Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов



Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
Доставка, применение и применения в терапии систем crispr-cas и композиций для целенаправленного воздействия на нарушения и заболевания с использованием вирусных компонентов
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2716421:

ПРЕЗИДЕНТ ЭНД ФЭЛЛОУЗ ОФ ХАРВАРД КОЛЛИДЖ (US)
МАССАЧУСЕТС ИНСТИТЬЮТ ОФ ТЕКНОЛОДЖИ (US)
ТЕ БРОД ИНСТИТЬЮТ ИНК. (US)

Настоящее изобретение относится к биотехнологии. Предложена композиция, содержащая один или несколько вирусных векторов, кодирующих систему CRISPR/Cas, для применения в лечении заболевания или расстройства мозга. Указанная система за счет наличия по меньшей мере одного сигнала ядерной локализации (NLS) позволяет осуществлять эффективное редактирование генома эукариотической клетки, в связи с чем она может быть использована для редактирования у млекопитающих генов, ассоциированных с заболеваниями мозга. 19 з.п. ф-лы, 85 ил., 18 табл., 40 пр.

 

Родственные заявки и включение при помощи ссылки

Заявляется приоритет по предварительным заявкам на патенты США 61/836123, поданной 17 июня 2013 г., 61/847537, поданной 17 июля 2013 г., 61/862355, поданной 5 августа 2013 г., 61/871301, поданной 28 августа 2013 г., 61/915225, поданной 12 декабря 2013 г., 61/979879, поданной 15 апреля 2014 г., и PCT/US2013/074667, поданной 12 декабря 2013 г., относительно которых применительно к США настоящая заявка также является частично продолжающей; и, как может быть разрешено согласно законодательству США, ее эквивалент в США или на национальной фазе может дополнительно заявлять и заявляет приоритет по PCT/US2013/074667 и заявкам, по которым PCT/US2013/074667 заявляет приоритет.

Вышеприведенные заявки, и все документы, цитируемые в них или во время их рассмотрения (''документы, цитируемые в заявке''), и все документы, цитируемые или упомянутые в документах, цитируемых в заявке, и все документы, цитируемые или упомянутые в данном документе (''документы, цитируемые в данном документе''), и все документы, цитируемые или упомянутые в документах, цитируемых в данном документе, вместе с любыми инструкциями изготовителя, описаниями, характеристиками продукта и технологическими картами для любых продуктов, упомянутыми в данном документе или в любом документе, включенном с помощью ссылки в данный документ, настоящим включены в данный документ с помощью ссылки и могут быть использованы в практическом осуществлении настоящего изобретения. Более конкретно, все упомянутые документы включены при помощи ссылки в такой же мере, как если бы конкретно и отдельно было указано, что каждый отдельный документ включен при помощи ссылки.

Область изобретения

Настоящее изобретение в целом относится к доставке, конструированию, оптимизации и применениям в терапии систем, способов и композиций, используемых для контроля экспрессии генов, включающего целенаправленное воздействие на последовательность, такое как внесение изменений в геном или редактирование гена, связанное с короткими палиндромными повторами, регулярно расположенными группами (CRISPR), и их компонентами. В частности, настоящее изобретение относится к аспектам, связанным с доставкой на основе вирусного вектора, генной терапией при помощи доставки на основе вирусного вектора, а также пониманием функции генов и созданием моделей посредством доставки на основе вирусного вектора.

Заявление в отношении финансируемого из федерального бюджета исследования

Настоящее изобретение было разработано при правительственной поддержке в рамках NIH Pioneer Award (1DP1MH100706), выданного Национальными институтами здравоохранения. Правительство обладает определенными правами на настоящее изобретение.

Предпосылки изобретения

Недавние достижения в технологиях секвенирования генома и способах анализа значительно ускорили возможность каталогизации и картирования генетических факторов, ассоциированных с широким разнообразием биологических функций и заболеваний. Точные технологии целенаправленного воздействия на геном необходимы для обеспечения систематичного обратного конструирования казуальных генетических изменений путем обеспечения возможности селективного внесения изменений в отдельные генетические элементы, а также для продвижения применений в области синтетической биологии, биотехнологии и медицины. Несмотря на то, что технологии редактирования генома, такие как использование ''дизайнерских'' ферментов с ''цинковыми пальцами'', эффекторов, подобных транскрипционным активаторам (TALE), или хоминг-мегануклеаз, доступны для осуществления внесения изменений в целевой геном, все еще существует необходимость в новых технологиях геномной инженерии, которые являются доступными, простыми в осуществлении, масштабируемыми и пригодными для целенаправленного воздействия на несколько положений в эукариотическом геноме.

Краткое описание изобретения

Настоящее изобретение включает разработку и применение системы CRISPR/Cas9 в качестве инструмента для целенаправленного воздействия на последовательность, такого как внесение изменений в геном или генное редактирование генов или геномов, связанных с нарушениями и заболеваниями, с использованием вирусных компонентов.

Система CRISPR-Cas не требует создания специальных белков для целенаправленного воздействия на конкретные последовательности, а скорее один фермент Cas может быть запрограммирован короткой молекулой РНК для узнавания конкретной ДНК-мишени. Добавление системы CRISPR-Cas к спектру технологий секвенирования и способам анализа генома может значительно упростить методику и ускорить возможность каталогизации и картирования генетических факторов, ассоциированных с широким спектром биологических функций и заболеваний. Для того, чтобы использовать систему CRISPR-Cas эффективно для редактирования генома без вредных воздействий, важно понимать аспекты конструирования, оптимизации и специфичной относительно типа клетки/ткани/органа доставки этих инструментов для геномной инженерии, которые являются аспектами заявленного изобретения.

Существует актуальная необходимость в альтернативных и функциональных системах и технологиях для целенаправленного воздействия на последовательность нуклеиновой кислоты с широким спектром применений. Аспекты настоящего изобретения удовлетворяют эту необходимость и предусматривают связанные с этим преимущества. Иллюстративный комплекс CRISPR содержит фермент CRISPR, образующий комплекс с направляющей последовательностью, которая гибридизируется с целевой последовательностью в целевом полинуклеотиде. Направляющая последовательность связана с парной tracr-последовательностью, которая, в свою очередь, гибридизируется с tracr-последовательностью.

В первом аспекте настоящее изобретение предусматривает способ модификации организма или отличного от человеческого организма путем манипуляции с целевой последовательностью в представляющем интерес локусе генома, который может включать

доставку не встречающейся в природе или сконструированной композиции, которая может содержать вирусную векторную систему, которая может содержать один или несколько вирусных векторов, функционально кодирующих композицию для ее экспрессии, где композиция может содержать:

(А) не встречающуюся в природе или сконструированную композицию, которая может содержать векторную систему, которая может содержать один или несколько векторов, которые могут содержать

I. первый регуляторный элемент, функционально связанный с полинуклеотидной последовательностью РНК системы CRISPR-Cas, где полинуклеотидная последовательность может содержать

(А) направляющую последовательность, способную гибридизироваться с целевой последовательностью в эукариотической клетке,

(b) парную tracr-последовательность и

(c) tracr-последовательность, и

II. второй регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей фермент CRISPR, который необязательно может содержать по меньшей мере одну или несколько последовательностей ядерной локализации,

где (А), (b) и (c) расположены в 5'-3' ориентации,

где компоненты I и II находятся в одном и том же или разных векторах системы,

где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и

где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью; или

(В) не встречающуюся в природе или сконструированную композицию, которая может содержать векторную систему, которая может содержать один или несколько векторов, которые могут содержать

I. первый регуляторный элемент, функционально связанный с

(А) направляющей последовательностью, способной гибридизироваться с целевой последовательностью в эукариотической клетке, и

(b) по меньшей мере одной или несколькими парными tracr-последовательностями,

II. второй регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей фермент CRISPR, и

III. третий регуляторный элемент, функционально связанный с tracr-последовательностью,

где компоненты I, II и III находятся в одном и том же или разных векторах системы,

где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и

где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью.

В одном аспекте настоящее изобретение предусматривает способы применения одного или нескольких элементов системы CRISPR-Cas. Комплекс CRISPR по настоящему изобретению обеспечивает эффективное средство модификации целевого полинуклеотида. Комплекс CRISPR по настоящему изобретению характеризуется большим разнообразием полезных свойств, включающих модификацию (например, делецию, вставку, транслокацию, инактивацию, активацию) целевого полинуклеотида во множестве типов клеток в различных тканях и органах. Комплекс CRISPR по настоящему изобретению как таковой имеет широкий спектр применений, например, в редактировании генов или генома, генной терапии, изыскании новых лекарственных средств, скрининге лекарственных средств, диагностике и прогнозировании заболеваний. Предусматриваются применения in vivo, in vitro и ex vivo.

Аспекты настоящего изобретения относятся к ферментам Cas9, обладающим улучшенной специфичностью целенаправленного воздействия в системе CRISPR-Cas9, имеющей направляющие РНК, характеризующиеся оптимальной активностью, имеющим меньшую длину, чем ферменты Cas9 дикого типа, и к кодирующим их молекулам нуклеиновых кислот, и к химерным ферментам Cas9, а также к способам улучшения специфичности целенаправленного воздействия фермента Cas9, или разработки системы CRISPR-Cas9, которые могут включать разработку или получение направляющих РНК, характеризующихся оптимальной активностью, и/или выбора или получения фермента Cas9, имеющего меньшие размер или длину, чем Cas9 дикого типа, при этом упаковка кодирующей его нуклеиновой кислоты в вектор доставки является более совершенной, поскольку в векторе доставки кодирующая его часть является меньшей, чем в случае Cas9 дикого типа, и/или создания химерных ферментов Cas9.

Также представлены применения последовательностей, векторов, ферментов или систем по настоящему изобретению в медицине. Также представлены их применения в редактировании генов или генома. Это относится к постмитотическим тканям или клеткам как in, так и ех vivo.

В дополнительном аспекте настоящего изобретения фермент Cas9 может содержать одну или несколько мутаций и может применяться в качестве стандартного ДНК-связывающего белка, слитого или не слитого с функциональным доменом. Мутации могут быть мутациями, введенными искусственным образом, или мутациями с приобретением или потерей функции. Мутации могут включать, без ограничения, мутации в одном из каталитических доменов (D10 и Н840) среди каталитических доменов RuvC и HNH, соответственно. Были охарактеризованы дополнительные мутации. В одном аспекте настоящего изобретения домен активации транскрипции может представлять собой VP64. В других аспектах настоящего изобретения домен репрессии транскрипции может представлять собой KRAB или SID4X. Другие аспекты настоящего изобретения относятся к подвергнутому мутации ферменту Cas9, слитому с доменами, которые включают, без ограничения, активатор транскрипции, репрессор транскрипции, рекомбиназу, транспозазу, фактор ремоделирования гистонов, деметилазу, ДНК-метилтрансферазу, криптохром, домен, индуцируемый/регулируемый светом, или домен, индуцируемый/регулируемый химическими веществами.

В дополнительном варианте осуществления настоящее изобретение предусматривает способы создания мутантной tracrRNA и последовательностей прямых повторов или мутантных химерных направляющих последовательностей, обеспечивающих повышение производительности этих РНК в клетках. Аспекты настоящего изобретения также предусматривают отбор указанных последовательностей.

Аспекты настоящего изобретения также предусматривают способы упрощения клонирования и доставки компонентов комплекса CRISPR. В предпочтительном варианте осуществления настоящего изобретения подходящий промотор, такой как промотор U6, амплифицируют с ДНК-олигонуклеотидом и добавляют к направляющей РНК. Полученным в результате продуктом ПЦР можно затем трансфицировать клетки для управления экспрессией направляющей РНК. Аспекты настоящего изобретения также относятся к направляющей РНК, транскрибированной in vitro или полученной от компании, проводящей синтез, и трансфицируемой напрямую.

В одном аспекте настоящее изобретение предусматривает способы улучшения активности путем применения более активной полимеразы. В предпочтительном варианте осуществления экспрессия направляющих РНК под контролем промотора Т7 управляется экспрессией полимеразы Т7 в клетке. В преимущественном варианте осуществления клетка является эукариотической клеткой. В преимущественном варианте осуществления эукариотическая клетка является клеткой человека. В более предпочтительном варианте осуществления клетка человека является специфичной клеткой пациента.

В одном аспекте настоящее изобретение предусматривает способы снижения токсичности ферментов Cas. В определенных аспектах фермент Cas представляет собой любой Cas9, описанный в данном документе, например, любой встречающийся в природе бактериальный Cas9, а также любые химерные формы, мутантные формы, гомологи или ортологи. В предпочтительном варианте осуществления Cas9 доставляют в клетку в форме мРНК. Это обеспечивает транзиентную экспрессию фермента со снижением, таким образом, токсичности. В другом предпочтительном варианте осуществления настоящее изобретение также предусматривает способы экспрессии Cas9 под контролем индуцируемого промотора и конструкции, применяемые в них.

В другом аспекте настоящее изобретение предусматривает способы улучшения in vivo применений системы CRISPR-Cas. В предпочтительном варианте осуществления фермент Cas представляет собой Cas9 дикого типа или любой из модифицированных вариантов, описанных в данном документе, в том числе любой встречающийся в природе бактериальный Cas9, а также любые химерные формы, мутантные формы, гомологи или ортологи. Преимущественный аспект настоящего изобретения предусматривает отбор гомологов Cas9, которые легко упаковываются в вирусные векторы для доставки. Ортологи Cas9, как правило, имеют общую структуру, включающую 3-4 домена RuvC и домен HNH. Наиболее близкий к 5'-концу домен RuvC расщепляет некомплементарную нить, а домен HNH расщепляет комплементарную нить. Все обозначения приведены в отношении направляющей последовательности.

Каталитический остаток в 5'-концевом домене RuvC идентифицируют посредством сравнения с целью поиска гомологии представляющего интерес Cas9 и других ортологов Cas9 (из локуса CRISPR типа II S. pyogenes, локуса 1 CRISPR S. thermophilus, локуса 3 CRISPR S. thermophilus и локуса CRISPR типа II Franciscilla novicida), и консервативный остаток Asp (D10) подвергают мутации по типу замены на аланин с превращением Cas9 в фермент, вносящий однонитевой разрыв в комплементарную нить. Аналогично, консервативные остатки His и Asn в доменах HNH подвергают мутации по типу замены на аланин с превращением Cas9 в фермент, вносящий однонитевой разрыв в некомплементарную нить. В некоторых вариантах осуществления можно осуществлять мутации из обеих групп для превращения Cas9 в неразрезающий фермент.

В некоторых вариантах осуществления фермент CRISPR представляет собой фермент CRISPR типа I или III, предпочтительно фермент CRISPR типа II. Этот фермент CRISPR типа II может быть любым ферментом Cas. Предпочтительный фермент Cas может быть идентифицирован как Cas9, поскольку он может относиться к общему классу ферментов, обладающих гомологией с самой большой нуклеазой с несколькими нуклеазными доменами системы CRISPR типа II. В наиболее предпочтительном случае фермент Cas9 получен или происходит из spCas9 или saCas9. Под происходящим заявители подразумевают, что в основе происходящего фермента главным образом лежит фермент дикого типа в том смысле, что он характеризуется высокой степенью гомологии последовательности с этим ферментом, но он был некоторым образом подвергнут мутации (модифицирован), как описано в данном документе.

Следует иметь в виду, что выражения Cas и фермент CRISPR обычно используются в данном документе взаимозаменяемо, если не очевидно иное. Как упоминается выше, большинство нумераций остатков, используемых в данном документе, относятся к ферменту Cas9 из локуса CRISPR типа II Streptococcus pyogenes. Однако следует иметь в виду, что настоящее изобретение включает многие другие Cas9 из других видов микроорганизмов, такие как SpCas9, SaCas9, St1Cas9 и т.д. Дополнительные примеры представлены в данном документе. Специалист в данной области будет способен определить надлежащие соответствующие остатки в ферментах Cas9, отличных от SpCas9, путем сравнения необходимых аминокислотных последовательностей. Таким образом, если конкретное аминокислотное замещение обозначается с помощью нумерации SpCas9, то если из контекста не очевидно, что это не предназначено для применения в отношении других ферментов Cas9, подразумевается, что настоящее раскрытие охватывает соответствующие модификации в других ферментах Cas9. Особенно предпочтительными ферментами Cas9 являются SpCas или SaCas9.

Пример кодон-оптимизированной последовательности, в данном случае оптимизированной для человека (т.е. оптимизированной для экспрессии у человека), представлен в данном документе, см. кодон-оптимизированную последовательность SaCas9 для человека. Хотя это является предпочтительным, следует иметь в виду, что возможны другие примеры, и что для вида-хозяина известна оптимизация кодонов.

В дополнительных вариантах осуществления настоящее изобретение предусматривает способы усиления функционирования Cas9 посредством образования химерных белков Cas9. Химерные белки Cas9 - химерные Cas9 - могут быть новыми Cas9, содержащими фрагменты из более чем одного встречающегося в природе Cas9. Эти способы могут включать слияние N-концевых фрагментов одного гомолога Cas9 с С-концевыми фрагментами другого гомолога Cas9. Эти способы также обеспечивают отбор новых свойств, проявляемых химерными белками Cas9.

Следует иметь в виду, что в способах по настоящему изобретению, где организм представляет собой животное или растение, модификация может иметь место ex vivo или in vitro, например, в клеточной культуре, и в ряде случаев не in vivo. В других вариантах осуществления она может иметь место in vivo.

В одном аспекте настоящее изобретение предусматривает способ модификации организма или отличного от человеческого организма путем манипуляции с целевой последовательностью в представляющем интерес локусе генома, включающий

доставку не встречающейся в природе или сконструированной композиции, содержащей:

А) - I. полинуклеотидную последовательность РНК системы CRISPR-Cas, необязательно полинуклеотидную последовательность химерной РНК (chiRNA), где полинуклеотидная последовательность может содержать:

(а) направляющую последовательность, способную гибридизироваться с целевой последовательностью в эукариотической клетке,

(b) парную tracr-последовательность и

(c) tracr-последовательность, и

II. полинуклеотидную последовательность, кодирующую фермент CRISPR, содержащий по меньшей мере одну или несколько последовательностей ядерной локализации,

где (а), (b) и (с) расположены в 5'-3' ориентации,

где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и

где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью, и полинуклеотидная последовательность, кодирующая фермент CRISPR, представляет собой ДНК или РНК,

или

(В) I. полинуклеотиды, которые могут содержать:

(a) направляющую последовательность, способную гибридизироваться с целевой последовательностью в эукариотической клетке, и

(b) по меньшей мере одну или несколько парных tracr-последовательностей,

II. полинуклеотидную последовательность, кодирующую фермент CRISPR, и

III. полинуклеотидную последовательность, которая может содержать tracr-последовательность,

где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и

где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью, и полинуклеотидная последовательность, кодирующая фермент CRISPR, представляет собой ДНК или РНК.

В некоторых вариантах осуществления, что применимо к любому или ко всем аспектам, предусмотренным в данном документе, предпочтительной является вторая вышеуказанная альтернатива (В). Однако первая альтернатива (А) является особенно предпочтительной. Это применимо ко всем аспектам настоящего изобретения, представляющих два альтернативных подхода с CRISPR.

Следует иметь в виду, что настоящая заявка направлена на доставку на основе вирусного вектора, вне зависимости от того, направлена ли она в орган как таковой, или ткань в нем, или просто на одну или несколько целевых клеток. Целевыми клетками являются клетки, выбранные для доставки системы CRISPR-Cas. Например, в случае доставки в печень такие целевые клетки могут представлять собой гепатоциты, предпочтительно первичные гепатоциты. Целевые клетки печени могут содержаться в позвоночном животном, являющимся пациентом (в том смысле, что животное нуждается в генной терапии под управлением CRISPR) или модельным организмом, или могут находиться в клеточной культуре, органоиде или другой ткани ex vivo, такой как ''печень на чипе'', например, где гепатоциты высевают и выращивают на подложке. Гепатоциты, взятые из нетрансплантированных органов, также являются применимой целевой клеткой. С учетом развития методик 3D-печати, применяемых в биологии, напечатанные ткани находятся в пределах доступности, и целенаправленное воздействие вполне возможно осуществить также и в клетках или тканях печени, напечатанных таким образом для создания органоида или находящихся на чипе. Пояснения в данном документе, касающиеся гепатоцитов, можно равным образом применять к другим клеткам печени и, в действительности, к клеткам других типов в целом, таким как клетки головного мозга или почки, примеры которых предусмотрены в данном документе.

Таким образом, предусмотрен модельный организм, который может содержать клетки печени, такие как гепатоциты, в которые была доставлена система CRISPR-Cas по настоящему изобретению. Аналогично, также представлена совокупность ех vivo двух или более клеток печени, таких как гепатоциты, в которые была доставлена система CRISPR-Cas по настоящему изобретению. Такие совокупности могут включать органы печени, органоиды печени, клетки печени, заселяющие подложку ('печень на чипе'). И в этом случае, конечно, предусмотрены не относящиеся к печени альтернативы, такие как головной мозг или почка, и хотя печень является предпочтительной, она представлена в данном документе в качестве примера. Также представлены способы создания таких моделей или совокупностей.

В частности, такие целевые клетки могут экспрессировать или содержать полинуклеотиды, способные к экспрессии фермента Cas. Как обсуждается в данном документе, преимуществом этого является обеспечение готовой модели для исследования функций генов посредством внесения изменений в гены, в том числе нокдауна. Это является особенно применимым при изучении состояний печени, таких как амилоидоз и другие, перечисленные в данном документе, а также более общих состояний, таких как ожирение.

В данном документе также представлены способы исследования функций генов в печени. Они обычно включают доставку системы CRISPR-Cas в целевые клетки, находящиеся in или ex vivo. Однако если клетки уже содержат Cas, экспрессируемый в виде белка или кодируемый полинуклеотидами, уже содержащимися в клетках, тогда необходимо доставить только полинуклеотид CRISPR. Способ может включать извлечение из целевой ткани, органа, органоида, чипа или совокупности клеток и, необязательно, повторное введение обратно в них, как обсуждается в данном документе. Под доставкой, в действительности, подразумевают физическую доставку полинуклеотидов в ядро клетки, а также трансфекцию.

Также предусмотрены способы генной терапии. Например, коррекцию одного или нескольких дефектных генотипов (например, одиночных точечных мутаций) можно осуществить посредством применения системы CRISPR-Cas по настоящему изобретению в клетках печени, обсуждаемых в данном документе (в том числе в моделях). Моногенные состояния, связанные с печенью, являются особенно предпочтительными и проиллюстрированы на примере в данном документе, см. пример 38, в котором мишенью системы CRISPR-Cas9, для которой она была эффективной в индукции фенотипического изменения in vivo, являлся АроВ, ген, участвующий в метаболизме липидов. Также представлены композиции для применения в генной терапии.

Состояния для исследования и генной терапии являются многочисленными и варьируют из-за широкого применения технологии CRIPS-Cas. Подходящие примеры представлены в данном документе, в том числе в таблицах А, В и С. Любой из них можно выбрать, и каждый из них является предпочтительным. Некоторыми особенно предпочтительными, но неограничивающими примерами являются состояния, конкретно приведенные в качестве примера в данном документе, а также любое моногенное состояние и, в частности, муковисцидоз (CFTR).

Хотя предусмотрены различные ферменты Cas, Cas9 является особенно предпочтительным, и заявителями была продемонстрирована особенная эффективность SaCa9 в печени. Tracr-последовательность из Sa также является предпочтительной, если фермент Cas является ферментом SaCas. Подходящим РАМ в данном случае является NNGRR.

Хотя можно применять одну направляющую последовательность, так называемое мультиплексирование с двумя, тремя, четырьмя или более направляющими последовательностями является особенно применимым в исследовании функций генов и создании моделей (с получением нокдауна нескольких генов), а также в генной терапии, когда коррекции подлежат несколько дефектных генотипов (несколько ошибок в одном гене либо, с большей долей вероятности, несколько ошибок, распределенных среди нескольких генов). Альтернативно, мультиплексирование с двумя направляющими последовательностями применимо в подходе с двойной никазой для снижения частоты нецелевых эффектов или попросту для отбора нескольких мишеней в одном гене для обеспечения привлечения Cas. Предпочтительными являются тройные и четверные направляющие последовательности. В данном документе на ген и локус генома ссылаются взаимозаменяемо.

Также применимым в этом отношении является подход с интроном, описанный в данном документе, где направляющая последовательность расположена в интроне Cas.

Предпочтительные средства доставки включают способы, описанные Kanasty ниже, такие как LNP, особенно если доставке подлежит только направляющая последовательность или она подлежит доставке в отдельности. Тем не менее, как правило, предпочтительными являются вирусные векторы, в том числе лентивирусный вектор и вектор на основе AAV. В частности, они являются предпочтительными для доставки в печень, поскольку до сих пор они были успешными. Среди них предпочтительным является AAV и особенно серотип 8, при этом было показано, что AAV2/8 является эффективным.

Некоторые предпочтительные целевые состояние и гены, при условии, что они присутствуют, или состояния печени или почки означают нарушения метаболизма, такие как любое из следующих: амилоидная невропатия (TTR, PALB); амилоидоз (АРОА1, АРР, ААА, CVAP, AD1, GSN, FGA, LYZ, TTR, PALB); цирроз (KRT18, KRT8, CIRH1A, NAIC, ТЕХ292, KIAA1988); муковисцидоз (CFTR, ABCC7, CF, MRP7); болезни накопления гликогена (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM); аденома печени, 142330 (TCF1, HNF1A, MODY3), печеночная недостаточность с ранним началом и с неврологическим нарушением (SCOD1, SCO1), недостаточность печеночной липазы (LIPC), гепатобластома, рак и виды эпителиомы (CTNNB1, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN, CTNNB1, ТР53, Р53, LFS1, IGF2R, MPRI, MET, CASP8, МСН5); заболевание по типу медуллярной кистозной нефропатии (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2); фенилкетонурия (РАН, PKU1, QDPR, DHPR, PTS); поликистоз почек и печени (FCYT, PKHD1, ARPKD, PKD1, PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63). Другие предпочтительные мишени включают любой один или несколько из PCSK9; Hmgcr; SERPINA1; АроВ и/или LDL.

Следует иметь в виду, что способы изменения экспрессии в целевой клетке могут не включать изменение в зародышевой линии, которое может быть исключено по моральным соображениям. В действительности, хотя трансфекция стволовых клеток предусмотрена и, безусловно, является предпочтительной в некоторых вариантах осуществления, нестволовые клетки (т.е. постмитотические клетки) являются особенно предпочтительными, в особенности если они могут проявлять некоторую регенерацию или могут быть простимулированы для ее проявления, как наблюдается у гепатоцитов.

CRISPR типа II являются особенно предпочтительными, в частности, для применения у эукариот, как в данном случае, поскольку, в любом случае, печень обнаруживается только у эукариот, в частности, у позвоночных животных.

Применение систем CRISPR-Cas для того, чтобы вызвать фенотипическое изменение, в частности in vivo, является особенным преимуществом.

Если предусмотрены применения в терапии или другая геномная инженерия в целевых клетках, то при необходимости коррекции следует иметь в виду, что после внесения однонитевого разрыва в геномную ДНК-мишень или ее расщепления предпочтительной является последующая коррекция посредством пути HDR. Для нокдауна генов преимущественным является NHEJ, однако для терапии предпочтительной является коррекция посредством пути HDR. В таких случаях предпочтительной является доставка матрицы для репарации. Она наиболее предпочтительно представляет собой ssDNA, хотя также возможно использование РНК посредством ретровирусного вектора, обеспечивающего соответствующую ДНК-матрицу. Специалист в данной области может без труда осуществлять настоящее изобретение на практике на основании изложенных в данном документе идей, вносящих вклад в уровень техники; и в этом отношении упоминается, что специалист в данной области на основании изложенных в данном документе идей, вносящих вклад в уровень техники, может без труда понимать и внедрять соображения, касающиеся длины гомологичных плеч. Упомянуты патентные заявки и публикации, в том числе автора Zhang, включенные в данный документ, в том числе цитируемые в данном документе. Матрицу для репарации предпочтительно доставляют совместно с одним или несколькими элементами системы CRISPR-Cas.

Также представлен способ изменения экспрессии по меньшей мере одного продукта гена в печени, который может включать введение в эукариотическую клетку, содержащую и экспрессирующую молекулу ДНК, имеющую последовательность целевой клетки и кодирующую продукт гена, сконструированной не встречающейся в природе системы коротких палиндромных повторов, регулярно расположенных группами (CRISPR), и CRISPR-ассоциированных генов (Cas) (CRISPR-Cas), которая может содержать один или несколько векторов, которые могут содержать:

a) первый регуляторный элемент, функционирующий в эукариотической клетке, функционально связанный по меньшей мере с одной нуклеотидной последовательностью, кодирующей направляющую РНК системы CRISPR-Cas, которая гибридизируется с целевой последовательностью, и

b) второй регуляторный элемент, функционирующий в эукариотической клетке, функционально связанный с нуклеотидной последовательностью, кодирующей белок Cas9 типа II,

где компоненты (а) и (b) находятся в одном и том же или в разных векторах системы, в результате чего направляющая РНК осуществляет нацеливание на целевую последовательность, а белок Cas9 расщепляет молекулу ДНК, в результате чего экспрессия по меньшей мере одного продукта гена в печени изменяется; и где белок Cas9 и направляющая РНК не встречаются вместе в естественных условиях.

Приведенную далее ссылку на мишени понимают как ссылку на гены или клетки, но, как правило, гены, если не очевидно иное.

Следующее относится в равной степени ко всем аспектам настоящего изобретения. Если в данном документе упоминают печень, это понимают как ссылку на постмитотические клетки в целом, в частности, клетки почки или головного мозга. Целевая последовательность наиболее предпочтительно представляет собой целевую последовательность постмитотической клетки. Постмитотическая клетка может находиться в или происходить из (т.е. источник клетки или тип клетки) какого-либо одного из следующих органов или может представлять собой органоиды или модели ех vivo или совокупности клеток, содержащие клетки

почки, такие как клетки гломерулы;

пищеварительной системы, в том числе желудка, поджелудочной железы, двенадцатиперстной кишки, подвздошной кишки и/или толстой кишки;

сердца;

легкого;

головного мозга, в частности нейроны, и/или CNS в целом;

глаза, в том числе ткани сетчатки;

уха, в том числе внутреннего уха;

кожи;

мышцы;

кости и/или

печени в целом, хотя она исключена в некоторых вариантах осуществления, поскольку она также является объектом отдельной заявки.

Головной мозг и почка являются особенно предпочтительными. В некоторых вариантах осуществления клетка представляет собой клетку головного мозга, такую как нейрон. В некоторых вариантах осуществления клетка представляет собой клетку почки.

Предпочтительные клетки почки включают любую одну или несколько из

париетальной клетки гломерулы почки;

подоцита гломерулы почки;

клетки с щеточной каемкой проксимального канальца почки;

клетки тонкого сегмента петли Генле;

клетки толстого восходящего колена;

клетки дистального канальца почки;

клетки собирающего протока почки и

интерстициальных клеток почки.

Предпочтительные примеры целевых клеток представлены в приведенной ниже таблице, в соответствующем разделе, озаглавленном, например, 'почка', или 'печень', или 'кость', или 'ухо', любые из которых являются предпочтительными, а также в таблице В. Предпочтительными являются любая одна или несколько из данных мишеней. Примеры 1 и 18 также направлены на клетки почки (хотя и стволовые клетки, которые не являются постмитотическими клетками), но в них может быть применима идея касательно доставки.

В некоторых особенно предпочтительных вариантах осуществления манипуляция вызывает фенотипическое изменение в клетке.

В некоторых вариантах осуществления фенотипическое изменение можно вызывать или поддерживать в клетке in vivo. Клетку либо трансфицируют in vivo, либо извлекают, трансфицируют ех vivo и затем повторно вводят (трансплантируют) обратно тому же или другому хозяину.

Экспрессия фермента CRISPR и необязательно направляющей последовательности может находиться под контролем промотора, специфичного для клетки, например содержащегося в кассете экспрессии, способной экспрессировать фермент и необязательную направляющую последовательность в указанной постмитотической клетке. Другими словами, фермент CRISPR и необязательно направляющая последовательность функционально связан(ы) с указанным промотором, специфичным для целевой клетки.

Целевая клетка может представлять собой постмитотическую клетку. Векторные системы на основе AAV являются особенно предпочтительными, главным образом, когда постмитотическая клетка представляет собой нейрон. Также предпочтительными являются соматические клетки.

Промотор для фермента CRISPR и необязательный промотор для направляющей последовательности могут быть одинаковыми или разными.

Обсуждение в данном документе, в частности следующее, также относится к любому способу, применению или композиции, описанным в данном документе. РНК системы CRISPR-Cas может представлять собой химерную РНК (chiRNA). Система CRISPR-Cas может представлять собой мультиплексную ферментную систему CRISPR, дополнительно содержащую несколько химер и/или несколько направляющих последовательностей для нескольких мишеней и одну tracr-последовательность. Фермент CRISPR может представлять собой нуклеазу, управляющую расщеплением обеих нитей в определенной точке целевой последовательности. Фермент CRISPR может содержать одну или несколько мутаций. Фермент CRISPR может содержать одну или несколько мутаций D10A, Е762А, Н840А, N854A, N863A или D986A. Одна или несколько мутаций могут присутствовать в домене RuvC1 фермента CRISPR. Фермент CRISPR может представлять собой никазу, управляющую расщеплением в определенной точке целевой последовательности. Никаза может представлять собой двойную никазу. Предпочтительными являются по меньшей мере две или более NLS.

Фермент CRISPR может относиться к типу II, предпочтительно представляет собой Cas и наиболее предпочтительно Cas9. Ссылку на Cas или Cas9 (например, в CRISPR-Cas или CRISPR Cas9) следует понимать как ссылку на любой Cas, наиболее предпочтительно Cas9, и, в частности, на Sa- или SpCas9 (охватывающие все мутации, такие как D10A, для обеспечения DSB, функцию никазы или двойной никазы).

Фермент CRISPR может иметь одну или несколько мутаций в каталитическом домене, где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и где фермент дополнительно содержит функциональный домен. Функциональный домен может представлять собой домен активации транскрипции. Домен активации транскрипции может представлять собой VP64.

Способы могут дополнительно включать сведение к минимуму нецелевых модификаций посредством манипуляции с первой и второй целевыми последовательностями на противоположных нитях ДНК-дуплекса в представляющем интерес локусе генома в клетке, что предусматривает

доставку не встречающейся в природе или сконструированной композиции, содержащей:

I. полинуклеотидную последовательность химерной РНК (chiRNA) системы CRISPR-Cas, где полинуклеотидная последовательность содержит:

(a) первую направляющую последовательность, способную гибридизироваться с первой целевой последовательностью,

(b) первую парную tracr-последовательность,

(c) первую tracr-последовательность,

(d) вторую направляющую последовательность, способную гибридизироваться со второй целевой последовательностью,

(e) вторую парную tracr-последовательность и

(f) вторую tracr-последовательность, и

где необязательно между первой tracr-последовательностью и второй направляющей последовательностью находится линкерная последовательность, в результате чего первая направляющая последовательность и вторая направляющая последовательность расположены последовательно; и

II. полинуклеотидную последовательность, кодирующую фермент CRISPR, содержащий по меньшей мере одну или несколько последовательностей ядерной локализации, где (а), (b), (с), (d), (е) и (f) расположены в 5'-3' ориентации, где полинуклеотидная последовательность содержит линкерную последовательность между первой tracr-последовательностью и второй направляющей последовательностью, в результате чего первая направляющая последовательность и вторая направляющая последовательность расположены последовательно, и где при транскрипции первая и вторая парные tracr-последовательности гибридизируются с первой и второй tracr-последовательностями, соответственно, а первая и вторая направляющие последовательности управляют специфичным к последовательности связыванием первого и второго комплексов CRISPR с первой и второй целевыми последовательностями, соответственно,

или

II. второй регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей фермент CRISPR, и где компоненты I и II находятся в одном и том же или разных векторах системы, и при транскрипции первая парная tracr-последовательность гибридизируется с первой tracr-последовательностью, а первая и вторая направляющие последовательности управляют специфичным к последовательности связыванием первого и второго комплексов CRISPR с первой и второй целевыми последовательностями, соответственно;

где первый комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) первой направляющей последовательностью, которая гибридизируется с первой целевой последовательностью, и (2) первой парной tracr-последовательностью, которая гибридизируется с первой tracr-последовательностью,

где второй комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) второй направляющей последовательностью, которая гибридизируется со второй целевой последовательностью, и (2) второй парной tracr-последовательностью, которая гибридизируется со второй tracr-последовательностью,

где полинуклеотидная последовательность, кодирующая фермент CRISPR, представляет собой ДНК или РНК, и

где первая направляющая последовательность управляет расщеплением одной нити ДНК-дуплекса возле первой целевой последовательности, а вторая направляющая последовательность управляет расщеплением другой нити возле второй целевой последовательности, индуцируя двухнитевой разрыв, с модификацией таким образом организма или отличного от человеческого организма путем сведения к минимуму нецелевых модификаций.

В некоторых вариантах осуществления вторая вышеуказанная альтернатива (В) является предпочтительной. Однако первая альтернатива (А) является особенно предпочтительной. Это применимо ко всем аспектам настоящего изобретения, представляющих два альтернативных подхода с CRISPR.

Следует иметь в виду, что настоящая заявка направлена на постмитотические клетки вне зависимости от того, представляют ли они орган как таковой, или ткань в нем, или просто одну или несколько постмитотических клеток, таких как нейроны. Нейроны и клетки почки являются предпочтительными. Постмитотические клетки могут содержаться в позвоночном животном, являющимся пациентом (в том смысле, что животное нуждается в генной терапии под управлением CRISPR) или модельным организмом, или могут находиться в клеточной культуре, органоиде или другой ткани ex vivo, такой как ''печень на чипе'', например, где гепатоциты высевают и выращивают на подложке. Гепатоциты, взятые из нетрансплантированных органов, также являются применимой мишенью. С учетом развития методик 3D-печати, применяемых в биологии, напечатанные ткани находятся в пределах доступности, и целенаправленное воздействие вполне возможно осуществить также и в клетках или тканях печени, напечатанных таким образом для создания органоида или находящихся на чипе. Также предусмотрены отличные от печени альтернативы, в частности, для тканей почки или других постмитотических клеток/тканей.

Таким образом, представлен модельный организм, содержащий постмитотические клетки, такие как нейроны или клетки почки, в которые была доставлена система CRISPR-Cas по настоящему изобретению. Аналогично, также представлена совокупность ex vivo двух или более постмитотических клеток, таких как нейроны или клетки почки, в которые была доставлена система CRISPR-Cas по настоящему изобретению. Такие совокупности могут включать постмитотические органы, органоиды, клетки, заселяющие подложку ('почка на чипе'). Также представлены способы создания таких моделей или совокупностей.

В частности, такие постмитотические клетки могут экспрессировать или содержать полинуклеотиды, способные экспрессировать фермент Cas. Как обсуждается в данном документе, преимуществом этого является обеспечение готовой модели для исследования функций генов посредством внесения изменений в гены, в том числе нокдауна. Это является особенно применимым при изучении состояний постмитотических клеток, например, клеток почки или головного мозга, таких как перечисленные в данном документе, а также более общих состояний, таких как ожирение.

В данном документе также представлены способы исследования функций генов постмитотической клетки. Они обычно включают доставку системы CRISPR-Cas в постмитотические клетки, находящиеся in или ех vivo. Однако если клетки уже содержат Cas, экспрессируемый в виде белка или кодируемый полинуклеотидами, уже содержащимися в клетках, тогда необходимо доставить только полинуклеотид CRISPR. Способ может включать извлечение из постмитотической клетки и необязательно повторное введение обратно в нее. Под доставкой, в действительности, подразумевают физическую доставку полинуклеотидов в ядро клетки, а также трансфекцию. Следовательно, доставку также следует понимать как включающую трансфекцию, если не очевидно иное.

Также представлен способ индукции внесения изменений в гены в одной или нескольких животных или растительных клетках, включающий трансдукцию первой популяции клеток системой CRISPR-Cas согласно настоящему изобретению с изменением, таким образом, генома первой популяции клеток и получением второй популяции клеток. Способ можно осуществлять ех vivo или in vitro, например, в клеточной культуре или в модели ех vivo или in vitro (такой как органоид или 'животная или растительная клетка на чипе'). Альтернативно, способ можно осуществлять in vivo, и в этом случае он может также включать выделение первой популяции клеток из субъекта и трансплантацию второй популяции клеток (обратно) субъекту. Внесение изменений в гены может производиться в отношении одного или нескольких, или двух или более, или трех или более, или четырех или более генов. Внесение изменений в гены может представлять собой ослабление функционирования гена (т.е. активности кодируемого продукта гена). Его можно индуцировать, например, путем изменения генома первой популяции клеток с получением второй популяции клеток, где вторая популяция клеток имеет дефектный генотип, как, например, при моногенном состоянии, которое отсутствует у первой популяции клеток. Для него может требоваться соответствующая матрица для репарации, обсуждаемая в данном документе, для получения дефектной последовательности, или его можно осуществлять посредством индукции DSB. В частности, внесение изменений в гены представляет собой нокдаун генов. В некоторых вариантах осуществления животная или растительная клетка наиболее предпочтительно представляет собой постмитотическую клетку, такую так клетка почки или головного мозга (нейрон) или клетку печени, такую как первичный гепатоцит.

Альтернативно, внесение изменений в гены может представлять собой усиление функционирования гена (т.е. активности кодируемого продукта гена). Его можно индуцировать, например, путем изменения генома первой популяции клеток с получением второй популяции клеток, где первая популяция клеток имеет дефектный генотип, как, например, при моногенном состоянии, которое отсутствует (т.е. подвергнуто коррекции) у второй популяции клеток. Для него может требоваться соответствующая матрица для репарации, обсуждаемая в данном документе, для получения скорректированной последовательности.

Если применяется мультиплексирование, то предусматривается комбинация ослабления функционирования одного или нескольких генов и усиление функционирования одного или нескольких генов. Этого можно достичь путем обеспечения одной или нескольких направляющих последовательностей (в мультиплексе) и соответствующих матриц для репарации, которые можно применять для ослабления функционирования, и в то же время одну или несколько направляющих последовательностей и соответствующих им матриц для репарации можно применять для усиления функционирования.

Также представлен способ исследования функций одного или нескольких генов в одной или нескольких животных или растительных клетках, включающий определение изменений экспрессии одного или нескольких генов в первой популяции животных или растительных клеток, индукцию указанного внесения изменений в гены в указанной первой популяции с получением указанной второй популяции с измененным геномом (или генотипом) и определение изменений экспрессии одного или нескольких генов во второй популяции животных или растительных клеток с исследованием, таким образом, функций одного или нескольких генов. В некоторых вариантах осуществления животная или растительная клетка наиболее предпочтительно представляет собой постмитотическую клетку, такую так клетка почки или головного мозга (нейрон) или клетку печени, такую как первичный гепатоцит.

Также представлена модель и способ создания такой модели. Моделью может являться животное, содержащее животную или растительную клетку (модель in vivo), или она может представлять собой модель ех vivo или in vitro, такую как животный или растительный органоид, или 'животную или растительную клетку на чипе', или совокупность животных или растительных клеток, как, например, на подложке, как описано в данном документе. Животные или растительные клетки любой модели предпочтительно трансфицируют с помощью Cas9. Соответственно, конкретно представлена модель, содержащая одну или несколько животных или растительных клеток, содержащих фермент CRISPR, предпочтительно Cas9, такой как Sa- или SpCas9. Модельные клетки могут быть трансфицированы или трансдуцированы вторым регуляторным элементом, представленным в данном документе, который является вторым регуляторным элементом, функционально связанным с кодирующей фермент последовательностью, кодирующей фермент CRISPR, содержащий по меньшей мере одну или несколько последовательностей ядерной локализации (NLS). Как описано выше, модель может представлять собой модель in vivo, или она может представлять собой модель ех vivo или in vitro. Такая модель позволяет проводить быстрое исследование функций одного или нескольких генов, поскольку для изменения функций указанного гена необходима доставка только полинуклеотидной последовательности из системы CRISPR-Cas (содержащей одну или несколько направляющих последовательностей, осуществляющих нацеливание на указанные один или несколько генов). Другими словами, способы исследования функций генов в таких моделях могут включать только доставку полинуклеотидной последовательности из системы CRISPR-Cas (содержащей одну или несколько направляющих последовательностей), при этом наличие Cas (фермента CRISPR) в клетке(клетках) модели уже было обеспечено. Также представлены способы создания таких моделей, включающие трансдукцию или трансфекцию одной или нескольких животных или растительных клеток в первой популяции животных или растительных клеток вторым регуляторным элементом, функционально связанным с кодирующей фермент последовательностью, кодирующей фермент CRISPR, содержащий по меньшей мере одну или несколько последовательностей ядерной локализации (NLS), как описано в данном документе, с получением, таким образом, одной или нескольких животных или растительных клеток второй популяции, содержащих или экспрессирующих фермент CRISPR. В некоторых вариантах осуществления животная или растительная клетка наиболее предпочтительно представляет собой постмитотическую клетку, такую так клетка почки или головного мозга (нейрон) или клетку печени, такую как первичный гепатоцит.

Также представлены способы создания моделей с внесенными изменениями в генах, в частности, моделей с нокдауном генов. Эти способы обычно могут включать индукцию внесения изменений в гены в одном или нескольких генах, как описано в данном документе, в первой популяции клеток с получением, таким образом, второй популяции клеток с измененным геномом (или генотипом). Вторую популяцию клеток можно затем высеять на подложку или на чип, например, с получением, таким образом, модели ex vivo или in vitro. Альтернативно, вторая популяция может содержаться в животном in vivo.

Также предусмотрены способы генной терапии. Например, коррекцию одного или нескольких дефектных генотипов (например, одиночных точечных мутаций) можно осуществить посредством применения системы CRISPR-Cas по настоящему изобретению в постмитотических клетках, обсуждаемых в данном документе (в том числе в моделях). Моногенные состояния, связанные с постмитотическими клетками, являются особенно предпочтительными и проиллюстрированы в данном документе, см. пример 36, в котором мишенью системы CRISPR-Cas9, для которой она была эффективной в индукции фенотипического изменения in vivo, являлся АроВ, ген, участвующий в метаболизме липидов. Пример 38 также является наглядным в отношении фенотипических изменений поведения, наблюдаемых in vivo в головном мозге мышей, трансдуцированных системой по настоящему изобретению. Также представлены композиции для применения в генной терапии.

Хотя предусмотрены различные ферменты Cas, Cas9 является особенно предпочтительным, и авторами настоящего изобретения была продемонстрирована особенная эффективность SaCa9 в печени. Tracr-последовательность из Sa также является предпочтительной, если фермент Cas является ферментом SaCas. Подходящим РАМ в данном случае является NNGRR.

Хотя можно применять одну направляющую последовательность, так называемое мультиплексирование с двумя, тремя, четырьмя или более направляющими последовательностями является особенно применимым в исследовании функций генов и создании моделей (с получением нокдауна нескольких генов), а также в генной терапии, когда коррекции подлежат несколько дефектных генотипов (либо несколько ошибок в одном гене, либо, с большей долей вероятности, несколько ошибок, распределенных среди нескольких генов). Альтернативно, мультиплексирование с двумя направляющими последовательностями применимо в подходе с двойной никазой для снижения частоты нецелевых эффектов или попросту для отбора нескольких мишеней в одном гене для обеспечения привлечения Cas. Предпочтительными являются тройные и четверные направляющие последовательности. В данном документе на ген и локус генома ссылаются взаимозаменяемо.

Также применимым в этом отношении является подход с интроном, описанный в данном документе, где направляющая последовательность расположена в интроне Cas.

Предпочтительные средства доставки включают способы, описанные Kanasty ниже, такие как LNP, особенно если доставке подлежит только направляющая последовательность или она подлежит доставке в отдельности. Тем не менее, для печени, как правило, предпочтительными являются вирусные векторы, в том числе лентивирусные и на основе AAV, поскольку до сих пор они были успешными. Среди них предпочтительным является AAV и особенно серотип 8, при этом было показано, что AAV2/8 является эффективным. Некоторые предпочтительные мишени, при условии, что они присутствуют, или состояния почки представляют собой нарушения метаболизма, такие как любое из следующих: амилоидная невропатия (TTR, PALB); амилоидоз (АРОА1, АРР, ААА, CVAP, AD1, GSN, FGA, LYZ, TTR, PALB); цирроз (KRT18, KRT8, CIRH1A, NAIC, TEX292, KIAA1988); муковисцидоз (CFTR, ABCC7, CF, MRP7); болезни накопления гликогена (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM); аденома печени, 142330 (TCF1, HNF1A, MODY3), печеночная недостаточность с ранним началом и с неврологическим нарушением (SCOD1, SCO1), недостаточность печеночной липазы (LIPC), гепатобластома, рак и виды эпителиомы (CTNNB1, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN, CTNNB1, ТР53, Р53, LFS1, IGF2R, MPRI, MET, CASP8, МСН5); заболевание по типу медуллярной кистозной нефропатии (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2); фенилкетонурия (РАН, PKU1, QDPR, DHPR, PTS); поликистоз почек и печени (FCYT, PKHD1, ARPKD, PKD1, PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63). Другие предпочтительные мишени включают какую-либо одну или несколько из PCSK9, HMGCR, АРОВ, LDLR, ANGPTL3, F8, F9/FIX, ААТ, FAH, HPD, TAT, ATP7B, UGT1A1, ОТС, ARH.

Следует иметь в виду, что способы изменения экспрессии в постмитотической клетке не включают изменение в зародышевой линии, которое может быть исключено по моральным соображениям. В действительности, хотя трансфекция стволовых клеток предусмотрена и является безусловно предпочтительной в некоторых вариантах осуществления, нейроны или клетки почки являются особенно предпочтительными, в особенности если они могут проявлять некоторую регенерацию или могут быть стимулированы для ее проявления.

CRISPR типа II являются особенно предпочтительными, в частности, для применения у эукариот, как в данном случае, поскольку, в любом случае, печень обнаруживается только у эукариот, в частности, у позвоночных животных.

Применение систем CRISPR-Cas для того, чтобы вызвать фенотипическое изменение, в частности in vivo, является особенным преимуществом. Авторы настоящего изобретения продемонстрировали это в настоящей заявке.

Если предусмотрены применения в терапии или другая геномная инженерия в постмитотических клетках, то при необходимости коррекции следует иметь в виду, что после внесения однонитевого разрыва в геномную ДНК-мишень или ее расщепления предпочтительной является последующая коррекция посредством пути HDR. Для нокдауна генов преимущественным является NHEJ, однако для терапии предпочтительной является коррекция посредством пути HDR. В таких случаях предпочтительной является доставка матрицы для репарации. Она наиболее предпочтительно представляет собой ssDNA, хотя также возможно использование РНК посредством ретровирусного вектора, обеспечивающего соответствующую ДНК-матрицу. Специалист в данной области может без труда осуществлять настоящее изобретение на практике на основании изложенных в данном документе идей, вносящих вклад в уровень техники; и в этом отношении упоминается, что специалист в данной области на основании изложенных в данном документе идей, вносящих вклад в уровень техники, может без труда понимать и внедрять соображения, касающиеся длины гомологичных плеч. Упомянуты патентные заявки и публикации, в том числе автора Zhang, включенные в данный документ, в том числе цитируемые в данном документе. Матрицу для репарации предпочтительно доставляют совместно с одним или несколькими элементами системы CRISPR-Cas.

Также представлен способ изменения экспрессии по меньшей мере одного продукта гена постмитотической клетки, включающий введение в эукариотическую клетку печени, например, гепатоцит, содержащую и экспрессирующую молекулу ДНК, имеющую целевую последовательность и кодирующую продукт гена, сконструированной не встречающейся в природе системы коротких палиндромных повторов, регулярно расположенных группами (CRISPR), и CRISPR-ассоциированных генов (Cas) (CRISPR-Cas), содержащей один или несколько векторов, содержащих:

а) первый регуляторный элемент, функционирующий в эукариотической клетке, функционально связанный по меньшей мере с одной нуклеотидной последовательностью, кодирующей направляющую РНК системы CRISPR-Cas, которая гибридизируется с целевой последовательностью, и

b) второй регуляторный элемент, функционирующий в эукариотической клетке, функционально связанный с нуклеотидной последовательностью, кодирующей белок Cas9 типа II,

где компоненты (а) и (b) находятся в одном и том же или в разных векторах системы, в результате чего направляющая РНК осуществляет нацеливание на целевую последовательность, а белок Cas9 расщепляет молекулу ДНК, в результате чего экспрессия по меньшей мере одного продукта гена постмитотической клетки изменяется; и где белок Cas9 и направляющая РНК не встречаются вместе в естественных условиях.

Мишени, на которые ссылаются ниже, понимают как постмитотические клетки-мишени или гены, экспрессируемые иным образом в постмитотической клетке, если не очевидно иное.

Любая или все из полинуклеотидной последовательности, кодирующей фермент CRISPR, направляющей последовательности, парной tracr-последовательности или tracr-последовательности могут представлять собой РНК. Полинуклеотиды, кодирующие последовательность, кодирующую фермент CRISPR, направляющую последовательность, парную tracr-последовательность или tracr-последовательность, могут представлять собой РНК, и их могут доставлять посредством липосом, наночастиц, экзосом, микропузырьков или генной пушки.

Следует иметь в виду, что если ссылаются на полинуклеотид, который представляет собой РНК и, как говорят, 'содержит' признак, такой как парная tracr-последовательность, то последовательность РНК содержит данный признак. Если полинуклеотид представляет собой ДНК и, как говорят, содержит признак, такой как парная tracr-последовательность, то последовательность ДНК транскрибируется или может быть транскрибирована в РНК, содержащую признак, о котором идет речь. Если признак представляет собой белок, такой как фермент CRISPR, то упоминаемая последовательность ДНК или РНК транслируется или может быть транслирована (а в случае ДНК сначала транскрибируется).

Соответственно, в определенных вариантах осуществления настоящее изобретение предусматривает способ модификации организма (например, путем модификации постмитотических клеток организма), например, млекопитающего, в том числе человека, или отличного от человека млекопитающего или организма путем манипуляции с целевой последовательностью в представляющем интерес локусе генома, включающий доставку не встречающейся в природе или сконструированной композиции, содержащей вирусную или плазмидную векторную систему, содержащую один или несколько вирусных или плазмидных векторов, функционально кодирующих композицию для ее экспрессии, где композиция содержит: (А) не встречающуюся в природе или сконструированную композицию, содержащую векторную систему, содержащую один или несколько векторов, содержащих I. первый регуляторный элемент, функционально связанный с полинуклеотидной последовательностью химерной РНК (chiRNA) системы CRISPR-Cas, где полинуклеотидная последовательность содержит (а) направляющую последовательность, способную гибридизироваться с целевой последовательностью в эукариотической клетке, (b) парную tracr-последовательность и (с) tracr-последовательность, и II. второй регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей фермент CRISPR, содержащий по меньшей мере одну или несколько последовательностей ядерной локализации (или необязательно по меньшей мере одну или несколько последовательностей ядерной локализации, поскольку некоторые варианты осуществления могут не включать NLS), где (а), (b) и (с) расположены в 5'-3' ориентации, где компоненты I и II находятся в одном и том же или разных векторах системы, где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью, или (В) не встречающуюся в природе или сконструированную композицию, содержащую векторную систему, содержащую один или несколько векторов, содержащих I. первый регуляторный элемент, функционально связанный с (а) направляющей последовательностью, способной гибридизироваться с целевой последовательностью в эукариотической клетке, и (b) по меньшей мере одной или несколькими парными tracr-последовательностями, II. второй регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей фермент CRISPR, и III. третий регуляторный элемент, функционально связанный с tracr-последовательностью, где компоненты I, II и III находятся в одном и том же или разных векторах системы, где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью. В некоторых вариантах осуществления компоненты I, II и III находятся в одном и том же векторе. В других вариантах осуществления компоненты I и II находятся в одном и том же векторе, тогда как компонент III находится в другом векторе. В других вариантах осуществления компоненты I и III находятся в одном и том же векторе, тогда как компонент II находится в другом векторе. В других вариантах осуществления компоненты II и III находятся в одном и том же векторе, тогда как компонент I находится в другом векторе. В других вариантах осуществления каждый из компонентов I, II и III находится в отдельном векторе. Настоящее изобретение также предусматривает вирусную или плазмидную векторную систему, описанную в данном документе.

Вектор предпочтительно представляет собой вирусный вектор, как, например, векторы на основе лентивируса, или бакуловируса, или, предпочтительно, аденовируса/аденоассоциированного вируса, но известны и предусмотрены другие средства доставки (такие как дрожжевые системы, микропузырьки, генные пушки/средства прикрепления векторов к наночастицам золота). В некоторых вариантах осуществления один или несколько вирусных или плазмидных векторов можно доставлять посредством липосом, наночастиц, экзосом, микропузырьков или генной пушки.

Под манипуляцией с целевой последовательностью заявители также подразумевают эпигенетическую манипуляцию с целевой последовательностью. Она может осуществляться в отношении состояния хроматина целевой последовательности, как, например, путем модификации состояния метилирования целевой последовательности (т.е. добавление или устранение метилирования, или паттернов метилирования, или CpG-островков), модификации гистонов, повышения или снижения доступности целевой последовательности, или путем активации укладки в 3D-структуру.

Следует иметь в виду, что если ссылаются на способ модификации организма или млекопитающего, в том числе человека или отличного от человека млекопитающего или организма, путем манипуляции с целевой последовательностью в представляющем интерес локусе генома, тогда его можно использовать в отношении организма (или млекопитающего) в целом или всего лишь одной клетки или популяции клеток из этого организма (если организм является многоклеточным). В случае человека, например, заявители предусматривают, помимо прочего, одну клетку или популяцию клеток, и их можно предпочтительно модифицировать ex vivo и затем вводить обратно. В этом случае может быть необходим биоптат или другой образец ткани или биологической жидкости. Стволовые клетки также являются особенно предпочтительными в этом отношении. Но, разумеется, также предусматриваются варианты осуществления in vivo.

В определенных вариантах осуществления настоящее изобретение предусматривает способ лечения или подавления состояния, вызванного дефектом в целевой последовательности в представляющем интерес локусе генома у субъекта (например, млекопитающего или человека) или отличного от человека субъекта (например, млекопитающего), нуждающегося в этом, включающий модификацию субъекта или отличного от человека субъекта путем манипуляции с целевой последовательностью, и где состояние является чувствительным к лечению или подавлению путем манипуляции с целевой последовательностью, включающий обеспечение лечения, предусматривающего: доставку не встречающейся в природе или сконструированной композиции, содержащей векторную систему на основе AAV или лентивируса, содержащую один или несколько векторов на основе AAV или лентивируса, функционально кодирующих композицию для ее экспрессии, где манипуляцию с целевой последовательностью осуществляют с помощью композиции при ее экспрессии, где композиция содержит: (А) не встречающуюся в природе или сконструированную композицию, содержащую векторную систему, содержащую один или несколько векторов, содержащих I. первый регуляторный элемент, функционально связанный с полинуклеотидной последовательностью химерной РНК (chiRNA) системы CRISPR-Cas, где полинуклеотидная последовательность содержит (а) направляющую последовательность, способную гибридизироваться с целевой последовательностью в эукариотической клетке, (b) парную tracr-последовательность и (с) tracr-последовательность, и II. второй регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей фермент CRISPR, содержащий по меньшей мере одну или несколько последовательностей ядерной локализации (или необязательно по меньшей мере одну или несколько последовательностей ядерной локализации, поскольку некоторые варианты осуществления могут не включать NLS), где (а), (b) и (с) расположены в 5'-3' ориентации, где компоненты I и II находятся в одном и том же или разных векторах системы, где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью, или (В) не встречающуюся в природе или сконструированную композицию, содержащую векторную систему, содержащую один или несколько векторов, содержащих I. первый регуляторный элемент, функционально связанный с (а) направляющей последовательностью, способной гибридизироваться с целевой последовательностью в эукариотической клетке, и (b) по меньшей мере одной или несколькими парными tracr-последовательностями, II. второй регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей фермент CRISPR, и III. третий регуляторный элемент, функционально связанный с tracr-последовательностью, где компоненты I, II и III находятся в одном и том же или разных векторах системы, где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью. В некоторых вариантах осуществления компоненты I, II и III находятся в одном и том же векторе. В других вариантах осуществления компоненты I и II находятся в одном и том же векторе, тогда как компонент III находится в другом векторе. В других вариантах осуществления компоненты I и III находятся в одном и том же векторе, тогда как компонент II находится в другом векторе. В других вариантах осуществления компоненты II и III находятся в одном и том же векторе, тогда как компонент I находится в другом векторе. В других вариантах осуществления каждый из компонентов I, II и III находится в отдельном векторе. Настоящее изобретение также предусматривает вирусную (например, на основе AAV или лентивируса) векторную систему, описанную в данном документе, и она может быть частью векторной системы, описанной в данном документе.

