Промотор, проявляющий высокую экспрессионную активность в микроорганизмах mortierella

Группа изобретений относится к биотехнологии. Предложен полинуклеотид для обеспечения высокой экспрессии целевого гена в микроорганизме, относящемся к роду Mortierella. Полинуклеотид соответствует любому полинуклеотиду, выбираемому из группы, состоящей из (а)-(с), где (а) полинуклеотид, который состоит из любой нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: с 22 по 26; (b) полинуклеотид, который имеет нуклеотидную последовательность с идентичностью 90% или более по отношению к любой нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: с 22 по 26, и который проявляет промоторную активность в клетках микроорганизма, относящегося к роду Mortierella; и (с) полинуклеотид, который может гибридизоваться в жестких условиях с полинуклеотидом, состоящим из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, выбираемых из группы, состоящей из SEQ ID NO: с 22 по 26, и который проявляет промоторную активность в клетках микроорганизма, относящегося к роду Mortierella. Также предложены вектор для трансформации Mortierella, содержащий указанный полинуклеотид; нечеловеческий трансформант, трансформированный указанным полинуклеотидом или трансформированный указанным вектором. Группа изобретений обеспечивает высокую экспрессию целевого гена. 4 н. и 4 з.п. ф-лы, 13 ил., 2 табл.

 

ОБЛАСТЬ ТЕХНИКИ

[0001] Настоящее изобретение относится к промотору, проявляющему высокую экспрессионную активностью в клетках микроорганизмов, относящихся к роду Mortierella, к вектору, содержащему такой промотор, к нечеловеческому трансформанту, трансформированному таким промотором, а также к способу получения белков, липидов или жирных кислот с помощью такого промотора или трансформанта.

УРОВЕНЬ ТЕХНИКИ

[0002] Способы получения полезных соединений посредством микробного метаболизма (ферментационные способы в широком смысле) были разработаны и применяются на практике. Например, известно, что грибки рода Mortierella (например, Mortierella alpina) производят полиненасыщенные жирные кислоты, включая арахидоновую кислоту, и являются грибками, особенно пригодными для промышленных целей (Патентный документ 1).

Для применения этих грибков проводили селекцию, т.е. вносили модификации для улучшения генетических свойств полезных организмов (улучшение штамма). В частности, в ферментационных способах селекция становится очень важной с точки зрения улучшения эффективности производства полезных соединений микроорганизмами и снижения производственной себестоимости данных соединений и т.п.

Для выведения полезных организмов, обладающих более желательными свойствами, используют способы на основе трансформации. В этом случае фрагмент ДНК, кодирующий белок, которому необходимо придать желаемое свойство, делают экспрессирующимся под контролем подходящего промотора гена, а затем вводят в подходящий организм, подлежащий селекции (т.е. в хозяина) для получения популяции трансформантов. Из этой популяции отбирают желаемый штамм (линию). Эта процедура требует наличия промотора гена, который подходит для того типа организма, который служит хозяином, или для подлежащего модификации свойства.

Были опубликованы многие способы трансформации мицеллярных грибков, к которым относятся грибки рода Mortierella. Более того, что касается способности грибков рода Mortierella производить липиды, было получено много генов ферментов, входящих в системы синтеза липидов. Однако было сделано лишь несколько сообщений о промоторах генов, необходимых для введения этих полезных генов ферментов в грибки рода Mortierella и для стимуляции их экспрессии на высоком уровне.

[0003] Патентные документы

Патентный документ 1: JP 63-044891 A

РАСКРЫТИЕ ИЗОБРЕТЕНИЯ

[0004] В этих обстоятельствах существует необходимость выведения штаммов, которые эффективно производят полезные липиды. Для достижения этой цели требуется наличие промоторов генов, подходящих для грибков рода Mortierella.

[0005] В результате экстенсивных и интенсивных усилий авторам настоящего изобретения удалось клонировать промотор гена, экспрессирующегося на высоком уровне в Mortierella alpina (M. alpina), и таким образом завершить настоящее изобретение. То есть настоящее изобретение представляет полинуклеотид, экспрессионный вектор, трансформант и способ производства белков, липидов или жирных кислот с помощью такого полинуклеотида или трансформанта, как показано ниже.

[0006] Подробнее настоящее изобретение представляет собой следующее.

[1] Полинуклеотид, соответствующий любому, выбираемому из группы, состоящей из пунктов с (а) по (с), показанных ниже:

(а) полинуклеотид, который содержит любую нуклеотидную последовательность, выбираемую из группы, состоящей из SEQ ID NO: с 1 по 28;

(b) полинуклеотид, который содержит нуклеотидную последовательность с идентичностью равной 90% или более по отношению к любой нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: с 1 по 28, и который проявляет промоторную активность в клетках микроорганизмов, относящихся к роду Mortierella; и

(c) полинуклеотид, который может гибридизоваться в жестких условиях с полинуклеотидом, состоящим из нуклеотидной последовательности, комплементарной любой нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: с 1 по 28, и который проявляет промоторную активность в клетках микроорганизмов, относящихся к роду Mortierella.

[2] Полинуклеотид по указанному выше [1], в котором промоторную активность подтверждают как активность белка GUS (глюкуронидаза, glucuronidase) равную по меньшей мере 500 нмоль/(мг⋅мин) при экспрессии репортерного гена GUS в клетках микроорганизмов, относящихся к роду Mortierella.

[3] Полинуклеотид по указанному выше [1], который содержит любую нуклеотидную последовательность, выбираемую из группы, состоящей из SEQ ID NO: с 1 по 28.

[4] Полинуклеотид по вышеперечисленным [1] или [2], который является ДНК.

[5] Вектор, содержащий полинуклеотид по любому из вышеперечисленных [1]-[4].

[6] Нечеловеческий трансформант, трансформированный полинуклеотидом по любому из вышеперечисленных [1]-[4].

[7] Нечеловеческий трансформант, трансформированный вектором по указанному выше [6].

[8] Трансформант по вышеперечисленным [7] или [8], в котором трансформант является продуцирующим липид грибком.

[9] Трансформант по указанному выше [8], в котором продуцирующий липид грибок является Mortierella alpina.

[0007] При применении в качестве промотора полинуклеотид согласно настоящему изобретению обеспечивает высоко эффективную экспрессию целевого гена в клетках микроорганизмов, относящихся к роду Mortierella.

КРАТКОЕ ОПИСАНИЕ РИСУНКОВ

[0008] Фигура 1 показывает пример вектора для применения в оценке промотора согласно настоящему изобретению. Последовательность HisP заменена промотором согласно настоящему изобретению перед применением.

Фигура 2 показывает промоторную активность в трансформантах, трансформированных последовательностями промотора согласно настоящему изобретению, при культивировании в разных средах (серый столбец: среда GY, белый столбец: среда на соевой муке). Культивирование в каждой среде (10 мл) проводили при 28°C при 300 об/мин в течение 5 дней.

Фигура 3 показывает промоторную активность GAL10-2p. Эта фигура показывает промоторную активность, индуцированного при добавлении галактозы.

Фигура 4 показывает промоторную активность PP7p и его укороченных промоторов. Культивирование проводили в среде GY (10 мл) при 28°C при 300 об/мин в течение 5 дней.

Фигура 5 показывает промоторную активность CIT1p и его укороченных промоторов. Культивирование проводили в среде GY (10 мл) при 28°C при 300 об/мин в течение 3 дней.

Фигура 6 показывает промоторную активность PP3p и его укороченных промоторов. Культивирование проводили в среде GY (10 мл) при 28°C при 300 об/мин в течение 10 дней.

Фигура 7 показывает промоторную активность PP6p и его укороченных промоторов. Культивирование проводили в среде GY (10 мл) при 28°C при 300 об/мин в течение 5 дней.

Фигура 8 показывает промоторную активность HSC82p и его укороченных промоторов. Культивирование проводили в среде GY (10 мл) при 28°C при 300 об/мин в течение 5 дней.

Фигура 9 показывает промоторную активность SSA2p и его укороченных промоторов. Культивирование проводили в среде GY (10 мл) при 28°C при 300 об/мин в течение 5 дней.

Фигура 10 показывает промоторную активность GAPp и его укороченных промоторов. Культивирование проводили в среде GY (10 мл) при 28°C при 300 об/мин в течение 5 дней.

Фигура 11 показывает промоторную активность GAL10-2p и его укороченных промоторов.

