Аденоассоциированные вирусные векторы для лечения миоцилиновой (myoc) глаукомы

Группа изобретений относится к области медицины, а именно к офтальмологии, и предназначена для лечения миоцилиновой (MYOC) глаукомы у млекопитающего. Способ лечения MYOC-глаукомы включает введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащего вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4, усеченный RSPO1, усеченный RSPO2, усеченный RSPO3 или усеченный RSPO4. Усеченный RSPO1, усеченный RSPO2, усеченный RSPO3 или усеченный RSPO4 содержит один или более фуриноподобных доменов, богатых Cys, но не имеет одного или более из: сигнального пептида, домена тромбоспондина типа 1 и/или C-концевого положительно заряженного домена. Другая альтернатива способа лечения MYOC-глаукомы у млекопитающего заключается во введении в глаз млекопитающего частицы rAAV, содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4, и частицы rAAV, содержащей вектор, кодирующий средство для RNAi в отношении MYOC, причем средство для RNAi в отношении MYOC представляет собой малую ингибирующую РНК (siRNA), микроРНК (miRNA) или малую шпилечную РНК (shRNA). Также обеспечиваются указанные выше рекомбинантные частицы AAV и их содержащие наборы для лечения миоцилиновой глаукомы у млекопитающего. Использование группы изобретений позволяет усилить передачу сигналов Wnt в глазу млекопитающего, обеспечивая тем самым эффективное лечение миоцилиновой глаукомы у млекопитающего. 6 н. и 14 з.п. ф-лы, 15 ил., 6 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

По этой заявке испрашивается приоритет временной заявки США № 62/051299, поданной 16 сентября 2014 года, которая полностью включена в настоящее описание посредством ссылки.

ПРЕДСТАВЛЕНИЕ ПЕРЕЧНЯ ПОСЛЕДОВАТЕЛЬНОСТЕЙ В ТЕКСТОВОМ ФАЙЛЕ ASCII

Содержание нижеследующего представленного текстового файла ASCII включено в данный документ посредством ссылки во всей своей полноте: машиночитаемая форма (CRF) перечня последовательностей (название файла: 159792012540SeqList.txt, дата составления: 15 сентября 2015 года, размер: 31 кБ).

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Настоящее изобретение относится к векторам на основе AAV и способам применения векторов на основе AAV для лечения миоцилиновой (MYOC) глаукомы.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Миоцилиновые (MYOC) мутации обуславливают 2%-4% случаев первичной открытоугольной глаукомы (POAG; ~90000 пациентов в США). В частности, глаукоматозные мутации MYOC P370L или Y437H обуславливают 10%-30% случаев ювенильной формы POAG (JOAG; ~6000 пациентов в США) и связаны с повышенным внутриглазным давлением (IOP), гибелью ганглиозных клеток сетчатки и повреждением головки зрительного нерва (ONH) (Shimizu et al. (2000) Am. J. Ophthalmol. 130:165-77; Fan и Wiggs (2010) J. Clin. Invest. 120:3064-72).

Несмотря на наличие взаимосвязи между мутациями MYOC и глаукомой, эффект мутантов MYOC на глазную функцию остается неясным. Соответственно, необходимо дополнительное понимание функции MYOC и мутантного MYOC для раскрытия новых терапевтических стратегий лечения миоцилиновой (MYOC) глаукомы.

Настоящее изобретение предусматривает способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, включающие введение в глаз млекопитающего средства, которое усиливает передачу сигнала Wnt в глазу млекопитающего. В некоторых вариантах осуществления средство усиливает передачу сигнала Wnt в клетке трабекулярной сети (TM) глаза млекопитающего. В некоторых вариантах осуществления средство усиливает активность R-спондина 1 (RSPO1), R-спондина 2 (RSPO2), R-спондина 3 (RSPO3) и/или R-спондина 4 (RSPO4) в глазу млекопитающего. В некоторых вариантах осуществления средство применяют в комбинации с одним или несколькими дополнительными средствами, которые усиливают один или несколько видов активности RSPO в глазу млекопитающего. В некоторых вариантах осуществления средство усиливает активность RSPO1 в TM глаза млекопитающего. В некоторых вариантах осуществления средство представляет собой RSPO1 или его функциональный вариант. В некоторых вариантах осуществления средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащую вектор, кодирующий RSPO1 или его функциональный вариант. В некоторых вариантах осуществления RSPO1 представляет собой усеченный RSPO1. В некоторых вариантах осуществления средство усиливает активность RSPO2 в TM глаза млекопитающего. В некоторых вариантах осуществления средство представляет собой RSPO2 или его функциональный вариант. В некоторых вариантах осуществления средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащую вектор, кодирующий RSPO2 или его функциональный вариант. В некоторых вариантах осуществления RSPO2 представляет собой усеченный RSPO2. В некоторых вариантах осуществления средство усиливает активность RSPO3 в TM глаза млекопитающего. В некоторых вариантах осуществления средство представляет собой RSPO3 или его функциональный вариант. В некоторых вариантах осуществления средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащую вектор, кодирующий RSPO3 или его функциональный вариант. В некоторых вариантах осуществления RSPO3 представляет собой усеченный RSPO3. В некоторых вариантах осуществления средство усиливает активность RSPO4 в TM глаза млекопитающего. В некоторых вариантах осуществления средство представляет собой RSPO4 или его функциональный вариант. В некоторых вариантах осуществления средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащую вектор, кодирующий RSPO4 или его функциональный вариант. В некоторых вариантах осуществления RSPO4 представляет собой усеченный RSPO4.

В некоторых аспектах в настоящем изобретении предусматривают введение второго средства, которое усиливает передачу сигнала Wnt в глазу млекопитающего. В некоторых вариантах осуществления второе средство усиливает передачу сигнала Wnt в TM глаза млекопитающего. В некоторых вариантах осуществления второе средство снижает или ингибирует экспрессию миоцилина (MYOC) в глазу млекопитающего. В некоторых вариантах осуществления второе средство снижает или ингибирует экспрессию MYOC в TM глаза млекопитающего. В некоторых вариантах осуществления второе средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащую вектор, кодирующий ингибирующую нуклеиновую кислоту, которая целенаправленно воздействует на экспрессию MYOC. В некоторых вариантах осуществления ингибирующая нуклеиновая кислота представляет собой средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию MYOC. В некоторых вариантах осуществления средство для RNAi в отношении MYOC представляет собой shRNA для MYOC, которая целенаправленно воздействует на экспрессию MYOC.

В некоторых аспектах средство по настоящему изобретению снижает или ингибирует экспрессию миоцилина (MYOC) в глазу млекопитающего. В некоторых вариантах осуществления средство снижает или ингибирует экспрессию MYOC в TM глаза млекопитающего. В некоторых вариантах осуществления средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащую вектор, кодирующий ингибирующую нуклеиновую кислоту, которая целенаправленно воздействует на экспрессию MYOC. В некоторых вариантах осуществления ингибирующая нуклеиновая кислота представляет собой средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию MYOC. В дополнительных вариантах осуществления средство для RNAi в отношении MYOC представляет собой shRNA для MYOC, которая целенаправленно воздействует на экспрессию MYOC.

В некоторых вариантах осуществления настоящего изобретения способы дополнительно включают введение второго средства, которое усиливает передачу сигнала Wnt в глазу млекопитающего. В некоторых вариантах осуществления второе средство усиливает передачу сигнала Wnt в TM глаза млекопитающего. В некоторых вариантах осуществления второе средство усиливает активность R-спондина 1 (RSPO1), R-спондина 2 (RSPO2), R-спондина 3 (RSPO3) или R-спондина 4 (RSPO4) в глазу млекопитающего. В некоторых вариантах осуществления второе средство усиливает активность RSPO1 в TM глаза млекопитающего. В некоторых вариантах осуществления второе средство представляет собой RSPO1 или его функциональный вариант. В некоторых вариантах осуществления второе средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащую вектор, кодирующий RSPO1 или его функциональный вариант. В некоторых вариантах осуществления RSPO1 представляет собой усеченный RSPO1. В некоторых вариантах осуществления второе средство усиливает активность RSPO2 в TM глаза млекопитающего. В некоторых вариантах осуществления второе средство представляет собой RSPO2 или его функциональный вариант. В некоторых вариантах осуществления второе средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащую вектор, кодирующий RSPO2 или его функциональный вариант. В некоторых вариантах осуществления RSPO2 представляет собой усеченный RSPO2. В некоторых вариантах осуществления второе средство усиливает активность RSPO3 в TM глаза млекопитающего. В некоторых вариантах осуществления второе средство представляет собой RSPO3 или его функциональный вариант. В некоторых вариантах осуществления второе средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащую вектор, кодирующий RSPO3 или его функциональный вариант. В некоторых вариантах осуществления RSPO3 представляет собой усеченный RSPO3. В некоторых вариантах осуществления второе средство усиливает активность RSPO4 в TM глаза млекопитающего. В некоторых вариантах осуществления второе средство представляет собой RSPO4 или его функциональный вариант. В некоторых вариантах осуществления второе средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащего вектор, кодирующий RSPO4 или его функциональный вариант. В некоторых вариантах осуществления RSPO4 представляет собой усеченный RSPO4.

В некоторых аспектах настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант. В некоторых аспектах настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего. В других аспектах настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, включающие введение в глаз млекопитающего средства, которое усиливает передачу сигнала Wnt в глазу млекопитающего, и средства, которое снижает или ингибирует экспрессию миоцилина у млекопитающего. В других аспектах настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и частицы rAAV, содержащей вектор, кодирующий средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию миоцилина у млекопитающего. Еще в других аспектах настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и кодирующий shRNA для MYOC, которая целенаправленно воздействует на экспрессию миоцилина (shRNA для MYOC) у млекопитающего. В некоторых вариантах осуществления средство для RNAi представляет собой shRNA, целенаправленно воздействующую на MYOC. В некоторых вариантах осуществления shRNA снижает или ингибирует экспрессию MYOC.

В некоторых аспектах настоящего изобретения предусматривают способы усиления передачи сигнала Wnt в клетках трабекулярной сети млекопитающего, имеющего глазное нарушение, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант. В некоторых аспектах настоящего изобретения предусматривают способы усиления передачи сигнала Wnt в клетках трабекулярной сети млекопитающего, имеющего глазное нарушение, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий ингибирующую нуклеиновую кислоту, которая целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего. В других аспектах настоящего изобретения предусматривают способы усиления передачи сигнала Wnt в клетках трабекулярной сети млекопитающего, имеющего глазное нарушение, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего. В других аспектах настоящего изобретения предусматривают способы усиления передачи сигнала Wnt в клетках трабекулярной сети млекопитающего, имеющего глазное нарушение, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и частицы rAAV, содержащей вектор, кодирующий средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию миоцилина у млекопитающего. В других аспектах настоящего изобретения предусматривают способы усиления передачи сигнала Wnt в клетках трабекулярной сети млекопитающего, имеющего глазное нарушение, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4, или их функциональный вариант и кодирующий средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего. В некоторых вариантах осуществления глазное нарушение представляет собой миоцилиновую (MYOC) глаукому.

В некоторых вариантах осуществления млекопитающее является человеком. В некоторых вариантах осуществления настоящего изобретения миоцилиновая (MYOC) глаукома связана с мутацией миоцилина. В некоторых вариантах осуществления миоцилиновая (MYOC) глаукома связана с мутацией миоцилина человека. В некоторых вариантах осуществления мутация миоцилина предусматривает одну или несколько аминокислотных замен, выбранных из E323K, K398R, Q368X, G364V, P370L, D380A, K423E, Y437H, и I477S. В некоторых вариантах осуществления мутация миоцилина предусматривает аминокислотную замену P370L. В некоторых вариантах осуществления мутация миоцилина предусматривает аминокислотную замену Y437H. В некоторых вариантах осуществления миоцилиновая (MYOC) глаукома представляет собой первичную открытоугольную глаукому (POAC). В некоторых вариантах осуществления миоцилиновая (MYOC) глаукома представляет собой ювенильную форму первичной открытоугольной глаукомы (JOAC). В некоторых вариантах осуществления настоящего изобретения лечение облегчает симптом миоцилиновой (MYOC) глаукомы. В некоторых вариантах осуществления облегчение симптома миоцилиновой (MYOC) глаукомы представляет собой снижение внутриглазного давления, снижение накопления MYOC в трабекулярной сети, снижение глазной гипертензии или усиление оттока водянистой влаги из трабекулярной сети.

В некоторых вариантах осуществления RSPO1 представляет собой RSPO1 человека. В некоторых вариантах осуществления RSPO1 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с RSPO1 человека. В некоторых вариантах осуществления RSPO1 содержит аминокислотную последовательность под SEQ ID NO: 8. В некоторых вариантах осуществления RSPO1 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 8. В некоторых вариантах осуществления RSPO1 содержит аминокислотную последовательность под SEQ ID NO: 11. В некоторых вариантах осуществления RSPO1 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 11. В некоторых вариантах осуществления RSPO1 содержит аминокислотную последовательность под SEQ ID NO: 12. В некоторых вариантах осуществления RSPO1 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 12. В некоторых вариантах осуществления RSPO2 представляет собой RSPO2 человека. В некоторых вариантах осуществления RSPO2 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с RSPO2 человека. В некоторых вариантах осуществления RSPO2 содержит аминокислотную последовательность под SEQ ID NO: 9. В некоторых вариантах осуществления RSPO2 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 9. В некоторых вариантах осуществления RSPO2 содержит аминокислотную последовательность под SEQ ID NO: 13. В некоторых вариантах осуществления RSPO2 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 13. В некоторых вариантах осуществления RSPO2 содержит аминокислотную последовательность под SEQ ID NO: 14. В некоторых вариантах осуществления RSPO2 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 14. В некоторых вариантах осуществления RSPO3 представляет собой RSPO3 человека. В некоторых вариантах осуществления RSPO3 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с RSPO3 человека. В некоторых вариантах осуществления RSPO3 содержит аминокислотную последовательность под SEQ ID NO: 1. В некоторых вариантах осуществления RSPO3 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 1. В некоторых вариантах осуществления RSPO3 содержит аминокислотную последовательность под SEQ ID NO: 15. В некоторых вариантах осуществления RSPO3 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 15. В некоторых вариантах осуществления RSPO3 содержит аминокислотную последовательность под SEQ ID NO: 16. В некоторых вариантах осуществления RSPO3 содержит аминокислотную последовательность под SEQ ID NO: 17. В некоторых вариантах осуществления RSPO3 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 17. В некоторых вариантах осуществления RSPO4 представляет собой RSPO4 человека. В некоторых вариантах осуществления RSPO4 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с RSPO4 человека. В некоторых вариантах осуществления RSPO4 содержит аминокислотную последовательность под SEQ ID NO: 10. В некоторых вариантах осуществления RSPO4 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 10. В некоторых вариантах осуществления RSPO4 содержит аминокислотную последовательность под SEQ ID NO: 18. В некоторых вариантах осуществления RSPO4 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 18. В некоторых вариантах осуществления RSPO4 содержит аминокислотную последовательность под SEQ ID NO: 19. В некоторых вариантах осуществления RSPO4 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 12. В некоторых вариантах осуществления RSPO1, RSPO2, RSPO3, RSPO4 и/или их функциональный вариант функционально связаны с промотором. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию RSPO1, RSPO2, RSPO3, RSPO4 и/или их функционального варианта в глазу млекопитающего. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию RSPO1, RSPO2, RSPO3, RSPO4 и/или их функционального варианта в клетках трабекулярной сети. В некоторых вариантах осуществления промотор представляет собой гибридный промотор β-актина курицы (CBA).

В некоторых вариантах осуществления средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию MYOC по настоящему изобретению, целенаправленно воздействует на MYOC человека. В некоторых вариантах осуществления средство для RNAi представляет собой малую ингибирующую РНК (siRNA), микроРНК (miRNA) или малую шпилечную РНК (shRNA). В некоторых вариантах осуществления средство для RNAi в отношении MYOC представляет собой shRNA для MYOC. В некоторых вариантах осуществления shRNA целенаправленно воздействует на аминокислотную последовательность MYOC, изложенную под SEQ ID NO: 6. В некоторых вариантах осуществления shRNA содержит последовательность петли под SEQ ID NO: 7. В некоторых вариантах осуществления средство для RNAi в отношении MYOC (например, shRNA) функционально связано с промотором. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию средства для RNAi в отношении MYOC (например, shRNA) в глазу млекопитающего. В дополнительных вариантах осуществления промотор способен обеспечивать экспрессию средства для RNAi в отношении MYOC (например, shRNA) в клетках трабекулярной сети. В некоторых вариантах осуществления промотор представляет собой гибридный промотор β-актина курицы (CBA). В некоторых вариантах осуществления промотор представляет собой промотор РНК-полимеразы III. В некоторых вариантах осуществления экспрессия средства для RNAi в отношении MYOC (например, shRNA) снижает или ингибирует экспрессию MYOC в глазу млекопитающего. В некоторых вариантах осуществления экспрессия средства для RNAi в отношении MYOC (например, shRNA) снижает или ингибирует экспрессию MYOC в клетках трабекулярной сети млекопитающего. В некоторых вариантах осуществления MYOC представляет собой MYOC дикого типа. В некоторых вариантах осуществления MYOC представляет собой мутантный MYOC. В некоторых вариантах осуществления MYOC представляет собой MYOC дикого типа и мутантный MYOC. В дополнительных вариантах осуществления мутантный MYOC содержит аминокислотные замены, соответствующие аминокислотным заменам P370L и/или Y437H в MYOC человека. В некоторых вариантах осуществления мутация миоцилина предусматривает одну или несколько аминокислотных замен, выбранных из E323K, K398R, Q368X, G364V, P370L, D380A, K423E, Y437H и I477S.

В некоторых вариантах осуществления аспектов и вариантов осуществления, описанных выше, вирусная частица AAV содержит AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (например, капсид AAV6 дикого типа или капсид варианта AAV6, такого как ShH10, как описано в публикации заявки на патент США 2012/0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (например, капсид AAV9 дикого типа или капсид модифицированного AAV9, как описано в публикации заявки на патент США 2013/0323226), AAV10, AAVrh10, AAV11, AAV12, мутантного капсида, содержащего тирозин, мутантного капсида с гепарин-связывающим мотивом, капсида AAV2R471A, капсида AAVAAV2/2-7m8, капсида AAV DJ (например, капсид AAV-DJ/8, капсид AAV-DJ/9 или любой другой из капсидов, описанных в публикации заявки на патент США 2012/0066783), капсида AAV2 N587A, капсида AAV2 E548A, капсида AAV2 N708A, капсида AAV V708K, капсида козьего AAV, химерного капсида AAV1/AAV2, капсида бычьего AAV, капсида мышиного AAV, капсида rAAV2/HBoV1, капсида AAV, описанных в патенте США № 8283151 или в Международной публикации № WO/2003/042397. В некоторых вариантах осуществления вирусная частица AAV содержит капсид AAV, содержащий аминокислотную замену в одном или нескольких положениях R484, R487, K527, K532, R585 или R588, нумерация которых приведена согласно VP1 AAV2. В дополнительных вариантах осуществления частица AAV содержит капсидные белки серотипа AAV из клад A-F. В некоторых вариантах осуществления вирусная частица rAAV содержит капсид AAV серотипа 2. В дополнительных вариантах осуществления капсид AAV серотипа 2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых вариантах осуществления вектор содержит инвертированные концевые повторы (ITR) серотипов AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, козьего AAV, бычьего AAV или мышиного AAV. В некоторых вариантах осуществления вектор содержит ITR AAV серотипа 2. В некоторых вариантах осуществления вирусная частица AAV содержит один или несколько ITR и капсид, полученные из одного и того же серотипа AAV. В других вариантах осуществления вирусная частица AAV содержит один или несколько ITR, полученных из серотипа AAV, отличного от такового для капсида вирусных частиц rAAV. В некоторых вариантах осуществления вирусная частица rAAV содержит капсид AAV2, и при этом вектор содержит ITR AAV2. В дополнительных вариантах осуществления капсид AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2.

В некоторых вариантах осуществления млекопитающему вводят по меньшей мере 1×109 копий генома частиц rAAV. В некоторых вариантах осуществления AAV вводят в роговицу, в сетчатку и/или в склеру глаза млекопитающего. В некоторых вариантах осуществления частицу AAV вводят с помощью интравитреальной инъекции и/или интракамеральной инъекции. В некоторых вариантах осуществления rAAV вводят в более чем одно местположение в глазу.

В некоторых вариантах осуществления настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, при этом млекопитающее является человеком. В некоторых вариантах осуществления миоцилиновая (MYOC) глаукома представляет собой первичную открытоугольную глаукому (POAC). В некоторых вариантах осуществления миоцилиновая (MYOC) глаукома представляет собой ювенильную форму первичной открытоугольной глаукомы (JOAC).

В некоторых вариантах осуществления по настоящему изобретению вирусная частица rAAV находится в фармацевтической композиции. В дополнительных вариантах осуществления фармацевтическая композиция дополнительно содержит фармацевтически приемлемый носитель.

В некоторых вариантах осуществления вышеуказанных способов, средство (например, частицу AAV) применяют в комбинации с одним или несколькими дополнительными средствами, которые повышают активность R-спондина (например, RSPO1, RSPO2, RSPO3 и/или RSPO4).

В некоторых аспектах в настоящем изобретении предусматривают рекомбинантные частицы AAV, содержащие вектор на основе AAV, при этом вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант. В других аспектах в настоящем изобретении предусматривают частицы rAAV, содержащие вектор, кодирующий ингибирующую нуклеиновую кислоту, которая целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего. В других аспектах в настоящем изобретении предусматривают частицы rAAV, содержащие вектор, кодирующий средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего. Еще в других аспектах в настоящем изобретении предусматривают частицы rAAV, содержащие вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и кодирующий средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию миоцилина у млекопитающего.

В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1 или его функциональный вариант, и RSPO1 или его функциональный вариант представляют собой RSPO1 человека. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1 или его функциональный вариант, и RSPO1 или его функциональный вариант содержат аминокислотную последовательность под SEQ ID NO: 8, 11 и/или 12. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1 или его функциональный вариант, и RSPO1 или его функциональный вариант содержат аминокислотную последовательность, которая характеризуется 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 8, 11 и/или 12. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO2 или его функциональный вариант, и RSPO2 или его функциональный вариант представляют собой RSPO2 человека. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO2 или его функциональный вариант, и RSPO2 или его функциональный вариант содержат аминокислотную последовательность под SEQ ID NO: 9, 13 и/или 14. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO2 или его функциональный вариант, и RSPO2 или его функциональный вариант содержат аминокислотную последовательность, которая характеризуется 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 9, 13 и/или 14. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO3 или его функциональный вариант, и RSPO3 или его функциональный вариант представляют собой RSPO3 человека. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO3 или его функциональный вариант, и RSPO3 или его функциональный вариант содержат аминокислотную последовательность под SEQ ID NO: 1 и/или 15-17. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO3 или его функциональный вариант, и RSPO3 или его функциональный вариант содержат аминокислотную последовательность, которая характеризуется 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 1 и/или 15-17. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO4, и RSPO4 представляет собой RSPO4 человека. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO4 или его функциональный вариант, и RSPO4 или его функциональный вариант содержат аминокислотную последовательность под SEQ ID NO: 10, 18 и/или 19. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO4 или его функциональный вариант, и RSPO4 или его функциональный вариант содержат аминокислотную последовательность, которая характеризуется 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 10, 18 и/или 19. В дополнительных вариантах осуществления RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант функционально связаны с промотором. В дополнительных вариантах осуществления промотор способен обеспечивать экспрессию RSPO1, RSPO2, RSPO3, RSPO4 или их функционального варианта в глазу млекопитающего. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию RSPO1, RSPO2, RSPO3, RSPO4 или их функционального варианта в клетках трабекулярной сети. В некоторых вариантах осуществления промотор представляет собой гибридный промотор β-актина курицы (CBA).

В некоторых вариантах осуществления ингибирующая нуклеиновая кислота, которая целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего, представляет собой средство для RNAi. В некоторых вариантах осуществления средство для RNAi в отношении MYOC (например, shRNA), которое целенаправленно воздействует на экспрессию MYOC по настоящему изобретению, целенаправленно воздействует на MYOC человека. В некоторых вариантах осуществления средство для RNAi представляет собой малую ингибирующую РНК (siRNA), микроРНК (miRNA) или малую шпилечную РНК (shRNA). В некоторых вариантах осуществления средство для RNAi в отношении MYOC представляет собой shRNA. В некоторых вариантах осуществления средство для RNAi (например, shRNA) целенаправленно воздействует на аминокислотную последовательность MYOC, изложенную под SEQ ID NO: 6. В некоторых вариантах осуществления средство для RNAi (например, shRNA) содержит последовательность петли под SEQ ID NO: 7. В некоторых вариантах осуществления средство для RNAi в отношении MYOC (например, shRNA) функционально связано с промотором. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию средства для RNAi в отношении MYOC (например, shRNA) в глазу млекопитающего. В дополнительных вариантах осуществления промотор способен обеспечивать экспрессию средства для RNAi в отношении MYOC (например, shRNA) в клетках трабекулярной сети. В некоторых вариантах осуществления промотор представляет собой гибридный промотор β-актина курицы (CBA). В некоторых вариантах осуществления промотор представляет собой промотор РНК-полимеразы III. В некоторых вариантах осуществления экспрессия средства для RNAi в отношении MYOC (например, shRNA) снижает или ингибирует экспрессию MYOC в глазу млекопитающего. В некоторых вариантах осуществления экспрессия средства для RNAi в отношении MYOC (например, shRNA) снижает или ингибирует экспрессию MYOC в клетках трабекулярной сети млекопитающего. В некоторых вариантах осуществления MYOC представляет собой MYOC дикого типа. В некоторых вариантах осуществления MYOC представляет собой мутантный MYOC. В некоторых вариантах осуществления MYOC представляет собой MYOC дикого типа и мутантный MYOC. В дополнительных вариантах осуществления мутантный MYOC содержит аминокислотные замены, соответствующие аминокислотным заменам E323K, K398R, Q368X, G364V, P370L, D380A, K423E, Y437H и I477S в MYOC человека. В некоторых вариантах осуществления мутантный MYOC содержит аминокислотные замены, соответствующие аминокислотным заменам P370L и/или Y437H в MYOC человека. В некоторых вариантах осуществления мутация миоцилина связана с первичной открытоугольной глаукомой (POAC). В некоторых вариантах осуществления мутация миоцилина связана с ювенильной формой первичной открытоугольной глаукомы (JOAC).

В некоторых вариантах осуществления аспектов и вариантов осуществления, описанных выше, вирусная частица AAV содержит AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (например, капсид AAV6 дикого типа или капсид варианта AAV6, такого как ShH10, как описано в публикации заявки на патент США 2012/0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (например, капсид AAV9 дикого типа или капсид модифицированного AAV9, как описано в публикации заявки на патент США 2013/0323226), AAV10, AAVrh10, AAV11, AAV12, мутантного капсида, содержащего тирозин, мутантного капсида с гепарин-связывающим мотивом, капсида AAV2R471A, капсида AAVAAV2/2-7m8, капсида AAV DJ (например, капсид AAV-DJ/8, капсид AAV-DJ/9 или любой другой из капсидов, описанных в публикации заявки на патент США 2012/0066783), капсида AAV2 N587A, капсида AAV2 E548A, капсида AAV2 N708A, капсида AAV V708K, капсида козьего AAV, химерного капсида AAV1/AAV2, капсида бычьего AAV, капсида мышиного AAV, капсида rAAV2/HBoV1, капсида AAV, описанных в патенте США № 8283151 или в Международной публикации № WO/2003/042397. В некоторых вариантах осуществления вирусная частица AAV содержит капсид AAV, содержащий аминокислотную замену в одном или нескольких положениях R484, R487, K527, K532, R585 или R588, нумерация которых приведена согласно VP1 AAV2. В дополнительных вариантах осуществления частица AAV содержит капсидные белки серотипа AAV из клад A-F. В некоторых вариантах осуществления вирусная частица rAAV содержит капсид AAV серотипа 2. В дополнительных вариантах осуществления капсид AAV серотипа 2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых вариантах осуществления вектор содержит инвертированные концевые повторы (ITR) серотипов AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, козьего AAV, бычьего AAV или мышиного AAV. В некоторых вариантах осуществления вектор содержит ITR AAV серотипа 2. В некоторых вариантах осуществления вирусная частица AAV содержит один или несколько ITR и капсид, полученные из одного и того же серотипа AAV. В других вариантах осуществления вирусная частица AAV содержит один или несколько ITR, полученных из серотипа AAV, отличного от такового для капсида вирусных частиц rAAV. В некоторых вариантах осуществления вирусная частица rAAV содержит капсид AAV2, и при этом вектор содержит ITR AAV2. В дополнительных вариантах осуществления капсид AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2.

В настоящем изобретении предусматривают фармацевтические композиции, содержащие любые рекомбинантные частицы AAV, описанные в данном документе. В настоящем изобретении также предусматривают фармацевтические композиции, которые являются подходящими для любого из способов, описанных в данном документе. В настоящем изобретении предусматривают применения фармацевтической композиции и рекомбинантных частиц AAV, описанных в данном документе, в получении лекарственного препарата для лечения миоцилиновой (MYOC) глаукомы у млекопитающего. В некоторых вариантах осуществления млекопитающее является человеком. В некоторых вариантах осуществления миоцилиновая (MYOC) глаукома представляет собой первичную открытоугольную глаукому (POAC). В некоторых вариантах осуществления миоцилиновая (MYOC) глаукома представляет собой ювенильную форму первичной открытоугольной глаукомы (JOAC).

В некоторых аспектах настоящего изобретения предусматривают наборы для лечения миоцилиновой (MYOC) глаукомы у млекопитающего, где набор содержит вирусную частицу rAAV, содержащую вектор, который кодирует RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант; вирусную частицу rAAV, содержащую вектор на основе AAV, где вектор на основе AAV содержит нуклеиновую кислоту, кодирующую ингибирующую нуклеиновую кислоту (например, средство для RNAi в отношении MYOC, в том числе shRNA), которая целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего; и/или вирусную частицу rAAV, содержащую вектор на основе AAV, где вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и кодирующую средство для RNAi в отношении MYOC (например, shRNA), которое целенаправленно воздействует на экспрессию MYOC у млекопитающего. В некоторых вариантах осуществления набор дополнительно содержит инструкции для применения при лечении миоцилиновой (MYOC) глаукомы. В некоторых вариантах осуществления набор дополнительно содержит буферы и/или фармацевтически приемлемые наполнители.

В некоторых вариантах осуществления наборы по настоящему изобретению содержат нуклеиновую кислоту, кодирующую средство для RNAi в отношении MYOC (например, shRNA), которое целенаправленно воздействует на экспрессию MYOC у млекопитающего. В некоторых вариантах осуществления средство для RNAi в отношении MYOC целенаправленно воздействует на экспрессию MYOC человека. В некоторых вариантах осуществления средство для RNAi в отношении MYOC целенаправленно воздействует на аминокислотную последовательность MYOC, изложенную под SEQ ID NO: 6. В некоторых вариантах осуществления средство для RNAi представляет собой малую ингибирующую РНК (siRNA), микроРНК (miRNA) или малую шпилечную РНК (shRNA). В некоторых вариантах осуществления средство для RNAi представляет собой shRNA. В некоторых вариантах осуществления shRNA для MYOC содержит последовательность петли под SEQ ID NO: 7. В некоторых вариантах осуществления наборы по настоящему изобретению содержат вектор на основе AAV, где вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1 или его функциональный вариант, и RSPO1 или его функциональный вариант представляют собой RSPO1 человека. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1 или его функциональный вариант, и RSPO1 или его функциональный вариант содержат аминокислотную последовательность под SEQ ID NO: 8, 11 и/или 12. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1 или его функциональный вариант, и RSPO1 или его функциональный вариант содержат аминокислотную последовательность, которая характеризуется 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 8, 11 и/или 12. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO2 или его функциональный вариант, и RSPO2 или его функциональный вариант представляют собой RSPO2 человека. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO2 или его функциональный вариант, и RSPO2 или его функциональный вариант содержат аминокислотную последовательность под SEQ ID NO: 9, 13 и/или 14. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO2 или его функциональный вариант, и RSPO2 или его функциональный вариант содержат аминокислотную последовательность, которая характеризуется 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 9, 13 и/или 14. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO3 или его функциональный вариант, и RSPO3 или его функциональный вариант представляют собой RSPO3 человека. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO3 или его функциональный вариант, и RSPO3 или его функциональный вариант содержат аминокислотную последовательность под SEQ ID NO: 1 и/или 15-17. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO3 или его функциональный вариант, и RSPO3 или его функциональный вариант содержат аминокислотную последовательность, которая характеризуется 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 1 и/или 15-17. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO4 или его функциональный вариант, и RSPO4 или его функциональный вариант представляют собой RSPO4 человека. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO4 или его функциональный вариант, и RSPO4 или его функциональный вариант содержат аминокислотную последовательность под SEQ ID NO: 10, 18 и/или 19. В некоторых вариантах осуществления вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO4 или его функциональный вариант, и RSPO4 или его функциональный вариант содержат аминокислотную последовательность, которая характеризуется 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 10, 18 и/или 19. В некоторых вариантах осуществления RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант функционально связаны с промотором. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию RSPO1, RSPO2, RSPO3, RSPO4 или их функционального варианта в глазу млекопитающего. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию RSPO1, RSPO2, RSPO3, RSPO4 или их функционального варианта в клетках трабекулярной сети. В некоторых вариантах осуществления промотор представляет собой гибридный промотор β-актина курицы (CBA). В некоторых вариантах осуществления средство для RNAi в отношении MYOC функционально связано с промотором. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию средства для RNAi в отношении MYOC в глазу млекопитающего. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию средства для RNAi в отношении MYOC в клетках трабекулярной сети. В некоторых вариантах осуществления промотор представляет собой гибридный промотор β-актина курицы (CBA). В некоторых вариантах осуществления промотор представляет собой промотор РНК-полимеразы III. В некоторых вариантах осуществления экспрессия средства для RNAi в отношении MYOC снижает или ингибирует экспрессию MYOC в глазу млекопитающего. В некоторых вариантах осуществления экспрессия средства для RNAi в отношении MYOC снижает или ингибирует экспрессию MYOC в клетках трабекулярной сети млекопитающего.