Некоторые способы по настоящему изобретению могут включать индукцию экспрессии. В некоторых способах по настоящему изобретению организм или субъект является эукариотом (в том числе млекопитающим, в том числе человеком), или отличным от человека эукариотом, или отличным от человека животным, или отличным от человека млекопитающим. В некоторых вариантах осуществления организм или субъект является отличным от человека животным и может быть членистоногим, например, насекомым, или может быть нематодой. В некоторых способах по настоящему изобретению организм или субъект является растением. В некоторых способах по настоящему изобретению организм или субъект является млекопитающим или отличным от человека млекопитающим. Отличное от человека млекопитающее может быть, например, грызуном (предпочтительно мышью или крысой), копытным или приматом. В некоторых способах по настоящему изобретению организм или субъект является водорослью, в том числе микроводорослью, или является грибом. В некоторых способах по настоящему изобретению вирусный вектор представляет собой AAV или лентивирус и может быть частью векторной системы, описанной в данном документе. В некоторых способах по настоящему изобретению фермент CRISPR представляет собой Cas9. В некоторых способах по настоящему изобретению экспрессия направляющей последовательности находится под контролем промотора Т7 и управляется экспрессией полимеразы Т7.

Настоящее изобретение в некоторых вариантах осуществления охватывает способ доставки фермента CRISPR, включающий доставку в клетку мРНК, кодирующей фермент CRISPR. В некоторых из данных способов фермент CRISPR представляет собой Cas9.

Настоящее изобретение также предусматривает способы получения векторных систем по настоящему изобретению, в частности, вирусных векторных систем, описанных в данном документе. Настоящее изобретение в некоторых вариантах осуществления охватывает способ получения AAV по настоящему изобретению, включающий трансфекцию плазмиды(плазмид), содержащей молекулу(молекулы) нуклеиновой кислоты, кодирующую AAV, или по сути состоящей из нее, в клетки, инфицированные AAV, и обеспечение rep и/или cap AAV, обязательных для репликации и упаковки AAV. В некоторых вариантах осуществления rep и/или cap AAV, обязательные для репликации и упаковки AAV, обеспечивают путем трансфекции клеток плазмидой-помощником(плазмидами-помощниками) или вирусом-помощником(вирусами-помощниками). В некоторых вариантах осуществления вирусом-помощником является поксвирус, аденовирус, герпесвирус или бакуловирус. В некоторых вариантах осуществления поксвирус представляет собой вирус осповакцины. В некоторых вариантах осуществления клетки являются клетками млекопитающих. А в некоторых вариантах осуществления клетки являются клетками насекомых, а вирус-помощник представляет собой бакуловирус. В других вариантах осуществления вирус представляет собой лентивирус.

У растений патогены часто являются специфичными по отношению к хозяину. Например, Fusarium oxysporum f. sp. lycopersici вызывает фузариозный вилт томата, но поражает только томат, а F. oxysporum f. dianthii и Puccinia graminis f. sp. tritici поражают только пшеницу. Растения обладают присущими и индуцированными защитными реакциями, обеспечивающими устойчивость к большинству патогенов. Мутации и события рекомбинации в поколениях растений приводят к генетической изменчивости, которая обуславливает восприимчивость, тем более, что патогены размножаются с большей частотой, чем растения. У растений может наблюдаться устойчивость видов, не относящихся к хозяевам, например, хозяин и патоген являются несовместимыми. Также может наблюдаться горизонтальная устойчивость, например, частичная устойчивость ко всем расам патогена, обычно контролируемая многими генами, и вертикальная устойчивость, например, полная устойчивость к некоторым расам патогена, но не к другим расам, обычно контролируемая несколькими генами. На уровне взаимодействия генов растения и патогены эволюционируют совместно, а генетические изменения одного уравновешивают изменения другого. Соответственно, используя естественную изменчивость, селекционеры комбинируют гены, наиболее полезные для урожайности, качества, однородности, выносливости, устойчивости. Источники генов устойчивости включают нативные или чужеродные сорта, старинные сорта, родственные дикорастущие растения и индуцированные мутации, например, при обработке растительного материала мутагенными средствами. Применяя настоящее изобретение, селекционеры растений получают новый инструмент для индукции мутаций. Соответственно, специалист в данной области может проанализировать геном источников генов устойчивости, а в отношении сортов, имеющих желаемые характеристики или признаки, использовать настоящее изобретение для индукции появления генов устойчивости с большей точностью, чем в случае применявшихся ранее мутагенных средств, и, следовательно, для ускорения и улучшения программ селекции растений.

Настоящее изобретение дополнительно охватывает композицию по настоящему изобретению или ее фермент CRISPR (в том числе, или альтернативно, мРНК, кодирующую фермент CRISPR) для применения в медицине или в терапии. В некоторых вариантах осуществления настоящее изобретение охватывает композицию согласно настоящему изобретению или ее фермент CRISPR (в том числе, или альтернативно, мРНК, кодирующую фермент CRISPR) для применения в способе согласно настоящему изобретению. В некоторых вариантах осуществления настоящее изобретение предусматривает применение композиции по настоящему изобретению или ее фермента CRISPR (в том числе, или альтернативно, мРНК, кодирующей фермент CRISPR) в редактировании генов или генома ex vivo. В определенных вариантах осуществления настоящее изобретение охватывает применение композиции по настоящему изобретению или ее фермента CRISPR (в том числе, или альтернативно, мРНК, кодирующей фермент CRISPR) в производстве лекарственного препарата для редактирования генов или генома ех vivo или для применения в способе согласно настоящему изобретению. Настоящее изобретение в некоторых вариантах осуществления охватывает композицию по настоящему изобретению или ее фермент CRISPR (в том числе, или в альтернативном случае, мРНК, кодирующую фермент CRISPR), где целевая последовательность фланкирована на своем 3'-конце РАМ-последовательностью (мотивом, прилегающим к протоспейсеру), содержащей 5'-концевой мотив, особенно если Cas9 получен из (или происходит из) Cas9 S. pyogenes или S. aureus. Например, подходящий РАМ представляет собой 5'-NRG или 5'-NNGRR (где N представляет собой любой нуклеотид) для ферментов SpCas9 или SaCas9 (или происходящих из них ферментов), соответственно, как отмечено ниже.

Следует иметь в виду, что SpCas9 или SaCas9 получены или происходят из Cas9 S. pyogenes или S. aureus. Они, разумеется, могут быть подвергнуты мутации или иным образом изменены по сравнению с диким типом для соответствия предполагаемому применению, описанному в данном документе. Предпочтительными являются мутантная форма или вариант двойной никазы D10A, особенно в комбинации с двумя перекрывающимися направляющими последовательностями, ориентированными как противоположные сайты в разных нитях одной и той же хромосомы.

Аспекты настоящего изобретения охватывают улучшение специфичности опосредованного ферментом CRISPR, например, Cas9, целенаправленного воздействия на гены и снижение вероятности нецелевой модификации ферментом CRISPR, например, Cas9. Настоящее изобретение в некоторых вариантах осуществления охватывает способ модификации организма или отличного от человеческого организма посредством сведения к минимуму нецелевых модификаций путем манипуляции с первой и второй целевыми последовательностями на противоположных нитях ДНК-дуплекса в представляющем интерес локусе генома в клетке, включающий доставку не встречающейся в природе или сконструированной композиции, которая может содержать:

I. первую полинуклеотидную последовательность химерной РНК (chiRNA) системы CRISPR-Cas, где первая полинуклеотидная последовательность содержит:

(a) первую направляющую последовательность, способную гибридизироваться с первой целевой последовательностью,

(b) первую парную tracr-последовательность и

(c) первую tracr-последовательность,

II. вторую полинуклеотидную последовательность chiRNA системы CRISPR-Cas, где вторая полинуклеотидная последовательность может содержать:

(a) вторую направляющую последовательность, способную гибридизироваться со второй целевой последовательностью,

(b) вторую парную tracr-последовательность и

(с) вторую tracr-последовательность, и

III. полинуклеотидную последовательность, кодирующую фермент CRISPR, который может содержать по меньшей мере одну или несколько последовательностей ядерной локализации и содержит одну или несколько мутаций, где (а), (b) и (с) расположены в 5'-3' ориентации, где при транскрипции первая и вторая парные tracr-последовательности гибридизируются с первой и второй tracr-последовательностями, соответственно, а первая и вторая направляющие последовательности управляют специфичным к последовательности связыванием первого и второго комплексов CRISPR с первой и второй целевыми последовательностями, соответственно, где первый комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) первой направляющей последовательностью, которая гибридизируется с первой целевой последовательностью, и (2) первой парной tracr-последовательностью, которая гибридизируется с первой tracr-последовательностью, где второй комплекс CRISPR содержит фермент CRISPR, образующий комплекс со (1) второй направляющей последовательностью, которая гибридизируется со второй целевой последовательностью, и (2) второй парной tracr-последовательностью, которая гибридизируется со второй tracr-последовательностью, где полинуклеотидная последовательность, кодирующая фермент CRISPR, представляет собой ДНК или РНК, и где первая направляющая последовательность управляет расщеплением одной нити ДНК-дуплекса возле первой целевой последовательности, а вторая направляющая последовательность управляет расщеплением другой нити возле второй целевой последовательности, индуцируя двухнитевой разрыв, с модификацией таким образом организма или отличного от человеческого организма посредством сведения к минимуму нецелевых модификаций.

В некоторых способах по настоящему изобретению любая или все из полинуклеотидной последовательности, кодирующей фермент CRISPR, первой и второй направляющих последовательностей, первой и второй парных tracr-последовательностей или первой и второй tracr-последовательностей представляет собой/представляют собой РНК. В дополнительных вариантах осуществления настоящего изобретения полинуклеотиды, кодирующие последовательность, кодирующую фермент CRISPR, первую и вторую направляющие последовательности, первую и вторую парные tracr-последовательности или первую и вторую tracr-последовательности, представляют собой РНК, и их доставляют посредством липосом, наночастиц, экзосом, микропузырьков или генной пушки. В определенных вариантах осуществления настоящего изобретения первая и вторая парные tracr-последовательности обладают 100% идентичностью, и/или первая и вторая tracr-последовательности обладают 100% идентичностью. В некоторых вариантах осуществления полинуклеотиды могут содержаться в векторной системе, содержащей один или несколько векторов. В предпочтительных вариантах осуществления настоящего изобретения фермент CRISPR представляет собой фермент Cas9, например, SpCas9. В аспекте настоящего изобретения фермент CRISPR содержит одну или несколько мутаций в каталитическом домене, где одна или несколько мутаций выбраны из группы, состоящей из D10A, Е762А, Н840А, N854A, N863A и D986A. В особенно предпочтительном варианте осуществления фермент CRISPR имеет мутацию D10A. В предпочтительных вариантах осуществления первый фермент CRISPR имеет одну или несколько мутаций, вследствие которых фермент является ферментом, вносящим однонитевой разрыв в комплементарную нить, а второй фермент CRISPR имеет одну или несколько мутаций, вследствие которых фермент является ферментом, вносящим однонитевой разрыв в некомплементарную нить. Альтернативно, первый фермент может являться ферментом, вносящим однонитевой разрыв в некомплементарную нить, а второй фермент может являться ферментом, вносящим однонитевой разрыв в комплементарную нить.

В предпочтительных способах по настоящему изобретению первая направляющая последовательность, управляющая расщеплением одной нити ДНК-дуплекса возле первой целевой последовательности, и вторая направляющая последовательность, управляющая расщеплением другой нити возле второй целевой последовательности, обуславливают возникновение ''липкого'' 5'-конца. В вариантах осуществления настоящего изобретения ''липкий'' 5'-конец содержит не более 200 пар оснований, предпочтительно не более 100 пар оснований или более предпочтительно не более 50 пар оснований. В вариантах осуществления настоящего изобретения ''липкий'' 5'-конец содержит по меньшей мере 26 пар оснований, предпочтительно по меньшей мере 30 пар оснований или более предпочтительно 34-50 пар оснований. Перекрывание наиболее предпочтительно охватывает от 5 до -1 пары оснований.

Настоящее изобретение в некоторых вариантах осуществления охватывает способ модификации организма или отличного от человеческого организма посредством сведения к минимуму нецелевых модификаций путем манипуляции с первой и второй целевыми последовательностями на противоположных нитях ДНК-дуплекса в представляющем интерес локусе генома в клетке, включающий доставку не встречающейся в природе или сконструированной композиции, содержащей векторную систему, содержащую один или несколько векторов, содержащих:

I. первый регуляторный элемент, функционально связанный с

(а) первой направляющей последовательностью, способной гибридизироваться с первой целевой последовательностью, и

(b) no меньшей мере одной или несколькими парными tracr-последовательностями,

II. второй регуляторный элемент, функционально связанный со

(a) второй направляющей последовательностью, способной гибридизироваться со второй целевой последовательностью, и

(b) по меньшей мере одной или несколькими парными tracr-последовательностями,

III. третий регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей фермент CRISPR, и

IV. четвертый регуляторный элемент, функционально связанный с tracr-последовательностью,

где компоненты I, II, III и IV находятся в одном и том же или в разных векторах системы, где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а первая и вторая направляющие последовательности управляют специфичным к последовательности связыванием первого и второго комплексов CRISPR с первой и второй целевыми последовательностями, соответственно, где первый комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) первой направляющей последовательностью, которая гибридизируется с первой целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью, где второй комплекс CRISPR содержит фермент CRISPR, образующий комплекс со (1) второй направляющей последовательностью, которая гибридизируется со второй целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью, где полинуклеотидная последовательность, кодирующая фермент CRISPR, представляет собой ДНК или РНК, и где первая направляющая последовательность управляет расщеплением одной нити ДНК-дуплекса возле первой целевой последовательности, а вторая направляющая последовательность управляет расщеплением другой нити возле второй целевой последовательности, индуцируя двухнитевой разрыв, с модификацией таким образом организма или отличного от человеческого организма посредством сведения к минимуму нецелевых модификаций.

Настоящее изобретение также предусматривает векторную систему, описанную в данном документе. Система может содержать один, два, три или четыре различных вектора. Компоненты I, II, III и IV могут, таким образом, находиться в одном, двух, трех или четырех различных векторах, и в данном документе предусмотрены все комбинации возможных местоположений компонентов, например: компоненты I, II, III и IV могут находиться в одном и том же векторе; каждый из компонентов I, II, III и IV может находиться в отдельном векторе; компоненты I, II, III и IV могут находиться в общей сложности в двух или трех различных векторах, при этом предусмотрены все комбинации местоположений, и т.п.

В некоторых способах по настоящему изобретению любая или все из полинуклеотидной последовательности, кодирующей фермент CRISPR, первой и второй направляющих последовательностей, первой и второй парных tracr-последовательностей или первой и второй tracr-последовательностей представляет собой/представляют собой РНК. В дополнительных вариантах осуществления настоящего изобретения первая и вторая парные tracr-последовательности обладают 100% идентичностью, и/или первая и вторая tracr-последовательности обладают 100% идентичностью. В предпочтительных вариантах осуществления настоящего изобретения фермент CRISPR представляет собой фермент Cas9, например, SpCas9. В аспекте настоящего изобретения фермент CRISPR содержит одну или несколько мутаций в каталитическом домене, где одна или несколько мутаций выбраны из группы, состоящей из D10A, Е762А, Н840А, N854A, N863A и D986A. В особенно предпочтительном варианте осуществления фермент CRISPR имеет мутацию D10A. В предпочтительных вариантах осуществления первый фермент CRISPR имеет одну или несколько мутаций, вследствие которых фермент является ферментом, вносящим однонитевой разрыв в комплементарную нить, а второй фермент CRISPR имеет одну или несколько мутаций, вследствие которых фермент является ферментом, вносящим однонитевой разрыв в некомплементарную нить. Альтернативно, первый фермент может являться ферментом, вносящим однонитевой разрыв в некомплементарную нить, а второй фермент может являться ферментом, вносящим однонитевой разрыв в комплементарную нить. В дополнительном варианте осуществления настоящего изобретения один или несколько вирусных векторов доставляют посредством липосом, наночастиц, экзосом, микропузырьков или генной пушки.

В предпочтительных способах по настоящему изобретению первая направляющая последовательность, управляющая расщеплением одной нити ДНК-дуплекса возле первой целевой последовательности, и вторая направляющая последовательность, управляющая расщеплением другой нити возле второй целевой последовательности, обуславливают возникновение ''липкого'' 5'-конца. В вариантах осуществления настоящего изобретения ''липкий'' 5'-конец содержит не более 200 пар оснований, предпочтительно не более 100 пар оснований или более предпочтительно не более 50 пар оснований. В вариантах осуществления настоящего изобретения ''липкий'' 5'-конец содержит по меньшей мере 26 пар оснований, предпочтительно по меньшей мере 30 пар оснований или более предпочтительно 34-50 пар оснований.

Настоящее изобретение в некоторых вариантах осуществления охватывает способ модификации представляющего интерес локуса генома посредством сведения к минимуму нецелевых модификаций путем введения в клетку, содержащую и экспрессирующую двухнитевую молекулу ДНК, кодирующую представляющий интерес продукт гена, сконструированной не встречающейся в природе системы CRISPR-Cas, содержащей белок Cas, имеющий одну или несколько мутаций, и две направляющие РНК, которые осуществляют нацеливание на первую нить и вторую нить молекулы ДНК, соответственно, при этом направляющие РНК осуществляют нацеливание на молекулу ДНК, кодирующую продукт гена, а белок Cas вносит однонитевой разрыв в каждую из первой нити и второй нити молекулы ДНК, кодирующей продукт гена, в результате чего экспрессия продукта гена изменяется; и где белок Cas и две направляющие РНК не встречаются вместе в естественных условиях.

В предпочтительных способах по настоящему изобретению белок Cas вносит однонитевой разрыв в каждую из первой нити и второй нити молекулы ДНК, кодирующей продукт гена, что обуславливает возникновение ''липкого'' 5'-конца. В вариантах осуществления настоящего изобретения ''липкий'' 5'-конец содержит не более 200 пар оснований, предпочтительно не более 100 пар оснований или более предпочтительно не более 50 пар оснований. В вариантах осуществления настоящего изобретения ''липкий'' 5'-конец содержит по меньшей мере 26 пар оснований, предпочтительно по меньшей мере 30 пар оснований или более предпочтительно 34-50 пар оснований.

Варианты осуществления настоящего изобретения также охватывают направляющие РНК, содержащие направляющую последовательность, слитую с парной tracr-последовательностью и tracr-последовательностью. В аспекте настоящего изобретения белок Cas является кодон-оптимизированным для экспрессии в эукариотической клетке, предпочтительно в клетке млекопитающего или клетке человека. В дополнительных вариантах осуществления настоящего изобретения белок Cas представляет собой белок системы CRISPR-Cas типа II, например, белок Cas9. В особенно предпочтительном варианте осуществления белок Cas представляет собой белок Cas9, например, SpCas9. В аспектах настоящего изобретения белок Cas имеет одну или несколько мутаций, выбранных из группы, состоящей из D10A, Е762А, Н840А, N854A, N863A и D986A. В особенно предпочтительном варианте осуществления белок Cas имеет мутацию D10A.

Аспекты настоящего изобретения относятся к снижению экспрессии продукта гена, или к дополнительному введению матричного полинуклеотида в молекулу ДНК, кодирующую продукт гена, или к точному вырезанию вставочной последовательности путем обеспечения повторного отжига и лигирования двух ''липких'' 5'-концов, или к изменению активности или функционирования продукта гена, или к повышению экспрессии продукта гена. В варианте осуществления настоящего изобретения продукт гена представляет собой белок.

Настоящее изобретение также охватывает сконструированную не встречающуюся в природе систему CRISPR-Cas, содержащую белок Cas с одной или несколькими мутациями, и две направляющие РНК, которые осуществляют нацеливание на первую нить и вторую нить, соответственно, двухнитевой молекулы ДНК, кодирующей продукт гена в клетке, при этом направляющие РНК осуществляют нацеливание на молекулу ДНК, кодирующую продукт гена, а белок Cas вносит однонитевой разрыв в каждую из первой нити и второй нити молекулы ДНК, кодирующей продукт гена, в результате чего экспрессия продукта гена изменяется; и где белок Cas и две направляющие РНК не встречаются вместе в естественных условиях.

В аспектах настоящего изобретения направляющие РНК могут содержать направляющую последовательность, слитую с парной tracr-последовательностью и tracr-последовательностью. В варианте осуществления настоящего изобретения белок Cas представляет собой белок системы CRISPR-Cas типа II. В аспекте настоящего изобретения белок Cas является кодон-оптимизированным для экспрессии в эукариотической клетке, предпочтительно в клетке млекопитающего или клетке человека. В дополнительных вариантах осуществления настоящего изобретения белок Cas представляет собой белок системы CRISPR-Cas типа II, например, белок Cas9. В особенно предпочтительном варианте осуществления белок Cas представляет собой белок Cas9, например, SpCas9. В аспектах настоящего изобретения белок Cas имеет одну или несколько мутаций, выбранных из группы, состоящей из D10A, Е762А, Н840А, N854A, N863A и D986A. В особенно предпочтительном варианте осуществления белок Cas имеет мутацию D10A.

Аспекты настоящего изобретения относятся к снижению экспрессии продукта гена, или к дополнительному введению матричного полинуклеотида в молекулу ДНК, кодирующую продукт гена, или к точному вырезанию вставочной последовательности путем обеспечения повторного отжига и лигирования двух ''липких'' 5'-концов, или к изменению активности или функционирования продукта гена, или к повышению экспрессии продукта гена. В варианте осуществления настоящего изобретения продукт гена представляет собой белок.

Настоящее изобретение также охватывает сконструированную не встречающуюся в природе векторную систему, содержащую один или несколько векторов, содержащих:

а) первый регуляторный элемент, функционально связанный с каждой из двух направляющих РНК системы CRISPR-Cas, которые осуществляют нацеливание на первую нить и вторую нить, соответственно, двухнитевой молекулы ДНК, кодирующей продукт гена,

b) второй регуляторный элемент, функционально связанный с белком Cas,

где компоненты (а) и (b) находятся в одном и том же или разных векторах системы, при этом направляющие РНК осуществляют нацеливание на молекулу ДНК, кодирующую продукт гена, а белок Cas вносит однонитевой разрыв в каждую из первой нити и второй нити молекулы ДНК, кодирующей продукт гена, в результате чего экспрессия продукта гена изменяется; и где белок Cas и две направляющие РНК не встречаются вместе в естественных условиях.

В аспектах настоящего изобретения направляющие РНК могут содержать направляющую последовательность, слитую с парной tracr-последовательностью и tracr-последовательностью. В варианте осуществления настоящего изобретения белок Cas представляет собой белок системы CRISPR-Cas типа II. В аспекте настоящего изобретения белок Cas является кодон-оптимизированным для экспрессии в эукариотической клетке, предпочтительно в клетке млекопитающего или клетке человека. В дополнительных вариантах осуществления настоящего изобретения белок Cas представляет собой белок системы CRISPR-Cas типа II, например, белок Cas9. В особенно предпочтительном варианте осуществления белок Cas представляет собой белок Cas9, например, SpCas9. В аспектах настоящего изобретения белок Cas имеет одну или несколько мутаций, выбранных из группы, состоящей из D10A, Е762А, Н840А, N854A, N863A и D986A. В особенно предпочтительном варианте осуществления белок Cas имеет мутацию D10A.

Аспекты настоящего изобретения относятся к снижению экспрессии продукта гена, или к дополнительному введению матричного полинуклеотида в молекулу ДНК, кодирующую продукт гена, или к точному вырезанию вставочной последовательности путем обеспечения повторного отжига и лигирования двух ''липких'' 5'-концов, или к изменению активности или функционирования продукта гена, или к повышению экспрессии продукта гена. В варианте осуществления настоящего изобретения продукт гена представляет собой белок. В предпочтительных вариантах осуществления настоящего изобретения векторы системы являются вирусными векторами. В дополнительном варианте осуществления векторы системы доставляют посредством липосом, наночастиц, экзосом, микропузырьков или генной пушки.

В одном аспекте настоящее изобретение предусматривает способ модификации целевого полинуклеотида в эукариотической клетке. В некоторых вариантах осуществления способ включает обеспечение связывания комплекса CRISPR с целевым полинуклеотидом для осуществления расщепления указанного целевого полинуклеотида с модификацией таким образом целевого полинуклеотида, где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с направляющей последовательностью, гибридизирующейся с целевой последовательностью в указанном целевом полинуклеотиде, где указанная направляющая последовательность связана с парной tracr-последовательностью, которая, в свою очередь, гибридизируется с tracr-последовательностью. В некоторых вариантах осуществления указанное расщепление включает расщепление одной или двух нитей в определенной точке целевой последовательности указанным ферментом CRISPR. В некоторых вариантах осуществления указанное расщепление приводит к сниженной транскрипции целевого гена. В некоторых вариантах осуществления способ дополнительно включает репарацию указанного расщепленного целевого полинуклеотида при помощи гомологичной рекомбинации с экзогенным матричным полинуклеотидом, где указанная репарация приводит к мутации, включающей вставку, делецию или замену одного или нескольких нуклеотидов указанного целевого полинуклеотида. В некоторых вариантах осуществления указанная мутация приводит к одной или нескольким аминокислотным заменам в белке, экспрессируемом с гена, содержащего целевую последовательность. В некоторых вариантах осуществления способ дополнительно включает доставку одного или нескольких векторов в указанную эукариотическую клетку, где один или несколько векторов управляют экспрессией одного или нескольких из: фермента CRISPR, направляющей последовательности, связанной с парной tracr-последовательностью, и tracr-последовательности. В некоторых вариантах осуществления указанные векторы доставляют в эукариотическую клетку, находящуюся в субъекте. В некоторых вариантах осуществления указанная модификация имеет место в указанной эукариотической клетке, находящейся в клеточной культуре. В некоторых вариантах осуществления способ дополнительно включает выделение указанной эукариотической клетки из субъекта перед указанной модификацией. В некоторых вариантах осуществления способ дополнительно включает возвращение указанной эукариотической клетки и/или клеток, полученных из субъекта, указанному субъекту.

В одном аспекте настоящее изобретение предусматривает способ модификации экспрессии полинуклеотида в эукариотической клетке. В некоторых вариантах осуществления способ включает обеспечение связывания комплекса CRISPR с полинуклеотидом, вследствие чего указанное связывание приводит к повышенной или пониженной экспрессии указанного полинуклеотида; где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с направляющей последовательностью, гибридизирующейся с целевой последовательностью в указанном целевом полинуклеотиде, где указанная направляющая последовательность связана с парной tracr-последовательностью, которая, в свою очередь, гибридизируется с tracr-последовательностью. В некоторых вариантах осуществления способ дополнительно включает доставку одного или нескольких векторов в указанные эукариотические клетки, где один или несколько векторов управляют экспрессией одного или нескольких из: фермента CRISPR, направляющей последовательности, связанной с парной tracr-последовательностью, и tracr-последовательности.

В одном аспекте настоящее изобретение предусматривает способ получения модельной эукариотической клетки, содержащей подвергнутый мутации ген, ответственный за развитие заболевания. В некоторых вариантах осуществления ген, ответственный за развитие заболевания, является любым геном, ассоциированным с повышением риска наличия или развития заболевания. В некоторых вариантах осуществления способ включает (а) введение одного или нескольких векторов в эукариотическую клетку, где один или несколько векторов управляют экспрессией одного или нескольких из: фермента CRISPR, направляющей последовательности, связанной с парной tracr-последовательностью, и tracr-последовательности; и (b) обеспечение связывания комплекса CRISPR с целевым полинуклеотидом для осуществления расщепления целевого полинуклеотида в указанном гене, ответственном за развитие заболевания, где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью в целевом полинуклеотиде, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью, таким образом, получая модельную эукариотическую клетку, содержащую подвергнутый мутации ген, ответственный за развитие заболевания. В некоторых вариантах осуществления указанное расщепление включает расщепление одной или двух нитей в определенной точке целевой последовательности указанным ферментом CRISPR. В некоторых вариантах осуществления указанное расщепление приводит к сниженной транскрипции целевого гена. В некоторых вариантах осуществления способ дополнительно включает репарацию указанного расщепленного целевого полинуклеотида при помощи гомологичной рекомбинации с экзогенным матричным полинуклеотидом, где указанная репарация приводит к мутации, включающей вставку, делецию или замену одного или нескольких нуклеотидов указанного целевого полинуклеотида. В некоторых вариантах осуществления указанная мутация приводит к одной или нескольким аминокислотным заменам при экспрессии белка с гена, содержащего целевую последовательность.

В одном аспекте настоящее изобретение предусматривает способ отбора одной или нескольких прокариотических клеток путем введения одной или нескольких мутаций в ген в одной или нескольких прокариотических клетках, при этом способ включает введение одного или нескольких векторов в прокариотическую(прокариотические) клетку(клетки), где один или несколько векторов управляют экспрессией одного или нескольких из: фермента CRISPR, направляющей последовательности, связанной с парной tracr-последовательностью, tracr-последовательности и матрицы редактирования; где матрица редактирования содержит одну или несколько мутаций, которые прекращают расщепление ферментом CRISPR; обеспечение гомологичной рекомбинации матрицы редактирования с целевым полинуклеотидом в отбираемой(отбираемых) клетке(клетках); обеспечение связывания комплекса CRISPR с целевым полинуклеотидом для осуществления расщепления целевого полинуклеотида в указанном гене, где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью в целевом полинуклеотиде, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью, где связывание комплекса CRISPR с целевым полинуклеотидом индуцирует гибель клеток, с обеспечением, таким образом, отбора одной или нескольких прокариотических клеток, в которые были введены одна или несколько мутаций. В предпочтительном варианте осуществления фермент CRISPR представляет собой Cas9. В другом аспекте настоящего изобретения отбираемая клетка может представлять собой эукариотическую клетку, такую как постмитотиеская эукариотическая клетка. Аспекты настоящего изобретения обеспечивают возможность отбора конкретных клеток без необходимости наличия маркера отбора или двухстадийного способа, который может включать систему негативного отбора.

В одном аспекте настоящее изобретение предусматривает способы модификации целевого полинуклеотида в эукариотической клетке. В некоторых вариантах осуществления способ включает обеспечение связывания комплекса CRISPR с целевьм полинуклеотидом для осуществления расщепления указанного целевого полинуклеотида с модификацией таким образом целевого полинуклеотида, где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с направляющей последовательностью, гибридизирующейся с целевой последовательностью в указанном целевом полинуклеотиде, где указанная направляющая последовательность связана с парной tracr-последовательностью, которая, в свою очередь, гибридизируется с tracr-последовательностью.

В других вариантах осуществления настоящее изобретение предусматривает способ модификации экспрессии полинуклеотида в эукариотической клетке. Способ включает повышение или снижение экспрессии целевого полинуклеотида при помощи комплекса CRISPR, который связывается с полинуклеотидом.

При желании для осуществления модификации экспрессии в клетке один или несколько векторов, содержащих tracr-последовательность, направляющую последовательность, связанную с парной tracr-последовательностью, последовательность, кодирующую фермент CRISPR, доставляют в клетку. В некоторых способах один или несколько векторов содержат регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей указанный фермент CRISPR, содержащий последовательность ядерной локализации; и регуляторный элемент, функционально связанный с парной tracr-последовательностью и одним или несколькими сайтами встраивания для встраивания направляющей последовательности выше парной tracr-последовательности. При экспрессии направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью в клетке. Как правило, комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью.

В некоторых способах целевой полинуклеотид можно инактивировать для осуществления модификации экспрессии в клетке. Например, при связывании комплекса CRISPR с целевой последовательностью в клетке целевой полинуклеотид инактивируется, вследствие чего последовательность не транскрибируется, кодируемый белок не продуцируется, или последовательность не функционирует так, как последовательность дикого типа. Например, последовательность, кодирующую белок или микроРНК, можно инактивировать, вследствие чего белок не будет продуцироваться.

В определенных вариантах осуществления фермент CRISPR содержит одну или-несколько мутаций, выбранных из группы, состоящей из D10A, Е762А, Н840А, N854A, N863A или D986A, и/или одна или несколько мутаций находятся в домене RuvC1 или HNH фермента CRISPR или представляют собой другую мутацию, обсуждаемую в данном документе. В некоторых вариантах осуществления фермент CRISPR имеет одну или несколько мутаций в каталитическом домене, где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и где фермент дополнительно содержит функциональный домен. В некоторых вариантах осуществления функциональный домен представляет собой домен активации транскрипции, предпочтительно VP64. В некоторых вариантах осуществления функциональный домен представляет собой домен репрессии транскрипции, предпочтительно KRAB. В некоторых вариантах осуществления домен репрессии транскрипции представляет собой SID или конкатемеры SID (например, SID4X). В некоторых вариантах осуществления функциональный домен представляет собой домен, участвующий в эпигенетической модификации, вследствие чего обеспечивается фермент, участвующий в эпигенетической модификации. В некоторых вариантах осуществления функциональный домен представляет собой активаторный домен, который может представлять собой активаторный домен Р65.

В некоторых вариантах осуществления фермент CRISPR представляет собой фермент CRISPR типа I или III, но предпочтительно представляет собой фермент CRISPR типа II. Этот фермент CRISPR типа II может быть любым ферментом Cas. Фермент Cas может быть идентифицирован как Cas9, поскольку он может относиться к общему классу ферментов, обладающих гомологией с самой большой нуклеазой с несколькими нуклеазными доменами системы CRISPR типа II. В наиболее предпочтительном случае фермент Cas9 получен или происходит из spCas9 или saCas9. Под происходящим заявители подразумевают, что в основе происходящего фермента главным образом лежит фермент дикого типа в том смысле, что он характеризуется высокой степенью гомологии последовательности с этим ферментом, но он был некоторым образом подвергнут мутации (модифицирован), как описано в данном документе.

Следует иметь в виду, что выражения Cas и фермент CRISPR обычно используются в данном документе взаимозаменяемо, если не очевидно иное. Как упоминается выше, большинство нумераций остатков, используемых в данном документе, относятся к ферменту Cas9 из локуса CRISPR типа II Streptococcus pyogenes. Однако, следует иметь в виду, что настоящее изобретение включает многие другие Cas9 из других видов микроорганизмов, такие как SpCas9, SaCa9, St1Cas9 и т.д.

Пример кодон-оптимизированной последовательности, в данном случае оптимизированной для человека (т.е. оптимизированной для экспрессии у человека), представлен в данном документе, см. кодон-оптимизированную последовательность SaCas9 для человека. Хотя это является предпочтительным, следует иметь в виду, что возможны другие примеры, и что для вида-хозяина известна оптимизация кодонов.

Доставку предпочтительно осуществляют в форме вектора, который может представлять собой вирусный вектор, как, например, векторы на основе лентивируса, или бакуловируса, или, предпочтительно, аденовируса/аденоассоциированного вируса, но известны и предусмотрены другие средства доставки (такие как дрожжевые системы, микропузырьки, генные пушки/средства прикрепления векторов к наночастицам золота). Вектор может означать не только вирусную или дрожжевую систему (например, где представляющие интерес нуклеиновые кислоты могут быть функционально связаны с промотором и находиться под его контролем (с точки зрения экспрессии, вследствие которой в конечном счете образуется процессированная РНК)), но также и прямую доставку нуклеиновых кислот в клетку-хозяина. Хотя в способах в данном документе вектор может быть вирусным вектором, и он преимущественно представляет собой AAV, можно использовать другие вирусные векторы, обсуждаемые в данном документе, такие как лентивирусы. Например, бакуловирусы можно использовать для экспрессии в клетках насекомых. Эти клетки насекомых могут, в свою очередь, быть применимыми для получения больших количеств дополнительных векторов, таких как векторы на основе AAV или лентивируса, приспособленных для доставки по настоящему изобретению. Также предусматривается способ доставки фермента CRISPR по настоящему изобретению, включающий доставку в клетку мРНК, кодирующей фермент CRISPR. Следует иметь в виду, что в определенных вариантах осуществления фермент CRISPR является усеченным, и/или содержит менее одной тысячи аминокислот или менее четырех тысяч аминокислот, и/или представляет собой нуклеазу или никазу, и/или является кодон-оптимизированным, и/или содержит одну или несколько мутаций, и/или включает химерный фермент CRISPR, и/или предусматривает другие варианты, обсуждаемые в данном документе. Предпочтительными являются векторы на основе AAV и лентивируса.

В определенных вариантах осуществления целевая последовательность на своем 3'-конце фланкирована или расположена перед РАМ, подходящим для фермента CRISPR, обычно Cas и, в частности, Cas9.

Например, подходящий РАМ представляет собой 5'-NRG или 5'-NNGRR для ферментов SpCas9 или SaCas9 (или происходящих из них ферментов), соответственно.

Следует иметь в виду, что SpCas9 или SaCas9 получены или происходят из Cas9 S. pyogenes или S. aureus.

Соответственно, целью настоящего изобретения не является охват в пределах настоящего изобретения любого ранее известного продукта, способа получения продукта или способа применения продукта, так что заявители оставляют за собой право и настоящим раскрывают отказ от прав на любой ранее известный продукт, процесс или способ. Следует дополнительно отметить, что настоящее изобретение не предназначено охватывать в пределах объема настоящего изобретения любой продукт, способ получения продукта или способ применения продукта, который не соответствует письменному описанию и требованиям достаточного раскрытия сути изобретения USPTO (первый пункт § 112 статьи 35 USC) или ЕРО (статья 83 ЕРС), так что заявители оставляют за собой право и настоящим раскрывают отказ от прав на любой ранее описанный продукт, способ получения продукта или способ применения продукта.

Следует отметить, что в данном раскрытии и особенно в формуле изобретения и/или абзацах такие выражения, как ''содержит'', ''содержащийся'', ''содержащий'' и т.п., могут иметь значение, приписываемое им в патентном законодательстве США, например, они могут означать ''включает'', ''включенный'', ''включающий'' и т.п., и что такие выражения, как ''по сути состоящий из'' и ''по сути состоит из'' имеют значение, приписываемое им в патентном законодательстве США, например, они допускают не указанные прямо элементы, но исключают элементы, которые имеются в известном уровне техники или которые влияют на основные или новые характеристики настоящего изобретения.

Эти и другие варианты осуществления раскрыты или являются очевидными на основании следующего подробного описания и охвачены им.

Краткое описание графических материалов

Новые признаки настоящего изобретения изложены с характерными особенностями в прилагаемой формуле изобретения. Лучшее понимание признаков и преимуществ настоящего изобретения будет доступно благодаря ссылке на следующее подробное описание, в котором изложены иллюстративные варианты осуществления, в которых используют принципы настоящего изобретения, и на сопутствующие графические материалы.

На фигуре 1 показана схематическая модель системы CRISPR. Нуклеаза Cas9 из Streptococcus pyogenes (желтый) целенаправленно воздействует на геномную ДНК при помощи синтетической направляющей РНК (sgRNA), состоящей из 20-нуклеотидной направляющей последовательности (голубой) и каркаса (красный). Направляющая последовательность образует пары оснований с ДНК-мишенью (голубой) непосредственно выше необходимого мотива 5'-NGG, прилегающего к протоспейсеру (РАМ; пурпурный), и Cas9 опосредует двухнитевой разрыв (DSB) на ~3 п.о. выше РАМ (красный треугольник).

На фигурах 2A-F показана иллюстративная система CRISPR, возможный механизм действия, пример адаптации для экспрессии в эукариотических клетках и результаты тестов, оценивающих ядерную локализацию и активность CRISPR.

На фигурах 3A-D показаны результаты оценки специфичности SpCas9 в отношении иллюстративной мишени.

На фигурах 4A-G показана иллюстративная векторная система и результаты ее применения при управлении гомологичной рекомбинацией в эукариотических клетках.

На фигуре 5 представлена таблица последовательностей протоспейсеров и обобщены результаты определения эффективности модификаций для протоспейсеров-мишеней, сконструированных на основе иллюстративных систем CRISPR S. pyogenes и S. thermophilus с соответствующими РАМ, воздействующих на локусы в геномах человека и мыши. Клетки трансфицировали Cas9 и либо pre-crRNA/tracrRNA, либо химерной РНК и анализировали через 72 часа после трансфекции. Процент вставок/делеций рассчитывали на основе результатов анализа с помощью Surveyor с указанными линиями клеток (N=3 для всех протоспейсеров-мишеней, ошибки представляют собой S.E.M., ''N.D.'' означает ''не выявляется посредством анализа с помощью Surveyor'', и ''N.T.'' означает ''не тестировали в данном исследовании'').

На фигурах 6А-С показано сравнение различных транскриптов tracrRNA для опосредованного Cas9 целенаправленного воздействия на ген.

На фигуре 7 показано схематическое изображение анализа с помощью нуклеазы Surveyor для выявления индуцированных двухцепочечным разрывом микровставок и микроделеций.

На фигурах 8А-В показаны иллюстративные бицистронные векторы экспрессии для экспрессии элементов системы CRISPR в эукариотических клетках.

На фигуре 9А-С показаны гистогораммы расстояний между смежными РАМ (NGG) для локуса 1 S. pyogenes SF370 (фигура 9А) и РАМ (NNAGAAW) для локуса 2 LMD9 S. thermophilus (фигура 9В) в геноме человека и расстояния для каждого РАМ в хромосомах (Chr) (фигура 9С).

На фигурах 10A-D показана иллюстративная система CRISPR как пример адаптации для экспрессии в эукариотических клетках и результаты тестов, оценивающих активность CRISPR.

На фигурах 11А-С показаны иллюстративные манипуляции с системой CRISPR для целенаправленного воздействия на локусы генома в клетках млекопитающего.

На фигурах 12А-В показаны результаты с помощью нозерн-блоттинга процессинга crRNA в клетках млекопитающего.

На фигурах 13А-В показан иллюстративный отбор протоспейсеров в локусах PVALB человека и Th мыши.

На фигуре 14 показаны иллюстративные последовательности протоспейсеров и соответствующих РАМ, являющиеся мишенями для системы CRISPR S. thermophilus, в локусе ЕМХ1 человека.

На фигуре 15 представлена таблица последовательностей для праймеров и зондов, используемых для анализа с помощью Surveyor, RFLP, геномного секвенирования и нозерн-блоттинга.

На фигурах 16А-С показана иллюстративная манипуляция с системой CRISPR с химерными РНК и результаты анализов с помощью SURVEYOR в отношении активности системы в эукариотических клетках.

На фигурах 17А-В показано графическое изображение результатов анализов с помощью SURVEYOR в отношении активности системы CRISPR в эукариотических клетках.

На фигуре 18 показано иллюстративное отображение некоторых целевых сайтов для Cas9 S. pyogenes в геноме человека, полученное с использованием геномного браузера UCSC.

На фигурах 19A-D показано круговое отображение филогенетического анализа, выявляющего пять семейств Cas9, в том числе трех групп больших Cas9 (~1400 аминокислот) и две малых Cas9 (~1100 аминокислот).

На фигурах 20A-F показано линейное отображение филогенетического анализа, выявляющего пять семейств Cas9, в том числе трех группы больших Cas9 (~1400 аминокислот) и две малых Cas9 (~1100 аминокислот).

На фигурах 21A-D показано редактирование генома посредством гомологичной рекомбинации, (а) Схематическое изображение никазы SpCas9 с мутацией D10A в каталитическом домене RuvC I. (b) Схематическое представление гомологичной рекомбинации (HR) в локусе ЕМХ1 человека при использовании смысловых или антисмысловых однонитевых олигонуклеотидов в качестве матриц для репарации. Красная стрелка вверху указывает на сайт расщепления для sgRNA; праймеры для ПЦР для генотипирования (таблицы J и K) обозначены стрелками в правой нанели. (с) Последовательность участка, модифицированного с помощью HR. (d) Анализ с помощью SURVEYOR в отношении вставок/делеций в целевом локусе 1 ЕМХ1 (n=3), опосредованных SpCas9 дикого типа (wt) и никазой SpCas9 (D10A). Стрелки указывают положения фрагментов ожидаемого размера.

На фигурах 22А-В показаны структуры одиночных векторов для SpCas9.

На фигуре 23 показана диаграмма, представляющая распределение ортологов Cas9 по длине.

На фигурах 24А-М показаны последовательности, в которых точки мутаций расположены в гене SpCas9.

На фигуре 25А показана карта вектора для целенаправленного воздействия на Rosa26 с условной экспрессией Cas9.

На фигуре 25В показана карта вектора для целенаправленного воздействия на Rosa26 с конститутивной экспрессией Cas9.

На фигуре 26 показано схематическое изображение важных элементов в конструкциях для конститутивной и условной экспрессии Cas9.

На фигуре 27 показаны данные о доставке и экспрессии Cas9 в головном мозге мышей in vivo.

На фигуре 28 показана доставка Cas9 и химерной РНК в виде РНК в клетки. (А) Доставка репортера GFP в виде ДНК или мРНК в клетки Neuro-2A. (В) Доставка Cas9 и химерной РНК, воздействующих на ген Icam2, в виде РНК приводит к разрезанию одного из двух тестируемых спейсеров. (С) Доставка Cas9 и химерной РНК, воздействующих на ген F7, в виде РНК приводит к разрезанию одного из двух тестируемых спейсеров.

На фигуре 29 показано, как репарация двухцепочечного разрыва (DSB) ДНК способствует редактированию генов. В пути склонного к ошибкам негомологичного соединения концов (NHEJ) концы DSB подвергаются обработке посредством эндогенных механизмов репарации ДНК и соединяются вместе, что может приводить к случайным мутациям по типу вставки или делеции (вставки/делеции) в месте соединения. Мутации по типу вставки/делеции, имеющие место в кодирующем участке гена, могут обуславливать сдвиг рамки считывания и появление преждевременного стоп-кодона, что приводит к нокауту гена. Альтернативно, матрицу для репарации в форме плазмиды или однонитевых олигодезоксинуклеотидов (ssODN) можно предоставлять для эффективного использования пути репарации с участием гомологичной рекомбинации (HDR), что обеспечивает высокое качество и точное редактирование.

На фигурах 30А-С показаны предполагаемые результаты HDR в клетках НЕK и HUES9. (а) Плазмиду для целенаправленного воздействия или ssODN (смысловой или антисмысловой) с гомологичными плечами можно использовать для редактирования последовательности в целевом локусе генома, расщепляемом Cas9 (красный треугольник). Для анализа эффективности HDR заявители вводили сайт для HindIII (красный прямоугольник) в целевой локус, который подвергали ПЦР-амплификации с праймерами, отжигаемыми за пределами участка гомологии. При расщеплении продукта ПЦР с помощью HindIII выявляют число случаев обнаружения событий HDR. (b) ssODN, ориентированные в смысловом или антисмысловом (s или а) направлении относительно представляющего интерес локуса, можно использовать в сочетании с Cas9 для достижения эффективного опосредованного HDR редактирования в целевом локусе. С каждой стороны от участка модификации (красная полоска) рекомендуется наличие минимального участка гомологии размером 40 п.о. и предпочтительно 90 п.о. (с) Пример эффекта ssODN в отношении HDR в локусе ЕМХ1 показан с использованием как Cas9 дикого типа, так и никазы Cas9 (D10A). Каждый ssODN содержит гомологичные плечи размером 90 п.о., фланкирующие вставку двух сайтов рестрикции размером 12 п.о.

На фигурах 31А-С показана стратегия репарации для мутации дельтаF508 гена регулятора трансмембранной проводимости при муковисцидозе.

На фигурах 32А-В (а) показано схематическое изображение экспансии GAA-повтора в интроне 1 FXN и (b) показано схематическое изображение стратегии, принятой для вырезания участка экспансии GAA с помощью системы CRISPR/Cas.

На фигуре 33 показан скрининг в отношении эффективного опосредованного SpCas9 целенаправленного воздействия на локусы генов Tet1-3 и Dnmt1, 3а и 3b. Анализ с помощью Surveyor в отношении ДНК из трансфицированных клеток N2A демонстрирует эффективное расщепление ДНК путем использования различных gRNA.

На фигуре 34 показана стратегия мультиплексного целенаправленного воздействия на геном с применением 2-векторной системы в системе доставки на основе AAV1/2. gRNA, воздействующая на Tet1-3 и Dnmt1, 3а и 3b, находится под контролем промотора U6. GFP-KASH находится под контролем промотора гена синапсина человека. Сайты рестрикции демонстрируют простую стратегию замены gRNA путем субклонирования. Показан SpCas9, меченный НА, фланкированный двумя сигналами ядерной локализации (NLS). Оба вектора доставляют в головной мозг с помощью вируса AAV1/2 в соотношении 1:1.

На фигуре 35 показано подтверждение функциональных свойств мультиплексного вектора #1 для целенаправленного воздействия на DNMT посредством анализа с помощью Surveyor. Клетки N2A подвергали совместному трансфицированию вектором #1 для целенаправленного воздействия на DNMT (+) и вектором, кодирующим SpCas9, для тестирования опосредованного SpCas9 расщепления локусов генов семейства DNMT. gRNA в отдельности (-) представляет собой отрицательный контроль. Клетки собирали для очистки и последующей обработки ДНК через 48 ч. после трансфекции.

На фигуре 36 показано подтверждение функциональных свойств мультиплексного вектора #2 для целенаправленного воздействия на DNMT посредством анализа с помощью Surveyor. Клетки N2A подвергали совместному трансфицированию вектором #1 для целенаправленного воздействия на DNMT (+) и вектором, кодирующим SpCas9, для тестирования опосредованного SpCas9 расщепления локусов генов семейства DNMT. gRNA отдельно (-) представляет собой отрицательный контроль. Клетки собирали для очистки и последующей обработки ДНК через 48 ч. после трансфекции.

На фигуре 37 показано схематическое представление коротких промоторов и коротких вариантов поли(А), используемых для экспрессии HA-SpCas9 in vivo. Размеры кодирующих участков от L-ITR до R-ITR показаны справа.

На фигуре 38 показано схематическое представление коротких промоторов и коротких вариантов поли(А), используемых для экспрессии HA-SaCas9 in vivo. Размеры кодирующих участков от L-ITR до R-ITR показаны справа.

На фигуре 39 показана экспрессия SpCas9 и SaCas9 в клетках N2A. Иллюстративный вестерн-блот-анализ меченных НА вариантов SpCas9 и SaCas9 под контролем различных коротких промоторов и с короткими поли(А)-последовательностями (spA). Тубулин представляет собой контроль загрузки. mCherry (mCh) представляет собой контроль трансфекции. Через 48 ч. после трансфекции клетки собирали и подвергали дальнейшей обработке для вестерн-блоттинга.

На фигуре 40 показан скрининг в отношении эффективного опосредованного SaCas9 целенаправленного воздействия на локус гена Tet3. Анализ с помощью Surveyor в отношении ДНК из трансфицированных клеток N2A демонстрирует эффективное расщепление ДНК путем применения различных gRNA с последовательностью PUM NNGGGT. Клетки, трансфицированные GFP, и клетки, экспрессирующие только SaCas9, являются контрольными.

На фигуре 41 показана экспрессия HA-SaCas9 в головном мозге мышей. Животным инъецировали в зубчатые извилины вирус, управляющий экспрессией HA-SaCas9 под контролем промотора гена синапсина человека. Животных умерщвляли через 2 недели после хирургической операции. НА-метку выявляли с помощью моноклонального антитела кролика C29F4 (Cell Signaling). Клеточные ядра окрашивали синим цветом с помощью красителя DAPI.

На фигуре 42 показана экспрессия SpCas9 и SaCas9 в первичных кортикальных нейронах в культуре через 7 дней после трансдукции. Иллюстративный вестерн-блот-анализ меченных НА вариантов SpCas9 и SaCas9 под контролем различных промоторов и с последовательностями bgh или короткими поли(А) (spA). Тубулин представляет собой контроль загрузки.

На фигуре 43 показано окрашивание с выявлением живых/мертвых первичных кортикальных нейронов через 7 дней после трансдукции частицами AAV1, несущими SpCas9 с различными промоторами и мультиплексные конструкции gRNA (пример показан на последней панели для DNMT). Нейроны после трансдукции с помощью AAV сравнивали с контрольными нетрансдуцированными нейронами. Красные ядра указывают на мертвые клетки с проницаемой мембраной (второй ряд панелей). Живые клетки отмечены зеленым цветом (третий ряд панелей).

На фигуре 44 показано окрашивание с выявлением живых/мертвых первичных кортикальных нейронов через 7 дней после трансдукции частицами AAV1, несущими SaCas9 с различными промоторами. Красные ядра указывают на мертвые клетки с проницаемой мембраной (второй ряд панелей). Живые клетки отмечены зеленым цветом (третий ряд панелей).

На фигуре 45 показано сравнение морфологических характеристик нейронов после трансдукции вирусом AAV1, несущим SpCas9 и мультиплексы gRNA для локусов генов ТЕТ и DNMT. Нейроны без трансдукции показаны в качестве контроля.

На фигуре 46 показано подтверждение функциональных свойств мультиплексного вектора #1 для целенаправленного воздействия на DNMT посредством анализа с помощью Surveyor в первичных кортикальных нейронах. Клетки подвергали совместной трансдукции вектором #1 для целенаправленного воздействия на DNMT и вирусами с SpCas9 с различными промоторами для тестирования опосредованного SpCas9 расщепления локусов генов семейства DNMT.

На фигуре 47 показана in vivo эффективность расщепления с помощью SpCas9 в головном мозге. Мышам инъецировали вирус AAV1/2, несущий мультиплекс gRNA, осуществляющий нацеливание на локусы генов семейства DNMT, вместе с вирусами с SpCas9 под контролем 2 различных промоторов: Меср2 мыши и Map1b крысы. Через две недели после инъекции ткань головного мозга извлекали и ядра получали и сортировали с помощью FACS на основании экспрессии GFP под управлением промотора гена синапсина из мультиплексной конструкции gRNA. После экстракции gDNA выполняли анализ с помощью Surveyor. + означает GFP-положительные ядра, а - означает контрольные, GFP-отрицательные ядра от того же животного. Числа возле геля означают оцененную эффективность SpCas9.

На фигуре 48 показана очистка меченных GFP-KASH клеточных ядер из нейронов гиппокампа. Внешняя ядерная мембрана (ONM) ядерной мембраны клетки мечена продуктом слияния GFP и белкового трансмембранного домена KASH. Через неделю после стереотаксического хирургического вмешательства и инъекции AAV1/2 в головном мозге наблюдается интенсивная экспрессия GFP. Осуществляли стадию центрифугирования в градиенте плотности для очистки клеточных ядер от интактных клеток головного мозга. Показаны очищенные ядра. Хроматин, окрашенный рубиновым красителем Vybrant® DyeCycle™, показан красным цветом, меченные GFP ядра показаны зеленым цветом. Иллюстративный профиль FACS GFP+ и GFP-клеточных ядер (пурпурный цвет: рубиновый краситель Vybrant® DyeCycle™, зеленый цвет: GFP).

На фигуре 49 показана эффективность расщепления при помощи SpCas9 в головном мозге мышей. Мышам инъецировали вирус AAV1/2, несущий мультиплекс gRNA, осуществляющий нацеливание на локусы генов семейства ТЕТ, вместе с вирусами с SpCas9 под контролем 2 различных промоторов: Меср2 мыши и Map1b крысы. Через три недели после инъекции ткань головного мозга извлекали, ядра получали и сортировали с помощью FACS на основании экспрессии GFP под управлением промотора гена синапсина из мультиплексной конструкции gRNA. После экстракции gDNA выполняли анализ с помощью Surveyor. + означает GFP-положительные ядра, а - означает контрольные, GFP-отрицательные ядра от того же животного. Числа возле геля означают оцененную эффективность SpCas9.

На фигуре 50 показана экспрессия GFP-KASH в кортикальных нейронах в культуре. Нейроны трансдуцировали вирусом AAV1, несущим мультиплексные конструкции gRNA, осуществляющие нацеливание на локусы генов ТЕТ. Локализация самого сильного сигнала возле клеточных ядер обусловлена локализацией домена KASH.

На фигуре 51 показан (в верхней части) перечень расстояний (на которые указывает схема расположения для двух РАМ-последовательностей) между парами направляющих РНК. Только для пар направляющих РНК, удовлетворяющих паттернам 1, 2, 3, 4, проявляются вставки/делеции в случае применения с никазой SpCas9(D10A). (Нижняя часть) Изображения гелей, демонстрирующие, что комбинация SpCas9(D10A) с парами направляющих РНК, удовлетворяющих паттернам 1, 2, 3, 4, приводит к образованию вставок/делеций в целевом сайте.

На фигуре 52 показан перечень последовательностей обратных праймеров для U6, используемых для создания кассет экспрессии U6-направляющая РНК. Каждый праймер необходимо применять в паре с прямым праймером для U6 ''gcactgagggcctatttcccatgattc'' для образования ампликонов, содержащих U6 и требуемую направляющую РНК.

На фигуре 53 показана карта секвенирования генома в локусе Emx1 человека, демонстрирующая местоположения 24 паттернов, перечисленных на фигуре 33.

На фигуре 54 показано (справа) изображение геля, указывающее на образование вставок/делеций в целевом сайте при наличии различных ''липких'' 5'-концов после расщепления никазой Cas9, нацеливаемой различными парами направляющих РНК. (Слева) Таблица, в которой указаны номера дорожек для геля справа и различные параметры, в том числе идентификация применяемых пар направляющих РНК и длина ''липкого'' 5'-конца, имеющегося в наличии после расщепления никазой Cas9.

На фигуре 55 показана карта секвенирования генома в локусе Emx1 человека, демонстрирующая местоположения различных пар направляющих РНК, которые обуславливают картины разделения в геле, показанные на фигуре 54 (справа), и которые дополнительно описаны в примере 35.

На фигурах 56А-K показано целенаправленное воздействие CRISPR-Cas9 на Меср2 в первичных кортикальных нейронах. (А) Векторы экспрессии AAV SpCas9 и sgRNA. Вектор sgRNA содержит последовательность, кодирующую белок слияния GFP-KASH для идентификации трансдуцированных нейронов. (В) Нейроны в культуре подвергают совместной трансдукции векторами Cas9 и sgRNA, демонстрирующими экспрессию меченного НА Cas9 (HA-Cas9) и GFP-KASH. Ядра метили с помощью DAPI. Масштабная метка - 20 мкм. (С) Эффективность совместного инфицирования GFP-KASH+ (n=635) и HA-Cas9 (n=659) в первичных кортикальных нейронах. (D) Графическое представление локуса Меср2 мыши, демонстрирующее местоположение целевого сайта Cas9; sgRNA показана синим цветом. Последовательность РАМ отмечена розовым цветом. (Е) Анализ в геле с помощью SURVEYOR™, демонстрирующий модификацию локуса Меср2 в кортикальных нейронах. (F) Вестерн-блот-анализ уровней белка МеСР2 после целенаправленного воздействия CRISPR-Cas9 на локус Меср2 и количественная оценка уровней белка МеСР2 (t-критерий, ***р<0,0001, n=7). (G) Снижение сложности дендритного дерева в нейронах после целенаправленного воздействия CRISPR-Cas9 на локус Меср2. Масштабная метка - 20 мкм. (Н) Морфология дендритного дерева, оцениваемая по количеству кончиков дендритов и (I) анализ Шолла (t-критерий, ***р<0,0001, n=40). (J) Изменения в морфологии дендритных шипиков в нейронах, подвергнутых целенаправленному воздействию Cas9 и sgRNA для Меср2. Масштабная метка - 10 мкм. (K) Количественная оценка плотности шипиков (t-критерий, ***р<0,0001, n=40).

На фигурах 57A-I показана доставка системы CRISPR-Cas9 и целенаправленное воздействие на Меср2 в головном мозге мыши. (А) Стратегия очистки клеточных ядер из клеток головного мозга мыши, подвергнутых целенаправленному воздействию CRISPR-Cas9. (В) Экспрессия HA-Cas9 и GFP-KASH (sgRNA) в дорсальной части зубчатой извилины (DG) гиппокампа мыши. Масштабная метка - 100 мкм. (С) Количественная оценка клеток, в которых произошло целенаправленное воздействие двухвекторной системы Cas9-CRISPR. (D) Анализ в геле с помощью SURVEYOR™, демонстрирующий модификацию локуса Меср2 через 2 недели после доставки с помощью AAV в DG-область. Отсортированные путем FACS GFP-KASH положительные клетки демонстрируют более высокий уровень модификации локуса Меср2. (Е) Вестерн-блот-анализ экспрессии белка МеСР2 в области головного мозга, подвергнутой целенаправленному воздействию, и количественная оценка уровней белка МеСР2 в дорсальной части DG (t-критерий, **р<0,001, n=4). (F) Фотографии дорсальной части DG-области через 2 недели после целенаправленного воздействия CRISPR-Cas9 на локус Меср2. Масштабная метка - 150 мкм. (G) Количественная оценка популяции МеСР2-положительных клеток в области головного мозга, подвергнутой целенаправленному воздействию, по сравнению с контрольным коллатеральных участком (t-критерий, ****р<0,0001, n=290 и 249 клеток, соответственно). (Н) Примеры окраски по Гольджи-Коксу, демонстрирующей морфологию дендритных шипиков гранулярных клеток в дорсальной части DG через одну неделю после доставки CRISPR-Cas9. Масштабная метка - 10 мкм. (I) Количественная оценка плотности дендритных шипиков в дорсальной части DG-области (t-критерий, ***р<0,0001, n=20).

