Микроорганизм рода corynebacterium, продуцирующий l-аргинин, и способ получения l-аргинина с использованием этого микроорганизма

Группа изобретений относится к микроорганизму рода Corynebacterium, продуцирующему L-аргинин, и к способу получения L-аргинина с использованием этого микроорганизма. В предложенном микроорганизме рода Corynebacterium, продуцирующем L-аргинин, инактивирован белок, содержащий аминокислотную последовательность SEQ ID NO.: 1. Предложен также способ получения L-аргинина, включающий культивирование вышеуказанного микроорганизма. Группа изобретений обеспечивает продукцию L-аргинина с высокой эффективностью. 2 н. и 3 з.п. ф-лы, 5 табл., 8 пр.

 

Область изобретения

Настоящее изобретение относится к микроорганизму рода Corynebacterium, продуцирующему L-аргинин, и к способу получения L-аргинина с использованием этого микроорганизма.

Предшествующий уровень техники

L-Аргинин в свободной форме содержится в семенах растений или чесноке и, в дополнение к использованию в обогащенных аминокислотами пищевых добавках, широко используется в лекарственных средствах, пищевых продуктах и тому подобном. Примеры медицинских применений L-аргинина включают усилители функции печени, усилители функции головного мозга, терапевтические средства для лечения бесплодия у мужчин и обычные композиции аминокислот. Репрезентативными примерами пищевых продуктов, в которых используют L-аргинин, являются добавки в рыбную пасту, добавки в диетические напитки и заменители соли для пациентов с гипертензией. Таким образом, L-аргинин представляет собой вещество, которое в последнее время привлекает большое внимание.

Микроорганизмы рода Corynebacterium, в частности Corynebacterium glutamicum, представляют собой грамположительные микроорганизмы, широко используемые в получении L-аминокислот. Для получения L-аргинина главным образом используют специфические в отношении целевого вещества подходы, такие как метод усиления экспрессии гена, кодирующего фермент, главным образом вовлеченный в синтез L-аргинина у штамма Corynebacterium, либо метод делетирования гена, не являющегося необходимым для биосинтеза L-аргинина, (патент Кореи № 10-1102263). Однако по-прежнему имеет место растущая потребность в разработке способов, с помощью которых можно эффективно получать L-аргинин с высоким выходом.

В таких обстоятельствах авторы настоящего изобретения предприняли интенсивные попытки создать микроорганизм, способный продуцировать L-аргинин с высокой эффективностью, и в результате они создали настоящее изобретение, подтвердив, что выход продуцирования L-аргинина увеличивается у микроорганизма рода Corynebacterium, в котором делетирован ген, кодирующий белок, функция которого неизвестна.

Техническая задача

Задача настоящего изобретения заключается в том, чтобы предложить микроорганизм рода Corynebacterium, продуцирующий L-аргинин, в котором инактивирован белок, включающий аминокислотную последовательность SEQ ID NO:

1. Задача настоящего изобретение также заключается в том, чтобы предложить способ получения L-аргинина с использованием этого микроорганизма.

Техническое решение

Далее настоящее изобретение будет описано подробно. При этом, каждое из раскрытых в данном описании разъяснений и иллюстративных воплощений может быть применено к другим разъяснениям и иллюстративным воплощениям. То есть, все комбинации раскрытых в данном описании различных факторов относятся к объему настоящего изобретения. Кроме того, объем настоящего изобретения не следует ограничивать конкретным раскрытием изобретения, предложенным далее.

Для решения вышеуказанной задачи в одном аспекте настоящего изобретения предложен микроорганизм рода Corynebacterium, продуцирующий L-аргинин, в котором инактивирован белок, включающий аминокислотную последовательность SEQ ID NO: 1.

Как его используют в данном описании, термин «L-аргинин» относится к L-аминокислоте, которая имеет химическую формулу C6H14N4O2 и представляет собой условно незаменимую аминокислоту, присутствующую во всех организмах. Известно, что L-аргинин продуцируется главным образом микроорганизмами рода Corynebacterium, но известно, что они подвержены ингибированию по типу обратной связи внутриклеточным аргинином (Vehary Sakanyan, et al., Microbiology, 142:9-108, 1996). Таким образом, известно, что эти микроорганизмы имеют ограничение в отношении продуцирования L-аргинина с высоким выходом. Авторы настоящего изобретения неожиданно обнаружили, что продуцирование L-аргинина повышалось, когда белок, включающий аминокислотную последовательность SEQ ID NO: 1, функция которого неизвестна, инактивировали, тем самым получив новый микроорганизм для продуцирования L-аргинина.

Как его используют в данном описании, термин «белок, включающий аминокислотную последовательность SEQ ID NO: 1», относится к белку, который естественным образом присутствует у микроорганизма рода Corynebacterium, или гипотетическому белку, функция которого неизвестна. Например, белок, включающий аминокислотную последовательность SEQ ID NO: 1, может представлять собой, без ограничения им, белок, (по существу) состоящий из аминокислотной последовательности SEQ ID NO: 1.

Кроме того, выражение «белок, состоящий из конкретной SEQ ID NO», как оно раскрыто в настоящем описании, не исключает мутацию в таком белке, которая может являться результатом вставки несмысловой последовательности в прямом или обратном направлении относительно аминокислотной последовательности соответствующей SEQ ID NO, или природную мутацию в нём, или молчащую мутацию в нём, до тех пор, пока белок, имеющий такую мутацию, обладает такой же активностью, что и белок, который состоит из аминокислотной последовательности соответствующей SEQ ID NO, или соответствующей ей активностью. Даже когда присутствует вставка последовательности или мутация, такой белок безусловно входит в объем настоящего изобретения.

В одном иллюстративном воплощении белок, включающий аминокислотную последовательность SEQ ID NO: 1, может включать аминокислотную последовательность, имеющую гомологию с SEQ ID NO: 1 по меньшей мере 80%. Белок, включающий аминокислотную последовательность, имеющую гомологию с SEQ ID NO: 1 по меньшей мере 80%, может включать белок, включающий аминокислотную последовательность, имеющую гомологию с аминокислотной последовательностью SEQ ID NO: 1 по меньшей мере 80%, более точно по меньшей мере 83%, по меньшей мере 84%, по меньшей мере 88%, по меньшей мере 90%, по меньшей мере 93%, по меньшей мере 95% или по меньшей мере 97%. Очевидно, что белок, имеющий аминокислотную последовательность, в которой последовательность частично делетирована, модифицирована, заменена или имеет вставку, входит в объем настоящего изобретения до тех пор, пока последовательность, имеющая гомологию с такой последовательностью, проявляет биологическую активность, практически эквивалентную или соответствующую активности аминокислотной последовательности SEQ ID NO: 1.