В некоторых вариантах осуществления частицы AAV, описанные в данном документе, можно применять в комбинации с одним или несколькими дополнительными средствами, которые повышают активность R-спондина (например, RSPO1, RSPO2, RSPO3 и/или RSPO4).

В некоторых вариантах осуществления наборы по настоящему изобретению содержат вирусную частицу AAV, содержащую вектор и AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (например, капсид AAV6 дикого типа или капсид варианта AAV6, такого как ShH10, как описано в публикации заявки на патент США 2012/0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (например, капсид AAV9 дикого типа или капсид модифицированного AAV9, как описано в публикации заявки на патент США 2013/0323226), AAV10, AAVrh10, AAV11, AAV12, мутантного капсида, содержащего тирозин, мутантного капсида с гепарин-связывающим мотивом, капсида AAV2R471A, капсида AAVAAV2/2-7m8, капсида AAV DJ (например, капсид AAV-DJ/8, капсид AAV-DJ/9 или любой другой из капсидов, описанных в публикации заявки на патент США 2012/0066783), капсида AAV2 N587A, капсида AAV2 E548A, капсида AAV2 N708A, капсида AAV V708K, капсида козьего AAV, химерного капсида AAV1/AAV2, капсида бычьего AAV, капсида мышиного AAV, капсида rAAV2/HBoV1, капсида AAV, описанных в патенте США № 8283151 или в Международной публикации № WO/2003/042397. В некоторых вариантах осуществления вирусная частица AAV содержит капсид AAV, содержащий аминокислотную замену в одном или нескольких положениях R484, R487, K527, K532, R585 или R588, нумерация которых приведена согласно VP1 AAV2. В дополнительных вариантах осуществления частица AAV содержит капсидные белки серотипа AAV из клад A-F. В некоторых вариантах осуществления вирусная частица rAAV содержит капсид AAV серотипа 2. В некоторых вариантах осуществления капсид AAV серотипа 2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых вариантах осуществления вектор содержит инвертированные концевые повторы (ITR) серотипов AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, козьего AAV, бычьего AAV или мышиного AAV. В некоторых вариантах осуществления вектор содержит ITR AAV серотипа 2. В некоторых вариантах осуществления вирусная частица AAV содержит один или несколько ITR и капсид, полученные из одного и того же серотипа AAV. В некоторых вариантах осуществления вирусная частица AAV содержит один или несколько ITR, полученных из серотипа AAV, отличного от такового для капсида вирусных частиц rAAV. В некоторых вариантах осуществления вирусная частица rAAV содержит капсид AAV2, и вектор содержит ITR AAV2. В некоторых вариантах осуществления капсид AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2.

В некоторых вариантах осуществления вышеуказанных наборов частицу AAV из набора применяют в комбинации с одним или несколькими дополнительными средствами, которые повышают активность R-спондина (например, RSPO1, RSPO2, RSPO3 и/или RSPO4). В некоторых вариантах осуществления наборы по настоящему изобретению содержат частицу AAV, как описано в данном документе, и одно или несколько дополнительных средств, которые повышают активность R-спондина (например, RSPO1, RSPO2, RSPO3 и/или RSPO4).

В настоящем изобретении предусматривают наборы, подходящие для применения в любом из способов, описанных в данном документе. В настоящем изобретении предусматривают наборы, содержащие любые рекомбинантные частицы AAV, описанные в данном документе. В некоторых аспектах наборы, описанные в данном документе, дополнительно содержат инструкции для применения при лечении миоцилиновой (MYOC) глаукомы. В некоторых аспектах наборы, описанные в данном документе, дополнительно содержат буферы и/или фармацевтически приемлемые наполнители.

В некоторых аспектах настоящего изобретения предусматривают способы доставки нуклеиновой кислоты (например, нуклеиновой кислоты, кодирующей терапевтический трансген) в трабекулярную сеть глаза млекопитающего, включающие введение частицы AAV серотипа 2 (AAV2), содержащей вектор на основе rAAV, в глаз млекопитающего, где вектор на основе rAAV содержит нуклеиновую кислоту, и где частица AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых аспектах настоящего изобретения предусматривают способы лечения глазного нарушения у млекопитающего, включающие введение частицы AAV2, содержащей вектор на основе rAAV, в глаз млекопитающего, где вектор на основе rAAV содержит нуклеиновую кислоту, кодирующую терапевтический трансген, и где частица AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых вариантах осуществления частицу rAAV вводят интравитреально и/или интракамерально. В некоторых вариантах осуществления частицей rAAV трансдуцируют клетки трабекулярной сети глаза. В некоторых вариантах осуществления терапевтический трансген экспрессируется в трабекулярной сети глаза. В некоторых вариантах осуществления терапевтический трансген кодирует терапевтический полипептид или терапевтическую нуклеиновую кислоту. В некоторых вариантах осуществления глазное нарушение связано с трабекулярной сетью глаза. В некоторых вариантах осуществления глазное нарушение представляет собой миоцилиновую (MYOC) глаукому. В некоторых вариантах осуществления млекопитающее является человеком.

В некоторых аспектах настоящего изобретения предусматривают рекомбинантную частицу AAV2 для доставки нуклеиновой кислоты (например, нуклеиновой кислоты, кодирующей терапевтический трансген) в трабекулярную сеть глаза млекопитающего, где частица AAV2 содержит вектор на основе rAAV, при этом вектор на основе rAAV содержит нуклеиновую кислоту, и где частица AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых аспектах настоящего изобретения предусматривают рекомбинантную частицу AAV2 для лечения глазного нарушения у млекопитающего, при этом частица AAV2 содержит вектор на основе rAAV, где вектор на основе rAAV содержит нуклеиновую кислоту, кодирующую терапевтический трансген, и при этом частица AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых вариантах осуществления частицей rAAV трансдуцируют клетки трабекулярной сети глаза. В некоторых вариантах осуществления терапевтический трансген экспрессируется в трабекулярной сети глаза. В некоторых вариантах осуществления терапевтический трансген кодирует терапевтический полипептид или терапевтическую нуклеиновую кислоту. В некоторых вариантах осуществления глазное нарушение связано с трабекулярной сетью глаза. В некоторых вариантах осуществления глазное нарушение представляет собой миоцилиновую (MYOC) глаукому. В некоторых вариантах осуществления млекопитающее является человеком.

В некоторых аспектах настоящего изобретения предусматривают применения рекомбинантной частицы AAV2 для доставки нуклеиновой кислоты (например, нуклеиновой кислоты, кодирующей терапевтический трансген) в трабекулярную сеть глаза млекопитающего, где частица AAV2 содержит вектор на основе rAAV, при этом вектор на основе rAAV содержит нуклеиновую кислоту, и где частица AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых аспектах настоящего изобретения предусматривают применение рекомбинантной частицы AAV2 для лечения глазного нарушения у млекопитающего, при этом частица AAV2 содержит вектор на основе rAAV, где вектор на основе rAAV содержит нуклеиновую кислоту, кодирующую терапевтический трансген, и при этом частица AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых вариантах осуществления частицу rAAV вводят интравитреально и/или интракамерально. В некоторых вариантах осуществления частицей rAAV трансдуцируют клетки трабекулярной сети глаза. В некоторых вариантах осуществления терапевтический трансген экспрессируется в трабекулярной сети глаза. В некоторых вариантах осуществления терапевтический трансген кодирует терапевтический полипептид или терапевтическую нуклеиновую кислоту. В некоторых вариантах осуществления глазное нарушение связано с трабекулярной сетью глаза. В некоторых вариантах осуществления глазное нарушение представляет собой миоцилиновую (MYOC) глаукому. В некоторых вариантах осуществления млекопитающее является человеком.

В некоторых аспектах настоящего изобретения предусматривают наборы для доставки нуклеиновой кислоты (например, нуклеиновой кислоты, кодирующей терапевтический трансген) в трабекулярную сеть глаза млекопитающего, которые содержат частицу rAAV2, содержащую вектор на основе rAAV, где вектор на основе rAAV содержит нуклеиновую кислоту, и при этом частица AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых аспектах настоящего изобретения предусматривают наборы для лечения глазного нарушения у млекопитающего, которые содержат частицу rAAV2, содержащую вектор на основе rAAV, где вектор на основе rAAV содержит нуклеиновую кислоту, кодирующую терапевтический трансген, и при этом частица AAV2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых вариантах осуществления частицу rAAV вводят интравитреально и/или интракамерально. В некоторых вариантах осуществления частицей rAAV трансдуцируют клетки трабекулярной сети глаза. В некоторых вариантах осуществления терапевтический трансген экспрессируется в трабекулярной сети глаза. В некоторых вариантах осуществления терапевтический трансген кодирует терапевтический полипептид или терапевтическую нуклеиновую кислоту. В некоторых вариантах осуществления глазное нарушение связано с трабекулярной сетью глаза. В некоторых вариантах осуществления глазное нарушение представляет собой миоцилиновую (MYOC) глаукому. В некоторых вариантах осуществления млекопитающее является человеком.

Все литературные источники, цитируемые в данном документе, в том числе патентные заявки и публикации, включены посредством ссылки во всей своей полноте.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

На фиг. 1 продемонстрировано, что мутанты MYOC P370L и Y437H не секретируются и блокируют секрецию MYOC дикого типа ("wtMYOC"). Среду для культивирования клеток или клеточные лизаты из 293 клеток, трансфицированных конструкциями, экспрессирующими wtMYOC и/или мутанты MYOC (как отмечено), исследовали с помощью вестерн-блоттинга с применением антитела к MYOC человека.

На фиг. 2 показано, что мутант P370L MYOC не секретируется и блокирует секрецию MYOC дикого типа ("wtMYOC") и в клетках 293T, и в клетках, трансформированных T-антигеном SV40, в трабекулярной сети ("hTM-T"). Среду для культивирования клеток или клеточные лизаты из клеток 293T или клеток hTM-T, трансфицированных конструкциями, экспрессирующими wtMYOC и/или MYOC P370L (как отмечено), исследовали с помощью вестерн-блоттинга с применением антитела к MYOC человека.

На фиг. 3 отображен эффект экспрессии wtMYOC, MYOC P370L или Y437H на передачу сигнала Wnt. Для каждого эксперимента "нет mWnt3a" обозначает столбик слева, а "w mWnt3a - 400 нг/мл" обозначает столбик справа.

На фиг. 4 показано, что экспрессия RSPO3 способствует восстановлению передачи сигнала Wnt в результате совместной экспрессии с MYOC P370L или Y437H. Для каждого эксперимента "нет mWnt3a" обозначает столбик слева, а "mWnt3a - 400 нг/мл" обозначает столбик справа.

На фиг. 5 показано, что экспрессия RSPO3 способствует восстановлению передачи сигнала Wnt в клетках hTM-T в результате совместной экспрессии с MYOC P370L. Для каждого эксперимента "нет mWnt3a" обозначает столбик слева, а "400 нг/мл hWnt3a" обозначает столбик справа.

На фиг. 6 показан эффект shRNA для MYOC на экспрессию MYOC в клетках 293T. Среду для культивирования клеток или клеточные лизаты из клеток 293T исследовали с помощью вестерн-блоттинга с применением антитела к MYOC человека. Клетки трансфицировали плазмидами, экспрессирующими wtMYOC (дорожка 1); wtMYOC и shRNA для MYOC #79 (2); wtMYOC и shRNA для MYOC #93 (3); wtMYOC и рандомизированный контроль с shRNA (4); или EGFP (5). Полосы 55/57 кДа представляют гликозилированные (57 кДа) и негликозилированные (55 кДа) формы полноразмерного белка MYOC. Полоса 22 кДа представляет N-конец продукта расщепления кальпаина II.

На фиг. 7 показан эффект shRNA для MYOC на экспрессию MYOC в клетках hTM-T. Среду для культивирования клеток или клеточные лизаты из клеток hTM-T исследовали с помощью вестерн-блоттинга с применением антитела к MYOC человека. Клетки трансфицировали плазмидами, экспрессирующими wtMYOC (дорожка 1); MYOC P370L (2); wtMYOC и MYOC P370L (3); wtMYOC и MYOC P370L и shRNA для Grp94 #1 (4); wtMYOC,и MYOC P370L, и shRNA для Grp94 #2 (5); wtMYOC, и MYOC P370L, и shRNA для MYOC #53 (6); wtMYOC, и MYOC P370L, и shRNA для MYOC pGIPZ #79 (7); wtMYOC и MYOC P370L и shRNA для MYOC pGIPZ #93 (8); wtMYOC, и MYOC P370L, и рандомизированный контроль с shRNA (9) или EGFP (10).

На фиг. 8 показано, что экспрессия RSPO3 и сайленсинг MYOC синергически способствуют восстановлению передачи сигнала Wnt в результате совместной экспрессии с MYOC P370L. Клетки 293T совместно трансфицировали с помощью репортерной конструкции TOP-Flash и wtMYOC ("MYOC"), плюс MYOC P370L, shRNA для Grp94, shRNA для MYOC pGIPZ #79(первая) и #93 (вторая) и/или RSPO3-плазмидами, как отмечено. Передача сигнала Wnt усиливалась после добавления рекомбинантной мышиной Wnt3a (400 нг/мл) и была измерена с помощью анализа TOP-Flash. Люциферазную активность (значение+SD, n=1-3 повторности планшетов) измеряли после трансфекции и нормализовали по контрольной трансфекции постоянно экспрессируемого уровня люциферазы Renilla. Для каждого эксперимента "не добавляли mWnt" обозначает столбик слева, а "добавляли 400 нг/мл Wnt3a" обозначает столбик справа.

На фиг. 9 показано, что сайленсинг MYOC способствует восстановлению передачи сигнала Wnt в результате совместной экспрессии с MYOC P370L или Y437H. Клетки 293T совместно трансфицировали с помощью репортерной конструкции TOP-Flash и wtMYOC ("MYOC"), плюс MYOC P370L, MYOC Y437H, shRNA для MYOC и/или рандомизированной контрольной shRNA ("pGIPZ-нуль"), как отмечено. Передача сигнала Wnt усиливалась после добавления рекомбинантной мышиной Wnt3a (400 нг/мл) и была измерена с помощью анализа TOP-Flash. Люциферазную активность (значение+SD, n=1-3 повторности планшетов) измеряли после трансфекции и нормализовали по контрольной трансфекции постоянно экспрессируемого уровня люциферазы Renilla. Для каждого эксперимента "не добавляли mWnt" обозначает столбик слева, а "добавляли 400 нг/мл Wnt3a" обозначает столбик справа.

На фиг. 10 показана трансдукция клеток трабекулярной сети in vitro (левые панели) и in vivo (правые панели) посредством вирусных частиц AAV2 дикого типа (верхние панели) и частиц AAV2, содержащих аминокислотную замену R471A в капсидном белке.

На фиг. 11 показана диаграмма доменов семейства белков RSPO человека, отображающая фуриноподобные домены, богатые Cys, домен тромбоспондина типа 1 и C-концевой положительно заряженный домен, как отмечено (фигура взята из Kim, K.A. et al. (2008) Mol. Biol. Cell. 19:2588-2596).

На фиг. 12 показана диаграмма доменов семейства генов RSPO человека, отображающая белковые домены, перечисленные на фиг. 11. Отображена нумерация аминокислотных последовательностей, и усеченные мутанты исследованы для каждого представителя семейства, как отмечено (фигура взята из Kim, K.A. et al. (2006) Cell Cycle 5:23-26).

На фиг. 13A показана последовательность полноразмерного RSPO3 человека (SEQ ID NO: 1) с сигнальной последовательностью, отмечены домены FU1, FU2 и TSP1.

На фиг. 13B показана последовательность активного фрагмента RSPO3 человека (SEQ ID NO: 16) с сигнальной последовательностью, отмечены домены FU1 и FU2. Используемый фрагмент, характеризующийся отсутствием сигнального пептида, соответствуют аминокислотам 22-146 последовательности под SEQ ID NO: 16 и составляет 15 кДа, включая метку His.

На фиг. 13C отображена структура домена полноразмерного hRSPO3 с сигнальным пептидом, отмечены домены FU1, FU2, TSP1 и BR. Предполагаемые функции для каждого домена перечислены ниже.

На фиг. 13D показан вестерн-блоттинг полноразмерного hRSPO3 и фрагмента hRSPO3.

На фиг. 14 отображены исследуемые фрагменты hRSPO3. Отмечены структура домена полноразмерного hRSPO3 с сигнальным пептидом, домены FU1, FU2, TSP1 и BR, а также ниже указаны предполагаемые функции для каждого домена.

На фиг. 15 показано, что экспрессия полноразмерных фрагментов RSPO3 и RSPO3 способствует восстановлению передачи сигнала Wnt в результате совместной экспрессии с MYOC Y437H.

На фиг. 16 показано, что экспрессия представителей семейства RSPO может индуцировать передачу сигнала Wnt в результате совместной экспрессии с MYOC Y437H даже без добавления Wnt3a.

ПОДРОБНОЕ ОПИСАНИЕ

В настоящем изобретении предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, включающие введение в глаз млекопитающего вирусной частицы рекомбинантного аденоассоциированного вируса (rAAV). В некоторых вариантах осуществления передача сигнала wnt в глазу млекопитающего усиливается, например посредством экспрессии R-спондина 1 (RSPO1), R-спондина 2 (RSPO2), R-спондина 3 (RSPO3), и/или R-спондина 4 (RSPO4). В некоторых вариантах осуществления экспрессия миоцилина (MYOC) (например, мутантного миоцилина) ингибируется, например посредством применения средства для RNAi, целенаправленно воздействующего на экспрессию MYOC. В некоторых аспектах частица AAV содержит вектор, кодирующий RSPO1, RSPO2, RSPO3, и/или RSPO4, и/или их функциональный вариант. В других аспектах частица rAAV содержит вектор, кодирующий средство для RNAi в отношении MYOC (например, shRNA), которое целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего. В других аспектах настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, включающие введение в глаз млекопитающего смеси частиц rAAV, содержащих вектор, кодирующий RSPO1, RSPO2, RSPO3, и/или RSPO4, и/или их функциональный вариант, и частиц rAAV, содержащих вектор, кодирующий средство для RNAi в отношении MYOC (например, shRNA), которое целенаправленно воздействует на экспрессию миоцилина у млекопитающего. В других аспектах настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, включающие введение в глаз млекопитающего частицы rAAV, содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3, и/или RSPO4, и/или их функциональный вариант и кодирующий средство для RNAi в отношении MYOC (например, shRNA), которое целенаправленно воздействует на экспрессию миоцилина (shRNA для MYOC) у млекопитающего. В настоящем изобретении также предусматривают композиции и наборы для лечения миоцилиновой (MYOC) глаукомы с применением векторов на основе rAAV, кодирующих RSPO1, RSPO2, RSPO3, и/или RSPO4, и/или их функциональный вариант, и/или средство для RNAi в отношении MYOC (например, shRNA). В настоящем изобретении также предусматривают рекомбинантные частицы AAV, композиции и наборы.

В некоторых аспектах настоящего изобретения предусматривают способы нацеливания AAV2 для трансдуцирования клеток трабекулярной сети. В некоторых аспектах в настоящем изобретении предусматривают частицы rAAV2, содержащие мутацию R471A, нумерация которой приведена согласно VP1 AAV2. В некоторых вариантах осуществления настоящего изобретения предусматривают способы и композиции для лечения глазных заболеваний, связанных с трабекулярной сетью (например, миоцилиновой (MYOC) глаукомы), с применением вирусных частиц AAV2, содержащих мутированный капсидный белок (например, с аминокислотной заменой R471A).

I. Общие методики

Методики и процедуры, описанные или упоминаемые в данном документе, как правило, широко распространены и обычно используются специалистами в данной области техники с применением традиционной методологии, как, например, широко используемые методики, описанные в Molecular Cloning: A Laboratory Manual (Sambrook et al., 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2012); Current Protocols in Molecular Biology (F.M. Ausubel, et al. eds., 2003); серии Methods in Enzymology (Academic Press, Inc.); PCR 2: A Practical Approach (M.J. MacPherson, B.D. Hames и G.R. Taylor eds., 1995); Antibodies, A Laboratory Manual (Harlow и Lane, eds., 1988); Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications (R.I. Freshney, 6th ed., J. Wiley and Sons, 2010); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J.E. Cellis, ed., Academic Press, 1998); Introduction to Cell and Tissue Culture (J.P. Mather и P.E. Roberts, Plenum Press, 1998); Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J.B. Griffiths, и D.G. Newell, eds., J. Wiley and Sons, 1993-8); Handbook of Experimental Immunology (D.M. Weir и C.C. Blackwell, eds., 1996); Gene Transfer Vectors for Mammalian Cells (J.M. Miller и M.P. Calos, eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); Current Protocols in Immunology (J.E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Ausubel et al., eds., J. Wiley and Sons, 2002); Immunobiology (C.A. Janeway et al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd и C. Dean, eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow и D. Lane, Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti и J. D. Capra, eds., Harwood Academic Publishers, 1995); и Cancer: Principles and Practice of Oncology (V.T. DeVita et al., eds., J.B. Lippincott Company, 2011).

II. Определения

"Вектор", как используется в данном документе, относится к рекомбинантной плазмиде или вирусу, содержащим нуклеиновую кислоту, которую необходимо доставить в клетку-хозяина in vitro либо in vivo.

Выражение "полинуклеотид" или "нуклеиновая кислота", используемое в данном документе, относится к полимерной форме нуклеотидов, будь то рибонуклеотиды или дезоксирибонуклеотиды, любой длины. Таким образом, данное выражение включает, без ограничения, одно-, двух- или многоцепочечные ДНК или РНК, геномную ДНК, кДНК, гибриды ДНК-РНК или полимер, содержащий пуриновые и пиримидиновые основания или другие природные, химически или биохимически модифицированные, неприродные или дериватизированные нуклеотидные основания. Остов нуклеиновой кислоты может содержать сахара и фосфатные группы (которые обычно могут обнаруживаться в РНК или ДНК) или модифицированные либо замещенные сахарные или фосфатные группы. В качестве альтернативы, остов нуклеиновой кислоты может включать в себя полимер из синтетических субъединиц, таких как фосфорамидаты, и, таким образом, может представлять собой олигодезоксинуклеозидный фосфорамидат (P-NH2) или смешанный фосфорамидатно-фосфодиэфирный олигомер. Кроме того, двухцепочечную нуклеиновую кислоту можно получить из одноцепочечного полинуклеотидного продукта химического синтеза посредством либо синтеза комплементарной цепи и отжига цепей в соответствующих условиях, либо посредством синтеза комплементарной цепи de novo с использованием ДНК-полимеразы с соответствующим праймером.

Выражения "полипептид" и "белок" используются взаимозаменяемо для обозначения полимера из аминокислотных остатков и не ограничены минимальной длиной. Такие полимеры из аминокислотных остатков могут содержать природные или неприродные аминокислотные остатки и включают, без ограничения, пептиды, олигопептиды, димеры, тримеры и мультимеры из аминокислотных остатков. Данным определением охватываются как полноразмерные белки, так и их фрагменты. Выражения включают также постэкспрессионные модификации полипептида, например, гликозилирование, сиалирование, ацетилирование, фосфорилирование и т. п. Кроме того, для целей настоящего изобретения "полипептид" относится к белку, который характеризуется модификациями, такими как делеции, добавления и замены (обычно консервативные по своей природе), в нативной последовательности при условии, что белок сохраняет желаемую активность. Данные модификации могут быть преднамеренными, как, например, посредством сайт-направленного мутагенеза, или могут быть случайными, как, например, посредством мутаций у хозяев, которые вырабатывают белки, или ошибок, обусловленных ПЦР-амплификацией.

"Рекомбинантный вирусный вектор" относится к рекомбинантному полинуклеотидному вектору, содержащему одну или несколько гетерологичных последовательностей (т. е. последовательность нуклеиновой кислоты невирусного происхождения). В случае рекомбинантных векторов на основе AAV рекомбинантную нуклеиновую кислоту фланкируют с помощью по меньшей мере одного, предпочтительно двух, последовательностей инвертированных концевых повторов (ITR).

"Рекомбинантный вектор на основе AAV (вектор на основе rAAV)" относится к полинуклеотидному вектору, содержащему одну или несколько гетерологичных последовательностей (т. e. последовательность нуклеиновой кислоты, не происходящую из AAV), которые являются фланкированными по меньшей мере одной, предпочтительно двумя, последовательностями инвертированных концевых повторов (ITR). Такие векторы на основе rAAV могут реплицироваться и упаковываться в инфекционные вирусные частицы в случае их присутствия в клетке-хозяине, которая была инфицирована подходящим вирусом-помощником (или которая экспрессирует подходящие хелперные функциональные элементы) и которая экспрессирует продукты генов rep и cap AAV (т. e. белки Rep и Cap AAV). Если вектор на основе rAAV встроен в более крупный полинуклеотид (например, в хромосому или в другой вектор, такой как плазмида, применяемая для клонирования или трансфекции), то вектор на основе rAAV можно обозначить как "провектор", который может быть "спасен"посредством репликации и инкапсидирования в присутствии упаковывающих функциональных элементов и подходящих хелперных функциональных элементов AAV. Вектор на основе rAAV может находиться в любой из множества форм, в том числе, без ограничения, в форме плазмид, линейных искусственных хромосом, образующих комплексы с липидами, инкапсулированными в липосомах, и наиболее предпочтительно инкапсулированными в вирусной частице, в частности частице AAV. Вектор на основе rAAV может быть упакован в капсид вируса AAV для получения "частицы рекомбинантного аденоассоциированного вируса (частицы rAAV)". Вспомогательные функции AAV (т. е., функции, которые способствуют репликации и упаковке AAV в клетке-хозяине) могут быть обеспечены любой из множества форм, в том числе, без ограничения, вирусом-помощником или генами вируса-помощника, которые способствуют репликации и упаковке AAV. Другие хелперные функциональные элементы AAV известны в области техники.

"Вирус rAAV" или "вирусная частица rAAV" относится к вирусной частице, состоящей из по меньшей мере одного капсидного белка AAV и инкапсидированного генома вектора на основе rAAV.

"Гетерологичный" означает полученный из объекта, генотипически отличающегося от остальной части объекта, с которым его сравнивают или в который его вводят или встраивают. Например, нуклеиновая кислота, введенная посредством методик генетической инженерии в другой тип клетки, является гетерологичной нуклеиновой кислотой (и при экспрессии может кодировать гетерологичный полипептид). Аналогично, клеточная последовательность (например, ген или его часть), встроенная в вирусный вектор, является гетерологичной нуклеотидной последовательностью по отношению к вектору.

Выражение "трансген" относится к нуклеиновой кислоте, вводимой в клетку и способной к транскрипции в РНК и необязательно к трансляции и/или экспрессии в соответствующих условиях. В некоторых аспектах он придает желаемое свойство клетке, в которую он был введен, или иным образом приводит к желаемому терапевтическому или диагностическому эффекту. В другом аспекте он может транскрибироваться в молекулу, которая опосредует РНК-интерференцию, такую как siRNA.

Выражения "геномные частицы (gp)", "геномные эквиваленты" или "копии генома", применяемые в отношении вирусного титра, относятся к числу вирионов, содержащих геном ДНК рекомбинантного AAV, вне зависимости от инфекционности или функциональности. Число геномных частиц в конкретном векторном препарате можно определять с помощью процедур, таких как описанные в примерах в данном документе или, например, в Clark et al. (1999) Hum. Gene Ther., 10:1031-1039; Veldwijk et al. (2002) Mol. Ther., 6:272-278.

Выражения "инфекционная единица (iu)", "инфекционная частица" или "единица репликации", применяемые в отношении вирусного титра, относятся к числу инфекционных и репликационно компетентных частиц вектора на основе рекомбинантного AAV, измеряемому с помощью анализа инфекционных центров, также известного как анализ центров репликации, описанного, например, в McLaughlin et al. (1988) J. Virol., 62:1963-1973.

Выражение "трансдуцирующая единица (tu)", используемое в отношении вирусного титра, относится к числу инфекционных частиц вектора на основе рекомбинантного AAV, которое приводит к получению функционального трансгенного продукта, измеряемому в функциональных анализах, таких как описанные в примерах в данном документе, или, например, в Xiao et al. (1997) Exp. Neurobiol., 144:113-124; или в Fisher et al. (1996) J. Virol., 70:520-532 (анализ LFU).

"Инвертированный концевой повтор" или последовательность "ITR" является выражением, широко распространенным в данной области техники, и относится к относительно коротким последовательностям, встречающимся на концах вирусных геномов, которые имеют противоположную ориентацию.

Последовательность "инвертированного концевого повтора (ITR) AAV", выражение, широко распространенное в данной области техники, представляет собой последовательность примерно из 145 нуклеотидов, которая присутствует на обоих концах нативного одноцепочечного генома AAV. Крайние 125 нуклеотидов ITR могут присутствовать в любой из двух альтернативных ориентаций, обуславливая гетерогенность между различными геномами AAV и между двумя концами одного генома AAV. Крайние 125 нуклеотидов также содержат несколько более коротких областей самокомплементарности (обозначенных как A-, A'-, B-, B'-, C-, C'- и D-области), обеспечивающих образование внутрицепочечных пар оснований в пределах данной части ITR.

"Последовательность концевого разрешения" или "trs" представляет собой последовательность в D-области ITR AAV, которая отщепляется белками rep AAV в ходе репликации вирусной ДНК. Мутантная последовательность концевого разрешения является невосприимчивой к отщеплению белками rep AAV.

"Вирус-помощник" для AAV относится к вирусу, который способствует репликации и упаковке AAV (который является дефектным парвовирусом) в клетке-хозяине. Было идентифицировано множество таких вирусов-помощников, в том числе аденовирусы, герпесвирусы и поксвирусы, такие как вирус осповакцины. Аденовирусы охватывают множество различных подгрупп, однако наиболее широко применяется аденовирус 5 типа подгруппы C (Ad5). Многочисленные аденовирусы, происходящие от человека, отличных от человека млекопитающих и птиц, известны и доступны из депозитариев, таких как ATCC. Вирусы семейства герпесвирусов, которые также доступны из депозитариев, таких как ATCC, включают, например, вирусы простого герпеса (HSV), вирусы Эпштейна-Барр (EBV), цитомегаловирусы (CMV) и вирусы псевдобешенства (PRV).

"Процентная (%) идентичность последовательностей" в отношении эталонной полипептидной последовательности или последовательности нуклеиновой кислоты определена как процентная доля аминокислотных остатков или нуклеотидов в последовательности-кандидате, которые идентичны аминокислотным остаткам или нуклеотидам в эталонной полипептидной последовательности или последовательности нуклеиновой кислоты после выравнивания последовательностей и введения гэпов, при необходимости, для достижения максимальной процентной идентичности последовательностей и без учета каких-либо консервативных замен как части идентичности последовательностей. Выравнивание для целей определения процентной идентичности аминокислотных последовательностей или последовательностей нуклеиновых кислот может быть достигнуто различными способами, которые находятся в пределах компетенции специалиста в данной области, например, с помощью общедоступных компьютерных программ, например, описанных в Current Protocols in Molecular Biology (Ausubel et al., eds., 1987), Supp. 30, section 7.7.18, Table 7.7.1, и в том числе программного обеспечения BLAST, BLAST-2, ALIGN или Megalign (DNASTAR). Предпочтительной программой выравнивания является ALIGN Plus (Scientific and Educational Software, Пенсильвания). Специалисты в данной области могут определять соответствующие параметры для оценки выравнивания, в том числе любые алгоритмы, необходимые для достижения максимального выравнивания по полной длине сравниваемых последовательностей. Для целей данного документа % идентичность аминокислотной последовательности к данной аминокислотной последовательности В, с ней или по отношению к ней для данной аминокислотной последовательности А (которую можно в качестве альтернативы назвать данной аминокислотной последовательностью A, которая характеризуется или обладает определенной % идентичностью аминокислотной последовательности к данной аминокислотной последовательности В, с ней или по отношению к ней) рассчитывается следующим образом: 100 умножить на частное X/Y, где X представляет собой число аминокислотных остатков, учитываемых в качестве идентичных совпадений программой для выравнивания последовательностей в таком программном выравнивании A и B, и где Y представляет собой общее число аминокислотных остатков в B. Следует принимать во внимание, что если длина аминокислотной последовательности A не равна длине аминокислотной последовательности B, то % идентичность аминокислотной последовательности A к B не будет равна % идентичности аминокислотной последовательности B к A. Для целей данного документа % идентичность последовательности нуклеиновой кислоты к данной последовательности нуклеиновой кислоты D, с ней или по отношению к ней для данной последовательности нуклеиновой кислоты C (которую можно в качестве альтернативы назвать данной последовательностью нуклеиновой кислоты C, которая характеризуется или обладает определенной % идентичностью последовательности нуклеиновой кислоты к данной последовательности нуклеиновой кислоты D, с ней или по отношению к ней) рассчитывается следующим образом: 100 умножить на частное W/Z, где W представляет собой число нуклеотидов, учитываемых в качестве идентичных совпадений программой для выравнивания последовательностей в таком программном выравнивании C и D, и где Z представляет собой общее число нуклеотидов в D. Следует принимать во внимание, что если длина последовательности нуклеиновой кислоты C не равна длине последовательности нуклеиновой кислоты D, то % последовательности нуклеиновой кислоты C к D не будет равна % идентичности последовательности нуклеиновой кислоты D к C.

"Выделенная" молекула (например, нуклеиновая кислота или белок) или клетка означает, что она была идентифицирована и отделена и/или извлечена из компонента своего естественного окружения.

