Изменение популяций микроорганизмов и модификация микробиоты

Изобретение относится к векторам для изменения относительного соотношения субпопуляций первых и вторых бактерий в смешанной популяции бактерий, а также к применению векторов. Вектор содержит сконструированный модифицирующий хозяина (HM) массив CRISPR. Вторые бактерии смешанной популяции содержат клетки-хозяева, и вторая субпопуляция состоит из бактериального вида, который отличается от вида первой субпопуляции. Каждая клетка-хозяин имеет последовательность-мишень хозяина. При этом вектор или клетка-хозяин имеют нуклеотидную последовательность, кодирующую нуклеазу Cas. Сконструированный модифицирующий хозяина (HM) массив CRISPR содержит спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью хозяина. HM-crRNA направляет нуклеазу Cas на мишень для модификации последовательности-мишени в клетке-хозяине, таким образом убивая клетку-хозяина или снижая рост клетки-хозяина. При этом вектор способен трансформировать клетку-хозяина. Вектор представляет собой фаговый вектор или плазмидный вектор, содержащийся в бактерии-носителе. Изобретение может быть использовано для применения при лечении или профилактики у субъекта, являющегося человеком или животным, состояния или заболевания, опосредованного бактериальными клетками-хозяевами. 4 н. и 11 з.п. ф-лы, 12 ил., 6 табл., 8 пр.

 

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Изобретение относится к способам ингибирования роста бактериальных популяций, изменения относительного соотношения первой и второй субпопуляции бактерий в смешанной популяции бактерий, к массивам нуклеиновых кислот для этой цели и к векторам, содержащим массивы. Изобретение относится к сконструированным системам для модификации нуклеиновой кислоты клетки-хозяина, к компонентам таких систем и к их применению в промышленности и медицине. Изобретение является особенно полезным, например, для обработки микроорганизмов, например, для применения для окружающей среды, пищевых продуктов и напитков. Изобретение относится, среди прочего, к способам контроля коррозии под воздействием микроорганизмов (MIC) или биообрастания субстрата или жидкости в промышленной или бытовой системе. Изобретение также относится к обработанным жидкостям и векторам для применения в способах. В вариантах осуществления, в способах используют горизонтальный перенос массивов. Изобретение относится также к массивам, составленным из мобильных генетических элементов (MGE) для этой цели, и к векторам, содержащим эти массивы.

УРОВЕНЬ ТЕХНИКИ ДЛЯ ИЗОБРЕТЕНИЯ

Ингибирование роста популяции бактерий и изменение относительных соотношений различных видов бактерий в смеси находит применение в широком диапазоне отраслей промышленности и условий, например, для обработки водных путей, питьевой воды или в других условиях внешней среды. Они находят применение также для изменения бактерий у человека и не относящихся к человеку животных, например, скота, для уменьшения патогенных инфекций или для восстановления равновесия микробиоты кишечника или ротовой полости. Недавно возник интерес к анализу относительных соотношений бактерий кишечника у людей с различными профилями массы тела или ожирения, или к исследованию возможного влияния бактерий в контексте заболеваний, таких как болезнь Крона.

Несмотря на большое количество присущих бактериям механизмов иммунитета против фагов, обширно документированной адаптивной иммунной системой бактерий является система CRISPR/Cas. Сконструированные системы CRISPR/Cas использовали для точной модификации нуклеиновой кислоты в различных типах прокариотических и эукариотических клеток, в диапазоне от клеток бактерий до клеток животных и растений (например, см. Jiang W et al (2013)). Прокариоты, такие как бактерии и археи, кодируют адаптивные иммунные системы, называемые CRISPR/Cas (коротких палиндромных повторов, расположенных кластерами, равномерно удаленными друг от друга/ассоциированных с CRISPR), для обеспечения устойчивости против подвижных вредителей, таких как вирусы (например, бактериофаг) и плазмиды. Приведена ссылка на Seed et al (2013), где объяснено, что бактериофаги (или фаги) являются наиболее распространенными биологическими организмами на земле, и по оценкам, численно превосходят своих бактериальных жертв в десять раз. Постоянная угроза истребления фагами привела к эволюции широкого диапазона бактериальных иммунных механизмов, которые, в свою очередь, приводят к эволюции разнообразных стратегий фагов для ускользания от иммунологического надзора, приводя к динамическому быстрому росту совместно эволюционирующих ветвей.

Иммунитет хозяина основан на включении последовательностей ДНК вредителя в локус памяти (массив CRISPR), формировании направляющих РНК с этого локуса, и деградации родственной ДНК вредителя (протоспейсера), расположенной рядом с мотивом, смежным с протоспейсером (PAM). См., например, WO2010/075424. Массив CRISPR содержит различные элементы: лидер (включая промотор) непосредственно на 5'-конце от одной или нескольких единиц повтор-спейсер-повтор, где повторы являются идентичными и спейсеры отличаются. Посредством захвата спейсерной последовательности из нуклеиновой кислоты вируса или плазмиды - вредителя, система защиты хозяина является способной включать в новые спейсеры в массив CRISPR (каждый спейсер фланкирован повторами), чтобы он действовал в качестве памяти для задержки будущего проникновения вируса или плазмиды. Наблюдали, что недавно приобретенные спейсеры проявляют тенденцию к вставке в массив хозяина непосредственно после лидера.

Приведена ссылка на Heler et al (2014), где объяснено, что локусы CRISPR и ассоциированные с ними гены (Cas) обеспечивают бактериям и археям адаптивный иммунитет против фагов и других проникающих генетических элементов. Основным требованием к любой иммунной системе является способность развивать память после инфекций, чтобы более эффективно справляться с рецидивирующими инфекциями. Адаптивное свойство иммунных систем CRISPR-Cas основано на их способности запоминать последовательности ДНК проникающих молекул и интегрировать их между повторяющимися последовательностями массива CRISPR в форме «спейсеров». При транскрипции спейсера образуется малая антисмысловая РНК, которую используют направляемые РНК нуклеазы Cas для расщепления проникающей нуклеиновой кислоты, чтобы защитить клетку от инфекции. Приобретенные новые спейсеры позволяют иммунной системе CRISPR-Cas быстро адаптироваться к новым угрозам, и это, таким образом, называют «адаптацией» (т.е. приобретение вектором последовательности спейсера).

Seed et al (2013) опубликовали примечательное стечение обстоятельств, в которых кодируемую фагом систему CRISPR/Cas использовали для противодействия ингибирующему фаги хромосомного островка бактериального хозяина. По имеющимся сообщениям, литическая инфекция фага зависела от идентичности последовательности между спейсерами CRISPR и хромосомным островком-мишенью. В отсутствие такого нацеливания, кодируемая фагом система CRISPR/Cas может приобретать новые спейсеры, чтобы быстро эволюционировать и обеспечивать эффективное нацеливание на хромосомный островок для восстановления репликации фага. Bondy-Denomy et al (2012) описывают ранее наблюдаемые примеры генов, опосредующих ингибирование системы CRISPR/Cas. Пять различных «анти-CRISPR» генов обнаружено в геномах бактериофагов, инфицирующих Pseudomonas aeruginosa. Мутация анти-CRISPR гена фага делает его неспособным инфицировать бактерии с функциональной системой CRISPR/Cas, и добавление такого же гена в геном фага, на который нацелена CRISPR/Cas, позволяет ему избегать системы CRISPR/Cas.

Незрелые РНК транскрибируются с массивов CRISPR и затем созревают с формированием crРНК. Некоторые системы CRISPR/Cas также содержат последовательности, кодирующие транс-активирующие РНК (tracrРНК), способные гибридизоваться с повторами в незрелых crРНК для формирования пре-crРНК, в результате чего дальнейший процессинг образует зрелые, или crРНК. Строение cРНК меняется в зависимости от типа (типа I, II или III) вовлеченной системы CRISPR/Cas.

Ассоциированные с CRISPR (cas) гены часто ассоциированы с массивами CRISPR. Обширные исследования сравнительной геномики идентифицировали множество различных генов cas; первоначальный анализ 40 геномов бактерий и архей позволил предположить, что может существовать 45 семейств генов cas, где только два гена, cas1 и cas2, присутствуют повсеместно. Считают, что Cas1 и Cas2 являются необходимыми для приобретения новых спейсеров в массивах, таким образом, являются важными для механизмов развития устойчивости к проникающей нуклеиновой кислоте из фага или плазмиды. et al (2015), как опубликовано, показали, что комплекс Cas1-Cas2 является минимальным аппаратом, катализирующим приобретение ДНК спейсеров, и по-видимому, объясняют значимость повторов CRISPR в обеспечении специфичности последовательности и структурной специфичности для опосредованного Cas1-Cas2 адаптивного иммунитета.

Системы CRISPR/Cas включают в себя также последовательности, экспрессирующие нуклеазы (например, Cas9) для разрезания проникающей нуклеиновой кислоты поблизости родственных мотивов узнавания (PAM) в проникающих нуклеотидных последовательностях. Узнавание PAM нуклеазами является специфическим для каждого типа нуклеазы Cas. PAM в проникающих последовательностях может лежать непосредственно на 3' от последовательности протоспейсера, где нуклеазы, как правило, разрезают 3-4 нуклеотида выше (к 5' от) PAM. Сохранение последовательности PAM отличается между системами CRISPR-Cas и, по-видимому, является эволюционно связанным с cas1 и лидерной последовательностью. Fineran et al (2014) наблюдали, что вредители могут избегать иммунитета CRISPR-Cas типа I-E в Escherichia coli K12 посредством введения точечных мутаций в области («области затравки») протоспейсера или прилежащего к ней PAM, однако, хозяева быстро восстанавливают иммунитет посредством интеграции новых спейсеров в процесс положительной обратной связи, включающий в себя приобретение («примирование»). До настоящего времени, PAM хорошо охарактеризованы в ряде систем типа I и типа II, и эффект мутаций в протоспейсере документирован (см. ссылки 5, 14, 23, 46, 47 в Fineran et al (2014)). Fineran et al (2014) заключили, что их результаты показывают критическую роль PAM и последовательности затравки, в соответствии с предшествующей работой.

Semenova et al (2011) исследовали роль последовательности затравки и заключили, что в случае системы CRISPR/Cas подтипа Escherichia coli, требования совпадения crРНК являются строгими для области затравки непосредственно после PAM. Они наблюдали, что мутации в области затравки прекращают опосредованный CRISPR/Cas иммунитет посредством уменьшения аффинности связывания направляемого crРНК каскадного комплекса с ДНК протоспейсера.

Стадии иммунитета CRISPR для каждого из трех главных типов адаптивного иммунитета являются следующими:-

(1) Приобретение начинается посредством узнавания проникающей ДНК посредством Cas1 и Cas2, и расщепления протоспейсера;

(2) Последовательность протоспейсера лигируется с прямым повтором, смежным с лидерной последовательностью; и

(3) Одноцепочечное удлинение репарирует CRISPR и дуплицирует прямой повтор.

Стадии процессинга crРНК и интерференции происходят различно в каждом из трех главных типов систем CRISPR. Cas расщепляет первичный транскрипт CRISPR для получения crРНК. В системах типа I Cas6e/Cas6f расщепляет на стыке оцРНК и дцРНК, сформированном петлями шпильки в прямом повторе. Системы типа II используют транс-активирующую (tracr) РНК для формирования дцРНК, которую расщепляют Cas9 и РНКазаIII. Системы типа III используют гомолог Cas6, не требующий петель шпилек в прямом повторе для расщепления. В системах типа II и типа III происходит вторичное укорочение либо на 5'- или 3'-конце для получения зрелых crРНК. Зрелые crРНК ассоциируются с белками Cas для формирования комплексов для интерференции. В системах типа I и типа II, спаривание оснований между crРНК и PAM вызывает деградацию проникающей ДНК. Системы типа III не требуют PAM для успешной деградации, и в системах типа III-A происходит спаривание оснований между crРНК и мРНК, а не ДНК, на которую нацелены системы типа III-B.

ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Первая конфигурация по изобретению

Авторы настоящего изобретения считают, что они впервые продемонстрировали ингибирование роста популяции специфического штамма бактерий в смешанном объединении бактерий, которые в природе встречаются вместе в микробиоте (в микробиоте человека, животного или окружающей среды), с одним или несколькими из следующих признаков:

Ингибирование роста популяции посредством

□ нацеливания на клетки дикого типа;

□ использования активности эндогенной нуклеазы Cas дикого типа;

□ нацеливания на жизненно важные гены и гены устойчивости к антибиотикам;

□ где мишени представляют собой последовательности дикого типа.

Авторы настоящего изобретения продемонстрировали это в смешанной популяции бактерий со следующими признаками:

□ нацеленное ингибирование роста бактерий в смешанной популяции видов микробиоты человека (такой как микробиота кишечника);

□ где популяция содержит три различных вида;

□ включение избирательного уничтожения одного из этих видов и сберегание клеток других видов;

□ нацеленное ингибирование роста клеток в присутствии филогенетически близких других видов, которые сберегают при таком ингибировании;

□ нацеленное ингибирование роста клеток в смешанной популяции, содержащей виды-мишени Firmicutes и не относящиеся к фирмикутам виды;

□ нацеленное ингибирование роста клеток специфического штамма Firmicutes со сбереганием в то же время других видов Firmicutes в смешанной популяции;

□ нацеленное ингибирование роста клеток специфического грамположительного штамма бактерий со сбереганием в то же время других грамположительных видов бактерий в смешанной популяции;

□ нацеливание на патогенные (у человека) виды бактерий со сбереганием в то же время комменсальных для кишечника человека видов бактерий;

□ нацеливание на патогенные виды бактерий со сбереганием в то же время пробиотических видов бактерий в кишечнике человека;

□ нацеленное ингибирование роста клеток в смешанной популяции бактерий на поверхности;

□ достижение по меньшей мере 10-кратного ингибирование роста специфических видов бактерий отдельно или при смешивании с другими видами бактерий в объединении; и

□ достижение по меньшей мере 10-кратного ингибирования роста двух различных штаммов специфических видов бактерий.

Возможность использовать активность эндогенной Cas в клетках дикого типа является очень полезной для лечения in situ инфекций клеток-хозяев в организмах (например, людей и животных) и в окружающей среде. Можно также рассматривать обработку популяций бактерий дикого типа (т.е., не сконструированных или не подвергнутых предварительной манипуляции), таких как микробиота человека, животного или растения, с использованием изобретения. Возможность осуществлять избирательное ингибирование роста в смешанной популяции является полезным при рассмотрении популяций бактерий, таких как микробиота человека, животного или растения, или при рассмотрении микробиомов окружающей среды. Этот признак является также полезным для получения лекарственных средств (например, трансплантатов бактериальных клеток для введения субъекту - человеку или животному, для любого лечения или предотвращения, описанного в настоящем документе; или для получения композиции гербицида или инсектицида, содержащей продукт популяции бактерий по изобретению), где избирательное уничтожение можно использовать для избирательного изменения соотношения различных бактерий в смешанной популяции для получения измененной популяции бактерий, которая представляет собой лекарственное средство, гербицид или инсектицид; или из которой получают лекарственное средство, гербицид или инсектицид. Например, лекарственное средство можно трансплантировать интраназально реципиенту - человеку или животному, для осуществления такого лечения или предотвращения.

В рабочем примере ниже, ингибирование роста рассматривали в популяции бактерий (популяция грамположительных Firmicutes) на твердой поверхности. Достигнуто >10-кратное ингибирование роста популяции. Нацеливание было направлено на ген устойчивости к антибиотику. Изобретение может быть полезным для ингибирования роста устойчивых к антибиотику бактерий, где последовательность-мишень представляет собой последовательность гена устойчивости к антибиотику. В одном примере, совместное введение сконструированной нуклеотидной последовательности с антибиотикм может являться эффективным. Это может обеспечивать более полное лечение или предотвращение инфекции клетки-хозяина у субъектов - людей или животных и/или обеспечивать уменьшение терапевтически эффективной дозы антибиотика для введения человеку или животному. Это является полезным, принимая во внимание увеличивающиеся опасения относительно избыточного введения антибиотиков и развития устойчивости в популяциях людей и животных. Изобретение также находит применение ex vivo и in vitro для обработки промышленных или медицинских жидкости, поверхности, устройства или контейнера (например, для пищевых продуктов, потребительских товаров, косметики, персонального изделия медицинского назначения, продукта нефти или масла); или для обработки водных путей, воды, напитка, пищевого продукта или косметики, где клетка-хозяин(клетки-хозяева) входит в состав жидкости, поверхности, устройства, контейнера, водных путей, воды, напитка, пищевого продукта или косметики, или находится на них. Изобретение также находит применение для контроля коррозии, биопленок и биообрастания. Первая конфигурация, таким образом, относится к следующим концепциям:-

Применение модифицирующей хозяина (HM) системы CRISPR/Cas для изменения относительного соотношения субпопуляций первых и вторых бактерий в смешанной популяции бактерий, где вторые бактерии содержат клетки-хозяева,

для каждой клетки-хозяина система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas;

(ii) последовательность-мишень клетки-хозяина и сконструированный модифицирующий хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая гибридизуется с последовательностью-мишенью клетки-хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК, экспрессирующая последовательность tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который трансформирует клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации системы CRISPR/Cas хозяина в клетке-хозяине; и

где последовательность-мишень модифицируют посредством Cas, в результате чего клетку-хозяина уничтожают, или рост клетки-хозяина уменьшают.

Модифицирующая хозяина (HM) система CRISPR/Cas для применения по п.1 для модификации нуклеотидной последовательности-мишени бактериальной клетки-хозяина, где система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas;

(ii) последовательность-мишень клетки-хозяина и сконструированный модифицирующий хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК для экспрессии последовательности tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который может трансформировать клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации системы CRISPR/Cas хозяина в клетке-хозяине.

Это проиллюстрировано в рабочих примерах в настоящем документе, где авторы настоящего изобретения показали избирательное ингибирование роста клетки-хозяина по меньшей мере в 10 раз в смешанной и не смешанной популяции клеток. Смесь имитирует комбинацию видов и штаммов, обнаруженную в микробиоте человека.

Применение активности эндогенной нуклеазы Cas дикого типа из популяции бактериальных клеток-хозяев для ингибирования роста популяции, где каждая клетка-хозяин обладает эндогенной системой CRISPR/Cas, обладающей активностью нуклеазы Cas дикого типа, где применение включает в себя трансформацию клеток-хозяев из популяции, где каждая трансформированная клетка-хозяин трансформирована сконструированной нуклеотидной последовательностью для обеспечения модифицирующей хозяина (HM) cРНК или направляющей РНК (gРНК) в клетке-хозяине, где HM-cРНК или gРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью протоспейсера клетки-хозяина для направления эндогенной Cas к мишени, где cРНК или gРНК является родственной эндогенной нуклеазе Cas клетки-хозяина, обладающей указанной активностью нуклеазы дикого типа, и после трансформации клеток-хозяев, рост популяции является ингибированным.

Применение (необязательно, применение в соответствии с применением из непосредственно предшествующего раздела выше) модифицирующей хозяина (HM) системы CRISPR/Cas для уничтожения или уменьшения роста бактериальных клеток-хозяев, где для каждой клетки-хозяина система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas;

(ii) сконструированный модифицирующей хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая гибридизуется с последовательностью-мишенью клетки-хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК, экспрессирующая последовательность tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который трансформирует клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации последовательности-мишени в клетке-хозяине;

Где нуклеаза Cas является эндогенной для клетки-хозяина; и где последовательность-мишень модифицируют посредством Cas в результате чего клетку-хозяина уничтожают или рост клетки-хозяина уменьшают.

Таким образом, HM-cРНК является способной гибридизоваться с последовательностью-мишенью клетки-хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени.

Альтернативно, HM-crРНК и tracrРНК содержатся в одиночной направляющей РНК (gРНК).

Посредством использования эндогенной нуклеазы Cas, в вариантах осуществления изобретения используют активность эндогенной нуклеазы Cas (т.е., без необходимости предварительной генетической модификации клетки-хозяина для активации или усиления активности нуклеазы). Таким образом, в одном примере, нуклеазу Cas кодирует ген дикого типа клетки-хозяина. В одном примере, нуклеаза является активной для достижения уничтожения или ингибирования роста клеток без инактивации репрессора эндогенной нуклеазы Cas (или гена нуклеазы Cas) в клетке-хозяине. Таким образом, по изобретению можно рассматривать популяции бактерий дикого типа без необходимости предшествующих манипуляций для получения эффективного опосредованного Cas уничтожения или уменьшения роста клеток. Таким образом, популяцию можно подвергать воздействию cРНК, когда популяция находится в своей окружающей среде дикого типа (такой как водные пути, или содержащейся в микробиоме человека или животного).

В одном примере, первые бактерии представляют собой клетки Bacteroidetes (например, Bacteroides). В одном примере, вторые бактерии представляют собой клетки Firmicutes. Способ используют, например, для изменения соотношений в популяции микробиоты кишечника (например, ex vivo или in vivo), что предназначено, например, для лечения или предотвращения увеличения массы тела или ожирения (например, где первые бактерии представляют собой клетки Firmicutes).

Первая конфигурация относится также к: способу изменения относительного соотношения субпопуляций первых и вторых бактерий в смешанной популяции бактерий, содержащей указанные субпопуляции, где первые бактерии представляют собой клетки-хозяева (например, клетки Bacteroidetes), инфицированные фагом, и вторые бактерии не являются инфицированными указанным фагом (или не являются бактериями Bacteroidetes), где способ включает в себя объединение смешанной популяции с множеством векторов за одну или несколько стадий для введения нуклеиновой кислоты вектора в клетки-хозяева и обеспечение роста бактерий в смешанной популяции, где относительные соотношения указанных первых и вторых бактерий изменяют; где каждый вектор содержит сконструированный модифицирующий фаг (PM) массив CRISPR для введения в инфицированную фагом клетку-хозяина для модификации нуклеотидной последовательности-мишени указанного фага в клетке,

(a) где PM-массив CRISPR содержит одну или несколько последовательностей для экспрессии PM-crРНК и промотор для транскрипции последовательности(последовательностей) в инфицированной фагом клетке-хозяине; и

(b) где PM-crРНК является способной гибридизоваться с последовательностью-мишенью фага для направления Cas (например, a нуклеазы Cas) в инфицированной клетке-хозяине для модификации последовательности-мишени.

Во второй конфигурации, изобретение относится к:

Модифицирующей хозяина (HM) системе CRISPR/Cas для модификации нуклеотидной последовательности-мишени клетки-хозяина (например, для применения из первой конфигурации), где система содержит компоненты по (i)-(iv):

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas;

(ii) сконструированный модифицирующей хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК для экспрессии последовательности tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который может трансформировать клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации последовательности-мишени в клетке-хозяине;

где необязательно, компонент (i) является эндогенным для клетки-хозяина.

Вторая конфигурация относится также к: сконструированному модифицирующему фаг (PM) массиву CRISPR для применения в способе из первой конфигурации для модификации генома указанного фага,

(a) где PM-массив CRISPR содержит одну или несколько последовательностей для экспрессии PM-crРНК и промотор для транскрипции последовательности(последовательностей) в инфицированной фагом клетке-хозяине; и

(b) где PM-crРНК является способной гибридизоваться с последовательностью-мишенью генома фага для направления Cas (например, нуклеазы Cas) в инфицированной клетке-хозяине для модификации последовательности-мишени.

В одном примере, фаг представляет собой фаг Bacteroidetes (например, Bacteroides), например, crAssphage.

В одном примере, массив содержит повторы CRISPR, которые являются функциональными с системой CRISPR/Cas клетки-хозяина. Это является преимущественным для увеличения избирательности массива для желательной клетки в смеси бактерий. Это также упрощает получение массива и векторов, содержащих массив по изобретению, поскольку может не являться необходимым включать большие нуклеотидные последовательности, кодирующие один или несколько белков (и/или tracrРНК) Cas, необходимых для функционирования массива в клетке-хозяине. Альтернативно, массив предоставляют вместе с кодирующей родственную Cas9 последовательностью и необязательно, с кодирующей родственную tracrРНК последовательностью.

В третьей конфигурации, изобретение относится к:

Сконструированному вектору на основе нуклеиновой кислоты для модификации бактериальной клетки-хозяина, содержащей эндогенную систему CRISPR/Cas, где вектор

(a) содержит последовательности нуклеиновой кислоты для экспрессии множества различных crРНК (например, одиночных направляющих РНК, т.е., gРНК) для применения в системе CRISPR/Cas или применения по изобретению; и

(b) лишен последовательности нуклеиновой кислоты, кодирующей нуклеазу Cas, где первая из указанных crРНК является способной гибридизоваться с первой последовательностью нуклеиновой кислоты в указанной клетке-хозяине; и вторая из указанных crРНК является способной гибридизоваться с второй последовательностью нуклеиновой кислоты в указанной клетке-хозяине, где указанная вторая последовательность отличается от указанной первой последовательности; и

(c) первая последовательность содержится в гене устойчивости к антибиотику (или его РНК), и вторая последовательность содержится в гене устойчивости к антибиотику (или его РНК); необязательно, где гены являются различными;

(d) первая последовательность содержится в гене устойчивости к антибиотику (или его РНК), и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК);

(e) первая последовательность содержится в жизненно важном гене (или его РНК), и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК); или

(f) первая последовательность содержится в гене вирулентности (или его РНК), и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК).

Третья конфигурация относится также к: вектору на основе нуклеиновой кислоты (например, плазмиде, фагу или фагмиде) для применения в способе по изобретению, где вектор содержит массив CRISPR по изобретению.

В четвертой конфигурации, изобретение относится к:

Вектору на основе нуклеиновой кислоты (например, плазмиде, вирусу, фагу или фагмиде), содержащему сконструированный массив CRISPR для модификации последовательности-мишени из генома бактериальной клетки-хозяина (например, клетка патогенной бактерии, такой как описано выше) или генома вируса (например, фаг) в клетке-хозяине,

(a) где массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК (например, представленных в форме gРНК) и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине;

(b) где crРНК является способной гибридизоваться с последовательностью-мишенью для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени;

(c) где массив содержится в транспозоне, который является способным к горизонтальному переносу между первыми и вторыми бактериальными клетками из различных видов.

В пятой конфигурации, изобретение относится к:

Сконструированному вектору CRISPR на основе нуклеиновой кислоты, содержащему мобильный генетический элемент (MGE) или состоящему из него, где MGE содержит точку начала переноса (oriT) и массив CRISPR для модификации последовательности-мишени из генома клетки-хозяина (например, клетки патогенной бактерии) или из генома вируса (например, профага) в клетке-хозяине,

(a) где массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине;

(b) где crРНК является способной гибридизоваться с последовательностью-мишенью для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени;

(c) где вектор является способным к переносу между (i) первым и вторым положениями нуклеиновой кислоты первой клетки-хозяина, где каждое положение представляет собой положение на хромосоме или на плазмиде, и последовательность-мишень содержится в клетке-хозяине, или (ii) первой и второй клетками-хозяевами, где последовательность-мишень содержится в первой и/или второй клетке-хозяине.

В шестой конфигурации, изобретение относится к:

Способу контроля коррозии под воздействием микроорганизмов (MIC) или биообрастания субстрата в промышленной или бытовой системе, где поверхность субстрата находится в контакте с популяцией первых клеток-хозяев из первого вида микроорганизмов, опосредующего MIC или биообрастание субстрата, где способ включает в себя

(i) приведение популяции в контакт со множеством векторов, способных трансформировать или трансдуцировать клетки, где каждый вектор содержит массив CRISPR, в результате чего массивы CRISPR вводят в клетки-хозяева, где

(a) каждый массив CRISPR содержит одну или несколько нуклеотидных последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине; и

(b) каждая crРНК является способной гибридизоваться с последовательностью-мишенью из клетки-хозяина для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); где последовательность-мишень представляет собой последовательность гена для обеспечения жизнеспособности клетки-хозяина; и

(ii) обеспечение экспрессии указанных cРНК в присутствии Cas в клетках-хозяевах, таким образом, модификации последовательностей-мишеней в клетках-хозяевах, приводящей к уменьшению жизнеспособности клетки-хозяина и контролю MIC или биообрастания указанного субстрата.

