Фармацевтическая композиция для лечения глазных инфекций, вызванных метициллин-устойчивыми штаммами staphylococcus aureus, включающая в качестве активного начала n-концевой chap-домен эндолизина бактериофага k staphylococcus aureus

Изобретение относится к биотехнологии, в частности к фармацевтической композиции для лечения глазных инфекций, вызванных метициллин-устойчивыми штаммами Staphylococcus aureus, включающей в качестве активного начала N-концевой СНАР-домен эндолизина бактериофага K Staphylococcus aureus. Заявляемая фармацевтическая композиция не токсична и более эффективна, чем антибиотик ванкомицин и расширяет арсенал средств для лечения глазных инфекций, вызванных метициллин-устойчивыми штаммами Staphylococcus aureus. 7 пр., 1 ил., 5 табл.

 

Изобретение относится к биотехнологии и медицине и касается разработки новых антибактериальных средств, эффективных в отношении множественно устойчивых к антибиотикам штаммов Staphylococcus aureus, в частности, изобретение касается офтальмологической фармацевтической композиции на основе N-концевого СНАР-домена эндолизина бактериофага К Staphylococcus aureus.

В настоящее время бактериальные инфекции являются проблемой здравоохранения мирового масштаба. Стафилококковые инфекции входят в число самых распространенных заболеваний. Лечение стафилококковых инфекций осложнено тем, что около 90% штаммов этого микроорганизма устойчивы к антибиотикам, в частности метициллину.

В качестве серьезной альтернативы антибиотикам рассматривают цитолитические ферменты (в том числе эндолизины) бактериофагов, способные лизировать бактериальные клеточные стенки. Фаговые эндолизины, активные против мультирезистентных штаммов S. aureus, представляют интерес как потенциальная основа для разработки лекарственных препаратов [KR 20170087770, CN 106636050, US 2016090584, US 2015247138, WO 2014039436, WO 2010036408]. Известны публикации, касающиеся применения литических ферментов для борьбы с биопленками S. aureus [ЕР 2200442, US 2017173121].

Некоторые исследователи используют модификацию литических ферментов, в частности, укороченный или гибридный вариант эндолизина, с целью улучшения их свойств [RU 2014152218, МХ 2016006277, US 2016298101, US 2016090584, US 2015335719, US 2015247138, ЕР 3068878, ЕР 3068877, WO 2013188203, WO 2013149010, US 2011318328, US 2011243916]. Эндолизины бактериофагов используют как совместно с антибиотиками, повышающими проницаемость внешней мембраны бактерий, так и в сочетании друг с другом [US 7572602, WO 2010036408].

На рынке представлен только один зарегистрированый в Европе препарат на основе эндолизина Ply2638 фага PHI.2638а. Его используют для местного применения против дерматитов, вызванных S. aureus [US 9382298].

Два других препарата против S. aureus предложены для лечения сепсиса и находятся на стадии клинических испытаний,. Это препарат на основе эндолизина PlySs2 из профага штамма Streptococcus suis 89/1591 [US 9499594, US 9889181] и препарат, содержащий в качестве действующего начала рекомбинантный фаговый эндолизин SAL-1 бактериофага SAP-1 rSoo Youn Jun et al., 2011. 2014. S.Y. Juna et al. 2013].

Публикаций о препаратах на основе эндолизинов для лечения глазных болезней, вызванных S. aureus, на данный момент не обнаружено, но известна фармацевтическая композиция на основе эндолизина для лечения глазных инфекций, вызванных псевдомонадами [RU 2015122812].

Лечение глазных болезней, вызванных S. aureus, осуществляют по-прежнему, путем антибиотикотерапии.

Задача настоящего изобретения - расширение арсенала средств для лечения глазных инфекций, вызванных Staphylococcus aureus.

Задача решена путем разработки фармацевтической композиции для лечения глазных инфекций, вызванных метициллин-устойчивыми штаммами Staphylococcus aureus, включающая в качестве активного начала N-концевой СНАР-домен эндолизина бактериофага К Staphylococcus aureus, при следующем соотношении компонентов в лиофилизованной смеси, в мас. % на сухой вес:

N-концевой СНАР-домен эндолизина бактериофага К Staphylococcus aureus - 1,9;

гипромеллоза - 7,5;
декспантенол - 15,1;
натрия хлорид - 33,0;
бензалкония хлорид - 0,6;
повидон - 30,3;
лимонная кислота моногидрат - 0,8;
двузамещенный натрия фосфат - 10,8.

Бактериофаг К является фагом S. aureus с широким кругом хозяев, включая метициллин резистентные штаммы [S. 2005]. Эндолизин фага К представляет собой блочный белок, состоящий из трех отдельных доменов [Marta Sanz-Gaitero, 2014], причем N-концевой CHAP-домен проявляет антистафилококковую литическую активность не менее активности полноразмерного фермента [Marianne Horgan, 2009]. N-концевой CHAP-домен эндолизина бактериофага К Staphylococcus aureus выбран в качестве активного начала в заявляемой композиции.

Фармацевтические композиции помимо основного вещества включают ряд вспомогательных компонентов, обеспечивающих предъявляемые к ним требования [Фармакопея 13. ОФС.1.4.1.0003.15 Глазные лекарственные формы].

Состав фармацевтической композиции зависит от свойств активного начала. Известно, что в состав капель «Офтальмоферона» на основе рекомбинантного альфа-2b интерферона человека входят димедрол, поливинилпирролидон, полиэтиленоксид, трилон Б и гипромеллоза. Использование этих компонентов необходимо для обеспечения стабильности и пролонгации действия интерферона. В то же время, капли «Офтан» на основе белка цитохрома С не содержат высокомолекулярных вспомогательных веществ, однако в их состав входят никотинамид, аденозин и сорбитол [https://yandex.ru/health/pills/product/oftan-katahrom-636]. Выбор тех или иных вспомогательных компонентов зависит от индивидуальных свойств активного начала и не является очевидным.

В заявляемой композиции в качестве консерванта использован хлорид бензалкония - вещество, обладающее широким бактерицидным действием. Хлорид бензалкония входит в состав таких глазных капель, как Визомитин, Лекролин, Визин [Энциклопедия лекарств и товаров аптечного ассортимента, Инструкции по применению https://www.rlsnet.ru/tn_index_id_50518.htm].