"Эффективное количество" представляет собой количество, достаточное для достижения благоприятных или желаемых результатов, в том числе клинических результатов (например, уменьшения интенсивности симптомов, достижения клинических конечных точек и т. п.). Эффективное количество можно вводить за одно или несколько введений. Применительно к болезненному состоянию эффективным количеством является количество, достаточное для уменьшения интенсивности, стабилизации или задержки развития заболевания. Например, эффективное количество частицы rAAV экспрессирует желаемое количество гетерологичной нуклеиновой кислоты, такой как терапевтический полипептид или терапевтическая нуклеиновая кислота.

"Индивидуум" или "субъект" является млекопитающим. Млекопитающие включают, без ограничения, одомашненных животных (например, коров, овец, кошек, собак и лошадей), приматов (например, людей и отличных от человека приматов, таких как обезьяны), кроликов и грызунов (например, мышей и крыс). В некоторых вариантах осуществления индивидуум или субъект является человеком.

Как используется в данном документе, "лечение" представляет собой подход для получения благоприятных или желаемых клинических результатов. Для целей настоящего изобретения благоприятные или требуемые клинические результаты включают, без ограничения, смягчение симптомов, снижение степени заболевания, стабилизированное (например не ухудшающееся) состояние заболевания, предотвращение распространения (например метастазирования) заболевания, задержку или замедление прогрессирования заболевания, ослабление или временное облегчение состояния заболевания и ремиссию (частичную или полную), выявляемую или невыявляемую. "Лечение" может означать также продление выживаемости по сравнению с ожидаемой выживаемостью в случае неполучения лечения.

Термин "трабекулярная сеть", используемый в данном документе, относится к губчатой ткани, расположенной вблизи роговицы и радужки, которая обеспечивает фильтрацию водянистой влаги из глаза в кровь. Губчатая ткань, расположенная вблизи роговицы и радужки, которая обеспечивает фильтрацию водянистой влаги из глаза в кровь. Трабекулярная сеть содержит выстланные эндотелием пространства (межтрабекулярные пространства), через которые происходит отток водянистой влаги в Шлеммов канал. Она обычно разделена на две части: корнеосклеральную сеть, которая контактирует с роговицей и склерой и открывается в Шлеммов канал, и увеальную сеть, которая обращена к передней камере.

Выражение "центральная зона сетчатки", используемое в данном документе, относится к наружной части желтого пятна, и/или к внутренней части желтого пятна, и/или к центральной ямке. Выражение "типы клеток центральной зоны сетчатки", используемое в данном документе, относится к типам клеток центральной зоны сетчатки, таким как, например, RPE и фоторецепторные клетки.

Выражение "желтое пятно" относится к области центральной зоны сетчатки у приматов, которая содержит фоторецепторные клетки, в частности, палочки и колбочки, в более высокой относительной концентрации по сравнению с периферической зоной сетчатки. Выражение "наружная часть желтого пятна", используемое в данном документе, также может упоминаться как "периферическая часть желтого пятна". Выражение "внутренняя часть желтого пятна", используемое в данном документе, также может упоминаться как "центральная часть желтого пятна".

Выражение "центральная ямка" относится к небольшой области в центральной зоне сетчатки приматов, диаметр которой примерно равен или составляет менее 0,5 мм, которая содержит фоторецепторные клетки, в частности, колбочки, в более высокой относительной концентрации по сравнению с периферической зоной сетчатки и желтым пятном.

Выражение "субретинальное пространство", используемое в данном документе, относится к местоположению в сетчатке между фоторецепторными клетками и клетками пигментного эпителия сетчатки. Субретинальное пространство может являться предполагаемым пространством, как, например, до какой-либо субретинальной инъекции жидкости. Субретинальное пространство может также содержать жидкость, введенную путем инъекции в предполагаемое пространство. В этом случае жидкость находится "в контакте с субретинальным пространством". Клетки, которые находятся "в контакте с субретинальным пространством", включают клетки, которые ограничивают субретинальное пространство, такие как RPE и фоторецепторные клетки.

Выражение "пузырек", используемое в данном документе, относится к жидкому пространству в пределах субретинального пространства глаза. Пузырек по настоящему изобретению можно создать посредством однократной инъекции жидкости в одно пространство, посредством нескольких инъекций одной или нескольких жидкостей в одно и то же пространство или посредством нескольких инъекций в несколько пространств, которые при перемещении создают общее жидкое пространство, применимое для достижения терапевтического эффекта на желаемой части субретинального пространства.

"Промотор β-актина курицы (CBA)" относится к полинуклеотидной последовательности, полученной из гена β-актина курицы (например, гена бета-актина Gallus gallus, представленного геном с ID 396526 в GenBank Entrez). Как используется в данном документе, "промотор β-актина курицы" может относиться к промотору, содержащему ранний энхансерный элемент цитомегаловируса (CMV), промотор и первый экзон и интрон гена β-актина курицы и акцепторный сайт сплайсинга гена бета-глобина кролика, такому как последовательности, описанные в Miyazaki, J., et al. (1989) Gene 79(2):269-77. Используемое в данном документе выражение "промотор CAG" может использоваться взаимозаменяемо. Используемое в данном документе выражение "ранний энхансер CMV/промотор бета-актина курицы (CAG)" может использоваться взаимозаменяемо.

"Миоцилин (MYOC)" относится к белку (или гену, кодирующему указанный белок), вовлеченному в функцию цитоскелета, адгезию клеток, передачу сигналов в клетках и миграцию клеток, также известный как глюкокортикоид-индуцибельный ответ трабекулярной сети, GPOA, TIGR, GLC1A, JOAG и JOAG1. Миоцилин экспрессируется как секретируемый белок во многих различных типах клеток. В глазу, как полагают, миоцилин секретируется в водянистую влагу трабекулярной сетью, тканью, которая является критической в регуляции внутриглазного давления (IOP). Как описано выше, мутации миоцилина предположительно составляют подмножество случаев первичной открытоугольной глаукомы, в частности ювенильной формы данного расстройства.

Как используется в данном документе, "миоцилин" может относиться к полноразмерному предшественнику, а также к любым процессированным формам белка (например, зрелому белку, секретируемому из клетки). Примеры белков миоцилина могут включать без ограничения миоцилин человека, мыши, собаки и кошки, например, эталонные последовательности из NCBI NP_000252, NP_034995, NP_001041495 и NP_001265779. Примеры генов миоцилина могут включать без ограничения гены миоцилина человека, мыши, собаки и кошки, например, ген в GenBank Entrez с идентификационным номером 4653 (MYOC, a.k.a. GPOA, JOAG, TIGR, GLC1A и JOAG1), ген в GenBank Entrez с идентификационным номером 17926 (Myoc, a.k.a. TIGR, GLC1A и AI957332), ген в GenBank Entrez с идентификационным номером 490344 и ген в GenBank Entrez с идентификационным номером 101087632.

"R-спондин 1 (RSPO1)" является представителем семейства R-спондинов, участвующим в модуляции передачи сигнала Wnt. Термин "RSPO1" может относиться к белку RSPO1 или гену, кодирующему белок RSPO1. Представители суперсемейства белков, содержащих повтор тромбоспондина типа 1 (TSR-1), R-спондины, включают в себя сигнальный пептид, домен TSR-1 и два фуриноподобных повтора. Хотя точный механизм неясен, предполагают, что полипептиды семейства R-спондинов активируют передачу сигнала Wnt. Дополнительное описание взаимосвязей между R-спондинами и передачей сигнала Wnt см., например, Kim, K.A. et al. (2006) Cell Cycle 5:23-26; Kim, K.A. et al. (2008) Mol. Biol. Cell. 19:2588-2596; Jin, Y.R. и Yoon, J.K. (2012) Int. J. Biochem. Cell Biol. 44:2278-2287; и de Lau, W.B., et al. (2012) Genome Biol. 13(3):242.

Как используется в данном документе, "RSPO1" может относиться к полноразмерному предшественнику, а также к любым процессированным формам белка (например, зрелому белку, секретируемому из клетки). Примеры белков RSPO1 могут включать без ограничения RSPO1 человека, мыши, собаки и кошки, например, эталонные последовательности NCBI NP_001229837, NP_619624, XP_00562890 и XP_003989918. Примеры генов RSPO1 могут включать без ограничения гены RSPO1 человека, мыши, собаки и кошки, например, ген в GenBank Entrez с идентификационным номером 284654 (RSPO1, a.k.a. RSPO и CRISTIN3), ген в GenBank Entrez с идентификационным номером 192199 (Rspo1, a.k.a. Rspondin и R-spondin), ген в GenBank Entrez с идентификационным номером 608179 и ген в GenBank Entrez с идентификационным номером 101091033. В некоторых вариантах осуществления RSPO1 представляет собой функциональный вариант RSPO1. В некоторых вариантах осуществления функциональный вариант RSPO1 может предусматривать одну или несколько аминокислотных замен, вставок и/или делеций (например, усечений), но при этом сохраняет частичную или полную активность в отношении одной или нескольких активностей полноразмерного RSPO1 (например, активность в отношении передачи сигнала Wnt, исследования которой описаны и/или проиллюстрированы в данном документе). В некоторых вариантах осуществления функциональный вариант RSPO1 представляет собой усеченный RSPO1. Примеры усеченных полипептидов RSPO1 включают без ограничения SEQ ID NO: 11 и 12 или процессированные формы SEQ ID NO: 11 и 12, характеризующиеся отсутствием сигнального пептида.

"R-спондин 2 (RSPO2)" является представителем семейства R-спондинов, участвующим в модуляции передачи сигнала Wnt. Термин "RSPO2" может относиться к белку RSPO2 или гену, кодирующему белок RSPO2. Представители суперсемейства белков, содержащих повтор тромбоспондина типа 1 (TSR-1), R-спондины, включают в себя сигнальный пептид, домен TSR-1 и два фуриноподобных повтора. Хотя точный механизм неясен, предполагают, что полипептиды семейства R-спондинов активируют передачу сигнала Wnt. Дополнительное описание взаимосвязей между R-спондинами и передачей сигнала Wnt, см., например, Kim, K.A. et al. (2006) Cell Cycle 5:23-26; Kim, K.A. et al. (2008) Mol. Biol. Cell. 19:2588-2596; Jin, Y.R. и Yoon, J.K. (2012) Int. J. Biochem. Cell Biol. 44:2278-2287; и de Lau, W.B., et al. (2012) Genome Biol. 13(3):242.

Как используется в данном документе, "RSPO2" может относиться к полноразмерному предшественнику, а также к любым процессированным формам белка (например, зрелому белку, секретируемому из клетки). Примеры белков RSPO2 могут включать без ограничения RSPO2 человека, мыши, собаки и кошки, например, эталонные последовательности NCBI NP_848660, NP_766403, XP_005627927 и XP_004000104. Примеры генов RSPO2 могут включать без ограничения гены RSPO2 человека, мыши, собаки и кошки, например, ген в GenBank Entrez с идентификационным номером ID 340419 (RSPO2, a.k.a. CRISTIN2), ген в GenBank Entrez с идентификационным номером 239405 (Rspo2, a.k.a. ftls, AA673245, D430027K22 и 2610028F08Rik), ген в GenBank Entrez с идентификационным номером 482004 и ген в GenBank Entrez с идентификационным номером 101087380. В некоторых вариантах осуществления RSPO2 представляет собой функциональный вариант RSPO2. В некоторых вариантах осуществления функциональный вариант RSPO2 может предусматривать одну или несколько аминокислотных замен, вставок и/или делеций (например, усечений), но при этом сохраняет частичную или полную активность в отношении одной или нескольких активностей полноразмерного RSPO2 (например, активность в отношении передачи сигнала Wnt, исследования которой описаны и/или проиллюстрированы в данном документе). В некоторых вариантах осуществления функциональный вариант RSPO2 представляет собой усеченный RSPO2. Примеры усеченных полипептидов RSPO2 включают без ограничения SEQ ID NO: 13 и 14 или процессированные формы SEQ ID NO: 13 и 14, характеризующиеся отсутствием сигнального пептида.

"R-спондин 3 (RSPO3)" является представителем семейства R-спондинов, участвующим в модуляции передачи сигнала Wnt. Термин "RSPO3" может относиться к белку RSPO3 или гену, кодирующему белок RSPO3. Представители суперсемейства белков, содержащих повтор тромбоспондина типа 1 (TSR-1), R-спондины, включают в себя сигнальный пептид, домен TSR-1 и два фуриноподобных повтора. Хотя точный механизм неясен, предполагают, что RSPO3 активирует передачу сигнала Wnt, и потеря функции RSPO3 у мышей и Xenopus приводит к фенотипам с потерей функции Wnt (Kazanskaya, O., et al. (2008) Development 135:3655-64). Дополнительное описание взаимосвязей между R-спондинами и передачей сигнала Wnt, см., например, de Lau, W.B., et al. (2012) Genome Biol. 13(3):242.

Как используется в данном документе, "RSPO3" может относиться к полноразмерному предшественнику, а также к любым процессированным формам белка (например, зрелому белку, секретируемому из клетки). Примеры белков RSPO3 могут включать без ограничения RSPO3 человека, мыши, собаки и кошки, например, эталонные последовательности NCBI NP_116173, NP_082627, XP_005615677 и XP_003986583. Примеры генов RSPO3 могут включать без ограничения гены RSPO3 человека, мыши, собаки и кошки, например, ген в GenBank Entrez с идентификационным номером 84870 (RSPO3, a.k.a. PWTSR, THSD2 и CRISTIN1), ген в GenBank Entrez с идентификационным номером 72780 (Rspo3, a.k.a. Thsd2, Cristin1, AW742308 и 2810459H04Rik), ген в GenBank Entrez с идентификационным номером 476287 и ген в GenBank Entrez с идентификационным номером 101085635. В некоторых вариантах осуществления RSPO3 представляет собой функциональный вариант RSPO3. В некоторых вариантах осуществления функциональный вариант RSPO3 может предусматривать одну или несколько аминокислотных замен, вставок и/или делеций (например, усечений), но при этом сохраняет частичную или полную активность в отношении одной или нескольких активностей полноразмерного RSPO3 (например, активность в отношении передачи сигнала Wnt, исследования которой описаны и/или проиллюстрированы в данном документе). В некоторых вариантах осуществления функциональный вариант RSPO3 представляет собой усеченный RSPO3. Примеры усеченных полипептидов RSPO3 включают без ограничения SEQ ID NO: 15-17 или процессированные формы SEQ ID NO: 15-17, характеризующиеся отсутствием сигнального пептида.

"R-спондин 4 (RSPO4)" является представителем семейства R-спондинов, участвующим в модуляции передачи сигнала Wnt. Термин "RSPO4" может относиться к белку RSPO4 или гену, кодирующему белок RSPO4. Представители суперсемейства белков, содержащих повтор тромбоспондина типа 1 (TSR-1), R-спондины, включают в себя сигнальный пептид, домен TSR-1 и два фуриноподобных повтора. Хотя точный механизм неясен, предполагают, что полипептиды семейства R-спондинов активируют передачу сигнала Wnt. Дополнительное описание взаимосвязей между R-спондинами и передачей сигнала Wnt, см., например, Kim, K.A. et al. (2006) Cell Cycle 5:23-26; Kim, K.A. et al. (2008) Mol. Biol. Cell. 19:2588-2596; Jin, Y.R. и Yoon, J.K. (2012) Int. J. Biochem. Cell Biol. 44:2278-2287; и de Lau, W.B., et al. (2012) Genome Biol. 13(3):242.

Как используется в данном документе, "RSPO4" может относиться к полноразмерному предшественнику, а также к любым процессированным формам белка (например, зрелому белку, секретируемому из клетки). Примеры белков RSPO4 могут включать без ограничения RSPO4 человека, мыши, собаки и кошки, например, эталонные последовательности NCBI NP_001025042, NP_001035779, XP_542937 и XP_011279253. Примеры генов RSPO4 могут включать без ограничения гены RSPO4 человека, мыши, собаки и кошки, например, ген в GenBank Entrez с идентификационным номером 343637 (RSPO4, a.k.a. CRISTIN4 и C20orf182), ген в GenBank Entrez с идентификационным номером 228770 (Rspo4, a.k.a. A730099F22 и A930029K19Rik), ген в GenBank Entrez с идентификационным номером 485813 и ген в GenBank Entrez с идентификационным номером ID 101091527. В некоторых вариантах осуществления RSPO4 представляет собой функциональный вариант RSPO4. В некоторых вариантах осуществления функциональный вариант RSPO4 может предусматривать одну или несколько аминокислотных замен, вставок и/или делеций (например, усечений), но при этом сохраняет частичную или полную активность в отношении одной или нескольких активностей полноразмерного RSPO4 (например, активность в отношении передачи сигнала Wnt, исследования которой описаны и/или проиллюстрированы в данном документе). В некоторых вариантах осуществления функциональный вариант RSPO4 представляет собой усеченный RSPO4. Примеры усеченных полипептидов RSPO4 включают без ограничения SEQ ID NO: 18 и 19 или процессированные формы SEQ ID NO: 18 и 19, характеризующиеся отсутствием сигнального пептида.

Используемый в данном документе термин "РНК-интерференция (RNAi)" обозначает биологический процесс, при котором молекулы РНК ингибируют генную экспрессию, как правило, вызывая разрушение конкретных молекул мРНК. Примеры средств для RNAi включают малую ингибирующую РНК (siRNA), микроРНК (miRNA), малую шпилечную РНК (shRNA).

Используемый в данном документе термин "малая шпилечная РНК" или "короткая шпилечная РНК" (shRNA) обозначает молекулу РНК, которая делает крутой поворот в виде шпильки, что может быть использовано для подавления экспрессии гена-мишени, например, путем РНК-интерференции.

"Передача сигнала Wnt" относится к группе связанных клеточных сигнальных путей, которые регулируются посредством взаимосвязи между белком Wnt и семейством рецепторов Frizzled (Fz) (для изучения см., например, Logan, C.Y., и Nusse, R. (2004) Annu. Rev. Cell Dev. Biol. 20:781-810). Эти пути вовлечены в широкий спектр процессов развития и патогенных процессов. Как используется в данном документе, если не указано иное, термин "передача сигнала Wnt" может относиться к части или ко всему каноническому сигнальному пути Wnt, пути Wnt/планарной клеточной полярности (PCP) и/или Wnt/кальциевому пути. Например, в случае канонического пути Wnt связывание Wnt с рецепторным комплексом Frizzled/LRP приводит к модуляции активности Dishevelled (Dsh), Axin, супрессорного белка аденоматозного полипоза толстой кишки (APC) и гликогенсинтазы (GSK-3), в конечном счете приводя к ингибированию разрушения бета-катенина. Бета-катенин становится способным проникать в ядро и регулировать генную транскрипцию, например, в сочетании с транскрипционными факторами, такими как лимфоидный энхансер-связывающий фактор 1/Т-клеточно-специфический транскрипционный фактор (LEF/TCF). В некоторых вариантах осуществления активность бета-катенина может быть оценена в виде регистрируемой передачи сигнала Wnt (например, с помощью анализа TOP-Flash, такого, как описано в Molenaar, M., et al. (1996) Cell 86(3):391-9).

Ссылка на "приблизительное" значение или параметр в данном документе включает (и описывает) варианты осуществления, которые направлены на это значение или параметр как таковые. Например, описание, относящееся к "приблизительно X", включает описание "X".

Используемые в данном документе формы единственного числа включают ссылки на множественное число, если не указано иное.

Понятно, что аспекты и варианты осуществления настоящего изобретения, описанные в данном документе, включают "содержащие", "состоящие из" и/или "состоящие по сути из" аспекты и варианты осуществления.

III. Способы лечения

В настоящем изобретении предусматривают способы генной терапии миоцилиновой (MYOC) глаукомы, где частицы rAAV, содержащие терапевтические векторы, доставляют в глаз млекопитающего. В некоторых вариантах осуществления миоцилиновая (MYOC) глаукома представляет собой первичную открытоугольную глаукому (POAC). В некоторых вариантах осуществления миоцилиновая (MYOC) глаукома представляет собой ювенильную форму первичной открытоугольной глаукомы (JOAC). В некоторых вариантах осуществления млекопитающее представляет собой человека (например, человека с POAC или человека с JOAC). В некоторых вариантах осуществления млекопитающее с миоцилиновой (MYOC) глаукомой характеризуется мутированным MYOC. В некоторых вариантах осуществления мутированный MYOC содержит одну или несколько аминокислотных замен, соответствующих E323K, K398R, Q368X, G364V, P370L, D380A, K423E, Y437H и I477S в MYOC человека. В некоторых вариантах осуществления мутированный ген MYOC содержит одну или несколько аминокислотных замен, соответствующих аминокислотным заменам P370L и/или Y437H в MYOC человека. В некоторых вариантах осуществления настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у человека, включающие введение в глаз человека эффективного количества частиц rAAV, содержащих вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и/или средство для RNAi в отношении MYOC (например, shRNA). В некоторых вариантах осуществления способы по настоящему изобретению применяют для облегчения симптома миоцилиновой (MYOC) глаукомы у млекопитающего, например, для снижения внутриглазного давления, снижения накопления MYOC в трабекулярной сети, снижения глазной гипертензии или усиления оттока водянистой влаги из трабекулярной сети.

В некоторых аспектах настоящего изобретения предусматривают способы усиления передачи сигнала Wnt в клетках трабекулярной сети млекопитающего, имеющего глазное нарушение, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант. В некоторых вариантах осуществления настоящего изобретения предусматривают способы усиления передачи сигнала Wnt в клетках трабекулярной сети млекопитающего, имеющего глазное нарушение, которые включают введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий средство для RNAi в отношении MYOC, которое целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего. В некоторых вариантах осуществления передача сигнала Wnt усиливается с применением одной или нескольких вирусных частиц, экспрессирующих RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и/или средства для RNAi MYOC; например, RSPO1, RSPO2, RSPO3, RSPO4 или их функционального варианта, и средство для RNAi в отношении MYOC может экспрессироваться с векторов на основе rAAV с различными рекомбинантными вирусными геномами или с одним и тем же вирусным геномом rAAV.

Терапевтические векторы

В настоящем изобретении предусматривают способы генной терапии миоцилиновой (MYOC) глаукомы, где частицы rAAV, содержащие терапевтические векторы, доставляют в глаз млекопитающего; например, терапевтический вектор может кодировать терапевтическую нуклеиновую кислоту и/или терапевтический полипептид. Терапевтический вектор на основе AAV, который кодирует терапевтическую нуклеиновую кислоту и/или терапевтический полипептид, можно получить с помощью способов, известных из уровня техники, с применением стандартных способов синтеза и рекомбинации. В некоторых вариантах осуществления терапевтический полипептид представляет собой полипептид, который стимулирует передачу сигнала Wnt. В некоторых вариантах осуществления терапевтический полипептид стимулирует передачу сигнала Wnt в присутствии мутантного MYOC. В некоторых вариантах осуществления терапевтический полипептид стимулирует передачу сигнала Wnt в присутствии мутантного MYOC человека. В некоторых вариантах осуществления терапевтический полипептид стимулирует передачу сигнала Wnt в присутствии мутантного MYOC человека, связанного с глаукомой. В некоторых вариантах осуществления мутантный MYOC содержит аминокислотную замену P370L и/или Y437H. В некоторых вариантах осуществления мутированный MYOC содержит одну или несколько аминокислотных замен, соответствующих E323K, K398R, Q368X, G364V, P370L, D380A, K423E, Y437H и I477S в MYOC человека.

В некоторых вариантах осуществления в настоящем изобретении предусматривают векторы на основе rAAV для лечения миоцилиновой (MYOC) глаукомы, где векторы на основе rAAV кодируют R-спондиновый полипептид (RSPO) (например, RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант). В некоторых вариантах осуществления полипептид RSPO1 представляет собой RSPO1 человека. В некоторых вариантах осуществления RSPO1 содержит аминокислотную последовательность под SEQ ID NO: 8 или ее функциональный вариант. Примером функционального варианта RSPO1 является RSPO1 с одной или несколькими аминокислотными заменами, добавлениями и/или делециями в аминокислотной последовательности под SEQ ID NO: 8. В некоторых вариантах осуществления вариант RSPO1 предусматривает одну, две, три, четыре, пять, шесть, семь, восемь, девять, десять или более чем 10 замен, добавлений и/или делеций в аминокислотной последовательности под SEQ ID NO: 8 с сохранением способности стимулировать передачу сигнала Wnt (например, в присутствии мутантного MYOC). В некоторых вариантах осуществления вариант RSPO1 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 8. В некоторых вариантах осуществления RSPO1 представляет собой усеченный RSPO1. В некоторых вариантах осуществления усеченный RSPO1 может включать в себя один или несколько фуриноподобных доменов, богатых Cys (например, FU1 и/или FU2), но при этом характеризоваться отсутствием одного или нескольких из следующего: сигнального пептида, домена тромбоспондина типа 1 (например, TSR-1 или TSP1) и/или C-концевого положительно заряженного домена (например, в том числе двойного NLS и/или домена BR; для ссылки см. фиг. 11-13C). В определенных вариантах осуществления усеченный RSPO1 может содержать SEQ ID NO: 11 и/или 12 или процессированные формы SEQ ID NO: 11 и/или 12, характеризующиеся отсутствием сигнального пептида. В определенных вариантах осуществления усеченный RSPO1 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 11 и/или 12. В некоторых вариантах осуществления полипептид RSPO2 представляет собой RSPO2 человека. В некоторых вариантах осуществления RSPO2 содержит аминокислотную последовательность под SEQ ID NO: 9 или ее функциональный вариант. Примером функционального варианта RSPO2 является RSPO2 с одной или несколькими аминокислотными заменами, добавлениями и/или делециями в аминокислотной последовательности под SEQ ID NO: 9. В некоторых вариантах осуществления вариант RSPO2 предусматривает одну, две, три, четыре, пять, шесть, семь, восемь, девять, десять или более чем 10 замен, добавлений и/или делеций в аминокислотной последовательности под SEQ ID NO: 9 с сохранением способности стимулировать передачу сигнала Wnt (например, в присутствии мутантного MYOC). В некоторых вариантах осуществления вариант RSPO2 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO:9. В некоторых вариантах осуществления RSPO2 представляет собой усеченный RSPO2. В некоторых вариантах осуществления усеченный RSPO2 может включать в себя один или несколько фуриноподобных доменов, богатых Cys (например, FU1 и/или FU2), но при этом характеризоваться отсутствием одного или нескольких из следующего: сигнального пептида, домена тромбоспондина типа 1 (например, TSR-1 или TSP1) и/или C-концевого положительно заряженного домена (например, в том числе двойного NLS и/или домена BR; для ссылки см. фиг. 11-13C). В определенных вариантах осуществления усеченный RSPO2 может содержать SEQ ID NO: 13 и/или 14 или процессированные формы SEQ ID NO: 13 и/или 14, характеризующиеся отсутствием сигнального пептида. В определенных вариантах осуществления усеченный RSPO2 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 13 и/или 14. В некоторых вариантах осуществления полипептид RSPO3 представляет собой RSPO3 человека. В некоторых вариантах осуществления RSPO3 содержит аминокислотную последовательность под SEQ ID NO: 1 или ее функциональный вариант. Примером функционального варианта RSPO3 является RSPO3 с одной или несколькими аминокислотными заменами, добавлениями и/или делециями в аминокислотной последовательности под SEQ ID NO: 1. В некоторых вариантах осуществления вариант RSPO3 предусматривает одну, две, три, четыре, пять, шесть, семь, восемь, девять, десять или более чем 10 замен, добавлений и/или делеций в аминокислотной последовательности под SEQ ID NO: 1 с сохранением способности стимулировать передачу сигнала Wnt (например, в присутствии мутантного MYOC). В некоторых вариантах осуществления вариант RSPO3 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 1. В некоторых вариантах осуществления RSPO3 представляет собой усеченный RSPO3. В некоторых вариантах осуществления усеченный RSPO3 может включать в себя один или несколько фуриноподобных доменов, богатых Cys (например, FU1 и/или FU2), но при этом характеризоваться отсутствием одного или нескольких из следующего: сигнального пептида, домена тромбоспондина типа 1 (например, TSR-1 или TSP1) и/или C-концевого положительно заряженного домена (например, в том числе двойного NLS и/или домена BR; для ссылки см. фиг. 11-13C). В определенных вариантах осуществления усеченный RSPO3 может содержать SEQ ID NO: 15, 16 и/или 17 или процессированные формы SEQ ID NO: 15, 16 и/или 17, характеризующиеся отсутствием сигнального пептида. В определенных вариантах осуществления усеченный RSPO3 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 15, 16 и/или 17. В некоторых вариантах осуществления полипептид RSPO4 представляет собой RSPO4 человека. В некоторых вариантах осуществления RSPO4 содержит аминокислотную последовательность под SEQ ID NO: 9 или ее функциональный вариант. Примером функционального варианта RSPO2 является RSPO2 с одной или несколькими аминокислотными заменами, добавлениями и/или делециями в аминокислотной последовательности под SEQ ID NO: 10. В некоторых вариантах осуществления вариант RSPO4 предусматривает одну, две, три, четыре, пять, шесть, семь, восемь, девять, десять или более чем 10 замен, добавлений и/или делеций в аминокислотной последовательности под SEQ ID NO: 10 с сохранением способности стимулировать передачу сигнала Wnt (например, в присутствии мутантного MYOC). В некоторых вариантах осуществления вариант RSPO4 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 10. В некоторых вариантах осуществления RSPO4 представляет собой усеченный RSPO4. В некоторых вариантах осуществления усеченный RSPO4 может включать в себя один или несколько фуриноподобных доменов, богатых Cys (например, FU1 и/или FU2), но при этом характеризоваться отсутствием одного или нескольких из следующего: сигнального пептида, домена тромбоспондина типа 1 (например, TSR-1 или TSP1) и/или C-концевого положительно заряженного домена (например, в том числе двойного NLS и/или домена BR; для ссылки см. фиг. 11-13C). В определенных вариантах осуществления усеченный RSPO4 может содержать SEQ ID NO: 18 и/или 19 или процессированные формы SEQ ID NO: 18 и 19, характеризующиеся отсутствием сигнального пептида. В определенных вариантах осуществления усеченный RSPO4 характеризуется более чем приблизительно 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с SEQ ID NO: 18 и/или 19.

В некоторых вариантах осуществления вектор на основе rAAV содержит нуклеиновую кислоту, кодирующую RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, функционально связанный с промотором. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию RSPO1, RSPO2, RSPO3, RSPO4 или их функционального варианта в глазу млекопитающего. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию RSPO1, RSPO2, RSPO3, RSPO4 или их функционального варианта в клетках трабекулярной сети. В некоторых вариантах осуществления промотор представляет собой гибридный промотор β-актина курицы (CBA).

В настоящем изобретении предусматривают способы генной терапии миоцилиновой (MYOC) глаукомы, где частицы rAAV, содержащие терапевтические векторы, доставляют в глаз млекопитающего; например, терапевтический вектор может кодировать терапевтическую нуклеиновую кислоту и/или терапевтический полипептид. Терапевтический вектор на основе AAV, который кодирует терапевтическую нуклеиновую кислоту и/или терапевтический полипептид, можно получить с помощью способов, известных из уровня техники, с применением стандартных способов синтеза и рекомбинации. В некоторых вариантах осуществления терапевтическая нуклеиновая кислота кодирует РНК, которая целенаправленно воздействует на экспрессию MYOC. В некоторых вариантах осуществления гетерологичная нуклеиновая кислота кодирует РНК, которая снижает или ингибирует экспрессию MYOC. В некоторых вариантах осуществления гетерологичная нуклеиновая кислота кодирует РНК, которая снижает или ингибирует экспрессию мутантного MYOC. В некоторых вариантах осуществления гетерологичная нуклеиновая кислота кодирует РНК, которая снижает или ингибирует экспрессию мутантного MYOC человека. В некоторых вариантах осуществления мутантный MYOC человека содержит аминокислотную замену P370L и/или Y437. Неограничивающие примеры нуклеиновой кислоты включают средство для RNAi, малую ингибирующую РНК (siRNA), микроРНК (miRNA), малую шпилечную РНК (shRNA) и/или рибозимы (такие как рибозимы типа "головки молотка" и рибозимы, содержащие шпильки). В некоторых вариантах осуществления гетерологичная нуклеиновая кислота, кодирующая РНК, которая снижает или ингибирует экспрессию MYOC, представляет собой shRNA, которая снижает или ингибирует экспрессию MYOC (например, мутантного MYOC и MYOC дикого типа).

В некоторых аспектах настоящего изобретения предусматривают способы генной терапии миоцилиновой (MYOC) глаукомы, при этом частицы rAAV, содержащие терапевтические векторы, доставляют в глаз млекопитающего, где векторы содержат нуклеиновую кислоту, которая кодирует один или несколько терапевтических полипептидов. Частицы rAAV, содержащие терапевтические векторы, могут быть получены с применением способов, известных из уровня техники, с применением стандартных способов синтеза и рекомбинации. В некоторых вариантах осуществления вектор кодирует терапевтический полипептид. В некоторых вариантах осуществления терапевтический полипептид целенаправленно воздействует на передачу сигнала Wnt. В некоторых вариантах осуществления терапевтический полипептид стимулирует передачу сигнала Wnt.

В некоторых аспектах настоящего изобретения предусматривают способы генной терапии миоцилиновой (MYOC) глаукомы, при этом частицы rAAV, содержащие терапевтические векторы, доставляют в глаз млекопитающего, где векторы содержат нуклеиновую кислоту, которая кодирует один или несколько терапевтических полипептидов и одну или несколько терапевтических нуклеиновых кислот. Частицы rAAV, содержащие терапевтические векторы, могут быть получены с применением способов, известных из уровня техники, с применением стандартных способов синтеза и рекомбинации. В некоторых вариантах осуществления терапевтический полипептид целенаправленно воздействует на передачу сигнала Wnt, и терапевтическая нуклеиновая кислота целенаправленно воздействует на экспрессию MYOC. В некоторых вариантах осуществления терапевтический полипептид стимулирует передачу сигнала Wnt. В некоторых вариантах осуществления гетерологичная нуклеиновая кислота кодирует РНК, которая снижает или ингибирует экспрессию MYOC. В некоторых вариантах осуществления гетерологичная нуклеиновая кислота кодирует РНК, которая снижает или ингибирует экспрессию мутантного MYOC. В некоторых вариантах осуществления гетерологичная нуклеиновая кислота кодирует РНК, которая снижает или ингибирует экспрессию мутантного MYOC человека. В некоторых вариантах осуществления мутантный MYOC человека содержит аминокислотную замену P370L и/или Y437. Неограничивающие примеры терапевтической нуклеиновой кислоты включают средство для RNAi, siRNA, miRNA, shRNA и/или рибозимы.