Фигура 12A показывает выравнивание гена GUS из E. coli (последовательность кДНК: SEQ ID NO: 29, аминокислотная последовательность: SEQ ID NO: 30) и гена GUSm (последовательность кДНК: SEQ ID NO: 31, аминокислотная последовательность: SEQ ID NO: 32), который был модифицирован таким образом, чтобы адаптировать применение кодонов гена GUS из E. coli к микроорганизмам рода Mortierella.

Фигура 12B является продолжением Фигуры 12A.

НАИЛУЧШИЙ СПОСОБ ОСУЩЕСТВЛЕНИЯ ИЗОБРЕТЕНИЯ

[0009] Ниже настоящее изобретение будет описано более подробно. Следующие варианты осуществления настоящего изобретения приведены для описания настоящего изобретения, и не следует считать, что настоящее изобретение ограничивается только этими вариантами осуществления настоящего изобретения. Настоящее изобретение можно выполнить в разных режимах без отступления от сущности настоящего изобретения.

Следует отметить, что все публикации, процитированные в данной заявке, включая документы, касающиеся предшествующего уровня техники, патентные бюллетени и другие патентные документы, включены в настоящую заявку посредством ссылки. Более того, это описание изобретения включает содержимое, раскрытое в описании изобретения и чертежах заявки на патент Японии № 2013-066265 (поданной 27 марта 2013 г.), на основании которой по настоящей заявке испрашивается приоритет.

[0010] Если иное не определено в настоящей заявке, нуклеотидные последовательности показаны так, что их 5'-конец находится слева, а 3'-конец справа.

[0011] 1. Промоторы

Авторам настоящего изобретения удалось, опережая других, клонировать несколько типов промоторных последовательностей из продуцирующего липид грибка M. alpina, как описано более подробно далее в разделе Примеров. Более того, авторы настоящего изобретения также подтвердили, что белки, экспрессирующиеся под данными промоторами, проявляют биологическую активность.

Промоторами, в соответствии с настоящим изобретением, являются PP7p, CIT1p, PP3p, PP2p, PP6ps, HSC82p, SSA2p, GAL10-2p и/или их частичными последовательностями (укороченными последовательностями). Данные последовательности промоторных областей и их укороченные последовательности показаны в таблице ниже.

Любая последовательность, выбранная из нуклеотидных последовательностей, показанных в таблице, т.е. любая последовательность, выбранная из группы, состоящая из SEQ ID NO: с 1 по 28, здесь и далее называют «последовательностью промотора согласно настоящему изобретению».

[0012] [Таблица 1]

Таблица 1
Последовательность промотора: название
(SEQ ID NO)
Последовательность укороченного промотора: название
(SEQ ID NO)
PP7p PP7p D1000 PP7p D750 PP7p D500
(SEQ ID NO: 1) (SEQ ID NO: 2) (SEQ ID NO: 3) (SEQ ID NO: 4)
CIT1p CIT1p D1300 CIT1p D1000 CIT1p D700 CIT1p D400
(SEQ ID NO: 5) (SEQ ID NO: 6) (SEQ ID NO: 7) (SEQ ID NO: 8) (SEQ ID NO: 9)
PP3p PP3p D1600 PP3p D1200
(SEQ ID NO: 10) (SEQ ID NO: 11) (SEQ ID NO: 12)
PP2p
(SEQ ID NO: 13)
PP6p PP6p D1000 PP6p D750
(SEQ ID NO: 14) (SEQ ID NO: 15) (SEQ ID NO: 16)
HSC82p HSC82p D800 HSC82p D600 HSC82p D400 HSC82p D200
(SEQ ID NO: 17) (SEQ ID NO: 18) (SEQ ID NO: 19) (SEQ ID NO: 20) (SEQ ID NO: 21)
SSA2p SSA2p D850 SSA2p D600 SSA2p D400 SSA2p D200
(SEQ ID NO: 22) (SEQ ID NO: 23) (SEQ ID NO: 24) (SEQ ID NO: 25) (SEQ ID NO: 26)
GAL10-2p GAL10-2p D2000
(SEQ ID NO: 27) (SEQ ID NO: 28)

[0013] Таким образом, настоящее изобретение относится к следующему полинуклеотиду в качестве промотора, проявляющего высокую экспрессионную активность в клетках микроорганизмов, относящихся к роду Mortierella.

Полинуклеотид, соответствующий любому, выбираемому из группы, состоящей из пунктов с (а) по (с), показанных ниже:

(а) полинуклеотид, который содержит последовательность промотора согласно настоящему изобретению;

(b) полинуклеотид, который содержит нуклеотидную последовательность с идентичностью равной 90% или более по отношению к последовательности промотора согласно настоящему изобретению и который проявляет промоторную активность в клетках микроорганизмов, относящихся к роду Mortierella; и

(c) полинуклеотид, который может гибридизоваться в жестких условиях с полинуклеотидом, состоящим из нуклеотидной последовательности, комплементарной последовательности промотора согласно настоящему изобретению, и который проявляет промоторную активность в клетках микроорганизмов, относящихся к роду Mortierella.

[0014] Каждый из указанных выше полинуклеотидов, показанных в п. с (а) по (с), здесь и далее называют «полинуклеотид согласно настоящему изобретению».

Более того, в контексте настоящего изобретения «обладающий» последовательностью промотора согласно настоящему изобретению означает «содержащий» последовательность промотора согласно настоящему изобретению. Таким образом, дополнительную последовательность (последовательности) (например, последовательность энхансера), отличную от последовательности промотора согласно настоящему изобретению, можно добавить до (с 5'-конца) или после (с 3'-конца) последовательности промотора согласно настоящему изобретению. Такую дополнительную последовательность можно добавить к последовательности промотора согласно настоящему изобретению через нуклеотидную последовательность длиной от 1 до 1000 п.о., от 1 до 900 п.о., от 1 до 800 п.о., от 1 до 700 п.о., от 1 до 600 п.о., от 1 до 500 п.о., от 1 до 400 п.о., от 1 до 300 п.о., от 1 до 200 п.о., от 1 до 100 п.о., от 1 до 75 п.о., от 1 до 50 п.о., от 1 до 25 п.о., от 1 до 10 п.о. или в качестве альтернативы можно напрямую добавить к последовательности промотора согласно настоящему изобретению (т.е. число нуклеотидных остатков, расположенных между последовательностью промотора согласно настоящему изобретению и дополнительной последовательностью, равно 0).

[0015] В рамках изобретения термин «полинуклеотид» предназначен для обозначения ДНК или РНК.

В рамках изобретения выражение «полинуклеотид, который может гибридизоваться в жестких условиях» предназначено для обозначения, например, полинуклеотида, который можно получить посредством, например, гибридизации колоний, гибридизации бляшек или Саузерн гибридизации, применяя в качестве зонда целый полинуклеотид или его часть, состоящий из нуклеотидной последовательности, комплементарной последовательности промотора согласно настоящему изобретению. Для гибридизации можно использовать способы, как описанные, например, в "Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor, Laboratory Press 2001" and "Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997."

[0016] В рамках изобретения термин «жесткие условия» предназначен для обозначения, например, условий (1) 5 × цитратно-солевой буфер, 5 × раствор Денхардта, 0,5% додецилсульфата натрия, 50% формамида и 50°C, (2) 0,2 × цитратно-солевой буфер, 0,1% додецилсульфата натрия и 60°C, (3) 0,2 × цитратно-солевой буфер, 0,1% додецилсульфата натрия и 62°C, (4) 0,2 × цитратно-солевой буфер, 0,1% додецилсульфата натрия и 65°C или (5) 0,1 × цитратно-солевой буфер, 0,1% додецилсульфата натрия и 65°C, не ограничиваясь ими. В данных условиях ожидают, что ДНК, обладающую большей идентичностью последовательности, можно более эффективно получить при более высокой температуре. Однако на жесткость гибридизации будет влиять множество факторов, включая температуру, концентрацию зонда, длину зонда, ионную силу, время реакции, концентрацию соли и т.д. Специалисты в данной области техники смогут добиться такой же жесткости, должным образом подбирая данные факторы.

[0017] Следует отметить, что при использовании коммерческого набора для гибридизации в этих целях в качестве примера можно применять систему прямого мечения и детектирования Alkphos Direct Labelling and Detection System (GE Healthcare). В этом случае гибридизацию можно проводить в соответствии с протоколом, включенным в набор, т.е. мембрану можно инкубировать в течение ночи с меченным зондом, а затем промывать первичным промывочным буфером, содержащим 0,1% (вес/объем) додецилсульфата натрия, в условиях 55°C для детектирования гибридизованной ДНК. В качестве альтернативы, при применении коммерческого реактива (например, смеси для мечения ПЦР PCR labeling mix (Roche Diagnostics)) для мечения зонда дигоксигенином (DIG, digoxigenin) во время подготовки зонда на основе целой или части нуклеотидной последовательности, комплементарной последовательности промотора согласно настоящему изобретению можно применять набор для детектирования нуклеиновых кислот DIG nucleic acid detection kit (Roche Diagnostics) для детектирования гибридизации.

