Растение кукурузы dbn9858, устойчивое к гербициду, и нуклеотидная последовательность и способ для ее выявления

Изобретение относится к области биохимии, в частности к молекуле нуклеиновой кислоты. Также раскрыты способы выявления присутствия нуклеиновой кислоты в образце, способ получения трансгенного растения кукурузы, способ культивирования трансгенного растения кукурузы, способ борьбы с сорняками, способ защиты растений, с помощью указанной нуклеиновой кислоты. Раскрыты набор для детекции ДНК, растительная клетка, часть растения, пищевой продукт кормовой продукт, наполнитель, косметический препарат, содержащий указанную молекулу нуклеиновой кислоты. Изобретение позволяет получать трансгенные растения, устойчивые к гербициду. 14 н. и 10 з.п. ф-лы, 2 ил., 7 табл., 6 пр.

 

По настоящей заявке испрашивается приоритет китайской патентной заявки № 201510219911,8, зарегистрированной 30 апреля 2015 года, и озаглавленной «Растение кукурузы DBN9858, устойчивое к гербициду, а также нуклеотидная последовательность и способ для ее выявления», содержание которой включено, таким образом, в качестве ссылки.

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к последовательности нуклеиновой кислоты для выявления растения кукурузы DBN9858, устойчивого к гербициду, и способ для ее выявления, и в частности, к растению кукурузы DBN9858, устойчивому к глифосату и глуфосинату, и к способу для выявления того, содержит ли биологический образец молекулу ДНК из конкретного трансгенного объекта кукурузы DBN9858.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

N-фосфонометилглицин, также называемый глифосат, представляет собой системный, длительного действия, стерилизующий гербицид широкого спектра. Глифосат является конкурентным ингибитором фосфоенолпирувата (PEP), который представляет собой синтетический субстрат 5-енолпирувилшикимат-3-фосфата (EPSPS), и может ингибировать превращение обоих субстратов, PEP и 3-фосфошикимата, в 5-енолпирувилшикимат-3-фосфошикимат с катализом EPSPS, таким образом, блокируя синтетический путь шикимовой кислоты, которая является синтетическим предшественником ароматической аминокислоты, и нарушая синтез белка, что вызывает гибель растений и бактерий.

Устойчивость к глифосату можно реализовать при помощи экспрессии модифицированного EPSPS. Модифицированный EPSPS демонстрирует меньшую аффинность к глифосату. Как таковой, в присутствии глифосата, EPSPS сохраняет свою каталитическую активность, и, таким образом, достигается устойчивость к глифосату.

Кукуруза (Zea mays L.) является основной продовольственной культурой во многих регионах мира. Для продукции кукурузы важным агротехническим признаком является устойчивость к гербицидам, в частности, устойчивость к гербициду глифосату. Устойчивость кукурузы к гербициду глифосату можно получать путем экспрессии гена устойчивости к глифосату (EPSPS, CP4) в растении кукурузы посредством трансгенного способа, например, трансгенный объект кукурузы NK603, трансгенный объект кукурузы MON88017 и т.п.

В последнее время широкое применение устойчивой к глифосату системы культивирования и повышение использования глифосата привели к преобладанию глифосат-устойчивых сорняков. При столкновении с глифосат-устойчивыми сорняками или в регионах, которые превращаются в те, где борьба с видами сорняков более сложна, фермер может компенсировать слабость глифосата путем смешивания с другим гербицидом или путем альтернативного использования другого гербицида, способного бороться с пропущенными сорняками.

Глуфосинат представляет собой несистемный, неселективный, гербицид из фосфинотрициновых гербицидов. Он, в основном, используется для послевсходовой борьбы с однолетними или многолетними широколистными сорняками, и борется с сорняками путем необратимого ингибирования L-фосфинотрицина (активный ингредиент в глуфосинате) на глутаминсинтазе (ферменте, необходимом для обезвреживания аммиака у растений). В отличие от глифосата, который убивает корни, глуфосинат предпочтительно убивает листья и может быть перенесен в ксилему растения путем растительной транспирации, а по быстроте действия находится между паракватом и глифосатом.

Фермент фосфинотрицин-N-ацетилтрансфераза (PAT), выделенный из Streptomyces, катализирует превращение L-фосфинотрицина в его неактивную форму путем ацетилирования. Ген, экспрессирующий PAT, в форме, оптимизированной для растений, был использован у сои, чтобы придать сое устойчивость к гербициду глуфосинату, например, трансгенный объект сои A5547-127. Таким образом, гербицид глуфосинат, применяемый в комбинации с признаком устойчивости к глуфосинату, может быть неселективным способом для эффективной борьбы с глуфосинат-устойчивыми сорняками.

Между тем, при масштабном культивировании трансгенной кукурузы, устойчивой к насекомым, небольшое количество выживших насекомых/вредителей может развить устойчивость после размножения в течение нескольких поколений. В качестве неустойчивой к насекомым трансгенной кукурузы, гербицид-устойчивая трансгенная кукуруза, культивируемая в определенной пропорции с устойчивой к насекомым трансгенной кукурузой может замедлить развитие устойчивости у насекомых/вредителей.

Известно, что на экспрессию экзогенных генов внутри растения влияет их положение на хромосомах, что может быть связано с тем, что структура хроматина (такого как гетерохроматин) или транскрипционного регуляторного элемента (такого как энхансер) находится близко к сайту интеграции. Таким образом, обычно необходимо проводить скрининг большого количества трансгенных объектов для выявления трансгенного объекта, который можно вывести на рынок (то есть объект, в котором введенный ген, представляющий интерес, производит оптимальную экспрессию). Например, в растениях и других организмах наблюдали, что уровень экспрессии введенного гена значительно варьирует от одного объекта к другому; также могут быть различия в пространственных и временных паттернах экспрессии, например, различие в относительной экспрессии трансгена в различных тканях растения, которое заключается в том, что фактический профиль экспрессии может отличаться от профиля экспрессии, ожидаемого в соответствии с транскрипционным регуляторным элементом в конструкции, введенной с геном. Таким образом, как правило, необходимо производить сотни различных трансгенных объектов и проводить скрининг каждого отдельного объекта, имеющего ожидаемый уровень и профиль экспрессии трансгена, для коммерциализации таких объектов. Объект, имеющий ожидаемый уровень и профиль экспрессии трансгена, можно использовать для проникновения трансгена в другое генетическое окружение через половое скрещивание особей разных видов путем общепринятого способа скрещивания. Потомство, полученное путем такой гибридизации, может сохранять признак экспрессии трансгена, как в исходном трансформанте. С помощью этой стратегии можно гарантировать, что многие сорта будут иметь надежную экспрессию гена, и эти сорта можно хорошо адаптировать к местным условиям роста.

Было бы полезно иметь возможность обнаруживать присутствие определенного события для того, чтобы определять содержит ли потомство от полового скрещивания ген, представляющий интерес. Кроме того, способ для выявления конкретного события был бы также полезен для соблюдения соответствующих правил, например, пищевые продукты, полученные от рекомбинантных сельскохозяйственных культур, требуют официального одобрения и маркировки перед выводом на рынок. Можно обнаруживать присутствие трансгена любым хорошо известным способом детекции полинуклеотидов, таким как полимеразная цепная реакция (ПЦР) или ДНК-гибридизация с использованием полинуклеотидных зондов. Эти способы детекции, как правило, сфокусированы на часто используемых генетических элементах, таких как промоторы, терминаторы, маркерные гены, и т.д. В результате такие способы могут быть бесполезными для различения различных событий, в частности, тех, которые получены с использованием той же самой конструкции ДНК, если только не известна последовательность хромосомной ДНК («фланкирующей ДНК»), прилежащей к вставленной ДНК трансгена. Таким образом, в настоящее время, конкретный трансгенный объект часто идентифицируют путем ПЦР с парой праймеров, перекрывающих соединение между вставленным трансгеном и фланкирующей ДНК, и, конкретно, с первым праймером, содержащим фланкирующую последовательность, и вторым праймером, содержащим последовательность вставки.

СУЩНОСТЬ

Целью настоящего изобретения является создание последовательности нуклеиновой кислоты для выявления растения кукурузы DBN9858, устойчивого к гербициду, и способ для ее выявления, в котором трансгенный объект кукурузы DBN9858 имеет лучшую устойчивость к гербициду глифосату и гербициду глуфосинату, и способ детекции может точно и быстро выявлять, содержит ли биологический образец молекулу ДНК из конкретного трансгенного объекта кукурузы DBN9858.

Для достижения вышеуказанной цели, настоящее изобретение относится к последовательности нуклеиновой кислоты, содержащей по меньшей мере 11 последовательных нуклеотидов в SEQ ID NO: 3 или комплементарную им последовательность, и/или по меньшей мере 11 последовательных нуклеотидов в SEQ ID NO: 4 или комплементарную им последовательность.

Предпочтительно, последовательность нуклеиновой кислоты содержит SEQ ID NO: 1 или комплементарную ей последовательность, и/или SEQ ID NO: 2 или комплементарную ей последовательность.

Дополнительно, последовательность нуклеиновой кислоты содержит SEQ ID NO: 3 или комплементарную ей последовательность, и/или SEQ ID NO: 4 или комплементарную ей последовательность.

Еще дополнительно, последовательность нуклеиновой кислоты содержит SEQ ID NO: 5 или комплементарную ей последовательность.

SEQ ID NO: 1 или комплементарная ей последовательность представляет собой последовательность, которая имеет 22 нуклеотида в длину, расположенную возле места соединения вставки на 5'-конце последовательности вставки в трансгенном объекте кукурузы DBN9858, и охватывает фланкирующую последовательность геномной ДНК у участка вставки и последовательность ДНК на 5'-конце последовательности вставки. Включение SEQ ID NO: 1 или комплементарной ей последовательности может быть идентифицировано как присутствие трансгенного объекта кукурузы DBN9858. SEQ ID NO: 2 или комплементарная ей последовательность представляет собой последовательность, которая имеет 22 нуклеотида в длину, расположенную возле места соединения вставки на 3'-конце последовательности вставки в трансгенном объекте кукурузы DBN9858, и охватывает фланкирующую последовательность геномной ДНК у участка вставки и последовательность ДНК на 3'-конце последовательности вставки. Включение SEQ ID NO: 2 или комплементарной ей последовательности может быть идентифицировано как присутствие трансгенного объекта кукурузы DBN9858.

В настоящем изобретении, последовательность нуклеиновой кислоты может составлять по меньшей мере 11 или более последовательных нуклеотидов в любой части последовательности трансгенной вставки в SEQ ID NO: 3 или комплементарной ей последовательности (первая последовательность нуклеиновой кислоты), или по меньшей мере 11 или более последовательных нуклеотидов в любой части 5'-области из фланкирующей ДНК генома кукурузы в SEQ ID NO: 3 или комплементарной ей последовательности (вторая последовательность нуклеиновой кислоты). Последовательность нуклеиновой кислоты может дополнительно быть частью, гомологичной или комплементарной SEQ ID NO: 3, содержащей полную SEQ ID NO: 1. Когда первую последовательность нуклеиновой кислоты и вторую последовательность нуклеиновой кислоты используют вместе, эти последовательности нуклеиновой кислоты можно использовать в качестве пары ДНК-праймеров в способе амплификации ДНК для получения продукта амплификации. Когда продукт амплификации, произведенный способом амплификации ДНК с использованием пары ДНК-праймеров, представляет собой продукт амплификации, содержащий SEQ ID NO: 1, может быть диагностировано присутствие трансгенного объекта кукурузы DBN9858 или его потомства. Как хорошо известно специалистам в данной области, первая и вторая последовательности нуклеиновой кислоты не обязательно полностью состоят из ДНК, и могут включать РНК, смесь ДНК и РНК, или сочетание ДНК, РНК или других нуклеотидов или их аналогов, которые не функционируют как матрицы для одной или нескольких полимераз. Кроме того, зонд или праймер по настоящему изобретению должны иметь по меньшей мере приблизительно 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 или 22 последовательных нуклеотида в длину, и их можно выбирать из нуклеотидных последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 и SEQ ID NO: 5. Когда зонд и праймер выбраны из нуклеотидных последовательностей, предложенных в SEQ ID NO: 3, SEQ ID NO: 4 и SEQ ID NO: 5, они могут иметь по меньшей мере приблизительно от 21 до приблизительно 50 или более последовательных нуклеотидов в длину. SEQ ID NO: 3 или комплементарная ей последовательность представляет собой последовательность, которая имеет 1301 нуклеотид в длину, расположенную возле места соединения вставки на 5'-конце последовательности вставки в трансгенном объекте кукурузы DBN9858. SEQ ID NO: 3 или комплементарная ей последовательность состоит из фланкирующей последовательности геномной ДНК кукурузы, которая имеет 1067 нуклеотидов в длину (нуклеотиды 1-1067 в SEQ ID NO: 3), последовательности ДНК-конструкции DBN10006, которая имеет 89 нуклеотидов в длину (нуклеотиды 1068-1156 в SEQ ID NO: 3) и последовательность ДНК на 5'-конце промотора pr35S, которая имеет 145 нуклеотидов в длину (нуклеотиды 1157-1301 в SEQ ID NO: 3). Включение SEQ ID NO: 3 или комплементарной ей последовательности может быть идентифицировано как присутствие трансгенного объекта кукурузы DBN9858.

Последовательность нуклеиновой кислоты может содержать по меньшей мере 11 или более последовательных нуклеотидов в любой части последовательности трансгенной вставки в SEQ ID NO: 4 или комплементарной ей последовательности (третья последовательность нуклеиновой кислоты), или по меньшей мере 11 или более последовательных нуклеотидов в любой части 3'-области фланкирующей геномной ДНК кукурузы в SEQ ID NO: 4 или комплементарной ей последовательности (четвертая последовательность нуклеиновой кислоты). Последовательность нуклеиновой кислоты может дополнительно являться частью, гомологичной или комплементарной SEQ ID NO: 4, которая содержит полную SEQ ID NO: 2. Когда третью последовательность нуклеиновой кислоты и четвертую последовательность нуклеиновой кислоты используют вместе, эти последовательности нуклеиновой кислоты можно использовать в качестве пары ДНК-праймеров в способе амплификации ДНК для получения продукта амплификации. Когда продукт амплификации, произведенный способом амплификации ДНК с использованием пары ДНК-праймеров, представляет собой продукт амплификации, содержащий SEQ ID NO: 2, может быть диагностировано присутствие трансгенного объекта кукурузы DBN9858 или его потомства. SEQ ID NO: 4 или комплементарная ей последовательность представляет собой последовательность, которая имеет 1310 нуклеотиды в длину, расположенную возле места соединения вставки на 3'-конце последовательности вставки в трансгенном объекте кукурузы DBN9858. SEQ ID NO: 4 или комплементарная ей последовательность состоит из последовательности терминатора tNos, которая имеет 164 нуклеотида (нуклеотиды 1-164 в SEQ ID NO: 4), последовательности ДНК-конструкции DBN10006, которая имеет 84 нуклеотида (нуклеотиды 165-248 в SEQ ID NO: 4), и фланкирующей последовательности геномной ДНК, которая имеет 1062 нуклеотида, в сайте интеграции кукурузы (нуклеотиды 249-1301 в SEQ ID NO: 4). Включение SEQ ID NO: 4 или комплементарной ей последовательности может быть идентифицировано как присутствие трансгенного объекта кукурузы DBN9858.

SEQ ID NO: 5 или комплементарная ей последовательность представляет собой последовательность, которая имеет 6890 нуклеотидов в длину, для характеристики трансгенного объекта кукурузы DBN9858, и, в частности, содержит геномы и генетические элементы, как показано в таблице 1. Включение SEQ ID NO: 5 или комплементарной ей последовательности может быть идентифицировано как присутствие трансгенного объекта кукурузы DBN9858.

Таблица 1. Геномы и генетические элементы в SEQ ID NO: 5

Генетические элементы/Геномы Длина (п.н.) Расположение в SEQ ID NO: 5
Геном на 5'-конце 1067 1-1067
LB 89 1068-1156
pr35S 530 1157-1686
cPAT 552 1706-2257
t35S 195 2279-2473
prOsAct1 1411 2479-3889
spAtCTP2 228 3890-4117
cEPSPS 1368 4118-5485
tNos 253 5492-5744
RB 84 5745-5828
Геном на 3'-конце 1062 5829-6890

Последовательность нуклеиновой кислоты или комплементарную ей последовательность можно использовать в способе амплификации ДНК для получения ампликона, который выявляется как диагностика присутствия трансгенного объекта кукурузы DBN9858 или его потомства в биологическом образце; и последовательность нуклеиновой кислоты или комплементарную ей последовательность можно использовать в способе детекции нуклеотидов, для выявления присутствия трансгенного объекта кукурузы DBN9858 или его потомства в биологическом образце.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу для выявления присутствия ДНК трансгенного объекта кукурузы DBN9858 в образце, включающему:

контакт образца для детекции по меньшей мере с двумя праймерами в реакции амплификации нуклеиновых кислот;

проведение реакции амплификации нуклеиновых кислот; и

выявление наличия продукта амплификации;

где продукт амплификации содержит по меньшей мере 11 последовательных нуклеотидов в SEQ ID NO: 3 или комплементарной ей последовательности, или по меньшей мере 11 последовательных нуклеотидов в SEQ ID NO: 4 или комплементарной ей последовательности.

