Способ диагностики стадии острого пиелонефрита

Изобретение относится к медицине и может быть использовано для диагностики стадии острого пиелонефрита. Для этого осуществляют подготовку образцов крови пациентов с острым пиелонефритом. Затем проводят флуоресцентную in situ гибридизацию с использованием люминесцентной микроскопии. Определяют количество адгезированных на поверхности эритроцитов и внутриэритроцитарно расположенных бактерий. При значении интегрального показателя меньше 3 диагностируют серозную стадию. При значении интегрального показателя от 3 до 6 диагностируют переходную стадию. При значении интегрального показателя больше 6 диагностируют гнойную стадию острого пиелонефрита. Изобретение позволяет диагностировать стадии острого пиелонефрита и определить вероятность развития гнойных осложнений у пациента. 3 пр., 3 табл.

 

Изобретение относится к медицине и может быть использовано в клинической практике для диагностики стадии острого пиелонефрита и определения вероятности развития гнойных осложнений.

Пиелонефрит является самым частым заболеванием почек во всех возрастных группах, причем в 25-30% случаев течение острого пиелонефрита осложняется развитием гнойно-деструктивных форм (апостематозный пиелонефрит, абсцесс и карбункул почки), которые нередко (до 50%) приводят к нефрэктомии. Послеоперационная летальность при этом достигает 28,4% [Плеханов В.Н. О трудностях: диагностики гнойно-деструктивныхформ острого пиелонефрита у мужчин молодого возраста. // Вестник РУДН, серия Медицина, 2010, №1, С. 172-177].

На фоне отмечающейся тенденции к увеличению заболеваемости пиелонефритом и его септических проявлений в виде гнойно-деструктивных форм проблема адекватной диагностики поражений почек остается весьма актуальной. [Mahmood Т., Puckrin R., Sugar L., Naimark D. Staphylococcus-associated glomerulonephritis mimicking purpura and cryoglo-bulinemic vasculitis in a patient with an epidural abscess: a case report and brief review of the literature. // Canadian Journal of Kidney Health and Disease, 2018, №5, С. 1-6.]. Несмотря на наличие современного диагностического оборудования, мощных антибактериальных средств и широких оперативных возможностей, число больных с гнойными заболеваниями почек неуклонно продолжает расти [Чернова Ю.Г., Неймарк А.И., Момот А.П. Роль пресепсина в оценке тяжести и эффективности лечения гнойного пиелонефрита. // Урология, 2018, №5, С. 22-26.].

При остром пиелонефрите выделяют серозную и гнойную стадии. Серозные формы острого пиелонефрита нередко протекают с более выраженной клинической картиной, имитирующей гнойный процесс. Вместе с тем, гнойно-деструктивный пиелонефрит у пожилых, беременных, пациентов с иммунодефицитными состояниями имеет сглаженную клиническую картину. В этих случаях диагностика тяжести поражения почечной паренхимы и выработка правильной хирургической тактики наиболее затруднительна [Алферов С.М., Дурникин A.M., Зубарев А.В., Морозов С.П., Васильева М.Б. Клинические аспекты диагностики и оперативного лечения первичного острого гнойно-деструктивного пиелонефрита. //Хирургия, 2008, №7, С. 15-19.].

При гнойном воспалении выделяют следующие варианты развития: апостематозный пиелонефрит, карбункул и абсцесс почки, что в последствие может привести к развитию уросепсиса [Белый Л.Е. Неотложная урология: Руководство для врачей. - М.: ООО «Медицинское информационное агентство», 2011, 472 с.].

Для диагностики острого пиелонефрита используют клинико-лабораторные и инструментальные методы. К клинико-лабораторным методам относят: клиническую симптоматику больных, лабораторное исследование мочи, крови. К инструментальным методам относят: эндоскопическое, рентгенологическое, ультразвуковое исследование, а также современные высокотехнологичные методы исследования, которые позволяют оценивать структурно-функциональное состояние почечной паренхимы. К данным методам относят - У3-допплерография, магнитно-резонансная томография (МРТ), мультиспиральная компьютерная томография (МСКТ) [Аляев Ю.Г., Газимиев М.А., Еникеев Д.Е. Современные аспекты диагностики острого пиелонефрита. // Врач, 2009, №6, С. 76-78].