Для пролонгирования терапевтического действия заявляемой композиции использованы гипромелоза (гидроксипропилметилцеллюлоза) и повидон (поливинилпирролидон). Эти вещества увеличивают вязкость раствора, и, за счет этого, замедляют вымывание компонентов из конъюнктивального мешка, обеспечивая более полное всасывание их через роговицу [RU 2549472; http://vkusologia.ru/dobavki/stabilizatory-emulgatory/e464.html]. Повидон кроме того обладает дезинтоксикационным действием за счет способности к комплексообразованию, то есть эффективно связывает токсины, образующиеся в ходе инфекции. Повидон входит в состав глазных капель Офтолик, а гипромелоза - в Визин [инструкции по применению, https://glazaizrenie.ru/lechenie/oftolik-glaznye-kapli-instruktsiya, http://soberpeoplesuck.com/397-povidon.html].

Повидон и гипромеллоза одновременно стабилизируют активный белок в процессе лиофилизации и последующем хранении.

Еще одним вспомогательным компонентом, обеспечивающим эффективность действия заявляемой композиции, является декспантенол (витамин группы В, производное пантотеновой кислоты), обеспечивающий дополнительное увлажнение слизистой и увеличение всасывания активного вещества, а также обладающий репаративным действием [RU 2575590, RU 2653260].

Для достижения оптимального значения рН, соответствующего таковому в слезной жидкости, в состав композиции добавлены фосфат натрия и лимонная кислота. Для изотонирования, то есть достижения осмотического давления, соответствующего осмотическому давлению слезной жидкости, использован хлорид натрия.

Заявляемая фармацевтическая композиция содержит N-концевой CHAP-домен эндолизина К S. aureus, обозначенный далее как rELSA, выделенный из культуральной жидкости штамма Е. coli ECR-rELSA (ВКПМ В-13269), который получен путем трансформации штамма Е. coli BL21-CodonPlus (DE3)-RIPL (Agilent, США) плазмидой pET24a_C165(LysK)st, включающей фрагмент структурного гена фага К под контролем Т7 промотора, а также ген устойчивости к канамицину (фиг. 1).

Фиг. 1. Плазмида pET24a_C165(LysK)st, включающая фрагмент структурного гена фага К S.aureus

Пример 1. Получение штамма Е. coli ВКПМ В-13269 - продуцента rELSA

Все стандартные генно-инженерные и микробиологические манипуляции осуществляют по известным методикам [Green and Sambrook, 2012].

Для получения rELSA проводят амплификацию на матрице ДНК, выделенной из коммерческого препарата «Бактериофаг стафилококковый» производства АО «НПО «Микроген»». Амплификацию фрагмента ДНК, кодирующего rELSA, проводят методом ПЦР с помощью высокоточной полимеразы Phusion (Thermo Scientific) по протоколам производителя с использованием следующих праймеров: прямого - F_C165(LysK)_NdeI - ATTCATATGGCTAAGACTCAAGCAGAA, и обратного - R_C165(LysK)_stop_XhoI - CTACTCGAGTTATGCTTTTACAGGTATTTCAATGAAG. В прямой праймер вводят сайт NdeI, а в обратный - сайт XhoI. Фрагмент конструируют с таким расчетом, чтобы рамка считывания прервалась стоп кодоном на С-конце СНАР-домена. В результате получают открытую рамку считывания, которая кодирует рекомбинантный белок, содержащий N-концевой СНАР-домен фагового эндолизина К S.aureus с 1 по 165 аминокислотный остаток (SEQ ID NO 1; SEQ ID NO 2). Очистку полученного амплификацией фрагмента ДНК проводят с помощью гель-электрофореза в 1,8% агаровом геле с последующим выделением нужной полосы с помощью набора для выделения ДНК из агарозных гелей (Биосилика, Россия).

Плазмиду pET24a_C165(LysK)st конструируют путем клонирования фрагмента, кодирующего rELSA, в вектор рЕТ - 24а (Novagen, США).

Гидролиз плазмиды рЕТ-24а и фрагмента ДНК, кодирующего rELSA, проводят путем обработки рестриктазами NdeI и XhoI (Thermo scientific, EU). Очистку полученных фрагментов ДНК осуществляют методом гель-электрофореза в 1,8% агаровом геле с последующим выделением нужной полосы с помощью набора для выделения ДНК. Легирование проводят в реакционной смеси объемом 20 мкл, содержащей 20 нг ДНК вектора, 20 нг ДНК фрагмента и 5 ед. Т4 ДНК лигазы (СибЭнзим, Россия), согласно методике производителя. Полученной лигазной смесью в количестве 5 мкл трансформируют компетентные клетки штамма Escherichia coli TOP 10 (Invitrogen, США) (генотип - F - mcrA Δ(mrr-hsdRMS-mcrBC) Ф80lacZΔM15 Δ lacX74 recA1 araD139 Δ(araleu)7697 galU galK rpsL (StrR) endA1 nupG). Плазмидную ДНК полученных трансформантов анализируют путем гидролиза рестриктазами NdeI и XhoI. В результате отбирают клоны, содержащие NdeI/XhoI фрагменты размером, равным исходному фрагменту вставки. Правильность клонирования подтверждают секвенированием вставки методом Сэнгера на генетическом анализаторе ABI 3500 (Life technology, США).

В результате получают рекомбинантную плазмиду pET24a_C165(LysK)st размером 5732 пар оснований, содержащую наряду с генами вектора рЕТ-24а открытую рамку считывания кодирующую rELSA (SEQ ID NO 3).

Штамм E. coli ВКПМ B-13269_ - продуцент rELSA получают путем химической трансформации клеток штамма Escherichia coli BL21-CodonPlus (DE3)-RIPL плазмидой pET24a_C165(LysK)st. по стандартной методике (Green and Sambrook, 2012). Селекцию трансформантов проводят на LB-агаре, содержащем (мас. %): тритон - 1; дрожжевой экстракт - 0,5; хлорид натрия - 0,7; агар - 1,5, канамицин - 2,5*10-3, хлорамфеникол - 3,4*10-3 и стрептомицин - 2,5*10-3, вода - остальное.

Пример 2. Получение активного начала композиции, представляющего собой rELSA

rELSA выделяют из растворимой фракции клеточного лизата штамма Е. coli ВКПМ В-13269.

Ферментацию проводят в ферментере емкостью 40 л, содержащем 0,5 л посевного материала (OD600 около 10) и 9,5 кг ферментационной питательной среды LB, следующего состава, в мас. %: тритон 1; дрожжевой экстракт 0,5; хлорид натрия 0,6; канамицин 2,5*10-3 и хлорамфеникол 3,4*10-3, остальное вода.

Биосинтез ведут при температуре 30°С, парциальном давлении кислорода в среде 20%, при перемешивании 500 об./мин и аэрации 5,0 л/мин.. Спустя 4 часа после начала ферментации добавляют 0,05 л 0,1 М раствора индуктора IPTG (изопропил-бета-D-тиогалактопиранозид), после чего ферментацию продолжают еще 4 часа до достижения оптической плотности 10 ОЕ. По данным ПААГ-электрофореза количество rELSA составляет 20% от общего белка клетки.