Дополнительно, продукт амплификации содержит последовательные нуклеотиды в положениях 1-11 или в положениях 12-22 в SEQ ID NO: 1 или комплементарной ей последовательности, или последовательные нуклеотиды в положениях 1-11 или в положениях 12-22 в SEQ ID NO: 2 или комплементарной ей последовательности.

Еще дополнительно, продукт амплификации содержит SEQ ID NO: 1 или комплементарную ей последовательность, SEQ ID NO: 2 или комплементарную ей последовательность, SEQ ID NO: 6 или комплементарную ей последовательность, или SEQ ID NO: 7 или комплементарную ей последовательность.

В вышеописанных технических растворах, праймеры содержат по меньшей мере одну из последовательностей нуклеиновой кислоты.

Конкретно, праймер содержит первый праймер, выбранный из SEQ ID NO: 8 и SEQ ID NO: 10, и второй праймер, выбранный из SEQ ID NO: 9 и SEQ ID NO: 11.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу для выявления присутствия ДНК трансгенного объекта кукурузы DBN9858 в образце, включающему:

контакт образца для детекции с зондом, содержащим по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 3 или комплементарной ей последовательности, или по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 4 или комплементарной ей последовательности;

гибридизацию образца для детекции с зондами в жестких условиях гибридизации; и

выявление гибридизации образца для детекции с зондом.

Жесткие условию могут включать гибридизацию в растворе 6×SSC (цитрата натрия), 0,5% SDS (додецилсульфата натрия) при 65°C, с последующей однократной отмывкой мембраны 2×SSC, 0,1% SDS, и 1×SSC, 0,1% SDS, соответственно.

Дополнительно, зонд содержит последовательные нуклеотиды в положениях 1-11 или в положениях 12-22 из SEQ ID NO: 1, или последовательные нуклеотиды в положениях 1-11 или в положениях 12-22 в SEQ ID NO: 2.

Еще дополнительно, зонд содержит SEQ ID NO: 1 или комплементарную ей последовательность, SEQ ID NO: 2 или комплементарную ей последовательность, SEQ ID NO: 6 или комплементарную ей последовательность, или SEQ ID NO: 7 или комплементарную ей последовательность.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу для выявления присутствия ДНК трансгенного объекта кукурузы DBN9858 в образце, включающему:

контакт образца для детекции с маркерными молекулами нуклеиновой кислоты, содержащими по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 3 или комплементарной ей последовательности, или по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 4 или комплементарной ей последовательности;

гибридизацию образца для детекции с маркерными молекулами нуклеиновой кислоты в жестких условиях гибридизации; и

выявление гибридизации образца для детекции с маркерными молекулами нуклеиновой кислоты, для определения того, связана ли генетически устойчивость к глифосату и/или устойчивость к глуфосинату с маркерными молекулами нуклеиновой кислоты путем анализа скрещивания при помощи маркера.

Дополнительно, маркерные молекулы нуклеиновой кислоты содержат последовательные нуклеотиды в положениях 1-11 или в положениях 12-22 из SEQ ID NO: 1, или последовательные нуклеотиды в положениях 1-11 или в положениях 12-22 из SEQ ID NO: 2.

Еще дополнительно, маркерные молекулы нуклеиновой кислоты содержат SEQ ID NO: 1 или комплементарную ей последовательность, SEQ ID NO: 2 или комплементарную ей последовательность, SEQ ID NO: 6 или комплементарную ей последовательность, или SEQ ID NO: 7 или комплементарную ей последовательность.

Необязательно по меньшей мере один из зондов мечен по меньшей мере одной флуоресцентной группой.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к набору для детекции ДНК, содержащему по меньшей мере молекулу ДНК, которая содержит по меньшей мере 11 последовательных нуклеотидов в последовательности, гомологичной SEQ ID NO: 3 или комплементарной ей последовательности, или по меньшей мере 11 последовательных нуклеотидов в последовательности, гомологичной SEQ ID NO: 4 или комплементарной ей последовательности, и подходит в качестве ДНК-праймера или зонда, специфичного к трансгенному объекту кукурузы DBN9858 или его потомству.

Дополнительно, молекула ДНК содержит последовательные нуклеотиды в положениях 1-11 или в положениях 12-22 из SEQ ID NO: 1 или комплементарной ей последовательности, или последовательные нуклеотиды в положениях 1-11 или в положениях 12-22 из SEQ ID NO: 2 или комплементарной ей последовательности.

Еще дополнительно, молекула ДНК содержит последовательность, гомологичную SEQ ID NO: 1 или комплементарной ей последовательности, последовательность, гомологичную SEQ ID NO: 2 или комплементарной ей последовательности, последовательность, гомологичную SEQ ID NO: 6 или комплементарной ей последовательности, или последовательность, гомологичную SEQ ID NO: 7 или комплементарной ей последовательности.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к растительной клетке, содержащей: последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глифосату EPSPS, последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глуфосинату PAT и последовательность нуклеиновой кислоты в определенной области, содержащую последовательность, предложенную в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 или SEQ ID NO: 7.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу для получения растения кукурузы, имеющего устойчивость к гербициду глифосату, включающему: введение последовательности нуклеиновой кислоты, кодирующей белок устойчивости к глифосату EPSPS и последовательности нуклеиновой кислоты в определенной области в геном растения кукурузы, где последовательность нуклеиновой кислоты в определенной области содержит по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Конкретно, способ для получения растения кукурузы, имеющего устойчивость к гербициду глифосату, включает:

половое скрещивание первого родительского растения кукурузы трансгенного объекта кукурузы DBN9858 с устойчивостью к гербициду глифосату со вторым родительским растением кукурузы без устойчивости к гербициду глифосату, для получения большого числа растений-потомков;

обработка растений-потомков гербицидом глифосатом; и

отбор устойчивых к глифосату растений-потомков.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу для получения растения кукурузы, имеющего устойчивость к гербициду глуфосинату, включающему: введение последовательности нуклеиновой кислоты, кодирующей белок устойчивости к глуфосинату PAT и последовательности нуклеиновой кислоты в определенной области в геном растения кукурузы, где последовательность нуклеиновой кислоты в определенной области содержит по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из последовательностей, предложенных SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Конкретно, способ для получения растения кукурузы, имеющего устойчивость к гербициду глуфосинату, включает:

половое скрещивание первого родительского растения кукурузы трансгенного объекта кукурузы DBN9858 с устойчивостью к гербициду глуфосинату со вторым родительским растением кукурузы без устойчивости к гербициду глуфосинату, для получения большого числа растений-потомков;

обработка растений-потомков гербицидом глуфосинатом; и

отбор устойчивых к глуфосинату растений-потомков.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу для получения растения кукурузы, имеющего устойчивость к гербициду глифосату и гербициду глуфосинату, включающему введение последовательности нуклеиновой кислоты, кодирующей белок устойчивости к глифосату EPSPS, последовательности нуклеиновой кислоты, кодирующей белок устойчивости к глуфосинату PAT и последовательности нуклеиновой кислоты в определенной области в геном растения кукурузы, где последовательность нуклеиновой кислоты в определенной области содержит по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из последовательностей, предложенных SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Конкретно, способ для получения растения кукурузы, имеющего устойчивость к гербициду глифосату и гербициду глуфосинату, включает:

половое скрещивание первого родительского растения кукурузы трансгенного объекта кукурузы DBN9858 с устойчивостью к гербициду глифосату и гербициду глуфосинату со вторым родительским растением кукурузы без устойчивости к гербициду глифосату и/или гербициду глуфосинату, для получения большого числа растений-потомков;

обработка растений-потомков гербицидом глифосатом и гербицидом глуфосинатом; и

отбор устойчивых к глифосату и глуфосинату растений-потомков.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу культивирования растения кукурузы, имеющему устойчивость к гербициду глифосату, включающему:

посадку по меньшей мере одного семени кукурузы, которое содержит в своем геноме последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глифосату EPSPS, и последовательность нуклеиновой кислоты в определенной области;

выращивание кукурузного семени до растения кукурузы;

опрыскивание растения кукурузы эффективной дозой гербицида глифосата, и сбор растения со сниженным повреждением растений по сравнению с другими растениями, не имеющими последовательности нуклеиновой кислоты в определенной области;

где последовательность нуклеиновой кислоты в определенной области является по меньшей мере одной последовательностью нуклеиновой кислоты, выбранной из последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу культивирования растения кукурузы, имеющему устойчивость к гербициду глуфосинату, включающему:

посадку по меньшей мере одного семени кукурузы, которое содержит в своем геноме последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глуфосинату PAT, и последовательность нуклеиновой кислоты в определенной области;

выращивание кукурузного семени до растения кукурузы;

опрыскивание растения кукурузы эффективной дозой гербицида глуфосината, и сбор растения со сниженным повреждением растений по сравнению с другими растениями, не имеющими последовательности нуклеиновой кислоты в определенной области;

где последовательность нуклеиновой кислоты в определенной области является по меньшей мере одной последовательностью нуклеиновой кислоты, выбранной из последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу культивирования растения кукурузы, имеющему устойчивость к гербициду глифосату и гербициду глуфосинату, включающему:

посадку по меньшей мере одного семени кукурузы, которое содержит в своем геноме последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глифосату EPSPS, последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глуфосинату PAT, и последовательность нуклеиновой кислоты в определенной области;

выращивание кукурузного семени до растения кукурузы;

опрыскивание растения кукурузы эффективной дозой гербицида глуфосината и гербицида глуфосината, и сбор растения со сниженным повреждением растений по сравнению с другими растениями, не имеющими последовательности нуклеиновой кислоты в определенной области;

где последовательность нуклеиновой кислоты в определенной области является по меньшей мере одной последовательностью нуклеиновой кислоты, выбранной из последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу для защиты растений от повреждений, вызванных гербицидом, включающему нанесение гербицида, содержащего эффективную дозу глифосата и/или глуфосината на поле, где посажено по меньшей мере одно трансгенное растение кукурузы, где трансгенное растение кукурузы содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7, и трансгенное растение кукурузы имеет устойчивость к гербициду глифосату и/или гербициду глуфосинату.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу борьбы с сорняками на поле, включающему нанесение гербицида, содержащего эффективную дозу глифосата и/или глуфосината на поле, где посажено по меньшей мере одно трансгенное растение кукурузы, где трансгенное растение кукурузы содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7, и трансгенное растение кукурузы имеет устойчивость к гербициду глифосату и/или гербициду глуфосинату.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу для борьбы с сорняками, усточивыми к глифосату на поле с растениями, устойчивыми к глифосату, включающему нанесение гербицида, содержащего эффективную дозу глуфосината, на поле, где посажено по меньшей мере одно трансгенное растение кукурузы, устойчивое к глифосату, где трансгенное растение кукурузы, устойчивое к глифосату, содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7, и трансгенное растение кукурузы, устойчивое к глифосату, имеет также устойчивость к гербициду глуфосинату.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к способу для замедления развития устойчивости у насекомых, включающему посадку по меньшей мере одного трансгенного растения кукурузы с устойчивостью к глифосату и/или глуфосинату на поле, где посажено растение кукурузы с устойчивостью к насекомым, где трансгенное растение кукурузы с устойчивостью к глифосату и/или глуфосинату содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Для достижения вышеуказанной цели, настоящее изобретение дополнительно относится к сельскохозяйственному продукту или товару, содержащему полинуклеотид из SEQ ID NO: 1 или SEQ ID NO: 2, где сельскохозяйственный продукт или товар представляет собой кукурузную муку грубого помола, кукурузную муку тонкого помола, кукурузное масло, кукурузный крахмал, кукурузный глютен, кукурузный жмых, косметический препарат или наполнитель.

Для последовательности нуклеиновой кислоты для выявления растения кукурузы, устойчивого к гербициду, и способа для выявления последовательности по настоящему изобретению, следующие определения и способы могут лучше определить настоящее изобретение и направить специалиста в данной области в практическом осуществлении настоящего изобретения. Если не указано иное, термины следует понимать в соответствии с общепринятым употреблением для специалиста в данной области.

«Кукуруза» относится к Zea mays, и включает все сорта растений, которые могут скрещиваться с кукурузой, включая дикие виды кукурузы.

Термины «содержащий» и «включающий» относятся к «включая в качестве неограничивающих примеров».

Термин «растение» включает растения целиком, растительные клетки, органы растений, протопласты растений, культуры растительных клеток и тканей, из которых может быть восстановлено растение, каллюсы растений, побеги растений и интактные растительные клетки в растениях или части растений, такие как зародыш, пыльца, семязачатки, семена, листья, цветы, побеги, плоды, стебли, корни, корневые кончики, пыльники и т.п. Следует понимать, что часть трансгенного растения в объеме настоящего изобретения в качестве неограничивающих примеров относится к растительным клеткам, протопластам, тканям, каллюсам, зародышам, а также цветам, стеблям, плодам, листья и корни, и частям растения, указанным выше, которые получены от трансгенных растений или их потомков, которые ранее были трансформированы молекулой ДНК по настоящему изобретению и, таким образом по меньшей мере частично состоят из трансгенных клеток.

Термин «ген» относится к фрагменту нуклеиновой кислоты, который экспрессирует конкретный белок, включая регуляторные последовательности до (5'-некодирующие последовательности) и после (3'-некодирующие последовательности) кодирующей последовательности. «Нативный ген» относится к гену, который встречается в природе со своими регуляторными последовательностями. «Химерный ген» относится к любому гену, который не является нативным геном, включая регуляторные и кодирующие последовательности, которые не встречаются вместе в природе. «Эндогенный ген» относится к нативному гену в его природном расположении в геноме организма. «Экзогенный ген» относится к гену, который в настоящее время присутствует, но изначально отсутствовал в геноме организма, и также относится к гену, который вводят в клетку-реципиент путем трансгенных этапов. Экзогенный ген может содержать нативный ген или химерный ген, который введен в не-природный организм. «Трансген» представляет собой ген, который был введен в геном способом трансформации. Участок в растительном геноме, куда была введена рекомбинантная ДНК, может быть обозначен как «участок вставки» или «сайт-мишень».

«Фланкирующая ДНК» может включать геном, в норме встречающийся в организме, таком как растение, или экзогенную (гетерологичную) ДНК, веденную путем трансформации, такую как фрагмент, связанный с событием трансформации. Таким образом, фланкирующая ДНК может содержать сочетание нативной ДНК и экзогенной ДНК. В настоящем изобретении, «фланкирующая область» или «фланкирующая последовательность» или «геномная пограничная область» или «геномная пограничная последовательность» относится к последовательности по меньшей мере из 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500 или 5000 пар оснований или более, которая расположена непосредственно до или после экзогенной молекулы ДНК, вставленной изначально, и прилегает к экзогенной молекуле ДНК, вставленной изначально. При расположении до вставки, фланкирующая область может также быть обозначена как «левая пограничная фланкирующая» или «3'-фланкирующая» или «3'-геномная пограничная область» или «геномная 3'-пограничная последовательность», и т.п. При расположении после вставки, фланкирующая область может также быть обозначена как «правая пограничная фланкирующая» или «5'-фланкирующая» или «5'- геномная пограничная область» или «геномная 5'-пограничная последовательность», и т.п.

Способы трансформации, приводящие к случайной интеграции экзогенной ДНК, будут приводить к трансформантам, содержащим различные фланкирующие области, характерные и уникальные для каждого трансформанта. Когда рекомбинантную ДНК вводят в растение посредством обычного скрещивания, ее фланкирующие области, как правило, не будут меняться. Трансформанты будут также содержать уникальные соединения между участком вставки гетерологичной ДНК и геномной ДНК или двумя участками геномной ДНК, или двумя участками гетерологичной ДНК. «Соединение» представляет собой точку, в которой соединяются два конкретных фрагмента ДНК. Например, соединение возникает, когда ДНК вставки соединяется с фланкирующей ДНК. Точка соединения также возникает в трансформированном организме, когда два фрагмента ДНК соединяются вместе способом, который модифицирован по сравнению со способом, существующим в нативном организме. «Соединительная ДНК» или «область соединения» относится к ДНК, которая содержит точку соединения.

Настоящее изобретение относится к трансгенному объекту кукурузы, обозначаемому как DBN9858, и его потомству, где трансгенный объект кукурузы DBN9858 представляет собой растение кукурузы DBN9858, включая растения и семена трансгенного объекта кукурузы DBN9858, а также его растительные клетки или части, из которых он может быть восстановлен, включая в качестве неограничивающих примеров клетки, пыльцу, семязачатки, цветы, почки, корни, стебли, пестичные столбики, соцветия, початки, листья, и продукты из растения кукурузы DBN9858, такие как кукурузная мука грубого помола, кукурузная мука тонкого помола, кукурузное масло, жидкий кукурузный экстракт, кукурузные рыльца, кукурузный крахмал, и биомасса, остающаяся на полях кукурузы.