Ультразвуковое исследование почек - повсеместно используемый метод диагностики острого пиелонефрита. Известно, что при остром пиелонефрите почка увеличивается в размерах: увеличиваются объем, толщина паренхимы, размеры пирамидок [Плеханов А.Н., Дамбаев А.Б. Инфекция мочевых путей: эпидемиология, этиология, патогенез, факторы риска, диагностика (обзор литературы) // Бюллетень ВСНЦ СО РАМН, 2016, Т. 1, №107, С. 70-74].

Ранее, при остром пиелонефрите рентгенологическому методу исследования была отведена главенствующая роль. В настоящее время с активным использованием ультрасонографии, компьютерной томографии роль традиционных рентгенологических методов в диагностике острого пиелонефрита значительно уменьшилась. Недостатком данного метода отмечается, что у больных с острым пиелонефритом на экскреторных урограммах не обнаруживаются ранние морфологические изменения.

Известны современные методы диагностики острого пиелонефрита, к которым относят компьютерную томографию (КТ) и магнитно-резонансную томографию (МРТ) почек. КТ и МРТ обладают более высокой контрастной чувствительностью, позволяют выявлять структурные изменения почечной паренхимы, которые не видны в нефрографическую фазу экскреторной урографии [Дубский С.Л., Курбатов Д.Г. Применение лучевых методов исследования в диагностике острого пиелонефрита и его гнойных форм // Вестник МСИ, 2008, №3, С. 49-57]. Однако, данные методы диагностики способны визуализировать грубые (крупные) изменения в почках, когда воспалительный процесс распространился не только в пределах почки, но и в перинефральных тканях и соседних органах, а диффузное острое гнойное воспаление паренхимы почки, в виде множественных мелких гнойничковых образований, величиной с булавочную головку, данные методы диагностики не способны выявлять.

Известен бактериологический метод диагностики гнойной стадии острого пиелонефрита, при котором у больных проводят исследование крови и мочи для обнаружения возбудителя заболевания, его идентификации и установления чувствительности к антибиотикам. Недостатком бактериологического метода является длительность культивирования посевов до 5-7 суток, длительное время для идентификации чистой культуры с помощью различных биохимических тестов, а также проведение теста на выявление резистентности к антибиотикам. Кроме того, эффективность бактериологического метода даже при уросепсисе составляет около 45% [Белый Л.E. Неотложная урология: Руководство для врачей. - М.: ООО «Медицинское информационное агентство», 2011, 472 с.].

Все указанные известные методы, как правило, решают задачу диагностики острого пиелонефрита и не позволяют спрогнозировать дальнейшее течение заболевания, а именно переход серозной стадии в гнойную при остром пиелонефрите, а значит, не позволяют выделить группы риска, усилить терапию и интенсифицировать диагностический алгоритм.

Технический результат, на достижение которого направлено патентуемое изобретение, заключается в разработке способа диагностики стадии острого пиелонефрита и, за счет возможности определения переходной стадии течения острого пиелонефрита, позволяющего спрогнозировать вероятность развития гнойных осложнений.

Для достижения указанного технического результата в заявляемом способе осуществляют подготовку образцов крови больных острым пиелонефритом для проведения флуоресцентной in situ гибридизации и с использованием люминисцентной микроскопии определяют количество адгезированных на поверхности эритроцитов и внутриэритроцитарно расположенных бактерий и рассчитывают интегральный показатель по формуле:

ИП=1,3-0,4×Х1+1,4×Х2,

где X1 - общее количество всех адгезированных бактерий на поверхности эритроцитов в образце крови больного, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6,

X2 - общее количество всех внутриэритроцитарно расположенных бактерий в образце крови больного, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6,

при этом при значении интегрального показателя меньше 3 - серозная стадия, при значении от 3 до 6 - переходная, а при значении больше 6 - гнойная стадия.

