Линия клеток c-halb, секретирующих рекомбинантный альбумин человека

Изобретение относится к области биологии, а именно к линии клеток С-НAlb, продуцирующих рекомбинантный белок альбумин человека. Линия клеток С-НAlb, трансформированных плазмидой phAlb, кодирующей альбумин человека, депонирована во Всероссийской Коллекции Промышленных Микроорганизмов (ВКПМ) под регистрационным номером ВКПМ Н-179. Изобретение позволяет расширить арсенал технических средств. 3 ил., 6 пр.

 

Область техники настоящего изобретения

Изобретение относится к области клеточной биологии, молекулярной биологии и биотехнологии, в частности, к получению линии генномодифицированных клеток яичника китайского хомячка, используемых для получения рекомбинантного биологически активного альбумина человека.

Предшествующий уровень техники настоящего изобретения

Альбумин человека является наиболее распространенным циркулирующим белком в плазме крови здоровых людей (3,5-5 г/л) и составляет примерно 50% от общего содержание белка. Альбумин - это небольшой глобулярный одноцепочечный белок с молекулярной массой около 66,5 кДа, состоящий из 585 аминокислот, организованный в три повторяющихся домена (I, II и III), каждый из которых содержит два отдельных субдомена (A и B).

В физиологических условиях около 10-15 грамм альбумина вырабатываются клетками печени каждый день, но не депонируется в ней. Синтез белка стимулируют гормоны, например, инсулин, кортизол, гормон роста, ингибирование данного процесса происходит под действием провоспалительных молекул (интерлейкин-6 и фактор некроза опухоли α), гипертермии, стрессовых состояний. Время полужизни синтезированного в печеночных клетках и поступившего после этого в циркуляцию альбумина составляет в 12-19 дней. [0; 0].

Из всего количества синтезированного в организме альбумина около 30-40% остается в кровотоке, остальной белок находится в интерстициальном пространстве. В организме постоянно происходит обмен альбумина между внутрисосудистым и внесосудистым пространством, интенсивность циркуляции осуществляется со скоростью примерно 5% белка в час [0; 0; 0; 0].

Альбумин выполняет важнейшую функцию - поддержание коллоидно-осмотического давления (КОД) плазмы крови, благодаря своей способности хорошо связывать воду и удерживать ее в сосудистом русле. Именно этот белок, та часть его, которая находится во внутрисосудистом пространстве, на 80 % обусловливает КОД.

В интерстициальном и внутриклеточном пространстве находятся остальные 60 % альбумина. При уменьшении содержания альбумина на 50 % происходит снижение КОД на 66 %, что сопровождается перераспределением воды из интерстициального пространства во внутрисосудистое.

Поддержание осмотического давления в сосудистом русле не единственная функция альбумина. За последние два десятилетия было установлено еще несколько важных свойств альбумина, связанных со структурой и конформацией молекулы.

Альбумин обладает транспортной и антиоксидантной функцией. Он способен связывать как эндогенные, так и экзогенные субстанции, участвует в транспорте гормонов, аминокислот, билирубина, жирных кислот, а также нейтрализует токсины, как бактериального происхождения, так и образующиеся в процессе обмена веществ. Альбумин способен связывать ионы металлов, непосредственно связывать и выводить реактивные формы кислорода и азота [0; 0].

В молекуле альбумина существует один неспаренный остаток цистеина в положении 34 (Cys34). Именно этот цистеин действует как мощный поглотитель реактивного кислорода (ROS). В N-терминальной части молекулы находится сайт с высоким сродством связывания некоторых металлов (медь, никель и др.), что обеспечивает их инактивацию и отсутствие радикал-продуцирующей активности [0; 0; 0].

Молекула альбумина способствует стабилизации эндотелиального слоя и поддержанию нормальной проницаемости капилляров, вероятно, за счет снижения окислительного повреждения и модулирования воспаления [0; 0].

Альбумин также действует как молекула-шаперон, который помогает правильному сворачиванию различных белков и предотвращает образование агрегированных белков, связанных с заболеваниями [0; 0].

Существуют другие менее известные свойства альбумина, такие как антикоагулянтные и антитромботические функции. Эти функции обуславливаются способностью альбумина связывать оксид азота с образованием комплекса «альбумин-NO» и постепенной его инактивацией. Этот процесс стабилизирует функциональную и морфологическую целостность тромбоцитов, отсутствует повреждение эндотелия сосудов, не происходит агрегации тромбоцитов [0; 0].