Кроме того, белок, включающий аминокислотную последовательность SEQ ID NO: 1, может кодироваться геном, включающим полинуклеотидную последовательность SEQ ID NO: 2. Кроме того, белок может кодироваться геном, состоящим или по существу состоящим из полинуклеотидной последовательности SEQ ID NO: 2, но без ограничения ими.

Кроме того, белок по настоящему изобретению может кодироваться не только геном, включающим полинуклеотидную последовательность SEQ ID NO: 2, но также геном, включающим полинуклеотид, имеющий гомологию с SEQ ID NO: 2 по меньшей мере 80%.

Более конкретно, полинуклеотидная последовательность, способная кодировать белок, включающий аминокислотную последовательность, имеющую гомологию с SEQ ID NO: 1 выше по меньшей мере 80%, может быть включена в объем настоящего изобретения, но белок может кодироваться геном, включающим полинуклеотидную последовательность, имеющую гомологию с приведенной выше полинуклеотидной последовательностью SEQ ID NO: 2 по меньшей мере 80%, более точно по меньшей мере 83%, по меньшей мере 84%, по меньшей мере 88%, по меньшей мере 90%, по меньшей мере 93%, по меньшей мере 95% или по меньшей мере 97%. Кроме того, с учетом вырожденности генетического кода, варианты последовательностей, кодирующих такую же аминокислотную последовательность, также могут быть включены в объем настоящего изобретения.

Как его используют в данном описании, термин «гомология» относится к идентичности с данной аминокислотной последовательностью или нуклеотидной последовательностью, и гомология может быть выражена в процентах. В настоящем изобретении гомология последовательности, имеющей активность, идентичную или аналогичную активности данной аминокислотной последовательности или полинуклеотидной последовательности, выражается в виде «% гомологии».

Гомология с аминокислотной последовательностью или нуклеотидной последовательностью может быть определена, например, с использованием алгоритма BLAST (смотри Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)) или FASTA (смотри Pearson, Methods Enzymol., 183, 63, 1990)). На основе алгоритма BLAST была разработана программа, названная BLASTN или BLASTX (смотри http://www.ncbi.nlm.nih.gov).

Как его используют в данном описании, термин «инактивация» означает, что белок совсем не экспрессируется, либо белок экспрессируется, но показывает отсутствие активности или снижение активности по сравнению с активностью родительского штамма, нативного штамма или штамма до модификации. Снижение относится к понятию, включающему случай, когда активность белка снижена по сравнению с активностью белка, первоначально наличествующей у микроорганизма, вследствие модификации, делеции и так далее, гена, кодирующего белок; случай, когда уровень общей активности белка в клетках ниже такового у нативного штамма или штамма до модификации благодаря ингибированию экспрессии или ингибированию трансляции гена, кодирующего этот белок; или их комбинацию.

В настоящем изобретении впервые было установлено, что инактивация этого белка связана с продуктивностью по L-аргинину.

В настоящем изобретении инактивация может быть осуществлена различными методами, хорошо известными в данной области техники. Примеры таких методов могут включать 1) метод делетирования всего гена или части гена, кодирующего белок; 2) метод модификации последовательности регуляции экспрессии таким образом, чтобы экспрессия гена, кодирующего белок, была понижена; 3) метод модификации последовательности гена, кодирующего белок, таким образом, чтобы активность белка была устранена или ослаблена; 4) метод введения антисмыслового олигонуклеотида (например антисмысловой РНК), который комплементарно связывается с транскриптом гена, кодирующего белок; 5) метод, делающий невозможным присоединение рибосомы посредством образования вторичной структуры путем добавления последовательности Шайна-Дальгарно и комплементарной ей последовательности на переднем конце последовательности Шайна-Дальгарно гена, кодирующего белок; 6) метод инженерии с обратной транскрипцией (RTE), который добавляет промотор, подлежащий обратной транскрипции, на 3'-конце открытой рамки считывания (ORF) полинуклеотидной последовательности гена, кодирующего белок, и так далее, и могут также включать их комбинацию, но не ограничиваясь конкретно этим.

Более конкретно, способ модифицирования последовательности регуляции экспрессии может быть осуществлен путем использования ряда методов, хорошо известных в данной области техники. Например, способ может быть осуществлен путем индуцирования модификации последовательности регуляции экспрессии в полинуклеотидной последовательности посредством делеции, вставки, неконсервативной или консервативной замены или их комбинации для дополнительного ослабления активности последовательности регуляции экспрессии, или путем замены последовательности регуляции экспрессии полинуклеотидной последовательностью, имеющей более слабую активность. Последовательность регуляции экспрессии может включать промотор, операторную последовательность, последовательность, кодирующую участок связывания рибосомы, и последовательности, регулирующие терминацию транскрипции и трансляции, но не ограничиваясь этим.

Кроме того, способ модифицирования нуклеотидной последовательности может быть осуществлен путем индуцирования модификации в данной последовательности посредством делеции, вставки, неконсервативной или консервативной замены, или их комбинации, в нуклеотидной последовательности для дополнительного ослабления активности фермента; или путем замены данной нуклеотидной последовательности нуклеотидной последовательностью, которую усовершенствовали для получения более слабой активности, или нуклеотидной последовательностью, которую усовершенствовали для получения отсутствия активности, но не ограничиваясь этим.

Кроме того, способ делетирования всего гена, кодирующего белок, или его части может быть осуществлен путем замены полинуклеотида, кодирующего эндогенный белок-мишень, в хромосоме на полинуклеотид или маркерный ген, где часть нуклеотидной последовательности делетирована, посредством вектора для хромосомальной вставки в микроорганизме. В иллюстративном воплощении способа делетирования части или всего полинуклеотида можно использовать метод делетирования полинуклеотида посредством гомологичной рекомбинации, но не ограничиваясь этим.

Кроме того, способ делетирования части или целого гена может быть осуществлен путем индуцирования мутации, используя свет, какой как УФ (ультрафиолет), или химические вещества, и путем отбора штамма, имеющего делетированный целевой ген, из полученных мутантов. Способ делетирования гена может включать метод использования технологии обратной транскрипции. Например, нуклеотидную последовательность или вектор, включающие нуклеотидную последовательность, имеющую гомологию с целевым геном, вводят в микроорганизм, чтобы вызвать гомологичную рекомбинацию. Кроме того, подлежащие введению нуклеотидная последовательность или вектор могут включать доминантный селективный маркер.

Как его используют в данном описании, термин «микроорганизм, продуцирующий L-аргинин» или «микроорганизм, обладающий продуктивностью по L-аргинину» относится к микроорганизму, естественным образом обладающему способностью продуцировать L-аргинин, или к микроорганизму, который получен путем придания способности продуцировать L-аргинин родительскому штамму, не обладающему способностью продуцировать L-аргинин. Например, способность продуцировать L-аргинин может быть обеспечена путем инактивирования активности белка, включающего аминокислотную последовательность SEQ ID NO: 1, и/или путем усиления экспрессии гена, кодирующего ферменты биосинтеза L-аргинина.