Техническим результатом изобретения является тот факт, что заявляемый способ позволяет диагностировать стадии острого пиелонефрита и за счет определения переходной стадии течения острого пиелонефрита спрогнозировать вероятность развития гнойных осложнений, а именно переход серозной стадии в гнойную. Также способ позволяет не только обнаружить бактерии находящиеся внутри и на поверхности эритроцитов, но и одновременно их идентифицировать.

Авторами экспериментально установлена информативность определения количества адгезированных на поверхности эритроцитов и внутриэритроцитарно расположенных бактерий и установлены пороговые значения показателей, позволяющие диагностировать стадии острого пиелонефрита: серозную, переходную и гнойную.

Авторами были проведены следующие эксперименты. Известен современный молекулярно-генетический метод флуоресцентной in situ гибридизации (FISH), в котором используются флуоресцирующие молекулы для детекции специфических фрагментов ДНК и РНК [Sladjana Malic et. al. Detection and identification of specific bacteria in wound biofilms using peptide nucleic acid fluorescent in situ hybridization (PNA FISH). // Microbiology, 2009, №155, р. 2603-2611]. Материалом для исследования методом FISH может служить кровь, костный мозг, биоптат и др. В исследуемых образцах FISH позволяет выявлять нуклеиновые кислоты в клеточных структурах, морфологию и одновременно проводить идентификацию микроорганизмов.

Авторы с помощью метода FISH с использованием нескольких видов ДНК-зондов, исследовали 45 образцов крови больных с диагнозом: «Острый пиелонефрит». Перечень нуклеотидных последовательностей, входящих в состав ДНК-зондов, представлены в Приложении 1. Данные ДНК-зонды были синтезированы в ООО «ДНК-синтез» (Москва) и на 5'-конце были помечены красителем флуоресцеина изотиоцианатом (FITC), позволяющим обнаружить свечения (бактерий) в люминесцентной микроскопии.

Известно, что при остром пиелонефрите основными возбудителями являются грамотрицательные условно-патогенные микроорганизмы (до 76,9%) и бактерии рода Staphylococcus [Плеханов А.Н., Дамбаев А.Б. Инфекция мочевых путей: эпидемиология, этиология, патогенез, факторы риска, диагностика (обзор литературы). // Бюллетень ВСНЦ СО РАМН, 2016, Т. 1, №107, С. 70-74].

Поэтому авторами для проведения метода флуоресцентной in situ гибридизации использовались характерные виды олигонуклеотидных зондов, комплементарных видоспецифическим участкам гена 16S рРНК микроорганизмов, как наиболее часто встречающихся возбудителей при воспалении почек.

Для выявления моно- или полимикробной инфекции авторы использовали одновременно все виды олигонуклеотидных зондов при обработке одного образца крови обследуемого больного.

В исследуемых образцах крови, используя метод FISH и люминесцентную микроскопию, авторы подсчитывали количество адгезированных на поверхности эритроцитов и внутриэритроцитарно расположенных бактерий. Также авторы изучили образцы крови указанных выше 45 больных, используя бактериологический метод выделения гемокультур.

Как видно из таблицы 1, метод FISH является более чувствительным, чем бактериологический метод. С помощью бактериологического метода удалось выявить наличие гемокультуры только у 6,6±1,2% обследуемых больных, в то время как метод FISH показал наличие гемокультур у 30±5,8% больных острым пиелонефритом.

Для диагностики стадии острого пиелонефрита и определения вероятности развития гнойных осложнений острого пиелонефрита авторы с помощью метода FISH определили процент бактериальных клеток адгезированных на поверхности эритроцитов и внутриэритроцитарно расположенных бактерий с использованием данных ДНК-зондов. Далее полученные результаты сопоставили с клиническим анамнезом больных острым пиелонефритом. Результаты представлены в таблице 2.

