Способ получения gd3+-связывающего белка



Способ получения gd3+-связывающего белка
Способ получения gd3+-связывающего белка
Способ получения gd3+-связывающего белка
Способ получения gd3+-связывающего белка
C07K1/36 - Пептиды (пептиды в пищевых составах A23, например получение белковых композиций для пищевых составов A23J, препараты для медицинских целей A61K; пептиды, содержащие бета-лактамовые кольца, C07D; циклические дипептиды, не содержащие в молекуле любого другого пептидного звена, кроме образующего их кольцо, например пиперазин-2,5-дионы, C07D; алкалоиды спорыньи циклического пептидного типа C07D519/02; высокомолекулярные соединения, содержащие статистически распределенные аминокислотные единицы в молекулах, т.е. при получении предусматривается не специфическая, а случайная последовательность аминокислотных единиц, гомополиамиды и блоксополиамиды, полученные из аминокислот, C08G 69/00; высокомолекулярные продукты, полученные из протеинов, C08H 1/00; получение

Владельцы патента RU 2713792:

Федеральное государственное бюджетное учреждение "Национальный медицинский исследовательский центр онкологии имени Н.Н. Блохина" Министерства здравоохранения Российской Федерации (ФГБУ "НМИЦ онкологии им. Н.Н. Блохина" Минздрава России) (RU)

Изобретение относится к области биотехнологии, в частности к способу получения Gd3+-связывающего белка. Комплекс белка с ионами Gd3+, в свою очередь, может быть использован для получения физиологически приемлемого Gd3+-содержащего агента, пригодного для контрастирования опухолей с помощью спектроскопии парамагнитного резонанса и для радиотерапии опухолей по принципу термоаблации. Техническим результатом данного изобретения является способ получения Gd3+-связывающего лиганда на основе искусственного рекомбинантного белка, обладающего способностью прочно удерживать ион металла в условиях, приближенных к физиологическим, обеспечивая его детоксикацию и адресную доставку в опухолевую ткань. 2 з.п. ф-лы, 7 ил., 2 пр.

 

Изобретение относится к медицинской биотехнологии, онкологии и может быть использовано для получения белка, прочно связывающего ионы Gd3+. Комплекс белка с ионами Gd3+, в свою очередь, может быть использован для получения физиологически приемлемого Gd3+- содержащего агента, необходимого для контрастирования опухолей с помощью спектроскопии парамагнитного резонанса и для радиотерапии опухолей по принципу термоаблации.

Ион гадолиния (Gd3+) обладает уникальными парамагнитными свойствами, которые широко используются в медицинской диагностике для магнитно-резонансной визуализации и для поражения опухолевых клеток вторичным тепловым излучением [Goischke H.K. MRI with gadolinium-based contrast agents: practical help to ensure patient safety // J. Am. Coll. Radiol. 2016. Vol. 1546-1440(16), P. 30315-30315]. Время релаксации электронно-спиновой решетки контрастирующих агентов на основе Gd3+ Т1 составляет около 0,1 нсек, что на порядок меньше времени релаксации протонов в воде [Dinger S.C., Fridjhon P., Rubin D.M. Thermal Excitation of Gadolinium-Based Contrast Agents Using Spin Resonance //PLoSOne. 2016. Vol. 11(6), P. e0158194]. Поскольку сам по себе ион Gd3+ токсичен даже в низких концентрациях (достаточных для контрастирования биологических структур с учётом высокой парамагнитной активности ионов Gd3+), его используют в хелатированной форме с комплексообразователями, которые обладают высокими константами связывания, например, этоксибензил-диэтилентриаминопентауксусной кислотой [Saito K., Yoshimura N., Shirota N., Saguchi T., Sugimoto K., Tokuuye K. Distinguishing liver haemangiomas froм Мetastatic tumours using gadolinium ethoxybenzyl diethylenetriaminepentaacetic acid-enhanced diffusion-weighted imaging at 1.5 TMRI // J. Med. Imaging Radiat. Oncol. 2016. [Epub ahead of print] PubMedPMID: 27324436]. Наночастицы, содержащие хелатированную форму Gd3+, рутинно применяются для прижизненного контрастирования тонкой инфраструктуры при выполнении МРТ в интересах клинической диагностики самых различных тканей: структур мозга [Hu H.H., Pokorney A., Towbin R.B., Miller J.H. Increased signal intensities in the dentate nucleus and globus pallidus on unenhanced T1-weighted images: evidence in children undergoing multiple gadoliniuм МRI exams //Pediatr.Radiol. 2016. [Epub ahead of print] PubMed PMID: 27282825], сосудистых плексусов [Schnell S., Wu C., Ansari S.A. Four-dimensional MRI flow examinations in cerebral and extracerebral vessels - ready for clinical routine? // Curr.Opin.Neurol. 2016. [Epub ahead of print] PubMed PMID: 27262148], миокарда и коронарных сосудов [Swoboda P.P., McDiarmid A.K., Erhayiem B., Haaf P., Kidambi A., Fent G.J., Dobson L.E., Musa T.A., Garg P., Law G.R., Kearney M.T., Barth J.H., Ajjan R., Greenwood J.P., Plein S. A novel and practical screening tool for the detection of silent myocardial infarction in patients with type 2 diabetes // J. Clin. Endocrinol. Metab. 2016. [Epub ahead of print] PubMed PMID: 27300573].

В работе [Kang M.K., LeeG.H., JungK.H., JungJ.C., KimH.K., KimY.H., LeeJ., RyeomH.K., KimT.J., ChangY. Gadolinium Nanoparticles Conjugated with Therapeutic Bifunctional Chelate as a Potential T1 Theranostic Magnetic Resonance Imaging Agent // J. Biomed. Nanotechnol. 2016. Vol. 12(5). P. 894-908] описан метод получения наночастиц оксида гадолиния Gd@SiO2-DO3AиGd@SiO2-DO2A-BTA размером 50-60 нм. Наночастицы изготавливались из тетраэтилортосиликата (TEOS) и (3-аминопропил) триэтоксисилана (APTES) с последующей функционализацией аминопропилсилановых групп 1,4,7,10-тетраазациклододекан-1,4,7,10-тетрауксуснойкислотой (DOTA) или 1,4,7,10-тетраазациклододекан-1,4,7-трсуксуснойкислотой, конъюгированной с бензотиазолом (DO3A-BTA). Наночастицы Gd@SiO2-DO3A и Gd@SiO2-DO2A-BTA отличались высокой растворимостью и стабильностью коллоидного раствора. Релаксивность r1 наночастиц Gd@SiO2-DO3A и Gd@SiO2-DO2A-BTA оказалась намного выше, чем у низкомолекулярных контрастных веществ, а соотношение r2/r1 [DeLeon-Rodriguez L.M., Martins A.F., Pinho M.C., Rofsky N.M., SherryA.D. Basic MR Relaxation Mechanisms and Contrast Agent Design // JMRI. 2015. Vol. 42, Issue 3. Pp. 545-565] для них приближалось к 1, что позволяет использовать их в МРТ [Yang C.-T., Chuang K.-H. Gd(III) chelates for MRI contrast agents: from high relaxivity to ‘‘smart’’, from blood pool to blood–brain barrier permeable // Med. Chem. Commun., 2012, Vol. 3.P. 552]. Исследование биораспределения наночастиц показало, что Gd@SiO2-DO2A-BTA выводится из организма преимущественно с желчью и мочой. Наночастицы Gd@SiO2-DO2A-BTA накапливались в опухолевых клетках и оказались пригодны для уничтожения in vivo таких перевиваемых клеточных линий, как SK-HEP-1, MDA-MB-231, HeLa и Hep-3B. Хотя имеются сообщения о кумулятивной токсичности наноструктурированных контрастных веществ на основе гадолиния [Maximova N., Gregori M., Zennaro F., Sonzogni A., Simeone R., Zanon D. Hepatic gadolinium deposition and reversibility after contrast agent-enhanced MR imaging of pediatric hematopoietic stem cell transplant recipients // Radiology. 2016 [Epub ahead of print] PubMed PMID: 27276243], в частности нефротоксичности [Ersoy H., Rybicki F.J. Biochemical Safety Profiles of Gadolinium-Based Extracellular Contrast Agents and Nephrogenic Systemic Fibrosis // J. Magn. Reson. Imaging. 2007. November. Vol. 26(5). P. 1190–1197], их применение в МРТ-диагностике самых различных заболеваний, а также перспектива использования для терапии опухолей рассматривается как актуальная задача, что подтверждается публикациями на эту тему [Le Duc G., Roux S., Paruta-Tuarez A., Dufort S., Brauer E., Marais A., Truillet C., Sancey L., Perriat P., Lux F., Tillement O. Advantages of gadolinium based ultrasmall nanoparticles vs molecular gadolinium chelates for radiotherapy guided by MRI for glioma treatment // Cancer Nanotechnology Basic, Translational and Clinical Research. 2014. 5:4].

