Композиция для предотвращения запаха, содержащая микроорганизмы без запаха

Настоящее изобретение относится к композиции для предотвращения запахов. Описана композиция для предотвращения запахов, содержащая микроорганизмы без запаха Caulobacter vibrioides HKMC-14 (учетный номер: KCCM 11685P), Bradyrhizobium diazoefficiens HKMC-15 (учетный номер: KCCM 11686P) и Bradyrhizobium daqingense HKMC-16 (учетный номер: KCCM 11687P) или раствор их культуры, а также применение композиции для предотвращения запахов в системе кондиционирования. Технический результат – предотвращение образования неприятного запаха. 7 н. и 6 з.п. ф-лы, 3 ил., 11 табл., 9 пр.

 

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

[0001] Настоящее раскрытие относится к композиции для предотвращения запахов, содержащей по меньшей мере один микроорганизм без запаха, выбираемый из группы, состоящей из Caulobacter vibrioides, Bradyrhizobium diazoefficiens, Bradyrhizobium daqingense и Methylobacterium brachiatum, или раствор их культуры, а также к способу предотвращения запахов, использующему эту композицию.

УРОВЕНЬ ТЕХНИКИ

[0002] Чистый воздух признается существенным для здоровья и хорошего самочувствия человека, и воздух, вызывающий неприятные запахи, или загрязненный воздух, является главным препятствием для приятной окружающей среды. Например, качество неудовлетворительного воздуха в закрытом помещении зависит от следующих двух важных факторов: одним является загрязнение воздуха в помещении, которое образуется непосредственно из материала (здания, транспортного средства и т.д.), окружающего среду (сооружение, транспортное средство и т.д.), а другим фактором является запах, который вызывается деятельностью человека или веществом, поступающим снаружи.

[0003] Системы кондиционирования воздуха являются системами, которые уменьшают температуру в помещении и оптимизируют внутреннюю среду для кондиционирования воздуха, включая кондиционирование температуры, влажности, воздушного потока и чистоты воздуха в зданиях, транспортных средствах, поездах, кораблях, воздушных судах и т.п. Эти системы кондиционирования воздуха становятся все более популярными с повышением уровня жизни. Однако, хотя распространенность систем кондиционирования воздуха привела к значительному развитию основных функций, многие проблемы окружающей среды в плане улучшения качества воздуха в помещении остаются нерешенными.

[0004] Хотя причиной появления запаха в системах кондиционирования воздуха, как известно, являются метаболиты грибков и бактерий, нет никаких конкретных данных относительно типов этих грибков и бактерий, а также количества метаболитов, выделяемых соответствующими микроорганизмами.

[0005] Благодаря структуре системы кондиционирования воздуха, весь воздух, проходящий через вентилятор, проходит через сердцевину испарителя. Когда теплообмен выполняется между хладагентом и воздухом, на поверхности сердцевины испарителя благодаря разности температур образуется конденсат. Непрерывная конденсация воды обеспечивает окружающую среду, выгодную для распространения грибков и бактерий. Когда грибки и бактерии распространяются в сердцевине испарителя, подвергаемую обдуву внешним воздухом, летучие органические соединения микроорганизмов (mVOC) образуются из метаболитов бактерий, осевших на поверхности сердцевины испарителя. Когда воздух, проходящий через сердцевину испарителя, выдувается в комнату, в ней после использования в течение долгого времени может появиться запах грибков и бактерий благодаря летучим органическим соединениям, производимым микроорганизмами.

[0006] Поверхность сердцевины испарителя, где выделяется запах, покрывается биопленкой по мере того, как система кондиционирования воздуха используется в течение длительного периода времени. Биопленки состоят из бактерий, клеточных кластеров и экзополимерных веществ (EPS). EPS содержат множество ингредиентов, включая белки, полисахариды, полиуроновые кислоты, нуклеиновые кислоты, липиды и т.п. На поверхности сердцевины испарителя множество бактерий и грибков размножаются, используя биопленки в качестве питательных веществ и выделяя органические соединения (mVOC) в качестве метаболитов. Испускаемый в это время органическими соединениями (mVOC) запах известен как прогорклый запах среди различных факторов неприятного запаха кондиционеров.

[0007] Хотя коммерчески доступны различные типы ароматизаторов для удаления неприятного запаха, они не могут существенно удалить грибки и бактерии, растущие в сердцевине испарителя, и служат просто для временного уменьшения неприятного запаха. В настоящее время коммерчески доступные бактерицидные агенты продаются благодаря только их бактерицидной активности против обычных болезнетворных организмов, даже при том, что они не были предназначены для борьбы с некоторыми грибками или бактериями.

[0008] Соответственно, корейская отложенная патентная заявка № 10-2012-0020309, поданная авторами настоящего изобретения, раскрывает способ производства сердцевины испарителя, включающий в себя покрытие поверхности сердцевины испарителя биопленкой, сделанной из некоторого не имеющего запаха или приятно пахнущего микроорганизма, для того, чтобы предотвратить отложение или размножение испускающих запах бактерий или грибков на поверхности сердцевины испарителя.

[0009] Однако это раскрытие не предполагает, какие именно бактерии являются микроорганизмами без запаха, и не в состоянии в достаточной степени продемонстрировать эффекты, относящиеся к тому, могут ли бактерии выжить на сердцевине испарителя, и может ли быть предотвращен рост микроорганизмов, вызывающих запахи, в частности неприятные запахи.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

ТЕХНИЧЕСКАЯ ПРОБЛЕМА

[0010] Авторы настоящего изобретения предпринимали попытки найти способы эффективного управления создающими запах микроорганизмами, используя микроорганизмы без запаха. В результате они успешно выделили четыре разновидности микроорганизмов, которые не производят запахов в системе кондиционирования воздуха и завершили настоящее изобретение на основе обнаружения того, что при формировании биопленки из этих микроорганизмов или их комбинации рост микроорганизмов, испускающих неприятный запах, может быть предотвращен, и в результате образование неприятного запаха может быть предотвращено.

[0011] Следовательно, настоящее изобретение было сделано с учетом вышеизложенных проблем, и одной задачей настоящего изобретения является предложить композицию для предотвращения запахов, содержащую по меньшей мере один микроорганизм без запаха, выбираемый из группы, состоящей из Caulobacter vibrioides, Bradyrhizobium diazoefficiens, Bradyrhizobium daqingense и Methylobacterium brachiatum, или раствор их культур.

[0012] Другой задачей настоящего изобретения является предложить сердцевину испарителя, покрытую этой композицией для предотвращения запахов.

[0013] Другой задачей настоящего изобретения является предложить способ производства сердцевины испарителя, не создающей запахов в кондиционере, включающий в себя покрытие сердцевины испарителя этой композицией для предотвращения запахов.

[0014] Другой задачей настоящего изобретения является предложить способ предотвращения запахов в кондиционере, включающий в себя покрытие сердцевины испарителя этой композицией для предотвращения запахов.

[0015] Другой задачей настоящего изобретения является предложить способ обнаружения запахов в кондиционере, включающий в себя покрытие сердцевины испарителя этой композицией для предотвращения запахов.

[0016] Другой задачей настоящего изобретения является предложить способ обеспечения микроорганизма без запаха для покрытия сердцевины испарителя для предотвращения запахов в кондиционере.

ТЕХНИЧЕСКОЕ РЕШЕНИЕ

[0017] В одном аспекте настоящее изобретение предлагает композицию для предотвращения запахов, содержащую микроорганизм без запаха или раствор его культуры.

[0018] Авторы настоящего изобретения предприняли попытки найти способы, способные эффективно управлять микроорганизмами, которые вызывают запахи, с использованием микроорганизмов, в частности для того, чтобы по существу удалить причину запахов, производимых системой кондиционирования воздуха. В результате они успешно выделили четыре разновидности микроорганизмов, которые не производят запахов в системе кондиционирования воздуха, и идентифицировали, что при формировании биопленки с использованием этих микроорганизмов или их комбинации рост микроорганизмов, испускающих запахи, может быть предотвращен, и в результате образование запахов может быть предотвращено.