На фигурах 58A-F показано одновременное мультиплексное редактирование генов в головном мозге мыши. (А) Схематическое изображение системы CRISPR-Cas9, разработанной для мультиплексного целенаправленного воздействия на геном. (В) Графическое представление локусов DNMT мыши, подвергнутых целенаправленному воздействию. Направляющие РНК показаны синим цветом. Последовательности РАМ отмечены розовым цветом. (С) Секвенирование нового поколения для определения степени целевой модификации семейства генов DNMT в отсортированных путем FACS ядрах из зубчатой извилины после доставки CRISPR-Cas9. Показаны показатели MLE (оценки максимального правдоподобия). (D) Вестерн-блот-анализ белков Dnmt3a и Dnmt1 после доставки in vivo системы CRISPR-Cas9, целенаправленно воздействующей на гены семейства DNMT (верхняя часть). Количественная оценка посредством вестерн-блот-анализа уровней белков Dnmt3a и Dnmt1 в DG после целенаправленного воздействия CRISPR-Cas9 in vivo (нижняя часть; t-критерий, **р<0,001, *р<0,05, Dnmt3a: n=7; Dnmt1: n=5). (E, F) Дефицита контекстного обучения через 8 недель после целенаправленного воздействия на гены DNMT с помощью SPR-Cas9 в DG-области гиппокампа при тестировании в тренировочном (E) и измененном контексте (F) (t-критерий, ***p<0,0001, n=18).

На фигурах 59А-Е показаны клонирование и экспрессия меченного НА SpCas9 (HA-Cas9) при упаковке в AAV. (А) Схематический обзор системы CRISPR/Cas9. Целенаправленное воздействие Cas9, опосредованное одиночной направляющей РНК (sgRNA), приводит к двухнитевому разрыву (DSB) в генном локусе, подвергнутом целенаправленному воздействию. Механизм негомологичного соединения концов (NHEJ) приводит к мутациям по типу вставки/делеции в геномном локусе, подвергнутом целенаправленному воздействию. (В) Схематический обзор различных стратегий клонирования для сведения к минимуму размера кассеты экспрессии Cas9 с помощью короткого промотора Map1b крысы (rMap1b), усеченного варианта промотора Меср2 мыши (sMecp2) и короткого мотива поли(А) (spA). (С) Вестерн-блот-анализ культуры первичных кортикальных нейронов, экспрессирующих Cas9, с помощью различных кассет экспрессии Cas9. (D) Промотор Меср2 управляет экспрессией Cas9 (красный цвет) в нейронах (Map1b, NeuN; стрелки), но не в астроглии (GFAP, указатели стрелок). Ядра метили с помощью DAPI (синий цвет). Масштабные метки - 20 мкм. (Е) Клетки окрашивали с помощью набора LIFE/DEAD® через 7 дней после вирусной доставки. Количественная оценка DAPI+ и мертвых (DEAD+) клеток. (ITR - инвертированный концевой повтор; НА - гемагглютининовая метка; NLS - сигнал ядерной локализации; spA - синтетический сигнал полиаденилирования; U6 - промотор PolIII; sgRNA - одиночная направляющая РНК; hSyn - промотор гена синапсина 1 человека; GFP - зеленый флуоресцентный белок; KASH - ядерный трансмембранный домен гомологии Klarsicht/ANC1/Syne; bGH pA - сигнал полиаденилирования бычьего гормона роста; WPRE - посттранскрипционный регуляторный элемент вируса гепатита сурков).

На фигурах 60А-В показано целенаправленное воздействие на Меср2 в клетках Neuro-2a. (А) Целевые последовательности Меср2 и соответствующие мотивы, прилегающие к протоспейсерам (РАМ). (В) Оценивание 6 sgRNA для Меср2, введенных путем совместной трансфекции с Cas9 в клетки Neuro-2a. Показатели эффективности модификации локусов анализировали через 48 ч. после трансфекции с применением анализа с помощью SURVEYOR™.

На фигуре 61 показана доставка CRISPR-Cas9 в первичных кортикальных нейронах. Иммунофлуоресцентное окрашивание МеСР2 (красный цвет) у культивируемых нейронов через 7 дней после трансдукции AAV-CRISPR (зеленых цвет, GFP-KASH). Показана пониженная иммунофлуоресценция МеСР2 в клетках, трандуцированных AAV-CRISPR, целенаправленно воздействующей на Меср2 (средняя панель). Ядра метили с помощью DAPI (синий цвет). Масштабная метка - 20 мкм.

На фигурах 62А-С показано мечение с помощью GFP клеточных ядер, подвергнутых целенаправленному воздействию. (А) Схематический обзор мечения с помощью GFP. Проиллюстрированы улучшенный зеленый флуоресцентный белок (GFP), слитый с ядерным трансмембранным доменом KASH, и интеграция GFP-KASH во внешнюю ядерную мембрану. (В) Экспрессия GFP-KASH под управлением промотора гена синапсина человека через 4 недели после вирусной доставки в зубчатую извилину. Окраска гематоксилином/эозином (вверху) не выявила морфологических аномалий. Иммунофлуоресцентный анализ, показывающий нормальную гистоморфологию (NeuN показан красным цветом, средняя панель) в гиппокампе, экспрессирующем GFP-KASH (средняя, зеленый цвет), и отсутствие признаков астроглиоза (GFAP показан красным цветом, нижняя панель). Ядра метили с помощью DAPI (синий цвет). Масштабная метка - 200 мкм. (С) При использовании промоторов, специфичных к типу клеток, можно целенаправленно воздействовать GFP-KASH на различные типы клеток. Промотор глиофибриллярного кислого белка (GFAP) управляет экспрессией GFP-KASH (зеленый цвет) в клетках астроглии (красный цвет) в гиппокампе мыши. Ядра метили с помощью DAPI (синий цвет). Во врезках показано большее увеличение. Масштабная метка - 50 мкм. (KASH - ядерный трансмембранный домен Klarsicht, ANC1, Syne Homology) (ONM - внешняя ядерная мембрана; INM - внутренняя ядерная мембрана).

На фигурах 63А-В показано мультиплексное целенаправленное воздействие на геном в отношении представителей семейства DNMT in vitro. (А) Целевые последовательности Dnmt3a, Dnmt1 и Dnmt3b и соответствующие мотивы, прилегающие к протоспейсерам (РАМ). (В) Анализ клеток Neuro-2a с помощью нуклеазы SURVEYOR™ через 48 часов после трансфекции с помощью вектора с Cas9 и 3 х sgRNA для DNMT, целенаправленно воздействующего на локусы Dnmt3a, Dnmt1 и Dnmt3b. Показано эффективное редактирование генома для всех трех целевых генов.

На фигурах 64А-С показано секвенирование нового поколения для локусов Dnmt3a, Dnmt1 и Dnmt3b, подвергнутых целенаправленному воздействию. Пример результатов секвенирования подвергнутых мутации локусов Dnmt3a (А), Dnmt1 (В) и Dnmt3b (С) после доставки Cas9 и DNMT 3 х sgRNA в зубчатую извилину мыши in vivo. Зеленый цвет: последовательность дикого типа, красная пунктирная линия: удаленные основания, красные основания: вставка или мутации. Красные указатели стрелок указывают на сайт разрезания CRISPR-Cas9.

На фигуре 65А показано, что направляющая последовательность для целевого сайта 1 индуцировала самое высокое процентное значение количества вставок/делеций в АроВ.

На фигуре 65В показаны результаты анализа в геле с помощью нуклеазы Surveyor в отношении эффективности образования вставок/делеций через 4 недели после инъекции.

На фигуре 66 показано окрашивание масляным красным для выявления фенотипа накопления липидов в печени in vivo после доставки AAV-Cas9-sgRNA. Масштабная метка в каждой квадратной панели представляет 20 микрометров.

На фигуре 67 показано, что оптимальная длина спейсера составляет 21 нуклеотид/пару оснований (п.о.), представлена серыми прямоугольниками, по меньшей мере по сравнению с 20 или 22 парами оснований (представлены черными и белыми прямоугольниками, соответственно) для ряда мишеней в двух различных генах (AAVS1 и ЕМХ1).

На фигуре 68 показано, можно ли направляющую последовательность вставить в интронную последовательность Cas9.

На фигуре 69 показано, что промотор H1 полной длины (серый прямоугольник) все же является более слабым, чем промотор U6 (черный прямоугольник), поскольку U6 демонстрирует повышенное процентное значение количества образующихся вставок/делений для каждой тестируемой мишени.

На фигуре 70 показано, что короткий промотор H1 является более слабым, чем промотор H1 полной длины.

На фигуре 71 показано расстояние между 5'-концами двух направляющих последовательностей в конструкции, измеренное применительно к эффективности расщепления двойной никазой SaCas9 D10A.

На фигуре 72 показана доставка и целенаправленное воздействие системы CRISPR-Cas9 на локус Меср2 в головном мозге мыши. (а) Векторы экспрессии AAV-SpCas9 и AAV-Sp-направляющая последовательность (Меср2). Вектор sgRNA содержит последовательность, кодирующую белок слияния GFP-KASH для идентификации трансдуцированных нейронов. (b) Экспрессия HA-Cas9 и GFP-KASH в дорсальной части зубчатой извилины (DG) гиппокампа мыши. Масштабная метка - 100 мкм. (с) Количественная оценка клеток, в которых произошло эффективное целенаправленное воздействие двухвекторной системы Cas9-CRISPR. (d) Графическое представление локуса Меср2 мыши, демонстрирующее местоположение целевого сайта для Cas9; sgRNA показана синим цветом. Последовательность РАМ отмечена розовым цветом. Иллюстративные паттерны мутаций, выявленные путем секвенирования локуса Меср2, показаны ниже: зеленый цвет - последовательность дикого типа; красная пунктирная линия - удаленные основания; красные основания: вставка или мутации; красный указатель стрелки указывает на сайт разрезания CRISPR-Cas9. (e) Анализ в геле с помощью SURVEYOR™, демонстрирующий модификацию локуса Меср2, через 2 недели после доставки с помощью AAV в DG-область. (f) Вестерн-блот-анализ экспрессии белка МеСР2 в области головного мозга, подвергнутой целенаправленному воздействию, и количественная оценка уровней белка МеСР2 в дорсальной части DG (t-критерий, **р<0,001, n=4 от 3 животных, планки погрешностей: s.e.m.). (g) Изображения дорсальной части DG-области через 2 недели после целенаправленного воздействия CRISPR-Cas9 на локус Меср2. Масштабная метка - 150 мкм. (h) Количественная оценка популяции МеСР2-положительных клеток среди всех выявленных клеток (окрашивание DAPI) в области головного мозга, подвергнутой целенаправленному воздействию, по сравнению с контрольным коллатеральным участком (t-критерий, ****р<0,0001, n=290 и 249 клеток от 2 животных, соответственно; планки погрешностей: s.e.m). (ITR - инвертированный концевой повтор; НА - гемагглютининовая метка; NLS - сигнал ядерной локализации; spA - синтетический сигнал полиаденилирования; U6 - промотор PolIII; sgRNA - одиночная направляющая РНК; hSyn - промотор гена синапсина 1 человека; GFP - зеленый флуоресцентный белок; KASH - ядерный трансмембранный домен гомологии Klarsicht/ANCl/Syne; bGH pA - сигнал полиаденилирования бычьего гормона роста; WPRE - посттранскрипционный регуляторный элемент вируса гепатита сурков).

На фигуре 73 показан анализ экспрессии генов в нейронах с опосредованном Cas9 нокдауном МеСР2. (а) Стратегия очистки клеточных ядер из клеток головного мозга мыши, подвергнутых целенаправленному воздействию CRISPR-Cas9. (b) Иерархическая кластеризация дифференциально экспрессируемых генов (t-критерий, р<0,01, n=19 групп отсортированных ядер от 8 животных), выявленная путем секвенирования РНК. Относительные уровни экспрессии генов в log2(TPM+1) нормализованы для каждого ряда и отображены на красно-синей цветовой шкале. В каждом столбце представлена группа из 100 ядер нейронов, подвергнутых целенаправленному воздействию, отсортированных путем FACS из выделенной популяции клеток зубчатой извилины контрольных или трансдуцированных sgRNA для Меср2 животных, как указано.

На фигуре 74 показаны клеточно-автономные дефекты в свойствах клеточных реакций нейронов после опосредованного CRISPR нокдауна МеСР2. (а) Рисунок, на котором показана схема эксперимента in vivo, состоящая из зрительной коры мыши и параметра зрительной стимуляции. Показан GFP+ нейрон. Масштабная метка - 20 мкм. (b) Рисунок, на котором показана схема регистрации в возбуждающих нейронах в слоях 2/3, которые получают специфический входной сигнал, направленный как на контра-, так и на ипсилатеральный глаз. GFP+ клетки с модифицированным геномом показаны зеленым цветом, тогда как немодифицированные клетки показаны серым цветом. Стандартная форма спайка указывает на возбуждающие нейроны с регулярными спайками. (c, d) Средние значения OSI (с) и вызванной FR (d) измеряли в GFP+ клетках, экспрессирующих Меср2 и контрольную sgRNA, соответственно (t-критерий, *р<0,05; числа на графике означают количество клеток, в которых проводили регистрацию; n=2-3 животных; планки погрешностей: s.e.m).

На фигуре 75 показано одновременное мультиплексное редактирование генов в головном мозге мыши. (а) Схематическое изображение системы CRISPR-Cas9, предназначенной для мультиплексного целенаправленного воздействия на геном, (b) Графическое представление локусов DNMT мыши, подвергнутых целенаправленному воздействию. Направляющие РНК показаны синим цветом. Последовательности РАМ отмечены розовым цветом. (с) Анализ в геле с помощью SURVEYOR™, демонстрирующий модификацию локусов DNMT в отсортированных путем FACS GFP-KASH-положительных клетках через 4 недели после доставки с помощью AAV в DG-область. (d) Анализ модификации локусов DNMT в отдельных клетках на основе глубокого секвенирования, демонстрирующий совместную встречаемость модификаций в нескольких локусах. (е) Вестерн-блот-анализ белков Dnmt3a и Dnmt1 после доставки in vivo системы CRISPR-Cas9, целенаправленно воздействующей на гены семейства DNMT (верхняя часть). Количественная оценка уровней белков Dnmt3a и Dnmtl в DG посредством вестерн-блот-анализа после целенаправленного воздействия CRISPR-Cas9 in vivo (нижняя часть; t-критерий, **р<0,001, *р<0,05, Dnmt3a: n=7; Dnmt1: n=5 от 5 животных; планки погрешностей: s.e.m). (f) Дефициты контекстного обучения через 8 недель после целенаправленного воздействия на гены DNMT с помощью SpCas9 в DG-области гиппокампа при тестировании в тренировочном и измененном контексте (t-критерий, ***р<0,0001, n=18 животных, 2 независимых эксперимента; планки погрешностей: s.e.m).

На фигуре 76 показаны клонирование и экспрессия меченного НА SpCas9 (НА-SpCas9) при упаковке в AAV. (а) Схематический обзор различных стратегий клонирования для сведения к минимуму размера кассеты экспрессии SpCas9 с помощью короткого промотора Map1b крысы (pMap1b), усеченного варианта промотора Меср2 мыши (рМеср2) и короткого мотива поли(А) (spA). (b) Вестерн-блот-анализ культуры первичных кортикальных нейронов, экспрессирующих HA-SpCas9 с помощью различных кассет экспрессии SpCas9. (с) Промотор Меср2 управляет экспрессией HA-SpCas9 (красный цвет) в нейронах (Map1b, NeuN; стрелки), но не в астроглии (GFAP, указатели стрелок). Показана совместная экспрессия HA-SpCas9 и GFP-KASH (нижняя часть). Ядра метили с помощью DAPI (синий цвет). Масштабные метки - 20 мкм. (d) Схематический обзор мечения с помощью GFP. Проиллюстрированы улучшенный зеленый флуоресцентный белок (GFP), слитый с ядерным трансмембранным доменом KASH, и интеграция GFP-KASH во внешнюю ядерную мембрану, (е) Расчет эффективности совместного инфицирования, показывающий популяции клеток, экспрессирующих как HA-SpCas9, так и GFP-KASH (n=973 нейрона из 3 культур; планки погрешностей: s.e.m). (f) Клетки окрашивали с помощью набора LIVE/DEAD® через 7 дней после вирусной доставки. Количественная оценка DAPI+ и мертвых (DEAD+) клеток (n=518 контрольных ядер DAPI+; n=1003 ядра DAPI+ с SpCas9/GFP-KASH из 2 культур; планки погрешностей: s.e.m). (ITR - инвертированный концевой повтор; НА - гемагглютининовая метка; NLS - сигнал ядерной локализации; spA - синтетический сигнал полиаденилирования; U6 - промотор PolIII; sgRNA - одиночная направляющая РНК; hSyn - промотор гена синапсина 1 человека; GFP - зеленый флуоресцентный белок; KASH - ядерный трансмембранный домен гомологии Klarsicht/ANCl/Syne; bGH pA - сигнал полиаденилирования бычьего гормона роста; WPRE - посттранскрипционный регуляторный элемент вируса гепатита сурков).

На фигуре 77 показано целенаправленное воздействие на Меср2 в клетках Neuro-2а. (а) Целевые последовательности Меср2 и соответствующие мотивы, прилегающие к протоспейсерам (РАМ). (b) Оценивание 6 sgRNA для Меср2, введенных путем совместной трансфекции с SpCas9 в клетки Neuro-2a. Показатели эффективности модификации локусов анализировали через 48 ч. после трансфекции с применением анализа с помощью SURVEYOR™.

На фигуре 78 показано целенаправленное воздействие CRISPR-SpCas9 на Меср2 в первичных кортикальных нейронах, (а) Иммунофлуоресцентное окрашивание МеСР2 (красный цвет) в культивируемых нейронах через 7 дней после трансдукции AAV-CRISPR (зеленый цвет, GFP-KASH). Ядра метили с помощью DAPI (синий цвет). Масштабная метка - 20 мкм. (b) Оценивание целенаправленного воздействия на локус Меср2 с применением SpCas9 или dSpCas9 вместе с sgRNA для Меср2 или контрольной sgRNA (осуществляющей нацеливание на бактериальный ген lacZ) посредством анализа в геле с помощью SURVEYOR™. (с) Количественная оценка МеСР2-положительных ядер в целевой популяции нейронов (GFP+). (d) Вестерн-блот-анализ уровней белка МеСР2 после целенаправленного воздействия CRISPR-SpCas9 на локус Меср2 и количественная оценка уровней белка МеСР2 (t-критерий, **р<0,001, n=5 из 3 культур, планки погрешностей: s.e.m).

На фигуре 79 показаны морфологические изменения в дендритном дереве нейронов после опосредованного SpCas9 нокдауна МеСР2 in vitro, (а) Снижение сложности дендритного дерева в нейронах после целенаправленного воздействия CRISPR-SpCas9 на локус Меср2. Масштабная метка - 20 мкм. (b) Изменения в морфологии дендритных шипиков в нейронах, подвергнутых целенаправленному воздействию SpCas9 и sgRNA для Меср2, Масштабная метка - 10 мкм. Морфологические характеристики клеток визуализировали путем совместной трансфекции с конструкцией mCherry. Клетки для морфологического анализа выбирали на основании результата окрашивания Меср2. (c) Морфология дендритного дерева, оцениваемая по количеству кончиков дендритов, и (d) анализ Шолла (t-критерий, ***р<0,0001, n=40 из 2 культур), (е) Количественная оценка плотности шипиков (t-критерий, ***р<0,0001, n=40 из 2 культур, планки погрешностей: s.e.m).

На фигуре 80 показано секвенирование РНК в ядрах нейронов от контрольных животных и животных с опосредованным SpCas9 нокдауном Меср2. На диаграмме размаха представлено количество выявленных генов среди библиотек для секвенирования РНК (19 библиотек для каждого из 100 ядер, отобранных из ядер, трансдуцированных контрольной sgRNA или sgRNA для Меср2; n=4 животных/группа) на квантиль уровня экспрессии. Все гены разделяли на 10 квантилей по их среднему уровню экспрессии в log2(TPM+1), а затем для каждого квантиля подсчитывали количество выявленных генов (log2(TPM+1)>2) в каждом образце. Три показанные целевые последовательности представляют собой SEQ ID NO:__, SEQ ID NO:__ и SEQ ID NO:__ для Dnmt3a, Dnmt1 и Dnmt3b, соответственно.

На фигуре 81 показано мультиплексное целенаправленное воздействие на геном в отношении представителей семейства DNMT in vitro, (а) Целевые последовательности Dnmt3a, Dnmt1 и Dnmt3b и соответствующие мотивы, прилегающие к протоспейсерам (РАМ). (b) Анализ клеток Neuro-2a с помощью нуклеазы SURVEYOR™ через 48 часов после трансфекции с помощью вектора с SpCas9 и 3 х sgRNA для DNMT, целенаправленно воздействующего на локусы Dnmt3a, Dnmt1 и Dnmt3b. Показано эффективное редактирование генома для всех трех генов, подвергнутых целенаправленному воздействию.

На фигуре 82 показано секвенирование нового поколения для локусов Dnmt3a, Dnmt1 и Dnmt3b, подвергнутых целенаправленному воздействию. Примеры результатов секвенирования подвергнутых мутации локусов Dnmt3a (а), Dnmt1 (b) и Dnmt3b (с) после доставки SpCas9 и 3 х sgRNA для DNMT в зубчатую извилину мыши in vivo. Зеленый цвет: последовательность дикого типа, красная пунктирная линия: удаленные основания, красные основания: вставка или мутации. Красные указатели стрелок указывают на сайт разрезания CRISPR-SpCas9. Полные последовательности, используемые на данной фигуре, приведены как SEQ ID NO:, SEQ ID NO: и SEQ ID NO: для локусов Dnmt3a, Dnmt1 и Dnmt3b, соответственно. Они представляют собой: SEQ ID NO: (Dnmt3a): ССТ CCG TGT CAG CGA CCC ATG ССА A, SEQ ID NO: (Dnmt1): CCA GCG TCG AAC AGC TCC AGC CCG и SEQ ID NO: (Dnmt3b) AGA GGG TGC CAG CGG GTA TAT GAG G.

Фигуры приведены в данном документе только в целях иллюстрации, и они не обязательно изображены в масштабе.

Подробное описание изобретения

Относительно общей информации о системах CRISPR-Cas: ссылка делается на предварительные заявки на патенты США 61/758468; 61/802174; 61/806375; 61/814263; 61/819803 и 61/828130, поданные 30 января 2013 г.; 15 марта 2013 г.; 28 марта 2013 г.; 20 апреля 2013 г.; 6 мая 2013 г. и 28 мая 2013 г., соответственно. Ссылка также делается на предварительную заявку на патент США 61/836123, поданную 17 июня 2013 г. Ссылка также делается на предварительные заявки на патенты США 61/736527 и 61/748427, поданные 12 декабря 2012 г. и 2 января 2013 г., соответственно. Ссылка также делается на предварительную заявку на патент США 61/791409, поданную 15 марта 2013 г. Ссылка также делается на предварительную заявку на патент США 61/799800, поданную 15 марта 2013 г. Ссылка также делается на предварительные заявки на патенты США 61/835931, 61/835936, 61/836127, 61/836101, 61/836080 и 61/835973, каждая из которых подана 17 июня 2013 г. Ссылка дополнительно делается на предварительные заявки на патенты США 61/862468 и 61/862355, поданные 5 августа 2013 г.; 61/871301, поданную 28 августа 2013 г.; 61/960777, поданную 25 сентября 2013 г., и 61/961980, поданную 28 октября 2013 г. Каждая из данных заявок, и все документы, цитируемые в них или во время их рассмотрения (''документы, цитируемые в заявке''), и все документы, цитируемые или упомянутые в документах, цитируемых в заявке, вместе с любыми инструкциями, описаниями, характеристиками продукта и технологическими картами для любых продуктов, упомянутыми в них или в любом документе, упомянутом в них и включенном с помощью ссылки в данный документ, настоящим включены в данный документ с помощью ссылки и могут быть использованы в практическом осуществлении настоящего изобретения. Все документы (например, данные заявки и документы, цитируемые в заявке) включены в данный документ при помощи ссылки в такой же мере, как если бы конкретно и отдельно было указано, что каждый отдельный документ включен при помощи ссылки.

Также относительно общей информации о системах CRISPR-Cas упоминают:

Multiplex genome engineering using CRISPR/Cas systems. Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N.. Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., & Zhang, F. Science Feb 15; 339(6121): 819-23 (2013);

RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang W., Bikard D., Cox D., Zhang F, Marraffini LA. Nat Biotechnol Mar; 31(3): 233-9 (2013);

One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering. Wang H., Yang H., Shivalila CS., Dawlaty MM., Cheng AW., Zhang F., Jaenisch R. Cell May 9; 153(4): 910-8 (2013);

Optical control of mammalian endogenous transcription and epigenetic states. Konermann S, Brigham MD, Trevino AE, Hsu PD, Heidenreich M, Cong L, Platt RJ, Scott DA, Church GM, Zhang F. Nature. 2013 Aug 22; 500(7463): 472-6. doi: 10.1038/Nature12466. Epub 2013 Aug 23;

Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity. Ran, FA., Hsu, PD., Lin, CY., Gootenberg, JS., Konermann, S., Trevino, AE., Scott, DA., Inoue, A., Matoba, S., Zhang, Y., & Zhang, F. Cell Aug 28. pii: S0092-8674(13)01015-5. (2013);

DNA targeting Specificity of RNA-guided Cas9 nucleases. Hsu, P., Scott, D., Weinstein, J., Ran, FA., Konermann, S., Agarwala, V., Li, Y., Fine, E., Wu, X., Shalem, O., Cradick, TJ., Marraffini, LA., Bao, G., & Zhang, F. Nat Biotechnol doi:10.1038/nbt.2647 (2013);

Genome engineering using the CRISPR-Cas9 system. Ran, FA., Hsu, PD., Wright, J., Agarwala, V., Scott, DA., Zhang, F. Nature Protocols Nov; 8(11): 2281-308. (2013);

Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells. Shalem, O., Sanjana, NE., Hartenian, E., Shi, X., Scott, DA., Mikkelson, Т., Heckl, D., Ebert, BL., Root, DE., Doench, JG., Zhang, F. Science Dec 12. (2013). [Электронная публикация, предшествующая печатной];

Crystal structure of cas9 in complex with guide RNA and target DNA. Nishimasu, H., Ran, FA., Hsu, PD., Konermann, S., Shehata, SI., Dohmae, N., Ishitani, R., Zhang, F., Nureki, O. Cell Feb 27. (2014). 156(5): 935-49;

Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Wu X., Scott DA., Kriz AJ., Chiu AC., Hsu PD., Dadon DB., Cheng AW., Trevino AE., Konermann S., Chen S., Jaenisch R., Zhang F., Sharp PA. Nat Biotechnol. (2014) Apr 20. doi: 10.1038/nbt.2889 и

Development and Applications of CRISPR-Cas9 for Genome Engineering, Hsu et al, Cell 157, 1262-1278 (June 5, 2014) (Hsu 2014).

каждый из которых включен в данный документ с помощью ссылки и вкратце обсуждается ниже.

Cong и соавт. сконструировали системы CRISPR/Cas типа II на основе Cas9 Streptococcus thermophilus, а также и Cas9 Streptococcus pyogenes для применения в эукариотических клетках и продемонстрировали, что нуклеазы Cas9 могут быть направлены короткими РНК с индуцированием точного расщепления ДНК в клетках человека и мыши. Их исследование дополнительно показало, что Cas9, превращенный в фермент, вносящий однонитевой разрыв, можно применять для содействия репарации с участием гомологичной рекомбинации в эукариотических клетках с минимальной мутагенной активностью. Дополнительно, их исследование продемонстрировало, что в одной матрице CRISPR могут быть закодированы несколько направляющих последовательностей для обеспечения одновременного редактирования в нескольких сайтах эндогенных локусов генома в геноме млекопитающих, что демонстрирует легкую программируемость и широкое применение технологии нуклеаз, направляемых РНК. Эта возможность применения РНК для программирования специфичного к последовательности расщепления ДНК в клетках определила новый класс инструментов для геномной инженерии. Данные исследования дополнительно показали, что другие локусы CRISPR, вероятно, можно пересадить в клетки млекопитающих, и они могут также опосредовать расщепление генома млекопитающих. Важно отметить, что можно предусмотреть дополнительное улучшение некоторых аспектов системы CRISPR/Cas для повышения ее эффективности и универсальности.

Jiang и соавт. применяли эндонуклеазы Cas9, ассоциированные с короткими палиндромными повторами, регулярно расположенными группами (CRISPR), в комплексе с двойной РНК для введения точных мутаций в геномы Streptococcus pneumoniae и Escherichia coli. Подход опирался на расщепление в целевом сайте генома под управлением системы двойная PHK:Cas9 для уничтожения не подвергшихся мутации клеток и устранял необходимость в селектируемых маркерах или системах негативного отбора. В исследовании сообщалось о перепрограммировании специфичности системы двойная PHK:Cas9 путем изменения последовательности короткой РНК CRISPR (crRNA) для внесения одно- или многонуклеотидных изменений, выполняемых с помощью матриц редактирования. Исследование показало, что одновременное использование двух crRNA обеспечивало мультиплексный мутагенез. Кроме того, когда подход применяли в комбинации с рекомбинационной инженерией, у S. pneumoniae практически 100% клеток, извлеченных с помощью описанного подхода, содержали требуемую мутацию, а у Е. coli 65% извлеченных клеток содержали мутацию.

Konermann и соавт. изучали существующую в данной области техники необходимость в гибких и надежных технологиях, позволяющих осуществлять оптическое и химическое модулирование фермента Cas9 CRISPR на основе ДНК-связывающих доменов, а также эффекторов, подобных активаторам транскрипции.

Как обсуждается в настоящем описании, нуклеаза Cas9 из микробной системы CRISPR-Cas целенаправленно воздействует на конкретные локусы генома при помощи направляющей последовательностью размером 20 нт, которая может допускать некоторые ошибки спаривания с ДНК-мишенью и, таким образом, способствует нежелательному нецелевому мутагенезу. Для изучения этого Ran и соавт. описали подход, в котором мутантную никазу Cas9 применяли в сочетании с парными направляющими РНК для введения целевых двухнитевых разрывов. Поскольку отдельные однонитевые разрывы в геноме подвергаются высокоточной репарации, одновременное внесение однонитевых разрывов с помощью соответствующим образом смещенных друг относительно друга направляющих РНК является необходимым для образования двухнитевых разрывов и увеличивает количество специфически распознаваемых оснований для расщепления мишени. Авторы продемонстрировали, что применение парного внесения однонитевых разрывов может снижать нецелевую активность в линиях клеток в 50-1500 раз и облегчать нокаут генов в зиготах мышей без уменьшения эффективности целевого расщепления. Данная гибкая стратегия обеспечивает большое разнообразие применений редактирования генома, требующих высокой специфичности.

Hsu и соавт. охарактеризовали специфичность целенаправленного воздействия SpCas9 в клетках человека, чтобы предоставить информацию для выбора целевых сайтов и избежать нецелевых эффектов. В исследовании оценивали >700 вариантов направляющей РНК и уровней мутаций по типу вставок/делеций, индуцированных SpCas9, в >100 предсказанных нецелевых локусах генома в клетках 293Т и 293FT. Авторы показали, что SpCas9 допускает ошибки спаривания между направляющей РНК и целевой ДНК в различных положениях в зависимости от последовательности с чувствительностью к количеству, положению и распределению ошибок спаривания. Авторы дополнительно показали, что на опосредованное SpCas9 расщепление не влияет метилирование ДНК и что для сведения к минимуму нецелевых модификаций можно подобрать дозу SpCas9 и sgRNA. Дополнительно, для облегчения применений в геномной инженерии млекопитающих авторы сообщили о получении инструментального программного обеспечения на веб-основе для управления выбором и подтверждением целевых последовательностей, а также анализов нецелевых явлений.

Ran и соавт. описали набор инструментов для опосредованного Cas9 редактирования генома посредством негомологичного соединения концов (NHEJ) или репарации с участием гомологичной рекомбинации (HDR) в клетках млекопитающих, а также создания модифицированных линий клеток для последующих функциональных исследований. Для сведения к минимуму нецелевого расщепления авторы дополнительно описали стратегию внесения двойных однонитевых разрывов с помощью мутантной никазы Cas9 с парными направляющими РНК. Протокол, представленный авторами, является полученным экспериментальным путем руководством по выбору целевых сайтов, оцениванию эффективности расщепления и анализу нецелевой активности. Исследования показали, что, начиная с конструирования мишени, модификации генов можно получить в течение всего 1-2 недель, и модифицированные клональные линии клеток можно получить в течение 2-3 недель.

Shalem и соавт. описали новый способ исследования функций генов в полногеномном масштабе. Их исследования показали, что доставка библиотеки CRISPR-Cas9 для нокаута в масштабе генома (GeCKO), целенаправленно воздействующей на 18080 генов, с 64751 уникальной направляющей последовательностью обеспечивала скрининг путем как позитивного, так и негативного отбора в клетках человека. Во-первых, авторы показали применение библиотеки GeCKO для идентификации генов, существенных для жизнеспособности клеток у раковых и плюрипотентных стволовых клеток. Далее, в модели меланомы, авторы провели скрининг в отношении генов, утрата функций которых вовлечена в устойчивость к вемурафенибу, терапевтическому средству, ингибирующему мутантную протеинкиназу BRAF. Их исследования показали, что кандидаты высшего ранга включали ранее подтвержденные гены NF1 и MED12, а также новые хиты NF2, CUL3, TADA2B и TADA1. Авторы наблюдали высокий уровень согласованности между независимыми направляющими РНК, осуществляющими нацеливание на один и тот же ген, и высоким показателем подтверждения хитов и, таким образом, продемонстрировали перспективность скрининга с помощью Cas9 в масштабе генома.

Nishimasu и соавт. сообщали о кристаллической структуре Cas9 Streptococcus pyogenes в комплексе с sgRNA и ее целевой ДНК при разрешающей способности в 2,5 А°. В структуре была выявлена двухлопастная архитектура, образованная лопастью распознавания мишени и нуклеазной лопастью, обеспечивающих размещение гетеродуплекса sgRNA:ДНК в положительно заряженной бороздке на поверхности их соприкосновения. При том, что лопасть распознавания является существенной для связывания sgRNA и ДНК, нуклеазная лопасть содержит нуклеазные домены HNH и RuvC, расположенные надлежащим образом для расщепления комплементарной и некомплементарной нитей целевой ДНК, соответственно. Нуклеазная лопасть также содержит карбоксиконцевой домен, отвечающий за взаимодействие с мотивом, прилегающим к протоспейсеру (РАМ). Эти структурные анализы с высокой разрешающей способностью и сопутствующие функциональные анализы выявили молекулярный механизм целенаправленного воздействия Cas9, направляемых РНК, на ДНК, проложив таким образом путь для рациональной разработки новых универсальных технологий редактирования генома.

Wu и соавт. производили полногеномное картирование сайтов связывания для каталитически неактивного Cas9 (dCas9) из Streptococcus pyogenes, который вводили с одиночными направляющими РНК (sgRNA) в эмбриональные стволовые клетки мыши (mESC). Авторы показали, что каждая из четырех тестируемых sgRNA осуществляет нацеливание dCas9 на сайты генома в количестве от нескольких десятков до нескольких тысяч, часто характеризуемых наличием 5-нуклеотидной затравочной области в sgRNA и мотива NGG, прилегающего к протоспейсеру (РАМ). Недоступность хроматина снижает связывание dCas9 с другими сайтами с последовательностями, комплементарными затравочной; таким образом, 70% нецелевых сайтов ассоциированы с генами. Авторы показали, что целенаправленное секвенирование 295 сайтов связывания для dCas9 в mESC, трансфицированных каталитически активным Cas9, выявило мутацию, превышающую фоновые уровни, только в одном сайте. Авторы предложили модель связывания с Cas9 и опосредованного им расщепления с двумя состояниями, в которой последовательность, комплементарная затравочной, запускает связывание, но для расщепления необходимо образование многочисленных пар с целевой ДНК.

Hsu 2014 представляет собой обзорную статью, в которой в общих чертах обсуждается история CRISPR-Cas9 от йогуртной культуры до редактирования генома, в том числе генетический скрининг клеток, которая содержится в информации, данных и полученных результатах в заявках, из которых происходит настоящее описание, поданных до 5 июня 2014 г. Общие идеи Hsu 2014 не включают конкретные модели животных из настоящего описания.

Настоящее изобретение относится к конструированию и оптимизации систем, способов и композиций, применяемых для контроля экспрессии генов, включающего целенаправленное воздействие на последовательность, такое как внесение изменений в геном или редактирование генов, связанное с системой CRISPR-Cas и ее компонентами. В преимущественных вариантах осуществления фермент Cas представляет собой Cas9.

Полинуклеотидная последовательность CRISPR-Cas обычно именуется в данном документе направляющей или даже направляющей РНК (sgRNA), хотя будет понятно, что данная терминология ранее не являлась обычной. Дополнительно, в данном документе делается ссылка на систему CRISPR-Cas9, хотя следует иметь в виду, что это общая ссылка на любой Cas, при условии что он обладает функцией нуклеазы для индукции DSB, однонитевого разрыва или двойного однонитевого разрыва, хотя Cas9 является предпочтительным, a SaCas9 является особенно предпочтительным.

Некоторые из основных положений данных по печени в настоящем изобретении обобщены ниже и касаются постмитотических клеток в целом, поскольку клетки печени обычно являются постмитотическими.

AAV2/8

Предпочтительная доставка системы CRISPR-Cas осуществляется посредством вирусного вектора. Этот вектор может представлять собой лентивирусный вектор или вектор на основе AAV, как подробно обсуждается в данном документе. В частности, авторы настоящего изобретения продемонстрировали, что AAV является предпочтительным примером вирусного вектора. В рамках этого авторы настоящего изобретения перешли к демонстрации того, что AAV8 и, в частности, AAV2/8 (AAV8, упакованный с помощью ITR AAV2 в качестве упаковочного сигнала) является применимым для доставки в печень, в особенности in vivo.

Фенотипические изменения, наблюдаемые in vivo

Как обсуждается в другом месте в данном документе, авторы настоящего изобретения были способны продемонстрировать in vivo, что фенотипическое изменение можно выявить. Это является значительным шагом вперед, поскольку недостаток, часто сглаживаемый посредством RNAi, заключается в отсутствии наблюдаемого длительного эффекта. В настоящем изобретении впервые можно увидеть фенотипическое изменение в печени. Предпочтительной схемой для его достижения является применяемая в примере 36. Ее важные элементы являются предпочтительными в отдельности или в комбинации, а именно:

SaCas9;

применение химерной направляющей РНК, содержащей направляющую последовательность, tracr-последовательность и парную tracr-последовательность;

что касается tracr-последовательности, tracr Sa является предпочтительной для привлечения SaCas9;

AAV8 или, более предпочтительно, AAV2/8;

для экспериментальных целей Rosa26 является применимым отрицательным контролем;

хотя применение промотора CMV в векторе AAV является целесообразным, особенно эффективным является применение печеночноспецифического промотора (для целенаправленного воздействия на печень), такого как TBG;

мишень или мишени могут находиться в широком диапазоне, поскольку было показано, что CRISPR имеет широкую применимость среди мишеней, так как ее направляющие последовательности успешно доставляются, а ферменты Css9 экспрессируются надлежащим образом. Однако, предпочтительные мишени в печени (для воздействия на которые могут быть предназначены направляющие последовательности), тем не менее, включают одну или несколько из: PCSK9; Hmgcr; SERPINA1; АроВ и/или LDL.

Соответственно, в некоторых вариантах осуществления особенно предпочтительно, чтобы фермент Cas представлял собой SaCas9. Полинуклеотидная последовательность CRISPR-Cas предпочтительно является химерной и предпочтительно включает в себя tracr Sa, где Cas9 представляет собой SaCas9. Можно применять вирусный вектор, который предпочтительно представляет собой AAV2/8. Кроме того, наиболее подходящим является печеночноспецифический промотор, и предпочтительным примером является TBG. Все из этого можно применять в комбинации с получением химерной полинуклеотидной последовательности CRISPR-Cas, включающей в себя tracr Sa, где Cas9 представляет собой SaCas9, а вектор представляет собой AAV2/8, и по меньшей мере Cas9 находится под контролем печеночноспецифического промотора, такого как TBG. Данная система может быть направлена на любую из вышеприведенных мишеней, в частности, АроВ ввиду его важной роли в ожирении.

В недавней статье Yin и Anderson в Nature Biotech (NBT 2884, упоминаемой в данном документе) дополнительно подтверждены фенотипические изменения in vivo, уже продемонстрированные авторами настоящего изобретения.

Дополнительные данные, приведенные авторами настоящего изобретения, в этом случае дают дополнительное подтверждение посредством демонстрации эффективного редактирования в соматической ткани печени in vivo с помощью Cas9. Более того, доставка с помощью AAV2/8 и применение SaCas9 опять-таки демонстрируют применимость данного конкретного подхода in vivo. На предпочтительный АроВ вновь осуществляли целенаправленное воздействие.

В последующих примерах 36 и 37 показаны превосходные in vivo данные об эффективности индукции фенотипического изменения in vivo: в частности, относительно АроВ, гена, участвующего в метаболизме липидов, при этом в примере 38 показана применимость методики к постмитотическим клеткам, среди которых клетки печени являются важным примером. В примере 39 показано, что для целей выявления предпочтительными являются множественные эпитопные метки.

Хотя предпочтительными являются вирусные векторы, в некоторых вариантах осуществления применение пептидов, проникающих в клетку, является жизнеспособной альтернативой и поэтому также является предпочтительным.

В примере 36 показано, что в случае использования систем CRISPR-Cas наблюдаются как генотипические, так и, что особенно важно, фенотипические изменения. Система CRISPR-Cas9, хотя и не только она, являлась эффективной в индукции фенотипического изменения in vivo.

В частности, мишень представляла собой АроВ, ген, участвующий в метаболизме липидов. Обнадеживающим является то, что можно сказать, что АроВ является ''золотым стандартом'' в доставке в печень и широко применяется в мышиных моделях ожирения. В некоторых вариантах осуществления клетка печени является предпочтительной постмитотической клеткой, хотя она может также быть исключена в других вариантах осуществления. В любом случае, настоящее изобретение обеспечивает подтверждение принципа, заключающегося в том, что фенотипическое изменение наблюдается даже in vivo, и это в равной степени применимо к другим постмитотическим клеткам. Так, пример 39 обеспечивает дополнительное подтверждение этого в отдельной ткани, головном мозге, в случае постмитотических нейронов.

Доставку в примере 37 осуществляли посредством внутривенной инъекции. Применяли вектор на основе AAV, а также печеночноспецифический промотор (TBG) для Cas9.

Доставка посредством экспрессии с вирусного вектора, рассматриваемая здесь, является улучшением по сравнению с предложенным Anderson/Yin (NBT 2884) применением гидродинамической доставки в качестве способа доставки, поскольку для гидродинамической доставки требуется инъекция нескольких мл жидкости, что является стрессовым для организма мыши и может быть смертельным. Гидродинамическая доставка лучше всего подходит для доставки плазмидной (''оголенной'') ДНК, тогда как заявители показали, что упаковка направляющей последовательности и последовательности Cas9 в вирусный вектор доставки является предпочтительной с точки зрения значительно возрастающей эффективности. Более того, необходимо вводить лишь относительно небольшие объемы, и это можно выполнить внутривенно (i.v.), что, вероятно, является намного более приемлемым с терапевтической точки зрения.

Особенно обнадеживающим было то, что для гена, являющегося ''золотым стандартом'' в печени, такого как АроВ, наблюдали не только генотипические изменения, но регистрировали также и фенотипические изменения. Предыдущая работа с PCSK9 показала генотипические, но не фенотипические изменения, так что фенотипические изменения, наблюдаемые для АроВ, подтверждают возможность доставки CRISPR в печень и ее способность к осуществлению фенотипического изменения в ней. Ее применяют в сочетании с более приемлемыми с терапевтической точки зрения способами доставки (i.v. по сравнению с гидродинамической доставкой). В связи с этим вирусная доставка системы CRISPR-Cas9 (направляющей последовательности и Cas9), особенно внутривенная, является предпочтительной.

Потенциальные мишени включают, без ограничения, PCSK9, HMGCR, АРОВ, LDLR, ANGPTL3, F8, F9/FIX, ААТ, FAH, HPD, TAT, ATP7B, UGT1A1, ОТС, ARH.

Соответственно, представлены способы индукции фенотипического изменения in vivo, включающие введение системы CRISPR-Cas9 в целевые клетки, например, в печень. В данном документе описаны подходящие пути доставки, но в некоторых вариантах осуществления предпочтительной является i.v. инъекция. Предпочтительными являются вирусные векторы, в особенности на основе AAV, в частности, AAV серотипа 2/8.

Также представлена система CRISPR-Cas9, содержащая одну или несколько направляющих последовательностей, осуществляющих нацеливание на гены, участвующие в метаболизме липидов, например АроВ. Также предусмотрены способы лечения ожирения, включающие введение указанной системы CRISPR-Cas9. Мышиная модель, содержащая в печени один или несколько генов с нокдауном, в частности, генов, участвующих в метаболизме липидов, например, включающих АроВ, является предпочтительной.

Печеночноспецифические промоторы для Cas9 будут очевидными, но могут включать перечисленные в данном документе. Предпочтительным примером является TBG.

Как показано в примере 38, направляющая последовательность может иметь длину 18-23 нуклеотида. Ее длина может составлять 18-22, или 19-22, или 18-21, 20-22, но предпочтительно 22 и наиболее предпочтительно 21 нуклеотид.

Также представлено подтверждение принципа успешной упаковки направляющей последовательности в интрон SaCas9. Соответственно, системы CRISPR-Cas9, где одна или несколько направляющих последовательностей упакованы (помещены или встроены) в интрон Cas9, являются предпочтительными.

Промотор H1 может применяться и может быть предпочтительным в некоторых обстоятельствах.

Дополняя работу Ran (Cell, 154, 21 Aug 2013), исследовали степень перекрывания в подходе с двумя направляющими последовательностями с использованием двойной никазы D10A. Оптимальные результаты демонстрировались от -5 до +1 п.о. (от 5' до 5'). Соответственно, предпочтительным является применение подхода с двумя направляющими последовательностями для сведения к минимуму нецелевых эффектов. Они предпочтительно перекрываются или близки к перекрыванию на своих 5'-концах в различных нитях ДНК в геномной мишени. Перекрывание предпочтительно находится в диапазоне от -5 до +1 п.о. В этих случаях будет понятно, что Cas9 является двойной никазой, такой как предпочтительный вариант D10A.

Для Cas9 предпочтительными являются множественные или повторяющиеся эпитопные метки. В частности, в примере 39 показана тройная эпитопная метка для улучшения выявления. Метка предпочтительно представляет собой повтор, более предпочтительно тройной повтор. НА является предпочтительной эпитопной меткой для Cas9. Тройная эпитопная НА-метка, таким образом, является предпочтительной в некоторых вариантах осуществления.

В примере 39 представлены следующие конкретные положения. В нем представлены:

первая демонстрация успешной опосредованной AAV доставки Cas9 in vivo, a также эффективной модификации генома в постмитотических нейронах;

разработка методики мечения ядер, позволяющей осуществлять простое выделение ядер нейронов из клеток, экспрессирующих Cas9 и sgRNA;

демонстрация путей применения анализа транскриптома нейрона путем секвенирования РНК;

то, как электрофизиологические исследования и другие методики можно объединить с опосредованным Cas9 внесением изменений в геном для определения фенотипических изменений и

демонстрация мультиплексного целенаправленного воздействия и возможности изучения функций генов по поведению грызунов с помощью опосредованного Cas9 редактирования генома.

На основании этого можно увидеть, что пример 39 предусматривает дальнейшее подтверждение концепции в двух основных областях: в понимании и тестировании функций генов, в том числе создании и тестировании моделей; и в генной терапии.

Дополнительный аспект, обсуждаемый в дальнейшем ниже, относится к способу мечения ядер.

Будет понятно, что ссылка на системы CRISPR-Cas9 в данном документе является сокращенной ссылкой на ферменты Cas9, представленные в данном документе, в комбинации с направляющими последовательностями или направляющими последовательностями, применяемыми для нацеливания на одну или несколько геномных последовательностей. Ссылка на направляющую(направляющие) последовательность(последовательности) включает sgRNA, а также химерные полинуклеотидные последовательности, описанные в данном документе, содержащие направляющие последовательности, способные к гибридизации с целевыми последовательностями в геноме субъекта, парную tracr-последовательность и tracr-последовательность.

Данные по сути показывают фенотипические изменения, обусловленные нокдауном генов с помощью двух отдельных систем CRISPR-Cas9 согласно настоящему изобретению (направляющей РНК в комбинации с ферментом Cas9), в данном случае для успешного изменения функционирования генов. Выбранной тканью была ткань головного мозга, но результаты обеспечивают подтверждение принципа действия для широкого диапазона постмитотических тканей. Это является важным отличием, поскольку предыдущая работа была сосредоточена на делящихся клетках (т.е. премитотических).

Иными словами, при том, что SpCas9 широко применялся в генной инженерии делящихся клеток, заявители продемонстрировали, что SpCas9 также можно применять для геномной инженерии постмитотических нейронов. Ее осуществляют с высокой эффективностью посредством опосредованного NHEJ образования вставок/делеций для получения нокдаунов, но также предусмотрены применения в терапии, включающие коррекцию посредством механизма HDR (при обеспечении наличия матрицы для репарации). Оба эти направления зависят от успешной доставки и функциональной экспрессии Cas9 и направляющей или направляющих РНК, что показано в данном документе.

Тот факт, что генотипические изменения, индуцируемые системами CRISPR-Cas9, впоследствии приводят к фенотипическому изменению, также важен для обеих вышеуказанных областей (исследования функций генов и генной терапии).

В первой системе CRISPR-Cas9 использовали направляющие последовательности, направленные на (осуществляющие нацеливание на) Меср2. Двухвекторная система CRISPR-Cas9, в которой один вектор содержит направляющую последовательность, а другой содержит Cas9, использовалась успешно, что предоставляло дополнительное подтверждение принципа действия для таких двухвекторных систем. Двухвекторную систему CRISPR-Cas9 успешно доставляли посредством стереотаксической инъекции в два отдельных участка головного мозга, а именно в зубчатую извилину гиппокампа и зрительную кору. В обоих случаях наблюдалось внесение изменений в гены в отношении одного и того же гена, Меср2, что указывало на успешную доставку двухвекторной системы и ее действие в соответствии с ожиданием, с транскрипцией и функциональной активностью фермента Cas9 (в данном случае SpCas9) и успешным привлечением Cas9 к целевой геномной последовательности с помощью направляющих последовательностей.

Опосредованная AAV доставка SpCas9 и sgRNA in vivo обеспечивает быструю и эффективную технологию осуществления внесения точных изменений в геном в интактных нервных цепях. В силу этого применяемым вектором являлся вектор на основе AAV, что дает дополнительное основание для его применения в общем и в двухвекторных системах CRISPR-Cas9 в частности, в особенности в постмитотических клетках и тканях и, в частности, в головном мозге.

Разумеется, будет понятно, что выбор промотора является важным в осуществлении экспрессии системы CRISPR-Cas9, в частности, Cas9 или как направляющей(направляющих) последовательности(последовательностей), так и Cas9. Подходящие примеры специфичности к клетке и стадии жизненного цикла клетки можно определить из литературы. Тем не менее, некоторые неограничивающие примеры включают: TBG, печеночноспецифический промотор, применяемый в данном документе для управления экспрессией SaCas9; промотор H1; усеченный промотор H1; промотор U6. Также, поскольку для направляющих последовательностей не обязательно нужен конкретный промотор, одна или несколько направляющих последовательностей могут быть упакованы аналогичным образом в интрон Cas9.

Вторая применяемая система CRISPR-Cas9 предусматривает мультиплексный подход. Одним из ключевых преимуществ системы SpCas9 является ее способность к облегчению мультиплексного редактирования генома. Эта вторая система успешно целенаправленно воздействовала на три или более генов из одного семейства (в данном случае Dmnt1, 3а и 3b) благодаря включению подходящих направляющих последовательностей и приводила к стабильным нокаутам нескольких генов. Это явление широко применяется для изучения функций не только отдельных генов, но также и целых семейств генов в тканях живых животных. Оно является особенно важным для таких тканей, как головной мозг, где оно не было возможным ранее или могло быть достигнуто лишь спустя долгие годы применения методов классической генетики. Заявители показали, что у нормального животного в постмитотических клетках может иметь место внесение изменений (и даже полный нокдаун) в один или несколько генов. Это, однако, в равной степени можно применять к модельному организму (например, уже несущему мутацию или внесенное изменение в гене или имеющему некоторым образом измененную экспрессию) или трансгенному организму, предоставляя быструю альтернативу существующим способам получения модельных организмов и применения модельных организмов для понимания функций генов. Для осуществления последующих циклов внесения изменений в гены и/или возобновления их действия (восстановление функции гена, например, путем коррекции гена с внесенными изменениями посредством обеспечения наличия, например, матрицы для репарации, такой как ssDNA, подходящей для HDR) в том же организме можно использовать дополнительные направляющие последовательности (и/или целые системы CRISPR-Cas9).

Известно, что при опосредованном SpCas9 целенаправленном воздействии на один или несколько генов, как правило, могут воспроизводиться морфологические, электрофизиологические и поведенческие фенотипы, наблюдаемые при применении классических, более трудоемких генетических мышиных моделей.

Альтернативно нокдауну целых семейств генов или родственных генов, данные, приведенные в данном документе, также предоставляют подтверждение принципа, что в равной степени возможен одновременный нокдаун трех или более неродственных генов. Это применимо ко всем тканям, но особенно убедительно представлено в отношении постмитотических тканей, особенно головного мозга.

Другим применимым аспектом данной работы является то, что она продемонстрировала, что для исследования функций генов можно прибегнуть к комбинированному, или интегрированному, подходу, в котором используют CRISPR для осуществления генотипического изменения, а затем используют классические инструменты, такие как электрофизиологическое исследование (особенно в отношении ткани головного мозга и CNS), снятие биохимических, относящихся к секвенированию, электрофизиологических и/или поведенческих показателей, для установления того, какие фенотипические изменения, если они имеют место, обусловлены генотипическим изменением, индуцированным системой CRISPR-Cas9. Например, в головном мозге он позволяет изучать функции отдельных генов, а также их групп в нервных процессах и их роль в мозговых нарушениях in vivo.

Успешное внесение изменений в гены в данной работе в равной степени применимо для коррекции или восстановления функции гена, т.е. для применения систем CRISPR-Cas9 в генной терапии. В частности, это относится к целенаправленному воздействию в постмитотических клетках, особенно в головном мозге.

В целом, применение систем CRISPR-Cas9 демонстрирует улучшения по сравнению с существующими методиками, такими как применение Zn-пальцев, разработка и получение которых занимает длительное время и которые не могут функционировать в мультиплексе, и shRNA, которые имеют слишком много нецелевых эффектов, тогда как нецелевые эффекты CRISPR можно свести к минимуму путем применения подходов с двойной никазой.

Целенаправленное воздействие в тканях

В работе в данном документе обосновано применение систем CRISPR-Cas9 для целенаправленного воздействия на гены в постмитотических клетках посредством доставки системы CRISPR-Cas9 в соответствующий участок (т.е. в клетки в органах или тканях, представляющих интерес). Предпочтительные ткани находятся в следующих органах:

почке;

пищеварительной системе, в том числе желудке, поджелудочной железе, двенадцатиперстной кишке, подвздошной кишке и/или толстой кишке;

сердце;

легком;

головном мозге, в частности нейроны, и/или ЦНС в целом;

глазу, в том числе ткань сетчатки;

ухе, в том числе внутреннее ухо;

коже;

мышце;

кости и/или

печени в целом.

Будет понятно, что многие из вышеперечисленных органов могут содержать премитотические клетки, но данный аспект настоящего изобретения направлен на постмитотические клетки или ткани в этих органах.

В частности, для заявителей предпочтительным органом является почка или головной мозг. Данные, в частности, демонстрируют доставку в зубчатую извилину гиппокампа и зрительную кору в головном мозге, которые являются предпочтительными тканями, хотя другие ткани, включающие любое одно или несколько из следующего: первичную моторную кору, первичную слуховую кору, первичную соматосенсорную кору, мозжечок, главную обонятельную луковицу, префронтальную кору, эндопириформное ядро, миндалевидное тело, черную субстанцию, полосатое тело, бледный шар, таламус, гипоталамус, парабрахиальное ядро, верхний оливарный комплекс, кохлеарные ядра, ядра сосцевидных тел, также являются предпочтительными в некоторых вариантах осуществления.

Клетки из головного мозга и, в частности, нейроны являются особенно предпочтительными.

Выбор промотора для управления экспрессией системы CRISPR-Cas9, в частности Cas9, является важным, как упоминается выше. При выборе промотора необходимо учитывать стадию клеточного цикла (раннюю/позднюю) и тип клеток, поскольку промоторы будут специфичными к одному или нескольким типам клеток и одной или нескольким стадиям клеточного цикла. Подходящие промоторы могут в некоторых вариантах осуществления включать в себя любой один или несколько из следующих.

В двухвекторной системе CRISPR-Cas9, применяемой для целенаправленного воздействия в головном мозге, в частности, в зубчатой извилине гиппокампа, кассеты экспрессии SpCas9 и sgRNA упакованы в два отдельных вирусных вектора. Cas9, в частности, SpCas9, таким образом, предпочтительно доставляют с помощью аденовирусных векторов, в частности AAV (т.е. в виде AAV-SpCas9). Направляющие последовательности предпочтительно доставляют в виде кассет экспрессии sgRNA с помощью аденовирусных векторов, в частности на основе AAV (т.е. в виде AAV-Sp-направляющая последовательность). Предпочтительным путем для данной ткани (зубчатой извилины гиппокампа) и для головного мозга в целом является стереотаксическая инъекция.

Понимание и тестирование функций генов и создание и применение моделей для этого

Состояния, которые могут быть рассмотрены, включают болезнь Гентингтона, но по сути включают любое состояние, обнаруживаемое в постмитотических клетках, и особенно те, изучение которых in vivo может принести пользу или для которых отсутствует применимая модель.

Как упоминается выше, системы CRISPR-Cas9 можно применять для исследования функций одного или нескольких генов в постмитотических клетках. Это можно осуществлять посредством доставки системы CRISPR-Cas9 в постмитотическую клетку и ее экспрессии в ней, где направляющая(направляющие) последовательность(последовательности) системы CRISPR-Cas9 предназначены для привлечения Cas9 к геномной мишени или мишеням, представляющим интерес. В то же время, если Cas9 уже содержится в постмитотической клетке в форме белка (транскрибированной), то будет достаточно доставить в постмитотическую клетку направляющие последовательности. Если Cas9 уже содержится в постмитотической клетке в форме полинуклеотида (нетранскрибированной), то будет необходима доставка направляющих последовательностей в постмитотическую клетку, а также индукция транскрипции полинуклеотида Cas9. В данном случае может быть преимущественным наличие Cas9 под контролем индуцируемого или репрессируемого промотора, такого как система tet-on/off (тетрациклиновая).

Одним особенно перспективным аспектом является объединение методик CRISPR с фенотипическими анализами для определения фенотипических изменений, если они имеют место, обусловленных внесением изменений в гены, в частности, нокдаунами. Например, в примере 39 показано, чего можно достичь с помощью целенаправленного внесения изменений в геном в сочетании со снятием количественных показателей для обеспечения проникновения в сущность биологических функций конкретных элементов генома. В частности, опосредованное Cas9 редактирование генома в головном мозге in vivo можно также сочетать с электрофизиологической регистрацией для изучения эффекта от внесения изменений в геном в отношении конкретных типов клеток или компонентов нервной цепи. В более широком смысле применение систем CRISPR-Cas9 (для обеспечения опосредованного Cas9 внесения изменений в геном) можно объединять с биохимическим, связанным с секвенированием, электрофизиологическим и поведенческим анализом для изучения функций элемента генома, подвергнутого целенаправленному воздействию.

Таким образом, в одном аспекте представлен способ исследования функций одного или нескольких генов в постмитотической клетке, включающий:

индукцию дефектного генотипа или нокдауна генов, как описано ниже; и

определение изменений в экспрессии одного или нескольких генов в данном состоянии с исследованием, таким образом, функций одного или нескольких генов.

Способ также необязательно может включать

трансплантацию второй популяции клеток субъекту с индукцией, таким образом, состояния, ассоциированного с дефектным генотипом или нокдауном генов. Это может предшествовать этапу определения.