Известны результаты, свидетельствующие о возможности использования белковых носителей для доставки ионов Gd3+in vivo. В статье [Chataigner L.; Guo J.; Erskine P.T.; Coker A.R.; Wood S.P., Gombos Z., Cooper J.B. (2016) Binding of Gd3+ to the neuronal signalling protein calexcitin identifies an exchangeable Ca2+-binding site. / Acta Crystallographica Section F: Structural Biology and Crystallization Communications, F72 (4) pp. 276-281. 10.1107/S2053230X16003526] для этой цели использован кальэкситин - белковый нейротоксин из морской змеи Hermissen dacrassicornis.

Известен патент РФ №2015514 «Способ получения кальмодулина», раскрывающий способ очистки кальмодулина из естественного источника - семенников крупного рогатого скота.

В публикации [Le Clainche L. и Vita C. «Binding Toxic Metals to New Calmodulin Peptides» в сборнике Environmental Chemistry pp 133-143] сообщается о создании синтетических пептидов с вторичной структурой типа «спираль-петля-спираль», стабилизированной дисульфидной связью, на основе кальмодулина инфузории Paramecium tetraurelia. Этот пептид образует прочные комплексы с ионами Ca2+ и Cd2+: константы диссоциации этих комплексов составляют 30±1 мкM и 8±4 мкM, соответственно.

Известен патент США N 20180134810 Uranium-chelating peptides and uses thereof, патентообладатель Coм Мissariat A L'energie Atomique Et Aux Energies Alternatives May 17, 2018, раскрывающий структуру пептидов, обладающих высоким сродством к ионам Gd3+, в том числе, на основе кальмодулина.

Наиболее близким аналогом заявляемого изобретения является работа [Позднякова Н.В., Григорьева Е.Ю., Шевелев А.Б. Мицеллярные композиции на основе функционализованных α фетопротеином амфифильных блок-сополимеров, содержащих гадолиний и куркумин. Вестник Российского государственного медицинского университета. 2016. № 3. С. 30-37]. В ней раскрывается методика получения мицеллярных композиций на основе трёхблочных амфифильных сополимеров полиэтиленгликоля и полипропиленгликоля Pluronic®F127 и Pluronic®P123, включающих хелатированный комплекс Gd3+ c природным гидрофобным комплексоном куркумином, поверхность которых функционализована рекомбинантным производным α-фетопротеина человека. Методом динамического светорассеяния определен размер наночастиц, показано, что мицеллы характеризуются узким диапазоном распределения по размеру. При этом средний диаметр мицелл существенно зависел от состава композиции, но никогда не превышал 100 нм. Предварительные эксперименты in vivo на животных по оценке переносимости мицеллярной композиции показали отсутствие явно выраженной токсичности при введении максимально возможной концентрации гадолиния.

Проблема, решаемая настоящим изобретением, состоит в разработке технологически эффективного способа получения Gd3+-связывающего лиганда на основе искусственного рекомбинантного белка, обладающего способностью прочно удерживать ион металла в условиях, приближенных к физиологическим, обеспечивая его детоксикацию и адресную доставку в опухолевую ткань.

Решение задачи в сравнении с прототипом достигается путём выполнения следующих операций:

1) Генно-инженерное конструирование:

Разрабатывают и получают генно-экспрессионную ДНК-конструкцию рW4, кодирующую искусственный белок в составе семи последовательно расположенных от N-конца к С-концу элементов первичной структуры: (1) His-таг для дополнительной очистки белка методом металл-хелатной хроматографии; (2) лидерный пептид гена 10 бактериофага T7 для улучшения эффективности трансляции в E. coli; (3) Xpress™ epitopetag - сайт расщепления пептида энтерокиназой; (4) пептид F3, обладающий сродством к перспективному поверхностному онкомаркеру нуклеолину для обеспечения адресной доставки в опухолевые клетки; (5) линкерный пептид «Small antibody fragment linker»; (6) основной блок гетероповторов состава [Е2-М-Е4-М*-E2], где E- эластиноподобный пептид, а М - N-концевой кальций-связывающий мотив кальмодулина человека; (7) зелёный флуоресцентный белок EmGFP;

2) Получение и первичная переработка биомассы штамма-продуцента:

Конструкцию вводят в штамм E. coli BL21 (DE3), нарабатывают биомассу методом поверхностного культивирования на агаризованной среде Агар LB по Lennox (ООО Диаэм, каталожный номер 3139.0250), содержащей 100 мкг/мл ампициллина в течение 16 часов при 37°С. При культивировании штамма-продуцента в указанных условиях происходит автоиндукция синтеза целевого белка без внесения в среду какого-либо искусственного индуктора. Биомассу собирают с поверхности чашки шпателем, проводят гомогенизацию, суспендируют в буфере состава Трис-HCl, 50 мМ, рН 8,0, ЭДТА 2 мМ, 4-(2-аминоэтил) бензилсульфонил фторид гидрохлорид (AEBSF) 1,5 мМ, лизоцим куриного яйца 0,2 мг/мл, NaCl 0,1 М из расчета 50 мл буфера на 1 г сырой биомассы, инкубируют при 37°С, проводят ультразвуковую дезинтеграцию с помощью 10 кратной обработки в аппарате Soniprep 150 plus (MSE, Южная Корея) при мощности излучения 300 ватт в течение 45 сек с промежуточным охлаждением в ледяной бане.

3) Очистка целевого белка W4 из лизата штамма E. coli, содержащего конструкцию рW4:

(1) лизат, полученный на предыдущей стадии, подвергают предварительной очистке с помощью ионнообменной хроматографии и диализа; (2) устанавливают невозможность получения целевого продукта с высокой степенью очистки за счёт использования металлохелатной хроматографии на агарозных сорбентах, содержащих нитрилтриацетатную группу, что объясняется высокой аффинностью белка W4 к ионам Ni2+, входящим в состав сорбента; (3) устанавливают возможность избирательного осаждения белка W4 из предварительно очищенного лизата путем внесения ионов Gd3+ до конечной концентрации 2 мМ, образовавшийся преципитат осаждают с помощью низкоскоростного центрифугирования; устанавливают неэффективность использования других многозарядных катионов металлов помимо Gd3+ для избирательного белка W4 в связи с тем, что они либо обладают недостаточной аффинностью к белку и не обеспечивают полноты и избирательности осаждения (например, ион Ca2+), либо обладают чрезмерной аффинностью и приводят к образованию комплексов с металлом, нерастворимых в присутствии ЭДТА (Cu2+, Ni2+, Co2+); (4) целевой продукт - белок W4 переводят Gd3+-преципитата в раствор добавлением ЭДТА (N,N’-этилендиаминтетраацетат) до конечной концентрации 10-50 мМ в присутствии нейтрального или слабокислого физиологического буфера; (5) окончательно обессоливают белок с помощью диализа.