[0019] Использующийся в настоящем документе термин «система кондиционирования воздуха» в целом относится к системе, которая может поддерживать приятную температуру, влажность, чистоту, поток и т.п. воздуха в области, которая целиком или частично изолирована от наружной окружающей среды. Предпочтительно, например, эта изолированная область может быть внутренней областью, которая целиком или частично изолирована от наружной окружающей среды, такой как внутренняя часть здания или внутренняя часть транспортного средства, поезда, судна, самолета и т.п. Предпочтительно система кондиционирования воздуха является, например, кондиционером.

[0020] Из-за структуры системы кондиционирования воздуха весь воздух, проходящий через вентилятор, проходит через сердцевину испарителя, и конденсат непрерывно конденсируется на поверхности сердцевины испарителя благодаря разности температур, обеспечивая окружающую среду, выгодную для роста микроорганизмов. После длительного времени формируется биопленка. В это время микроорганизмы метаболизируют различные внутренние и наружные материалы в качестве питательных веществ, присутствующих в воздухе, образуя запахи, происходящие от летучих органических соединений (mVOC), образующихся в результате этого метаболизма.

[0021] Биопленки являются формой микробных сообществ, в которой микроорганизмы существуют в виде кластеров, имеют структуру, в которой слой окружается одной мембраной, служащей для защиты микроорганизмов от внешней окружающей среды и обеспечения питательных веществ. Экзополимерные вещества (EPS) присутствуют в качестве ингредиента, составляющего пленку, и содержат множество ингредиентов, таких как белки, полисахариды, полиуроновые кислоты, нуклеиновые кислоты и липиды. На поверхности сердцевины испарителя различные микроорганизмы размножаются, потребляя питательные вещества, и испускают неприятные запахи от метаболитов.

[0022] Авторы настоящего изобретения изолировали микроорганизмы, которые не производят запахов, из сердцевины испарителя и, в результате культивирования этих микроорганизмов, выделили и культивировали доминирующие штаммы среди микроорганизмов, образующих колонии. Способ выделения и культивирования доминирующих штаммов может быть выполнен с использованием множества способов, известных специалисту в данной области техники. Например, доминирующие микроорганизмы могут быть отобраны посредством морфологических подходов, таких как степень разбавления, а также цвет, размер или форма колоний.

[0023] Доминирующий микроорганизм включает в себя Caulobacter, Bradyrhizobium или Methylobacterium, предпочтительно Caulobacter vibrioides, Bradyrhizobium diazoefficiens, Bradyrhizobium daqingense или Methylobacterium brachiatum.

[0024] Эти микроорганизмы были отправлены в Корейский центр культур микроорганизмов 17 апреля 2015 г. и им были даны следующие учетные номера: Caulobacter vibrioides HKMC-14 (учетный номер: KCCM 11685P), Bradyrhizobium diazoefficiens HKMC-15 (учетный номер: KCCM 11686P), Bradyrhizobium daqingense HKMC-16 (учетный номер: KCCM 11687P), и Methylobacterium brachiatum HKMC-17 (учетный номер: KCCM 11688P).

[0025] Эти микроорганизмы могут включаться в композицию для предотвращения запахов по отдельности или как их комбинация.

[0026] Композиция для предотвращения запахов в соответствии с настоящим изобретением может использоваться для предотвращения появления вызывающих запах микроорганизмов и/или для блокирования их запахов. Таким образом, композиция по настоящему изобретению может быть нанесена или разбрызгана на все или на некоторую часть создающих запах устройств (например, систем кондиционирования воздуха, систем утилизации сточных вод и т.п.), предметов (например мусорных ведер, туалетов и т.п.), животных (например загрязненный домашний скот и т.п.), или человеческое тело (например, в полость рта, на стопы при диабете и т.п.) для того, чтобы предотвратить быстрое размножение вызывающих запах микроорганизмов.

[0027] Композиция для предотвращения запахов по настоящему изобретению может дополнительно включать в себя множество ингредиентов культуральной среды, известных в данной области техники для улучшения способности к формированию биопленки в зависимости от покрываемого предмета. Среда, которая может включаться в композицию, является, например, агар-агаром, желатином, альгинатом, каррагинаном или пектином, и предпочтительно представляет собой среду PTYG, R2A или LB при нанесении на сердцевину испарителя в системе кондиционирования воздуха.

[0028] В дополнение к этому, композиция для предотвращения запахов в соответствии с настоящим изобретением может дополнительно включать в себя ароматизатор, дезинфицирующее средство или бактерицидную добавку в дополнение к микроорганизму без запаха для того, чтобы блокировать неприятные запахи или предотвратить появление или удалить вызывающие запах бактерии.

[0029] В одном предпочтительном варианте осуществления настоящего изобретения композиция по настоящему изобретению должна предотвращать образование запахов в системе кондиционирования воздуха.

[0030] Системы кондиционирования воздуха, которые могут использовать композицию по настоящему изобретению, включают в себя системы, которые могут быть установлены в зданиях, транспортных средствах, поездах, судах, самолетах и т.п., и могут использоваться для управления температурой, влажностью, воздушным потоком или чистотой воздуха.

[0031] Предмет, на который наносится биопленка по настоящему изобретению, является системой кондиционирования воздуха, и система кондиционирования воздуха включает в себя выносной элемент, вентилятор, сердцевину испарителя и т.п., и в частности предпочтительным предметом, на который наносится биопленка по настоящему изобретению, является сердцевина испарителя.

[0032] В частности, поверхность сердцевины испарителя в системе кондиционирования воздуха обеспечивает среду, которая является подходящей для роста и размножения бактерий благодаря конденсации воды в результате теплообмена с воздухом. После некоторого предопределенного времени присоединившиеся бактерии создают биопленку и выживают как устойчивые сообщества, которые очень трудно удалить. Таким образом, микроорганизмы без запаха могут быть предварительно размножены для того, чтобы предотвратить быстрое размножение плохо пахнущих микроорганизмов.

[0033] На основе этого свойства авторами настоящего изобретения было найдено, что при предварительном покрытии системы кондиционирования воздуха или сердцевины испарителя доминирующими штаммами или микроорганизмами без запаха с превосходной жизнеспособностью биопленка может быть сформирована в сердцевине испарителя только с сообществами микроорганизмов, и отложение и размножение вызывающих запах микроорганизмов может быть в значительной степени ингибировано (см. Примеры 8 и 9).

[0034] В то же время использующийся в настоящем документе термин «без запаха», используемый в таких терминах, как «микроорганизмы без запаха», означает такие условия, при которых субъект ничего не может почувствовать своим органом обоняния. Критерий отсутствия запаха также показан в методе испытаний на запах (Извещение № 2007-17, Национальный институт экологических исследований).

[0035] В другом аспекте настоящее изобретение предлагает сердцевину испарителя, покрытую этой композицией для предотвращения запахов, а также способ ее производства.

[0036] Ребро сердцевины испарителя делается из алюминия или алюминиевого сплава, и сердцевина испарителя производится с использованием антибактериально обработанного алюминия или не обработанного сплава. Материал для сердцевины испарителя не ограничивается алюминием или алюминиевым сплавом, и металл с превосходной теплопроводностью и коррозионной стойкостью, такой как медь, может использоваться в качестве материала в дополнение к алюминию, а также может использоваться для производства сплава. В электромобиле и т.п. теплообменник соединен с элементом Пельтье, и может использоваться любой материал, имеющий структуру, подобную или аналогичную структуре, облегчающей теплообмен.

[0037] Способ покрытия сердцевины испарителя композицией для предотвращения запахов, содержащей микроорганизмы без запаха или раствор их культуры, может быть выбран из известных в данной области техники способов (например, распыления, нанесения или погружения). Предпочтительно сердцевина испарителя погружается в раствор культуры микроорганизма без запаха для покрытия ребер в сердцевине испарителя, чтобы равномерно и полностью покрыть всю поверхность сердцевины испарителя. Это покрытие может быть выполнено по меньшей мере один раз.

[0038] Раствор культуры микроорганизма без запаха является предпочтительно раствором культуры микроорганизма, имеющим оптическую плотность (O.D.) от 0,3 до 0,9, более предпочтительно от 0,4 до 0,8.