В настоящем изобретении примеры ферментов биосинтеза L-аргинина включают N-ацетилглутамил-фосфатредуктазу (ArgC), орнитинацетилтрансферазу (ArgJ), N-ацетилглутаматкиназу (ArgB), ацетилорнитинтрансаминазу (ArgD), орнитинкарбамоилтрансферазу (ArgF), синтетазу аргинин-янтарной кислоты (ArgG), лиазу аргинин-янтарной кислоты (argH) и карбамоилфосфатсинтетазу. Эти ферменты размещаются в Arg-опероне (argCJBDFRGH) и регулируются репрессором аргинина, кодируемым argR (J Bacteriol. 2002Dec; 184(23):6602-14.). Таким образом, способность продуцировать L-аргинин может быть обеспечена ослаблением репрессора аргинина (US2002-0045223) или сверхэкспрессией по меньшей мере одного из генов биосинтеза.

В настоящем изобретении микроорганизм, продуцирующий L-аргинин, представляет собой микроорганизм, в котором инактивирован белок, включающий аминокислотную последовательность SEQ ID NO: 1. Кроме того, для цели настоящего изобретения микроорганизм может представлять собой любой микроорганизм, способный продуцировать L-аргинин благодаря инактивированию белка, включающего аминокислотную последовательность SEQ ID NO: 1. В качестве конкретного примера микроорганизм может включать штамм микроорганизма, такого как микроорганизм рода Escherichia, микроорганизм рода Serratia, микроорганизм рода Erwinia, микроорганизм рода Enterobacteria, микроорганизм рода Salmonella, микроорганизм рода Streptomyces, микроорганизм рода Pseudomonas, микроорганизм рода Brevibacterium или микроорганизм рода Corynebacterium, и, более конкретно, может представлять собой микроорганизм рода Corynebacterium. Для цели настоящего изобретения микроорганизм может представлять собой микроорганизм рода Corynebacterium, продуцирующий L-аргинин.

«Микроорганизм рода Corynebacterium, продуцирующий L-аргинин» относится к микроорганизму рода Corynebacterium, который обладает L-аргинин-продуцирующей способностью естественным образом или вследствие модифицирования. Уже известно, что микроорганизм рода Corynebacterium может продуцировать L-аргинин. Однако его L-аргинин-продуцирующая способность является весьма низкой, и гены или механизмы, вовлеченные в продуцирование, еще не были обнаружены. Таким образом, в настоящем изобретении микроорганизм рода Corynebacterium, продуцирующий L-аргинин, относится к нативному микроорганизму как таковому или к микроорганизму рода Corynebacterium, в котором активность чужеродного гена, вовлеченного в механизм продуцирования L-аргинина, усилена или инактивирована таким образом, что он обладает улучшенной L-аргинин- продуцирующей способностью.

В настоящем изобретении “микроорганизм рода Corynebacterium” может включать все микроорганизмы рода Corynebacterium. Более конкретно, микроорганизм может представлять собой Corynebacterium glutamicum, Corynebacterium ammoniagenes, Corynebacterium thermoaminogenes, Brevibacterium flavum, Corynebacterium efficiens, Corynebacterium maris, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium pilosum, Corynebacterium cystitidis, Corynebacterium uterequi, Corynebacterium renale или Brevibacterium lactofermentum и, еще более конкретно, может представлять собой Corynebacterium glutamicum.

В настоящем изобретении предложен способ получения L-аргинина, включающий культивирование микроорганизма согласно настоящему изобретению в среде.

Микроорганизм согласно настоящему изобретению является таким, как описано выше.

В способе по настоящему изобретению культивирование микроорганизма рода Corynebacterium может быть осуществлено с использованием любых условий культивирования и способа культивирования, известных в данной области техники.

Как его используют в данном описании, термин «культивирование» означает, что микроорганизмы выращивают в надлежащим образом искусственно контролируемых условиях среды. В настоящем изобретении способ культивирования микроорганизма рода Corynebacterium, продуцирующего L-аргинин, может быть осуществлен с использованием способа, широко известного в данной области техники. Более конкретно, для культивирования может быть использован периодический процесс или непрерывный процесс, такой как периодический процесс с подпиткой или повторяющийся периодический процесс с подпиткой, но культивирование ими не ограничивается.

Среда для использования в культивировании должна удовлетворять требованиям используемого штамма. Культуральные среды, подходящие для использования в культивировании штаммов Corynebacteria, хорошо известны в данной области техники (например, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).

Источники углерода, которые можно использовать в среде, включают сахара и углеводы, такие как глюкоза, сахароза, лактоза, фруктоза, мальтоза, крахмал или целлюлоза; масла и жиры, такие как соевое масло, подсолнечное масло, касторовое масло или кокосовое масло; жирные кислоты, такие как пальмитиновая кислота, стеариновая кислота или линолевая кислота; спирты, такие как глицерин или этиловый спирт; и органические кислоты, такие как уксусная кислота. Эти вещества можно использовать по отдельности или в смеси, но без ограничения ими.

Источники азота, которые можно использовать, включают соединения, содержащие органический азот, такие как пептон, дрожжевой экстракт, мясной экстракт, солодовый экстракт, кукурузный экстракт, соевая мука и мочевина, или неорганические соединения, такие как сульфат аммония, хлорид аммония, фосфат аммония, карбонат аммония и нитрат аммония. Источники азота также можно использовать по отдельности или в виде смеси, но без ограничения ими.

Источники фосфора, которые можно использовать, включают дигидрофосфат калия или гидрофосфат дикалия, или соответствующие натриевые соли. Кроме того, культуральная среда может содержать соли металлов, такие как сульфат магния или сульфат железа, которые требуются для роста. И наконец, в дополнение к вышеописанным веществам можно использовать необходимые для роста вещества, такие как аминокислоты и витамины. Кроме того, в культуральную среду можно добавлять подходящие предшественники. Указанные вещества можно добавлять к культуре периодическим или непрерывным образом подходящим методом во время культивирования.

pH культурального продукта можно регулировать посредством использования основных соединений, таких как гидроксид натрия, гидроксид калия, аммиак или водный аммиак; либо кислых соединений, таких как фосфорная кислота или серная кислота, целесообразным образом. Пенообразование можно регулировать посредством использования пеногасителей, таких как полигликолевые эфиры жирных кислот. Аэробные условия можно поддерживать посредством ввода в культуру кислорода или газовых смесей, содержащих кислород (например, воздуха). Температура культивирования обычно может составлять от 20°C до 45°C, более точно от 25°C до 40°C. Культивирование можно продолжать вплоть до получения желаемого количества L-аминокислот. Более точно, время культивирования может составлять от 10 часов до 160 часов.