По окончании ферментации биомассу отделяют центрифугированием при 4°С и 5100 об/мин в течение 30 мин, суспендируют в 0,02 М Трис-HCl буфере, рН 6,8, и разрушают на дезинтеграторе APV1000 при давлении 970 бар. rELSA выделяют из растворимой фракции клеточного лизата путем последовательной катионо- и анионообменной хроматографии на колонках с сорбентами SP - и Q- Сефароза FF (GE Healthcare), соответственно. Затем раствор rELSA концентрируют методом ультрафильтрации в тангенциальном потоке на установке «Владисарт» с использованием мембранного кассетного модуля с отсекающим размером 10 кДа при 20°С и давлении 2 бара до содержания rELSA 2,5 мг/мл.

Специфическую литическую активность выделенного rELSA определяют с помощью турбидиметрии [Л.Ю. Филатова и др., 2014] по изменению во времени мутности суспензии автоклавированных клеток штамма S. aureus АТСС 29213 (ночная культура). Для этого в спектрофотометрическую кювету объемом 1 мл вносят 900 мкл автоклавированной клеточной суспензии S.aureus, (OD590 0,8 - 1 о.е.) и 100 мкл раствора rELSA с концентрацией 15-20 мкг/мл. Тщательно перемешивают в течение 10-15 с. Помещают кювету в спектрофотометр и измеряют оптическую плотность при длине волны А590 в течение 5 минут, снимая показания спектрофотометра каждую минуту, включая начальную точку.

Измерение активности контрольной пробы проводят аналогично, используя вместо раствора rELSA буферный раствор.

Используя значения разности оптических плотностей, с помощью программы Microsoft Excel строят кривую изменения оптической плотности испытуемой суспензии во времени и подбирают уравнение, описывающее характер линейного участка данной кривой: Y=kX+b, где k - тангенс угла наклона прямой.

Используя полученное уравнение, производят расчет активности фермента по следующей формуле:

A=k/Vo*C,

Где: А - удельная литическая активность белка rELSA (Ед/мин*мг),

Vo - объем испытуемого раствора, используемый в энзиматической реакции (мл),

С - концентрация белка rELSA (мг/мл).

Специфическая литическуая активность выделенного rELSA составляет 180 Ед/мин*мг.

Пример 3. Получение заявляемой фармацевтической композиции

Готовят 0,02 М натрий-фосфат-цитратный буфер, рН 7,2, содержащий вспомогательные добавки в следующих количествах, в мас. %: натрия хлорид 0,950; гипромеллоза 0,255; декспантенол 0,500; бензалкония хлорид 0,005; повидон 1,000.

Смешивают полученный раствор rELSA (2,5 мг/мл, пример 1) с раствором, содержащим вспомогательные добавки, в объемном соотношении 1: 4.

Стерилизующую фильтрацию раствора, содержащего rELSA и вспомогательные добавки, осуществляют с помощью Vacuum Filter System "Corning" через мембранный фильтр с удерживающим размером пор 0,22 мкм в ламинарном шкафу.

Разливают стерильный раствор rELSA по колбам, замораживают в морозильной камере сушки MartinChrist (Alpha 1-4) при температуре (-30)°С и лиофилизируют при температуре (-56)°С и остаточном давлении 12 Па.

В результате получают фармацевтическую композицию, представляющую собой лиофильно высушенную смесь rELSA и вспомогательных добавок, при следующем соотношении компонентов в лиофилизованной смеси, в мас. % на сухой вес:

N-концевой СНАР-домен эндолизина бактериофага К Staphylococcus aureus - 1,9;

гипромеллоза - 7,5;
декспантенол - 15,1;
натрия хлорид - 33,0;
бензалкония хлорид - 0,6;
повидон - 30,3;
лимонная кислота моногидрат - 0,8;
двузамещенный натрия фосфат - 10,8.

Заявляемая фармацевтическая композиция стабильна в течение не менее двух лет при хранении при температуре 4-8°С.

Пример 4. Оценка острой токсичности заявляемой фармацевтической композиции

Оценку острой токсичности заявляемой композиции проводят по установлению значений максимальных переносимых, токсических и полулетальных доз при однократном внутривенном введении мышам и крысам, а также по выявлению органов, наиболее чувствительных к повреждающему действию препарата.

В эксперименте используют раствор заявляемой фармацевтической композиции с концентрацией rELSA 0,5 мг/мл.

Исследование проводят на мышах самцах и самках, массой тела на момент начала исследований 18-19 граммов, и белых аутбредных крысах, самцах и самках, массой на момент начала исследования 195-200 граммов.

Делят животных на группы по 6 особей. Раствор rELSA в остром опыте вводят однократно внутривенно аутбредным мышам обоего пола в объеме 0,5 мл (доза 25 мл/кг веса) и аутбредным крысам обоего пола в объеме 2,0 мл (доза 10 мл/кг веса). В контрольном опыте животным вводят соответствующее количество 0,9% раствора NaCl.

После внутривенного введения отмечены реакции, направленные на место введения (хвостовая вена). Двигательная активность животных, реакции на внешние раздражители угнетались в легкой степени выраженности. Эти симптомы редуцировались в течение двух часов после введения.

В последующий период наблюдения (14 суток) не отмечено видимых различий в двигательном и пищевом поведении животных, в состоянии внешних покровов и видимых слизистых, в реакциях на внешние раздражители в сравнении с контрольными.

После окончания эксперимента (через 14 суток) животные подвергнуты эвтаназии для макроскопического описания и определения массовых коэффициентов органов.

По данным вскрытия и макроскопического исследования изучаемых органов различий между животными, получившими внутривенно токсические дозы препарата, и контрольными животными не установлено.

Гематологические показатели, а именно содержание форменных элементов, концентрация гемоглобина и гематокрит, в группах с внутривенным введением исследуемого препарата соответствовали таковым в контрольных группах как у мышей, так и у крыс.Анализ биохимических показателей сыворотки крови не выявил статистически значимого изменения параметров крови.

Таким образом, результаты токсикометрии, данные наблюдений за экспериментальными животными в постинтоксикационном периоде острого отравления после введения токсических доз 25 мл/кг для мышей и 10 мл/кг для крыс, а также данные некропсии, гематологии и биохимии сыворотки крови позволяют оценить заявляемую фармацевтическую композицию как малотоксичную.

Пример 5. Оценка хронической токсичности заявляемой фармацевтической композиции

Оценку хронической токсичности проводят по характеристике повреждающего действия фармакологической композиции при ее многократном введении и выявлении наиболее чувствительных органов и систем организма.