В клинической практике чаще всего эксплуатируется основное свойство альбумина, а именно, поддержание коллоидно-осмотического давления плазмы крови. Тем не менее, сывороточный альбумин используется при различных клинических состояниях, связанных с гиповолемией: восстановление объема крови, экстренное лечение шока, острое лечение ожогов и других ситуаций. Количество альбумина в крови служит хорошим диагностическим и прогностическим маркером при определении заболеваний печени и ряда других заболеваний, таких как воспалительные заболевания, опухоли головного мозга, ревматоидный артрит, ишемия миокарда, рак, заболевания почек, и др. [0; 0; 0; 0].

Кроме того, альбумин имеет различные применения в смежных областях исследований, например: криоконсервация клеток; в качестве стабилизатора белков при хранении и транспортировке; добавки к среде культивирования клеточных культур. В последние несколько лет, альбумин используют как транспортер кислорода, а также для создания лекарственных препаратов в виде «слитых пептидов» для увеличения времени циркуляции препарата в организме [0; 0].

Несмотря на широкий спектр функций альбумина и высокие потребности в нем со стороны практической медицины, стратегия использования белков человеческого происхождения очищенных из донорского материала имеет ряд серьёзных ограничений. Ограничений, связанных с необходимостью использования большого количества исходного биоматериала, сложностью процедур очистки, и, самое главное, возможной биологической опасностью конечного продукта из-за содержания в нем известных и неизвестных патогенов. Все эти ограничения отсутствуют при использовании рекомбинантных белков, полученных в контролируемых условиях.

Для получения рекомбинантных белков используют различные системы экспрессии, основанные на культивировании в качестве продуцентов клеток E.coli, дрожжей, насекомых, млекопитающих. Выбор системы экспрессии для продукции конкретного белка определяется различными факторами, которые включают в себя стоимость продукции и очистки, характеристики выхода целевого белка, необходимость проведения очистки от продуктов неправильного фолдинга и неполноразмерных молекул, необходимость присутствия пост-трансляционных модификаций в рекомбинантном белке. Одним из широко используемых подходов при продукции рекомбинантных секреторных белков млекопитающих, является использование в качестве продуцентов клеток хомяка линии СНО. Использование для экспрессии клеток линии СНО позволяет добиться присутствия в рекомбинантных белках, продуцируемых в них, наиболее соответствующего естественному эндогенному паттерну пост-трансляционных модификаций, характерному для белков млекопитающих, что позволяет получить рекомбинантный белок, максимально схожий с натурально встречающимся белком.

Вне зависимости от используемой для продукции рекомбинантного белка системы экспрессии, рекомбинантный белок должен быть подвергнут процедуре очистки, призванной удалить примеси как белковой, так и небелковой природы, которые могут интерферировать со специфической активностью самого рекомбинантного белка и проявлять собственную биологическую активность, включая токсическое действие на клетки-мишени для целевого белка. Процедура очистки основана на специфических физико-химических свойствах целевого белка. Такими свойствами являются молекулярная масса белка, его заряд, специфическая аффинность к определённым сорбентам и тому подобные, на основании которых проводится фракционирование сложной смеси. Методы очистки могут включать в себя ультрафильтрацию, дифференциальное осаждение и различные виды хроматографии.

Одним из широко используемых подходов при очистке рекомбинантных белков является высокоспецифичная аффинная хроматография, основанная на специфическом связывании аффинным матриксом целевого белка. Этот метод позволяет в одну стадию добиться высокой очистки целевого белка от примесей.

Раскрытие настоящего изобретения

Сущностью настоящего изобретения является создание новой линии клеток хомяка С-HAlb, продуцирующих рекомбинантный альбумин человека. Способность клеток С-HAlb секретировать рекомбинантный альбумин достигается при помощи генной модификации клеток хомяка линии СНО генной конструкцией - плазмидой phAlb, содержащей комплементарную ДНК (кДНК) альбумина человека (SEQ ID NO: 1).

Технический результат заключается в получении клеток линии С-HAlb, стабильно трансфицированных плазмидой phAlb, предназначенной для экспрессии в клетках млекопитающих белка альбумина человека, и секретирующих этот белок в ростовую среду при культивировании in vitro.