[0018] В дополнение к перечисленным выше другие способные к гибридизации полинуклеотиды включают полинуклеотиды и идентичностью равной 90% или более, 91% или более, 92% или более, 93% или более, 94% или более, 95% или более, 96% или более, 97% или более, 98% или более, 99% или более, 99,1% или более, 99,2% или более, 99,3% или более, 99,4% или более, 99,5% или более, 99,6% или более, 99,7% или более, 99,8% или более, или 99,9% или более по отношению к последовательности промотора согласно настоящему изобретению, по данным расчета с помощью программ поиска гомологии, таких как FASTA или BLAST с параметрами, заданными по умолчанию.

[0019] Следует отметить, что идентичность нуклеотидных последовательностей можно определить с помощью FASTA (Science 227 (4693): 1435-1441, (1985)) или алгоритма Карлин и Альтшуль (Karlin and Altschul), BLAST (Basic Local Alignment Search Tool) (Proc. Natl. Acad. Sci. USA 872264-2268, 1990; Proc Natl Acad Sci USA 90: 5873, 1993). На основании алгоритма BLAST, были разработаны программы, называемые blastn, blastx, tblastn и tblastx (Altschul SF, et al: J Mol Biol 215: 403, 1990). При применении blastn для анализа нуклеотидной последовательности можно задать параметры, например, такие вес = 100 и длина слова = 12. При применении программ BLAST и Gapped BLAST в каждой программе можно применять параметры, заданные по умолчанию.

[0020] В контексте настоящего изобретения термин «промоторная активность» предназначен для обозначения того, что при введении последовательности кодирующего белок гена (здесь и далее называемого «целевой ген») после промотора согласно настоящему изобретению получают продукта экспрессии данного гена.

В рамках изобретения термин «продукт экспрессии» предназначен для обозначения либо РНК (например, гяРНК (гетерогенной ядерной РНК), мРНК, миРНК (малой интерферирующей РНК) или микроРНК), которая является продуктом транскрипции данного гена, либо белка, который является продуктом трансляции данного гена, либо и РНК, и белка.

[0021] Введение целевого гена можно провести так, чтобы 5’-конец целевого гена был расположен в области в пределах 500 п.о., 400 п.о., 300 п.о., 200 п.о., 100 п.о., 50 п.о., 30 п.о. или 10 п.о. от 3’-конца последовательности промотора согласно настоящему изобретению.

[0022] При попытке подтвердить активность последовательности промотора согласно настоящему изобретению целевой ген никак не ограничивают, но предпочитают ген, кодирующий белок, чью активность можно измерить установленным способом.

[0023] Примеры такого гена включают, но не ограничиваются выбором селективных маркерных генов, таких как гена устойчивости к неомицину, гена гидромицин B фосфотрансферазы и т.д., а также экспрессионных репортерных генов, таких как генов LacZ, GFP (Green Fluorescence Protein, зеленого флуоресцентного белка) и люциферазы и пр.

[0024] Предпочтительно, подтверждать промоторную активность можно, применяя ген β-D-глюкуронидазы (GUS) для измерения активности GUS. В тех случаях, когда M. alpina применяют в качестве хозяина, предпочтительно, чтобы ген GUS был геном GUSm, частота применения кодонов которого адаптирована к M. alpina.

Активность GUS можно измерить, как описано ниже: применить последовательность промотора согласно настоящему изобретению, чтобы вызвать экспрессию гена GUS в клетках микроорганизмов, относящихся к роду Mortierella, затем запустить реакцию белка GUS, собранного с клеток, с п-нитрофенил-β-D-глюкуронидом и в реакционной смеси измерить поглощение в течение времени при длине волны 405 нм, а затем провести расчет на основании измеренных значений в соответствии со следующим уравнением:

Активность GUS (нмоль/(мг⋅мин)) =

1000 × [(величина наклона графика зависимости поглощения от времени для каждого образца)/(величина наклона калибровочного графика)]/[(концентрация белка в образце)/5]

[0025] Ген GUS, применяемый с этой целью, как правило, является геном GUS из E. coli (последовательность кДНК: SEQ ID NO: 29, аминокислотная последовательность: SEQ ID NO: 30). В тех случаях, когда последовательность промотора согласно настоящему изобретению применяют, чтобы вызвать экспрессию гена GUS в клетках микроорганизмов, относящихся к роду Mortierella, можно применять ген GUSm (последовательность кДНК: SEQ ID NO: 31, аминокислотная последовательность: SEQ ID NO: 32), который был модифицирован таким образом, чтобы адаптировать применение кодонов гена GUS из E. coli к микроорганизмам рода Mortierella.

Что касается примеров модификации кодонов, можно сослаться на выравнивание GUSm и GUS, показанное на Фигуре 12A и Фигуре 12B.

[0026] Промоторная активность в настоящем изобретении предпочтительно предназначена для обеспечения активности белка GUS равной по меньшей мере 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800 или 2000 нмоль/(мг⋅мин) при экспрессии репортерного гена GUS в клетках микроорганизмов, относящихся к роду Mortierella, как описано выше.

Процедуры переноса генов в хозяйскую клетку описаны далее.

[0027] Упомянутый выше полинуклеотид согласно настоящему изобретению можно получить с помощью известных генно-инженерных процедур или известных процедур синтеза.

[0028] 2. Векторы и трансформанты

В другом варианте настоящее изобретение также представляет экспрессионный вектор, содержащий полинуклеотид согласно настоящему изобретению (здесь и далее называемый «вектор настоящего изобретения»).

Вектор настоящего изобретения, как правило, составлен так, что он содержит:

(i) промотор согласно настоящему изобретению; и

(ii) экспрессионную кассету, содержащую составные элементы, сигналы, которые функционируют в хозяйской клетке для терминации транскрипции и полиаденилирования молекулы РНК.

Составленный таким образом вектор вводят в хозяйские клетки. Примеры подходящих хозяйских клеток, применяемых в настоящем изобретении, включают продуцирующие липиды грибки, дрожжи и подобное.

[0029] В качестве продуцирующих липиды грибков можно применять штаммы, как описанные в MYCOTAXON, Vol. XLIV, No. 2, pp. 257-265 (1992). Конкретные примеры включают микроорганизмы, относящиеся к роду Mortierella, на примере микроорганизмов, относящихся к подроду Mortierella, таких как Mortierella elongata IFO8570, Mortierella exigua IFO8571, Mortierella hygrophila IFO5941, Mortierella alpina IFO8568, ATCC16266, ATCC32221, ATCC42430, CBS 219.35, CBS224.37, CBS250.53, CBS343.66, CBS527.72, CBS528.72, CBS529.72, CBS608.70, CBS754.68 и пр., а также микроорганизмов, относящихся к подроду Micromucor, таким как Mortierella isabellina CBS194.28, IFO6336, IFO7824, IFO7873, IFO7874, IFO8286, IFO8308, IFO7884, Mortierella nana IFO8190, Mortierella ramanniana IFO5426, IFO8186, CBS112.08, CBS212.72, IFO7825, IFO8184, IFO8185, IFO8287, Mortierella vinacea CBS236.82 и пр. Особенно предпочтительным является Mortierella alpina.

[0030] Такой вектор можно получить, начиная с существующего экспрессионного вектора, например, pDura5 (Appl. Microbiol. Biotechnol., 65, 419-425, (2004)), pBIG35 (Appl. Environ. Microbiol., (2009), vol. 75, p. 5529-5535), pD4 (Appl. Environ. Microbiol., November 2000, 66(11), p. 4655-4661), pDZeo (J. Biosci. Bioeng., December 2005, 100(6), p. 617-622), pDX vector (Curr. Genet., 2009, 55(3), p. 349-356) или pBIG3ura5 (Appl. Environ. Microbiol., 2009, 75, p. 5529-5535) посредством замены промоторной области в исходном экспрессионном векторе последовательностью промотора согласно настоящему изобретению, хотя исходный вектор не ограничен приведенными выше векторами.