Для опытов используют половозрелых аутбредных белых крыс, самцов и самок, а также кроликов породы Шиншилла, самцов и самок. Введение препарата или 0,9% раствора NaCl (в контрольной серии) осуществляют интраконъюнктивально ежедневно, в течение 28 дней в одно и то же время.

В эксперименте используют раствор заявляемой фармацевтической композиции с концентрацией rELSA 0,5 мг/мл.

Препарат вводят в двух дозах: наименьшая доза, равная терапевтической дозе для данного вида экспериментальных животных и десятикратная доза, необходимая для выявления органов, наиболее чувствительных к токсическому эффекту.

Величину эквитерапевтических доз (ЭТД) и график введения устанавливают исходя из учета поверхности глаза животных.

Для крыс ЭТД соответствует 1 капля (50 мкл)/глаз, для кроликов - 2 капли/глаз. При однократном закапывании в оба глаза ЭТД для крысы составляет 0,1 мл/200 г или 0,25 мг rELSA /кг, для кролика - 0,2 мл/2000 г или 0,05 мг rELSA/кг.

1 ЭТД крысы = 0, 1 мл (1 раз в сутки по 1 капле в каждый глаз);

10 ЭТД крысы = 1 мл (дробно в течение суток по 1 капли в каждый глаз);

1 ЭТД кролика = 0,2 мл (1 раз в сутки по 2 капли в глаз);

10 ЭТД кролика = 2,0 мл/ (дробно в течение суток по 2 капли в каждый глаз). На протяжении эксперимента отмечают общее состояние животных, вес и потребление корма, гематологические и биохимические показатели. По окончании введения препарата (через 28 дней введения препарата и через 28 дней после отмены препарата) проводят патоморфологическое исследование (некропсию, макроскопическое исследование, взвешивание органов, гистологию органов).

Результаты оценки хронической токсичности.

В течение 28 дней и в последующие дни наблюдения после отмены препарата не отмечалось гибели животных (крыс и кроликов). Внешний вид и поведение животных в опытных группах не отличалось от контрольных. Реакция на тактильные, болевые, звуковые и световые раздражители была стандартная.

Различия в потреблении пищи и приросте массы тела по сравнению с контрольной группой экспериментальных животных не выявлено.

Данные гематологических исследований показали, что содержание форменных элементов в группах с интраконъюнктивальным введением препарата оставалось неизменным по сравнению с контрольной серией. Изучение основных биохимических показателей сыворотки крови крыс и кроликов также не выявило изменения параметров крови по группам.

По результатам макроскопического исследования органов (грудная и брюшная полость, лимфатические узлы, щитовидная железа, сердце, трахея, слизистая оболочка пищевода, желудок, печень, селезенка, яичники, молочные железы, семенники, оболочка головного мозга) различий между группами животных, получавших интраконъюнктивально заявляемую композицию и группой контроля не установлено.

Безопасность заявляемой композиции подтверждена тем, что ее многократное интраконъюнктивальное введение не вызвало нарушений функционального состояния основных органов и систем организма.

Пример 6. Оценка антибактериальной активности заявляемой фармацевтической композиции in vitro

В эксперименте используют раствор заявляемой фармацевтической композиции с концентрацией rELSA 0,5 мг/мл.

В качестве контроля используют антибиотик ванкомицин (Vancomycin j, JODAS EXPOIM Pvt. Ltd., Индия), применяемый при лечении заболеваний, вызванных штаммами S. aureus, резистентными к ряду других антибиотиков, в частности, метициллину.

Характеристика использованной тест-системы in vitro:

- метициллин-резистентный тест-штамм S.aureus АТСС 38591

- метициллин-резистентные клинические изоляты S.aureus. Специфическую активность заявляемой композиции оценивают по подавлению

роста штаммов S.aureus [А.С. Лабинская, Микробиология, Москва, Медицина 1972 г, с. 86] в сравнении с контролем (без засева бактерий).

В пробирки, содержащие 2 мл питательной среды LB с 105 КОЕ/мл тест-культуры вносят раствор заявляемой композиции и контроля в десяти последовательных разведениях.

После 24 ч инкубирования без перемешивания визуально регистрируют рост бактерий в пробирках по сравнению с контрольной пробиркой. За МПК (наименьшая концентрация антибиотиков, которая in vitro полностью подавляет видимый рост бактерий) принимают концентрацию действующего вещества в последней пробирке, в которой отсутствует рост бактерий.

Результаты, полученные для штамма S. aureus АТСС 38591 приведены в таблице 1, для клинического изолята S. aureus - в таблице 2.

«+» обозначает рост бактерий, а «-» - отсутствие роста

«+» обозначает рост бактерий, а «-» - отсутствие роста

Таким образом, выявлено выраженное антибактериальное действие заявляемой композиции in vitro, МПК активного начала которой составляет 0,0152 мкг/мл для тест-штамма S. aureus АТСС 38591 и - 0,0095 мкг/мл для клинического изолята S. aureus (табл. 3). Заявляемая композиция более эффективна, чем используемый в качестве контроля антибиотик ванкомицин.

Пример 7. Оценка специфической активности фармацевтической композиции in vivo Для экспериментов используют раствор фармацевтической композиции с содержанием rELSA 0,5 мг/мл.

В качестве препарата сравнения используют ванкомицин. Тесты проводят на кроликах породы шиншилла, весом 2,0-2,5 кг. Для тестирования формируют следующие группы животных:

Для моделирования заболевания, после предварительной анестезии раствором ультракаина кроликам наносят проникающую рану роговицы размером 2 мм × 3 мм от лимба на 2-3 часах на обоих глазах алмазным лезвием с опорожнением передней камеры глаза. После этого всем кроликам в переднюю камеру обоих глаз вводят по 0,1 мл жидкой суспензии тест-штамма S. aureus АТСС 38591 в тестируемой концентрации 106 КОЕ/мл.

Введение раствора заявляемой композиции или ванкомицина осуществляют в оба глаза интраконъюнктивально через сутки после заражения по 2 капли (0,1 мл) 1 раз, 2 раза и 3 раза в сутки в течение 7 суток. Лечение проводят для обоих глаз.

В контрольной группе животных через сутки после внесения суспензии стафилококка интраконъюнктивально вводят 0,9% раствор NaCl по 2 капли (0,1 мл) 1 раз, 2 раза и 3 раза в сутки в течение 7 суток.

Оценку клинических признаков заболевания проводят ежесуточно по параметрам, представленным в таблице 4.

Период наблюдения после окончания введения - 3-е суток.