В способе по настоящему изобретению культивирование может быть осуществлено непрерывно, или посредством периодического процесса, или посредством периодического процесса с подпиткой, или посредством повторяющегося периодического процесса с подпиткой. Такое культивирование может быть осуществлено с использованием любого способа, хорошо известного в данной области техники.

Отделение L-аргинина от культурального продукта может быть осуществлено традиционным методом, известным в данной области техники. Для упомянутого выше способа разделения можно использовать такие методы, как центрифугирование, фильтрование, ионообменная хроматография, кристаллизация и так далее. Например, супернатант, полученный путем центрифугирования культурального продукта с низкой скоростью и удаления биомассы, можно разделять посредством ионообменной хроматографии, но метод не ограничивается этим.

В способе по настоящему изобретению после культивирования может быть дополнительно включено выделение L-аргинина из микроорганизма или среды.

Выделение может включать процесс очистки.

Полезные эффекты изобретения

Микроорганизм по настоящему изобретению, который продуцирует L-аргинин, может продуцировать L-аргинин с высокой эффективностью. Кроме того, полученный L-аргинин можно применять не только в кормах для животных или в кормовых добавках, но также в различных продуктах, таких как продукты питания человека или пищевые добавки, лекарства и так далее.

Подробное описание изобретения

Далее настоящее изобретение будет описано подробно с сопутствующими иллюстративными воплощениями. Однако иллюстративные воплощения, раскрытые в данном описании, предназначены только для иллюстративных целей и их не следует рассматривать как ограничивающие объем настоящего изобретения.

Пример 1: Конструирование библиотеки случайных мутаций с использованием транспозона

Для получения штамма, имеющего повышенную продуктивность по L-аргинину, следующим образом была получена векторная библиотека.

Сначала, используя Corynebacterium glutamicum KCCM10741P (патент Кореи № 0791659) в качестве родительского штамма, полученной с использованием набора EZ-Tn5™ <R6Kγ или i/KAN-2>Tnp Transposome™ (Epicentre) плазмидой трансформировали этот родительский штамм методом электропорации (Appl. Microbiol. Biotechnol. (1999) 52:541-545). Затем штамм распределяли по чашке с комплексной средой, содержащей канамицин (25 мг/л), и посредством этого получали примерно 20000 колоний.

Чашка с комплексной средой (pH 7,0)

10 г глюкозы, 10 г пептона, 5 г мясного экстракта, 5 г дрожжевого экстракта, 18,5 г сердечно-мозговой вытяжки, 2,5 г NaCl, 2 г мочевины, 91 г сорбита, 20 г агара (на литр дистиллированной воды)

Пример 2: Скрининг библиотеки случайных мутаций с использованием транспозона

Каждую из примерно 20000 колоний, полученных в Примере 1, инокулировали в 300 мкл нижеследующей селективной среды и культивировали в 96-луночных планшетах с глубокими лунками при 30°C при 1000 об./мин в течение примерно 24 часов.

Селективная среда (pH 8,0)

10 г глюкозы, 5,5 г сульфата аммония, 1,2 г MgSO47H2O, 0,8 г KH2PO4, 16,4 г K2HPO4, 100 мкг биотина, 1 мг тиамина HCl, 2 мг пантотената кальция, 2 мг никотинамида (на литр дистиллированной воды)

Для анализа количества L-аргинина, продуцированного в культуре, использовали нигидриновый метод (Moore, S., Stein, W. H., Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem. 1948, 176, 367-388).

После завершения культивирования 10 мкл культурального супернатанта приводили во взаимодействие со 190 мкл раствора для нигидриновой реакции при 65°C в течение 30 минут и после этого с помощью спектрофотометра измеряли поглощение при длине волны 570 нм. На основе результатов измерения в качестве мутантных штаммов было отобрано примерно 60 колоний, показывающих более высокое поглощение по сравнению со штаммом Corynebacterium glutamicum KCCM10741P, используемым в качестве контроля. Было подтверждено, что другие колонии показывали поглощение, аналогичное или более низкое, чем поглощение штамма Corynebacterium glutamicum KCCM10741P, используемого в качестве контроля.

Примерно 60 штаммов, отобранных как описано выше, снова культивировали таким же образом, как описано выше, и затем подвергали нигидриновой реакции. В результате были отобраны лучшие десять мутантных штаммов, имеющих повышенную продуктивность по L-аргинину по сравнению со штаммом Corynebacterium glutamicum KCCM10741P, используемым в качестве родительского штамма.

Пример 3: Анализ продуктивности по L-аргинину отобранных штаммов со случайными мутациями

Для окончательного отбора штаммов, чья продуктивность по L-аргинину воспроизводимо повышалась, из десяти мутантов, отобранных в Примере 2, выполняли культивирование в колбе с использованием среды, описанной ниже. После завершения культивирования анализировали концентрацию L-аргинина в культуре посредством HPLC. Концентрация L-аргинина, продуцированного каждым из мутантных штаммов, показана в Таблице 1 ниже.

Среда для продуцирования (pH 7,0)

6% глюкозы, 3% сульфата аммония, 0,1% монокалия фосфат, 0,2% сульфата магния гептагидрата, 1,5% кукурузного экстракта (CSL), 1% NaCl, 0,5% дрожжевого экстракта, 100 мг/л биотина, 3% CaCO3, (на литр дистиллированной воды)

Таблица 1. Концентрации L-аргинина, продуцированного 10 отобранными штаммами со случайными мутациями

Штаммы L-Аргинин (г/л)
Партия 1 Партия 2 Партия 3 Среднее
Контроль KCCM10741P 3 3,1 3,1 3,07
1 KCCM10741P/mt-1 2,8 3 2,7 2,83
2 KCCM10741P/mt-2 3,1 3 3,2 3,10
3 KCCM10741P/mt-3 3,3 3,2 3,4 3,30
4 KCCM10741P/mt-4 2,5 2,2 2,1 2,27
5 KCCM10741P/mt-5 2,9 3 3,2 3,03
6 KCCM10741P/mt-6 3,5 3,2 3,2 3,30
7 KCCM10741P/mt-7 3,2 3,3 3,3 3,27
8 KCCM10741P/mt-8 3,4 3 3,2 3,20
9 KCCM10741P/mt-9 2,7 2,7 3 2,80
10 KCCM10741P/mt-10 3,6 3,9 3,5 3,67

Среди 10 отобранных мутантных штаммов KCCM10741P/mt-10 был окончательно отобран в качестве штамма, чья продуктивность по L-аргинину была значительно повышенной.

Пример 4: Выяснение причин повышенной продуктивности по L-аргинину у окончательно отобранного штамма

В этом Примере выполняли эксперимент на мутантном штамме, окончательно отобранном в Примере 3, для того, чтобы идентифицировать гены, делетированные в результате случайной вставки транспозона.