[0039] Когда используется раствор культуры микроорганизма, имеющий O.D. от 0,3 до 0,9, концентрация микроорганизма в результате прилипания может составить от 104 КОЕ/г до 108 КОЕ/г, а когда используется раствор культуры микроорганизма, имеющий O.D. от 0,4 до 0,8, концентрация микроорганизма в результате прилипания может составить от 105 КОЕ/г до 107 КОЕ/г. При учете того факта, что концентрация микроорганизмов, присутствующих в сердцевине испарителя подержанного автомобиля, составляет приблизительно 106 КОЕ/г, с точки зрения применения транспортных средств наиболее предпочтительным является присоединять микроорганизмы с концентрацией от 105 КОЕ/г до 107 КОЕ/г с использованием раствора культуры микроорганизма, имеющего O.D. от 0,4 до 0,8.

[0040] Покрытие из микроорганизма без запаха, нанесенное описанным выше способом, было равномерно распределено и выращено на поверхности сердцевины испарителя и смогло сформировать на ней биопленку, устойчивую в течение длительного времени (30 дней или больше) (см. Пример 9).

[0041] В другом аспекте настоящее изобретение предлагает способ предотвращения запахов в кондиционере, включающий в себя покрытие сердцевины испарителя этой композицией для предотвращения запахов.

[0042] Соответственно, при формировании биопленки путем покрытия композицией для предотвращения запахов, содержащей микроорганизмы без запаха или их комбинацию в соответствии с настоящим изобретением, проникновение и рост внешних микроорганизмов, которые могут вызывать запахи, могут быть в значительной степени предотвращены, и запахи системы кондиционирования воздуха могут быть предотвращены эффективным образом.

[0043] В другом аспекте настоящее изобретение предлагает способ обнаружения запахов в кондиционере, включающий в себя покрытие сердцевины испарителя этой композицией для предотвращения запахов.

[0044] Будут ли микроорганизмы, включенные в композицию для предотвращения запахов, испускать запахи, может зависеть от ингредиентов питательных веществ, которыми эти микроорганизмы питаются и которые они метаболизируют. Может быть важным, чтобы запах не образовывался, хотя подается питательный источник фактической промышленности, на который нанесены микроорганизмы.

[0045] В случае системы кондиционирования воздуха микроорганизмы метаболизируют различные внутренние или наружные материалы, присутствующие в воздухе, в качестве питательных веществ, и внутренние или наружные загрязнители воздуха или ингредиенты выхлопа (например бензин, дизельное топливо или сжиженный нефтяной газ) становятся источниками питания для этих микроорганизмов. Испускает ли система кондиционирования воздуха запахи, может быть заранее обнаружено, когда эти питательные источники вводятся в сердцевину испарителя, покрытую микроорганизмами и применяемую в промышленности.

[0046] В другом аспекте настоящее изобретение предлагает в качестве микроорганизмов для покрытия сердцевины испарителя для предотвращения запахов в системе кондиционирования воздуха Caulobacter vibrioides HKMC-14 (учетный номер: KCCM 11685P), Bradyrhizobium diazoefficiens HKMC-15 (учетный номер: KCCM 11686P), Bradyrhizobium daqingense HKMC-16 (учетный номер: KCCM 11687P), и Methylobacterium brachiatum HKMC-17 (учетный номер: KCCM 11688P).

[0047] Эти микроорганизмы могут использоваться по отдельности или в комбинации для покрытия сердцевины испарителя, чтобы предотвратить образование запахов в системе кондиционирования воздуха.

ПОЛЕЗНЫЕ ЭФФЕКТЫ

[0048] Настоящее раскрытие предлагает композицию для предотвращения запахов, содержащую по меньшей мере один микроорганизм без запаха, выбираемый из группы, состоящей из Caulobacter vibrioides, Bradyrhizobium diazoefficiens, Bradyrhizobium daqingense и Methylobacterium brachiatum, или раствор их культуры. В дополнение к этому настоящее раскрытие предлагает сердцевину испарителя, покрытую этой композицией для предотвращения запахов, а также способ ее производства. Кроме того, настоящее раскрытие предлагает способ производства сердцевины испарителя без запаха, не создающей запахов в кондиционере, включающий покрытие сердцевины испарителя композицией для предотвращения запахов.

[0049] Кроме того, при формировании биопленки путем покрытия композицией для предотвращения запахов предмета, на котором могут быть выращены вызывающие запах микроорганизмы, проникновение и рост внешних микроорганизмов, которые могут вызывать запахи, могут быть в значительной степени предотвращены, и запахи могут быть предотвращены эффективным образом.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

[0050] Фиг. 1 показывает чашку Петри для посева микроорганизмов без запаха после стерилизации алюминиевых ребер и погружения в питательную среду;

[0051] Фиг. 2 показывает количество микроорганизмов в зависимости от цвета колонии для теста на 30-дневное выживание комбинации (Пример 9) выделенных из такси микроорганизмов; и

[0052] Фиг. 3 показывает доли штаммов, проанализированных с помощью REP-PCR для теста на 30-дневное выживание комбинации (Пример 9) выделенных из такси микроорганизмов.

НАИЛУЧШИЙ СПОСОБ РЕАЛИЗАЦИИ ИЗОБРЕТЕНИЯ

[0053] Далее настоящее изобретение будет описано более подробно со ссылками на примеры. Эти примеры приведены лишь для иллюстрации настоящего изобретения, и для специалиста в данной области техники будет очевидно, что область охвата настоящего изобретения не ограничивается этими примерами, зависящими от предмета настоящего изобретения.

[0054] Пример 1: Выбор пахнущих такси для перевозок на большие расстояния

[0055] Авторы настоящего изобретения получили пять пахнущих такси для перевозок на большие расстояния (см. Таблицу 1), выделили сердцевины испарителя, установленные на моделях А - E и взяли образцы этих сердцевин испарителя для испытания.

[0056] [Таблица 1]

Автомобиль для перевозок на большие расстояния Расстояние (км)
1 Модель A 753300
2 Модель B 760000
3 Модель C 770000
4 Модель D 857600
5 Модель E 482800

[0057] Пример 2: Взятие образцов сердцевины испарителя

[0058] Образцы сердцевины испарителя, взятые из пахнущих такси для перевозок на большие расстояния А - E, были запечатаны в полиэтиленовых мешках и перед их использованием хранились в холодильнике при 4°C. Для того, чтобы изолировать и культивировать микроорганизмы, образцы ребер массой 5 г были взяты из любых мест, включая переднюю и заднюю части, в соответствующих сердцевинах испарителя с использованием стерилизованных длинноносых плоскогубцев, а затем смешаны перед использованием.

[0059] Пример 3: Разделение микроорганизмов из сердцевины испарителя

[0060] Микроорганизмы были отделены от сердцевин испарителя в соответствии со следующим процессом и способом.

[0061] (1) Образцы для испытания, извлеченные из сердцевин испарителя, были смешаны и помещены в смеситель.

[0062] (2) Стерилизованный 1× забуференный фосфатом физиологический раствор (PBS) был помещен в смеситель объемом 200 мл.

[0063] (3) Смешанный образец для испытания перемешивался с PBS в течение 30 с.

[0064] (4) Смеситель был помещен на лед на одну минуту.

[0065] (5) Стадии (3) и (4) были повторены дважды.

[0066] (6) Суспензия центрифугировалась при 4°C и 13000 об/мин в течение 3 минут.

[0067] (7) Только надосадочная жидкость была собрана и помещена в новую пробирку.

[0068] (8) Стерилизованный помазок был пропитан надосадочной жидкостью, и поверхность сердцевины испарителя, из которой был взят образец, была очищена помазком несколько раз.

[0069] (9) Только головка очищенного помазка была погружена в надосадочную жидкость, и было выполнено интенсивное перемешивание.

[0070] (10) Осадок, полученный на стадии (6), был смешан со смесью, полученной на стадии (9), и результирующая смесь использовалась в качестве исходного раствора для посева.

