, причем целевой геномный локус содержит сайт распознавания для нуклеазного агента, и где мышиная ЭС клетка находится в культуре, содержащей основную среду DMEM, введение в мышиную ЭС клетку нуклеазного агента или полинуклеотида, кодирующего нуклеазный агент, причем нуклеазный агент индуцирует одно- или двухцепочечный разрыв на сайте распознавания, и большого нацеливающего вектора, содержащего полинуклеотидную вставку, и идентификацию по меньшей мере одной мышиной ЭС клетки, содержащей в своем геноме полинуклеотидную вставку, интегрированную в целевой геномный локус.

Изобретение относится к биохимии. Описано применение in vitro модифицированных лимфоцитов, содержащих вектор для регулируемой экспрессии белка, обладающего функцией интерлейкина-12 (IL-12) для лечения опухоли у млекопитающего, причем указанный вектор содержит полинуклеотид, кодирующий переключатель гена, где указанный генный переключатель содержит: (a) по меньшей мере одну последовательность транскрипционного фактора, причем указанная по меньшей мере одна последовательность транскрипционного фактора кодирует лиганд-зависимый транскрипционный фактор, функционально связанный с промотором; и (b) полинуклеотид, кодирующий белок, обладающий функцией IL-12, связанный с промотором, который активируется указанным лиганд-зависимым транскрипционным фактором; причем указанный полинуклеотид, кодирующий указанный белок, обладающий функцией IL-12, кодирует белок, который по меньшей мере на 85% идентичен человеческому IL-12 дикого типа, и при этом указанный лиганд вводят в эффективном количестве через или менее чем через 24 часа после внутриопухолевой доставки эффективного количества указанных лимфоцитов.

Группа изобретений относится к иммунологии, в частности к антителам и их антиген-связывающим фрагментам, специфически связывающимся с PD-1, а также к способам применения таких антител и антиген-связывающих фрагментов, в частности, для лечения рака и инфекционного заболевания, ассоциированных с экспрессией PD-1.

Изобретение относится к области биотехнологии, конкретно к химерным антигенным рецепторам, нацеленным на CD123 (CD123CAR), и может быть использовано в медицине для лечения острого миелоидного лейкоза (AML).

Изобретение относится к области биотехнологии, а именно к клеточным технологиям, может также быть использовано в медицине и ветеринарии. Предложен способ модификации пролиферативной активности клеточных культур млекопитающих с применением D-аспарагина.

Изобретение относится к способу получения полоксамера для применения в клеточной культуральной среде. Твердый полоксамер нагревают до 60-185°C до образования жидкого полоксамера.
Изобретение относится к медицине, а именно к биотехнологии, и может быть использовано для получения и концентрирования микроРНК-содержащих экзосом мультипотентных мезенхимально-стромальных клеток.

Изобретение относится к области биохимии, в частности к способу модификации целевого геномного локуса на Y-хромосоме в мышиной эмбриональной стволовой клетке (ЭС). При этом способ предусматривает: обеспечение мышиной ЭС клетки, содержащей целевой геномный локус на Y-хромосоме, причем целевой геномный локус содержит сайт распознавания для нуклеазного агента, и где мышиная ЭС клетка находится в культуре, содержащей основную среду DMEM, введение в мышиную ЭС клетку нуклеазного агента или полинуклеотида, кодирующего нуклеазный агент, причем нуклеазный агент индуцирует одно- или двухцепочечный разрыв на сайте распознавания, и большого нацеливающего вектора, содержащего полинуклеотидную вставку, и идентификацию по меньшей мере одной мышиной ЭС клетки, содержащей в своем геноме полинуклеотидную вставку, интегрированную в целевой геномный локус.

Изобретение относится к новым эукариотическим клеткам, подходящим для рекомбинантного продуцирования представляющего интерес продукта, где геном клетки-хозяина модифицируют для ингибирования функция белка FAM60A в указанной клетке, например, посредством снижения или блокирования функциональной экспрессии гена FAM60A, что приводит к повышению ее стабильности. Кроме того, настоящее изобретение относится к технологиям рекомбинантного продуцирования, в которых используются такие клетки-хозяева. Изобретение позволяет повысить уровень продуцирования полипептида. 5 н. и 12 з.п. ф-лы, 9 ил., 12 табл., 6 пр.

Наверх