Следующие фигуры чертежей поясняют сущность изобретения:

Фиг. 1. Генетическая карта расположения функциональных элементов вспомогательной конструкции pB7 с участком гетероповторов состава E(Y)-M-E-M*.

Фиг. 2. Генетическая карта расположения функциональных элементов промежуточной конструкции pFL16. Объёмной стрелкой FL-16 показан участок, кодирующий F3-пептид, слитый с линкером.

Фиг. 3. Генетическая карта расположения функциональных элементов конструкции pW4. Показаны F3-пептид (F3), линкер (L), блок гетероповторов (ELP-M) и зелёный флуоресцентный белок (EmGFP).

Фиг. 4. Расположение функциональных элементов в первичной структуре искусственного Gd3+-связывающего белка W4.

Фиг. 5. Анализ фракций, полученных при переработке лизата E. coli BL21 (DE3), несущего экспрессионную конструкцию pW4, при щелочных значениях рН (в буфере Tрис-HCl, pH 8,0), с помощью денатурирующего диск-электрофореза в 12,5% полиакриламидном геле (окрашен Кумасси R-250). На дорожки геля нанесены:

1 - растворимая фракция лизата биомассы E. coli BL21 (DE3, pW4), полученного в условиях автоиндукции (супернатант после центрифугирования лизата при 13 тыс. g);

2 - нерастворимая фракция лизата биомассы E. coli BL21 (DE3, pW4), полученного в условиях автоиндукции (осадок после центрифугирования лизата при 13 тыс. g);

3 - преципитат, полученный в результате внесения CaCl2 до конечной концентрации 90 мМ в растворимую фракцию лизата биомассы E. coli BL21 (DE3, pW4) с последующим центрифугированием при 13 тыс. g;

4 - преципитат, полученный в результате внесения Gd(NO3)3 до конечной концентрации 2 мМ в растворимую фракцию лизата биомассы E. coli BL21 (DE3, pW4) после осветления в присутствии CaCl2, с последующим центрифугированием при 13 тыс. g;

5 - растворимая фракция белков, полученная в результате внесения Gd(NO3)2 до конечной концентрации 2 мМ в растворимую фракцию лизата биомассы E. coli BL21 (DE3, pW4) после осветления в присутствии CaCl2, с последующим центрифугированием при 13 тыс. g;

6, 7, 8 - фракция, полученная в результате солюбилизации преципитата (4) в щелочном буфере Tрис-HCl, pH 8,0 с ЭДТА 10 мМ с последующим осветлением центрифугированием при 13 тыс. g, 2, 4, 6 мкл, соответственно;

L - Стандарт молекулярных масс (ThermoFisher Scientific). Стрелкой показано расположение целевого белка W4 (теоретически рассчитанная молекулярная масса 47,4 кДа).

Фиг. 6. Анализ фракций, полученных при переработке лизата E. coli BL21 (DE3), несущего экспрессионную конструкцию pW4, при кислых значениях рН (в буфере PIPES, pH 6,5), с помощью денатурирующего диск-электрофореза в 12,5% полиакриламидном геле (окрашен Кумасси R-250). На дорожки геля нанесены:

1 - растворимая фракция лизата биомассы E. coli BL21 (DE3, pW4), полученного в условиях автоиндукции (супернатант после центрифугирования лизата при 13 тыс. g);

2 - нерастворимая фракция лизата биомассы E. coli BL21 (DE3, pW4), полученного в условиях автоиндукции (осадок после центрифугирования лизата при 13 тыс. g);

3 - преципитат, полученный в результате внесения CaCl2 до конечной концентрации 90 мМ в растворимую фракцию лизата биомассы E. coli BL21 (DE3, pW4) с последующим центрифугированием при 13 тыс. g;

4 - растворимая фракция, полученная в результате внесения CaCl2 до конечной концентрации 90 мМ в лизат биомассы E. coli BL21 (DE3, pW4) с последующим центрифугированием при 13 тыс. g;

5 - растворимая фракция, полученная в результате внесения Gd(NO3)3 до конечной концентрации 2 мМ в растворимую фракцию лизата биомассы E. coli BL21 (DE3, pW4) после осветления в присутствии CaCl2, с последующим центрифугированием при 13 тыс. g;

6 - фракция, полученная в результате солюбилизации в кислом буфере PIPES, pH 6,5 с 10 мМ ЭДТА, преципитата, полученного при осаждении 2 мМ Gd(NO3)3 растворимой фракции лизата биомассы E. coli BL21 (DE3, pW4);

7 - фракция, полученная в результате солюбилизации в щелочном буфере Tрис-HCl, pH 8,0 с 10 мМ ЭДТА, преципитата, полученного при осаждении 2 мМ Gd(NO3)3 растворимой фракции лизата биомассы E. coli BL21 (DE3, pW4);

L - Стандарт молекулярных масс (ThermoFisher Scientific). Стрелкой показано расположение целевого белка W4 (теоретически рассчитанная молекулярная масса 47,4 кДа).

Фиг. 7. Спектр поглощения белка W4, очищенного по вышеописанной методике: фракция, полученная в результате солюбилизации в буфере Tрис-HCl, pH 8,0 с 10 мМ ЭДТА, преципитата, полученного при осаждении 2 мМ Gd(NO3)3 растворимой фракции лизата биомассы E. coli BL21 (DE3, pW4). Максимум поглощения при 277 нм соответствует ароматическим аминокислотам, при 482 нм - хромофору зелёного флуоресцентного белка EmGFP.

К описанию изобретения прилагаются последовательности:

SEQ ID NO: 1 - полная нуклеотидная последовательность экспрессионной конструкции pW4;

SEQ ID NO: 2 - аминокислотная последовательность Gd3+-связывающего белка W4

Осуществление изобретения иллюстрируется следующими примерами.

Пример 1. Получение экспрессионной конструкции pW4

Все конструкции получают и поддерживают в штамме E. coli BL21 (DE3), культивируемом на полноценной среде LB при 37°С в присутствии ампициллина в концентрации 100 мкг/мл. С целью повышения эффективности экспрессии гена искусственного белка при проведении ферментаций все искусственные кодирующие последовательности создают с преимущественным использованием наиболее часто встречающихся в E. coli кодонах.

Для получения экспрессионной конструкции pW4 создают промежуточные конструкции pB7 и pFL16.

1. Получение вспомогательной конструкции pB7

Плазмидную конструкцию pB7, кодирующая аминокислотный блок состава [ELP(Y)-ELP(S)-M-ELP(S)-ELP(S)-ELP(S)-ELP(S)-M*] или сокращенно [Е62], где ELP(Y), ELP(S) - ELP-повторы с «гостевыми» аминокислотами Tyr и Ser, соответственно, а M и M* - инвариантные кальций-связывающие мотивы кальмодулина человека, получают на базе коммерчески доступного вектора pJET1.2/blunt (CloneJET PCR Cloning Kit, каталожный номер K1231).