Из представленной таблицы 2 видно, что в образцах крови обследуемых больных острым пиелонефритом наблюдали свечение как адгезированных бактерий на поверхности эритроцитов, так и внутриэритроцитарное расположение, но в разном процентном соотношении.

Авторы выявили, что при адгезии бактерий к поверхности эритроцитов в 26 раз чаще наблюдали свечение с ДНК-зондом (Oligo 1), характерного для представителей семейства Enterobacteriaceae в группе больных с гнойной стадией острого пиелонефрита, чем в группе с серозной стадией и в 5,3 раза чаще, чем в группе с переходной стадией, что составляло 47±5,9% против 1,8±0,7 и 8,9±3,8 (%) соответственно (при р<0,05). Среди ДНК-зондов, характерных для стафилококков, в 34,6 раз чаще наблюдали свечение бактерий S. aureus (Oligo 3) в группе больных с гнойной стадией, чем в группе с серозной и в 8,6 раз чаще, чем больные с переходной стадией острого пиелонефрита, что составляло 20,8±4,1% против 2,4±4,1 и 0,6±0,2 (%) соответственно (при р<0,05).

Необходимо отметить, что свечение бактерий с Oligo 5 - комплементарные таксон-специфическим участкам гена S. epidermidis наблюдали в образцах крови только у больных с гнойной стадией.

Аналогичные результаты оказались и при внутриэритроцитарном проникновении бактерий в образцах крови обследуемых больных.

Авторы отметили, что при изучении образцов крови обследуемых больных с серозной и переходной стадий (n=40) свечения от бактерий наблюдали, но гораздо реже. Авторы предположили, что бактерии появляются в серозной стадии острого пиелонефрита за долго до деструкции (образование гнойничковых очагов в паренхиме почки) и увеличивается их количество в переходной стадии. Данные бактерии могут быть «предвестниками» перехода из серозной стадии в гнойную при остром пиелонефрите.

Авторы провели статистический анализ полученных данных, результаты которого позволили получить регрессионную модель, описывающую взаимосвязь между количеством адгезированных на поверхности эритроцитов и внутриэритроцитарно расположенных бактерий и развитием стадий острого пиелонефрита.

Регрессионная модель представляет собой интегральный показатель, значения которого позволили получить диапазоны соответствующих стадий при развитии острого пиелонефрита.

Интегральный показатель (ИП) рассчитывается по формуле:

ИП=1,3-0,4×X1+1,4×X2,

где X1 - общее количество всех адгезированных бактерий на поверхности эритроцитов в образце крови больного, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6,

X2 - общее количество всех внутриэритроцитарно расположенных бактерий в образце крови больного, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6.

По результатам значений ИП и клинически подтвержденных диагнозов авторы получили диапазоны значений для дифференциаций стадий острого пиелонефрита, которые представлены в таблице 3.

Как видно из таблицы 3, что чем больше значения интегрального показателя (количество адгезированных на поверхности эритроцитов и внутриэритроцитарно расположенных бактерий), тем больше вероятность развития гнойной стадии острого пиелонефрита и соответственно тяжелее состояние больного.

Таким образом, заявляемый способ позволяет диагностировать стадии острого пиелонефрита с возможностью обнаружения и одновременной идентификации микроорганизмов (по известным ДНК-зондам), находящихся как на поверхности, так и внутри эритроцитов в образцах крови больных острым пиелонефритом.

Способ осуществляется следующим образом:

1) Кровь от обследуемого больного трехкратно отмывают фосфатно-солевым буфером (ФСБ) (рН=7,4) центрифугированием при 1000 об/мин в течение 5 мин, доводят эритроциты до одномиллионной концентрации клеток в миллилитре и готовят для проведения флуоресцентной in situ гибридизации.