Целью настоящего изобретения является расширение коллекции уникальных клеточных штаммов, которые можно использовать для получения рекомбинантного альбумина человека. Эта задача является особенно актуальной для современной фармакологической биотехнологии. Наработанный указанным штаммом белок может применяться во многих сферах биологических и медицинских исследований, в частности, при создании и изучении лекарственных средств, в области клеточной и тканевой инженерии.

Поставленная задача решается тем, что получена новая линия клеток С-HAlb, несущая интегрированную в геном генную конструкцию phAlb, предназначенную для экспрессии в клетках млекопитающих, и продуцирующих биологически активный рекомбинантный альбумин человека, обеспечивающих возможность проводить одностадийную аффинную очистку белка, в количестве не менее 0,3 г рекомбинатного белка на 1 л культуральной среды. Полученная клеточная линия обладает стабильными культуральными и морфологическими свойствами и в результате генной модификации обладает способностью секретировать рекомбинантный альбумин человека. Линия клеток С-HAlb депонирована во Всероссийской Коллекции Промышленных Микроорганизмов (ВКПМ) под регистрационным номером ВКПМ Н-179.

Краткое описание чертежей

На фиг. 1 показана аминокислотная последовательность альбумина человека, кодируемого плазмидой phAlb.

На фиг. 2 показан результат анализа культуральных сред немодифицированных клеток линии СНО (-) и клеток линий СНО, модифицированных плазмидой phAlb, на присутствие в них альбумина человека. Монослойные культуры клеток инкубировали с бессывороточной культуральной средой в течение 48 часов, после чего аликвоты кондиционной среды разделяли в 10% ДСН-ПААГ в редуцирующих условиях. Приведены результаты окраски геля красителем Кумасси R-250. Слева приведены положения полос маркера молекулярного веса (Bio-Rad, США, Prescision Plus Protein™ Standard) в килодальтонах (кДа).

На фиг. 3 показан результат очистки рекомбинантного белка альбумина из культуральной среды клеток линии С-HAlb. Аликвоты очищенного рекомбинантного белка разделяли в 10% ДСН-ПААГ в редуцирующих условиях с последующим окрашиванием геля красителем Bio-Safe™ Coomassie (Bio-Rad). Для оценки молекулярной массы белков использовали маркер молекулярной массы (MW) Prescision Plus Protein™ Standard (Bio-Rad, США). Размеры полос маркера молекулярного веса приведены слева в килодальтонах. Справа показан денситометрический профиль дорожки геля с разделенным 1 мкг рекомбинантного белка альбумина.

Примеры осуществления настоящего изобретения

Пример 1. Получение кДНК альбумина человека, встроенной в вектор, предназначенный для экспрессии в клетках млекопитающих (плазмида phAlb)

Для получения фрагмента кДНК альбумина человека использовали полимеразную цепную реакцию с последующим клонированием амплифицированного фрагмента в плазмидный вектор с использованием методов и подходов, хорошо известных специалистам в этой области. кДНК альбумина человека амплифицировали с использованием в качестве матрицы первых цепей кДНК из печени человека. Праймеры подбирали таким образом, чтобы амплифицируемый фрагмент кДНК альбумина содержал полную открытую рамку считывания, кодирующую сигнальный пептид и зрелый полипептид, и последовательности инициации и терминации трансляции. Продукт амплификации использовался в качестве матрицы в полимеразной цепной реакции с праймерами [5' - TTGAATTCGCCACCATGAAGTGGGTAACCTTT-3'] и [5' -TTGGATCCTTATAAGCCTAAGGCAGCTTGACT-3'] для (1) введения сайта узнавания рестрикционной эндонуклеазы EcoRI на 5'-конце фрагмента, (2) введения сайта узнавания рестрикционной эндонуклеазы BamHI на 3'-конце фрагмента. Амплифицированный фрагмент расщепляли с использованием рестрикционных эндонуклеаз EcoRI и BamHI и клонировали в вектор, предназначенный для экспрессии в клетках млекопитающих, для получения плазмиды phAlb. Это помещает амплифицированный фрагмент ДНК, кодирующий белок альбумин, между конститутивным промотором и сигналом терминации транскрипции и полиаденилирования в использованном векторе для экспрессии в клетках млекопитающих таким образом, что 5'-конец фрагмента следует за промотором, а 3'-конец предшествует сигналу терминации транскрипции и полиаденилирования. Нуклеотидная последовательность фрагмента, кодирующего белок альбумин человека, клонированная в вектор для экспрессии в клетках млекопитающих, была определена и полностью идентична известной последовательности соответствующего фрагмента кДНК альбумина человека и соответствует аминокислотной последовательности белка альбумина человека с 19 по 609 аминокислоные остатки (фигура 1).