Следующее относится в широком смысле к соответствующим аспектам настоящего изобретения. Клетка может находиться в субъекте, таком как человек, животное или модельный организм, так что функции генов исследуют in vivo. Однако, также предусмотрено, что клетка может находиться ех vivo, например, в клеточной культуре или в модельном органе или органоиде. В некоторых вариантах осуществления способ может включать выделение первой популяции клеток из субъекта, необязательно их культивирование и их трансдукцию одной или несколькими системами CRISPR-Cas9. За этим может следовать необязательное дополнительное культивирование. Затем может происходить трансплантация трансдуцированных клеток обратно субъекту.

Клетка может быть получена из любой ткани или органа, описанных в данном документе. Головной мозг является одним предпочтительным примером, обеспечивающим осуществление указанного способа исследования функций одного или нескольких генов, где постмитотическая клетка является клеткой головного мозга, например, нейроном. В частности, он обеспечивает исследование функций генов, касающихся поведения животного, in vivo. Животное предпочтительно является млекопитающим, например, грызуном. С учетом сложности нервной системы, состоящей из переплетенных сетей разнородных типов клеток, способность к эффективному редактированию генома нейронов in vivo позволяет осуществлять прямое тестирование функций генов в надлежащих типах клеток, погруженных в естественное окружение. Это подтверждается данными заявителей, где нокаутные мыши демонстрировали ухудшение консолидации памяти при тестировании в условиях тренировочного контекста. Результаты заявителей демонстрируют, что опосредованный CRISPR-Cas9 нокаут представителей семейства DNMT в нейронах зубчатой извилины является достаточным для изучения функций генов в поведенческих задачах.

Это показывает универсальность Cas9 в облегчении целенаправленного нокаута генов в головном мозге млекопитающих in vivo для изучения функций генов и, в частности, для анализа нейронных цепей. Введение стабильных нокаутов нескольких генов в головной мозг живых животных будет иметь потенциально многообещающие применения, такие как казуальное исследование полигенных механизмов, лежащих в основе физиологических и невропатологических состояний.

Характерной особенностью данной работы является то, что заявители выбрали промотор Меср2 мыши (235 п.о., рМеср2)7 и минимальный сигнал полиаденилирования (48 п.о., spA) на основании их способности к обеспечению достаточных уровней экспрессии SpCas9 в культивируемых первичных кортикальных нейронах мыши. Ген Меср2 играет важнейшую роль при синдроме Ретта, типе расстройства аутистического спектра. Для целенаправленного воздействия на Меср2 заявители вначале разработали несколько sgRNA, осуществляющих нацеливание на экзон 3 гена Меср2 мыши, и оценивали их эффективность с применением клеток Neuro-2a. Наиболее эффективную sgRNA идентифицировали путем применения анализа с помощью нуклеазы SURVEYOR. Доставку осуществляли посредством стереотаксической инъекции смеси (в соотношении 1:1) векторов AAV-SpCas9 и AAV-Sp-направляющая последовательность высокого титра. Заявители также успешно протестировали возможность мультиплексного редактирования генома в головном мозге; заявители разработали мультиплексный вектор экспрессии sgRNA, состоящий из трех sgRNA в тандеме вместе с GFP-KASH для мечения ядер.

Таким образом, также представлены способы индукции состояний, характеризирующихся одним или несколькими нокдаунами генов в постмитотической клетке. Примеры таких состояний являются многочисленными, но могут включать синдром Ретта, проиллюстрированный на примере. Подходящие промоторы будут очевидными, и промотор Меср2 является наиболее подходящим для синдрома Ретта. Одним из способов выбора промотора для управления экспрессией системы CRISPR-Cas9, в частности, Cas9, является выбор промотора для гена, представляющего интерес.

Таким образом, в одном аспекте представлен способ индукции состояний, характеризующихся одним или несколькими дефектными генами (или генотипами) или нокаутами генов в постмитотической клетке, который может включать:

трансдукцию первой популяции клеток не встречающейся в природе или сконструированной композицией, содержащей векторную систему, содержащую один или несколько векторов, содержащих

первый регуляторный элемент, функционально связанный с полинуклеотидной последовательностью химерной РНК (chiRNA) системы CRISPR-Cas, где полинуклеотидная последовательность содержит

одну, две, три, четыре или более направляющих последовательностей, способных к гибридизации с тремя или более целевыми последовательностями в геноме субъекта,

парную tracr-последовательность, и

tracr-последовательность, и

второй регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей фермент CRISPR, содержащий по меньшей мере одну или несколько последовательностей ядерной локализации (NLS), где (а), (b) и (с) расположены в 5'-3' ориентации,

где компоненты I и II находятся в одном и том же или разных векторах системы, где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплексов CRISPR с целевой последовательностью,

где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью,

где фермент CRISPR изменяет геном клеток первой популяции с получением второй популяции клеток, содержащих один или несколько дефектных генов или генов с нокдауном.

Способ также необязательно может включать

выделение первой популяции клеток из субъекта.

Способ также необязательно может включать

трансплантацию второй популяции клеток субъекту с индукцией, таким образом, пролиферативного состояния.

Она может включать индукцию нефункционального (которое включает частично нефункциональное) состояния генотипа в целевой клетке с получением, таким образом, модели для изучения (в том числе будущего восстановления функционального генотипа).

Системы CRISPR-Cas9 также можно применять для облегчения изучения функций генов в клеточных анализах путем обеспечения целенаправленного нокаута в постмитотических нейронах.

Способы доставки нуклеотидов в нервные клетки хорошо известны и рассматриваются Karra and Dahm в The Journal of Neuroscience (5 May 2010, 30(18): 6171-6177; doi: 10.1523/JNEUROSCI.0183-10.2010). Примеры включают электрические способы трансфекции (такие как электропорация, нуклеофекция и электропорация отдельных клеток); химические способы трансфекции (такие как совместное осаждение фосфатом Са2+ и липофекция); вирусная доставка (как, например, с помощью аденовируса, аденоассоциированного вируса (AAV), лентивируса и вируса простого герпеса) и физические способы трансфекции (такие как микроинъекция и баллистическая трансфекция (применение частиц золота, покрытых ДНК)). Все их можно применять для доставки системы CRISPR-Cas9, но липофекция или вирусные способы, в особенности с применением AAV или лентивируса, являются предпочтительными.

Модели

Представлены модели с нокдауном одного или нескольких генов. Примером может быть модель синдрома Ретта с нокдауном Меср2 на грызунах. В других моделях предусмотрены нокдауны генов семейства Dmnt, в частности, нокдауны Dmnt1, 3а и 3b. В силу этого представлены модели, в которых изучают неврологические состояния. Все, что должно быть сделано - это идентификация целевых генов, представляющих интерес, разработка подходящей(подходящих) направляющей(направляющих) последовательности(последовательностей) и включение их в состав подходящей системы CRISPR-Cas9, а также ее доставка в постмитотическую(постмитотические) клетку(клетки) in vivo либо ex vivo в соответствии с требованиями. Например, представлены модели, которые могут иметь измененную морфологию дендритного дерева и/или плотность шипиков.

Как упоминается выше, представлены также модельные ткани, такие как органоиды или ''печень на чипе'' или их эквиваленты, отличные от печени, такие как ткани уха, почки и головного мозга, например, на чипе или закрепленные на подложке. Предпочтительными являются животные модели и модельные ткани. Они могут быть уже трансформированы с помощью Cas9, так что они содержат Cas9 в форме нуклеотида или белка, как упоминается выше. Их преимущество заключается в том, что Cas9 не нужно доставлять вместе с направляющей(направляющими) последовательностью(последовательностями), и это, в свою очередь, может обеспечивать значительно более высокую степень мультиплексирования направляющих последовательностей, которые следует поместить в векторы доставки. В этом случае применение индуцируемых или репрессируемых систем, таких как tet-on или tet-off, здесь также может быть преимущественным.

Все эти модели можно получить с применением системы CRISPR-Cas9, как описано выше. Ввиду универсальности системы CRISPR-Cas9 диапазон возможных моделей, на человеке, грызунах, млекопитающих либо иных, является весьма разнообразным, и он может быть установлен путем простого выбора соответствующей(соответствующих) направляющей(направляющих) последовательности(последовательностей). Также представлены способы создания таких моделей, которые включают следующее.

Генная терапия

Данные в примере 39 сосредотачивают внимание на внесении изменений в гены, главным образом на нокдауне. Нокдаун генов, вероятно, является лишь небольшой, хотя и важной частью общей совокупности возможных применений систем CRISPR-Cas9 в генной терапии. Как уже было показано в статье Yin and Anderson (Nature Biotech 2884, опубликованной в режиме онлайн 30 марта 2014 г.), функциональный фенотип можно восстановить после коррекции мутации недостаточности при наследственной тирозинемии I типа (HTI), в иных случаях смертельном состоянии, вызываемом мутацией фумарилацетоацетатгидролазы (FАН) (замена G на А в последнем нуклеотиде экзона 8), вызывающей пропуск экзона 8 при сплайсинге и обуславливающей образование усеченного нестабильного белка FAH, что приводит к накоплению токсичных метаболитов. Коррекция мутации А с возвращением к генотипу G дикого типа приводила к восстановлению фенотипа.

В силу этого подходы, принятые в настоящей работе, демонстрируют, что настоящее изобретение, вероятно, может применяться в генной терапии. В частности, подход с двумя векторами, подход с мечением ядер, характерные особенности доставки в головной мозг (форма инъекции, применяемые промоторы и/или вирусные векторы), а также мультиплексирование (применение нескольких направляющих последовательностей для нескольких мишеней в одном и том же либо в разных генах) можно в равной степени применять в коррекционной генной терапии (т.е. где коррекции подвергается дефектный генотип), а также и в проиллюстрированном на примере нокдауне генов. Основным различием между коррекционной генной терапией и нокдауном генов является то, что в целях коррекции дефектного генотипа, как, например, точечной мутации (например, при муковисцидозе, см. ссылку на Schwank et al, Cell Stem Cell 13, 653-658 5 Dec 2013), преимущественным является обеспечение наличия матрицы для репарации для стимуляции механизма HDR, а в идеальном случае также обеспечение наличия подходящей никазы Cas9.

Соответственно, векторы по настоящему изобретению предпочтительно целенаправленно воздействуют на постмитотические клетки. Если направляющая последовательность или направляющие последовательности осуществляют нацеливание на дефектный генотип, то они предпочтительно также представлены вместе с матрицей для репарации, например ssDNA, соответствующей скорректированной последовательности (генотипу, обеспечивающему наличие функционального фенотипа). Матрицы для репарации описаны в данном документе. Cas9 можно предусматривать в том же векторе, что и направляющую последовательность или направляющие последовательности, или в другом векторе. Векторы предпочтительно являются вирусными векторами, более предпочтительно аденовирусными векторами и наиболее предпочтительно векторами на основе AAV. Доставку в клетки предпочтительно осуществляют посредством внутривенной инъекции или посредством стереотаксической инъекции в соответствующих случаях. Выбор промотора также может быть важен, и предпочтительные примеры приведены в данном документе.

Представлены способы лечения генетических заболеваний или состояний, обусловленных или ассоциированных с дефектным генотипом в постмитотических клетках, включающие доставку системы CRISPR-Cas9 в соответствующую клетку. Дефектный генотип может представлять собой генотип, отличный от дикого типа. В частности, одиночные точечные мутации и/или моногенные нарушения особенно подходят для лечения с помощью систем CRISPR-Cas9. Если редактирования или коррекции требуют несколько генов, то для одновременного целенаправленного воздействия на всех них можно применять мультиплексный подход. Альтернативно, могут быть предусмотрены два или более цикла применения различных систем CRISPR-Cas9. Целью коррекции предпочтительно является получение генотипа дикого типа. Он не обязательно должен быть наиболее распространенным генотипом, при условии, что в фенотипе восстанавливается или улучшается функция.

Примером восстановленного фенотипа является восстановление слуха с восстановлением функции VGLUT3 во внутреннем ухе и, следовательно, слуха у мышей (Omar Akil, Rebecca P. Seal, Kevin Burke, Chuansong Wang, Aurash Alemi, Matthew During, Robert H. Edwards, Lawrence R. Lustig. Restoration of Hearing in the VGLUT3 Knockout Mouse Using Virally Mediated Gene Therapy, Neuron, 2012; 75 (2): 283 DOI: 10.1016/j.neuron.2012.05.019). Его осуществляли с помощью опосредованной AAV доставки самого VGLUT3, но вполне вероятно, что также можно было применять систему CRISPR-Cas9, предпочтительно также с помощью векторов на основе AAV, для целенаправленного воздействия в клетках внутреннего уха и коррекции нефункционального генотипа VGLUT3 с аналогичными фенотипическими последствиями, а именно восстановлением слуха. В силу этого предпочтительной является доставка системы CRISPR-Cas9 во внутреннее ухо, предпочтительно, с помощью векторов на основе AAV с лечением, таким образом, потери слуха. В связи с этим можно заметить, что предпочтительным является восстановление функций генов в органах чувств, таких как глаз, в том числе сетчатка, нос и ухо (в частности, внутреннее ухо).

Сравнительно недавний обзор, включающий обсуждение нарушений в постмитотических тканях (в глазу, ухе и за их пределами), представлен Kaufmann и соавт. (ЕМВО Mol Med (2013, 5, р. 1642-1661). Это подтверждает применимость AAV в коррекции моногенных нарушений в постмитотических тканях. В нем отмечено, что ''в сочетании с другими характеристиками, такими как низкая воспалительная активность, они продемонстрировали, что обладают превосходным профилем безопасности и поэтому являются весьма привлекательными инструментами для генной терапии in vivo. Так, Glybera® является рекомбинантным AAV для прямой внутримышечной инъекции…''. В данной статье вместе с цитируемыми документами рассматривается генная терапия в сетчатке, центральной нервной системе, печени, скелетной мускулатуре и сердечной мышце в качестве целевых тканей. Также в ней вместе с цитируемыми документами указано, что ''в начальных исследованиях использовали вектор-прототип на основе AAV серотипа 2, ассортимент векторов на основе AAV недавно был расширен с включением дополнительных серотипов и даже сконструированных капсидов''. Статья Kaufmann и документы, цитируемые в статье Kaufmann, настоящим включены в данный документ с помощью ссылки.

Анализ транскриптома путем секвенирования РНК

Комбинация опосредованного SpCas9 внесения изменений в геном и анализа путем секвенирования РНК на популяционном уровне дает возможность охарактеризовать регуляцию транскрипции и предположить, какие гены могут быть важными для конкретных функций или болезненных процессов в рассматриваемых клетках. В частности, клетки являются клетками головного мозга, в частности, нейронами. Быстродействующие методики, такие как применение системы CRISPR-Cas9, являются преимущественными в изучении транскриптома, который по своей природе является изменчивым. В силу этого представлено применение систем CRISPR-Cas9 согласно настоящему изобретению в анализе транскриптома (секвенировании РНК).

Способ мечения ядер

Для облегчения иммунофлуоресцентной идентификации нейронов, экспрессирующих SpCas9, заявители метили SpCas9 эпитопной НА-меткой (полученной из гемагглютинина вируса гриппа человека, обычной эпитопной меткой, широко применяемой в векторах экспрессии).

Заявители упаковывали в вектор AAV-Sp-направляющая последовательность кассету экспрессии U6-sgRNA, а также зеленый флуоресцентный белок (GFP), слитый с ядерным трансмембранным доменом KASH, под управлением промотора гена синапсина I человека. Белок слияния GFP-KASH направляет GFP во внешнюю ядерную мембрану и обеспечивает флуоресцентную идентификацию и очистку интактных ядер нейронов, трансдуцированных вектором AAV-Sp-направляющая последовательность.

Соответственно, векторы по настоящему изобретению предпочтительно приспосабливают аналогичным образом. Таким образом, представлены векторы, где Cas9 помечен эпитопной меткой, такой как эпитопная НА-метка. Cas9 может представлять собой любой Cas9, описанный в данном документе, например, Sp или SaCas9, и может представлять собой любой вариант (такой как двойная никаза D10A и т.д.), при условии, что он помечен или может быть помечен соответствующим образом.

Векторы по настоящему изобретению могут также быть приспособлены так, чтобы направляющая РНК была упакована в кассету экспрессии, которая содержит:

репортерный белок и

необязательно подходящий промотор для направляющей РНК, такой как U6;

где репортерный белок слит с ядерным трансмембранным доменом, функционально связанным с подходящим для него промотором.

Репортерный белок предпочтительно представляет собой флуоресцентный белок,

например, один из зеленого, красного или желтого флуоресцентных белков (GFP, RFP, YFP) и т.д.

Примеры ядерных трансмембранных доменов включают KASH-подобные домены, домены Sun2, домены LEM. В некоторых предпочтительных вариантах осуществления ядерный трансмембранный домен представляет собой ядерный трансмембранный домен KASH. Промотор для трансмембранного домена предпочтительно представляет собой промотор гена синапсина I человека; см. также документы, цитируемые в данном документе.

Данный подход с мечением можно применять в рамках одновекторных или двухвекторных систем, но предпочтительно в рамках двухвекторных систем, поскольку в одновекторных системах пространство ограничено, и необходимость в отдельных метках также снижается.

Дополнительно, каждый аспект данной методики мечения можно применять независимо от другого, так что эпитопное мечение Cas9 можно применять в отдельности, или подход с кассетой с репортерным/флуоресцентным белком можно применять в отдельности, или, более предпочтительно, оба их можно применять вместе.

Публикация Kanasty and Anderson (Nature Materials, Vol 12 Nov 2013), изначально поданная 11 марта 2013 г. и опубликованная в режиме онлайн 23 октября 2013 г., является полезным обзором доставки средств для RNAi. Ввиду сходств между средствами для RNAi и направляющими последовательностями CRISPR идеи этого и других источников из уровня техники в отношении RNAi являются информативными относительно механизмов доставки направляющих последовательностей в системе CRISPR-Cas9 от заявителей. Некоторые из описанных методик также подходят для доставки Cas9. В некоторых случаях может быть целесообразной доставка направляющих последовательностей системы CRISPR-Cas9 от заявителей отдельно от Cas9.

Она может быть частью двухвекторной системы доставки, где векторы рассматриваются в самом широком смысле попросту как любые средства доставки, а не как конкретные вирусные векторы. Предусмотрено, что Cas9 можно доставлять с помощью вирусного вектора, и что направляющие последовательности, специфичные к геномным мишеням, доставляют отдельно. Как обсуждается в данном документе, направляющие последовательности можно доставлять с помощью тех же типов векторов, что и в случае Cas9, например, с использованием двухвекторной системы, где Cas9 доставляют в векторе на основе AAV, а направляющую(направляющие) последовательность(последовательности) доставляют в отдельном векторе на основе AAV. Это можно осуществлять практически одновременно (т.е. путем совместной доставки), но это также можно осуществлять в разные моменты времени, разделенные даже несколькими неделями или месяцами. Например, если были доставлены системы CRISPR-Cas9 для первого цикла, но затем впоследствии требуется обеспечение наличия дополнительных направляющих последовательностей, то первоначальный Cas9, который, как следует надеяться, по-прежнему является функциональным в целевых клетках, можно использовать повторно. Если Cas9 находится под контролем индуцируемого промотора, то предпочтительной является индукция транскрипции нового Cas9 в целевых клетках. В то же время, если применяется модель, экспрессирующая Cas9, представленная в данном документе, то необходимой является только доставка направляющей(направляющих) последовательности (последовательностей). Соответственно, если требуется доставка направляющей(направляющих) последовательности(последовательностей) отдельно от Cas9, то их можно доставлять практически таким же образом, как и средство для RNAi.

В силу этого обзор Kanasty является полезным в том, что указывает на ряд известных подходов, являющихся подходящими, сосредотачивая особое внимание на печени, хотя средства доставки, как правило, пригодны для широкого диапазона клеток. Примеры включают следующее:

''липосомную систему доставки, а также siRNA, конъюгированные с липофильными молекулами, которые взаимодействуют с сывороточными липопротеинами и впоследствии проникают в гепатоциты, поглощающие эти липопротеины'';

пегилирование;

конъюгаты, такие как:

динамические поликонъюгаты (DPC, наночастицы размером 10 нм), которые, как было показано, доставляют средства для RNAi с успешным подавлением экспрессии АроВ (что, таким образом, пересекается с работой заявителей по целенаправленному воздействию на АроВ с помощью системы CRISPR-Cas9); и

трехантенные конъюгаты GalNAc

являются ''высокоэффективными в обеих категориях'', в особенности GalNAc;

другие наночастицы, в том числе:

полимерные наночастицы на основе циклодекстрина (CDP), включающие дополнительные компоненты состава, такие как адамантин-PEG (AD-PEG) и адамантин-PEG-трансферрин (AD-PEG-Tf);

липидные наночастицы (LNP), включающие катионные или ионизируемые липиды, экранирующие липиды, холестерин и эндогенные или экзогенные нацеливающие лиганды. Примером эндогенного нацеливающего лиганда является ретинол-связывающий белок (RBP), применимый для нацеливания на звездчатые клетки печени и поджелудочной железы, которые экспрессируют рецептор RBP. Примером экзогенного нацеливающего лиганда является GalNac, который также осуществляет нацеливание на печень посредством асиалогликопротеинового рецептора на поверхности гепатоцитов. В ALN-VSP от Anlylams представлен комбинированный подход;

''фенестрация эндотелия печени позволяет молекулам диаметром 100-200 нм диффундировать из кровотока и получать доступ к гепатоцитам и другим клеткам печени'';

лиганды, такие как GalNAc, подходят для доставки в непаренхимные клетки печени, экспрессирующие маннозный рецептор, и в гепатоциты, где, как было показано, конъюгация подходящей siRNA с лигандом GalNAc обеспечивает успешное подавление экспрессии PCSK9; и

олигонуклеотидные наночастицы (ONP), состоящие из комплементарных фрагментов ДНК, предназначенных для гибридизации в предварительно определенную 3D-структуру. С помощью подходящих последовательностей с ''липкими'' 3'-концами к каждой частице могут быть прикреплены, и даже в определенном положении, 6 нитей siRNA. Гидродинамический диаметр составлял приблизительно 29 нм.

Эти подходы в некоторых вариантах осуществления являются предпочтительными для доставки по меньшей мере направляющих последовательностей системы CRISPR-Cas9. Особенно предпочтительными являются динамические поликонъюгаты или применение эндогенных нацеливающих лигандов, таких как ретинол-связывающий белок, или экзогенных нацеливающих лигандов, таких как GalNac.

В еще одном варианте осуществления редактирование генома, опосредованное CRISPR-Cas9, можно применять для коррекции мутации и/или фенотипа, связанных с заболеванием. Это редактирование генома, опосредованное CRISPR-Cas9, можно применять для коррекции мутации и/или фенотипа, связанных с заболеванием, в печени и/или гепатоцитах, что проиллюстрировано в рукописи Нао Yin и соавт. под названием ''Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype'', опубликованной в Nature Biotechnology, опубликованной в режиме онлайн 30 марта 2014 г.; исправленной в режиме онлайн 31 марта 2014 г., доступной на веб-сайте nature.com/doifinder/10.1038/nbt.2884, включенной в данный документ с помощью ссылки во всей своей полноте. Данная статья относится к опосредованной CRISPR-Cas9 коррекции мутации Fah в гепатоцитах в мышиной модели заболевания человека врожденной тирозинемии. Было показано, что доставка компонентов системы CRISPR-Cas9 с помощью гидродинамической инъекции приводила к исходному уровню экспрессии белка Fah дикого типа в ~1/250 клеток печени. Было дополнительно показано, что размножение Fah-положительных гепатоцитов избавляло от фенотипа потери массы тела.

Преимущество способов по настоящему изобретению заключается в том, что система CRISPR избегает нецелевого связывания и возникающих в результате этого побочных эффектов. Это достигается при применении систем, предусматривающих наличие высокой степени специфичности к последовательности в отношении целевой ДНК.

Cas9

Оптимизацию Cas9 можно применять для улучшения функционирования или для формирования новых функций, можно создавать химерные белки Cas9. Созданные заявителями образцы представлены в примере 6. Химерные белки Cas9 можно получать путем объединения фрагментов от различных гомологов Cas9. Например, в данном документе описаны два иллюстративных химерных белка Cas9 из группы Cas9. Например, заявители слили N-конец St1Cas9 (фрагмент из этого белка выделен жирным шрифтом) с С-концом SpCas9. Преимущество от создания химерных Cas9 включает любое или все из следующего: пониженной токсичности; улучшенной экспрессии в эукариотических клетках; повышенной специфичности; сниженного молекулярного веса белка, например получения меньшего белка за счет объединения наименьших доменов от различных гомологов Cas9; и/или изменения требований к последовательности РАМ.

Cas9 можно использовать в качестве стандартного ДНК-связывающего белка. Например, как показано в примере 7, заявители использовали Cas9 в качестве стандартного ДНК-связывающего белка путем внесения мутации в два каталитических домена (D10 и Н840), ответственных за расщепление обеих нитей ДНК-мишени. С целью повышающей регуляции транскрипции гена в целевом локусе заявители слили домен активации транскрипции (VP64) с Cas9. Известны и другие домены активации транскрипции. Как показано в примере 17, активация транскрипции является возможной. Как также показано в примере 17, репрессия генов (в этом случае гена бета-катенина) возможна при использовании репрессора Cas9 (ДНК-связывающего домена), который связывается с последовательностью целевого гена, тем самым подавляя ее активность.

Cas9 и одну или несколько направляющих РНК можно доставлять при помощи аденоассоциированного вируса (AAV), лентивируса, аденовируса или других типов плазмидных или вирусных векторов, в частности, с применением составов и доз, например, из патентов США №№8454972 (составы, дозы для аденовируса), 8404658 (составы, дозы для AAV) и 5846946 (составы, дозы для ДНК-плазмид) и из клинических испытаний и публикаций относительно клинических испытаний, предусматривающих использование лентивируса, AAV и аденовируса. Например, для AAV путь введения, состав и доза могут быть такими, как в патенте США №8454972 и в клинических испытаниях, предусматривающих использование AAV. Для аденовируса путь введения, состав и доза могут такими, как в патенте США №8404658 и в клинических испытаниях, предусматривающих использование аденовируса. Для доставки с помощью плазмид путь введения, состав и доза могут быть такими, как определено в патенте США №5846946 и в клинических испытаниях, предусматривающих использование плазмид. Дозы могут быть определены в расчете на среднего индивидуума массой 70 кг или экстраполированы на такого индивидуума, и их можно корректировать для пациентов, субъектов, млекопитающих с другой массой и из другого вида. Кратность введения находится в пределах компетенции практикующего врача или ветеринара (например, врача-терапевта, ветеринарного врача) и зависит от обычных факторов, в том числе от возраста, пола, общего состояния здоровья, других состояний пациента или субъекта и конкретных состояний или симптомов, на которые направлено лечение.

Вирусные векторы можно инъецировать в представляющую интерес ткань. В случае модификации генома, специфичной к типу клетки, экспрессия Cas9 может управляться промотором, специфичным к типу клеток. Например, при печеночноспецифической экспрессии может использоваться промотор гена альбумина, а при нейрон-специфической экспрессии может использоваться промотор гена синапсина I.

Трансгенные животные и растения

Также представлены трансгенные животные (модели), и следующее в равной степени относится к модельным тканям и совокупности тканей ex vivo, таким как органоиды, печень на чипе и т.д. Предпочтительные примеры включают животных, содержащих Cas9, в виде полинуклеотидов, кодирующих Cas9, или белка самого по себе. Предпочтительными являются мыши, крысы и кролики. Для получения трансгенных мышей с конструкциями, приведенными в качестве примера в данном документе, можно инъецировать чистую линейную ДНК в пронуклеус зиготы от псевдобеременной самки, например, самки СВ56. Особей-основателей можно затем идентифицировать, генотипировать и подвергать возвратному скрещиванию с мышами СВ57. Затем конструкции можно клонировать и необязательно проверять, например, посредством секвенирования по Сэнгеру. Предусматриваются нокауты, где, например, один или несколько генов в модели подвергают нокауту. Однако, также предусматриваются нокины (отдельно или в комбинации). Была получена иллюстративная мышь, нокинная по Cas9, и это представлено в качестве примера, при этом нокины Cas9 являются предпочтительными. Для создания нокина Cas9 у мышей можно целенаправленно воздействовать теми же конструкциями для конститутивной и условной экспрессии на локус Rosa26, как описано в данном документе (фигуры 25А-В и 26). Способы из публикаций заявок на патенты США №№20120017290 и 20110265198, закрепленные за Sangamo BioSciences, Inc., связанные с целенаправленным воздействием на локус Rosa, можно модифицировать для использования системы CRISPR-Cas по настоящему изобретению. В другом варианте осуществления способы из публикации заявки на патент США №20130236946, закрепленной за Cellectis, связанные с целенаправленным воздействием на локус Rosa, можно также модифицировать для использования системы CRISPR-Cas по настоящему изобретению.

Использование мышей с условной экспрессией Cas9. Заявители показали на клетках 293, что конструкция для условной экспрессии Cas9 может активироваться при совместной экспрессии с Cre. Заявители также показали, что надлежащим образом подвергшиеся целенаправленному воздействию mESC R1 могут иметь активный Cas9 при экспрессии Cre. Поскольку за Cas9 следует последовательность расщепления пептидом Р2А, а затем EGFP, заявители идентифицировали успешную экспрессию путем наблюдения EGFP. Заявители показали активацию Cas9 в mESC. Эта же идея делает использование мышей с условной экспрессией Cas9 столь полезным. Заявители могут скрещивать свою мышь с условной экспрессией Cas9 с мышью, у которой повсеместно экспрессируется Cre (линия АСТВ-Cre), и могут получать мышь, у которой Cas9 экспрессируется в каждой клетке. Для этого потребуется только доставка химерной РНК для индукции редактирования генома у мышиных эмбрионов или взрослых мышей. Что интересно, если мышь с условной экспрессией Cas9 скрестить с мышью, экспрессирующей Cre под контролем тканеспецифического промотора, Cas9 будет лишь в тканях, в которых также экспрессируется Cre. Этот подход можно применять для редактирования генома только в определенных тканях путем доставки химерной РНК в ту же ткань.

Как указано выше, также представлены трансгенные животные, как и трансгенные растения, в частности, сельскохозяйственные культуры и водоросли. Трансгенные растения могут быть полезными при других применениях помимо получения модели заболевания. Они могут включать производство пищи или кормов благодаря биосинтезу, например, белков, углеводов, питательных веществ или витаминов на более высоких уровнях, чем будет наблюдаться в обычных условиях у дикого типа. В этом отношении предпочтительными являются трансгенные растения, в особенности зернобобовые и клубненосные культуры, и животные, в особенности млекопитающие, такие как домашний скот (коровы, овцы, козы и свиньи), но также домашняя птица и съедобные насекомые.

Трансгенные водоросли или другие растения, такие как рапс, могут быть особенно применимыми в производстве растительных масел или таких видов биотоплива, как, например, спирты (особенно метанол и этанол). Они могут быть сконструированы для синтеза или повышенного синтеза высоких уровней масла или спиртов для применения в масложировой или биотопливной промышленности.

Аденоассоциированный вирус (AAV)

Что касается доставки in vivo, то AAV является преимущественным по сравнению с другими вирусными векторами по двум причинам:

низкая токсичность (она может быть обусловлена способом очистки, не требующим ультрацентрифугирования клеточных частиц, которые могут активировать иммунный ответ);

низкая вероятность появления инсерционного мутагенеза, поскольку он не интегрируется в геном хозяина.

AAV имеет предел упаковки, составляющий 4,5 или 4,75 т.п.о. Это означает, что все из Cas9, а также промотора и терминатора транскрипции должны вместиться в один вирусный вектор. Конструкции, размер которых превышает 4,5 или 4,75 т.п.о., будут обуславливать значительное снижение продуцирования вируса. SpCas9 является довольно большим, размер гена самого по себе превышает 4,1 т.п.о., что осложняет его упаковку в AAV. Следовательно, варианты осуществления настоящего изобретения включают использование более коротких гомологов Cas9. Например:

Эти виды, таким образом, в целом являются предпочтительными видами для получения Cas9. Заявители показали данные о доставке и in vivo экспрессии Cas9 в головном мозге мышей.

Предпочтительными являются два способа упаковки молекул нуклеиновых кислот, кодирующих Cas9, например, ДНК, в вирусные векторы для опосредования модификации генома in vivo.

Для обеспечения опосредованного NHEJ нокаута гена.

Один вирусный вектор:

вектор, содержащий две или более кассеты экспрессии:

промотор-молекула нуклеиновой кислоты, кодирующая Cas9-терминатор;

промотор-gRNA1-терминатор;

промотор-gRNA2-терминатор;

промотор-gRNA(N)-терминатор (до предельного размера вектора).

Два вирусных вектора:

вектор 1, содержащий одну кассету экспрессии для управления экспрессией Cas9:

промотор-молекула нуклеиновой кислоты, кодирующая Cas9-терминатор;

вектор 2, содержащий одну или несколько кассет экспрессии для управления экспрессией одной или нескольких направляющих РНК:

промотор-gRNA1-терминатор;

промотор-gRNA(N)-терминатор (до предельного размера вектора).

Для опосредования репарации с участием гомологичной рекомбинации. В дополнение к подходам с одним и двумя вирусными векторами, описанными выше, используют дополнительный вектор для доставки матрицы для репарации с участием гомологичной рекомбинации.

Промотор, используемый для управления экспрессией молекулы нуклеиновой кислоты, кодирующей Cas9, может включать следующее.

ITR AAV может служить в качестве промотора: это является преимущественным для устранения необходимости в дополнительном промоторном элементе (который может занимать пространство в векторе). Освободившееся дополнительное пространство можно задействовать для управления экспрессией дополнительных элементов (gRNA и т.д.). К тому же, активность ITR является относительно более слабой, поэтому их можно использовать для снижения токсичности, обусловленной сверхэкспрессией Cas9.

Для повсеместной экспрессии можно использовать следующие промоторы: CMV, CAG, CBh, PGK, SV40, генов тяжелой или легкой цепей ферритина и т.д.

Для экспрессии в головном мозге можно использовать следующие промоторы: гена синапсина I для всех нейронов, гена CaMKII-альфа для возбуждающих нейронов, GAD67, или GAD65, или VGAT для GABA-эргических нейронов и т.д.

Для экспрессии в печени можно использовать промотор гена альбумина.

Для экспрессии в легких можно использовать SP-B.

Для эндотелиальных клеток можно использовать ICAM.

Для гемопоэтических клеток можно использовать промотор гена IFN-бета или CD45.

Для остеобластов можно использовать OG-2.

Промотор, используемый для управления направляющей РНК, может включать следующее:

Промоторы для Pol III, такие как U6 или H1;

использование промотора для Pol II и интронных кассет для экспрессии gRNA.

Что касается AAV, AAV может представлять собой AAV1, AAV2, AAV5 или любую их комбинацию. Можно выбрать AAV из AAV с учетом клеток, подлежащих целенаправленному воздействию, например, можно выбрать AAV серотипов 1, 2, 5, или гибридный капсид AAV1, AAV2, AAV5, или любую их комбинацию для целенаправленного воздействия в головном мозге или нервных клетках; и можно выбрать AAV4 для целенаправленного воздействия в сердечной ткани. AAV8 применим для доставки в печень. Вышеуказанные промоторы и векторы являются предпочтительными по отдельности.

Доставка РНК также является применимым способом доставки in vivo. На фигуре 27 показаны данные о доставке и экспрессии Cas9 в головном мозге мышей in vivo. Возможно доставлять Cas9 и gRNA (и, например, матрицу для HR-репарации) в клетки посредством липосом или наночастиц. Таким образом, доставка фермента CRISPR, такого как Cas9, и/или доставка РНК по настоящему изобретению может осуществляться в форме РНК и посредством микропузырьков, липосом или наночастиц. Например, мРНК Cas9 и gRNA могут быть упакованы в липосомные частицы для доставки in vivo. Реагенты для липосомной трансфекции, такие как Lipofectamine от Life Technologies, и другие реагенты, имеющиеся в продаже, могут эффективно доставлять молекулы РНК в печень.

Повышение эффективности NHEJ или HR также способствует доставке. Предпочтительно, чтобы эффективность NHEJ повышалась посредством совместной экспрессии ферментов для обработки концов, таких как Trex2 (Dumitrache et al. Genetics. 2011 August; 188(4): 787-797). Предпочтительно, чтобы эффективность HR повышалась путем транзиентного ингибирования компонентов механизма NHEJ, таких как Ku70 и Ku86. Эффективность HR также можно повысить путем совместной экспрессии прокариотических или эукариотических ферментов гомологичной рекомбинации, таких как RecBCD, RecA.

Различные средства доставки описаны в данном документе и дополнительно обсуждаются в данном разделе.

Вирусная доставка: фермент CRISPR, например, Cas9, и/или любую из РНК по настоящему изобретению, например, направляющую РНК, можно доставлять с помощью аденоассоциированного вируса (AAV), лентивируса, аденовируса или других типов вирусных векторов или их комбинаций. Cas9 и одну или несколько направляющих РНК можно упаковать в один или несколько вирусных векторов. В некоторых вариантах осуществления вирусный вектор доставляют в представляющую интерес ткань посредством, например, внутримышечной инъекции, тогда как в других случаях вирусная доставка осуществляется посредством внутривенного, трансдермального, интраназального, перорального, трансмукозального или других способов доставки. Такая доставка может осуществляться в виде однократной дозы или многократных доз. Специалист в данной области понимает, что фактическая дозировка, подлежащая доставке в соответствии с данным документом, может в значительной степени варьировать в зависимости от ряда факторов, таких как выбранный вектор, целевые клетка, организм или ткань, общее состояние субъекта, подлежащего лечению, степень желаемой трансформации/модификации, путь введения, способ введения, тип желаемой трансформации/модификации и т.п.

Такая доза может дополнительно содержать, например, носитель (воду, солевой раствор, этанол, глицерин, лактозу, сахарозу, фосфат кальция, желатин, декстран, агар, пектин, арахисовое масло, кунжутное масло и т.д.), разбавитель, фармацевтически приемлемый носитель (например, фосфатно-солевой буфер), фармацевтически приемлемый наполнитель и/или другие соединения, известные из уровня техники. Такой дозированный состав может без труда определить специалист в данной области. Доза может дополнительно содержать одну или несколько фармацевтически приемлемых солей, таких как, например, соль неорганической кислоты, такая как гидрохлорид, гидробромид, фосфат, сульфат и т.д.; и соли органических кислот, такие как ацетаты, пропионаты, малонаты, бензоаты и т.д. Дополнительно, в данном документе также могут присутствовать вспомогательные вещества, такие как смачивающие или эмульгирующие средства, буферные вещества, поддерживающие рН, гели или гелеобразующие материалы, ароматизаторы, красители, микросферы, полимеры, суспендирующие средства и т.д. В дополнение, также могут присутствовать один или несколько других традиционных фармацевтических ингредиентов, таких как консерванты, увлажнители, суспендирующие средства, поверхностно-активные вещества, антиоксиданты, средства против слеживания, заполнители, хелатообразователи, покрывающие средства, химические стабилизаторы и т.д., особенно если лекарственная форма представляет собой восстанавливаемую форму. Пригодные иллюстративные ингредиенты включают микрокристаллическую целлюлозу, натрий-карбоксиметилцеллюлозу, полисорбат 80, фенилэтиловый спирт, хлорбутанол, сорбат калия, сорбиновую кислоту, диоксид серы, пропилгаллат, парабены, этилванилин, глицерин, фенол, парахлорфенол, желатин, альбумин и их комбинацию. Подробное обсуждение фармацевтически приемлемых наполнителей доступно в REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., N.J. 1991), включенном в данный документ посредством ссылки.

В варианте осуществления в данном документе доставку осуществляют посредством аденовируса, который может находиться в однократной бустерной дозе, содержащей по меньшей мере 1×105 частиц (также называемых единичными частицами, pu) аденовирусного вектора. В варианте осуществления в данном документе доза предпочтительно составляет по меньшей мере приблизительно 1×106 частиц (например, приблизительно 1×106-1×1012 частиц), более предпочтительно по меньшей мере приблизительно 1×107 частиц, более предпочтительно по меньшей мере приблизительно 1×108 частиц (например, приблизительно 1×108-1×1011 частиц или приблизительно 1×108-1×1012 частиц), и наиболее предпочтительно по меньшей мере приблизительно 1×109 частиц (например, приблизительно 1×109-1×1010 частиц или приблизительно 1×109-1×1012 частиц) или даже по меньшей мере приблизительно 1×1010 частиц (например, приблизительно 1×1010-1×1012 частиц) аденовирусного вектора. В альтернативном случае доза содержит не более приблизительно 1×1014 частиц, предпочтительно не более приблизительно 1×1013 частиц, еще более предпочтительно не более приблизительно 1×1012 частиц, еще более предпочтительно не более приблизительно 1×1011 частиц и наиболее предпочтительно не более приблизительно 1×1010 частиц (например, не более приблизительно 1×109 частиц). Таким образом, доза может включать в себя однократную дозу аденовирусного вектора с, например, приблизительно 1×106 единичных частиц (pu), приблизительно 2×106 pu, приблизительно 4×106 pu, приблизительно 1×107 pu, приблизительно 2×107 pu, приблизительно 4×107 pu, приблизительно 1×108 pu, приблизительно 2×108 pu, приблизительно 4×108 pu, приблизительно 1×109 pu, приблизительно 2×109 pu, приблизительно 4×109 pu, приблизительно 1×1010 pu, приблизительно 2×1010 pu, приблизительно 4×1010 pu, приблизительно 1×1011 pu, приблизительно 2×1011 pu, приблизительно 4×1011 pu, приблизительно 1×1012 pu, приблизительно 2×1012 pu или приблизительно 4×1012 pu аденовирусного вектора. См., например, аденовирусные векторы в патенте США №8454972 В2 Nabel, et. al., выданном 4 июня 2013 г.; включенном в данный документ посредством ссылки, и дозы в столбце 29, строках 36-58 данного патента. В варианте осуществления в данном документе аденовирус доставляют посредством многократных доз.

В варианте осуществления в данном документе доставку осуществляют посредством AAV. Полагают, что терапевтически эффективная доза для доставки AAV человеку in vivo находится в диапазоне от приблизительно 20 до приблизительно 50 мл солевого раствора, содержащего от приблизительно 1×1010 до приблизительно 1×1010 функциональных частиц AAV/мл раствора. Дозу можно скорректировать для уравновешивания терапевтической пользы и любых побочных эффектов. В варианте осуществления в данном документе доза AAV, как правило, находится в диапазоне концентраций от приблизительно 1×105 до 1×105 геномов AAV, от приблизительно 1×108 до 1×1020 геномов AAV, от приблизительно 1×1010 до приблизительно 1×1016 геномов или от приблизительно 1×1011 до приблизительно 1×1016 геномов AAV. Доза для человека может составлять приблизительно 1×1013 геномов AAV. Такие концентрации можно доставлять в растворе носителя, составляющем от приблизительно 0,001 мл до приблизительно 100 мл, от приблизительно 0,05 до приблизительно 50 мл или от приблизительно 10 до приблизительно 25 мл. Другие эффективные дозы может без труда установить специалист в данной области техники посредством стандартных испытаний с построением кривых зависимости ''доза-эффект''. См., например, патент США №8404658 В2 Hajjar et al., выданный 26 марта 2013 г., в столбце 27, строках 45-60.

В варианте осуществления в данном документе доставку осуществляют посредством плазмиды. В таких плазмидных композициях доза должна представлять собой количество плазмид, достаточное для того, чтобы вызвать реакцию. Например, подходящее количество плазмидной ДНК в плазмидных композициях может составлять от приблизительно 0,1 до приблизительно 2 мг или от приблизительно 1 мкг до приблизительно 10 мкг.

Дозы в данном документе определяются в расчете на среднего индивидуума массой 70 кг. Кратность введения находится в пределах компетенции практикующего врача или ветеринара (например, врача-терапевта, ветеринарного врача) или ученого, являющегося специалистом в данной области. Мыши, используемые в эксперименте, имели массу приблизительно 20 г. Дозы, вводимые мыши массой 20 г, можно экстраполировать на индивидуума массой 70 кг.

Лентивирус

Лентивирусы являются сложными ретровирусами, которые обладают способностью инфицировать как митотические, так и постмитотические клетки и экспрессировать в них свои гены. Наиболее широко известным лентивирусом является вирус иммунодефицита человека (HIV), который использует гликопротеины оболочки других вирусов для целенаправленного воздействия на широкий спектр типов клеток.

Лентивирусы можно получить следующим образом. После клонирования pCasES10 (которая содержит каркас лентивирусной плазмиды-переносчика) HEK293FT, прошедшие малое количество пассажей (р=5), высевали во флакон Т-75 до 50% конфлюентности за день до трансфекции в DMEM с 10% фетальной бычьей сывороткой и без антибиотиков. Через 20 часов среду заменяли на среду OptiMEM (бессывороточную) и спустя 4 часа проводили трансфекцию. Клетки трансфицировали с помощью 10 мкг лентивирусной плазмиды-переносчика (pCasES10) и следующих упаковывающих плазмид: 5 мкг pMD2.G (псевдотип VSV-g) и 7,5 мкг psPAX2 (gag/pol/rev/tat). Трансфекцию проводили в 4 мл OptiMEM со средством доставки на основе катионного липида (50 мкл Lipofectamine 2000 и 100 мкл реагента Plus). Через 6 часов среду заменяли на DMEM, не содержащую антибиотиков, с 10% фетальной бычьей сывороткой.

Лентивирус можно очистить следующим образом. Вирусосодержащие надосадочные жидкости отбирали через 48 часов. Надосадочные жидкости сперва очищали от дебриса и фильтровали через 0,45 мкм фильтр с низкой степенью связывания белка (PVDF). Затем их центрифугировали на ультрацентрифуге в течение 2 часов при 24000 об./мин. Вирусосодержащие осадки ресуспендировали в 50 мкл DMEM в течение ночи при 4°С. Затем их разделяли на аликвоты и сразу же замораживали при -80°С.

В другом варианте осуществления также предусмотрены минимальные лентивирусные векторы для отличных от приматов организмов на основе вируса инфекционной анемии лошадей (EIAV), особенно для генной терапии глаз (см., например, Balagaan, J Gene Med 2006; 8: 275-285, опубликовано в режиме онлайн 21 ноября 2005 г. в Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/jgm.845). В другом варианте осуществления также предусмотрен RetinoStat®, лентивирусный вектор на основе вируса инфекционной анемии лошадей для генной терапии, экспрессирующий ангиостатические белки эндостатин и ангиостатин, который доставляют посредством субретинальной инъекции для лечения влажной формы возрастной макулодистрофии (см., например, Binley et al., HUMAN GENE THERAPY 23:980-991 (September 2012)), который может быть модифицирован для системы CRISPR-Cas по настоящему изобретению.

В другом варианте осуществления самоинактивирующиеся лентивирусные векторы с siRNA, целенаправленно воздействующими на общий экзон, который имеют tat/rev HIV, сигналом ядрышковой локализации TAR-ловушкой и специфичным к CCR5 рибозимом в виде головки молотка (см., например, DiGiusto et al. (2010) Sci Transi Med 2:36ra43), можно использовать и/или приспосабливать к системам CRISPR-Cas по настоящему изобретению. Не менее 2,5×106 CD34+ клеток на килограмм массы пациента можно собирать и предварительно стимулировать в течение 16-20 часов в среде X-VIVO 15 (Lonza), содержащей 2 мМ L-глутамина, фактор стволовых клеток (100 нг/мл), лиганд Flt-3 (Flt-3L) (100 нг/мл) и тромбопоэтин (10 нг/мл) (CellGenix), при плотности 2×106 клеток/мл. Предварительно стимулированные клетки можно трансдуцировать лентивирусом при множественности заражения 5 в течение 16-24 часов в колбах с культурой тканей на 75 см2, покрытых фибронектином (25 мг/см2) (RetroNectin, Takara Bio Inc.).

Лентивирусные векторы были раскрыты в отношении лечения болезни Паркинсона, см., например, публикацию заявки на патент США №20120295960 и патенты США №№7303910 и 7351585. Лентивирусные векторы также были раскрыты в отношении лечения заболеваний глаз, см., например, публикации заявок на патенты США №№20060281180, 20090007284, US 20110117189; US 20090017543; US 20070054961, US 20100317109. Лентивирусные векторы также были раскрыты в отношении доставки в головной мозг, см., например, публикации заявок на патенты США №№ US 20110293571; US 20110293571, US 20040013648, US 20070025970, US 20090111106 и патент США № US 7259015.

Доставка РНК

Доставка РНК: фермент CRISPR, например Cas9, и/или любую из РНК по настоящему изобретению, например направляющую РНК, также можно доставлять в форме РНК. мРНК Cas9 можно получить с помощью транскрипции in vitro. Например, мРНК Cas9 можно синтезировать с помощью кассеты для ПЦР, содержащей следующие элементы: промотор Т7-последовательность Козак (GCCACC)-Cas9-3'-UTR гена бета-глобина-поли(А)-хвост (цепь из 120 или более адениновых остатков). Кассету можно использовать для транскрипции при помощи полимеразы Т7. Направляющие РНК также можно транскрибировать с помощью транскрипции in vitro с кассеты, содержащей промотор Т7-GG-последовательность направляющей РНК.

Для повышения экспрессии и снижения токсичности фермент CRISPR и/или направляющую РНК можно модифицировать с помощью псевдо-U или 5-метил-С.

Способы доставки мРНК в настоящее время являются особенно перспективными для доставки в печень. В частности, для доставки в печень особенно предпочтительным является AAV8.

Наночастицы

мРНК фермента CRISPR и направляющую РНК можно доставлять одновременно с помощью наночастиц или липидных оболочек.

Например, у Su X, Fricke J, Kavanagh DG, Irvine DJ (''In vitro and in vivo mRNA delivery using lipid-enveloped pH-responsive polymer nanoparticles'' Mol Pharm. 2011 Jun 6; 8(3):774-87. doi: 10.1021/mp100390w. Epub 2011 Apr 1) раскрываются биоразлагаемые наночастицы со структурой ядро/оболочка с ядром из сложного поли-β-аминоэфира (РВАЕ), окруженным фосфолипидной двухслойной оболочкой. Они были разработаны для доставки мРНК in vivo. Чувствительный к рН компонент РВАЕ был выбран для содействия разрушению эндосом, тогда как поверхностный липидный слой был выбран для сведения к минимуму токсичности поликатионного ядра. Они, таким образом, являются предпочтительными для доставки РНК по настоящему изобретению.

В одном варианте осуществления предусмотрены наночастицы на основе самособирающихся биоадгезивных полимеров, которые можно использовать для пероральной доставки пептидов, внутривенной доставки пептидов и интраназальной доставки пептидов, во всех случаях в головной мозг. Также предусмотрены другие варианты осуществления, такие как всасывание при пероральном применении и внутриглазная доставка гидрофобных лекарственных средств. Технология молекулярных оболочек предусматривает сконструированную полимерную оболочку, защищенную и доставляемую в очаг заболевания (см., например, Mazza, M. et al. ACSNano, 2013. 7(2): 1016-1026; Siew, A., et al. Mol Pharm, 2012. 9(1):14-28; Lalatsa, A., et al. J Contr Rel, 2012. 161(2):523-36; Lalatsa, A., et al., Mol Pharm, 2012. 9(6):1665-80; Lalatsa, A., et al. Mol Pharm, 2012. 9(6):1764-74; Garrett, N.L., et al. J Biophotonics, 2012. 5(5-6):458-68; Garrett, N.L., et al. J Raman Spect, 2012. 43(5):681-688; Ahmad, S., et al. J Royal Soc Interface 2010. 7:S423-33; Uchegbu, I.F. Expert Opin Drug Deliv, 2006. 3(5):629-40; Qu, X., et al. Biomacromolecules, 2006. 7(12):3452-9 и Uchegbu, I.F., et al. Int J Pharm, 2001. 224:185-199). Предусмотрены дозы, составляющие приблизительно 5 мг/кг, которые в зависимости от целевой ткани будут однократными или многократными дозами.

В одном варианте осуществления наночастицы, которые могут доставлять РНК в раковую клетку для прекращения роста опухоли, разработанные в лаборатории Дэна Андерсона в MIT, можно использовать для систем CRISPR-Cas по настоящему изобретению и/или приспосабливать к ним. В частности, в лаборатории Андерсона были разработаны полностью автоматизированные, комбинаторные системы для синтеза, очистки, определения характеристик и составления новых биоматериалов и наносоставов. См., например, Alabi et al., Proc Natl Acad Sci USA. 2013 Aug 6;110(32):12881-6; Zhang et al., Adv Mater. 2013 Sep 6;25(33):4641-5; Jiang et al., Nano Lett. 2013 Mar 13;13(3):1059-64; Karagiannis et al., ACS Nano. 2012 Oct 23;6(10):8484-7; Whitehead et al., ACS Nano. 2012 Aug 28;6(8):6922-9 и Lee et al., Nat Nanotechnol. 2012 Jun 3;7(6):389-93.

Заявка на патент США 20110293703 относится к липидоподобным соединениям, также являющимся особенно применимыми при введении полинуклеотидов, которые можно использовать для доставки системы CRISPR-Cas по настоящему изобретению. В одном аспекте аминоспиртовые липидоподобные соединения объединяют со средством, подлежащим введению в клетку или субъекту, с образованием микрочастиц, наночастиц, липосом или мицелл. Средство, подлежащее доставке с помощью частиц, липосом или мицелл, может быть в форме газа, жидкости или твердого вещества, и средство может представлять собой полинуклеотид, белок, пептид или малую молекулу. Аминоспиртовые липидоподобные соединения можно объединять с другими аминоспиртовыми липидоподобными соединениями, полимерами (синтетическими или природными), поверхностно-активными веществами, холестерином, углеводами, белками, липидами и т.д. с образованием частиц. Эти частицы можно затем необязательно объединять с фармацевтическим наполнителем с образованием фармацевтической композиции.

В публикации заявки на патент США №0110293703 также представлены способы получения аминоспиртовых липидоподобных соединений. Для образования аминоспиртового липидоподобного соединения по настоящему изобретению обеспечивают реакцию одного или нескольких эквивалентов амина с одним или несколькими эквивалентами соединения с концевыми эпоксидными группами в подходящих условиях. В определенных вариантах осуществления все аминогруппы амина являются полностью прореагировавшими с соединением с концевыми эпоксидными группами с образованием третичных аминов. В других вариантах осуществления не все аминогруппы амина являются полностью прореагировавшими с соединением с концевыми эпоксидными группами с образованием третичных аминов, в результате чего, таким образом, в аминоспиртовом липидоподобном соединении находятся первичные или вторичные аминогруппы. Эти первичные или вторичные аминогруппы оставляют в существующем состоянии или могут вводить в реакцию с другим электрофилом, таким как другое соединение с концевыми эпоксидными группами. Специалисту в данной области следует принять во внимание, что осуществление реакции амина с меньшим, чем избыточное, количеством соединения с концевыми эпоксидными группами приведет к образованию множества различных аминоспиртовых липидоподобных соединений с различным количеством ''хвостов''. Определенные амины могут быть полностью функционализированными с помощью двух ''хвостов'', полученных из эпоксидных соединений, тогда как другие молекулы могут быть не полностью функционализированными с помощью ''хвостов'', полученных из эпоксидных соединений. Например, диамин или полиамин может содержать один, два, три или четыре ''хвоста'', полученных из эпоксидных соединений, у различных аминогрупп молекулы, в результате чего образуются первичные, вторичные и третичные амины. В определенных вариантах осуществления все аминогруппы являются не полностью функционализированными. В определенных вариантах осуществления используют два соединения с концевыми эпоксидными группами одного типа. В других вариантах осуществления используют два или более различных соединений с концевыми эпоксидными группами. Синтез аминоспиртовых липидоподобных соединений осуществляют в присутствии растворителя или без него, и синтез можно осуществлять при более высоких температурах, варьирующих в диапазоне от 30 до 100°С, предпочтительно при приблизительно 50-90°С. Полученные аминоспиртовые липидоподобные соединения можно необязательно очищать. Например, смесь аминоспиртовых липидоподобных соединений можно очищать с получением аминоспиртового липидоподобного соединения с определенным количеством ''хвостов'', полученных из эпоксидных соединений. Или же смесь можно очищать с получением определенного стерео- или региоизомера. Аминоспиртовые липидоподобные соединения можно также алкилировать с помощью алкилгалогенида (например, йодистого метила) или другого алкилирующего средства, и/или их можно ацилировать.

В публикации заявки на патент США №0110293703 также представлены библиотеки аминоспиртовых липидоподобных соединений, полученных согласно способам по настоящему изобретению. Эти аминоспиртовые липидоподобные соединения можно получать и/или подвергать скринингу с применением высокопроизводительных методик, предусматривающих использование дозирующих станций, роботов, планшетов для микротитрования, компьютеров и т.д. В определенных вариантах осуществления аминоспиртовые липидоподобные соединения подвергают скринингу в отношении их способности к трансфекции полинуклеотидов или других средств (например, белков, пептидов, малых молекул) в клетку.

Публикация заявки на патент США №20130302401 относится к классу поли(бета-аминоспиртов) (РВАА), получаемых при помощи комбинаторных методик полимеризации. РВАА по настоящему изобретению можно применять в биотехнологии и биомедицинских применениях в качестве покрытий (таких как пленочные покрытия или многослойные пленки для медицинских инструментов или имплантатов), добавок, материалов, наполнителей, средств против биологического обрастания, средств для формирования микроструктуры и средств для инкапсулирования клеток. В случае применения в качестве поверхностных покрытий эти РВАА вызывают различные уровни воспаления как in vitro, так и in vivo в зависимости от их химических структур. Большое химическое разнообразие этого класса материалов позволяет идентифицировать полимерные покрытия, ингибирующие активацию макрофагов in vitro. Кроме того, эти покрытия уменьшают привлечение воспалительных клеток и уменьшают выраженность фиброза после подкожной имплантации микрочастиц карбоксилированного полистирола. Эти полимеры можно использовать для образования капсул на основе полиэлектролитных комплексов для инкапсулирования клеток. Настоящее изобретение также может иметь много других применений в биологии, таких как получение противомикробных покрытий, доставка ДНК или siRNA и тканевая инженерия с применением стволовых клеток. Идеи, изложенные в публикации заявки на патент США №20130302401, можно применять к системе CRISPR-Cas по настоящему изобретению.

В другом варианте осуществления предусмотрены липидные наночастицы (LNP). В частности, малые интерферирующие РНК, воздействующие на транстиретин, инкапсулированные в липидных наночастицах (см., например, Coelho et al., N Engl J Med 2013; 369:819-29), можно применять в отношении системы CRISPR-Cas по настоящему изобретению. Предусмотрены дозы, составляющие от приблизительно 0,01 до приблизительно 1 мг на кг массы тела, вводимые внутривенно. Для снижения риска возникновения инфузионных реакций предусмотрены лекарственные препараты, такие как дексаметазон, ацетаминофен, дифенгидрамин или цетиризин и ранитидин. Также предусмотрены многократные дозы в составе пяти доз по приблизительно 0,3 мг на килограмм, принимаемые каждые 4 недели.

Было показано, что LNP являются высокоэффективными в доставке siRNA в печень (см., например, Tabernero et al., Cancer Discovery, April 2013, Vol. 3, No. 4, pages 363-470) и, таким образом, предусмотрены для доставки CRISPR-Cas в печень. Может быть предусмотрен режим дозирования с приемом приблизительно четырех доз по 6 мг/кг LNP (или РНК системы CRISPR-Cas) каждые две недели. Tabernero и соавт. продемонстрировали, что после первых 2 циклов введения LNP в дозе 0,7 мг/кг наблюдалась регрессия опухоли, а к концу 6 циклов у пациента достигался частичный ответ с полной регрессией метастазов в лимфатических узлах и значительным уменьшением размеров опухолей в печени. У данного пациента, у которого сохранялась ремиссия и который завершил лечение после получения доз в течение 26 месяцев, полный ответ достигался после приема 40 доз. У двух пациентов с RCC и внепеченочными очагами заболевания, включающими почку, легкое и лимфатические узлы, в которых наблюдалось прогрессирование после предшествующей терапии ингибиторами сигнального пути VEGF, наблюдалось стабильное заболевание во всех очагах в течение примерно 8-12 месяцев, а пациент с PNET и метастазами в печени продолжал участие в расширенном исследовании в течение 18 месяцев (36 доз) при стабильном заболевании.