Геномную ДНК экстрагировали из KCCM10741P/mt-10, обрабатывали рестриктазами и затем лигировали, и продуктом лигирования трансформировали E. coli DH5α. Трансформированные клетки E. coli высевали на твердую среду LB, содержащую канамицин (25 мг/л). Отбирали двадцать трансформированных колоний и затем получали плазмиды, содержащие неизвестную часть гена. Нуклеотидные последовательности анализировали с использованием праймера 1 (SEQ ID NO: 3) и праймера 2 (SEQ ID NO: 4) из набора EZ-Tn5™ <R6Kγ или i/KAN-2>Tnp Transposome™. В результате было подтверждено, что делетированный и инактивированный ген имел нуклеотидную последовательность SEQ ID NO: 2, кодирующую аминокислотную последовательность SEQ ID NO: 1

Праймер 1 (SEQ ID NO: 3): ACCTACAACAAAGCTCTCATCAACC

Праймер 2 (SEQ ID NO: 4): CTACCCTGTGGAACACCTACATCT

Соответственно, для определения того, влияет ли белок, включающий аминокислотную последовательность SEQ ID NO: 1, на способность продуцировать L- аргинин при инактивации белка, указанный выше ген отобрали в качестве гена- кандидата для делетирования.

Пример 5: Конструирование рекомбинантного вектора для делетирования гена, содержащего нуклеотидную последовательность SEQ ID NO: 2

В этом Примере для установления того, будет ли инактивация гена, содержащего нуклеотидную последовательность SEQ ID NO: 2, влиять на продуцирование L-аргинина, конструировали рекомбинантную плазмиду для делетирования гена, отобранного в Примере 4, на хромосоме L-аргинин- продуцирующего штамма Corynebacterium.

Сначала синтезировали праймеры 3-6, показанные в Таблице 2, для получения рекомбинантного вектора, способного делетировать ген на хромосоме микроорганизма рода Corynebacterium.

Таблица 2

Используемые праймеры Нуклеотидные последовательности
Праймер 3 (SEQ ID NO: 5) CCGCTCGAGACATCGAAATCGTAAGGGTA
Праймер 4 (SEQ ID NO: 6) CAGCATTGACAAGCAGTTCT
Праймер 5 (SEQ ID NO: 7) AGAACTGCTTGTCAATGCTGGGCCCTTTCCCAGGTGGCAT
Праймер 6 (SEQ ID NO: 8) CCGCTCGAGAAGGCCACCGCTGCAGACCG

Конкретно, для того, чтобы делетировать участок открытой рамки считывания (ORF) (SEQ ID NO: 2) этого гена, синтезировали праймер 3 (SEQ ID NO: 5), праймер 4 (SEQ ID NO: 6), праймер 5 (SEQ ID NO: 7) и праймер 6 (SEQ ID NO: 8) так, чтобы сайт фермента рестрикции XhoI присутствовал как на 5'-конце, так и на 3'-конце. Проводили ПЦР (полимеразная цепная реакция) с хромосомной ДНК Corynebacterium glutamicum KCCM10741P в качестве матрицы с использованием праймеров 3-6, приведенных выше. В результате было подтверждено, что каждый из фрагментов ДНК, соответствующих переднему и заднему сегментам той части, где закодирован белок, кодируемый этим геном, амплифицирован до 500 п.н., соответственно. Далее, после денатурации при 95°C в течение 5 минут выполняли ПЦР в течение всего 30 циклов в следующих условиях: денатурация при 94°C в течение 30 секунд, отжиг при 56°C в течение 30 секунд и полимеризация при 72°C в течение 1 минуты. После этого выполняли реакцию полимеризации при 72°C в течение 7 минут. Затем вектор pDZ (патент Кореи № 10-0924065), который не реплицируется у Corynebacterium glutamicum, обрабатывали ферментом рестрикции XhoI и после этого полученный продукт ПЦР подвергали прямому «бесшовному» клонированию (fusion). Это прямое «бесшовное» клонирование осуществляли с помощью набора In-Fusion® HD Cloning (Clontech). Затем полученным в результате продуктом трансформировали E. coli DH5α, которые затем высевали на твердую среду LB, содержащую канамицин (25 мг/л).

Посредством ПЦР отбирали колонию, трансформированную плазмидой, имеющей встроенный в нее желаемый ген, и затем плазмиду выделяли с использованием технологии экстракции плазмид. Плазмиду назвали “pDZ-ΔRS1”.

Пример 6: Конструирование Corynebacterium glutamicum KCCM10741P с делецией гена, содержащего нуклеотидную последовательность SEQ ID NO: 2, и оценка продуктивности по L-аргинину сконструированного штамма

На основе L-аргинин-продуцирующего штамма рода Corynebacterium, который представляет собой штамм KCCM10741P, был сконструирован штамм, в котором ген, содержащий нуклеотидную последовательность SEQ ID NO: 2, был делетирован, и провели оценку продуктивность по L-аргинину сконструированного штамма.

Более точно, рекомбинантной плазмидой pDZ-ΔRS1, полученную в Примере 5, трансформировали Corynebacterium glutamicum KCCM10741P, который представляет собой L-аргинин-продуцирующий штамм, путем гомологичной рекомбинации на хромосоме (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).

Затем трансформант выращивали на чашке с твердой средой, содержащей 4% сахарозы, чтобы дать возможность произойти второй рекомбинации. После завершения второй рекомбинации делецию гена на хромосоме трансформированного штамма Corynebacterium glutamicum подтверждали посредством ПЦР с использованием праймера 3 и праймера 6. Рекомбинантный штамм был назван “Corynebacterium glutamicum KCCM10741P-RS1”.

Для того, чтобы проанализировать продуктивность по L-аргинину, сконструированный штамм Corynebacterium glutamicum KCCM10741P-RS1 и родительский штамм Corynebacterium glutamicum KCCM10741P культивировали следующим образом.

Родительский штамм Corynebacterium glutamicum KCCM10741P и штамм Corynebacterium glutamicum KCCM10741P-RS1, сконструированный в Примере 6, инокулировали в колбу с разделительными перегородками на 250 мл, содержащую 25 мл среды для посева, описанной ниже, и культивировали со встряхиванием при 200 об./мин при 30°C в течение 20 часов. Затем 1 мл каждой из посевных культур инокулировали в колбу с разделительными перегородками на 250 мл, содержащую 24 мл описанной ниже среды для продуцирования и культивировали со встряхиванием при 200 об./мин при 30°C в течение 72 часов. Состав среды для посева и состав среды для продуцирования были следующими.