Примечание: * - дни введения препаратов

В результате сделаны следующие выводы.

• В контрольной группе животных, которым не проводили лечения, наблюдают нарастающее развитие инфекционного посттравматического воспалительного процесса, локализованного в тканях роговицы - экзогенного кератита, приводящее к полной потере зрительной функции на 7-е сутки после инфицирования колотой раны роговицы тест-штаммом S. aureus АТСС 38591.

• В группе животных, которым проводили введение заявляемой композиции 1 раз в сутки по 2 капли в каждый глаз, наблюдают значительное улучшение к моменту окончания лечения. В течение последующих 3-х суток полного выздоровления не наступало.

• В группе животных, которым проводили введение заявляемой композиции 2 раза в сутки, положительная динамика снижения клинических показателей воспаления наступала быстрее и в более полном объеме. В течение 3-е суток после прекращения лечения ухудшения клинических показателей не происходило.

• В группе животных, которым проводили введение заявляемой композиции 3 раза в сутки, полное выздоровление глаз наступало на 8 сутки. Повторного возникновения воспаления не наблюдали.

• В группе с применением раствора заявляемой композиции снижение воспалительных явлений наступало на 1 сутки быстрее, чем в группе с применением ванкомицина.

Таким образом, заявляемая фармацевтическая композиция включающая N-концевой СНАР-домен эндолизина бактериофага К Staphylococcus aureus, обладает эффективным антибактериальным действием (МПК 0,010 -0,015 для метициллин-устойчивых штаммов Staphylococcus aureus). Результаты исследования фармакологической активности в отношении глазных заболеваний различных групп животных демонстрируют отсутствие токсичности, высокую эффективность и быстроту действия заявляемой композиции, которая представляет собой лиофильно высушенную смесь активного начала - rELSA и вспомогательных компонентов, стабильную в течение не менее 2 лет. Она более эффективна in vivo, чем антибиотик ванкомицин.

ИСТОЧНИКИ ИНФОРМАЦИИ

KR 20170087770: SA11 LysSA11 Endolysin with novel host binding domain from Staphylococcus aureus bacteriophage SA11 and antibiotic composition thereof. RYU SANG et al.

CN 106636050: Broad-spectrum endolysin derived from methicillin-resistant Staphylococcus aureus bacteriophage and application thereof. WANG JINGXUE et al., 2017.

US 2016090584: Phage Twort Endolysin CHAP Domain is Lytic for Staphylococcus aureus. MRSA, DONOVAN DAVID M. et al., 2010.

US 2015247138: Enhanced Staphylolytic Activity of the Staphylococcus aureus Bacteriophage vB_SauS-philPLA88 Virion-Associated Peptidoglycan Hydrolase HydH5: Fusions, Deletions and Synergy with LysH5, DONOVAN DAVID M. et al.

WO 2014039436: STAPHYLOCOCCUS HAEMOLYTICUS PROPHAGE PhiSH2 ENDOLYSIN IS LYTIC FOR STAPHYLOCOCCUS AUREUS. DONOVAN DAVID M. et al., 2014.

WO 2010036408: LYSK ENDOLYSIN IS SYNERGISTIC WITH LYSOSTAPHIN AGAINST MRSA. DONOVAN DAVID M. et al., 2010.

EP 2200442: BACTERIOPHAGE OR LYTIC PROTEIN DERIVED FROM THE BACTERIOPHAGE WHICH EFFECTIVE FOR TREATMENT OF STAPHYLOCOCCUS AUREUS BIOFILM. YOON SEONGJUN. et al., 2016.

US 2017173121: Method of reducing biofilms.

RU 2014152218: Staphylococcal Phage2638A Endolysin Amidase Domain Is Lytic for Staphylococcus aureus Абаев Игорь и др.

МХ 2016006277: MODIFIED KZ144 ENDOLYSIN SEQUENCE, STEFAN MILLER et al

US 2016298101: MODIFIED ELI88 ENDOLYSIN SEQUENCE. ANOSOVAIRINA

US 2016090584: Phage Twort Endolysin CHAP Domain is Lytic for Staphylococcus aureus. DONOVAN et al., 2016.

US 2015335719: Intravitreal Injection of a Chimeric Phage Endolysin Ply 187; Protection from Staphylococcus aureus Endophthalmitis, DONOVAN DAVID et al.

US 2015247138: Enhanced Staphylolytic Activity of the Staphylococcus aureus Bacteriophage vB_SauS-philPLA88 Virion-Associated Peptidoglycan Hydrolase HydH5: Fusions, Deletions and Synergy with LysH5, DONOVAN DAVID M. et al.

EP 3068878: MODIFIED EL 188 ENDOLYSIN SEQUENCE ANOSOVA IRINA, 201.

EP 3068877: MODIFIED KZ144 ENDOLYSIN SEQUENCE, MILLER STEFAN, 2016.

WO 2013188203: STAPHYLOCOCCAL PHAGE2638A ENDOLYSIN AMIDASE DOMAIN IS LYTIC FOR STAPHYLOCOCCUS AUREUS. DONOVAN et al.,2013.

WO 2013149010: ENHANCED ANTIMICROBIAL LYTIC ACTIVITY OF A CHIMERIC PLY187 ENDOLYSIN. DONOVAN DAVID M et al., 2013.

US 2011318328: Specific Lysis of Staphylococcal Pathogens by Bacteriophage phil 1 Endolysin DONOVAN DAVID M.

US 2011243916: MODIFIED ENDOLYSIN PLY511. SCHERZINGER ANNA et. al.

US 7572602: Nucleic acid encoding endolysin fusion protein. Donovan et al., 2009.

WO 2010036408: LYSK ENDOLYSIN IS SYNERGISTIC WITH LYSOSTAPHIN AGAINST MRSA, DONOVAN DAVID M. et al., 2010.

US 9,382,298: Polypeptide. Loessner etal.,2016.

US 9,499,594: Biofilm prevention, disruption and treatment with bacteriophage lysine, Schuch, et al. 2016.

US 9,889,181: Bacteriophage lysin and antibiotic combinations against gram positive bacteria. Schuch, et al., 2018

Soo Youn Jun, Gi Mo Jung, Jee-Soo Son, Seong Jun Yoon, Yun-Jaie Choi, Sang Hyeon Kang / Comparison of the Antibacterial Properties of Phage Endolysins SAL-1 and LysK// Antimicrob Agents Chemother., 2011, V. 55, N 4, p. 1764-1767.

S.Y. Jun, G.M. Jung, S. J. Yoon / Preclinical safety evaluation of intravenously administered SAL200 containing the recombinant phage endolysin SAL-1 as a pharmaceutical ingredient antimicrobial agents and chemotherapy// Int. J. Antimicrobial Agents, 2014, V. 58, N 4, p. 2084-2088.