[0031] Для трансформации хозяйских клеток можно применять селективный маркер, чтобы подтвердить, что вектор был введен. Примеры доступных для применения селективных маркеров включают ауксотрофные маркеры (ura5, niaD, trp1), маркеры лекарственной устойчивости (гигромицин, зеоцин), ген устойчивости к генетицину (G418r), ген устойчивости к меди (CUP1) (Marin et al., Proc. Natl. Acad. Sci. USA, 81, 337 1984), гены устойчивости к церуленину (fas2m, PDR4) (Junji Inokoshi et al., Biochemistry, vol. 64, p. 660, 1992; Hussain et al., gene, 101, 149, 1991) и подобные.

[0032] Примеры ауксотрофных маркеров включают, но не ограничиваются п. с (1) по (15), показанными ниже:

(1) метиониновый ауксотрофный маркер: met1, met2, met3, met4, met5, met6, met7, met8, met10, met13, met14 или met20;

(2) тирозиновый ауксотрофный маркер: tyr1 или изолейцин;

(3) валиновый ауксотрофный маркер: ilv1, ilv2, ilv3 или ilv5;

(4) фенилаланиновый ауксотрофный маркер: pha2;

(5) ауксотрофный маркер глутаминовой кислоты: glu3;

(6) треониновый ауксотрофный маркер: thr1 или thr4;

(7) ауксотрофный маркер аспарагиновой кислоты: asp1 или asp5;

(8) сериновый ауксотрофный маркер: ser1 или ser2;

(9) аргининовый ауксотрофный маркер: arg1, arg3, arg4, arg5, arg8, arg9, arg80, arg81, arg82 или arg84;

(10) урациловый ауксотрофный маркер: ura1, ura2, ura3, ura4, ura5 или ura6;

(11) адениновый ауксотрофный маркер: ade1, ade2, ade3, ade4, ade5, ade6, ade8, ade9, ade12 или ADE15;

(12) лизиновый ауксотрофный маркер: lys1, lys2, lys4, lys5, lys7, lys9, lys11, lys13 или lys14;

(13) триптофановый ауксотрофный маркер: trp1, trp2, trp3, trp4 или trp5;

(14) лейциновый ауксотрофный маркер: leu1, leu2, leu3, leu4 или leu5; и

(15) гистидиновый ауксотрофный маркер: his1, his2, his3, his4, his5, his6, his7 или his8.

[0033] Примеры маркеров лекарственной устойчивости включают, но не ограничиваются геном устойчивости к гигромицину (гигромицину B), геном устойчивости к блеомицину t (плеомицину) (Transformation of filamentous fungi based on hygromycin b and phleomycin resistance markers, Methods in Enzymology, Volume 216, 1992, Pages 447-457, Peter J. Punt, Cees A.M.J.J. van den Hondel), геном устойчивости к биалафосу (Avalos, J., Geever, R. F., and Case, M. E. 1989. Bialaphos resistance as a dominant selectable marker in Neurospora crassa. Curr. Genet. 16: 369-372), геном устойчивости к сульфонилмочевине (Zhang, S., Fan, Y., Xia, Y.X., and Keyhani, N.O. (2010) Sulfonylurea resistance as a new selectable marker for the entomopathogenic fungus Beauveria bassiana. Appl Microbiol Biotechnol 87: 1151-1156), геном устойчивости к беномилу (Koenraadt, H., S. C. Sommerville, and A. L. Jones. 1992. Characterization of mutations in the beta-tubulin gene of benomyl-resistant field strains of Venturia inaequalis and other pathogenic fungi. Mol. Plant Pathol. 82:1348-1354), геном ассимиляции ацетамида (ацетамидазой, AmdS) (Kelly, J. M. and Hynes, M. J. (1985). Transformation of Aspergillus niger by the Eamds gene of Aspergiilus nidulans. EMBO J. 4, 475-479) и подобным.

[0034] Для трансформации хозяйских клеток можно применять известные способы. Например, в случае с продуцирующими липиды грибками можно применять электропорацию (Mackenxie D. A. et al. Appl. Environ. Microbiol., 66, 4655-4661, 2000), способ доставки частиц (описанный в японском патенте JP 2005-287403 под названием “Breeding Method of Lipid Producing Fungi”) или способом с применением Agrobacterium, не ограничиваясь ими.

[0035] Кроме того, рассматривая стандартные способы клонирования, можно сослаться на "Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor Laboratory Press 2001" and "Methods in Yeast Genetics, A laboratory manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY)," и подобное.

[0036] 3. Способ получения белков, липидов или жирных кислот

В другом варианте применения настоящее изобретение также представляет способ получения белков, липидов или жирных кислот с помощью указанного выше трансформанта.

Целевой ген экспрессируется на высоком уровне в нечеловеческом трансформанте, трансформированном промотором согласно настоящему изобретению (здесь и далее называемом «трансформант настоящего изобретения»), особенно полученный с помощью микроорганизма, относящегося к роду Mortierella, в качестве хозяйской клетки. Таким образом, при применении трансформанта настоящего изобретения можно эффективно производить целевой белок.

[0037] Например, целевой ген можно эффективно ввести в вектор настоящего изобретения и культивировать трансформант, трансформированный данным вектором, в результате чего можно экспрессировать целевой белок с целевого гена в клетках трансформанта.

Экспрессированный целевой белок можно собрать, например, получив клеточный лизат из трансформанта и обработав этот лизат в соответствии с известными процедурами. При рассмотрении подробностей сбора целевого белка можно сослаться на "Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor Laboratory Press 2001" and "Methods in Yeast Genetics, A laboratory manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY)" и подобное.

[0038] Целевой ген никак не ограничен, но предпочтительно, чтобы он был геном, кодирующим липидсинтазу (здесь и далее называемым «ген липидсинтазы»). Примеры включают гены, кодирующие ацил-КоА-синтазу, глицерин-3-фосфатацилтрансферазу, диацилглицеринацилтрансферазу, элонгазу жирных кислот, ген Δ9-десатуразы жирных кислот, ген Δ12-десатуразы жирных кислот, ген Δ6-десатуразы жирных кислот, ген Δ5-десатуразы жирных кислот, ген Δ4-десатуразы жирных кислот, ген ω3-десатуразы жирных кислот, ген лизофосфолипилацилтрансферазы, ген фосфатазы фосфатидной кислоты, ген синтетазы жирных кислот, ген ацетил-КоА-карбоксилазы и ген АТФ:цитратлиазы.

[0039] При применении клеток, способных синтезировать липиды, например, продуцирующих липиды грибков или подобных, в качестве хозяина для экспрессии гена липидсинтазы, липидсинтаза, экспрессирующаяся с данного гена, вызывает синтез липидов и/или жирных кислот, которые впоследствии можно собрать. Таким образом, при культивировании трансформанта настоящего изобретения можно получить липиды и/или жирные кислоты с высокой эффективностью.

[0040] Липиды или жирные кислоты можно экстрагировать, как описано далее, из клеток, трансформированных в соответствии с настоящим изобретением. После культивирования трансформированный штамм организма (например, продуцирующего липиды грибка или дрожжей) обрабатывают стандартным способом, например, центрифугированием или фильтрацией, для получения культивируемых клеток. Клетки тщательно промывают водой и, предпочтительно, впоследствии высушивают. Высушивание можно провести посредством лиофилизации, высушивания на воздухе и т.п. Высушенные клетки при необходимости можно гомогенизировать, например, с помощью Dynomil или обработки ультразвуком, а затем экстрагировать органическим растворителем, предпочтительно в потоке азота. Органические растворители, применяемые для этой цели, включают простой эфир, гексан, метанол, этанол, хлороформ, дихлорметан, петролейный эфир и подобные. В качестве альтернативы хорошие результаты можно получить при чередующейся экстракции метанолом и петролейным эфиром или при экстракции однофазной системой растворителей хлороформ-метанол-вода. После отгонки органического растворителя из экстракта при пониженном давлении можно получить содержащие жирные кислоты липиды. Экстрагированные жирные кислоты можно перевести в соответствующие метиловые эфиры с помощью способа с применением соляной кислоты и метанола и т.п.

[0041] Более того, жирные кислоты можно отделить в виде смешанных жирных кислот или смешанных сложных эфиров жирных кислот от содержащих жирные кислоты липидов посредством концентрирования и разделения стандартным способом (например, добавлением мочевины, разделением при охлаждении, колоночной хроматографией).

ПРИМЕРЫ

[0042] Здесь настоящее изобретение будет описано подробнее с помощью следующих примеров, не предназначенных для ограничения объема настоящего изобретения.

[0043] Геномный анализ Mortierella alpina

Штамм M. alpina 1S-4 инокулировали в 100 мл среды GY2:1 (2% глюкоза, 1% дрожжевой экстракт, pH 6,0) и культивировали при 28°C в течение 2 дней при перемешивании. Клетки собирали фильтрацией, а их геномную ДНК получали с помощью DNeasy (QIAGEN).