Исходный мономер двунитевой ДНК, кодирующей блок указанного состава, получают, смешивая в эквимолярных соотношениях синтетические олигонуклеотиды E(Y) (5'-gtcccaggctatggcgtgccaggttctggt), E(Y)1 (5'-tggcacgccatagcctgggac), M (5'-gacaaagacggtgacggcaccatcaccaccaaagaactg), EME (5'-acccggaaccagttctttggtggtgatggtgccgtcaccgtctttgtcaccagaacc), E (5'-gttccgggttctggtgtgccaggcagtggtgtacctgggtcaggcgttccgggttctggt), E2 (5'-agaccacacggtccgtcaccacatggacccagtccgcaaggc), M* (5'-gacaaagacggtgacggcacgatcacgacgaaggagtta) и EME* (5'-ccaagaccactgtttctgccactgccgtgctagtgctgcttcctcaat) с последующей ПЦР-амплификацией полученного фрагмента ДНК с праймерами Bgl-E(Y) (5'-gcatcagatctgtcccaggctatggcg) и Bam-M* (5'-gcatcggatcctaactccttcgtcgtgatcgt). Продукт ПЦР клонируют в вектор pJET1.2/blunt (CloneJET PCR Cloning Kit, каталожный номер K1231) в соответствии с инструкцией производителя вектора.

Карта функциональных элементов конструкции pB7 представлена на Фиг. 1.

2. Получение вспомогательной конструкции pFL16

Вспомогательную конструкцию pFL16 получают на базе вектора pJET1.2/blunt. Она содержит вставку, кодирующую последовательно расположенные пептид F3 и пептидный линкер.

Получение конструкции включает следующие этапы:

• олигонуклеотиды F3-1for (5'-aaagacgagccgcagcgtcgctccgcccgcctcagcgccaaaccggcaccgccaaaaccc), и F3-1rev (5'-ttttttggctggcgcttttttcggctttggctcgggttttggcggtgccggtttggcgctgag) смешивают в эквимолярных соотношениях (3 пмоль каждого), после чего проводят достройку одноцепочечных участков с помощью высокоточной теромостабильной ДНК-полимеразы (Q5® High-Fidelity DNA Polymerase (NEB, каталожный номер M0491S) в присутствии dNTP согласно инструкции производителя фермента;

• проводят амплификацию двухцепочечного фрагмента, получение которого описано в предыдущем пункте, с помощью ПЦР с праймерами F3-2for (5'-aaagacgagccgcagcg) и F3-2rev (5'-ttttttggctggcgctttttt) (продукт ПЦР 1),

• проводят амплификацию продукта ПЦР 1, получение которого описано в предыдущем пункте, с помощью ПЦР с праймером FL for (5'-cgaaaaaagcgccagccaaaaaaggtggtggtggttctggtggcggcggctctggtggt) с последующей достройкой одноцепочечных участков (продукт ПЦР 2),

• проводят амплификацию продукта ПЦР 2, получение которого описано в предыдущем пункте, с праймерами F3-2for (5'-aaagacgagccgcagcg) и BamLrev (5'-gcatcggatccaccaccagagccgcc) (продукт ПЦР 3),

• проводят клонирование продукта ПЦР 3 в вектор pJET1.2/blunt в соответствии с инструкцией производителя вектора.

Карта конструкции pFL16 представлена на Фиг. 2

3. Получение экспрессионного вектора pW4

С использованием в качестве исходного материала вспомогательных конструкций pFL16 и pB7, добиваются последовательной экспансии числа блоков [Е62]. В качестве реципиентного вектора используют конструкцию pFL16, кодирующую пептид F3 с пептидным линкером.

Единичный блок, кодирующий пептидный мономер состава [Е62], получают с помощью ПЦР на матрице плазмиды pB7 с праймерами Bgl-E(Y)for (5'-gcatcagatctgtcccaggctatggcg) и Bam-M*rev (5'-gcatcggatcctaactccttcgtcgtgatcgt).

В качестве экспрессионного вектора используют вектор pRSET-EmGFP (ThermoFisher Scientific, каталожный номер V35320), и трансляционно слитый с ним зелёный флуоресцентный белок, необходимый для визуального наблюдения за продуктом в процессе биосинтеза, очистки и анализа.

Получение конструкции включает следующие этапы:

• проводят амплификацию блока [Е62] в реакции ПЦР с праймерами Bgl-E(Y)for (5'-gcatcagatctgtcccaggctatggcg) и Bam-M*rev (5'-gcatcggatcctaactccttcgtcgtgatcgt) с использованием в качестве матрицы плазмиды pB7 (продукт ПЦР 4),

• продукт ПЦР 4 после обработки рестриктазой BamHI, лигируют с ДНК плазмиды pFL16, расщепленной по сайту BamHI; продукт лигирования вновь расщепляют рестриктазой BamHI и повторно лигируют с продуктом ПЦР 4, предварительно обработанным рестриктазой BamHI;

• получают фланкирующий концевой фрагмент экспрессионной единицы, содержащий два ELP-повтора, с использованием комплементарных олигонуклеотидов End-for (5'gatctgttccgggttctggtgtgcctggtagcggtg) и End-rev (5'gatccaccgctaccaggcacaccagaacccggaaca) с последующим клонированием его в полученный на предыдущем этапе вектор, расщепленный по сайту рестрикции BamHI: продукт ПЦР 5;

• проводят ПЦР-амплификацию продукта ПЦР 5 с использованием праймеров Bgl-Ffor (5'gcatcagatctaaagacgagccgcag) и EcoW4rev (5'gcactagaattcaccgctaccaggc) с последующим клонированием ПЦР-продукта в экспрессионный вектор pRSET-EmGFP по сайтам рестрикции BamHI и EcoRI.

Полученная конструкция представлена на Фиг. 3

Пример 2. Очистка рекомбинантного продукта конструкции pW4 - белка W4

Этапы:

Получение штамма-продуцента

Штамм-продуцент получают химической трансформацией клеток E. coli BL21 (DE3) плазмидной ДНК pW4. Для этого 0,1 мкг очищенной плазмидной ДНК добавляют к аликвоте компетентных клеток E. coli BL21(DE3) объемом 70 мкл, приготовленных по методике, предложенной в работе (Cohen et al., 1972). Суспензию клеток высевают на агаризованную среду LB, содержащую ампициллин (100 мкг/мл), и культивируют при 37°С в течение 16 часов.

Одну из выросших колоний со свежей трансформации переносят микробиологической петлей на полноценную питательную среду LB объемом 2-3 мл, содержащую ампициллин (100 мкг/мл), культивируют на микробиологической качалке при ротации со скоростью 220 об/мин при 37°С в течение 2 часов, затем высевают на агаризованную среду LB, содержащую ампициллин (100 мкг/мл), и культивируют при 37°С в течение 16-20 часов. Биомассу собирают с поверхности чашки шпателем. При необходимости хранят при -20°С в течение месяца. Выход биомассы с четырёх чашек Петри диаметром 9 см, содержащих по 12 мл среды на чашке, составляет 0,3-0,5 г сырой биомассы.