[0071] После стадий (1) - (10) микроорганизмы были отделены путем физического отсоединения от сердцевин испарителей, установленных на моделях A - Е транспортных средств.

[0072] Пример 4: Разделение культур микроорганизмов

[0073] Разделение бактерий из кондиционера обычно производится путем выполнения разводки культуры в чашках Петри на аэробных гетеротрофных бактериях, которые называются обычными бактериями. Двумя комплексными питательными средами, обычно используемыми для разделения бактерий, являются агаровая среда PTYG и агаровая среда R2A. В случае агаровой среды PTYG, 0,25 г пептона (Difco), 0,25 г триптона (Difco), 0,5 г дрожжевого экстракта (Difco), 0,5 г глюкозы (Difco), 30 мг MgSO4 (Сигма), 3 мг CaCl2 (Сигма), и 15 г бактериального агар-агара (Difco) были добавлены к 980 мл дистиллированной воды, значение pH было доведено до 7,0, и полученная смесь была обработана в автоклаве при 121°C в течение 15 мин. В случае агаровой среды R2A, 0,5 г дрожжевого экстракта (Difco), 0,5 г пептона протеозы № 3 (Difco), 0,5 г казаминовых кислот (Difco), 0,5 г глюкозы (Difco), 0,5 г растворимого крахмала (Difco), 0,3 г пирувата натрия (Difco), 0,3 г сульфата калия (Difco), 0,05 г сульфата магния (Difco) и 15 г бактериального агар-агара (Difco) были добавлены к 980 мл дистиллированной воды, значение pH было доведено до 7,2, и полученная смесь была обработана в автоклаве при 121°C в течение 15 мин. Три вида антибиотиков использовались для изолирования недоминирующих обычных бактерий (Таблица 2), и антибиотики были посеяны в концентрации 100 частей на миллион, когда средняя температура достигла 50°C после стерилизации фильтра, для того, чтобы произвести антибиотические среды.

[0074] Таблица 2

Антибиотик Вид Производитель
1 Канамицин Аминогликозид Sigma
2 Ампициллин бета-лактам Sigma
3 Хлорамфеникол Хлорамфеникол Sigma

[0075] Пример 5: Отдельная культура доминирующих штаммов во всей среде, в которой культивируются микроорганизмы сердцевины испарителя

[0076] Для того, чтобы отдельно культивировать доминирующие штаммы, во-первых, различные доминирующие штаммы должны быть выбраны посредством морфологического подхода по степени разбавления, а также цвету, размеру и форме колоний и т.п. Соответственно, доминирующие штаммы отдельно культивировались в соответствии со следующим процессом.

[0077] (1) Бактерии были изолированы от отдельной культивированной среды.

[0078] (2) Множество бактерий, имеющих различную морфологию, были посеяны в сложном носителе с использованием цикла и выделены в чистом виде.

[0079] (3) Среда, которая выросла больше всех, выбиралась из засеянных сред, и проводилось пересеваемое культивирование.

[0080] Пример 6: Анализ генетических характеристик доминирующих бактерий сердцевины испарителя

[0081] Исследование пептидных карт посредством анализа рисунка REP-PCR

[0082] REP-PCR является молекулярно-биологическим способом анализа структуры бактериальных хромосом и представляет собой способ пептидных карт, который способен различать конкретные бактериальные штаммы от других бактерий. Генетические характеристики были проанализированы в соответствии с соответствующими процессами для выполнения REP-PCR.

[0083] (1) Процесс клеточного лизиса

[0084] (1) 2,5 мкл PCR реагента Lyse-N-Go (Thermo) было помещено в пробирку для PCR.

[0085] (2) Колонии были собраны пипеткой на чистом лабораторном столе, помещены в пробирку и пипетированы. Количество колоний должно определяться так, чтобы не сделать раствор немного мутным.

[0086] (3) Культивирование проводилось в установке PCR в соответствии с инструкциями изготовителя.

[0087] (4) Циклы программы лизиса, перечисленные в следующей Таблице 3, были повторены, и установка PCR поддерживалась при температуре 80°C во время циклов.

[0088] Таблица 3

Цикл Температура (°C) Время (с)
1 65 30
2 8 30
3 65 90
4 97 180
5 8 60
6 65 180
7 97 60
8 65 60
9 80 выдержка

[0089] (2) Реакция PCR

[0090] Подходящее количество ингредиентов, требуемых для реакции PCR, описанное в следующей Таблице 4, было смешано для того, чтобы подготовить реакционную смесь и, как показано в Таблице 5, выполнялись предварительная денатурация при 94°C в течение 7 мин, денатурация при 92°C в течение 1 мин, отжиг при 51,5°C в течение 1 мин и удлинение при 65°C в течение 8 мин, и процессы денатурации, отжига и удлинения были повторены 33 раза для того, чтобы выполнить PCR-амплификацию.

[0091] [Таблица 4]

(1) дНТФ (2,5 мМ для каждого) 12,5 мкл
(2) Буфер Гитшера 5,0 мкл
(3) Диметилсульфоксид (100%) 2,5 мкл
(4) Стерилизованная в автоклаве 3° дистиллированная вода 0,3 мкл
(5) Праймер BOXA1R (50 пмоль/мкл) 1,0 мкл
5'CTACGGCAAGGCGACGCTGACG
(6) BSA (l0 мг/мл) 0,4 мкл
(7) Бактериальная ДНК 2,5 мкл
(8) Полимераза Taq (Roche) (5 ед/мкл) 0,8 мкл

[0092] [Таблица 5]

Стадия 1 93°C 7 мин
Стадия 2 92°C 1 мин
Стадия 3 51,5°C 1 мин
Стадия 4 65°C 8 мин
стадии 2,3,4: дополнительные 33 цикла
Стадия 6 65°C 16 мин
Стадия 7 4°C

[0093] (3) Гелевый электрофорез

[0094] Фрагменты ДНК, амплифицированные с помощью PCR, были собраны, использовался агарозный гель с концентрацией 1,2-1,5%, дополненный EtBr, и смесь 6x красителя и образца в соотношении 1 к 5 была загружена в максимально возможном количестве. Поскольку большинство продуктов PCR имело от 100 до 1000 п.о., они были загружены с лесенкой в 100 п.о., и электрофорез выполнялся настолько медленно, насколько это возможно, так, чтобы середина (50 V) красителей бромфенол синего и ксиленцианола достигалась посередине всего геля. Штаммы, которые имели идентичные паттерны ДНК на геле, рассматривались как одинаковые.

[0095] (4) Идентификация доминирующих бактерий кондиционера посредством генетического анализа 16S рРНК

[0096] Гены 16S рРНК (рибосомной рибонуклеиновой кислоты) используются для идентификации генетических классов бактерий и могут быть идентифицированы на уровне рода и вида бактерий, классифицированных с помощью REP-PCR. 16S рРНК являются рибонуклеиновыми кислотами, которые взаимодействуют с различными белками, образуя рибосомы. Поскольку полные последовательности 16S рРНК или последовательности оснований списка олигонуклеотидов были найдены в 2000 или больше видов бактерий, бактерии могут быть классифицированы на несколько главных групп на основе генного подобия 16S рРНК. Степень подобия последовательности оснований 16S рРНК, как полагают, отражает филогенетическое расстояние между организмами, поскольку вариация последовательности оснований гена 16S рРНК намного меньше чем вариация последовательности оснований других генов, присутствующих в большинстве геномов. Способ, который анализирует последовательности оснований фрагментов гена 16S рРНК и идентифицирует микроорганизмы в зависимости от их подобия, использовался в качестве репрезентативного способа идентификации микроорганизмов, в частности полезных в промышленном отношении микроорганизмов, в дополнение к вышеупомянутому анализу жирной кислоты и анализу способности к ассимиляции углеводов.

[0097] <Полимеразная цепная реакция 16S рРНК>

[0098] Условия PCR (всего 50 мкл): ингредиенты для раствора за исключением ДНК и Taq были смешаны в предопределенном количестве, как показано в следующей Таблице 6, и полученная смесь была добавлена к 44,5 мкл раствора для лизиса. Затем, как показано в следующей Таблице 7, выполнялись предварительная денатурация при 94°C в течение 5 мин, денатурации при 94°C в течение 1 мин, отжиг при 55°C в течение 1 мин и удлинение при 72°C в течение 1 мин 30 с, и стадии денатурации, отжига и удлинения проводились 29 раз для того, чтобы выполнить PCR-амплификацию.