Помимо вышеописанных структурных элементов, вектор для экспрессии в клетках млекопитающих (а также его производная - плазмида phAlb) также содержит селективный маркер (кДНК неомицин-фосфотрансферазы II), позволяющий проводить селекцию в клетках E.coli в присутствии канамицина при проведении процедуры клонирования, а также в клетках млекопитающих в присутствии генетицина (антибиотик G418) при получении клонов клеток линии СНО, продуцирующих белок альбумин человека.

Пример 2. Получение генномодифицированных клеток линии СНО, секретирующих белок альбумин человека

Для получения клонов клеток, продуцирующих рекомбинантный альбумин человека, кодируемый плазмидой phAlb, клетки линии СНО трансфицировали плазмидой phAlb и проводили отбор клонов клеток со стабильной интеграцией в геном плазмиды phAlb на основании их устойчивости к антибиотику G418.

Клетки линии СНО трансфицировали плазмидой phAlb с использованием реагента для трансфекции Unifetin-56 (UnifectGroup, Москва). Селекцию клонов проводили в полутвердой ростовой среде (среда DMEM/F12 (1:1) c 10% фетальной бычьей сыворотки, 100 ед/мл пенициллина и 100 мкг/мл стрептомицина), содержащей 600 мкг/мл антибиотика G418, метилцеллюлоза 2% (Sigma-Aldrich, США) и флуоресцентно меченные антитела против альбумина человека. После формирования клетками колоний проводился анализ продукции рекомбинантного белка на основании его взаимодействия с меченными антителами с использованием флуоресцентного микроскопа. Колонии клеток с максимальной экспрессией рекомбинантного белка переносили в 96-луночный планшет с помощью автоматической пипетки. После формирования клетками монослоя их переносили в 24-луночный планшет. После формирования монослоя в нем клетки рассевали в 6-луночный планшет для последующей заморозки и в лунку 24 луночного планшета для проведения анализа секреции белка.

Пример 3. Анализ продукции рекомбинантного белка альбумина человека клонами клеток линии СНО, трансфицированных плазмидой phAlb

После достижения отобранными клонами клеток линии СНО, трансфицированных плазмидой phAlb, конфлюентности в лунках 24-луночного планшета, лунки промывали 1 мл ростовой среды без сыворотки и добавляли 1 мл той же среды. Среду собирали через 48 часов инкубации для анализа содержания рекомбинантного белка альбумина в ней. Для проведения анализа аликвоты культуральной среды, смешанные с 6-кратным буфером для нанесения на электрофорез ДСН-ПААГ, разделяли в 10% ДСН-ПААГ. В качестве контролей использовали процессированные кондиционные среды нетрансфицированных клеток лини CHO (отрицательный контроль). По результатам анализа из полученных клонов клеток линии СНО, был отобран клон С-HAlb, продуцирующий максимальное количество рекомбинантного альбумина человека в культуральную среду. Целевой белок, секретируемый клетками С-HAlb, модифицированных плазмидой phAlb, детектировался как белок с молекулярным весом в интервале от 50 кДа и до 75кДа (фигура 2), что соответствует молекулярной массе сывороточного альбумина человека.

Пример 4. Оценка концентрации рекомбинантного альбумина человека в культуральной среде клеток линии С-HAlb.

Клетки линии С-HAlb выращивали в 100 мм чашках Петри до конфлюентности, после чего культуральную среду заменяли на свежую культуральную среду без добавления сыворотки (10 мл на чашку) и инкубировали в течение 48 часов. Собранную культуральную среду использовали для определения концентрации рекомбинантного альбумина человека.

Концентрацию рекомбинатного альбумина человека оценивали с использованием набора Bicinchoninic Acid Protein Assay Kit (Sigma, США) в соответствии с рекомендацией производителя. В соответствии с инструкцией к набору анализ проводили в диапазоне от 0,2 до 1 мг/мл общего белка в растворе, на этом диапазоне имеется линейная зависимость оптической плотности от концентрации.

В качестве раствора-сравнения использовали культуральную среду немодифицированых клеток линии СНО. Подготовку культуральной среды немодифицированных клеток линии СНО проводили аналогично клеткам линии C-HAlb. Полученный штамм С-HAlb секретировал 300 мкг/мл.