Лизис клеток методом ультразвуковой дезинтеграции

Биомассу суспендируют в буфере [50 мМ Трис, рН 8,0, 2 мМ ЭДТА, 1,5 мМ AEBSF, 0,2 мг/мл лизоцима, 0,1 М NaCl] из расчета 50 мл буфера на 1 г сырой биомассы, инкубируют 30 мин при 37°С. Затем проводят ультразвуковую обработку на дезинтеграторе Soniprep 150 plus (MSE, Корея) при мощности излучения 250-300 Вт в течение 45 секунд с перерывом на охлаждение в ледяной бане. Процедуру повторяют около 10 раз (до полного осветления лизата). Затем лизат центрифугируют при 13 000 об/мин, в течение 20 мин. Супернатант диализуют против 100-кратного избытка буфера состава 50 мМ Трис, рН 8,0, 50 мМ NaCl при +4°С в течение 16 часов, затем еще раз осветляют центрифугированием при 13 000 об./мин в течение 20 мин. Супернатант используют для дальнейшей очистки.

Предварительная очистка белка W4

Проводят предварительную очистку белка W4 с помощью одноступенчатой ионообменной хроматографии на DEAE Sepharose CL-6B.

• колонку уравновешивают буфером 50 мМ Трис, рН 8,0, 2 мМ ЭДТА, 0,1 М NaCl,

• наносят осветленный лизат E. coli BL21(DE3, pW4) на колонку с сорбентом DEAE Sepharose CL-6B объёмом 10 мл,

• удаляют не связавшийся с колонкой материал промыванием сорбента буфером 50 мМ Трис-HCl 8,0, 0,05 М NaCl объемом 50 мл;

• проводят элюцию целевого материала буфером состава 50 мМ Трис-HCl 8,0, 0,2 M NaCl объемом 5 мл.

Очистка белка дробным переосаждением солями Gd3+ в щелочном буфере Трис-HCl, рН 8,0

К 1 мл раствору осветленного и очищенного на ионообменной колонке лизата E. coli BL21(DE3, pW4) в буфере 50 мМ Трис-HCl, рН 8,0, 0,2 M NaCl при комнатной температуре добавляют водный раствор 0,9 М CaCl2 до конечной концентрации Ca2+ 80-100 мМ, инкубируют при 37°С 30 мин, осветляют центрифугированием при 13 000 об/мин при +4°С в течение 20 мин. К супернатанту добавляют водный раствор нитрата гадолиния до конечной концентрации Gd3+ 2 мМ, инкубируют при 37°С 5 мин, центрифугируют при 13 000 об/мин, в течение 20 мин. Супернатант отбрасывают, осадок растворяют в 100 мкл буфера [Трис-HCl 50 мМ, рН 8,0, NaCl 50 мМ, ЭДТА 10 мМ], центрифугируют при 13 000 об/мин, в течение 20 мин. Осадок, содержащий нерастворимые примеси клеточных белков, удаляют, а супернатант, обогащенный фракцией белка W4, диализуют против 100-кратного избытка буфера состава 50 мМ Трис-HCl, рН 8,0, 50 мМ NaCl, 0,002% NaN3 при +4°С в течение 16 часов. Процедуру переосаждения ионом Gd3+ повторяют дважды. Очистку белка от примесей ионов металлов осуществляют путём многократного диализа при 100-кратном избытке диализного буфера.

• Диализ 1 - буфер [50 мм Трис-HCl, рH 8,0, 100 мм ЭДТА, 0,1 М NaCl, 0,002% NaN3], 24 часа при комнатной температуре,

• Диализ 2 - буфер [50 мм Трис-HCl, рH 8,0, 100 мм ЭДТА, 0,1 М NaCl], 24 часа при +4°C,

• Диализ 3 - буфер [50 мм Трис-HCl, рH 8,0, 0,1 М NaCl], 24 часа при +4°C,

• Диализ 4 - буфер [50 мМ Трис-HCl, рН 8,0, 0,1 М NaCl], 24 часа при +4°С.

Очистка белка дробным переосаждением солями Gd3+ при кислых значениях рН буфере PIPES, pH 6,5)

После предварительной очистки белок диализуют при 100-кратном избытке буфера [50 мМ PIPES, pH 6,5, 50 мМ NaCl] 24 часа при +4°C. Затем проводят процедуру очистки с использованием тех же условий, что и при очистке при щелочных значениях рН. Конечную солюбилизацию в буфере с ЭДТА проводят и в щелочном буфере [50 мм Трис-HCl, рH 8,0, 10 мм ЭДТА, 50 мМ NaCl], и в кислом буфере [50 мМ PIPES, pH 6,5, 10 мм ЭДТА, 50 мМ NaCl].

Приготовление проб для диск-электрофореза в денатурирующем ПААГ

10 мкл образца соответствующей фракции смешивают с 10 мкл 2×кратного буфера для приготовления проб (Sample Buffer, Laemmli 2× Concentrate, Sigma, каталожный номер S3401-10VL) и прогревают при 99°С в течение 4 мин. Подготовленные пробы наносят на дорожку в объеме, пропорциональном объему каждой фракции.

Анализ результатов фракционирования лизата E. coli BL21(DE3, pW4) методом диск-электрофореза в денатурирующем ПААГ проводят с использованием бесплатного программного обеспечения GelAnalyzer2010a.

По результатам анализа фракций, полученных при дробном осаждении лизата E. coli BL21(DE3, pW4), делают вывод о том, что разработан способ очистки белка W4, основанный на его способности избирательно связывать ионы Gd3+ в концентрации 2 мМ с последующей солюбилизацией в присутствии ЭДТА в концентрации 10 мМ. По данным определения А482 (молярный коэффициент экстинкции при длине волны 482 нм принимают равным 57 500 ОЕ/моль, т.е. соответствующим табличному коэффициенту экстинкции белка EmGFP) проводят расчет общего содержания целевого белка. Выход целевого продукта составляет 1 мг с 400 мг сырой биомассы при электрофоретической чистоте 60%.

--->

Перечень нуклеотидной и аминокислотной последовательностей к заявке на патент на изобретение «Способ получения Gd3+-связывающего белка»

<110> The Research Institute of Pediatric Oncology and Hematology of the federal state budgetary institution “N.N. Blokhin National Medical Research Centre of oncology” of the Health Ministry of Russia
<120> The method of obtaining Gd3+ -binding protein
<160> SEQ ID NO 1
<210> SEO ID NO:1
<211> 4113 BP
<212> DNA
<213> E. coli / artificial sequence / plasid pW4
<220> Plasmid expression construct for expression of a fused protein W4
<221> T7 промотор РНК-полимеразы (promoter for bacteriophage T7 RNA polymerase)
<400> 1