[0099] [Таблица 6]

Стерилизованная в автоклаве 3° дистиллированная вода 22 мкл
l0x буфер (Roche) 5 мкл
дНТФ (Roche 2,5 мМ) 5 мкл
Диметилсульфоксид 5 мкл
BSA (10 мг/мл) 2,5 мкл
27mf (20 пмоль/мкл) 2,5 мкл
1492r (20 пмоль/мкл) 2,5 мкл
ДНК 5 мкл
Taq (Roche) 0,5 мкл

[0100] [Таблица 7]

Стадия 1 94°C 5 мин
Стадия 2 94°C 1 мин
Стадия 3 55°C 1 мин
Стадия 4 72°C 1 мин 30 с
Переход к стадии 2: дополнительные 29 циклов
Стадия 6 72°C 10 мин
Стадия 7 4°C выдержка

[0101] (5) Очистка PCR

[0102] Продукты, амплифицированные с помощью PCR 16S-рРНК, были очищены с использованием комплекта очистки Qiaquick PCR в соответствии со следующим процессом.

[0103] (1) К продукту PCR был добавлен 5x объем буфера PB.

[0104] (2) Смешанный раствор был посеян на колонке QIAquick.

[0105] (3) Для связывания ДНК центрифугирование проводилось в течение одной минуты, и надосадочная жидкость была удалена.

[0106] (4) Для промывки 750 мкл буфера PE было помещено в колонку QIAquick, центрифугирование проводилось в течение одной минуты, и надосадочная жидкость была удалена.

[0107] (5) Центрифугирование снова проводилось в течение одной минуты.

[0108] (6) Содержимое колонки QIAquick было перенесено в новую пробирку.

[0109] (7) Для того, чтобы извлечь ДНК, 30 мкл буфера EB было добавлено в эту пробирку, и она была оставлена на одну минуту.

[0110] (8) Центрифугирование проводилось в течение одной минуты для того, чтобы позволить ДНК, растворенным в EB, собраться в пробирке.

[0111] (6) Названия и характеристики соответствующих изолированных микроорганизмов

[0112] <Микроорганизм 1>

[0113] 1. Название микроорганизма: HKMC-14

[0114] Родовое название: Caulobacter

[0115] Видовое название: Vibrioides

[0116] Учетный номер: KCCM 11685P (2015,04,17)

[0117] 2. Условия ремедиации

[0118] A. Агент ремедиации

[0119] (1) Композиция: среда PTYG (на 1 л, Пептон 0,25 г, Триптон 0,25 г, Дрожжевой экстракт 0,5 г, Глюкоза 0,5 г, MgSO4 30 мг, CaCl2 3 мг) или среда R2A.

[0120] (2) pH: 7,0

[0121] (3) Условия стерилизации: 121°C, 20 мин

[0122] B. Температура(°C): культивирование при 28°C в течение 7 дней

[0123] 3. Среда

[0124] (1) Композиция: среда PTYG (на 1 л, Пептон 0,25 г, Триптон 0,25 г, Дрожжевой экстракт 0,5 г, Глюкоза 0,5 г, MgSO4 30 мг, CaCl2 3 мг) или среда R2A.

[0125] (2) pH: 7,0

[0126] (3) Условия стерилизации: 121°C, 20 мин

[0127] 4. Условия культивирования

[0128] A. Аэробное или анаэробное: аэробное

[0129] B. Температура: 28°C

[0130] C. Возможны как встряхивание, так и отстаивание (жидкость, твердое)

[0131] 5. Условия хранения

[0132] Температура (°C): -70°C

[0133] <Микроорганизм 2>

[0134] 1. Название микроорганизма: HKMC-15

[0135] Родовое название: Bradyrhizobium

[0136] Видовое название: Diazoefficiens

[0137] Учетный номер: KCCM 11686P (2015,04,17)

[0138] 2. Условия ремедиации

[0139] A. Агент ремедиации

[0140] (1) Композиция: среда PTYG (на 1 л, Пептон 0,25 г, Триптон 0,25 г, Дрожжевой экстракт 0,5 г, Глюкоза 0,5 г, MgSO4 30 мг, CaCl2 3 мг) или среда R2A.

[0141] (2) pH: 7,0

[0142] (3) Условия стерилизации: при 121°C в течение 20 мин

[0143] B. Температура (°C): культивирование при 28°C в течение 7 дней

[0144] 3. Среда

[0145] (1) Композиция: среда PTYG (на 1 л, Пептон 0,25 г, Триптон 0,25 г, Дрожжевой экстракт 0,5 г, Глюкоза 0,5 г, MgSO4 30 мг, CaCl2 3 мг) или среда R2A.

[0146] (2) pH: 7,0

[0147] (3) Условия стерилизации: 121°C, 20 мин

[0148] 4. Условия культивирования

[0149] A. Аэробное или анаэробное: аэробное

[0150] B. Температура: 28°C

[0151] C. Возможны как встряхивание, так и отстаивание (жидкость, твердое)

[0152] 5. Условия хранения

[0153] Температура (°C): -70°C

[0154] <Микроорганизм 3>

[0155] 1. Название микроорганизма: HKMC-16

[0156] Родовое название: Bradyrhizobium

[0157] Видовое название: Daqingense

[0158] Учетный номер: KCCM 11687P (2015,04,17)

[0159] 2. Условия ремедиации

[0160] A. Агент ремедиации

[0161] (1) Композиция: среда PTYG (на 1 л, Пептон 0,25 г, Триптон 0,25 г, Дрожжевой экстракт 0,5 г, Глюкоза 0,5 г, MgSO4 30 мг, CaCl2 3 мг) или среда R2A.

[0162] (2) pH: 7,0

[0163] (3) Условия стерилизации: 121°C, 20 мин

[0164] B. Температура(°C): культивирование при 28°C в течение 7 дней

[0165] 3. Среда

[0166] (1) Композиция: среда PTYG (на 1 л, Пептон 0,25 г, Триптон 0,25 г, Дрожжевой экстракт 0,5 г, Глюкоза 0,5 г, MgSO4 30 мг, CaCl2 3 мг) или среда R2A.

[0167] (2) pH: 7,0

[0168] (3) Условия стерилизации: 121°C, 20 мин

[0169] 4. Условия культивирования

[0170] A. Аэробное или анаэробное: аэробное

[0171] B. Температура: 28°C

[0172] C. Возможны как встряхивание, так и отстаивание (жидкость, твердое)

[0173] 5. Условия хранения

[0174] Температура (°C): -70°C

[0175] <Микроорганизм 4>

[0176] 1. Название микроорганизма: HKMC-17

[0177] Родовое название: Methylobacterium

[0178] Видовое название: Brachiatum

[0179] Учетный номер: KCCM 11688P (2015,04,17)

[0180] 2. Условия ремедиации

[0181] A. Агент ремедиации

[0182] (1) Композиция: среда PTYG (на 1 л, Пептон 0,25 г, Триптон 0,25 г, Дрожжевой экстракт 0,5 г, Глюкоза 0,5 г, MgSO4 30 мг, CaCl2 3 мг) или среда R2A.

[0183] (2) pH: 7,0

[0184] (3) Условия стерилизации: 121°C, 20 мин

[0185] В. Температура (°C): 28°C в течение 7 дней

[0186] 3. Среда

[0187] (1) Композиция: среда PTYG (на 1 л, Пептон 0,25 г, Триптон 0,25 г, Дрожжевой экстракт 0,5 г, Глюкоза 0,5 г, MgSO4 30 мг, CaCl2 3 мг) или среда R2A.