Пример 5. Наработка среды культуры клеток линии С-HAlb

Клетки линии C-HAlb растили в роллерах. В процессе и после достижения культурой клеток монослойного состояния культуральная среда при ее замене собиралась следующим образом. После отбора среды из роллеров среда центрифугировалась в течение 5 мин при 1000 об/мин для осаждения возможно присутствующих в ней открепившихся клеток. Надосадок после центрифугирования переносился в чистую емкость и хранился замороженным при -20°С. В результате последовательной смены среды после достижения культурой монослоя в роллере было получено 0,8 литра культуральной среды клеток линии C-HAlb (объем культуральной среды в роллере - 200-250 мл в зависимости от срока инкубации до замены среды; смена среды раз в 2-3 дня) (с учетом собранной среды в процессе наращивания клеток для засева их в роллер и достижения монослойного состояния культурой в роллере). Кондиционная культуральная среда собиралась на каждом цикле смены среды и криоконсервировалась для хранения до окончания сбора необходимого количества культуральной среды.

Пример 6. Очистка альбумина из культуральной среды клеток линии С-HAlb

Наработанная культуральная среда клеток линии C-HAlb, содержащая альбумин, использовалась в качестве источника сырья для очистки рекомбинантного альбумина человека.

Очистку белка из культуральной среды проводили с помощью аффинной хроматографии. После оттаивания, культуральная среда, собранная с различных циклов смены среды, объединяется и требует предварительной подготовки перед процедурой аффинной хроматографии. А именно, проводится фильтрация культуральной среды через фильтр с диаметром пор 1-1,5 мкм и дополнительная фильтрация через 0,2 мкм с последующей дегазацией в течение 20 мин под вакуумом. После этого среда готова для нанесения на аффинную колонку.

Подготовленную культуральную среду наносили на колонку, предварительно уравновешенную водным раствором 20мМ 2-амино-2гидроксиметила-пропан-1,3-диола (далее трис), при скорости потока 0,75 мл в минуту. После нанесения среды колонку промывали буфером, использовавшимся для уравновешивания, до достижения базового уровня поглощения при 280 нм. Затем буфером, содержащим 20мМ трис и 40мМ хлорида калия, удаляли компоненты культуральной среды, неспецифически связавшиеся с субстратом колонки. Элюцию, сорбированного на аффинном носителе рекомбинантного белка, производили 20мМ раствором трис, содержащим 1,5М хлорида калия.

Контроль оптической плотности производили с помощью проточного денситометра. Собирали весь пик белка. Раствор разводили в три раза 20мМ растовром трис для достижения концентрации хлорида калия 0,5М. Полученный препарат стерилизовали мембранной фильтрацией (размер пор 0,2 мкм) и хранили при температуре +4°С.

Чистоту полученного препарата рекомбинантного белка контролировали по окраске разделенного препарата рекомбинантного белка в ДСН-ПААГ в редуцирующих условиях. Как видно из фигуры 3, окраска 1 мкг препарата очищенного рекомбинантного белка альбумина человека демонстрирует отсутствие посторонних белковых полос помимо полосы с преимущественной подвижностью 65-70 кДа, соответствующей белку альбумина. Денситометрический анализ изображения геля с помощью программы Quantity One (BioRad, США) показал, что чистота полученного препарата составляет 97% (фигура 3). Концентрацию белка определяли спектрофотометрически по поглощению при длине волны 280 нм, принимая расчетный коэффициент экстинкции на основании содержания остатков цистина и тирозина (определен с помощью программы ProtParam, ExPASy Proteomics Server, www.expasy.ch [0]).

Основные характеристики клеток линии C-HAlb

Родословная клеточной линии:

Линия клеток C-HAlb получена из клеток линии СНО-S путем трансформации их плазмидой phAlb. Клетки CHO-S представляют собой клон клеток яичника китайского хомячка (CHO). Клетки CHO-S не ревертируют к нормальному фенотипу при длительном пассировании в неселективных условиях с добавлением 10% сыворотки крупного рогатого скота и с высокой эффективностью трансфицируются экзогенным ДНК.

Число пассажей:

К моменту составления паспорта клеточная линия прошла 17 пассажей.

Стандартные условия культивирования:

Питательная среда DMEM/F12 (1:1) (90%), фетальная бычья сыворотка 10%, содержащая антибиотики (пенициллин со стрептомицином в концентрации 100 ед/мл и 100 мкг/мл соответственно). Культивирование при 37°С и 5% СО2.