2) С помощью люминесцентной микроскопии выявляют и одновременно идентифицируют бактерии по соответствующим зондам в образцах крови обследуемого больного.

3) Рассчитывают интегральный показатель по формуле:

ИП=1,3-0,4×Х1+1,4×Х2,

где X1 - общее количество всех адгезированных бактерий на поверхности эритроцитов в образце крови больного, обработанного зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6,

X2 - общее количество всех внутриэритроцитарно расположенных бактерий в образце крови больного, обработанного зондами: Oligo 1, Oligo2, Oligo 3, Oligo 5, Oligo 6.

4) Диагностируют стадию острого пиелонефрита: при значении ИП меньше 3 - серозная стадия, при значении от 3 до 6 - переходная, а при значении больше 6 - гнойная стадия.

Примеры конкретного выполнения способа:

Пример 1. Больная С., 1975 г.р. поступила в ООКБ №1 с предварительным диагнозом: «Острый левосторонний пиелонефрит». При осмотре предъявляла жалобы на повышение температуры тела до 38,6°С, тошноту, однократную рвоту, боли в левой поясничной области и в левых отделах живота, при пальпации отмечается умеренная болезненность в проекции левой почки,

Симптом Пастернацкого положительный слева, мочеиспускание не нарушено.

Для диагностики стадии острого пиелонефрита и определения вероятности развития гнойных осложнений провели исследование образца крови обследуемой больной согласно заявляемому способу.

Исследуемую кровь трехкратно отмывали фосфатно-солевым буфером (ФСБ) (рН=7,4) центрифугированием при 1000 об/мин в течение 5 мин и доводили до одномиллионной концентрации клеток в миллилитре. Пробу объемом 1 мл осаждали центрифугированием при 1000 об/мин в течение 5 мин и ресуспендировали в 400 мкл 0,5% раствора глутарового альдегида, фиксировали в течение 30 мин при 25°С. Фиксированные клетки промывали ФСБ (рН=7,4) и ресуспендировали в растворах этанола с восходящей концентрацией 50, 80 и 100% по 400 мкл каждого раствора с последующей инкубацией в течение 10 мин при 4°С. Эритроциты промывали ФСБ (рН=7,4) центрифугированием при 1000 об/мин в течение 5 мин и ресуспендировали в 300 мкл дистиллированной воде. Аликвоты по 100 мкл фиксированных клеток осаждали центрифугированием при 1000 об/мин в течение 5 мин и ресуспендировали в 100 мкл буферного раствора для гибридизации (0,9 М NaCl и 20 mM Tris-HCl, рН=7), содержащего 500 нМ соответствующего ДНК-зонда, меченного на 5'-конце флуоресцеина изотиоцианатом (FITC) (ООО «ДНК-синтез», Москва).

Далее в исследуемой пробе проводили гибридизацию в течение 5 ч при температуре соответствующей температуре отжига для каждого вида зонда. Для ДНК-зонда, характерного Enterobacteriaceae (Oligo 1) температура отжига соответствует 53,8°С, для Oligo 2 - 32,5°С, для Oligo 3 - 39,3°С, для Oligo 5 - 45,5°С и для Oligo 6 - 54,0°С. После гибридизации клетки центрифугировали при 1000 об/мин в течение 5 мин и добавляли 500 мкл промывочного раствора для удаления ДНК-зондов, не связавшихся с ДНК исследуемых бактерий, инкубировали в течение 30 мин при соответствующей температуре каждого зонда. Пробу центрифугировали и ресуспендировали в 300 мкл ФСБ. Эритроциты дополнительно окрашивали синим Эванса. С помощью люминесцентной микроскопии выявили 23 свечения адгезированных на поверхности эритроцитов и 13 свечений - внутриэритроцитарно расположенных бактерий. Далее рассчитывали интегральный показатель по формуле:

ИП=1,3-0,4×Х1+1,4×Х2

X1=23 - общее количество всех адгезированных бактерий на поверхности эритроцитов в образце крови больной, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6,

X2=13 - общее количество всех внутриэритроцитарно расположенных бактерий в образце крови больной, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6. Полученные экспериментальные значения были использованы для расчета интегрального показателя по вышеуказанной формуле:

ИП=1,3-0,4×23+1,4×13=10,3

В результате расчета получили значение интегрального показателя равное 10,3 и согласно заявляемому способу диагностировали гнойную стадию острого пиелонефрита.