[0188] (2) pH: 7,0

[0189] (3) Условия стерилизации: 121°C, 20 мин

[0190] 4. Условия культивирования

[0191] A. Аэробное или анаэробное: аэробное

[0192] B. Температура: 28°C

[0193] C. Возможны как встряхивание, так и отстаивание (жидкость, твердое)

[0194] 5. Условия хранения

[0195] Температура (°C): -70°C

[0196] Пример 7: Сенсорная оценка микроорганизмов, изолированных из алюминиевого ребра

[0197] (1) Культура в питательной среде

[0198] Для сенсорной оценки 26 видов микроорганизмов, идентифицированных в Примере 6, микроорганизмы культивировались при 28°C в питательной среде, из которой микроорганизмы изолировались в течение 7 дней. Процесс культивирования бактерий в питательной среде выполнялся следующим образом.

[0199] (1) Чистые отдельно культивированные микроорганизмы были посеяны в жидкой питательной среде.

[0200] (2) Засеянная среда культивировалась при 28°C в течение 5-7 дней.

[0201] (3) 100 мкл бактерий, культивированных в жидкой среде, было посеяно в твердой питательной среде.

[0202] (4) Посеянные бактерии были равномерно распределены с использованием шпателя.

[0203] (5) Чашка Петри была запечатана и культивировалась при 28°C в течение 10 дней.

[0204] (2) Сенсорная оценка в алюминиевом ребре 26 разновидностей доминирующих микроорганизмов, выделенных из такси для перевозок на большие расстояния

[0205] Прямоугольное алюминиевое ребро стерилизовалось и погружалось в пыль и питательные среды. Затем на него высевались бактерии и культивировались в этой питательной среде при условиях, описанных в пунктах (2) - (4), и оценивались. Результаты сенсорной оценки показаны в следующей Таблице 8 (первичная) и Таблице 9 (вторичная). Первичная и вторичная сенсорная оценка проводились в зависимости от разности в темпе роста микроорганизмов.

[0206] Обработанное антибактериальным препаратом алюминиевое ребро: алюминий, который является главным ингредиентом сердцевины испарителя, был покрыт антибактериальным покрытием. Покрытие наносилось на сердцевину коммерчески доступного испарителя серийного производства.

[0207] [Таблица 8]

Видовое название Панель 1 Интенсивность запаха Панель 2 Интенсивность запаха Панель 3 Интенсивность запаха Выбор микроорганизма без запаха
Контроль Алюминиевое ребро Без запаха 0 Без запаха 0 Без запаха 0
1 Chryseobacterium geocarposphaerae Соленый запах 3,5 Соленый запах 3 Соленый запах, зловоние 2,9 X
2 Spirosoma panaciterrae Соленый запах 2 Водный запах 1 Металлический (железный) запах 2 X
3 Spirosoma linguale Соленый запах 3 Капустный, соленый запах 2,5 Зловоние, соленый запах 3,5 X
4 Sphingomonas asaccharolytica Рыбный запах 1 Водный запах 1 Соленый запах, зловоние 2,3 X
5 Bradyrhizobium diazoefficiens Рыбный запах 1,5 Без запаха 0,5 Без запаха 0 O
6 Methylobacterium brachiatum Без запаха 0 Слабый соленый запах 1,5 Металлический (железный) запах 1,2 O
7 Methylobacterium longum Кислый запах 0,5 Соленый запах, рыбный запах 2,5 Спирт, зловоние 3,2 X
8 Bradyrhizobium daqingense Без запаха 0 Водный запах 1 Металлический (железный) запах 1 O
9 Radyrhizobium liaoningense Пластмасса 1,5 Запах почвы 1,5 Металлический (железный) запах 1,3 X
10 Methylobacterium radiotolerans Зловоние мочи 2 Аромат уксуса 2 Приятный запах 1 X
11 Methylobacterium variabile Химический запах 2 Соленый запах, рыбный запах 2 Запах курятника 1,5 X
12 Caulobacter vibrioides Без запаха 1 Без запаха 0 Без запаха 0 0

[0208] [Таблица 9]

Видовое название Панель 1 Интенсивность запаха Панель 2 Интенсивность запаха Панель 3 Интенсивность запаха Панель 4 Интенсивность запаха Выбор микроорганизма без запаха
Контроль Алюминиевое ребро Без запаха 0 Без запаха 0 Без запаха 0 Без запаха 0
1 Sphingomonas glacialis Без запаха 1 Без запаха 0 Без запаха 0 Без запаха 0 O
2 Phingomo nasaquatilis Неприятный запах 2,5 Запах куриного помета 1,5 Пыль 1 Куриный запах, соленый запах 0,5 X
3 Sphingomonas mucosissima Куриный запах 2 Запах яйца 1,8 Рыбный запах 1,5 Запах куриных перьев 0,6 X
4 Methylobacterium tarhaniae Куриный запах 2,3 Химический запах 2,5 Рыбный запах 2,5 Запах куриных перьев 0,6 X
5 Sphingomonas melonis Куриный запах 2,1 Химический запах 2 Водный запах, рыбный запах 2 Куриный запах 0,8 X
6 Acidovorax avenae Без запаха 0,3 Запах мусорного ведра 1,5 Почти нет 0,5 Среднегорький запах 1,2 X
7 Acidovorax oryzae Присутствие начального запаха 2 Запах яйца 2 Соленый запах 1 Запах гусиных перьев 1,3 X
8 Sphingomonas ginsenosidi mutans Куриный запах 2,6 Запах пластмассы 2,5 Рыбный запах, запах старых книг 2,5 Зловоние 1,5 X
9 Sphingomo nas dokdonensi Среда 2,3 Рыбный запах 1,5 Рыбный запах 1,5 Зловоние мочи 1,8 X
10 Pelomonas puraquae Фекальный запах 3 Зловоние мочи 2 Запах протухшей еды 3,2 Зловоние мочи 2,2 X
11 Methylobacterium platani Неприятный острый запах 2,5 Кислый запах старой пластмассы 2,5 Кислый фабричный запах 2,8 Кислый запах 2,5 X
12 Methylobacterium tardum Фекальный запах 2,5 Зловоние мочи 3 Рыбный запах, водный запах 3 Кислый запах 3 X
13 Spirosoma radiotolerans Средний
запах куриного помета
3 Зловоние мочи, кислотный запах 3 Рыбный запах, запах влажного полотенца 3,5 Зловоние мочи 3,2 X
14 Fibrella aestuarina Фекальный запах 3,5 Зловоние мочи, кислый запах 4 Запах туалета 4 Кислый запах, зловоние мочи 4 X

[0209] В результате посева и культивирования 26 разновидностей микроорганизмов в алюминиевом антибактериальном ребре следующие четыре вида микроорганизмов не имели запаха.

[0210] [Таблица 10]

Антибактериальное ребро Родовое название
1 Без запаха Bradyrhizobium diazoefficiens
2 Без запаха Methylobacterium brachiatum
3 Без запаха Bradyrhizobium daqingense
4 Без запаха Caulobacter vibrioides

[0211] Используемый в настоящем документе термин «без запаха» означает такие условия, при которых субъект не может почувствовать своим органом обоняния.

[0212] Что касается оценки запахов, сенсорная оценка проводилась с использованием органа обоняния в соответствии с текущими условиями. Других способов оценки запаха, которые исключали бы обонятельную оценку, не существует во всем мире. Как можно увидеть из вышеупомянутого примера, критерий «без запаха» определяется в зависимости от субъективного критерия и зависит от человека, производящего сенсорную оценку с помощью своего органа обоняния.

[0213] Критерий определения отсутствия запаха показан в методе испытаний на запах (Извещение № 2007-17, Национальный институт экологических исследований). На странице 65 этого метода испытаний говорится, что термин «без запаха» означает такое состояние, при котором предмет не может ничего обнаружить своим органом обоняния.

[0214] Кроме того, как описано на страницах 65 и 66 этого метода испытаний, также определяющих критерий выбора людей, которые могут оценивать запах, критерий определения считается более ясным.

[0215] В дополнение к этому можно заметить, что «без запаха» пишется в части, соответствующей оценке «0» в таблице оценок на странице 2 Главы 2, а также в Статье 4 Регулирующих стандартов.

[0216] По сути критерий «без запаха» в сенсорной оценке означает состояние, при котором субъект, выбранный по предопределенному критерию, не может ничего унюхать, как ясно определяется в корейских и японских нормативных документах.