Другой вариант осуществления относится к:

Способу контроля коррозии под воздействием микроорганизмов (MIC) или биообрастания субстрата, содержащегося в оборудовании для выделения, переработки, хранения или транспортировки нефти, газа или нефтехимических продуктов, где поверхность субстрата находится в контакте с популяцией первых клеток-хозяев, где первые клетки-хозяева представляют собой серо- или сульфатвосстанавливающие бактерии (SRB), продуцирующие внеклеточные полимерные вещества бактерии (EPSB), кислотообразующие бактерии (APB), серо- или сульфидокисляющие бактерии (SOB), железоокисляющие бактерии (IOB), марганецокисляющие бактерии (MOB), продуцирующие аммиак бактерии (AmPB) или продуцирующие ацетат бактерии (AcPB) из первого вида, опосредующего MIC или биообрастание субстрата, где поверхности и популяция клеток находятся в контакте с жидкостью, выбранной из морской воды, пресной воды, жидкости для гидроразрыва или жидкости в скважине, где способ включает в себя

(i) приведение популяции клеток в контакт с векторами посредством смешивания жидкости со множеством векторов, способных трансформировать или трансдуцировать первые клетки-хозяева, где каждый вектор содержит массив CRISPR, в результате чего массивы CRISPR вводят в клетки-хозяева, где

(a) каждый массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине;

(b) каждая crРНК является способной гибридизоваться с последовательностью-мишенью из клетки-хозяина для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); последовательность-мишень представляет собой последовательность гена для обеспечения жизнеспособности клетки-хозяина;

(c) где каждая последовательность из (a) содержит последовательность R1-S1-R1' для экспрессии и продукции соответствующей crРНК в первой клетке-хозяине, где R1 представляет собой первый повтор CRISPR, R1' представляет собой второй повтор CRISPR, и R1 или R1' является необязательным; и S1 представляет собой первый спейсер CRISPR, который содержит нуклеотидную последовательность или состоит из нуклеотидной последовательности, на 80% или более идентичной последовательности-мишени из указанной первой клетки-хозяина, и

(ii) обеспечение экспрессии указанных cРНК в присутствии of Cas в клетках-хозяевах, таким образом, модификации последовательностей-мишеней в клетках-хозяевах, приводящей к уменьшению жизнеспособности клетки-хозяина и контролю MIC или биообрастания указанного субстрата.

Другие варианты осуществления относятся к:

Вектору для применения в способе, где первые клетки представляют собой клетки сульфатвосстанавливающих бактерий (SRB), например, клетки Desulfovibrio или Desulfotomaculum, где вектор содержит один или несколько массивов CRISPR для нацеливания на SRB, где каждый массив является таким, как определено в (a)-(c).

Другой вариант осуществления относится к: способу контроля биообрастания микроорганизмами жидкости в промышленной или бытовой системе, где жидкость содержит популяцию первых клеток-хозяев из первого вида микроорганизмов, опосредующего указанное биообрастание, где способ включает в себя

(i) приведение популяции в контакт со множеством векторов, способных трансформировать или трансдуцировать клетки, где каждый вектор содержит массив CRISPR, в результате чего массивы CRISPR вводят в клетки-хозяева, где

(a) каждый массив CRISPR содержит одну или несколько нуклеотидных последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине; и

(b) каждая crРНК является способной гибридизоваться с последовательностью-мишенью из клетки-хозяина для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); последовательность-мишень представляет собой последовательность гена для обеспечения жизнеспособности клетки-хозяина; и

(ii) обеспечение экспрессии указанных cРНК в присутствии Cas в клетках-хозяевах, таким образом, модификации последовательностей-мишеней в клетках-хозяевах, приводящей к уменьшению жизнеспособности клетки-хозяина и контролю указанного биообрастания.

Например, представлен: способ контроля бактериального биообрастания в балластной воде судна или лодки, где вода содержит популяцию первых клеток-хозяев из первого вида микроорганизмов, опосредующего указанное биообрастание, где способ включает в себя

(i) приведение популяции в контакт со множеством векторов, способных трансформировать или трансдуцировать клетки, где каждый вектор содержит массив CRISPR, в результате чего массивы CRISPR вводят в клетки-хозяева, где

(a) каждый массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине; и

(b) каждая crРНК является способной гибридизоваться с последовательностью-мишенью из клетки-хозяина для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); последовательность-мишень представляет собой последовательность гена для обеспечения жизнеспособности клетки-хозяина; и

(ii) обеспечение экспрессии указанных cРНК в присутствии Cas в клетках-хозяевах, таким образом, модификации последовательностей-мишеней в клетках-хозяевах, приводящей к уменьшению жизнеспособности клетки-хозяина и контролю указанного биообрастания.

Другие варианты осуществления относятся к: балластной морской воде (например, к образцу морской воды или к морской воде в контейнере), содержащей массивы CRISPR, где балластная вода получена или может быть получена этим способом. К судну, лодке, морскому контейнеру или установке, содержащим балластную морскую воду. К вектору для применения в способе, где первые клетки представляют собой клетки видов Cholera (например, vibrio, например, O1 или O139), E coli или Enterococci, где вектор содержит один или несколько массивов CRISPR для нацеливания на клетки, где каждый массив является таким, как определено в (a) и (b) способа.

Изобретение относится также к векторам и массивам CRISPR, пригодным для применения в этой шестой конфигурации или для других применений, например, для медицинского применения или для обработки пищевого продукта или напитка. С этой целью представлен: вектор, содержащий массив CRISPR для введения в бактериальную клетку-хозяина, где бактерия является способной к переносу через воду, где

(a) массив CRISPR содержит последовательность для экспрессии crРНК и промотор для транскрипции последовательности в указанной клетке-хозяине;

(b) crРНК является способной гибридизоваться с последовательностью-мишенью клетки-хозяина для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); где последовательность-мишень представляет собой нуклеотидную последовательность для обеспечения жизнеспособности клетки-хозяина;

(c) где последовательность из (a) содержит последовательность R1-S1-R1' для экспрессии и продукции crРНК, где R1 представляет собой первый повтор CRISPR, R1' представляет собой второй повтор CRISPR, и R1 или R1' является необязательным; и S1 представляет собой первый спейсер CRISPR, который содержит нуклеотидную последовательность или состоит из нуклеотидной последовательности, на 80% или более идентичной последовательности-мишени клетки-хозяина.

Представлены также: композиция для обработки воды или пищевого продукта, содержащая множество таких векторов. Лекарственное средство для лечения или предотвращения бактериальной инфекции (например, инфекции Vibrio cholerae) у человека, где лекарственное средство содержит множество таких векторов. Изобретение относится также к содержащим бактерии популяциям, композициям, пищевым продуктам и напиткам. Например, пищевой продукт или напиток представляет собой молочный продукт.

В седьмой конфигурации, изобретение относится к:

В первом аспекте:-

Способу модификации поддающегося экспрессии гена, кодирующего первую Cas, где способ включает в себя

(a) объединение направляющей РНК (gРНК1) с геном Cas в присутствии первой Cas, экспрессированной с указанного гена; и

(b) обеспечение гибридизации gРНК1 с последовательностью указанного гена Cas (например, с его промотором или кодирующей первую Cas последовательностью ДНК) и направления первой Cas на ген, в результате чего Cas модифицирует ген Cas.

Первому вектору на основе нуклеиновой кислоты или комбинации векторов, например, для применения в способе, где

(a) первый вектор или вектор из указанной комбинации содержит поддающуюся экспрессии нуклеотидную последовательность, которая кодирует направляющую РНК (gРНК1, например, одиночную gРНК), которая является комплементарной предопределенной последовательности протоспейсера (PS1) для направления первой Cas для модификации PS1 в первом участке (CS1), где PS1 является смежным с PAM (P1), который является родственным первой Cas; или поддающаяся экспрессии последовательность кодирует crРНК, которая формирует gРНК1 с tracrРНК; и

(b) PS1 и P1 представляют собой последовательности поддающегося экспрессии кодирующего первую Cas гена, и PS1 способен подвергаться модификации в CS1 посредством первой Cas.

Эти аспекты по изобретению являются полезными для регуляции активности Cas, например, в клетке или in vitro. Изобретение включает в себя нацеливание на кодирующий Cas ген для ограничения активности Cas, что является преимущественным для временной регуляции Cas. Изобретение может также являться полезным в условиях, где увеличенная строгость активности Cas является желательной, например, для уменьшения шансов нецелевого разрезания Cas при модификации генома клетки. Существуют применения, например, при модификации клеток человека, животных или растений, где нецелевые эффекты необходимо минимизировать или исключить, например, для генотерапии или нацеливания на гены клетки или ткани или организма, содержащего клетку. Например, очень высокая строгость необходима при использовании модификации Cas для получения желательных изменений в клетке человека (например, клетке iPS), предназначенной для введения пациенту для генотерапии или для лечения или предотвращения заболевания или состояния у человека. Описание относится к этим применениям в качестве части способов и продуктов по изобретению.

Изобретение также направлено на проблему ограниченной емкости вставки в векторах, в частности, в вирусных векторах.

Таким образом, восьмая конфигурация по изобретению относится к:

Вектору на основе нуклеиновой кислоты, содержащему более 1,4 т.п.о. экзогенной последовательности ДНК, кодирующей компоненты системы CRISPR/Cas, где последовательность содержит сконструированный массив или сконструированную последовательность (необязательно как описано в настоящем документе) для экспрессии одной или нескольких HM- или PM-crРНК или gРНК в клетках-хозяевах (любых клетках в настоящем документе, например, клетках-хозяевах человека, животного или бактерий или архей), где массив или сконструированная последовательность не содержит нуклеотидную последовательность, кодирующую нуклеазу Cas, родственную cРНК(нескольким cРНК) или gРНК(нескольким gРНК); необязательно, где по меньшей мере 2, 3 или 4 cРНК или gРНК кодированы экзогенной ДНК.

Вектору на основе нуклеиновой кислоты, содержащему более 1,4 т.п.о. или более 4,2 т.п.о. экзогенной последовательности ДНК, где экзогенная ДНК кодирует один или несколько компонентов системы CRISPR/Cas и содержит сконструированный массив или последовательность (например, любые такие массивы или последовательности, описанные в настоящем документе) для экспрессии одной или нескольких HM-crРНК или gРНК в клетках-хозяевах, где экзогенная последовательность лишена нуклеотидной последовательности, кодирующей нуклеазу Cas, родственную cРНК(нескольким cРНК) или gРНК(нескольким gРНК); необязательно, где по меньшей мере 2 различных cРНК или gРНК кодированы экзогенной ДНК.

В настоящем документе в любых конфигурациях, например, cРНК(несколько cРНК) предоставлены посредством одной или нескольких одиночных направляющих РНК (gРНК), и в этом случае «массив CRISPR» может относится к одной или нескольким поддающимся экспрессии нуклеотидным последовательностям, кодирующим указанную gРНК(несколько gРНК). Таким образом, последовательности являются способными к экспрессии в клетке-хозяине(клетках-хозяевах) для экспрессии gРНК(нескольких gРНК) внутри клетки(клеток).

Изобретение в основном описано в отношении бактерий, но его можно также применять, с соответствующими изменениями, для архей.

Любые признаки одной конфигурации в настоящем документе, в одном примере, комбинируют с другой конфигурацией по изобретению для возможного включения такой комбинации в один или несколько пунктов формулы изобретения в настоящем документе.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

ФИГУРА 1: Индуцируемая ксилозой система.

ФИГУРА 2: Массив ST1-CRISPR.

ФИГУРА 3: Анализ пятен на TH с агаром для штаммов, использованных в этой работе. Все штаммы выращивали на TH с агаром при 37°C в течение 20 часов. Серийные разведения ночных культур выполняли в двух повторах для E.coli, L Lactis и S.mutans, и в трех повторах для обоих штаммов S. thermophilus для подсчета индивидуальных колоний.

ФИГУРА 4: Избирательный рост S. thermophilus, S. mutans, L. lactis и E. coli в различных условиях культивирования. Тетрациклин невозможно использовать для избирательного выращивания S. thermophilus LMD-9. Однако, доказана пригодность 3 г л-1 PEA для избирательного выращивания S. thermophilus LMD-9 с ограничением в то же время роста E. coli.

ФИГУРА 5: Конструкция двух индуцируемых ксилозой кассет (в середине, справа) на основе оперона B. megaterium дикого типа (слева). (Xie et al. 2013)

ФИГУРА 6: Характеризация индуцируемой ксилозой кассеты в Streptoccocus thermophilus LMD-9 с плазмидой pBAV1KT5-XylR-mCherry-Pldha. Явный ответ флуоресценции можно наблюдать при увеличении количества ксилозы.

ФИГУРА 7: Дизайн массива CRISPR в pBAV1KT5-XylR-mCherry-Pldha+XylA. Массив содержит 2 спейсерные последовательности, нацеленные на гены S. Thermophiles, под контролем индуцируемого ксилозой промотора и tracrРНК под контролем сильного конститутивного промотора P3A.

ФИГУРА 8: Эффективность трансформации Streptoccocus thermophilus LMD-9 плазмидой pBAV1KT5-XylR-CRISPR-Pldh+XylA (слева) и pBAV1KT5-XylR-CRISPR-PXylA (справа).

ФИГУРА 9: Схема индуцируемого ксилозой аппарата CRISPR. При индукции ксилозой экспрессируется массив CRISPR, нацеленный на оба polIII и tetA в геноме S. thermophiles LMD-9. Вместе с конститутивно экспрессированной tracrРНК формируется комплекс с Cas9. Этот комплекс вносит двухцепочечный разрыв в гены tetA и polIII в геноме S. thermophilus LMD-9, что приводит к ограниченной жизнеспособности клеток.

ФИГУРА 10: Ингибирование роста Streptoccocus thermophilus DSM 20617(T) с использованием плазмиды pBAV1KT5-XylR-CRISPR-PXylA (слева) или pBAV1KT5-XylR-CRISPR-Pldha+XylA (справа). Без индукции (верхняя панель) и после индукции (нижняя панель). Изображение получено после 63 час инкубации. Количество колоний в нижнем левом углу (верхний ряд: >1000, >1000, нижний ряд: 336, 113).

ФИГУРА 11: Построенное по принципу максимального правдоподобия филогенетическое древо последовательностей 16S из S. thermophilus, L. lactis и E. coli.

ФИГУРА 12: Показано избирательное ингибирование роста S thermophilus в совместной культуре с E. coli, L. lactis и S. Thermophiles, несущих плазмиду либо pBAV1KT5-XylR-CRISPR-PxylA, либо pBAV1KT5-XylR-CRISPR-PldhA+XylA. Не наблюдали различий роста между E. coli, несущей плазмиду pBAV1KT5-XylR-CRISPR-PxylA или pBAV1KT5-XylR-CRISPR-PldhA+XylA (средний столбец). Однако, для S. thermophiles (избирательно выращенного на TH с агаром, дополненным 2,5 г л-1 PEA, последний столбец) показано различие эффективности трансформации между плазмидами pBAV1KT5-XylR-CRISPR-PxylA (сильная) или pBAV1KT5-XylR-CRISPR-PldhA+XylA (слабая), как ожидали авторы настоящего изобретения. Авторы настоящего изобретения, таким образом, показали избирательное ингибирование роста целевой субпопуляции S thermophilus в смешанной популяции клеток. Количество колоний в нижнем левом углу (верхний ряд: >1000, >1000, 68, нижний ряд: >1000, >1000, 32).

ПОДРОБНОЕ ОПИСАНИЕ

ИНГИБИРОВАНИЕ РОСТА ПОПУЛЯЦИИ МИКРООРГАНИЗМОВ И ИЗМЕНЕНИЕ СООТНОШЕНИЙ МИКРООРГАНИЗМОВ

Изобретение относится к способам, применениям, системам, массивам, cРНК, gРНК и векторам для ингибирования роста популяции бактерий или изменения относительного соотношения первой и второй субпопуляции бактерий в смешанной популяции бактерий, например, для изменения микробиомов человека или животных, например, для изменения соотношения Bacteroidetes (например, Bacteroides), Firmicutes и/или грамположительных или грамотрицательных бактерий в микробиоте человека. См., например, первую - третью конфигурации, описанные в настоящем документе. Изобретение, например, относится к модификации одной или нескольких нуклеотидных последовательностей-мишеней бактериальной клетки-хозяина, например, клетки Bacteroidetes или клетки Firmicutes.

Существует ряд исследований, указывающих, что соответствующие уровни двух основных кишечных филумов, Bacteroidetes и Firmicutes, связаны с ожирением, как у человека, так и у свободных от микроорганизмов мышей. Авторы исследований заключили, что метаболизм углеводов является важным фактором. Они наблюдали, что микробиота страдающих ожирением индивидуумов более сильно обогащена бактериями филума Firmicutes и менее - Bacteroidetes, и они предположили, что эта смесь бактерий может являться более эффективной для получения энергии из данной диеты, чем микробиота худощавых индивидуумов (обладающих обратными соотношениями). В некоторых исследованиях, они обнаружили, что относительное содержание Bacteroidetes увеличивается с потерей массы страдающими ожирением индивидуумами, и, кроме того, когда микробиоту от страдающими ожирением мышей переносят свободным от микроорганизмов мышам, эти мыши набирают больше жира, чем контрольная группа, получающая микробиоту от тощих мышей. См., например, Turnbaugh, P. J., R. E. Ley, M. A. Mahowald, V. Magrini, E. R. Mardis, and J. I. Gordon. 2006, «An obesity-associated кишечника microbiome with increased capacity for energy harvest», Nature 444:1027-1131.

КОНЦЕПЦИИ

Изобретение относится к следующим концепциям, включающим в себя клетку-хозяина - мишень:-

1. Применение модифицирующей хозяина (HM) системы CRISPR/Cas для уничтожения или уменьшения роста бактериальных клеток-хозяев, где для каждой клетки-хозяина система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas;

(ii) сконструированный модифицирующей хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая гибридизуется с последовательностью-мишенью клетки-хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК, экспрессирующая последовательность tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который трансформирует клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации последовательности-мишени в клетке-хозяине;

где нуклеаза Cas является эндогенной для клетки-хозяина; и где последовательность-мишень модифицируют посредством Cas, в результате чего клетку-хозяина уничтожают или рост клетки-хозяина уменьшают.

Концепция 1 альтернативно относится к: применению модифицирующей хозяина (HM) системы CRISPR/Cas для изменения относительного соотношения субпопуляций первых и вторых бактерий в смешанной популяции бактерий, где вторые бактерии содержат клетки-хозяева, где для каждой клетки-хозяина система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas;

(ii) сконструированный модифицирующей хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая гибридизуется с последовательностью-мишенью клетки-хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК, экспрессирующая последовательность tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который трансформирует клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации последовательности-мишени в клетке-хозяине;

где, необязательно, нуклеаза Cas является эндогенной для клетки-хозяина; и

где последовательность-мишень модифицируют посредством Cas в результате чего клетку-хозяина уничтожают или рост клетки-хозяина уменьшают.

Концепция 1 относится также к: способу изменения относительного соотношения субпопуляций первых и вторых бактерий в смешанной популяции бактерий, где вторые бактерии содержат клетки-хозяева, и где способ включает в себя объединение смешанной популяции с модифицирующей хозяина (HM) системой CRISPR/Cas, в результате чего вторые бактериальные клетки-хозяева уничтожают, или рост указанных клеток уменьшают, таким образом изменяя указанное соотношение,

где для каждой клетки-хозяина система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas;

(ii) сконструированный модифицирующей хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая гибридизуется с последовательностью-мишенью клетки-хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК, экспрессирующая последовательность tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который трансформирует клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации последовательности-мишени в клетке-хозяине;

где, необязательно, нуклеаза Cas является эндогенной для клетки-хозяина; и

где последовательность-мишень модифицируют посредством Cas в результате чего клетку-хозяина уничтожают, или рост клетки-хозяина уменьшают.

Концепция 1 относится также к:

Применению модифицирующей хозяина (HM) системы CRISPR/Cas для изменения относительного соотношения субпопуляций первых и вторых бактерий в смешанной популяции бактерий, где вторые бактерии содержат множество клеток-хозяев, где каждая содержит последовательность-мишень протоспейсера, где для каждой клетки-хозяина система содержит компоненты (ii) и (iii), определенные выше, где система, кроме того, содержит по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую нуклеазу Cas; где указанный компонент (ii) и указанная кодирующая Cas последовательность содержатся по меньшей мере в одном векторе на основе нуклеиновой кислоты, который трансформирует клетку-хозяина, в результате чего HM-crРНК, кодируемая (i), направляет Cas на мишень для модификации последовательности-мишени в клетке-хозяине;

где нуклеаза Cas является эндогенной для клетки-хозяина; и где последовательность-мишень модифицируют посредством Cas в результате чего клетку-хозяина уничтожают, или рост клетки-хозяина уменьшают.

В одном варианте осуществления, рост первых бактерий не ингибируют; или ингибирование роста указанных клеток-хозяев составляет по меньшей мере 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 50x, 100x или 1000x ингибирование роста первых клеток. Ингибирование роста можно рассчитывать как кратность ингибирования или как процент ингибирования (как описано в настоящем документе). В другом примере, ингибирование измеряют в образце культуры посредством спектрофотометра, где светопоглощение (например, при OD600) определяют в начале и в конце предопределенного периода обработки crРНК/gРНК (см. описание такого периода в настоящем документе при определении ингибирования по кратности или проценту). В одном примере, увеличение поглощения (сравнение поглощения в начале предопределенного периода с поглощением в конце этого периода) для образца клетки-хозяина меньше, чем для контрольного образца (который не подвергали воздействию указанной cРНК или gРНК), например, увеличение для первого по меньшей мере в 10, 100, 1000, 10000 или 100000 раз меньше, чем для последнего (например, определенное как OD600). В одном примере, определение ингибирования роста (т.е., в конце предопределенного периода) выполняют в средней логарифмической фазе роста каждого образца (например, через 6-7 часов после начала предопределенного периода).

В одном примере, клетки-хозяева содержатся в популяции микробиоты, содержащейся в организме или окружающей среде (например, микробиоте водных путей, микробиоте воды, микробиоте кишечника человека или животного, микробиоте ротовой полости человека или животного, вагинальной микробиоте человека или животного, микробиоте кожи или волос человека или животного, или микробиоте подмышечной впадины человека или животного), где популяция содержит первые бактерии, которые являются симбиотическими или комменсальными с организмом или окружающей средой, и вторые бактерии, содержащие указанные клетки-хозяева, где клетки-хозяева являются вредными (например, патогенными) для организма или окружающей среды. В одном варианте осуществления, популяция находится ex vivo.

Соотношение субпопуляции первых бактерий и субпопуляции вторых бактерий увеличено.

Концепция 1 относится также к применению для ингибирования роста клетки-хозяина, как более подробно описано ниже.

2. Модифицирующая хозяина (HM) система CRISPR/Cas для модификации нуклеотидной последовательности-мишени из клетки-хозяина (например, для применения из концепции 1), где система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas;

(ii) сконструированный модифицирующей хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, HM-crРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК для экспрессии последовательности tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который может трансформировать клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации последовательности-мишени в клетке-хозяине;

где, необязательно, компонент (i) является эндогенным для клетки-хозяина.

Альтернативно, HM-crРНК и tracrРНК содержатся в одиночной направляющей РНК (gРНК).

Посредством использования эндогенной нуклеазы Cas, в вариантах осуществления изобретения используют активность эндогенной нуклеазы Cas (т.е., без необходимости предшествующей генетической модификации клетки-хозяина для активации или усиления активности нуклеазы). Таким образом, в одном примере, нуклеазу Cas кодирует ген дикого типа клетки-хозяина. В одном примере, нуклеаза является активной для достижения уничтожения или уменьшения роста клеток без ингибирования репрессора эндогенной нуклеазы Cas (или гена нуклеазы Cas) в клетке-хозяине. Таким образом, по изобретению можно рассматривать популяции бактерий дикого типа без необходимости предшествующих манипуляций для получения эффективного опосредованного Cas уничтожения или уменьшения роста клеток. Таким образом, популяцию можно подвергать воздействию cРНК, когда популяция находится в ее окружающей среде дикого типа (например, в водных путях, или содержится в микробиоме человека или животного).

В одном примере, вторые бактерии представляют собой клетки Bacteroidetes (например, Bacteroides). В одном примере, вторые бактерии представляют собой клетки Firmicutes. Применение, систему или способ, например, используют для изменения соотношений в популяции микробиоты кишечника (например, ex vivo или in vivo), которое предназначено, например, для лечения или предотвращения увеличенной массы тела или ожирения (например, где вторые бактерии представляют собой клетки Firmicutes).

В одном примере, применение, способ, система, вектор, сконструированная нуклеотидная последовательность, cРНК или gРНК предназначены для терапевтического или профилактического восстановления равновесия микробиоты человека или не относящегося к человеку животного, содержащей смешанную популяцию, например, для лечения или предотвращения ожирения, диабета IBD, состояния GI тракта или состояния ротовой полости.

В одном примере, микробиота, упомянутая в настоящем документе, представляет собой микробиоту из микробиома человека или животного (например, микробиома кишечника, вагины, волосяного покрова, подмышечной впадины, кожи, кровотока, горла или ротовой полости).

В одном примере, микробиота, упомянутая в настоящем документе, представляет собой микробиоту подмышечной впадины, и применение, способ, система, вектор, сконструированная нуклеотидная последовательность, cРНК или gРНК предназначены для предотвращения или уменьшения запаха тела человека.

В одном примере, популяция клетки-хозяина или смешанная популяция содержится в напитке или воде (например, в водных путях или питьевой воде) для употребления человеком.

В одном примере, применение, способ, система, вектор, сконструированная нуклеотидная последовательность, cРНК или gРНК предназначены для уменьшения патогенных инфекций или для восстановления равновесия микробиоты кишечника или ротовой полости, например, для лечения или предотвращения ожирения или заболевания у человека или животного. Например, применение, способ, система, вектор, сконструированная нуклеотидная последовательность, cРНК или gРНК предназначены для нокдауна бактерий Clostridium dificile в микробиоте кишечника.

В одном примере, первые бактерии представляют собой бактерии Bacteroides, и вторые бактерии представляют собой Firmicutes или патогенные бактерии, например, бактерии кишечника. В одном примере, клетки-хозяева или вторые бактерии представляют собой клетки Firmicutes, например, выбранные из клеток Streptococcus (например, thermophilus и/или pyogenes), Bacillus, Lactobacillus, Listeria, Clostridium, Heliobacterium и Staphylococcus. В одном примере, смешанная популяция содержит Bacteroides и устойчивые к метронидазолу (MTZ) субпопуляции C dificile штамма 630, где клетки-хозяева содержат указанные клетки C dificile.

В одном примере, популяция клеток-хозяев, смешанная популяция или система содержится в композиции (например, напитка, ополаскивателя для ротовой полости или пищевого продукта) для введения человеку или не относящемуся к человеку животному для заселения и восстановления равновесия микробиоты его кишечника или ротовой полости.

В одном примере, продукт применения или способа, или системы, вектора, сконструированной нуклеотидной последовательности, cРНК или gРНК предназначен для введения человеку или не относящемуся к человеку животному посредством введения на слизистые оболочки, в кишечник, перорального, интраназального, ректального, интравагинального, глазного или буккального введения.

В одном примере любой конфигурации в настоящем документе, смешанная популяция (до комбинации с массивом, gРНК, crРНК или сконструированной последовательностью) представляет собой образец микробиоты субъекта - человека или животного, например, микробиоты кишечника или любой другой, описанной в настоящем документе, или микробиоты из любого микробиома, описанного в настоящем документе. В одном примере, в этом случае, продукт применения по изобретению представляет собой модифицированную популяцию микробиоты, которую можно использовать для обработки или терапии субъекта - человека или животного, как описано в настоящем документе.

3. Система из концепции 2, где вектор или векторы лишены кодирующей нуклеазу Cas (например, Cas9) последовательности.

4. Применение, способ или система из любой предшествующей концепции, где каждая клетка-хозяин принадлежит к штамму или виду, обнаруженного в микробиоте человека, необязательно, где клетки-хозяева смешаны с клетками из другого штамма или вида, где другие клетки представляет собой Enterobacteriaceae или бактерии, которые являются пробиотическими, комменсальными или симбиотическими для человека (например, в кишечнике человека). В одном примере, клетка-хозяин представляет собой клетку Firmicutes, например, Streptococcus.

5. Применение, способ или система из любой предшествующей концепции для изменения доли бактерий Bacteroidetes (например, Bacteroides) в смешанной популяции бактерий (например, у человека, например, в микробиоте человека).

6. Применение, способ или система из концепции 5 для увеличения относительного соотношения Bacteroidetes к Firmicutes.

7. Применение, способ или система из любой предшествующей концепции, где указанная нуклеаза Cas предоставлена посредством an эндогенной системы CRISPR/Cas типа II клетки.

8. Применение, способ или система из любой предшествующей концепции, где компонент (iii) является эндогенным для клетки-хозяина.

9. Применение, способ или система из любой предшествующей концепции, где последовательность-мишень содержится в гене устойчивости к антибиотику, гене вирулентности или жизненно важном гене клетки-хозяина.