Кратность рассева 1:4 - 1:5, оптимальная плотность посева 1,0×105 клеток/мл.

Метод снятия: 0,05% раствор трипсина и 0,02% раствор версена в соотношении 1:1.

Культуральные свойства:

Пассаж 1 раз в 2-3 суток. Клетки имеют преимущественно адгезионный, преимущественно монослойный характер роста в стандартных условиях культивирования.

Производимый продукт

Линия клеток C-HAlb секретирует альбумин человека, аминокислоты 19-609, в количестве не менее 0,3 г на 1 л среды.

Контаминация:

Бактерии и грибы в культуре не обнаружены при длительном наблюдении. Тест на микоплазму отрицателен

Условия криоконсервации:

Среда для замораживания: 70% ростовая среда, 20% эмбриональная телячья сыворотка, 10% DMSO, 2.0-4.0×106 клеток/мл в ампуле.

Хранение в жидком азоте при температуре -196°С.

Размораживание быстрое, при 37°С. Клетки разводят в 5 мл ростовой среды и осаждают центрифугированием, ресуспендируют в 5 мл той же среды, и переносят в культуральный флакон с площадью роста 25 см2.

Жизнеспособность клеток оценивают по включению трипанового синего. Жизнеспособность клеток после размораживания 85-90%.

Список процитированной литературы

1. Evans TW. Review article: albumin as a drug-biological effects of albumin unrelated to oncotic pressure. Aliment Pharmacol Ther 2002; 16 (Suppl 5): 6-11.

2. Nicholson JP, Wolmarans MR, Park GR. The role of albumin in critical illness. Br J Anaesth 2000; 85: 599-610].

3. Fanali G, di Masi A, Trezza V, et al. Human serum albumin: from bench to bedside. Mol Aspects Med 2012; 33: 209-90.

4. Garcia-Martinez R, Caraceni P, Bernardi M, et al. Albumin: Pathophysiologic basis of its role in the treatment of cirrhosis and its complications. Hepatology 2013; DOI 10.1002/hep.26338].

5. Sadler PJ, Tucker A, Viles JH. Involvement of a lysine residue in the N-terminal Ni2+ and Cu2+ binding site of serum albumins. Comparison with Co2+, Cd2+ and Al3+. Eur J Biochem 1994; 220: 193-200.

6. Sokołowska M, Wszelaka-Rylik M, Poznański J, Bal W. Spectroscopic and thermodynamic determination of three distinct binding sites for Co(II) ions in human serum albumin. J Inorg Biochem 2009; 103: 1005-13.

7. Kitano H, Fukui H, Okamoto Y, et al. Role of albumin and high-density lipoprotein as endotoxin-binding proteins in rats with acute and chronic alcohol loading. Alcohol Clin Exp Res 1996; 20: 73A-6A.

8. Chen TA, Tsao YC, Chen A, et al. Effect of intravenous albumin on endotoxin removal, cytokines, and nitric oxide production in patients with cirrhosis and spontaneous bacterial peritonitis. Scand J Gastroenterol 2009; 44: 619-25.

9. Elzoghby AO, Samy WM, Elgindy NA. Albumin-based nanoparticles as potential controlled release drug delivery systems. J Control Release 2012;157(2):168-82. doi: 10.1016/j.jconrel.2011.07.031.

10. Sleep D. Albumin and its application in drug delivery. Expert Opin Drug Deliv 2015;12(5):793-812. doi: 10.1517/17425247.2015.993313.

11. Keaney JF, Simon DI, Stamler JS, et al. NO forms an adduct with serum albumin that has endothelium-derived relaxing factor-like properties. J Clin Invest 1993; 91: 1582-9.

12. Kim SB, Chi HS, Park JS, et al. Effect of increasing serum albumin on plasma D-dimer, von Willebrand factor, and platelet aggregation in CAPD patients. Am J Kidney Dis 1999; 33: 312-7].

13. Gupta D, Lis CG. Pretreatment serum albumin as a predictor of cancer survival: A systematic review of the epidemiological literature. Nutr J 2010;9:69. doi: 10.1186/1475-2891-9-69.

14. Apple FS, Wu AH, Mair J, Ravkilde J, Panteghini M, Tate J, et al. Future biomarkers for detection of ischemia and risk stratification in acute coronary syndrome. Clin Chem 2005;51(5):810-24. doi: 10.1373/clinchem.2004.046292.