Нуклеотидную последовательность указанной выше геномной ДНК определяли с помощью Roche 454 GS FLX Standard, проводя секвенирование нуклеотидов в два подхода для библиотеки фрагментов и в три подхода для библиотеки спаренных концов. Полученные в результате нуклеотидные последовательности объединяли для получения 300 суперконтигов.

[0044] Анализ экспрессии

Штамм M. alpina 1S-4 инокулировали в 100 мл среды (1,8% глюкоза, 1% дрожжевой экстракт, pH 6,0) и предварительно культивировали в течение 3 дней при 28ºC. 10-литровый культуральный сосуд (Able Co., Токио) заполняли 5 л среды (1,8% глюкозы, 1% соевой муки, 0,1% оливкового масла, 0,01% адеканола, 0,3% KH2PO4, 0,1% Na2SO4, 0,05% CaCl2⋅2H2O, 0,05% MgCl2⋅6H2O, pH 6,0) и инокулировали всем продуктом предварительного культивирования, а затем выращивали аэробную спинкультуру в условиях 300 об/мин, 1 об/об/мин (vvm) и 26ºC в течение 8 дней. В дни 1, 2 и 3 культивирования добавляли глюкозу в количестве, соответствующем 2%, 2% и 1,5%, соответственно. Клетки собирали на каждой стадии культивирования (в дни 1, 2, 3, 6 или 8) для получения общей РНК с помощью способа с применением гуанидингидрохлорида/CsCl. Применяя SOLiD™ Total RNA-Seq для полнотранскриптомных библиотек (Applied Biosystems), синтезировали кДНК на каждой стадии и секвенировали ее в SOLiD.

[0045] Клонирование промоторных областей

Клонирование проводили, как описано ниже, в промоторных областях генов, уровни экспрессии которых считали высокими в штамме M. alpina 1S-4 по результатам анализа экспрессии, или в промоторной области гомолога гена системы метаболизма галактозы.

Сначала праймеры, необходимые для ПЦР амплификации каждой промоторной области, составляли, как описано ниже. Следует отметить, что подчеркнутые части нуклеотидной последовательности праймеров, показанных ниже, представляют собой сайт узнавания рестрикционным ферментом. Праймеры составляли так, что последовательности узнавания XbaI и SpeI добавляли, соответственно, к обоим концам промоторной области. Однако только праймеры для GAL10-2p, имеющего последовательность узнавания SpeI в составе своей последовательности, составляли так, что последовательность узнавания XbaI добавляли на каждый конец. Символ «F» или «R», встречающийся в каждом названии праймера означает, что праймер является прямым (F, forward) или обратным (R, reverse), соответственно.

[0046] Промотор PP7p

PP7p F XbaI AATATCTAGATGACCGTGCGCTTTTTGAGAC (SEQ ID NO: 33)

PP7p R SpeI AGCAACTAGTCGTATATTTGTTGAAAGGTG (SEQ ID NO: 34)

Промотор CIT1p

CIT1p F XbaI ATTTTCTAGACACCTCAAAAACGTGCCTTG (SEQ ID NO: 35)

CIT1p R SpeI AATAACTAGTGGCGGATATGTGTATGGAG (SEQ ID NO: 36)

Промотор PP3p

PP3p F XbaI AACGTCTAGACGTGTTATCTTGCGCTGC (SEQ ID NO: 37)

PP3p R SpeI TCATACTAGTGATGATTTAGAGGTGTTGG (SEQ ID NO: 38)

Промотор PP2p

PP2p F XbaI AAGCTCTAGAGACTGTAAAGACGGAGGGG (SEQ ID NO: 39)

PP2p R SpeI AGTAACTAGTTGTGGATAGTGGGTAGTGG (SEQ ID NO: 40)

Промотор PP6ps

PP6ps F XbaI AAAGTCTAGACTGGCAATAGTTAGTGCACG (SEQ ID NO: 41)

PP6ps R SpeI ATCAACTAGTGATGGAGGTTTGTTTGAGAAG (SEQ ID NO: 42)

Промотор HSC82p

HSC82p F XbaI ATCATCTAGAGAGCTCAAGATGAAGGTGCTC (SEQ ID NO: 43)

HSC82p R SpeI AATAACTAGTGGTGTGTGTGGTTTGCGGG (SEQ ID NO: 44)

Промотор SSA2p

SSA2p F XbaI TTAGTCTAGAAAAGTGCTGCTTCGGAACC (SEQ ID NO: 45)

SSA2p R SpeI AGATACTAGTGATGTAGATGTGAGTGTGAG (SEQ ID NO: 46)

Промотор GAL10-2p

GAL10-2p F XbaI AATATCTAGAGGTTCCGAGAGGTGGATTTG (SEQ ID NO: 47)

GAL10-2p R XbaI ATAATCTAGATGGCTCCTGAAAGGACGAG (SEQ ID NO: 48)

Применяя геном штамма Mortierella alpina 1S-4 в качестве матрицы, клонировали каждую промоторную область с помощью ПЦР. Применяли полимеразу PrimeSTAR GXL (TaKaRa).

[0047] Создание вектора для оценки промотора

Ген GUSm (SEQ ID NO: 31), модифицированный таким образом, чтобы адаптировать применение кодонов гена GUS из E. coli (SEQ ID NO: 29) к микроорганизмам рода Mortierella (Фигура 12A и Фигура 12B), применяли в качестве репортерного гена.

GUSm лигировали в плазмиду pBIG35, содержащую гистоновый промотор (HisP), служащий конститутивным экспрессионным промотором (Appl. Environ. Microbiol., (2009), vol. 75, p. 5529-5535), для создания экспрессионной кассеты. Данную экспрессионную кассету впоследствии лигировали тандемно к гену урацилового ауксотрофного маркера (ura5) для создания бинарного вектора для трансформации pBIG35ZhGUSm (Фигура 1). Следует отметить, что ген GUSm, применяемый в этом векторе, является искусственно синтезированным геном β-D-глюкуронидазы, частота применения кодонов которого адаптирована к M. alpina. Ura5 является геном оротатфосфорибозилтрансферазы M. alpina. HisP является промотором гена гистона H4.1 M. alpina. SdhBt является терминатором гена сукцинатдегидрогеназы M. alpina. ColE1 ori является точкой начала репликации, NPTII является геном устойчивости к канамицину, TrfA является геном, отвечающим за амплификацию плазмиды, а левая и правая границы являются повторяющимися последовательностями для переноса гена.

Каждую их промоторных областей, клонированных, как описано выше, вырезали с помощью рестрикционных ферментов XbaI и SpeI или с помощью рестрикционного фермента XbaI, а затем вставляли на место HisP в разрезанный XbaI и SpeI вектор pBIG35ZhGUSm.