[0217] Пример 8: Оценка оптимальных условий адгезии микроорганизмов без запаха

[0218] (1) Анализ оптимальной концентрации адгезии к ребру микроорганизмов без запаха

[0219] Для того, чтобы покрыть сердцевину испарителя 11 разновидностями микроорганизмов без запаха, была определена оптимальная для адгезии концентрация посева на уровне 6 КОЕ/г, как показано в результатах исследования 2012 г. (приоритетная заявка). Тест определения концентрации проводился с использованием Methylobacterium aquaticum, которая является одним из обычных штаммов. Methylobacterium aquaticum культивировалась при 28°C до поздней фазы логарифмического роста, промывалась стерилизованным физиологическим раствором с концентрацией 0,85%, а затем культивировалась при 4°C в течение 18 час. После культивирования при 4°C оптическая плотность (О. D.) была доведена до 0,749, 0,588, 0,55, 0,5 и 0,45, и 2 г подковообразного ребра было опущено в этот раствор для покрытия и встряхивалось при комнатной температуре и с предопределенной скоростью (об/мин) в течение одного часа. Ребро, к которому прилипла каждая концентрация микроорганизма, было отделено с использованием мешалки и распределено на агаровой пластинке R2A с помощью последовательного разведения.

[0220] В результате распределения можно было заметить, что концентрация микроорганизмов, прилипших к ребру, изменяется в зависимости от значения O.D. При значении O.D. 0,749 уровень микроорганизмов, прилипших к ребру, составил 1,53×108 ± 1,52×107 КОЕ/г ребра, а при значениях O.D. 0,588 и 0,55 уровни микроорганизмов, прилипших к ребру, составили 4,00×107 ± 1,00×107 КОЕ/г ребра и 1,03×107 ± 8,50×105 КОЕ/г ребра, соответственно. В дополнение к этому, при значениях O.D. 0,5 и 0,45 уровни микроорганизмов, прилипших к ребру, составили 6,00×106 ± 7,00×105 КОЕ/г ребра, и 2,53×106 ± 3,51×105 КОЕ/г ребра, соответственно, что указывает на то, что степень адгезии пропорциональна значению O.D. Из этих концентраций адгезии десять различных разновидностей микроорганизмов без запаха были нанесены с оптической плотностью 0,5, которая является значением O.D., которое позволяет покрытию с 106 КОЕ/г микроорганизмов существовать в сердцевине испарителя, из которого эти микроорганизмы были выделены.

[0221] (2) Подтверждение адгезии микроорганизмов без запаха к сердцевине испарителя и ребру

[0222] В результате испытания на адгезию к ребру, независимо от рода, 11 видов микроорганизмов без запаха показали идентичную степень адгезии при предопределенном значении O.D. Соответственно, количество микроорганизмов, прилипших к сердцевине испарителя, было проверено с использованием раствора культуры, имеющего то же самое значение O.D., что и ребро, покрытое бактериями Methylobacterium aquaticum, которые являются одним штаммом.

[0223] Количество Methylobacterium aquaticum, прилипших к сердцевине испарителя при значении O.D. 0,5, составило 8,95×106 ± 5,51×105 КОЕ/г ребра. Сердцевина испарителя, покрытая с использованием того же самого раствора культуры, показала степень адгезии 2,55×106 ± 3,51×105 КОЕ/г ребра. Этот результат показывает, что тот же самый уровень микроорганизмов прилипал при использовании раствора культуры, имеющего ту же самую O.D.

[0224] Пример 9: Оценка 30-дневного выживания четырех комбинаций

[0225] Оценка выживания в течение 30 дней проводилась на следующих комбинациях. Номер комбинации микроорганизмов, использованных для покрытия, и список ее микроорганизмов будут даны ниже (см. Таблицу 11).

[0226] [Таблица 11]

Комбинация
1 Methylobacterium aquaticum PR1016A
2 Caulobacter vibrioides TX0632
3 Methylobacterium brachiatum TX0642
4 Bradyrhizobium diazoefficiens TX0618

[0227] Для того, чтобы оценить 30-дневные краткосрочные эффекты комбинаций микроорганизмов без запаха, выделенных из такси, были организованы эти комбинации, и 30-дневная краткосрочная оценка была проведена на этих комбинациях.

[0228] Комбинация, состоящая из четырех штаммов Methylobacterium aquaticum PR1016A, Caulobacter vibrioides TX0632, Methylobacterium brachiatum TX0642 и Bradyrhizobium diazoefficien sTX0618, была обнаружена в момент времени 0 с общим уровнем 3,99×106 ± 2,82×106 КОЕ/г ребра, и красные и белые колонии были обнаружены при уровнях 3,62×106 ± 2,79×106 КОЕ/г ребра и 3,67×105 ± 3,06×104 КОЕ/г ребра, соответственно. После 30 дней белая колония не была обнаружена, а красная колония была обнаружена на уровне 2,14×106 ± 1,25×105 КОЕ/г ребра, что было равно полному количеству бактерий (см. Фиг. 2).

[0229] В результате подсчета количества микроорганизмов с помощью REP-PCR, в случае комбинации в момент времени 0 было обнаружено, что из 111 репрезентативных образцов 43 образца представляли собой Methylobacterium aquaticum PR1016A, 6 образцов представляли собой Caulobacter vibrioides TX0632, 52 образца представляли собой Methylobacterium brachiatum TX0642, и 10 образцов представляли собой Bradyrhizobium diazoefficiens TX0618. Эти результаты показали, что две разновидности Methylobacterium sp. 2 заняли 85,6% всей комбинации (см. Фиг. 3).

[0230] После 30 дней результаты анализа с помощью REP-PCR показали, что из 89 репрезентативных образцов выжило 26 образцов Methylobacterium aquaticum PR1016A и 63 образца Methylobacterium brachiatum TX0642, что означает, что Methylobacterium sp. была доминирующей в условиях среды сердцевины испарителя, независимо от течения времени.

[0231] В дополнение к этому, рост внешних микроорганизмов не наблюдался.

[0232] В заключение, для оценки 30-дневных краткосрочных эффектов комбинаций микроорганизмов без запаха, выделенных из такси, были организованы комбинации, и было обнаружено, что Methylobacterium aquaticum PR1016A и Methylobacterium brachiatum TX0642 выжили после 30 дней. Биопленки, сделанные из этих двух разновидностей, оставались непахучими и ингибировали рост внешних микроорганизмов.

[0233] Хотя предпочтительные варианты осуществления настоящего изобретения были раскрыты для иллюстративных целей, специалисту в данной области техники будет понятно, что различные модификации, добавления и подстановки могут быть сделаны без отступлений от области охвата и духа настоящего изобретения, раскрытых в прилагаемой формуле изобретения.

1. Композиция для предотвращения запахов, содержащая микроорганизмы без запаха Caulobacter vibrioides HKMC-14 (учетный номер: KCCM 11685P), Bradyrhizobium diazoefficiens HKMC-15 (учетный номер: KCCM 11686P) и Bradyrhizobium daqingense HKMC-16 (учетный номер: KCCM 11687P) или раствор их культуры.

2. Композиция по п. 1, которая используется для предотвращения запахов в системе кондиционирования воздуха.

3. Применение композиции для предотвращения запахов по п. 1 для обработки сердцевины испарителя.

4. Применение по п. 3, в котором микроорганизмы по п. 1 прилипают к сердцевине испарителя в концентрации от 104 КОЕ/г до 108 КОЕ/г.

5. Применение по п. 4, в котором прилипание микроорганизма выполняется с использованием раствора культуры микроорганизма, имеющего оптическую плотность (O.D.) от 0,3 до 0,9.

6. Применение по п. 3, в котором микроорганизм в композиции формирует биопленку на поверхности сердцевины испарителя.

7. Способ производства сердцевины испарителя без запаха, содержащий покрытие сердцевины испарителя композицией по п. 1, где покрытие содержит прилипание микроорганизмов, включенных в композицию в концентрации от 104 КОЕ/г до 108 КОЕ/г, к сердцевине испарителя.