10. Применение, способ или система из любой предшествующей концепции, где массив содержится в антибиотической композиции, где массив присутствует в комбинации с антибиотическим средством.

11. Применение, способ или система из любой предшествующей концепции, где альтернативно, HM-crРНК и tracrРНК содержатся в одиночной направляющей РНК (gРНК), например, предоставленной посредством вектора.

12. Применение, способ или система из любой предшествующей концепции, где клетка-хозяин содержит цепь дезоксирибонуклеиновой кислоты со свободным концом (HM-ДНК), кодирующую представляющую интерес последовательность HM, и/или где система содержит последовательность, кодирующую HM-ДНК, где HM-ДНК содержит последовательность или последовательности, которые являются гомологичными, соответственно, последовательности или последовательностям в последовательности-мишени или фланкирующим последовательность-мишень для вставки HM-ДНК в геном хозяина (например, в хромосомный или эписомный участок).

13. Сконструированный вектор на основе нуклеиновой кислоты для модификации бактериальной клетки-хозяина, содержащей эндогенную систему CRISPR/Cas, где вектор

(a) содержит последовательности нуклеиновой кислоты для экспрессии множества различных crРНК (например, gРНК) для применения в системе CRISPR/Cas, способе или применении в соответствии с любой предшествующей концепцией; и

(b) необязательно, лишен последовательности нуклеиновой кислоты, кодирующей нуклеазу Cas, где первая из указанных crРНК является способной гибридизоваться с первой последовательностью нуклеиновой кислоты в указанной клетке-хозяине; и вторая из указанных crРНК является способной гибридизоваться с второй последовательностью нуклеиновой кислоты в указанной клетке-хозяине, где указанная вторая последовательность отличается от указанной первой последовательности; и

(c) первая последовательность содержится в гене устойчивости к антибиотику (или его РНК) и вторая последовательность содержится в гене устойчивости к антибиотику (или его РНК); необязательно, где гены являются различными;

(d) первая последовательность содержится в гене устойчивости к антибиотику (или его РНК) и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК);

(e) первая последовательность содержится в жизненно важном гене (или его РНК), и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК); или

(f) первая последовательность содержится в гене вирулентности (или его РНК) и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК).

14. Вектор из концепции 13 внутри клетки-хозяина, содержащей одну или несколько Cas, которые являются способными функционировать с cРНК (например, одиночной направляющей РНК), кодируемой вектором.

15. Применение, способ, система или вектор из любой предшествующей концепции, где HM-массив CRISPR содержит множество копий одного и того же спейсера.

16. Применение, способ, система или вектор из любой предшествующей концепции, где вектор(ы) содержит множество HM-массивов CRISPR.

17. Применение, способ, система или вектор из любой предшествующей концепции, где каждый вектор представляет собой плазмиду, космиду, вирус, вирион, фаг, фагмиду или профаг.

18. Применение, способ, система или вектор из любой предшествующей концепции, где система или вектор содержит две, три или более копий последовательностей нуклеиновой кислоты, кодирующей crРНК (например, gРНК), где копии содержат одну и ту же спейсерную последовательность для нацеливания на последовательность клетки-хозяина (например, последовательность гена вирулентности, гена устойчивости или жизненно важного гена).

19. Применение, способ, система или вектор из концепции 18, где копии разделены между двумя или более векторами с массивами CRISPR.

20. Бактериальная клетка-хозяин, содержащая систему или вектор, указанные в любой предшествующей концепции.

21. Система, вектор или клетка по любой из концепций 2-20 в комбинации с антибиотическим средством (например, с бета-лактамным антибиотиком).

22. Применение, способ, система, вектор или клетка из любой предшествующей концепции, где эта или каждая клетка-хозяин представляет собой клетку-хозяина Staphylococcus, Streptococcus, Pseudomonas, Salmonella, Listeria, E coli, Desulfovibrio или Clostridium. В одном примере, эта или каждая клетка-хозяин представляет собой клетку Firmicutes, например, клетку Staphylococcus, Streptococcus, Listeria или Clostridium.

В одном примере, каждый массив CRISPR содержит последовательность R1-S1-R1' для экспрессии и продукции соответствующей crРНК (например, содержащейся в одиночной направляющей РНК) в клетке-хозяине, (i) где R1 представляет собой первый повтор CRISPR, R1' представляет собой второй повтор CRISPR, и R1 или R1' является необязательным; и (ii) S1 представляет собой первый спейсер CRISPR, который содержит нуклеотидную последовательность или состоит из нуклеотидной последовательности, на 95% или более идентичной указанной последовательности-мишени.

В одном примере, R1 и R1' являются по меньшей мере на 95% идентичными, соответственно, последовательностям первого и второго повтора из массива CRISPR из вида второй клетки-хозяина. В одном примере, R1 и R1' являются по меньшей мере на 95% (например, 96, 97, 98, 99 или 100%) идентичными, соответственно, последовательностям первого (наиболее близкого к 5'-концу) и второго (повтора, непосредственно на 3'-конце первого повтора) повтора из массива CRISPR из указанного вида, например, из указанной клетки-хозяина из указанного вида. В одном примере, R1 и R1' являются функциональными с нуклеазой Cas9 типа II (например, Cas9 S thermophilus, S pyogenes или S aureus) для модификации мишени в указанной клетке-хозяине.

Альтернативное применение по концепции 1 по изобретению относится к следующему, как показано в рабочем экспериментальном примере:

Применение активности эндогенной нуклеазы Cas дикого типа из популяции бактериальной клетки-хозяина для ингибирования роста популяции, где каждая клетка-хозяин обладает эндогенной системой CRISPR/Cas, обладающей активностью нуклеазы Cas дикого типа, где применение включает в себя трансформацию клеток-хозяев из популяции, где каждая трансформированная клетка-хозяин трансформирована сконструированной нуклеотидной последовательностью для предоставления модифицирующей хозяина (HM) cРНК или направляющей РНК (gРНК) в клетке-хозяине, где HM-cРНК или gРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью протоспейсера клетки-хозяина для направления эндогенной Cas к мишени, где cРНК или gРНК является родственной эндогенной нуклеазе Cas клетки-хозяина, обладающей указанной активностью нуклеазы дикого типа, и после трансформации клеток-хозяев рост популяции является ингибированным.

В рабочем примере ниже, ингибирование было направлено на популяцию бактерий (грамположительных Firmicutes) на твердой поверхности. Достигнуто >10-кратное ингибирование роста популяции клеток-хозяев. Нацеливание было направлено на ген устойчивости к антибиотику и на жизненно важный ген. Изобретение может являться полезным для ингибирования роста устойчивых к антибиотику бактерий, где последовательность-мишень представляет собой последовательность гена устойчивости к антибиотику. В одном примере, совместное введение сконструированной нуклеотидной последовательности с антибиотиком может являться эффективным. Это может обеспечивать более полное лечение или предотвращение инфекции клетки-хозяина у субъектов - людей или животных и/или позволять уменьшение терапевтически эффективной дозы антибиотика для введения человеку или животному. Это является полезным, принимая во внимание увеличивающиеся опасения относительно избыточного введения антибиотиков и развития устойчивости в популяциях людей и животных.

Демонстрация возможности изобретения ингибировать рост клетки-хозяина на поверхности является важной и желательной в вариантах осуществления, где изобретение предназначено для лечения или предотвращения заболеваний или состояний, опосредованных или вызванных микробиотой, как описано в настоящем документе, у субъекта - человека или животного. Такая микробиота, как правило, находится в контакте с тканью субъекта (например, тканью кишечника, ротовой полости, легкого, подмышечной впадины, глаза, вагины, ануса, уха, носа или горла) и таким образом, авторы настоящего изобретения считают, что демонстрация активности ингибирования роста видов бактерий микробиоты (проиллюстрированных посредством Streptococcus) на поверхности поддерживает эту полезность.

В одном примере, используют активность эндогенных Cas9 или cfp1 дикого типа клетки-хозяина. Сконструированная нуклеотидная последовательность может не присутствовать в комбинации с последовательностью, кодирующей экзогенную нуклеазу Cas.

В одном примере, клетки-хозяева представляют собой бактериальные клетки дикого типа (например, не сконструированные). В другом примере, клетки-хозяева являются сконструированными (например, для введения в хромосому экзогенной нуклеотидной последовательности или для модификации эндогенной нуклеотидной последовательности, например, на хромосоме или плазмиде клетки-хозяина), и где клетки-хозяева содержат эндогенную систему CRISPR/Cas обладающую активностью нуклеазы Cas дикого типа, способную функционировать с crРНК или gРНК. В одном примере, формирование бактериальных колоний указанных клеток-хозяев является ингибированным после указанной трансформации. В одном примере, пролиферация клеток-хозяев является ингибированной после указанной трансформации. В одном примере, клетки-хозяева уничтожают после указанной трансформации.

Под «родственной» подразумевают, что эндогенная Cas способна функционировать с последовательностью crРНК или gРНК для направления на мишень в клетке-хозяине. Специалисту в данной области понятно, что такое направление Cas, как правило, является признаком активности CRISPR/Cas в бактериальных клетках, например, активности CRISPR/Cas дикого типа в бактериальных клетках, обладающих эндогенными активными системами CRISPR/Cas дикого типа.

Под активностью Cas «дикого типа» подразумевают, как понятно специалисту в данной области, что эндогенная Cas не является сконструированной Cas, или что клетка не является сконструированной для дерепрессии эндогенной активности Cas. Это отличается от конкретных бактерий, где активность нуклеазы Cas естественным образом репрессирована (т.е., в которых не присутствует активность нуклеазы Cas дикого типа или активность, пригодная по настоящему изобретению, которое, напротив, можно применять по отношению к клеткам-хозяевам дикого типа in situ, например, где эндогенную активность Cas можно использовать для получения эффекта ингибирования роста популяции клеток).

В одном примере, происходит ингибирование роста популяции клеток-хозяев по меньшей мере в 2, 3, 4, 5, 6, 7, 8, 9 или 10 раз по сравнению с ростом указанных клеток-хозяев, не подвергнутых воздействию указанной сконструированной нуклеотидной последовательности. Например, ингибирование роста показывают по более низкому количеству бактериальных колоний для первого образца клеток-хозяев (отдельно или в смешанной популяции бактерий) по меньшей мере в 2, 3, 4, 5, 6, 7, 8, 9 или 10 раз по сравнению с количеством колоний для второго образца клеток-хозяев (отдельно или в смешанной популяции бактерий), где первые клетки трансформированы указанной сконструированной нуклеотидной последовательностью, но второй образец не подвергнут воздействию указанной сконструированной нуклеотидной последовательности. В одном варианте осуществления, количество колоний определяют через 12, 24, 36 или 48 часов после подвергания первого образца воздействию сконструированной последовательности. В одном варианте осуществления, колонии выращивают на твердом агаре in vitro (например, на чашке Петри). Таким образом, понятно, что это ингибирование роста можно показать по уменьшению (<100% рост по сравнению с отсутствием обработки, т.е., ростом контрольного образца) роста клеток или популяций, содержащих последовательность-мишень, или может присутствовать полное прекращение такого роста. В одном примере, рост популяции клетки-хозяина уменьшают по меньшей мере на 10, 20, 30, 40, 50, 60, 70, 80, 90 или 95%, т.е., в течение предопределенного периода времени (например, 24 часа или 48 часов после комбинации с cРНК или gРНК в клетках-хозяевах), т.е., рост популяции клетки-хозяина является по меньшей мере на такой процент ниже, чем рост контрольной популяции клеток-хозяев, которую не подвергали воздействию указанной cРНК или gРНК, но в ином отношении сохраняли в таких же условиях в течение продолжительности указанного предопределенного периода. В одном примере, процент уменьшения роста определяют посредством сравнения количества колоний в образце из каждой популяции в конце указанного периода (например, на время средней логарифмической фазы роста контрольного образца). Например, после воздействия на тестируемую популяцию crРНК или gРНК на время ноль, отбирают образец тестируемой и контрольной популяций, и каждый образец высевают на чашку с агаром и инкубируют в идентичных условиях в течение указанного предопределенного периода. В конце этого периода, подсчитывают количество колоний из каждого образца и процент различий (т.е., тестируемое количество колоний, разделенное на контрольное количество колоний, и затем умноженное на 100, и затем результат вычитают из 100 для получения процента уменьшения роста). Кратность различий рассчитывают посредством деления контрольного количества колоний на тестируемое количество колоний.

Ингибирование роста популяции можно показывать, таким образом, посредством уменьшения пролиферации клеток-хозяев в популяции. Это может быть обусловлено уничтожением клеток посредством нуклеазы и/или понижающей регуляции пролиферации клеток-хозяев (деления и/или роста клеток) посредством действия нуклеазы на последовательность-мишень протоспейсера. В одном варианте осуществления лечения или предотвращения, как описано в настоящем документе, уменьшают нагрузку клетки-хозяина на субъекта - человека или животного, в результате чего заболевание или состояние лечат (например, уменьшают или прекращают) или предотвращают (т.е., риск развития у субъекта заболевания или состояния) уменьшают или исключают.

Изобретение является полезным для нацеливания на популяции бактерий дикого типа, обнаруженные в природе в окружающей среде (например, в воде или в водных путях, в оборудовании для охлаждения или нагревания), содержащиеся в напитках и пищевых продуктах (или в оборудовании для их изготовления, переработки или хранения), или на популяции бактерий дикого типа, содержащиеся в микробиоте человека или животного. Таким образом, изобретение находит применение в ситуациях, когда предварительная модификация клеток-хозяев, чтобы сделать их восприимчивыми для уничтожения или ингибирования роста, не является возможной или желательной (например, когда обработка in situ микробиоты в кишечнике или других локализациях у субъекта является желательной). В другом применении, изобретение находит применение для получения лекарственного средства ex vivo для введения субъекту - человеку или животному для лечения или предотвращения заболевания или состояния, вызванного или опосредованного клетками-хозяевами, где лекарственное средство содержит модифицированную смешанную популяцию бактерий (например, полученную из фекалий или микробиоты кишечника одного или нескольких доноров-людей), которая является продуктом применения или способа по изобретению, где популяция содержит субпопуляцию бактерий вида или штамма, отличного от вида или штамма клеток-хозяев. Первая субпопуляция клеток не содержит мишени, и таким образом, ее не модифицируют посредством применения или способа. Таким образом, например, способ можно использовать для уменьшения доли субпопуляции Firmicutes и сберегания Bacteroidetes в смешанной популяции, например, для получения лекарственного средства для лечения или предотвращения состояния или заболевания метаболизма или GI, описанного в настоящем документе. Таким образом, изобретение может относиться к лекарственному средству на основе модифицированного бактериального трансплантата (например, модифицированного фекального трансплантата) для такого применения или для указанного лечения или предотвращения у человека или животного. Например, способ можно использовать для модификации одной или нескольких микробиот in vitro для получения модифицированной коллекции бактерий для введения человеку или животному для медицинского применения (например, лечения или предотвращения метаболического состояния (такого как ожирение или диабет) или состояния GI тракта (например, любого такого состояния, упомянутого в настоящем документе), или злокачественной опухоли (например, злокачественной опухоли GI тракта)) или для косметического применения или для применения для личной гигиены (например, для местного применения у человека, например, для уменьшения запаха подмышечной впадины или другого запаха тела посредством местного нанесения на подмышечную впадину человека или другую соответствующую локализацию у человека). В другом примере, массив, crРНК, gРНК или сконструированную нуклеотидную последовательность вводят человеку или животному, и клетки-хозяева переносятся человеком или животным, например, содержатся в микробиоте человека или животного (такой как микробиота кишечника или любой другой тип микробиоты, описанной в настоящем документе). Таким образом, заболевание или состояние, опосредованное или вызванное клетками-хозяевами, можно лечить или предотвращать. В одном примере, трансформацию проводят in vitro и, необязательно, массив, crРНК, gРНК или сконструированная нуклеотидная последовательность содержатся в нуклеиновой кислоте, вводимой посредством электропорации в клетки-хозяева. В одном примере, нуклеиновая кислота представляет собой РНК (например, копии gРНК). В другом примере, нуклеиновая кислота представляет собой ДНК, кодирующую crРНК или gРНК для их экспрессии в клетках-хозяевах.

Таким образом, в одном примере, изобретение относится к сконструированной нуклеотидной последовательности для предоставления модифицирующей клетку-хозяина (HM) cРНК или направляющей РНК (gРНК) в популяции бактериальных клеток-хозяев дикого типа, содержащейся в микробиоте субъекта - человека или животного, для лечения или предотвращения заболевания или состояния, опосредованного или вызванного клетками-хозяевами из микробиоты субъекта, где cРНК или gРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью протоспейсера клетки-хозяина для направления Cas на мишень, где cРНК или gРНК является родственной эндогенной нуклеазе Cas клетки-хозяина, обладающей активностью нуклеазы дикого типа, где после трансформации клеток-хозяев рост популяции является ингибированным, и заболевание или состояние лечат или предотвращают.

В одном примере, сконструированная нуклеотидная последовательность содержит HM-массив CRISPR, как определено в настоящем документе. В одном примере, сконструированная нуклеотидная последовательность кодирует одиночную направляющую РНК. В одном примере, сконструированная нуклеотидная последовательность представляет собой направляющую РНК (например, одиночную направляющую РНК) или crРНК. В одном примере, сконструированная последовательность содержится в бактериофаге, способном инфицировать клетки-хозяева, где трансформация включает в себя трансдукцию клеток-хозяев бактериофагом. Бактериофаг может представлять собой бактериофаг, как описано в настоящем документе. В одном примере, сконструированная нуклеотидная последовательность содержится в плазмиде (например, конъюгативной плазмиде), способной трансформировать клетки-хозяева. Плазмида может представлять собой плазмиду, как описано в настоящем документе. В одном примере, сконструированная нуклеотидная последовательность содержится в транспозоне, который можно переносить в клетки-хозяева и/или между клетками-хозяевами. Транспозон может представлять собой транспозон, как описано в настоящем документе.

Любое применение или способ по изобретению может включать в себя трансформацию клеток-хозяев векторами на основе нуклеиновой кислоты для продукции cРНК или gРНК в клетках. Например, векторы или нуклеиновую кислоту, содержащие сконструированную нуклеотидную последовательность, вводят перорально, внутривенно, местно, в глаза, интраназально, посредством ингаляции, посредством ректального введения, введения в ухо, вагинального введения или посредством любого другого способа введения, описанного в настоящем документе, или иным образом, человеку или животному, содержащему смешанную популяцию бактерий (например, в качестве части микробиоты человека или животного), где введение трансформирует клетки-хозяева векторами или нуклеиновой кислотой.

В одном примере, популяция клеток-хозяев присутствует ex vivo. В одном примере, смешанная популяция содержится у субъекта - человека или животного, и инфекцию клеткой-хозяином у субъекта лечат или предотвращают.

В одном примере, первые и вторые бактерии содержатся в объединении микроорганизмов, где бактерии живут симбиотически. В одном примере, объединение представляет собой микробиоту человека или животного; в одном примере объединение содержится у человека или животного (например, где применение, система, сконструированная последовательность, вектор или клетка предназначены для лечения инфекции клетками-хозяевами из объединения у человека или животного, например, где клетки-хозяева опосредуют или вызывают устойчивость к антибиотику или опасное заболевание или состояние у человека или животного). Виды (E coli, L lactis и S thermophilus), используемые в рабочем примере ниже, представляют собой штаммы, которые сосуществуют симбиотически в микробиоте кишечника у человека и животного. Пример относится также к нацеливанию на смешанную популяцию грамположительных и грамотрицательных бактерий. Кроме того, пример относится к популяции Firmicutes (S thermophilus) и к популяции Enterobacteriaceae (E coli), обе из которых обнаружены в микробиоте человека. Другие примеры Enterobacteriaceae представляют собой Salmonella, Yersinia pestis, Klebsiella, Shigella, Proteus, Enterobacter, Serratia и Citrobacter.

В одном примере, способ, применение, сконструированная нуклеотидная последовательность, массив, crРНК, gРНК, вектор или система предназначены для лечения инфекции клеткой-хозяином в популяции микробиоты кишечника человека, необязательно, где популяция содержит также первые бактерии, представляющие собой комменсальные бактерии кишечника человека и/или Enterobacteriaceae, например, где клетки-хозяева и комменсальные клетки (первые и вторые бактерии) живут симбиотически в микробиоте кишечника человека.

В одном примере применение или система предназначены для изменения доли бактерий Bacteroidetes в смешанной популяции бактерий, содержащей бактерии Bacteroidetes и другие бактерии. Например, для увеличения относительного соотношения Bacteroidetes по сравнению с одними, несколькими или всеми Firmicutes (например, по сравнению с Streptococcus) в популяции. В этом случае, клетки-хозяева могут представлять собой клетки Firmicutes, содержащие мишень(мишени). В одном примере, популяция представляет собой популяцию бактерий из микробиоты, содержащейся у субъекта - человека или животного, и способ, применение, сконструированная нуклеотидная последовательность, вектор или система предназначены для (i) лечения инфекции у субъекта указанными клетками-хозяевами, содержащимися в смешанной популяции (например, составляющими смешанную популяцию); (ii) лечения или предотвращения у субъекта состояния или заболевания, опосредованного указанными клетками-хозяевами; (iii) уменьшения запаха тела человека, вызванного или опосредованного указанными клетками-хозяевами; или (iv) обработки для личной гигиены человека. В одном примере, сконструированная нуклеотидная последовательность, массив, crРНК, gРНК или вектор по изобретению предназначены для использования в такой системе или применении по изобретению.

В одном примере, состояние или заболевание представляет собой метаболическое или желудочно-кишечное заболевание или состояние, например, ожирение, IBD, IBS, болезнь Крона или язвенный колит. В одном примере, состояние или заболевание представляет собой злокачественную опухоль, например, солидную опухоль или злокачественную опухоль GI (например, рак желудка), рак печени или рак поджелудочной железы. В одном примере, состояние представляет собой устойчивость к антибиотику или уменьшенную способность отвечать на антибиотик (например, любой антибиотик, описанный в настоящем документе).

В одном примере, клетка содержит эндогенную РНКазу III, которая может функционировать с компонентом (ii) при продукции указанной HM-crРНК в клетке. Альтернативно, один или несколько векторов содержат нуклеотидную последовательность, кодирующую такую РНКазу III, для экспрессии РНКазы III в клетке-хозяине.

В одном примере, жизненно важный ген (содержащий мишень) кодирует ДНК-полимеразу клетки. Это проиллюстрировано ниже.

В одном примере применения, система, вектор или клетка, массив, cРНК или gРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью протоспейсера клетки-хозяина, смежной с мотивом NGG, NAG, NGA, NGC, NGGNG, NNGRRT или NNAGAAW, смежным с протоспейсером, (PAM), например, PAM AAAGAAA или TAAGAAA (эти последовательности записаны от 5' к 3'). В одном варианте осуществления, PAM является непосредственно смежным с 3'-концом последовательности протоспейсера. В одном примере, Cas представляет собой Cas S aureus, S theromophilus или S pyogenes. В одном примере, Cas представляет собой Cpf1, и/или PAM представляет собой TTN или CTA.

В одном примере сконструированная нуклеотидная последовательность, crРНК, gРНК или массив присутствует в комбинации с антибиотическим средством, например, где мишень содержится в гене устойчивости к антибиотику, где антибиотик представляет собой указанное средство. В одном варианте осуществления, клетки-хозяева являются чувствительными к антибиотику. Например, они могут обладать недостаточной чувствительностью для применения антибиотика для уничтожения инфекции присутствующими клетками-хозяевами (например, у человека или в промышленном сосуде/оборудовании, содержащих популяцию), но антибиотик может ослабить или уменьшить размер или рост субпопуляции клеток-хозяев, в то время как дальнейшее уничтожение или ингибирование роста осуществляют с использованием модификации Cas (например, разрезания мишени) по изобретению.

Изобретение относится к применению, системе, массиву, crРНК, gРНК, сконструированной нуклеотидной последовательности, вектору или клетке для способа лечения антибиотиком (первым антибиотиком) инфекции указанными клетками-хозяевами у субъекта - человека или животного, где ген устойчивости к антибиотику (для устойчивости к первому антибиотику) подлежит нацеливанию Cas посредством системы или вектора в клетках-хозяевах, где способ включает в себя введение системы, массива, crРНК, gРНК, сконструированной нуклеотидной последовательности, вектора или клетки и антибиотика субъекту. Ген подвергают понижающей регуляции, т.е., экспрессию белкового продукта, кодируемого геном, уменьшают или прекращают в клетке-хозяине, в результате чего устойчивость к антибиотику подвергают понижающей регуляции. Инфекцию уменьшают или предотвращают у субъекта. В одном примере, антибиотик вводят одновременно с системой, массивом, crРНК, gРНК, сконструированной нуклеотидной последовательностью, вектором или клеткой; в другом примере, введение является последовательным (например, антибиотик перед системой, массивом, crРНК, gРНК, сконструированной нуклеотидной последовательностью, вектором или клеткой). Этот признак изобретения является полезным для улучшения лечения антибиотиком у субъекта, например, когда только антибиотик не является полностью эффективным для лечения такой инфекции клеткой-хозяином. Антибиотик может представлять собой любой антибиотик, описанный в настоящем документе, например, тетрациклин.

В одном примере, каждая сконструированная нуклеотидная последовательность или вектор содержит указанный массив CRISPR или последовательность, кодирующую указанную crРНК или gРНК, и дополнительно содержит ген устойчивости к антибиотику (например, устойчивости к канамицину), где HM-crРНК или gРНК не нацелена на ген устойчивости к антибиотику. В одном примере, последовательность-мишень содержится в гене устойчивости к антибиотику клетки-хозяина, где антибиотик является отличным от первого антибиотика (например, канамицина). Таким образом, система, сконструированная последовательность или вектор являются способными к нацеливанию на хозяина без нацеливания на себя. Посредством подвергания клеток-хозяев воздействию первого антибиотика, можно способствовать поддержанию в них сконструированной последовательности или вектора посредством положительного селективного давления, поскольку клетки, содержащие ген устойчивости к первому антибиотику, обладают преимуществом для выживания в присутствии первого антибиотика (когда клетки-хозяева, не трансформированные сконструированной последовательностью или векторами, не являются устойчивыми к первому антибиотику). Таким образом, пример относится к: применению по изобретению, включающему в себя подвергание клетки-хозяина или смешанной популяции воздействию указанного антибиотика (например, канамицина) и указанных сконструированной последовательности или вектора(векторов), чтобы способствовать поддержанию кодирующих cРНК или gРНК последовательностей в клетках-хозяевах; или к системе, сконструированной последовательности, массиву или вектору по изобретению в комбинации с указанным антибиотиком.

В одном примере последовательность, кодирующая cРНК или gРНК, или компонент (ii), находится под контролем конститутивного промотора (например, сильного промотора), способного функционировать в виде клетки-хозяина, или индуцируемого промотора. В одном примере компонент (iii) находится под контролем конститутивного промотора, способного функционировать в виде клетки-хозяина, или индуцируемого промотора.

В одном примере, эта или каждая клетка-хозяин представляет собой грамположительную клетку. В другом примере, эта или каждая клетка-хозяин представляет собой грамположительную клетку.

В одном примере способ, применение, система, сконструированная последовательность или вектор предназначены для лечения инфекции клеткой-хозяином в популяции микробиоты кишечника человека, необязательно, где популяция содержит комменсальные бактерии кишечника человека (т.е., бактерии кишечника, которые являются комменсальными для человека).

В одном примере способа, применения, системы, массива, crРНК, gРНК, сконструированной последовательности или вектора, клетки-хозяева содержатся в смешанной популяции бактерий, содержащейся у субъекта - человека или животного, и способ, применение, система, массив, crРНК, gРНК, сконструированная последовательность или вектор предназначены для (i) лечения у субъекта инфекции указанными клетками-хозяевами, содержащимися в смешанной популяции; (ii) лечения или предотвращения у субъекта состояния или заболевания, опосредованного указанными клетками-хозяевами; (iii) уменьшения запаха тела человека, вызванного или опосредованного указанными клетками-хозяевами; или (iv) обработки для личной гигиены человека.

В одном примере способ, применение, система, массив, crРНК, gРНК, сконструированная последовательность или вектор предназначены для обработки in vitro промышленных или медицинских жидкости, твердой поверхности, устройства или контейнера (например, для пищевых продуктов, потребительских товаров, косметики, персонального изделия медицинского назначения, продукта нефти или масла); или для обработки водных путей, воды, напитка, пищевого продукта или косметики, где клетка-хозяин(клетки-хозяева) содержится в жидкости, поверхности, устройства, контейнера, водных путей, воды, напитка, пищевого продукта или косметики или находится на них.