Трансгенный объект кукурузы DBN9858 по настоящему изобретению содержит конструкцию ДНК, и если конструкция экспрессируется в растительных клетках, трансгенный объект кукурузы DBN9858 производит устойчивость к гербицидам глифосату и глуфосинату. Конструкция ДНК содержит две экспрессирующих кассеты последовательно. Первая экспрессирующая кассета содержит подходящий промотор для экспрессии в растении, функционально связанный с геном, кодирующим 5-енолпирувилшикимат-3-фосфатсинтетазу (EPSPS) с устойчивостью к гербициду глифосату, и подходящую последовательность сигнала полиаденилирования. Вторая экспрессирующая кассета содержит подходящий промотор для экспрессии в растении, функционально связанный с геном, кодирующим фосфинотрицин-N-ацетилтрансферазу (PAT) с устойчивостью к гербициду глуфосинату, и подходящую последовательность сигнала полиаденилирования. Дополнительно, промотор может быть промотором, выделенным из растения, включая конститутивные, индуцибельные и/или тканеспецифические промоторы; подходящий промотор включает в качестве неограничивающих примеров промотор 35S вируса мозаики цветной капусты (CaMV), промотор 35S вируса мозаики норичника (FMV), промотор Tsf1, промотор убиквитина, промотор актина, промотор нопалинсинтазы (NOS) Agrobacterium tumefaciens, промотор октопинсинтазы (OCS), промотор желтой курчавости листьев Cestrum, промотор пататина, промотор рибулоза-1,5-бисфосфат карбоксилaзы/оксигеназы (RuBisCO), промотор глутатион S-трансферазы (GST), промотор E9, промотор GOS, промотор alcA/alcR, промотор RolD Agrobacterium rhizogenes и промотор Suc2 Arabidopsis. Последовательность сигнала полиаденилирования может быть подходящей последовательностью сигнала полиаденилирования, которая функционирует в растении, включая в качестве неограничивающих примеров последовательности сигнала полиаденилирования, полученные из гена нопалинсинтазы (NOS) Agrobacterium tumefaciens, терминатора 35S вируса мозаики цветной капусты (CaMV), терминатора E9 рибулоза-1,5-бисфосфат карбоксилaзы/оксигеназы гороха, гена ингибитора протеазы II (PIN II) и гена α-тубулина.

Кроме того, экспрессирующая кассета может дополнительно содержать другие генетические элементы, включая в качестве неограничивающих примеров энхансер и сигнальный пептид/транзитный пептид. Энхансер может повышать уровень экспрессии гена, включая в качестве неограничивающих примеров, активатор трансляции вируса гравировки табака (TEV), энхансер CaMV35S и энхансер FMV35S. Сигнальный пептид/транзитный пептид может направлять белок EPSPS и/или белок PAT к транспорту за пределы клетки или в конкретные органеллы или компартменты внутри клетки, например, нацеливать на хлоропласт при помощи последовательности, кодирующей хлоропластный транзитный пептид, или нацеливать на эндоплазматический ретикулум при помощи удерживающей последовательности «KDEL».

Ген 5-енолпирувилшикимат-3-фосфатсинтетазы (EPSPS) можно выделять и получать из штамма CP4 Agrobacterium tumefaciens sp., и можно модифицировать по полинуклеотиду, кодирующему EPSPS, способом оптимизации кодонов или другими способами, для того чтобы повысить стабильность и доступности транскрипта в трансформированной клетке. Ген 5-енолпирувилшикимат-3-фосфатсинтетазы (EPSPS) можно также использовать в качестве гена селективного маркера.

«Глифосат» относится к N-фосфонометилглицину и его соли, и обработка «гербицидом глифосатом» относится к обработке любым составом гербицида, содержащим глифосат. Выбор нормы использования определенного гербицида с глифосатом для получения эффективной биологической дозы находится в пределах навыков обычного технического специалиста в сельском хозяйстве. Обработка поля, содержащего растительные материалы, полученные от гербицид-устойчивых растений кукурузы DBN9858, любым составом гербицида, содержащим глифосат, будет бороться с ростом сорняков на поле, без воздействия на рост или продукцию растительных материалов, полученных от гербицид-устойчивых растений кукурузы DBN9858.

Ген фермента фосфинотрицин N-ацетилтрансферазы (PAT), выделенный из Streptomyces viridochromogenes, катализирует превращение L-фосфинотрицина в его неактивную форму путем ацетилирования, и, таким образом, придает растению устойчивость к гербициду глуфосинату. Фосфинотрицин (PTC, 2-амино-4-метилфосфономасляная кислота) является ингибитором глутаминсинтетазы. PTC является структурной единицей антибиотика 2-амино-4-метилфосфонил-аланил-аланина, трипептид которого (PTT) имеет свойство устойчивости к грамположительным бактериям и грамотрицательным бактериям, а также устойчивости к грибку Botrytis cinerea. Ген фосфинотрицин N-ацетилтрансферазы (PAT) можно использовать в качестве гена селективного маркера.

«Глуфосинат», также называемый «фосфинотрицин», относится к аммоний 2-амино-4-[гидрокси(метил)фосфонил]бутаноату, и обработка «гербицидом глуфосинатом» относится к обработке любым составом гербицида, содержащим глуфосинат. Выбор нормы использования определенного гербицида с глуфосинатом для получения эффективной биологической дозы находится в пределах навыков обычного технического специалиста в сельском хозяйстве. Обработка поля, содержащего растительные материалы, полученные от гербицид-устойчивых растений кукурузы DBN9858, любым составом гербицида, содержащим глуфосинат, будет бороться с ростом сорняков на поле, без воздействия на рост или продукцию растительных материалов, полученных от гербицид-устойчивых растений кукурузы DBN9858.

Конструкцию ДНК вводят в растение при помощи способа трансформации, включая в качестве неограничивающих примеров трансформацию, опосредованную Agrobacterium, трансформацию, опосредованную генной пушкой, и трансформацию путем пыльцевых трубок.

Трансформация, опосредованная Agrobacterium, является распространенным способом для трансформации растений. Экзогенную ДНК, которую собираются вводить в растение, клонируют в вектор между правой и левой пограничными последовательностями, т.е., областями Т-ДНК. Вектором трансформируют клетку Agrobacterium, которую затем используют для заражения ткани растения, что позволяет векторным областям Т-ДНК, содержащим экзогенную ДНК, встроиться в геном растения.

Трансформация, опосредованная генной пушкой, представляет собой бомбардировку растительных клеток вектором, содержащим экзогенную ДНК (опосредованная частицами биолистическая трансформация).

Трансформация путем пыльцевых трубок заключается в том, что экзогенная ДНК переносится при помощи природного пути пыльцевых трубок (также называемого передающая ткань пыльцевых трубок), сформированного после опыления растения, посредством пути нуцеллуса в бластоцисту.

После трансформации трансгенное растение должно быть восстановлено из трансформированной растительной ткани, и произведен отбор потомства, имеющего экзогенную ДНК, при помощи подходящего маркера.

Конструкция ДНК представляет собой комбинацию молекул ДНК, которые соединены вместе, которая обеспечивает одну или несколько экспрессирующих кассет. Конструкция ДНК предпочтительно является плазмидой, которая способна к саморепликации внутри бактериальной клетки, и содержит различные участки узнавания рестрикционных эндонуклеаз для вставки молекул ДНК, обеспечивающих функциональные генетические элементы, т.е., промоторы, интроны, лидерные последовательности, кодирующие последовательности, 3'-терминаторные области и другие последовательности. Экспрессирующие кассеты, входящие в конструкцию ДНК, содержат генетические элементы, необходимые для того чтобы обеспечить транскрипцию матричной РНК, и могут быть сконструированы для экспрессии в прокариотических или эукариотических клетках. Наиболее предпочтительно, экспрессирующие кассеты по настоящему изобретению сконструированы для экспрессии в растительных клетках.

Трансгенный «объект» получают путем трансформации растительных клеток гетерологичной конструкцией ДНК, т.е., включает экспрессирующую кассету из нуклеиновой кислоты, содержащую интересующий ген, восстановление популяции растений, полученных в результате вставки путем трансгенного способа в геном растения, и селекцию конкретного растения, которое характеризуется вставкой в конкретном месте в геноме. Термин «объект» относится к исходному трансформанту и потомству трансформанта, которое содержит гетерологичную ДНК. Термин «объект» также относится к потомству, полученному путем полового скрещивания между трансформантом и индивидуумом из других видов, которое содержит гетерологичную ДНК. Даже после повторного обратного скрещивания с родителем, ДНК вставки и фланкирующая геномная ДНК от трансформанта-родителя также присутствует у потомства от скрещивания в том же самом расположении на хромосоме. Термин «объект» также относится к последовательности ДНК от исходного трансформанта, содержащей ДНК вставки и фланкирующую геномную последовательность непосредственно рядом с ДНК вставки, которая, как ожидается, будет перенесена потомству, полученному путем полового скрещивания между одной родительской линией, которая содержит ДНК вставки (например, исходный трансформант и потомство, полученное путем самоопыления) и родительской линией, которая не содержит ДНК вставки, и получающему ДНК вставки с геном, представляющим интерес.

В настоящем изобретении, «рекомбинантный» относится к форме ДНК и/или белка и/или организма, которая обычно не встречается в природе и, таким образом, получена путем ручного вмешательства. Такое ручное вмешательство может производить рекомбинантную молекулу ДНК и/или рекомбинантное растение. «Рекомбинантную молекулу ДНК» получают путем искусственной комбинации двух, в ином случае разделенных, сегментов последовательностей, например, путем химического синтеза или путем манипуляций с сегментами выделенной нуклеиновой кислоты путем генетической инженерии. Технологии для проведения манипуляций с нуклеиновыми кислотами хорошо известны.

Термин «трансгенный» включает любую клетку, линию клеток, каллюс, ткань, часть растения или растение, генотип которых был изменен за счет присутствия гетерологичной нуклеиновой кислоты, включая те трансгенные, которые были изменены так изначально, а также индивидуумы потомства, полученные путем полового скрещивания или бесполого размножения от исходных трансгенных. В настоящем изобретении, термин «трансгенный» не включает изменения генома (хромосомные или внехромосомные) путем общепринятых способов селекции растений или природных событий, таких как случайное опыление, нерекомбинантные вирусные заражения, нерекомбинантная трансформация бактериями, нерекомбинантная транспозиция или спонтанная мутация.

«Гетерогенный» в настоящем изобретении относится к той первой молекуле, которая, как правило, не встречается в виде комбинации со второй молекулой в природе. Например, молекула может быть получена из первого вида и вставлена в геном второго вида. Таким образом, такая молекула является гетерогенной по отношению к хозяину и искусственно вставлена в геном клетки-хозяина.

Трансгенный объект кукурузы DBN9858 с устойчивостью к гербициду глифосату и гербициду глуфосинату культивируют посредством этапов: первоначального полового скрещивания первого родительского растения кукурузы со вторым родительским растением кукурузы для получения разнообразных растений-потомков первого поколения, в котором первое родительское растение кукурузы состоит из растений кукурузы, культивируемых из трансгенного объекта кукурузы DBN9858 и его потомства, которые получены путем трансформации экспрессирующей кассетой по настоящему изобретению с устойчивостью к гербициду глифосату и гербициду глуфосинату, и у второго родительского растения кукурузы отсутствует устойчивость к гербициду глифосату и гербициду глуфосинату; а затем отбор растения-потомка с устойчивостью к применению к гербицида глифосата и/или гербицида глуфосината, которая позволяет культивировать растения кукурузы с устойчивостью к гербициду глифосату и гербициду глуфосинату. Эти этапы могут дополнительно включать обратное скрещивание растения-потомка с устойчивостью к гербициду глифосату и/или гербициду глуфосинату со вторым родительским растением кукурузы или с третьим родительским растением кукурузы; а затем селекцию потомства путем применения гербицида глифосата и/или гербицида глуфосината или путем выявления молекулярного маркера, коррелирующего с признаком (такого как молекула ДНК, содержащая участок соединения, который выявляется на 5'-конце и 3'-конце последовательности вставки в трансгенном объекте кукурузы DBN9858), таким образом, получение растений кукурузы с устойчивостью к гербициду глифосату и гербициду глуфосинату.

Следует также понимать, что два различных трансгенных растения можно также скрещивать для получения потомства, содержащего два отдельных и добавленных раздельно экзогенных гена. Самоопыление подходящего потомства может производить растения-потомки, гомозиготные по обоим добавленным экзогенным генам. Также можно предполагать обратное скрещивание с родительским растением и ауткроссинг с не-трансгенным растением, как описано выше, и бесполое размножение делает то же самое.

Трансгенные кукурузы Bt способны к уничтожению, например, насекомых/вредителей Lepidoptera и Coleoptera, но все же существует небольшое количество выживших насекомых/вредителей, которые после размножения в течение нескольких поколений возможно могут развиваться в насекомых/вредителей, устойчивых к белку Bt. Для того чтобы решить проблему развития устойчивости у насекомых/вредителей министерство охраны окружающей среды США предлагает следующее руководство по использованию трансгенных культур: необходимо обеспечить определенную долю кукуруз-укрытий (кукурузы-укрытия необходимы в различном количестве в зависимости от урожая, составляя 5%, 10%, 20% и т.п., и они могут быть трансгенными растениями кукурузы без устойчивости к насекомым (такими как трансгенные растения кукурузы, устойчивые к гербициду) или растениями кукурузы, устойчивыми к вредителям, не представляющим интерес, и необязательно трансгенными растениями кукурузы). После того, как большинство насекомых/вредителей будут уничтожены на соответствующих трансгенных растениях, устойчивых к насекомым, часть насекомых/вредителей все же выживет на кукурузах-укрытиях, обеспечивая доминирование популяции насекомых/вредителей с отсутствием устойчивости. Таким образом, даже если выживет небольшое количество устойчивых насекомых/вредителей, гены устойчивости будут значительно разбавлены после скрещивания с доминирующими насекомыми/вредителями с отсутствием устойчивости.

Термин «зонд» означает изолированную молекулу нуклеиновой кислоты, к которой присоединена общепринятая детектируемая метка или репортерная молекула, например, радиоактивный изотоп, лиганд, хемилюминесцентное вещество, или фермент. Такой зонд комплементарен цепи интересующей нуклеиновой кислоты, в случае по настоящему изобретению, цепи геномной ДНК от трансгенного объекта кукурузы DBN9858, будет ли геномная ДНК от трансгенного объекта кукурузы DBN9858 или семени, или от растения, или семени, или экстракта трансгенного объекта кукурузы DBN9858. Зонды по настоящему изобретению включают не только дезоксирибонуклеиновые или рибонуклеиновые кислоты, но также полиамиды и другие материалы для зондов, которые специфически связываются с интересующей последовательностью ДНК и которые можно использовать для выявления присутствия интересующей последовательности ДНК.

Термин «праймер» представляет собой часть изолированной молекулы нуклеиновой кислоты, которая отжигается на комплементарной цепи ДНК, представляющей интерес, путем гибридизации нуклеиновых кислот с образованием гибрида между праймером и цепью ДНК, представляющей интерес, а затем удлиняется вдоль цепи ДНК, представляющей интерес, при помощи полимеразы, например, ДНК-полимеразы. Пара праймеров по настоящему изобретению относится к их применению для амплификации последовательностей нуклеиновой кислоты, представляющей интерес, например, путем полимеразной цепной реакции (ПЦР) или других общепринятых способов амплификации нуклеиновых кислот.

Зонды и праймеры, как правило, имеют 11 или более полинуклеотидов в длину, предпочтительно, 18 или более полинуклеотидов, более предпочтительно, 24 или более полинуклеотидов, и наиболее предпочтительно, 30 или более полинуклеотидов. Такие зонды и праймеры специфически гибридизируются с интересующей последовательностью в условиях гибридизации с высокой жесткостью. Предпочтительно, зонды и праймеры по настоящему изобретению имеют полную идентичность последовательности с последовательностью нуклеиновой килосты, представляющей интерес, хотя зонды, отличающиеся от интересующей последовательности ДНК, которые сохраняют способность гибридизироваться с интересующими последовательностями ДНК, можно разрабатывать общепринятыми способами.

Праймеры и зонды на основе последовательностей фланкирующей геномной ДНК и вставки по настоящему изобретению можно подтверждать общепринятыми способами, например, путем выделения соответствующих молекул ДНК из растительного материала, полученного из трансгенного объекта кукурузы DBN9858, и определения последовательности нуклеиновой кислоты этой молекулы ДНК. Молекула ДНК содержит трансгенную вставленную последовательность и фланкирующую область генома кукурузы, фрагмент которых можно использовать в качестве праймера или зонда.