CGCGAAATTA ATACGACTCA CTATAGGGAG ACCACAACGG TTTCCCTCTA GAAATAATTT 60

TGTTTAACTT TAAGAAGGAG ATATACATAT GCGGGGTTCT CATCATCATC ATCATCATGG 120

TATGGCTAGC ATGACTGGTG GACAGCAAAT GGGTCGGGAT CTGTACGACG ATGACGATAA 180

GGATCGATGG GgatctAAAG ACGAGCCGCA GCGTCGCTCC GCCCGCCTCA GCGCCAAACC 240

GGCACCGCCA AAACCCGAGC CAAAGCCGAA AAAAGCGCCA GCCAAAAAAG GTGGTGGTGG 300

TTCTGGTGGC GGCGGCTCTG GTGGTGGATC TGTCCCAGGC TATGGCGTGC CAGGTTCTGG 360

TGACAAAGAC GGTGACGGCA CCATCACCAC CAAAGAACTG GTTCCGGGTT CTGGTGTGCC 420

AGGCAGTGGT GTACCTGGGT CAGGCGTTCC GGGTTCTGGT GACAAAGACG GTGACGGCAC 480

GATCACGACG AAGGAGTTAG GATCTGTCCC AGGCTATGGC GTGCCAGGTT CTGGTGACAA 540

AGACGGTGAC GGCACCATCA CCACCAAAGA ACTGGTTCCG GGTTCTGGTG TGCCAGGCAG 600

TGGTGTACCT GGGTCAGGCG TTCCGCGTTC TGGTGACAAA GACGGTGACG GCACGATCAC 660

GACGAAGGAG TTAGGATCTG TTCCGGGTTC TGGTGTGCCT GGTAGCGGTG AATTCGCCAC 720

CATGGTGAGC AAGGGCGAGG AGCTGTTCAC CGGGGTGGTG CCCATCCTGG TCGAGCTGGA 780

CGGCGACGTA AACGGCCACA AGTTCAGCGT GTCCGGCGAG GGCGAGGGCG ATGCCACCTA 840

CGGCAAGCTG ACCCTGAAGT TCATCTGCAC CACCGGCAAG CTGCCCGTGC CCTGGCCCAC 900

CCTCGTGACC ACCTTGACCT ACGGCGTGCA GTGCTTCGCC CGCTACCCCG ACCACATGAA 960

GCAGCACGAC TTCTTCAAGT CCGCCATGCC CGAAGGCTAC GTCCAGGAGC GCACCATCTT 1020

CTTCAAGGAC GACGGCAACT ACAAGACCCG CGCCGAGGTG AAGTTCGAGG GCGACACCCT 1080

GGTGAACCGC ATCGAGCTGA AGGGCATCGA CTTCAAGGAG GACGGCAACA TCCTGGGGCA 1140

CAAGCTGGAG TACAACTACA ACAGCCACAA GGTCTATATC ACCGCCGACA AGCAGAAGAA 1200

CGGCATCAAG GTGAACTTCA AGACCCGCCA CAACATCGAG GACGGCAGCG TGCAGCTCGC 1260

CGACCACTAC CAGCAGAACA CCCCCATCGG CGACGGCCCC GTGCTGCTGC CCGACAACCA 1320

CTACCTGAGC ACCCAGTCCG CCCTGAGCAA AGACCCCAAC GAGAAGCGCG ATCACATGGT 1380

CCTGCTGGAG TTCGTGACCG CCGCCGGGAT CACTCTCGGC ATGGACGAGC TGTACAAGTA 1440

ACTCGAGAAG CTTGATCCGG CTGCTAACAA AGCCCGAAAG GAAGCTGAGT TGGCTGCTGC 1500

CACCGCTGAG CAATAACTAG CATAACCCCT TGGGGCCTCT AAACGGGTCT TGAGGGGTTT 1560

TTTGCTGAAA GGAGGAACTA TATCCGGATC TGGCGTAATA GCGAAGAGGC CCGCACCGAT 1620

CGCCCTTCCC AACAGTTGCG CAGCCTGAAT GGCGAATGGG ACGCGCCCTG TAGCGGCGCA 1680

TTAAGCGCGG CGGGTGTGGT GGTTACGCGC AGCGTGACCG CTACACTTGC CAGCGCCCTA 1740

GCGCCCGCTC CTTTCGCTTT CTTCCCTTCC TTTCTCGCCA CGTTCGCCGG CTTTCCCCGT 1800

CAAGCTCTAA ATCGGGGGCT CCCTTTAGGG TTCCGATTTA GTGCTTTACG GCACCTCGAC 1860

CCCAAAAAAC TTGATTAGGG TGATGGTTCA CGTAGTGGGC CATCGCCCTG ATAGACGGTT 1920

TTTCGCCCTT TGACGTTGGA GTCCACGTTC TTTAATAGTG GACTCTTGTT CCAAACTGGA 1980

ACAACACTCA ACCCTATCTC GGTCTATTCT TTTGATTTAT AAGGGATTTT GCCGATTTCG 2040

GCCTATTGGT TAAAAAATGA GCTGATTTAA CAAAAATTTA ACGCGAATTT TAACAAAATA 2100

TTAACGCTTA CAATTTAGGT GGCACTTTTC GGGGAAATGT GCGCGGAACC CCTATTTGTT 2160

TATTTTTCTA AATACATTCA AATATGTATC CGCTCATGAG ACAATAACCC TGATAAATGC 2220

TTCAATAATA TTGAAAAAGG AAGAGTATGA GTATTCAACA TTTCCGTGTC GCCCTTATTC 2280

CCTTTTTTGC GGCATTTTGC CTTCCTGTTT TTGCTCACCC AGAAACGCTG GTGAAAGTAA 2340

AAGATGCTGA AGATCAGTTG GGTGCACGAG TGGGTTACAT CGAACTGGAT CTCAACAGCG 2400

GTAAGATCCT TGAGAGTTTT CGCCCCGAAG AACGTTTTCC AATGATGAGC ACTTTTAAAG 2460

TTCTGCTATG TGGCGCGGTA TTATCCCGTA TTGACGCCGG GCAAGAGCAA CTCGGTCGCC 2520

GCATACACTA TTCTCAGAAT GACTTGGTTG AGTACTCACC AGTCACAGAA AAGCATCTTA 2580

CGGATGGCAT GACAGTAAGA GAATTATGCA GTGCTGCCAT AACCATGAGT GATAACACTG 2640

CGGCCAACTT ACTTCTGACA ACGATCGGAG GACCGAAGGA GCTAACCGCT TTTTTGCACA 2700

ACATGGGGGA TCATGTAACT CGCCTTGATC GTTGGGAACC GGAGCTGAAT GAAGCCATAC 2760

CAAACGACGA GCGTGACACC ACGATGCCTG TAGCAATGGC AACAACGTTG CGCAAACTAT 2820

TAACTGGCGA ACTACTTACT CTAGCTTCCC GGCAACAATT AATAGACTGG ATGGAGGCGG 2880

ATAAAGTTGC AGGACCACTT CTGCGCTCGG CCCTTCCGGC TGGCTGGTTT ATTGCTGATA 2940

AATCTGGAGC CGGTGAGCGT GGGTCTCGCG GTATCATTGC AGCACTGGGG CCAGATGGTA 3000

AGCCCTCCCG TATCGTAGTT ATCTACACGA CGGGGAGTCA GGCAACTATG GATGAACGAA 3060

ATAGACAGAT CGCTGAGATA GGTGCCTCAC TGATTAAGCA TTGGTAACTG TCAGACCAAG 3120

TTTACTCATA TATACTTTAG ATTGATTTAA AACTTCATTT TTAATTTAAA AGGATCTAGG 3180

TGAAGATCCT TTTTGATAAT CTCATGACCA AAATCCCTTA ACGTGAGTTT TCGTTCCACT 3240

GAGCGTCAGA CCCCGTAGAA AAGATCAAAG GATCTTCTTG AGATCCTTTT TTTCTGCGCG 3300

TAATCTGCTG CTTGCAAACA AAAAAACCAC CGCTACCAGC GGTGGTTTGT TTGCCGGATC 3360

AAGAGCTACC AACTCTTTTT CCGAAGGTAA CTGGCTTCAG CAGAGCGCAG ATACCAAATA 3420

CTGTTCTTCT AGTGTAGCCG TAGTTAGGCC ACCACTTCAA GAACTCTGTA GCACCGCCTA 3480

CATACCTCGC TCTGCTAATC CTGTTACCAG TGGCTGCTGC CAGTGGCGAT AAGTCGTGTC 3540

TTACCGGGTT GGACTCAAGA CGATAGTTAC CGGATAAGGC GCAGCGGTCG GGCTGAACGG 3600

GGGGTTCGTG CACACAGCCC AGCTTGGAGC GAACGACCTA CACCGAACTG AGATACCTAC 3660

AGCGTGAGCT ATGAGAAAGC GCCACGCTTC CCGAAGGGAG AAAGGCGGAC AGGTATCCGG 3720

TAAGCGGCAG GGTCGGAACA GGAGAGCGCA CGAGGGAGCT TCCAGGGGGA AACGCCTGGT 3780

ATCTTTATAG TCCTGTCGGG TTTCGCCACC TCTGACTTGA GCGTCGATTT TTGTGATGCT 3840

CGTCAGGGGG GCGGAGCCTA TGGAAAAACG CCAGCAACGC GGCCTTTTTA CGGTTCCTGG 3900

CCTTTTGCTG GCCTTTTGCT CACATGTTCT TTCCTGCGTT ATCCCCTGAT TCTGTGGATA 3960

ACCGTATTAC CGCCTTTGAG TGAGCTGATA CCGCTCGCCG CAGCCGAACG ACCGAGCGCA 4020

GCGAGTCAGT GAGCGAGGAA GCGGAAGAGC GCCCAATACG CAAACCGCCT CTCCCCGCGC 4080

GTTGGCCGAT TCATTAATGC AGGATCTCGA TCC 4113

<110> The Research Institute of Pediatric Oncology and Hematology of the federal state budgetary institution “N.N. Blokhin National Medical Research Centre of oncology” of the Health Ministry of Russia
<120> The method of obtaining Gd3+ -binding protein
<160> SEQ ID NO 2
<210> SEO ID NO:2
<211> 4113
<212> DNA
<213> E. coli / artificial sequence / plasid pW4
<220> Plasmid expression construct for expression of a fused protein W4
<221> T7 промотор РНК-полимеразы (promoter for bacteriophage T7 RNA polymerase)
<400> 2