S.Y. Juna, Gi Mo Junga, S. Jun Yoona/ Antibacterial properties of a pre-formulated recombinant phage endolysin, SAL-1// Int. J. Antimicrobial Agents, 2013, V. 41, p/156- 161.

S.Y. Jun, G.M. Jung, S.J. Yoon et al./ Preclinical safety evaluation of intravenously administered SAL200containing the recombinant phage endolysin SAL-1 as a pharmaceutical ingredient// Antimicrob. Agents Chemother., 2014; V. 58, N4, p. 2084-2088.

RU 2015122812: Лекарственная композиция для офтальмологического применения на основе рекомбинантного эндолизина. Свиридов Борис и др.

S. A. Coffey, W. Meaney, G.F. Fitzgerald, and R.P. Ross/ The Recombinant Phage Lysin LysK Has a Broad Spectrum of Lytic Activity against Clinically Relevant Staphylococci, Including Methicillin-Resistant Staphylococcus aureus// J. Bacteriol., 2005, V. 187(20), p. 7161-7164.

Marta Sanz-Gaitero, Ruth Keary,2 Carmela Garcia-Doval, Aidan Coffey, and Mark J van Raaij/ Crystal structure of the lytic CHAPK domain of the endolysin LysK from Staphylococcus aureus bacteriophage K.// Virol J., 2014 Jul., 26, p. 11:133.

Marianne Horgan, Gary Jennifer Garry, Jakki Cooney, Aidan Coffey, Gerald F. Fitzgerald, R. Paul Ross, and Olivia McAuliffe/ Phage Lysin LysK Can Be Truncated to Its CHAP Domain and Retain Lytic Activity against Live Antibiotic-Resistant Staphylococci// Appl Environ Microbiol., 2009 Feb; 75(3), p. 872-874.

Фармакопея 13. ОФС.1.4.1.0003.15 Глазные лекарственные формы.

https://yandex.ru/health/pills/product/oftalmoferon-20359

https://yandex.ru/health/pills/product/oftan-katahrom-636

Энциклопедия лекарств и товаров аптечного ассортимента, Инструкции по применению https://www.rlsnet.ru/tn_index_id_50518.htm.

RU 2549472: Фармацевтическая композиция в форме капель для профилактики и лечения аллергических заболеваний глаз.

http://vkusologia.ru/dobavki/stabilizatory-emulgatory/e464.html

Инструкции по применению, https://glazaizrenie.ru/lechenie/oftolik-glaznye-kapli-instruktsiya, http://soberpeoplesuck.eom/397-povidon.html

RU 2575590: Способ лечения рецидивирующих эрозий роговицы. Пронкин И.А. и др., 2016.

RU 2653260: Способ лечения хронических эрозий роговицы герпетической этиологии Майчук Д.Ю. и др., 2018.

Green, M.R., and Sambrook, J./ 2012, Molecular cloning. A laboratory manual. 4th ed. Cold. Spring Harbor (NY): Cold Spring Harbor Laboratory Press.

Л.Ю. Филатова, Д.М. Донован, С.С. Беккер, А.Д. Прийма, А.В. Кабанов, Н.Л. Клячко/ Исследование структурно-функциональных особенностей антистафилококковых эндолизинов кинетическими методами//Вестн. Моск. Ун-та, сер. 2. ХИМИЯ, 2014, Т. 55. №3, с. 148-152.

А.С. Лабинская/ Микробиология, Москва, Медицина, 1972, с. 86.

Фармацевтическая композиция для лечения глазных инфекций, вызванных метициллин-устойчивыми штаммами Staphylococcus aureus, включающая в качестве активного начала N-концевой СНАР-домен эндолизина бактериофага K Staphylococcus aureus, при следующем соотношении компонентов в лиофилизованной смеси, мас.% на сухой вес:

N-концевой СНАР-домен эндолизина
Бактериофага K Staphylococcus aureus 1,9
гипромеллоза 7,5
декспантенол 5,1
натрия хлорид 33,0
бензалкония хлорид 0,6
повидон 30,3
лимонная кислота моногидрат 0,8
двузамещенный натрия фосфат 10,8



 

Похожие патенты:

Изобретение относится к области биотехнологии. Изобретение представляет собой вакцинный штамм А/17/Швейцария/2017/51 (H3N2) - реассортант, полученный путем скрещивания эпидемического вируса А/Швейцария/8060/2017 (H3N2) с холодоадаптированным температурочувствительным вирусом А/Ленинград/134/17/57 (H2N2) - донором аттенуации, безвредным для людей.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложены рекомбинантный вирус болезни Марека серотипа 1 (rMDV1) для лечения птиц, содержащий в своем геноме чужеродный ген, в котором данный чужеродный ген располагается в нетранслируемом генетическом участке генома, и причем данный нетранслируемый генетический участок расположен в геноме между MDV010 и MDV011, между MDV015.5 и MDV016, между MDV033 и MDV034, между MDV071 и MDV072 или между MDV096 и MDV097.6, а также молекула нуклеиновой кислоты, клетка-хозяин, способ получения или воспроизведения rMDV1, композиция, вакцина, применение rMDV1 и набор для вакцинации.

Настоящее изобретение относится к биотехнологии. Предложен способ получения цитотоксических Т-лимфоцитов, экспрессирующих химерный рецептор.

Изобретение относится к области биотехнологии. Описан способ получения мышиных моноклональных антител, специфичных к различным штаммам вируса гриппа В Ямагатской и Викторианской эволюционных линий и имеющих высокую специфичность к NP-белку, включающий стадии получения антитело-продуцирующих спленоцитов; накопления клеток мышиной миеломы; слияния антитело-продуцирующих спленоцитов с миеломными клетками; отбора гибридом; инокуляции клеток гибридомы в брюшную полость праймированных пристаном мышей; накопления моноклональных антител в асцитах; очистки полученных моноклональных антител.

Изобретение относится к биотехнологии и представляет собой способ оптимизации крупномасштабной продукции парвовируса в существенно бессывороточной среде. Описан способ оптимизации продукции парвовируса, включающий существенно бессывороточную среду, которая позволяет увеличить продукцию парвовируса по сравнению со стандартной средой, предпочтительно для продукции H-1PV.

Изобретение относится к области биотехнологии. Описан способ получения мышиных моноклональных антител, специфичных к F-белку респираторно-синцитиального вируса групп А и В.