В некоторых аспектах настоящего изобретения предусматривают способы генной терапии миоцилиновой (MYOC) глаукомы у млекопитающего, при этом частицы rAAV, содержащие векторы, кодирующие один или несколько терапевтических полипептидов, вводят млекопитающему, и частицы rAAV, содержащие векторы, кодирующие одну или несколько терапевтических нуклеиновых кислот, вводят млекопитающему. В некоторых вариантах осуществления терапевтический полипептид целенаправленно воздействует на передачу сигнала Wnt, и терапевтическая нуклеиновая кислота целенаправленно воздействует на экспрессию MYOC. В некоторых вариантах осуществления терапевтический полипептид стимулирует передачу сигнала Wnt. В некоторых вариантах осуществления гетерологичная нуклеиновая кислота кодирует РНК, которая снижает или ингибирует экспрессию MYOC. В некоторых вариантах осуществления гетерологичная нуклеиновая кислота кодирует РНК, которая снижает или ингибирует экспрессию мутантного MYOC. В некоторых вариантах осуществления гетерологичная нуклеиновая кислота кодирует РНК, которая снижает или ингибирует экспрессию мутантного MYOC человека. В некоторых вариантах осуществления мутантный MYOC человека содержит аминокислотную замену P370L и/или Y437. Неограничивающие примеры терапевтической нуклеиновой кислоты включают средство для RNAi, siRNA, miRNA, shRNA и/или рибозимы. Частицы rAAV, содержащие векторы, кодирующие один или несколько терапевтических полипептидов, и частицы rAAV, содержащие векторы, кодирующие одну или несколько терапевтических нуклеиновых кислот, можно вводить млекопитающему одновременно или последовательно. В некоторых вариантах осуществления частицы rAAV, содержащие векторы, кодирующие один или несколько терапевтических полипептидов, вводят после того, как ввели частицы rAAV, содержащие векторы, кодирующие одну или несколько терапевтических нуклеиновых кислот. В некоторых вариантах осуществления частицы rAAV, содержащие векторы, кодирующие один или несколько терапевтических полипептидов, вводят до того, как ввели частицы rAAV, содержащие векторы, кодирующие одну или несколько терапевтических нуклеиновых кислот.

Нуклеиновые кислоты по настоящему изобретению могут кодировать полипептиды, которые представляют собой внутриклеточные белки, заякоренные в клеточной мембране, остающиеся внутри клетки или секретируемые клеткой, трансдуцированной векторами по настоящему изобретению. В случае полипептидов, секретируемых клеткой, которая получает вектор, полипептид предпочтительно является растворимым (т. е. не прикрепленным к клетке). Например, растворимые полипептиды лишены трансмембранной области и секретируются из клетки. Методики идентификации и удаления последовательностей нуклеиновых кислот, кодирующих трансмембранные домены, известны из уровня техники.

Векторы, которые можно вводить согласно настоящему изобретению, также включают векторы, содержащие нуклеиновую кислоту, которая кодирует РНК (например, shRNA, средство для RNAi, рибозимы, miRNA, siRNA, антисмысловую РНК), которая при транскрипции с нуклеиновых кислот вектора может обеспечивать лечение миоцилиновой (MYOC) глаукомы путем препятствования трансляции или транскрипции аномального или избыточного белка, связанного с болезненным состоянием по настоящему изобретению, например, белка MYOC. В некоторых примерах нуклеиновые кислоты по настоящему изобретению могут кодировать РНК, которая обеспечивает лечение заболевания путем высокоспецифического устранения или снижения уровня мРНК, кодирующей аномальные и/или избыточные белки. Последовательности терапевтических РНК включают малую шпилечную РНК (shRNA), средство для RNAi, малую ингибирующую РНК (siRNA), микроРНК (miRNA) и/или рибозимы (такие как рибозимы типа "головки молотка" и рибозимы, содержащие шпильки), которые могут обеспечивать лечение заболеваний путем высокоспецифического устранения или снижения уровня мРНК, кодирующей аномальные и/или избыточные белки, такие как белки, встречающиеся при различных формах наследственной дегенерации сетчатки. Примеры последовательностей терапевтических РНК и нуклеиновых кислот, кодирующих эти последовательности, которые можно применять в настоящем изобретении, включают описанные, например, в патенте США № 6225291, раскрытие которого включено в данный документ посредством ссылки во всей своей полноте.

В некоторых вариантах осуществления настоящего изобретения последовательность терапевтической РНК представляет собой последовательность средства для RNAi (например, shRNA), целенаправленно воздействующую на экспрессию MYOC. В некоторых вариантах осуществления последовательность средства для RNAi (например, shRNA), целенаправленно воздействующая на экспрессию MYOC, представляет собой последовательность средства для RNAi (например, shRNA), которая снижает или ингибирует экспрессию MYOC. В некоторых вариантах осуществления средство для RNAi (например, shRNA) снижает или ингибирует экспрессию MYOC человека. В некоторых вариантах осуществления средство для RNAi (например, shRNA) снижает или ингибирует экспрессию MYOC, содержащего аминокислотную последовательность под SEQ ID NO: 3. В некоторых вариантах осуществления средство для RNAi в отношении MYOC (например, shRNA) целенаправленно воздействует на аминокислотную последовательность QAMSVIH (SEQ ID NO: 6) MYOC. В некоторых вариантах осуществления частицы rAAV кодируют вектор, содержащий более чем одно средство для RNAi (например, shRNA), которое целенаправленно воздействует на экспрессию MYOC (например, снижает или ингибирует). В некоторых вариантах осуществления последовательность петли средства для RNAi в отношении MYOC (например, shRNA) содержит последовательность нуклеиновой кислоты AATAGTGAAGCCACAGATGTATT (SEQ ID NO: 7). В некоторых вариантах осуществления частицы rAAV кодируют вектор, содержащий одно, два, три, четыре, пять или более средств для RNAi (например, shRNA), которые целенаправленно воздействуют на экспрессию MYOC (например, снижают или ингибируют).

В некоторых вариантах осуществления вектор на основе rAAV содержит нуклеиновую кислоту, кодирующую средство для RNAi в отношении MYOC (например, shRNA), функционально связанное с промотором. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию средства для RNAi в отношении MYOC (например, shRNA) в глазу млекопитающего. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию средства для RNAi в отношении MYOC (например, shRNA) в клетках трабекулярной сети. В некоторых вариантах осуществления промотор представляет собой гибридный промотор β-актина курицы (CBA). В некоторых вариантах осуществления промотор представляет собой промотор РНК-полимеразы III.

В некоторых вариантах осуществления вектор на основе rAAV содержит нуклеиновую кислоту, кодирующую любой RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, как описано в данном документе, и нуклеиновую кислоту, кодирующую любое средство для RNAi в отношении MYOC (например, shRNA), как описано в данном документе. В некоторых вариантах осуществления нуклеиновая кислота, кодирующая RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и нуклеиновая кислота, кодирующая средство для RNAi в отношении MYOC (например, shRNA), находятся в разных геномах rAAV. В некоторых вариантах осуществления нуклеиновая кислота, кодирующая RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и нуклеиновая кислота, кодирующая средство для RNAi в отношении MYOC (например, shRNA), находятся в одном и том же геноме rAAV. В некоторых вариантах осуществления нуклеиновая кислота, кодирующая RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и нуклеиновая кислота, кодирующая средство для RNAi в отношении MYOC (например, shRNA), функционально связаны с одним и тем же промотором. В некоторых вариантах осуществления нуклеиновая кислота, кодирующая RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и нуклеиновая кислота, кодирующая средство для RNAi в отношении MYOC (например, shRNA), функционально связаны с разными промоторами. В некоторых вариантах осуществления нуклеиновая кислота кодирующая RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, расположена в направлении 5'-конца от нуклеиновой кислоты, кодирующей средство для RNAi в отношении MYOC (например, shRNA). В некоторых вариантах осуществления нуклеиновая кислота кодирующая RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, расположена в направлении 3'-конца от нуклеиновой кислоты, кодирующей средство для RNAi в отношении MYOC (например, shRNA). В некоторых вариантах осуществления нуклеиновая кислота, кодирующая RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и нуклеиновая кислота, кодирующая средство для RNAi в отношении MYOC (например, shRNA), функционально связаны с одним и тем же промотором, при этом нуклеиновая кислота включает в себя сайт внутренней посадки рибосомы (IRES) между RSPO1, RSPO2, RSPO3, RSPO4 или их функциональным вариантом и нуклеиновыми кислотами средства для RNAi в отношении MYOC (например, shRNA).

Композиции на основе rAAV

В некоторых аспектах настоящее изобретение предусматривает композиции, содержащие любые частицы rAAV, описанные в данном документе. Как правило, композиции для применения в способах и системах по настоящему изобретению содержат эффективное количество частиц rAAV, содержащих векторы на основе rAAV, кодирующие полипептид и/или РНК, предпочтительно в фармацевтически приемлемом наполнителе. Как хорошо известно из уровня техники, фармацевтически приемлемые наполнители представляют собой относительно инертные вещества, облегчающие введение фармакологически эффективного вещества, и могут поставляться в виде жидких растворов или суспензий, в виде эмульсий или в виде твердых форм, подходящих для растворения или суспендирования в жидкости перед применением. Например, наполнитель может придавать форму или консистенцию или выступать в качестве разбавителя. Подходящие наполнители включают, без ограничения, стабилизаторы, смачивающие и эмульгирующие средства, соли для изменения осмолярности, инкапсулирующие средства, буферные вещества для поддержания pH и буферы. Такие наполнители включают любое фармацевтическое средство, подходящее для прямой доставки в глаз, которое можно вводить без излишней токсичности. Фармацевтически приемлемые наполнители включают, без ограничения, сорбит, любое из различных соединений TWEEN и жидкости, такие как вода, физиологический раствор, глицерин и этанол. В них могут быть включены фармацевтически приемлемые соли, например, соли минеральных кислот, такие как гидрохлориды, гидробромиды, фосфаты, сульфаты и т. п.; и соли органических кислот, такие как ацетаты, пропионаты, малонаты, бензоаты и т. п. Всестороннее обсуждение фармацевтически приемлемых наполнителей доступно в REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., N.J. 1991).

Как правило, эти композиции составляют для введения путем глазной инъекции (например, интравитреальной, интракамеральной, субретинальной). Соответственно, эти композиции предпочтительно необходимо объединять с фармацевтически приемлемыми основами, такими как физиологический раствор, сбалансированный солевой раствор Рингера (pH 7,4) и т. п. Хотя это и не требуется, композиции необязательно могут поставляться в виде стандартной лекарственной формы, подходящей для введения точного количества.

В некоторых вариантах осуществления в настоящем изобретении предусматривают фармацевтические составы с rAAV для лечения миоцилиновой (MYOC) глаукомы. В некоторых вариантах осуществления состав содержит частицы rAAV, содержащие вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3 и/или RSPO4 или их функциональный вариант. В некоторых вариантах осуществления состав содержит частицы rAAV, содержащие вектор на основе rAAV, кодирующий средство для RNAi в отношении MYOC (например, shRNA). В некоторых вариантах осуществления состав содержит частицы rAAV, содержащие вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3 и/или RSPO4 или их функциональный вариант и средство для RNAi в отношении MYOC (например, shRNA). В некоторых вариантах осуществления состав содержит частицы rAAV, содержащие вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3 и/или RSPO4 или их функциональный вариант, и частицы rAAV, содержащие вектор на основе rAAV, кодирующий средство для RNAi в отношении MYOC (например, shRNA).

Способы глазной доставки rAAV

В некоторых аспектах настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего, включающие введение частиц rAAV в глаз млекопитающего. В некоторых вариантах осуществления частицы rAAV содержат вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3 и/или RSPO4 или их функциональный вариант, и/или вектор на основе rAAV, кодирующий средство для RNAi в отношении MYOC (например, shRNA). В некоторых вариантах осуществления частицы rAAV доставляют в глаз с помощью интравитреальной и/или интракамеральной инъекции. Способы введения частиц rAAV в глаз известны из уровня техники.

В некоторых вариантах осуществления частицы rAAV, содержащие векторы на основе rAAV, кодирующие RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и/или средство для MYOC RNAi (например, shRNA), доставляют в глаз млекопитающего, где RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и/или средство для RNAi в отношении MYOC (например, shRNA) экспрессируются в трабекулярной сети глаза. В некоторых вариантах осуществления частицы rAAV, содержащие векторы на основе rAAV, кодирующие RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, доставляют в глаз млекопитающего, где происходит трансдукция других частей глаза (например, ганглионарных клеток сетчатки). Применение частиц rAAV, содержащих капсид AAV2, который содержит аминокислотную замену R471A, может облегчать трансдукцию клеток трабекулярной сети.

Благодаря безопасной и эффективной трансдукции клеток глаза (например, клеток трабекулярной сети) с помощью вектора, содержащего терапевтический полипептид или последовательность нуклеиновой кислоты, способы по настоящему изобретению можно применять для лечения индивидуума, например, человека с миоцилиновой (MYOC) глаукомой, при этом трансдуцированные клетки продуцируют терапевтический полипептид или последовательность РНК в количестве, достаточном для лечения миоцилиновой (MYOC) глаукомы (например, POAC или JOAC). В некоторых вариантах осуществления трансдукцию клеток глаза улучшают посредством применения частиц rAAV2, содержащих аминокислотную замену R471A в капсидных белках AAV, нумерация которой приведена согласно VP1 AAV2. В некоторых вариантах осуществления частицы rAAV демонстрируют повышение трансдукции в клетках трабекулярной сети, например, трансдукция наблюдалась более чем у приблизительно 10%, 25%, 50%, 75%, 100% или любого количества в этих пределах клеток трабекулярной сети.

Эффективное количество rAAV (в некоторых вариантах осуществления в форме частиц) вводят в зависимости от целей лечения. Например, если при низкой процентной доле трансдукции можно достичь желаемого терапевтического эффекта, то целью лечения, как правило, является соответствие этому уровню трансдукции или его превышение. В некоторых случаях этого уровня трансдукции можно достичь путем трансдукции лишь приблизительно 1-5% клеток-мишеней (например, клеток трабекулярной сети), в некоторых вариантах осуществления по меньшей мере приблизительно 20% клеток желаемого типа ткани, в некоторых вариантах осуществления по меньшей мере приблизительно 50%, в некоторых вариантах осуществления по меньшей мере приблизительно 80%, в некоторых вариантах осуществления по меньшей мере приблизительно 95%, в некоторых вариантах осуществления по меньшей мере приблизительно 99% клеток желаемого типа ткани. В качестве руководства, число частиц, вводимых в расчете на одну инъекцию, как правило, составляет от приблизительно 1×106 до приблизительно 1×1014 частиц, от приблизительно 1×107 до 1×1013 частиц, от приблизительно 1×109 до 1×1012 частиц или приблизительно 1×109 частиц, приблизительно 1×1010 частиц или приблизительно 1×1011 частиц. Композицию на основе rAAV можно вводить путем одной или нескольких глазных инъекций, производимых в ходе одной и той же процедуры или разделенных несколькими днями, неделями, месяцами или годами. В некоторых вариантах осуществления для лечения человека можно применять несколько векторов.

Способы идентификации клеток глаза, трансдуцированных вирусными частицами AAV, известны из уровня техники; например, можно применять иммуногистохимический анализ или маркер, такой как усиленный зеленый флуоресцентный белок, для выявления трансдукции вирусными частицами, например вирусными частицами, содержащими капсид rAAV с одной или несколькими аминокислотными заменами.

В некоторых вариантах осуществления настоящего изобретения, способы включают интравитреальное и/или интракамеральное введение эффективного количества вирусных частиц AAV млекопитающему для лечения индивидуума с миоцилиновой (MYOC) глаукомой, например, человека с POAC или JOAC. В некоторых вариантах осуществления композицию вводят путем инъекции в одно или несколько местоположений в глазу для обеспечения экспрессии гетерологичной нуклеиновой кислоты в клетках глаза (например, клетках трабекулярной сети). В некоторых вариантах осуществления композицию вводят путем инъекции в любое из одного, двух, трех, четырех, пяти, шести, семи, восьми, девяти, десяти или более десяти местоположений в глазу.

В некоторых вариантах осуществления вирусные частицы rAAV, содержащие капсид rAAV, инъецируют в более чем одно местоположение одновременно или последовательно. В некоторых вариантах осуществления многократные инъекции вирусных частиц rAAV проводят с интервалом не более чем один час, два часа, три часа, четыре часа, пять часов, шесть часов, девять часов, двенадцать часов или 24 часа.

Способы субретинальной доставки

Способы субретинальной доставки известны из уровня техники. Например, см. WO 2009/105690, включенную в данный документ посредством ссылки. Вкратце, общий способ доставки частиц rAAV (например, частиц rAAV2) в субретинальную область желтого пятна и центральной ямки можно проиллюстрировать следующим кратким обзором. Этот пример направлен лишь на иллюстрацию определенных признаков способа и никаким образом не подразумевается как ограничивающий.

Как правило, вектор на основе rAAV можно доставлять в форме композиции, вводимой путем внутриглазной инъекции (субретинально), при непосредственном наблюдении с помощью операционного микроскопа. В некоторых вариантах осуществления вектор инкапсидирован в частице rAAV, где частица rAAV содержит капсид rAAV, содержащий капсидные белки rAAV, содержащие одну или несколько аминокислотных замен в одном или нескольких положениях, в которых происходит взаимодействие с гепарансульфатсодержащим протеогликаном (например, уменьшающих, или ингибирующих, или устраняющих связывание с HSPG), и вектор на основе rAAV, содержащий гетерологичную нуклеиновую кислоту и по меньшей мере один инвертированный концевой повтор AAV. Данная процедура может включать удаление стекловидного тела с последующей инъекцией суспензии вектора на основе rAAV в субретинальное пространство при помощи тонкой канюли через один или несколько небольших разрезов сетчатки.

Вкратце, инфузионную канюлю можно закреплять швом на месте для поддержания нормального объема глазного яблока путем инфузии (например, физиологического раствора) на протяжении всей операции. Удаление стекловидного тела проводят при помощи канюли с подходящим размером канала (например, 20-27 калибра), где объем удаляемого гелеобразного стекловидного тела замещают путем инфузии физиологического раствора или другого изотонического раствора из инфузионной канюли. Преимущественно проводят удаление стекловидного тела, поскольку (1) удаление его коркового слоя (задней гиалоидной мембраны) облегчает проникновение канюли в сетчатку; (2) его удаление и замещение жидкостью (например, физиологическим раствором) создает пространство для обеспечения внутриглазной инъекции вектора, и (3) его контролируемое удаление снижает вероятность разрывов сетчатки и незапланированного отслоения сетчатки.

В некоторых вариантах осуществления композицию на основе rAAV вводят путем прямой инъекции в субретинальное пространство за пределами центральной зоны сетчатки при использовании канюли с подходящим размером канала (например, 27-45 калибра), создавая таким образом пузырек в субретинальном пространстве. В других вариантах осуществления субретинальной инъекции композиции на основе rAAV предшествует субретинальная инъекция небольшого объема (например, от приблизительно 0,1 до приблизительно 0,5 мл) подходящей жидкости (такой как физиологический раствор или раствор Рингера) в субретинальное пространство за пределами центральной зоны сетчатки. Посредством этой первоначальной инъекции в субретинальное пространство в субретинальном пространстве формируется первоначальный пузырек жидкости, что вызывает локальное отслоение сетчатки в местоположении первоначального пузырька. Этот первоначальный пузырек жидкости может облегчать целенаправленную доставку композиции на основе rAAV в субретинальное пространство (посредством определения плоскости инъекции перед доставкой rAAV) и обеспечивать сведение к минимуму возможности введения rAAV в сосудистую оболочку глаза и вероятности инъекции или обратного тока rAAV в полость стекловидного тела. В некоторых вариантах осуществления в этот первоначальный пузырек жидкости можно дополнительно вводить с жидкостями, содержащими одну или несколько композиций на основе rAAV и/или одно или несколько дополнительных терапевтических средств, посредством введения этих жидкостей непосредственно в первоначальный пузырек жидкости при помощи тех же самых или дополнительных узких канюль.

Внутриглазное введение композиций на основе rAAV и/или первоначального небольшого объема жидкости можно проводить при помощи узкой канюли (например, 27-45 калибра), прикрепленной к шприцу. В некоторых вариантах осуществления поршень этого шприца может управляться механическим устройством, как, например, путем нажатия на ножную педаль. Благодаря проведению склеротомии узкую канюлю продвигают через полость стекловидного тела в участок сетчатки, предварительно определенный для каждого субъекта в соответствии с зоной сетчатки, подлежащей целенаправленному воздействию (но за пределами центральной зоны сетчатки). При непосредственной визуализации суспензию вектора вводят путем механической инъекции под нейросенсорную часть сетчатки, что вызывает локальное отслоение сетчатки с самозатягивающимся нерасширяющимся разрезом сетчатки. Как отмечено выше, композицию на основе rAAV можно вводить путем прямой инъекции в субретинальное пространство, создавая пузырек за пределами центральной зоны сетчатки, либо вектор можно вводить путем инъекции в первоначальный пузырек за пределами центральной зоны сетчатки, вызывая его расширение (и расширение зоны отслоения сетчатки). В некоторых вариантах осуществления за инъекцией композиции на основе rAAV следует инъекция другой жидкости в пузырек.

Не желая ограничиваться какой-либо теорией, полагают, что скорость и местоположение субретинальной(субретинальных) инъекции(инъекций) могут обуславливать возникновение локальных сил сдвига, которые могут повреждать желтое пятно, центральную ямку и/или нижележащие клетки RPE. Субретинальные инъекции можно проводить при скорости, при которой силы сдвига сводятся к минимуму или исключаются. В некоторых вариантах осуществления композицию на основе rAAV вводят путем инъекции в течение приблизительно 15-17 минут. В некоторых вариантах осуществления вектор вводят путем инъекции в течение приблизительно 17-20 минут. В некоторых вариантах осуществления композицию на основе rAAV вводят путем инъекции в течение приблизительно 20-22 минут. В некоторых вариантах осуществления композицию на основе rAAV вводят путем инъекции при скорости от приблизительно 35 до приблизительно 65 мкл/мин. В некоторых вариантах осуществления композицию на основе rAAV вводят путем инъекции при скорости приблизительно 35 мкл/мин. В некоторых вариантах осуществления композицию на основе rAAV вводят путем инъекции при скорости приблизительно 40 мкл/мин. В некоторых вариантах осуществления композицию на основе rAAV вводят путем инъекции при скорости приблизительно 45 мкл/мин. В некоторых вариантах осуществления композицию на основе rAAV вводят путем инъекции при скорости приблизительно 50 мкл/мин. В некоторых вариантах осуществления композицию на основе rAAV вводят путем инъекции при скорости приблизительно 55 мкл/мин. В некоторых вариантах осуществления композицию на основе rAAV вводят путем инъекции при скорости приблизительно 60 мкл/мин. В некоторых вариантах осуществления композицию на основе rAAV вводят путем инъекции при скорости приблизительно 65 мкл/мин. Специалисту в данной области будет понятно, что скорость и продолжительность инъекции в пузырек может определяться, например, объемом композиции на основе rAAV или размером пузырька, необходимым для создания достаточного отслоения сетчатки для получения доступа к клеткам центральной зоны сетчатки, размером канюли, применяемой для доставки композиции на основе rAAV, и возможностью безопасного сохранения положения канюли по настоящему изобретению.

В некоторых вариантах осуществления настоящего изобретения объем композиции, вводимой путем инъекции в субретинальное пространство сетчатки, превышает приблизительно любое количество из 1 мкл, 2 мкл, 3 мкл, 4 мкл, 5 мкл, 6 мкл, 7 мкл, 8 мкл, 9 мкл, 10 мкл, 15 мкл, 20 мкл, 25 мкл, 50 мкл, 75 мкл, 100 мкл, 200 мкл, 300 мкл, 400 мкл, 500 мкл, 600 мкл, 700 мкл, 800 мкл, 900 мкл или 1 мл или любое количество между ними.

Можно создать один или несколько (например, 2, 3 или более) пузырьков. Как правило, общий объем пузырька или пузырьков, создаваемых с помощью способов и систем по настоящему изобретению, не может превышать объем жидкости в глазу, например, приблизительно 4 мл у типичного субъекта-человека. Общий объем каждого отдельного пузырька предпочтительно составляет по меньшей мере приблизительно 0,3 мл или более предпочтительно по меньшей мере приблизительно 0,5 мл для обеспечения отслоения сетчатки достаточного размера для обнажения типов клеток центральной зоны сетчатки и создания пузырька с достаточной способностью к оседанию для оптимальных действий. Специалисту в данной области будет понятно, что при создании пузырька согласно способам и системам по настоящему изобретению необходимо поддерживать соответствующее внутриглазное давление во избежание повреждения структур глаза. Размер каждого отдельного пузырька может составлять, например, от приблизительно 0,5 до приблизительно 1,2 мл, от приблизительно 0,8 до приблизительно 1,2 мл, от приблизительно 0,9 до приблизительно 1,2 мл, от приблизительно 0,9 до приблизительно 1,0 мл, от приблизительно 1,0 до приблизительно 2,0 мл, от приблизительно 1,0 до приблизительно 3,0 мл. Таким образом, в одном примере для инъекции в общей сложности 3 мл суспензии композиции на основе rAAV можно сформировать 3 пузырька приблизительно по 1 мл каждый. Общий объем всех пузырьков в комбинации может составлять, например, от приблизительно 0,5 до приблизительно 3,0 мл, от приблизительно 0,8 до приблизительно 3,0 мл, от приблизительно 0,9 до приблизительно 3,0 мл, от приблизительно 1,0 до приблизительно 3,0 мл, от приблизительно 0,5 до приблизительно 1,5 мл, от приблизительно 0,5 до приблизительно 1,2 мл, от приблизительно 0,9 до приблизительно 3,0 мл, от приблизительно 0,9 до приблизительно 2,0 мл, от приблизительно 0,9 до приблизительно 1,0 мл.

В целях безопасной и эффективной трансдукции в целевых зонах сетчатки (например, в центральной зоне сетчатки) за пределами границ исходного местоположения пузырька пузырек можно подвергнуть действиям по перемещению пузырька в целевую зону для трансдукции. Действия с пузырьком могут происходить благодаря способности пузырька к оседанию, создаваемой объемом пузырька, посредством перемещения глаза, содержащего пузырек, перемещения головы человека с глазом или глазами, содержащими один или несколько пузырьков, и/или путем обмена жидкость-воздух. Это особенно относится к центральной зоне сетчатки, поскольку эта зона обычно является устойчивой к отслоению в результате субретинальной инъекции. В некоторых вариантах осуществления для перемещения пузырька используют обмен жидкость-воздух; жидкость из инфузионной канюли временно замещают воздухом, например, воздухом, выдуваемым на поверхность сетчатки. Поскольку объем воздуха вытесняет жидкость полости стекловидного тела с поверхности сетчатки, жидкость из полости стекловидного тела может вытекать из канюли. Временное отсутствие давления жидкости полости стекловидного тела вызывает движение и перемещение пузырька под действием силы тяжести в нижнюю часть глаза. С пузырьком с субретинально введенной композицией на основе rAAV производят действия для охвата прилегающих зон (например, желтого пятна и/или центральной ямки) посредством соответствующего размещения глазного яблока. В некоторых случаях масса пузырька является достаточной, чтобы вызвать его перемещение под действием силы тяжести даже без применения обмена жидкость-воздух. Движение пузырька в желаемое местоположение можно дополнительно облегчить путем изменения положения головы субъекта для того, чтобы позволить пузырьку переместиться под действием силы тяжести в желаемое местоположение в глазу. По достижении желаемой конфигурации пузырька жидкость возвращают в полость стекловидного тела. Жидкость представляет собой подходящую жидкость, например, свежеприготовленный физиологический раствор. Как правило, субретинально введенную композицию на основе rAAV можно оставить in situ без ретинопексии разреза сетчатки и без внутриглазной тампонады, и сетчатка самопроизвольно повторно прикрепляется в течение приблизительно 48 часов.

Благодаря безопасной и эффективной трансдукции клеток глаза (например, клеток трабекулярной сети) с помощью вектора, содержащего терапевтический полипептид или последовательность РНК, способы по настоящему изобретению можно применять для лечения индивидуума, например, человека с миоцилиновой (MYOC) глаукомой, при этом трансдуцированные клетки продуцируют терапевтический полипептид или последовательность РНК в количестве, достаточном для лечения миоцилиновой (MYOC) глаукомы.

Эффективное количество rAAV (в некоторых вариантах осуществления в форме частиц) вводят в зависимости от целей лечения. Например, если при низкой процентной доле трансдукции можно достичь желаемого терапевтического эффекта, то целью лечения, как правило, является соответствие этому уровню трансдукции или его превышение. В некоторых случаях этого уровня трансдукции можно достичь путем трансдукции лишь приблизительно 1-5% клеток-мишеней, в некоторых вариантах осуществления по меньшей мере приблизительно 20% клеток желаемого типа ткани, в некоторых вариантах осуществления по меньшей мере приблизительно 50%, в некоторых вариантах осуществления по меньшей мере приблизительно 80%, в некоторых вариантах осуществления по меньшей мере приблизительно 95%, в некоторых вариантах осуществления по меньшей мере приблизительно 99% клеток желаемого типа ткани. Как обсуждается выше, замена одной или нескольких аминокислот капсида rAAV, которые взаимодействуют с HSPG, улучшает трансдукцию, опосредованную rAAV. В качестве руководства, число частиц, вводимых в расчете на одну инъекцию, как правило, составляет от приблизительно 1×106 до приблизительно 1×1014 частиц, от приблизительно 1×107 до 1×1013 частиц, от приблизительно 1×109 до 1×1012 частиц или приблизительно 1×1011 частиц. Композицию на основе rAAV можно вводить путем одной или нескольких субретинальных инъекций, производимых в ходе одной и той же процедуры или разделенных несколькими днями, неделями, месяцами или годами. В некоторых вариантах осуществления для лечения человека можно применять несколько векторов.

В некоторых вариантах осуществления введение в глаз эффективного количества вирусных частиц rAAV приводит к трансдукции более чем приблизительно 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% или 100% или любого количества клеток глаза в этих промежутках. В некоторых вариантах осуществления от приблизительно 5% до приблизительно 100%, от приблизительно 10% до приблизительно 50%, от приблизительно 10% до приблизительно 30%, от приблизительно 25% до приблизительно 75%, от приблизительно 25% до приблизительно 50% или от приблизительно 30% до приблизительно 50% клеток глаза являются трансдуцированными. Способы идентификации клеток глаза, трансдуцированных вирусными частицами AAV, содержащими капсид rAAV, известны из уровня техники; например, можно применять иммуногистохимический анализ или маркер, такой как усиленный зеленый флуоресцентный белок, для выявления трансдукции вирусными частицами.

В некоторых вариантах осуществления введение в трабекулярную сеть эффективного количества вирусных частиц rAAV приводит к трансдукции более чем приблизительно 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% или 100% или любого количества клеток трабекулярной сети в этих промежутках. В некоторых вариантах осуществления от приблизительно 5% до приблизительно 100%, от приблизительно 10% до приблизительно 50%, от приблизительно 10% до приблизительно 30%, от приблизительно 25% до приблизительно 75%, от приблизительно 25% до приблизительно 50% или от приблизительно 30% до приблизительно 50% клеток трабекулярной сети являются трансдуцированными. Способы идентификации клеток трабекулярной сети, трансдуцированных вирусными частицами AAV, содержащими капсид rAAV, известны из уровня техники; например, можно применять иммуногистохимический анализ или маркер, такой как усиленный зеленый флуоресцентный белок, для выявления трансдукции вирусными частицами.

В некоторых вариантах осуществления настоящего изобретения способы включают введение в глаз млекопитающего эффективного количества вирусных частиц AAV для лечения индивидуума с миоцилиновой (MYOC) глаукомой, например, человека с миоцилиновой (MYOC) глаукомой. В некоторых вариантах осуществления композицию вводят путем инъекции в одно или несколько местоположений в глазу для обеспечения экспрессии гетерологичной нуклеиновой кислоты в клетках глаза. В некоторых вариантах осуществления композицию вводят путем инъекции в любое из одного, двух, трех, четырех, пяти, шести, семи, восьми, девяти, десяти или более десяти местоположений в глазу.

В некоторых вариантах осуществления настоящего изобретения способы включают введение в трабекулярную сеть млекопитающего эффективного количества вирусных частиц AAV для лечения индивидуума с миоцилиновой (MYOC) глаукомой, например, человека с миоцилиновой (MYOC) глаукомой. В некоторых вариантах осуществления композицию вводят путем инъекции в одно или несколько местоположений в трабекулярной сети для обеспечения экспрессии гетерологичной нуклеиновой кислоты в клетках трабекулярной сети. В некоторых вариантах осуществления композицию вводят путем инъекции в любое из одного, двух, трех, четырех, пяти, шести, семи, восьми, девяти, десяти или более десяти местоположений в трабекулярной сети.

В некоторых вариантах осуществления вирусные частицы rAAV инъецируют в более чем одно местоположение одновременно или последовательно. В некоторых вариантах осуществления многократные инъекции вирусных частиц rAAV проводят с интервалом не более чем в один час, два часа, три часа, четыре часа, пять часов, шесть часов, девять часов, двенадцать часов или 24 часа.

Способы интравитреальной инъекции

Общий способ интравитреальной инъекции можно проиллюстрировать следующим кратким обзором. Этот пример направлен лишь на иллюстрацию определенных признаков способа и никаким образом не подразумевается как ограничивающий. Процедуры интравитреальной инъекции известны из уровня техники (см., например, Peyman, G.A., et al. (2009) Retina 29(7):875-912 и Fagan, X.J. и Al-Qureshi, S. (2013) Clin. Experiment. Ophthalmol. 41(5):500-7).