Met Arg Gly Ser His His His His His His Gly Met Ala Ser Met Thr Gly Gly Gln Gln

Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys Asp Arg Trp Gly Ser Lys Asp Glu Pro

Gln Arg Arg Ser Ala Arg Leu Ser Ala Lys Pro Ala Pro Pro Lys Pro Glu Pro Lys Pro

Lys Lys Ala Pro Ala Lys Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

Ser Val Pro Gly Tyr Gly Val Pro Gly Ser Gly Asp Lys Asp Gly Asp Gly Thr Ile Thr

Thr Lys Glu Leu Val Pro Gly Ser Gly Val Pro Gly Ser GlyVal Pro Gly Ser GlyVal

Pro Gly Ser Gly Asp Lys Asp Gly Asp Gly Thr Ile Thr Thr Lys Glu Leu Gly Ser Val

Pro Gly Tyr Gly Val Pro Gly Ser Gly Asp Lys Asp Gly Asp Gly Thr Ile Thr Thr Lys

Glu Leu Val Pro Gly Ser Gly Val Pro Gly Ser Gly Val Pro Gly Ser Gly Val Pro Arg

Ser Gly Asp Lys Asp Gly Asp Gly Thr Ile Thr Thr Lys Glu Leu Gly Ser Val Pro Gly

Ser Gly Val Pro Gly Ser Gly Glu Phe Ala Thr Met Val Ser Lys Gly Glu Glu Leu Phe

Thr Gly Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser

Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys

Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Thr Tyr Gly Val

Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met

Pro Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr

Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile

Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn Ser His

Lys Val Tyr Ile Thr Ala Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe Lys Thr Arg

His Asn Ile Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile

Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser

Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala Ala Gly

Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys

<---

1. Способ получения Gd3+-связывающего белка, включающий создание экспрессионной конструкции с нуклеотидной последовательностью SEQ ID NO 1, её введение в штамм E. coli BL21 (DE3), наращивание биомассы, ультразвуковую дезинтеграцию биомассы, осветление лизата низкоскоростным центрифугированием, предварительную очистку с помощью ионообменной хроматографии и диализа, удаление примесей путем добавления CaCl2 до 90-100 мМ, осаждение целевого белка добавлением нитрата гадолиния с последующим низкоскоростным центрифугированием, солюбилизация целевого продукта добавлением к осадку раствора ЭДТА с последующим центрифугированием с целью удаления нерастворимых примесей, обессоливание целевого продукта диализом.

2. Способ по п. 1, отличающийся тем, что осаждение целевого белка из обессоленного лизата проводят добавлением 2 мМ нитрата гадолиния.

3. Способ по п. 1, отличающийся тем, что солюбилизация целевого продукта после осаждения ионами Gd3+ с последующим центрифугированием проводится путём добавления к осадку раствора ЭДТА с концентрацией 10 мМ.



 

Похожие патенты:

Изобретение относится к области биотехнологии. Предложена рекомбинантная плазмида pNanH, экспрессирующая клонированный ген nanH (нейраминидазы) Vibrio cholerae, встроенный по сайтам BamHI-PstI в полилинкер векторной плазмиды pQE30, под контролем Т5-промотора.

Группа изобретений относится к ферментативному получению аланина. Предложены рекомбинантная молекула нуклеиновой кислоты для ферментативного получения аланина, рекомбинантный полипептид, рекомбинантная экспрессионная конструкция, рекомбинантный вектор экспрессии, рекомбинантный микроорганизм рода Escherichia и их применение для ферментативного получения аланина.

Изобретение относится к биотехнологии. Описан микроорганизм рода Escherichia, обладающий улучшенной способностью продуцировать L-триптофан по сравнению с немодифицированным микроорганизмом, где активность фосфатазы, содержащей аминокислотную последовательность SEQ ID NO: 1, модифицирована с инактивацией для того, чтобы поддерживать внутриклеточную концентрацию E4P (эритрозо-4-фосфата).

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению в клетках Escherichia coli гибридного белка, и может быть использовано для очистки биотехнологических субстанций от бактериальных липополисахаридов.

Генотерапевтический днк-вектор на основе генотерапевтического днк-вектора vtvaf17, несущий целевой ген, выбранный из группы генов col1a1, col1a2, bmp2, bmp7, для повышения уровня экспрессии этих целевых генов, способ его получения и применения, штамм escherichia coli scs110-af/vtvaf17- col1a1 или escherichia coli scs110-af/vtvaf17- col1a2 или escherichia coli scs110-af/vtvaf17- bmp2 или escherichia coli scs110-af/vtvaf17- bmp7, несущий генотерапевтический днк-вектор, способ его получения, способ производства в промышленных масштабах генотерапевтического днк-вектора // 2707537
Изобретение относится к генной инженерии. Описан генотерапевтический ДНК-вектор на основе генотерапевтического ДНК-вектора VTvaf17, несущий целевой ген, выбранный из группы генов COL1A1, COL1A2, ВМР2, ВМР7, для повышения уровня экспрессии этого целевого гена в организме человека и животных, при этом генотерапевтический ДНК-вектор VTvaf17-COL1A1, или VTvaf17- COL1A2, или VTvaf17- ВМР2, или VTvaf17-ВМР7 имеет нуклеотидную последовательность SEQ ID №1 или SEQ ID №2 или SEQ ID №3 или SEQ ID №4 соответственно.

Изобретение относится к биотехнологии, генной инженерии, медицинской микробиологии. Предложена рекомбинантная плазмида pHFQ2.21, экспрессирующая клонированный ген hfq (шаперона) Vibrio cholerae 01 биовара El Tor, встроенный по сайтам Bam HI-PstI в полилинкер векторной плазмиды pQE30, под контролем Т5-промотора.

Изобретение относится к области биотехнологии и генной инженерии. Предложен способ получения штамма Е.