Изобретение относится также к: смешанной популяции бактерий ex vivo, которую можно получить посредством применения или способа по любой концепции в настоящем документе.

В одном примере, смешанная популяция или продукт применения или способа находится в контейнере для медицинского или пищевого применения. Например, контейнер представляет собой стерилизованный контейнер, например, ингалятор, или соединен со шприцем или IV иглой.

В одном примере, продукт популяции из применения или способа можно использовать для введения человеку или животному для заселения его микробиома.

Изобретение относится к: пищевому продукту или напитку для употребления человеком или не относящимся к человеку животным, содержащему продукт популяции из применения или способа.

В настоящем документе, в примере любой конфигурации, концепции или аспекта, Bacteroides представляет собой вид, выбранный из caccae, capillosus, cellulosilyticus, coprocola, coprophilus, coprosuis, distasonis, dorei, eggerthii, faecis, finegoldii, fluxus, fragalis, intestinalis, melaninogenicus, nordii, oleiciplenus, oralis, ovatus, pectinophilus, plebeius, stercoris, thetaiotaomicron, uniformis, vulgatus и xylanisolvens. Например, Bacteroides представляет собой thetaiotaomicron, например, где клетка-хозяин или смешанная популяция представляет собой популяцию микробиоты кишечника ex vivo или in vitro. В одном примере, клетки-хозяева, субпопуляция первых или вторых бактерий содержат множество различных видов Bacteroidetes, или множество видов Bacteroides (например, содержащее B thetaiotaomicron и B fragalis), или видов Bacteroides и Prevotella. В настоящем документе, в одном примере, Prevotella представляет собой вид, выбранный из bergensis, bivia, buccae, buccalis, copri, melaninogenica, oris, ruminicola, tannerae, timonensis и veroralis. Альтернативно, клетки-хозяева, первые или вторые бактерии представляют собой клетки Firmicutes. В одном примере, клетки-хозяева, первая или вторая субпопуляция содержат один или несколько или состоят из одного или нескольких Firmicutes, выбранных из Anaerotruncus, Acetanaerobacterium, Acetitomaculum, Acetivibrio, Anaerococcus, Anaerofilum, Anaerosinus, Anaerostipes, Anaerovorax, Butyrivibrio, Clostridium, Capracoccus, Dehalobacter, Dialister, Dorea, Enterococcus, Ethanoligenens, Faecalibacterium, Fusobacterium, Gracilibacter, Guggenheimella, Hespellia, Lachnobacterium, Lachnospira, Lactobacillus, Leuconostoc, Megamonas, Moryella, Mitsuokella, Oribacterium, Oxobacter, Papillibacter, Proprionispira,Pseudobutyrivibrio, Pseudoramibacter, Roseburia, Ruminococcus, Sarcina, Seinonella, Shuttleworthia, Sporobacter, Sporobacterium, Streptococcus, Subdoligranulum, Syntrophococcus, Thermobacillus, Turibacter и Weisella. В одном примере, клетки-хозяева, или первая или вторая субпопуляция состоят из клеток Clostridium (и необязательно, другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron)). В одном примере, клетки-хозяева, или первая или вторая субпопуляция состоят из клеток Enterococcus (и необязательно, другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron)). В одном примере, клетки-хозяева, или первая или вторая субпопуляция состоят из клеток Ruminococcus (и необязательно, другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron)). В одном примере, клетки-хозяева, или первая или вторая субпопуляция состоят из клеток Streptococcus (и необязательно, другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron)). В одном примере, клетки-хозяева, или первая или вторая субпопуляция состоят из клеток Faecalibacterium (и необязательно, другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron)). Например, Faecalibacterium представляет собой Faecalibacterium prausnitzii (например, A2-165, L2-6, M21/2 или SL3/3).

В одном примере, клетки-хозяева, или первая или вторая субпопуляция, содержат один или несколько или состоят из одного или нескольких Firmicutes, выбранных из Anaerotruncus, Acetanaerobacterium, Acetitomaculum, Acetivibrio, Anaerococcus, Anaerofilum, Anaerosinus, Anaerostipes, Anaerovorax, Butyrivibrio, Clostridium, Capracoccus, Dehalobacter, Dialister, Dorea, Enterococcus, Ethanoligenens, Faecalibacterium, Fusobacterium, Gracilibacter, Guggenheimella, Hespellia, Lachnobacterium, Lachnospira, Lactobacillus, Leuconostoc, Megamonas, Moryella, Mitsuokella, Oribacterium, Oxobacter, Papillibacter, Proprionispira,Pseudobutyrivibrio, Pseudoramibacter, Roseburia, Ruminococcus, Sarcina, Seinonella, Shuttleworthia, Sporobacter, Sporobacterium, Streptococcus, Subdoligranulum, Syntrophococcus, Thermobacillus, Turibacter и Weisella. В одном примере, клетки-хозяева, или первая или вторая субпопуляция, состоят из клеток Clostridium (например, dificile) (и необязательно, другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron)). В одном примере, клетки-хозяева, или первая или вторая субпопуляция состоят из клеток Enterococcus (и необязательно, другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron)). В одном примере, клетки-хозяева, или первая или вторая субпопуляция, состоят из клеток Ruminococcus (и необязательно, другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron)). В одном примере, клетки-хозяева, или первая или вторая субпопуляция состоят из клеток Streptococcus (и необязательно, другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron) и/или Enterobacteriaceae (например, E coli)). В одном примере, клетки-хозяева, или первая или вторая субпопуляция состоят из клеток Faecalibacterium (и необязательно, другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron)). В одном примере, клетки-хозяева, или первая или вторая субпопуляция состоят из клеток Streptococcus (необязательно, клеток S thermophilus и/или pyogenes) и другая субпопуляция состоит из клеток Bacteroides (например, thetaiotaomicron) и/или Enterobacteriaceae (например, E coli).

Продукт популяции из применения или способа по изобретению предназначен, в одном варианте осуществления, для введения человеку или не относящемуся к человеку животному посредством введения на слизистые оболочки, в кишечник, перорального, интраназального, ректального, интравагинального, глазного или буккального введения.

Необязательно, клетки-хозяева, или первая или вторая субпопуляция бактерий представляют собой бактерии B fragalis, и популяция содержится в воде.

Пригодный напиток, содержащий массив, систему, сконструированную последовательность, вектор или gРНК по изобретению, представляет собой, например, пробиотический напиток, например, адаптированные Yakult (торговое наименование), Actimel (торговое наименование), Kevita (торговое наименование), Activia (торговое наименование), Jarrow (торговое наименование) или сходный напиток для употребления человеком.

ПоследовательностИ-МИШЕНИ ФАГОВ

В аспектах по изобретению, последовательность-мишень представляет собой последовательность фага, инфицирующего бактериальную клетку-хозяина. Желательная модификация геномов фагов, как достигают по изобретению, относится не только к уничтожению или нокдауну фага, но вместо этого может представлять собой активацию желательного гена или регуляторного элемента фага в клетке-хозяине (например, когда фаг экспрессирует желательный белок или другой продукт, ассоциированный с увеличенной жизнеспособностью или пролиферацией клетки-хозяина). Альтернативно, модификация может представлять собой индуцируемую регуляцию экспрессии гена фага, например, посредством использования индуцируемой Cas, которую нацеливают по изобретению на участок-мишень фага. В одном варианте осуществления, изобретение относится к модификации участка-мишени фага посредством разрезания нуклеазой Cas в клетке-хозяине. Это может являться полезным по разным причинам, например:-

A. для введения мутаций в участок-мишень для его активации или инактивации (например, для нокдауна гена или инактивации направленного против хозяина гена; или для уничтожения клетки-хозяина, когда мишень фага интегрирована в хромосому хозяина);

B. для делеции последовательности-мишени или более крупной последовательности, содержащей последовательность-мишень (например, когда изобретение используют с первой и второй PM-crРНК, нацеленными на геном фага, где разрезы в каждом участке приводят к делеции нуклеиновой кислоты фага между разрезами);

C. для вставки желательной PM-последовательности ДНК в геном клетки-хозяина (например, посредством обеспечения одного или нескольких направляемых PM-crNA разрезов в нуклеиновой кислоте хозяина для вставки желательной PM-ДНК посредством гомологичной рекомбинации).

Изобретение относится к следующим аспектам:-

1. Способ изменения относительного соотношения субпопуляций первых и вторых бактерий в смешанной популяции бактерий, содержащей указанные субпопуляции, где первые бактерии представляют собой клетки-хозяева (например, клетки-хозяева Bacteroidetes) (где первые бактерии, необязательно, инфицированы фагом, и вторые бактерии не являются инфицированными указанным фагом (или не являются Bacteroidetes)), где способ включает в себя комбинирование смешанной популяции с множеством векторов за одну или несколько стадий для введения нуклеиновой кислоты вектора (например, его содержащего PM транспозона) в клетки-хозяева и обеспечение роста бактерий в смешанной популяции, где относительные соотношения указанных первых и вторых бактерий изменяют; где каждый вектор содержит сконструированный модифицирующий фаг (PM) массив CRISPR для введения в клетку-хозяина для модификации нуклеотидной последовательности-мишени (например, из указанного фага) в клетке,

(a) где PM-массив CRISPR содержит одну или несколько последовательностей для экспрессии PM-crРНК, соответственно, и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине; и (b) где PM-crРНК является способной гибридизоваться с последовательностью-мишенью для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени.

Посредством нацеливания на последовательность(последовательности) фага для инактивации гена(генов), необходимых для жизнеспособности, размножения или инфекционности фага, в одном аспекте изобретение относится к массиву с преимуществом положительного отбора, который может способствовать его поглощению и поддержанию клетками-хозяевами, инфицированными фагом. Когда клетки-хозяева уничтожают или их рост уменьшают, относительное соотношение первых к вторым бактериям в популяции уменьшают. Изобретение относится к такой популяции-продукту, например, для применения в качестве лекарственного средства для лечения или предотвращения (уменьшения риска) заболевания или состояния у субъекта - человека или животного, где лекарственное средство вводят субъекту. Заболевание или состояние может представлять собой заболевание или состояние, описанное в настоящем документе. В одном примере, одиночную направляющую РНК (gРНК) экспрессируют в клетках-хозяевах для получения crРНК, и каждый вектор содержит поддающуюся экспрессии сконструированную нуклеотидную последовательность, кодирующую такую gРНК.

В одном примере с использованием PM-массива, последовательность-мишень представляет собой последовательность Bacteroides thetaiotaomicron. Необязательно, последовательность-мишень не содержится в B fragalis. Это является полезным, например, где модификация разрезает или иным образом делает последовательность-мишень нефункциональной, в результате чего доля клеток-хозяев B thetaiotaomicron увеличивается без нацеливания на B fragalis, например, где смешанная популяция представляет собой популяцию микробиоты кишечника, как описано в настоящем документе. B fragalis в некоторых условиях является ассоциированным с абсцессами, и таким образом, этот пример уменьшает риск этого, в то же время позволяя изменение соотношений (увеличение доли клеток B thetaiotaomicron) по изобретению, что можно использовать например, для восстановления равновесия микробиоты кишечника, например, для лечения или предотвращения ожирения или диабета, или IBD.

Промотор (или HM- или PM-массив) является способным функционировать в клетке-хозяине. В одном примере, промотор представляет собой промотор вируса или фага, например, промотор T7. В другом примере, промотор представляет собой промотор бактерии (например, промотор вида клетки-хозяина).

2. Способ по аспекту 1, где первые бактерии представляют собой бактерии Bacteroides (например, thetaiotamicron или fragalis), Alistipes, Alkaliflexus, Parabacteroides, Tannerella, Xylanibacter и/или Prevotella.

3. Способ по аспекту 1 или 2, где вторые бактерии представляют собой бактерии Firmicutes (например, когда первые бактерии представляют собой Bacteroidetes или Bacteroides).

4. Способ по любому из предшествующих аспектов, где соотношение субпопуляции первых бактерий и субпопуляции вторых бактерий увеличено, т.е., является большим после осуществления указанного способа, чем до этого.

5. Способ по аспекту 4, где смешанная популяция содержится в композиции (например, напитка, ополаскивателя для ротовой полости или пищевого продукта) для введения человеку или не относящемуся к человеку животному для заселения и восстановления равновесия его микробиоты кишечника или ротовой полости, например, где смешанная популяция присутствует in vitro, или in vivo у человека или не относящегося к человеку животного.

6. Способ по аспекту 1, 2 или 3, где соотношение субпопуляции первых бактерий и субпопуляции вторых бактерий уменьшено, т.е., является меньшим после осуществления указанного способа, чем до этого.

7. Способ по аспекту 6, где смешанная популяция содержится в напитке или воде (например, в водных путях или питьевой воде) для употребления человеком.

8. Способ по любому из предшествующих аспектов, где каждый вектор представляет собой плазмиду, фаг (например, упакованный фаг) или фагмиду.

9. Способ по аспекту 8, где каждый вектор представляет собой фаг (например, упакованный фаг), и нуклеиновую кислоту вектора вводят в клетки-хозяева посредством трансдукции нуклеиновой кислоты фагового вектора в клетки-хозяева, т.е., посредством инфекции клеток-хозяев фаговыми векторами. В одном примере, фаг содержит один или несколько транспозонов, как описано в настоящем документе.

10. Способ по аспекту 8, где каждый вектор представляет собой плазмиду, и нуклеиновую кислоту вектора вводят в клетки-хозяева посредством трансформации или горизонтального переноса плазмиды от бактерий, несущих векторы. В одном примере, плазмида содержит один или несколько транспозонов, как описано в настоящем документе. В одном примере, бактерии, несущие векторы, не являются видами Bacteroidetes или Bacteroides. Дополнительно или альтернативно, бактерии, несущие векторы, не являются видами Firmicutes. В одном примере, бактерии, несущие векторы, представляют собой бактерии одного или нескольких видов, выбранных из группы, состоящей из видов Lactobacillus (например, acidophilus (например, La-5, La-14 или NCFM), brevis, bulgaricus, plantarum, rhammosus, fermentum, caucasicus, helveticus, lactis, reuteri или casei например, casei Shirota), видов Bifidobacterium (например, bifidum, breve, longum или infantis), Streptococcus thermophilus и Enterococcus faecium. Например, бактерии представляют собой бактерии L acidophilus или lactis.

11. Сконструированный модифицирующий фаг (PM) Bacteroidetes массив CRISPR для применения в способе по любому из предшествующих аспектов для модификации генома указанного фага Bacteroidetes,

(a) где PM-массив CRISPR содержит одну или несколько последовательностей для экспрессии PM-crРНК и промотор для транскрипции последовательности(последовательностей) в инфицированной фагом Bacteroidetes клетке-хозяине; и

(b) где PM-crРНК является способной гибридизоваться с последовательностью-мишенью генома фага Bacteroidetes для направления Cas (например, нуклеазы Cas) в инфицированной клетке-хозяине для модификации последовательности-мишени.

12. Вектор на основе нуклеиновой кислоты (например, плазмида, фаг или фагмида) для применения в способе по любому из аспектов 1-10, где вектор содержит PM-массив CRISPR по аспекту 11.

В общем варианте осуществления изобретения, альтернативно представлено для аспекта 12:-

Вектор на основе нуклеиновой кислоты (например, плазмида, вирус, фаг или фагмида), содержащий сконструированный HM-массив CRISPR для модификации последовательности-мишени из генома бактериальной клетки-хозяина (например, клетки патогенной бактерии, такой как описано выше) или генома вируса (например, фага) в клетке-хозяине, (a) где массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине; и (b) где crРНК является способной гибридизоваться с последовательностью-мишенью для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени.

Промотор является способным функционировать в клетке-хозяине. В одном примере, промотор представляет собой промотор вируса или фага, например, промотор T7. В другом примере, промотор представляет собой промотор бактерии (например, промотор вида клетки-хозяина).

В одном примере, массив содержится в транспозоне, описанном в настоящем документе. В одном примере, массив содержится в бактерии-носителе, как описано в настоящем документе. В одном примере, представлено множество массивов для нацеливания на одну или несколько нуклеотидных последовательностей-мишеней фага или клетки-хозяина, где множество массивов содержатся в бактериальных клетках, например, клетках носителя, первого реципиента или второго реципиента, как описано в настоящем документе. В одном примере, клетки-носители содержатся в напитке (например, пробиотическом напитке для употребления человеком) или пищевом продукте, как описано в настоящем документе. В одном примере, массив или бактерии-носители предназначены для введения человеку или не относящемуся к человеку животному для лечения или предотвращения инфекции человека или животного, например, где клетка-хозяин является патогенной. В одном примере, массив или бактерии-носители предназначены для введения в кишечник человека или не относящегося к человеку животного для лечения или предотвращения ожирения, диабета или IBD человека или животного.

13. Массив или вектор по аспекту 11 или 12, где массив или вектор содержится в бактериальной клетке, например, в пробиотической клетке для употребления человеком или не относящимся к человеку животным.

14. Способ, массив или вектор по любому из предшествующих аспектов, где векторы содержатся в третьей популяции бактерий (например, бактерий-носителей, описанных в настоящем документе), которую используют для указанной комбинации со смешанной популяцией или которая предназначена для комбинации со смешанной популяцией, в результате чего нуклеиновую кислоту вектора вводят в клетки-хозяева посредством трансформации (например, посредством горизонтального переноса плазмидного вектора или транспозона от третьих бактерий к первым бактериальным клеткам-хозяевам) или трансдукции (например, посредством инфекции фаговыми векторами первых бактериальных клеток-хозяев).

15. Способ, массив или вектор по любому из предшествующих аспектов, где этот или каждый массив или вектор содержится в комменсальной или симбиотической бактериальной клетке кишечника человека или не относящегося к человеку животного (например, в бактериальной клетке-носителе, как описано в настоящем документе). Таким образом, клетка происходит из вида бактерий кишечника, который является комменсальным или симбиотическим с человеком или не относящимся к человеку животным.

16. Способ или вектор по любому из аспектов 12-15, где этот или каждый вектор представляет собой плазмиду, фаг или фагмиду, содержащие точку начала репликации, которая является способной функционировать в клетке-хозяине Firmicutes или в инфицированной фагом клетке-хозяине Bacteroidetes (например, в клетке Bacteroides), и необязательно, является способной функционировать в комменсальной или симбиотической бактериальной клетке, как определено в аспекте 15. В одном примере, точка начала репликации представляет собой oriT или любую другую точку начала репликации, описанную в настоящем документе.

17. Способ или вектор по любому из аспектов 12-16, где этот или каждый вектор представляет собой плазмиду или фагмиду, содержащую последовательность (например, транспозон, описанный в настоящем документе), которая является способной к горизонтальному переносу между (1) комменсальной или симбиотической для человека или не относящегося к человеку животного бактериальной клеткой, которая не является клеткой Bacteroides, и (2) инфицированной указанным фагом клеткой, которая является клеткой Bacteroides; или между (3) комменсальной или симбиотической для человека или не относящегося к человеку животного бактериальной клеткой, которая не является клеткой Firmicutes, и (4) клеткой Firmicutes, содержащей последовательность-мишень.

18. Способ или вектор по любому из аспектов 12-17, где этот или каждый вектор представляет собой последовательность плазмиды или фагмиды (например, транспозон, описанный в настоящем документе), который является способным к горизонтальному переносу между (1) инфицированной указанным фагом клеткой, которая является клеткой Bacteroides и (2) бактериальной клеткой, пригодной для пробиотического введения в кишечник человека или не относящегося к человеку животного; или между (3) клеткой Firmicutes, содержащей последовательность-мишень, и (4) бактериальной клеткой, пригодной для пробиотического введения в кишечник человека или не относящегося к человеку животного.

19. Способ или вектор по любому из аспектов 15-18, где комменсальный, симбиотический или пробиотический вид выбран из группы, состоящей из видов Lactobacillus (например, acidophilus (например, La-5, La-14 или NCFM), brevis, bulgaricus, plantarum, rhammosus, fermentum, caucasicus, helveticus, lactis, reuteri или casei например, casei Shirota), видов Bifidobacterium (например, bifidum, breve, longum или infantis), Streptococcus thermophilus и Enterococcus faecium.

Способ, массив или вектор по любому из предшествующих аспектов, где промотор является способным функционировать для транскрипции указанной последовательности(последовательностей) в инфицированной указанным фагом клетке-хозяине Bacteroidetes и в комменсальной, симбиотической или пробиотической бактериальной клетке, как определено в любом из аспектов 15-19; или в клетке Firmicutes, содержащей последовательность-мишень, и в комменсальной, симбиотической или пробиотической бактериальной клетке, как определено в любом из аспектов 15-19. Например, промотор представляет собой вирусный или бактериальный промотор, например, промотор T7. В одном примере, промотор представляет собой промотор клетки-хозяина, например, промотор массива CRISPR/Cas хозяина.

20. Способ, массив или вектор по любому из предшествующих аспектов или любому применению в настоящем документе, где модификация представляет собой (i) разрезание последовательности-мишени, (ii) понижающую регуляцию транскрипции гена, содержащего последовательность-мишень, (iii) повышающую регуляцию транскрипции гена, содержащего последовательность-мишень, или (iv) добавление, делецию или замену последовательности нуклеиновой кислоты в мишени.

21. Способ, массив или вектор по любому из предшествующих аспектов, где фаг Bacteroidetes представляет собой фаг Bacteroides, выбранный из crAssphage, фага GB-124, фага GA-17, фага HB-13, фага H16-10, фага B40-8 и фага B fragalis ATCC51477-B1. Приведена ссылка на Nat Commun. 2014 Jul 24;5:4498. doi: 10,1038/ncomms5498, «A highly abundant bacteriophage discovered in the unknown sequences of human faecal metagenomes», Dutilh BE et al. Геном crAssphage ~97 т.п.о. является в шесть раз более распространенным в публично доступных метагеномах, чем все другие известные фаги вместе; он содержит вплоть до 90% и 22% из всех прочтений в происходящих из вирусоподобных частиц (VLP) метагеномах и метагеномах общего сообщества, соответственно; и он содержит всего 1,68% из всех прочтений секвенирования метагеномов фекалий человека в публичных базах данных. С использованием нового способа получения профиля совместной встречаемости, Dutilh et al прогнозировали хозяина Bacteroides для этого фага, в соответствии с гомологами родственных Bacteroides белков и уникальным связывающим углевод доменом, кодируемыми геномом фага.

22. Способ, массив или вектор по любому из предшествующих аспектов или любому применению в настоящем документе, где последовательность-мишень содержится в гене фага, необходимого для инфекционности по отношению к клетке-хозяину, лизогенного или литического цикла фага или жизнеспособности фага, например, жизненно важного гена или гена белка оболочки.

23. Способ, массив или вектор по любому из предшествующих аспектов, где последовательность-мишень содержится в последовательности, кодирующей домен BACON (ассоциированный с Bacteroidetes связывающий углевод) (например, где хозяин представляет собой хозяина Bacteroides), или в последовательности, кодирующей эндолизин. Приведена ссылка на FEBS Lett. 2010 Jun 3;584(11):2421-6, doi:10,1016/j.febslet.2010,04,045. Epub 2010 Apr 21, «Mining metagenomic data for novel domains: BACON, a new carbohydrate-binding module», Mello L et al. Присутствие домена BACON в структурном белке фага можно объяснить предположительной адгезией бактериофага в модели слизи. В соответствии с этой моделью, фаг проявляет адгезию к гликопротеинам муцина, составляющим слизистый слой кишечника, посредством экспонированных на капсиде связывающих углеводы доменов (таких как иммуноглобулиноподобная складка или домен BACON), способствующих более частым взаимодействиям с бактериями, которые инфицирует фаг.

25. Способ, массив или вектор по любому из предшествующих аспектов или любому применению в настоящем документе, где массив CRISPR содержит последовательность R1-S1-R1' для экспрессии и продукции crРНК в клетке-хозяине,

(i) где R1 представляет собой первый повтор CRISPR, R1' представляет собой второй повтор CRISPR, и R1 или R1' является необязательным; и

(ii) S1 представляет собой первый спейсер CRISPR, который содержит нуклеотидную последовательность или состоит из нуклеотидной последовательности, на 95% или более идентичной указанной последовательности-мишени. Например, последовательность-мишень содержит протоспейсер или содержится в последовательности протоспейсера, непосредственно смежной с мотивом, смежным с протоспейсером (PAM), который является родственным Cas, когда массив по изобретению присутствует в клетке-хозяине, где Cas также является родственной crРНК, экспрессированной с массива. В одном варианте осуществления, Cas является эндогенной для клетки. В другом примере, Cas является экзогенной для клетки-хозяина, например, предоставленной посредством вектора по изобретению.

26. Способ, массив или вектор по аспекту 25, где R1 и R1' являются по меньшей мере на 95% (например, на 96, 97, 98, 99 или 100%) идентичными последовательностям повторов из массива CRISPR из клетки того же вида, что и клетка-хозяин.

27. Способ, массив или вектор по аспекту 25, где каждый из R1 и R1' является по меньшей мере на 95% (например, на 96, 97, 98, 99 или 100%) идентичными последовательности повтора из массива CRISPR (например, массива типа II-C) из видов Bacteroides, выбранных из thetaiotamicron и fragalis (например, Bacteroides fragalis NCTC 9343), где клетки-хозяева содержат систему CRISPR/Cas, которая является функциональной с последовательностью повтора, и представляют собой клетки Bacteroides, например, из указанного вида.

28. Способ, массив, применение или вектор по аспекту 27, где R1 и R1' являются по меньшей мере на 95% (например, на 96, 97, 98, 99 или 100%) идентичными, соответственно, последовательностям первого (наиболее близкого к 5'-концу) и второго (повтора, непосредственно на 3'-конце первого повтора) повтора из массива CRISPR из указанного вида, например, из указанной клетки-хозяина из указанного вида. В одном примере, массив представляет собой массив типа II-C. В одном примере, массив или вектор дополнительно содержит R2-S2-R2', где спейсер S2 является одинаковым или отличным от спейсера S1 (например, для нацеливания на отличный участок-мишень в геноме клетки-хозяина или фага), где R2 и R2' являются функциональными в клетке-хозяине и, необязательно, являются такими же, как R1. Например, каждый из R1, R1', R2 и R2' представляет собой повтор CRISPR B fragalis.

29. Способ, массив, применение или вектор по аспекту 25, где (iii) каждый из R1 и R1' является идентичным последовательности повтора из массива CRISPR (например, массива типа II-C) из клетки из вида Bacteroides, где вид выбран из группы, состоящей из caccae, capillosus, cellulosilyticus, coprocola, coprophilus, coprosuis, distasonis, dorei, eggerthii, faecis, finegoldii,fluxus, fragalis (например, fragalis NCTC 9343), intestinalis, melaninogenicus, nordii, oleiciplenus, oralis, ovatus, pectinophilus, plebeius, stercoris, thetaiotaomicron, uniformis, vulgatus и xylanisolvens, и (iv) где клетка-хозяин содержит систему CRISPR/Cas, которая является функциональной с последовательностью повтора и в клетке Bacteroides из вида, выбранного из указанной группы (например, такого же вида, как избранный вид из (iii)).

30. Способ, массив, применение или вектор по аспекту 25, где R1 и R1' являются функциональными с системой CRISPR/Cas из указанной клетки-хозяина Bacteroidetes или Firmicutes для модификации последовательности-мишени. В одном примере, R1, R1', R2 и R2' представляют собой повторы из системы CRISPR/Cas типа II (например, типа II-C) из того же вида бактерий, например, Bacteroides, такого как thetaiotamicron или fragalis или Streptococcus, такого как thermophilus или pyogenes.

31. Способ, массив, применение или вектор по аспекту 25, где R1 и R1' являются по меньшей мере на 95% (например, на 96, 97, 98, 99 или 100%) идентичными последовательностям повторов из массива CRISPR (например, массива типа II-C) из клетки Bacteroidetes (например, Bacteroides или Prevotella) или Firmicutes (например, Streptococcus).

32. Способ, массив, применение или вектор по аспекту 25, где каждый из R1 и R1' является по меньшей мере на 95% (например, 96, 97, 98, 99 или 100%) идентичной последовательности, выбранной из SEQ ID NO: 1-5 из таблицы 2, и необязательно первые бактериальные клетки представляют собой клетки Bacteroides, например, из вида или штамма (например, видов или штаммов, перечисленных напротив выбранной последовательности) в таблице 2.