Среда для посева (pH 7,0)

20 г глюкозы, 10 г пептона, 5 г дрожжевого экстракта, 1,5 г мочевины, 4 г KH2PO4, 8 г K2HPO4, 0,5 г MgSO4⋅7H2O, 100 мкг биотина, 1 мг тиамина HCl, 2 мг пантотената кальция, 2 мг никотинамида (на литр дистиллированной воды).

Среда для продуцирования (pH 7,0)

6% глюкозы, 3% сульфата аммония, 0,1% монокалия фосфата, 0,2% сульфата магния гептагидрата, 1,5% кукурузного экстракта (CSL), 1% NaCl, 0,5% дрожжевого экстракта, 100 мг/л биотина (на литр дистиллированной воды).

После завершения культивирования количество продуцированного L-аргинина измеряли посредством HPLC; концентрация проанализированного L-аргинина показана в Таблице 3 ниже.

Таблица 3 Анализ продуктивности по L-аргинину Corynebacterium glutamicum KCCM10741P, у которого делетирован ген, содержащий нуклеотидную последовательность SEQ ID NO: 2

Штаммы L-Аргинин (г/л)
Партия 1 Партия 2 Партия 3 Среднее
KCCM10741P 3,0 3,1 3,1 3,06
KCCM10741P-RS1 3,8 3,9 3,8 3,83

На основании приведенных выше результатов было подтверждено, что KCCM10741P-RS1, у которого делетирован ген из Corynebacterium glutamicum KCCM10741P (то есть L-аргинин-продуцирующего штамма), имел продуктивность по L-аргинину, которая превышает на 25% среднюю, в сравнении с родительский штамм.

Штамм KCCM10741P-RS1 был назван “CA06-2830” и был депонирован в Корейском центре культур микроорганизмов (KCCM), который представляет собой международный орган депонирования в соответствии с Будапештским договором, 15 декабря 2017, и ему был присвоин депозитарный номер доступа KCCM12187P.

Таким образом, было подтверждено, что продуктивность по L-аргинину может быть улучшена посредством делетирования гена, содержащего нуклеотидную последовательность SEQ ID NO: 2, из микроорганизма рода Corynebacterium .

Пример 7: Конструирование рекомбинантного вектора для ослабления гена, содержащего нуклеотидную последовательность SEQ ID NO: 2

Для конструирования рекомбинантного вектора, способного ослаблять ген, содержащий нуклеотидную последовательность SEQ ID NO: 2, на хромосоме штамма рода Corynebacterium инициирующий кодон этого гена заменяли с ATG на TTG для ослабления гена. Кроме того, для конструирования его фрагмента синтезировали праймер 3 и праймеры 7-9, показанные в Таблице 4 ниже.

Таблица 4

Ген Используемые праймеры Нуклеотидные последовательности
SEQ ID NO: 2 Праймер 3 (SEQ ID NO: 5) CCGCTCGAGACATCGAAATCGTAAGGGTA
Праймер 7 (SEQ ID NO: 9) GATCCACAGTCCCAATATTCTCGCTTCTTC
Праймер 8 (SEQ ID NO: 10) GAAGAAGCGAGAATATTGGGACTGTGGATC
Праймер 9 (SEQ ID NO: 11) CCGCTCGAGCAGCATTGACAAGCAGTTCT

Для амплификации участка ORF (SEQ ID NO: 2) данного гена синтезировали праймер 3 (SEQ ID NO: 5), праймер 7 (SEQ ID NO: 9), праймер 8 (SEQ ID NO: 10) и праймер 9 (SEQ ID NO: 11) таким образом, чтобы сайт фермента рестрикции XhoI присутствовал как на 5'-конце, так и на 3'-конце. ПЦР выполняли с хромосомной ДНК Corynebacterium glutamicum KCCM10741P в качестве матрицы с использованием праймера 3, праймера 7, праймера 8 и праймера 9. Далее, после денатурирования при 95°C в течение 5 минут выполняли ПЦР в течение всего 30 циклов в следующих условиях: денатурация при 94°C в течение 30 секунд, отжиг при 56°C в течение 30 секунд и полимеризация при 72°C в течение 1 минуты. После этого проводили реакцию полимеризации при 72°C в течение 7 минут. Затем вектор pDZ (патент Кореи № 10-0924065), который не реплицируется у Corynebacterium glutamicum, обрабатывали ферментом рестрикции XhoI и после этого полученный продукт ПЦР подвергали прямому «бесшовному» клонированию (fusion). Это прямое «бесшовное» клонирование осуществляли с помощью набора In-Fusion® HD Cloning (Clontech). Затем полученным в результате продуктом трансформировали E. coli DH5α, которые затем высевали на твердую среду LB, содержащую канамицин (25 мг/л). Колонию, трансформированную с помощью плазмиды, имеющей желаемый ген, вставленный в неё, отбирали посредством ПЦР и затем выделяли плазмиду, используя способ выделения плазмид. Плазмиду называли“pDZ-ΔRS2”.

Пример 8: Конструирование Corynebacterium glutamicum KCCM10741P, у которого ген, содержащий нуклеотидную последовательность SEQ ID NO: 2, ослаблен, и оценка продуктивности по L-аргинину сконструированного штамма

Рекомбинантной плазмидой pDZ-ΔRS2, полученной в Примере 7, трансформировали Corynebacterium glutamicum KCCM10741P, который представляет собой L-аргинин-продуцирующий штамм, путем гомологичной рекомбинации на хромосоме (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).

Затем трансформант выращивали на чашке с твердой средой, содержащей 4% сахарозы, чтобы дать возможность произойти второй рекомбинации. Нуклеотидную последовательность трансформированного штамма Corynebacterium glutamicum, полученного после второй рекомбинации, анализировали с использованием праймера 3 и праймера 9 для идентификации штамма, у которого инициирующий кодон гена, содержащего нуклеотидную последовательность SEQ ID NO: 2, заменен на TTG. Рекомбинантный штамм был назван “Corynebacterium glutamicum KCCM10741P-RS2”.

Родительский штамм Corynebacterium glutamicum KCCM10741P и сконструированный выше штамм Corynebacterium glutamicum KCCM10741P-RS2 культивировали таким же образом, как в Примере 6, для анализа продуктивности по L- аргинину. После этого количество продуцированного L-аргинина измеряли посредством HPLC; концентрация проанализированного L-аргинина показана в Таблице 5 ниже.

Таблица 5. Анализ продуктивности по L-аргинину Corynebacterium glutamicum KCCM10741P, в котором ослаблен ген, содержащий нуклеотидную последовательность SEQ ID NO: 2

Штаммы L-Аргинин (г/л)
Партия 1 Партия 2 Партия 3 Среднее
KCCM10741P 4,2 4,2 4,1 4,17
KCCM10741P-RS2 4,6 4,8 4,6 4,67

Как видно из приведенных выше результатов, было подтверждено, что когда в L-аргинин-продуцирующем штамме KCCM10741P был ослаблен ген, содержащий нуклеотидную последовательность SEQ ID NO: 2, продуктивность по L-аргинину этого штамма увеличивалась в среднем на 12%.