Группа изобретений относится к биотехнологии. Полипептид, обладающий активностью по высвобождению О-ацетилгомосерина, где по меньшей мере одна аминокислота, выбранная из группы, состоящей из фенилаланина в положении 30, лейцина в положении 95 и фенилаланина в положении 165 аминокислотной последовательности SEQ ID NO: 1, заменена на другую аминокислоту, и необязательно валин в положении 1 аминокислотной последовательности SEQ ID NO: 1 дополнительно заменен на метионин.

Группа изобретений относится к области биотехнологии. Предложены способы получения содержащего две цепи полипептида, в частности содержащего тяжелую цепь и легкую цепь полуантитела, в частности полуантитела против ИЛ-13, а также против ИЛ-17 в прокариотической клетке-хозяине, а также способы получения биспецифического антитела, содержащего способное связывать первый антиген, в частности связывать ИЛ-13, первое полуантитело и способное связывать второй антиген, в частности связывать ИЛ-17, второе полуантитело.

Генотерапевтический днк-вектор на основе генотерапевтического днк-вектора vtvaf17, несущий целевой ген, выбранный из группы генов ski, tgfb3, timp2, fmod для повышения уровня экспрессии этих целевых генов, способ его получения и применения, штамм escherichia coli scs110-af/vtvaf17-ski или escherichia coli scs110-af/vtvaf17-tgfb3 или escherichia coli scs110-af/vtvaf17-timp2 или escherichia coli scs110-af/vtvaf17-fmod, несущий генотерапевтический днк-вектор, способ его получения, способ производства в промышленных масштабах генотерапевтического днк-вектора // 2705256
Изобретение относится к генной инженерии. Описан генотерапевтический ДНК-вектор на основе генотерапевтического ДНК-вектора VTvaf17 для лечения заболеваний, характеризующихся развитием фиброза тканей, формированием рубцов, повреждением соединительной ткани и для ускорения заживления ран, реэпителизации, для увеличения образования грануляционной ткани и ингибирования образования рубцовой ткани, путем повышения уровня экспрессии целевого гена SKI в организме человека и животных, при этом генотерапевтический ДНК-вектор содержит кодирующую часть целевого гена SKI, клонированную в генотерапевтический ДНК-вектор VTvaf17, с получением генотерапевтического ДНК-вектора VTvaf17-SKI, с нуклеотидной последовательностью SEQ ID №1.

Изобретение относится к биотехнологии. Предложено активируемое антитело, которое в активированном состоянии связывает рецептор эпидермального фактора роста (EGFR), включающее антитело, маскирующий фрагмент, который в нерасщепленном состоянии ингибирует связывание антитела с EGFR, и расщепляемый фрагмент, который функционирует в качестве субстрата для протеазы.

Изобретение относится к области биотехнологии, конкретно к Fc-связывающему полипептиду с улучшенной щелочной стабильностью, содержащему мутант Fc-связывающего домена белка А Staphylococcus (SpA), где мутант имеет последовательность, выбранную из группы, состоящей из SEQ ID NO: 9-17.

Изобретение относится к области биотехнологии, конкретно к белковому комплексу агонист ИЛ-15, состоящему из растворимого слитого белка (I) и растворимого слитого белка (II), где слитый белок (I) представляет собой ИЛ-15(L52C) с SEQ ID NO: 2, а слитый белок (II), выбран из ИЛ-15Rα-ECD(S40C)-Fc с SEQ ID NO: 5, Fc-ИЛ-15Rα-ECD(S40C) с SEQ ID NO: 6, ИЛ-15Rα-Sushi+(S40C)-Fc с SEQ ID NO: 7 или Fc-ИЛ-15Rα-sushi+(S40C) с SEQ ID NO: 8, и может быть использовано в медицине.

Настоящее изобретение относится к области иммунологии. Предложены выделенная молекула нуклеиновой кислоты, кодирующая анти-CD19 химерный антигенный рецептор, выделенная молекула анти-CD19 химерный антигенный рецептор, а также гуманизированный анти-CD19-связывающий домен.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая конъюгат антитела или его антигенсвязывающего фрагмента и цитотоксина для доставки цитотоксина субъекту (варианты), композицию для терапевтического применения, содержащую вышеуказанный конъюгат, способ лечения нуждающегося в этом пациента, включающий введение эффективного количества композиции, выделенный полинуклеотид, кодирующий антитело для получения вышеуказанного конъюгата, вектор экспрессии, клетку-хозяина для продуцирования вышеуказанного конъюгата, способ получения конъюгата, конъюгат антитело-лекарственное средство для доставки группы лекарственного средства субъекту.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая выделенное антитело или его антигенсвязывающий фрагмент, которое способно к связыванию с гемагглютинином (HA) вируса гриппа B и нейтрализации вируса гриппа B в двух филогенетически разных линиях, выделенную нуклеиновую кислоту, кодирующую антитело, вектор, для получения антитела, клетку-хозяин, для экспрессии антитела, способ получения антитела или его антигенсвязывающего фрагмента, включающий культивирование клетки-хозяина, композицию для лечения вируса гриппа B, применение антитела или его антигенсвязывающего фрагмента в получении лекарственного препарата для профилактики или лечения инфекции, вызванной вирусом гриппа В, применение антитела или его антигенсвязывающего фрагмента в получении лекарственного препарата для профилактики или лечения инфекции, вызванной вирусом гриппа А и вирусом гриппа В, способ профилактики или лечения инфекции, вызванной вирусом гриппа B, способ профилактики или лечения инфекции, вызванной вирусом гриппа А и вирусом гриппа B, применение антитела или его фрагмента для in vitro диагностики инфекции, вызванной вирусом гриппа В.

Изобретение относится к биотехнологии, в частности к способу получения конъюгата агента, связывающегося с клетками, и цитотоксического агента. Цитотоксический агент приводят в контакт с бифункциональным сшивающим реагентом, представленным структурной формулойили его солью, в буферном растворе, содержащем буферный агент, причем буферный раствор имеет высокую буферную емкость и молярное отношение буферного агента к бифункциональному сшивающему реагенту составляет от 2:1 до 8:1.

Изобретение относится к области биохимии, в частности к антителу для лечения или профилактики инфекционного заболевания, вызываемого антигеном O25b. Также раскрыты фармацевтический препарат и диагностический препарат, содержащие указанное антитело.

Изобретение относится к области биотехнологии, конкретно к рекомбинантной молекуле нуклеиновой кислоты для увеличения эффективности продукции трансгена, экспрессируемого в клетке млекопитающего.

Предложены способ лечения ожирения, диабета II типа или метаболического синдрома с использованием композиции, содержащей фармацевтически эффективное количество молекулярного антагониста желудочного ингибиторного полипептида (GIP), а также способ снижения накопления жировой ткани в печени, снижения накопления жировой ткани в сальнике или снижения накопления подкожной жировой ткани с использованием композиции, содержащей фармацевтически эффективное количество молекулярного антагониста GIP.

Изобретение относится к области биотехнологии, в частности к способу получения Gd3+-связывающего белка. Комплекс белка с ионами Gd3+, в свою очередь, может быть использован для получения физиологически приемлемого Gd3+-содержащего агента, пригодного для контрастирования опухолей с помощью спектроскопии парамагнитного резонанса и для радиотерапии опухолей по принципу термоаблации. Техническим результатом данного изобретения является способ получения Gd3+-связывающего лиганда на основе искусственного рекомбинантного белка, обладающего способностью прочно удерживать ион металла в условиях, приближенных к физиологическим, обеспечивая его детоксикацию и адресную доставку в опухолевую ткань. 2 з.п. ф-лы, 7 ил., 2 пр.

Наверх