Однако следует принимать во внимание заряд LNP. Так, объединение катионных липидов с отрицательно заряженными липидами индуцирует образование структур, не являющихся двухслойными, которые содействуют внутриклеточной доставке. Поскольку заряженные LNP быстро выводятся из кровотока после внутривенной инъекции, были разработаны ионизируемые катионные липиды со значениями pKa ниже 7 (см., например, Rosin et al, Molecular Therapy, vol. 19, no. 12, pages 1286-2200, Dec. 2011). Отрицательно заряженные полимеры, такие как олигонуклеотиды siRNA, можно загружать в LNP при низких значениях рН (например, рН 4), где ионизируемые липиды проявляют положительный заряд. Однако, при физиологических значениях рН LNP проявляют низкий поверхностный заряд, совместимый с большими значениями времени пребывания в кровотоке. Основное внимание было сосредоточено на четырех молекулах ионизируемых катионных липидов, а именно 1,2-дилинолеоил-3-диметиламмонийпропане (DLinDAP), 1,2-дилинолеилокси-3-N,N-диметиламинопропане (DLinDMA), 1,2-дилинолеилоксикето-N,N-диметил-3-аминопропане (DLinKDMA) и 1,2-дилинолеил-4-(2-диметиламиноэтил)-[1,3]-диоксолане (DLinKC2-DMA). Было показано, что системы LNP с siRNA, содержащие эти липиды, проявляют существенно отличающиеся свойства сайленсинга генов в гепатоцитах in vivo, при этом их активность изменяется в ряду DLinKC2-DMA>DLinKDMA>DLinDMA>>DLinDAP, при использовании модели сайленсинга гена фактора VII (см., например, Rosin et al, Molecular Therapy, vol. 19, no. 12, pages 1286-2200, Dec. 2011). Могут быть предусмотрены уровни дозы 1 мкг/мл, особенно для состава, содержащего DLinKC2-DMA.

Получение LNP и инкапсулирование CRISPR-Cas можно применять и/или модифицировать согласно Rosin et al, Molecular Therapy, vol. 19, no. 12, pages 1286-2200, Dec. 2011. Катионные липиды 1,2-дилинолеоил-3-диметиламмонийпропан (DLinDAP), 1,2-дилинолеилокси-3-N,N-диметиламинопропан (DLinDMA), 1,2-дилинолеилоксикето-N,N-диметил-3-аминопропан (DLinK-DMA), 1,2-дилинолеил-4-(2-диметиламиноэтил)-[1,3]-диоксолан (DLinKC2-DMA), (3-о-[2''-(метоксиполиэтиленгликоль 2000)-сукциноил]-1,2-димиристоил-sn-гликоль (PEG-S-DMG) и R-3-[(ω-метоксиполи(этиленгликоль)2000)-карбамоил]-1,2-димиристилоксипропил-3-амин (PEG-C-DOMG) могут быть предоставлены Tekmira Pharmaceuticals (Ванкувер, Канада) или синтезированы. Холестерин можно приобрести у Sigma (Сент-Луис, Миссури). Конкретную РНК CRISPR-Cas можно инкапсулировать в LNP, содержащие DLinDAP, DLinDMA, DLinK-DMA и DLinKC2-DMA (катионный липид:DSPC:холестерин: PEG-S-DMG или PEG-C-DOMG в молярном соотношении 40:10:40:10). При необходимости можно включать в состав 0,2% SP-DiOC18 (Invitrogen, Берлингтон, Канада) для определения поглощения клетками, внутриклеточной доставки и биораспределения. Инкапсулирование можно осуществлять путем растворения липидных смесей, содержащих катионный липид:DSPC:холестерин:РЕG-С-DOMG (молярное соотношение 40:10:40:10) в этаноле до конечной концентрации липидов 10 ммоль/л. Этот раствор липидов в этаноле можно добавлять по каплям к 50 ммоль/л цитрата, рН 4,0, с образованием многослойных пузырьков до получения конечной концентрации этанола 30% об./об. Крупные однослойные пузырьки можно формировать после экструзии многослойных пузырьков через два установленных один над другим поликарбонатных фильтра Nuclepore на 80 нм при помощи экструдера (Northern Lipids, Ванкувер, Канада). Инкапсулирование можно осуществлять путем добавления РНК, растворенной при 2 мг/мл в 50 ммоль/л цитрата, рН 4,0, содержащего 30% этанола об./об., по каплям к экструдированным предварительно сформированным крупным однослойным пузырькам и инкубирования при 31°С в течение 30 минут при постоянном перемешивании до конечного весового соотношения РНК/липид 0,06/1 вес./вес. Удаление этанола и нейтрализацию буфера для получения состава проводили путем диализа против фосфатно-солевого буфера (PBS), рН 7,4, в течение 16 часов при помощи диализных мембран Spectra/Por 2 из регенерированной целлюлозы. Распределение наночастиц по размеру можно определить посредством динамического рассеяния света с использованием измерителя размера частиц NICOMP 370, режимов объема пузырьков/интенсивности рассеянного света и аппроксимации функцией Гаусса (Nicomp Particle Sizing, Санта-Барбара, Калифорния). Размер частиц для всех трех систем LNP может составлять ~70 нм в диаметре. Эффективность инкапсулирования siRNA можно определить путем удаления свободной siRNA из образцов, отобранных до или после диализа, с помощью колонок VivaPureD MiniH (Sartorius Stedim Biotech). Инкапсулированную РНК можно экстрагировать из элюированных наночастиц и подвергать количественной оценке при 260 нм. Соотношение siRNA и липидов определяли путем измерения содержания холестерина в пузырьках с помощью ферментативного анализа Cholesterol E от Wako Chemicals USA (Ричмонд, Виргиния). Для доставки также можно применять пегилированные липосомы (или LNP).

Получение крупных LNP можно применять и/или приспосабливать согласно Rosin et al, Molecular Therapy, vol. 19, no. 12, pages 1286-2200, Dec. 2011. Раствор предварительно приготовленной смеси липидов (общая концентрация липидов 20,4 мг/мл) можно получать в этаноле, содержащем DLinKC2-DMA, DSPC и холестерин в молярном соотношении 50:10:38,5. К предварительно приготовленной смеси липидов можно добавлять ацетат натрия в молярном соотношении 0,75:1 (ацетат натрия:DLinKC2-DMA). Липиды затем можно гидрировать путем объединения смеси с 1,85 объема цитратного буфера (10 ммоль/л, рН 3,0) при энергичном перемешивании, что приводит к самопроизвольному образованию липосом в водном буфере, содержащем 35% этанол. Раствор липосом можно инкубировать при 37°С для обеспечения зависимого от времени увеличения размера частиц. В различные моменты времени в ходе инкубирования можно отбирать аликвоты для изучения изменений размера липосом посредством динамического рассеяния света (Zetasizer Nano ZS, Malvern Instruments, Вустершир, Великобритания). По достижении требуемого размера частиц к смеси липосом можно добавлять водный раствор конъюгатов PEG-липид (исходный раствор = 10 мг/мл PEG-DMG в 35% (об./об.) этаноле) с получением конечной молярной концентрации PEG 3,5% от общего количества липидов. После добавления конъюгатов PEG-липид липосомы будут сохранять свой размер с эффективным подавлением дальнейшего роста. К ''пустым'' липосомам можно затем добавить РНК при соотношении siRNA и общих липидов, составляющем примерно 1:10 (вес:вес), с последующим инкубированием в течение 30 минут при 37°С с образованием нагруженных LNP. Затем смесь можно подвергать диализу в течение ночи в PBS и отфильтровать через шприцевой фильтр с диаметром пор 0,45 мкм.

Конструкции сферических нуклеиновых кислот (SNA™) и другие наночастицы (в частности, наночастицы золота) также предусмотрены в качестве средств доставки системы CRISPR/Cas к предполагаемым мишеням. Достоверные данные показывают, что конструкции сферических нуклеиновых кислот (SNA™) от AuraSense Therapeutics на основе наночастиц золота, функционализированных нуклеиновыми кислотами, превосходят альтернативные платформы за счет нескольких следующих ключевых факторов успеха.

Высокая стабильность in vivo. По причине их плотной загрузки большинство молекул-карго (ДНК или siRNA) остаются связанными с конструкциями внутри клеток, что придает нуклеиновым кислотам стабильность и устойчивость к ферментативному расщеплению.

Возможность доставки. Для всех изученных типов клеток (например, нейронов, линий опухолевых клеток и т.д.) конструкции демонстрируют 99% эффективность трансфекции без необходимости в носителях или средствах для трансфекции.

Терапевтическое целенаправленное воздействие. Уникальная аффинность связывания с мишенью и специфичность конструкций обеспечивают превосходную специфичность в отношении совпадающих целевых последовательностей (т.е. с ограниченными нецелевыми эффектами).

Превосходящая эффективность. Конструкции значительно превосходят ведущие традиционные реагенты для трансфекции (Lipofectamine 2000 и Cytofectin).

Низкая токсичность. Конструкции могут проникать в ряд культивируемых клеток, первичных клеток и тканей без видимой токсичности.

Отсутствие значительного иммунного ответа. Конструкции вызывают минимальные изменения глобальной экспрессии генов согласно измерениям в полногеномных микроматричных исследованиях и специфичных в отношении цитокинов анализах белков.

Способность получения заданных химических свойств. Для получения заданных свойств поверхности конструкций можно использовать любое количество отдельных или комбинированных средств (например, белков, пептидов, малых молекул).

Данная платформа для терапевтических средств на основе нуклеиновых кислот может быть применима к многочисленным болезненным состояниям, включающим воспаление и инфекционное заболевание, рак, кожные нарушения и сердечно-сосудистое заболевание.

Литературные источники, на которые можно ссылаться, включают: Cutler et al.,. J. Am. Chem. Soc. 2011 133:9254-9257, Hao et al., Small. 2011 7:3158-3162. Zhang et al., ACS Nano. 2011 5:6962-6970, Cutler et al., J. Am. Chem. Soc. 2012 134:1376-1391, Young et al.,. Nano Lett. 2012 12:3867-71, Zheng et al., Proc. Natl. Acad. Sci. USA. 2012 109:11975-80, Mirkin, Nanomedicine 2012 7:635-638, Zhang et al., J. Am. Chem. Soc. 2012 134:16488-1691, Weintraub, Nature 2013 495:S14-S16, Choi et al., Proc. Natl. Acad. Sci. USA. 2013 110(19):7625-7630, Jensen et al., Sci. Transl. Med. 5, 209ra152 (2013) и Mirkin, et al., Small, doi.org/10.1002/smll.201302143.

Самособирающиеся наночастицы с siRNA могут быть сконструированы с помощью полиэтиленимина (PEI), который является пегилированным, с пептидным лигандом Arg-Gly-Asp (RGD), присоединенным к дистальному концу полиэтиленгликоля (PEG), например, в качестве средства для нацеливания на новообразованные сосуды опухоли, в которых экспрессируются интегрины, и их используют для доставки siRNA, ингибирующих экспрессию рецептора фактора роста эндотелия сосудов-2 (VEGF R2) и, таким образом, ангиогенез опухоли (см., например, Schiffelers et al., Nucleic Acids Research, 2004, Vol. 32, No. 19). Наноплексы можно получать путем смешивания равных объемов водных растворов катионного полимера и нуклеиновой кислоты с получением чистого молярного избытка ионизируемого азота (полимера) относительно фосфата (нуклеиновой кислоты) в диапазоне от 2 до 6. Электростатические взаимодействия между катионными полимерами и нуклеиновой кислотой приводили к образованию полиплексов, характеризующихся распределением частиц по размеру со средним размером, составляющим приблизительно 100 нм, называемых здесь, таким образом, наноплексами. Для доставки в самособирающихся наночастицах согласно Schiffelers и соавт. предполагается доза, составляющая от приблизительно 100 до 200 мг CRISPR-Cas.

Наноплексы по Bartlett и соавт. (PNAS, September 25, 2007, vol. 104, no. 39) также можно применять в настоящем изобретении. Наноплексы по Bartlett и соавт. получают путем смешивания равных объемов водных растворов катионного полимера и нуклеиновой кислоты с получением чистого молярного избытка ионизируемого азота (полимера) относительно фосфата (нуклеиновой кислоты) в диапазоне от 2 до 6. Электростатические взаимодействия между катионными полимерами и нуклеиновой кислотой приводили к образованию полиплексов, характеризующихся распределением частиц по размеру со средним размером, составляющим приблизительно 100 нм, называемых здесь, таким образом, наноплексами. Конъюгаты DOTA-siRNA no Bartlett и соавт. синтезировали следующим образом. Сложный моно(N-гидроксисукцинимидный эфир) 1,4,7,10-тетраазациклододекан-1,4,7,10-тетрауксусной кислоты (сложный эфир DOTA-NHS) заказывали у Macrocyclics (Даллас, Техас). В микроцентрифужную пробирку добавляли аминомодифицированную смысловую нить РНК со 100-кратным молярным избытком сложного эфира DOTA-NHS в карбонатном буфере (рН 9). Осуществляли реакцию содержимого путем перемешивания в течение 4 ч. при комнатной температуре. Конъюгат DOTA-смысловая нить РНК осаждали этанолом, ресуспендировали в воде и отжигали с немодифицированной антисмысловой нитью с получением конъюгата DOTA-siRNA. Все жидкости предварительно обрабатывали с помощью Chelex-100 (Bio-Rad, Геркулес, Калифорния) для удаления следовых количеств металлических примесей. Tf-нацеленные или ненацеленные наночастицы с siRNA можно получать с помощью поликатионов, содержащих цикло декстрин. Как правило, наночастицы получали в воде при соотношении зарядов 3 (+/-) и концентрации siRNA 0,5 г/литр. Один процент молекул адамантан-PEG на поверхности нацеленных наночастиц модифицировали с помощью Tf (адамантан-PEG-Tf). Наночастицы суспендировали в 5% (вес/об.) глюкозе в качестве раствора-носителя для инъекции.

Davis и соавт. (Nature, Vol 464, 15 April 2010) проводят клиническое испытание siRNA, в котором используют систему доставки на основе нацеленных наночастиц (регистрационный номер клинического испытания NCT00689065). Пациентам с солидными формами рака, трудно поддающимися стандартным методикам лечения, вводят дозы нацеленных наночастиц в дни 1, 3, 8 и 10 21-дневного цикла посредством 30-минутной внутривенной инфузии. Наночастицы состоят из синтетической системы доставки, содержащей: (1) линейный полимер на основе циклодекстрина (CDP), (2) нацеливающий лиганд на основе белка трансферрина человека (TF), представленный на внешней поверхности наночастиц, для контакта с рецепторами TF (TFR) на поверхности раковых клеток, (3) гидрофильный полимер (полиэтиленгликоль (PEG), используемый для обеспечения стабильности наночастиц в биологических жидкостях), и (4) siRNA, предназначенную для снижения экспрессии RRM2 (последовательность, применяемая в клинической практике, ранее была обозначена как siR2B+5). Давно известно, что в злокачественных клетках повышена экспрессия TFR, a RRM2 является общепризнанной мишенью для противоопухолевой терапии. Было показано, что эти наночастицы (клинический вариант обозначен как CALAA-01) хорошо переносятся в исследованиях с использованием многократных доз у отличных от человека приматов. Даже притом, что отдельным пациентам с хроническим миелоидным лейкозом вводили siRNA посредством доставки с помощью липосом, клиническое испытание по Davis и соавт. является первым испытанием с участием человека, в котором проводят системную доставку siRNA с помощью системы целенаправленной доставки и лечат пациентов с солидным раком. Для того, чтобы выяснить, может ли система целенаправленной доставки обеспечивать эффективную доставку функциональных siRNA в опухоли человека, Davis и соавт. исследовали биоптаты от трех пациентов из трех различных групп дозирования; пациентов А, В и С, все из которых имели метастазирующую меланому и получали дозы CALAA-01 с 18, 24 и 30 мг*м-2 siRNA, соответственно. Аналогичные дозы также могут быть предусмотрены для системы CRISPR-Cas по настоящему изобретению. Доставку по настоящему изобретению можно осуществлять с помощью наночастиц, содержащих линейный полимер на основе циклодекстрина (CDP), нацеливающий лиганд на основе белка трансферрина человека (TF), представленный на внешней поверхности наночастиц, для контакта с рецепторами TF (TFR) на поверхности раковых клеток, и/или гидрофильный полимер (например, полиэтиленгликоль (PEG), применяемый для обеспечения стабильности наночастиц в биологических жидкостях).

Экзосомы

Экзосомы являются эндогенными нанопузырьками, переносящими РНК и белки, которые могут доставлять короткие интерферирующие РНК (siRNA) в головной мозг мышей. Для снижения иммуногенности Alvarez-Erviti и соавт. (2011, Nat Biotechnol 29: 341) использовали собственные дендритные клетки для получения экзосом. Нацеливания достигали путем конструирования дендритных клеток, экспрессирующих Lamp2b, мембранный белок экзосом, слитый с нейрон-специфическим пептидом RVG. Очищенные экзосомы нагружали экзогенной siRNA путем электропорации. RVG-нацеленные экзосомы, инъецируемые внутривенно, осуществляли специфическую доставку siRNA для GAPDH в нейроны, микроглию, олигодендроциты в головном мозге, что приводило к нокдауну конкретного гена. Предварительное воздействие RVG-экзосом не ослабляло выраженность нокдауна, и неспецифическое поглощение в других тканях не наблюдалось. Терапевтические возможности опосредованной экзосомами доставки siRNA были продемонстрированы сильно выраженным нокдауном мРНК (60%) и белка (62%) ВАСЕ1, терапевтической мишени при болезни Альцгеймера.

Для получения пула иммунологически инертных экзосом Alvarez-Erviti и соавт. собирали костный мозг у инбредных мышей C57BL/6 с гомогенным гаплотипом главного комплекса гистосовместимости (МНС). Поскольку незрелые дендритные клетки вырабатывают большие количества экзосом, лишенных активаторов Т-клеток, таких как MHC-II и CD86, Alvarez-Erviti и соавт. производили отбор дендритных клеток с гранулоцитарно-макрофагальным колониестимулирующим фактором (GM-CSF) в течение 7 дней. Экзосомы очищали от культуральной надосадочной жидкости на следующий день с применением общепринятых протоколов ультрацентрифугирования. Вырабатываемые экзосомы были физически гомогенными и характеризовались распределением по размеру с пиком при 80 нм в диаметре, как определяли с помощью анализа отслеживания наночастиц (NTA) и электронной микроскопии. Alvarez-Erviti и соавт. получали 6-12 мкг экзосом (измерено на основании концентрации белка) на 106 клеток.

Затем Alvarez-Erviti и соавт. исследовали возможность загрузки модифицированных экзосом экзогенными молекулами-карго с применением протоколов электропорации, приспособленных для применений на наноразмерном уровне. Поскольку электропорация для мембранных частиц в нанометрическом масштабе изучена недостаточно хорошо, для эмпирической оптимизации протокола электропорации использовали неспецифическую меченную Су5 siRNA. Количество инкапсулированной siRNA анализировали после ультрацентрифугирования и лизиса экзосом. Электропорация при 400 В и 125 мкФ приводила к наибольшему удержанию siRNA и применялась для всех последующих экспериментов.

Alvarez-Erviti и соавт. вводили по 150 мкг каждой siRNA для ВАСЕ1, инкапсулированной в 150 мкг RVG-экзосом, нормальным мышам C57BL/6 и сравнивали эффективность нокдауна с таковой в четырех контрольных группах: необработанные мыши, мыши, которым инъецировали только RVG-экзосомы, мыши, которым инъецировали siRNA для ВАСЕ1 в комплексе с реагентом на основе катионных липосом для доставки in vivo, и мыши, которым инъецировали siRNA для ВАСЕ1 в комплексе с RVG-9R, пептидом RVG, конъюгированным с 9 остатками D-аргинина, который электростатически связывается с siRNA. Образцы кортикальной ткани анализировали через 3 дня после введения, и как у обработанных siRNA-RVG-9R, так и у обработанных RVG-экзосомами с siRNA мышей наблюдали значительный нокдаун белка (45%, Р<0,05 и 62%, Р<0,01), обусловленный значительным снижением уровней мРНК ВАСЕ1 (66% [+ или -] 15%, Р<0,001 и 61% [+ или -] 13%, Р<0,01, соответственно). Кроме того, заявители продемонстрировали значительное снижение (55%, Р<0,05) общих уровней [бета]-амилоидного пептида 1-42, основного компонента амилоидных бляшек в патологическом процессе при болезни Альцгеймера у животных, обработанных RVG-экзосомами. Наблюдавшееся снижение было большим, чем снижение уровней β-амилоидного пептида 1-40, демонстрируемое у нормальных мышей после внутрижелудочковой инъекции ингибиторов ВАСЕ1. Alvarez-Erviti и соавт. проводили быструю амплификацию 5'-концов кДНК (RACE) в отношении продукта расщепления ВАСЕ1, что свидетельствовало об опосредованном RNAi нокдауне с помощью siRNA.

Наконец, Alvarez-Erviti и соавт. исследовали, индуцируют ли RVG-экзосомы с siRNA иммунные ответы in vivo, путем определения концентраций IL-6, IP-10, TNFα и IFN-α в сыворотке. После обработки с помощью RVG-экзосом с siRNA для всех цитокинов регистрировали незначительные изменения, подобное таковому при обработке реагентом для трансфекции с siRNA и противоположное siRNA-RVG-9R, который активно стимулировал секрецию IL-6, что подтверждало иммунологическую инертность как особенность обработки экзосомами. С учетом того, что экзосомы инкапсулируют только 20% siRNA, доставка с помощью RVG-экзосом, по-видимому, является более эффективной, чем доставка с помощью RVG-9R, поскольку при использовании в пять раз меньшего количества siRNA без соответствующего уровня стимуляции иммунного ответа достигали сопоставимый нокдаун мРНК и больший нокдаун белка. Данный эксперимент продемонстрировал терапевтические возможности технологии RVG-экзосом, которая потенциально подходит для долговременного сайленсинга генов, связанных с нейродегенеративными заболеваниями. Систему доставки на основе экзосом по Alvarez-Erviti и соавт. можно использовать для доставки системы CRISPR-Cas по настоящему изобретению к терапевтическим мишеням, особенно при нейродегенеративных заболеваниях. В настоящем изобретении может быть предусмотрена доза, составляющая приблизительно 100-1000 мг CRISPR-Cas, инкапсулированных в приблизительно 100-1000 мг RVG-экзосом.

El-Andaloussi и соавт. (Nature Protocols 7, 2112-2126(2012)) раскрывают, как экзосомы, полученные из культивируемых клеток, можно приспособить для доставки siRNA in vitro и in vivo. В данном протоколе впервые описано создание нацеленных экзосом посредством трансфекции вектором экспрессии, содержащим белок экзосом, слитый с пептидным лигандом. Затем El-Andaloussi и соавт. объясняют, как очищать и характеризовать экзосомы из надосадочной жидкости культуры трансфицированных клеток. Затем El-Andaloussi и соавт. подробно описывают важнейшие стадии загрузки siRNA в экзосомы. Наконец, El-Andaloussi и соавт. излагают в общих чертах, как использовать экзосомы для эффективной доставки siRNA в головной мозг мышей in vitro и in vivo. Также приведены примеры предполагаемых результатов, в которых опосредованная экзосомами доставка siRNA оценивается посредством функциональных анализов и визуализации. Выполнение полного протокола занимает ~ 3 недели. Доставку или введение согласно настоящему изобретению можно осуществлять с помощью экзосом, полученных из собственных дендритных клеток.

В другом варианте осуществления предусмотрены экзосомы плазмы по Wahlgren и соавт. (Nucleic Acids Research, 2012, Vol. 40, No. 17 е130). Экзосомы представляют собой наноразмерные пузырьки (размером 30-90 нм), вырабатываемые многими типами клеток, в том числе дендритными клетками (DC), В-клетками, Т-клетками, тучными клетками, эпителиальными клетками и опухолевыми клетками. Данные пузырьки образуются путем внутреннего почкования поздних эндосом, а затем высвобождаются во внеклеточную среду после слияния с плазматической мембраной. Поскольку экзосомы в естественных условиях переносят РНК между клетками, это свойство может быть полезным в генной терапии.

Экзосомы из плазмы получают путем центрифугирования лейкоцитарной пленки при 900 g в течение 20 мин. для выделения плазмы с последующим сбором надосадочной жидкости культуры клеток, центрифугированием при 300 g в течение 10 мин. для удаления клеток и при 16500 g в течение 30 мин. с последующей фильтрацией через фильтр с диаметром пор 0,22 мм. Экзосомы осаждают путем ультрацентрифугирования при 120000 g в течение 70 мин. Введение siRNA в экзосомы посредством химической трансфекции проводят согласно инструкциям производителя в наборе RNAi Human/Mouse Starter Kit (Quiagen, Хильден, Германия). siRNA добавляют к 100 мл PBS в конечной концентрации 2 ммоль/мл. После добавления реагента для трансфекции HiPerFect смесь инкубируют в течение 10 мин. при RT. С целью удаления избытка мицелл экзосомы повторно выделяют при помощи латексных гранул с альдегидными/сульфатными группами. Введение CRISPR-Cas в экзосомы посредством химической трансфекции можно проводить аналогично введению siRNA. Экзосомы можно совместно культивировать с моноцитами и лимфоцитами, выделенными из периферической крови здоровых доноров. Таким образом, может быть предусмотрено, чтобы экзосомы, содержащие CRISPR-Cas, можно было вводить в моноциты и лимфоциты и подвергать аутологическому обратному введению в организм человека. Соответственно, доставку или введение согласно настоящему изобретению можно осуществлять с помощью экзосом плазмы.

Липосомы

Доставку или введение согласно настоящему изобретению можно осуществлять с помощью липосом. Липосомы являются сферическими везикулярными структурами, содержащими одно- или многослойный липидный бислой, окружающий внутренние водные компартменты, и относительно непроницаемый внешний липофильный фосфолипидный бислой. Липосомы получили значительное внимание в качестве носителей для доставки лекарственных средств, поскольку они являются биологически совместимыми, нетоксичными, могут доставлять как гидрофильные, так и липофильные молекулы лекарственных средств, защищают свою молекулу-карго от расщепления ферментами плазмы и переносят свой "груз" через биологические мембраны и гематоэнцефалический барьер (ВВВ) (для обзора см., например, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155/2011/469679).

Липосомы можно получать из нескольких различных типов липидов; однако, для создания липосом в качестве носителей лекарственных средств чаще всего применяют фосфолипиды. Хотя образование липосом является самопроизвольным при смешивании липидной пленки с водным раствором, его также можно ускорить путем приложения силы в виде встряхивания посредством применения гомогенизатора, ультразвукового диспергатора или экструзионного аппарата (для обзора см., например, Spuch and Navarro, Journal of Drag Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi: 10.1155/2011/469679).

К липосомам можно добавлять некоторые другие добавки с целью модификации их структуры и свойств. Например, холестерин либо сфингомиелин можно добавлять к смеси липосом в целях содействия стабилизации структуры липосом и предотвращения утечки внутренних молекул-карго липосом. Дополнительно, липосомы получают из гидрогенизированного яичного фосфатидилхолина или яичного фосфатидилхолина, холестерина и дицетилфосфата, и средние размеры их визикул доводили до приблизительно 50 и 100 нм (для обзора см., например, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi: 10.1155/2011/469679).

Традиционный липосомный состав содержит главным образом природные фосфолипиды и липиды, такие как 1,2-дистеароил-sn-глицеро-3-фосфатидилхолин (DSPC), сфингомиелин, формы яичного фосфатидилхолина и моносиалоганглиозид. Поскольку данный состав состоит только из фосфолипидов, липосомные составы сталкиваются со многими проблемами, одной из которых является нестабильность в плазме. Было предпринято несколько попыток преодоления данных проблем, в частности, посредством манипуляции с липидной мембраной. Одна из этих попыток направлена на манипуляцию с холестерином. Добавление холестерина к традиционным составам уменьшает быстрое высвобождение инкапсулированного биологически активного соединения в плазму, а 1,2-диолеоил-sn-глицеро-3-фосфоэтаноламин (DOPE) повышает стабильность (для обзора см., например, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi: 10.1155/2011/469679).

В особенно преимущественном варианте осуществления желательными являются липосомы "троянские кони" (также известные как "молекулярные троянские кони"), и протоколы можно найти на http://cshprotocols.cshlp.org/content/2010/4/pdb.prot5407.long. Эти частицы обеспечивают доставку трансгена в головной мозг в целом после внутрисосудистой инъекции. Без ограничений полагают, что нейтральные липидные частицы с конъюгированными на их поверхности специфичными антителами обеспечивают проникновение через гематоэнцефалический барьер посредством эндоцитоза. Заявитель теоретически допускает использование липосом "троянских коней" для доставки нуклеаз семейства CRISPR в головной мозг посредством внутрисосудистой инъекции, что будет обеспечивать получение животных с трансгенами во всем головном мозге без необходимости в манипуляции с эмбрионами. Может быть предусмотрено приблизительно 1-5 г молекул нуклеиновой кислоты, например, ДНК, РНК, для введения в липосомы in vivo.

В другом варианте осуществления систему CRISPR-Cas можно вводить в липосомы, такие как стабильная частица из нуклеиновой кислоты и липидов (SNALP) (см., например, Morrissey et al., Nature Biotechnology, Vol. 23, No. 8, August 2005). Предусматриваются ежедневные внутривенные инъекции приблизительно 1, 3 или 5 мг/кг/день специфичной целенаправленно воздействующей CRISPR-Cas в SNALP. Ежедневное лечение можно осуществлять в течение приблизительно трех дней и затем еженедельно в течение приблизительно пяти недель. В другом варианте осуществления также предусмотрена специфичная CRISPR-Cas, инкапсулированная в SNALP, вводимая посредством внутривенной инъекции в дозах, составляющих приблизительно 1 или 2,5 мг/кг (см., например, Zimmerman et al., Nature Letters, Vol. 441, 4 May 2006). Состав на основе SNALP может содержать липиды 3-N-[(ω-метоксиполи(этиленгликоль)2000)карбамоил]-1, 2-димиристилоксипропиламин (PEG-CDMA), 1,2-дилинолеилокси-N,N-диметил-3-аминопропан (DLinDMA), 1,2-дистеароил-sn-глицеро-3-фосфохолин (DSPC) и холестерин в молярном процентном соотношении 2:40:10:48 (см., например, Zimmerman et al., Nature Letters, Vol. 441, 4 May 2006).

В другом варианте осуществления было подтверждено, что стабильные частицы из нуклеиновой кислоты и липидов (SNALP) являются эффективными молекулами для доставки в высоковаскуляризированные опухоли печени, происходящие из HepG2, но не в слабо васкуляризированные опухоли печени, происходящие из НСТ-116 (см., например, Li, Gene Therapy (2012) 19, 775-780). SNALP-липосомы можно получать путем составления D-Lin-DMA и PEG-C-DMA с дистеароилфосфатидилхолином (DSPC), холестерином и siRNA с использованием соотношения липид/siRNA 25:1 и молярного соотношения холестерин/D-Lin-DMA/DSPC/PEG-C-DMA 48/40/10/2. Полученные в результате SNALP-липосомы имеют размер приблизительно 80-100 нм.

В еще одном варианте осуществления SNALP может содержать синтетический холестерин (Sigma-Aldrich, Сент-Луис, Миссури, США), дипальмитоилфосфатидилхолин (Avanti Polar Lipids, Алабастер, Алабама, США), 3-N-[(ω-метоксиполи(этиленгликоль)2000)карбамоил]-1,2-димиристилоксипропиламин и катионный 1,2-дилинолеилокси-3-N,N-диметиламинопропан (см., например, Geisbert et al., Lancet 2010; 375: 1896-905). Может предусматриваться режим дозирования с приемом приблизительно 2 мг/кг общего количества CRISPR-Cas на дозу, вводимую, например, в виде болюсной внутривенной инфузии.

В еще одном варианте осуществления SNALP может содержать синтетический холестерин (Sigma-Aldrich), 1,2-дистеароил-sn-глицеро-3-фосфохолин (DSPC; Avanti Polar Lipids Inc.), PEG-cDMA и 1,2-дилинолеилокси-3-(N,N-диметил)аминопропан (DLinDMA) (см., например, Judge, J. Clin. Invest. 119:661-673 (2009)). Составы, используемые для исследований in vivo, могут содержать липиды и РНК в конечном массовом соотношении, составляющем приблизительно 9:1.

Профиль безопасности нанопрепаратов для RNAi был рассмотрен Barros и Gollob из Alnylam Pharmaceuticals (см., например, Advanced Drug Delivery Reviews 64 (2012) 1730-1737). Стабильная частица из нуклеиновой кислоты и липидов (SNALP) содержит четыре различных липида - ионизируемый липид (DLinDMA), который является катионным при низком рН, нейтральный липид-помощник, холестерин и диффундирующий конъюгат полиэтиленгликоль (PEG)-липид. Частица имеет диаметр примерно 80 нм и является электронейтральной при физиологическом значении рН. Во время составления ионизируемый липид служит для конденсации липида с анионной siRNA в ходе образования частиц. Будучи положительно заряженным в условиях возрастающей кислотности в эндосомах, ионизируемый липид также опосредует слияние SNALP с мембраной эндосомы, обеспечивая высвобождение siRNA в цитоплазму. Конъюгат PEG-липид стабилизирует частицу и уменьшает агрегацию во время составления, а также впоследствии обеспечивает нейтральную гидрофильную внешнюю поверхность, улучшающую фармакокинетические свойства.

К настоящему времени была начата реализация двух программ клинических исследований с применением составов на основе SNALP с siRNA. В Tekmira Pharmaceuticals недавно завершили фазу I однодозового исследования SNALP-ApoB с участием взрослых добровольцев с повышенным уровнем холестерина LDL. АроВ преимущественно экспрессируется в печени и тонкой кишке и является ключевым для сборки и секреции VLDL и LDL.. АроВ также успешно подвергается целенаправленному воздействию с помощью систем CRISPR-Cas заявителей, см. примеры 37-38. Семнадцать субъектов получали однократную дозу SNALP-ApoB (повышение дозы, охватывающее 7 уровней дозирования). Не наблюдалось свидетельств гепатотоксичности (предполагаемой в качестве возможной дозолимитирующей токсичности на основании доклинических исследований). Один (или два) субъекта при наиболее высокой дозе испытывали гриппоподобные симптомы, указывающие на стимуляцию иммунной системы, и было принято решение завершить испытание.

В Alnylam Pharmaceuticals аналогичным образом успешно провели исследование ALN-TTR01, в котором используется технология SNALP, описанная выше, и целенаправленно воздействуют на выработку гепатоцитами как мутантного, так и TTR дикого типа, для лечения опосредованного TTR амилоидоза (ATTR). Были описаны три синдрома при ATTR: семейная амилоидическая полинейропатия (FAP) и семейная амилоидическая кардиомиопатия (FAC) - оба обусловленные аутосомно-доминантными мутациями в TTR; и старческий системный амилоидоз (SSA), обусловленный TTR дикого типа. Недавно завершилась I фаза плацебо-контролируемого испытания с повышением однократной дозы ALN-TTR01 с участием пациентов с ATTR. Введение ALN-TTR01 осуществляли в виде 15-минутной IV инфузии 31 пациенту (исследуемое лекарственное средство для 23 и плацебо для 8) в диапазоне доз 0,01-1,0 мг/кг (из расчета siRNA). Лечение хорошо переносилось без значительного повышения показателей печеночных проб. Инфузионные реакции отмечались у 3 из 23 пациентов при ≥0,4 мг/кг; все они реагировали на замедление скорости инфузии и все они продолжали участие в исследовании. Минимальные и временные повышения уровней цитокинов IL-6, IP-10 и IL-1RA в сыворотке отмечались у двух пациентов при наиболее высокой дозе 1 мг/кг (как предполагалось на основании доклинических исследований и исследований с участием NHP). Снижение уровня TTR в сыворотке, ожидаемый фармакодинамический эффект ALN-TTR01, наблюдалось при 1 мг/кг.

В еще одном варианте осуществления SNALP можно получить путем солюбилизации катионного липида, DSPC, холестерина и конъюгата PEG-липид, которые солюбилизируют в этаноле в молярном соотношении 40:10:40:10, соответственно (см. Semple et al., Nature Biotechnology, Volume 28 Number 2 February 2010, pp. 172-177). Смесь липидов добавляли к водному буферу (50 мМ цитрат, рН 4) с перемешиванием до конечной концентрации этанола и липидов 30% (об./об.) и 6,1 мг/мл, соответственно, и ей позволяли уравновешиваться при 22°С в течение 2 мин. перед экструзией. Гидрированные липиды экструдировали через два установленных один над другим фильтра с размером пор 80 нм (Nuclepore) при 22°С при помощи экструдера Lipex (Northern Lipids) до достижения диаметра пузырьков 70-90 нм, определяемого посредством анализа по методу динамического рассеяния света. Для этого обычно требовалось 1-3 прохождения. siRNA (солюбилизированную в водном растворе, содержащем 30% этанол, с 50 мМ цитратом, рН 4) добавляли к предварительно уравновешенным (35°С) пузырькам со скоростью ~5 мл/мин. при перемешивании. После достижения конечного целевого соотношения siRNA/липиды 0,06 (вес/вес) смесь инкубировали в течение дополнительных 30 мин. при 35°С для обеспечения реорганизации пузырьков и инкапсулирования siRNA. Этанол затем удаляли, а внешний буфер заменяли на PBS (155 мМ NaCl, 3 мМ Na2HPO4, 1 мМ KН2РО4, рН 7,5) путем диализа либо тангенциальной поточной диафильтрации. siRNA инкапсулировали в SNALP посредством регулируемого способа по методу ступенчатого разбавления. Липидные составляющие KC2-SNALP представляли собой DLin-KC2-DMA (катионный липид), дипальмитоилфосфатидилхолин (DPPC; Avanti Polar Lipids), синтетический холестерин (Sigma) и PEG-C-DMA, используемые в молярном соотношении 57,1:7,1:34,3:1,4. После образования нагруженных частиц SNALP подвергали диализу против PBS и стерилизации путем фильтрации через фильтр с диаметром пор 0,2 мкм перед применением. Средние значения размера частиц составляли 75-85 нм, и 90-95% siRNA были инкапсулированы в липидных частицах. Конечное, соотношение siRNA/липиды в составах, используемых для тестирования in vivo, составляло ~0,15 (вес/вес). Системы LNP-siRNA, содержащие siRNA для фактора VII, разводили до соответствующих концентраций в стерильном PBS непосредственно перед применением, и составы вводили внутривенно через латеральную хвостовую вену в общем объеме 10 мл/кг. Данный способ можно экстраполировать на систему CRISPR-Cas по настоящему изобретению.

Другие липиды

Другие катионные липиды, такие как аминолипид 2,2-дилинолеил-4-диметиламиноэтил-[1,3]-диоксолан (DLin-KC2-DMA), можно использовать для инкапсулирования CRISPR-Cas аналогично siRNA (см., например, Jayaraman, Angew. Chem. Int. Ed. 2012, 51, 8529-8533). Может быть предусмотрен предварительно сформированный пузырек со следующим составом липидов: аминолипид, дистеароилфосфатидилхолин (DSPC), холестерин и (R)-2,3-бис(октадецилокси)пропил-1-(метоксиполи(этиленгликоль)2000)пропилкарбамат (конъюгат PEG-липид) в молярном соотношении 40/10/40/10, соответственно, и с соотношением siRNA для FVII/общие липиды, составляющим примерно 0,05 (вес/вес). Для обеспечения узкого распределения частиц по размеру в диапазоне 70-90 нм и низкого коэффициента полидисперсности 0,11±0,04 (n=56) частицы можно экструдировать до трех раз через мембраны с диаметром пор 80 нм перед добавлением РНК CRISPR-Cas. Можно использовать частицы, содержащие высокоактивный аминолипид 16, в которых молярное соотношение четырех липидных компонентов 16, DSPC, холестерина и конъюгата PEG-липид (50/10/38,5/1,5) можно дополнительно оптимизировать для повышения активности in vivo.

Michael S D Kormann и соавт. ("Expression of therapeutic proteins after delivery of chemically modified mRNA in mice: Nature Biotechnology, Volume: 29, Pages: 154-157 (2011), опубликовано в интернете 09 января 2011 г.) описывают применение липидных оболочек для доставки РНК. Применение липидных оболочек также является предпочтительным в настоящем изобретении.

В другом варианте осуществления липиды можно составлять с системой CRISPR-Cas по настоящему изобретению с образованием липидных наночастиц (LNP). Липиды включают, без ограничения, DLin-KC2-DMA4, С12-200 и совместно действующие липиды дистеароилфосфатидилхолин, холестерин и PEG-DMG, которые можно составлять с CRISPR-Cas вместо siRNA (см., например, Novobrantseva, Molecular Therapy-Nucleic Acids (2012) 1, e4; doi:10.1038/mtna.2011.3) с помощью процедуры самопроизвольного образования пузырьков. Молярное соотношение компонентов может составлять приблизительно 50/10/38,5/1,5 (DLin-KC2-DMA или С12-200/дистеароилфосфатидилхолин/холестерин/РЕО-ВМО). Конечное весовое соотношение липиды : siRNA может составлять ~12:1 и 9:1 в случае липидных наночастиц (LNP) на основе DLin-KC2-DMA и С12-200, соответственно. Составы могут характеризоваться средними диаметрами частиц ~80 нм при >90% эффективности включения. Может быть предусмотрена доза 3 мг/кг.

Tekmira имеет портфель из примерно 95 семейств патентов-аналогов, выданных в США и за границей, которые направлены на различные аспекты LNP и составы на основе LNP (см., например, патенты США №№7982027; 7799565; 8058069; 8283333; 7901708; 7745651; 7803397; 8101741; 8188263; 7915399; 8236943 и 7838658 и европейские патенты №№1766035; 1519714; 1781593 и 1664316), все из которых можно применять в настоящем изобретении и/или приспосабливать к нему.

Систему CRISPR-Cas можно доставлять инкапсулированной в микросферах на основе PLGA, таких как дополнительно описанные в опубликованных заявках на патенты США 20130252281, и 20130245107, и 20130244279 (закрепленные за Moderna Therapeutics), которые относятся к аспектам составления композиций, содержащих модифицированные молекулы нуклеиновых кислот, которые могут кодировать белок, предшественник белка или частично или полностью процессированную форму белка или предшественника белка. Состав может характеризоваться молярным соотношением 50:10:38,5:1,5-3,0 (катионный липид : фузогенный липид:холестерин : конъюгат PEG-липид). Конъюгат PEG-липид может быть выбран, без ограничения, из PEG-C-DOMG, PEG-DMG. Фузогенный липид может представлять собой DSPC. См. также Schrum et al., Delivery and Formulation of Engineered Nucleic Acids, опубликованную заявку на патент США 20120251618.

Технология Nanomerics преодолевает проблемы, связанные с биологической доступностью, для широкого спектра терапевтических средств, в том числе низкомолекулярных гидрофобных лекарственных средств, пептидов и терапевтических средств на основе нуклеиновых кислот (плазмид, siRNA, miRNA). Конкретные пути введения, для которых технология продемонстрировала очевидные преимущества, включают пероральный путь, перенос через гематоэнцефалический барьер, доставку в солидные опухоли, а также в глаз. См., например, Mazza et al., 2013, ACS Nano. 2013 Feb 26;7(2):1016-26; Uchegbu and Siew, 2013, J Pharm Sci. 102(2):305-10 и Lalatsa et al., 2012, J Control Release. 2012 Jul 20; 161(2):523-36.

В публикации заявки на патент США №20050019923 описаны катионные дендримеры для доставки биологически активных молекул, таких как молекулы полинуклеотидов, пептиды и полипептиды и/или фармацевтические средства, в организм млекопитающего. Дендримеры подходят для обеспечения нацеленной доставки биологически активных молекул в, например, печень, селезенку, легкое, почку или сердце. Дендримеры являются синтетическими 3-мерными макромолекулами, получаемыми ступенчатым способом из простых разветвленных мономерных звеньев, природу и количество функциональных групп которых можно легко регулировать и изменять. Дендримеры синтезируют путем повторяющегося присоединения "строительных блоков" в направлении от сердцевины с несколькими функциональными группами (дивергентный подход к синтезу) или к сердцевине с несколькими функциональными группами (конвергентный подход к синтезу), и каждое присоединение 3-мерной оболочки из "строительных блоков" приводит к образованию дендримеров более высокой генерации. Синтез полипропилениминовых дендримеров начинается с диаминобутановой сердцевины, к которой присоединяют удвоенное количество аминогрупп посредством двойного присоединения по Михаэлю ацетонитрила к первичным аминогруппам с последующим гидрированием нитрильных групп. Это обуславливает удвоение количества аминогрупп. Полипропилениминовые дендримеры содержат 100% протонируемых атомов азота и до 64 концевых аминогрупп (генерация 5, DAB 64). Протонируемые группы обычно представляют собой аминогруппы, способные принимать протоны при нейтральном рН. Применение дендримеров в качестве средств для доставки генов в основном ориентировано на использование полиамидоамина и фосфорсодержащих соединений со смесью из амина/амида или N-P(O2)S в качестве конъюгирующих единиц, соответственно, при этом в работах не сообщалось о применении полипропилениминовых дендримеров более низкой генерации для доставки генов. Полипропилениминовые дендримеры также изучали в качестве рН-чувствительных систем с контролируемым высвобождением для доставки лекарственных средств и для инкапсулирования в них гостевых молекул в случае химической модификации периферических аминокислотных групп. Также изучали цитотоксичность и взаимодействие полипропилениминовых дендримеров с ДНК, а также эффективность трансфекции с помощью DAB 64.

Публикация заявки на патент США №20050019923 основана на наблюдении того, что, в противоположность более ранним сообщениям, катионные дендримеры, такие как полипропилениминовые дендримеры, проявляют надлежащие свойства, такие как специфичное нацеливание и низкая токсичность, для применения в целенаправленной доставке биологически активных молекул, таких как генетический материал. В дополнение, производные катионного дендримера также проявляют подходящие свойства для целенаправленной доставки биологически активных молекул. См. также "Биологически активные полимеры", публикацию заявки на патент США 20080267903, в которой раскрыто следующее: "Показано, что различные полимеры, в том числе катионные полиаминные полимеры и дендримерные полимеры, обладают антипролиферативной активностью и могут, таким образом, быть применимыми для лечения нарушений, характеризующихся нежелательной пролиферацией клеток, таких как неоплазии и опухоли, воспалительные нарушения (в том числе аутоиммунные нарушения), псориаз и атеросклероз. Полимеры можно применять в отдельности в качестве активных средств или в качестве средств доставки других терапевтических средств, таких как молекулы лекарственных средств или нуклеиновые кислоты, для генной терапии. В таких случаях присущая полимерам собственная противоопухолевая активность может дополнять активность средства, подлежащего доставке".

Белки с избыточным зарядом

Белки с избыточным зарядом представляют собой класс сконструированных или встречающихся в природе белков с необычно высоким положительным или отрицательным теоретическим суммарным зарядом. Белки как с избыточным отрицательным, так и с избыточным положительным зарядом проявляют особое свойство устойчивости к термически или химически индуцированной агрегации. Белки с избыточным положительным зарядом также способны проникать в клетки млекопитающих. Ассоциация молекул-карго, таких как плазмидная ДНК, siRNA или другие белки, с этими белками может обеспечивать функциональную доставку данных макромолекул в клетки млекопитающих как in vitro, так и in vivo. В лаборатории Дэвида Лю сообщили о создании и определении характеристик белков с избыточным зарядом в 2007 г. (Lawrence et al., 2007, Journal of the American Chemical Society 129, 10110-10112).

Невирусная доставка siRNA и плазмидной ДНК в клетки млекопитающих является значимой как в исследованиях, так и в терапевтических применениях (Akinc et al., 2010, Nat. Biotech. 26, 561-569). Очищенный белок GFP с зарядом +36 (или другой белок с избыточным положительным зарядом) смешивают с siRNA в подходящей бессывороточной среде и обеспечивают возможность образования ими комплекса перед добавлением к клеткам. Включение сыворотки на этой стадии ингибирует образование комплексов белка с избыточным зарядом с siRNA и снижает эффективность обработки. Было обнаружено, что следующий протокол является эффективным для ряда линий клеток (McNaughton et al., 2009, Proc. Natl. Acad. Sci. USA 106, 6111-6116). Однако, в целях оптимизации процедуры для конкретных линий клеток следует проводить предварительные эксперименты с различными дозами белка и siRNA.

(1) За один день до обработки высеять 1×105 клеток на лунку в 48-луночный планшет.

(2) В день обработки развести очищенный белок GFP с зарядом +36 в бессывороточной среде до конечной концентрации 200 нМ. Добавить siRNA до конечной концентрации 50 нМ. Перемешать на вихревой мешалке и инкубировать при комнатной температуре в течение 10 мин.

(3) Во время инкубирования аспирировать среду от клеток и промыть один раз с помощью PBS.

(4) После инкубирования GFP с зарядом +36 и siRNA добавить к клеткам комплексы белка с siRNA.

(5) Инкубировать клетки с комплексами при 37°С в течение 4 ч.

(6) После инкубирования аспирировать среду и промыть три раза с помощью 20 ед./мл гепарина в PBS. Инкубировать клетки в сывороточной среде в течение дополнительных 48 ч. или дольше в зависимости от анализа нокдауна.

(7) Анализировать клетки с помощью иммуноблоттинга, количественной ПЦР, фенотипического анализа или другого соответствующего способа.

Было обнаружено, что GFP с зарядом +36 является эффективным реагентом для доставки плазмид в ряд клеток. Поскольку плазмидная ДНК является более крупной молекулой-карго, чем siRNA, то для образования эффективного комплекса с плазмидами требуется пропорционально больше белка GFP с зарядом +36. Для эффективной доставки плазмид заявители разработали вариант GFP с зарядом +36, несущий С-концевую пептидную метку НА2, известный пептид, разрушающий эндосомы, полученный из белка гемагглютинина вируса гриппа. Следующий протокол был эффективным для многих клеток, но, как указано выше, рекомендуется, чтобы дозы плазмидной ДНК и белка с избыточным зарядом были оптимизированы для конкретных линий клеток и применений в доставке.

(1) За один день до обработки высеять 1×105 клеток на лунку в 48-луночный планшет.

(2) В день обработки разбавить очищенный белок GFP с зарядом р36 в бессывороточной среде до конечной концентрации 2 мМ. Добавить 1 мг плазмидной ДНК. Перемешать на вихревой мешалке и инкубировать при комнатной температуре в течение 10 мин.

(3) Во время инкубирования аспирировать среду от клеток и промыть один раз с помощью PBS.

(4) После инкубирования GFP с зарядом р36 и плазмидной ДНК осторожно добавить к клеткам комплексы белок-ДНК.

(5) Инкубировать клетки с комплексами при 37°С в течение 4 ч.

(6) После инкубирования аспирировать среду и промыть с помощью PBS. Инкубировать клетки в сывороточной среде и инкубировать в течение дополнительных 24-48 ч.

(7) При необходимости проанализировать доставку плазмид (например, посредством экспрессии генов, обусловленной плазмидами).

См. также, например, McNaughton et al., Proc. Natl. Acad. Sci. USA 106, 6111-6116 (2009); Cronican et al., ACS Chemical Biology 5, 747-752 (2010); Cronican et al., Chemistry & Biology 18, 833-838 (2011); Thompson et al., Methods in Enzymology 503, 293-319 (2012); Thompson, D.B., et al., Chemistry & Biology 19 (7), 831-843 (2012). Способы использования белков с избыточным зарядом можно применять для доставки системы CRISPR-Cas по настоящему изобретению и/или приспосабливать к ней.

Пептиды, проникающие в клетку

В еще одном варианте осуществления предусмотрены пептиды, проникающие в клетку (СРР), для доставки системы CRISPR-Cas. СРР представляют собой короткие пептиды, содействующие поглощению клетками различных молекул-карго (от наноразмерных частиц до малых химических молекул и крупных фрагментов ДНК). Выражение "молекула-карго", используемое в данном документе, включает, без ограничения, группу, состоящую из терапевтических средств, диагностических зондов, пептидов, нуклеиновых кислот, антисмысловых олигонуклеотидов, плазмид, белков, наночастиц, липосом, хромофоров, малых молекул и радиоактивных материалов. В аспектах настоящего изобретения молекула-карго может также содержать любой компонент системы CRISPR-Cas или всю функциональную систему CRISPR-Cas. В аспектах настоящего изобретения дополнительно представлены способы доставки требуемой молекулы-карго субъекту, включающие: (а) получение комплекса, содержащего пептид, проникающий в клетку, по настоящему изобретению и требуемую молекулу-карго, и (b) пероральное, внутрисуставное, внутрибрюшинное, интратекальное, внутриартериальное, интраназальное, интрапаренхиматозное, подкожное, внутримышечное, внутривенное, накожное, ректальное или местное введение комплекса субъекту. Молекула-карго связана с пептидами химической связью посредством ковалентных связей либо посредством нековалентных взаимодействий.

Функцией СРР является доставка молекулы-карго в клетки, при этом процесс, который обычно происходит посредством эндоцитоза приводит к доставке молекулы-карго в эндосомы живых клеток млекопитающих. Пептиды, проникающие в клетку, имеют различные размер, аминокислотные последовательности и заряды, но все СРР имеют одну отличительную характеристику, которая представляет собой способность к перемещению через плазматическую мембрану и содействию доставке различных молекул-карго в цитоплазму или органеллу. Перемещение СРР можно подразделить на три основных механизма поступления: прямое прохождение через мембрану, поступление, опосредованное эндоцитозом, и перемещение посредством образования промежуточной структуры. СРР нашли многочисленные применения в медицине в качестве средств для доставки лекарственных средств при лечении различных заболеваний, в том числе рака, и ингибиторов вирусов, а также контрастных веществ для мечения клеток. Примеры последнего включают действие в качестве носителя GFP, контрастных веществ для MRI или квантовых точек. СРР обладают большим потенциалом в качестве векторов доставки in vitro и in vivo для применения в исследованиях и медицине. СРР обычно имеют такой аминокислотный состав, при котором они характеризуются высокой относительной распространенностью положительно заряженных аминокислот, таких как лизин или аргинин, либо имеют последовательности, характеризующиеся чередующимся расположением полярных/заряженных аминокислот и неполярных гидрофобных аминокислот. Эти два типа структур называются поликатионными или амфипатическими, соответственно. Третьим классом СРР являются гидрофобные пептиды, содержащие только неполярные остатки с низким суммарным зарядом или имеющие гидрофобные группы аминокислот, крайне важные для поглощения клетками. Одним из первых обнаруженных СРР был трансактивирующий активатор транскрипции (Tat) вируса иммунодефицита человека 1 (HIV-1), который, как было выявлено, эффективно поглощался из окружающей среды многочисленными типами клеток в культуре. С тех пор количество известных СРР значительно увеличилось, и были созданы низкомолекулярные синтетические аналоги с более эффективными свойствами белковой трансдукции. СРР включают, без ограничения, пенетратин, Tat (48-60), транспортан и (R-AhX-R4) (Ahx = аминогексаноил).

В патенте США 8372951 представлен СРР, полученный из катионного белка эозинофилов (ЕСР), проявляющий высокую эффективность проникновения в клетку и низкую токсичность. Также представлены аспекты доставки СРР со своей молекулой-карго позвоночному субъекту. Дополнительные аспекты, касающиеся СРР и их возможной доставки, описаны в патентах США 8575305, 8614194 и 8044019.

Эти СРР можно использовать для доставки системы CRISPR-Cas, что также представлено в рукописи "Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA" Suresh Ramakrishna, Abu-Bonsrah Kwaku Dad, Jagadish Beloor, et al. Genome Res. 2014 Apr 2. [Электронная публикация, предшествующая печатной], включенной с помощью ссылки во всей своей полноте, где продемонстрировано, что обработка с помощью рекомбинантного белка Cas9 конъюгированного с СРР, и направляющих РНК, образующих комплекс с СРР, приводит к нарушениям функционирования эндогенных генов в линиях клеток человека. В данной статье белок Cas9 был конъюгирован СРР с помощью тиоэфирной связи, тогда как направляющая РНК образовывала комплекс с СРР с образованием конденсированных положительно заряженных наночастиц. Было показано, что одновременная и последовательная обработка клеток человека, в том числе эмбриональных стволовых клеток, дермальных фибробластов, клеток НЕK293Т, клеток HeLa и клеток эмбриональной карциномы, модифицированным Cas9 и направляющей РНК приводила к эффективным нарушениям функционирования генов со сниженной частотой нецелевых мутаций по сравнению с трансфекцией плазмидами.

Имплантируемые устройства

В другом варианте осуществления также предусмотрены имплантируемые устройства для доставки системы CRISPR-Cas. Например, в публикации заявки на патент США 20110195123 раскрыто представленное имплантируемое медицинское устройство, высвобождающее лекарственное средство локально и в течение длительного периода, в том числе несколько типов такого устройства, реализуемые методы лечения и способы имплантации. Устройство содержит полимерный субстрат, такой как матрица, например, применяемый в качестве корпуса устройства, и лекарственные средства, и в некоторых случаях дополнительные трехмерные подложки-носители, такие как металлы или дополнительные полимеры, и материалы для улучшения видимости и визуализации. В основе выбора лекарственного средства лежит преимущество высвобождения лекарственного средства, происходящего локально и в течение длительного периода, где лекарственное средство высвобождается непосредственно во внеклеточный матрикс (ЕСМ) пораженной заболеванием области, как, например, в случае опухоли, воспаления, дегенерации, или в целях симптоматической терапии, или в пораженные гладкомышечные клетки, или для предупреждения. Один вид лекарственных средств представляет собой лекарственные средства для сайленсинга генов на основе РНК-интерференции (RNAi), включающие, без ограничения, siRNA, shRNA или антисмысловые РНК/ДНК, рибозимы и нуклеозидные аналоги. Таким образом, данную систему можно применять для системы CRISPR-Cas по настоящему изобретению и/или приспосабливать к ней. Методы имплантации в некоторых вариантах осуществления представляют собой существующие процедуры имплантации, разработанные и применяемые в настоящее время для других видов лечения, в том числе для брахитерапии и пункционной биопсии. В таких случаях размеры нового имплантата, описанного в настоящем изобретении, аналогичны размерам первоначального имплантата. Как правило, в ходе одной процедуры лечения имплантируют несколько устройств.

Как описано в публикации заявки на патент США 20110195123, представлена имплантируемая или вставная система доставки лекарственных средств, в том числе системы, применимые для введения в полость, такую как брюшная полость, и/или для любого другого типа введения, в которой система доставки лекарственных средств не закреплена и не присоединена, содержащая биоустойчивый, и/или разлагаемый, и/или биопоглощаемый полимерный субстрат, который может, например, необязательно представлять собой матрицу. Следует отметить, что выражение "вставка" также включает имплантацию. Система для доставки лекарственных средств преимущественно реализуется как "Loder", что описано в публикации заявки на патент США 20110195123.

Полимер или множество полимеров, содержащие средство и/или множество средств, являются биосовместимыми, обеспечивая высвобождение средства с контролируемой скоростью, где общий объем полимерного субстрата, такого как матрица, например, в некоторых вариантах осуществления необязательно и предпочтительно не превосходит максимальный объем, позволяющий достигнуть терапевтического уровня средства. В качестве неограничивающего примера, такой объем предпочтительно находится в диапазоне от 0,1 м3 до 1000 мм3, как того требует объем загруженного средства. Loder необязательно может иметь больший размер, например, будучи включенной в состав устройства, размер которого определяется функциональным назначением, например, без ограничения коленного сустава, внутриматочного или шеечного кольца и т.п.

Система доставки лекарственных средств (для доставки композиции) в некоторых вариантах осуществления предназначена для предпочтительного использования разлагаемых полимеров, где основным механизмом высвобождения является объемная эрозия; или же в некоторых вариантах осуществления применяются неразлагаемые или медленно разлагаемые полимеры, где основным механизмом высвобождения является диффузия, а не объемная эрозия, так что их наружная часть функционирует в качестве мембраны, а их внутренняя часть функционирует в качестве депо лекарственного средства, которое практически не подвергается воздействию окружения в течение продолжительного периода (например, от приблизительно недели до приблизительно нескольких месяцев). Также можно необязательно применять комбинации различных полимеров с различными механизмами высвобождения. Градиент концентраций на поверхности предпочтительно эффективно поддерживается постоянным в течение значительного периода в ходе общего периода высвобождения лекарственного средства, и, таким образом, скорость диффузии (называемой "диффузией нулевого порядка") является эффективно постоянной. Под выражением "постоянный" подразумевают скорость диффузии, которая предпочтительно поддерживается выше нижнего порога терапевтической эффективности, но которая, тем не менее, может необязательно характеризоваться начальным всплеском и/или колебаться, например, повышаясь и понижаясь в некоторой степени. Скорость диффузии предпочтительно поддерживается таким образом в течение длительного периода, и до определенного уровня она может считаться постоянной для оптимизации терапевтически эффективного периода, например, эффективного периода сайленсинга.

Система доставки лекарственных средств необязательно и предпочтительно предназначена для защиты нуклеотидного терапевтического средства от деградации, химической по своей природе или обусловленной воздействием ферментов и других факторов в организме субъекта.

Система доставки лекарственных средств, описанная в публикации заявки на патент США 20110195123, необязательно связана с чувствительными и/или активирующими приборами, функционирующими во время и/или после имплантации устройства посредством неинвазивных и/или минимально инвазивных способов активации и/или ускорения/замедления, например, необязательно включающих, без ограничения, способы или устройства с применением термического нагревания и охлаждения, лазерных пучков и ультразвука, в том числе фокусированного ультразвука, и/или RF (радиочастот).