По соответствующим зондам одновременно провели идентификацию бактерий в образцах крови обследуемой больной. Специфическое свечение обнаружили с зондами Oligol (11 свечений - адгезированных на поверхности эритроцитов и 7 свечений - внутри эритроцитов) и Oligo 3 (12 свечений - адгезированных на поверхности эритроцитов и 6 свечений - внутри эритроцитов), комплементарных видоспецифическим участкам гена 16S рРНК микроорганизмов Enterobacteriaceae и Staphylococcus aureus, соответственно. У больной С.выявили полимикробную инфекцию.

Последующее наблюдение пациентки на основе клинических и лабораторных показателей подтвердило диагностированную гнойную стадию острого пиелонефрита и был выставлен диагноз: «Острый гнойный пиелонефрит слева. Карбункул левой почки». Больная была оперирована - произвели люмботомию слева, в области нижнего сегмента обнаружили карбункул с абссцедированием, который рассекли. Была выполнена декапсуляция левой почки, дренирование забрюшинного пространства. В последствие, больная С. была выписана с выздоровлением на 14 день.

Пример 2. Больная Ф., 1967 г.р. поступила в ООКБ №1 с предварительным диагнозом: «Острый правосторонний пиелонефрит». При осмотре предъявляла жалобы на повышение температуры тела до 38,7°С, боли в правой поясничной области и в правой половине живота, в проекции правой почки.

Аналогично примеру 1 провели исследование образца крови обследуемой больной согласно заявляемому способу.

При люминесцентной микроскопии образца крови обследуемой больной специфического свечения не обнаружили.

Далее рассчитывали интегральный показатель по формуле:

ИП=1,3-0,4×Х1+1,4×Х2

X1=0 - общее количество всех адгезированных бактерий на поверхности эритроцитов в образце крови больной, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6,

X2=0 - общее количество всех внутриэритроцитарно расположенных бактерий в образце крови больной, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6.

ИП=1,3-0,4×0+1,4×0=1,3.

В результате расчета получили значение интегрального показателя равное 1,3 и согласно заявляемому способу диагностировали серозную стадию острого пиелонефрита, не требующую оперативного лечения.

Последующее наблюдение пациентки на основе клинических и лабораторных показателей подтвердило диагностированную серозную стадию острого пиелонефрита и был выставлен диагноз: «Острый серозный пиелонефрит справа».

Пример 3. Больная Р., 1991 г.р. поступила в ООКБ №1 с предварительным диагнозом: «Острый левосторонний пиелонефрит». При осмотре предъявляла жалобы на повышение температуры тела до 37,9°С, боли в левой поясничной области и в левой половине живота, в проекции левой почки.

Аналогично примеру 1 провели исследование образца крови обследуемой больной согласно заявляемому способу.

При люминесцентной микроскопии обнаружили 5 свечений адгезированных на поверхности эритроцитов и 3 свечения внутриэритроцитарно расположенных бактерий.

Далее рассчитывали интегральный показатель по формуле:

ИП=1,3-0,4×Х1+1,4×Х2

X1=5 - общее количество всех адгезированных бактерий на поверхности эритроцитов в образце крови больной, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6,

X2=3 - общее количество всех внутриэритроцитарно расположенных бактерий в образце крови больной, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6.

ИП=1,3-0,4×5+1,4×3=3,5

В результате расчета получили значение интегрального показателя равное 3,5 и согласно заявляемому способу диагностировали переходную стадию острого пиелонефрита, что свидетельствовало о возможности развития гнойных осложнений.