Таким образом, было подтверждено, что продуктивность по L-аргинину у микроорганизма рода Corynebacterium может быть улучшена путем ослабления экспрессии гена, содержащего нуклеотидную последовательность SEQ ID NO: 2.

Из приведенных выше результатов очевидно, что у штамма, у которого ген, содержащий нуклеотидную последовательность SEQ ID NO: 2, делетирован или ослаблен, продуктивность по L-аргинину повышается, и это указывает на то, что L-аргинин может продуцироваться в большом количестве в микроорганизме, когда активность белка, кодированного этим геном, инактивирована.

Несмотря на то, что настоящее изобретение было описано со ссылкой на конкретные иллюстративные воплощения, специалист в области техники, к которой принадлежит данное изобретение, понимает, что настоящее изобретение может быть воплощено в других конкретных формах без отступления от технической идеи или существенных признаков настоящего изобретения, Следовательно, воплощения, раскрытые выше, рассматриваются во всех отношениях как иллюстративные и неограничивающие. Более того, объем настоящего изобретения определяется прилагаемой формулой изобретения, а не подробным описанием, и следует понимать, что все модификации или вариации, выводимые из значений и объема настоящего изобретения, и их эквиваленты включены в объем прилагаемой формулы.

Номер доступа

Учреждение депонирования: Корейский центр культур микроорганизмов (KCCM) (Международный орган по депонированию)