Вкратце, субъекта можно подготовить к процедуре интравитреальной инъекции путем расширения зрачков, стерилизации глаза и введения анестетика. Для расширения зрачков можно применять любое подходящее мидриатическое средство, известное в данной области техники. Перед лечением можно подтвердить надлежащее расширение зрачков. Стерилизацию можно осуществлять путем применения стерилизующей обработки глаза, например, йодидсодержащего раствора, такого как повидон-йод (BETADINE®). Аналогичный раствор также можно применять для очистки века, ресниц и любых других соседних тканей (например, кожи). Можно применять любой подходящий анестетик, такой как лидокаин или пропаракаин, в любой подходящей концентрации. Анестетик можно вводить с помощью любого способа, известного из уровня техники, в том числе, без ограничения, в составе капель, гелей или желе местного действия и путем субконъюнктивального применения анестетика.

Перед инъекцией можно применять стерилизованный векорасширитель для удаления ресниц от зоны. Место инъекции можно отметить шприцем. Место инъекции можно выбрать в зависимости от хрусталика пациента. Например, место инъекции может находиться на расстоянии 3-3,5 мм от лимба роговицы у пациентов с псевдофакичным или афакичным глазом и на расстоянии 3,5-4 мм от лимба роговицы у пациентов с факичным глазом. Пациент может смотреть в сторону, противоположную месту инъекции.

Во время инъекции игла может быть вставлена перпендикулярно склере и направлена в центр глаза. Игла может быть вставлена таким образом, чтобы кончик заканчивался в стекловидном теле, а не в субретинальном пространстве. Можно применять любой подходящий объем для инъекции, известный из уровня техники. После инъекции глаз можно обработать стерилизующим средством, таким как антибиотик. Глаз также можно промыть для удаления избытка стерилизующего средства.

Способы интракамеральной инъекции

Способы интракамеральной инъекции известны из уровня техники. Неограничивающий пример интракамерального введения представлен в Buie, et al., (2010) IOVS 51(1):236-248.

Эффективность доставки rAAV путем интравитреальной или интракамеральной инъекции можно контролировать по нескольким критериям, описанным в данном документе. Например, после лечения субъекта с применением способов по настоящему изобретению у субъекта можно оценивать, например, улучшение, и/или стабилизацию, и/или задержку прогрессирования одного или нескольких признаков или симптомов болезненного состояния по одному или нескольким клиническим параметрам, включающим описанные в данном документе. Примеры таких тестов известны из уровня техники и включают объективные, а также субъективные (например, сообщаемые субъектами) показатели. Например, для измерения эффективности лечения в отношении зрительной функции субъекта можно оценивать одно или несколько из следующего: субъективное качество зрения или улучшенная функция центрального зрения субъекта (например, по улучшению способности субъекта к свободному чтению и узнаванию лиц), визуальная подвижность субъекта (например, по уменьшению времени, необходимого для прохождения лабиринта), острота зрения (например, по улучшению количественного показателя субъекта по LogMAR), показатели микропериметрии (например, по улучшению количественного показателя субъекта в dB), показатели периметрии глаза, адаптированного к темноте (например, по улучшению количественного показателя субъекта в dB), показатели тонкого матричного картирования (например, по улучшению количественного показателя субъекта в dB), показатели периметрии по Гольдману (например, по уменьшению размера зоны скотомы (т. е. зон слепоты) и улучшению способности к различению более мелких целей), показатели чувствительности к мельканиям (например, по улучшению в герцах), аутофлуоресценции и электрофизиологических показателей (например, по улучшению ERG). В некоторых вариантах осуществления зрительную функцию измеряют по визуальной подвижности субъекта. В некоторых вариантах осуществления зрительную функцию измеряют по остроте зрения субъекта. В некоторых вариантах осуществления зрительную функцию измеряют с помощью микропериметрии. В некоторых вариантах осуществления зрительную функцию измеряют с помощью периметрии глаза, адаптированного к темноте. В некоторых вариантах осуществления зрительную функцию измеряют с помощью ERG. В некоторых вариантах осуществления зрительную функцию измеряют по субъективному качеству зрения субъекта.

Для любых способов или композиций, описанных в данном документе, для оценки эффективности лечения, описанного в данном документе, или для диагностики пациентов, которые могут получить улучшения при использовании описанного в данном документе лечения, можно использовать диагностическое исследование в отношении миоцилиновой (MYOC) глаукомы. В области техники известно множество исследований для диагностики или контроля миоцилиновой (MYOC) глаукомы. Например, для обследования зрительного нерва, который может быть поврежден миоцилиновой (MYOC) глаукомой, можно применять офтальмоскопию, лазерную поляриметрию, глазную когерентную томографию и/или сканирующую лазерную томографию. Внутриглазное давление можно измерить с помощью тонометрии. Пахиметр можно применять для измерения толщины центральной роговицы (например, тонкая центральная толщина роговицы может служить прогнозом для миоцилиновой (MYOC) глаукомы). Для оценки поля зрения можно применять исследование поля зрения.

Как описано выше, миоцилиновые мутации вовлечены в развитие первичной открытоугольной миоцилиновой (MYOC) глаукомы (POAG). Таким образом, для оценки эффективности лечения, описанного в данном документе, или для диагностики пациентов, которые могут получить улучшения при использовании описанного в данном документе лечения, можно использовать диагностическое исследование в отношении POAG. Любое диагностическое исследование для диагностики POAG, известное в области техники, можно применять, например, для различения POAG от другой формы миоцилиновой (MYOC) глаукомы (такой как закрытоугольная глаукома). Например, для оценки, которая помогает диагностировать POAG, можно применять гониоскопию.

Эффективность лечения миоцилиновой (MYOC) глаукомы можно исследовать на животной модели. Животные модели для миоцилиновой (MYOC) глаукомы известны из области техники. Например, было продемонстрировано, что у мышей, экспрессирующих MYOC Y437H человека или MYOC Y423H мыши, развиваются симптомы миоцилиновой (MYOC) глаукомы, подобные POAG (см. Zode et al. (2011) J. Clin. Invest. 121(9):3542-53 и Senatorov, V., et al. (2006) J. Neurosci. 26(46):11903-14). Кроме того, мыши с отсутствием альфа-субъединицы рецептора оксида азота, растворимой гуанилатциклазы, являются еще одной моделью POAG (Buys, E.S., et al. (2013) PLoS ONE 8(3):e60156). Также были разработаны крысиные модели; крысы, экспрессирующие TGF-бета человека, доставленный посредством переноса гена с помощью аденовируса, показывают повышенное IOP (Shepard, A.R., et al. (2010) Invest. Ophthalmol. 51(4):2067-76). Дополнительное описание других животных моделей для различных аспектов POAG, включая модели на примате, собаке и данио, можно найти в Bouhenni, R.A., et al. (2012) J. Biomed. Biotechnol. 2012:692609).

При некоторых глазных нарушениях имеет место феномен "клетки-няни", при котором улучшение функции одного типа клеток приводит к улучшению функции другого. Например, трансдукция RPE центральной зоны сетчатки, опосредованная rAAV по настоящему изобретению, может в таком случае улучшать функцию палочек, и, в свою очередь, улучшение функции палочек приводит к улучшению функции колбочек. Соответственно, лечение в отношении одного типа клеток может приводить к улучшению функции другого. При миоцилиновой (MYOC) глаукоме снижение IOP посредством трансдукции TM будет уменьшать дегенерацию структуры и функции ганглионарных клеток.

Выбор конкретного вектора и композиции на основе rAAV зависит от ряда различных факторов, включающих, без ограничения, индивидуальный анамнез человека и характерные особенности состояния и индивидуума, подвергаемых лечению. Оценка таких характерных особенностей и разработка соответствующего режима терапии в конечном счете является ответственностью лечащего врача.

Композиции по настоящему изобретению (например, вирусные частицы AAV, кодирующие RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и/или средство для RNAi в отношении MYOC (например, shRNA)) можно использовать отдельно или в комбинации с одним или несколькими дополнительными терапевтическими средствами для лечения глазных нарушений. Интервал между последовательными введениями может измеряться в сроках по меньшей мере (или, в качестве альтернативы, менее чем) минут, часов или дней.

В некоторых вариантах осуществления в трабекулярную сеть можно вводить одно или несколько дополнительных терапевтических средств. Неограничивающие примеры дополнительного терапевтического средства включают простогландины, такие как ксалатан, лумиган, траватан Z и рескула; бета-блокаторы, в том числе тимоптик XE, исталол и бетоптик S; альфа-адренергические агонисты, в том числе иопидин, альфаган и альфаган-P; ингибиторы карбоангидразы, в том числе трусопт и азопт, диамокс, нептазан и даранид; парасимпатомиметики, в том числе пилокарпин, карбахол, эхотиофат и демекарий; эпинефрины, в том числе пропин; или комбинированное лечение, включающее косопт, комбиган и дуотрав.

IV. Экспрессионные конструкции

В настоящем изобретении предусматривают способы доставки гетерологичной нуклеиновой кислоты в глаз путем субретинальной доставки вектора на основе rAAV, содержащего гетерологичную нуклеиновую кислоту, и где вектор на основе rAAV инкапсидирован в капсид rAAV, содержащий одну или несколько аминокислотных замен, которые взаимодействуют с HSPG. В некоторых вариантах осуществления гетерологичная нуклеиновая кислота (например, трансген) функционально связана с промотором. Иллюстративные промоторы включают, без ограничения, промотор гена немедленного раннего ответа цитомегаловируса (CMV), LTR RSV, LTR MoMLV, промотор фосфоглицераткиназы-1 (PGK), промотор вируса обезьян 40 (SV40) и промотор CK6, промотор транстиретина (TTR), промотор TK, тетрациклин-чувствительный промотор (TRE), промотор HBV, промотор hAAT, LSP-промотор, химерные печень-специфические промоторы (LSP), промотор E2F, промотор теломеразы (hTERT); энхансер цитомегаловируса/промотор бета-актина курицы/промотор β-глобина кролика (промотор CAG; Niwa et al., Gene, 1991, 108(2):193-9) и промотор фактора элонгации 1-альфа (EF1-альфа) (Kim et al., Gene, 1990, 91(2):217-23 и Guo et al., Gene Ther., 1996, 3(9):802-10). В некоторых вариантах осуществления промотор включает в себя промотор β-глюкуронидазы человека или энхансер цитомегаловируса, соединенный с промотором β-актина курицы (CBA). Промотор может представлять собой конститутивный, индуцируемый или репрессируемый промотор. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию гетерологичной нуклеиновой кислоты в клетке глаза. В некоторых вариантах осуществления промотор способен обеспечивать экспрессию гетерологичной нуклеиновой кислоты в фоторецепторных клетках или RPE. В вариантах осуществления промотор представляет собой промотор родопсинкиназы (RK); например, промотор RK человека. В некоторых вариантах осуществления промотор представляет собой промотор опсина; например, промотор опсина человека или промотор опсина мыши. В некоторых вариантах осуществления промотор представляет собой промотор РНК-полимеразы III. В некоторых вариантах осуществления настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего (например, человека) посредством введения в глаз млекопитающего частицы rAAV, содержащей вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, под контролем промотора CBA. В некоторых вариантах осуществления настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего (например, человека) посредством введения в глаз млекопитающего частицы rAAV, содержащей вектор на основе rAAV, кодирующий средство для RNAi (например, shRNA), которое целенаправленно воздействует (например, снижает или ингибирует) на MYOC (например, MYOC человека), под контролем промотора CBA. В некоторых вариантах осуществления настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего (например, человека) посредством введения в глаз млекопитающего частицы rAAV, содержащей вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, под контролем промотора CBA и частицы rAAV, содержащей вектор на основе rAAV, кодирующий средство для RNAi (например, shRNA), которое целенаправленно воздействует (например, снижает или ингибирует) на MYOC (например, MYOC человека), под контролем промотора CBA. В некоторых вариантах осуществления настоящего изобретения предусматривают способы лечения миоцилиновой (MYOC) глаукомы у млекопитающего (например, человека) посредством введения в глаз млекопитающего частицы rAAV, содержащей вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, под контролем промотора CBA и средство для RNAi (например, shRNA), которое целенаправленно воздействует (например, снижает или ингибирует) на MYOC (например, MYOC человека), под контролем промотора CBA.

Настоящее изобретение рассматривает применение рекомбинантного вирусного генома для введения одной или нескольких последовательностей нуклеиновых кислот, кодирующих терапевтический полипептид и/или нуклеиновую кислоту, для упаковки в вирусную частицу rAAV. Рекомбинантный вирусный геном может содержать любой элемент для осуществления экспрессии терапевтических полипептида и/или нуклеиновой кислоты, например, промотор, ITR, элемент связывания рибосомы, терминатор, энхансер, селективный маркер, интрон, сигнал поли-А и/или точку начала репликации.

В некоторых аспектах в настоящем изобретении представлены вирусные частицы, содержащие рекомбинантный самокомплементарный геном. Вирусные частицы AAV с самокомплементарными геномами и способы применения самокомплементарных геномов AAV описаны в патентах США №№ 6596535; 7125717; 7765583; 7785888; 7790154; 7846729; 8093054; и 8361457; и Wang Z., et al., (2003) Gene Ther 10:2105-2111, каждый из которых включен в данный документ посредством ссылки в полном объеме. rAAV, содержащий самовзаимодополняющий геном, будет быстро образовывать двухцепочечную молекулу ДНК благодаря своим частично комплементарным последовательностям (например, комплементарным кодирующим и некодирующим цепям трансгена). В некоторых вариантах осуществления первая гетерологичная последовательность нуклеиновой кислоты и вторая гетерологичная последовательность нуклеиновой кислоты соединены с помощью мутированного ITR (например, правого ITR). В некоторых вариантах осуществления ITR содержит полинуклеотидную последовательность 5'-CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGG TCGCCCACGCCCGGGCTTTGCCCGGGCG - 3' (SEQ ID NO: 20). Мутированный ITR характеризуется делецией D-области, содержащей последовательность концевого разрешения. В результате, при репликации вирусного генома AAV белки rep не отщепляют вирусный геном на мутированном ITR, и как таковой, рекомбинантный вирусный геном, содержащий следующее в порядке от 5' к 3', будет упакован в вирусный капсид: ITR AAV, первая гетерологичная полинуклеотидная последовательность, в том числе регуляторные последовательности, мутированный ITR AAV, второй гетерологичный полинуклеотид в обратной ориентации по отношению к первому гетерологичному полинуклеотиду и третий ITR AAV.

VI. Вирусные частицы и способы получения вирусных частиц

Вирусные частицы rAAV

В настоящем изобретении предусматривают способы применения частиц rAAV для лечения миоцилиновой (MYOC) глаукомы и предусматривают композиции, содержащие частицы rAAV. В некоторых вариантах осуществления вирусная частица представляет собой рекомбинантную частицу AAV, содержащую нуклеиновую кислоту, содержащую последовательность, которая кодирует полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и/или средство для RNAi в отношении MYOC (например, shRNA), описанные в данном документе, фланкированные одним или двумя ITR. Нуклеиновая кислота инкапсидирована в частице AAV. Частица AAV также содержит капсидные белки. В некоторых вариантах осуществления нуклеиновая кислота содержит представляющую интерес кодирующую последовательность (последовательности) (например, нуклеиновую кислоту, кодирующую полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и/или средство для RNAi в отношении MYOC (например, shRNA)), функционально связанные компоненты в направлении транскрипции, контролирующие последовательности, в том числе последовательности инициации и терминации, с образованием, таким образом, кассеты экспрессии. Кассета экспрессии фланкирована на 5'- и 3'-конце по меньшей мере одной функциональной последовательностью ITR AAV. Под "функциональными последовательностями ITR AAV" подразумевается, что последовательности ITR функционируют в качестве предполагаемых для спасения, репликации и упаковки вириона AAV. См. Davidson et al., PNAS, 2000, 97(7)3428-32; Passini et al., J. Virol., 2003, 77(12):7034-40; и Pechan et al., Gene Ther., 2009, 16:10-16, все из которых включены в данный документ во всей своей полноте посредством ссылки. Для практического использования некоторых аспектов настоящего изобретения рекомбинантные векторы содержат по меньшей мере все из последовательностей AAV, необходимых для капсидирования, и физические структуры для инфицирования rAAV. ITR AAV для использования в векторах по настоящему изобретению не требуют наличия нуклеотидной последовательности дикого типа (например, как описано у Kotin, Hum. Gene Ther., 1994, 5:793-801) и могут быть изменены посредством вставки, делеции или замены нуклеотидов, или ITR AAV могут происходить из любого из нескольких серотипов AAV. В настоящее время известно более 40 серотипов AAV, и продолжают идентифицироваться новые серотипы и варианты существующих серотипов. См. Gao et al., PNAS, 2002, 99(18): 11854-6; Gao et al., PNAS, 2003, 100(10):6081-6; и Bossis et al., J. Virol., 2003, 77(12):6799-810. Использование любого серотипа AAV рассматривается в пределах объема настоящего изобретения. В некоторых вариантах осуществления вектор на основе rAAV представляет собой вектор, полученный из серотипа AAV, включая без ограничения AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, козий AAV, бычий AAV или мышиный AAV или т. п. В некоторых вариантах осуществления нуклеиновая кислота в AAV содержит ITR из AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, AAV козы, бычьего AAV или инвертированные концевые повторы (ITR) серотипа мышиного AAV или т. п. В некоторых вариантах осуществления нуклеиновая кислота в AAV дополнительно кодирует полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант; средство для RNAi в отношении MYOC (например, shRNA); или полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и MYOC, как описано в данном документе. Например, нуклеиновая кислота в AAV может содержать по меньшей мере один ITR любого серотипа AAV, рассмотренного в данном документе, и может дополнительно кодировать нуклеиновую кислоту, кодирующую средство для RNAi в отношении MYOC (например, shRNA), целенаправленно воздействующее на SEQ ID NO:6 и содержащее последовательность петли под SEQ ID NO: 7 и/или одно или несколько из следующего: RSPO1, содержащий SEQ ID NO: 8, 11 и/или 12; RSPO2, содержащий SEQ ID NO: 9, 13 и/или 14; RSPO3, содержащий SEQ ID NO: 1, 15, 16 и/или 17; и RSPO4, содержащий SEQ ID NO: 10, 18 и/или 19. В некоторых вариантах осуществления нуклеиновая кислота кодирует RSPO1, который по меньшей мере приблизительно на 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичен SEQ ID NO: 8, 11 или 12; RSPO2, который по меньшей мере приблизительно на 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичен SEQ ID NO: 9, 13 или 14; RSPO3, который по меньшей мере приблизительно на 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичен SEQ ID NO: 1 или 15-17; или RSPO4, который по меньшей мере приблизительно на 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичен SEQ ID NO: 10, 18 или 19.

В дополнительных вариантах осуществления частица rAAV содержит капсидные белки AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (например, капсид AAV6 дикого типа или капсид варианта AAV6, такой как ShH10, как описано в публикации заявки на патент США 2012/0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (например, капсид AAV9 дикого типа или капсид модифицированного AAV9, как описано в публикации заявки на патент США 2013/0323226), AAV10, AAVrh10, AAV11, AAV12, мутантного капсида, содержащего тирозин, мутантного капсида с гепарин-связывающим мотивом, капсида AAV2R471A, капсида AAVAAV2/2-7m8, капсида AAV DJ (например, капсид AAV-DJ/8, капсид AAV-DJ/9 или любой другой из капсидов, описанных в публикации заявки на патент США 2012/0066783), капсида AAV2 N587A, капсида AAV2 E548A, капсида AAV2 N708A, капсида AAV V708K, капсида козьего AAV, химерного капсида AAV1/AAV2, капсида бычьего AAV, капсида мышиного AAV, капсида rAAV2/HBoV1, капсида AAV, описанных в патенте США № 8283151 или в Международной публикации № WO/2003/042397. В некоторых вариантах осуществления вирусная частица AAV содержит капсид AAV, содержащий аминокислотную замену в одном или нескольких положениях R484, R487, K527, K532, R585 или R588, нумерация которых приведена согласно VP1 AAV2. В дополнительных вариантах осуществления частица AAV содержит капсидные белки серотипа AAV из клад A-F. В некоторых вариантах осуществления мутантный капсидный белок сохраняет способность образовывать капсид AAV. В некоторых вариантах осуществления частицы rAAV содержат капсидный белок, который обеспечивает трансдукцию в трабекулярной сети. В некоторых вариантах осуществления частицы rAAV содержат мутантный капсидный белок, который обеспечивает трансдукцию в трабекулярной сети. В некоторых вариантах осуществления частица rAAV содержит капсидные белки AAV2, где капсидный белок содержит аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2 (Lochrie et al., J Virol (2006) 80(2):821-834). В некоторых вариантах осуществления в настоящем изобретении предусматривают частицы rAAV, содержащие вектор, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант; капсид AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2; и/или вектор, кодирующий средство для RNAi в отношении MYOC (например, shRNA).

В некоторых вариантах осуществления в настоящем изобретении предусматривают композиции и способы для лечения миоцилиновой (MYOC) глаукомы у млекопитающего, где вирусную частицу rAAV2, содержащую вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, доставляют в глаз млекопитающего, где различные части глаза могут подвергаться трансдукции (например, сетчатка), и вирусную частицу rAAV2 R471A, содержащую вектор на основе rAAV, кодирующий средство для RNAi в отношении MYOC, доставляют в глаз млекопитающего, где клетки трабекулярной сети являются трансдуцированными. В некоторых вариантах осуществления в настоящем изобретении предусматривают композиции и способы для лечения миоцилиновой (MYOC) глаукомы у млекопитающего, где вирусную частицу rAAV2 R471A, содержащую вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и вирусную частицу rAAV2 R471A, содержащую вектор на основе rAAV, кодирующий средство для RNAi в отношении MYOC, доставляют в глаз млекопитающего, где клетки трабекулярной сети являются трансдуцированными. В некоторых вариантах осуществления в настоящем изобретении предусматривают композиции и способы для лечения миоцилиновой (MYOC) глаукомы у млекопитающего, где вирусную частицу rAAV2 R471A, содержащую вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и кодирующий средство для RNAi в отношении MYOC, доставляют в глаз млекопитающего, где клетки трабекулярной сети являются трансдуцированными.

В некоторых аспектах в настоящем изобретении предусматривают композиции и способы доставки трансгена (например, терапевтического трансгена в трабекулярную сеть глаза). В некоторых вариантах осуществления в композициях и способах применяют частицу rAAV2, содержащую мутантный капсид, где капсид содержит аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2. Такие композиции и способы могут быть использованы при лечении глазного заболевания; например, глазного заболевания, связанного с трабекулярной сетью, такого как миоцилиновая (MYOC) глаукома.

Для оптимизации трансдукции определенных клеток-мишеней или для нацеливания специфических типов клеток в пределах определенной ткани-мишени (например,больной ткани) используются различные серотипы AAV. Частица rAAV может содержать вирусные белки и вирусные нуклеиновые кислоты из того же серотипа или смешанного серотипа.

Самокомплементарные вирусные геномы AAV

В некоторых аспектах в настоящем изобретении представлены вирусные частицы, содержащие рекомбинантный самокомплементарный геном. Вирусные частицы AAV с самокомплементарными геномами и способы применения самокомплементарных геномов AAV описаны в патентах США №№ 6596535; 7125717; 7765583; 7785888; 7790154; 7846729; 8093054; и 8361457; и Wang Z., et al., (2003) Gene Ther 10:2105-2111, каждый из которых включен в данный документ посредством ссылки в полном объеме. rAAV, содержащий самовзаимодополняющий геном, будет быстро образовывать двухцепочечную молекулу ДНК благодаря своим частично комплементарным последовательностям (например, комплементарным кодирующим и некодирующим цепям трансгена). В некоторых вариантах осуществления настоящее изобретение предусматривает вирусную частицу AAV, содержащую геном AAV, где геном rAAV содержит первую гетерологичную полинуклеотидную последовательность (например, кодирующую цепь miR-708 и/или родопсина) и вторую гетерологичную полинуклеотидную последовательность (например, антисмысловую цепь miR-708 и/или некодирующую или антисмысловую цепь родопсина), где первая гетерологичная полинуклеотидная последовательность может образовывать внутрицепочечные пары оснований со второй полинуклеотидной последовательностью вдоль большей части или всей ее длины. В некоторых вариантах осуществления первая гетерологичная полинуклеотидная последовательность и вторая гетерологичная полинуклеотидная последовательность связаны с помощью последовательности, которая облегчает внутрицепочечное спаривание оснований, например, шпилечной структуры ДНК. Шпилечные структуры известны в данной области техники, например в молекулах siRNA. В некоторых вариантах осуществления первая гетерологичная полинуклеотидная последовательность и вторая гетерологичная полинуклеотидная последовательность связаны с помощью мутированного ITR (например, правого ITR). В некоторых вариантах осуществления ITR содержит полинуклеотидную последовательность 5'-CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG - 3' (SEQ ID NO: 20). Мутированный ITR характеризуется делецией D-области, содержащей последовательность концевого разрешения. В результате, при репликации вирусного генома AAV белки rep не отщепляют вирусный геном на мутированном ITR, и как таковой, рекомбинантный вирусный геном, содержащий следующее в порядке от 5' к 3', будет упакован в вирусный капсид: ITR AAV, первая гетерологичная полинуклеотидная последовательность, в том числе регуляторные последовательности, мутированный ITR AAV, второй гетерологичный полинуклеотид в обратной ориентации по отношению к первому гетерологичному полинуклеотиду и третий ITR AAV. В некоторых вариантах осуществления в настоящем изобретении предусматривают вирусные частицы AAV, содержащие рекомбинантный вирусный геном, который содержит функциональный ITR AAV2, первую полинуклеотидную последовательность, кодирующую полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и/или средство для RNAi в отношении MYOC (например, shRNA), мутированный ITR AAV2, характеризующийся делецией в D-области и лишенный функциональной концевой разрешающей последовательности, вторую полинуклеотидную последовательность, содержащую последовательность, комплементарную последовательности, кодирующей полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и/или средство для RNAi в отношении MYOC (например, shRNA) из первой полинуклеотидной последовательности, а также функциональный ITR AAV2.

Получение частиц AAV

Частицы rAAV можно получить с помощью способов, известных в данной области техники. См., например, патенты США №№ 6566118; 6989264 и 6995006. При практическом использовании настоящего изобретения клетки-хозяева для продукции частиц rAAV включают в себя клетки млекопитающих, клетки насекомых, растительные клетки, микроорганизмы и дрожжи. Клетки-хозяева также могут быть упаковывающими клетками, в которых гены rep и cap AAV стабильно сохраняются в клетке-хозяине или клетках-продуцентах, в которых стабильно сохраняется геном вектора AAV. Иллюстративные упаковывающие клетки и клетки-продуценты получают из клеток 293, A549 или HeLa. Векторы AAV очищают и помещают в составы с помощью стандартных методик, известных в данной области.

В некоторых аспектах предусмотрен способ получения любой частицы rAAV, раскрываемой в данном документе, включающий: (a) культивирование клетки-хозяина в условиях, при которых получают частицы rAAV, где клетка-хозяин содержит (i) один или несколько генов AAV, обеспечивающих упаковку, где каждый указанный ген AAV, обеспечивающий упаковку, кодирует белок AAV, участвующий в репликации и/или инкапсидировании; (ii) провектор на основе rAAV, содержащий нуклеиновую кислоту, кодирующую терапевтические полипептид и/или нуклеиновую кислоту, как описано в данном документе, фланкированный по меньшей мере одним ITR AAV, и (iii) хелперный функциональный элемент AAV; и (b) извлечение частиц rAAV, образуемых в клетке-хозяине.

В дополнительном варианте осуществления частицы rAAV очищаются. Выражение "очищенный", применяемое в данном документе, включает получение частиц rAAV, лишенных по меньшей мере некоторых из других компонентов, которые могут также присутствовать, если частицы rAAV встречаются в природе или изначально получены из них. Таким образом, например, выделенные частицы rAAV можно получать с помощью методики очистки для обогащения ими исходной смеси, такой как лизат культуры или надосадочная жидкость производственной культуры. Обогащение можно измерять с помощью множества способов, таких как, например, по доле устойчивых к ДНКазе частиц (DRP) или геномных копий (gc), присутствующих в растворе, или по инфекционности, либо его можно измерить по отношению ко второму, потенциально мешающему веществу, присутствующему в исходной смеси, такому как контаминанты, в том числе контаминанты производственной культуры или внутрипроизводственные контаминанты, в том числе хелперный вирус, компоненты среды и т. п.

В данном документе также предусматриваются фармацевтические композиции, содержащие частицу rAAV, содержащую гетерологичную нуклеиновую кислоту, кодирующую терапевтический полипептид и/или терапевтическую нуклеиновую кислоту, где частица rAAV содержит капсид rAAV, содержащий одну или несколько замен аминокислот, которые взаимодействуют с HSPG, и фармацевтически приемлемый носитель. Фармацевтические композиции могут подходить для любого способа введения, описанного в данном документе; например, для субретинального введения.

В некоторых вариантах осуществления фармацевтические композиции, содержащие rAAV, описанный в данном документе, и фармацевтически приемлемый носитель, пригодны для введения человеку. Такие носители хорошо известны из уровня техники (см., например, Remington's Pharmaceutical Sciences, 15th Edition, pp. 1035-1038 и 1570-1580). В некоторых вариантах осуществления фармацевтические композиции, содержащие rAAV, описанный в данном документе, и фармацевтически приемлемый носитель, пригодны для глазной инъекции. Такими фармацевтически приемлемыми носителями могут быть стерильные жидкости, такие как вода и масло, в том числе стерильные жидкости нефтяного, животного, растительного или синтетического происхождения, такие как арахисовое масло, соевое масло, минеральное масло и т.п. В качестве жидких носителей, в частности для инъекционных растворов, могут использоваться также физиологические растворы и водные растворы декстрозы, полиэтиленгликоля (PEG) и глицерина. Фармацевтическая композиция может дополнительно содержать дополнительные компоненты, например, консерванты, буферы, вещества, регулирующие тоничность, антиоксиданты и стабилизаторы, неионные увлажняющие и осветляющие средства, загустители и т. п. Фармацевтические композиции, описанные в данном документе, могут быть упакованы в единичные дозированные формы или множественные дозированные формы. Как правило, композиции составляют в виде стерильного или практически изотонического раствора.

VII. Системы и наборы

Композиции на основе rAAV, описанные в данном документе, могут содержаться в системе, предназначенной для применения в одном из способов по настоящему изобретению, описанных в данном документе. В некоторых вариантах осуществления в настоящем изобретении предусматривают систему доставки вектора в глаз индивидуума, содержащую: a) композицию, содержащую эффективное количество частиц rAAV, где вектор содержит гетерологичную нуклеиновую кислоту, кодирующую терапевтический полипептид и/или терапевтическую РНК, и по меньшей мере один концевой повтор AAV; и b) устройство для доставки rAAV в глаз. В некоторых вариантах осуществления частицы rAAV содержат вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант. В некоторых вариантах осуществления частицы rAAV содержат вектор на основе rAAV, кодирующий одно или несколько средств для RNAi в отношении MYOC (например, shRNA), которые целенаправленно воздействуют (например, снижают или ингибируют) на экспрессию MYOC. В некоторых вариантах осуществления частицы rAAV содержат вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и одно или несколько средств для RNAi в отношении MYOC (например, shRNA), которые целенаправленно воздействуют (например, снижают или ингибируют) на экспрессию MYOC. В некоторых вариантах осуществления набор или система содержит частицы rAAV, содержащие вектор на основе rAAV, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант, и частицы rAAV, содержащие вектор на основе rAAV, кодирующий одно или несколько средств для RNAi в отношении MYOC (например, shRNA), которые целенаправленно воздействуют (например, снижают или ингибируют) на экспрессию MYOC.

Как правило, система содержит узкую канюлю, где канюля имеет калибр от 27 до 45, один или несколько шприцев (например, 1, 2, 3, 4 или более) и одну или несколько жидкостей (например, 1, 2, 3, 4 или более), подходящих для применения в способах по настоящему изобретению.

Узкая канюля подходит для субретинальной инъекции суспензии вектора и/или других жидкостей, подлежащих введению путем инъекции в субретинальное пространство. В некоторых вариантах осуществления канюля имеет калибр от 27 до 45. В некоторых вариантах осуществления узкая канюля имеет калибр 35-41. В некоторых вариантах осуществления узкая канюля имеет калибр 40 или 41. В некоторых вариантах осуществления узкая канюля имеет калибр 41. Канюля может представлять собой любой подходящий тип канюли, например, канюлю de-Juan® или канюлю Eagle®.

Шприц может представлять собой любой подходящий шприц, при условии, что его можно соединить с канюлей для доставки жидкости. В некоторых вариантах осуществления шприц представляет собой шприц системы Accurus®. В некоторых вариантах осуществления система имеет один шприц. В некоторых вариантах осуществления система имеет два шприца. В некоторых вариантах осуществления система имеет три шприца. В некоторых вариантах осуществления система имеет четыре или более шприцев.

Система может дополнительно содержать автоматический инъекционный насос, который можно активировать, например, ножной педалью.

Жидкости, подходящие для применения в способах по настоящему изобретению, включают жидкости, описанные в данном документе, например, одну или несколько жидкостей, каждая из которых содержит эффективное количество одного или нескольких векторов, описанных в данном документе, одну или несколько жидкостей для создания первоначального пузырька (например, физиологический раствор или другую подходящую жидкость) и одну или несколько жидкостей, содержащих одно или несколько терапевтических средств.

Жидкости, подходящие для применения в способах по настоящему изобретению, включают жидкости, описанные в данном документе, например, одну или несколько жидкостей, каждая из которых содержит эффективное количество одного или нескольких векторов, описанных в данном документе, одну или несколько жидкостей для создания первоначального пузырька (например, физиологический раствор или другую подходящую жидкость) и одну или несколько жидкостей, содержащих одно или несколько терапевтических средств.