15. Tibbling G, Link H, Ohman S. Principles of albumin and igg analyses in neurological disorders. I. Establishment of reference values. Scand J Clin Lab Invest 1977;37(5):385-90. doi: 10.1080/00365517709091496.

16. Fouque D, Kalantar-Zadeh K, Kopple J, Cano N, Chauveau P, Cuppari L, et al. A proposed nomenclature and diagnostic criteria for protein-energy wasting in acute and chronic kidney disease. Kidney Int 2008;73(4):391-8. doi: 10.1038/sj.ki.5002585.

17. Chen Z, He Y, Shi B, Yang D. Human serum albumin from recombinant DNA technology: Challenges and strategies. Biochim Biophys Acta 2013;1830(12):5515-25. doi: 10.1016/j.bbagen.2013.04.037.

18. Raoufinia R, Mota A, Nozari S, Aghebati Maleki L, Balkani S, Abdolalizadeh J. A methodological approach for purification and characterization of human serum albumin. J Immunoassay Immunochem 2016;37(6):623-35. doi: 10.1080/15321819.2016.1184163.

19. Gasteiger E., et al. Protein Identification and Analysis Tools on the ExPASy Server; (In) John M. Walker (ed): The Proteomics Protocols Handbook, Humana Press (2005). pp. 571-607.

--->

ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

<110> Общество с ограниченной ответственностью «СайСторЛаб»

<120> ЛИНИЯ КЛЕТОК С-HAlb, СЕКРЕТИРУЮЩИХ РЕКОМБИНАНТНЫЙ АЛЬБУМИН ЧЕЛОВЕКА

<160> 1

<210> 1

<211> 1830

<212> DNA

<213> Искусственная последовательность

<220> Последовательность кДНК альбумина в векторе для трансфекции

<223> Кодирующая последовательность

<400> 1

atgaagtgggtaacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagtgaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagtgtccatttgaagatcatgtaaaattagtgaatgaagtaactgaatttgcaaaaacatgtgttgctgatgagtcagctgaaaattgtgacaaatcacttcataccctttttggagacaaattatgcacagttgcaactcttcgtgaaacctatggtgaaatggctgactgctgtgcaaaacaagaacctgagagaaatgaatgcttcttgcaacacaaagatgacaacccaaacctcccccgattggtgagaccagaggttgatgtgatgtgcactgcttttcatgacaatgaagagacatttttgaaaaaatacttatatgaaattgccagaagacatccttacttttatgccccggaactccttttctttgctaaaaggtataaagctgcttttacagaatgttgccaagctgctgataaagctgcctgcctgttgccaaagctcgatgaacttcgggatgaagggaaggcttcgtctgccaaacagagactcaagtgtgccagtctccaaaaatttggagaaagagctttcaaagcatgggcagtagctcgcctgagccagagatttcccaaagctgagtttgcagaagtttccaagttagtgacagatcttaccaaagtccacacggaatgctgccatggagatctgcttgaatgtgctgatgacagggcggaccttgccaagtatatctgtgaaaatcaagattcgatctccagtaaactgaaggaatgctgtgaaaaacctctgttggaaaaatcccactgcattgccgaagtggaaaatgatgagatgcctgctgacttgccttcattagctgctgattttgttgaaagtaaggatgtttgcaaaaactatgctgaggcaaaggatgtcttcctgggcatgtttttgtatgaatatgcaagaaggcatcctgattactctgtcgtgctgctgctgagacttgccaagacatatgaaaccactctagagaagtgctgtgccgctgcagatcctcatgaatgctatgccaaagtgttcgatgaatttaaacctcttgtggaagagcctcagaatttaatcaaacaaaattgtgagctttttgagcagcttggagagtacaaattccagaatgcgctattagttcgttacaccaagaaagtaccccaagtgtcaactccaactcttgtagaggtctcaagaaacctaggaaaagtgggcagcaaatgttgtaaacatcctgaagcaaaaagaatgccctgtgcagaagactatctatccgtggtcctgaaccagttatgtgtgttgcatgagaaaacgccagtaagtgacagagtcaccaaatgctgcacagaatccttggtgaacaggcgaccatgcttttcagctctggaagtcgatgaaacatacgttcccaaagagtttaatgctgaaacattcaccttccatgcagatatatgcacactttctgagaaggagagacaaatcaagaaacaaactgcacttgttgagcttgtgaaacacaagcccaaggcaacaaaagagcaactgaaagctgttatggatgatttcgcagcttttgtagagaagtgctgcaaggctgacgataaggagacctgctttgccgaggagggtaaaaaacttgttgctgcaagtcaagctgccttaggcttataa

<---

Линия клеток С-НAlb, трансформированных плазмидой phAlb, кодирующей альбумин человека, и продуцирующих рекомбинантный белок альбумина человека, депонированная во Всероссийской Коллекции Промышленных Микроорганизмов (ВКПМ) под регистрационным номером ВКПМ Н-179.