Зонды и праймеры из нуклеиновых кислот по настоящему изобретению гибридизируются при жестких условиях с интересующей последовательностью ДНК. Для выявления присутствия ДНК из трансгенного объекта кукурузы DBN9858 в образце можно использовать любой общепринятый способ гибридизации или амплификации нуклеиновых кислот. Молекулы нуклеиновой кислоты или их фрагменты способны к специфической гибридизации с другими молекулами нуклеиновой кислоты при определенных условиях. Как используют в настоящем документе, две молекулы нуклеиновой кислоты способны специфически гибридизироваться друг с другом, если две молекулы нуклеиновой кислоты способны к образованию антипараллельной, двухцепочечной структуры нуклеиновой кислоты. Молекула нуклеиновой кислоты является «комплементарной» другой молекуле нуклеиновой кислоты, если они демонстрируют полную комплементарность. Как используют в настоящем документе, молекулы демонстрируют «полную комплементарность», когда каждый нуклеотид одной из молекул комплементарен нуклеотиду другой молекулы. Две молекулы являются «минимально комплементарными», если они гибридизируются одна с другой с достаточной стабильностью, позволяющей им отжигаться одна на другой по меньшей мере при общепринятых условиях с «низкой жесткостью». Аналогично, молекулы являются «комплементарными», если они гибридизируются одна с другой с достаточной стабильностью, позволяющей им отжигаться одна на другой по меньшей мере при общепринятых условиях с «высокой жесткостью». Допустимы отступления от полной комплементарности, при условии, что такие отступления не полностью препятствуют способности двух молекул формировать двухцепочечную структуру. Для того чтобы молекула нуклеиновой кислоты служила в качестве праймера или зонда, ей необходимо только быть достаточно комплементарной по последовательности, чтобы быть способной формировать стабильную двухцепочечную структуру при использовании конкретного растворителя и концентраций солей.

Как применяют в настоящем изобретении, по существу гомологичная последовательность представляет собой последовательность нуклеиновой кислоты, которая способна специфически гибридизироваться с комплементарной цепью другой последовательности нуклеиновой кислоты, с которой она сопоставляется при условиях с высокой жесткостью. Подходящие условия жесткости, которые способствуют гибридизации ДНК, например, обработка 6,0× хлоридом натрия/цитратом натрия (SSC) приблизительно при 45°C, с последующим отмыванием 2,0×SSC при 50°C, хорошо известны специалистам в данной области. Например, концентрацию солей на этапе отмывки можно выбирать от низкой жесткости приблизительно 2,0×SSC при 50°C до высокой жесткости приблизительно 0,2×SSC при 50°C. Кроме того, температуру на этапе отмывки можно повысить от комнатной температуры при условиях с низкой жесткостью, приблизительно 22°C, до условий с высокой жесткостью приблизительно до 65°C. И температуру, и концентрацию солей можно менять; и либо температуру, либо концентрацию солей можно сохранять постоянной, в то время как другая переменная меняется. Предпочтительно, молекула нуклеиновой кислоты по настоящему изобретению будет специфически гибридизироваться с одной или несколькими молекулами нуклеиновой кислоты, предложенными в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7, или с комплементарными им последовательностями, или любым фрагментом вышеуказанных последовательностей при умеренно жестких условиях, например, приблизительно при 2,0×SSC и приблизительно 65°C. Дополнительно предпочтительно, молекула нуклеиновой кислоты по настоящему изобретению будет специфически гибридизироваться с одной или несколькими молекулами нуклеиновой кислоты, предложенными в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7, или с комплементарными им последовательностями, или любым фрагментом вышеуказанных последовательностей при условиях с высокой жесткостью. В настоящем изобретении, предпочтительная маркерная молекула нуклеиновой кислоты имеет последовательность нуклеиновой кислоты, предложенную в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7 или комплементарных им последовательностей, или любого фрагмента вышеуказанных последовательностей. Другая предпочтительная маркерная молекула нуклеиновой кислоты по настоящему изобретению имеет от 80% до 100%, или от 90% до 100% идентичности последовательности с SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7, или с комплементарными им последовательностями, или с любым фрагментом вышеуказанных последовательностей. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7 можно использовать в качестве маркеров для способов селекции растений для выявления потомства генетического скрещивания. Гибридизацию зонда с интересующей молекулой ДНК можно детектировать любым способом, хорошо известным специалистам в данной области, который в качестве неограничивающих примеров включает флуоресцентные метки, радиоактивные метки, метки на основе антител и хемилюминесцентные метки.

Что касается амплификации последовательностей нуклеиновой кислоты, представляющих интерес, (например, путем ПЦР) с использованием специфических праймеров для амплификации, «жесткие условия» представляют собой условия, которые позволяют праймерам гибридизироваться только с последовательностью нуклеиновой кислоты, представляющей интерес, в реакции термальной амплификации ДНК, в которой праймер, имеющий последовательность дикого типа (или комплементарную ей), соответствующую последовательности нуклеиновой кислоты, представляющей интерес, способен связываться с последовательностью нуклеиновой кислоты, представляющей интерес, и предпочтительно производить уникальный продукт амплификации, который представляет собой ампликон.

Термин «специфическое связывание с (последовательностью, представляющей интерес)» указывает на то, что зонд или праймер при жестких условиях гибридизации гибридизируется только с последовательностью, представляющей интерес, в образце, содержащем последовательность, представляющую интерес.

Как применяют в настоящем изобретении, «амплифицированная ДНК» или «ампликон» относится к продукту аплификации нуклеиновой кислоты из молекулы нуклеиновой кислоты, представляющей интерес, который является частью матрицы из нуклеиновой кислоты. Например, для того чтобы определить, получено ли растение кукурузы путем полового скрещивания с трансгенным объектом кукурузы DBN9858 по настоящему изобретению, или содержит ли образец кукурузы, собранный с поля, трансгенный объект кукурузы DBN9858, или содержит ли экстракт кукурузы, такой как неочищенный порошок, порошок или масло, трансгенный объект кукурузы DBN9858, ДНК, выделенную из образца ткани или экстракта растения кукурузы, можно подвергать способу амплификации нуклеиновых кислот с использованием пары праймеров для получения ампликона, который является диагностическим для ДНК трансгенного объекта кукурузы DBN9858. Пара праймеров включает первый праймер, полученный из фланкирующей последовательности в геноме растения, прилежащей к участку вставки из экзогенной ДНК, и второй праймер, полученный из вставки экзогенной ДНК. Ампликон имеет длину и последовательность, которые также являются диагностическими для трансгенного объекта кукурузы DBN9858. Длина ампликона может варьировать от сочетания длины пары праймеров плюс одна нуклеотидная пара оснований, предпочтительно, приблизительно плюс пятьдесят нуклеотидных пар оснований, более предпочтительно, приблизительно плюс двести пятьдесят нуклеотидных пар оснований, и наиболее предпочтительно, приблизительно плюс четыреста пятьдесят нуклеотидных пар оснований или больше.

Необязательно, пара праймеров может быть получена из фланкирующих геномных последовательностей, вставленных с двух сторон от ДНК, для получения ампликона, содержащего полную нуклеотидную последовательность вставки. Одна из пар праймеров, полученных из геномной последовательности растения может быть расположена на расстоянии от последовательности ДНК вставки, и это расстояние может варьировать от одной нуклеотидной пары оснований вплоть до приблизительно двухсот пятидесяти нуклеотидных пар оснований. Использование термина «ампликон» конкретно исключает димеры праймеров, которые могут образоваться в реакции термальной амплификации ДНК.

Амплификацию полинуклеиновых кислот можно проводить любыми способами амплификации полинуклеиновых кислот, известными в данной области, включая полимеразную цепную реакцию (ПЦР). Различные способы амплификации нуклеиновых кислот хорошо известны специалистам в данной области. Способы амплификации на основе ПЦР были разработаны для амплификации вплоть до 22 т.п.н. геномной ДНК и вплоть до 42 т.п.н. ДНК бактериофага. Эти способы, а также другие способы амплификации ДНК, известные в данной области, можно использовать в настоящем изобретении. Последовательность вставки экзогенной ДНК и фланкирующую последовательность ДНК из трансгенного объекта кукурузы DBN9858 можно амплифицировать из генома трансгенного объекта кукурузы DBN9858 с использованием предоставленных последовательностей праймеров с последующим стандартным секвенированием ДНК из ПЦР ампликона или из клонированной ДНК.

Наборы для детекции ДНК на основе способов амплификации ДНК содержат ДНК-праймеры, которые специфически гибридизируются с ДНК, представляющей интерес, и амплифицируют диагностический ампликон при соответствующих условиях реакции. Набор может предоставлять способ детекции на основе агарозного геля или множество способов для детекции диагностического ампликона, известных в данной области. В настоящем изобретении предлагается набор, содержащий ДНК-праймеры, которые гомологичны или комплементарны любой части области генома кукурузы из SEQ ID NO: 3 или SEQ ID NO: 4, и гомологичны или комплементарны любой части области трансгенной вставки из SEQ ID NO: 5. В частности, пара праймеров, которая определена как подходящая для способов амплификации ДНК, представляет собой SEQ ID NO: 8 и SEQ ID NO: 9, которые амплифицируют диагностический ампликон, гомологичный части из области 5'-трансген/геном трансгенного объекта кукурузы DBN9858, где ампликон содержит SEQ ID NO: 1. Другие молекулы ДНК в качестве ДНК-праймеров можно выбирать из SEQ ID NO: 5.

Ампликон, полученный этими способами, можно детектировать при помощи множества способов. Один такой способ представляет собой анализ генетических битов, в котором ДНК-олигонуклеотид разработан таким образом, чтобы покрывать и последовательность ДНК вставки и прилежащую фланкирующую последовательность геномной ДНК. Олигонуклеотид иммобилизован внутри лунок планшета для микротитрования. После амплификации интересующей области на основе ПЦР (с использованием одного праймера в последовательности вставки и одного в прилежащей фланкирующей геномной последовательности), одноцепочечный продукт ПЦР можно гибридизировать с иммобилизованным олигонуклеотидом и использовать в качестве матрицы для реакции удлинения по одному основанию при помощи ДНК-полимеразы и меченых ddNTP, специфических для ожидаемого следующего основания. Результаты можно получать путем способа на основе флуоресценции или ELISA. Сигнал указывает на присутствие вставки/фланкирующей последовательности, таким образом, указывая на успешную амплификацию, гибридизацию, и удлинение по одному основанию.

Другой способ представляет собой способ пиросеквенирования, где олигонуклеотидная цепь разработана таким образом, чтобы охватывать соединение последовательности ДНК вставки и прилежащей геномной ДНК. Олигонуклеотидную цепь гибридизуют с одноцепочечным продуктом ПЦР из интересующей области (один праймер в последовательности вставки и один - в фланкирующей геномной последовательности), а затем инкубируют с ДНК-полимеразой, АТФ, сульфурилазой, люциферазой, апиразой, аденозин-5'-фосфосульфатом и люциферином. Добавляют dNTP по отдельности, а затем измеряют сгенерированный световой сигнал. Световой сигнал отражает присутствие вставки/фланкирующей последовательности, что указывает на успешную амплификацию, гибридизацию, и удлинение по одному или нескольким основаниям.

Феномен флуоресцентной поляризации, как описано у Chen, et al., (Genome Res. 9:492-498, 1999) также представляет собой способ, который можно использовать для детекции ампликона по настоящему изобретению. Для использования этого способа, необходимо сконструировать олигонуклеотидную цепь, которая охватывает последовательность ДНК вставки и прилежащее соединение с геномной ДНК. Олигонуклеотид гибридизуют с одноцепочечным продуктом ПЦР из области, представляющей интерес (один праймер в ДНК вставки и один - в фланкирующей последовательности геномной ДНК) и инкубируют с ДНК-полимеразой и флуоресцентно-мечеными ddNTP. Удлинение по одному основанию приводит к вставке ddNTP, что можно измерять по изменению поляризации при помощи флуориметра. Изменение поляризации отражает присутствие вставки/фланкирующей последовательности, что указывает на успешную амплификацию, гибридизацию, и удлинение по одному основанию.

Taqman описывают как способ детекции и количественной оценки присутствия последовательности ДНК, и он полностью представлен в инструкциях, предложенных производителем. В кратком изложении, конструируют олигонуклеотидный зонд для FRET, чтобы он охватывал последовательность ДНК вставки и прилежащее соединение с фланкирующей геномной ДНК. Зонд для FRET и праймеры для ПЦР (один праймер в ДНК вставки и один - в фланкирующей геномной последовательности) участвуют в циклической реакции в присутствии термостабильной полимеразы и dNTP. Гибридизация зонда для FRET приводит к расщеплению и высвобождению флуоресцентной группы из гасящей молекулы в зонде для FRET. Флуоресцентный сигнал отражает присутствие вставки/фланкирующей последовательности, что указывает на успешную амплификацию и гибридизацию.

Подходящие способы на основе гибридизации для выявления растительных материалов, полученных из трансгенного объекта кукурузы DBN9858, дополнительно включают саузерн-блот гибридизацию, «нозерн»-блот гибридизацию и гибридизацию in situ. В частности, подходящий способ включает: инкубирование зонда и образца, отмывание для удаления несвязавшегося зонда и детекцию гибридизации зонда. Описанный способ детекции зависит от типа маркера, присоединенного к зонду. Например, зонд с радиоактивной меткой можно детектировать при помощи экспонирования и проявки рентгеновской пленки, или зонд с ферментативной меткой можно детектировать по изменению цвета, происходящего при превращении субстрата.

Молекулярные маяки были описаны для применения для детекции последовательностей, как описано у Tyangi, et al. (Nature Biotech. 14:303-308, 1996). В кратком изложении, конструируют олигонуклеотидный зонд для FRET, чтобы он охватывал последовательность ДНК вставки и прилежащее соединение с фланкирующей геномной ДНК. Уникальная структура зонда для FRET содержит вторичную структуру, которая удерживает флуоресцентную и гасящую молекулы в непосредственной близости. Зонд для FRET и праймеры для ПЦР (один праймер в ДНК вставки и один - в фланкирующей геномной последовательности) участвуют в циклической реакции в присутствии термостабильной полимеразы и dNTP. После успешной амплификации на основе ПЦР, гибридизация зонда для FRET с целевой последовательностью приводит к потере зондом вторичной структуры и пространственному разделению флуоресцентной и гасящей молекул, что создает флуоресцентный сигнал. Флуоресцентный сигнал отражает присутствие вставки/фланкирующей последовательности, что указывает на успешную амплификацию и гибридизацию.

Другие описанные способы, такие как микроструйные устройства, предлагают способ и приборы для выделения и амплификации образца ДНК. Для детекции и анализа конкретной молекулы ДНК используют фотокрасители. Устройство с нанотрубками, подходящее для детекции молекулы ДНК по настоящему изобретению, содержит электронный сенсор для выявления молекулы ДНК или наногранулу, связывающуюся с конкретной молекулой ДНК, и, таким образом, можно производить детекцию.

Наборы для детекции ДНК можно разрабатывать с использованием композиции, описанной в настоящем изобретении, и способов, описанных или известных в области детекции ДНК. Набор облегчает выявление присутствия ДНК из трансгенного объекта кукурузы DBN9858 в образце, и может быть дополнительно использован для скрещивания растений кукурузы, содержащих ДНК из трансгенного объекта кукурузы DBN9858. Набор может содержать ДНК-праймеры или зонды, которые гомологичны или комплементарны по меньшей мере части SEQ ID NO: 1, 2, 3, 4 или 5, или другие ДНК-праймеры или зонды, которые гомологичны или комплементарны ДНК, содержащейся в трансгенных генетических элементах ДНК, и эти последовательности ДНК можно использовать в качестве праймеров в реакциях амплификации ДНК или в качестве зондов в способе гибридизации ДНК. Структура последовательности ДНК трансгенной вставки и соединение с геномом кукурузы, включенные в геном кукурузы, показаны на фигуре 1, и таблица 1 содержит фланкирующую геномную область из растения кукурузы DBN9858, расположенную на 5'-конце последовательности трансгенной вставки; часть последовательности вставки из левой пограничной области (LB) из Agrobacterium; первую экспрессирующую кассету, которая состоит из промотора 35S вируса мозаики цветной капусты (pr35S), содержащего тандемные повторы энхансерной области, функционально связанной с глуфосинат-устойчивой фосфинотрицин N-ацетил трансферазой (cPAT) из Streptomyces и с терминатором 35S вируса мозаики цветной капусты (t35S); вторую экспрессирующую кассету, которая состоит из промотора актина-1 риса (prOsAct1), функционально связанного с последовательностью, кодирующей транзитный пептид хлоропласта из Arabidopsis thaliana для EPSPS (spAtCTP2), с глифосат-устойчивой 5-енолпирувил-3-фосфошикимат синтазой (cEPSPS) из штамма CP4 Agrobacterium, и с терминатором транскрипции нопалинсинтазы (tNos); часть последовательности вставки из правой пограничной области (RB) из Agrobacterium; а также фланкирующую геномную область из растения кукурузы DBN9858, расположенную на 3-конце последовательности трансгенной вставки (SEQ ID NO:5). Молекулы ДНК, подходящие в качестве праймеров в способах амплификации ДНК, можно получать из любой части последовательности трансгенной вставки в растении кукурузы DBN9858, а также из любой части области ДНК из фланкирующего генома кукурузы в трансгенном объекте кукурузы DBN9858.