8. Способ по п. 7, дополнительно содержащий размножение микроорганизмов в композиции покрытия для формирования биопленки.

9. Способ предотвращения запахов в системе кондиционирования воздуха, содержащий покрытие сердцевины испарителя композицией по п. 1, где покрытие содержит прилипание микроорганизмов, включенных в композицию в концентрации от 104 КОЕ/г до 108 КОЕ/г, к сердцевине испарителя.

10. Способ по п. 9, дополнительно содержащий размножение микроорганизмов в композиции покрытия для формирования биопленки.

11. Caulobacter vibrioides HKMC-14 (учетный номер: KCCM 11685P).

12. Bradyrhizobium diazoefficiens HKMC-15 (учетный номер: KCCM 11686P).

13. Bradyrhizobium daqingense HKMC-16 (учетный номер: KCCM 11687P).



 

Похожие патенты:

Изобретение относится к биотехнологии, пищевой промышленности и медицине и может быть использовано при производстве биологически активных добавок и пищевых продуктов.

Изобретение относится к животноводству, в частности к белковой кормовой добавке для сельскохозяйственных животных, птицы и культивируемых рыб. Способ характеризуется тем, что она содержит штамм метанокисляющих бактерий Methylococcus capsulatus ГБС-15 ВКПМ В-12549 и штамм гетеротрофных бактерий Cupriavidus gilardii GBS-15-1 при определенном соотношении.
Изобретение относится к медицинской микробиологии. Предложен способ выделения чистой культуры возбудителя пастереллеза Pasteurella multocida.

Изобретение относится к способу выделения золота и/или серебра из минеральной руды с применением бактерии для выделения указанных металлов. Выделяют золото и/или серебро, присутствующие в суспензии, содержащей частицы минеральной руды, содержащей металл.
Группа изобретений относится к микроорганизму рода Corynebacterium, продуцирующему L-аргинин, и к способу получения L-аргинина с использованием этого микроорганизма. В предложенном микроорганизме рода Corynebacterium, продуцирующем L-аргинин, инактивирован белок, содержащий аминокислотную последовательность SEQ ID NO.: 1.

Группа изобретений относится к биотехнологии и касается получения генетической конструкции, обеспечивающей синтез в клетках Escherichia coli рекомбинантного полипептида G4223 (рG4223).

Изобретение относится к области медицинской микробиологии. Питательная среда для выделения и идентификации неферментирующих бактерий содержит питательный бульон сухой, экстракт кормовых дрожжей для микробиологических питательных сред, Д-глюкозу, Д-галактозу, натрия хлорид, натрий серноватистокислый, железо (III) лимоннокислое водное, натрий углекислый, натрий сернистокислый, феноловый красный, бромтимоловый синий, кальций углекислый, агар микробиологический и дистиллированную воду при заданных количествах компонентов.

Изобретение относится к биотехнологии. Предложен биогеосорбент для очистки нефтезагрязненных водных объектов.

Изобретение относится к области биотехнологии. Штамм бактерий Xanthomonas theicola 6.3, обладающий способностью продуцировать ксантан, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ В-11268.

Изобретение относится к биотехнологии. Предложен способ получения эффективного многофункционального штаммового средства для активации микроорганизмов в канализационных водах.

Система кондиционирования воздуха для моторного транспортного средства согласно изобретению включает вакуумный кожух, имеющий хладагент, первую секцию и вторую секцию.

Изобретение относится к механическим системам кондиционирования воздуха. Для извлечения воды из механической системы кондиционирования регулируют нагрузку компрессора и величину усилия фрикционного торможения для обеспечения задаваемого водителем усилия торможения в зависимости от уровня воды.

Изобретение относится к устройствам для кондиционирования воздуха рельсовых транспортных средств. Устройство (10) для кондиционирования воздуха содержит средство (22) выпуска потока кондиционированного воздуха и по меньшей мере один контур (28) распространения воздуха, предназначенный для оснащения вагона.

Изобретение относится к системам устранения избыточной влажности в транспортном средстве. Система включает в себя теплопроводящий элемент, соединенный с наружной обшивкой транспортного средства, и трубопровод, по меньшей мере частично охватывающий теплопроводящий элемент таким образом, что между трубопроводом и теплопроводящим элементом образован воздушный проточный канал.

Изобретение касается осушительного устройства для осушения воздуха в резервуаре. Оно имеет элемент Пельтье, который выполнен в виде одноступенчатого элемента Пельтье, и он термически соединен с холодной стороной и горячей стороной, при этом холодная сторона выполнена таким образом, что при эксплуатации осушительного устройства на холодной стороне конденсируется влага воздуха, при этом элемент Пельтье зажат между горячей стороной и холодной стороной посредством винтовой пружины и зажимного штифта, при этом горячая сторона на обращенной к элементу Пельтье стороне имеет сальниковое уплотнение, причем оно выполнено в виде углубления на горячей стороне, имеющей введенную в нее резиновую втулку, причем эта резиновая втулка охватывает зажимной штифт по внутреннему диаметру.

Изобретение относится к области транспортного машиностроения, в частности к климатическим системам кабины грузовых автомобилей. Климатическая система транспортного средства содержит эжектор (1), через который в компрессор (2) поступает поток атмосферного и холодного отработанного воздуха, блок очистки воздуха (3), теплообменник воздух-воздух (4) выполнен кожухотрубным конусообразной формы корпуса и наклонных трубок, со стороны больших диаметров подсоединен к каналу подвода воздуха, а малыми диаметрами подсоединен к входу вихревого энергоразделителя.

Изобретение относится к устройствам для обработки воздуха в пассажирском салоне транспортного средства. Корпус HVAC имеет секцию поступления рециркуляции, секцию поступления свежего воздуха, секцию нагнетателя и секцию вывода.

Изобретение относится к кондиционированию воздуха в железнодорожных вагонах. Система кондиционирования воздуха содержит входной рециркуляционный воздуховод (1), входной воздуховод (2) для наружного воздуха, подсоединенные к камере (3) смешивания наружного и рециркуляционного воздуха.

Изобретение относится к области обработки воздуха. Способ калибровки датчика воздуха устройства обработки воздуха включает в себя этапы, на которых: i) - очищают воздух, используя устройство обработки воздуха; ii) - измеряют первое количество воздуха, используя датчик воздуха для получения первого значения для калибровки датчика воздуха, причем первое количество воздуха представляет собой смесь окружающего воздуха и очищенного воздуха, причем устройство обработки воздуха расположено в воздухонепроницаемом пространстве, а этап 2 дополнительно включает в себя этапы, на которых: определяют, удовлетворяет ли качество первого количества воздуха в воздухонепроницаемом пространстве заданному критерию; и если качество первого количества воздуха удовлетворяет заданному критерию, измеряют первое количество воздуха, используя датчик воздуха, для получения первого значения.

Изобретение относится к области обработки воздуха, в частности в автомобильной промышленности. Устройство обработки воздуха содержит: блок очистки воздуха, ароматический диспенсер; детектор воздуха, выполненный с возможностью обнаруживать очищенный воздух и создавать выходной сигнал; процессор, выполненный с возможностью принимать сигнал от детектора и управлять рабочей скоростью блока очистки воздуха и распределяющим потоком ароматизатора, распределяемого посредством ароматического диспенсера, основываясь на выходном сигнале, причем распределяющий поток, распределяемый посредством ароматического диспенсера, уменьшается с увеличением рабочей скорости блока очистки воздуха.

Группа изобретений может быть использована в химической промышленности для обработки потока природного газа, содержащего соединения серы, включая сероводород и бисульфиды, с образованием элементарной серы.

Настоящее изобретение относится к композиции для предотвращения запахов. Описана композиция для предотвращения запахов, содержащая микроорганизмы без запаха Caulobacter vibrioides HKMC-14, Bradyrhizobium diazoefficiens HKMC-15 и Bradyrhizobium daqingense HKMC-16 или раствор их культуры, а также применение композиции для предотвращения запахов в системе кондиционирования. Технический результат – предотвращение образования неприятного запаха. 7 н. и 6 з.п. ф-лы, 3 ил., 11 табл., 9 пр.

Наверх