Согласно некоторым вариантам осуществления публикации заявки на патент США 20110195123 участок для локальной доставки может необязательно включать целевые участки, характеризующиеся высокой аномальной пролиферацией клеток и подавлением апоптоза, в том числе опухоли, очаги активного и/или хронического воспаления и инфекции, включающие аутоиммунные болезненные состояния, ткань с дегенеративными изменениями, включающую мышечную и нервную ткань, очаги хронической боли, участки с дегенеративными изменениями, и местоположения переломов костей, и другие местоположения ран, для усиления регенерации ткани, а также поврежденные сердечные, гладкие и поперечно-полосатые мышцы. Участок для локальной доставки также может необязательно включать участки, позволяющие осуществлять профилактические мероприятия, в том числе при беременности, при предупреждении инфекции и старения.

Участок для имплантации композиции, или целевой участок, предпочтительно характеризуется радиусом, площадью и/или объемом, достаточно малыми для целенаправленной локальной доставки. Например, целевой участок необязательно имеет диаметр в диапазоне от приблизительно 0,1 мм до приблизительно 5 см.

Местоположение целевого участка предпочтительно выбирают для достижения максимальной терапевтической эффективности. Например, композицию системы для доставки лекарственных средств (необязательно вместе с устройством для имплантации, описанным выше) необязательно и предпочтительно имплантируют в опухолевое окружение, или рядом с ним, или в кровеносную сеть, связанную с ним.

Например, композицию (необязательно вместе с устройством) необязательно имплантируют в поджелудочную железу, предстательную железу, молочную железу, печень или рядом с ними, через сосок, в сосудистую систему и т.д.

Целевое местоположение необязательно выбирают из группы, состоящей из (только в качестве неограничивающих примеров, поскольку любой участок в организме необязательно может подходить для имплантации Loder): 1. участков головного мозга с дегенеративными изменениями, таких как базальные ганглии, белое и серое вещество, при болезни Паркинсона или Альцгеймера; 2. спинного мозга, как в случае бокового амиотрофического склероза (ALS); 3. шейки матки для предупреждения HPV-инфекции; 4. суставов с активным или хроническим воспалением; 5. дермы, как в случае псориаза; 6. участков симпатических и чувствительных нервов для обезболивающего эффекта; 7. участков внутрикостной имплантации; 8. очагов острой и хронической инфекции; 9. интравагинальных участков; 10. внутреннего уха - слуховой системы, лабиринта внутреннего уха, вестибулярной системы; 11. внутритрахеальных участков; 12. внутрисердечных участков; участков коронарных сосудов, эпикардиальных участков; 13. мочевого пузыря; 14. желчевыделительной системы; 15. паренхимной ткани, включающей, без ограничения, почку, печень, селезенку; 16. лимфатических узлов; 17. слюнных желез; 18. десен вокруг зубов; 19. внутрисуставных участков (имплантация в суставы); 20. внутриглазных участков; 21. ткани головного мозга; 22. желудочков головного мозга; 23. полостей, в том числе брюшной полости (например, без ограничения, для лечения рака яичника); 24. внутрипищеводных участков и 25. внутрипрямокишечных участков.

Вставка системы (например, устройства, содержащего композицию) необязательно связана с инъекцией материала в ЕСМ целевого участка и окружение этого участка для воздействия на локальные рН, и/или температуру, и/или другие биологические факторы, влияющие на диффузию лекарственного средства и/или кинетику лекарственного средства в ЕСМ целевого участка и окружении такого участка.

Согласно некоторым вариантам осуществления высвобождение указанного средства необязательно может быть связано с чувствительными и/или активирующими приборами, функционирующими до, и/или во время, и/или после вставки посредством неинвазивных, и/или минимально инвазивных, и/или других способов активации и/или ускорения/замедления, включающих способы или устройства с применением лазерных пучков, излучения, термического нагревания и охлаждения, и ультразвука, в том числе фокусированного ультразвука, и/или RF (радиочастот), а также химических активаторов.

Согласно другим вариантам осуществления в публикации заявки на патент США 20110195123 лекарственное средство предпочтительно включает биологическое лекарственное средство для сайленсинга генов на основе RNAi, например, для лечения случаев локализованного рака молочной железы, поджелудочной железы, головного мозга, почки, мочевого пузыря, легкого и предстательной железы, описанных ниже. Кроме того, многие лекарственные средства, отличные от siRNA, применимы для инкапсулирования в Loder и могут применяться в контексте настоящего изобретения, поскольку такие лекарственные средства могут быть инкапсулированы в субстрат Loder, такой как, например, матрица. Такие лекарственные средства включают одобренные лекарственные средства, доставляемые в настоящее время с помощью способов, отличных от способов по настоящему изобретению, включающие амфотерицин В для лечения грибковой инфекции; антибиотики, как, например, при остеомиелите; обезболивающие средства, такие как наркотические средства; антидегенеративные средства, как, например, при болезни Альцгеймера или Паркинсона, в Loder, имплантируемой вблизи спинного мозга в случае боли в спине. Такую систему можно применять для доставки системы CRISPR-Cas по настоящему изобретению и/или приспосабливать к ней.

Например, для конкретных применений, таких как предупреждение роста или возобновления роста гладкомышечных клеток (поврежденных в ходе процедуры стентирования и вследствие этого склонных к пролиферации), лекарственное средство может необязательно представлять собой siRNA, осуществляющую сайленсинг в гладкомышечных клетках, в том числе сайленсинг H19, или лекарственное средство, выбранное из группы, состоящей из таксола, рапамицина и аналогов рапамицина. В таких случаях Loder предпочтительно представляет собой стент, выделяющий лекарственное средство (DES), с пролонгированным высвобождением при постоянной скорости либо выделенное устройство, которое имплантируют отдельно, совместно со стентом. Все из этого можно применять для системы CRISPR-Cas по настоящему изобретению и/или приспосабливать к ней.

В качестве другого примера конкретного применения, нейро- и миодегенеративные заболевания развиваются в связи с аномальной экспрессией генов. Локальная доставка РНК для сайленсинга может иметь терапевтические свойства, препятствующие такой аномальной экспрессии генов. Локальная доставка антиапоптотических, противовоспалительных и антидегенеративных лекарственных средств, в том числе низкомолекулярных лекарственных средств и макромолекул, может также необязательно быть терапевтической. В таких случаях Loder применяют для пролонгированного высвобождения при постоянной скорости и/или посредством выделенного устройства, которое имплантируют отдельно. Все из этого можно применять для системы CRISPR-Cas по настоящему изобретению и/или приспосабливать к ней.

В качестве еще одного примера конкретного применения психические и когнитивные расстройства лечат с помощью модификаторов генов. Нокдаун гена с помощью РНК для сайленсинга является возможным методом лечения. Применение Loder для локальной доставки нуклеотидных средств в участки центральной нервной системы является возможным методом терапии психических и когнитивных расстройств, в том числе, без ограничения, психоза, биполярных расстройств, невротических расстройств и расстройств поведения. Loder могут также обеспечивать локальную доставку лекарственных средств, в том числе низкомолекулярных лекарственных средств и макромолекул, при имплантации в конкретные участки головного мозга. Все из этого можно применять для системы CRISPR-Cas по настоящему изобретению и/или приспосабливать к ней.

В качестве другого примера конкретного применения сайленсинг генов медиаторов врожденного и/или приобретенного иммунного ответа в локальных участках обеспечивает предупреждение отторжения трансплантированного органа. Локальная доставка РНК для сайленсинга и иммуномодулирующих реагентов с помощью Loder, имплантированной в трансплантированный орган и/или участок имплантации, активирует местное подавление иммунного ответа в отношении трансплантированного органа путем отвлечения иммунных клеток, таких как CD8+. Все из этого можно применять для системы CRISPR-Cas по настоящему изобретению и/или приспосабливать к ней.

В качестве другого примера конкретного применения факторы роста сосудов, в том числе VEGF, и ангиогенин, и другие, являются существенно важными для неоваскуляризации. Локальная доставка факторов, пептидов, пептидомиметиков или подавление их репрессоров является важным терапевтическим воздействием; сайленсинг репрессоров и локальная доставка факторов, пептидов, макромолекул и низкомолекулярных лекарственных средств, стимулирующих ангиогенез, с помощью Loder являются терапевтическими мерами в отношении заболевания периферических сосудов, системного заболевания сосудов и заболевания сосудов сердца.

Способ вставки, такой как имплантация, необязательно можно еще применять для других типов имплантации в ткань, и/или для вставок, и/или для отбора образцов тканей необязательно без модификаций или, в альтернативном случае, необязательно лишь с незначительными модификациями таких способов. Такие способы необязательно включают, без ограничения, способы брахитерапии, биопсию, эндоскопию с применением ультразвуковых технологий и/или без них, такую как ERCP, стереотаксические способы в отношении ткани головного мозга, лапароскопию, в том числе имплантацию с помощью лапароскопа в суставы, органы брюшной полости, стенку мочевого пузыря и полости тела.

мРНК фермента CRISPR и направляющая РНК

мРНК фермента CRISPR и направляющую РНК можно также доставлять по отдельности. мРНК фермента CRISPR можно доставлять перед направляющей РНК, чтобы предоставить время для экспрессии фермента CRISPR. мРНК фермента CRISPR можно вводить за 1-12 часов (предпочтительно примерно за 2-6 часов) до введения направляющей РНК.

Альтеорнативно, мРНК фермента CRISPR и направляющую РНК можно вводить совместно. Вторую бустерную дозу направляющей РНК можно преимущественно вводить через 1-12 часов (предпочтительно примерно через 2-6 часов) после первого введения мРНК фермента CRISPR + направляющей РНК.

Введение дополнительных доз мРНК фермента CRISPR и/или направляющей РНК может быть применимым для достижения наиболее эффективных уровней модификации генома.

Для сведения к минимуму токсичности и нецелевого эффекта будет важной регуляция концентрации доставляемых мРНК фермента CRISPR и направляющей РНК. Оптимальные концентрации мРНК фермента CRISPR и направляющей РНК можно определить путем тестирования различных концентраций в клеточной или животной модели и применения глубокого секвенирования для анализа степени модификации в возможных нецелевых локусах генома. Например, для направляющей последовательности, нацеливающейся на 5'-GAGTCCGAGCAGAAGAAGAA-3' в гене ЕМХ1 генома человека, можно применять глубокое секвенирование для определения уровня модификации в следующих двух нецелевых локусах, 1: 5'-GAGTCCTAGCAGGAGAAGAA-3' и 2: 5'-GAGTCTAAGCAGAAGAAGAА-3'. Для доставки in vivo следует выбрать концентрацию, дающую наиболее высокий уровень целевой модификации при сведении к минимуму уровня нецелевой модификации.

Альтернативно, для сведения к минимуму уровня токсичности и нецелевого эффекта можно доставлять мРНК фермента никазы CRISPR (например, Cas9 S. pyogenes с мутацией D10A) вместе с парой направляющих РНК, которые осуществляют нацеливание на сайт, представляющий интерес. Две направляющие РНК необходимо расположить следующим образом. Направляющие последовательности показаны красным (одинарное подчеркивание) и синим (двойное подчеркивание), соответственно (эти примеры основаны на требованиях к РАМ для Cas9 Streptococcus pyogenes).

Дополнительное исследование системы предоставило заявителям свидетельство наличия "липкого" 5'-конца (см., например, Ran et al., Cell. 2013 Sep 12; 154(6): 1380-9 и предварительную заявку на патент США с регистрационным номером 61/871301, поданную 28 августа 2013 г.). Заявители дополнительно идентифицировали параметры, связанные с эффективным расщеплением мутантной никазой Cas9 в сочетании с двумя направляющими РНК, и эти параметры включают, без ограничения, длину "липкого" 5'-конца. В вариантах осуществления настоящего изобретения "липкий" 5'-конец содержит не более 200 пар оснований, предпочтительно не более 100 пар оснований или более предпочтительно не более 50 пар оснований. В вариантах осуществления настоящего изобретения "липкий" 5'-конец содержит по меньшей мере 26 пар оснований, предпочтительно по меньшей мере 30 пар оснований или более предпочтительно 34-50 пар оснований или 1-34 пары оснований. В других предпочтительных способах по настоящему изобретению первая направляющая последовательность, управляющая расщеплением одной нити ДНК-дуплекса возле первой целевой последовательности, и вторая направляющая последовательность, управляющая расщеплением другой нити возле второй целевой последовательности, обуславливают возникновение "тупого" конца или "липкого" 3'-конца. В вариантах осуществления настоящего изобретения "липкий" 3'-конец содержит не более 150, 100 или 25 пар оснований или не менее 15, 10 или 1 пары оснований. В предпочтительных вариантах осуществления "липкий" 3'-конец содержит 1-100 пар оснований.

Аспекты настоящего изобретения относятся к снижению экспрессии продукта гена, или к дополнительному введению матричного полинуклеотида в молекулу ДНК, кодирующую продукт гена, или к точному вырезанию вставочной последовательности путем обеспечения повторного отжига и лигирования двух "липких" 5'-концов, или к изменению активности или функционирования продукта гена, или к повышению экспрессии продукта гена. В варианте осуществления настоящего изобретения продукт гена представляет собой белок.

Только пары sgRNA, создающие "липкие" 5'-концы, с перекрыванием между направляющими последовательностями, составляющим менее 8 п.о. (смещение превышает -8 п.о.), были способны опосредовать выявляемое образование вставок/делеций. Важно, что каждая направляющая последовательность, применяемая в данных анализах, способна эффективно индуцировать образование вставок/делеций при спаривании с Cas9 дикого типа, что указывает на то, что взаимное расположение пар направляющих последовательностей является наиболее важным параметром для предсказания активности внесения двойных однонитевых разрывов.

Поскольку Cas9n и Cas9H840A вносят однонитевые разрывы в противоположные нити ДНК, замена Cas9n на Cas9H840A с указанной парой sgRNA должна обуславливать инверсию типа "липкого" конца. Например, пара sgRNA, которая с Cas9n будет образовывать "липкий" 5'-конец, теоретически будет образовывать вместо этого соответствующий "липкий" 3'-конец. Таким образом, пары sgRNA, обуславливающие с Cas9n образование "липкого" 3'-конца, можно применять с Cas9H840A для образования "липкого" 5'-конца. Заявители тестировали Cas9H840A с набором пар sgRNA, предназначенных для образования "липких" как 5'-, так и 3'-концов (диапазон смещений от -278 до +58 п.о.), но, вопреки ожиданиям, не могли наблюдать образование вставок/делеций. Может потребоваться дополнительная работа для определения необходимых правил конструирования пар sgRNA для обеспечения внесения двойных однонитевых разрывов с помощью Cas9H840A.

Печень, пропротеинконвертаза субтилизин/кексин 9 (PCSK9)

Данные демонстрируют фенотипическую конверсию.

Пропротеинконвертаза субтилизин/кексин 9 (PCSK9) является представителем семейства сериновых протеаз субтилизинового типа. PCSK9 экспрессируется главным образом в печени и является критически важным для снижения экспрессии рецепторов LDL в гепатоцитах. Уровни LDL-C в плазме значительно повышены у людей с мутациями приобретения функции в PCSK9, вследствие чего их считают имеющими тяжелую гиперхолестеринемию. Таким образом, PCSK9 является привлекательной мишенью для CPJSPR. Целенаправленно воздействующие на PCS9K CRISPR можно составлять в липидных частицах и вводить, например, при приблизительно 15, 45, 90, 150, 250 и 400 мкг/кг внутривенно (см., например, http://www.alnylam.com/capella/wp-content/uploads/2013/08/ALN-PCS02-001-Protocol-Lancet.pdf).

Bailey и соавт. (J Mol Med (Berl). 1999 Jan; 77(1):244-9) раскрывают доставку инсулина посредством генной терапии соматических клеток ex vivo, включающей выделение отличных от В-клеток соматических клеток (например, фибробластов) у пациента с диабетом и генетическое изменение их in vitro для выработки и секреции инсулина. Клетки можно выращивать в культуре и возвращать донору в качестве источника заменителя инсулина. Клетки, модифицированные таким образом, можно оценивать перед имплантацией, а резервные запасы можно подвергать криоконсервации. В случае применения собственных клеток пациента процедура будет избавлена от необходимости в подавлении иммунитета и преодолеет проблему снабжения тканей, избегая при этом повторного разрушения клеток. Для генной терапии соматических клеток ex vivo требуется доступный и устойчивый тип клеток, поддающийся нескольким трансфекциям и подвергаемый регулируемой пролиферации. Особые проблемы, связанные с применением отличных от В-клеток соматических клеток, включают процессинг проинсулина в инсулин и придание чувствительности стимулируемому глюкозой биосинтезу проинсулина и регулируемому высвобождению инсулина. Предварительные исследования с применением фибробластов, гипофизарных клеток, клеток почек (COS) и клеток яичников (СНО) позволяют предположить, что эти проблемы могут быть разрешены и что генная терапия соматических клеток ex vivo предлагает возможный подход к терапии с использованием заменителя инсулина. Систему по Bailey и соавт. можно применять для доставки системы CRISPR-Cas по настоящему изобретению в печень и/или приспосабливать к ней.

Способы по Sato и соавт. (Nature Biotechnology Volume 26 Number 4 April 2008, Pages 431-442) можно применять для доставки системы CRISPR-Cas по настоящему изобретению в печень. Sato и соавт. обнаружили, что виды лечения с помощью связанных с витамином А липосом, содержащих siRNA, практически полностью устраняли фиброз печени и продлевали период выживания у крыс со смертельным в иных случаях циррозом печени, индуцированным диметилнитрозамином, в зависимости от дозы и продолжительности. Катионные липосомы (Lipotrust), содержащие O,O'-дитетрадеканоил-N-(а-триметиламмонийацетил)диэтаноламинохлорид (DC-6-14) в качестве катионного липида, холестерин и диолеоилфосфатидилэтаноламин в молярном соотношении 4:3:3 (демонстрировавшие высокую эффективность трансфекции в условиях сывороточной среды для доставки генов in vitro и in vivo), приобретали у Hokkaido System Science. Липосомы изготовляли посредством способа с применением подвергнутых сублимационной сушке "пустых" липосом и получали в концентрации 1 мМ (DC-16-4) путем добавления бидистиллированной воды (DDW) к лиофилизированной смеси липидов при перемешивании на вихревой мешалке перед применением. Для получения связанных с VA липосом 200 нмоль витамина А (ретинол, Sigma), растворенного в DMSO, смешивали с суспензиями липосом (в виде 100 нмоль DC-16-4) путем перемешивания на вихревой мешалке в пробирке на 1,5 мл при 25°С. Для получения связанных с VA липосом, несущих siRNAgp46 (VA-липосома-siRNAgp46), раствор siRNAgp46 (580 пмоль/мл в DDW) добавляли к раствору связанных с ретинолом липосом при перемешивании при 25°С. Соотношение siRNA и DC-16-4 составляло 1:11,5 (моль/моль), а соотношение siRNA и липосом (вес/вес) составляло 1:1. Любой свободный витамин А или siRNA, не поглощенную липосомами, отделяли от липосомных препаратов при помощи системы микроразделения (концентратор VIVASPIN 2, MWCO 30000, PES, VIVASCIENCE). Суспензию липосом добавляли на фильтры и центрифугировали при 1500 g в течение 5 мин. 3 раза при 25°С. Фракции собирали, и материал, захваченный фильтром, разбавляли в PBS с получением требуемой дозы для применения in vitro или in vivo. Крысам проводили три инъекции по 0,75 мг/кг siRNA через день. Систему по Sato и соавт. можно применять для доставки системы CRISPR-Cas по настоящему изобретению в печень посредством доставки приблизительно 0,5-1 мг/кг РНК CRISPR-Cas в липосомах, как описано Sato и соавт., людям, и/или приспосабливать к ней.

Способы по Rozema и соавт. (PNAS, August 7, 2007, vol. 104, no. 32) в отношении средства для доставки siRNA в гепатоциты как in vitro, так и in vivo, которое Rozema и соавт. назвали динамическими поликонъюгатами siRNA, можно также применять в настоящем изобретении. Ключевые особенности технологии динамических поликонъюгатов включают применение мембраноактивного полимера, способность к обратимой маскировке активности данного полимера до достижения им кислой среды эндосом и способность к специфичному целенаправленному воздействию этого модифицированного полимера и его молекулы-карго siRNA на гепатоциты in vivo после простой i.v. инъекции под низким давлением. SATA-модифицированные siRNA синтезируют с помощью реакции 5'-аминомодифицированной siRNA с 1 весовым эквивалентом (вес. экв.) реагента N-сукцинимидил-S-ацетилтиоацетата (SATA) (Pierce) и 0,36 вес. экв. NaHCO3 в воде при 4°С в течение 16 ч. Модифицированные siRNA затем осаждают путем добавления 9 об. этанола и инкубирования при 80°С в течение 2 ч. Осадок ресуспендируют в IX буфере для siRNA (Dharmacon) и оценивают количественно путем измерения поглощения при длине волны 260 нм. PBAVE (30 мг/мл в 5 мМ TAPS, рН 9) модифицируют путем добавления 1,5 вес. % SMPT (Pierce). После инкубирования в течение 1 ч. 0,8 мг SMPT-PBAVE добавляли к 400 мкл изотонического раствора глюкозы, содержащего 5 мМ TAPS (рН 9). К этому раствору добавляли 50 мкг SATA-модифицированной siRNA. Для экспериментов по изучению зависимости "доза-эффект", где [PBAVE] была постоянной, добавляют различные количества siRNA. Смесь затем инкубируют в течение 16 ч. К раствору затем добавляют 5,6 мг свободного основания Hepes, а после этого смесь 3,7 мг CDM-NAG и 1,9 мг CDM-PEG. Раствор затем инкубируют в течение по меньшей мере 1 ч. при комнатной температуре перед инъекцией. CDM-PEG и CDM-NAG синтезируют из хлорангидрида, образующегося посредством применения оксалилхлорида. К хлорангидриду добавляют 1,1 молярного эквивалента полиэтиленгликольмонометилового эфира (средняя молекулярная масса 450) с образованием CDM-PEG или (аминоэтокси)этокси-2-(ацетиламино)-2-дезокси-β-D-глюкопиранозида с образованием CDM-NAG. Конечный продукт очищают с помощью обращенно-фазовой HPLC с 0,1% TFA в градиенте вода/ацетонитрил. Мышам доставляли приблизительно 25-50 мкг siRNA. Систему по Rozema и соавт. можно применять для доставки системы CRISPR-Cas по настоящему изобретению в печень, например, предусматривая дозу от приблизительно 50 до приблизительно 200 мг CRISPR-Cas для доставки человеку.

Кость

Oakes and Lieberman (Clin Orthop Relat Res. 2000 Oct; (379 Suppl): S101-12) обсуждают доставку генов в кость. Путем переноса генов в клетки в конкретном анатомическом участке можно использовать остеоиндуктивные свойства факторов роста в физиологических дозах в течение длительного периода для содействия более значительной реакции заживления. Конкретный анатомический участок, качество кости и мягкотканный футляр влияют на выбор целевых клеток для регионарной генной терапии. Векторы для генной терапии, доставляемые в обрабатываемый участок в остеоиндуктивных носителях, давали многообещающие результаты. Некоторые исследователи показали впечатляющие результаты, применяя регионарную генную терапию в животных моделях ex vivo и in vivo. Такую систему можно применять для доставки системы CRISPR-Cas в кость и/или приспосабливать к ней.

Головной мозг

Варианты доставки в головной мозг включают инкапсулирование фермента CRISPR и направляющей РНК в форме ДНК или РНК в липосомы и конъюгацию с "молекулярными троянскими конями" для доставки через гематоэнцефалический барьер (ВВВ). Было показано, что "молекулярные троянские кони" являются эффективными для доставки векторов экспрессии B-gal в головной мозг отличных от человека приматов. Этот же подход можно применять для доставки векторов, содержащих фермент CRISPR и направляющую РНК. Например, Xia CF and Boado RJ, Pardridge WM ("Antibody-mediated targeting of siRNA via the human insulin receptor using avidin-biotin technology." Mol Pharm. 2009 May-Jun; 6(3):747-51. doi: 10.1021/mp800194) описывают, что доставка коротких интерферирующих РНК (siRNA) в клетки в культуре и in vivo возможна в случае комбинированного применения моноклонального антитела (mAb), специфичного к рецептору, и авидин-биотиновой технологии. Авторы также сообщают, что, поскольку в случае применения авидин-биотиновой технологии связь между нацеливающим mAb и siRNA является устойчивой, после внутривенного введения целенаправленно воздействующей siRNA наблюдаются эффекты RNAi in vivo в отдаленных участках, таких как головной мозг.

Zhang и соавт. (Mol Ther. 2003 Jan; 7(1):11-8.)) описывают, как экспрессионные плазмиды, кодирующие репортеры, такие как люцифераза, инкапсулировали во внутреннее пространство "искусственного вируса", включающего пегилированную иммунолипосому размером 85 нм, нацеливаемую на головной мозг макака-резуса in vivo с помощью моноклонального антитела (MAb) к рецептору инсулина человека (HIR). MAb к HIR позволяет липосоме, несущей экзогенный ген, подвергаться трансцитозу через гематоэнцефалический барьер и эндоцитозу через плазматическую мембрану нейронов после внутривенной инъекции. Уровень экспрессии гена люциферазы в головном мозге у макака-резуса был в 50 раз выше по сравнению с крысой. Широко распространенная экспрессия гена бета-галактозидазы в нейронах головного мозга приматов была продемонстрирована с помощью как гистохимического анализа, так и конфокальной микроскопии. Авторы указывают, что данный подход позволяет достичь обратимой экспрессии трансгена у взрослых животных в течение 24 часов. Соответственно, применение иммунолипосом является предпочтительным. Их можно использовать в сочетании с антителами для нацеливания на конкретные ткани или белки клеточной поверхности.

Также являются предпочтительными другие средства доставки РНК, как, например, посредством наночастиц (Cho, S., Goldberg, М., Son, S., Xu, Q., Yang, F., Mei, Y., Bogatyrev, S., Langer, R. and Anderson, D., Lipid-like nanoparticles for small interfering RNA delivery to endothelial cells, Advanced Functional Materials, 19: 3112-3118, 2010) или экзосом (Schroeder, A., Levins, С., Cortez, С., Langer, R., and Anderson, D., Lipid-based nanotherapeutics for siRNA delivery, Journal of Internal Medicine, 267: 9-21, 2010, PMID: 20059641).

Так, было показано, что экзосомы являются особенно применимыми в доставке siRNA, системы, в некоторой степени сходной с системой CRISPR. Например, Еl-Andaloussi S и соавт. ("Exosome-mediated delivery of siPHK in vitro and in vivo." Nat Protoc. 2012 Dec; 7(12):2112-26. doi: 10.1038/nprot.2012.131. Epub 2012 Nov 15.) описывают, как экзосомы, являющиеся перспективными инструментами доставки лекарственных средств через различные биологические барьеры, можно приспособить для доставки siRNA in vitro и in vivo. Данный подход заключается в создании нацеленных экзосом посредством трансфекции вектором экспрессии, содержащим белок экзосом, слитый с пептидным лигандом. Экзосомы затем очищают от надосадочной жидкости с трансфицированными клетками и характеризуют, а затем в экзосомы загружают siRNA. Доставку или введение согласно настоящему изобретению можно осуществлять с помощью экзосом, в частности, без ограничения, в головной мозг.

Витамин Е (α-токоферол) можно конъюгировать с CRISPR-Cas и доставлять в головной мозг вместе с липопротеином высокой плотности (HDL), например, аналогично тому, как это было выполнено Uno и соавт. (HUMAN GENE THERAPY 22:711-719 (June 2011)) для доставки коротких интерферирующих РНК (siRNA) в головной мозг. Мышам проводили инфузию с помощью осмотических мининасосов (модель 1007D; Alzet, Купертино, Калифорния), наполненных фосфатно-солевым буфером (PBS), или свободной Toc-siBACE, или Toc-siBACE/HDL, и соединенных с набором 3 для инфузий в головной мозг (Alzet). Канюлю для инфузий в головной мозг размещали приблизительно на 0,5 мм кзади от брегмы на средней линии для инфузий в дорсальную часть третьего желудочка. Uno и соавт. обнаружили, что всего 3 нмоля Toc-siRNA с HDL в том же способе ICV инфузий могут индуцировать сравнимую степень целевого снижения. Аналогичная доза CRISPR-Cas, конъюгированной с α-токоферолом и вводимой совместно с HDL, нацеливающейся на головной мозг, может предусматриваться в настоящем изобретении для людей, например, может предусматриваться от приблизительно 3 нмоль до приблизительно 3 мкмоль CRISPR-Cas, нацеливающейся на головной мозг.

Zou и соавт. ((HUMAN GENE THERAPY 22:465-475 (April 2011)) описывают способ опосредованной лентивирусами доставки коротких шпилечных РНК, целенаправленно воздействующих на PKCγ, для сайленсинга генов in vivo в спинном мозге крыс. Zou и соавт. вводили приблизительно 10 мкл рекомбинантного лентивируса с титром 1×109 трансдуцирующих единиц (ТЕ)/мл с помощью интратекального катетера.

Аналогичная доза экспрессируемой CRISPR-Cas в лентивирусном векторе, нацеливающемся на головной мозг, может предусматриваться в настоящем изобретении для людей, например, может предусматриваться приблизительно 10-50 мл CRISPR-Cas, нацеливающейся на головной мозг, в лентивирусе с титром 1×109 трансдуцирующих единиц (ТЕ)/мл.

Направленная делеция, терапевтические применения

Направленная делеция генов является предпочтительной. Примеры проиллюстрированы в примере 18. Таким образом, предпочтительными являются гены, вовлеченные в биосинтез холестерина, биосинтез жирных кислот и другие метаболические нарушения, гены, кодирующие неправильно свернутые белки, вовлеченные в амилоидоз и другие заболевания, онкогены, приводящие к трансформации клеток, латентные гены вирусов и гены, приводящие к доминантно-негативным нарушениям среди прочих нарушений. Как проиллюстрировано здесь, заявители отдают предпочтение доставке генов системы CRISPR-Cas в ткань печени, головного мозга, глаза, эпителиальную, кроветворную или иную ткань субъекта или пациента, нуждающегося в этом, страдающего от метаболических нарушений, амилоидоза и заболеваний, связанных с агрегацией белков, трансформации клеток, возникающей в результате генетических мутаций и транслокаций, доминантно-негативных эффектов генных мутаций, латентных вирусных инфекций и других связанных симптомов, с использованием либо вирусных систем доставки, либо систем доставки на основе наночастиц.

Терапевтические применения системы CRISPR-Cas включают применения при глаукоме, амилоидозе и болезни Гентингтона. Они проиллюстрированы в примере 20, и особенности, описанные там, являются предпочтительными по отдельности или в комбинации.

Другой пример заболевания, характеризующегося экспансией полиглутаминовых повторов, которое можно лечить с помощью настоящего изобретения, включает спинально-церебеллярную атаксию типа 1 (SCA1). При внутримозжечковой инъекции векторы на основе рекомбинантного аденоассоциированного вируса (AAV), экспрессирующие короткие шпилечные РНК, существенно улучшают координацию движений, восстанавливают морфологические характеристики мозжечка и устраняют характерные включения атаксина 1 в клетках Пуркинье мышей с SCA1 (см., например, Xia et al., Nature Medicine, Vol. 10, No. 8, Aug. 2004). В частности, предпочтительными являются векторы AAV1 и AAV5, и требуемыми являются титры AAV, составляющие приблизительно 1×1012 векторных геномов/мл.

В качестве примера можно лечить или предупреждать хроническую инфекцию, вызываемую HIV-1. Для выполнения этой задачи можно создать направляющие РНК CRISPR-Cas, которые осуществляют нацеливание на подавляющее большинство геномов HIV-1 с учетом вариантов штаммов HIV-1 для максимального охвата и эффективности. Можно осуществлять доставку системы CRISPR-Cas с помощью общепринятой, опосредованной аденовирусом или лентивирусом инфекции иммунной системы хозяина. В зависимости от подхода иммунные клетки хозяина могут быть а) выделены, трансдуцированы CRISPR-Cas, подвергнуты отбору и повторно введены хозяину или b) трансдуцированы in vivo путем системной доставки системы CRISPR-Cas. Первый подход обеспечивает возможность получения популяции устойчивых иммунных клеток, тогда как второй, по всей вероятности, целенаправленно воздействует на резервуары латентного вируса в хозяине. Более подробно это обсуждается в разделе "Примеры".

В другом примере публикация заявки на патент США №20130171732, закрепленная за Sangamo Biosciences, Inc., относится к вставке в геном трансгена, действующего против HIV, способы которой можно применять к системе CRISPR-Cas по настоящему изобретению. В другом варианте осуществления можно целенаправленно воздействовать на ген CXCR4, и систему TALE согласно публикации заявки на патент США №20100291048, закрепленной за Sangamo Biosciences, Inc., можно модифицировать для системы CRISPR-Cas по настоящему изобретению. Способ согласно публикациям заявок на патенты США №№20130137104 и 20130122591, закрепленным за Sangamo Biosciences, Inc., и публикации заявки на патент США №20100146651, закрепленной за Cellectis, может быть в более общем смысле применимым к экспрессии трансгена, поскольку он включает модификацию локуса гена гипоксантингуанинфосфорибозилтрансферазы (HPRT) для повышения частоты модификации гена.

В настоящем изобретении также предусматривается создание клеточной библиотеки нокаутных генов. Каждая клетка может иметь один нокаутный ген. Это проиллюстрировано в примере 23.

Можно получить библиотеку клеток ES, в которой каждая клетка имеет один нокаутный ген, и в полной библиотеке клеток ES все без исключения гены будут нокаутными. Эта библиотека применима для скрининга функции гена в клеточных процессах, а также в заболеваниях. Для получения этой клеточной библиотеки заявители могут интегрировать Cas9, управляемый индуцируемым промотором (например, индуцируемым доксициклином промотором), в клетку ES. Кроме того, можно интегрировать одну направляющую РНК, осуществляющую нацеливание на конкретный ген в клетке ES. Для создания библиотеки клеток ES можно просто смешать клетки ES с библиотекой генов, кодирующих направляющие РНК, которые осуществляют нацеливание на каждый ген в геноме человека. Сначала можно ввести один сайт attB для ВхВ1 в локус AAVS1 в клетках ES человека. Затем можно использовать интегразу В×В1 для облегчения интеграции отдельных генов направляющих РНК в сайт attB для В×В1 в локусе AAVS1. Для облегчения интеграции каждый ген направляющей РНК можно размещать на плазмиде, которая несет один сайт attP. Таким образом, ВхВ1 будет рекомбинировать сайт attB в геноме с сайтом attP на плазмиде, содержащей направляющую РНК. Для создания клеточной библиотеки можно взять библиотеку клеток, имеющих интегрированные одиночные направляющие РНК, и индуцировать экспрессию Cas9. После индукции Cas9 опосредует двухнитевой разрыв в сайтах, определенных направляющей РНК.

Длительное введение белковых терапевтических средств может вызвать нежелательные иммунные ответы на данный белок. Иммуногенность белковых лекарственных средств может объясняться наличием нескольких иммунодоминантных эпитопов для Т-лимфоцитов-помошников (HTL). Путем снижения аффинности связывания этих эпитопов для HTL, содержащихся в данных белках, с МНС можно создавать лекарственные средства с более низкой иммуногенностью (Tangri S, et al. ("Rationally engineered therapeutic proteins with reduced immunogenicity" J Immunol. 2005 Mar 15; 174(6):3187-96.) В настоящем изобретении иммуногенность фермента CRISPR, в частности, можно снизить, следуя подходу, впервые изложенному Tangri и соавт. в отношении эритропоэтина и впоследствии получившему развитие. Соответственно, для снижения иммуногенности фермента CRISPR (например, Cas9) у вида-хозяина (человека или другого вида) можно применять направленную эволюцию или рациональное проектирование.

В примере 28 заявители применяют 3 направляющие РНК, представляющие интерес, и могут визуализировать эффективное расщепление ДНК in vivo, имеющее место лишь в небольшой субпопуляции клеток. В сущности, здесь заявители показали целенаправленное расщепление in vivo. В частности, это предоставляет подтверждение концепции, заключающейся в том, что у высших организмов, таких как млекопитающие, также можно достичь специфичного целенаправленного воздействия. Это также подчеркивает множественность аспекта в том отношении, что несколько направляющих последовательностей (т.е. для отдельных мишеней) можно использовать одновременно (в смысле совместной доставки). Другими словами, заявители применяли многосторонний подход с несколькими различными последовательностями, осуществляющими нацеливание одновременно, но независимо.

Подходящий пример протокола получения AAV, предпочтительного вектора согласно настоящему изобретению, приведен в примере 34.

Нарушения, связанные с тринуклеотидными повторами, являются предпочтительными состояниями для лечения. Они также проиллюстрированы в данном документе.

Например, в публикации заявки на патент США №20110016540 описывается применение нуклеаз с "цинковыми пальцами" для генетической модификации клеток, животных и белков, ассоциированных с нарушениями, связанными с экспансией тринуклеотидных повторов. Нарушения, связанные с экспансией тринуклеотидных повторов, являются комплексными прогрессирующими нарушениями, затрагивающими биологию развития нервной системы и часто нарушающими когнитивные функции, а также сенсомоторные функции.

Белки, связанные с экспансией тринуклеотидных повторов, представляют собой разнородную группу белков, ассоциированных с подверженностью развития нарушения, связанного с экспансией тринуклеотидных повторов, наличием нарушения, связанного с экспансией тринуклеотидных повторов, тяжестью нарушения, связанного с экспансией тринуклеотидных повторов, или любой их комбинацией. Нарушения, связанные с экспансией тринуклеотидных повторов, подразделяют на две категории, определяемые типом повтора. Наиболее распространенным повтором является триплет CAG, который в случае наличия в кодирующем участке гена кодирует аминокислоту глутамин (Q). Таким образом, эти нарушения называются нарушениями, связанными с экспансией полиглутаминовых повторов (поли-Q), и включают следующие заболевания: болезнь Гентингтона (HD); спинобульбарную мышечную атрофию (SBMA); формы спинально-церебеллярной атаксии (SCA типов 1, 2, 3, 6, 7 и 17) и дентато-рубро-паллидо-льюисову атрофию (DRPLA). Остальные нарушения, связанные с экспансией тринуклеотидных повторов, при которых триплет CAG не вовлечен либо триплет CAG находится не в кодирующем участке гена, называются, таким образом, нарушениями, не связанными с экспансией полиглутаминовых повторов. Нарушения, не связанные с экспансией полиглутаминовых повторов, включают синдром ломкой Х-хромосомы (FRAXA); синдром умственной отсталости, сцепленный с ломкой Х-хромосомой (FRAXE); атаксию Фридрейха (FRDA); миотоническую дистрофию (DM) и формы спинально-церебеллярной атаксии (SCA типов 8 и 12).

Белки, ассоциированные с нарушениями, связанными с экспансией тринуклеотидных повторов, обычно выбирают на основании экспериментального изучения взаимосвязи белка, ассоциированного с нарушением, связанным с экспансией тринуклеотидных повторов, и нарушения, связанного с экспансией тринуклеотидных повторов. Например, скорость образования или концентрация в кровотоке белка, ассоциированного с нарушением, связанным с экспансией тринуклеотидных повторов, может быть повышенной или пониженной в популяции, имеющей нарушение, связанное с экспансией тринуклеотидных повторов, по сравнению с популяцией, не имеющей нарушения, связанного с экспансией тринуклеотидных повторов. Различия в уровнях белка можно оценить при помощи протеомных методик, в том числе, без ограничения, вестерн-блот-анализа, иммуногистохимического окрашивания, твердофазного иммуноферментного анализа (ELISA) и масс-спектрометрии. В альтернативном случае белки, ассоциированные с нарушениями, связанными с экспансией тринуклеотидных повторов, можно идентифицировать путем получения профилей экспрессии генов для генов, кодирующих белки, при помощи методик геномного анализа, в том числе, без ограничения, микроматричного анализа ДНК, серийного анализа экспрессии генов (SAGE) и количественной полимеразной цепной реакции в режиме реального времени (Q-PCR).

Неограничивающие примеры белков, ассоциированных с нарушениями, связанными с экспансией тринуклеотидных повторов, включают AR (андрогенный рецептор), FMR1 (белок 1, ассоциированный с умственной отсталостью, сцепленной с ломкой Х-хромосомой), НТТ (гентингтин), DMPK (протеинкиназу, ассоциированную с миотонической дистрофией), FXN (фратаксин), ATXN2 (атаксин 2), ATN1 (атрофии 1), FEN1 (структуроспецифичную флэп-эндонуклеазу 1), TNRC6A (белок, кодируемый геном 6А, содержащим тринуклеотидные повторы), PABPN1 (ядерный поли(А)-связывающий белок 1), JPH3 (юнктофилин 3), MED15 (субъединицу 15 медиаторного комплекса), ATXN1 (атаксин 1), ATXN3 (атаксин 3), ТВР (ТАТА-бокс-связывающий белок), CACNA1A (альфа-1А-субъединицу потенциал-зависимого кальциевого канала P/Q-типа), ATXN80S (белок, синтезируемый с противоположной нити ATXN8 (не кодирующей белок)), PPP2R2B (бета-изоформу регуляторной субъединицы В протеинфосфатазы 2), ATXN7 (атаксин 7), TNRC6B (белок, кодируемый геном 6В, содержащим тринуклеотидные повторы), TNRC6C (белок, кодируемый геном 6С, содержащим тринуклеотидные повторы), CELF3 (CUGBP, член 3 семейства Elav-подобных белков), MAB21L1 (mab-21-подобный белок 1 (С.elegans)), MSH2 (гомолог 2 mutS, ассоциированный с неполипозным колоректальным раком типа 1 (Е. coli)), ТМЕМ185А (трансмембранный белок 185A), SIX5 (белок, кодируемый гомеобоксом 5 SIX), CNPY3 (гомолог Canopy 3 (данио-рерио)), FRAXE (белок, ассоциированный с "редким" ломким сайтом, проявляющимся при недостатке фолиевой кислоты, fra(X)(q28) Е), GNB2 (бета полипептид 2 белка, связывающего гуаниновые нуклеотиды (G-белка)), RPL14 (рибосомный белок L14), ATXN8 (атаксин 8), INSR (инсулиновый рецептор), TTR (транстиретин), ЕР400 (Е1А-связывающий белок р400), GIGYF2 (белок GYF 2, взаимодействующий с GRB10), OGG1 (8-оксогуанин-ДНК-гликозилазу), STC1 (станниокальцин 1), CNDP1 (карнозиндипептидазу 1 (металлопептидазу семейства М20)), C10orf2 (белок, кодируемый открытой рамкой считывания 2 хромосомы 10), MAML3 (mastermind-подобный белок 3 (Drosophila)), DKC1 (белок 1, ассоциированный с врожденным дискератозом, дискерин), PAXIP1 (белок 1, взаимодействующий с PAX (с доменом активации транскрипции)), CaSK (кальций/кальмодулин-зависимую сериновую протеинкиназу (семейства MAGUK)), МАРТ (белок tau, ассоциированный с микротрубочками), SP1 (фактор транскрипции Sp1), POLG (полимеразу гамма (ДНК-направленную)), AFF2 (член 2 семейства AF4/FMR2), THBS1 (тромбоспондин 1), ТР53 (опухолевый белок р53), ESR1 (эстрогеновый рецептор 1), CGGBP1 (белок 1, связывающий триплетный повтор CGG), АВТ1 (активатор 1 базальной транскрипции), KLK3 (родственную калликреину пептидазу 3), PRNP (белок приона), JUN (онкоген jun), KCNN3 (кальций-активируемый калиевый канал средней/малой проводимости, представитель 3 подсемейства N), ВАХ (ВСL2-ассоциированный белок X), FRAXA (белок, ассоциированный с "редким" ломким сайтом, проявляющимся при недостатке фолиевой кислоты, fra(X)(q27.3) А (макроорхидизм, умственная отсталость)), KBTBD10 (белок 10, содержащий повтор Kelch и домен ВТВ (POZ)), MBNL1 (muscleblind-подобный белок (Drosophila)), RAD51 (гомолог RAD51 (гомолог RecA, Е. coli) (S. cerevisiae)), NCOA3 (коактиватор 3 ядерных рецепторов), ERDA1 (белок с экспансией повторяющихся доменов, CAG/CTG 1), TSC1 (белок 1, ассоциированный с туберозным склерозом), СОМР (олигомерный матриксный белок хряща), GCLC (каталитическую субъединицу глутаматцистеинлигазы), RRAD (Ras-родственный белок, ассоциированный с сахарным диабетом), MSH3 (гомолог 3 mutS (Е. coli)), DRD2 (дофаминовый рецептор D2), CD44 (молекулу CD44 (система групп крови Indian)), CTCF (СССТС-связывающий фактор (белок с "цинковыми пальцами")), CCND1 (циклин D1), CLSPN (гомолог класпина (Xenopus laevis)), MEF2A (энхансерный фактор 2А миоцитов), PTPRU (протеинтирозинфосфатазу рецепторного типа U), GAPDH (глицеральдегид-3-фосфатдегидрогеназу), TRIM22 (белок 22, содержащий тройной мотив), WT1 (белок 1 опухоли Вильмса), AHR (арил-углеводородный рецептор), GPX1 (глутатионпероксидазу 1), ТРМТ (тиопурин-S-метилтрансферазу), NDP (белок, ассоциированный с болезнью Норри (псевдоглиомой)), ARX (белок, кодируемый гомеобоксом гена, родственного aristaless), MUS81 (гомолог эндонуклеазы MUS81 (S. cerevisiae)), TYR (тирозиназу (глазокожный альбинизм IA)), EGR1 (белок 1 раннего ростового ответа), UNG (урацил-ДНК-гликозилазу), NUMBL (белок, подобный гомологу numb (Drosophila)), FABP2 (белок 2, связывающий жирные кислоты в кишечнике), EN2 (белок, кодируемый гомеобоксом engrailed 2), CRYGC (гамма-С-кристаллин), SRP14 (гомологичный РНК-связывающий белок Alu размером 14 кДа из частицы узнавания сигнала), CRYGB (гамма-В-кристаллин), PDCD1 (белок 1 запрограммированной гибели клеток), НОХА1 (белок, кодируемый гомеобоксом A1), ATXN2L (атаксин-2-подобный белок), PMS2 (PMS2, белок 2, противодействующий повышению уровня постмейотической сегрегации (S. cerevisiae)), GLA (альфа-галактозидазу), CBL (белок, кодируемый последовательностью, трансформирующей с экотропным ретровирусом Cas-Br-M (мышей)), FTH1 (полипептид 1 тяжелой субъединицы ферритина), IL12RB2 (бета-2-субъединицу рецептора интерлейкина 12), ОТХ2 (белок, кодируемый гомеобоксом orthodenticle 2), НОХА5 (белок, кодируемый гомеобоксом А5), POLG2 (вспомогательную гамма-2-субъединицу полимеразы (ДНК-направленной)), DLX2 (белок, кодируемый гомеобоксом distal-less 2), SIRPA (сигнально-регуляторный белок альфа), ОТХ1 (белок, кодируемый гомеобоксом orthodenticle 1), AHRR (репрессор арил-углеводородного рецептора), MANF (мезэнцефальный нейротрофический фактор, происходящий из астроцитов), ТМЕМ158 (трансмембранный белок 158 (ген/псевдоген)) и ENSG00000078687.

Предпочтительные белки, ассоциированные с нарушениями, связанными с экспансией тринуклеотидных повторов, включают НТТ (гентингтин), AR (андрогенный рецептор), FXN (фратаксин), Atxn3 (атаксин), Atxn1 (атаксин), Atxn2 (атаксин), Atxn7 (атаксин), Atxn10 (атаксин), DMPK (миотонин-протеинкиназу), Atn1 (атрофии 1), СВР (creb-связывающий белок), VLDLR (рецептор липопротеинов очень низкой плотности) и их любую комбинацию.

В соответствии с другим аспектом предусматривается способ генной терапии для лечения субъекта, имеющего мутацию в гене CFTR, который включает введение в клетки субъекта терапевтически эффективного количества частиц с CRISPR-Cas для генной терапии, необязательно посредством биологически совместимого фармацевтического носителя. Целевая ДНК предпочтительно содержит мутацию дельта-Р508. Обычно предпочтительно, чтобы у мутантов восстанавливался дикий тип. В этом случае мутация представляет собой делецию трех нуклеотидов, включающих в себя кодон фенилаланина (F), в положении 508. Соответственно, репарация в данном случае требует повторного введения мутанту недостающего кодона.

Для реализации этой стратегии репарации генов предпочтительно, чтобы векторную систему на основе аденовируса/AAV вводили в клетку-хозяина, в клетки или пациенту. Система предпочтительно содержит Cas9 (или никазу Cas9) и направляющую РНК вместе с векторной системой на основе аденовируса/AAV, содержащей матрицу для репарации путем гомологичной рекомбинации, содержащую остаток F508. Ее можно вводить субъекту посредством одного из обсуждаемых ранее способов доставки. Система CRISPR-Cas может направляться химерной направляющей РНК для дельта-508 CFTR. Она целенаправленно воздействует на конкретный сайт локуса генома CFTR, подлежащий внесению однонитевого разрыва или расщеплению. После расщепления матрица для репарации вставляется в сайт расщепления посредством гомологичной рекомбинации, корректирующей делецию, которая приводит к муковисцидозу или вызывает связанные с муковисцидозом симптомы. Данную стратегию для управления доставкой и обеспечения системного введения систем CRISPR с соответствующими направляющими РНК можно использовать для целенаправленного воздействия на генные мутации, чтобы редактировать или проводить иного рода манипуляции с генами, которые вызывают метаболические заболевания и нарушения, заболевания и нарушения печени, почек и заболевания и нарушения, связанные с белками, такие как приведенные в таблице В.

Редактирование генома

Системы CRISPR/Cas9 по настоящему изобретению можно применять для коррекции генетических мутаций, попытки которой с ограниченным успехом ранее предпринимались с применением TALEN и ZFN. Например, в опубликованной заявке Duke University WO 2013163628 А2 "Генетическая коррекция подвергшихся мутации генов" описаны попытки коррекции, например, мутации по типу сдвига рамки считывания, которая вызывает появление преждевременного стоп-кодона и усеченного продукта гена, которую можно скорректировать посредством опосредованного нуклеазами негомологичного соединения концов, как, например, обуславливающей мышечную дистрофию Дюшенна ("DMD"), рецессивное смертельное сцепленное с X-хромосомой нарушение, приводящее к мышечной дегенерации в связи с мутациями гена дистрофина. Большинство мутаций гена дистрофина, вызывающих DMD, представляют собой делеции экзонов, нарушающие рамку считывания и вызывающие преждевременную терминацию трансляции гена дистрофина. Дистрофии представляет собой цитоплазматический белок, обеспечивающий стабильность структуры дистрогликанового комплекса клеточной мембраны, отвечающего за регуляцию целостности и функционирования мышечных клеток. Ген дистрофина или "ген DMD", как взаимозаменяемо используется в данном документе, образован 2,2 миллиона пар оснований в локусе Хр21. Размер первичного транскрипта составляет приблизительно 2400 т.п.о., при этом размер зрелой мРНК составляет приблизительно 14 т.п.о. 79 экзонов кодируют белок, образованный более 3500 аминокислотами. Экзон 51 часто является смежным с положениями делеций, нарушающих рамку считывания, у пациентов с DMD, и в клинических испытаниях на него был направлен пропуск экзона, основанный на применении олигонуклеотидов. Недавно в клиническом испытании с пропуском экзона 51 с помощью соединения этерлипсена сообщали о значительном положительном функциональном эффекте в течение 48 недель со средним количеством дистрофин-положительных волокон 47% по сравнению с исходным уровнем. Мутации в экзоне 51 идеально подходят для устойчивой коррекции посредством редактирования генома на основе NHEJ.

Способы согласно публикации заявки на патент США №20130145487, закрепленной за Cellectis, которые относятся к вариантам мегануклеаз для расщепления целевой последовательности гена дистрофина человека (DMD), также можно модифицировать для системы CRISPR-Cas по настоящему изобретению.

Кровь

Настоящее изобретение также предусматривает доставку системы CRISPR-Cas в кровь.

Экзосомы плазмы по Wahlgren и соавт. (Nucleic Acids Research, 2012, Vol. 40, No. 17 e130) были описаны ранее и могут быть использованы для доставки системы CRISPR-Cas в кровь.

Система CRISPR-Cas по настоящему изобретению также предусматривается для лечения гемоглобинопатии, таких как формы талассемии и серповидно-клеточная анемия. См., например, публикацию международной заявки на патент WO 2013/126794 в отношении потенциальных мишеней, на которые может целенаправленно воздействовать система CRISPR-Cas по настоящему изобретению.

Публикации заявок на патенты США №№20110225664, 20110091441, 20100229252, 20090271881 и 20090222937, закрепленные за Cellectis, относятся к вариантам CREI, где по меньшей мере один из двух мономеров I-CreI имеет по меньшей мере две замены, по одной в каждом из двух функциональных субдоменов сердцевинного домена LAGLIDADG, расположенных, соответственно, в положениях 26-40 и 44-77 I-CreI, при этом указанный вариант способен расщеплять целевую последовательность ДНК гена гамма-цепи рецептора интерлейкина-2 человека (IL2RG), также называемого геном общей гамма-цепи рецепторов цитокинов или геном гамма-С. Целевые последовательности, указанные в публикациях заявок на патенты США №№20110225664, 20110091441, 20100229252, 20090271881 и 20090222937, можно использовать для системы CRISPR-Cas по настоящему изобретению.

Тяжелый комбинированный иммунодефицит (SCID) возникает в результате нарушения созревания Т-лимфоцитов, во всех случаях ассоциированного с нарушением функционирования В-лимфоцитов (Cavazzana-Calvo et al., Annu. Rev. Med., 2005, 56, 585-602; Fischer et al., Immunol. Rev., 2005, 203, 98-109). Общая заболеваемость по оценкам составляет 1 на 75000 родившихся. Пациенты с нелеченым SCID подвержены множественным инфекциям, вызываемым условно-патогенными микроорганизмами, и живут, как правило, не более одного года. SCID можно лечить путем аллогенного переноса гемопоэтических стволовых клеток от донора-родственника. Степень гистосовместимости с донором может варьировать в широких пределах. В случае аденозиндезаминазной (ADA) недостаточности, одной из форм SCID, пациентов можно лечить с помощью инъекции рекомбинантного фермента аденозиндезаминазы.

Поскольку было показано, что ген ADA у пациентов с SCID является мутантным (Giblett et al., Lancet, 1972, 2, 1067-1069), были идентифицированы некоторые другие гены, вовлеченные в SCID (Cavazzana-Calvo et al, Annu. Rev. Med., 2005, 56, 585-602; Fischer et al., Immunol. Rev., 2005, 203, 98-109). Существуют четыре основные причины SCID. (i) Наиболее часто встречающуюся форму SCID, SCID-X1 (SCID, сцепленный с X-хромосомой, или X-SCID), вызывает мутация в гене IL2RG, которая приводит к отсутствию зрелых Т-лимфоцитов и NK-клеток. IL2RG кодирует белок гамма-С (Noguchi, et al., Cell, 1993, 73, 147-157), общий компонент по меньшей мере пяти рецепторных комплексов интерлейкинов. Данные рецепторы активируют несколько мишеней с помощью киназы JAK3 (Macchi et al., Nature, 1995, 377, 65-68), инактивация которой приводит к возникновению того же синдрома, что и инактивация гамма-С. (ii) Мутация в гене ADA приводит к нарушению метаболизма пуринов, вызывающему гибель предшественников лимфоцитов, что, в свою очередь, приводит к кажущемуся отсутствию В-, Т- и NK-клеток. (iii) V(D)J-рекомбинация является существенным этапом созревания иммуноглобулинов и рецепторов Т-лимфоцитов (TCR). Мутации в генах, активирующих рекомбинацию, 1 и 2 (RAG1 и RAG2) и Artemis, трех генах, участвующих в этом процессе, приводят к отсутствию зрелых Т- и В-лимфоцитов. (iv) Также сообщали о мутациях в других генах, таких как CD45, участвующих в специфичной передаче сигналов в Т-клетках, хотя они представляют меньшинство случаев (Cavazzana-Calvo et al., Annu. Rev. Med., 2005, 56, 585-602; Fischer et al., Immunol. Rev., 2005, 203, 98-109).

С тех пор, как были выявлены их генетические основы, различные формы SCID стали модельными для подходов к генной терапии (Fischer et al., Immunol. Rev., 2005, 203, 98-109) по двум основным причинам. Во-первых, как и при всех заболеваниях крови, может быть предусмотрено лечение ex vivo. Можно выделить гемопоэтические стволовые клетки (HSC) из костного мозга и сохранять их свойства плюрипотентности в течение нескольких клеточных делений. Таким образом, их можно обрабатывать in vitro, а затем повторно инъецировать пациенту, где они повторно заселяют костный мозг. Во-вторых, поскольку созревание лимфоцитов у пациентов с SCID ухудшено, подвергнутые коррекции клетки имеют селективное преимущество. Таким образом, небольшое количество подвергнутых коррекции клеток может восстановить функционирование иммунной системы. Эта гипотеза была неоднократно подтверждена (i) частичным восстановлением иммунных функций, связанным с реверсией мутаций у пациентов с SCID (Hirschhorn et al., Nat. Genet, 1996, 13, 290-295; Stephan et al, N. Engl. J. Med., 1996, 335, 1563-1567; Bousso et al., Proc. Natl., Acad. Sci. USA, 2000, 97, 274-278; Wada et al., Proc. Natl. Acad. Sci. USA, 2001, 98, 8697-8702; Nishikomori et al., Blood, 2004, 103, 4565-4572), (ii) коррекцией форм недостаточности SCID-X1 in vitro в гемопоэтических клетках (Candotti et al., Blood, 1996, 87, 3097-3102; Cavazzana-Calvo et al., Blood, 1996, Blood, 88, 3901-3909; Taylor et al., Blood, 1996, 87, 3103-3107; Hacein-Bey et al, Blood, 1998, 92, 4090-4097), (iii) коррекцией форм недостаточности SCID-X1 (Soudais et al., Blood, 2000, 95, 3071-3077; Tsai et al., Blood, 2002, 100, 72-79), JAK-3 (Bunting et al., Nat. Med., 1998, 4, 58-64; Bunting et al., Hum. Gene Ther., 2000, 11, 2353-2364) и RAG2 (Yates et al, Blood, 2002, 100, 3942-3949) в животных моделях in vivo и (iv) результатом клинических испытаний генной терапии (Cavazzana-Calvo et al, Science, 2000, 288, 669-672; Aiuti et al., Nat. Med., 2002; 8, 423-425; Gaspar et al, Lancet, 2004, 364, 2181-2187).

Публикация заявки на патент США №20110182867, закрепленная за Children's Medical Center Corporation и президентом и членами управляющего совета Гарвардского университета, относится к способам модулирования экспрессии фетального гемоглобина (HbF) и ее применениям в гемопоэтических клетках-предшественниках с помощью ингибиторов экспрессии или активности BCL11A, таких как средства для RNAi и антитела. На мишени, раскрытые в публикации заявки на патент США №20110182867, такие как BCL11 А, можно целенаправленно воздействовать с помощью системы CRISPR-Cas по настоящему изобретению для модулирования экспрессии фетального гемоглобина. См. также Bauer et al. (Science 11 October 2013: Vol. 342 no. 6155 pp. 253-257) и Xu et al. (Science 18 November 2011: Vol. 334 no. 6058 pp. 993-996) в отношении дополнительных мишеней BCL11 А.

Уши

Настоящее изобретение также предусматривает доставку системы CRISPR-Cas в одно ухо или оба уха.

Исследователи рассматривают вопрос о том, можно ли применять генную терапию для содействия существующим способам лечения глухоты - а именно, применению кохлеарных имплантатов. Глухоту часто вызывают утрата или повреждение волосковых клеток, которые не могут передавать сигналы слуховым нейронам. В таких случаях можно применять кохлеарные имплантаты для обеспечения реакции на звук и передачи электрических сигналов нервным клеткам. Однако эти нейроны часто дегенерируют и подвергаются ретракции отростков в улитке, поскольку пораженные волосковые клетки высвобождают меньше факторов роста.

В заявке на патент США 20120328580 описана инъекция фармацевтической композиции в ухо (например, путем ушного введения), как, например, в просветы улитки (например, в проток улитки, лестницу преддверия и барабанную лестницу улитки), например, с помощью шприца, например, шприца с однократной дозой. Например, одно или несколько соединений, описанных в данном документе, можно вводить путем интратимпанальной инъекции (например, в среднее ухо) и/или инъекций в наружное, среднее и/или внутреннее ухо. Такие способы регулярно применяются в данной области, например, для введения стероидов и антибиотиков в уши людей. Инъекцию можно осуществлять, например, через круглое окно уха или через капсулу улитки. В данной области известны и другие способы введения во внутреннее ухо (см., например, Salt and Plontke, Drug Discovery Today, 10:1299-1306, 2005).