Настоящее изобретение относится к иммунологии. Предложены способы получения популяции Т-клеток, специфичных в отношении папилломавируса человека (HPV), включающие разделение образца HPV-позитивной опухоли головы и шеи на многочисленные фрагменты; культивирование многочисленных фрагментов по отдельности; получение Т-клеток из культивируемых многочисленных фрагментов; тестирование по отдельности Т-клеток из многочисленных фрагментов на специфичное распознавание HPV; отбор Т-клеток, которые демонстрируют специфичное распознавание HPV, и увеличение числа отобранных Т-клеток для получения популяции HPV-специфичных Т-клеток.

Изобретение относится к биотехнологии и иммунологии и представляет собой рекомбинантный белок, содержащий антигенно-значимый фрагмент белка вируса гепатита Е 1 генотипа, используемый в тест-системах для серодиагностики гепатита Е (варианты).

Изобретение относится к биотехнологии и иммунологии, в частности к рекомбинантному вирусному вектору, индуцирующему иммунный ответ против вируса гриппа собачьих, содержащему полинуклеотид, кодирующий белок гемагглютинин (НА).

Изобретение относится к биотехнологии и представляет собой выделенный вирус гриппа, который способен инфицировать животных из группы псовых и вызывать респираторное заболевание у представителей псовых.

Изобретение относится к применимому в медицине в том числе в составе фармацевтической композиции и набора соединению формулы (В): где R1 обозначает углерод-связанный, незамещенный или замещенный одним или несколькими T1, ароматический, насыщенный, полностью или частично ненасыщенный 4-, 5- или 6-членный гетероцикл, содержащий по меньшей мере один атом азота; -CN; -C(O)NHQ1; -C(O)NHOQ1; -C(O)NH-NHQ1; -C(O)O-NHQ1; -C(O)OQ1; -(CH2)mOC(O)OQ1; -(CH2)mOQ1; -(CH2)mOC(O)Q1; -(CH2)mOC(O)NQ1Q2; -(CH2)m-NHC(O)Q1; -(CH2)mNHS(O)2Q1; -(CH2)mNHS(O)2NQ1Q2; -(CH2)mNHC(O)OQ1; -(CH2)mNHC(O)NQ1Q2; -(CH2)mNHQ3; -(CH2)mNH-C(NHQ3)=NQ4; -(CH2)mNH-CH=NQ3; -C(NHQ3)=NQ4; R2 обозначает О или NOQ5; R3 обозначает SO3H, CFHCO2H или CF2CO2H; Q1 и Q2 независимо обозначают атом водорода; -(CH2)pNHQ3; -(CH2)p-NH-C(NHQ3)=NQ4; (CH2)p-NH-CH=NQ3; (CH2)q-C(NHQ3)=NQ4; -(CH2)pOQ3; -(CH2)qCONHQ3; или Q1 и Q2, незамещенные или замещенные одним или несколькими Т2, независимо обозначают (C1-C3)алкил; -(CH2)n-(4-, 5- или 6-членный гетероцикл); или Q1, Q2 и атом азота, к которому они присоединены, вместе образуют насыщенный или частично ненасыщенный 4-, 5- или 6-членный гетероцикл, содержащий 1, 2 или 3 гетероатома; Q3 и Q4 независимо обозначают H или (С1-С3)алкил; Q5, незамещенный или замещенный одним или несколькими Т3, обозначает (С1-С3)алкил; (С1-С3)фторалкил; -(CH2)n-(C3-C6)циклоалкил; -(CH2)n-(C3-C6)циклофторалкил; -(CH2)n-(4-, 5- или 6-членный гетероцикл); или Q5 обозначает атом водорода; (CH2)pOQ6; -(CH2)q-CN; -(CH2)pOC(O)Q6; -(CH2)q-C(O)OQ6; -(CH2)p-OC(O)OQ6; -(CH2)p-OC(O)NQ6Q7; -(CH2)q-C(O)NQ6Q7; -(CH2)q-C(O)NQ6OQ7; -(CH2)q-C(O)NQ6-NQ6Q7; -(CH2)p-NQ6C(O)Q7; -(CH2)pNQ6S(O)2Q7; -(CH2)pNQ6S(O)2NQ6Q7; -(CH2)p-NQ6C(O)OQ6; -(CH2)p-NQ6C(O)NQ6Q7; -(CH2)pNQ6Q7; -(CH2)p-NH-C(NHQ3)=NQ4; -(CH2)p-NH-CH=NQ3; (CH2)q-C(NHQ3)=NQ4; Т1 независимо обозначает атом фтора; -(CH2)nOQ1; -(CH2)n-CN; -(CH2)nOC(O)Q1; -(CH2)n-C(O)OQ1; -(CH2)n-OC(O)OQ1; -(CH2)n-OC(O)NHQ1; -(CH2)n-C(O)NHQ1; -(CH2)n-C(O)NHOQ1; -(CH2)n-C(O)NH-NHQ1; -(CH2)n-C(O)O-NHQ1; -(CH2)n-NHC(O)Q1; -(CH2)nNHS(O)2Q1; -(CH2)nNHS(O)2NQ1Q2; -(CH2)n-NHC(O)OQ1; -(CH2)n-NHC(O)NQ1Q2; -(CH2)nNHQ1; -(CH2)n-NH-C(NHQ3)=NQ4; -(CH2)n-NH-CH=NQ3; (CH2)n-C(NHQ3)=NQ4; или Т1, незамещенный или замещенный одним или несколькими Т2, независимо обозначает (C1-C3)алкил; (C1-C3)фторалкил; O-(C1-C3)фторалкил; -(CH2)n-(4-, 5- или 6-членный ароматический, насыщенный, полностью или частично ненасыщенный гетероцикл, содержащий по меньшей мере один N); Т2 независимо обозначает OH, NH2, CONH2; Т3 независимо обозначает H, F; (C1-C3)алкил; (C1-C3)фторалкил; O-(C1-C3)фторалкил; -(CH2)nOQ6-(CH2)n-(C3-C6)циклоалкил; -(CH2)n-(C3-C6)циклофторалкил; -(CH2)n-гетероцикл; -(CH2)n-CN; -(CH2)nOC(O)Q6; -(CH2)n-C(O)OQ6; -(CH2)n-OC(O)OQ6; -(CH2)n-OC(O)NQ6Q7; -(CH2)n-C(O)NQ6Q7; -(CH2)n-C(O)NQ6OQ7; -(CH2)n-C(O)NQ6-NQ6Q7; -(CH2)n-C(O)O-NHQ6; -(CH2)n-NQ6C(O)Q7; -(CH2)nNQ6S(O)2Q7; -(CH2)nNQ6S(O)2NQ6Q7; -(CH2)n-NQ6C(O)OQ7; -(CH2)n-NQ6C(O)NQ6Q7; -(CH2)nNQ6Q7; -(CH2)n-NH-C(NHQ3)=NQ4; -(CH2)n-NH-CH=NQ3; -(CH2)n-C(NHQ3)=NQ4; Q6 и Q7 независимо обозначают H; (C1-C3)алкил; -(CH2)pNHQ3; -(CH2)p-NH-C(NHQ3)=NQ4; (CH2)p-NH-CH=NQ3; (CH2)q-C(NHQ3)=NQ4; -(CH2)pOQ3; -(CH2)qC(O)NQ3Q4; -(CH2)n- (4-, 5- или 6-членный ароматический, насыщенный, полностью или частично ненасыщенный гетероцикл, содержащий по меньшей мере один атом азота); или Q6, Q7 и атом азота, к которому они присоединены, образуют вместе насыщенный или частично ненасыщенный 4-, 5- или 6-членный гетероцикл, содержащий 1, 2 или 3 гетероатома; m имеет одинаковые или различные значения и независимо обозначает 1 или 2; n имеет одинаковые или различные значения и независимо обозначает 0, 1, 2 или 3; p имеет одинаковые или различные значения и независимо обозначает 2 или 3; q имеет одинаковые или различные значения и независимо обозначает 1, 2 или 3; при этом любой атом углерода, присутствующий в группе, выбранный из алкила, циклоалкила, фторалкила, циклофторалкила и гетероцикла, может быть окислен с образованием группы С=О; любой атом серы, присутствующий в гетероцикле, может быть окислен с образованием группы S=O или группы S(O)2; любой атом азота, присутствующий в гетероцикле, или присутствующий в группе, в которой он является тризамещенным, образуя, таким образом, третичную аминогруппу, может быть дополнительно кватернизирован метильной группой; и его рацемат, энантиомер, диастереоизомер, геометрический изомер или фармацевтически приемлемая соль.