Трансгенный объект кукурузы DBN9858 можно комбинировать с другими сортами трансгенной кукурузы, например, с кукурузой, устойчивой к гербицидам (таким как 2,4-D, дикамба и т.п.), или сортами трансгенной кукурузы, несущими другие гены устойчивости к насекомым (такие как Cry1Ab, Vip3A и т.п.). Скрещивание различных комбинаций этих различных трансгеных объектов с трансгенным объектом кукурузы DBN9858 по настоящему изобретению может создать улучшенные гибридные сорта трансгенной кукурузы, которые устойчивы к различным насекомым и к различным гербицидам и которые могут показывать более выдающиеся характеристики, такие как повышенный урожай и т.п., по сравнению с не-трансгенными сортами и трансгенными сортами с одним признаком.

Настоящее изобретение относится к последовательности нуклеиновой кислоты, подходящей для выявления растения кукурузы DBN9858, устойчивого к гербициду, и к способу ее детекции, где трансгенный объект кукурузы DBN9858 устойчив к фитотоксическому эффекту сельскохозяйственных гербицидов, содержащих глифосат и/или глуфосинат. Такое растение кукурузы с двойными признаками экспрессирует глифосат-устойчивые белки 5-енолпирувилшикимат-3-фосфатсинтетазы (EPSPS) из штамма CP4 Agrobacterium, которые придают растению устойчивость к глифосату; и глуфосинат-устойчивые белки фосфинотрицин N-ацетилтрансферазы (PAT) из Streptomyces, которые придают растению устойчивость к глуфосинату. Кукуруза с двойными признаками имеет следующие преимущества: 1) возможность применять сельскохозяйственные гербициды, содержащие глифосат, на культурах кукурузы для борьбы с широким спектром сорняков; 2) признак устойчивости к глуфосинату может действовать как неселективные способы, эффективные для борьбы с глифосат-устойчивыми сорняками, при использовании в комбинации с гербицидами с глуфосинатом (в смеси с гербицидами с глифосатом или альтернативно); 3) устойчивая к гербицидам трансгенная кукуруза в качестве трансгенной кукурузы без устойчивости к насекомым может замедлять развитие устойчивости у насекомых/вредителей, когда высаживается в определенном соотношении с трансгенной кукурузой с устойчивостью к вредителям; 4) отсутствие снижения урожая кукурузы. Кроме того, гены, кодирующие признаки устойчивости к глифосату и глуфосинату, связаны с одним и тем же сегментом ДНК и присутствуют в одном локусе генома трансгенного объекта кукурузы DBN9858. Это обеспечивает улучщенную эффективность скрещивания и позволяет отслеживать фрагмент трансгенной вставки, содержащийся у воспроизводящих популяций и их потомства, с использованием молекулярного маркера. При этом, SEQ ID NO: 1, 2, 6 или 7, или комплементарные им последовательности можно использовать в способе детекции по настоящему изобретению в качестве ДНК-праймеров или зондов для получения продуктов амплификации, которые определяются как трансгенный объект кукурузы DBN9858 или его потомство, и быстро, точно и стабильно выявляют присутствие растительных материалов, полученных из трансгенного объекта кукурузы DBN9858.

КРАТКОЕ ОПИСАНИЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

SEQ ID NO: 1 11 нуклеотидов с обеих сторон участка вставки из 5'-фрагмента трансгена и геномной ДНК кукурузы в трансгенном объекте кукурузы DBN9858;
SEQ ID NO: 2 11 нуклеотидов с обеих сторон участка вставки из 3'-фрагмента трансгена и геномной ДНК кукурузы в трансгенном объекте кукурузы DBN9858;
SEQ ID NO: 3 последовательность из 1301 нуклеотида в длину, расположенная рядом с участком соединения вставки на 5'-конце последовательности вставки в трансгенном объекте кукурузы DBN9858;
SEQ ID NO: 4 последовательность из 1310 нуклеотидов в длину, расположенная рядом с участком соединения вставки на 5'-конце последовательности вставки в трансгенном объекте кукурузы DBN9858;
SEQ ID NO: 5 полная последовательность Т-ДНК, 5'- и 3'-фланкирующей последовательности генома кукурузы;
SEQ ID NO: 6 последовательность, расположенная внутри SEQ ID NO: 3, которая охватывает последовательность ДНК-конструкции DBN10006 и последовательность промотора pr35S;
SEQ ID NO: 7 последовательность, расположенная внутри SEQ ID NO: 3, которая охватывает последовательность терминатора tNos и последовательность ДНК-конструкции DBN10006;
SEQ ID NO: 8 первый праймер для амплификации SEQ ID NO: 3;
SEQ ID NO: 9 второй праймер для амплификации SEQ ID NO: 3;
SEQ ID NO: 10 первый праймер для амплификации SEQ ID NO: 4;
SEQ ID NO: 11 второй праймер для амплификации SEQ ID NO: 4;
SEQ ID NO: 12 праймер на 5'-фланкирующей геномной последовательности;
SEQ ID NO: 13 праймер, расположенный на Т-ДНК, парный к SEQ ID NO: 12;
SEQ ID NO: 14 праймер на 3'- фланкирующей геномной последовательности, парный к SEQ ID NO: 12, для определения гомозиготного или гетерозиготного состояния трансгена;
SEQ ID NO: 15 праймер, расположенный на Т-ДНК, парный к SEQ ID NO: 14;
SEQ ID NO: 16 праймер 1 для выявления EPSPS путем Taqman;
SEQ ID NO: 17 праймер 2 для выявления EPSPS путем Taqman;
SEQ ID NO: 18 зонд 1 для выявления EPSPS путем Taqman;
SEQ ID NO: 19 праймер 3 для выявления PAT путем Taqman;
SEQ ID NO: 20 праймер 4 для выявления PAT путем Taqman;
SEQ ID NO: 21 зонд 2 для выявления PAT путем Taqman;
SEQ ID NO: 22 первый праймер для эндогенного гена кукурузы убиквитина;
SEQ ID NO: 23 второй праймер для эндогенного гена кукурузы убиквитина;
SEQ ID NO: 24 зонд для PAT для детекции гибридизации путем саузерн-блоттинга;
SEQ ID NO: 25 зонд для EPSPS для детекции гибридизации путем саузерн-блоттинга;
SEQ ID NO: 26 праймер, расположенный на Т-ДНК, в том же направлении, что и SEQ ID NO: 13;
SEQ ID NO: 27 праймер, расположенный на Т-ДНК, в противоположном направлении с SEQ ID NO: 13, который используют для получения фланкирующей последовательности;
SEQ ID NO: 28 праймер, расположенный на Т-ДНК, в противоположном направлении с SEQ ID NO: 13, который используют для получения фланкирующей последовательности;
SEQ ID NO: 29 праймер, расположенный на Т-ДНК, в том же направлении, что и SEQ ID NO: 15;
SEQ ID NO: 30 праймер, расположенный на Т-ДНК, в противоположном направлении с SEQ ID NO: 15, который используют для получения фланкирующей последовательности;
SEQ ID NO: 31 праймер, расположенный на Т-ДНК, в противоположном направлении с SEQ ID NO: 15, который используют для получения фланкирующей последовательности.

Далее в настоящем документе, технические растворы по настоящему изобретению будут дополнительно подробно описаны со ссылкой на прилагаемые чертежи и примеры.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

Фигура 1 представляет собой структурную схему последовательности трансгенной вставки и последовательности соединительной нуклеиновой кислоты из генома кукурузы, и способ их детекции по настоящему изобретению, который используют для выявления растения кукурузы DBN9858, устойчивого к гербициду.

Фигура 2 представляет собой структурную схему последовательностей нуклеиновых кислот рекомбинантного экспрессирующего вектора DBN10006 и способ его детекции по настоящему изобретению, который используют для выявления растения кукурузы DBN9858, устойчивого к гербициду.

ПОДРОБНОЕ ОПИСАНИЕ

Далее в настоящем документе, технические растворы для последовательности нуклеиновой кислоты и способ ее детекции по настоящему изобретению, который используют для выявления растения кукурузы DBN9858, устойчивого к гербициду, будут дополнительно проиллюстрированы при помощи конкретных примеров.

Пример 1. Клонирование и трансформация

1.1. Клонирование вектора

Рекомбинантный экспрессирующий вектор DBN10006 конструировали при помощи стандартного способа клонирования генов (как показано на фиг. 2). Вектор DBN10006 содержал две тандемных экспрессирующих кассеты с трансгеном. Первая экспрессирующая кассета состоит из промотора 35S вируса мозаики цветной капусты (pr35S), содержащего тандемные повторы энхансерной области, функционально связанной с глуфосинат-устойчивой фосфинотрицин N-ацетил трансферазой (cPAT) из Streptomyces и с терминатором 35S вируса мозаики цветной капусты (t35S). Вторая экспрессирующая кассета состоит из промотора актина-1 риса (prOsAct1), функционально связанного с последовательностью, кодирующей транзитный пептид хлоропласта из Arabidopsis thaliana для EPSPS (spAtCTP2), с глифосат-устойчивой 5-енолпирувил-3-фосфошикимат синтазой (cEPSPS) из штамма CP4 Agrobacterium, и с терминатором транскрипции нопалинсинтазы (tNos).

Вектором DBN10006 трансформировали LBA4404 Agrobacterium (Invitrogen, Chicago, USA; каталожный № 18313-015) с использованием способа с жидким азотом, и проводили отбор трансформированных клеток при помощи 5-енолпирувилшикимат-3-фосфатсинтетазы (EPSPS) в качестве селективного маркера.

1.2. Трансформация растений

Трансформацию проводили при помощи общепринятого способа заражения Agrobacterium. Зародыш кукурузы культивировали в стерильных условиях с Agrobacterium, описанными в части 1.1 настоящего примера, для переноса Т-ДНК в сконструированном рекомбинантном экспрессирующем векторе DBN10006 в геном кукурузы, таким образом, получая трансгенный объект кукурузы DBN9858.

Относительно общепринятого способа трансформации кукурузы, опосредованной Agrobacterium: кратко, выделяли из кукурузы незрелые зародыши и приводили в контакт с суспензией Agrobacterium, где нуклеотидные последовательности генов EPSPS и PAT могли быть перенесены по меньшей мере в одну клетку одного из зародышей посредством Agrobacterium (этап 1: этап заражения). На этом этапе зародыши предпочтительно погружали в суспензию Agrobacterium (OD660=0,4-0,6, среда для заражения (соль MS 4,3 г/л, витамин MS, казеин 300 мг/л, сахароза 68,5 г/л, глюкоза 36 г/л, ацетосирингон (AS) 40 мг/л, 2,4-дихлорфеноксиуксусная кислота (2,4-D) 1 мг/л, pH 5,3) для инициации засева. Зародыши культивировали совместно с Agrobacterium в течение периода времени (3 суток) (этап 2: этап совместного культивирования). Предпочтительно, зародыши после этапа заражения культивировали на твердой среде (соль MS 4,3 г/л, витамин MS, казеин 300 мг/л, сахароза 20 г/л, глюкоза 10 г/л, ацетосирингон (AS) 100 мг/л, 2,4-дихлорфеноксиуксусная кислота (2,4-D) 1 мг/л, агар 8 г/л, pH 5,8). После этого периода совместного культивирования, предусматривался необязательный этап «восстановления». На этапе «восстановления» был по меньшей мере один антибиотик, известный ингибированием роста Agrobacterium (цефалоспорин), в среде для восстановления (соль MS 4,3 г/л, витамин MS, казеин 300 мг/л, сахароза 30 г/л, 2,4-дихлорфеноксиуксусная кислота (2,4-D) 1 мг/л, фитагель 3 г/л, pH 5,8), но не добавляли никакого селективного агента для растений-трансформантов (этап 3: этап восстановления). Предпочтительно, зародыши культивировали на твердой среде с антибиотиком, но без селективного агента, для удаления Agrobacterium и обеспечения периода восстановления для инфицированных клеток. Далее, зараженные зародыши культивировали на среде, содержащей селективный агент (глифосат) и отбирали по растущему трансформированному каллюсу (этап 4: этап селекции). Предпочтительно, зародыши культивировали на твердой среде для селекции с селективным агентом (соль MS 4,3 г/л, витамин MS, казеин 300 мг/л, сахароза 30 г/л, N-(фосфонометил)глицин 0,25 моль/л, 2,4-дихлорфеноксиуксусная кислота (2,4-D) 1 мг/л, фитагель 3 г/л, pH 5,8), получая селективный рост трансформированных клеток. Каллюсы затем восстанавливали в растения (этап 5: этап регенерации). Предпочтительно, каллюсы, которые выросли на среде, содержащей селективный агент, культивировали на твердой среде (среда MS для дифференцировки и среда MS для укоренения) для восстановления растения.

Прошедшие скрининг устойчивые каллюсы переносили на среду MS для дифференцировки (соль MS 4,3 г/л, витамин MS, казеин 300 мг/л, сахароза 30 г/л, 6-бензиладенин 2 мг/л, N-(фосфонометил)глицин 0,125 моль/л, фитагель 3 г/л, pH 5,8), и культивировали при 25°C для дифференцировки. Дифференцированные проростки переносили на среду MS для укоренения (соль MS 2,15 г/л, витамин MS, казеин 300 мг/л, сахароза 30 г/л, индол-3-уксусная кислота 1 мг/л, агар 8 г/л, pH 5,8), культивировали при 25°C приблизительно до высоты 10 см, а затем переносили в теплицу и культивировали, пока они не станут крепкими. В теплице, культивирование проводили при 28°C в течение 16 часов ежедневно, с последующими 20°C в течение 8 часов.

1.3. Выявление и скрининг трансгенных объектов

Всего получали 332 отдельных трансгенных растения T0.

Присутствие генов EPSPS и PAT в восстановленных трансгенных растениях кукурузы детектировали при помощи анализа TaqMan™ (см. пример 2), и охарактеризовали число копий в линиях, устойчивых к глифосату и глуфосинату. Путем скрининга, было выявлено, что объект DBN9858 был превосходным и характеризовался одной копией генов, хорошей устойчивостью к гербицидам с глифосатом, устойчивостью к гербицидам с глуфосинатом и агрономическими признаками (см. пример 5).

Пример 2. Выявление трансгенного объекта кукурузы DBN9858 при помощи TaqMan

Приблизительно 100 мг листьев брали в качестве образца от трансгенного объекта кукурузы DBN9858, выделяли геномную ДНК с использованием набора DNeasy Plant Maxi от Qiagen, и выявляли число копий генов EPSPS и PAT при помощи флуоресцентной количественной ПЦР с зондом Taqman. При этом, использовали в качестве контроля растения кукурузы дикого типа, и проводили детекцию и анализ, как описано выше. Эксперименты проводили в трех повторах и брали среднее.

Конкретный способ был следующим:

Этап 11. Приблизительно 100 мг листьем брали в качестве образца от трансгенного объекта кукурузы DBN9858 и гомогенизировали в ступке с использованием жидкого азота. Каждый образец брали в трех повторах;

Этап 12. Геномную ДНК из вышеуказанных образцов выделяли с использованием набора DNeasy Plant Maxi от Qiagen. Для конкретного способа, пожалуйста, смотрите инструкции к продукту;

Этап 13. Концентрацию геномной ДНК вышеуказанных образцов определяли с использованием NanoDrop 2000 (Thermo Scientific);

Этап 14. Концентрации геномной ДНК вышеуказанных образцов корректировали до одной и той же величины концентрации в диапазоне 80-100 нг/мкл;

Этап 15. Число копий в вышеуказанных образцах выявляли при помощи флуоресцентной количественной ПЦР с зондом Taqman, образец с известным числом копий использовали в качестве стандарта, и использовали в качестве контроля растение кукурузы дикого типа. Каждый образец делали в трех повторах и брали среднее. Праймеры и зонды для флуоресцентной количественной ПЦР представляли собой, соответственно:

Для выявления последовательности гена EPSPS использовали следующие праймеры и зонды:

Праймер 1: CTGGAAGGCGAGGACGTCATCAATA, как предложено в SEQ ID NO: 16 из списка последовательностей;

Праймер 2: TGGCGGCATTGCCGAAATCGAG, как предложено в SEQ ID NO: 17 из списка последовательностей;

Зонд 1: ATGCAGGCGATGGGCGCCCGCATCCGTA, как предложено в SEQ ID NO: 18 из списка последовательностей;

Для выявления последовательности гена PAT использовали следующие праймеры и зонды:

Праймер 3: CAGTTGAGATTAGGCCAGCTACAG, как предложено в SEQ ID NO: 19 из списка последовательностей;

Праймер 4: TTCACTGTAGACGTCTCAATGTAATGG, как предложено в SEQ ID NO: 20 из списка последовательностей;

Зонд 2: CAGCTGATATGGCCGCGGTTTGTG, как предложено в SEQ ID NO: 21 из списка последовательностей;

Система для реакции ПЦР:

JumpStart™ Taq ReadyMix™ (Sigma) 10 мкл
50× смесь праймер/зонд 1 мкл
Геномная ДНК 3 мкл
Вода (ddH2O) 6 мкл

50× смесь праймер/зонд содержит 45 мкл каждого праймера в концентрации 1 мМ, 50 мкл 100 мкМ зонда и 860 мкл 1×буфера TE, и хранится в непрозрачной пробирке при 4°C.