[0048] Трансформация Mortierella alpina

Ауксотрофный по урацилу штамм (Δura-3) индуцировали из штамма M. alpina 1S-4 в соответствии с процедурами, описанными в патентном документе (WO2005/019437), и культивировали на содержащей 0,05 мг/мл урацила агаризованной среде Чапека-Докса (Czapek-Dox) (3% сахароза, 0,2% NaNO3, 0,1% KH2PO4, 0,05% KC1, 0,05% MgSO4⋅7H2O, 0,001% FeSO4⋅7H2O, 2% агар, pH 6,0). Полученный таким образом продукт культивирования собирали и фильтровали через Miracloth (Calbiochem) для получения суспензии спор M. alpina Δura-3. Agrobacterium (Agrobacterium tumefaciens C58C1) трансформировали каждым из полученных векторов для оценки промотора посредством электропорации и культивировали при 28°C в течение 48 часов на агаризованной среде LB-Mg (1% триптон, 0,5% дрожжевой экстракт, 85 мМ NaCl, 0,5 мМ MgSO4⋅7H2O, 0,5 мМ NaOH, 1,5% агар, pH 7,0). Трансформанты Agrobacterium, несущие векторы, проверяли с помощью ПЦР. Трансформанты Agrobacterium, несущие векторы, культивировали при 28ºC при 120 об/мин в течение 2 дней при перемешивании в 100 мл минимальной среды MM (10 мМ K2HPO4, 10 мМ KH2PO4, 2,5 мМ NaCl, 2 мМ MgSO4⋅7H2O, 0,7 мМ CaCl2, 9 мкM FeSO4⋅7H2O, 4 мМ (NH4)2SO4, 10 мМ глюкоза, pH 7,0), центрифугировали при 5800 × g, а затем растворяли свежей средой IM (минимальной средой MM, содержащей 0,5% глицерин, 200 мкМ ацетосирингон и 40 мМ 2-(N-морфолино)этансульфоновая кислота (MES), и доведенной до pH 5,3) для получения суспензий. Данные суспензии культивировали на протяжении от 8 до 12 часов при 28°C при 300 об/мин при перемешивании до достижения оптической плотности OD 660 = от 0,4 до 3,7. Каждую из клеточных суспензий (100 мкл) смешивали с равным объемом указанной выше суспензии M. alpina Δura-3 (108 мл-1), распределяли по нитроцеллюлозной мембране (70 мм в диаметре; упрочненная малозольная уровня 50, Whatman), помещенной в среде сокультивирования (имеющей тот же состав, что и среда IM, за исключением того, что она содержит 5 мМ глюкозы вместо 10 мМ глюкозы и 1,5% агара), а затем культивировали при 23°C на протяжении от 2 до 5 дней. После сокультивирования мембрану переносили на не содержащую урацил и содержащую 0,03% нильский синий A (Sigma) агаризованную среду SC (5,0 г основы азотного агара без аминокислот и сульфата аммония (Difco), 1,7 г (NH4)2SO4, 20 г глюкозы, 20 мг аденина, 30 мг тирозина, 1,0 мг метионина, 2,0 мг аргинина, 2,0 мг гистидина, 4,0 мг лизина, 4,0 мг триптофана, 5,0 мг треонина, 6,0 мг изолейцина, 6,0 мг лейцина, 6,0 мг фенилаланина, 20 г/л агара) и культивировали при 28ºC в течение 5 дней. Гифы из видимых грибковых колоний переносили в не содержащую урацил среду SC. Перенос в свежую не содержащую урацил среду SC повторяли дважды, чтобы таким образом отобрать трансформанты, стабильно сохраняющие свои свойства.

[0049] Селекция экспрессирующихся на высоком уровне промоторов

Культивирование и сбор штаммов

Каждый трансформант культивировали при 28°C в течение 2 дней на агаризованной среде GY (2% глюкозы, 1% дрожжевого экстракта, 1,5% агара). После завершения культивирования клетки собирали, соскребая их вместе с агаром.

[0050] Экстракция белков из клеток

Собранные клетки смешивали с 500 мкл буфера для гомогенизации (100 мМ Трис-HCl (pH 8,0), 5 мМ 2-меркаптоэтанола) и гомогенизировали дважды при 5000 об/мин в течение 30 сек с помощью шарикового гомогенизатора TOMY beads shocker, применяя стеклянные шарики диаметром 0,1 мм. Гомогенат центрифугировали при 8000 × g в течение 10 минут и собранный супернатант впоследствии центрифугировали при 20400 × g в течение 10 минут для сбора супернатанта в виде раствора белков. В собранном растворе измеряли концентрацию белка и при желании разводили до любой концентрации буфером для гомогенизации. Все описанные выше операции проводили на льду.

[0051] Измерение активности GUS

Субстрат (п-нитрофенил-β-D-глюкуронид) растворяли в аналитическом буфере (21,7 мМ NaH2PO4, 33,9 мМ Na2HPO4, 1,11 мМ EDTA (pH 8,0)) для получения конечной концентрации равной 1,25 мМ. Этот раствор субстрата (160 мкл) и каждый образец белка (40 мкл) смешивали в 96-луночном микротитровальном планшете и измеряли поглощение при 405 нм в течение времени при 37ºC. Поглощение п-нитрофенола измеряли при 0,05 мМ, 0,1 мМ, 0,2 мМ и 0,5 мМ для получения калибровочной кривой, а значение активности GUS в каждом образце рассчитывали в соответствии со следующим уравнением:

Активность GUS (нмоль/(мг⋅мин)) =

1000 × [(величина наклона графика зависимости поглощения от времени для каждого образца)/(величина наклона калибровочного графика)]/[(концентрация белка в образце)/5]

[0052] Количество (нмоль) п-нитрофенил-β-D-глюкуронида, превращенного в п-нитрофенол под действием 1 мг/мл белка за 1 минуту определяют как 1 единицу активности GUS.

[0053] Селекция штаммов для оценки активности GUS

Стабильные трансформированные штаммы (30 штаммов), отобранные для оценки каждого промотора, культивировали на агаризованной среде GY, как описано выше, и измеряли в них активность GUS. Из этих 30 штаммов отобрали 10 штаммов, проявляющих умеренную активность GUS.

[0054] Оценка промоторной активности

Отобранные штаммы культивировали при 28ºC при 300 об/мин в течение 5 дней при перемешивании в жидкой среде GY (10 мл) или в среде на соевой муке (10 мл). После завершения культивирования клетки собирали фильтрованием и измеряли в них активность GUS. Оценивали среднее измеренных значений как промоторную активность. Полученные результаты показаны на Фигуре 2.

Было обнаружено, что оцененные промоторы обладают большей промоторной активностью, чем известные промоторы из Mortierella, HisP и GAPp, в среде GY medium и/или в среде на соевой муке.

[0055] Исследование времени культивирования и активности каждого промотора

Чтобы определить индуцированные временем культивирования изменения промоторной активности, штаммы, отобранные для каждого промотора, культивировали при 28°C при перемешивании в жидкой среде GY (10 мл) в течение 2 дней, 5 дней, 7 дней или 14 дней. После завершения культивирования клетки собирали фильтрованием и измеряли в них активность GUS. Полученные результаты показаны в таблице ниже.

[0056] [Таблица 2]

Таблица 2
Количество дней культивирования и активность каждого промотора
Активность GUS (нмоль/(мин⋅мгбелка))
Название промотора 2 дней 5 дней 7 дней 14 дней
PP7p 10000 10000 10000
CIT1p 7000 2000 1000
PP3p 2500 28000 30000
PP2p 1000 1000 4500
PP6p 10000 20000 2500
HSC82p 10000 10000 6000
SSA2p 12000 10000 14000
GAPp 3000 2500 2500
HisP 2500 2500 2500

[0057] Оценка индуцибельного промотора

Промотор GAL10-2p оценивали, как описано ниже.

Сначала стабильные трансформированные штаммы (30 штаммов) культивировали при 28°C в течение 3 дней на агаризованной среде SC + gal (агаризованная среда SC, содержащая 2% галактозы вместо 2% глюкозы) и измеряли в них активность GUS, как описано выше, чтобы таким образом отобрать 10 штаммов, проявляющих умеренную активность GUS. Эти штаммы инокулировали в жидкую среду GY, в которую добавляли галактозу в концентрации 2% в день 4 или 7. Условия культивирования задавали как 28ºC и 300 об/мин. Фигура 3 показывает активность GUS, измеренную между 2 и 14 днями после начала культивирования. Промотор GAL10-2p индуцировали к экспрессии при добавлении галактозы.

[0058] Исследование областей, необходимых для промоторной активности

Чтобы определить область, необходимую для промоторной активности каждого промотора получали фрагменты ДНК для каждого промотора, укорачивая расположенную выше область промотора, и оценивали промоторную активность.

Для получения таких фрагментов ДНК для каждого промотора получали следующие праймеры. Следует отметить, что каждая подчеркнутая часть представляют собой сайт узнавания рестрикционным ферментом.