Изобретение относится к новым тилозиновым производным, фармацевтической и ветеринарной композиции на их основе, пригодных в способах лечения бактериальных инфекций.

Изобретение относится к области ветеринарии, а именно к средству для лечения некробактериоза крупного рогатого скота. Средство для лечения некробактериоза крупного рогатого скота состоит из электроактивированного водного раствора природного минерала бишофита Волгоградского месторождения, раствор дополнительно содержит электрохимически полученные ионы меди, в качестве растворителя используется дистиллированная вода.

Изобретение относится к области биотехнологии, конкретно к вариантам фактор H-связывающих белков, и может быть использовано в медицине для индукции антительного ответа против N.

Изобретение относится к соединению формулы (A2) (A2),в которой • Х, одинаковые или различные, независимо представляют собой O или S; • R1 представляет собой атом водорода; • R2, одинаковые или различные, независимо представляют собой -(CH2)qOQ5, -(C(O))w(CH2)v-C(O)OQ5, -(C(O))w(CH2)v-C(O)NQ5Q6, (CH2)q-NHC(O)OQ5, -(CH2)qNQ5Q6, -(CH2)q-NH-C(NHQ3)=NQ4; или R2, одинаковые или различные, независимо незамещенные или замещенные одним или несколькими T2, независимо представляют собой -(C(O))w-C1-C3-алкил, -(C(O))w-(CH2)p-(4-, 5- или 6-членный ароматический, насыщенный, полностью или частично ненасыщенный гетероцикл); • R3 представляет собой SO3H; • Q3 и Q4, одинаковые или различные, независимо представляют собой атом водорода или C1-C3-алкил; • Q5 и Q6, одинаковые или различные, независимо представляют собой атом водорода; или C1-C4-алкил; • T2, одинаковые или различные, независимо представляют собой ОН, NH2 или CONH2; • р, одинаковые или различные, независимо равны 0, 1, 2 или 3; • q, одинаковые или различные, независимо равны 2 или 3; • v, одинаковые или различные, независимо равны 1, 2 или 3; • w равен 0; и его фармацевтически приемлемым солям, в качестве антибактериальных средств.

Изобретение относится к химии органических гетероциклических соединений, а именно к соединениям фторхинолонового ряда на основе производных пиридоксина общей формулы (I), которые обладают антибактериальными свойствами и могут найти применение в медицине и ветеринарии.

Изобретение относится к фармацевтической промышленности, а именно к применению композиции в качестве противовирусного и/или противобактериального агента у индивидуумов, проходящих противоопухолевое химиотерапевтическое лечение, лечение синдрома приобретенного иммунодефицита и лечение лейкозов.

Изобретение относится к фармацевтической промышленности, а именно к применению антимикробной композиции для лечения или предупреждения инфекции, выбранной из бактериальной или грибковой.
Группа изобретений относится к фармацевтической промышленности, а именно к стабильному терапевтическому раствору сульфометилированного полимиксина. Стабильный водный терапевтический раствор сульфометилированного полимиксина, содержащий от 80 мг А/мл до 400 мг А/мл сульфометилированного полимиксина.

Изобретение относится к соединениям, характеризующимся высокой антибактериальной активностью, общей формулы (I), где R1-R2 имеют значения, указанные в описании. Изобретение также относится к фармацевтическим композициям, содержащим указанные соединения, и к применению вышеуказанных соединений для лечения и/или профилактики инфекционных заболеваний, в том числе вызванных антибиотикорезистентными патогенами (включая мультирезистентные штаммы), в частности заболеваний стафилококковой этиологии, например, инфекционных заболеваний кожи и/или мягких тканей, пневмонии, эндокардита или остеомиелита.

Изобретение относится к фармации и микробиологии. Предложено применение сывороточного альбумина человека (ЧСА) в концентрации от 49 до 71 мг/мл в качестве антимикробного средства, разрушающего клетки микроорганизмов. Технический результат состоит в реализации назначения: показано не только подавление роста E. coli, C. albicans, S. aureus, Cr. neoformans, но также разрушение клеток с образованием дебриса в физиологических концентрациях ЧСА. Изобретение обеспечивает возможность применять ЧСА в качестве антимикробного средства и использовать его в качестве показателя противомикробной активности сыворотки крови у пациентов. 2 ил., 2 табл., 3 пр.

Изобретение относится к биотехнологии, в частности к фармацевтической композиции для лечения глазных инфекций, вызванных метициллин-устойчивыми штаммами Staphylococcus aureus, включающей в качестве активного начала N-концевой СНАР-домен эндолизина бактериофага K Staphylococcus aureus. Заявляемая фармацевтическая композиция не токсична и более эффективна, чем антибиотик ванкомицин и расширяет арсенал средств для лечения глазных инфекций, вызванных метициллин-устойчивыми штаммами Staphylococcus aureus. 7 пр., 1 ил., 5 табл.

Наверх