Условия реакции ПЦР:

Этап Температура Время
21 95°C 5 минут
22 95°C 30 секунд
23 60°C 1 минута
24 Обратно к этапу 22, и повторить 40 раз

Данные анализировали при помощи программного обеспечения SDS2.3 (Applied Biosystems) и получали трансгенный объект кукурузы DBN9858 с одной копией.

Пример 3. Выявление трансгенного объекта кукурузы DBN9858

3.1. Выделение геномной ДНК

ДНК выделяли в соответствии с традиционно используемым способом со CTAB (гексадецилтриметиламмонийбромидом): брали 2 г молодых листьев от трансгенного объекта кукурузы DBN9858 и растирали в порошок в жидком азоте. После этого добавляли 0,5 мл буфера с CTAB для выделения ДНК, прогретого при 65°C (20 г/л CTAB, 1,4 M NaCl, 100 мМ трис-HCl, 20 мМ ЭДТА (этилендиаминтетрауксусная кислота), pH скорректирован до 8,0 при помощи NaOH), полностью перемешивали, а затем экстрагировали при 65°C в течение 90 минут. Добавляли 0,5 объема фенола и 0,5 объема хлороформа, перемешивали переворачиваниями и центрифугировали при скорости вращения 12000 об/мин (оборотов в минуту) в течение 10 минут. Отбирали супернатант и добавляли 2 объема абсолютного этанола. Центрифужную пробирку мягко покачивали и оставляли при 4°C в течение 30 минут. Центрифугирование проводили при скорости вращения 12000 об/мин еще раз 10 минут, и осаждали ДНК на дно пробирки. Супернатант удаляли, а осадок отмывали 1 мл этанола с массовой концентрацией 70%, центрифугировали при скорости вращения 12000 об/мин в течение 5 минут и высушивали насухо под вакуумом или высушивали на сверхчистом столе. Осадок ДНК растворяли в соответствующем количестве буфера TE (10 мМ трис-HCl, 1 мМ ЭДТА, pH 8,0), и хранили при температуре 20°C.

3.2. Анализ фланкирующей последовательности ДНК

Оценивали концентрацию вышеуказанных образцов ДНК, и приводили концентрацию тестируемых образцов к диапазону 80-100 нг/мкл. Геномную ДНК расщепляли при помощи выбранных рестрикционных эндонуклеаз BamHI, XmaI, KpnI, SacII (для анализа 5'-конца) и SpeI, PstI, Eco57I (для анализа 3'-конца), соответственно. В каждую систему для ферментативного расщепления добавляли 26,5 мкл геномной ДНК, 0,5 мкл вышеуказанных выбранных рестрикционных эндонуклеаз и 3 мкл буфера для расщепления. Ферментативное расщепление проводили в течение 1 часа. После завершения расщепления добавляли 70 мкл абсолютного этанола в систему для ферментативного расщепления, держали на ледяной бане в течение 30 минут, и центрифугировали при скорости вращения 12000 об/мин в течение 7 минут. Супернатант удаляли, и высушивали насухо. После этого добавляли 8,5 мкл дважды дистиллированной воды (ddH2O), 1 мкл 10× буфера для T4 и 0,5 мкл T4-лигазы и лигировали при температуре 4°C в течение ночи. Амплификацию путем ПЦР проводили с использованием серии вложенных праймеров для выделения 5'- и 3'-трансгенной/геномной ДНК. Конкретно, комбинация ДНК-праймеров для выделения 5'-трансгенной/геномной ДНК содержит SEQ ID NO: 13 и SEQ ID NO: 26 в качестве первого праймера, SEQ ID NO: 27 и SEQ ID NO: 28 в качестве второго праймера, и SEQ ID NO: 13 в качестве секвенирующего праймера. Комбинация ДНК-праймеров для выделения 3'-трансгенной/геномной ДНК содержит SEQ ID NO: 15 и SEQ ID NO: 29 в качестве первого праймера, SEQ ID NO: 30 и SEQ ID NO: 31 в качестве второго праймера, и SEQ ID NO: 15 в качестве секвенирующего праймера. Условия реакции ПЦР показаны в таблице 3.

Проводили электрофорез полученного ампликона на 2,0% агарозном геле для выделения продукта ПЦР, а затем интересующие фрагменты выделяли из агарозной матрицы с использованием набора для выделения QIAquick Gel (Кат. №_ 28704, Qiagen Inc., Valencia, CA). После этого, очищенный продукт ПЦР секвенировали (например, ABI PrismTM 377, PE Biosystems, Foster City, CA) и анализировали (например, программным обеспечением DNASTAR sequence analysis, DNASTAR Inc., Madison, WI).

5'- и 3'-фланкирующую последовательность и соединительную последовательность определяли при помощи стандартного способа ПЦР. 5'-фланкирующую последовательность и соединительную последовательность можно определить при помощи SEQ ID NO: 8 или SEQ ID NO: 12 в сочетании с SEQ ID NO: 9, SEQ ID NO: 13 или SEQ ID NO: 26. 3'-фланкирующую последовательность и соединительную последовательность можно определить при помощи SEQ ID NO: 11 или SEQ ID NO: 14 в сочетании с SEQ ID NO: 10, SEQ ID NO: 15 или SEQ ID NO: 29. Система для реакции ПЦР и условия амплификации показаны в таблицах 2 и 3. Специалисты в данной области понимают, что также можно использовать другие праймеры для определения фланкирующей последовательности и соединяющей последовательности.

Секвенирование ДНК по продукту ПЦР обеспечивает ДНК, подходящую для конструирования других молекул ДНК, которые используют в качестве праймеров и зондов для выявления растений или семян кукурузы, полученных из трансгенного объекта кукурузы DBN9858.

Обнаружили, что геномная последовательность кукурузы, показанная как нуклеотиды 1-1067 из SEQ ID NO: 5, фланкирует правую границу последовательности вставки из трансгенного объекта кукурузы DBN9858 (5'-фланкирующая последовательность), и геномная последовательность кукурузы, показанная как нуклеотиды 5829-6890 of SEQ ID NO: 5, фланкирует левую границу последовательности вставки из трансгенного объекта кукурузы DBN9858 (3'-фланкирующая последовательность). 5'-соединительная последовательность показана в SEQ ID NO: 1, и 3'- соединительная последовательность показана в SEQ ID NO: 2.

3.3. Тест ПЦР на зиготность

Соединительные последовательности представляют собой относительно короткие полинуклеотидные молекулы, которые являются новыми последовательностями ДНК, и являются диагностическими для ДНК трансгенного объекта кукурузы DBN9858, если они выявляются при анализе детекции нескольких нуклеиновых кислот. Соединительные последовательности в SEQ ID NO: 1 и SEQ ID NO: 2 представляют собой участок вставки трансгенного фрагмента в трансгенном объекте кукурузы DBN9858 и 11 полинуклеотидов геномной ДНК кукурузы с каждой стороны. Более длинные или более короткие полинуклеотидные соединительные последовательности можно выбирать из SEQ ID NO: 3 или SEQ ID NO: 4. Соединительные последовательности (5'-область соединения SEQ ID NO: 1 и 3'-область соединения SEQ ID NO: 2) подходят в качестве молекул ДНК-зондов или ДНК-праймеров для способов для детекции ДНК. Соединительные последовательности SEQ ID NO: 6 и SEQ ID NO: 7 также являются новыми последовательностями ДНК в трансгенном объекте кукурузы DBN9858, которые также можно использовать в качестве молекул ДНК-зондов или ДНК-праймеров для детекции присутствия ДНК трансгенного объекта кукурузы DBN9858. SEQ ID NO: 6 (от нуклеотида 1068 до нуклеотида 1301 SEQ ID NO: 3) охватывает последовательность ДНК-конструкции DBN10006 и последовательность промотора pr35S, а SEQ ID NO: 7 (от нуклеотида 1 до нуклеотида 248 SEQ ID NO: 4) охватывает последовательность терминатора tNos и последовательность ДНК-конструкции DBN10006.

Дополнительно, получают ампликон с использованием по меньшей мере одного праймера из SEQ ID NO: 3 и SEQ ID NO: 4, и праймер производит диагностический ампликон для трансгенного объекта кукурузы DBN9858, когда используется в способе ПЦР.

Конкретно, продукт ПЦР получают из 5'-конца последовательности трансгенной вставки, и продукт ПЦР является частью геномной ДНК, фланкирующей 5'-конец последовательности вставки Т-ДНК, которая получена из генома растительного материала трансгенного объекта кукурузы DBN9858. Этот продукт ПЦР содержит SEQ ID NO: 3. Для амплификации путем ПЦР, конструируют праймер 5 (SEQ ID NO: 8), который гибридизуется с последовательностью геномной ДНК, фланкирующей 5'-конец последовательности трансгенной вставки, и парный праймер 6 (SEQ ID NO: 9), расположенный на последовательности терминации транскрипции трансгенного tNos.

Продукт ПЦР получают из 3'-конца последовательности трансгенной вставки, и продукт ПЦР содержит часть геномной ДНК, фланкирующей 3'-конец последовательности вставки Т-ДНК, которая получена из генома растительного материала трансгенного объекта кукурузы DBN9858. Этот продукт ПЦР содержит SEQ ID NO: 4. Для амплификации путем ПЦР, конструируют праймер 8 (SEQ ID NO: 11), гибридизующийся последовательностью геномной ДНК, фланкирующей 3'-конец последовательности трансгенной вставки, и парный праймер 7 (SEQ ID NO: 10) из последовательности промотора pr35S, расположенной на 3'-конце вставки.

Условия амплификации ДНК, показанные в таблице 2 и таблице 3, можно использовать в вышеуказанном тесте ПЦР на зиготность для получения диагностического ампликона трансгенного объекта кукурузы DBN9858. Детекцию ампликонов можно проводить при помощи термоциклера Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700, или Eppendorf Mastercycler Gradient, как показано в таблице 3, или при помощи способов и приборов, известных специалистам в данной области.

Таблица 2. Этапы ПЦР и условия реакционной смеси для выявления 5'-трансгенной вставки/геномной соединяющей области трансгенного объекта кукурузы DBN9858.

Этап Реагент Количество Примечание
1 Вода без нуклеаз Добавить до конечного объема 20 мкл
2 10× реакционный буфер(с MgCl2) 2,0 мкл 1× конечная концентрация буфера, 1,5 мМ конечная концентрация MgCl2
3 10 мМ раствор dATP、dCTP、dGTP и dTTP 0,4 мкл 200 мкМ конечная концентрация каждого dNTP
4 Праймер 5 для трансгенного объекта (SEQ ID NO:8), ресуспендированный в 1× буфере TE или в воде без нуклеаз до концентрации 10 мкМ 0,2 мкл 0,1 мкМ конечная концентрация
5 Праймер 6 для трансгенного объекта (SEQ ID NO:9), ресуспендированный в 1× буфере TE или в воде без нуклеаз до концентрации 10 мкМ 0,2 мкл 0,1 мкМ конечная концентрация
6 РНКаза, свободная от ДНКаз (500 мкг/мл) 0,1 мкл 50 нг/реакцию
7 ДНК-полимераза REDTaq(1 единица/мкл) 1,0 мкл (рекомендовано сменить пипетки перед следующим этапом) 1 единица/реакцию
8 Выделенная ДНК (матрица): листья от образцов для анализа 200 нг геномной ДНК
Отрицательный контроль 50 нг геномной ДНК нетрансгенной кукурузы
Отрицательный контроль Без матрицы ДНК (раствор, в котором ресуспендировали ДНК)
Положительный контроль 50 нг геномной ДНК кукурузы, содержащей DBN9858

Таблица 3. Условия для термоциклера Perkin-Elmer 9700

Номер цикла Настройки
1 94°C 3 минуты
34 94°C 30 секунд
64°C 30 секунд
72°C 1 минута
1 72°C 10 минут

Мягко перемешивали, при необходимости (в отсутствие горячей крышки на термоциклере) можно добавить 1-2 капли минерального масла на поверхность каждой реакционной жидкости. ПЦР проводили на термоциклере Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) или Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) с использованием вышеуказанных параметров циклов (таблица 3). Термоциклер MJ Engine или Eppendorf Mastercycler Gradient должны работать в расчетном режиме. Термоциклер Perkin-Elmer 9700 работал на максимуме скорости подъема температуры.

Экспериментальные результаты показывают, что, когда праймеры 5 и 6 (SEQ ID NO: 8 и 9) использовали в реакциях ПЦР для геномной ДНК трансгенного объекта кукурузы DBN9858, они привели к продукту амплификации в виде фрагмента 1301 п.н., а когда их использовали в реакциях ПЦР для геномной ДНК нетрансформированной кукурузы и геномной ДНК кукурузы, не являющейся DBN9858, никакой фрагмент не амплифицировался; и когда праймеры 7 и 8 (SEQ ID NO: 10 и 11) в реакциях ПЦР для геномной ДНК трансгенного объекта кукурузы DBN9858, они привели к продукту амплификации в виде фрагмента 1310 п.н., а когда их использовали в реакциях ПЦР для геномной ДНК нетрансформированной кукурузы и геномной ДНК кукурузы, не являющейся DBN9858, никакой фрагмент не амплифицировался.

Тест на зиготность на основе ПЦР также можно использовать для выявления того, является ли материал, полученный от трансгенного объекта кукурузы DBN9858, гомозиготным или гетерозиготным. Праймер 9 (SEQ ID NO: 12), праймер 10 (SEQ ID NO: 13) и праймер 11 (SEQ ID NO: 14) использовали в реакции амплификации для получения диагностического ампликона для трансгенного объекта кукурузы DBN9858. Условия амплификации ДНК, показанные в таблице 4 и таблице 5, можно использовать в вышеуказанном тесте на зиготность для получения диагностического ампликона для трансгенного объекта кукурузы DBN9858.

Таблица 4. Реакционный раствор для теста на зиготность.

Этап Реагент Количество Примечание
1 Вода без нуклеаз Добавить до конечного объема 10 мкл
2 2× Universal Master Mix (Applied Biosystems, каталожный номер 4304437) 5 мкл 1× конечная концентрация
3 Праймер 9 (SEQ ID NO:12), праймер 10 (SEQ ID NO:13) и праймер 11 (SEQ ID NO:14) (ресуспендированные в воде без нуклеаз до концентрации 10 мкМ) 0,3 мкл 0,1 мкМ конечная концентрация
4 REDTaq ДНК-полимераза (1 единица /мкл) 1,0 мкл (рекомендовано сменить пипетки перед следующим этапом) 1 единица/реакцию
5 Выделенная ДНК (матрица): листья от образцов для анализа 200 нг геномной ДНК
Отрицательный контроль 50 нг геномной ДНК нетрансгенной кукурузы
Отрицательный контроль Без матрицы ДНК (раствор, в котором ресуспендировали ДНК)
Положительный контроль 50 нг геномной ДНК кукурузы, содержащей DBN9858

Таблица 5. Условия для термоциклера Perkin-Elmer 9700 для теста на зиготность

Номер цикла Настройки
1 95°C 10 минут
10 95°C 15 секунд
64°C 1 минута(-1°C/цикл)
30 95°C 15 секунд
54°C 1 минута
1 10°C погружение

ПЦР проводили на термоциклере Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) или Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) с использованием вышеуказанных параметров циклов (таблица 5). Термоциклер MJ Engine или Eppendorf Mastercycler Gradient должны работать в расчетном режиме. Термоциклер Perkin-Elmer 9700 работал на максимуме скорости подъема температуры.