Провели идентификацию бактерий по соответствующим зондам в образцах крови обследуемой больной. Специфическое свечение обнаружили с зондом Oligo 1, комплементарного видоспецифическим участкам гена 16S рРНК микроорганизмов соответствующих семейству Enterobacteriaceae.

В условиях стационара начато внутривенное дезинтоксикационное лечение и введение антибиотиков (фторхинолоны, цефалоспорины III поколения). Через 5 дней обследуемой больной было выполнено повторное исследование крови и при люминесцентной микроскопии специфического свечения не обнаружили.

Далее рассчитали интегральный показатель по формуле:

ИП=1,3+0,4×Х1+1,4×Х2

X1=0 - общее количество всех адгезированных бактерий на поверхности эритроцитов в образце крови больной, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6,

X2=0 - общее количество всех внутриэритроцитарно расположенных бактерий в образце крови больной, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6.

ИП=1,3-0,4×0+1,4×0=1,3

В результате расчета получили значение интегрального показателя равное 1,3 и согласно заявляемому способу диагностировали серозную стадию острого пиелонефрита, не требующую оперативного лечения.

Последующее наблюдение пациентки на основе клинических и лабораторных показателей подтвердило диагностированную серозную стадию острого пиелонефрита и был выставлен клинический диагноз «Острый серозный пиелонефрит слева». Консервативное лечение было продолжено. После курса традиционной консервативной терапии состояние больной стало улучшаться и на 10 день больная Р. была выписана из стационара с выздоровлением.

Таким образом, заявляемый способ позволяет диагностировать стадии острого пиелонефрита и за счет определения переходной стадии течения острого пиелонефрита спрогнозировать вероятность развития гнойных осложнений, а именно переход серозной стадии в гнойную. Также способ позволяет не только обнаружить бактерии находящиеся внутри и на поверхности эритроцитов, но и одновременно их идентифицировать. Данный способ гораздо дешевле и более легкий в обработке исследуемого материала, чем ПЦР-анализ гемокультуры и метод мультиплексного ПЦР-анализа в режиме реального времени и может достаточно широко применяться в условиях клинико-диагностических лабораторий.

Способ диагностики стадии острого пиелонефрита, характеризующийся тем, что осуществляют подготовку образцов крови больных острым пиелонефритом для проведения флуоресцентной in situ гибридизации, с использованием люминесцентной микроскопии определяют количество адгезированных на поверхности эритроцитов и внутриэритроцитарно расположенных бактерий и рассчитывают интегральный показатель (ИП) по формуле:

ИП=1,3-0,4×X1+1,4×X2,

где: X1 - общее количество всех адгезированных бактерий на поверхности эритроцитов в образце крови больного, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6,

X2 - общее количество всех внутриэритроцитарно расположенных бактерий в образце крови больного, обработанных зондами: Oligo 1, Oligo 2, Oligo 3, Oligo 5, Oligo 6,

где Oligo 1 представляет собой ДНК-зонд, полученный из Enterobacteriaceae, имеющий нуклеотидную последовательность ATGTAAGCTCCTGGGGATT-САС; Oligo 2 представляет собой ДНК-зонд, полученный из Pseudomonas aeruginosa, имеющий нуклеотидную последовательность AACTTGCTGAAC-САС; Oligo 3 представляет собой ДНК-зонд, полученный из Staphylococcus aureus, имеющий нуклеотидную последовательность GCTTCTCGTCCGTTC; Oligo5 представляет собой ДНК-зонд, полученный из Staphylococcus epidermidis, имеющий нуклеотидную последовательность ACTCTATCTCTAGAGGGGTCAG; Oligo 6 представляет собой ДНК-зонд, полученный из Staphylococcus spp., имеющий нуклеотидную последовательность TCCTCCATATCTCTGCGC,

и при значении интегрального показателя меньше 3 диагностируют серозную стадию, при значении от 3 до 6 - переходную стадию, а при значении больше 6 - гнойную стадию острого пиелонефрита.