В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет более чем приблизительно 0,8 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет по меньшей мере приблизительно 0,9 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет по меньшей мере приблизительно 1,0 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет по меньшей мере приблизительно 1,5 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет по меньшей мере приблизительно 2,0 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет более чем от приблизительно 0,8 до приблизительно 3,0 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет более чем от приблизительно 0,8 до приблизительно 2,5 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет более чем от приблизительно 0,8 до приблизительно 2,0 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет более чем от приблизительно 0,8 до приблизительно 1,5 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет более чем от приблизительно 0,8 до приблизительно 1,0 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет от приблизительно 0,9 до приблизительно 3,0 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет от приблизительно 0,9 до приблизительно 2,5 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет от приблизительно 0,9 до приблизительно 2,0 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет от приблизительно 0,9 до приблизительно 1,5 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет от приблизительно 0,9 до приблизительно 1,0 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет от приблизительно 1,0 до приблизительно 3,0 мл. В некоторых вариантах осуществления объем жидкости, содержащей эффективное количество вектора, составляет от приблизительно 1,0 до приблизительно 2,0 мл.

Жидкость для создания первоначального пузырька может иметь объем, например, от приблизительно 0,1 до приблизительно 0,5 мл. В некоторых вариантах осуществления общий объем всех жидкостей в системе составляет от приблизительно 0,5 до приблизительно 3,0 мл.

В некоторых вариантах осуществления система содержит одну жидкость (например, жидкость, содержащую эффективное количество вектора). В некоторых вариантах осуществления система содержит 2 жидкости. В некоторых вариантах осуществления система содержит 3 жидкости. В некоторых вариантах осуществления система содержит 4 или более жидкостей.

Системы по настоящему изобретению могут быть дополнительно упакованы в наборы, где наборы могут дополнительно содержать инструкции по применению. В некоторых вариантах осуществления наборы дополнительно содержат устройство для субретинальной доставки композиций на основе частиц rAAV. В некоторых вариантах осуществления инструкции по применению включают инструкции в соответствии с одним из способов, описанных в данном документе. В некоторых вариантах осуществления инструкции для применения включают инструкции для интравитреальной и/или интракамеральной доставки частиц rAAV, содержащих вектор, кодирующий полипептиды RSPO1, RSPO2, RSPO3, RSPO4 или их функциональный вариант и/или средство для RNAi в отношении MYOC (например, shRNA).

ПРИМЕРЫ

Настоящее изобретение будет более понятным со ссылкой на следующие примеры. Тем не менее, их не следует истолковывать как ограничивающие объем настоящего изобретения. Понятно, что описанные в данном документе примеры и варианты осуществления имеют место только в качестве иллюстрации, и что различные модификации или изменения с их учетом будут предложены специалистам в данной области техники и должны быть включены в сущность и содержание данной заявки, а также объем прилагаемой формулы изобретения.

Пример 1. Глаукоматозные мутации MYOC (например, P370L и Y437H) блокируют секрецию MYOC

Для того, чтобы понять, каким образом мутанты MYOC влияют на функцию глаза, в частности клеток, таких как клетки трабекулярной сети, которые могут обуславливать IOP, необходимы новые сведения о патогенезе миоцилиновой (MYOC) глаукомы. Понимание функции MYOC может также помочь выявить потенциальные терапевтические стратегии для лечения миоцилиновой (MYOC) глаукомы. Результаты, описанные в данном документе, демонстрируют, что мутанты MYOC уменьшают экспрессию MYOC дикого типа и блокируют передачу сигнала Wnt. Кроме того, эти результаты свидетельствуют о том, что экспрессия R-спондина 3 (RSPO3) и/или сайленсинг MYOC могут восстановить передачу сигнала Wnt, блокированную экспрессией мутантного MYOC.

Способы

Плазмидные векторы

Для плазмид MYOC и RSPO3 кДНК MYOC предоставлялись из Clone DB- Sanofi Oncology. кДНК RSPO3 предоставлялись из Clone DB- Sanofi Oncology.

Для конструкции pCBA2-в-P370L MYOC для введения желаемой замены одного основания использовали набор QUIKCHANGE® II (Agilent, Санта-Клара) в соответствии с рекомендациями производителя и праймеры 5'- ACCACGGACAGTTCCTGTATTCTTGGGGTGG -3' (SEQ ID NO:21) и 5'- CCACCCCAAGAATACAGGAACTGTCCGTGGT-3' (SEQ ID NO:22).

Для конструкции pCBA2-в-MYOC Y437H для введения желаемой замены одного основания использовали набор QUIKCHANGE® Lightning (Agilent, Санта-Клара) в соответствии с рекомендациями производителя и праймеры 5'-TCTGTGGCACCTTGCACACCGTCAGCAGC-3' (SEQ ID NO: 23) и 5'-GCTGCTGACGGTGTGCAAGGTGCCACAGA-3' (SEQ ID NO: 24).

Плазмиды Grp94 shRNA получали от OriGene Technologies, Inc. (№ по кат. TR312309). Плазмиды pGIPZ-MYOC (Dharmacon GE Life Sciences) предоставлялись из Clone DB- Sanofi Oncology. Коллекция GIPZ shRNA, основанных на microRNA (Stegmeier, et al. (2005) Proc. Natl. Acad. Sci. USA. 102:13212-7). Строение GIPZ shRNA основано на нативном первичном транскрипте miR-30 для обеспечения процессинга эндогенным RNAi-путем и приводит к обеспечению сайленсинга генов с минимальной клеточной токсичностью. Плазмида pGIPZ-нуль, конститутивный вектор shRNAmir, который экспрессирует нулевую shRNAmir, не воздействующую целенаправленно, предоставлялись из Clone DB- Sanofi Oncology.

Культура клеток и рекомбинантные белки

Клетки HEK293 (Microbix Biosystems Inc.) культивировали в DMEM, 10% FCS и 5% CO2. Клеточную линию HEK293T (293T) получали из ATCC и культивировали в DMEM, 10% FCS и 5% CO2.

Иммортализация первичных клеток трабекулярной сети человека (hTM)

Большой Т-антиген SV40 (SV40 TAg) применяли для иммортализации посредством трансдукции вектором AAV2-SV40 с T-антигеном. Клетки hTM пассажа 7 (ScienCell Research Laboratories, Карлсбад, Калифорния), поддерживаемые на полной питательной среде для фибробластов (ScienCell), высевали на планшеты для культивирования клеток размером 10 см и трансдуцировали посредством 1×105 DRP либо AAV2-SV40-Tag (отмеченные как "hTM-T"), либо AAV2-EGFP (отрицательный контроль, отмеченные как "hTM-ENT") в течение 24 часов. Сразу после слияния клеток их пассировали на планшеты размером 2×15 см (P8). Клетки повторно пассировали приблизительно каждые 3-4 дня. В ходе пассажа 10 отбирали аликвоту для определения количества клеток. Общее количество клеток из клеток hTM-T составляло 5, 2×106, по сравнению с общим количеством клеток из клеток hTM-ENT, которое составляло 2,5×105.

Для определения присутствия T-антигена SV40 проводили вестерн-блоттинг. Вкратце, суспензию клеток по 500 мкл центрифугировали и полученный осадок клеток лизировали в 100 мкл буфера RIPA, содержащего коктейль ингибиторов протеаз. 5 мкл клеточных лизатов анализировали посредством SDS-PAGE с последующим иммуноблоттингом с использованием системы быстрой передачи iBlot (Life Technologies). Блот блокировали с использованием небелкового блокатора TBS (Thermo Fisher Scientific, Уолтем, Массачусетс) и инкубировали с моноклональным антителом к T-антигену SV40 (GeneTex, Ирвайн, Калифорния). Затем блот инкубировали с антителом к иммуноглобулину мыши, меченым HRP (R & D Systems, Миннеаполис, Миннесота). Иммунореактивные полосы визуализировали с использованием хемилюминесцентного субстрата Supersignal West Femto (Thermo Fisher). Выраженную полосу 80 кДа, соответствующую Т-антигену SV40, детектировали из hTM-T, но не из клеток hTM-ENT, что свидетельствует о присутствии и экспрессии Т-антигена SV40. Лизат из клеток 293Т служил в качестве положительного контроля, который также содержал полосу Т-антигена SV40 80 кДа. Клетки hTM-T размножали и клеточные банки замораживали в среде для замораживания клеток (Life Technologies, Гранд-Айленд, Нью-Йорк) в пассаже 12 (10 флаконов с плотностью 1×106 клеток), а затем в пассаже 18 (46 флаконов с плотностью 106 клеток).

Определение характеристик hTM-T

Сравнение клеток hTM-T и первичных клеток hTM показало заметное различие в морфологии клеток, времени удвоения популяции и эффективности плазмидной трансфекции. Первичные клетки hTM оказывались более крупными и фибробластоподобными с длинным веретенообразным телом, тогда как иммортализованные клетки hTM-T были меньше, кубической формы и относительно однородного размера. Клеточная линия hTM-T демонстрировала повышенную скорость роста с удвоением популяции, происходящим примерно в 3-4 раза быстрее, чем у первичных клеток. Кроме того, клетки hTM-T продолжали пролиферировать после 20 клеточных пассажей, тогда как первичные клетки hTM демонстрировали снижение скорости роста после 10-го пассажа и последующее прекращение роста после 12-го пассажа. Эффективность трансфекции определяли с использованием EGFP-плазмиды и липофектамина на обоих типах клеток при сходной плотности клеток. Вкратце, субконфлюентные клетки hTM-T или hTM трансфицировали EGFP-плазмидой с использованием Lipofectamine 2000 (Life Technologies) в соответствии с протоколом производителя. Хотя клетки hTM-T характеризовались бόльшим количеством клеток на мм2 поверхности клеточной культуры, была очевидна бόльшая процентная доля клеток EGFP+hTM-T (~ 50%) по сравнению с первичными клетками hTM (~ 5%).

Вестерн-блоттинг

Клетки 293T или hTM-T трансфицировали плазмидами, экспрессирующими wtMYOC, мутанты MYOC P370L и Y437H, RSPO3 и/или shRNA, с применением Lipofectamine 2000 (Life Technologies). Вкратце, клетки лизировали в 50-100 мкл буфера RIPA, содержащего коктейль ингибиторов протеаз. 10-13 мкл клеточных лизатов анализировали посредством SDS-PAGE с последующим иммуноблоттингом с использованием системы быстрой передачи iBlot (Life Technologies). Блот блокировали с использованием трис-буферного солевого раствора, 0,05% Твин 20 (TBST). 0,2% I-Block (блокирующий реагент на основе казеина, Life Technologies) и инкубировали с мышиным антителом к MYOC человека. Затем блот инкубировали с антителом к иммуноглобулину мыши, меченым HRP (R & D Systems, Миннеаполис, Миннесота). Иммунореактивные полосы визуализировали с использованием хемилюминесцентного субстрата ECL (Thermo Fisher) и визуализировали на пленке BioMax XAR (Carestream Health), разработанной с помощью Kodak X-Omat 2000 Processor.

Анализ репортерного гена люциферазы

Клетки 293T или hTM-T высевали в 96-луночные планшеты Costar с белыми или черными стенками с плотностью 2×104 клеток/лунку. Трансфекции проводили через 1-2 дня после посева клеток, используя реагент для трансфекции Fugene HD (Promega, Мэдисон, Висконсин) в соответствии с протоколом производителя.

Вкратце, репортерную плазмиду Topflash (Millipore, Биллерика, Массачусетс), содержащую регулируемый Tcf/lef ген-репортер люциферазы светлячка и управляемый промотором цитомегаловируса (CMV) ген люциферазы Renilla в всоотношении 40:1 смешивали 1:1 с целевыми плазмидами. Добавляли 8 мкл реагента Fugene HD и образцы немедленно перемешивали вортексом, затем инкубировали в течение 15 минут при комнатной температуре. Комплексы плазмидной ДНК добавляли к клеткам и инкубировали при 37°С в течение 24 часов. Образцы либо не стимулировали, либо стимулировали при помощи 400 нг/мл рекомбинантного человеческого или мышиного белка wnt3a (R&D Systems) и инкубировали в течение еще 20-24 часов. Передачу сигнала Wnt измеряли с использованием системы анализа Dual Luciferase (Promega) в соответствии с протоколом производителя. Значения поглощения измеряли на люминометре микропланшетов Centro XS3 960 (Berthold Technologies, Ок-Ридж, Теннесси) и сообщали как относительные световые единицы (RLU). Для контроля эффективности трансфекции RLU люциферазы светляков нормализовали относительно RLU люциферазы Renilla. Все образцы выполняли в трех лунках.

Результаты

MYOC дикого типа (wtMYOC) секретируется из культивируемых клеток, но практически не секретируется MYOC из клеток, экспрессирующих пять различных мутантных форм MYOC, и сообщалось, что совместная трансфекция культивируемых клеток с нормальным и мутантным MYOC подавляет секрецию wtMYOC (Jacobson et al. (2001) Hum. Mol. Genet. 10(2):117-25). Для того, чтобы исследовать влияние экспрессии мутантного MYOC на секрецию MYOC, клетки 293 трансфицировали плазмидами, экспрессирующими MYOC дикого типа, мутантный MYOC P370L или мутантный MYOC Y437H.

Как показано на фиг. 1, клетки 293, экспрессирующие MYOC дикого типа, проявляли детектируемую экспрессию белка MYOC в обоих клеточных лизатах (см. нижний блот, отмеченный «КЛЕТКИ») и характеризовались секрецией в среду для культивирования клеток (см. верхний блот, отмеченный «СРЕДА»). Однако клетки, трансфицированные плазмидами, экспрессирующими MYOC P370L или Y437H, проявляли внутриклеточную экспрессию, но не характеризовались секрецией в среду для культивирования клеток. Более того, совместная трансфекция клеток 293 плазмидами, экспрессирующими MYOC дикого типа и MYOC либо P370L, либо Y437H, вызывала недостаток секреции MYOC в среду для культивирования клеток. Эти результаты указывают на то, что мутантные P370L и Y437H не могут секретироваться из клеток 293 и также способны блокировать секрецию MYOC дикого типа.

Дальнейшие эксперименты проводили для того, чтобы определить, наблюдаются ли эти результаты в человеческих клетках глаза. Линию клеток трабекулярной сети человека иммортализовали посредством AAV-опосредованной экспрессии большого T-антигена SV40 (клетки hTM-T), как описано выше. Клетки 293T и hTM-T трансфицировали плазмидой, экспрессирующей MYOC дикого типа, плазмидой, экспрессирующей MYOC P370L, или трансфицировали обеими плазмидами. На фиг. 2 показано зондирование с помощью вестерн-блоттинга в отношении присутствия внутриклеточного или секретируемого белка MYOC в данных клетках. Хотя экспрессия и секреция MYOC дикого типа наблюдалась в клетках 293T и клетках hTM-T, для MYOC P370L наблюдалась только экспрессия, но не секреция как в клетках 293T, так и в клетках hTM-T. MYOC P370L также блокировал секрецию MYOC дикого типа как в клетках 293T, так и в клетках hTM-T.

Эти результаты демонстрируют, что глаукоматозные мутанты MYOC (например, P370L и Y437H) способны блокировать секрецию MYOC дикого типа в клетках человека. Кроме того, мутантный MYOC также способен блокировать секрецию MYOC в клетках hTM.

Пример 2. Глаукоматозные мутации MYOC (например, P370L и Y437H) блокируют передачу сигнала Wnt

Предполагают, что MYOC взаимодействует с компонентами сигнальных путей Wnt, такими как рецепторы Wnt семейства Frizzled (Fzd), антагонисты Wnt секретируемого родственного Frizzled белка (sFRP) и Wnt ингибирующий фактор 1 (WIF-1)), которые модулируют организацию актинового цитоскелета, стимулируя образование стрессовых волокон (Kwon et al. (2009) Mol. Cell. Biol. 29:2139-54). Образование стрессовых волокон является критическим для сократимости трабекулярной сети (TM) и регуляции IOP. Однако, как именно MYOC связан с передачей сигнала Wnt и как эта связь влияет на IOP, остается неясным. На основании экспериментов по клеточной биологии была предложена роль миоцилина в качестве белка внеклеточного матрикса (Resch и Fautsch, 2009; Koch et al, 2014). Другие группы продемонстрировали, что миоцилин является медиатором дифференцировки олигодендроцитов и участвует в миелинизации зрительного нерва у мышей (Kwon et al., 2014).

Было высказано предположение, что MYOC может служить в качестве модулятора передачи сигнала Wnt, и что белки Wnt могут компенсировать отсутствие миоцилина, выполняя его функции (Kwon et al. (2009) Mol. Cell. Biol. 29:2139-54). Несколько групп сообщили о сходстве действия миоцилина и белков Wnt, действующих посредством b-катенин-независимого механизма (Kwon и Tomarev (2011) J. Cell. Physiol. 226(12):3392-402). Сообщалось, что ослабление передачи сигнала Wnt в клетках TM глаукомы (GTM) обусловлено более высокими эндогенными уровнями sFRP1 (Wang et al. (2008) J. Clin. Invest. 118:1056-64; Lin и Hankenson (2011) J. Cell. Biochem. 112:3491-501). Другая группа показала, что сигнальный путь Wnt защищает линию клеток сетчатки RGC-5 от повышенного давления (Fragoso et al. (2011) Cell. Mol. Neurobiol. 31(1):163-73).

Из литературы неясно, оказывают ли глаукоматозные мутации MYOC (например, P370L или Y437H) какой-либо эффект на передачу сигнала Wnt в ТМ. В одном из сообщений было указано, что эффект глаукоматозных мутаций MYOC, которые ингибируют секрецию MYOC из ТМ, на передачу сигнала Wnt в ТМ неясно, что измерено с помощью анализа TOP-Flash передачи сигнала Wnt (Mao et al. (2012) Invest. Ophthalmol. Vis. Sci. 53(11):7043-51). Другая группа сообщила, что P370L оказывает стимулирующий эффект на передачу сигнала Wnt в клетках Caco-2, что показано с помощью анализа TOP-Flash передачи сигнала Wnt (Shen et al. (2012) PLoS ONE 7(9):e44902).

В отличие от этого, авторы изобретения обнаружили, что мутации MYOC (например, P370L и Y437H) оказывают ингибирующий эффект на передачу сигнала Wnt в клетках 293 и клетках ТМ, как показано в анализе TOP-Flash передачи сигнала Wnt, в котором отображается активность бета-катенина.

Для оценки эффекта мутантов MYOC P370L и Y437H на передачу сигнала Wnt клетки 293T совместно трансфицировали репортерной конструкцией TOP-Flash и плазмидами wtMYOC («MYOC»), MYOC P370L или MYOC Y437H. Передача сигнала Wnt усиливалась после добавления рекомбинантной мышиной Wnt3a (400 нг/мл) и была измерена с помощью анализа TOP-Flash. Люциферазную активность (значение+SD, n=4) измеряли после трансфекции и нормализовали по контрольной трансфекции постоянно экспрессируемого уровня люциферазы Renilla.

Как показано на фиг. 3, стимуляция клеток 293T рекомбинантной Wnt3 мыши вызывала увеличение репортера TOP-Flash. Экспрессия MYOC дикого типа не мешала передаче сигнала Wnt, как проанализировано при помощи TOP-Flash. Однако совместная экспрессия MYOC дикого типа с MYOC P370L или MYOC Y437H блокировала активацию TOP-Flash в клетках 293T. Эти результаты демонстрируют, что глаукоматозные мутанты MYOC (например, P370L и Y437H) способны ингибировать передачу сигнала Wnt в клетках человека.

Пример 3. Восстановление передачи сигнала Wnt, блокированного глаукоматозными мутациями MYOC (например, P370L и Y437H)

В предыдущем примере продемонстрировано, что глаукоматозные мутанты MYOC P370L и Y437H блокируют передачу сигнала Wnt в клетках человека. Дальнейшие эксперименты были предприняты для изучения потенциальных механизмов, с помощью которых передача сигнала Wnt может быть восстановлена в клетках, экспрессирующих эти мутанты MYOC.

R-спондин 3 (RSPO3) представляет собой белок, кодируемый геном RSPO3, который активирует передачу сигнала Wnt, и было исследовано, способна ли экспрессия RSPO3 восстанавливать передачу сигнала Wnt при ее ингибировании посредством экспрессии мутантного MYOC. Для этих экспериментов, аналогично фиг. 3 выше, клетки 293T совместно трансфицировали репортерной конструкцией TOP-Flash и плазмидами wtMYOC («MYOC»), MYOC P370L, MYOC Y437H и/или RSPO3, как отмечено. Передача сигнала Wnt усиливалась после добавления рекомбинантной мышиной Wnt3a (400 нг/мл) и была измерена с помощью анализа TOP-Flash. Люциферазную активность (значение+SD, n=3) измеряли после трансфекции и нормализовали по контрольной трансфекции постоянно экспрессируемого уровня люциферазы Renilla.

Как показано на фиг. 4, экспрессия RSPO3 вызывала усиление передачи сигнала Wnt, как измерено при помощи TOP-Flash. Важно отметить, что совместная экспрессия RSPO3 и MYOC P370L или MYOC Y437H способна восстанавливать передачу сигнала Wnt по сравнению с ингибированием передачи сигнала Wnt, наблюдаемого при экспрессии только MYOC P370L или только MYOC Y437H. Клетки 293T совместно трансфицировали репортерной конструкцией TOP-Flash и плазмидами wtMYOC («MYOC»), MYOC P370L, MYOC Y437H и/или RSPO3, как отмечено. Передача сигнала Wnt усиливалась после добавления рекомбинантной мышиной Wnt3a (400 нг/мл) и была измерена с помощью анализа TOP-Flash. Люциферазную активность измеряли после трансфекции и нормализовали по контрольной трансфекции постоянно экспрессируемого уровня люциферазы Renilla.

Чтобы исследовать, наблюдается ли подобный эффект в клетках hTM, клетки hTM-T совместно трансфицировали репортерной конструкцией TOP-Flash и плазмидами wtMYOC ("MYOC w.t."), MYOC P370L и/или RSPO3. Активность Wnt измеряли с помощью анализа TOP-Flash, как описано выше (активность люциферазы показана как среднее значение+SD, n=3). На фиг. 5 показано, что экспрессия MYOC P370L вызывала ослабление передачи сигнала Wnt и была способна ослаблять передачу сигнала Wnt в клетках hTM-T с совместной экспрессией MYOC дикого типа. Экспрессия RSPO3 способна увеличивать передачу сигнала Wnt в клетках hTM-T, экспрессирующих только MYOC P370L или MYOC P370L в комбинации с MYOC дикого типа. Результаты, показанные на фиг. 4 и 5 показывают, что экспрессия RSPO3 восстанавливает передачу сигнала Wnt в клетках, экспрессирующих глаукоматозные мутанты MYOC, в таких как клетки 293T и клетки hTM-T.

Удивительно, но было также обнаружено, что ингибирование Wnt посредством экспрессии глаукоматозных мутантов MYOC может быть отменено посредством сайленсинга MYOC (например, с помощью RNAi). Эффект shRNA для MYOC на экспрессию MYOC исследовали в клетках 293T. Как показано на фиг. 6, shRNA для MYOC уменьшала экспрессию белка MYOC в клетках, экспрессирующих MYOC дикого типа, по сравнению с рандомизированной контрольной shRNA. Это снижение наблюдалось как для внутриклеточного, так и для секретируемого MYOC.

На фиг. 7 показан эффект shRNA для MYOC в клетках hTM-T. shRNA для MYOC уменьшала экспрессию белка MYOC в клетках hTM-T с совместной экспрессией MYOC дикого типа и мутантного MYOC P370L. Это снижение наблюдалось как для внутриклеточного, так и для секретируемого MYOC. Напротив, shRNA, целенаправленно воздействующая на Grp94, не оказывала эффект на экспрессию MYOC. Grp94 представляет собой молекулярный шаперон, который участвует в процессинге и транспорте секретируемых белков, и недавно был предложен в качестве терапевтического средства для пациентов, страдающих некоторыми случаями глаукомы MYOC, поскольку считалось, что Grp94 облегчает клиренс мутантов MYOC(Suntharalingam et al., (2012) J. Biol. Chem. 287(48):40661-9). Аналогично, рандомизированные контрольные shRNA не оказывали эффекта на экспрессию MYOC.

Поскольку shRNA для MYOC влияла на экспрессию MYOC, в дальнейшем исследовали ее эффекты на передачу сигнала Wnt. Как показано на фиг. 8, экспрессия MYOC P370L ослабляла передачу сигнала Wnt в клетках 293T. shRNA для Grp94 и рандомизированные контрольные shRNA были не способны восстанавливать передачу сигнала Wnt, ингибированную посредством MYOC P370L. Напротив, shRNA для MYOC усиливала передачу сигнала Wnt в клетках, экспрессирующих MYOC P370L, приблизительно до уровней дикого типа (т. е. уровня передачи сигнала Wnt, наблюдаемого в контрольных клетках, не экспрессирующих MYOC P370L, как измерено с помощью TOP-Flash). Было также установлено, что экспрессия RSPO3 усиливает передачу сигнала Wnt в клетках, экспрессирующих MYOC P370L, и объединение экспрессии RSPO3 со средством для RNAi в отношении MYOC (например, shRNA) привело к синергетическому усилению передачи сигнала Wnt в клетках, экспрессирующих MYOC P370L.

Хотя ингибирование Grp94 было предложено в качестве механизма снижения эффектов мутантов MYOC, эти результаты, описанные в данном документе, показывают, что экспрессия RSPO3 и/или shRNA для MYOC может быть более эффективной для дерепрессии передачи сигнала Wnt в присутствии экспрессии мутанта MYOC.

Также исследовали эффект shRNA для MYOC на передачу сигнала Wnt в клетках, экспрессирующих MYOC Y437H. Как показано на фиг. 9, экспрессия MYOC P370L или MYOC Y437H ослабляла передачу сигнала Wnt в клетках 293T. Однако shRNA для MYOC была способной восстанавливать передачу сигнала Wnt в клетках, экспрессирующих либо MYOC P370L, либо MYOC Y437H. Этот эффект не наблюдался при экспрессии рандомизированной контрольной shRNA.

Таким образом, эти результаты демонстрируют, что передача сигнала Wnt, блокированная мутантами MYOC (например, P370L и Y437H), может быть восстановлена посредством экспрессии R-спондина 3 (RSPO3) и/или ингибирования MYOC (например, с помощью RNAi).

Пример 4. Трансдукция клеток трабекулярной сети с помощью AAV2 R471A

Для определения того, могут ли частицы AAV трансдуцировать клетки трабекулярной сети, векторы AAV2, кодирующие EGFP, упаковывали в частицы AAV2 дикого типа из частиц AAV2, содержащих аминокислотную замену R471A (нумерация которой приведена согласно VP1). Вирусные частицы оценивали in vitro путем обработки клеток hTM (описанных выше) AAV2 EGFP и AAV2 R471A EGFP. Как показано на фиг. 10 (левые панели), AAV2 R471A EGFP показывала более высокий уровень трансдукции клеток TM по сравнению с AAV2 дикого типа. Для оценки трансдукции клеток TM in vivo, AAV2 EGFP и AAV2 R471A EGFP вводили путем инъекции в глаза мышей. Мышей затем умерщвляли и анализировали в отношении экспрессии EGFP. Как показано на фиг. 10 (правые панели), AAV2 R471A EGFP показывала более высокий уровень трансдукции клеток TM in vivo по сравнению с AAV2 дикого типа.

Пример 5. Экспрессия RSPO3 или shRNA для MYOC в животных моделях миоцилиновой (MYOC) глаукомы

Приведенные выше примеры демонстрируют, что глаукоматозные мутации MYOC (например, P370L и Y437H) блокируют передачу сигнала Wnt и что это ингибирование передачи сигнала Wnt можно получить путем экспрессии R-спондина 3 (RSPO3) или с помощью shRNA для MYOC. Не желая быть ограниченными какой-либо теорией, полагают, что мутации MYOC (например, P370L и/или Y437H) могут влиять на передачу сигнала Wnt в TM, модулируя таким образом IOP и обуславливая POAG. В следующих экспериментах тестировали, способна ли экспрессия R-спондина 3 (RSPO3) или shRNA для MYOC, доставленная посредством вектора на основе AAV2, приводить к улучшению симптомов в мышиных моделях данного заболевания.

Мышиную модель POAG использовали для исследования эффективности экспрессии R-спондина 3 (RSPO3) и/или shRNA для MYOC при AАV-опосредованной доставке в глаз при лечении миоцилиновой (MYOC) глаукомы. Например, можно применять мышиную модель, экспрессирующую MYOC Y437H (см. Zode et al. (2011) J. Clin. Invest. 121(9):3542-53). В данной модели, MYOC Y437H человека экспрессируется под контролем промотора CMV у трансгенной мыши. С применением данной системы MYOC Y437H экспрессируется в тканях, связанных с миоцилиновой (MYOC) глаукомой, таких как трабекулярная сеть и склера. Данные мыши проявляют совершенно нормальную морфологию глаза, но начинают демонстрировать симптомы, подобные миоцилиновой (MYOC) глаукоме, после наступления возраста три месяца, такие как IOP и прогрессивная аксональная дегенерация зрительного нерва.

Трансгены, экспрессирующие GFP, мышиный RSPO3, shRNA, целенаправленно воздействующую на MYOC мыши (мишень shRNA для MYOC и последовательность петли из pGIPZ #93; Dharmacon, GE Healthcare), или рандомизированную shRNA клонировали в геном AAV2 под контролем гибридного промотора β-актина курицы (CBA) из плазмиды pCBA(2)-в-BGH, которая также содержала последовательность сигнала полиаденилирования бычьего гормона роста (Xu, R., et al. (2001) Gene Ther. 8:1323-32). Кассету экспрессии затем клонировали в превирусный плазмидный вектор pAAVSP70, содержащий инвертированные концевые повторы (ITR) AAV2 (Ziegler, R.J., et al. (2004) Mol. Ther. 9:231-40). Общий размер полученного в результате генома AAV в плазмиде sp70.BR/sFLT01, включая область, фланкированную ITR, составил 4,6 т.п.о.

Геномы AAV2 упаковывали в капсиды AAV2 с мутацией R471A для обеспечения возможности инфицирования трабекулярной сети или капсиды AAV2 для обеспечения возможности инфицирования ганглионарных клеток сетчатки. Геномы AAV2 упаковывали в AAV2 дикого типа или капсид R471A с применением подхода "выпотрошенного" вектора с применением способа тройной трансфекции (см. e.g., Xiao et al. (1998) J. Virol., 3:2224-32). Вкратце, гены rep и cap замещали терапевтическим геном и его регуляторными элементами, оба находящиеся между 5'- и 3'-инвертированными концевыми повторами (ITR). Доставку генов rep и cap обеспечивали в разных плазмидах, и третья плазмида обеспечивала необходимые аденовирусные хелперные гены. Альтернативно, необходимые аденовирусные хелперные гены обеспечивали путем репликации дефицитного аденовируса и/или аденовирусных хелперных генов, которые стабильно интегрированы в геном клетки-хозяина. Не желая ограничиваться какой-либо конкретной теорией, можно предположить, что вирусные капсиды полностью собраны, и ITR-фланкированный геном вектора затем вставляют в капсид через капсидную пору (Myers & Carter (1980) Virology, 102:71-82). Капсиды, содержащие геном, затем составляют для инъекции.

Трансгенных мышей, экспрессирующих MYOC Y437H человека, выращивают до возраста примерно три месяца и затем рандомно распределяли в группы лечения. Мышей подвергали анестезии и вводили им путем инъекции посредством интравитреальной или интракамеральной инъекции векторы AAV, кодирующие GFP, RSPO3 мыши, shRNA, целенаправленно воздействующую на MYOC мыши, или рандомизированную shRNA. В одной группе лечения для исследования эффектов в ганглионарных клетках сетчатки мышь получала инъекцию векторов на основе AAV2 с капсидом AAV2 дикого типа, экспрессирующих RSPO3, и инъекцию векторов на основе AAV2 с капсидом AAV2 дикого типа, экспрессирующих GFP, в контралатеральный глаз. В одной группе лечения для исследования эффектов в трабекулярной сети мышь получала инъекцию векторов на основе AAV2 с капсидом R471A AAV2, экспрессирующим shRNA, целенаправленно воздействующую на MYOC мыши, и инъекцию векторов AAV2 с капсидом R471A AAV2, экспрессирующим рандомизированную shRNA, в контралатеральный глаз. В одной группе лечения мышь получала инъекцию смеси векторов на основе AAV, экспрессирующих RSPO3 мыши, и векторов на основе AAV, экспрессирующих shRNA, целенаправленно воздействующую на MYOC мыши, в один глаз и инъекцию векторов на основе AAV, экспрессирующих GFP, и/или векторов на основе AAV, экспрессирующих рандомизированную shRNA, в контралатеральный глаз. В одной группе лечения мышь получала инъекцию векторов на основе AAV, экспрессирующих RSPO3 мыши и экспрессирующих shRNA, целенаправленно воздействующую на MYOC мыши, в один глаз и инъекцию векторов на основе AAV, экспрессирующих GFP и экспрессирующих рандомизированную shRNA, в контралатеральный глаз.

Мышей исследовали при равных интервалах с последующей инъекцией для симптомов миоцилиновой (MYOC) глаукомы, сравнивая глаз, получающий экспериментальное лечение, с глазом, получающим контрольное лечение. IOP измеряли с помощью тонометрии (Kim, C.Y., et al. (2007) Eye (Lond.) 21(9):1202-9). Толщину роговицы измеряли с помощью ультразвукового пахиметра (Lively, G.D., et al. (2010) Physiol. Genomics 42(2):281-6). Радужно-роговичный угол оценивали с помощью гониоскопии. Функцию ганглионарных клеток сетчатки измеряли путем анализирования картины структурной электроретинографии ответов на зрительный раздражитель с применением модели электроретинографии (PERG) (Zode et al. (2011) J. Clin. Invest. 121(9):3542-53). Мышей могли умерщвлять и глаза могли вырезать для других фенотипических характеристик. Например, количество и/или морфологию ганглионарных клеток сетчатки оценивали с помощью иммунофлуоресцентной микроскопии и/или просвечивающей электронной микроскопии.