33. Способ, массив, применение или вектор по аспекту 25, где каждый из R1 и R1' является по меньшей мере на 95% (например, на 96, 97, 98, 99 или 100%) идентичным последовательности, выбранной из SEQ ID NO: 6-11 из таблицы 2, и необязательно, первые бактериальные клетки представляют собой клетки Prevotella, например, из вида или штамма (например, видов или штаммов, перечисленных напротив выбранной последовательности) в таблице 2.

34. Способ, массив или вектор по любому из предшествующих аспектов, где этот или каждый массив присутствует в комбинации с одной или несколькими нуклеазой(нуклеазами) Cas, которые функционируют с crРНК в указанной клетке-хозяине для модификации последовательности-мишени. Например, последовательность-мишень содержит последовательность протоспейсера, непосредственно смежную с мотивом, смежным с протоспейсером (PAM), необязательно, где PAM является родственным нуклеазе Cas, содержащейся в клетках-хозяевах Bacteroidetes. В одном примере, Cas представляет собой нуклеазу Cas типа II-C.

35. Способ, массив или вектор по любому из предшествующих аспектов, где этот или каждый массив присутствует в комбинации с последовательностью(последовательностями) нуклеиновой кислоты, кодирующими одну или несколько нуклеазу(нуклеаз) Cas, которые функционируют с crРНК в указанной клетке-хозяине для модификации последовательности-мишени.

36. Способ, массив, применение или вектор по аспекту 25, где R1 и R1' являются функциональными с нуклеазой Cas9 типа II (например, a S pyogenes, S thermophilus или S aureus Cas9) для модификации мишени в указанной клетке-хозяине, необязательно, где способ, массив или вектор дополнительно соответствует аспекту 34 или 35, где Cas представляет собой указанную Cas9.

37. Смешанная популяция бактерий ex-vivo, которую можно получить способом по любому из аспектов 1-10 или 14-36 или по применению в настоящем документе. Например, смешанная популяция находится в контейнере для медицинского или пищевого применения. Например, контейнер представляет собой стерилизованный контейнер.

38. Композиция для введения человеку или не относящемуся к человеку животному для терапевтического, профилактического, косметического применения, для уменьшения массы тела человека или не относящегося к человеку животного (например, косметического уменьшения), или для пищевого применения, где композиция содержит смешанную популяцию по аспекту 37. В одном примере, композиция предназначена для перорального, системного введения, введения посредством ингаляции, ректального, глазного, буккального или интравагинального введения. В одном примере, композиция предназначена для введения в кишечник или ротовую полость человека или не относящегося к человеку животного.

39. Пищевой продукт или напиток для употребления человеком или не относящимся к человеку животным, содержащий смешанную популяцию по аспекту 37 или композицию по аспекту 38.

40. Пищевой продукт или напиток по аспекту 39, который представляет собой пищевую добавку или пробиотический напиток, или пищевой продукт.

41. Антибиотическая композиция для лечения или предотвращения инфекции Bacteroidetes у человека или не относящегося к человеку животного, или в питьевой воде, где композиция содержит массив или вектор по любому из аспектов 11-36, необязательно, где модификацию осуществляют в соответствии с аспектом 21 (iii) или (iv).

42. Пробиотическая композиция для увеличения доли Bacteroidetes кишечника (например, для лечения или предотвращения ожирения, диабета (например, типа I) или воспалительного состояния GI) у человека или не относящегося к человеку животного, где композиция содержит массив или вектор по любому из аспектов 11-36, необязательно где модификацию осуществляют в соответствии с аспектом 21 (iii) или (iv).

43. Композиция по аспекту 38, 41 или 42 для увеличения относительных соотношений Bacteroides кишечника к Firmicutes у человека или животного, например, для лечения или предотвращения ожирения, диабета (например, диабета типа I) или состояния GI (например, болезни Крона, IBD, IBS или язвенного колита).

Альтернативно, «массив» в любой конфигурации по изобретению можно заменять сконструированной нуклеотидной последовательностью, кодирующей HM-crРНК или gРНК для экспрессии в клетке-хозяине. Признаки любого из аспектов в настоящем документе, относящиеся к массиву, можно, таким образом, альтернативно применять, с соответствующими изменениями, к такой сконструированной последовательности.

МобильныЕ генетическиЕ элементЫ И СИСТЕМЫ CRISPR

44. Вектор на основе нуклеиновой кислоты (например, a плазмида, вирус, фаг или фагмида), содержащий сконструированный массив CRISPR для модификации последовательности-мишени из генома бактериальной клетки-хозяина (например, Firmicutes или клетки патогенной бактерии, такой как описано выше) или генома вируса (например, фага) в клетке-хозяине,

(a) где массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК (например, содержащихся в gРНК) и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине;

(b) где crРНК является способной гибридизоваться с последовательностью-мишенью для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени;

(c) где массив состоит из транспозона, который является способным к горизонтальному переносу между первыми и вторыми бактериальными клетками из различных видов. Необязательно, нуклеаза Cas представляет собой эндогенную нуклеазу Cas дикого типа клетки-хозяина.

45. Вектор по аспекту 44, где массив предназначен для введения человеку или не относящемуся к человеку животному; и первый вид клеток является непатогенным для человека или животного, и второй вид клеток является патогенным для человека или животного, где массив содержится в первой клетке.

46. Вектор по аспекту 45, где первый вид клеток представляет собой вид, являющийся комменсальным или симбиотическим для человека или животного, например, вид из микробиоты кишечника.

47. Вектор по аспекту 45 или 46, где первый вид клеток выбран из группы, состоящей из видов Lactobacillus (например, acidophilus (например, La-5, La-14 или NCFM), brevis, bulgaricus, plantarum, rhammosus, fermentum, caucasicus, helveticus, lactis, reuteri или casei например, casei Shirota), видов Bifidobacterium (например, bifidum, breve, longum или infantis), Streptococcus thermophilus и Enterococcus faecium.

48. Вектор по любому из аспектов 44-47, где вектор содержится в напитке (например, пробиотическом напитке) или пищевом продукте для употребления человеком или животным.

49. Вектор по любому из аспектов 44-48, где вектор содержит по меньшей мере одну единицу повтор-спейсер-повтор для нацеливания на последовательность-мишень, где повторы являются по меньшей мере на 95% (например, на 96, 97, 98, 99 или 100%) идентичными повторам из системы CRISPR/Cas клетки-хозяина, в результате чего повторы из вектора способны функционировать в клетке-хозяине для направления Cas из системы хозяина для модификации нуклеотидной последовательности-мишени.

50. Вектор по аспекту 49, где вектор лишен последовательности, кодирующей Cas (например, нуклеазу Cas).

Нацеливание на нуклеотидную последовательность из системы CRISPR/Cas хозяина по изобретению можно использовать для удаления устойчивости клетки-хозяина к вектору (например, проникающему вирусу) или уменьшения развития или увеличения устойчивости. Например, изобретение, таким образом, предоставляет преимущество нацеливания на эндогенную систему CRISPR/Cas и нокдауна ее активности, так что ингибируется приобретение спейсеров нового вектора (например, фага). Признаком мобилизации является присутствие цис-действующей области (oriT), необходимой для переноса. Эта область представляет собой точку инициации процессинга ДНК, в которой специфический для участка и цепи разрыв вносят в плазмиду для начала события переноса. Изобретение относится к дополнительным вариантам осуществления с использованием мобильных генетических элементов (MGE), следующим образом:-

1. Сконструированный вектор на основе нуклеиновой кислоты с CRISPR, содержащий мобильный генетический элемент или состоящий из мобильного генетического элемента (MGE), где MGE содержит точку начала переноса (oriT) и массив CRISPR для модификации последовательности-мишени из генома клетки-хозяина (например, клетки патогенной бактерии) или генома вируса (например, профага) в клетке-хозяине,

(a) где массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине;

(b) где crРНК является способной гибридизоваться с последовательностью-мишенью для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени;

(c) где вектор является способным к переносу между (i) первым и вторым положениями нуклеиновой кислоты первой клетки-хозяина, где каждое положение представляет собой положение на хромосоме или на плазмиде, и последовательность-мишень содержится в клетке-хозяине, или (ii) первыми и вторыми клетками-хозяевами, где последовательность-мишень содержится в первой и/или второй клетке-хозяине.

Примерами MGE являются ICE, транспозоны, плазмиды и бактериофаг. Точка начала переноса (oriT) представляет собой короткую последовательность (например, вплоть до 500 п.о.), которая является необходимой для переноса содержащей ее ДНК от бактериального хозяина к реципиенту в ходе конъюгации. oriT является цис-действующей - она обнаружена на той же ДНК, которую переносят, и она переносится вместе с ДНК. Типичная точка начала переноса содержит три функционально определенных домена: вносящий разрывы домен, домен для переноса и домен для терминации.

Необязательно, промотор является способным функционировать для транскрипции указанной последовательности(последовательностей) в первых и вторых (и необязательно, третьих) клетках.

Необязательно последовательность-мишень содержится во второй клетке. Необязательно последовательность-мишень не содержится во второй клетке.

В одном примере, первые и вторые клетки происходят из различных видов бактерий (например, видов, обнаруженных в популяции микробиома человека, например, из кишечника, подмышечной впадины, вагины или ротовой полости). В одном примере, первые и вторые клетки присутствуют ex vivo. В другом примере, первые и вторые клетки содержатся в микробиоме кишечника, вагины, подмышечной впадины или ротовой полости человека in vivo или ex vivo.

2. Вектор из варианта осуществления 1, где MGE представляет собой или содержит интегративный и конъюгативный элемент (ICE). Альтернативно, MGE представляет собой мобилизуемый MGE (т.е., способный использовать факторы, кодируемые генами, которые не несет MGE, чтобы стать мобилизированным). Термины «мобилизуемый» и «конъюгативный» по отношению к MGE ясно очевидны специалисту в данной области.

Приведена ссылка на базу данных ICEberg (http://db-mml.sjtu.edu.cn/ICEberg/), где представлены примеры подходящих ICE для изобретения и источников подходящих oriT. В одном примере, ICE является членом семейства ICE, содержащего ICE, выбранный из группы 1-28, или oriT представляет собой oriT из члена такого семейства: 1=SXT/R391; 2=Tn916; 3=Tn4371; 4=CTnDOT/ERL; 5=ICEclc; 6=ICEBs1; 7=ICEHin1056; 8=PAPI-1; 9=ICEMlSym(R7A); 10=ICESt1; 11=SPI-7; 12=ICE6013; 13=ICEKp1; 14=TnGBS1; 15=Tn5253; 16=ICESa2603; 17=ICEYe1; 18=10270-RD.2; 19=Tn1207,3; 20=Tn1806; 21=ICEA5632; 22=ICEF-I/II; 23=ICEAPG2; 24=ICEM; 25=10270-RD.1; 26=Tn5801; 27=PPI-1; 28=ICEF-III. Описания семейств обнаружены в базе данных ICEberg. Например, семейство Tn916 определено в Roberts et al (2009) (Trends Microbiol. 2009 Jun;17(6):251-8. doi: 10,1016/j.tim.2009,03,002. Epub 2009 May 20; «A modular master on the move: the Tn916 family of mobile genetic elements», Roberts A, Mullany P). Элементы, принадлежащие к семейству Tn916, определяют по следующим критериям: они должны обладать общей организацией, показанной в Roberts et al, и они должны обладать коровой областью (модулем для конъюгации и регуляции), сходной по последовательности и структуре с оригинальным Tn916 на уровне ДНК. Исключениями являются некоторые конъюгативные транспозоны, такие как Tn1549, который ранее классифицировали в этом семействе, и транспозоны с высокой степенью сходства белка, как описано в соответствующих ссылках.

3. Вектор из варианта осуществления 2, где ICE представляет собой транспозон, например, конъюгативный транспозон. В одном примере, MGE представляет собой мобилизуемый транспозон, мобилизуемый в присутствии функционального вспомогательного элемента, необязательно, где транспозон присутствует в комбинации с указанным вспомогательным элементом.

4. Вектор по любому предшествующему варианту осуществления, где вектор представляет собой плазмиду, необязательно, где MGE представляет собой транспозон, содержащийся в плазмиде. Например, транспозон представляет собой конъюгативный транспозон. В одном примере транспозон представляет собой мобилизуемый транспозон (например, мобилизуемый с использованием одного или нескольких факторов, кодируемых плазмидой, например, посредством генов вне последовательности транспозона из плазмиды). Необязательно, транспозон представляет собой транспозон типа I. Необязательно, транспозон представляет собой транспозон типа II.

5. Вектор по любому предшествующему варианту осуществления, где oriT является функциональной в первых и вторых клетках-хозяевах. Это является полезным для стимуляции распространения и размножения среди бактерий в популяции бактерий, например, когда первые и вторые клетки происходят из различных видов.

6. Вектор из варианта осуществления 5, когда содержится в первой клетке, где первая клетка содержит нуклеотидные последовательности, кодирующие белки, способные функционировать для переноса MGE во вторую клетку, где последовательности не содержатся в MGE. Это является полезным, чтобы избегать использования пространства в MGE для таких последовательностей. Например, это позволяет конструирование более компактного MGE для переноса между клетками или позволяет включение более крупных массивов CRISPR или большего количества массивов CRISPR, например, для включения множества спейсеров для нацеливания на соответствующие последовательности в клетке-хозяине или для нацеливания на различные последовательности в первых и вторых клетках-хозяевах.

7. Вектор из варианта осуществления 6, где последовательности не содержатся в векторе. Это является полезным чтобы избегать использования пространства в векторе или MGE для таких последовательностей. Например, это позволяет конструирование более компактного вектора или MGE для переноса между клетками или позволяет включение более крупных массивов CRISPR или большего количества массивов CRISPR, например, для включения множества спейсеров для нацеливания на соответствующие последовательности в клетке-хозяине или для нацеливания на различные последовательности в первых и вторых клетках-хозяевах, и/или для включения одной или нескольких последовательностей для кодирования белка(белков) Cas, например, Cas9.

8. Вектор из варианта осуществления 6 или 7, где последовательности содержатся в конъюгативном транспозоне из первой клетки. Это является полезным, поскольку это позволяет использование факторов вне MGE для осуществления конъюгативной транспозиции, для горизонтального переноса MGE по изобретению между первыми и вторыми клетками-хозяевами (например, из различных видов бактерий в микробиоме человека).

9. Вектор из варианта осуществления 8, где транспозон является способным функционировать в транс-положении для переноса MGE во вторую клетку. Это является полезным, поскольку это позволяет использование факторов вне MGE для осуществления конъюгативной транспозиции, для горизонтального переноса MGE по изобретению между первыми и вторыми клетками-хозяевами (например, из различных видов бактерий в микробиоме человека). Например, oriT из MGE по изобретению является такой же, как oriT, содержащаяся в конъюгативном транспозоне клетки-хозяина. Это является полезным, чтобы позволить MGE по изобретению функционировать с факторами, кодируемыми клеткой-хозяиной, для осуществления горизонтального переноса MGE между первыми и вторыми клетками-хозяевами (например, бактериальный клетки из различных видов, например, видов из микробиома человека). Это позволяет MGE являться более компактным или высвобождает пространство для массивов CRISPR и/или гена(генов) Cas, как обсуждают выше.

Термин «способный функционировать в транс-положении» означает, что MGE (ICE) является способным функционировать для горизонтального переноса с использованием белков, экспрессированных с нуклеотидных последовательностей хозяина вне нуклеотидных последовательностей вектора (например, белков, экспрессированных посредством конъюгативного транспозона клетки-хозяина) для переноса MGE (или целого вектора, такого как плазмида, содержащая MGE) во вторую клетку.

10. Вектор по любому предшествующему варианту осуществления, когда содержится в первой клетке, где oriT из MGE является таким же, как oriT, содержащаяся в ICE из первой клетки, где ICE является способным функционировать в транс-положении для переноса MGE во вторую клетку.

11. Вектор по любому предшествующему варианту осуществления, где oriT вектора представляет собой oriT из транспозона Bacteroidetes (например, Bacteroidales или Bacteroides) или Prevotella. Это можно использовать, когда первая и/или вторая клетка-хозяин представляет собой клетку Bacteroidetes (например, Bacteroidales или Bacteroides) или Prevotella, соответственно. Например, первая клетка представляет собой клетку из такого вида, и вторая клетка представляет собой клетку Firmicutes, где последовательность-мишень содержится во второй клетке, но не в первой клетке, в результате чего массив CRISPR направляет Cas во второй клетке для разрезания последовательности-мишени. В одном примере, последовательность-мишень содержится в жизненно важном гене или гене устойчивости к антибиотику из второй клетки (и для последнего, необязательно, вектор присутствует в комбинации с указанным антибиотиком, или его вводят человеку или не относящегося к человеку животному в комбинации с указанным антибиотиком). Необязательно, транспозон представляет собой транспозон CTnDot или CTnERL, и вектор присутствует в комбинации с тетрациклином, или его вводят человеку или не относящемуся к человеку животному в комбинации с тетрациклином.

12. Вектор по любому предшествующему варианту осуществления, где oriT вектора представляет собой CTnDot, CTnERL SXT/R391, Tn916 или oriT семейства транспозонов Tn4371.

13. Вектор по любому предшествующему варианту осуществления, где MGE содержит последовательности первого и второго концевого повтора и массив CRISPR между последовательностями повторов.

14. Вектор по любому предшествующему варианту осуществления, где MGE оставляет копию транспозона (1) в первом положении нуклеиновой кислоты, когда он переносится во второе положение; или (2) в первой клетке, когда он переносится во вторую клетку. Это является полезным, чтобы способствовать размножению и поддержанию MGE в популяции бактерий, содержащей клетку-хозяина(клетки-хозяева). Альтернативно, MGE не оставляет копию транспозона (i) в первом положении нуклеиновой кислоты, когда он переносится во второе положение; или (ii) в первой клетке, когда он переносится во вторую клетку.

15. Вектор по любому предшествующему варианту осуществления, когда он содержится в первой и/или второй клетке (например, первая и вторая копии вектора содержатся в первой и второй клетках).

16. Вектор из варианта осуществления 15, где первые и вторые клетки представляют собой клетки из различных видов. Например, первая клетка представляет собой клетку Lactobacillus (например, как описано в настоящем документе) и/или вторая клетка представляет собой клетку Bcteroidetes (например, Bacteroides, например, такую клетку, как описано в настоящем документе) или клетку Firmicutes (например, такую клетку, как описано в настоящем документе). В одном примере, первая клетка представляет собой клетку Bcteroidetes (например, клетку Bacteroides, например, такую клетку, как описано в настоящем документе), и вторая клетка представляет собой клетку Firmicutes (например, такую клетку, как описано в настоящем документе), например, для введения в микробиом кишечника человека для лечения или предотвращения состояния GI или диабета; или для лечения или предотвращения ожирения.

17. Вектор из варианта осуществления 15 или 16, где первые и вторые клетки представляют собой клетки бактерий или архей.

18. Вектор из варианта осуществления 16 или 17, где первая клетка является непатогенной для человека (например, комменсальная или симбиотическая бактериальная клетка) и необязательно, вторая клетка является патогенной клеткой для человека. Альтернативно, вторая клетка является непатогенной клеткой для человека. Термин «непатогенный для человека» включает в себя клетки, такие как конкретные виды бактерий (например, виды Bacteroides, такие как fragalis), которые могут населять микробиомы человека (например, микробиом кишечника, вагины, подмышечной впадины или ротовой полости) без патогенности или значительной патогенности, но в другой окружающей человека среде являются патогенными. Специалисту в данной области ясно понятно, что первый тип клеток можно сохранять у человека или на человеке, и количество второго типа клеток следует уменьшать у человека или на человеке. Например, массив CRISPR модифицирует геном второй клетки для уничтожения или уменьшения жизнеспособности или роста клеток у человека или на человеке. Например, участок-мишень содержится во второй клетке, и участок разрезают посредством указанной нуклеазы Cas, таким образом, осуществляя инактивацию или понижающую регуляцию гена, содержащего участок-мишень. Например, ген представляет собой жизненно важный ген или ген устойчивости к антибиотику из второй клетки. В одном примере, ген представляет собой ген вирулентности.

19. Вектор по любому предшествующему варианту осуществления, или любое применение в настоящем документе, где вторая клетка (каждая клетка-хозяин) представляет собой клетку, выбранную из (i) клетки Staphylococcus aureus, например, устойчивой к антибиотику, выбранному из метициллина, устойчивые к ванкомицину и тейкопланину; (ii) клетки Pseudomonas aeuroginosa, например, устойчивой к антибиотику, выбранному из цефалоспоринов (например, цефтазидима), карбапенемов (например, имипенема или меропенема), фторхинолонов, аминогликозидов (например, гентамицина или тобрамицина) и колистина; (iii) клетки Klebsiella (например, pneumoniae), например, устойчивой к карбапенему; (iv) клетки Streptoccocus (например, pneumoniae или pyogenes), например, устойчивой к антибиотику, выбранному из эритромицина, клиндамицина, бета-лактама, макролида, амоксициллина, азитромицина и пенициллина; (v) клетки Salmonella (например, серотипа Typhi), например, устойчивой к антибиотику, выбранному из цефтриаксона, азитромицина и ципрофлоксацина; (vi) клетки Shigella, например, устойчивой к антибиотику, выбранному из ципрофлоксацина и азитромицина; (vii) клетки mycobacterium tuberculosis, например, устойчивой к антибиотику, выбранному из изониазида (INH), рифампицина (RMP), фторхинолона, амикацина, канамицина и капреомицина; (viii) клетки Enterococcus, например, устойчивой к ванкомицину; (ix) клетки Enterobacteriaceae, например, устойчивой к антибиотику, выбранному из цефалоспорина и карбапенема; (x) клетки E. coli, например, устойчивой к антибиотику, выбранному из триметоприма, нитрофурантоина, цефалексина и амоксициллина; (xi) клетки Clostridium (например, dificile), например, устойчивой к антибиотику, выбранному из фторхинолонового антибиотика и карбапенема; (xii) клетки Neisseria gonnorrhoea, например, устойчивой к антибиотику, выбранному из цефиксима (например, перорального цефалоспорина), цефтриаксона (пригодного для инъекций цефалоспорина), азитромицина и тетрациклина; (xiii) клетки Acinetoebacter baumannii, например, устойчивой к антибиотику, выбранному из бета-лактама, меропенема и карбапенема; или (xiv) клетки Campylobacter, например, устойчивой к антибиотику, выбранному из ципрофлоксацина и азитромицина. Такие виды могут являться патогенными для человека.

20. Вектор или применение из варианта осуществления 19, где участок-мишень содержится в гене устойчивости к антибиотику из второй клетки, где антибиотик представляет собой соответствующий антибиотик, перечисленный в варианте осуществления 19.

21. Вектор по любому из вариантов осуществления 15-20, где первая клетка представляет собой клетку Bacteroidetes (например, Bacteroidales или Bacteroides); Lactobacillus (например, acidophilus (например, La-5, La-14 или NCFM), brevis, bulgaricus, plantarum, rhammosus, fermentum, caucasicus, helveticus, lactis, reuteri или casei например, casei Shirota); Bifidobacterium (например, bifidum, breve, longum или infantis); Streptococcus thermophiles; Enterococcus faecium; Alistipes; Alkaliflexus; Parabacteroides; Tannerella; или Xylanibacter.

22. Вектор по любому предшествующему варианту осуществления, где первое и/или второе положения нуклеиновой кислоты из (i) содержатся в клетке Bacteroidetes (например, Bacteroidales или Bacteroides); или первые и/или вторые клетки-хозяева из (ii) представляют собой клетки Bacteroidetes (например, Bacteroidales или Bacteroides) или Prevotella.

23. Вектор из варианта осуществления 22, где первая клетка представляет собой клетку Bacteroidetes (например, Bacteroidales или Bacteroides), и вторая клетка представляет собой клетку Firmicutes (например, Clostridium или Staphylococcus), например, где вектор предназначен для введения в микробиом кишечника человека для лечения или предотвращения состояния GI или диабета; или для лечения или предотвращения ожирения.

24. Вектор из варианта осуществления 16 или 17 (или любое применение в настоящем документе), где эта первая клетка (каждая первая клетка) является экологически приемлемой в окружающей среде (например, в окружающей среде воды или почвы) и необязательно, эта вторая клетка (каждая клетка-хозяин) не является приемлемой в окружающей среде. Водная окружающая среда явно очевидна специалисту в данной области и может, например, представлять собой морскую окружающую среду или окружающую среду водных путей (например, озера, канала, реки или резервуара). В одном примере, водная окружающая среда представляет собой питьевую воду, предназначенную для употребления человеком, или сточные воды. В одном примере, окружающая среда почвы представляет собой почву сельскохозяйственных угодий или почву в участке добычи (например, в участке добычи минерала или металла).

Под «приемлемым» и «неприемлемым» специалист в данной области явно понимает, что первый тип клеток можно сохранять в окружающей среде, и количество второго типа клеток следует уменьшать в окружающей среде. Например, массив CRISPR модифицирует геном второй клетки для уничтожения или уменьшения жизнеспособности или роста клеток в окружающей среде. Например, участок-мишень содержится во второй клетке, и участок разрезают посредством указанной нуклеазы Cas, таким образом, осуществляя инактивацию или понижающую регуляцию гена, содержащего участок-мишень. Например, ген представляет собой жизненно важный ген или ген устойчивости к антибиотику из второй клетки. В одном примере, ген представляет собой ген вирулентности.

В одном примере, окружающая среда представляет собой микробиом человека, например, микробиом ротовой полости или микробиом кишечника, или кровоток. В одном примере, окружающая среда не является окружающей средой в человеке или на человеке. В одном примере, окружающая среда не является окружающей средой в не относящемся к человеку животном или на не относящемся к человеку животном. В одном варианте осуществления, окружающая среда представляет собой воздушную окружающую среду. В одном варианте осуществления, окружающая среда представляет собой сельскохозяйственную окружающую среду. В одном варианте осуществления, окружающая среда представляет собой окружающую среду для добычи нефти или нефтепродуктов, например, в месторождении или скважине для нефти или нефтепродуктов. В одном примере, окружающая среда представляет собой окружающую среду в пищевом продукте или напитке или на поверхности пищевого продукта или напитка для употребления человеком или не относящимся к человеку животным.

В одном примере, вектор, система, вектор, массив, crРНК, gРНК, способ или любое применение в настоящем документе предназначено для применения в промышленности, или окружающая среда представляет собой промышленную окружающую среду, где промышленность представляет собой промышленность в области, выбранной из группы, состоящей из областей медицины и здравоохранения; фармацевтики; продуктов питания для человека; корма для животных; удобрений для растений; напитков; молочных продуктов; переработки мяса; сельского хозяйства; разведения скота; разведения домашней птицы; разведения рыбы и моллюсков; ветеринарии; нефти; газа; нефтехимических продуктов; обработки воды; обработки сточных вод; упаковки; электроники и компьютеров; персонального здравоохранения и гигиены; косметики; стоматологии; не медицинского ухода за зубами; офтальмологии; не медицинского применения для глаз; добычи и переработки минералов; добычи и переработки металлов; разработки карьеров; авиации; автотранспорта; железных дорог; судоходства; космоса; окружающей среды; обработки почвы; пульпы и бумаги; швейного производства; красителей; печати; связывающих веществ; обработки воздуха; растворителей; биологической защиты; витаминных добавок; холодильного хранения; замачивания и производства пряжи; биотехнологии; химии; промышленных чистящих средств; бытовых чистящих средств; мыла и детергентов; потребительских товаров; лесоводства; рыбной ловли; отдыха; переработки; пластика; шкур, кожи и замши; утилизации отходов; погребения и захоронения; топлива; строительства; энергии; стали; и табачной промышленности.

25. Вектор по любому предшествующему варианту осуществления в комбинации с нуклеиновой кислотой (например, ДНК) для введения в модифицированный участок-мишень.

В одном примере, модификация представляет собой разрезание участка-мишени, и нуклеиновую кислоту (например, ДНК) вводят посредством гомологичной рекомбинации в клетку-хозяина. Это является полезным для осуществления точно нацеленной модификации генома клетки-хозяина с использованием вектора по изобретению.

26. Вектор из варианта осуществления 25, где нуклеиновая кислота для введения представляет собой или содержит последовательность регуляторного элемента или экзона, например, человеческую последовательность.

27. Вектор по любому предшествующему варианту осуществления в комбинации с транспозазой для мобилизации MGE.

28. Вектор по любому предшествующему варианту осуществления, где вектор или MGE содержит модуль токсина-антитоксина, который является способным функционировать в первой клетке-хозяине; необязательно, где модуль токсина-антитоксина содержит ген антитоксина, который неспособен функционировать или обладает уменьшенной функциональностью в клетках, отличных от первой клетки.