Номер доступа: KCCM12187P

Дата депонирования: 15 декабря 2017

--->

<110> CJ CheilJedang Corporation

<120> Microorganism of genus corynebacterium producing L-arginine

and method for producing L-arginine using the same

<130> OPA18459

<150> KR 10-2017-0175046

<151> 2017-12-19

<160> 11

<170> KoPatentIn 3.0

<210> 1

<211> 356

<212> PRT

<213> Corynebacterium glutamicum

<400> 1

Val Leu Leu Arg Ala Glu Glu Val Val Arg Gln Gly Gln Arg Gly Ile

1 5 10 15

Lys Leu His Val Glu Ala Gln His Glu His His His His Arg His Leu

20 25 30

Ser Thr Ile Lys Glu Leu Leu Val Asn Ala Asp Ile Pro Ala Gln Thr

35 40 45

Lys Gln Asp Ala Leu Gly Val Phe Glu Leu Ile Ala Ile Ala Glu Gly

50 55 60

Lys Val His Gly Ile Glu Pro Glu Lys Ile His Phe His Glu Val Gly

65 70 75 80

Ala Trp Asp Ser Ile Ala Asp Ile Val Gly Val Cys Glu Ala Ile Arg

85 90 95

Gln Leu Asn Pro Gly Leu Ile Ala Ala Ser Pro Ile Ala Leu Gly Phe

100 105 110

Gly Arg Ile Lys Ala Ala His Gly Asp Ile Pro Val Pro Val Pro Ala

115 120 125

Val Ala Glu Leu Val Lys Gly Trp Pro Thr Gln Thr Gly Ala Leu Met

130 135 140

Glu Ser Thr Glu Pro Val Gly Glu Leu Ala Thr Pro Thr Gly Val Ala

145 150 155 160

Leu Ile Arg His Phe Ala Thr Gln Asp Gly Pro Phe Pro Gly Gly Ile

165 170 175

Ile Asn Glu Val Gly Ile Gly Ala Gly Thr Lys Asp Thr Ala Gly Arg

180 185 190

Pro Asn Val Val Arg Ala Val Leu Phe Ser Thr Ser Gly Lys Ala Ala

195 200 205

Ser Asn Pro Asp Thr Arg Thr Leu Val Gln Leu Glu Ala Asn Val Asp

210 215 220

Asp Gln Asp Pro Arg Leu Trp Pro Gly Val Ile Glu Ser Leu Phe Ala

225 230 235 240

Ala Gly Ala Val Ala Ala Trp Leu Thr Pro Ile Leu Met Lys Lys Gly

245 250 255

Arg Pro Ala His Thr Val Ser Ala Leu Val Asp Ser Ser Glu Val Glu

260 265 270

Ala Val Lys Thr Ala Leu Phe Ala Ala Thr Thr Thr Phe Gly Val Arg

275 280 285

Ser Trp Glu Val Gln Arg Glu Gly Leu Asp Arg Arg Phe Glu Gln Val

290 295 300

Glu Val Asp Gly Arg Thr Ile Asn Ile Lys Ile Gly Ser Arg Asn Gly

305 310 315 320

His Asp Ile Ser Ala Gln Pro Glu Phe Glu Asp Ile Arg Ser Ala Ala

325 330 335

Val Ala Leu Gly Ile Ser Glu Arg Glu Val Val Ala Arg Ile Pro Gln

340 345 350

Gly Thr Thr Glu

355

<210> 2

<211> 1071

<212> DNA

<213> Corynebacterium glutamicum

<400> 2

gtgcttttga gagcagaaga ggtagtgcgc caaggccaac gaggcatcaa actacatgta 60

gaagcacaac atgaacacca ccatcaccgc catttgagca ccattaaaga actgcttgtc 120

aatgctgaca tccctgcaca aaccaagcag gatgccttag gcgtttttga actcatcgct 180

atcgctgaag gaaaagtcca cggcatcgag ccggagaaaa tccacttcca tgaggtagga 240

gcttgggatt ccatcgcaga cattgtgggt gtgtgcgaag cgatcaggca gcttaaccca 300

ggtttgattg ctgcatctcc gattgcttta ggattcggac gcatcaaggc agctcacgga 360

gacattccag tgccagttcc agcagtggca gagctggtga aaggctggcc cacccaaacc 420

ggagctctta tggagagcac cgaacctgtt ggtgaattag ccaccccaac tggtgttgcg 480

ttgatccgtc actttgccac ccaagatggc cctttcccag gtggcatcat caatgaagtc 540

ggtatcggcg caggaactaa ggacaccgca gggcgtccca atgtggtgcg cgcggtcctg 600

ttcagcacct ccggtaaggc tgcctcaaac ccagacaccc gtaccctcgt gcaattggaa 660

gccaacgttg atgatcaaga cccacggctg tggccaggag taatagagag cctctttgcc 720

gctggcgcag tagctgcatg gctgactcca attttgatga agaagggccg tcctgcacat 780

acggtgtcag cattggtgga tagctccgag gtggaagcag tgaaaaccgc attatttgca 840

gccaccacga cttttggggt cagatcatgg gaagtccagc gagaagggtt ggatcgtcgt 900

ttcgaacaag tcgaggtgga cggacgcacc atcaacatca agattggctc ccgaaatggc 960

cacgacatca gtgcacagcc cgagtttgaa gatattcggt ctgcagcggt ggccttggga 1020

atttcagaga gggaagttgt ggcaagaatt ccgcaaggca ccactgagta a 1071

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer 1

<400> 3

acctacaaca aagctctcat caacc 25

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer 2

<400> 4

ctaccctgtg gaacacctac atct 24

<210> 5

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer 3

<400> 5

ccgctcgaga catcgaaatc gtaagggta 29

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer 4

<400> 6

cagcattgac aagcagttct 20

<210> 7

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer 5

<400> 7

agaactgctt gtcaatgctg ggccctttcc caggtggcat 40

<210> 8

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer 6

<400> 8

ccgctcgaga aggccaccgc tgcagaccg 29

<210> 9

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer 7

<400> 9

gatccacagt cccaatattc tcgcttcttc 30

<210> 10

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer 8

<400> 10

gaagaagcga gaatattggg actgtggatc 30

<210> 11

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer 9

<400> 11

ccgctcgagc agcattgaca agcagttct 29

<---

1. Микроорганизм рода Corynebacterium, продуцирующий L-аргинин, в котором инактивирован белок, содержащий аминокислотную последовательность SEQ ID NO: 1.

2. Микроорганизм рода Corynebacterium по п. 1, где этот белок кодируется геном, состоящим из нуклеотидной последовательности SEQ ID NO: 2.

3. Микроорганизм рода Corynebacterium по п. 1, который представляет собой Corynebacterium glutamicum.

4. Способ получения L-аргинина, включающий культивирование микроорганизма по любому из пп. 1-3 в среде.

5. Способ получения L-аргинина по п. 4, дополнительно включающий выделение L-аргинина из микроорганизма или среды.



 

Похожие патенты:

Изобретение относится к биотехнологии. Описан промотор, содержащий нуклеотидную последовательность, представленную под SEQ ID NO: 1.

Группа изобретений относится к области биотехнологии. Предложен модифицированный микроорганизм рода Corynebacterium, продуцирующий путресцин, с пониженной активностью регулятора транскрипции метаболизма сахара (SugR) по сравнению с его эндогенной активностью и повышенной активностью цитратсинтазы (GltA) по сравнению с ее эндогенной активностью.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Corynebacterium, обладающий способностью продуцировать L-аргинин, с усиленной активностью аргининового оперона и орнитин-карбамоилтрансферазы.

Группа изобретений относится к области биохимии. Предложен способ получения основной аминокислоты (варианты).

Изобретение относится к области биохимии. Предложен способ получения L-орнитина.

Группа изобретений относится к биотехнологии. Предложены варианты способа получения аргинина посредством ферментации агропромышленных отходов, в том числе крахмалосодержащих, с получением ферментированной жидкости, содержащей аргинин, и выделения аргинина из ферментированной жидкости.

Изобретение относится к биотехнологии и представляет собой способ получения L-аминокислоты, такой как L-аргинин, ферментацией с использованием бактерии рода Escherichia, которая модифицирована таким образом, что содержит ген argJ, который кодирует фермент, имеющий, по меньшей мере, орнитинацетилтрансферазную активность, и при этом бактерия модифицирована таким образом, что содержит N-ацетилорнитиндеацетилазу с нарушенной активностью.
Изобретение относится к области биохимии. .

Изобретение относится к области биотехнологии и микробиологической промышленности, в частности к способу получения L-аргинина с использованием бактерии рода Escherichia, которая модифицирована таким образом, что в указанной бактерии инактивированы один или несколько генов, входящих в состав кластера artPIQM-artJ.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Corynebacterium, обладающий L-изолейцин-продуцирующей способностью, где указанный микроорганизм содержит белок, обладающий активностью цитрамалатсинтазы.

Изобретение относится к области биотехнологии. Предложен способ получения L-треонина, включающий культивирование рекомбинантного коринеформного микроорганизма, способного продуцировать L-треонин, где рекомбинантный коринеформный микроорганизм трансформируют посредством инсерции промотора, который представлен нуклеотидной последовательностью SEQ ID NO:1, ниже стоп-кодона гена-мишени на хромосоме, и где ген-мишень представляет собой ген, кодирующий дигидродипиколинатсинтазу.

Группа изобретений относится к области биотехнологии. Предложен штамм Corynebacterium glutamicum, продуцирующий L-лейцин, депонированный в Корейском Центре Культур Микроорганизмов (KCCM) с номером доступа KCCM11662P.

Изобретение относится к биотехнологии. Описан промотор, содержащий нуклеотидную последовательность, представленную под SEQ ID NO: 1.

Группа изобретений относится к области биотехнологии. Предложен модифицированный микроорганизм рода Corynebacterium, продуцирующий путресцин, с пониженной активностью регулятора транскрипции метаболизма сахара (SugR) по сравнению с его эндогенной активностью и повышенной активностью цитратсинтазы (GltA) по сравнению с ее эндогенной активностью.
Группа изобретений относится к области биотехнологии. Предложен L-лизин-продуцирующий микроорганизм рода Corynebacterium, где белок, содержащий аминокислотную последовательность SEQ ID NO: 1, является инактивированным.

Группа изобретений относится к области биотехнологии. Предложен L-лизин-продуцирующий микроорганизм рода Corynebacterium, где активность белка, содержащего аминокислотную последовательность SEQ ID NO: 1, инактивирована.

Группа изобретений относится к области биотехнологии. Предложен микроорганизм рода Corynebacterium, модифицированный таким образом, что активность белка, вовлеченного в гидролиз клеточной стенки, инактивирована по сравнению с его эндогенной активностью.

Группа изобретений относится к области биотехнологии. Предложен вариант пируватдегидрогеназы, содержащий по меньшей мере одну аминокислотную замену в области аминокислот в положениях 190-205 или в области аминокислот в положениях 415-440 SEQ ID NO: 1.

Группа изобретений относится к области биотехнологии. Предложен полипептид, обладающий активностью репрессора глюконата, и полинуклеотид, кодирующий его.

Группа изобретений относится к биотехнологии и касается получения генетической конструкции, обеспечивающей синтез в клетках Escherichia coli рекомбинантного полипептида G4223 (рG4223).

Группа изобретений относится к микроорганизму рода Corynebacterium, продуцирующему L-аргинин, и к способу получения L-аргинина с использованием этого микроорганизма. В предложенном микроорганизме рода Corynebacterium, продуцирующем L-аргинин, инактивирован белок, содержащий аминокислотную последовательность SEQ ID NO.: 1. Предложен также способ получения L-аргинина, включающий культивирование вышеуказанного микроорганизма. Группа изобретений обеспечивает продукцию L-аргинина с высокой эффективностью. 2 н. и 3 з.п. ф-лы, 5 табл., 8 пр.

Наверх