 

Похожие патенты:

Данное изобретение относится к области иммунологии. Предложен способ производства Т-клеток, согласно которому стадии активации, стимуляции, трансдукции с помощью вирусного вектора, содержащего полинуклеотид, кодирующий Т-клеточный рецептор (TCR) или химерный антигенный рецептор (CAR), а также культивирования трансдуцированных Т-клеток для пролиферации выполняют в присутствии ингибитора фосфатидил-инозитол-3-киназы (PI3K).

Изобретение относится к области биохимии, в частности к способу культивирования клетки яичников китайского хомячка (CHO), включающей нуклеиновую кислоту, кодирующую рекомбинантное антитело, а также к способу получения композиции очищенного рекомбинантного антитела с уменьшенной интенсивностью окрашивания.

Группа изобретений относится к области биохимии, биомедицины и биотехнологии и включает биоматериал на основе бесклеточного матрикса, производимого мезенхимными стромальными клетками (МСК) человека, способ его получения, а также способы стимуляции регенеративных процессов с помощью полученного биоматериала, а именно стимуляции дифференцировки и поддержания пролиферации и жизнеспособности недифференцированных МСК человека, которые являются ключевыми участниками регенерации различных тканей после повреждения.

Изобретение относится к биотехнологии и представляет собой способ лечения млекопитающего, страдающего заболеванием, связанным с экспрессией CD19, включающий введение млекопитающему эффективного количества популяции иммунных эффекторных клеток, экспрессирующих молекулу CAR, которая связывается с CD19, (CAR19-экспрессирующие клетки), в комбинации с ингибитором тирозинкиназы Брутона (BTK), где молекула CAR содержит связывающий CD19 домен, трансмембранный домен и внутриклеточный сигнальный домен, где внутриклеточный сигнальный домен содержит костимулирующий домен и первичный сигнальный домен.

Изобретение относится к области биотехнологии, а именно к получению дифференцирующихся клеток путем клеточного перепрограммирования. Способ включает выращивание неплюрипотентных или соматических клеток в ростовой среде, стимулирующей рост, при этом выбранные клетки растут с оптимальной скоростью роста.

Группа изобретений относится к панелям дискретных объемов микроокружений клеточных культур, обладающих различными свойствами, к способу и набору для изготовления таких панелей и к комбинаторному способу тестирования влияния композиций гидрогеля на характер клеточного роста.

Клетка // 2717984
Настоящая группа изобретений относится к иммунологии и клеточной биологии. Предложены цитотоксическая Т-клетка и клетка естественного киллера (NK-клетка), содержащие по два химерных антигенных рецептора (CAR), один из которых содержит эндодомен CD3ξ, активирующий клетку в присутствии первого антигена, а второй - домен тирозиновой фосфатазы CD148 или CD45, ингибирующий клетку в отсутствии второго антигена.

Изобретение относится к области биотехнологии, а именно к индукционным средам для получения иммунологически поляризованной популяции мезенхимальных стволовых клеток из нестимулированной популяции мезенхимальных стволовых клеток, иммунологически поляризованным популяциям мезенхимальных стволовых клеток и лечению заболеваний у субъекта.

Изобретение относится к области биотехнологии. Предложена новая клеточная линия рака молочной железы человека BrCCh4e, обладающая стабильными культуральными и морфологическими характеристиками.

Настоящее изобретение относится к области иммунологии. Предложено антитело, способное специфически связываться с эритропоэтином человека.

Изобретение относится к области биологии, а именно к линии клеток С-НAlb, продуцирующих рекомбинантный белок альбумин человека. Линия клеток С-НAlb, трансформированных плазмидой phAlb, кодирующей альбумин человека, депонирована во Всероссийской Коллекции Промышленных Микроорганизмов под регистрационным номером ВКПМ Н-179. Изобретение позволяет расширить арсенал технических средств. 3 ил., 6 пр.

Наверх