29. Вектор по любому предшествующему варианту осуществления, где вектор или MGE содержит модуль токсина-антитоксина, который является способным функционировать во второй клетке-хозяине; необязательно, где модуль токсина-антитоксина содержит ген антитоксина, который неспособен функционировать или обладает уменьшенной функциональностью в клетках, отличных от второй клетки.

30. Вектор по любому предшествующему варианту осуществления, где вектор или MGE содержит модуль токсина-антитоксина, который является способным функционировать в первых и вторых клетках-хозяевах; необязательно, где модуль токсина-антитоксина содержит ген антитоксина, который неспособен функционировать или обладает уменьшенной функциональностью в клетках, отличных от первых и вторых клеток. Применение модуля токсина-антитоксина является полезным для обеспечения преимуществ при отборе и таким образом, поддержания и распространения MGE. Например, модуль представляет собой модуль типа I, например, модуль Hok-Sok. Например, модуль представляет собой модуль типа II, например, модуль HiCa-HicB. Например, модуль представляет собой модуль токсина-антитоксина типа tad-ata. Например, модуль представляет собой зависимый от плазмиды модуль. В одном примере, первая и/или вторая клетка представляет собой клетку Bacteroides, и модуль представляет собой модуль из видов Bacteroides, например, зависимый от семейства Txe/YoeB модуль (см., например, http://www.uniprot.org/uniprot/F0R9D1); зависимый от семейства RelE/StbE модуль (см., например, http://www.uniprot.org/uniprot/F0R9A0); зависимый от семейства HigA модуль (см., например, http://www.uniprot.org/uniprot/D7J8V2 или http://www.uniprot.org/uniprot/D2ESD0); зависимый от семейства RelE/StbE модуль (см., например, http://www.uniprot.org/uniprot/F0R5F4). Применение токсина-антитоксина в векторе или MGE можно использовать для обеспечения разрушения несущей вектор клетки, отличной от желательной клетки (например, первой и второй и/или третьей бактериальной клетки). В этом примере, MGE или вектор содержит ген токсина из бактериального модуля токсина-антитоксина и родственный ген антитоксина, где экспрессия генов токсина и антитоксина регулируется по отдельности, например, с различных промоторов. Например, ген токсина может содержать промотор, который является конститутивно активным в первых, вторых (и третьих) клетках, так что токсин всегда продуцируется. Ген антитоксина может содержать промотор, который поддается индукции посредством одного или нескольких факторов (например, экспрессированного белка) в первых и/или вторых клетках, но не в не являющихся мишенью клетках из другого штамма или вида. Как известно, антитоксину свойственна меньшая стабильность, чем токсину, в бактериальной системе токсин/антитоксин, и таким образом, перенос вектора или MGE в клетку, которая не является клеткой-мишенью (например, не является первой и/или второй клеткой), может приводить к экспрессии токсина в отсутствие экспрессии антитоксина или к более низкой активности антитоксина, таким образом, приводя к гибели клетки для не являющейся мишенью клетки. Это, таким образом, создает селективное давление для клеток-мишеней (первых, вторых и третьих клеток) для поглощения и поддержания вектора по изобретению, так что они могут обладать активностью в них желательного массива CRISPR, а также могут размножаться среди клеток-мишеней в популяции (такой как микробиота кишечника). Это также ограничивает распространение вектора или MGE в не являющихся мишенью клетках, так что эффект массива контролируют в популяции - в этом отношении, может присутствовать давление на не являющиеся мишенью клетки, чтобы они не поглощали вектор, и если они поглощают, клетки-реципиенты не выживают в популяции, таким образом, ограничивая воспроизведение не являющихся мишенью клеток с MGE и массивом.

31. Вектор по любому предшествующему варианту осуществления где первые и вторые клетки происходят из одного и того же филума (например, и те, и другие являются бактериальными клетками) и вектор является способным реплицироваться или функционировать (d) в первой клетке и/или второй клетке, но не в другой клетке из того же самого филума; (e) в первой клетке и/или второй клетке, но не в другой клетке из того же самого порядка; (f) в первой клетке и/или второй клетке, но не в другой клетке из того же самого класса; (g) в первой клетке и/или второй клетке, но не в другой клетке из того же самого порядка; (h) в первой клетке и/или второй клетке, но не в другой клетке из того же самого семейства; (i) в первой клетке и/или второй клетке, но не в другой клетке из того же самого рода; (j) в первой клетке и/или второй клетке, но не в другой клетке из того же самого вида; (k) в первой клетке и/или второй клетке, но не в другой клетке из того же самого штамма.

Это обеспечивает избирательность вектора по изобретению (например, для избирательного уничтожения клетки-хозяина второго типа в смешанной популяции бактерий) в микробиоме. Этого можно достигать, например, посредством конструирования MGE или массива (например, его промотора) таким образом, что он требует экспрессии конкретного белка для репликации или функционирования (например, экспрессии для продукции crРНК). Например, промотор можно выбирать из промотора, который функционирует в первой и/или второй клетке, но не в других клетках, или где MGE сконструирован таким образом, что один или несколько из участков инициации репликации зависят от белка или другого фактора, продуцируемого в первой и/или второй клетке, но не в других клетках.

32. Первая и вторая копии вектора по любому предшествующему варианту осуществления в смешанной популяции клеток, где первый вектор содержится в первой клетке, второй вектор содержится во второй клетке, где клетки представляют собой клетки из различных видов (например, различных видов бактерий), и один или оба из векторов MGE являются способными к переносу в третью клетку (например, бактериальную клетку), где вид третьей клетки является таким же, как вид первой или второй клетки, или представляет собой вид, который является отличным от вида первой и второй клетки. Это является полезным, поскольку первая клетка может действовать в качестве носителя (например, когда она является непатогенной, ее можно вводить человеку или животному, так что она заселяет человека или животного, например, их микробиом). Посредством горизонтального переноса, носитель может переносить и размножать массивы CRISPR по изобретению в третьих клетках (непосредственно или через вторые клетки, где последние действуют в качестве резервуара для массивов). Затем массивы могут опосредовать модификацию Cas (например, разрезание) последовательности-мишени в третьих клетках, например, для осуществления инактивации или понижающей регуляции жизненно важного гена или гена устойчивости к антибиотику из третьих клеток.

В общем, в настоящем документе, когда последовательность-мишень содержится в гене устойчивости к антибиотику из клетки, вектор, сконструированную последовательность или массив по изобретению можно вводить человеку или животному вместе (одновременно или последовательно) с антибиотиком. Это является полезным для уничтожения или уменьшения пролиферации клеток, содержащих последовательность-мишень. В этом отношении, вектор, сконструированная последовательность или массив содержится в композиции, содержащей антибиотик, где последовательность-мишень представляет собой последовательность из гена, кодирующего устойчивость к указанному антибиотику.

Необязательно, смешанная популяция содержит третью клетку.

В одном примере, представлено множество из первых клеток, где каждая содержит вектор по изобретению. В одном примере, представлено множество из вторых клеток, где каждая содержит вектор по изобретению. В одном примере, представлено множество из первых клеток в комбинации с множеством из вторых клеток, где каждая клетка содержит вектор по изобретению. В одном примере, представлено множество из первых клеток в комбинации с множеством из вторых клеток и множество из третьих клеток, где клетки по меньшей мере из 2 (или из всех) указанных множеств содержат вектор по изобретению.

33. Векторы из варианта осуществления 32, где вектор или MGE содержит модуль токсина-антитоксина, который является способным функционировать в первых, вторых и третьих клетках-хозяевах; необязательно, где модуль токсина-антитоксина содержит ген антитоксина, который не является способным функционировать или обладает сниженной (т.е., уменьшенной) функциональностью в клетках, отличных от первых, вторых и третьих клеток.

34. Вектор по любому предшествующему варианту осуществления, где MGE представляет собой конъюгативный транспозон, oriT является функциональной в первых и вторых клетках-хозяевах, MGE содержит последовательности первого и второго концевого повтора и массив CRISPR между последовательностями повторов, и где первые и вторые клетки представляют собой бактериальные клетки, где вторая клетка принадлежит к видам клеток из микробиоты человека (например, патогенных видов), где участок-мишень содержится во второй клетке, но не в первой клетке, и где указанная модификация осуществляет инактивацию или понижающую регуляцию гена или регуляторной последовательности, содержащих указанную мишень, во второй клетке.

Полезно, что первые клетки могут, таким образом, действовать в качестве носителей и резервуаров для массивов по изобретению, которые можно переносить посредством горизонтального переноса MGE.

В одном примере, MGE представляет собой конъюгативный транспозон Bacteroidetes, oriT представляет собой oriT Bacteroidetes, функциональную в первых и вторых клетках-хозяевах, MGE содержит последовательности первого и второго концевого повтора и массив CRISPR между последовательностями повторов, и где первые и вторые клетки представляют собой бактериальные клетки, где первая клетка представляет собой клетку Bacteroidetes, и вторая клетка представляет собой клетку Firmicutes (например, клетку Clostridium или Staphylococcus), где участок-мишень содержится во второй клетке, но не в первой клетке, и где указанная модификация осуществляет инактивацию или понижающую регуляцию гена или регуляторной последовательности, содержащих указанную мишень, во второй клетке.

35. Вектор из варианта осуществления 34, когда он содержится в первой или второй клетке.

36. Вектор по любому предшествующему варианту осуществления, где первые и вторые клетки содержатся в смешанной популяции бактериальных клеток, например, в популяции клеток из видов микробиоты кишечника, вагины, подмышечной впадины или ротовой полости человека или не относящегося к человеку животного (например, собаки, кошки или лошади). Как объяснено выше, популяцию можно использовать для введения человеку или животному для заселения его микробиома.

37. Композиция ex vivo, содержащая множество клеток, как определено в варианте осуществления 22, где каждая клетка содержит вектор по любому из вариантов осуществления 1-36. Альтернативно, композиция присутствует in vivo, например, у не относящегося к человеку животного.

38. Напиток или пищевой продукт для употребления человеком или не относящимся к человеку животным, содержащий вектор по любому из вариантов осуществления 1-36 или композицию из варианта осуществления 37. Напиток может представлять собой, например, пробиотический напиток, например, для употребления ежесуточно, один раз в каждые двое суток или еженедельно человеком или животным, например, для лечения или предотвращения ожирения или состояния GI у человека или животного.

39. Композиция, содержащая множество клеток Bacteroides, где каждая клетка содержит вектор по любому из вариантов осуществления 1-36.

Полезно, что клетки могут действовать в качестве носителей и резервуаров для массивов по изобретению, для введения в микробиом (например, микробиом кишечника) человека или животного, например, для лечения или предотвращения ожирения или состояния GI у человека или животного,

40. Смешанная популяция бактериальных клеток, содержащая субпопуляцию первых клеток и субпопуляцию вторых клеток, где первые клетки содержат векторы по любому из вариантов осуществления 1-36, где векторы являются способными к горизонтальному переносу между первой и второй субпопуляциями клеток. Такая популяция является полезной, поскольку ее можно вводить (например, интраназально) человеку или животному, так что бактерии заселяют один или несколько микробиомов (например, микробиом кишечника) человека или животного. Первые (и необязательно, также вторые) клетки могут действовать в качестве носителей массивов CRISPR по изобретению, особенно когда эти клетки являются непатогенными для человека или животного (например, непатогенными в микробиоме кишечника). Микробиом может представлять собой любую другую популяцию микробиома или микробиоты, описанную в настоящем документе.

41. Популяция из варианта осуществления 40, где один или оба из первого и второго видов бактерий являются способными к заселению микробиоты кишечника человека или не относящегося к человеку животного, и необязательно, первые бактерии являются комменсальными или симбиотическими для человека или животных. Полезно, что первые бактерии можно безопасно вводить человеку или животному и могут действовать в качестве носителей массивов по изобретению для последующего переноса в другие клетки микробиоты.

42. Популяция из варианта осуществления 40, где смешанная популяция содержится в напитке или воде (например, в водных путях или питьевой воде для употребления человеком), или в почве. Предусмотрено, что популяцию в воде или почве можно использовать для такой обработки в окружающей среде или (для воды) в системах для нагревания, охлаждения или в промышленных системах, или в контейнерах для хранения питьевой воды.

В одном примере по любому варианту осуществления, вторая клетка представляет собой клетку возбудителя холеры, содержащую последовательность-мишень, где, когда последовательность-мишень модифицируют, клетку уничтожают или пролиферацию клетки уменьшают. В одном примере, вторая клетка содержится в воде для употребления человеком (например, в такой воде до или после переработки для употребления человеком). В одном примере, вектор содержится в фармацевтической композиции для введения человеку для лечения или предотвращения холеры у человека.

43. Композиция, содержащая множество векторов по любому из вариантов осуществления 1-36 in vitro. Например, композицию смешивают с популяцией множества видов бактерий в промышленном устройстве или контейнере (например, для пищевых продуктов, потребительских товаров, косметики, персонального изделия медицинского назначения, продукта нефти или масла).

44. Вектор, композиция, пищевой продукт, напиток или популяция по любому предшествующему варианту осуществления для введения человеку или не относящемуся к человеку животному для терапевтического или профилактического заселения и восстановления равновесия в его микробиоме или для косметического изменения человека или животного (например, для косметической потери массы).

45. Способ модификации нуклеотидной последовательности-мишени в клетке-хозяине, где способ включает в себя

(1) объединение клетки-хозяина с клеткой-носителем,

(a) где клетка-носитель содержит вектор на основе нуклеиновой кислоты с CRISPR, содержащий массив CRISPR для модификации мишени,

(b) где массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине;

(c) где crРНК является способной гибридизоваться с последовательностью-мишенью для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени; и

(2) культивирование клеток вместе, где вектор переносится от клетки-носителя к клетке-хозяину, в результате чего crРНК гибридизуется с последовательностью-мишенью для направления Cas в клетке-хозяине и мишень становится модифицированной.

В одном примере, способ осуществляют ex vivo. В одном примере, способ представляет собой косметический способ, и не является терапевтическим или профилактическим медицинским способом.

46. Способ из варианта осуществления 45, где вектор соответствует любому из вариантов осуществления 1-36.

47. Способ из варианта осуществления 45 или 46, где клетка-хозяин представляет собой клетку из видов бактерий микробиома человека или не относящегося к человеку животного, необязательно, где клетка-хозяин представляет собой клетку из патогенных видов бактерий. В одном примере, любой микробиом в настоящем документе выбран из микробиома кишечника, вагины, подмышечной впадины, волосяного покрова, кожи или ротовой полости.

48. Способ по любому из вариантов осуществления 45-47, где клетка-носитель принадлежит к видам, представляющим собой виды бактерий, комменсальные или симбиотические для микробиома человека или не относящегося к человеку животного. В одном примере, клетка-носитель является непатогенной для человека, например, при введении интраназально, местно или перорально.

В любой конфигурации, концепции, аспекте, варианте осуществления или примере и т.д. в настоящем документе вектор, композицию, массив или популяцию по изобретению вводят интраназально, местно или перорально человеку или не относящемуся к человеку животному, или они предназначены для такого введения. Специалист в данной области, с целью обработки микробиома человека или животного, способен определить наилучший способ введения, в зависимости от представляющего интерес микробиома. Например, когда микробиом представляет собой микробиом кишечника, введение может являться интраназальным или пероральным. Когда микробиом представляет собой микробиом волосяного покрова или подмышечной впадины, введение может являться местным. Когда микробиом присутствует в ротовой полости или горле, введение может являться пероральным.

49. Способ по любому из вариантов осуществления 45-48, где клетка-хозяин принадлежит к видам бактерий микробиома кишечника человека или не относящегося к человеку животного.

50. Способ изменения относительного соотношения субпопуляций первых и вторых бактерий из видов клеткок-хозяев в смешанной популяции бактерий, содержащей указанные субпопуляции, где способ включает в себя

A: предоставление указанных первых бактериальных клеток-хозяев;

B: предоставление вторых бактериальных клеток-хозяев, где вторые клетки представляют собой клетки вида или штамма, отличного от первых клеток;

C: введение сконструированных массивов CRISPR в первые бактериальные клетки-хозяева, где каждый массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в указанной второй клетке-хозяине, где crРНК является способной гибридизоваться с последовательностью-мишенью, содержащейся в указанной второй клетке, для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени;

D: объединение первых и вторых бактериальных клеток вместе для получения смешанной популяции бактерий; и

E: обеспечение роста бактерий в смешанной популяции, так что происходит горизонтальный перенос массивов CRISPR от первых бактериальных клеток к вторым бактериальным клеткам, где последовательности-мишени во вторых клетках модифицируют посредством Cas, в результате чего относительные соотношения указанных первых и вторых бактерий изменяют.

51. Способ из варианта осуществления 50, где каждый массив CRISPR является таким, как по любому из вариантов осуществления 1-26.

52. Способ из варианта осуществления 50 или 51, дополнительно включающий в себя получение первого образца смешанной популяции со стадии E и необязательно, сравнение доли вторых клеток в первом образце с долей вторых клеток во втором образце клеток, где второй образец представляет собой образец смешанной популяции бактериальных клеток, используемой для предоставления вторых клеток на стадии B, и сравнение показывает, что доля вторых клеток увеличена или уменьшена после стадии E.

53. Способ из варианта осуществления 52, где второй образец представляет собой образец микробиома человека или животного (например, клеток кишечника, вагины, волосяного покрова, подмышечной впадины, кожи или ротовой полости).

54. Способ по любому из вариантов осуществления 50-53, где образец микробиома человека или животного (например, кишечника, вагины, волосяного покрова, подмышечной впадины, кожи или ротовой полости клетки) используют для предоставления вторых клеток со стадии B.

55. Способ по любому из вариантов осуществления 50-54, где рекомбинантную, культивируемую популяцию первых клеток используют для стадии A.

56. Способ по любому из вариантов осуществления 50-55, где горизонтальный перенос плазмиды, ICE или транспозона используют на стадии E, где каждая плазмида, ICE или транспозон содержит указанный массив CRISPR.

57. Способ по любому из вариантов осуществления 50-56 для терапевтического или профилактического восстановления равновесия микробиоты человека или не относящегося к человеку животного, например, для лечения или предотвращения ожирения, диабета IBD, состояния GI тракта или состояния ротовой полости. Диабет может относиться к типу I или II. В одном примере, профилактика является медицинской. В одном примере, профилактика в настоящем документе является не медицинской, например, косметической или для гигиенических целей. Например, микробиота представляет собой микробиоту подмышечной впадины и способ предназначен для предотвращения или уменьшения запаха тела человека. Например, в этом случае, способом осуществляют понижающую регуляцию роста или жизнеспособности бактериальных клеток-хозяев, опосредующих возникновение и/или персистенцию запаха тела человека.

58. Способ по любому из вариантов осуществления 50-57, включающий в себя предоставление третьих бактериальных клеток-хозяев из вида или штамма, отличных от клеток-носителей и клеток-хозяев, где третьи клетки содержатся в смешанной популяции на стадии E, или их объединяют с указанной популяцией после стадии E, где происходит горизонтальный перенос массивов CRISPR к третьим клеткам-хозяевам.

59. Способ из варианта осуществления 58, где третьи клетки не содержат указанную последовательность-мишень. Таким образом, третьи клетки могут действовать в качестве носителей массивов и являются способными к горизонтальному переносу массивов к клеткам-хозяевам, содержащим последовательность-мишень.

60. Способ из варианта осуществления 58, где третьи клетки содержат последовательность-мишень для модификации Cas.

61. Способ по любому из вариантов осуществления 50-60, где клетки-носители (и необязательно, также третьи) клетки принадлежат к видам, перечисленным в варианте осуществления 21, например, клеткам Bacteroidetes.

62. Способ по любому из вариантов осуществления 50-60, где клетки-хозяева принадлежат к видам, перечисленным в варианте осуществления 19, или клеткам Firmicutes.

63. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому предшествующему варианту осуществления, где каждый вектор представляет собой плазмиду, фаг (например, упакованный фаг) или фагмиду, или содержится в них.

64. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому предшествующему варианту осуществления, где модификация представляет собой (i) разрезание последовательности-мишени, (ii) понижающую регуляцию транскрипции гена, содержащего последовательность-мишень, (iii) повышающую регуляцию транскрипции гена, содержащего последовательность-мишень, или (iv) добавление, делецию или замену последовательности нуклеиновой кислоты в мишени.

65. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому предшествующему варианту осуществления, где каждая последовательность-мишень представляет собой последовательность, содержащуюся в регуляторном элементе или гене клетки-хозяина, где ген представляет собой жизненно важный ген, ген CRISPR или ген устойчивости к антибиотику, необязательно, где регуляторный элемент представляет собой элемент такого гена. Альтернативно, ген представляет собой ген вирулентности.

66. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому предшествующему варианту осуществления, где каждая последовательность-мишень представляет собой последовательность, содержащуюся в геноме фага, где фаг содержится в клетке-хозяине. В одном примере, последовательность-мишень содержится в гене фага, необходимого для инфекционности по отношению к клетке-хозяину, лизогенного или литического цикла фага или жизнеспособности фага, например, жизненно важного гена или гена белка оболочки.

В одном примере, фаг Bacteroidetes представляет собой фаг Bacteroides, выбранный из crAssphage, фага GB-124, фага GA-17, фага HB-13, фага H16-10, фага B40-8 и фага B fragalis ATCC51477-B1. Это является полезным, например, для обеспечения преимущества выживаемости Bacteroidetes в микробиоме кишечника человека или животного. Таким образом, соотношение Bacteroidetes к Firmicutes можно изменять для увеличения доли первых по сравнению с последними (например, для лечения или предотвращения ожирения). В одном примере, последовательность-мишень содержится в последовательности, кодирующей домен BACON (ассоциированный с Bacteroidetes связывающий углеводы) - (например, где хозяин представляет собой хозяина Bacteroides), или в последовательности, кодирующей эндолизин.

67. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому предшествующему варианту осуществления, где каждый массив CRISPR содержит последовательность R1-S1-R1' для экспрессии и продукции соответствующей crРНК в клетке-хозяине,

(i) где R1 представляет собой первый повтор CRISPR, R1' представляет собой второй повтор CRISPR, и R1 или R1' является необязательным; и

(ii) S1 представляет собой первый спейсер CRISPR, который содержит нуклеотидную последовательность или состоит из нуклеотидной последовательности, на 95% или более идентичной указанной последовательности-мишени.

68. Вектор, композиция, пищевой продукт, напиток, популяция или способ из варианта осуществления 67, где R1 и R1' являются по меньшей мере на 95% идентичными, соответственно, последовательностям первого и второго повтора из массива CRISPR из вида второй клетки-хозяина.

69. Вектор, композиция, пищевой продукт, напиток, популяция или способ из варианта осуществления 67 или 68, где R1 и R1' являются функциональными с системой CRISPR/Cas из указанной клетки-хозяина для модификации последовательности-мишени.

70. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому предшествующему варианту осуществления, где этот или каждый массив присутствует в комбинации с одной или несколькими нуклеазой(нуклеазами) Cas, которые функционируют с соответствующей crРНК в клетке-хозяине для модификации последовательности-мишени. Последовательность-мишень содержит последовательность протоспейсера, непосредственно смежную с мотивом, смежным с протоспейсером, (PAM).

71. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому предшествующему варианту осуществления, где этот или каждый массив присутствует в комбинации с последовательностью(последовательностями) нуклеиновой кислоты, кодирующими одну или несколько нуклеазу(нуклеаз) Cas, которые функционируют с соответствующей crРНК в клетке-хозяине для модификации последовательности-мишени.

72. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому из вариантов осуществления 67-71, где R1 и R1' являются функциональными с нуклеазой Cas9 типа II (например, Cas9 S pyogenes или S aureus) для модификации мишени в указанной клетке-хозяине, необязательно, где вектор, композиция, пищевой продукт, напиток, популяция или способ, кроме того, соответствует варианту осуществления 70 или 71, где Cas представляет собой указанную Cas9.

73. Смешанная популяция бактерий ex-vivo, которую можно получать способом по любому из вариантов осуществления 50-72.

74. Композиция для введения человеку или не относящемуся к человеку животному для терапевтического, профилактического, косметического применения, для уменьшения массы тела человека или не относящегося к человеку животного (например, косметического уменьшения) или для пищевого применения, где композиция содержит смешанную популяцию из варианта осуществления 73.

75. Пищевой продукт или напиток для употребления человеком или не относящимся к человеку животным, содержащий смешанную популяцию из варианта осуществления 73 или композицию из варианта осуществления 74.

76. Пищевой продукт или напиток из варианта осуществления 75, который представляет собой пищевую добавку или пробиотический напиток, или пищевой продукт.

77. Антибиотическая композиция для лечения или предотвращения бактериальной инфекции у человека или не относящегося к человеку животного, или в питьевой воде, или в почве, где композиция содержит вектор по любому из вариантов осуществления 1-36 и 63-72.

78. Пробиотическая композиция для увеличения доли Bacteroidetes кишечника (например, для лечения или предотвращения ожирения, диабета или a воспалительного состояния GI) у человека или не относящегося к человеку животного, где композиция содержит вектор по любому из вариантов осуществления 1-36 и 63-72.

79. Композиция из варианта осуществления 74, 77 или 78 для увеличения относительных соотношений Bacteroides кишечника к Fermicutes у человека или животного, например, для лечения или предотвращения ожирение, диабета или состояния GI.

80. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому предшествующему варианту осуществления, где вектор не содержит кодирующую нуклеазу Cas последовательность, способную функционировать с массивом. Это является полезным для сохранения пространства в векторе (например, чтобы позволять включение более крупных массивов или большего количества массивов для нацеливания на клетку-хозяина - это является полезным для нацеливания на множество локализаций в геноме для уменьшения вероятности эволюции устойчивости к массивам по изобретению).

81. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому предшествующему варианту осуществления, где MGE не содержит кодирующую нуклеазу Cas последовательность, способную функционировать с массивом. Это является полезным для сохранения пространства в MGE (например, чтобы позволять включение более крупных массивов или большего количества массивов для нацеливания на клетку-хозяина - это является полезным для нацеливания на множество локализаций в геноме для уменьшения вероятности эволюции устойчивости к массивам по изобретению). Например, является возможным избегать включения большой последовательности, кодирующей эндонуклеазу Cas9.

82. Вектор, композиция, пищевой продукт, напиток, популяция или способ из варианта осуществления 80 или 81, где массив является способным функционировать с эндонуклеазой Cas, обнаруженной в клетках того же вида или штамма, что и первая и/или вторая клетка. В одном примере, массив является способным функционировать с эндонуклеазой Cas, обнаруженной в клетках того же вида или штамма, что и клетка-хозяин или третья клетка. Это является полезным для сохранения пространства в векторе или MGE (например, чтобы позволять включение более крупных массивов или большего количества массивов для нацеливания на клетку-хозяина - Это является полезным для нацеливания на множество локализаций в геноме для уменьшения вероятности эволюции устойчивости к массивам по изобретению).

83. Вектор, композиция, пищевой продукт, напиток или популяция по любому предшествующему варианту осуществления, где первые и вторые клетки представляют собой бактериальные клетки из различных видов, где вторая клетка происходит из вида микробиоты человека и первая клетка происходит из вида, который является непатогенным в указанной микробиоте человека, где последовательность-мишень не содержится в геноме первой клетки, где MGE содержит oriT, который является способным функционировать в первых и вторых клеток, где MGE является способным к горизонтальному переносу от первой клетки во вторую клетку.

Альтернативно, представлены:-

Способ по любому предшествующему варианту осуществления, где носитель и клетки-хозяева представляют собой бактериальные клетки из различных видов, где клетка-хозяин происходит из видов микробиоты человека, и клетка-носитель происходит из вида, который является непатогенным в указанной микробиоте человека, где последовательность-мишень не содержится в геноме клетки-носителя, где MGE содержит oriT, который является способным функционировать в клетке-носителе и в клетках-хозяевах, где MGE является способным к горизонтальному переносу от клетки-носителя к клетке-хозяину.

84. Вектор, композиция, пищевой продукт, напиток, популяция или способ по п.83, где вектор содержится в бактериофаге, где бактериофаг является способным инфицировать первую клетку (носитель) для введения MGE в первую клетку (носителя).

85. Вектор, композиция, пищевой продукт, напиток, популяция или способ из варианта осуществления 83 или 84, где последовательность-мишень содержится в геноме второй клетки (хозяина) (например, содержится в жизненно важном гене или гене устойчивости к антибиотику из генома).

86. Вектор, композиция, пищевой продукт, напиток, популяция или способ из варианта осуществления 85, где второй вид клетки (хозяина) является патогенным в указанной микробиоте человека, где последовательность-мишень модифицируют посредством разрезания последовательности-мишени или понижающей регуляции гена, содержащего указанную последовательность-мишень. В одном примере, вторая клетка (хозяин) представляет собой клетку по любому из признаков (i)-(xiv) из варианта осуществления 19. В одном примере вторая клетка (хозяин) представляет собой клетку Firmicutes, например, где вектор предназначен для лечения или предотвращения ожирения у человека.