[0059] PP7p

Праймер для амплификации промотора PP7p-D1000

PP7p D1000 F XbaI AGCATCTAGAAAAACTATTCAATAATGGGCG (SEQ ID NO: 49)

Праймер для амплификации промотора PP7p-D750

PP7p D750 F XbaI ATTTCTAGAATGGCGAGACGCAGGGGGTAG (SEQ ID NO: 50)

Праймер для амплификации промотора PP7p-D500

PP7p D500 F XbaI AATATCTAGAGAGTGGGCACTGAACTAAAAAG (SEQ ID NO: 51)

Праймер для амплификации промотора PP7p-D250

PP7p D250 F XbaI AATATCTAGAGACACTGCATGACGCGAAATC (SEQ ID NO: 52)

CIT1p

Праймер для амплификации промотора CIT1p-D1300

CIT1p D1300 F XbaI AAGTCTAGATGTCAATCATCTTTGCTGCTG (SEQ ID NO: 53)

Праймер для амплификации промотора CIT1p-D1000

CIT1p D1000 F XbaI TGCGTCTAGAATTATAATTATAATGAGGAAGTG (SEQ ID NO: 54)

Праймер для амплификации промотора CIT1p-D700

CIT1p D700 F XbaI TTATCTAGAGGCGAGTGGCGGACTGC (SEQ ID NO: 55)

Праймер для амплификации промотора CIT1p-D400

CIT1p D400 F XbaI TTGTCTAGACAATTGGCAAGGCTGGGTTG (SEQ ID NO: 56)

PP3p

Праймер для амплификации промотора PP3p-D1600

PP3p D1600 R XbaI AATATCTAGAGATCCTGGTCGAAAAAGACAG (SEQ ID NO: 57)

Праймер для амплификации промотора PP3p-D1200

PP3p D1200 R XbaI AATGTCTAGATGAGTTTCTGTTTTTTCCTTTTTGC (SEQ ID NO: 58)

Праймер для амплификации промотора PP3p-D800

PP3p D800 R XbaI AATATCTAGATGAACAATTCATGCAGCTTCACG (SEQ ID NO: 59)

Праймер для амплификации промотора PP3p-D400

PP3p D400 R XbaI AATATCTAGACGTCTAAGCGTTTACGTGCC (SEQ ID NO: 60)

Праймер для амплификации промотора PP3p-D200

PP3p D200 R XbaI AATATCTAGACTCGTTTTGATGGAGTTCTC (SEQ ID NO: 61)

PP2p

Праймер для амплификации промотора PP2p-D1200

PP2p D1200 F XbaI ATTTCTAGATGCATTTACAGGTGAATATTAC (SEQ ID NO: 62)

Праймер для амплификации промотора PP2p-D800

PP2p D800 F XbaI TTATCTAGACATAAAAGTGTCTGGAGCG (SEQ ID NO: 63)

Праймер для амплификации промотора PP2p-D400

PP2p D400 F XbaI TTATCTAGAACTAAGTGGTGTCTACTTTGG (SEQ ID NO: 64)

Праймер для амплификации промотора PP2p-D200

PP2p D200 F XbaI AATTCTAGAGGATACTCCATCCCCACCC (SEQ ID NO: 65)

Праймер для амплификации промотора PP6ps

PP6ps-D1000

PP6ps D1000 F XbaI AATTCTAGACAGTTACCGTGCGCCCACTG (SEQ ID NO: 66)

Праймер для амплификации промотора PP6ps-D750

PP6ps D750 F XbaI AATTCTAGACTTTCACAAATAGGCATCCTATC (SEQ ID NO: 67)

Праймер для амплификации промотора PP6ps-D500

PP6ps D500 F XbaI AATTCTAGAGGCTTTTTCGTTTATTGGATTG (SEQ ID NO: 68)

Праймер для амплификации промотора PP6ps-D100

PP6ps D100 F XbaI ACGTCTAGATATCCAATTCTCACCACTTC (SEQ ID NO: 69)

HSC82p

Праймер для амплификации промотора HSC82p-D800

HSC82p D800 F XbaI AATTCTAGATTTTACTACCGCATTCCCTTTTC (SEQ ID NO: 70)

Праймер для амплификации промотора HSC82p-D600

HSC82p D600 F XbaI ACGTCTAGACCTTTTCAGTAAACAATTTC (SEQ ID NO: 71)

Праймер для амплификации промотора HSC82p-D400

HSC82p D400 F XbaI ATTTCTAGACACAAAGAAGAAGGGTGTGTC (SEQ ID NO: 72)

Праймер для амплификации промотора HSC82p-D200

HSC82p D200 F XbaI ACGTCTAGAACTGTTTTCTTGAAACTTC (SEQ ID NO: 73)

SSA2p

Праймер для амплификации промотора SSA2p-D850

SSA2p D850 F SpeI AGTAACTAGTTGACGGCGTGTATATGTCAG (SEQ ID NO: 74)

Праймер для амплификации промотора SSA2p-D600

SSA2p D600 F SpeI AGGTACTAGTCCATTGTATCGATTTCTGAT (SEQ ID NO: 75)

Праймер для амплификации промотора SSA2p-D400

SSA2p D400 F SpeI AGTAACTAGTGCTATGCGAACGGTTCATTTTG (SEQ ID NO: 76)

Праймер для амплификации промотора SSA2p-D200

SSA2p D200 F SpeI AGGTACTAGTTTTTTTCTCTCTGGTGTGAACG (SEQ ID NO: 77)

GAL10-2p

Праймер для амплификации промотора GAL10-2p-D2000

GAL10-2p D2000 F XbaI AATTCTAGACGCAGAGTGATGGTCATTACC (SEQ ID NO: 78)

Праймер для амплификации промотора GAL10-2p-D1600

GAL10-2p D1600 F XbaI AATTCTAGACTCTATGGCAAGATTACGAG (SEQ ID NO: 79)

Праймер для амплификации промотора GAL10-2p-D1200

GAL10-2p D1200 F XbaI AATTCTAGATGCTCGTGAAGAGGGGCAC (SEQ ID NO: 80)

Праймер для амплификации промотора GAL10-2p-D800

GAL10-2p D800 F XbaI ACGTCTAGACATTTTTTGCCGCCAATTCTG (SEQ ID NO: 81)

Праймер для амплификации промотора GAL10-2p-D400

GAL10-2p D400 F XbaI ATTTCTAGACCCCCGCCTATTTTTTTTTTC (SEQ ID NO: 82)

[0060] Для получения укороченных промоторов каждого промотора полученный ранее вектор для оценки каждого промотора применяли в качестве матрицы в ПЦР с указанными выше праймерами и с обратными праймерами, применяемыми в примерах (PP7p R SpeI, CIT1p R SpeI, PP3p R SpeI, PP2p R SpeI, PP6ps R SpeI, HSC82p R SpeI, SSA2p R SpeI, GAL10-2p R XbaI), каждый из которых соответствует 3’-концу каждого промотора. Каждый из образованных в результате фрагментов ДНК разрезали рестрикционными ферментами XbaI и SpeI или рестрикционным ферментом XbaI, а затем вставляли в вектор для оценки промотора.

Так же, как описано в разделе «Трансформация Mortierella alpine» трансформировали M. alpina для отбора стабильных трансформированных штаммов. В этих штаммах измеряли активность GUS таким же способом, как и способ, применяемый в примерах. Следует отметить, что количество дней культивирования устанавливали равным 3 дням (CIT1p), 5 дням (PP7p, PP6p, HSC82p, SSA2p, GAPp) или 10 дням (PP3p), в зависимости от свойств каждого промотора. Полученные результаты показаны на Фигурах с 4 по 10.

[0061] В случае индуцируемого галактозой промотора стабильные трансформированные линии предварительно культивировали при 28°C в течение 3 дней на агаризованной среде SC + gal (агаризованная среда SC, содержащая 2% галактозы вместо 2% глюкозы) или предварительно культивировали при 28ºC при 300 об/мин в течение 4 дней в среде SC + raf (жидкая среда SC, содержащая 2% раффинозы вместо 2% глюкозы), после чего добавляли галактозу до конечной концентрации 2%. Культивирование продолжали дополнительно 1 день и измеряли активность GUS в клетках. Полученные результаты показаны на Фигуре 11.

[0062] Как видно на Фигурах с 4 по 10, было получено подтверждение того, что каждый из полноразмерных промоторов и укороченных промоторов, показанных в Таблице 1 выше, проявляет активность белка GUS равную 500 нмоль/(мг⋅мин) или выше.

[0063] ПРОМЫШЛЕННАЯ ПРИМЕНИМОСТЬ

Настоящее изобретение обеспечивает высокий уровень экспрессии целевых генов в продуцирующих липиды грибках и таким образом обеспечивает эффективный синтез и получение целевых белков, липидов и жирных кислот.

[0064] Список последовательностей в произвольной форме

SEQ ID NOs: с 31 по 82: синтетические ДНК

1. Полинуклеотид, соответствующий любому, выбираемому из группы, состоящей из (а)-(с), показанных ниже, для обеспечения высокой экспрессии целевого гена в микроорганизме, относящемся к роду Mortierella:

(а) полинуклеотид, который состоит из любой нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: с 22 по 26;

(b) полинуклеотид, который имеет нуклеотидную последовательность с идентичностью 90% или более по отношению к любой нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: с 22 по 26, и который проявляет промоторную активность в клетках микроорганизмов, относящихся к роду Mortierella; и

(с) полинуклеотид, который может гибридизоваться в жестких условиях с полинуклеотидом, состоящим из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, выбираемых из группы, состоящей из SEQ ID NO: с 22 по 26, и который проявляет промоторную активность в клетках микроорганизмов, относящихся к роду Mortierella.