В другом способе введения фармацевтическую композицию можно вводить in situ с помощью катетера или насоса. Катетер или насос могут, например, направлять фармацевтическую композицию в просветы улитки, или круглое окно уха, и/или просвет толстой кишки. Иллюстративный аппарат для доставки лекарственных средств и способы, подходящие для введения одного или нескольких соединений, описанных в данном документе, в ухо, например, в ухо человека, описаны McKenna и соавт. (публикация заявки на патент США №2006/0030837) и Jacobsen и соавт. (патент США №7206639). В некоторых вариантах осуществления катетер или насос могут быть расположены, например, в ухе (например, в наружном, среднем и/или внутреннем ухе) пациента во время хирургического вмешательства. В некоторых вариантах осуществления катетер или насос могут быть расположены, например, в ухе (например, в наружном, среднем и/или внутреннем ухе) пациента без необходимости в хирургическом вмешательстве.

Альтернативно или в дополнение, одно или несколько соединений, описанных в данном документе, можно вводить в сочетании с механическим устройством, таким как кохлеарный имплантат или слуховой аппарат, которое носят в наружном ухе. Иллюстративный кохлеарный имплантат, подходящий для применения в настоящем изобретении, описан Edge и соавт. (публикация заявки на патент США №2007/0093878).

В некоторых вариантах осуществления способы введения, описанные выше, можно комбинировать в любом порядке и можно применять одновременно или попеременно.

Альтернативно или в дополнение, настоящее изобретение можно применять согласно любому из способов, одобренных Управлением по контролю качества пищевых продуктов и лекарственных средств, например, описанных в справочнике стандартов CDER, версия номер 004 (доступном по адресу fda.give/cder/dsm/DRG/drg00301.htm).

В целом, способы клеточной терапии, описанные в заявке на патент США 20120328580, можно применять для стимуляции полной или частичной дифференцировки клеток в определенный тип зрелых клеток внутреннего уха (например, в волосковые клетки) или в его направлении in vitro. Клетки, полученные в результате осуществления таких способов, можно затем трансплантировать или имплантировать пациенту, нуждающемуся в таком лечении. Способы культивирования клеток, необходимые для осуществления на практике этих способов, включающие способы идентификации и отбора подходящих типов клеток, способы стимуляции полной или частичной дифференцировки выбранных клеток, способы идентификации полностью или частично дифференцированных типов клеток и способы имплантации полностью или частично дифференцированных клеток, описаны ниже.

Клетки, подходящие для применения в настоящем изобретении, включают, без ограничения, клетки, способные к полной или частичной дифференцировке в зрелые клетки внутреннего уха, например, в волосковые клетки (например, внутренние и/или наружные волосковые клетки), при контакте, например, in vitro, с одним или несколькими соединениями, описанными в данном документе. Иллюстративные клетки, способные к дифференцировке в волосковые клетки, включают, без ограничения, стволовые клетки (например, стволовые клетки внутреннего уха, взрослые стволовые клетки, стволовые клетки костномозгового происхождения, эмбриональные стволовые клетки, мезенхимальные стволовые клетки, стволовые клетки кожи, iPS-клетки и стволовые клетки жировой ткани), клетки-предшественники (например, клетки-предшественники внутреннего уха), поддерживающие клетки (например, клетки Дейтерса, столбовые клетки, внутренние фаланговые клетки, тектальные клетки и клетки Гензена) и/или зародышевые клетки. Применение стволовых клеток для замещения чувствительных клеток внутреннего уха описано Li и соавт. (публикация заявки на патент США №2005/0287127) и Li и соавт. (патент США с регистрационным №11/953797). Применение стволовых клеток костномозгового происхождения для замещения чувствительных клеток внутреннего уха описано Edge и соавт. в PCT/US 2007/084654. iPS-клетки описаны, например, в Takahashi et al., Cell, Volume 131, Issue 5, Pages 861-872 (2007); Takahashi and Yamanaka, Cell 126, 663-76 (2006); Okita et al., Nature 448, 260-262 (2007); Yu, J. et al, Science 318(5858):1917-1920 (2007); Nakagawa et al., Nat. Biotechnol. 26:101-106 (2008) и Zaehres and Scholer, Cell 131(5):834-835 (2007).

Такие подходящие клетки можно идентифицировать путем анализа (например, качественного или количественного) наличия одного или нескольких тканеспецифичных генов. Например, экспрессию гена можно выявить путем выявления белкового продукта одного или нескольких тканеспецифичных генов. Методики выявления белков включают окрашивание белков (например, с использованием клеточных экстрактов или цельных клеток) с помощью антител к соответствующему антигену. В данном случае соответствующий антиген является белковым продуктом экспрессии тканеспецифичного гена. Хотя, в принципе, меченым может быть первое антитело (т.е. антитело, связывающее антиген), более распространенным (и улучшающим визуализацию) является применение второго антитела, направленного против первого (например, антитела к IgG). Данное второе антитело конъюгируют с флуорохромами, или соответствующими ферментами для колориметрических реакций, или гранулами золота (для электронной микроскопии), или с системой биотин-авидин, так что можно определить местоположение первичного антитела и, следовательно, антигена.

Молекулы CRISPR-Cas по настоящему изобретению можно доставлять в ухо путем непосредственного нанесения фармацевтической композиции на наружное ухо с применением модифицированных композиций из опубликованной заявки на патент США 20110142917. В некоторых вариантах осуществления фармацевтическую композицию наносят на наружный слуховой проход. Доставка в ухо может также называться внутриушной или ушной доставкой.

В некоторых вариантах осуществления молекулы РНК по настоящему изобретению доставляют в липосомных составах или составах на основе Lipofectin и т.п., и их можно получить с помощью способов, хорошо известных специалистам в данной области. Такие способы описаны, например, в патентах США №№5593972, 5589466 и 5580859, включенных в данный документ посредством ссылки.

Были разработаны системы доставки, специально предназначенные для повышения эффективности и улучшения доставки siRNA в клетки млекопитающих (см., например, Shen et al FEBS Let. 2003, 539:111-114; Xia et al., Nat. Biotech. 2002, 20:1006-1010; Reich et al., Mol. Vision. 2003, 9: 210-216; Sorensen et al, J. Mol. Biol. 2003, 327: 761-766; Lewis et al., Nat. Gen. 2002, 32: 107-108 и Simeoni et al., NAR 2003, 31,11: 2717-2724), и их можно применять в настоящем изобретении. siRNA недавно успешно применяли для ингибирования экспрессии генов у приматов (см., например, Tolentino et al., Retina 24(4):660), и их также можно применять в настоящем изобретении.

Qi и соавт. раскрывают способы эффективного введения siRNA во внутреннее ухо через неповрежденное круглое окно путем трансфекции с помощью новой технологии доставки протеидов, которую можно применять в отношении системы CRISPR-Cas по настоящему изобретению (см., например, Qi et al., Gene Therapy (2013), 1-9). В частности, успешным было применение доменов ТАТ, связывающих двухнитевую РНК (ТАТ-DRBD), с помощью которых можно трансфицировать меченную Су3 siRNA в клетки внутреннего уха, в том числе внутренние и наружные волосковые клетки, ампулярный гребешок, пятно эллиптического мешочка и пятно сферического мешочка, посредством проникновения через неповрежденное круглое окно, для доставки двухнитевых siRNA in vivo для лечения различных болезней внутреннего уха и сохранения слуховой функции. Приблизительно 40 мкл 10 мМ РНК может быть предусмотрено в качестве дозы для введения в ухо.

Согласно Rejali и соавт. (Hear Res. 2007 Jun; 228(1-2):180-7) функционирование кохлеарных имплантатов можно улучшить путем надлежащего сохранения нейронов спирального ганглия, которые являются мишенью для электростимуляции имплантатом, и ранее было показано, что нейротрофический фактор головного мозга (BDNF) повышает выживаемость спирального ганглия в ушах с экспериментально индуцированной глухотой. Rejali и соавт. тестировали модифицированную конструкцию электрода кохлеарного имплантата, имеющего покрытие из клеток-фибробластов, трансдуцированных вирусным вектором со вставкой гена BDNF. Для осуществления данного типа переноса генов ex vivo Rejali и соавт. трансдуцировали фибробласты морской свинки аденовирусом со вставкой кассеты с геном BDNF, и определили, что эти клетки секретируют BDNF, а затем прикрепили клетки, секретирующие BDNF, к электроду кохлеарного имплантата с помощью агарозного геля и имплантировали электрод в барабанную лестницу улитки. Rejali и соавт. определили, что электроды с экспрессией BDNF были способны обеспечивать сохранение значительно большего количества нейронов спирального ганглия в базальных витках улитки через 48 дней после имплантации по сравнению с контрольными электродами и демонстрировали возможность осуществления терапии с применением кохлеарных имплантатов в комбинации с переносом генов ex vivo для повышения выживаемости нейронов спирального ганглия. Такую систему можно применять для доставки системы CRISPR-Cas по настоящему изобретению в ухо.

Mukherjea и соавт. (Antioxidants & Redox Signaling, Volume 13, Number 5, 2010) документально подтверждают, что нокдаун NOX3 с помощью короткой интерферирующей (si) РНК нейтрализовал ототоксичность цисплатина, о чем свидетельствует защита ОНС от повреждения и снижение величин сдвига порогов стволомозговых слуховых вызванных потенциалов (ABR). Крысам вводили различные дозы siNOX3 (0,3, 0,6 и 0,9 мкг), и экспрессию NOX3 оценивали с помощью ОТ-ПЦР в режиме реального времени. Наименьшая применяемая доза siRNA для NOX3 (0,3 мкг) не демонстрировала какого-либо ингибирования мРНК NOX3 по сравнению с транстимпанальным введением скремблированной siRNA или отсутствием обработки улиток. Введение более высоких доз siRNA для NOX3 (0,6 и 0,9 мкг), однако, снижало экспрессию NOX3 по сравнению с контрольной скремблированной siRNA. Такую систему можно применять для транстимпанального введения системы CRISPR-Cas по настоящему изобретению в дозе от приблизительно 2 мг до приблизительно 4 мг CRISPR-Cas для введения человеку.

Jung и соавт. (Molecular Therapy, vol. 21 no. 4, 834-841 apr. 2013) демонстрируют, что уровни Hes5 в эллиптическом мешочке снижались после внесения siRNA и что количество волосковых клеток в этих эллиптических мешочках было значительно большим, чем после контрольной обработки. Данные позволяют предположить, что технология siRNA может быть применимой для индукции восстановления и регенерации во внутреннем ухе и что сигнальный путь Notch является потенциально применимой мишенью для ингибирования экспрессии конкретного гена. Jung и соавт. инъецировали 8 мкг siRNA для Hes5 в объеме 2 мкл, полученном путем добавления стерильного физиологического раствора к лиофилизированной siRNA, в вестибулярный эпителий уха. Такую систему можно применять для введения системы CRISPR-Cas по настоящему изобретению в вестибулярный эпителий уха в дозе от приблизительно 1 до приблизительно 30 мг CRISPR-Cas для введения человеку.

Глаза

Настоящее изобретение также предусматривает доставку системы CRISPR-Cas в один глаз или оба глаза.

В еще одном аспекте настоящего изобретения систему CRISPR-Cas можно использовать для корректировки офтальмологических дефектов, которые являются результатом нескольких генетических мутаций, дополнительно описанных в Genetic Diseases of the Eye, Second Edition, edited by Elias I. Traboulsi, Oxford University Press, 2012.

Для введения в глаз особенно предпочтительными являются лентивирусные векторы, в частности, вирусы инфекционной анемии лошадей (EIAV).

В другом варианте осуществления также предусмотрены минимальные лентивирусные векторы для отличных от приматов организмов на основе вируса инфекционной анемии лошадей (EIAV), особенно для генной терапии глаз (см., например, Balagaan, J Gene Med 2006; 8: 275-285, опубликовано в режиме онлайн 21 ноября 2005 г. в Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/jgm.845). Предусмотрено, что векторы имеют промотор цитомегаловируса (CMV), управляющий экспрессией целевого гена. Также предусмотрена любая из внутрикамерной, субретинальной, внутриглазной и интравитреальной инъекций (см., например, Balagaan, J Gene Med 2006; 8: 275-285, опубликовано в режиме онлайн 21 ноября 2005 г. в Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/jgm.845). Внутриглазные инъекции можно осуществлять с помощью операционного микроскопа. В случае субретинальной и интравитреальной инъекций можно выпятить глаза путем осторожного надавливания пальцами и визуализировать глазное дно с помощью системы контактных линз, состоящей из капли раствора контактной среды на роговице, накрытой покровным стеклом для микропрепаратов. При субретинальных инъекциях наконечник иглы 34 калибра на 10 мм, закрепленной на 5-мкл шприце Hamilton, можно при непосредственной визуализации продвигать через экваториальную область верхней части склеры тангенциально к заднему полюсу глазного яблока, пока в субретинальном пространстве не будет видна апертура иглы. Затем можно инъецировать 2 мкл суспензии вектора, вызывая буллезное верхнее отслоение сетчатки, что, таким образом, подтверждает субретинальное введение вектора. В данном подходе производят самогерметизирующийся разрез склеры, позволяющий суспензии вектора удерживаться в субретинальном пространстве до поглощения ее RPE, обычно в течение 48 ч. после процедуры. Эту процедуру можно повторить в нижнем полушарии, вызывая нижнее отслоение сетчатки. Данная методика обуславливает воздействие суспензии вектора на приблизительно 70% нейросенсорной части сетчатки и RPE. В случае интравитреальных инъекций можно продвигать наконечник иглы через склеру на 1 мм кзади от корнеосклерального лимба и инъецировать 2 мкл суспензии вектора в полость стекловидного тела. В случае внутрикамерных инъекций можно продвигать наконечник иглы через парацентез корнеосклерального лимба в направлении центральной части роговицы и можно инъецировать 2 мкл суспензии вектора. В случае внутрикамерных инъекций можно продвигать наконечник иглы через парацентез корнеосклерального лимба в направлении центральной части роговицы и можно инъецировать 2 мкл суспензии вектора. Эти векторы можно инъецировать в титрах 1,0-1,4×1010 или 1,0-1,4×109 трансдуцирующих единиц (ТЕ)/мл.

В другом варианте осуществления также предусмотрен RetinoStat®, лентивирусный вектор на основе вируса инфекционной анемии лошадей для генной терапии, экспрессирующий ангиостатические белки эндостатин и ангиостатин, который доставляют посредством субретинальной инъекции для лечения влажной формы возрастной макулодистрофии (см., например, Binley et al., HUMAN GENE THERAPY 23:980-991 (September 2012)). Такой вектор может быть модифицирован для системы CRISPR-Cas по настоящему изобретению. Каждый глаз можно обрабатывать любым RetinoStat® в дозе 1,1×105 трансдуцирующих единиц на глаз (ТЕ/глаз) в общем объеме 100 мкл.

В другом варианте осуществления может быть предусмотрен аденовирусный вектор с делецией Е1 и Е4 и частичной делецией Е3 для доставки в глаз. Двадцать восемь пациентов с неоваскулярной возрастной макулодистрофией на поздней стадии (AMD) получали однократную интравитреальную инъекцию аденовирусного вектора с делецией Е1 и Е4 и частичной делецией Е3, экспрессирующего фактор пигментного эпителия человека (AdPEDF.ll) (см., например, Campochiaro et al., Human Gene Therapy 17:167-176 (February 2006)). Исследовали дозы, варьирующие в диапазоне от 106 до 109,5 единичных частиц (PU), и не наблюдали серьезных нежелательных явлений, связанных с AdPEDF.ll, и дозолимитирующей токсичности (см., например, Campochiaro et al., Human Gene Therapy 17:167-176 (February 2006)). Опосредованный аденовирусными векторами перенос генов в глаза, по-видимому, является действенным подходом для лечения нарушений со стороны органов зрения и может применяться для системы CRISPR-Cas.

В другом варианте осуществления систему sd-rxRNA® от RXi Pharmaceuticals можно применять для доставки CRISPR-Cas в глаз и/или приспосабливать к ней. В этой системе однократное интравитреальное введение 3 мкг sd-rxRNA приводит к специфичному относительно последовательности снижению уровней мРНК PPIB в течение 14 дней. Систему sd-rxRNA® можно применять для системы CRISPR-Cas по настоящему изобретению, предусматривая введение человеку дозы CRISPR, составляющей приблизительно 3-20 мг.

Millington-Ward и соавт. (Molecular Therapy, vol. 19 no. 4, 642-649 apr. 2011) описывают векторы на основе аденоассоциированного вируса (AAV) для доставки супрессора родопсина, функционирующего на основе РНК-интерференции (RNAi), и замещающего гена родопсина с модифицированными кодонами, устойчивого к супрессии в связи с нуклеотидными изменениями в вырожденных положениях в целевом сайте для RNAi. Осуществляли субретинальную инъекцию 6,0×108 vp или 1,8×1010 vp AAV в глаза согласно Millington-Ward и соавт. Векторы на основе AAV согласно Millington-Ward и соавт. можно применять для системы CRISPR-Cas по настоящему изобретению, предусматривая введение человеку дозы, составляющей от приблизительно 2×1011 до приблизительно 6×1013 vp.

Dalkara и соавт. (Sci Transl Med 5, 189ra76 (2013)) также обращаются к направленной эволюции in vivo для конструирования вектора на основе AAV, доставляющего варианты дефектных генов дикого типа по всей сетчатке после безвредной инъекции в жидкую часть стекловидного тела глаза. Dalkara описывает дисплейную библиотеку 7-мерных пептидов и библиотеку AAV, сконструированную посредством ДНК-шаффлинга генов cap AAV1, 2, 4, 5, 6, 8 и 9. Упаковывали библиотеки rcAAV и векторы на основе rAAV, экспрессирующие GFP под контролем промотора CAG или Rho, и с помощью количественной ПЦР получали титры геномов, устойчивых к действию дезоксирибонуклеаз. Библиотеки объединяли, и проводили два цикла эволюции, каждый из которых состоял из диверсификации исходной библиотеки с последующими тремя этапами отбора in vivo. На каждом таком этапе мышам Р30 с экспрессией rho-GFP интравитреально инъецировали 2 мл очищенной йодиксанолом и подвергнутой диализу против фосфатно-солевого буфера (PBS) библиотеки с титром геномов приблизительно 1×1012 vg/мл. Векторы на основе AAV согласно Dalkara и соавт. можно применять для системы CRISPR-Cas по настоящему изобретению, что предусматривает введение человеку дозы, составляющей от приблизительно 1×1015 до приблизительно 1×1016 vg/мл.

В другом варианте осуществления можно целенаправленно воздействовать на ген родопсина для лечения пигментного ретинита (RP), где систему согласно публикации заявки на патент США №20120204282, закрепленной за Sangamo Biosciences, Inc., можно модифицировать по образу системы CRISPR-Cas по настоящему изобретению.

В другом варианте осуществления способы согласно публикации заявки на патент США №20130183282, закрепленной за Cellectis, направленной на способы расщепления целевой последовательности гена родопсина человека, можно также модифицировать для системы CRISPR-Cas по настоящему изобретению.

Публикация заявки на патент США №20130202678, закрепленная за Academia Sinica, относится к способам лечения форм ретинопатии и офтальмологических нарушений с угрозой потери зрения, относящимся к доставке гена Puf-A (экспрессируемого в ганглиозных и пигментных клетках сетчатки в тканях глаза и проявляющего уникальную антиапоптотическую активность) в субретинальное или интравитреальное пространство глаза. В частности, желаемые мишени представляют собой zgc:193933, prdm1a, spata2, tex10, rbb4, ddx3, zp2.2, Blimp-1 и HtrA2, на все из которых можно целенаправленно воздействовать с помощью системы CRISPR-Cas по настоящему изобретению.

Wu (Cell Stem Cell, 13:659-62, 2013) разработал направляющую РНК, которая нацеливает Cas9 на местоположение мутации в одной паре оснований, вызывающей формы катаракты у мышей, где он индуцирует расщепление ДНК. Затем с помощью другого аллеля дикого типа или олигонуклеотидов, вводимых в зиготы, механизмы репарации корректируют последовательность поврежденного аллеля и корректируют генетический дефект, вызывающий катаракту, у мутантной мыши.

В публикации заявки на патент США №20120159653 описывается применение нуклеаз с "цинковыми пальцами" для генетической модификации клеток, животных и белков, ассоциированных с макулодистрофией (MD). Макулодистрофия (MD) является основной причиной ухудшения зрения у лиц пожилого возраста, однако также является характерным симптомом детских заболеваний, таких как болезнь Штаргардта, дистрофия глазного дна Сорсби и детские нейродегенеративные заболевания с летальным исходом, при этом начало заболеваний проявляется уже в младенческом возрасте. Макулодистрофия приводит к потере зрения в центре поля зрения (желтом пятне) по причине поражения сетчатки. Существующие в настоящее время животные модели не воспроизводят основные отличительные признаки заболевания, как это наблюдается у людей. У доступных животных моделей, содержащих мутантные гены, кодирующие белки, ассоциированные с MD, также получают крайне изменчивые фенотипы, что делает проблематичными переход к заболеванию человека и разработку способов терапии.

Один аспект публикации заявки на патент США №20120159653 относится к редактированию любых хромосомных последовательностей, которые кодируют белки, ассоциированные с MD, что можно распространяться на систему CRISPR-Cas по настоящему изобретению. Белки, ассоциированные с MD, как правило, выбирают, исходя из экспериментально установленной взаимосвязи белка, ассоциированного с MD, с нарушением по типу MD. Например, скорость образования или концентрация в кровотоке белка, ассоциированного с MD, может быть повышенной или пониженной в популяции с нарушением по типу MD по сравнению с популяцией без нарушения по типу MD. Различия в уровнях белка можно оценить при помощи протеомных методик, в том числе, без ограничения, вестерн-блот-анализа, иммуногистохимического окрашивания, твердофазного иммуноферментного анализа (ELISA) и масс-спектрометрии. В альтернативном случае, белки, ассоциированные с MD, можно идентифицировать путем получения профилей экспрессии генов для генов, кодирующих белки, при помощи методик геномного анализа, в том числе, без ограничения, микроматричного анализа ДНК, серийного анализа экспрессии генов (SAGE) и количественной полимеразной цепной реакции в режиме реального времени (Q-PCR).

В качестве неограничивающего примера белки, ассоциированные с MD, включают, без ограничения, следующие белки: представитель 4 (АВСА4) подсемейства А (АВС1) АТФ-связывающей кассеты, АСНМ1 - белок 1, ассоциированный с ахроматопсией (палочковым монохроматизмом), АроЕ - аполипопротеин Е (АроЕ), C1QTNF5 (CTRP5) -C1q/белок 5, родственный фактору некроза опухолей (C1QTNF5), С2 - компонент 2 системы комплемента (С2), компонент С3 системы комплемента (С3), CCL2 - хемокиновый лиганд 2 (с мотивом С-С) (CCL2), CCR2 - рецептор хемокина 2 (с мотивом С-С) (CCR2), CD36 - кластер дифференцировки 36, CFB - фактор В системы комплемента, CFH - фактор Н системы комплемента (CFH), CFHR1 - белок 1, родственный фактору Н системы комплемента, CFHR3 - белок 3, родственный фактору Н системы комплемента, CNGB3 - бета-3-субъединица ионного канала, регулируемого циклическими нуклеотидами, CP - церулоплазмин (CP), CRP - С-реактивный белок (CRP) CST3 - цистатин С или цистатин 3 (CST3), CTSD - катепсин D (CTSD), CX3CR1 - рецептор хемокина 1 (с мотивом С-Х3-С), ELOVL4 - белок 4, отвечающий за удлинение жирных кислот с очень длинной цепью, ERCC6 - белок эксцизионной репарации, вступающий в перекрестную комплементацию, корректирующий дефицит репарации у грызунов, комплементационная группа 6, FBLN5 - фибулин-5, FBLN5 - фибулин 5, FBLN6 - фибулин 6, FSCN2 - фасцин (FSCN2), HMCN1 - гемицентрин 1, HMCN1 - гемицентрин 1, HTRA1 - сериновая пептидаза HtrA 1 (HTRA1), HTRA1 - сериновая пептидаза HtrA 1, IL-6 - интерлейкин 6, IL-8 - интерлейкин 8, LOC387715 - гипотетический белок, PLEKHA1 - белок, содержащий плекстрин-гомологичный домен, представитель 1 семейства А (PLEKHA1), PROM1 - проминин 1 (PROM1 или CD133), PRPH2 - периферин-2, RPGR - регулятор ГТФазы, ассоциированный с пигментным ретинитом, SERPING1 - ингибитор сериновой пептидазы, представитель 1 клады G (С1-ингибитор), TCOF1 - Treacle, TIMP3 - ингибитор 3 металлопротеиназ (TIMP3), TLR3 - Toll-подобный рецептор 3.

Идентичность белка, ассоциированного с MD, редактирование хромосомной последовательности которого осуществляют, может и будет варьировать. В предпочтительном варианте осуществления белки, ассоциированные с MD, редактирование хромосомных последовательностей которых осуществляют, могут представлять собой белок представитель 4 (АВСА4) подсемейства А (АВС1) АТФ-связывающей кассеты, кодируемый геном ABCR, белок аполипопротеин Е (АРОЕ), кодируемый геном АРОЕ, белок хемокиновый лиганд 2 (с мотивом С-С) (CCL2), кодируемый геном CCL2, белок рецептор хемокина 2 (с мотивом С-С) (CCR2), кодируемый геном CCR2, белок церулоплазмин (CP), кодируемый геном CP, белок катепсин D (CTSD), кодируемый геном CTSD, или белок ингибитор 3 металлопротеиназ (TIMP3), кодируемый геном TIMP3. В иллюстративном варианте осуществления генетически модифицированное животное представляет собой крысу, и редактируемая хромосомная последовательность, кодирующая белок, ассоциированный с MD, может быть следующей: NM_000350 (АВСА4) для представителя 4 подсемейства А (АВС1) АТФ-связывающей кассеты, NM_138828 (АРОЕ) для аполипопротеина Е АРОЕ, NM_031530 (CCL2) для хемокинового лиганда 2 (с мотивом С-С) CCL2, NM_021866 (CCR2) для рецептора хемокина 2 (с мотивом С-С) CCR2, NM_012532 (CP) для церулоплазмина CP, NM_134334 (CTSD) для катепсина D CTSD, NM_012886 (TIMP3) для ингибитора 3 металлопротеиназ TIMP3. Животное или клетка могут содержать 1, 2, 3, 4, 5, 6, 7 или более хромосомных последовательностей с нарушенной структурой, кодирующих белок, ассоциированный с MD, и ноль, 1, 2, 3, 4, 5, 6, 7 или более интегрированных в хромосомы последовательностей, кодирующих белок с нарушенной структурой, ассоциированный с MD.

Отредактированную или интегрированную хромосомную последовательность можно модифицировать так, чтобы она кодировала измененный белок, ассоциированный с MD. Некоторые мутации в хромосомных последовательностях, связанных с MD, были ассоциированы с MD. Неограничивающие примеры мутаций в хромосомных последовательностях, ассоциированные с MD, включают те, которые могут вызывать MD, в том числе в белке ABCR - Е471K (т.е. глутамат в положении 471 заменен на лизин), R1129L (т.е. аргинин в положении 1129 заменен на лейцин), Т1428М (т.е. треонин в положении 1428 заменен на метионин), R1517S (т.е. аргинин в положении 1517 заменен на серии), I1562T (т.е. изолейцин в положении 1562 заменен на треонин) и G1578R (т.е. глицин в положении 1578 заменен на аргинин); в белке CCR2 - V64I (т.е. валин в положении 192 заменен на изолейцин); в белке CP - G969B (т.е. глицин в положении 969 заменен на аспарагин или аспартат); в белке TIMP3 - S156C (т.е. серии в положении 156 заменен на цистеин), G166C (т.е. глицин в положении 166 заменен на цистеин), G167C (т.е. глицин в положении 167 заменен на цистеин), Y168C (т.е. тирозин в положении 168 заменен на цистеин), S170C (т.е. серии в положении 170 заменен на цистеин), Y172C (т.е. тирозин в положении 172 заменен на цистеин) и S181C (т.е. серии в положении 181 заменен на цистеин). В данной области известны и другие взаимосвязи генных вариантов генов, ассоциированных с MD, и заболевания.

Сердце

Настоящее изобретение также предусматривает доставку системы CRISPR-Cas в сердце. Для сердца предпочтительным является тропный к миокарду аденоассоциированный вирус (AAVM), в частности AAVM41, при использовании которого продемонстрирован преимущественный перенос генов в сердце (см., например, Lin-Yanga et al., PNAS, March 10, 2009, vol. 106, no. 10). Введение может быть системным или местным. Для системного введения предусматривается доза, составляющая приблизительно 1-10×1014 векторных геномов. См. также, например, Eulalio et al. (2012) Nature 492: 376 и Somasuntharam et al. (2013) Biomaterials 34: 7790.

Например, в публикации патентного документа США №20110023139 описывается применение нуклеаз с "цинковыми пальцами" для генетической модификации клеток, животных и белков, ассоциированных с сердечно-сосудистым заболеванием. Сердечнососудистые заболевания, как правило, включают высокое кровяное давление, сердечные приступы, сердечную недостаточность и инсульт, а также TIA. Любую хромосомную последовательность, связанную с сердечно-сосудистым заболеванием, или белок, кодируемый любой хромосомной последовательностью, связанной с сердечнососудистым заболеванием, можно использовать в способах, описанных в настоящем раскрытии. Белки, связанные с сердечно-сосудистым заболеванием, обычно выбирают исходя из экспериментально подтвержденной ассоциации белка, связанного с сердечнососудистым заболеванием, с развитием сердечно-сосудистого заболевания. Например, скорость образования или концентрация в кровотоке белка, связанного с сердечнососудистым заболеванием, может быть повышенной или пониженной в популяции с сердечно-сосудистым заболеванием по сравнению с популяцией без сердечно-сосудистого заболевания. Различия в уровнях белка можно оценить при помощи протеомных методик, в том числе, без ограничения, вестерн-блот-анализа, иммуногистохимического окрашивания, твердофазного иммуноферментного анализа (ELISA) и масс-спектрометрии. В альтернативном случае, белки, связанные с сердечно-сосудистым заболеванием, можно идентифицировать путем получения профилей генной экспрессии для генов, кодирующих белки, при помощи методик геномного анализа, в том числе, без ограничения, микроматричного анализа ДНК, серийного анализа экспрессии генов (SAGE) и количественной полимеразной цепной реакции в режиме реального времени (Q-PCR).

В качестве примера, хромосомная последовательность может содержать без ограничения следующие: IL1B (интерлейкин 1, бета), XDH (ксантиндегидрогеназа), ТР53 (опухолевый белок р53), PTGIS (простагландин 12 (простациклин) синтаза), MB (миоглобин), IL4 (интерлейкин 4), ANGPT1 (ангиопоэтин 1), ABCG8 (АТФ-связывающая кассета, подсемейство G (WHITE), представитель 8), CTSK (катепсин K), PTGIR (рецептор простагландина 12 (простациклина) (IP)), KCNJ11 (входящий калиевый канал, подсемейство J, представитель 11), INS (инсулин), CRP (С-реактивный белок, родственный пентраксину), PDGFRB (полипептид рецептора тромбоцитарного фактора роста бета), CCNA2 (циклин А2), PDGFB (полипептид тромбоцитарного фактора роста бета (гомолог онкогена вируса саркомы обезьян (v-sis))), KCNJ5 (входящий калиевый канал, подсемейство J, представитель 5), KCNN3 (кальций-активируемый калиевый канал средней/малой проводимости, подсемейство N, представитель 3), CAPN10 (кальпаин 10), PTGES (простагландин Е синтаза), ADRA2B (адренергический, альфа-2В-, рецептор), ABCG5 (АТФ-связывающая кассета, подсемейство G (WHITE), представитель 5), PRDX2 (пероксиредоксин 2), CAPN5 (кальпаин 5), PARP14 (семейство полимераз поли(АДФ-рибозы), представитель 14), МЕХ3С (гомолог С mex-3 (С. elegans)), АСЕ, ангиотензинпревращающий фермент I (пептидилдипептидаза А) 1), TNF (фактор некроза опухоли (суперсемейство TNF, представитель 2)), IL6 (интерлейкин 6 (интерферон, бета 2)), STN (статин), SERPINE1 (ингибитор серпиновой пептидазы, клада Е (нексин, ингибитор активатора плазминогена типа 1), представитель 1), ALB (альбумин), ADIPOQ (адипонектин, содержащий C1Q и коллагеновый домен), АРОВ (аполипопротеин В (в том числе антиген Ag(x))), АРОЕ (аполипопротеин Е), LEP (лептин), MTHFR (5,10-метилентетрагидрофолатредуктаза (NADPH)), АРОА1 (аполипопротеин A-I), EDN1 (эндотелии 1), NPPB (предшественник В натрийуретического пептида), NOS3 (синтаза 3 оксида азота (эндотелиальная клетка)), PPARG (рецептор гамма, активируемый пролифератором пероксисом), PLAT (активатор плазминогена, ткань), PTGS2 (простагландин-эндопероксидсинтаза 2 (простагландин G/H синтаза и циклооксигеназа)), СЕТР (транспортный белок сложного эфира холестерина, плазма), AGTR1 (рецептор ангиотензина II, тип 1), HMGCR (редуктаза 3-гидрокси-3-метилглутарилкофермента А), IGF1 (инсулиноподобный фактор роста 1 (соматомедин С)), SELE (селектин Е), REN (ренин), PPARA (альфа-рецептор, активируемый пролифератором пероксисом), PON1 (параоксоназа 1), KNG1 (кининоген 1), CCL2 (лиганд 2 хемокина (мотив С-С)), LPL (липопротеинлипаза), VWF (фактор фон Виллебранда), F2 (фактор коагуляции II (тромбин)), ICAM1 (внутриклеточная молекула адгезии 1), TGFB1 (трансформирующий фактор роста, бета 1), NPPA (предшественник А натрийуретического пептида), IL10 (интерлейкин 10), ЕРО (эритропоэтин), SOD1 (супероксиддисмутаза 1, растворимая), VCAM1 (молекула адгезии сосудистого эндотелия типа 1), IFNG (интерферон, гамма), LPA (липопротеин, Lp(a)), МРО (миелопероксидаза), ESR1 (эстрогеновый рецептор 1), МАРK1 (митоген-активируемая протеинкиназа 1), HP (гаптоглобин), F3 (фактор коагуляции III (тромбопластин, тканевой фактор)), CST3 (цистатин С), COG2 (компонент олигомерного комплекса Гольджи 2), ММР9 (матриксная металлопептидаза 9 (желатиназа В, 92 кДа желатиназа, 92 кДа коллагеназа типа IV)), SERPINC1 (ингибитор серпиновой пептидазы, клада С (антитромбин), представитель 1), F8 (фактор коагуляции VIII, прокоагулянтный компонент), НМОХ1 (гемоксигеназа (дециклизирующая) 1), АРОС3 (аполипопротеин С-III), IL8 (интерлейкин 8), PROK1 (прокинетицин 1), CBS (цистатион-бета-синтаза), NOS2 (синтаза 2 оксида азота, индуцируемая), TLR4 (толл-подобный рецептор 4), SELP (селектин Р (гранулярный мембранный белок 140 кДа, антиген CD62)), АВСА1 (АТФ-связывающая кассета, подсемейство А (АВС1), представитель 1), AGT (ангиотензиноген (ингибитор серпиновой пептидазы, клада А, представительн 8)), LDLR (рецептор липопротеинов низкой плотности), GPT (глутамат-пируватная трансаминаза (аланинаминотрансфераза)), VEGFA (фактор роста эндотелия сосудов A), NR3C2 (ядерный рецептор, подсемейство 3, группа С, представитель 2), IL18 (интерлейкин 18 (интерферон-гамма-индуцирующий фактор)), NOS1 (синтаза 1 оксида азота (нейрональная)), NR3C1 (ядерный рецептор, подсемейство 3, группа С, представитель 1 (глюкокортикоидный рецептор)), FGB (бета-цепь фибриногена), HGF (фактор роста гепатоцитов (гепапоэтин А; рассеивающий фактор)), IL1A (интерлейкин 1, альфа), RETN (резистин), АКТ1 (гомолог 1 онкогена v-akt вируса тимомы мышей), LIPC (липаза, печеночная), HSPD1 (60 кДа белок теплового шока 1 (шаперонин)), МАРК 14 (митоген-активируемая протеинкиназа 14), SPP1 (секретируемый фосфопротеин 1), ITGB3 (интегрин, бета 3 (гликопротеин 111а тромбоцитов, антиген CD61)), CAT (каталаза), UTS2 (уротензин 2), THBD (тромбомодулин), F10 (фактор коагуляции X), CP (церулоплазмин (ферроксидаза)), TNFRSF11B (суперсемейство рецепторов фактора некроза опухоли, представитель 11b), EDNRA (рецептор эндотелина типа A), EGFR (рецептор эпидермального фактора роста (гомолог онкогена вируса эритробластического лейкоза (v-erb-b), птичий)), ММР2 (матриксная металлопептидаза 2 (желатиназа А, 72 кДа желатиназа, 72 кДа коллагеназа типа IV)), PLG (плазминоген), NPY (нейропептид Y), RHOD (гомолог белка семейства генов ras, представитель D), МАРK8 (митоген-активируемая протеинкиназа 8), MYC (гомолог онкогена v-myc вируса миелоцитоматоза (птичий)), FN1 (фибронектин 1), СМА1 (химаза 1, тучная клетка), PLAU (активатор плазминогена, урокиназа), GNB3 (белок, связывающий гуаниновый нуклеотид (G-белок), бета-полипептид 3), ADRB2 (адренергический, бета-2-, рецептор, поверхностный), АРОА5 (аполипопротеин A-V), SOD2 (супероксиддисмутаза 2, митохондриальная), F5 (фактор коагуляции V (проакцелерин, лабильный фактор)), VDR (рецептор витамина D (1,25-дигидроксивитамин D3)), ALOX5 (арахидонат-5-липоксигеназа), HLA-DRB1 (главный комплекс гистосовместимости, класс II, DR-бета 1), PARP1 (полимераза 1 поли(ADP-рибозы)), CD40LG (лиганд CD40), PON2 (параоксоназа 2), AGER (рецептор, специфичный к конечным продуктам усиленного гликозилирования), IRS1 (субстрат 1 инсулинового рецептора), PTGS1 (простагландин-эндопероксидсинтаза 1 (простагландин G/H синтаза и циклооксигеназа)), ЕСЕ1 (эндотелин-превращающий фермент 1), F7 (фактор коагуляции VII (сывороточный ускоритель превращения протромбина)), URN (антагонист рецептора интерлейкина 1), ЕРНХ2 (эпоксидгидролаза 2, цитоплазматическая), IGFBP1 (белок 1, связывающий инсулиноподобный фактор роста), МАРK 10 (митоген-активируемая протеинкиназа 10), FAS (Fas (суперсемейство рецепторов TNF, представитель 6)), АВСВ1 (АТФ-связывающая кассета, подсемейство В (MDR/TAP), представитель 1), JUN (онкоген jun), IGFBP3 (белок 3, связывающий инсулиноподобный фактор роста), CD 14 (молекула CD 14), PDE5A (фосфодиэстераза 5А, cGMP-специфичная), AGTR2 (рецептор ангиотензина II, тип 2), CD40 (молекула CD40, представитель 5 суперсемейства рецепторов TNF), LCAT (лецитинхолестеринацилтрансфераза), CCR5 (рецептор 5 хемокина (мотив С-С)), ММР1 (матриксная металлопептидаза 1 (интерстициальная коллагеназа)), TIMP1 (ингибитор 1 металлопептидазы TIMP), ADM (адреномедуллин), DYT10 (белок 10, связанный с дистонией), STAT3 (переносчик сигнала и активатор транскрипции 3 (фактор ответа острой фазы)), ММР3 (матриксная металлопептидаза 3 (стромелизин 1, прожелатиназа)), ELN (эластин), USF1 (транскрипционный фактор 1, расположенный выше промотора), CFH (фактор комплемента Н), HSPA4 (70 кДа белок теплового шока 4), ММР12 (матриксная металлопептидаза 12 (эластаза макрофагов)), ММЕ (мембранная металлоэндопептидаза), F2R (рецептор фактора коагуляции II (тромбина)), SELL (селектин L), CTSB (катепсин В), ANXA5 (аннексии А5), ADRB1 (адренергический, бета-1-, рецептор), CYBA (цитохром b-245, альфа-полипетид), FGA (альфа-цепь фибриногена), GGT1 (гамма-глутамилтрансфераза 1), LIPG (липаза, эндотелиальная), HIF1A (фактор 1, индуцируемый гипоксией, альфа-субъединица (транскрипционный фактор с основным доменом типа спираль-петля-спираль)), CXCR4 (рецептор 4 хемокина (мотив С-Х-С)), PROC (белок С (инактиватор факторов коагуляции Va и VIIIa)), SCARB1 (класс В фагоцитарных рецепторов, представитель 1), CD79A (молекула CD79a, иммуноглобулин - ассоциированная альфа), PLTP (белок, переносящий фосфолипиды), ADD1 (аддуцин 1 (альфа)), FGG (гамма-цепь фибриногена), SAA1 (сывороточный амилоид A1), KCNH2 (калиевый потенциалзависимый канал, подсемейство Н (eag-родственный), представитель 2), DPP4 (дипептидилпептидаза 4), G6PD (глюкозо-6-фосфатдегидрогеназа), NPR1 (рецептор А натрийуретического пептида/гуанилатциклаза А (рецептор А атрионатрийуретического пептида)), VTN (витронектин), KIAA0101 (KIAA0101), FOS (гомолог онкогена вируса остеосаркомы мышей FBJ), TLR2 (толл-подобный рецептор 2), PPIG (пептидилпролилизомераза G (циклофилин G)), IL1R1 (рецептор интерлейкина 1, тип I), AR (андрогеновый рецептор), CYP1A1 (цитохром Р450, семейство 1, подсемейство А, полипептид 1), SERPINA1 (ингибитор серпиновой пептидазы, клада А (альфа-1 антипротеиназа, антитрипсин), представитель 1), MTR (5-метилтетрагидрофолатгомоцистеинметилтрансфераза), RBP4 (белок 4, связывающий ретинол, плазма), АРОА4 (аполипопротеин A-IV), CDKN2A (ингибитор 2А циклин-зависимой киназы (меланома, р16, ингибирует CDK4)), FGF2 (фактор 2 роста фибробластов (основной)), EDNRB (рецептор эндотелина типа В), ITGA2 (интегрин, альфа 2 (CD49B, субъединица альфа 2 рецептора VLA-2)), CABIN 1 (белок 1, связывающий кальциневрин), SHBG (глобулин, связывающий половые гормоны), HMGB1 (группа белков с высокой подвижностью 1), HSP90B2P (90 кДа белок теплового шока бета (Grp94), представитель 2 (псевдоген)), CYP3A4 (цитохром Р450, семейство 3, подсемейство А, полипептид 4), GJA1 (белок межклеточных щелевых контактов, альфа 1, 43 кДа), CAV1 (кавеолин 1, кавеолярный белок, 22 кДа), ESR2 (эстрогеновый рецептор 2 (ER-бета)), LTA (лимфотоксин-альфа (суперсемейство TNF, представитель 1)), GDF15 (фактор 15 роста и дифференцировки), BDNF (нейротрофический фактор головного мозга), CYP2D6 (цитохром Р450, семейство 2, подсемейство D, полипептид 6), NGF (фактор роста нервов (бета-полипептид)), SP1 (транскрипционный фактор Sp1), TGIF1 (гомеобокс 1 TGFB-индуцируемого фактора), SRC (гомолог онкогена v-src вируса саркомы (Schmidt-Ruppin А-2) (птичий)), EGF (эпидермальный фактор роста (бета-урогастрон)), PIK3CG (фосфоинозитид-3-киназа, каталитическая, гамма-полипептид), HLA-A (главный комплекс гистосовместимости, класс I, A), KCNQ1 (калиевый потенциалзависимый канал, подсемейство KQT-подобных белков, представитель 1), CNR1 (каннабиноидный рецептор 1 (головной мозг)), FBN1 (фибриллин 1), СНKА (холинкиназа альфа), BEST1 (бестрофин 1), АРР (белок-предшестенник бета-амилоида (А4)), CTNNB1 (катенин (кадгерин-ассоциированный белок), бета 1, 88 кДа), IL2 (интерлейкин 2), CD36 (молекула CD36 (рецептор тромбоспондина)), PRKAB1 (протеинкиназа, АМР-активируемая, бета 1, некаталитическая субъединица), ТРО (тиреоидная пероксидаза), ALDH7A1 (семейство альдегиддегидрогеназы 7, представитель A1) CX3CR1 (рецептор 1 хемокина (мотив С-Х3-С)), ТН (тирозингидроксилаза), F9 (фактор коагуляции IX), GH1 (гормон роста 1), TF (трансферрин), HFE (гемохроматоз), IL17A (интерлейкин 17А), PTEN (гомолог фосфатазы и тензина), GSTM1 (глутатион-S-трансфераза mu 1), DMD (дистрофии), GATA4 (GATA-связывающий белок 4), F13A1 (фактор коагуляции XIII, полипептид A1), TTR (транстиретин), FABP4 (белок 4, связывающий жирные ксилоты, адипоцитарный), PON3 (параоксоназа 3), АРОС1 (аполипопротеин C-I), INSR (инсулиновый рецептор), TNFRSF1B (суперсемейство рецепторов фактора некроза опухоли, представитель 1B), HTR2A (5 гидрокситриптаминовый (серотониновый) рецептор 2А), CSF3 (колониестимулирующий фактор 3 (гранулоцитарный)), CYP2C9 (цитохром Р450, семейство 2, подсемейство С, полипептид 9), TXN (тиоредоксин), CYP11B2 (цитохром Р450, семейство 11, подсемейство В, полипептид 2), РТН (паратиреоидный гормон), CSF2 (колониестимулирующий фактор 2 (гранулоцитарно-макрофагальный)), KDR (рецептор вставочного домена киназы (рецептор тирозинкиназы III типа)), PLA2G2A (фосфолипаза А2, группа IIA (тромбоциты, синовиальная жидкость)), В2М (бета-2-микроглобулин), THBS1 (тромбоспондин 1), GCG (глюкагон), RHOA (гомолог белка семейства генов ras, представитель A), ALDH2 (семейство альдегиддегидрогеназы 2 (митохондриальная)), TCF7L2 (белок 2, подобный транскрипционному фактору 7 (специфический по отношению к Т-клеткам, HMG-бокс)), BDKRB2 (брадикининовый рецептор В2), NFE2L2 (белок 2, подобный ядерному фактору (эритроидному 2)), NOTCH1 (гомолог Notch 1, ассоциированный с транслокацией (Drosophila)), UGT1A1 (семейство UDP-глюкуронозилтрансферазы 1, полипептид A1), IFNA1 (интерферон, альфа 1), PPARD (рецептор дельта, активируемый пролифератором пероксисом), SIRT1 (сиртуин (гомолог регулятора 2 экспрессии, обеспечивающего сайленсинг) 1 (S. cerevisiae)), GNRH1 (гонадотропин-рилизинг гормон 1 (лютеинизирующий рилизинг-гормон)), РАРРА (ассоциированный с беременностью белок плазмы А, паппализин 1), ARR3 (аррестин 3, ретинальный (Х-аррестин)), NPPC (предшественник С натрийуретического пептида), AHSP (белок, стабилизирующий альфа-гемоглобин), РТK2 (РТК2 тирозиновая протеинкиназа 2), IL13 (интерлейкин 13), MTOR (механистическая мишень рапамицина (серин/треонинкиназа)), ITGB2 (интегрин, бета 2 (субъединица рецептора 3 и 4 компонента комплемента 3)), GSTT1 (глутатион-S-трансфераза тета 1), IL6ST (переносчик сигнала интерлейкина 6 (gp130, рецептор онкостатина М)), СРВ2 (карбоксипептидаза В2 (плазма)), CYP1A2 (цитохром Р450, семейство 1, подсемейство А, полипептид 2), HNF4A (гепатоцитарный ядерный фактор 4, альфа), SLC6A4 (семейство переносчиков растворенных веществ 6 (транспортер нейротрансмиттеров, серотониновый), представитель 4), PLA2G6 (фосфолипаза А2, группа VI (цитозольная, кальций-независимая)), TNFSF11 (суперсемейство фактора некроза опухоли (лиганд), представитель 11), SLC8A1 (семейство переносчиков растворенных веществ 8 (натрий/кальциевый обменник), представитель 1), F2RL1 (белок 1, подобный рецептору фактора коагуляции II (тромбина)), AKR1A1 (семейство 1 альдокеторедуктаз, представитель А1 (альдегидредуктаза)), ALDH9A1 (семейство альдегиддегидрогеназы 9, представитель A1), BGLAP (гамма-карбоксиглутаматный (gla) белок кости), МТТР (микросомальный белок-переносчик триглицеридов), MTRR (редуктаза 5 метилтетрагидрофолат-гомоцистеинметилтрансферазы), SULT1A3 (семейство сульфотрансфераз, цитозольная, 1А, преимущественно воздействующих на фенол, представитель 3), RAGE (антиген опухоли почек), С4В (компонент комплемента 4В (группа крови Chido), P2RY12 (пуринергический рецептор P2Y, связанный с G-белком, 12), RNLS (реналаза, FAD-зависимая аминоксидаза), CREB1 (белок 1, связывающий сАМР-чувствительный элемент), РОМС (проопиомеланокортин), RAC1 (родственный ras субстрат 1 ботулотоксина С3 (семейство rho, малый GTP-связывающий белок Rac1)), LMNA (ламин NC), CD59 (молекула CD59, регуляторный белок комплемента), SCN5A (натриевый канал, потенциалзависимый, тип V, альфа-субъединица), CYP1B1 (цитохром Р450, семейство 1, подсемейство В, полипептид 1), MIF (фактор ингибирования миграции макрофагов (фактор, ингибирующий гликозилирование)), ММР13 (матриксная металлопептидаза 13 (коллагеназа 3)), TIMP2 (ингибитор 2 металлопептидазы TIMP), CYP19A1 (цитохром Р450, семейство 19, подсемейство А, полипептид 1), CYP21A2 (цитохром Р450, семейство 21, подсемейство А, полипептид 2), PTPN22 (тирозиновая протеинфосфатаза, нерецепторного типа 22 (лимфоидная)), MYH14 (миозин, тяжелая цепь 14, отличный от мышечного), MBL2 (лектин, связывающий маннозу (белок С) 2, растворимый (опсонический дефект)), SELPLG (лиганд селектина Р), АОС3 (аминоксидаза, белок 3, содержащий медь (васкулярный адгезивный белок 1)), CTSL1 (катепсин L1), PCNA (ядерный антиген пролиферирующих клеток), IGF2 (инсулиноподобный фактор роста 2 (соматомедин A)), ITGB1 (интегрин, бета 1 (рецептор фибронектина, бета-полипептид, антиген CD29, включающий MDF2, MSK12)), CAST (кальпастатин), CXCL12 (лиганд 12 хемокина (мотив С-Х-С) (стромальный клеточный фактор 1)), IGHE (константный участок тяжелой эпсилон-цепи иммуноглобулина), KCNE1 (калиевый потенциалзависимый канал, Isk-родственное семейство, представитель 1), TFRC (рецептор трансферрина (р90, CD71)), COL1A1 (коллаген, тип I, альфа 1), COL1A2 (коллаген, тип I, альфа 2), IL2RB (рецептор интерлейкина 2, бета), PLA2G10 (фосфолипаза А2, группа X), ANGPT2 (ангиопоэтин 2), PROCR (рецептор белка С, эндотелиальный (EPCR)), NOX4 (NADPH-оксидаза 4), НАМР (противомикробный пептид гепсидин), PTPN11 (тирозиновая протеинфосфатаза, нерецепторного типа 11), SLC2A1 (семейство 2 переносчиков растворенных веществ (транспортер, обеспечивающий облегченный перенос глюкозы), предствитель 1), IL2RA (рецептор интерлейкина 2, альфа), CCL5 (лиганд 5 хемокина (мотив С-С)), IRF1 (регуляторный фактор 1 интерферона), CFLAR (CASP8 и FADD-подобный регулятор апоптоза), CALCA (полипептид альфа, родственный кальцитонину), EIF4E (эукариотический фактор инициации трансляции 4Е), GSTP1 (глутатион-S-трансфераза пи 1), JAK2 (Janus киназа 2), CYP3A5 (цитохром Р450, семейство 3, подсемейство А, полипептид 5), HSPG2 (гепарансульфат-протеогликан 2), CCL3 (лиганд 3 хемокина (мотив С-С)), MYD88 (белок гена первичного ответа, связанного с дифференцировкой миелоидных клеток (88)), VIP (вазоактивный интестинальный пептид), SOAT1 (стерол-О-ацилтрансфераза 1), ADRBK1 (адренергическая, бета, рецепторная киназа 1), NR4A2 (ядерный рецептор, подсемейство 4, группа А, представитель 2), ММР8 (матриксная металлопептидаза 8 (коллагеназа нейтрофилов)), NPR2 (рецептор В натрийуретического пептида/гуанилатциклаза В (рецептор В атрионатрийуретического пептида)), GCH1 (GTP-циклогидролаза 1), EPRS (глутамилпролил-тРНК-синтетаза), PPARGC1A (гамма-рецептор, активируемый пролифератором пероксисом, коактиватор 1 альфа), F12 (фактор коагуляции XII (фактор Хагемана)), РЕСАМ1 (молекула клеточной адгезии эндотелиальных клеток/тромбоцитов), CCL4 (лиганд 4 хемокина (мотив С-С)), SERPINA3 (ингибитор серпиновой пептидазы, клада А (альфа-1 антипротеиназа, антитрипсин), представитель 3), CASR (кальций-чувствительный рецептор), GJA5 (белок межклеточных щелевых контактов, альфа 5, 40 кДа), FABP2 (белок 2, связывающий жирные кислоты, кишечный), TTF2 (фактор терминации транскрипции, РНК-полимераза II), PROS1 (белок S (альфа)), CTF1 (кардиотрофин 1), SGCB (саркогликан, бета (43 кДа дистрофин-ассоциированный гликопротеин)), YME1L1 (YME1-подобный белок 1 (S. cerevisiae)), CAMP (противомикробный пептид кателицидин), ZC3H12A (белок 12А СССН-типа, содержащий "цинковые пальцы"), AKR1B1 (семейство 1 альдокеторедуктаз, представитель В1 (альдозоредуктаза)), DES (десмин), ММР7 (матриксная металлопептидаза 7 (матрилизин, маточный)), AHR (арилуглеводородный рецептор), CSF1 (колониестимулирующий фактор 1 (макрофагальный)), HDAC9 (деацетилаза гистонов 9), CTGF (фактор роста соединительной ткани), KCNMA1 (кальций-активируемый калиевый канал большой проводимости, подсемейство М, альфа, представитель 1), UGT1A (семейство UDP-глюкуронозилтрансферазы 1, полипептид А сложного локуса), PRKCA (протеинкиназа С, альфа), СОМТ (катехол-бета-метилтрансфераза), S100B (S100 кальций-связывающий белок В), EGR1 (белок, связанный с ранними стадиями роста 1), PRL (пролактин), IL15 (интерлейкин 15), DRD4 (допаминовый рецептор D4), CAMK2G (кальций/кальмодулин-зависимая протеинкиназа II гамма), SLC22A2 (семейство 22 переносчиков растворенных веществ (транспортер органических катионов), представитель 2), CCL11 (лиганд 11 хемокина (мотив С-С)), PGF (В321 плацентарный фактор роста), ТНРО (тромбопоэтин), GP6 (гликопротеин VI (тромбоцитарный)), TACR1 (тахикининовый рецептор 1), NTS (нейротензин), FINF1A (HNF1 гомеобокс A), SST (соматостатин), KCND1 (калиевый потенциалзависимый канал, Shal-родственное подсемейство, представитель 1), LOC646627 (ингибитор фосфолипазы), TBXAS1 (тромбоксан А синтаза 1 (тромбоцитарная)), CYP2J2 (цитохром Р450, семейство 2, подсемейство J, полипептид 2), TBXA2R (рецептор тромбоксана А2), ADH1C (алкогольдегидрогеназа 1С (класс I), гамма-полипептид), ALOX12 (арахидонат 12-липоксигеназа), AHSG (альфа-2-НS-гликопротеин), ВНМТ (бетаин-гомоцистеинметилтрансфераза), GJA4 (белок межклеточных щелевых контактов, альфа 4, 37 кДа), SLC25A4 (семейство 25 переносчиков растворенных веществ (митохондриальный переносчик; переносчик адениновых нуклеотидов), представитель 4), ACLY (АТР-цитратлиаза), ALOX5AP (арахидонат-5-липоксигеназа-активирующий белок), NUMA1 (белок 1 ядерного митотического аппарата), CYP27B1 (цитохром Р450, семейство 27, подсемейство В, полипептид 1), CYSLTR2 (цистеиниллейкотриеновый рецептор 2), SOD3 (супероксиддисмутаза 3, внеклеточная), LTC4S (лейкотриен-С4-синтаза), UCN (урокортин), GHRL (препропептид грелин/обестатин), АРОС2 (аполипопротеин С-II), CLEC4A (семейство 4 лектиновых доменов С-типа, представитель A), KBTBD10 (белок 10, содержащий повтор kelch и домен ВТВ (POZ)), TNC (тенасцин С), TYMS (тимидилатсинтетаза), SHC1 (SHC (гомолог 2, содержащий домен Src) трансформирующий белок 1), LRP1 (белок 1, родственный рецептору липопротеинов низкой плотности), SOCS3 (супрессор цитокинового сигнала 3), ADH1B (алкогольдегидрогеназа 1В (класс I), бета-полипептид), KLK3 (калликреин-родственная пептидаза 3), HSD11B1 (гидроксистероидная (11-бета) дегидрогеназа 1), VKORC1 (комплекс эпоксидредуктазы и витамина K, субъединица 1), SERPINB2 (ингибитор серпиновой пептидазы, клада В (овальбумин), представитель 2), TNS1 (тензин 1), RNF19A (белок 19А с доменом ring), EPOR (рецептор эритропоэтина), ITGAM (интегрин, альфа М (субъединица рецептора 3 компонента комплемента 3)), PITX2 (гомеодомен 2, подобный парному), МАРK7 (митоген-активируемая протеинкиназа 7), FCGR3A (Fc-фрагмент IgG, белок 111а с низким сродством, рецептор (CD16а)), LEPR (лептиновый рецептор), ENG 4 (эндоглин), GPX1 (глутатионпероксидаза 1), GOT2 (глутамат-оксалоацетат-трансаминаза 2, митохондриальная (аспартатаминотрансфераза 2)), HRH1 (гистаминовый рецептор H1), NR112 (ядерный рецептор, подсемейство 1, группа I, представитель 2), CRH (кортикотропин-рилизинг-гормон), HTR1A (5-гидрокситриптаминовый (серотониновый) рецептор 1А), VDAC1 (потенциалзависимый анионный канал 1), HPSE (гепараназа), SFTPD (сурфактантный белок D), ТАР2 (транспортер 2, АТР-связывающая кассета, подсемейство В (MDR/TAP)), RNF123 (белок 123 с доменом ring), РТK2В (РТK2В тирозиновая протеинкиназа 2 бета), NTRK2 (нейротрофическая тирозинкиназа, рецептор, тип 2), IL6R (рецептор интерлейкина 6), ACHE (ацетилхолинэстераза (группа крови Yt)), GLP1R (рецептор глюкагон-подобного пептида 1), GHR (рецептор гормона роста), GSR (глутатионредуктаза), NQO1 (NАD(Р)Н-дегидрогеназа, хинон 1), NR5A1 (ядерный рецептор, подсемейство 5, группа А, представитель 1), GJB2 (белок межклеточных щелевых контактов, бета 2, 26 кДа), SLC9A1 (семейство 9 переносчиков растворенных веществ (натрий/водородный обменник), представитель 1), МАОА (моноаминоксидаза А), PCSK9 (пробелок-конвертаза субтилизин/кексин типа 9), FCGR2A (Fc-фрагмент IgG, белок IIа с низким сродством, рецептор (CD32)), SERPINF1 (ингибитор серпиновой пептидазы, клада F (альфа-2 антиплазмин, фактор из пигментного эпителия), представитель 1), EDN3 (эндотелии 3), DHFR (дигидрофолатредуктаза), GAS6 (белок 6, специфический по отношению к остановке роста), SMPD1 (сфингомиелинфосфодиэстераза 1, кислая лизосомная), UCP2 (разобщающий белок 2 (митохондриальный, переносчик протонов)), TFAP2A (транскрипционный фактор АР-2 альфа (активирующий энхансер-связывающий белок 2 альфа)), С4ВРА (компонент комплемента 4 связывающий белок, альфа), SERPINF2 (ингибитор серпиновой пептидазы, клада F (альфа-2 антиплазмин, фактор из пигментного эпителия), представитель 2), TYMP (тимидинфосфорилаза), ALPP (щелочная фосфатаза, плацентарная (изофермент Regan)), CXCR2 (рецептор 2 хемокина (мотив С-Х-С)), SLC39A3 (семейство 39 переносчиков растворенных веществ (цинковый транспортер), представитель 3), ABCG2 (АТР-связывающая кассета, подсемейство G (WHITE), представитель 2), ADA (аденозиндезаминаза), JAK3 (Janus киназа 3), HSPA1A (70 кДа белок теплового шока 1А), FASN (синтаза жирных кислот), FGF1 (фактор 1 роста фибробластов (кислый)), F11 (фактор коагуляции XI), АТР7А (АТФаза, Cu++-транспортирующая, альфа-полипетид), CR1 (рецептор 1 компонента комплемента (3b/4b) (группа крови Knops)), GFAP (глиальный фибриллярный кислый белок), ROCK1 (Rho-ассоциированная, протеинкиназа 1, содержащая суперспираль), МЕСР2 (метил-СрG-связывающий белок 2 (синдром Ретта)), MYLK (киназа легкой цепи миозина), ВСНЕ (бутирилхолинэстераза), LIPE (липаза, гормон-чувствительная), PRDX5 (пероксиредоксин 5), ADORA1 (рецептор аденозина A1), WRN (синдром Вернера, белок, подобный хеликазе RecQ), CXCR3 (рецептор 3 хемокина (мотив С-Х-С)), CD81 (молекула CD81), SMAD7 (представитель 7 семейства SMAD), LAMC2 (ламинин, гамма 2), МАР3K5 (митоген-активируемая протеинкиназа 5), CHGA (хромогранин А (паратиреоидный секреторный белок 1)), IAPP (островковый амилоидный полипептид), RHO (родопсин), ENPP1 (эктонуклеотидпирофосфатаза/фосфодиэстераза 1), PTHLH (гормон, подобный паратиреоидному гормону), NRG1 (нейрегулин 1), VEGFC (фактор роста эндотелия сосудов С), ENPEP (глутамиламинопептидаза (аминопептидаза А)), СЕВРВ (ССААТ/энхансер-связывающий белок (С/ЕВР), бета), NAGLU (N-ацетилглюкозаминидаза, альфа-), F2RL3 (белок 3, подобный рецептору фактора коагуляции II (тромбина)), CX3CL1 (лиганд 1 хемокина (мотив С-Х3-С)), BDKRB1 (брадикининовый рецептор B1), ADAMTS13 (ADAM металлопептидаза с мотивом тромбоспондина типа 1, 13), ELANE (эластаза, экспрессируемая нейтрофилами), ENPP2 (эктонуклеотидпирофосфатаза/фосфодиэстераза 2), CISH (индуцируемый цитокинами белок, содержащий SH2), GAST (гастрин), MYOC (миоциллин, обеспечивающий индуцируемую чувствительность трабекулярной сети к глюкокортикоидам), АТР1А2 (АТФаза, Na+/K+-транспортирующая, альфа 2 полипептид), NF1 (нейрофибромин 1), GJB1 (белок межклеточных щелевых контактов, бета 1, 32 кДа), MEF2A (энхансерный фактор миоцитов 2А), VCL (винкулин), BMPR2 (рецептор костного морфогенетического белка, тип II (серин/треонинкиназа)), TUBB (тубулин, бета), CDC42 (белок 42 цикла клеточного деления (GTP-связывающий белок, 25 кДа)), KRT18 (кератин 18), HSF1 (транскрипционный фактор 1 теплового шока), MYB (гомолог онкогена v-myb вируса миелобластоза (птичий)), PRKAA2 (протеинкиназа, АМР-активируемая, альфа 2 каталитическая субъединица), ROCK2 (Rho-ассоциированная, протеинкиназа 2, содержащая суперспираль), TFPI (ингибитор пути тканевого фактора (липопротеин-ассоциированный ингибитор коагуляции)), PRKG1 (протеинкиназа, cGMP-зависимая, тип I), ВМР2 (костный морфогенетический белок 2), CTNND1 (катенин (кадгерин-ассоциированный белок), дельта 1), СТН (цистатионаза (цистатион гамма-лиаза)), CTSS (катепсин S), VAV2 (фактор обмена гуаниновых нуклеотидов vav 2), NPY2R (рецептор Y2 нейропептида Y), IGFBP2 (белок 2, связывающий инсулиноподобный фактор роста, 36 кДа), CD28 (молекула CD28), GSTA1 (глутатион-S-трансфераза альфа 1), PPIA (пептидилпролилизомераза А (циклофилин А)), АРОН (аполипопротеин Н (бета-2-гликопротеин I)), S100A8 (S100 кальций-связывающий белок А8), IL11 (интерлейкин 11), ALOX15 (арахидонат-15-липоксигеназа), FBLN1 (фибулин 1), NR1H3 (ядерный рецептор, подсемейство 1, группа Н, представитель 3), SCD (стеароил-СоА-десатураза (дельта-9-десатураза)), GIP (желудочный ингибиторный полипептид), CHGB (хромогранин В (секретогранин 1)), PRKCB (протеинкиназа С, бета), SRD5A1 (стероид-5-альфа-редуктаза, альфа-полипетид 1 (3-оксо-5-альфа-стероид-дельта-4-дегидрогеназа альфа 1)), HSD11B2 (гидроксистероид (11-бета) дегидрогеназа 2), CALCRL (белок, подобный кальцитониновому рецептору), GALNT2 (UDP-N-ацетил-альфа-D-галактозамин : полипептид N-ацетилгалактозаминилтрансфераза 2 (GalNAc-T2)), ANGPTL4 (белок 4, подобный ангиопоэтину), KCNN4 (кальций-активируемый калиевый канал средней/малой проводимости, подсемейство N, представитель 4), PIK3C2A (фосфоинозитид-3-киназа, класс 2, альфа-полипетид), HBEGF (гепарин-связывающий EGF-подобный фактор роста), CYP7A1 (цитохром Р450, семейство 7, подсемейство А, полипептид 1), HLA-DRB5 (главный комплекс гистосовместимости, класс II, DR бета 5), BNIP3 (19 кДа белок 3 аденовируса Е1В, взаимодействующий с BCL2), GCKR (регулятор глюкокиназы (гексокиназы 4)), S100A12 (S100 кальций-связывающий белок А12), PADI4 (пептидиларгининдезиминаза, тип IV), HSPA14 (70 кДа белок 14 теплового шока), CXCR1 (рецептор 1 хемокина (мотив С-Х-С)), H19 (H19, подвергающийся импринтингу, экспрессируемый с материнской хромосомы транскрипт (не кодирующий белок)), KRTAP19-3 (кератин-ассоциированный белок 19-3), IDDM2 (инсулин-зависимый белок 2, связанный с сахарным диабетом), RAC2 (родственный ras субстрат 2 ботулотоксина С3 (семейство rho, малый GTP-связывающий белок Rac2)), RYR1 (рианодиновый рецептор 1 (скелетный)), CLOCK (гомолог clock (мышь)), NGFR (суперсемейство рецепторов фактора роста нервов (TNFR, представитель 16)), DBH (допамин-бета-гидроксилаза (допамин-бета-монооксигеназа)), CHRNA4 (холинергический рецептор, никотиновый, альфа 4), CACNA1C (кальциевый канал, потенциалзависимый, L-тип, субъединица альфа 1С), PRKAG2 (протеинкиназа, АМР-активируемая, некаталитическая субъединица гамма 2), CHAT (холинацетилтрансфераза), PTGDS (21 кДа простагландин-D2-синтаза (головной мозг)), NR1H2 (ядерный рецептор, подсемейство 1, группа Н, представитель 2), ТЕK (тирозинкиназа ТЕK, эндотелиальная), VEGFB (фактор роста эндотелия сосудов В), MEF2C (энхансерный фактор миоцитов 2С), МАРKАРK2 (митоген-активируемая протеинкиназа-активируемая протеинкиназа 2), TNFRSF11A (суперсемейство рецепторов фактора некроза опухоли, представитель 11а, активатор NFKB), HSPA9 (70 кДа белок 9 теплового шока (морталин)), CYSLTR1 (цистеиниллейкотриеновый рецептор 1), МАТ1А (метионинаденозилтрансфераза I, альфа), OPRL1 (белок 1, подобный опиатному рецептору), IMPA1 (инозитол(мио)-1(или 4)-монофосфатаза 1), CLCN2 (хлорный канал 2), DLD (дигидролипоамиддегидрогеназа), PSMA6 (субъединица протеасомы (просома, макропаин), тип альфа, 6), PSMB8 (субъединица протеасомы (просома, макропаин), тип бета, 8 (большая мультифункциональная пептидаза 7)), CHI3L1 (белок 1, подобный хитиназе 3 (хрящевой гликопротеин-39)), ALDH1B1 (семейство альдегиддегидрогеназы 1, представитель B1), PARP2 (полимераза 2 поли(АDР-рибозы)), STAR (стероидогенный острый регуляторный белок), LBP (липополисахарид-связывающий белок), АВСС6 (АТФ-связывающая кассета, подсемейство C(CFTR/MRP), представитель 6), RGS2 (регулятор 2 передачи сигнала G-белком, 24 кДа), EFNB2 (эфрин-В2), GJB6 (белок межклеточных щелевых контактов, бета 6, 30 кДа), АРОА2 (аполипопротеин А-II), AMPD1 (аденозинмонофосфатдезаминаза 1), DYSF (дисферлин, белок 2В, связанный с тазово-плечевой мышечной дистрофией (аутосомно-рецессивное наследование)), FDFT1 (фарнезилдифосфатфарнезилтрансфераза 1), EDN2 (эндотелии 2), CCR6 (рецептор 6 хемокина (мотив С-С)), GJB3 (белок межклеточных щелевых контактов, бета 3, 31 кДа), IL1RL1 (белок 1, подобный рецептору интерлейкина 1), ENTPD1 (эктонуклеозидтрифосфатдифосфогидролаза 1), BBS4 (белок 4, связанный с синдромом Барде-Бидля), CELSR2 (кадгерин, рецептор 2 G-типа с доменами EGF и LAG (гомолог flamingo, Drosophila)), F11R (рецептор F11), RAPGEF3 (фактор обмена гуаниновых нуклеотидов Rap (GEF) 3), HYAL1 (гиалуроноглюкозаминидаза 1), ZNF259 (белок 259, содержащий "цинковые пальцы"), АТОХ1 (гомолог антиоксидантного белка 1 АТХ1 (дрожжи)), ATF6 (активирующий транскрипционный фактор 6), KНK (кетогексокиназа (фруктокиназа)), SAT1 (спермидин/спермин-N1-ацилтрансфераза 1), GGH (гамма-глутамилгидролаза (конъюгаза, фолилполигаммаглутамилгидролаза)), TIMP4 (ингибитор 4 металлопептидазы TIMP), SLC4A4 (семейство 4 переносчиков растворенных веществ, котранспортер бикарбоната натрия, представитель 4), PDE2A (фосфодиэстераза 2А, cGMP-стимулируемая), PDE3B (фосфодиэстераза 3В, cGMP-ингибируемая), FADS1 (десатураза 1 жирных кислот), FADS2 (десатураза 2 жирных кислот), TMSB4X (тимозин бета 4, Х-сцепленный), TXNIP (белок, взаимодействующий с тиоредоксином), LIMS1 (домены 1, подобные антигенам LIM и сенесцентных клеток), RHOB (гомолог белка семейства генов ras, представитель В), LY96 (лимфоцитарный антиген 96), FOXO1 (белок forkhead box O1), PNPLA2 (белок 2, содержащий домен фосфолипазы, подобной пататину), TRH (тиреотропин-рилизинг гормон), GJC1 (белок межклеточных щелевых контактов, гамма 1, 45 кДа), SLC17A5 (семейство 17 переносчиков растворенных веществ (анионный/сахарный транспортер), представитель 5), FTO (белок, ассоциированный с жировой массой и ожирением), GJD2 (белок межклеточных щелевых контактов, дельта 2, 36 кДа), PSRC1 (белок 1 с суперспиралью, богатой пролином/серином), CASP12 (каспаза 12 (ген/псевдоген)), GPBAR1 (G белок-связанный рецептор 1 желчной кислоты), РХK (серин/треонинкиназа, содержащая домен РХ), IL33 (интерлейкин 33), TRIB1 (гомолог 1 белка tribbles (Drosophila)), РВХ4 (гомеобокс 4, связанный с лейкозом с вовлечением В-клеток-предшественников), NUPR1 (ядерный белок, регулятор транскрипции, 1), 15-Sep (15 кДа селенопротеин), CILP2 (хрящевой белок 2 промежуточного слоя), TERC (РНК-компонент теломеразы), GGT2 (гамма-глутамилтрансфераза 2), МТ-СO1 (кодируемая митохондриальным геномом цитохром с-оксидаза I) и UOX (уратоксидаза, псевдоген).