87. Вектор, композиция, пищевой продукт, напиток, популяция или способ из варианта осуществления 83, 84 или 85, где вид второй клетки (хозяина) является непатогенным в указанной микробиоте человека.

88. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому из вариантов осуществления 83-87, где вторая клетка (хозяин) представляет собой клетку Bacteroidetes или Prevotella; необязательно, где MGE является способным к горизонтальному переносу от вида второй клетки (хозяина) к виду Firmicutes из указанной микробиоты человека. Последний можно использовать, например, для лечения или предотвращения ожирения у человека, когда последовательность-мишень содержится в клетке Firmicutes, но не в первой клетке (носителе) или второй клетке (хозяине).

89. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому из вариантов осуществления 83-88, где MGE является способным к горизонтальному переносу от вида второй клетки (хозяина) к третьему виду бактериальных клеток из указанной микробиоты человека, где третий вид клеток является патогенным в указанной микробиоте человека и содержит указанную последовательность-мишень. В одном примере, первая клетка (носитель) и вторая клетка (хозяин) не содержат последовательность-мишень.

90. Вектор, композиция, пищевой продукт, напиток, популяция или способ из варианта осуществления 89, где третья клетка представляет собой клетку по любому из признаков (i)-(xiv) по п.19.

91. Вектор, композиция, пищевой продукт, напиток, популяция или способ по любому предшествующему варианту осуществления, где MGE лишен последовательности, кодирующей эндонуклеазу Cas, которая может функционировать с последовательностями повторов из массива, и где вектор содержит такую последовательность (например, кодирующую Cas9) вне MGE.

Любые из общих признаков также можно применять для настоящей конфигурации. Любые из признаков любых других конфигурации, аспекта, абзаца, примера, варианта осуществления или концепции в настоящем документе также можно комбинировать с настоящими конфигурациями с применением MGE.

Таким образом, изобретение относится к следующим признакам, пронумерованным как абзацы; эти абзацы применяют к любому из аспектов, как перечислено, или к любому из вариантов осуществления 1-91, или к любой другой конфигурации в настоящем документе:-

1. Вектор по любому из аспектов 44-50, где последовательность-мишень представляет собой нуклеотидную последовательность из системы CRISPR/Cas хозяина, в результате чего crРНК направляет Cas на мишень для модификации системы CRISPR/Cas хозяина в клетке-хозяине.

2. Вектор из абзаца 1, где система CRISPR/Cas хозяина представляет собой систему типа I, II или III, и последовательность-мишень представляет собой нуклеотидную последовательность, консервативную в указанном типе системы по меньшей мере в одном, двух или трех дополнительных штаммах-хозяевах или видах-хозяевах, где указанные дополнительные штаммы или виды отличаются от указанного хозяина.

3. Вектор по любому из предшествующих абзацев, где последовательность-мишень является идентичной последовательности системы CRISPR/Cas видов Streptococcus (например, S thermophilus или S pyogenes).

4. Вектор по любому из предшествующих абзацев, где последовательность-мишень из системы CRISPR/Cas хозяина содержит

i. последовательность лидера или лидерного промотора массива CRISPR, смежную с наиболее близким к 5'-концу нуклеотидом из первого повтора (и необязательно, содержащую указанный наиболее близкий к 5'-концу нуклеотид из повтора, например, содержащую 3 первых нуклеотида на 5'-конце первого повтора.);

ii. последовательность из вплоть до 20 (например, 3, 5, 7, 9, 10, 12, 15, 20, 30 или 32) нуклеотидов, смежных с нуклеотидами непосредственно на 5'-конце первого повтора;

iii. последовательность из вплоть до 20 (например, 3, 5, 7, 9, 10, 12, 15, 20, 30 или 32) смежных нуклеотидов из наиболее близких к 5'-концу нуклеотидов из первого повтора; или

iv. последовательность из вплоть до 20 (например, 3, 5, 7, 9, 10, 12, 15, 20, 30 или 32) смежных нуклеотидов непосредственно на 3'-конце первого спейсера (и необязательно, где последовательность содержит наиболее близкий к 3'-концу нуклеотид из первого спейсера, например, содержит 3 последних нуклеотида на 3'-конце первого повтора).

5. Вектор из абзаца 1, 2 или 3, где массив содержится в векторе на основе нуклеиновой кислоты (например, в вирусе, вирионе, фаге, фагмиде или профаге) и

i. crРНК содержит структуру или состоит из структуры R-S-R, где R=повтор CRISPR и S=спейсер CRISPR, где S содержит (в направлении от 5' к 3') V-HR или HR-V, где V=последовательность, идентичная последовательности ДНК вектора и HR=последовательность ДНК повтора из массива CRISPR, из массива CRISPR указанной клетки-хозяина;

ii. где последовательность HR является непосредственно смежной с последовательностью V в массиве CRISPR хозяина; и

iii. где crРНК является способной гибридизоваться со спейсером из массива CRISPR хозяина для направления Cas на мишень хозяина для модификации массива CRISPR хозяина в клетке. Например, V представляет собой последовательность из последовательности, кодирующей белок оболочки фагового вектора. В этом отношении, Heler et al обнаружили в исследовании устойчивости бактерий, что три независимых от CRISPR, устойчивых к бактериофагу мутанта обладают заметным дефектом адсорбции фага (приблизительно 50%), что указывает на то, что они, наиболее вероятно, несут мутации устойчивости к оболочке.

6. Вектор из абзаца 5, где первая crРНК не гибридизуется или по существу не гибридизуется с нуклеиновой кислотой, присутствующей в векторе. Например, первая crРНК не гибридизуется с V в векторе или гибридизуется менее сильно, чем он гибридизуется со спейсером из массива хозяина. Тестирование гибридизации является общеупотребительным для специалиста в данной области. Например, его можно определять in vitro посредством выделения или синтеза ДНК вектора и ее инкубации с crРНК. Стандартные способы, например, с использованием ПЦР, можно использовать для детекции того, произошла или нет гибридизация (например, тестировать в условиях pH и температуры, которое можно обнаружить в клетке-хозяине).

7. Вектор из абзаца 5 или 6, где V=один или вплоть до 40 (например, вплоть до 15) смежных нуклеотидов из ДНК вектора. Последовательность затравки непосредственно на 5'-конце от PAM в протоспейсере, обнаруженная в последовательности-мишени, является важной для спаривания crРНК и функционирования системы CRISPR/Cas для разрезания. Эта последовательность затравки содержит приблизительно 15 или 12 смежных нуклеотидов, непосредственно на 5'-конце PAM.

8. Способ, массив или вектор из любого предшествующего аспекта или раздела, где массив содержится в векторе и содержит (в направлении от 5' к 3') последовательность первого повтора, первую спейсерную последовательность и последовательность второго повтора, где спейсерная последовательность содержит последовательность, которая способна гибридизоваться (например, является идентичной или обладает более 90% идентичности) с последовательностью-мишенью в клетке-хозяине, где массив дополнительно содержит промотор для транскрипции повторов и спейсера в клетке-хозяине, и необязательно, вектор содержит нуклеазу, кодирующую последовательность Cas и/или последовательность, кодирующую tracrРНК для кодирования функциональной последовательности Cas и/или tracrРНК в клетке-хозяине, где последовательность tracrРНК содержит последовательность, комплементарную первому или второму повтору.

9. Способ, массив или вектор из любого предшествующего аспекта или раздела, где массив CRISPR содержится в векторе и содержит (в направлении от 5' к 3') последовательность первого повтора, первую спейсерную последовательность и последовательность второго повтора, где спейсерная последовательность содержит последовательность, которая способна гибридизоваться (например, является идентичной или обладает более 90% идентичности) с последовательностью-мишенью в клетке-хозяине, где массив дополнительно содержит промотор для транскрипции повторов и спейсера в клетке-хозяине, и где вектор не содержит последовательность, кодирующую нуклеазу Cas, и/или последовательность, кодирующую tracrРНК, для кодирования последовательности tracrРНК в клетке-хозяине, где последовательность tracrРНК содержит последовательность, комплементарную первому или второму повтору, где HM-массив CRISPR является функциональным в клетке-хозяине для направления Cas (например, эндогенной нуклеазы Cas хозяина) на участок-мишень хозяина, необязательно, с использованием tracrРНК хозяина.

10. Способ, массив или вектор из абзаца 8 или 9, где повторы являются идентичными повторам в массиве хозяина, где массив CRISPR по изобретению не содержит PAM, узнаваемый Cas (например, a нуклеазой Cas, например, Cas9) из системы CRISPR/Cas хозяина. Возможность исключать последовательности Cas высвобождает пространство в массиве по изобретению.

«Жизненно важный ген» представляет собой ген у хозяина, присутствие или экспрессия которого необходимы для роста клетки-хозяина или для стимуляции или поддержания жизнеспособности клеток. Ген устойчивости представляет собой ген у хозяина, присутствие или экспрессия которого необходимы для обеспечения полной или частичной устойчивости к лекарственному средству против хозяина, например, антибиотику, например, бета-лактамному антибиотику. Ген вирулентности представляет собой ген у хозяина, присутствие или экспрессия которого необходимы для инфекционности по отношению к организму, который клетка-хозяин способна инфицировать, например, где хозяин представляет собой патоген (например, для растения, животного, человека, скота, животного-компаньона, растения, птицы, рыбы или насекомого).

11. Способ, массив или вектор из любого предшествующего аспекта или раздела, где массив CRISPR присутствует в комбинации с Cas не из клетки-хозяина (например, системой Cas типа I, где система хозяина принадлежит к типу II или III; системой Cas типа II, где система хозяина принадлежит к типу I или III; или системой Cas типа III, где система хозяина принадлежит к типу I или II), необязательно, где клетка-хозяин не содержит или не экспрессирует Cas типа, который является таким же, как тип Cas не из хозяина. Это является полезным, поскольку массив CRISPR не нацелен на последовательность внутри себя (например, в векторе) или на кодируемую вектором Cas в хозяине.

12. Способ, массив или вектор из любого предшествующего аспекта или раздела, где массив CRISPR присутствует в комбинации с последовательностью tracrРНК или последовательностью, кодирующей последовательность tracrРНК (например, на той же нуклеиновой кислоте, что и массив), необязательно, где последовательность tracrРНК и HM-crРНК содержатся в одиночной направляющей РНК (gРНК)).

13. Способ, массив или вектор из любого предшествующего аспекта или раздела, где массив CRISPR присутствует в комбинации с Cas или последовательностью, кодирующей Cas, необязательно, где массив интегрирован в геном клетки-хозяина, и Cas является эндогенной для клетки-хозяина или кодированной экзогенной последовательностью. В одном примере, кодирующая Cas последовательность представляет собой экзогенную последовательность, введенную хозяину, например, из плазмиды или вируса, такого как фаг.

14. Способ, массив или вектор из любого предшествующего аспекта или раздела, где массив CRISPR содержится в нуклеотидной последовательности плазмиды, вируса, вириона, фага, фагмиды или профага. Фагмида представляет собой упакованный фаг. Профаг представляет собой фаг, интегрированный в хромосому хозяина или эписомальный в клетке.

15. Способ, массив или вектор из любого предшествующего аспекта или раздела, где массив CRISPR интегрирован в геном клетки-хозяина, например, в нуклеиновую кислоту хромосомы или эписомы.

В одном примере массив присутствует в комбинации с Cas смерти (например, dCas9), конъюгированной с активатором транскрипции или трансляции, который действует на последовательность-мишень или ген, содержащей последовательность-мишень. Это является полезным, например, для переключения экспрессии гена в клетке-хозяине (например, желательного гена, например, последовательности экзогенного гена, которая ранее сконструирована в клетке-хозяине, например, для кодирования антибиотика, когда хозяин представляет собой микроорганизм, или для кодирования желательного экзогенного белка для продукции в культуре хозяина, например, для пищевого продукта, напитка, лекарственного средства или любого другого применения по изобретению, как описано в настоящем документе,).

16. Вирус (например, вирион, фаг, фагмида или профаг), содержащий массив CRISPR из любого предшествующего аспекта или раздела, например, для инфицирования клетки, например, микроорганизма, или для применения в медицине или стоматологии.

17. Популяция вирионов по абзацу 16, где первый и второй вирион из нее содержит различные лидеры или промоторы массива для нацеливания на различные последовательности-мишени в клетке-хозяине или в различных штаммах-хозяевах.

18. Коллекция массивов CRISPR, где каждый массив соответствует любому предшествующему аспекту или абзацу, где первый массив содержит первый промотор для транскрипции crРНК; второй массив содержит второй промотор для транскрипции crРНК, который отличается от первого промотора; и где каждый промотор является идентичным промотору хозяина или его гомологу; необязательно, где первый или оба промотора являются идентичными промотору Cas хозяина (например, Cas1, 2, 9 или Csn2) или промотору массива CRISPR. Например, первый промотор представляет собой промотор эндогенной нуклеазы Cas или промотор эндогенной Cas1 или Cas2; или промотор эндогенного гена, который экспрессируется на высоком уровне или конститутивно, или представляет собой жизненно важный ген, ген вирулентности или ген устойчивости клетки-хозяина. При использовании эндогенных промоторов, присутствует давление в ходе эволюции хозяина для сохранения промоторов хозяина, и таким образом, это уменьшает вероятность нацеливания системы защиты CRISPR/Cas хозяина на один или несколько промоторов массивов.

19. Коллекция массивов CRISPR по изобретению, где первый массив содержит один или несколько спейсеров (например, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 или более спейсеров); и второй массив содержит более одного спейсера (например, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 или более спейсеры), где указанные спейсеры из второго массива являются идентичными одному или нескольким спейсерам из первого массива. Это является полезным для избегания устойчивости хозяина посредством гомологичной рекомбинации спейсеров HM-массива, поскольку подтверждение множества таких спейсеров в HM-массиве (или более того, распределения спейсеров среди множества массивов) увеличивает шансы того, что некоторые спейсеры HM-массива останутся в клетке-хозяине, даже если в клетке-хозяине произойдет делеция некоторых из спейсеров. Защиту против делеции усиливают также посредством использования различных повторов, фланкирующих идентичные копии спейсеров в различных массивах. Таким образом, изобретение относится к следующему:-

20. Коллекция из абзаца 18 или 19, где спейсеры (или указанные спейсеры) из первого массива фланкированы первыми повторами, которые являются идентичными; спейсеры (или указанные спейсеры) из второго массива фланкированы вторыми повторами, которые являются идентичными; и где первые повторы отличаются от вторых повторов.

21. Коллекция из абзаца 20, где первые повторы являются идентичными повторам в системе CRISPR/Cas клетки-хозяина.

22. Коллекция из абзаца 20, где первые повторы отличаются от повторов в системе CRISPR/Cas хозяина.

23. Коллекция по любому из абзацев 18-22, где первый и второй массивы содержатся в одной и той же клетке-хозяине или в одном и том же векторе (например, плазмиде, вирусе, вирионе, фаге, фагмиде или профаге).

24. Коллекция по любому из абзацев 18-22, где первый массив содержится в первом векторе, и второй массив содержится во втором векторе, который не содержит первый массив (например, где векторы представляют собой плазмиды или вирионы (например, из одного и того же типа вируса) или упакованный фаг (например, из одного и того же типа фага).

В одном варианте осуществления, векторы, используемые в способе по изобретению, представляют собой векторы, составляющие массив по любому из абзацев 18-24.

25. Клетка-хозяин, содержащая массив, вирус, вирион, фаг, фагмиду, профаг, популяцию или коллекцию по любому из предшествующих абзацев.

Любой из общих признаков (см. ниже) также можно применять для настоящей конфигурации.

В одном примере по изобретению представлено следующее для уменьшения риска адаптации и устойчивости хозяина к массиву:-

Массив CRISPR или вектор по изобретению для модификации нуклеотидной последовательности-мишени из клетки-хозяина,

a. где клетка-хозяин содержит первый эндогенный промотор (первый промотор хозяина) для транскрипции последовательности-мишень;

b. где массив CRISPR содержит последовательность, кодирующую crРНК, и первый промотор для транскрипции crРНК, где crРНК, необязательно, содержится в одиночной направляющей РНК (gРНК) и является способной гибридизоваться с последовательностью-мишенью хозяина для направления Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

c. где последовательность первого промотора представляет собой последовательность второго эндогенного промотора хозяина, отличную от последовательности первого промотора хозяина.

В одном примере, для каждой единицы CRISPR вектора (например, фага) используют промотор, представляющий собой промотор жизненно важного гена в хозяине - таким образом, хозяин может экспрессировать crРНК хорошо (и конститутивно, если промотор происходит из гена хозяина, который всегда или часто должен быть включен). Хозяину непросто адаптироваться в отсутствие этого промотора, так что непросто приобрести устойчивость. Необязательно, можно использовать различные жизненно важные промоторы для различных единиц CRISPR вектора для уменьшения шанса адаптации (устойчивости) хозяина. Можно использовать промотор гена вирулентности или жизненно важного гена или гена устойчивости, на который нацеливаются в хозяине посредством массива (или различных массивов). Для приобретения устойчивости к фагу хозяину необходимо внести мутации в промотор эндогенного гена и участок-мишень в гене (который может, например, находиться в кодирующей последовательности, которая является жизненно важной для роста, жизнеспособности клеток или их устойчивости к лекарственному средству против хозяина (например, антибиотика)) и таким образом, также существует риск инактивации гена таким образом.

Предоставление, как по изобретению, множества копий последовательностей нуклеиновой кислоты, кодирующих crРНК, где копии содержат одну и ту же спейсерную последовательность для нацеливания на последовательность клетки-хозяина, как по изобретению, является преимущественным для уменьшения шансов удаления хозяином (например, посредством гомологичной рекомбинации клетки-хозяина) полезных нацеливающих спейсеров из вектора. Множество нацеливающих спейсеров могут обеспечивать гибкость, в одном и том же или многих HM-массивах, по изобретению для обеспечения альтернативных способов избегания устойчивости.

Таким образом, изобретение относится к следующим концепциям:-

1. модифицирующая хозяина (HM) система CRISPR/Cas (например, типа I, II или III) для модификации нуклеотидной последовательности-мишени из клетки-хозяина, где система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas (например, a Cas9);

(ii) сконструированный модифицирующей хозяина (HM) массив CRISPR (например, массив, как описано выше), содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью хозяина для направления Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК для экспрессии последовательности tracrРНК;

(iv) где указанные компоненты системы содержат две, три или более копии (например, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 или более); последовательностей нуклеиновой кислоты, кодирующих crРНК, где копии содержат одну и ту же спейсерную последовательность для нацеливания на последовательность клетки-хозяина (например, последовательность гена вирулентности, устойчивости или жизненно важного гена хозяина, или последовательность компонента из системы CRISPR/Cas хозяина, опосредующего адаптацию к вектору).

Например, система содержит 4 или более; или 5 или более; указанных копий последовательностей нуклеиновой кислоты, кодирующих crРНК, содержащих один и тот же спейсер. Это является преимущественным для увеличения экспрессии желательных cРНК в хозяине. Кроме того, это обеспечивает больше шансов избегания устойчивости хозяина, поскольку необходимо нацеливание на более, чем одну последовательность (особенно, если присутствует множество копий, например, 5, 10, 15, 20, 30, 40, 50 или 100 или более). Распределение копий среди различных массивов, например, где вектор содержит их, разделенных промежутками, на одной и той же цепи ДНК, можно использовать для уменьшения шансов рекомбинации между спейсерами или между фланкирующими повторами, которая может затем приводить к вырезанию желательных кодирующих cРНК последовательностей. Шансы хозяина для вырезания всех копий уменьшают посредством предоставления копий, распределенных среди массивов из множества векторов, их также уменьшают посредством включения множества копий желательных спейсеров (например, множества копий в массиве из первого вектора и множества копий в массиве из второго вектора - можно включать по меньшей мере 2, 3, 4, 5, 6, 10 или более таких массивов, где каждый содержит 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 или 100 или более копий желательного спейсера).

2. Система из концепции 1, где указанные компоненты системы содержат 4, 5, 10, 15, 20 или более указанных копий последовательностей нуклеиновой кислоты, кодирующих crРНК, содержащих один и тот же спейсер.

3. Система из концепции 1 или 2, где копии разделены между массивами CRISPR двух или более векторов на основе нуклеиновой кислоты.

4. Система из концепции 3, где система содержит первый и второй HM-массивы, где первый и второй массивы CRISPR вектора содержатся в одной и той же клетке-хозяине или в одном и том же векторе (например, в плазмиде, вирусе, вирионе, фаге, фагмиде или профаге).

5. Система из концепции 3 или 4, где первый массив содержится в первом векторе и второй массив содержится во втором векторе, который не содержит первый массив (например, где векторы представляют собой плазмиды или вирионы (например, из одного и того же типа вируса) или фагмиды (например, из одного и того же типа фага).

6. Система из любой предшествующей концепции, где повторы являются идентичными повторам в массиве CRISPR хозяина.

7. Система по любой из концепций 1-5, где повторы не являются идентичными повторам в массиве CRISPR хозяина.

8. Клетка-хозяин, содержащая систему, вектор, вирус, вирион, фаг, фагмиду или профаг в соответствии с любой предшествующей концепцией.

9. Противомикробная композиция (например, антибиотика, например, лекарственного средства, дезинфицирующего средства или ополаскивателя для ротовой полости), содержащая систему, вектор, вирус, вирион, фаг, фагмиду или профаг по любой из концепций 1-8.

Любой из общих признаков (см. ниже) также можно применять для настоящих концепций.

РАЗДЕЛЕННАЯ СИСТЕМА CRISPR/CAS9

Эта конфигурация является преимущественной для высвобождения пространства в целевых векторах, например, вирусах или фаге, обладающих ограниченной емкостью для переноса экзогенной последовательности. Посредством высвобождения пространства, можно включать больше нацеливающих спейсеров или массивов, которые можно использовать для избегания устойчивости хозяина. Является преимущественным, например, использовать эндогенную эндонуклеазу Cas, вместо того, чтобы кодировать ее в векторе - особенно для больших последовательностей Cas, таких как sp или saCas9. Кроме того, не существует шанса несоответствия совместимости, как можно наблюдать для некоторых экзогенных Cas из источников, отличных от хозяина. Возможность уменьшать размер генома вируса, например, фага, может также является преимущественным, чтобы способствовать поглощению клеткой-хозяином (инфекции и/или поддержанию вируса в клетках-хозяевах). В некоторых примерах, преимуществом является то, что проникновение в хозяина вектора (например, фага) может осуществлять повышающую регуляцию активности CRISPR/Cas хозяина, включая увеличенную экспрессию нуклеаз Cas хозяина - в попытке хозяина бороться с проникающей нуклеиновой кислотой. Это, однако, можно также использовать для предоставления эндогенной Cas для применения с массивами, векторами, системами и другими аспектами этой конфигурации изобретения, когда они содержат один или несколько повторов, узнаваемых Cas хозяина. В случае, когда изобретение относится к одному или нескольким спейсерам, нацеленным на массив CRISPR хозяина (также, как в первой конфигурации по изобретению), это затем способствует инактивации самого массива CRISPR хозяина, по типу «суицидальной» клетки-хозяина, которая затем использует свою собственную нуклеазу Cas для инактивации своих собственных систем CRISPR.

Таким образом, изобретение относится к следующим признакам, пронумерованным как примеры:-

1. Модифицирующая хозяина (HM) система CRISPR/Cas9 (например, типа I, II или III) для модификации нуклеотидной последовательности-мишени из клетки-хозяина, где система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas (например, Cas9);

(ii) сконструированный модифицирующей хозяина (HM) массив CRISPR (например, массив по изобретению, описанный выше), содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК для экспрессии последовательности tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который может трансформировать клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации последовательности-мишени в клетке-хозяине.

Под «разделением» в настоящем документе понимают, что вектор содержит один или несколько (но не все) из компонентов системы, и клетка-хозяин содержит один или несколько (но не все) из компонентов, и вектор содержит один или несколько компонентов, не содержащихся в клетке-хозяине. В одном варианте осуществления, вектор и клетка-хозяин не разделяют никаких общих компонентов, например, клетка-хозяин содержит компонент (i), и вектор содержит компонент (ii), и или вектор содержит компонент (iii), и/или клетка-хозяин содержит компонент (iii). Когда вектор находится внутри клетки-хозяина (например, в форме интегрированного или эписомного вектора, например, профага), подразумевают, что вектор представляет собой нуклеиновую кислоту, предоставленную вектором, трансформировавшим клетку-хозяина (и компоненты системы, предоставленные такой нуклеиновой кислотой, в этом случае не следует рассматривать как компоненты клетки-хозяина). Это можно легко определить посредством секвенирования нуклеиновой кислоты (например, хромосомной и эписомной нуклеиновой кислоты) трансформированного хозяина и сравнения ее с последовательностями из нетрансформированного хозяина такого же типа (например, из тех же родительских колонии или клона хозяина, например, когда хозяин представляет собой микроорганизм, например, бактерию или архей).

Необязательно, система представляет собой систему CRISPR/Cas9. Необязательно, нуклеаза из (a) представляет собой нуклеазу Cas типа I. Необязательно, нуклеаза из (a) представляет собой нуклеазу Cas типа II (например, Cas9). Необязательно, нуклеаза из (a) представляет собой нуклеазу Cas типа III.

2. Система из примера 1, где по меньшей мере один из компонентов является эндогенным для клетки-хозяина.

3. Система из примера 1 или 2, где компонент (i) является эндогенным для клетки-хозяина.

4. Система по любому из примеров 1-3, где компонент (iii) является эндогенным для клетки-хозяина.

5. Модифицирующая хозяина (HM) система CRISPR/Cas (например, типа I, II или III) для модификации нуклеотидной последовательности-мишени из клетки-хозяина, где система содержит компоненты по (a)-(e):-

a. по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas (например, a Cas9);

b. сконструированный модифицирующей хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью хозяина для направления указанной Cas на мишень в клетке-хозяине;

c. необязательно, последовательность tracrРНК или последовательность ДНК для экспрессии последовательности tracrРНК;

d. где указанные компоненты системы разделены между по меньшей мере первым и вторым вектором на основе нуклеиновой кислоты, где первый вектор содержит компонент (a), но второй вектор лишен компонента (a); и

e. где векторами можно трансформировать, одновременно или последовательно, клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации последовательности-мишени в клетке-хозяине.

Определение «разделения», представленное выше, применимо, с соответствующими изменениями, к настоящему примеру, включающему в себя первый и второй векторы.

В одном варианте осуществления последовательность tracrРНК не предоставлена посредством векторов, но представляет собой последовательность tracrРНК из эндогенной системы CRISPR/Cas клетки-хозяина, где tracrРНК является способной гибридизоваться с HM-crРНК в клетке для последующего процессинга до зрелой crРНК для направления Cas на мишень в клетке-хозяине.

6. Система из примера 5, где первый вектор содержит компонент (a), и второй вектор содержит компоненты (b) и (c).

7. Система из примера 5 или 6, где каждый из первого и/или второго вектора содержит один, два, три или более дополнительно сконструированных HM-CRISPR-массивов.

8. Система по любому из примеров 5-7, где один из первого и второго векторов представляет собой фагмиду, и второй вектор представляет собой фаг-помощник.

9. Система по любому из предшествующих примеров (например, примеру 3 или 6), где последовательность crРНК и последовательность tracrРНК содержатся в одиночной направляющей РНК (gРНК), например, предоставленной посредством вектора.

10. Система по любому из предшествующих примеров, где каждый вектор обладает ограниченной емкостью для вставки экзогенной нуклеиновой кислоты.

11. Система по любому из предшествующих примеров, где вектор или векторы представляют собой вирусы (например, вирионы, упакованный фаг, фагмиду или профаг).

12. Система по любому из предшествующих примеров, где клетка-хозяин содержит цепь дезоксирибонуклеиновой кислоты со свободным концом (HM-ДНК), кодирующую представляющую интерес последовательность HM, и/или где система содержит последовательность, кодирующую HM-ДНК (например, интегрированную в вектор или в геном клетки-хозяина, или в его эписому), где HM-ДНК содержит последовательность или последовательности, которые являются гомологичными, соответственно, последовательности или последовательностям в последовательности-мишени или фланкирующим последовательность-мишень.

Цепь содержит свободный конец, т.е., конец, не интегрированный в ДНК хозяина или вектора, так что цепь имеет один или два свободных конца, т.е., ДНК является не связанной с соседним нуклеотидом непосредственно с 5'- и/или 3'-конца, соответственно.