 

Похожие патенты:

Изобретение относится к медицине, а именно к оториноларингологии, и может быть использовано для диагностики хронических заболеваний глотки, таких как компенсированная и декомпенсированная формы хронического тонзиллита, и хронический фарингит.

Изобретение относится к медицине, а именно к лабораторной диагностике, и позволяет диагностировать локальную эндогенную интоксикацию при заболеваниях слизистой оболочки.

Изобретение относится к медицине, а именно к урологии, в частности к лечению мочекаменной болезни. Предложен способ, в котором пациент, с помощью компьютерной программы, установленной в мобильном приложении, передает показатели анализатора в отдел обработки информации на дистанционно-консультативный портал, состоящий из врачей-урологов, данные автоматически отражаются в ленте здоровья пациента, после чего врач осуществляет динамическое дистанционное мониторирование рН мочи пациента и при необходимости корректирует дозировку и кратность приема препарата.

Изобретение относится к области медицины, в частности к способу прогнозирования индивидуального риска развития бронхиальной астмы (БА) у человека на различные по продолжительности периоды жизни.

Изобретение относится к области медицины и представляет собой способ определения сроков пребывания на втором этапе ранней реабилитации пациентов с производственными травмами, включающий обследование пациента, проведение курсовой программы реабилитации, рассчитанной на 21 день, состоящей из физиотерапевтических, бальнеологических процедур и лечебной гимнастики, отличающийся тем, что в начале курсовой программы реабилитации и через пять дней ее выполнения у пациента проводят забор капиллярной крови из пальца и по формуле периферической крови проводят оценку адаптационной реакции организма, по результатам которой определяют срок пребывания на втором этапе ранней реабилитации: при реакции тренировки - 21 день, при реакции активации - 21 день, при реакции спокойной активации - 21 день плюс 10 дней, при реакции повышенной активации - 21 день плюс 14 дней, при реакции стресс острый - 21 день плюс 18 дней, при реакции стресс хронический - 21 день плюс 21 день, при добавлении дополнительных дней проводят корректировку расстановки процедур по дням.

Изобретение относится к области медицины, в частности к иммунологии и клинической лабораторной диагностике, и предназначено для обнаружения внеклеточной ДНК в цельной периферической крови.

Изобретение относится к медицине и может быть использовано для определения метаболизма фибрина у пациента путем цифровой микроскопии нативной крови. Для этого каплю крови, взятую у пациента без задержек, накрывают покровным стеклом и размещают на оптической поверхности предметного столика микроскопа.

Группа изобретений относится к медицине, а именно цитологии, и может быть использовано для оценки цитогенетического и цитотоксического действия различных факторов на гепатоциты экспериментальных животных и человека.

Группа изобретений относится к медицине, а именно цитологии, и может быть использовано для оценки цитогенетического и цитотоксического действия различных факторов на гепатоциты экспериментальных животных и человека.
Изобретение относится к медицине, а именно к гематологии, биохимии, имплантологии, и может быть использовано для оценки интеграции остеозамещающего материала в эксперименте.

Изобретение относится к медицине и может быть использовано для диагностики стадии острого пиелонефрита. Для этого осуществляют подготовку образцов крови пациентов с острым пиелонефритом. Затем проводят флуоресцентную in situ гибридизацию с использованием люминесцентной микроскопии. Определяют количество адгезированных на поверхности эритроцитов и внутриэритроцитарно расположенных бактерий. При значении интегрального показателя меньше 3 диагностируют серозную стадию. При значении интегрального показателя от 3 до 6 диагностируют переходную стадию. При значении интегрального показателя больше 6 диагностируют гнойную стадию острого пиелонефрита. Изобретение позволяет диагностировать стадии острого пиелонефрита и определить вероятность развития гнойных осложнений у пациента. 3 пр., 3 табл.

Наверх