В реакции амплификации биологический образец с матричной ДНК содержит ДНК для диагностики присутствия трансгенного объекта кукурузы DBN9858 в образце. Альтернативно, реакция будет содержать два различных ДНК-ампликона, произведенных биологическим образцом, который содержит ДНК, полученную из генома кукурузы. ДНК, полученная из генома кукурузы, является гетерозиготной в отношении соответствующих аллелей ДНК вставки, присутствующей в трансгенном объекте кукурузы DBN9858. Эти два различных ампликона будут соответствовать первому ампликону, который получен из локуса генома кукурузы дикого типа, и второму ампликону для диагностики присутствия ДНК трансгенного объекта кукурузы DBN9858. Если из образца ДНК кукурузы получен только один ампликон, соответствующий второму ампликону, как описано относительно гибридного генома, присутствие трансгенного объекта кукурузы DBN9858 в образце можно диагностировать и подтверждать, и этот образец был произведен из семени кукурузы, которое было гомозиготным в отношении соответствующих аллелей ДНК вставки, присутствующей в трансгенном объекте кукурузы DBN9858.

Следует отметить, что пару праймеров из трансгенного объекта кукурузы DBN9858 использовали для получения ампликонов, которые были диагностическими для геномной ДНК трансгенного объекта кукурузы DBN9858. Эти пары праймеров включают, но без ограничений, праймеры 5 и 6 (SEQ ID NO: 8 и 9) и праймеры 7 и 8 (SEQ ID NO: 10 и 11) для применения в способе амплификации ДНК. Дополнительно, контрольные праймеры 12 и 13 (SEQ ID NO: 22 и 23) были включены для амплификации эндогенных генов кукурузы в качестве внутреннего стандарта для условий реакции. Анализ экстракта ДНК образцов из трансгенного объекта кукурузы DBN9858 должен включать положительный контроль из экстракта ДНК из ткани трансгенного объекта, отрицательный контроль из экстракта ДНК из ткани не от трансгенного объекта кукурузы DBN9858 и отрицательный контроль, не содержащий матрицы из экстракта ДНК кукурузы. В дополнение к этим парам праймеров также можно использовать любые пары праймеров из SEQ ID NO: 3 или SEQ ID NO: 4, или комплементарном им последовательности. Когда их используют в реакции амплификации ДНК, они соответственно производят ампликоны, содержащие SEQ ID NO: 1 или SEQ ID NO: 2, которые являются диагностическими для тканей, происходящих из трансгенного растения кукурузы DBN9858. Условия амплификации ДНК, показанные в таблицах от 2 до 5 можно использовать для получения диагностических ампликонов для трансгенного объекта кукурузы DBN9858 с подходящими парами праймеров. Экстракт ДНК из растения или семени кукурузы или продукт, полученный из трансгенного объекта кукурузы DBN9858, который производит диагностические ампликоны для трансгенного объекта кукурузы DBN9858 при исследовании способом амплификации ДНК, и который предположительно содержит трансгенный объект кукурузы DBN9858, можно использовать в качестве матриц для амплификации, чтобы определить, присутствует или нет трансгенный объект кукурузы DBN9858.

Пример 4. Выявление трансгенного объекта кукурузы DBN9858 при помощи саузерн-блот гибридизации

4.1. ДНК, выделенная для саузерн-блот гибридизации

Гомозиготные объекты трансформации из поколений T4 и T5 использовали анализа при помощи саузерн-блотa. Приблизительно от 5 до 10 г ткани растения растирали в жидком азоте с использованием ступки и пестика. Ткань растения ресуспендировали 12,5 мл буфера А для экстракции (0,2 M трис, pH 8,0, 50 мМ ЭДТА, 0,25 M NaCl, 0,1% об./об. β-меркаптоэтанола, 2,5% масс./об. поливинил-пирролидона), и центрифугировали в течение 10 минут при 4,000 об/мин (2755 g). После удаления супернатанта осадок ресуспендировали 2,5 мл буфера В для экстракции (0,2 M трис, pH 8,0, 50 мМ ЭДТА, 0,5 M NaCl, 1% об./об. β-меркаптоэтанола, 2,5% масс./об. поливинил-пирролидона, 3% паркосила, 20% этанола) и инкубировали при 37°C в течение 30 минут. Во время инкубации образец перемешивали один раз стерильной петлей. После инкубации добавляли равный объем хлороформа/изоамилового спирта (24:1), осторожно перемешивали переворачиванием и центрифугировали в течение 20 минут при 4,000 об/мин. Водный слой собирали и добавляли 0,54 объема изопропанола, с последующим центрифугированием в течение 5 минут при 4,000 об/мин для осаждения ДНК. Супернатант удаляли и осадок ДНК ресуспендировали в 500 мкл TE. Для того чтобы разрушить любую присутствующую РНК, ДНК инкубировали при 37°C в течение 30 минут с 1 мкл 30 мг/мл РНКазы A, центрифугировали в течение 5 минут при 4,000 об/мин и осаждали посредством центрифугирования при 14,000 об/мин в течение 10 минут в присутствии 0,5 объема 7,5 M ацетата аммония и 0,54 объема изопропанола. После удаления супернатанта осадок отмывали 500 мкл 70% (массовая доля) этанола, и оставляли сохнуть перед растворением в 100 мкл буфера TE.

4.2. Расщепление рестрикционными ферментами

ДНК количественно определяли при помощи спектрофотометра или флуориметра (с использованием 1× TNE и красителя Хехста).

Каждый раз в 100 мкл реакционной системы расщепляли 5 мкг ДНК. Геномную ДНК расщепляли рестрикционными ферментами SacI и HindIII соответственно, и частичную последовательность EPSPS и PAT в Т-ДНК в качестве зонда. Реакции расщепления инкубировали в течение ночи при соответствующей температуре для каждого фермента. Образцы вращали в скоростном вакууме для уменьшения объема до 30 мкл.

4.3. Электрофорез в геле

Краситель для нанесения бромфеноловый синий добавляли к каждому образцу, полученному в настоящем примере 4.2, и каждый образец наносили на 0,7% агарозный гель, содержащий бромистый этидий. Электрофоретическое разделение проводили в электрофорезном буфере TBE и электрофорез геля проводили при 20 вольтах в течение ночи.

Гель отмывали в 0,25 M HCl в течение 15 минут для депуринизации ДНК, а затем промывали водой. Саузерн-блот собирали следующим образом: 20 листов толстой сухой фильтровальной бумаги помещали в лоток и 4 листа тонкой сухой фильтровальной бумаги дополнительно помещали сверху. Один лист тонкой фильтровальной бумаги был предварительно смочен 0,4 M NaOH и помещен на верх бумажной стопки, а затем лист мембраны для переноса Hybond-N+ (Amersham Pharmacia Biotech, #RPN303B), также смоченный 0,4 M NaOH. Гель помещали наверх, обеспечивая отсутствие пузырьков воздуха между гелем и мембраной. Три дополнительных листа предварительной смоченной фильтровальной бумаги помещали поверх геля и заполняли лоток для буфера 0,4 M NaOH. Стопка с гелем и лоток с буфером были соединены с использованием фитиля, предварительно смоченного в 0,4 M NaOH, и ДНК переносили на мембрану. Перенос ДНК занял приблизительно 4 часа при комнатной температуре. После переноса мембрану Hybond промывали в 2× SSC в течение 10 секунд, и ДНК была связана с мембраной путем перекрестного сшивания УФ.

4.4. Гибридизация

Подходящую последовательность ДНК амплифицировали при помощи ПЦР для получения зондов. ДНК-зонды представляли собой SEQ ID NO: 24 и SEQ ID NO: 25, или гомологичные или комплементарные им последовательности. 25 нг ДНК-зонда в 45 мкл TE кипятили в течение 5 минут, помещали на лед на 7 минут, а затем переносили в пробирку Rediprime II (Amersham Pharmacia Biotech, #RPN1633). После добавления 5 мкл dCTP, меченного 32P, в пробирку Rediprime, зонд инкубировали при 37°C в течение 15 минут. Зонд очищали посредством центрифугирования через колонку для микроцентрифугирования G-50 (Amersham Pharmacia Biotech, #27-5330-01) по инструкциям производителя для удаления невстроившихся dNTP. Активность зонда измеряли при помощи сцинтилляционного счетчика.

Проводили пре-гибридизацию мембраны Hybond, смачивая ее 20 мл предварительно прогретого раствора Черча для предварительной гибридизации (500 мМ Na3PO4, 1 мМ ЭДТА, 7% SDS, 1% BSA) при 65°C в течение 30 минут. Меченый зонд кипятили в течение 5 минут и помещали на лед на 10 минут. Соответствующее количество зонда (1 миллион импульсов на 1 мл буфера для пре-гибридизации) добавляли к буферу для пре-гибридизации, и проводили гибридизацию при 65°C в течение ночи. На следующие сутки удаляли гибридизационный буфер и после отмывания с 20 мл отмывочного раствора 1 Черча (40 мМ Na3PO4, 1 мМ ЭДТА, 5% SDS, 0,5% BSA), мембрану отмывали 150 мл отмывочного раствора 1 Черча при 65°C в течение 20 минут. This Этот процесс повторяли дважды с отмывочнымого раствором 2 Черча (40 мМ Na3PO4, 1 мМ ЭДТА, 1% SDS). Мембрану экспонировали на люминесцентном экране или рентгеновской пленке, чтобы выявить, где связался зонд.

В каждый саузерн-блот были включены три контрольных образца: (1) ДНК из отрицательного (нетрансформированного) изолята, которую использовали для выявления любой эндогенной последовательности кукурузы, которая может гибридизироваться с элемент-специфическим зондом; (2) ДНК из отрицательного изолята, в которую был введен DBN10006, расщепленный Hind III-digested, в количестве эквивалентном одной копии на основании длины зонда для того чтобы показать чувствительность эксперимента для выявления однокопийного гена в геноме кукурузы; и (3) плазмида DBN10006, расщепленная Hind III, которая была эквивалентна одной копии на основании длины зонда, и которую использовали как положительный контроль для гибридизации, чтобы показать чувствительность эксперимента.

Данные гибридизации предоставили убедительные доказательства в поддержку анализа ПЦР с TaqMan, т.е. растение кукурузы DBN9858 содержит одну копию генов EPSPS и PAT. С этим зондом EPSPS были получены одиночные полосы размером приблизительно 4 т.п.н. и 11 т.п.н. соответственно при ферментативном расщеплении Sac I и Hind III; с зондом PAT были получены одиночные полосы размером приблизительно 3,5 т.п.н. и 1,8 т.п.н. соответственно при ферментативном расщеплении Sac I и Hind III. Это указывает на то, что EPSPS и PAT присутствовали в трансформированном объекте кукурузы DBN9858 в одной копии.

Пример 5. Выявление устойчивости к гербицидам у трансгенного объекта

Гербицид Roundup (водное средство с 41% изопропиламмонийной соли глифосата) и гербицид Basta (активный ингредиент представляет собой 18% глуфосинат) использовали в этом тесте для распыления. Использовали случайное расположение участков, проводили в трех повторах. Площадь составляла 15 м2 (5 м × 3 м), расстояние между линиями составляло 60 см, и расстояние между растениями составляло 25 см, с общепринятой культивацией и уходом. Между участками находилась широкая зона изоляции в 1 м. Трансгенный объект кукурузы DBN9858 обрабатывали следующим образом: 1) без опрыскивания; 2) опрыскивание гербицидом Roundup на стадии листа V3 в дозе 1680 г а.и./га (а.и./га относится к «эквиваленту кислоты активного ингредиента на гектар»), затем снова опрыскивали такой же дозой гербицида Roundup на стадии V8; 3) опрыскивание гербицидом Basta на стадии листа V3 в дозе 800 г а.и./га (а.и./га относится к «активному ингредиенту на гектар»), затем снова опрыскивали такой же дозой гербицида Basta на стадии V8. Следует отметить, что различное содержание и формы дозировок гербицида глифосата можно преобразовывать в равное количество кислоты глифосата, а различные концентрации раствора глуфосината можно преобразовывать в равное количество активного ингредиента глуфосината, все применимо к последующим выводам.

Фитотоксический симптом исследовали через 1 неделю и 2 недели после введения, соответственно, и урожай кукурузы на участке измеряли при уборке. Классификация фитотоксических симптомов показана в таблице 6. Степень повреждения гербицидом использовали в качестве индикатора для оценки устойчивости трансформантов к гербицидам, в частности, степень повреждения гербицидом (%) =Σ (число растений с повреждениями одинакового уровня × номер уровня)/(общее число растений × самый высокий уровень); где степень повреждения гербицидом включает степень повреждения глифосатом и степень повреждения глуфосинатом, и степень повреждения гербицидом определяли на основании результатов исследования фитотоксичности через 2 недели после обработки глифосатом или глуфосинатом. Урожай кукурузы на каждом участке измеряли путем взвешивания всего урожая (массы) зерен кукурузы из трех рядов в центре участка. Различия в урожае между различными обработками измеряли в форме процента урожая, процент урожая (%)=урожай при опрыскивании/урожай без опрыскивания. Результаты устойчивости трансгенного объекта кукурузы DBN9858 к гербициду и результаты урожая кукурузы показаны в таблице 7.

Таблица 6. Стандарты классификации для уровня фитотоксичности гербицида по отношению к кукурузе

Уровень фитотоксичности Описание симптомов
1 Нормальный рост, без всяких симптомов фитотоксичности
2 Легкая фитотоксичность, фитотоксичность менее 10%
3 Умеренная фитотоксичность, возможно восстановить позже, не воздействует на урожай
4 Тяжелая фитотоксичность, сложно восстановить, приводит к снижению урожая
5 Серьезная фитотоксичность, нельзя восстановить, приводит к значительному снижению или отсутствию урожая

Таблица 7. Результаты устойчивости трансгенного объекта кукурузы DBN9858 к гербициду и результаты урожая кукурузы

Наименование/Растение DBN9858
Степень повреждения гербицидом (%) (без опрыскивания) 0
степень повреждения глифосатом (%) 0
Степень повреждения глуфосинатом (%) 0
Процент урожая (%) (глифосат) 100,1
Процент урожая (%) (глуфосинат) 101

Результаты демонстрируют, что в отношении степени повреждения гербицидом (глифосатом и глуфосинатом) 1) степень повреждения трансгенного объекта кукурузы DBN9858 по существу составила ноль после обработки гербицидом глифосатом (1680 г а.и./га); и степень повреждения трансгенного объекта кукурузы DBN9858 также по существу составила ноль после обработки гербицидом глуфосинатом (800 г а.и./га); таким образом, трансгенный объект кукурузы DBN9858 имеет хорошую устойчивость к гербицидам (глифосату и глуфосинату).

Что касается урожая: трансгенный объект кукурузы DBN9858 не имел значимых отличий в урожае после трех обработок: без опрыскивания, гербицид глифосат (1680 г а.и./га) и гербицид глуфосинат (800 г а.и./га); после опрыскивания гербицидом урожай трансгенного объекта кукурузы DBN9858, напротив, слегка повысился, таким образом, дополнительно указывая на то, что трансгенный объект кукурузы DBN9858 имеет хорошую устойчивость к гербицидам (глифосату и глуфосинату).

Пример 6

Продукты, такие как сельскохозяйственные продукты и товары можно получать при помощи трансгенного объекта кукурузы DBN9858. Если достаточное количество экспрессии выявляют в сельскохозяйственных продуктах или товарах, то ожидается, что они содержат нуклеотидную последовательность, которая может диагностировать присутствие материала трансгенного объекта кукурузы DBN9858 в сельскохозяйственных продуктах или товарах. Сельскохозяйственные продукты и товары неограничивающим образом включают кукурузное масло, кукурузную муку грубого помола, кукурузную муку тонкого помола, кукурузный глютен, кукурузный жмых, кукурузный крахмал и любой другой пищевой продукт, который может быть использован как источник пищи для потребления животными, или в ином случае в качестве разрыхлителя теста или ингредиентов в косметических композициях для косметического применения, и т.д. Можно разработать способ детекции нуклеиновых кислот и/или набор на основе зонда или пары праймеров для выявления нуклеотидной последовательности трансгенного объекта кукурузы DBN9858, такой как предложенные в SEQ ID NO: 1 или SEQ ID NO 2, в биологическом образце для выявления присутствия трансгенного объекта кукурузы DBN9858, где последовательность зонда или последовательность праймера выбраны из последовательности, предложенной в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 и SEQ ID NO: 5.

В итоге трансгенный объект кукурузы DBN9858 по настоящему изобретению имеет хорошую устойчивость к гербициду глифосату и гербицид глуфосинату, и не оказывает воздействия на урожай, и способ детекции может точно и быстро выявлять, содержит ли биологический образец молекулу ДНК из трансгенного объекта кукурузы DBN9858.

Для семян трансгенного объекта кукурузы DBN9858 было сделано депонирование в Центре общей микробиологической коллекции культур Китая (сокращение CGMCC, адрес: Institute of Microbiology, Chinese Academy of Sciences, No.1 Beichen West Road, Chaoyang District, Beijing, индекс 100101) 24 декабря 2014 года в категории под названием: кукуруза (Zea mays), номер депонирования CGMCC No.10212. Депонирование будет храниться в хранилище в течение 30 лет.