В дополнительном варианте осуществления хромосомная последовательность также может быть выбрана из следующих: Pon1 (параоксоназа 1), LDLR (рецептор LDL), АроЕ (аполипопротеин Е), Аро В-100 (аполипопротеин В-100), АроА (аполипопротеин(а)), ApoA1 (аполипопротеин A1), CBS (цистатион-В-синтаза), гликопротеин IIb/IIb, MTHRF (5,10-метилентетрагидрофолатредуктаза (NADPH) и их комбинаций. В одном случае хромосомные последовательности и белки, кодируемые хромосомными последовательностями, связанные с сердечно-сосудистым заболеванием, могут быть выбраны из Cacna1C, Sod1, Pten, Ppar(альфа), Аро Е, лептина и их комбинаций.

Почки

Настоящее изобретение также предусматривает доставку системы CRISPR-Cas в почку. Стратегии доставки для индукции поглощения клетками терапевтической нуклеиновой кислоты предусматривают использование физических сил или векторных систем, например, доставку с использованием вирусов, липидов, или комплексов, или наноносителей. Исходя из первоначальных применений, имеющих незначительную возможную клиническую значимость, в случае доставки нуклеиновых кислот в клетки почки при помощи гидродинамической системной инъекции с созданием высокого давления, широкий диапазон вирусных и невирусных носителей для генной терапии уже применяется для целенаправленного воздействия на посттранскрипционные события в различных животных моделях заболевания почек in vivo (Csaba Révész and Péter Hamar (2011). Delivery Methods to Target RNAs in the Kidney, Gene Therapy Applications, Prof. Chunsheng Kang (Ed.), ISBN: 978-953-307-541-9, InTech, доступно на: http://www.intechopen.com/books/gene-therapy-applications/delivery-methods-to-target-rnas-in-the-kidney). Способы доставки в почку обобщены ниже.

Yuan и соавт. (Am J Physiol Renal Physiol 295: F605-F617, 2008) исследовали, может ли доставка in vivo малых интерферирующих РНК (siRNA), целенаправленно воздействующих на 12/15-липоксигеназный (12/15-LO) путь метаболизма арахидоновой кислоты, приводить к уменьшению повреждения почек и диабетической нефропатии (DN) в модели диабета 1 типа на мышах, которым инъецировали стрептозотоцин. Для достижения большей доступности и экспрессии siRNA в почке in vivo Yuan и соавт. использовали двухнитевые олигонуклеотиды siRNA к 12/15-LO, конъюгированные с холестерином. Приблизительно 400 мкг siRNA вводили мышам путем подкожной инъекции. Способ согласно Yuang и соавт. можно применять по отношению к системе CRISPR-Cas согласно настоящему изобретению, что предусматривает подкожную инъекцию человеку 1-2 г CRISPR-Cas, конъюгированной с холестерином, для доставки в почки.

Molitoris и соавт. (J Am Soc Nephrol 20: 1754-1764, 2009) использовали клетки проксимальных канальцев (РТС) в качестве участка реабсорбции олигонуклеотидов в почке для тестирования эффективности siRNA, целенаправленно воздействующей на р53, ключевой белок в апоптическом пути, для предупреждения повреждения почки. "Оголенная" синтетическая siRNA к р53, которую вводили путем внутривенной инъекции через 4 ч после ишемического повреждения, обеспечивала максимальную защиту как РТС, так и функции почки. Данные Molitoris и соавт. указывают, что после внутривенного введения следует быстрая доставка siRNA в клетки проксимальных канальцев. Для анализа зависимости эффекта от дозы крысам инъецировали дозы siP53 0,33; 1, 3 или 5 мг/кг, которые предоставляли в одни и те же четыре момента времени, что давало в результате суммарные дозы 1,32; 4, 12 и 20 мг/кг, соответственно. Все протестированные дозы siRNA приводили к эффекту снижения SCr, в день один, причем более высокие дозы являлись эффективными в течение приблизительно пяти дней по сравнению с обработанными PBS контрольными крысами с ишемией. Суммарные дозы 12 и 20 мг/кг обеспечивали наилучший защитный эффект. Способ согласно Molitoris и соавт. можно применять по отношению к системе CRISPR-Cas согласно настоящему изобретению, что предусматривает введение человеку суммарных доз 12 и 20 мг/кг для доставки в почки.

Thompson и соавт. (Nucleic Acid Therapeutics, Volume 22, Number 4, 2012) сообщили о токсикологических и фармакокинетических свойствах синтетических малых интерферирующих РНК I5NP после внутривенного введения грызунам и приматам, отличным от человека. I5NP разработан так, чтобы действовать посредством пути РНК-интерференции (RNAi) для временного ингибирования экспрессии проапоптического белка р53 и создан для защиты клеток от повреждений, связанных с острой ишемией/реперфузией, как, например, острое повреждение почки, что может возникать при обширной операции на сердце, и отсроченная функция трансплантата, что может возникать после пересадки почки. Дозы 800 мг/кг I5NP для грызунов и 1000 мг/кг I5NP для приматов, отличных от человека, требовались для того, чтобы вызвать нежелательные эффекты, которые у обезьян сводились к непосредственному воздействию на кровь, которое включало бессимптомную активацию комплемента и несколько увеличенное время свертывания крови. У крыс не наблюдали дополнительных нежелательных эффектов при использовании аналога I5NP, предназначенного для крыс, что указывало на то, что эти эффекты, вероятно, представляют собой эффекты, связанные с классом синтетических РНК-дуплексов, а не токсичностью, обусловленной целевой фармакологической активностью I5NP. Взятые вместе, эти данные согласуются с клиническим исследованием внутривенного введения I5NP для сохранения функции почек после повреждения, связанного с острой ишемией/реперфузией. Уровень, при котором не наблюдали нежелательных эффектов (NOAEL) у обезьян, составлял 500 мг/кг. Не наблюдали эффектов в отношении параметров сердечно-сосудистой, дыхательной и нервной системы у обезьян после внутривенного введения при уровнях дозы до 25 мг/кг. Следовательно, аналогичная доза может предусматриваться для внутривенного введения CRISPR-Cas в почки человека.

Shimizu и соавт. (J Am Soc Nephrol 21: 622-633, 2010) разработали систему для целенаправленной доставки siRNA в клубочки при помощи средств на основе полиэтиленгликоля и поли-L-лизина. Диаметр комплекса siRNA/наноноситель составлял от приблизительно 10-20 нм, причем данный размер будет позволять ему проходить через окончатый эндотелий для того, чтобы попасть в мезангий. После интраперитонеальной инъекции флуоресцентно меченых комплексов siRNA/наноноситель, Shimizu и соавт. выявляли siRNA в кровотоке в течение длительного времени. Повторное интраперитонеальное введение комплекса siRNA к митоген-активируемой протеинкиназе 1 (МАРК1)/наноноситель подавляло экспрессию мРНК и белка МАРК1 в клубочках в мышиной модели гломерулонефрита. Для исследования накопления siRNA Су5-меченые siRNA в комплексе с PIC наноносителями (0,5 мл, содержание siRNA 5 нмоль), "оголенные" Су5-меченые siRNA (0,5 мл, 5 нмоль) или Су5-меченые siRNA, инкапсулированные в HVJ-E (0,5 мл, содержание siRNA 5 нмоль), вводили мышам BALB-с. Способ согласно Shimizu и соавт. можно применять по отношению к системе CRISPR-Cas согласно настоящему изобретению, что предусматривает дозу приблизительно 10-20 мкмоль CRISPR-Cas в комплексе с наноносителями на приблизительно 1-2 литра для интраперитонеального введения человеку и доставки в почки.

Легкие

Настоящее изобретение также предусматривает доставку системы CRISPR-Cas в одно легкое или оба легких.

Несмотря на то, что векторы на основе AAV-2 были изначально предложены для доставки CFTR в дыхательные пути при CF, другие серотипы, например, AAV-1, AAV-5, AAV-6 и AAV-9, демонстрировали улучшенную эффективность переноса генов в ряде моделей эпителия легких (см., например, Li et al., Molecular Therapy, vol. 17 no. 12, 2067-2077 Dec 2009). Как было продемонстрировано, AAV-1 являлся в ~100 раз более эффективным, чем AAV-2 и AAV-5 при трансдукции эпителиальных клеток дыхательных путей человека in vitro, хотя эффективность трансдукции при помощи AAV-1 эпителия воздухоносных путей трахеи мышей in vivo была равной таковой для AAV-5. Другие исследования продемонстрировали, что AAV-5 является в 50 раз более эффективным, чем AAV-2, при доставке генов в эпителий дыхательных путей человека (НАЕ) in vitro и значительно более эффективным в эпителии воздухоносных путей легких мышей in vivo. Также было продемонстрировано, что AAV-6 являлся более эффективным, чем AAV-2, в эпителиальных клетках дыхательных путей человека in vitro и дыхательных путях мышей in vivo. Как было показано, обнаруженный позже изолят, AAV-9, продемонстрировал большую эффективность переноса генов, чем AAV-5, в назальном и альвеолярном эпителии мышей in vivo, причем экспрессию гена выявляли в течение более 9 месяцев, что позволяет предположить, что AAV может обеспечивать длительную экспрессию генов in vivo, являющуюся необходимым свойством для вектора для доставки гена CFTR. Кроме того, было продемонстрировано, что AAV-9 можно повторно вводить в легкие мышей без потери экспрессии CFTR и с минимальными последствиями, связанными с иммунной системой. Культуры НАЕ с CF и без CF можно инокулировать на апикальной поверхности 100 мкл векторов AAV в течение нескольких часов (см., например, Li et al., Molecular Therapy, vol. 17 no. 12, 2067-2077 Dec 2009). MOI может варьировать от 1×103 до 4×105 векторных геномов/клетку, в зависимости от концентрации вируса и целей экспериментов. Упомянутые выше векторы предусматриваются для доставки и/или введения согласно настоящему изобретению.

Zamora и соавт. (Am J Respir Crit Care Med Vol 183. pp 531-538, 2011) представили пример применения терапевтического средства на основе РНК-интерференции для лечения инфекционных заболеваний человека, а также рандомизированного исследования противовирусного лекарственного средства у реципиентов трансплантата легкого, инфицированного респираторным синцитиальным вирусом (RSV). Zamora и соавт. провели рандомизированное, двойное слепое, плацебо-контролируемое исследование у реципиентов LTX с инфекцией дыхательных путей RSV. Пациентам давали возможность получать стандартное лечение RSV. ALN-RSV01 в форме аэрозоля (0,6 мг/кг) или плацебо вводили ежедневно в течение 3 дней. Это исследование продемонстрировало, что терапевтическое средство на основе RNAi, целенаправленно воздействующее на RSV, можно вводить без риска реципиентам LTX с инфекцией RSV. Три ежедневные дозы ALN-RSV01 не приводили в результате к какому-либо обострению симптомов в дыхательных путях или нарушению функции легких и не проявляли каких-либо системных провоспалительньгх эффектов, таких как индукция цитокинов или CRP. Фармакокинетические исследования продемонстрировали только низкий уровень временного системного воздействия после ингаляции, что согласуется с данными доклинических исследований на животных, демонстрирующих, что ALN-RSV01, вводимый внутривенно или путем ингаляции, подвергается быстрому клиренсу из кровотока при помощи опосредованного экзонуклеазами расщепления и почечной экскреции. Способ согласно Zamora и соавт. можно применять по отношению к системе CRISPR-Cas согласно настоящему изобретению и при этом CRISPR-Cas в форме аэрозоля, например, при дозе 0,6 мг/кг, может предусматриваться в соответствии с настоящим изобретением.

Что касается примера химерной направляющей РНК для CFTR с мутацией дельта-508, см. пример 22, в котором демонстрируется перенос генов или доставка генов системы CRISPR-Cas в дыхательные пути нуждающегося в этом субъекта или пациента, страдающего от муковисцидоза или от связанных с муковисцидозом (CF) симптомов, с использованием частиц аденоассоциированного вируса (AAV). В частности, на примере представлена стратегия репарации для мутации дельта-Р508 при муковисцидозе. Этот тип стратегии может применяться у всех организмов. В особенности, что касается CF, подходящие пациенты могут включать следующих: человек, не относящийся к человеку примат, собака, кошка, корова, лошадь и другие домашние животные. В этом случае заявители использовали систему CRISPR-Cas, содержащую фермент Cas9, для целенаправленного воздействия на дельта-F508 или другие мутации, индуцирующие CFTR.

Подвергающиеся лечению субъекты в данном случае получали фармацевтически эффективное количество векторной системы на основе AAV в форме аэрозоля на легкое, доставляемое эндобронхиально при самостоятельном дыхании. Таким образом, в общем, доставка в форме аэрозоля является предпочтительной для доставки с помощью AAV. Аденовирус или частицу AAV можно использовать для доставки. Подходящие конструкции с генами, каждый из которых функционально связан с одной или несколькими регуляторными последовательностями, можно клонировать в вектор доставки. В этом случае следующие конструкции представлены в качестве примеров: промотор Cbh или EF1a для Cas9, промотор U6 или H1 для химерной направляющей РНК. Предпочтительной схемой является применение химерной направляющей последовательности, нацеливающей на CFTR с мутацией дельта-508, матрицы для репарации мутации дельта-F508 и кодон-оптимизированного фермента Cas9 (предпочтительными Cas9 являются ферменты с нуклеазной или никазной активностью) необязательно с одним или несколькими сигналами или последовательностями ядерной локализации (NLS), например, с двумя (2) NLS. Также предусматриваются конструкции без NLS.

Для идентификации целевого сайта Cas9 заявители анализировали локус CFTR генома человека и идентифицировали целевой сайт Cas9. Предпочтительно, как правило и в данном случае CF, РАМ может содержать мотив NGG или NNAGAAW.

Соответственно, в случае CF способ по настоящему изобретению предусматривает манипуляцию с целевой последовательностью в представляющем интерес локусе генома, включающую

доставку не встречающейся в природе или сконструированной композиции, содержащей вирусную векторную систему, содержащую один или несколько вирусных векторов, функционально кодирующих композицию для ее экспрессии, где композиция содержит

не встречающуюся в природе или сконструированную композицию, содержащую векторную систему, содержащую один или несколько векторов, содержащих

I. первый регуляторный элемент, функционально связанный с полинуклеотидной последовательностью химерной РНК (chiRNA) системы CRISPR-CAS, где полинуклеотидная последовательность содержит

(a) направляющую последовательность, способную гибридизироваться с целевой последовательностью, связанной с CF, в подходящей клетке млекопитающего,

(b) парную tracr-последовательность и

(c) tracr-последовательность, и

II. второй регуляторный элемент, функционально связанный с кодирующей фермент последовательностью, кодирующей фермент CRISPR, содержащий по меньшей мере одну или несколько последовательностей ядерной локализации,

где (а), (b) и (с) расположены в 5'-3' ориентации,

где компоненты I и II находятся в одном и том же или в разных векторах системы,

где при транскрипции парная tracr-последовательность гибридизируется с tracr-последовательностью, а направляющая последовательность управляет специфичным к последовательности связыванием комплекса CRISPR с целевой последовательностью, и

где комплекс CRISPR содержит фермент CRISPR, образующий комплекс с (1) направляющей последовательностью, которая гибридизируется с целевой последовательностью, и (2) парной tracr-последовательностью, которая гибридизируется с tracr-последовательностью. Что касается CF, предпочтительные целевые последовательности ДНК содержат CFTR с мутацией дельта-508. Предпочтительный РАМ описан выше. Предпочтительным ферментом CRISPR является любой Cas (описанный в данном документе, но в особенности описанный в примере 22).

Альтернативы CF включают любое наследственное заболевание, и их примеры хорошо известны. Другим предпочтительным способом или применением согласно настоящему изобретению является коррекция дефектов в генах ЕМР2А и ЕМР2В, которые, как было идентифицировано, ассоциированы с болезнью Лафора.

В некоторых вариантах осуществления "направляющая последовательность" может отличаться от "направляющей РНК". Направляющей последовательностью может называться последовательность, составляющая приблизительно 20 п.о., в пределах направляющей РНК, которая определяет целевой сайт.

В некоторых вариантах осуществления Cas9 представляет собой (или происходит из) SpCas9. В этих вариантах осуществления предпочтительными мутациями являются мутации по любому или всем из положений 10, 762, 840, 854, 863 и/или 986 в SpCas9 или соответствующим положениям в других Cas9 (которые могут быть определены, например, при помощи стандартных инструментов сравнения последовательностей). В частности, любые или все из следующих мутаций являются предпочтительными для SpCas9: D10A, Е762А, Н840А, N854A, N863A и/или D986A; а также предусматривается консервативная замена для любого аминокислотного замещения. То же самое (или консервативные замены по этим мутациям) также является предпочтительным в соответствующих положениях других Cas9. Особенно предпочтительными являются D10 и Н840 в SpCas9. Однако в других Cas9 остатки, соответствующие D10 и Н840 SpCas9, также являются предпочтительными. Преимущественными являются те, которые обеспечивают никазную активность. Эти мутации можно применять согласно всем аспектам настоящего изобретения, не только для лечения CF.

Schwank и соавт. (Cell Stem Cell, 13:653-58, 2013) использовали CRISPR/Cas9 для коррекции дефекта, ассоциированного с муковисцидозом, в стволовых клетках человека. Целью исследователей являлся ген ионного канала, рецептора трансмембранной проводимости при муковисцидозе (CFTR). Делеция в CFTR приводит к неправильной укладке белка у пациентов с муковисцидозом. С использованием культивируемых стволовых клеток кишечника, полученных из образцов клеток от двух детей с муковисцидозом, Schwank и соавт. могли скорректировать дефект с использованием CRISPR вместе с донорной плазмидой, содержащей репаративную последовательность, подлежащую вставке. Исследователи затем вырастили клетки до "органоидов" кишечника или кишок небольшого размера и продемонстрировали, что они нормально функционировали. В этом случае приблизительно половина клональных органоидов подвергалась надлежащей коррекции наследственного материала.

Мышцы

Настоящее изобретение также предусматривает доставку системы CRISPR-Cas в мышцу (мышцы).

Bortolanza и соавт. (Molecular Therapy vol. 19 no. 11, 2055-2064 Nov. 2011) продемонстрировали, что системная доставка кассет экспрессии для РНК-интерференции у мышей FRG1 после начала проявления плече-лопаточно-лицевой мышечной дистрофии (FSHD) приводила к дозозависимому длительному нокдауну FRG1 без симптомов токсичности. Bortolanza и соавт. обнаружили, что однократная внутривенная инъекция 5×1012 vg (векторных геномов) rAAV6-sh1FRG1 восстанавливает гистопатологические характеристики мышц и функцию мышц у мышей FRG1. Более подробно, 200 мкл, содержащие 2×1012 или 5×1012 vg вектора в физиологическом растворе, инъецировали в хвостовую вену с использованием шприца Terumo с иглой 25-ого калибра. Способ согласно Bortolanza и соавт.можно применять в отношении AAV, экспрессирующего CRISPR-Cas, и инъецировать его человеку в дозе приблизительно 2×1015 или 2×1016 vg вектора.

Dumonceaux и соавт. (Molecular Therapy vol. 18 no. 5, 881-887 May 2010) осуществляли ингибирование пути миостатина с применением методики РНК-интерференции, направленной против мРНК рецептора миостатина AcvRIIb (sh-AcvRIIb). Восстановление квази-дистрофина было опосредовано методикой направленного U7 пропуска экзона (U7-DYS). Векторы на основе аденоассоциированных вирусов, несущих либо только конструкцию sh-AcvrIIb, только конструкцию U7-DYS, либо комбинацию обеих конструкций, инъецировали в переднюю большеберцовую (ТА) мышцу мышей mdx с дистрофией. Инъекции осуществляли с использованием 1011 геномов вируса AAV. Способ согласно Dumonceaux и соавт. можно применять в отношении AAV, экспрессирующего CRISPR-Cas, и вводить его человеку путем инъекции, например, при дозе от приблизительно 1014 до приблизительно 1015 vg вектора.

Kinouchi и соавт. (Gene Therapy (2008) 15, 1126-1130) сообщили об эффективности доставки siRNA in vivo в скелетные мышцы нормальных или больных мышей посредством образования наночастиц из химически не модифицированной siRNA с ателоколлагеном (ATCOL). ATCOL-опосредованное местное применение siRNA, целенаправленно воздействующей на миостатин, отрицательный регулятор роста скелетных мышц, при введении в скелетные мышцы мышей или внутривенно приводило к существенному увеличению мышечной массы в течение нескольких недель после применения. Эти результаты указывают на то, что ATCOL-опосредованное применение siRNA является мощным инструментом для дальнейшего терапевтического применения для лечения заболеваний, в том числе мышечной атрофии. Mst-siRNA (конечная концентрация, 10 мМ) смешивали с ATCOL (конечная концентрация для местного введения, 0,5%) (AteloGene, Kohken, Токио, Япония) в соответствии с инструкциями производителя. После анестезии мышей (самцы C57BL/6 в возрасте 20 недель) при помощи нембутала (25 мг/кг, интраперитонеально) комплекс Mst-siRNA/ATCOL инъецировали в жевательные мышцы и двуглавую мышцу бедра. Способ согласно Kinouchi и соавт. можно применять в отношении CRISPR-Cas и вводить ее человеку путем инъекции, например, в дозе от приблизительно 500 до 1000 мл 40 мкМ раствора в мышцу.

Hagstrom и соавт. (Molecular Therapy Vol. 10, No. 2, August 2004) описывали интраваскулярную методику без использования вируса, которая обеспечивает эффективную и воспроизводимую доставку нуклеиновых кислот в мышечные клетки (мышечные волокна) мышц конечности млекопитающих. Методика включает инъекцию "оголенной" плазмидной ДНК или siRNA в вену дистальной части конечности, временно изолированную при помощи жгута или пневматической манжеты. Доставка нуклеиновой кислоты в мышечные волокна обеспечивается ее быстрой инъекцией в объеме, достаточном для обеспечения просачивания раствора нуклеиновой кислоты в мышечную ткань. Высокие уровни экспрессии трансгена в скелетной мышце достигались как у мелких, так и у крупных животных при минимальной токсичности. Также были получены доказательства доставки siRNA в мышцу конечности. Для внутривенной инъекции плазмидной ДНК макаку-резусу трехходовый кран присоединяли к двухшприцевым насосам (Model PHD 2000; Harvard Instruments), в каждый из которых помещали один шприц. Через пять минут после инъекции папаверина инъецировали pDNA (15,5-25,7 мг в 40-100 мл солевого раствора) при скорости 1,7 или 2,0 мл/с. Это можно воспроизводить в увеличенном масштабе для плазмидной ДНК, экспрессирующей CRISPR-Cas согласно настоящему изобретению, с инъекцией человеку от приблизительно 300 до 500 мг в 800-2000 мл солевого раствора. В случае инъекции аденовирусного вектора крысе инъецировали 2×109 инфекционных частиц в 3 мл физиологического солевого раствора (NSS). Это можно воспроизводить в увеличенном масштабе для аденовирусного вектора, экспрессирующего CRISPR-Cas согласно настоящему изобретению, с инъекцией человеку приблизительно 1×1013 инфекционных частиц в 10 литрах NSS. В случае siRNA крысе инъецировали в большую подкожную вену 12,5 мкг siRNA, а примату инъецировали в большую подкожную вену 750 мкг siRNA. Это можно воспроизводить в увеличенном масштабе для CRISPR-Cas согласно настоящему изобретению, например, с инъекцией от приблизительно 15 до приблизительно 50 мг в большую подкожную вену человека.

Кожа

Настоящее изобретение также предусматривает доставку системы CRISPR-Cas в кожу.

Работа Hickerson и соавт. (Molecular Therapy-Nucleic Acids (2013) 2, e129) имеет отношение к снабженному приводом устройству с матрицей микроигл для доставки в кожу, предназначенному для самостоятельной (sd) доставки siRNA в кожу человека и мыши. Основной проблемой, связанной с переносом терапевтических средств на основе siRNA для кожи, в клиническую практику, является разработка эффективных систем доставки. Значительные усилия были приложены к созданию ряда методик доставки в кожу при ограниченном успехе. В клиническом исследовании, в котором кожу обрабатывали siRNA, острая боль, связанная с инъекцией при помощи иглы для подкожных инъекций, препятствовала включению дополнительных пациентов в исследование, что придает большое значение потребности в улучшенных, более "удобных для пациента" (т.е. причиняющих слабую боль или не причиняющих ее) средствах доставки. Микроиглы представляют эффективный способ доставки крупных заряженных молекул-карго, включающих siRNA, через первичный барьер, роговой слой, и, как правило, считаются причиняющими меньшую боль, чем обычные иглы для подкожных инъекций. Снабженные приводом устройства "штамповочного типа" с микроиглами, в том числе снабженное приводом устройство с матрицей микроигл (MMNA), используемое Hickerson и соавт., как было продемонстрировано, были безопасными в исследованиях на бесшерстных мышах и причиняли слабую боль или не причиняли боли, о чем свидетельствует (i) широкое применение в косметологии и (ii) ограниченное тестирование, в котором практически все добровольцы считали применение устройства причиняющим намного меньшую боль, чем при вакцинации против гриппа, что позволяет предположить, что доставка siRNA с применением этого устройства будет намного менее болезненной, чем испытываемая в предшествующих клинических исследованиях с применением игл для подкожных инъекций. Устройство MMNA (продаваемое как Triple-М или Tri-M от Bomtech Electronic Со, Сеул, Южная Корея) приспособили для доставки siRNA в кожу мыши и человека. Раствор sd-siRNA (до 300 мкл с 0,1 мг/мл РНК) вводили в камеру одноразового инъекционного картриджа с иглами Tri-M (Bomtech), которые устанавливали на глубину 0,1 мм. Для обработки кожи человека деидентифицированную кожу (полученную непосредственно после хирургических процедур) растягивали вручную и прикалывали к пробковому столу перед обработкой. Все интрадермальные инъекции осуществляли при помощи инсулинового шприца с иглой 28 калибра на 0,5 дюйма. Устройство MMNA и способ согласно Hickerson и соавт. можно применять и/или приспосабливать для доставки CRISPR-Cas согласно настоящему изобретению, например, в дозе до 300 мкл 0,1 мг/мл CRISPR-Cas, в кожу.

Работа Leachman и соавт. (Molecular Therapy, vol. 18 no. 2, 442-446 Feb. 2010) имеет отношение к клиническому исследованию фазы Ib, направленному на лечение редкого кожного заболевания врожденной пахионихии (PC), аутосомно-доминантного синдрома, которое предусматривает блокирование подошвенной кератодермии, с использованием первого терапевтического средства на основе короткой интерферирующей РНК (siRNA) для кожи. Эта siRNA, под названием TD101, специфично и эффективно целенаправленно воздействует на мРНК мутантного кератина 6а (K6а) N171К, не оказывая влияния на мРНК K6а дикого типа. Схема с повышением дозы представлена ниже:

Вначале 0,1 мл 1,0 мг/мл раствора TD101 или только среды (фосфатно-солевого буферного раствора Дульбекко без кальция или магния) вводили в симметрично расположенные мозоли. Осуществляли введение шести возрастающих объемов дозы без нежелательной реакции на увеличения: 0,1, 0,25, 0,5, 1,0, 1,5 и 2,0 мл 1,0 мг/мл раствора TD101 на инъекцию. Так как наиболее высокий запланированный объем (2,0 мл) был хорошо переносим, концентрацию TD101 затем увеличивали каждую неделю от 1 мг/мл до конечной концентрации 8,5 мг/мл. Аналогичные дозы предусматриваются для введения CRISPR-Cas, которая специфично и эффективно целенаправленно воздействует на мРНК мутантного кератина 6а (K6а) N171K.

Zhang и соавт. (PNAS, July 24, 2012, vol. 109, no. 30, 11975-11980) продемонстрировали, что конъюгаты сферических наночастиц с нуклеиновой кислотой (SNA-NC), причем ядра из золота, окружены плотной оболочкой из строго ориентированных, ковалентно иммобилизованных siRNA, свободно проникают практически в 100% кератиноцитов in vitro, в кожу мыши и в эпидермис человека в течение нескольких часов после применения. Zheng и соавт. продемонстрировали, что однократное применение 25 нМ SNA-NC к рецептору эпидермального фактора роста (EGFR) в течение 60 ч демонстрировало эффективный нокдаун гена в коже человека. Аналогичная доза может предусматриваться для CRISPR-Cas, иммобилизованной в SNA-NC для введения в кожу.

Вирусы гепатита

Настоящее изобретение также можно применять для лечения вируса гепатита В (HBV). Однако система CRISPR-Cas должна быть приспособлена для того, чтобы избежать недостатков RNAi, таких как риск перенасыщения эндогенных путей малых РНК, с помощью, например, оптимизации дозы и последовательности (см., например, Grimm et al., Nature vol. 441, 26 May 2006). Например, предусматриваются низкие дозы, такие как приблизительно 1-10×1014 частиц на человека.

В другом варианте осуществления систему CRISPR-Cas, направленную против HBV, можно вводить в липосомах, таких как стабильная частица из нуклеиновой кислоты и липидов (SNALP) (см., например, Morrissey et al., Nature Biotechnology, Vol. 23, No. 8, August 2005). Предусматриваются ежедневные внутривенные инъекции приблизительно 1, 3 или 5 мг/кг/день CRISPR-Cas, целенаправленно воздействующей на РНК HBV, в SNALP. Ежедневное лечение можно осуществлять в течение приблизительно трех дней и затем еженедельно в течение приблизительно пяти недель.

В другом варианте осуществления систему согласно Chen и соавт. (Gene Therapy (2007) 14, 11-19) можно применять в системе CRISPR-Cas согласно настоящему изобретению и/или приспосабливать к ней. Chen и соавт. использовали двухнитевой псевдотипированный вектор на основе аденоассоциированного вируса 8 (dsAAV2/8) для доставки shRNA. Однократное введение вектора dsAAV2/8 (1×1012 векторных геномов на мышь), несущего специфичную к HBV shRNA, эффективно подавляло стабильный уровень белка, мРНК и репликационной ДНК HBV в печени трансгенных мышей с HBV, что приводило к снижению нагрузки HBV в кровотоке на вплоть до 2-3 log10. Значительное подавление HBV продолжалось в течение по меньшей мере 120 дней после введения вектора. Терапевтический эффект shRNA зависел от целевой последовательности и не приводил к активации интерферона. В соответствии с настоящим изобретением систему CRISPR-Cas, направленную в отношении HBV, можно клонировать в вектор на основе AAV, например, вектор на основе dsAAV2/8, и вводить человеку, например, в дозе от приблизительно 1×1015 векторных геномов до приблизительно 1×1016 векторных геномов на человека.

В другом варианте осуществления способ согласно Wooddell и соавт. (Molecular Therapy vol. 21 no. 5, 973-985 May 2013) можно применять в системе CRISPR-Cas согласно настоящему изобретению и/или приспосабливать к ней. Woodell и соавт. продемонстрировали, что простая совместная инъекция целенаправленно воздействующего на гепатоциты, конъюгированного с N-ацетилгалактозамином мелиттин-подобного пептида (NAG-MLP) с тропной к печени конъюгированной с холестерином siRNA (chol-siRNA), целенаправленно воздействующей на фактор коагуляции VII (F7), приводит в результате к эффективному нокдауну F7 у мышей и приматов, отличных от человека, без изменений клинических химических показателей или индукции цитокинов. С использованием временных и трансгенных мышиных моделей инфекции HBV, Wooddell и соавт. продемонстрировали, что однократная совместная инъекция NAG-MLP с активной chol-siRNA, целенаправленно воздействующей на консервативные последовательности HBV, приводила в результате к многократной репрессии вирусной РНК, белков и вирусной ДНК с большой продолжительностью эффекта. Внутривенные совместные инъекции, например, приблизительно 6 мг/кг NAG-MLP и 6 мг/кг специфичной к HBV CRISPR-Cas могут предусматриваться в соответствии с настоящим изобретением. В альтернативном случае приблизительно 3 мг/кг NAG-MLP и 3 мг/кг специфичной к HBV CRISPR-Cas могут доставляться в первый день с последующим введением приблизительно 2-3 мг/кг NAG-MLP и 2-3 мг/кг специфичной к HBV CRISPR-Cas две недели спустя.

Настоящее изобретение также можно применять для лечения вируса гепатита С (HCV). Способы согласно Roelvinki и соавт. (Molecular Therapy vol. 20 no. 9, 1737-1749 Sep 2012) можно применять по отношению к системе CRISPR-Cas. Например, вектор на основе AAV, такого как AAV8, может быть предполагаемым вектором и может предусматриваться, например, доза от приблизительно 1,25×1011 до 1,25×1013 векторных геномов на килограмм массы тела (vg/кг).

В еще одном варианте осуществления редактирование генома, опосредованное CRISPR-Cas9, можно применять для коррекции мутации и/или фенотипа, связанных с заболеванием. Это редактирование генома, опосредованное CRISPR-Cas9, можно применять для коррекции мутации и/или фенотипа, связанных с заболеванием, в печени и/или гепатоцитах, что проиллюстрировано в рукописи Нао Yin и соавт. под названием "Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype", опубликованной в Nature Biotechnology, опубликованной в режиме онлайн 30 марта 2014 г.; исправленной в режиме онлайн 31 марта 2014 г., доступной на веб-сайте nature.com/doifinder/10.1038/nbt.2884, включенной в данный документ с помощью ссылки во всей своей полноте. Данная статья относится к опосредованной CRISPR-Cas9 коррекции мутации Fah в гепатоцитах в мышиной модели заболевания человека, врожденной тирозинемии. Было показано, что доставка компонентов системы CRISPR-Cas9 с помощью гидродинамической инъекции приводила к исходному уровню экспрессии белка Fah дикого типа в ~1/250 клеток печени. Было дополнительно показано, что размножение Fah-положительных гепатоцитов избавляло от фенотипа потери массы тела.

Будет очевидно, что организм-хозяин с другими заболеваниями можно лечить подобным образом. Некоторые примеры наследственных заболеваний, вызванных мутациями, приведены в данном документе, но известно их намного больше. Изложенную выше стратегию можно применять для лечения этих заболеваний.

Болезнь Гентингтона (HD)

РНК-интерференция (RNAi) предоставляет терапевтические возможности для лечения этого нарушения посредством уменьшения экспрессии НТТ, гена, приводящего к развитию болезни Гентингтона (см., например, McBride et al., Molecular Therapy vol. 19 no. 12 Dec. 2011, pp. 2152-2162), следовательно, заявитель предполагает, что ее можно использовать с системой CRISPR-Cas и/или приспособить к ней. Систему CRISPR-Cas можно получить с использованием алгоритма для уменьшения возможности нецелевого воздействия антисмысловых последовательностей. Последовательности CRISPR-Cas могут целенаправленно воздействовать на последовательность в экзоне 52 гентингтина мыши, макака-резуса или человека и экспрессироваться вирусным вектором, например, на основе AAV. Животным, в том числе человеку, можно вводить приблизительно три микроинъекции на полушарие (всего шесть инъекций): первую на 1 мм ростральнее передней комиссуры (12 мкл) и две оставшиеся инъекции (12 мкл и 10 мкл, соответственно) на расстоянии 3 и 6 мм каудальнее по отношению к первой инъекции, с 1e12 vg/мл AAV при скорости приблизительно 1 мкл/минуту, при этом иглу оставляли на месте в течение дополнительных 5 минут для обеспечения диффузии вводимого вещества с наконечника иглы.

DiFiglia и соавт. (PNAS, October 23, 2007, vol. 104, no. 43, 17204-17209) наблюдали, что однократное введение в полосатое тело взрослого организма siRNA, целенаправленно воздействующей на Htt, может привести к сайленсингу Htt, ослаблению нейрональной патологии и задержке развития аномального поведенческого фенотипа, наблюдаемого в модели HD на трансгенных мышах, полученной с использованием вируса, с быстрым началом проявления. DiFiglia инъецировал мышам в полосатое тело 2 мкл Су3-меченых cc-siRNA-Htt или неконъюгированных siRNA-Htt при 10 мкМ. Аналогичная доза CRISPR-Cas, целенаправленно воздействующей на Htt, может предусматриваться в настоящем изобретении для человека, например, приблизительно 5-10 мл 10 мкМ CRISPR-Cas, целенаправленно воздействующей на Htt, можно инъецировать в полосатое тело.

В другом примере Boudreau и соавт. (Molecular Therapy vol. 17 no. 6 June 2009) инъецировали 5 мкл рекомбинантных векторов на основе вируса AAV серотипа 2/1, экспрессирующих htt-специфичный вирус для RNAi (при 4×1012 вирусных геномов/мл) в полосатое тело. Аналогичная доза CRISPR-Cas, целенаправленно воздействующей на Htt, может предусматриваться в настоящем изобретении для человека, например, от приблизительно 10 до 20 мл 4×1012 вирусных геномов/мл), причем CRISPR-Cas, целенаправленно воздействующую на Htt, можно инъецировать в полосатое тело.

В другом примере CRISPR-Cas, целенаправленно воздействующую на НТТ, можно вводить непрерывно (см., например, Yu et al., Cell 150, 895-908, August 31, 2012). Yu и соавт. использовали доставку при помощи осмотических насосов, обеспечивающих скорость 0,25 мл/ч (модель 2004), для доставки 300 мг/день ss-siRNA или фосфатно-солевого буферного раствора (PBS) (Sigma Aldrich) в течение 28 дней, и насосы, выполненные с возможностью доставки 0,5 мкл/ч (модель 2002), использовали для доставки 75 мг/день МОЕ ASO положительного контроля в течение 14 дней. Насосы (Durect Corporation) заполняли ss-siRNA или МОЕ, разведенным стерильным PBS, а затем инкубировали при 37°С в течение 24 или 48 (Model 2004) часов перед имплантацией. Мышей анестезировали 2,5% изофлураном и делали срединный разрез у основания черепа. Используя стереотаксические зонды, имплантировали канюлю в боковой правый желудочек и закрепляли при помощи клея Loctite. Катетер, прикрепленный к осмотическому мининасосу Alzet, прикрепляли к канюле, и насос размещали подкожно между лопатками. Разрез закрывали швами, используя нейлон 5,0. Аналогичная доза CRISPR-Cas, целенаправленно воздействующей на Htt, может предусматриваться в настоящем изобретении для человека, например, можно вводить от приблизительно 500 до 1000 г/день CRISPR Cas, целенаправленно воздействующей на Htt.

В другом примере непрерывной инфузии Stiles и соавт. (Experimental Neurology 233 (2012) 463-471) имплантировали интрапаренхиматозный катетер с титановым наконечником иглы в правую скорлупу. Катетер присоединяли к насосу SynchroMed® II (Medtronic Neurological, Миннеаполис, Миннесота), подкожно имплантированному в области живота. После 7 дней инфузии фосфатно-солевого буферного раствора при 6 мкл/день насосы повторно заполняли исследуемым препаратом и программировали на непрерывную доставку в течение 7 дней. От приблизительно 2,3 до 11,52 мг/день siRNA вводили путем инфузии при различных значениях скорости инфузии, составляющих приблизительно 0,1-0,5 мкл/мин. Аналогичная доза CRISPR-Cas, целенаправленно воздействующей на Htt, может предусматриваться в настоящем изобретении для человека, например, можно вводить от приблизительно 20 до 200 мг/день CRISPR-Cas, целенаправленно воздействующей на Htt.

В другом примере способы согласно публикации патентного документа США №20130253040, закрепленного за Sangamo, также можно адаптировать, исходя из TALES к системе CRISPR-Cas согласно настоящему изобретению для лечения болезни Гентингтона.

Нуклеиновые кислоты, аминокислоты и белки

В настоящем изобретении нуклеиновые кислоты используются для связывания целевых последовательностей ДНК. Это является преимущественным, поскольку получать нуклеиновые кислоты намного легче и дешевле, чем белки, и их специфичность можно варьировать в зависимости от длины фрагмента, если необходима гомология. Например, не требуется сложное 3D-определение положений многочисленных доменов.

Выражения "полинуклеотид", "нуклеотид", "нуклеотидная последовательность", "нуклеиновая кислота" и "олигонуклеотид" используют взаимозаменяемо. Они обозначают полимерную форму нуклеотидов любой длины, как дезоксирибонуклеотидов, так и рибонуклеотидов или их аналогов. Полинуклеотиды могут обладать любой пространственной структурой и могут выполнять любую функцию, известную или неизвестную. Неограничивающими примерами полинуклеотидов являются следующие: кодирующие или некодирующе участки гена или фрагмента гена, локусы (локус), определенные в результате анализа сцепления, экзоны, интроны, матричная РНК (мРНК), транспортная РНК, рибосомная РНК, короткая интерферирующая РНК (siRNA), короткая шпилечная РНК (shRNA), микроРНК (miRNA), рибозимы, кДНК, рекомбинантные полинуклеотиды, разветвленные полинуклеотиды, плазмиды, векторы, выделенные ДНК любой последовательности, выделенные РНК любой последовательности, нуклеиновые кислоты-зонды и праймеры. Выражение также охватывает структуры, подобные нуклеиновым кислотам, с синтетическими каркасами из WO 97/03211 и WO 96/39154. Полинуклеотид может содержать один или несколько модифицированных нуклеотидов, как, например, метилированные нуклеотиды и аналоги нуклеотидов. При наличии, модификации в нуклеотидную структуру могут быть внесены до или после сборки полимера. Последовательность нуклеотидов может прерываться отличными от нуклеотидов компонентами. Полинуклеотид можно дополнительно модифицировать после полимеризации, как, например, путем конъюгации с компонентом для мечения.

Используемое в данном документе выражение "дикий тип" является выражением из данной области, понятным специалисту в данной области, и означает типичную форму организма, штамма, гена или характеристики, которые встречаются в природе в отличие от мутантных или вариантных форм.

Используемое в данном документе выражение "вариант" следует понимать как означающее проявление качеств, которые характеризуются паттерном, который отличается от такового, встречающегося в природе.

Выражение "не встречающийся в природе" или "сконструированный" используют взаимозаменяемо, и оно указывает на вмешательство человека. Выражения, в тех случаях, когда они касаются молекул нуклеиновых кислот или полипептидов, означают, что молекула нуклеиновой кислоты или полипептид по меньшей мере практически не содержат по меньшей мере один отличный компонент, с которым они естественным образом связаны в природе и встречаются в природе.

"Комплементарность" означает способность нуклеиновой кислоты образовывать водородную(водородные) связь(связи) с другой последовательностью нуклеиновой кислоты при помощи либо традиционного спаривания оснований по Уотсону-Крику, либо других нетрадиционных типов. Процентное значение комплементарности показывает процентное значение остатков в молекуле нуклеиновой кислоты, которые могут образовывать водородные связи (к примеру, спаривание оснований по Уотсону-Крику) со второй последовательностью нуклеиновой кислоты (к примеру, при этом 5, 6, 7, 8, 9, 10 из 10 будут на 50%, 60%, 70%, 80%, 90% и 100% комплементарны). "Точная комплементарность" означает, что все непрерывные остатки последовательности нуклеиновой кислоты будут связаны водородными связями с таким же количеством непрерывных остатков во второй последовательности нуклеиновой кислоты. Используемое в данном документе выражение "практически комплементарный" означает степень комплементарности, которая составляет по меньшей мере 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% или 100% в пределах участка из 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 или более нуклеотидов, или относится к двум нуклеиновым кислотам, которые гибридизируются при жестких условиях.

Используемые в данном документе "жесткие условия" в отношении гибридизации означают условия, при которых нуклеиновая кислота с комплементарностью к целевой последовательности преимущественно гибридизируется с целевой последовательностью и практически не гибридизируется с нецелевыми последовательностями. Жесткие условия,

как правило, являются зависимыми от последовательности и изменяются в зависимости от ряда факторов. В общем, чем длиннее последовательность, тем выше температура, при которой последовательность специфично гибридизируется со своей целевой последовательностью. Неограничивающие примеры жестких условий описаны подробно в Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y. Если предполагается полинуклеотидная последовательность, то т акже предусматриваются комплементарные или частично комплементарные последовательности. Они предпочтительно способны гибридизироваться с эталонной последовательностью при очень жестких условиях. Как правило, для доведения до максимума скорости гибридизации, выбирают условия гибридизации относительно низкой жесткости: температура на приблизительно 20-25°С ниже температуры точки плавления (Тm). Тm представляет собой температуру, при которой 50% специфичной целевой последовательности гибридизируется с точно комплементарным зондом в растворе при определенной ионной силе и рН. Как правило, если требуется по меньшей мере приблизительно 85% нуклеотидная комплементарность гибридизированных последовательностей, выбирают очень жесткие условия отмывки с температурой на приблизительно 5-15°С ниже, чем Тm. Если требуется по меньшей мере приблизительно 70% нуклеотидная комплементарность гибридизированных последовательностей, выбирают умеренно жесткие условия отмывки с температурой на приблизительно 15-30°С ниже, чем Тm. Высоко пермиссивные (очень низкой жесткости) условия отмывки могут характеризоваться температурой, которая вплоть до 50°С ниже Тm, что допускает высокий уровень ошибочных совпадений между гибридизированными последовательностями. Специалисты в данной области поймут, что другие физические и химические параметры на стадиях гибридизации и отмывки также можно изменять для того, чтобы повлиять на получаемый в результате выявляемый сигнал гибридизации, исходя из конкретного уровня гомологии между целевой последовательностью и последовательностью зонда. Предпочтительные условия высокой жесткости предусматривают инкубирование в 50% формамиде, 5×SSC и 1% SDS при 42°С или инкубирование в 5×SSC и 1% SDS при 65°С с отмывкой в 0,2×SSC и 0,1% SDS при 65°С.

"Гибридизация" означает реакцию, при которой один или несколько полинуклеотидов реагируют с образованием комплекса, который стабилизируется посредством образования водородных связей между основаниями нуклеотидных остатков. Образование водородных связей может происходить по принципу спаривания оснований по Уотсону-Крику, Хугстиновского связывания или любым другим специфичным к последовательности образом. Комплекс может содержать две нити, образующие дуплексную структуру, три или более нитей, образующих многонитевой комплекс, одиночную самогибридизирующуюся нить или любую их комбинацию. Реакция гибридизации может представлять собой стадию в более обширном способе, таком как начальная стадия ПЦР или расщепление полинуклеотида при помощи фермента. Последовательность, способную гибридизироваться с данной последовательностью, называют "комплементарной последовательностью" для данной последовательности.

Используемое в данном документе выражение "локус генома" или "локус" (форма множественного числа локусы) представляет собой конкретное положение гена или последовательности ДНК на хромосоме. "Ген" относится к фрагментам ДНК или РНК, которые кодируют цепь полипептида или РНК, которые играют функциональную роль в организме, и, следовательно, он представляет собой молекулярную единицу наследственности в живых организмах. Для цели настоящего изобретения может считаться, что гены содержат участки, которые регулируют образование продукта гена, независимо от того, являются ли регуляторные последовательности смежными с кодирующими и/или транскрибируемыми последовательностями или нет. Соответственно, ген содержит, но без обязательного ограничения, промоторные последовательности, терминаторы, последовательности регуляции трансляции, например, участки связывания рибосомы и участки внутренней посадки рибосомы, энхансеры, сайленсеры, инсуляторы, граничные элементы, точки начала репликации, участки прикрепления к матриксу и регуляторные участки локуса.

Используемое в данном документе выражение "экспрессия локуса генома" или "экспрессия гена" относится к процессу, в ходе которого информация гена используется в синтезе функционального продукта гена. Продукты экспрессии генов часто представляют собой белки, но у генов, не кодирующих белки, например, генов рРНК или генов тРНК, продукт представляет собой функциональную РНК. Процесс экспрессии генов используется всеми известными живыми организмами - эукариотами (в том числе многоклеточными организмами), прокариотами (бактериями и археями) и вирусами - для образования функциональных продуктов, необходимых для выживания. Используемое в данном документе выражение "экспрессия" гена или нуклеиновой кислоты охватывает не только экспрессию генов в клетках, но также транскрипцию и трансляцию нуклеиновой(нуклеиновых) кислоты(кислот) в системах клонирования и в любом другом контексте. Используемое в данном документе