Пример 6. Применение белков семейства RSPO для восстановления передачи сигнала Wnt, блокированной глаукоматозной мутацией MYOC

Как продемонстрировано в примере 3, передача сигнала Wnt, блокированная мутантами MYOC (например, P370L и Y437H) может быть восстановлена экспрессией R-спондина 3 (RSPO3). Для дальнейшего понимания механизмов, лежащих в основе этого восстановления передачи сигнала Wnt, исследовали способность различных представителей и вариантов семейства RSPO восстанавливать передачу сигнала Wnt.

Белки hRSPO1, 2, 3, и 4 семейства RSPO человека обладают схожей структурой домена, которая включает в себя фуриноподобные домены, богатые Cys, домен тромбоспондина типа 1 и C-концевой положительно заряженный домен, как проиллюстрировано на фиг. 11 и 12. Для исследования функциональных доменов, необходимых для восстановления передачи сигнала Wnt, создавали несколько усеченных вариантов RSPO3 человека. Варианты и специфические домены, включенные и исключенные для каждого варианта, показаны на фиг. 11, 12, 13A и 14.

Для тестирования эффектов вариантов RSPO3 на передачу сигнала Wnt клетки 293T совместно трансфицировали репортерной конструкцией TOP-Flash и wtMYOC ("MYOC") или MYOC Y437H, и также трансфицировали плазмидами полной длины или частичными плазмидами с RSPO3, как отмечено на фиг. 15. Передача сигнала Wnt усиливалась после добавления рекомбинантной человеческой Wnt3a (400 нг/мл) и была измерена с помощью анализа TOP-Flash. Люциферазную активность (значение+SD, n=3) измеряли после трансфекции и нормализовали по контрольной трансфекции постоянно экспрессируемого уровня люциферазы Renilla.

Как описано в примере 3, мутантный MYOC Y437H ингибирует передачу сигнала Wnt в клетках 293T, измеренную с помощью анализа TOP-Flash. На фиг. 15 показан эффект различных усеченных вариантов hRSPO3 на передачу сигнала Wnt в данном анализе. Как показано на фиг. 15, все исследуемые формы hRSPO3, как частичные, так и полной длины, обладали активностью восстановления передачи сигнала Wnt, при этом RSPO3 полной длины проявлял более сильную активность, чем многие усеченные формы.

Для исследования эффекта различных представителей семейства RSPO на передачу сигнала Wnt клетки 293T совместно трансфицировали репортерной конструкцией TOP-Flash и wtMYOC ("MYOC") или MYOC Y437H, а также трансфицировали плазмидами полной длины или частичными плазмидами с RSPO1, RSPO2 или RSPO4, как отмечено на фиг. 16 (см. фиг. 12 для описания сеченных форм RSPO1, 2, 3, и 4). Передача сигнала Wnt усиливалась после добавления рекомбинантной мышиной Wnt3a (400 нг/мл) и была измерена с помощью анализа TOP-Flash. Люциферазную активность (значение+SD, n=3) измеряли после трансфекции и нормализовали по контрольной трансфекции постоянно экспрессируемого уровня люциферазы Renilla.

Результаты этих исследований показаны на фиг. 16. Эти результаты указывают, что RSPO1, 2, и 4, полной длины и усеченные, также обладали активностью восстановления передачи сигнала Wnt, при этом RSPO полной длины проявлял более сильную активность, чем усеченные формы. Все представители и формы семейства RSPO и взаимодействовали с Wnt3a.

ПОСЛЕДОВАТЕЛЬНОСТИ

Полипептидная последовательность RSPO3 (сигнальная последовательность подчеркнута)

MHLRLISWLFIILNFMEYIGSQNASRGRRQRRMHPNVSQGCQGGCATCSDYNGCLSCKPRLFFALERIGMKQIGVCLSSCPSGYYGTRYPDINKCTKCKADCDTCFNKNFCTKCKSGFYLHLGKCLDNCPEGLEANNHTMECVSIVHCEVSEWNPWSPCTKKGKTCGFKRGTETRVREIIQHPSAKGNLCPPTNETRKCTVQRKKCQKGERGKKGRERKRKKPNKGESKEAIPDSKSLESSKEIPEQRENKQQQKKRKVQDKQKSVSVSTVH (SEQ ID NO:1)

Полипептидная последовательность RSPO3

ATGCACTTGCGACTGATTTCTTGGCTTTTTATCATTTTGAACTTTATGGA ATACATCGGCAGCCAAAACGCCTCCCGGGGAAGGCGCCAGCGAAGAATGC ATCCTAACGTTAGTCAAGGCTGCCAAGGAGGCTGTGCAACATGCTCAGAT TACAATGGATGTTTGTCATGTAAGCCCAGACTATTTTTTGCTCTGGAAAG AATTGGCATGAAGCAGATTGGAGTATGTCTCTCTTCATGTCCAAGTGGAT ATTATGGAACTCGATATCCAGATATAAATAAGTGTACAAAATGCAAAGCT GACTGTGATACCTGTTTCAACAAAAATTTCTGCACAAAATGTAAAAGTGG ATTTTACTTACACCTTGGAAAGTGCCTTGACAATTGCCCAGAAGGGTTGG AAGCCAACAACCATACTATGGAGTGTGTCAGTATTGTGCACTGTGAGGTC AGTGAATGGAATCCTTGGAGTCCATGCACGAAGAAGGGAAAAACATGTGG CTTCAAAAGAGGGACTGAAACACGGGTCCGAGAAATAATACAGCATCCTT CAGCAAAGGGTAACCTGTGTCCCCCAACAAATGAGACAAGAAAGTGTACA GTGCAAAGGAAGAAGTGTCAGAAGGGAGAACGAGGAAAAAAAGGAAGGGA GAGGAAAAGAAAAAAACCTAATAAAGGAGAAAGTAAAGAAGCAATACCTG ACAGCAAAAGTCTGGAATCCAGCAAAGAAATCCCAGAGCAACGAGAAAAC AAACAGCAGCAGAAGAAGCGAAAAGTCCAAGATAAACAGAAATCGGTATC AGTCAGCACTGTACACTAG (SEQ ID NO:2)

Полипептидная последовательность MYOC

MRFFCARCCSFGPEMPAVQLLLLACLVWDVGARTAQLRKANDQSGRCQYTFSVASPNESSCPEQSQAMSVIHNLQRDSSTQRLDLEATKARLSSLESLLHQLTLDQAARPQETQEGLQRELGTLRRERDQLETQTRELETAYSNLLRDKSVLEEEKKRLRQENENLARRLESSSQEVARLRRGQCPQTRDTARAVPPGSREVSTWNLDTLAFQELKSELTEVPASRILKESPSGYLRSGEGDTGCGELVWVGEPLTLRTAETITGKYGVWMRDPKPTYPYTQETTWRIDTVGTDVRQVFEYDLISQFMQGYPSKVHILPRPLESTGAVVYSGSLYFQGAESRTVIRYELNTETVKAEKEIPGAGYHGQFPYSWGGYTDIDLAVDEAGLWVIYSTDEAKGAIVLSKLNPENLELEQTWETNIRKQSVANAFIICGTLYTVSSYTSADATVNFAYDTGTGISKTLTIPFKNRYKYSSMIDYNPLEKKLFAWDNLNMVTYDIKLSKM (SEQ ID NO:3)

кДНК-последовательность MYOC

ATGAGGTTCTTCTGTGCACGTTGCTGCAGCTTTGGGCCTGAGATGCCAGCTGTCCAGCTGCTGCTTCTGGCCTGCCTGGTGTGGGATGTGGGGGCCAGGACAGCTCAGCTCAGGAAGGCCAATGACCAGAGTGGCCGATGCCAGTATACCTTCAGTGTGGCCAGTCCCAATGAATCCAGCTGCCCAGAGCAGAGCCAGGCCATGTCAGTCATCCATAACTTACAGAGAGACAGCAGCACCCAACGCTTAGACCTGGAGGCCACCAAAGCTCGACTCAGCTCCCTGGAGAGCCTCCTCCACCAATTGACCTTGGACCAGGCTGCCAGGCCCCAGGAGACCCAGGAGGGGCTGCAGAGGGAGCTGGGCACCCTGAGGCGGGAGCGGGACCAGCTGGAAACCCAAACCAGAGAGTTGGAGACTGCCTACAGCAACCTCCTCCGAGACAAGTCAGTTCTGGAGGAAGAGAAGAAGCGACTAAGGCAAGAAAATGAGAATCTGGCCAGGAGGTTGGAAAGCAGCAGCCAGGAGGTAGCAAGGCTGAGAAGGGGCCAGTGTCCCCAGACCCGAGACACTGCTCGGGCTGTGCCACCAGGCTCCAGAGAAGTTTCTACGTGGAATTTGGACACTTTGGCCTTCCAGGAACTGAAGTCCGAGCTAACTGAAGTTCCTGCTTCCCGAATTTTGAAGGAGAGCCCATCTGGCTATCTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCTCACGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGGTGTGTGGATGCGAGACCCCAAGCCCACCTACCCCTACACCCAGGAGACCACGTGGAGAATCGACACAGTTGGCACGGATGTCCGCCAGGTTTTTGAGTATGACCTCATCAGCCAGTTTATGCAGGGCTACCCTTCTAAGGTTCACATACTGCCTAGGCCACTGGAAAGCACGGGTGCTGTGGTGTACTCGGGGAGCCTCTATTTCCAGGGCGCTGAGTCCAGAACTGTCATAAGATATGAGCTGAATACCGAGACAGTGAAGGCTGAGAAGGAAATCCCTGGAGCTGGCTACCACGGACAGTTCCCGTATTCTTGGGGTGGCTACACGGACATTGACTTGGCTGTGGATGAAGCAGGCCTCTGGGTCATTTACAGCACCGATGAGGCCAAAGGTGCCATTGTCCTCTCCAAACTGAACCCAGAGAATCTGGAACTCGAACAAACCTGGGAGACAAACATCCGTAAGCAGTCAGTCGCCAATGCCTTCATCATCTGTGGCACCTTGTACACCGTCAGCAGCTACACCTCAGCAGATGCTACCGTCAACTTTGCTTATGACACAGGCACAGGTATCAGCAAGACCCTGACCATCCCATTCAAGAACCGCTATAAGTACAGCAGCATGATTGACTACAACCCCCTGGAGAAGAAGCTCTTTGCCTGGGACAACTTGAACATGGTCACTTATGACATCAAGCTCTCCAAGATGTAG (SEQ ID NO:4)

Целевые последовательности shRNA для MYOC

GGCCATGTCAGTCATCCAT (SEQ ID NO:5)

QAMSVIH (SEQ ID NO:6)

Последовательность петли shRNA

AATAGTGAAGCCACAGATGTATT (SEQ ID NO:7)

Полипептидная последовательность RSPO1 (сигнальная последовательность подчеркнута)

MRLGLCVVALVLSWTHLTISSRGIKGKRQRRISAEGSQACAKGCELCSEVNGCLKCSPKLFILLERNDIRQVGVCLPSCPPGYFDARNPDMNKCIKCKIEHCEACFSHNFCTKCKEGLYLHKGRCYPACPEGSSAANGTMECSSPAQCEMSEWSPWGPCSKKQQLCGFRRGSEERTRRVLHAPVGDHAACSDTKETRRCTVRRVPCPEGQKRRKGGQGRRENANRNLARKESKEAGAGSRRRKGQQQQQQQGTVGPLTSAGPA (SEQ ID NO:8)

Полипептидная последовательность RSPO2 (сигнальная последовательность подчеркнута)

MQFRLFSFALIILNCMDYSHCQGNRWRRSKRASYVSNPICKGCLSCSKDNGCSRCQQKLFFFLRREGMRQYGECLHSCPSGYYGHRAPDMNRCARCRIENCDSCFSKDFCTKCKVGFYLHRGRCFDECPDGFAPLEETMECVEGCEVGHWSEWGTCSRNNRTCGFKWGLETRTRQIVKKPVKDTILCPTIAESRRCKMTMRHCPGGKRTPKAKEKRNKKKKRKLIERAQEQHSVFLATDRANQ (SEQ ID NO:9)

Полипептидная последовательность RSPO4 (сигнальная последовательность подчеркнута)

MRAPLCLLLLVAHAVDMLALNRRKKQVGTGLGGNCTGCIICSEENGCSTCQQRLFLFIRREGIRQYGKCLHDCPPGYFGIRGQEVNRCKKCGATCESCFSQDFCIRCKRQFYLYKGKCLPTCPPGTLAHQNTRECQGECELGPWGGWSPCTHNGKTCGSAWGLESRVREAGRAGHEEAATCQVLSESRKCPIQRPCPGERSPGQKKGRKDRRPRKDRKLDRRLDVRPRQPGLQP (SEQ ID NO:10)

Полипептидная последовательность RSPO1 с усечением 1-135 (сигнальная последовательность подчеркнута)

MRLGLCVVALVLSWTHLTISSRGIKGKRQRRISAEGSQACAKGCELCSEVNGCLKCSPKLFILLERNDIRQVGVCLPSCPPGYFDARNPDMNKCIKCKIEHCEACFSHNFCTKCKEGLYLHKGRCYPACPEGSSA (SEQ ID NO:11)

Полипептидная последовательность RSPO1 с усечением 1-206 (сигнальная последовательность подчеркнута)

MRLGLCVVALVLSWTHLTISSRGIKGKRQRRISAEGSQACAKGCELCSEVNGCLKCSPKLFILLERNDIRQVGVCLPSCPPGYFDARNPDMNKCIKCKIEHCEACFSHNFCTKCKEGLYLHKGRCYPACPEGSSAANGTMECSSPAQCEMSEWSPWGPCSKKQQLCGFRRGSEERTRRVLHAPVGDHAACSDTKETRRCTVRRVPC (SEQ ID NO:12)

Полипептидная последовательность RSPO2 с усечением 1-134 (сигнальная последовательность подчеркнута)

MQFRLFSFALIILNCMDYSHCQGNRWRRSKRASYVSNPICKGCLSCSKDNGCSRCQQKLFFFLRREGMRQYGECLHSCPSGYYGHRAPDMNRCARCRIENCDSCFSKDFCTKCKVGFYLHRGRCFDECPDGFAP (SEQ ID NO:13)

Полипептидная последовательность RSPO2 с усечением 1-203 (сигнальная последовательность подчеркнута)

MQFRLFSFALIILNCMDYSHCQGNRWRRSKRASYVSNPICKGCLSCSKDNGCSRCQQKLFFFLRREGMRQYGECLHSCPSGYYGHRAPDMNRCARCRIENCDSCFSKDFCTKCKVGFYLHRGRCFDECPDGFAPLEETMECVEGCEVGHWSEWGTCSRNNRTCGFKWGLETRTRQIVKKPVKDTILCPTIAESRRCKMTMRHC (SEQ ID NO:14)

Полипептидная последовательность RSPO3 с усечением 1-135 (сигнальная последовательность подчеркнута)

MHLRLISWLFIILNFMEYIGSQNASRGRRQRRMHPNVSQGCQGGCATCSDYNGCLSCKPRLFFALERIGMKQIGVCLSSCPSGYYGTRYPDINKCTKCKADCDTCFNKNFCTKCKSGFYLHLGKCLDNCPEGLEA (SEQ ID NO:15)

Полипептидная последовательность RSPO3 с усечением 1-146 (сигнальная последовательность подчеркнута)

MHLRLISWLFIILNFMEYIGSQNASRGRRQRRMHPNVSQGCQGGCATCSDYNGCLSCKPRLFFALERIGMKQIGVCLSSCPSGYYGTRYPDINKCTKCKADCDTCFNKNFCTKCKSGFYLHLGKCLDNCPEGLEANNHTMECVSIV (SEQ ID NO:16)

Полипептидная последовательность RSPO3 с усечением 1-206 (сигнальная последовательность подчеркнута)

MHLRLISWLFIILNFMEYIGSQNASRGRRQRRMHPNVSQGCQGGCATCSDYNGCLSCKPRLFFALERIGMKQIGVCLSSCPSGYYGTRYPDINKCTKCKADCDTCFNKNFCTKCKSGFYLHLGKCLDNCPEGLEANNHTMECVSIVHCEVSEWNPWSPCTKKGKTCGFKRGTETRVREIIQHPSAKGNLCPPTNETRKCTVQRKKC (SEQ ID NO:17)

Полипептидная последовательность RSPO4 с усечением 1-128 (сигнальная последовательность подчеркнута)

MRAPLCLLLLVAHAVDMLALNRRKKQVGTGLGGNCTGCIICSEENGCSTCQQRLFLFIRREGIRQYGKCLHDCPPGYFGIRGQEVNRCKKCGATCESCFSQDFCIRCKRQFYLYKGKCLPTCPPGTLA (SEQ ID NO:18)

Полипептидная последовательность RSPO4 с усечением 1-195 (сигнальная последовательность подчеркнута)

MRAPLCLLLLVAHAVDMLALNRRKKQVGTGLGGNCTGCIICSEENGCSTCQQRLFLFIRREGIRQYGKCLHDCPPGYFGIRGQEVNRCKKCGATCESCFSQDFCIRCKRQFYLYKGKCLPTCPPGTLAHQNTRECQGECELGPWGGWSPCTHNGKTCGSAWGLESRVREAGRAGHEEAATCQVLSESRKCPIQRP (SEQ ID NO:19)

Мутированная полинуклеотидная последовательность ITR

CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG (SEQ ID NO:20)

Прямой мутагенезный праймер для MYOC370L (замена подчеркнута)

ACCACGGACAGTTCCTGTATTCTTGGGGTGG (SEQ ID NO:21)

Обратный мутагенезный праймер для MYOC370L (замена подчеркнута)

CCACCCCAAGAATACAGGAACTGTCCGTGGT (SEQ ID NO:22)

Прямой мутагенезный праймер для MYOCY437H (замена подчеркнута)

TCTGTGGCACCTTGCACACCGTCAGCAGC (SEQ ID NO:23)

Обратный мутагенезный праймер для MYOCY437H (замена подчеркнута)

GCTGCTGACGGTGTGCAAGGTGCCACAGA (SEQ ID NO:24)