2. Полинуклеотид по п.1, в котором промоторную активность подтверждают как активность белка GUS равную по меньшей мере 500 нмоль/(мг⋅мин) при экспрессии репортерного гена GUS в клетках микроорганизмов, относящихся к роду Mortierella.

3. Полинуклеотид по п.1, который состоит из любой нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: с 22 по 26.

4. Полинуклеотид по п.1, который представляет собой ДНК.

5. Вектор, содержащий полинуклеотид по любому из пп.1-4, для трансформации микроорганизма, относящегося к роду Mortierella.

6. Нечеловеческий трансформант, трансформированный полинуклеотидом по любому из пп.1-4, для обеспечения высокой экспрессии целевого гена, причем трансформант представляет собой микроорганизм, относящийся к роду Mortierella.

7. Нечеловеческий трансформант, трансформированный вектором по п.5, для обеспечения высокой экспрессии целевого гена, причем трансформант представляет собой микроорганизм, относящийся к роду Mortierella.

8. Трансформант по п.6 или 7, в котором микроорганизмом, относящимся к роду Mortierella, является Mortierella alpina.



 

Похожие патенты:

Изобретение относится к области биотехнологии и биохимии, в частности к рекомбинантному штамму мицелиального гриба Aspergillus nidulans 031/pDHG25-SgrDI (pyrG-). Указанный штамм обладает стероид-11α-гидроксилирующей активностью, способностью конвертировать прогестерон в 11α-ацетоксипрогестерон, ацетилирующей активностью и способностью этерифицировать 11α-гидроксипрогестерон.

Изобретение относится к области биотехнологии и биохимии, в частности к рекомбинантной клетке-хозяину для получения диальдегида кроцетина, кроцетина и гидроксил-β-циклоцитраля.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к генетической конструкции для обеспечения экспрессии целевых гомологичного и гетерологичного генов в клетках реципиентного гриба Penicillium verruculosum.

Группа изобретений относится к клетке для получения гетерологичного полипептида, способу повышения стабильности полипептида и способу получения гетерологичного полипептида с использованием указанной клетки.

Изобретение относится к области биохимии, генной инженерии и биотехнологии, в частности к применению штамма мицелиального гриба Aspergillus awamori ВКПМ F-148 в качестве реципиента для конструирования продуцентов целевых ферментов.

Изобретение относится к области биотехнологии. Описан ген, кодирующий пенициллопепсин из Penicillium canescens.

Изобретение относится к микробиологии. Описан способ получения ферментного препарата с эндоинулиназной и сахаразной активностью путем культивирования рекомбинантного штамма мицелиального гриба Penicillium canescens Sopp INUA3.

Изобретение относится в области биотехнологии. Описан фермент сериновая протеаза грибов, имеющая аминокислотную последовательность зрелого фермента, которая по меньшей мере на 86% идентична аминокислотной последовательности зрелого фермента Fe_RF6318, представленной в описании.

Представленные изобретения касаются выделенного полинуклеотида, кодирующего полипептид, вовлеченный в биосинтез пирипиропена А, вектора и клетки-хозяина, включающих такой полипептид, и способов получения предшественников пирипиропена А, включающих культивирование клетки-хозяина.

Изобретение относится к области биотехнологии, а именно к клетке-хозяину Trichoderma reesei для получения целлюлолитической белковой композиции, целлюлолитической белковой композиции, способам получения и применения композиции.

Настоящее изобретение относится к области иммунологии. Предложено антитело, обладающее иммунологической реактивностью в отношении белка CAPRIN-1.

Настоящее изобретение относится к иммунологии. Предложен связывающий агент, представляющий собой биспецифическое антитело, содержащее домен, связывающийся с клаудином (CLDN), а именно CLDN18.2, и домен, связывающийся с CD3.

Изобретение относится к области биотехнологии и биохимии, в частности к выделенному ферменту P450. Указанный фермент отличается тем, что он состоит из аминокислотной последовательности, которая по меньшей мере на 80% идентична SEQ ID NO: 1, которая содержит треонин в положении 225 и аспарагиновую кислоту в положении 289.

Изобретение относится к биотехнологии и представляет собой рекомбинантную плазмидную ДНК pPA-OPRF-ATOX-OPRI, которая содержит слитые гены, кодирующие белки F и I наружной мембраны Pseudomonas aeruginosa, а также атоксический вариант экзотоксина A Pseudomonas aeruginosa.

Изобретение относится к области биотехнологии и биохимии, в частности к рекомбинантному штамму мицелиального гриба Aspergillus nidulans 031/pDHG25-SgrDI (pyrG-). Указанный штамм обладает стероид-11α-гидроксилирующей активностью, способностью конвертировать прогестерон в 11α-ацетоксипрогестерон, ацетилирующей активностью и способностью этерифицировать 11α-гидроксипрогестерон.

Изобретение относится к области молекулярной биологии и биотехнологии и представляет собой биологически активный белковый препарат, обладающий специфической активностью папаин-подобных цистеиновых протеиназ, характеризующийся тем, что представляет собой аминокислотную последовательность, выбранную из SEQ ID NO:2-4, экспрессирующийся в растворимой форме.

Изобретение относится к области биохимии, в частности к антителу для осуществления взаимодействия антиген-антитело с клаудином 6 (CLDN6), находящимся на поверхности клеток, экспрессирующих CLDN6, при этом по существу неспособному к взаимодействию антиген-антитело с другими высокогомологичными клаудинами, а также к иммуноконъюгату, фармацевтической композиции, содержащим вышеуказанное антитело.

Группа изобретений относится к области биотехнологии. Предложен способ получения L-валина путем ферментации микроорганизмов из рода Corynebacterium, содержащих в реплицируемой форме полинуклеотид с операторной активностью, последовательность которого по меньшей мере на 85% идентична последовательности от положения 1 до 121 согласно SEQ ID NO: 1, 2 или 3, с которым связывается активатор PrpR, и функционально ниже которого на 3’-конце находится второй полинуклеотид, характеризующийся промоторной активностью, а также гены ilvB и ilvN, и который регулирует транскрипцию генов ilvBN в зависимости от добавления активатора PrpR в среду, к которой после первой фазы (фазы роста), проходящей без индуктора, во второй фазе в качестве индуктора добавляют пропионат или 2-метилцитрат.

Данное изобретение относится к области биотехнологии и иммунологии. Предложена нуклеотидная композиция для получения гетеродимерной конструкции Fc, имеющей замены в CH3 доменах, обеспечивающие повышение температуры плавления.

Группа изобретений относится к биохимии. Предложена нуклеиновая кислота, кодирующая люциферазу или ее функциональный фрагмент и выбранная из группы, состоящей из нуклеиновой кислоты, кодирующей белок, характеризующийся аминокислотной последовательностью, представленной в SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 или 34, нуклеиновой кислоты, кодирующей белок, имеющий последовательность, которая по крайней мере на 65% идентична аминокислотной последовательности, представленной в SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 или 34, и нуклеиновой кислоты, кодирующей белок, в состав которого входит консенсусная последовательность SEQ ID NO: 35.

Изобретение относится к области биотехнологии и касается рекомбинантного онколитического вируса осповакцины Л-ИВП_oncoM депонированного в государственной коллекции возбудителей вирусных инфекций и реккетсиозов ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора под номером V-797.

Группа изобретений относится к биотехнологии. Предложен полинуклеотид для обеспечения высокой экспрессии целевого гена в микроорганизме, относящемся к роду Mortierella. Полинуклеотид соответствует любому полинуклеотиду, выбираемому из группы, состоящей из -, где полинуклеотид, который состоит из любой нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: с 22 по 26; полинуклеотид, который имеет нуклеотидную последовательность с идентичностью 90 или более по отношению к любой нуклеотидной последовательности, выбираемой из группы, состоящей из SEQ ID NO: с 22 по 26, и который проявляет промоторную активность в клетках микроорганизма, относящегося к роду Mortierella; и полинуклеотид, который может гибридизоваться в жестких условиях с полинуклеотидом, состоящим из нуклеотидной последовательности, комплементарной любой из нуклеотидных последовательностей, выбираемых из группы, состоящей из SEQ ID NO: с 22 по 26, и который проявляет промоторную активность в клетках микроорганизма, относящегося к роду Mortierella. Также предложены вектор для трансформации Mortierella, содержащий указанный полинуклеотид; нечеловеческий трансформант, трансформированный указанным полинуклеотидом или трансформированный указанным вектором. Группа изобретений обеспечивает высокую экспрессию целевого гена. 4 н. и 4 з.п. ф-лы, 13 ил., 2 табл.

Наверх