Наконец, следует отметить, что вышеуказанные примеры приведены только для иллюстрации технических растворов по настоящему изобретению и не ограничивают изобретение. Хотя настоящее изобретение было подробно описано со ссылкой на предпочтительные примеры, специалистам в данной области понятно, что можно производить любую модификацию или эквивалентную замену в технических растворах по настоящему изобретению в пределах сущности и объема технических растворов по настоящему изобретению.

1. Молекула нуклеиновой кислоты для выявления присутствия SEQ ID NO: 5 или комплементарной ей последовательности в образце, где последовательность нуклеиновой кислоты содержит SEQ ID NO: 1 или комплементарную ей последовательность, и/или SEQ ID NO: 2 или комплементарную ей последовательность.

2. Молекула нуклеиновой кислоты по п.1, где последовательность нуклеиновой кислоты содержит SEQ ID NO: 3 или комплементарную ей последовательность, и/или SEQ ID NO: 4 или комплементарную ей последовательность.

3. Молекула нуклеиновой кислоты по п.2, где последовательность нуклеиновой кислоты содержит SEQ ID NO: 5 или комплементарную ей последовательность.

4. Способ выявления присутствия SEQ ID NO: 5 или комплементарной ей последовательности в образце, включающий:

контакт образца для детекции по меньшей мере с двумя праймерами для амплификации продукта, представляющего интерес, в реакции амплификации нуклеиновой кислоты;

проведение реакции амплификации нуклеиновой кислоты; и

выявление присутствия продукта амплификации, представляющего интерес;

где продукт амплификации, представляющий интерес, содержит SEQ ID NO: 1 или комплементарную ей последовательность и/или SEQ ID NO: 2 или комплементарную ей последовательность.

5. Способ по п.4, где продукт амплификации, представляющий интерес, дополнительно содержит SEQ ID NO: 6 или комплементарную ей последовательность и/или SEQ ID NO: 7 или комплементарную ей последовательность.

6. Способ по п.4 или 5, где по меньшей мере один из праймеров содержит последовательность нуклеиновой кислоты по любому из пп. 1-3, или фрагмент или комплементарную ей последовательность.

7. Способ по п.6, где праймеры включают первый праймер, выбранный из SEQ ID NO: 8 и SEQ ID NO: 10, и второй праймер, выбранный из SEQ ID NO: 9 и SEQ ID NO: 11.

8. Способ выявления присутствия SEQ ID NO: 5 или комплементарной ей последовательности в образце, включающий:

контакт образца для детекции с зондом, где зонд содержит последовательность нуклеиновой кислоты, содержащую SEQ ID NO: 1 или комплементарную ей последовательность или SEQ ID NO: 2 или комплементарную ей последовательность;

гибридизацию образца для детекции с зондом в жестких условиях гибридизации; и

выявление гибридизации образца для детекции с зондом.

9. Способ по п.8, где зонд дополнительно содержит или имеет SEQ ID NO: 6 или комплементарную ей последовательность и/или SEQ ID NO: 7 или комплементарную ей последовательность.

10. Способ по п.8 или 9, где зонд представляет собой маркерную молекулу нуклеиновой кислоты, и используют анализ скрещивания при помощи маркера для определения того, связана ли генетически устойчивость к глифосату и/или устойчивость к глуфосинату с маркерной молекулой нуклеиновой кислоты.

11. Способ по любому из пп. 8-10, где по меньшей мере один из зондов мечен флуоресцентной группой.

12. Набор для детекции ДНК, включающий по меньшей мере молекулу ДНК и инструкцию по применению набора, где молекула ДНК содержит SEQ ID NO: 1 или комплементарную ей последовательность и/или SEQ ID NO: 2 или комплементарную ей последовательность, и используется в качестве ДНК праймера или ДНК-зонда, специфичного для SEQ ID NO: 5 или комплементарной ей последовательности, или его потомства.

13. Набор для детекции ДНК по п.12, где молекула ДНК дополнительно содержит SEQ ID NO: 6 или комплементарную ей последовательность и/или SEQ ID NO: 7 или комплементарную ей последовательность.

14. Растительная клетка для получения трансгенного растения кукурузы, которая содержит последовательность нуклеиновой кислоты, представленная в SEQ ID NO: 5, причем SEQ ID NO: 5 содержит последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глифосату EPSPS, и последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глуфосинату PAT.

15. Часть растения для получения трансгенного растения кукурузы, которая содержит последовательность нуклеиновой кислоты, представленную в SEQ ID NO: 5, причем SEQ ID NO: 5 содержит последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глифосату EPSPS, и последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глуфосинату PAT.

16. Способ получения трансгенного растения кукурузы, имеющего устойчивость к гербициду глифосату и гербициду глуфосинату, включающий:

введение последовательности нуклеиновой кислоты, кодирующей белок устойчивости к глифосату EPSPS и последовательности нуклеиновой кислоты, кодирующей белок устойчивости к глуфосинату PAT, и последовательности нуклеиновой кислоты определенной области в геном растения кукурузы, где последовательность нуклеиновой кислоты определенной области является по меньшей мере одной последовательностью нуклеиновой кислоты, выбранной из последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 и SEQ ID NO: 7, или комплементарных им последовательностей;

предпочтительно, способ, включающий введение последовательности нуклеиновой кислоты, предложенной в SEQ ID NO: 5, в геном растения кукурузы.

17. Способ по п.16, дополнительно включающий:

половое скрещивание первого родительского растения кукурузы, содержащего SEQ ID NO: 5 или комплементарную ей последовательность, с устойчивостью к гербициду глифосату и гербициду глуфосинату со вторым родительским растением кукурузы без устойчивости к глифосату и глуфосинату, для получения большого числа растений-потомков;

обработку растений-потомков гербицидом глифосатом и гербицидом глуфосинатом; и

отбор устойчивых к глифосату и глуфосинату растений-потомков.

18. Способ культивирования растения кукурузы, имеющего устойчивость к гербициду глифосату и гербициду глуфосинату, включающий:

введение последовательности нуклеиновой кислоты, кодирующей белок устойчивости к глифосату EPSPS и последовательности нуклеиновой кислоты, кодирующей белок устойчивости к глуфосинату PAT, и последовательности нуклеиновой кислоты определенной области в геном растения кукурузы;

посадку по меньшей мере одного семени кукурузы, которое содержит в своем геноме последовательность нуклеиновой кислоты, кодирующую белок устойчивости к глифосату EPSPS, и последовательность нуклеиновой кислоты, кодирующей белок устойчивости к глуфосинату PAT, и последовательность нуклеиновой кислоты определенной области;

выращивание кукурузного семени до растения кукурузы;

опрыскивание растения кукурузы эффективной дозой гербицида глифосата и гербицида глуфосината, и сбор растения со сниженным повреждением растения по сравнению с другими растениями, не имеющими введенной последовательности нуклеиновой кислоты определенной области;

где последовательность нуклеиновой кислоты определенной области является по меньшей мере одной последовательностью нуклеиновой кислоты, выбранной из последовательностей, предложенных в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 и SEQ ID NO: 7;

предпочтительно, способ, включающий:

введение последовательности нуклеиновой кислоты, предложенной в SEQ ID NO: 5, в геном растения кукурузы;

посадку по меньшей мере одного семени кукурузы, которое содержит в своем геноме последовательность нуклеиновой кислоты, предложенную в SEQ ID NO: 5;

выращивание кукурузного семени до растения кукурузы;

опрыскивание растения кукурузы эффективной дозой гербицида глифосата, и сбор растения со сниженным повреждением растения по сравнению с другими растениями, не имеющими SEQ ID NO: 5.

19. Способ защиты растений от повреждения, вызванного гербицидом, и для борьбы с сорняками на поле, включающий:

нанесение гербицида, содержащего эффективную дозу глифосата и глуфосината на поле, где высажено по меньшей мере одно трансгенное растение кукурузы, где трансгенное растение кукурузы содержит в своем геноме SEQ ID NO: 1, нуклеотиды 1157-5744 последовательности нуклеиновой кислоты SEQ ID NO: 5 и SEQ ID NO: 2 в последовательности, или трансгенное растение кукурузы содержит в своем геноме SEQ ID NO: 5, и трансгенное растение кукурузы имеет устойчивость к гербициду глифосату и гербициду глуфосинату.

20. Способ борьбы с сорняками, устойчивыми к глифосату, на поле с растениями, устойчивыми к глифосату, включающий:

нанесение гербицида, содержащего эффективную дозу глуфосината на поле, где высажено по меньшей мере одно трансгенное растение кукурузы, устойчивое к глифосату, где трансгенное растение кукурузы, устойчивое к глифосату, содержит в своем геноме SEQ ID NO: 1, нуклеотиды 1157-5744 последовательности нуклеиновой кислоты SEQ ID NO: 5 и SEQ ID NO: 2 в последовательности, или трансгенное растение кукурузы, устойчивое к глифосату, содержит в своем геноме SEQ ID NO: 5, и трансгенное растение кукурузы, устойчивое к глифосату, также имеет устойчивость к гербициду глуфосинату.

21. Пищевой продукт, содержащий полинуклеотид, представленный в SEQ ID NO: 5, где пищевой продукт представляет собой кукурузную муку грубого помола, кукурузную муку тонкого помола, кукурузное масло, кукурузный крахмал, кукурузный глютен.

22. Кормовой продукт, содержащий полинуклеотид, представленный в SEQ ID NO: 5, где кормовой продукт представляет собой кукурузный жмых.

23. Наполнитель, содержащий полинуклеотид, представленный в SEQ ID NO: 5.

24. Косметический препарат, содержащий полинуклеотид, представленный в SEQ ID NO: 5.



 

Похожие патенты:

Изобретение относится к области биотехнологии. Предложен способ идентификации патогенных бактерий в пищевых субстратах с использованием высокопроизводительного секвенирования, включающий отбор биологического материала и выделение ДНК с проведением мультиплексной ПЦР, отличающийся тем, что для амплификации в одной реакции одновременно используются 34 праймера: прямые SEQ ID NO 1-17 и обратные SEQ ID NO 18-34, все амплифицированные последовательности подвергаются высокопроизводительному секвенированию, проводится сравнение секвенированных нуклеотидных последовательностей с последовательностями бактерий Bacillus cereus, Campylobacter coli, Campylobacter jejuni, Clostridium perfringens, Clostridium tyrobutyricum, Cronobacter sakazii, Escherichia coli (EHEC), Escherichia coli (STEC/VTEC), Listeria monocytogenes, Mycobacterium tubercolosis, Proteus mirabilis, Salmonella enteric, Shigella flexneri, Shigella boydii, Shigella sonnei, Staphylococcus aureus, Vibrio cholera, Vibrio parahaemoliticus, причем при идентичности последовательностей свыше 95% делается вывод о присутствии данной патогенной бактерии в пищевом субстрате.

Изобретение относится к биотехнологии, в частности описан основанный на применении микровезикул способ обнаружения некротического энтерита птиц, а также новые маркеры, которые идентифицированы в качестве приемлемых для обнаружения некротического энтерита птиц и/или заражения птиц Clostridium perfringens.

Изобретение относится к биотехнологии, в частности описан основанный на применении микровезикул способ обнаружения некротического энтерита птиц, а также новые маркеры, которые идентифицированы в качестве приемлемых для обнаружения некротического энтерита птиц и/или заражения птиц Clostridium perfringens.

Изобретение относится к биотехнологии и касасется применения белка, содержащего аминокислотную последовательность SEQ ID NO: 1, или содержащего аминокислотную последовательность, которая по меньшей мере на 95% идентична аминокислотной последовательности SEQ ID NO: 1 и имеет отличия по сравнению с SEQ ID NO: 1 только в неконсервативных аминокислотных остатках, для образования двунитевого разрыва в молекуле ДНК, расположенного непосредственно перед нуклеотидной последовательностью 5'-NNNNGNA-3' в указанной молекуле ДНК.

Изобретение относится к биотехнологии и описывает новую бактериальную нуклеазу системы CRISPR-Cas9 из бактерии Defluviimonas sp. 20V17, а также ее применение для образования строго специфичных двунитевых разрывов в молекуле ДНК.

Группа изобретений относится к области аналитической химии. Раскрыт способ выявления присутствия или отсутствия целевой молекулы в образце, предусматривающий введение образца в контакт с молекулой, содержащей расщепляемый линкер, при этом указанный расщепляемый линкер специфически расщепляется в присутствии указанной целевой молекулы; загрузку указанного образца в устройство, содержащее нанопору; создание конфигурации устройства с возможностью пропускания каркаса, выбранного из нуклеиновых кислот, пептидной нуклеиновой кислоты (PNA), дендримеров, линеаризованных белков или пептидов, через указанную нанопору, расщепляемого линкера, содержащего первый домен, который связывается с указанным каркасом, и второй домен, который связывается с молекулярным грузом, тем самым образуя комплекс, и при этом устройство содержит датчик для измерения тока; и определение с помощью датчика, был ли расщепляемый линкер расщеплен путем выявления индивидуальной сигнатуры тока при транслокации указанного комплекса через нанопору.

Изобретение относится к области медицины. Предложен способ неинвазивного пренатального скрининга анеуплоидий плода путем массового параллельного секвенирования при помощи полупроводниковой технологии.

Изобретение относится к области медицины. Предложен способ неинвазивного пренатального скрининга анеуплоидий плода путем массового параллельного секвенирования при помощи полупроводниковой технологии.
Изобретение относится к биотехнологии. Предложены способы диагностирования хронического заболевания клапанов у животного.
Изобретение относится к биотехнологии. Предложены способы диагностирования хронического заболевания клапанов у животного.

Предложенная группа изобретений относится к области медицины. Предложена фармацевтическая композиция для предотвращения и лечения вызванного неоваскуляризацией заболевания глаз, содержащая белок слияния, в котором проникающий в ткань пептид слит с анти-VEGF.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, способные к специфическому связыванию с участком бета цепи семейства TRBV9 Т-клеточного рецептора человека.

Настоящее изобретение относится к области иммунологии. Предложены выделенная молекула нуклеиновой кислоты, кодирующая анти-CD19 химерный антигенный рецептор, выделенная молекула анти-CD19 химерный антигенный рецептор, а также гуманизированный анти-CD19-связывающий домен.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, способные к специфическому связыванию с участком бета цепи семейства TRBV9 Т-клеточного рецептора человека.

Группа изобретений относится к иммунологии, в частности к антителам и их антиген-связывающим фрагментам, специфически связывающимся с PD-1, а также к способам применения таких антител и антиген-связывающих фрагментов, в частности, для лечения рака и инфекционного заболевания, ассоциированных с экспрессией PD-1.

Настоящее изобретение относится к биотехнологии. Предложены антитела и их антиген-связывающие фрагменты против ИЛ-1-бета.

Изобретение относится к области биотехнологии, конкретно к химерным антигенным рецепторам, нацеленным на CD123 (CD123CAR), и может быть использовано в медицине для лечения острого миелоидного лейкоза (AML).

Изобретение относится к области биотехнологии, конкретно к получению выделенной клетки млекопитающего, подходящей для рекомбинантной экспрессии интересующего полипептида, где клетку млекопитающего изменяют для ухудшения функции эндогенной протеазы матриптазы посредством нокаута, мутации, делеции или сайленсинга гена матриптазы.

Настоящее изобретение относится к биотехнологии. Предложено антитело против пресепсина, а также антигенсвязывающий фрагмент антитела, полинуклеотид, экспрессирующий вектор, трансформированный штамм, способы получения антитела и его антигенсвязывающего фрагмента.

Изобретение относится к биотехнологии. Описан вектор экспрессии фактора VIII (FVIII) на основе аденоассоциированного вируса (ААВ), содержащий нуклеиновую кислоту, содержащую 5’-инвертированный концевой повтор (ITR) ААВ2, специфическую для печени область регуляции транскрипции, кодон-оптимизированную область, кодирующую функционально активный FVIII, возможно один или более интронов, последовательность полиаденилирования и 3’-ITR ААВ2, причем область, кодирующая функционально активный FVIII, включает нуклеотиды 923-5296 последовательности SEQ ID NO: 9 и причем вектор имеет длину менее 5000 нуклеотидов.

Изобретение относится к области биохимии, в частности к способу получения гетерологичного пептида в растении Nicotiana tabacum. Также раскрыто применение комбинации Nicotiana tabacum и Agrobacterium в транзиторной Agrobacterium трансформации растений табака.

Изобретение относится к области биохимии, в частности к молекуле нуклеиновой кислоты. Также раскрыты способы выявления присутствия нуклеиновой кислоты в образце, способ получения трансгенного растения кукурузы, способ культивирования трансгенного растения кукурузы, способ борьбы с сорняками, способ защиты растений, с помощью указанной нуклеиновой кислоты. Раскрыты набор для детекции ДНК, растительная клетка, часть растения, пищевой продукт кормовой продукт, наполнитель, косметический препарат, содержащий указанную молекулу нуклеиновой кислоты. Изобретение позволяет получать трансгенные растения, устойчивые к гербициду. 14 н. и 10 з.п. ф-лы, 2 ил., 7 табл., 6 пр.

Наверх