--->

СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

<110> PECHAN, Peter

SCARIA, Abraham

ARDINGER, Jeffery

<120> АДЕНОАССОЦИИРОВАННЫЕ ВИРУСНЫЕ ВЕКТОРЫ ДЛЯ ЛЕЧЕНИЯ МИОЦИЛИНОВОЙ (MYOC) ГЛАУКОМЫ

<130> 159792012540

<140> еще не определено

<141> вместе с этим

<150> 62/051,229

<151> 2014-09-16

<160> 24

<170> FastSEQ для Windows версии 4.0

<210> 1

<211> 272

<212> БЕЛОК

<213> Homo sapiens

<400> 1

Met His Leu Arg Leu Ile Ser Trp Leu Phe Ile Ile Leu Asn Phe Met

1 5 10 15

Glu Tyr Ile Gly Ser Gln Asn Ala Ser Arg Gly Arg Arg Gln Arg Arg

20 25 30

Met His Pro Asn Val Ser Gln Gly Cys Gln Gly Gly Cys Ala Thr Cys

35 40 45

Ser Asp Tyr Asn Gly Cys Leu Ser Cys Lys Pro Arg Leu Phe Phe Ala

50 55 60

Leu Glu Arg Ile Gly Met Lys Gln Ile Gly Val Cys Leu Ser Ser Cys

65 70 75 80

Pro Ser Gly Tyr Tyr Gly Thr Arg Tyr Pro Asp Ile Asn Lys Cys Thr

85 90 95

Lys Cys Lys Ala Asp Cys Asp Thr Cys Phe Asn Lys Asn Phe Cys Thr

100 105 110

Lys Cys Lys Ser Gly Phe Tyr Leu His Leu Gly Lys Cys Leu Asp Asn

115 120 125

Cys Pro Glu Gly Leu Glu Ala Asn Asn His Thr Met Glu Cys Val Ser

130 135 140

Ile Val His Cys Glu Val Ser Glu Trp Asn Pro Trp Ser Pro Cys Thr

145 150 155 160

Lys Lys Gly Lys Thr Cys Gly Phe Lys Arg Gly Thr Glu Thr Arg Val

165 170 175

Arg Glu Ile Ile Gln His Pro Ser Ala Lys Gly Asn Leu Cys Pro Pro

180 185 190

Thr Asn Glu Thr Arg Lys Cys Thr Val Gln Arg Lys Lys Cys Gln Lys

195 200 205

Gly Glu Arg Gly Lys Lys Gly Arg Glu Arg Lys Arg Lys Lys Pro Asn

210 215 220

Lys Gly Glu Ser Lys Glu Ala Ile Pro Asp Ser Lys Ser Leu Glu Ser

225 230 235 240

Ser Lys Glu Ile Pro Glu Gln Arg Glu Asn Lys Gln Gln Gln Lys Lys

245 250 255

Arg Lys Val Gln Asp Lys Gln Lys Ser Val Ser Val Ser Thr Val His

260 265 270

<210> 2

<211> 819

<212> ДНК

<213> Homo sapiens

<400> 2

atgcacttgc gactgatttc ttggcttttt atcattttga actttatgga atacatcggc 60

agccaaaacg cctcccgggg aaggcgccag cgaagaatgc atcctaacgt tagtcaaggc 120

tgccaaggag gctgtgcaac atgctcagat tacaatggat gtttgtcatg taagcccaga 180

ctattttttg ctctggaaag aattggcatg aagcagattg gagtatgtct ctcttcatgt 240

ccaagtggat attatggaac tcgatatcca gatataaata agtgtacaaa atgcaaagct 300

gactgtgata cctgtttcaa caaaaatttc tgcacaaaat gtaaaagtgg attttactta 360

caccttggaa agtgccttga caattgccca gaagggttgg aagccaacaa ccatactatg 420

gagtgtgtca gtattgtgca ctgtgaggtc agtgaatgga atccttggag tccatgcacg 480

aagaagggaa aaacatgtgg cttcaaaaga gggactgaaa cacgggtccg agaaataata 540

cagcatcctt cagcaaaggg taacctgtgt cccccaacaa atgagacaag aaagtgtaca 600

gtgcaaagga agaagtgtca gaagggagaa cgaggaaaaa aaggaaggga gaggaaaaga 660

aaaaaaccta ataaaggaga aagtaaagaa gcaatacctg acagcaaaag tctggaatcc 720

agcaaagaaa tcccagagca acgagaaaac aaacagcagc agaagaagcg aaaagtccaa 780

gataaacaga aatcggtatc agtcagcact gtacactag 819

<210> 3

<211> 502

<212> БЕЛОК

<213> Homo sapiens

<400> 3

Met Arg Phe Phe Cys Ala Arg Cys Cys Ser Phe Gly Pro Glu Met Pro

1 5 10 15

Ala Val Gln Leu Leu Leu Leu Ala Cys Leu Val Trp Asp Val Gly Ala

20 25 30

Arg Thr Ala Gln Leu Arg Lys Ala Asn Asp Gln Ser Gly Arg Cys Gln

35 40 45

Tyr Thr Phe Ser Val Asp Asn Glu Ser Ser Cys Pro Glu Gln Ser Gln

50 55 60

Ala Met Ser Val Ile His Asn Leu Gln Arg Asp Ser Ser Thr Gln Arg

65 70 75 80

Leu Asp Leu Glu Ala Thr Lys Ala Arg Leu Ser Ser Leu Glu Ser Leu

85 90 95

Leu His Gln Leu Thr Leu Asp Gln Ala Ala Arg Pro Gln Glu Thr Gln

100 105 110

Glu Gly Leu Gln Arg Glu Leu Gly Thr Leu Arg Arg Glu Arg Asp Gln

115 120 125

Leu Glu Thr Gln Thr Arg Glu Leu Glu Thr Ala Tyr Ser Asn Leu Leu

130 135 140

Arg Asp Lys Ser Val Leu Glu Glu Glu Lys Lys Arg Leu Arg Gln Glu

145 150 155 160

Asn Glu Asn Leu Ala Arg Arg Leu Glu Ser Ser Ser Gln Glu Val Ala

165 170 175

Arg Leu Arg Arg Gly Gln Cys Pro Gln Thr Arg Asp Thr Ala Arg Ala

180 185 190

Val Pro Pro Gly Ser Arg Glu Val Ser Thr Trp Asn Leu Asp Thr Leu

195 200 205

Ala Phe Gln Glu Leu Lys Ser Glu Leu Thr Glu Val Pro Ala Ser Arg

210 215 220

Ile Leu Lys Glu Ser Pro Ser Gly Tyr Leu Arg Ser Gly Glu Gly Asp

225 230 235 240

Thr Gly Cys Gly Glu Leu Val Trp Val Gly Glu Pro Leu Thr Leu Arg

245 250 255

Thr Ala Glu Thr Ile Thr Gly Lys Tyr Gly Val Trp Met Arg Asp Pro

260 265 270

Lys Pro Thr Tyr Pro Tyr Thr Gln Glu Thr Thr Trp Arg Ile Asp Thr

275 280 285

Val Gly Thr Asp Val Arg Gln Val Phe Glu Tyr Asp Leu Ile Ser Gln

290 295 300

Phe Met Gln Gly Tyr Pro Ser Lys Val His Ile Leu Pro Arg Pro Leu

305 310 315 320

Glu Ser Thr Gly Ala Val Val Tyr Ser Gly Ser Leu Tyr Phe Gln Gly

325 330 335

Ala Glu Ser Arg Thr Val Ile Arg Tyr Glu Leu Asn Thr Glu Thr Val

340 345 350

Lys Ala Glu Lys Glu Ile Pro Gly Ala Gly Tyr His Gly Gln Phe Pro

355 360 365

Tyr Ser Trp Gly Gly Tyr Thr Asp Ile Asp Leu Ala Val Asp Glu Ala

370 375 380

Gly Leu Trp Val Ile Tyr Ser Thr Asp Glu Ala Lys Gly Ala Ile Val

385 390 395 400

Leu Ser Lys Leu Asn Pro Glu Asn Leu Glu Leu Glu Gln Thr Trp Glu

405 410 415

Thr Asn Ile Arg Lys Gln Ser Val Ala Asn Ala Phe Ile Ile Cys Gly

420 425 430

Thr Leu Tyr Thr Val Ser Ser Tyr Thr Ser Ala Asp Ala Thr Val Asn

435 440 445

Phe Ala Tyr Asp Thr Gly Thr Gly Ile Ser Lys Thr Leu Thr Ile Pro

450 455 460

Phe Lys Asn Arg Tyr Lys Tyr Ser Ser Met Ile Asp Tyr Asn Pro Leu

465 470 475 480

Glu Lys Lys Leu Phe Ala Trp Asp Asn Leu Asn Met Val Thr Tyr Asp

485 490 495

Ile Lys Leu Ser Lys Met

500

<210> 4

<211> 1515

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 4

atgaggttct tctgtgcacg ttgctgcagc tttgggcctg agatgccagc tgtccagctg 60

ctgcttctgg cctgcctggt gtgggatgtg ggggccagga cagctcagct caggaaggcc 120

aatgaccaga gtggccgatg ccagtatacc ttcagtgtgg ccagtcccaa tgaatccagc 180

tgcccagagc agagccaggc catgtcagtc atccataact tacagagaga cagcagcacc 240

caacgcttag acctggaggc caccaaagct cgactcagct ccctggagag cctcctccac 300

caattgacct tggaccaggc tgccaggccc caggagaccc aggaggggct gcagagggag 360

ctgggcaccc tgaggcggga gcgggaccag ctggaaaccc aaaccagaga gttggagact 420

gcctacagca acctcctccg agacaagtca gttctggagg aagagaagaa gcgactaagg 480

caagaaaatg agaatctggc caggaggttg gaaagcagca gccaggaggt agcaaggctg 540

agaaggggcc agtgtcccca gacccgagac actgctcggg ctgtgccacc aggctccaga 600

gaagtttcta cgtggaattt ggacactttg gccttccagg aactgaagtc cgagctaact 660

gaagttcctg cttcccgaat tttgaaggag agcccatctg gctatctcag gagtggagag 720

ggagacaccg gatgtggaga actagtttgg gtaggagagc ctctcacgct gagaacagca 780

gaaacaatta ctggcaagta tggtgtgtgg atgcgagacc ccaagcccac ctacccctac 840

acccaggaga ccacgtggag aatcgacaca gttggcacgg atgtccgcca ggtttttgag 900

tatgacctca tcagccagtt tatgcagggc tacccttcta aggttcacat actgcctagg 960

ccactggaaa gcacgggtgc tgtggtgtac tcggggagcc tctatttcca gggcgctgag 1020

tccagaactg tcataagata tgagctgaat accgagacag tgaaggctga gaaggaaatc 1080

cctggagctg gctaccacgg acagttcccg tattcttggg gtggctacac ggacattgac 1140

ttggctgtgg atgaagcagg cctctgggtc atttacagca ccgatgaggc caaaggtgcc 1200

attgtcctct ccaaactgaa cccagagaat ctggaactcg aacaaacctg ggagacaaac 1260

atccgtaagc agtcagtcgc caatgccttc atcatctgtg gcaccttgta caccgtcagc 1320

agctacacct cagcagatgc taccgtcaac tttgcttatg acacaggcac aggtatcagc 1380

aagaccctga ccatcccatt caagaaccgc tataagtaca gcagcatgat tgactacaac 1440

cccctggaga agaagctctt tgcctgggac aacttgaaca tggtcactta tgacatcaag 1500

ctctccaaga tgtag 1515

<210> 5

<211> 19

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 5

ggccatgtca gtcatccat 19

<210> 6

<211> 7

<212> БЕЛОК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 6

Gln Ala Met Ser Val Ile His

1 5

<210> 7

<211> 23

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 7

aatagtgaag ccacagatgt att 23

<210> 8

<211> 259

<212> БЕЛОК

<213> Homo sapiens

<400> 8

Met Arg Leu Gly Leu Cys Val Val Val Leu Ser Trp Thr His Leu Thr

1 5 10 15

Ile Ser Ser Arg Gly Ile Lys Gly Lys Arg Gln Arg Arg Ile Ser Ala

20 25 30

Glu Gly Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu Cys Ser Glu Val

35 40 45

Asn Gly Cys Leu Lys Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg

50 55 60

Asn Asp Ile Arg Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly

65 70 75 80

Tyr Phe Asp Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys

85 90 95

Ile Glu His Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys

100 105 110

Lys Glu Gly Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly

115 120 125

Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser Pro Ala Gln Cys

130 135 140

Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser Lys Lys Gln Gln

145 150 155 160

Leu Cys Gly Phe Arg Arg Gly Ser Glu Glu Arg Thr Arg Arg Val Leu

165 170 175

His Ala Pro Val Gly Asp His Ala Ala Cys Ser Asp Thr Lys Glu Thr

180 185 190

Arg Arg Cys Thr Val Arg Arg Val Pro Cys Pro Glu Gly Gln Lys Arg

195 200 205

Arg Lys Gly Gly Gln Gly Arg Arg Glu Asn Ala Asn Arg Asn Leu Ala

210 215 220

Arg Lys Glu Ser Lys Glu Ala Gly Ala Gly Ser Arg Arg Arg Lys Gly

225 230 235 240

Gln Gln Gln Gln Gln Gln Gln Gly Thr Val Gly Pro Leu Thr Ser Ala

245 250 255

Gly Pro Ala

<210> 9

<211> 243

<212> БЕЛОК

<213> Homo sapiens

<400> 9

Met Gln Phe Arg Leu Phe Ser Phe Ala Leu Ile Ile Leu Asn Cys Met

1 5 10 15

Asp Tyr Ser His Cys Gln Gly Asn Arg Trp Arg Arg Ser Lys Arg Ala

20 25 30

Ser Tyr Val Ser Asn Pro Ile Cys Lys Gly Cys Leu Ser Cys Ser Lys

35 40 45

Asp Asn Gly Cys Ser Arg Cys Gln Gln Lys Leu Phe Phe Phe Leu Arg

50 55 60

Arg Glu Gly Met Arg Gln Tyr Gly Glu Cys Leu His Ser Cys Pro Ser

65 70 75 80

Gly Tyr Tyr Gly His Arg Ala Pro Asp Met Asn Arg Cys Ala Arg Cys

85 90 95

Arg Ile Glu Asn Cys Asp Ser Cys Phe Ser Lys Asp Phe Cys Thr Lys

100 105 110

Cys Lys Val Gly Phe Tyr Leu His Arg Gly Arg Cys Phe Asp Glu Cys

115 120 125

Pro Asp Gly Phe Ala Pro Leu Glu Glu Thr Met Glu Cys Val Glu Gly

130 135 140

Cys Glu Val Gly His Trp Ser Glu Trp Gly Thr Cys Ser Arg Asn Asn

145 150 155 160

Arg Thr Cys Gly Phe Lys Trp Gly Leu Glu Thr Arg Thr Arg Gln Ile

165 170 175

Val Lys Lys Pro Val Lys Asp Thr Ile Leu Cys Pro Thr Ile Ala Glu

180 185 190

Ser Arg Arg Cys Lys Met Thr Met Arg His Cys Pro Gly Gly Lys Arg

195 200 205

Thr Pro Lys Ala Lys Glu Lys Arg Asn Lys Lys Lys Lys Arg Lys Leu

210 215 220

Ile Glu Arg Ala Gln Glu Gln His Ser Val Phe Leu Ala Thr Asp Arg

225 230 235 240

Ala Asn Gln

<210> 10

<211> 234

<212> БЕЛОК

<213> Homo sapiens

<400> 10

Met Arg Ala Pro Leu Cys Leu Leu Leu Leu Val Ala His Ala Val Asp

1 5 10 15

Met Leu Ala Leu Asn Arg Arg Lys Lys Gln Val Gly Thr Gly Leu Gly

20 25 30

Gly Asn Cys Thr Gly Cys Ile Ile Cys Ser Glu Glu Asn Gly Cys Ser

35 40 45

Thr Cys Gln Gln Arg Leu Phe Leu Phe Ile Arg Arg Glu Gly Ile Arg

50 55 60

Gln Tyr Gly Lys Cys Leu His Asp Cys Pro Pro Gly Tyr Phe Gly Ile

65 70 75 80

Arg Gly Gln Glu Val Asn Arg Cys Lys Lys Cys Gly Ala Thr Cys Glu

85 90 95

Ser Cys Phe Ser Gln Asp Phe Cys Ile Arg Cys Lys Arg Gln Phe Tyr

100 105 110

Leu Tyr Lys Gly Lys Cys Leu Pro Thr Cys Pro Pro Gly Thr Leu Ala

115 120 125

His Gln Asn Thr Arg Glu Cys Gln Gly Glu Cys Glu Leu Gly Pro Trp

130 135 140

Gly Gly Trp Ser Pro Cys Thr His Asn Gly Lys Thr Cys Gly Ser Ala

145 150 155 160

Trp Gly Leu Glu Ser Arg Val Arg Glu Ala Gly Arg Ala Gly His Glu

165 170 175

Glu Ala Ala Thr Cys Gln Val Leu Ser Glu Ser Arg Lys Cys Pro Ile

180 185 190

Gln Arg Pro Cys Pro Gly Glu Arg Ser Pro Gly Gln Lys Lys Gly Arg

195 200 205

Lys Asp Arg Arg Pro Arg Lys Asp Arg Lys Leu Asp Arg Arg Leu Asp

210 215 220

Val Arg Pro Arg Gln Pro Gly Leu Gln Pro

225 230

<210> 11

<211> 131

<212> БЕЛОК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 11

Met Arg Leu Gly Leu Cys Val Val Val Leu Ser Trp Thr His Leu Thr

1 5 10 15

Ile Ser Ser Arg Gly Ile Lys Gly Lys Arg Gln Arg Arg Ile Ser Ala

20 25 30

Glu Gly Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu Cys Ser Glu Val

35 40 45

Asn Gly Cys Leu Lys Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg

50 55 60

Asn Asp Ile Arg Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly

65 70 75 80

Tyr Phe Asp Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys

85 90 95

Ile Glu His Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys

100 105 110

Lys Glu Gly Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly

115 120 125

Ser Ser Ala

130

<210> 12

<211> 202

<212> БЕЛОК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 12

Met Arg Leu Gly Leu Cys Val Val Val Leu Ser Trp Thr His Leu Thr

1 5 10 15

Ile Ser Ser Arg Gly Ile Lys Gly Lys Arg Gln Arg Arg Ile Ser Ala

20 25 30

Glu Gly Ser Gln Ala Cys Ala Lys Gly Cys Glu Leu Cys Ser Glu Val

35 40 45

Asn Gly Cys Leu Lys Cys Ser Pro Lys Leu Phe Ile Leu Leu Glu Arg

50 55 60

Asn Asp Ile Arg Gln Val Gly Val Cys Leu Pro Ser Cys Pro Pro Gly

65 70 75 80

Tyr Phe Asp Ala Arg Asn Pro Asp Met Asn Lys Cys Ile Lys Cys Lys

85 90 95

Ile Glu His Cys Glu Ala Cys Phe Ser His Asn Phe Cys Thr Lys Cys

100 105 110

Lys Glu Gly Leu His Lys Gly Arg Cys Tyr Pro Ala Cys Pro Glu Gly

115 120 125

Ser Ser Ala Ala Asn Gly Thr Met Glu Cys Ser Ser Pro Ala Gln Cys

130 135 140

Glu Met Ser Glu Trp Ser Pro Trp Gly Pro Cys Ser Lys Lys Gln Gln

145 150 155 160

Leu Cys Gly Phe Arg Arg Gly Ser Glu Glu Arg Thr Arg Arg Val Leu

165 170 175

His Ala Pro Val Gly Asp His Ala Ala Cys Ser Asp Thr Lys Glu Thr

180 185 190

Arg Arg Cys Thr Val Arg Arg Val Pro Cys

195 200

<210> 13

<211> 134

<212> БЕЛОК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 13

Met Gln Phe Arg Leu Phe Ser Phe Ala Leu Ile Ile Leu Asn Cys Met

1 5 10 15

Asp Tyr Ser His Cys Gln Gly Asn Arg Trp Arg Arg Ser Lys Arg Ala

20 25 30

Ser Tyr Val Ser Asn Pro Ile Cys Lys Gly Cys Leu Ser Cys Ser Lys

35 40 45

Asp Asn Gly Cys Ser Arg Cys Gln Gln Lys Leu Phe Phe Phe Leu Arg

50 55 60

Arg Glu Gly Met Arg Gln Tyr Gly Glu Cys Leu His Ser Cys Pro Ser

65 70 75 80

Gly Tyr Tyr Gly His Arg Ala Pro Asp Met Asn Arg Cys Ala Arg Cys

85 90 95

Arg Ile Glu Asn Cys Asp Ser Cys Phe Ser Lys Asp Phe Cys Thr Lys

100 105 110

Cys Lys Val Gly Phe Tyr Leu His Arg Gly Arg Cys Phe Asp Glu Cys

115 120 125

Pro Asp Gly Phe Ala Pro

130

<210> 14

<211> 203

<212> БЕЛОК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 14

Met Gln Phe Arg Leu Phe Ser Phe Ala Leu Ile Ile Leu Asn Cys Met

1 5 10 15

Asp Tyr Ser His Cys Gln Gly Asn Arg Trp Arg Arg Ser Lys Arg Ala

20 25 30

Ser Tyr Val Ser Asn Pro Ile Cys Lys Gly Cys Leu Ser Cys Ser Lys

35 40 45

Asp Asn Gly Cys Ser Arg Cys Gln Gln Lys Leu Phe Phe Phe Leu Arg

50 55 60

Arg Glu Gly Met Arg Gln Tyr Gly Glu Cys Leu His Ser Cys Pro Ser

65 70 75 80

Gly Tyr Tyr Gly His Arg Ala Pro Asp Met Asn Arg Cys Ala Arg Cys

85 90 95

Arg Ile Glu Asn Cys Asp Ser Cys Phe Ser Lys Asp Phe Cys Thr Lys

100 105 110

Cys Lys Val Gly Phe Tyr Leu His Arg Gly Arg Cys Phe Asp Glu Cys

115 120 125

Pro Asp Gly Phe Ala Pro Leu Glu Glu Thr Met Glu Cys Val Glu Gly

130 135 140

Cys Glu Val Gly His Trp Ser Glu Trp Gly Thr Cys Ser Arg Asn Asn

145 150 155 160

Arg Thr Cys Gly Phe Lys Trp Gly Leu Glu Thr Arg Thr Arg Gln Ile

165 170 175

Val Lys Lys Pro Val Lys Asp Thr Ile Leu Cys Pro Thr Ile Ala Glu

180 185 190

Ser Arg Arg Cys Lys Met Thr Met Arg His Cys

195 200

<210> 15

<211> 135

<212> БЕЛОК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 15

Met His Leu Arg Leu Ile Ser Trp Leu Phe Ile Ile Leu Asn Phe Met

1 5 10 15

Glu Tyr Ile Gly Ser Gln Asn Ala Ser Arg Gly Arg Arg Gln Arg Arg

20 25 30

Met His Pro Asn Val Ser Gln Gly Cys Gln Gly Gly Cys Ala Thr Cys

35 40 45

Ser Asp Tyr Asn Gly Cys Leu Ser Cys Lys Pro Arg Leu Phe Phe Ala

50 55 60

Leu Glu Arg Ile Gly Met Lys Gln Ile Gly Val Cys Leu Ser Ser Cys

65 70 75 80

Pro Ser Gly Tyr Tyr Gly Thr Arg Tyr Pro Asp Ile Asn Lys Cys Thr

85 90 95

Lys Cys Lys Ala Asp Cys Asp Thr Cys Phe Asn Lys Asn Phe Cys Thr

100 105 110

Lys Cys Lys Ser Gly Phe Tyr Leu His Leu Gly Lys Cys Leu Asp Asn

115 120 125

Cys Pro Glu Gly Leu Glu Ala

130 135

<210> 16

<211> 146

<212> БЕЛОК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 16

Met His Leu Arg Leu Ile Ser Trp Leu Phe Ile Ile Leu Asn Phe Met

1 5 10 15

Glu Tyr Ile Gly Ser Gln Asn Ala Ser Arg Gly Arg Arg Gln Arg Arg

20 25 30

Met His Pro Asn Val Ser Gln Gly Cys Gln Gly Gly Cys Ala Thr Cys

35 40 45

Ser Asp Tyr Asn Gly Cys Leu Ser Cys Lys Pro Arg Leu Phe Phe Ala

50 55 60

Leu Glu Arg Ile Gly Met Lys Gln Ile Gly Val Cys Leu Ser Ser Cys

65 70 75 80

Pro Ser Gly Tyr Tyr Gly Thr Arg Tyr Pro Asp Ile Asn Lys Cys Thr

85 90 95

Lys Cys Lys Ala Asp Cys Asp Thr Cys Phe Asn Lys Asn Phe Cys Thr

100 105 110

Lys Cys Lys Ser Gly Phe Tyr Leu His Leu Gly Lys Cys Leu Asp Asn

115 120 125

Cys Pro Glu Gly Leu Glu Ala Asn Asn His Thr Met Glu Cys Val Ser

130 135 140

Ile Val

145

<210> 17

<211> 206

<212> БЕЛОК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 17

Met His Leu Arg Leu Ile Ser Trp Leu Phe Ile Ile Leu Asn Phe Met

1 5 10 15

Glu Tyr Ile Gly Ser Gln Asn Ala Ser Arg Gly Arg Arg Gln Arg Arg

20 25 30

Met His Pro Asn Val Ser Gln Gly Cys Gln Gly Gly Cys Ala Thr Cys

35 40 45

Ser Asp Tyr Asn Gly Cys Leu Ser Cys Lys Pro Arg Leu Phe Phe Ala

50 55 60

Leu Glu Arg Ile Gly Met Lys Gln Ile Gly Val Cys Leu Ser Ser Cys

65 70 75 80

Pro Ser Gly Tyr Tyr Gly Thr Arg Tyr Pro Asp Ile Asn Lys Cys Thr

85 90 95

Lys Cys Lys Ala Asp Cys Asp Thr Cys Phe Asn Lys Asn Phe Cys Thr

100 105 110

Lys Cys Lys Ser Gly Phe Tyr Leu His Leu Gly Lys Cys Leu Asp Asn

115 120 125

Cys Pro Glu Gly Leu Glu Ala Asn Asn His Thr Met Glu Cys Val Ser

130 135 140

Ile Val His Cys Glu Val Ser Glu Trp Asn Pro Trp Ser Pro Cys Thr

145 150 155 160

Lys Lys Gly Lys Thr Cys Gly Phe Lys Arg Gly Thr Glu Thr Arg Val

165 170 175

Arg Glu Ile Ile Gln His Pro Ser Ala Lys Gly Asn Leu Cys Pro Pro

180 185 190

Thr Asn Glu Thr Arg Lys Cys Thr Val Gln Arg Lys Lys Cys

195 200 205

<210> 18

<211> 128

<212> БЕЛОК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 18

Met Arg Ala Pro Leu Cys Leu Leu Leu Leu Val Ala His Ala Val Asp

1 5 10 15

Met Leu Ala Leu Asn Arg Arg Lys Lys Gln Val Gly Thr Gly Leu Gly

20 25 30

Gly Asn Cys Thr Gly Cys Ile Ile Cys Ser Glu Glu Asn Gly Cys Ser

35 40 45

Thr Cys Gln Gln Arg Leu Phe Leu Phe Ile Arg Arg Glu Gly Ile Arg

50 55 60

Gln Tyr Gly Lys Cys Leu His Asp Cys Pro Pro Gly Tyr Phe Gly Ile

65 70 75 80

Arg Gly Gln Glu Val Asn Arg Cys Lys Lys Cys Gly Ala Thr Cys Glu

85 90 95

Ser Cys Phe Ser Gln Asp Phe Cys Ile Arg Cys Lys Arg Gln Phe Tyr

100 105 110

Leu Tyr Lys Gly Lys Cys Leu Pro Thr Cys Pro Pro Gly Thr Leu Ala

115 120 125

<210> 19

<211> 195

<212> БЕЛОК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 19

Met Arg Ala Pro Leu Cys Leu Leu Leu Leu Val Ala His Ala Val Asp

1 5 10 15

Met Leu Ala Leu Asn Arg Arg Lys Lys Gln Val Gly Thr Gly Leu Gly

20 25 30

Gly Asn Cys Thr Gly Cys Ile Ile Cys Ser Glu Glu Asn Gly Cys Ser

35 40 45

Thr Cys Gln Gln Arg Leu Phe Leu Phe Ile Arg Arg Glu Gly Ile Arg

50 55 60

Gln Tyr Gly Lys Cys Leu His Asp Cys Pro Pro Gly Tyr Phe Gly Ile

65 70 75 80

Arg Gly Gln Glu Val Asn Arg Cys Lys Lys Cys Gly Ala Thr Cys Glu

85 90 95

Ser Cys Phe Ser Gln Asp Phe Cys Ile Arg Cys Lys Arg Gln Phe Tyr

100 105 110

Leu Tyr Lys Gly Lys Cys Leu Pro Thr Cys Pro Pro Gly Thr Leu Ala

115 120 125

His Gln Asn Thr Arg Glu Cys Gln Gly Glu Cys Glu Leu Gly Pro Trp

130 135 140

Gly Gly Trp Ser Pro Cys Thr His Asn Gly Lys Thr Cys Gly Ser Ala

145 150 155 160

Trp Gly Leu Glu Ser Arg Val Arg Glu Ala Gly Arg Ala Gly His Glu

165 170 175

Glu Ala Ala Thr Cys Gln Val Leu Ser Glu Ser Arg Lys Cys Pro Ile

180 185 190

Gln Arg Pro

195

<210> 20

<211> 78

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 20

cactccctct ctgcgcgctc gctcgctcac tgaggccggg cgaccaaagg tcgcccacgc 60

ccgggctttg cccgggcg 78

<210> 21

<211> 31

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 21

accacggaca gttcctgtat tcttggggtg g 31

<210> 22

<211> 31

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 22

ccaccccaag aatacaggaa ctgtccgtgg t 31

<210> 23

<211> 29

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 23

tctgtggcac cttgcacacc gtcagcagc 29

<210> 24

<211> 29

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Синтетическая конструкция

<400> 24

gctgctgacg gtgtgcaagg tgccacaga 29

<---

1. Способ лечения миоцилиновой (MYOC) глаукомы у млекопитающего, включающий введение в глаз млекопитающего средства, которое усиливает передачу сигнала Wnt в глазу млекопитающего, где средство представляет собой частицу рекомбинантного аденоассоциированного вируса (rAAV), содержащую вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4, усеченный RSPO1, усеченный RSPO2, усеченный RSPO3 или усеченный RSPO4; и где усеченный RSPO1, усеченный RSPO2, усеченный RSPO3 или усеченный RSPO4 содержит один или более фуриноподобных доменов, богатых Cys, но не имеет одного или более из: сигнального пептида, домена тромбоспондина типа 1 и/или C-концевого положительно заряженного домена.

2. Способ лечения миоцилиновой (MYOC) глаукомы у млекопитающего, включающий введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4, и частицы rAAV, содержащей вектор, кодирующий средство для RNAi в отношении MYOC, которые целенаправленно воздействуют на экспрессию миоцилина у млекопитающего, причем средство для RNAi в отношении MYOC представляет собой малую ингибирующую РНК (siRNA), микроРНК (miRNA) или малую шпилечную РНК (shRNA).

3. Способ по п. 2, где:

(i) средство РНК-интерференции (RNAi) в отношении миоцилина (MYOC) нацелено на аминокислотную последовательность MYOC, представленную в SEQ ID NO: 6;

(ii) средство RNAi представляет собой малую шпилечную РНК (shRNA) для MYOC, содержащую последовательность петли SEQ ID NO: 7; и/или

(iii) средство RNAi в отношении MYOC функционально связано с гибридным промотором β-актина курицы (CBA) или промотором РНК-полимеразы III.

4. Способ по любому из пп. 1-3, где:

(i) миоцилиновая (MYOC) глаукома представляет собой первичную открытоугольную миоцилиновую (MYOC) глаукому (POAC);

(ii) глаукома представляет собой ювенильную форму первичной открытоугольной глаукомы; и/или

(iii) млекопитающее является человеком и глаукома MYOC связана с мутацией миоцилина человеческом, включающей одну или более аминокислотных замен, выбранных из E323K, K398R, Q368X, G364V, P370L, D380A, K423E, Y437H и I477S.

5. Способ по п. 1, где:

(i) млекопитающему вводят по меньшей мере 1×109 копий генома частицы rAAV;

(ii) частицы rAAV вводят путем интравитреальной инъекции и/или интракамеральной инъекции;

(iii) частицы rAAV вводят более чем в одно место глаза; и/или

(iv) частицы rAAV находится в составе фармацевтической композиции.

6. Способ по любому из пп. 2-4, где:

(i) млекопитающему вводят по меньшей мере 1×109 копий генома частицы rAAV, содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4;

(ii) млекопитающему вводят по меньшей мере 1×109 копий генома частицы rAAV, где частица rAAV содержит вектор, кодирующий средство для RNAi в отношении MYOC;

(ii) частицы rAAV вводят путем интравитреальной инъекции и/или интракамеральной инъекции;

(iii) частицы rAAV вводят более чем в одно место глаза; и/или

(iv) частицы rAAV находятся в составе фармацевтической композиции.

7. Способ по любому из пп. 1-6, где:

(i) RSPO1 представляет собой RSPO1 человека или RSPO1 имеет аминокислотную последовательность, которая имеет 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности с аминокислотной последовательностью RSPO1 человека, где RSPO1 необязательно содержит аминокислотную последовательность SEQ ID NO: 8, SEQ ID NO: 11 или SEQ ID NO: 12, или аминокислотную последовательность, которая имеет 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности с аминокислотной последовательностью SEQ ID NO: 8, SEQ ID NO: 11 или SEQ ID NO: 12;

(ii) RSPO2 представляет собой RSPO2 человека или RSPO2 имеет аминокислотную последовательность, которая имеет 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности с аминокислотной последовательности RSPO2 человека, где, необязательно, RSPO2 содержит аминокислотную последовательность SEQ ID NO: 9, SEQ ID NO: 13 или SEQ ID NO: 14, или аминокислотную последовательность, имеющую 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности с аминокислотной последовательностью SEQ ID NO: 9, SEQ ID NO: 13 или SEQ ID NO: 14;

(iii) RSPO3 представляет собой RSPO3 человека или RSPO3 имеет аминокислотную последовательность, которая имеет 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности с аминокислотной последовательностью RSPO3 человека, где, необязательно, RSPO3 содержит аминокислотную последовательность SEQ ID NO: 1, SEQ ID NO: 15, SEQ ID NO: 16 или SEQ ID NO: 17, или аминокислотную последовательность, имеющую 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности с аминокислотной последовательностью SEQ ID NO: 1, SEQ ID NO: 15, SEQ ID NO: 16 или SEQ ID NO: 17; или

(iv) RSPO4 представляет собой RSPO4 человека или RSPO4 имеет аминокислотную последовательность, которая имеет 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности с аминокислотной последовательностью RSPO4 человека, где, необязательно, RSPO4 содержит аминокислотную последовательность SEQ ID NO: 10, SEQ ID NO: 18 или SEQ ID NO: 19, или аминокислотную последовательность, имеющую 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности с аминокислотной последовательностью SEQ ID NO: 10, SEQ ID NO: 18 или SEQ ID NO 19.

8. Способ по п. 1 или 5, где:

(i) частица rAAV содержит капсид серотипов AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6 ShH10, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, бычьего AAV, козьего AAV или мышиного AAV или капсид серотипа AAV из клад A-F;

(ii) частица rAAV содержит мутантный капсид, содержащий тирозин, мутантный капсид с гепарин-связывающим мотивом, капсид AAV2R471A, капсид AAVAAV2/2-7m8, капсид AAV DJ, капсид AAV2 N587A, капсид AAV2 E548A, капсид AAV2 N708A, капсид AAV V708K, химерный капсид AAV1/AAV2 или капсид AAV2/HBoV1; и/или

(iii) частица rAAV содержит капсид AAV, содержащий аминокислотную замену в одном или нескольких положениях R484, R487, K527, K532, R585 или R588, нумерация которых приведена согласно VP1 AAV2.

9. Способ по любому из пп. 2-4 и 6, 7, где:

(i) частица rAAV, содержащая вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4, содержит капсид серотипов AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6 ShH10, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, бычьего AAV, козьего AAV или мышиного AAV, или капсид серотипа AAV из клад A-F;

(ii) частица rAAV, содержащая вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4, содержит мутантный капсид, содержащий тирозин, мутантный капсид с гепарин-связывающим мотивом, капсид AAV2R471A, капсид AAVAAV2/2-7m8, капсид AAV DJ, капсид AAV2 N587A, капсид AAV2 E548A, капсид AAV2 N708A, капсид AAV V708K, химерный капсид AAV1/AAV2 или капсид AAV2/HBoV1; и/или

(iii) частица rAAV, содержащая вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4, содержит капсид AAV, содержащий аминокислотную замену в одном или нескольких положениях R484, R487, K527, K532, R585 или R588, нумерация которых приведена согласно VP1 AAV2.

10. Способ по любому из пп. 2-4, 6, 7 и 9, где:

(i) частица rAAV, содержащая вектор, кодирующий средство для RNAi в отношении MYOC, содержит капсид серотипов AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6 ShH10, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, бычьего AAV, козьего AAV или мышиного AAV или капсид серотипа AAV из клад A-F;

(ii) частица rAAV, содержащая вектор, кодирующий средство для RNAi в отношении MYOC, содержит мутантный капсид, содержащий тирозин, мутантный капсид с гепарин-связывающим мотивом, капсид AAV2R471A, капсид AAVAAV2/2-7m8, капсид AAV DJ, капсид AAV2 N587A, капсид AAV2 E548A, капсид AAV2 N708A, капсид AAV V708K, химерный капсид AAV1/AAV2 или капсид AAV2/HBoV1; и/или

(iii) частица rAAV, содержащая вектор, кодирующий средство для RNAi в отношении MYOC, содержит капсид AAV, содержащий аминокислотную замену в одном или более положений R484, R487, K527, K532, R585 или R588, нумерация которых приведена согласно VP1 AAV2.

11. Способ по любому из пп. 1, 5 и 8, где:

(i) вектор содержит инвертированные концевые повторы (ITR) серотипов AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, козьего AAV, бычьего AAV или мышиного AAV; и/или

(ii) вектор содержит ITR AAV серотипа 2, где необязательно:

(а) частица rAAV содержит один или более ITR и капсид, полученный из одного и того же серотипа AAV; или

(b) частица rAAV содержит один или более ITR, полученных из серотипа AAV, отличного от такового для капсида частиц rAAV.

12. Способ по любому из пп. 2-4, 6, 7 и 9, 10, где:

(i) вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4, содержит инвертированные концевые повторы (ITR) серотипов AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, козьего AAV, бычьего AAV или мышиного AAV; и/или

(ii) вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4, содержит ITR AAV серотипа 2, где необязательно:

(a) частица rAAV, содержащая вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4, содержит один или более ITR и капсид, полученный из одного и того же серотипа AAV; или

(b) частица rAAV, содержащая вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4, содержит один или более ITR, полученных из серотипа AAV, отличного от такового для капсида частиц rAAV.

13. Способ по любому из пп. 2-4, 6, 7, 9, 10 и 12, где:

(i) вектор, кодирующий средство для RNAi в отношении MYOC, содержит инвертированные концевые повторы (ITR) серотипов AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, козьего AAV, бычьего AAV или мышиного AAV; и/или

(ii) вектор, кодирующий средство для RNAi в отношении MYOC, содержит ITR AAV серотипа 2, где необязательно:

(a) частица rAAV, содержащая вектор, кодирующий средство для RNAi в отношении MYOC, содержит один или более ITR и капсид, полученный из одного и того же серотипа AAV; или

(b) частица rAAV, содержащая вектор, кодирующий средство для RNAi в отношении MYOC, содержит один или более ITR, полученных из серотипа AAV, отличного от такового для капсида частиц rAAV.

14. Способ по п. 11, где частица rAAV содержит капсид AAV серотипа 2 и где необязательно:

(i) капсид AAV серотипа 2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2; и/или

(ii) вектор содержит ITR AAV2.

15. Способ по п. 12 или 13, где частица rAAV содержит капсид AAV серотипа 2 и где необязательно:

(i) капсид AAV серотипа 2 содержит капсидный белок AAV2, содержащий аминокислотную замену R471A, нумерация которой приведена согласно VP1 AAV2; и/или

(ii) вектор содержит ITR AAV2.

16. Рекомбинантная частица AAV для лечения миоцилиновой (MYOC) глаукомы у млекопитающего, содержащая вектор на основе AAV, где вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1, RSPO2, RSPO3 или RSPO4.

17. Рекомбинантная частица AAV для лечения миоцилиновой (MYOC) глаукомы у млекопитающего, содержащая вектор на основе AAV, где вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1, RSPO2, RSPO3 или RSPO4 и кодирующую ингибирующую нуклеиновую кислоту, которая целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего.

18. Набор для лечения миоцилиновой (MYOC) глаукомы у млекопитающего, содержащий вирусную частицу rAAV, которая содержит вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4.

19. Набор для лечения миоцилиновой (MYOC) глаукомы у млекопитающего, содержащий вирусную частицу rAAV, которая содержит вектор на основе AAV, где вектор на основе AAV содержит нуклеиновую кислоту, кодирующую RSPO1, RSPO2, RSPO3 или RSPO4 и кодирующую ингибирующую нуклеиновую кислоту, которая целенаправленно воздействует на экспрессию миоцилина (MYOC) у млекопитающего.

20. Набор по п. 19, где ингибирующая нуклеиновая кислота представляет собой средство для RNAi в отношении MYOC, причем средство для RNAi в отношении MYOC представляет собой siRNA, miRNA или shRNA.



 

Похожие патенты:

Изобретение относится к области медицины. Предложен способ предотвращения, ингибирования или лечения одного или нескольких симптомов мукополисахаридоза типа I (MPS I) у человека, включающий интратекальное введение нуждающемуся в этом человеку композиции, содержащей эффективное количество вектора на основе рекомбинантного аденоассоциированного вируса (rAAV), содержащего открытую рамку считывания, кодирующую альфа-L-идуронидазу, причем rAAV представляет собой rAAV9 или rAAVrh10.

Изобретение относится к биотехнологии. Описан вектор на основе аденоассоциированного вируса (AAV) для доставки субъекту гетерологичной последовательности нуклеиновой кислоты, содержащей капсидный белок VP1, который содержит одну или несколько замен лизина, где одна замена лизина представляет K137R.

Изобретение относится к области биотехнологии. Раскрывается заполняющий компонент аденоассоциированного вируса, состоящий из нуклеиновой кислоты длиной от 3300 до 4200 нуклеотидов.

Изобретение относится к области биотехнологии. Раскрывается заполняющий компонент аденоассоциированного вируса, состоящий из нуклеиновой кислоты длиной от 3300 до 4200 нуклеотидов.

Изобретение относится к биотехнологии. Раскрыты биотехнологические способы лечения болезни или доставки терапевтического средства млекопитающему.

Изобретения касаются двухцистронного вектора экспрессии, его применения для облегчения болезни Паркинсона, фармацевтической композиции и способа определения соотношения экспрессии полипептида GTP-циклогидроксилазы 1 и полипептида тирозингидрокислазы, экспрессируемых указанным двухцистронным вектором.

Изобретение относится к биотехнологии и медицине, а именно к белково-пептидному комплексу и фармакологической композиции для профилактики и лечения ретинальных заболеваний глаза человека и сельскохозяйственных животных.
Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для лечения рецидивирующей эрозии роговицы различного генеза. Для этого осуществляют установку мягкой контактной линзы (МКЛ) с первого дня лечения, с последующей заменой ее каждые 6-7 дней, инстилляцию пиклоксидина гидрохлорида 0,05%, вводят декспантенол 5% и Баларпан-Н 0,01% по 2 капли 4 раза в день каждого препарата, с интервалом 5-7 минут.

Заявленная группа изобретений относится к области медицины и фармацевтики и представляет собой применение композиции, содержащей более 90 мас.% норбиксина, полученного путем очистки из экстракта семян Bixa orellana, для фотозащиты клеток пигментного эпителия сетчатки (ПЭС) у млекопитающих путем введения этому млекопитающему указанной композиции в количестве от 0,48 мг/кг массы тела до 48 мг/кг массы тела в сутки, и композицию, содержащую более 95 мас.% норбиксина, полученного путем очистки из экстракта семян Bixa orellana, для использования с целью фотозащиты клеток пигментного эпителия сетчатки (ПЭС) у млекопитающих.

Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для лечения воспалительных или дистрофических заболеваний глаз. Для этого пациенту через 2-4 недели после проведения противовоспалительной или противодистрофической терапии вводят в пораженный глаз 0,6-0,8 мл аутологичного лизата тромбоцитов субконъюнктивально или 0,8-1,0 мл параэкваториально, курсом 4-6 инъекций, с интервалом в 48-72 часа.

Группа изобретений относится к области медицины, а именно к офтальмологии, и предназначена для лечения офтальмологических заболеваний путем субконъюнктивального инъекционного введения.
Изобретение относится к области медицины, а именно к офтальмологии, и может быть использовано при хирургическом лечении идиопатических макулярных разрывов сетчатки.

Предложенная группа изобретений относится к области медицины. Предложена фармацевтическая композиция для предотвращения и лечения вызванного неоваскуляризацией заболевания глаз, содержащая белок слияния, в котором проникающий в ткань пептид слит с анти-VEGF.

Группа изобретений относится к области медицины, а именно к офтальмологии, и предназначена для поддержания стабильности дибутилгидрокситолуола в жидком препарате.

Настоящая группа изобретений относится к лечению пигментной дистрофии сетчатки у человека. Способ лечения пигментной дистрофии сетчатки у млекопитающего, который включает введение млекопитающему терапевтически эффективного количества дозы N-ацетилцистеинамида (NACA), составляющей 100, 150, 300, 333, 400, 500, 600, 700, 750, 800, 900, 1000, 2500, 5000, 7500 или 10000 мг на дозу.

Изобретение относится к медицине, а именно к экспериментальной медицине и офтальмологии, и может быть использовано для лечения экспериментальных химических ожогов и катаракты, смоделированных на кроликах породы Шиншилла.

Изобретение относится к биотехнологии. Заявлена импортируемая в митохондрии гидовая РНК с субдоменами транспортной РНК лизина HD и HF.

Настоящее изобретение относится к биотехнологии. Предложена композиция, содержащая один или несколько вирусных векторов, кодирующих систему CRISPR/Cas, для применения в лечении заболевания или расстройства мозга.

Настоящее изобретение относится к медицине, а именно к способу изготовления средства для клеточно-опосредованной генной терапии. Способ изготовления средства для клеточно-опосредованной генной терапии из цельной крови с последовательным получением лейкотромбослоя из цельной крови и лейкоконцентрата из лейкотромбослоя, в который добавляют гидроксиэтилкрахмал в соотношении 1:1, полученную смесь лейкотромбослоя с гидроксиэтилкрахмалом центрифугируют с последующим получением надосадочной жидкости, содержащей плазму, гидроксиэтилкрахмал и лейкоциты, затем к надосадочной жидкости добавляют физиологический раствор, центрифугируют с получением лейкоконцентрата, в который добавляют рекомбинантный репликативно-дефектный вирусный вектор Ad5/35F, созданный на основе аденовируса человека 5 серотипа с модифицированным фибером и несущий рекомбинантный ген репортерного зеленого флуоресцирующего белка в соотношении лейкоцит:вирусный вектор - 1:5, доставляющий рекомбинантный генетический материал, в CD46 - позитивные лейкоциты.

Настоящее изобретение относится к статистическому полимеру, композиции для введения нуклеиновой кислоты в клетку, фармацевтической композиции, применению сополимера или композиции для доставки РНК в клетку, способу доставки РНК в клетку-мишень или ткань-мишень и способу получения сополимера.

Настоящее изобретение относится к области биотехнологии, конкретно к редактированию генов, и может быть использовано в медицине. Способ лечения дистрофического буллезного эпидермолиза включает доставку в кератиноциты пациента путем введения в эпидермис синтетической РНК, кодирующей редактирующий ген белок, который нацелен на ген COL7 и вызывает двухцепочечный разрыв в гене COL7, и доставку матрицы для репарации COL7 пациенту, для редактирования гена COL7.

Группа изобретений относится к области медицины, а именно к офтальмологии, и предназначена для лечения миоцилиновой глаукомы у млекопитающего. Способ лечения MYOC-глаукомы включает введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса, содержащего вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4, усеченный RSPO1, усеченный RSPO2, усеченный RSPO3 или усеченный RSPO4. Усеченный RSPO1, усеченный RSPO2, усеченный RSPO3 или усеченный RSPO4 содержит один или более фуриноподобных доменов, богатых Cys, но не имеет одного или более из: сигнального пептида, домена тромбоспондина типа 1 иили C-концевого положительно заряженного домена. Другая альтернатива способа лечения MYOC-глаукомы у млекопитающего заключается во введении в глаз млекопитающего частицы rAAV, содержащей вектор, кодирующий RSPO1, RSPO2, RSPO3 или RSPO4, и частицы rAAV, содержащей вектор, кодирующий средство для RNAi в отношении MYOC, причем средство для RNAi в отношении MYOC представляет собой малую ингибирующую РНК, микроРНК или малую шпилечную РНК. Также обеспечиваются указанные выше рекомбинантные частицы AAV и их содержащие наборы для лечения миоцилиновой глаукомы у млекопитающего. Использование группы изобретений позволяет усилить передачу сигналов Wnt в глазу млекопитающего, обеспечивая тем самым эффективное лечение миоцилиновой глаукомы у млекопитающего. 6 н. и 14 з.п. ф-лы, 15 ил., 6 пр.

Наверх