13. Система из примера 12, где участок-мишень разрезают в клетке-хозяине посредством Cas (например, посредством Cas9, когда указанная нуклеаза Cas представляет собой Cas9), и HM-ДНК содержит первую и вторую последовательности, которые являются гомологичными 5'- и 3'-последовательностям, соответственно, фланкирующим разрез, для вставки HM-ДНК в геном хозяина (например, в хромосомный или эписомный участок).

14. Система из примера 13, где вставка происходит посредством направляемой гомологией рекомбинации (HDR).

15. Система из примера 13, где вставка происходит посредством соединения негомологичных концов (NHEJ).

16. Система по любому из примеров 12-15, где HM-последовательность представляет собой или кодирует регуляторный элемент (например, промотор, например, индуцируемый промотор, заменяющий эндогенный промотор), ингибирующую транскрипцию последовательность, усиливающую транскрипцию последовательность, метку или последовательность, кодирующую экзогенный белок или домен.

17. Система по любому из примеров 12-16, где система содержит первую и вторую HM-ДНК, где последовательность первой HM-ДНК является комплементарной последовательности второй ДНК, в результате чего ДНК способны к объединению в клетке-хозяине посредством гомологичной рекомбинации для формирования комбинированной HM-ДНК для вставки в геном клетки-хозяина (например, в хромосомный или эписомный участок).

18. Система по любому из предшествующих примеров, где вектор или векторы являются способными инфицировать клетку-хозяина для введения нуклеиновой кислоты вектора, содержащей компонент системы, в клетку.

19. Система по любому из предшествующих примеров, где указанная нуклеаза Cas представляет собой никазу.

20. Система по любому из предшествующих примеров, где клетка принадлежит к бактериям или археям, и указанная нуклеаза Cas предоставлена посредством эндогенной системы CRISPR/Cas типа II бактерий или архей.

21. Система по любому из предшествующих примеров, где вектор или векторы находятся внутри указанной клетки-хозяина, необязательно, интегрированы в ДНК хозяина.

22. Система по любому из предшествующих примеров, где вектор или векторы лишены последовательности, кодирующей нуклеазу Cas (например, Cas9).

23. Сконструированный вирусный вектор на основе нуклеиновой кислоты (например, a вектор, вирион или упакованный фаг, как описано выше) для инфекции клетки-хозяина микроорганизма, содержащей эндогенную систему CRISPR/Cas, где вектор

(a) содержит последовательности нуклеиновой кислоты для экспрессии множества различных crРНК для применения в системе CRISPR/Cas по любому из предшествующих примеров; и

(b) лишен последовательности нуклеиновой кислоты, кодирующей нуклеазу Cas (например, a Cas9), где первая из указанных crРНК является способной гибридизоваться с первой последовательностью нуклеиновой кислоты в указанной клетке-хозяине; и вторая из указанных crРНК является способной гибридизоваться с второй последовательностью нуклеиновой кислоты в указанной клетке-хозяине, где указанная вторая последовательность отличается от указанной первой последовательности; и

(c) первая последовательность содержится в гене устойчивости к противомикробному средству (например, антибиотику) (или его РНК) и вторая последовательность содержится в гене устойчивости к противомикробному средству (или его РНК); необязательно, где гены являются различными;

(d) первая последовательность содержится в гене устойчивости к противомикробному средству (или его РНК) и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК);

(e) первая последовательность содержится в жизненно важном гене (или его РНК) и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК); или

(f) первая последовательность содержится в гене вирулентности (или его РНК), и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК).

24. Сконструированный (непосредственно сконструированный или выделенный из вектора в клетке-хозяине, где этот вектор происходит из сконструированного вектора, трансформировавшего хозяина) вектор на основе нуклеиновой кислоты для трансформации клетки-хозяина, содержащей эндогенную систему CRISPR/Cas, где вектор, необязательно, представляет собой вектор, как описано выше, и

(a') содержит последовательности нуклеиновой кислоты для экспрессии множества различных crРНК для применения в системе CRISPR/Cas по любому из предшествующих примеров; и

(b') лишен последовательности нуклеиновой кислоты, кодирующей нуклеазу Cas (например, a Cas9), где первая из указанных crРНК является способной гибридизоваться с первой последовательностью нуклеиновой кислоты в указанной клетке-хозяине; и вторая из указанных crРНК является способной гибридизоваться с второй последовательностью нуклеиновой кислоты в указанной клетке-хозяине, где указанная вторая последовательность отличается от указанной первой последовательности; и где первая и/или вторая последовательность представляет собой последовательность-мишень из системы CRISPR/Cas хозяина, где последовательность представляет собой или содержит

(c') последовательность повтора ДНК или РНК (например, где повтор представляет собой наиболее близкий 5'-концу повтор (первый повтор) в указанном массиве CRISPR хозяина;

(d') последовательность tracrРНК или последовательность ДНК, кодирующую tracrРНК;

(e') лидерную последовательность массива CRISPR;

(f') промотор гена Cas (например, промотор Cas1, Cas2 или Csn2);

(g') последовательность лидерного промотора массива CRISPR; или

(h') последовательность ДНК или РНК, кодирующую Cas (например, где Cas представляет собой Cas9, Cas1, Cas2 или Csn2), например, где первая из указанных crРНК является способной к нацеливанию на последовательность гена Cas1 хозяина (или на его последовательность РНК) и вторая из указанных crРНКs является способной к нацеливанию на последовательность гена Cas2 хозяина (или на его последовательность РНК).

25. Вектор из примера 24, где первая и/или вторая последовательность-мишень представляет собой или содержит

i. последовательность лидера или лидерного промотора массива CRISPR, смежную с наиболее близким к 5'-концу нуклеотидом из первого повтора (и необязательно, содержащую указанный наиболее близкий к 5'-концу нуклеотид из повтора), например, содержащую 3 первых нуклеотида на 5'-конце первого повтора;

ii. последовательность из вплоть до 20 (например, 3, 5, 7, 9, 10, 12, 15, 20, 30 или 32) смежных нуклеотидов непосредственно на 5'-конце первого повтора;

iii. последовательность из вплоть до 20 (например, 3, 5, 7, 9, 10, 12, 15, 20, 30 или 32) смежных нуклеотидов из наиболее близких к 5'-концу нуклеотидов из первого повтора; или

iv. последовательность из вплоть до 20 (например, 3, 5, 7, 9, 10, 12, 15, 20, 30 или 32) смежных нуклеотидов непосредственно на 3'-конце первого спейсера (и необязательно где последовательность содержит наиболее близкий к 3'-концу нуклеотид из первого спейсера), например, содержит 3 последних нуклеотида на 3'-конце первого повтора.

26. Вектор из примера 24 или 25, где эта или каждая последовательность-мишень содержится в последовательности, выбранной из группы, состоящей из SEQ ID NO: 1-44, или комплементарных им последовательностей.

27. Вектор по любому из примеров 24-26, где первая crРНК содержит структуру или состоит из структуры R-S-R, где R=повтор CRISPR и S=спейсер CRISPR, где S содержит (в направлении от 5' к 3') V-HR или HR-V, где V=последовательность, идентичная последовательности ДНК вектора и HR=последовательность ДНК повтора из массива CRISPR указанной системы CRISPR/Cas клетки-хозяина, где первая crРНК является способной гибридизоваться со спейсером из массива CRISPR хозяина для направления Cas на мишень crРНК для модификации массива CRISPR хозяина в клетке.

28. Вектор из примера 27, где первая crРНК по существу не гибридизуется с нуклеиновой кислотой, присутствующей в векторе, например, где первая crРНК не гибридизуется с V в векторе или гибридизуется менее сильно, чем он гибридизуется со спейсером из массива хозяина. Обсуждение определения этого выше применимо также к этому примеру.

29. Вектор из примера 27 или 28, где V=один или вплоть до 40 (например, вплоть до 15) смежных нуклеотидов ДНК вектора. Например, V=1, 2, 3, 4, 5, 6, 7 8 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 или 40 смежных нуклеотидов ДНК вектора.

30. Вектор из примера 29, где

i. система CRISPR/Cas хозяина является способной узнавать родственный PAM;

j. где ДНК вектора содержит такой PAM непосредственно на 3' от последовательности протоспейсера;

k. где V=один или вплоть до 40 (например, вплоть до 15) нуклеотидов протоспейсера; и

l. где HR=последовательность, идентичная непрерывной последовательности из повтора из массива CRISPR хозяина.

31. Вектор из примера 30, где указанная непрерывная последовательность из повтора из массива хозяина представляет собой последовательность по меньшей мере из 50% повтора хозяина (например, включая наиболее близкий к 5'-концу или наиболее близкий к 3'-концу нуклеотид из повтора хозяина).

32. Вектор из примера 30 или 31, где V=от 1 до 40 (например, вплоть до 15) из наиболее близких к 3'-концу смежных нуклеотидов протоспейсера; и необязательно, указанная непрерывная последовательность из повтора включает наиболее близкий к 5'-концу нуклеотид из повтора хозяина.

33. Вектор из примера 30 или 31, где V= от 1 до 40 (например, вплоть до 15) из наиболее близких к 5'-концу смежных нуклеотидов протоспейсера; и необязательно, указанная непрерывная последовательность из повтора включает наиболее близкий к 3'-концу нуклеотид из повтора хозяина.

34. Вектор по любому из примеров 27-33, где R=повтор, узнаваемый системой CRISPR/Cas хозяина. Альтернативно, R=повтор, не узнаваемый системой CRISPR/Cas хозяина. В этом случае, предпочтительно вектор содержит нуклеотидную последовательность нуклеазы Cas (и необязательно, tracrРНК), родственную R, т.е., способную функционировать с R в клетке-хозяине.

35. Вектор по любому из примеров 24-34, где первая последовательность соответствует любому из (c') - (h') и вторая последовательность выбрана из жизненно важного гена, гена вирулентности или гена устойчивости хозяина.

36. Сконструированный вирусный вектор на основе нуклеиновой кислоты (например, вирион или упакованный фаг) для применения в системе по любому из примеров 1-22 для инфекции клетки-хозяина микроорганизма, содержащей эндогенную систему CRISPR/Cas,

a. где вектор содержит первую последовательность нуклеиновой кислоты для экспрессии первой crРНК в хозяине; и

b. где первая последовательность содержит (в направлении от 5' к 3') R1a-S1-R1b, где R1a=первый повтор CRISPR, где R1a является необязательным; R1b=второй повтор CRISPR и S1=спейсер CRISPR, комплементарный последовательности хозяина (например, последовательностям хозяина, перечисленным в примере 23 или 24), где R1a и R1b являются узнаваемыми нуклеазой Cas хозяина (например, нуклеазой типа II, например, Cas9);

c. где вектор лишен (i) последовательности нуклеиновой кислоты, кодирующей нуклеазу Cas (например, Cas9), узнающую повтор(ы) из (b) и/или (ii) последовательности нуклеиновой кислоты, кодирующей последовательность tracrРНК, комплементарную последовательности crРНК, кодируемой первой последовательностью.

Например, вектор представляет собой вектор на основе нуклеиновой кислоты, содержащийся в фаге.

37. Вектор из примера 36, где

d. вектор содержит вторую последовательность нуклеиновой кислоты для экспрессии второй crРНК в хозяине, где вторая crРНК отличается от первой crРНК;

e. где вторая последовательность содержит (в направлении от 5' к 3') R2a-S2-R2b, где R2a=первый повтор CRISPR, где R2a является необязательным; R2b=второй повтор CRISPR и S2=спейсер CRISPR, комплементарный последовательности хозяина (например, последовательностям хозяина, перечисленным в примере 23 или 24), где R2a и R2b являются узнаваемыми нуклеазой Cas хозяина (например, нуклеазой типа I или II, например, Cas6).

Таким образом, например, первая и вторая последовательности нуклеиновой кислоты содержатся в одной и той же упакованной фагмиде, например, в одном и том же или в разных массивах CRISPR.

38. Вектор из примера 37, где вектор лишен (iii) последовательности нуклеиновой кислоты, кодирующей Cas (например, Cas6), узнающую повтор(ы) из (e) и/или (iv) последовательности нуклеиновой кислоты, кодирующей последовательность tracrРНК, комплементарную последовательности crРНК, кодируемой второй последовательностью.

39. Коллекция сконструированных вирусных векторов на основе нуклеиновой кислоты (например, векторов, вирионов или упакованных фагов, как описано выше) для применения в системе по любому из примеров 1-22 для совместной инфекции клетки-хозяина микроорганизма содержащей эндогенную систему CRISPR/Cas, где коллекция содержит первый вектор и второй вектор,

f. где первый вектор соответствует примеру 36;

g. где второй вектор содержит вторую последовательность нуклеиновой кислоты для экспрессии второй crРНК в хозяине, где вторая crРНК отличается от первой crРНК;

h. где вторая последовательность содержит (в направлении от 5' к 3') R2a-S2-R2b, где R2a=первый повтор CRISPR, где R2a является необязательным; R2b=второй повтор CRISPR и S2=спейсер CRISPR, комплементарный последовательности хозяина, где R2a и R2b являются узнаваемыми нуклеазой Cas хозяина (например, нуклеазой типа I или II, например, Cas6).

Например, первый вектор содержится в первой упакованной фагмиде, и второй вектор содержится во второй упакованной фагмиде.

40. Коллекция из примера 39, где второй вектор содержит (v) последовательность нуклеиновой кислоты, кодирующую Cas (например, a Cas9), узнающую повтор(ы) из (b), и/или (vi) последовательность нуклеиновой кислоты, кодирующую последовательность tracrРНК, комплементарную последовательности crРНК, кодируемой первой последовательностью.

Например, в этом случае функции Cas обеспечивает эндогенная система хозяина. Это сохраняет пространство в векторе (например, для включения большего количества нацеленных на хозяина спейсеров HM-массива) и упрощает конструирование вектора и массива.

41. Коллекция из примера 39 или 40, где второй вектор лишен (vii) последовательности нуклеиновой кислоты, кодирующей Cas (например, Cas6), узнающую повтор(ы) из (h), и/или (viii) последовательности нуклеиновой кислоты, кодирующей последовательность tracrРНК, комплементарную последовательности crРНК, кодируемой второй последовательностью.

Например, в этом случае функции Cas обеспечивает эндогенная система хозяина.

42. Коллекция из примера 39, где каждый из первого и второго векторов лишен (ix) последовательности нуклеиновой кислоты, кодирующей Cas (например, Cas9), узнающую повтор(ы) из (b), и (x) последовательности нуклеиновой кислоты, кодирующей Cas (например, Cas6), узнающую повтор(ы) из (h); необязательно, где коллекция содержится в клетке-хозяине, содержащей одну или несколько Cas, узнающих повтор(ы) из (b) и (h).

43. Коллекция из примера 42, дополнительно включающая в себя третий вектор (например, вирион или фаг), содержащий последовательность нуклеиновой кислоты по (ix) и/или (x).

44. Коллекция по любому из примеров 39-43, где каждый вектор содержится в соответствующих упакованных вирионе или фагмиде, или в нуклеиновой кислоте соответствующих вириона или фага.

45. Вектор или коллекция по любому из примеров 36-44, где R1a и R1b содержат одинаковую последовательность повтора.

46. Вектор или коллекция по любому из примеров 37-45, где R2a и R2b содержат одинаковую последовательность повтора.

47. Вектор или коллекция по любому из примеров 37-46, где повтор(ы) из (b) являются узнаваемыми нуклеазой Cas, которая отличается от нуклеазы Cas, узнающей повтор(ы) из (e).

48. Вектор или коллекция по любому из примеров 37-47, где хозяин содержит системы CRISPR/Cas различных типов (например, системы типа I и типа II; системы типа I и типа III; системы типа II и типа III система; или системы типа I, II и III).

49. Вектор или коллекция по любому из примеров 36-48, где повтор(ы) из (b) являются узнаваемыми нуклеазой Cas типа II, например, Cas9.

50. Вектор или коллекция по любому из примеров 37-49, где повтор(ы) из (e) являются узнаваемыми нуклеазой Cas типа I или III, например, Cas6.

51. Вектор или коллекция по любому из примеров 23-50, где вектор представляет собой вирус, вирион, фаг, фагмиду или профаг.

52. Вектор или коллекция по любому из примеров 23-51 внутри клетки-хозяина, содержащей одну или несколько Cas, способных функционировать с cРНК, кодируемой вектором(векторами).

53. Вектор или коллекция по любому из примеров 23-52 внутри клетки-хозяина, содержащей Cas9.

54. Вектор или коллекция по любому из примеров 23-53, в комбинации с HM-ДНК (например, интегрированной в векторе, на плазмиде или в геноме клетки-хозяина или на его эписоме), где HM-ДНК является такой, как перечислено в любом из примеров 12-17.

55. Система, вектор или коллекция по любому из предшествующих примеров, содержащие последовательности нуклеиновой кислоты для экспрессии множества различных crРНК, где указанные crРНК являются способными к нацеливанию по меньшей мере на 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 или 100 последовательности ДНК в клетке-хозяине.

56. Система, вектор или коллекция по любому из предшествующих примеров, содержащие первую crРНК или последовательность нуклеиновой кислоты, кодирующую первую cРНК, способную к нацеливанию на последовательность ДНК нуклеазы Cas (или на ее последовательность РНК), которая не является указанной нуклеазой Cas (например, Cas9), но которая опосредует адаптацию хозяина к вектору; необязательно, содержащие вторую crРНК или последовательность нуклеиновой кислоты, кодирующую вторую cРНК, способную к нацеливанию на последовательность гена устойчивости, гена вирулентности или жизненно важного гена (или его РНК) в хозяине.

57. Система, вектор или коллекция по любому из предшествующих примеров, содержащие две, три или более копий последовательностей нуклеиновой кислоты, кодирующих crРНК, где копии содержат одну и ту же спейсерную последовательность для нацеливания на последовательность клетки-хозяина (например, на последовательность гена вирулентности, гена устойчивости или жизненно важного гена или на последовательность компонента системы CRISPR/Cas хозяина, который опосредует адаптацию к вектору, но который не является указанной нуклеазой Cas).

58. Система, вектор или коллекция из примера 57, где копии разделены между двумя или более векторами с массивами CRISPR.

59. Система, вектор или коллекция по любому из предшествующих примеров, где повторы вектора являются идентичными повторам в массиве CRISPR или массиву CRISPR хозяина (например, каждый повтор вектора обладает по меньшей мере 95% идентичностью последовательности с повтором хозяина).

60. Система, вектор или коллекция по любому из примеров 1-58, где повторы вектора не являются идентичными повторам в массиве CRISPR или массиву CRISPR хозяина.

61. Система, вектор или коллекция по любому из предшествующих примеров, содержащие массивы CRISPR первого и второго вектора, которые содержатся в одной и той же клетке-хозяине или в одном и том же векторе (например, плазмиде или вирусе, или вирионе, или фаге, или профаге, или фагмиде).

62. Система, вектор или коллекция из примера 61, где первый массив содержится в первом векторе, и второй массив содержится во втором векторе, который не содержит первый массив (например, где векторы представляют собой плазмиды или вирионы (например, из одного и того же типа вируса), или фагмиды (например, из одного и того же типа фага).

63. Клетка-хозяин, содержащая систему, вектор, коллекцию, вирус, вирион, фаг, фагмиду или профаг по любому из предшествующих примеров.

64. Противомикробная композиция (например, антибиотик, например, лекарственное средство, дезинфицирующее средство или ополаскиватель для ротовой полости), содержащая систему, вектор, вирус, вирион, фаг, фагмиду или профаг по любому из примеров 1-62.

СОВМЕСТНАЯ АДАПТАЦИЯ МИКРООРГАНИЗМОВ

Изобретение относится к способам получения микроорганизмов (например, популяций фагов и/или бактерий), включающим в себя совместную адаптацию хозяев и вирусов для облегчения совместной эволюции и таким образом, адаптации хозяев для вирусов (например, фагов) и наоборот. С использованием поддающейся репрессии экспрессии или активности crРНК по изобретению намеренно модулируют совместную эволюцию контролируемым способом, где желательную активность спейсера можно включать или выключать для обеспечения осуществления регулировки в присутствии или в отсутствие стресса, обусловленного направляемым спейсером действием Cas в хозяине, например, в присутствии или в отсутствие нацеливания на ген устойчивости к антибиотику. Таким образом, популяции бактерий можно регулировать для применения в ситуациях (например, в культурах молочных или пищевых продуктов), где может встречаться инактивация фагом желательных генов; или для применения для регулировки фага, подлежащего использованию для уничтожения или модуляции бактерий, например, для нокдауна устойчивости к антибиотику. Эта конфигурация дополнительно позволяет, в одном варианте осуществления, культивирование устойчивого к антибиотику бактериального хозяина с вирусом, например, фагом, несущим один или несколько массивов CRISPR по изобретению, нацеленных на ген устойчивости к антибиотику хозяина, поскольку способом намеренно репрессируют активность инактивации массивом гена устойчивости к антибиотику в ходе культивирования с хозяином. Таким образом, устойчивую популяцию бактерий-хозяев можно использовать для выращивания фага в культуре (например, в промышленном культуральном сосуде или устройстве), позволяя совместную эволюцию фага и хозяина без эффекта инактивации устойчивости к антибиотику, затрудняющего рост, и таким образом, возможность культивирования клеток-хозяев (что в ином случае может минимизировать распространение фага) и в то же время, все еще позволяя регулировку всех других компонентов желательного фага для культивируемой популяции хозяев. Можно проводить тестирование образца полученной популяции фага, например, в лабораторном масштабе, с использованием популяции устойчивых к антибиотику клеток-хозяев, но со снятием в тестируемом фаге репрессии массива, нацеленного на ген устойчивости к антибиотику клеток-хозяев. Природная и синтетическая репрессия экспрессии гена в условиях прокариотической клетки и фага хорошо известны специалисту в данной области, например, системы tet или индуцируемые светом системы.

Таким образом, изобретение относится к следующим признакам, пронумерованным как абзацы:-

1. Способ получения микроорганизмов, где способ включает в себя

(a) предоставление клетки-хозяина, содержащей систему CRISPR/Cas хозяина для нацеливания на нуклеотидную последовательность в клетке-хозяине;

(b) предоставление вируса, способного инфицировать клетку-хозяина, где

(i) вирус содержит один или несколько сконструированных модифицирующих хозяина (HM) массивов CRISPR (например, массива, как описано выше) для модификации нуклеотидных последовательностей-мишеней клетки-хозяина;

(ii) первый указанный HM-массив кодирует первую HM-crРНК, содержащую спейсерную последовательность (HM-спейсер), которая является способной гибридизоваться с первой последовательностью-мишенью хозяина для направления Cas на мишень в клетке-хозяине для модификации последовательности-мишени, необязательно, где модификация первой последовательности-мишени уменьшает рост или жизнеспособность клетки-хозяина; и

(iii) первый HM-массив поддается обратимой репрессии для транскрипции первой HM-crРНК, и/или активность первой HM-crРНК поддается обратимой репрессии;

(c) инфекцию клетки-хозяина вирусом для введения одного или нескольких HM-массивов CRISPR в клетку;

(d) репрессию транскрипции первой HM-crРНК и/или активности первой HM-crРНК в клетке;

(e) культивирование инфицированной клетки-хозяина для получения популяции (PH1) клеток-хозяев, содержащих популяцию (PV1) вируса; и

(f) получение популяции вируса PV1 и/или культивированной популяции клеток-хозяев.

В одном примере, первая HM-crРНК содержит HM-спейсер, который является способным гибридизоваться с первой последовательностью-мишенью хозяина для направления Cas на мишень в клетке-хозяине для модификации последовательности-мишени, где последовательность-мишень представляет собой нуклеотидную последовательность из системы CRISPR/Cas хозяина, в результате чего первая HM-crРНК направляет Cas на мишень для модификации системы CRISPR/Cas хозяина в клетке-хозяине, где модификация последовательности-мишени уменьшает или исключает функционирование системы CRISPR/Cas хозяина.

Альтернативно, модификация усиливает или ингибирует экспрессию гена в хозяине. В одном варианте осуществления, ген представляет собой жизненно важный ген, ген вирулентности или ген устойчивости (например, ген устойчивости к антибиотику). В одном варианте осуществления, модификация усиливает экспрессию продукта гена, который является эндогенным или экзогенным для хозяина. В одном примере, хозяин представляет собой сконструированного хозяина, содержащего экзогенную нуклеотидную последовательность (например, для получения желательного белка), и модификация усиливает или ингибирует экспрессию желательного белка в клетке-хозяине. В одном примере, желательный белок представляет собой антибиотик, и клетка-хозяин представляет собой клетку микроорганизма, например, бактерий или архей. Таким образом, способ позволяет культивирование клеток-хозяев для получения популяции вируса, где антибиотик не экспрессируется, что в ином случае может затруднять распространение популяции клетки-хозяина. Затем, один или несколько вирусов из выделенной популяции вируса можно использовать в противомикробной композиции для уменьшения роста или жизнеспособности клетки-хозяина, поскольку репрессию первой HM-crРНК можно удалять после выделения, таким образом, получая активную антибиотическую композицию вируса. Изобретение, таким образом, относится также к такому способу и к такой антибиотической композиции, содержащей вирус, способный экспрессировать антибиотик в клетке-хозяине. Модификацию для активации экспрессии можно осуществлять, например, посредством предоставления Cas (например, Cas9), конъюгированной с активатором транскрипции, где Cas представляет собой родственную Cas для первой HM-crРНК, и активатор активирует транскрипцию желательного экзогенного или эндогенного гена. Модификацию для ингибирования экспрессии можно осуществлять, например, посредством предоставления Cas смерти (например, dCas9), где Cas представляет собой родственную Cas для первой HM-crРНК и ингибирует транскрипцию желательного экзогенного или эндогенного гена.

Репрессия транскрипции или активности crРНК может являться частичной или полной (т.е., отсутствие активности или отсутствие транскрипции crРНК из массива в хозяине). Активность относится к способности crРНК гибридизоваться с родственной последовательностью хозяина для направления Cas на первый участок-мишень хозяина для модификации.

В одном примере, вирус не является таким образом репрессированным при введении в клетку, где способ включает в себя осуществление стадии (d) после того, как вирусом инфицировали клетку, например, с использованием химического, физического, механического, магнитного, светового или другого средства. В одном варианте осуществления, первый HM-массив содержит поддающийся репрессии промотор (HM-промотор) для транскрипции первой HMcrРНК, и промотор является репрессированным (например, посредством связывания репрессирующего средства, например, химического вещества или белка, с промотором) после введения первого HM-массива в клетку.

В другом примере, вирус является таким образом репрессированным перед осуществлением стадии (c), например, с использованием химического, физического, механического, магнитного, светового или другого средства для вызова репрессии. В одном варианте осуществления, первый HM-массив содержит поддающийся репрессии промотор (HM-промотор) для транскрипции первой HMcrРНК, и промотор является репрессированным (например, посредством связывания репрессирующего средства, например, химического вещества или белка, с промотором) перед введением первого HM-массива в клетку, где затем репрессированный первый HM-массив вводят в клетку.

В одном варианте осуществления, стадия (f) включает в себя выделение PV1. В одном варианте осуществления, стадия включает в себя отделение PV1 или вирус из нее от клеток-хозяев из PH1.

2. Способ из абзаца 1, дополнительно включающий в себя дерепрессию транскрипции первой HM-crРНК и/или активности первой HM-crРНК в популяции вируса после стадии (e) или (f), и необязательно, затем дополнительное культивирование клеток-хозяев.

3. Способ по любому из предшествующих абзацев, включающий в себя

A. получение популяции (PH2) клеток-хозяев, которые, необязательно, являются идентичными клетке-хозяину из (a), (f) или дополнительное культивирование клеток из абзаца 2;

B. инфекцию клеток-хозяев из A вирусом из популяции PV1;

C. репрессию транскрипции первой HM-crРНК и/или активности первой HM-crРНК в клетках;

D. культивирование инфицированных клеток-хозяев для получения популяции (PH3) клеток-хозяев, содержащей популяцию вируса (PV2); и

E. получение популяции вируса PV2 (или вируса из нее) и/или культивированной популяции клеток-хозяев.

4. Способ из абзаца 3, дополнительно включающий в себя дерепрессию транскрипции первой HM-crРНК и/или активности первой HM-crРНК в популяции вируса после стадии (D) или (E), и необязательно, затем дополнительное культивирование клеток-хозяев.

5. Способ по любому из предшествующих абзацев, включающий в себя тестирование выделенного образца из популяции вируса PV1 или PV2 в дополнительной клетке-хозяине или популяции (PH4) клеток-хозяев, необязательно, где дополнительная клетка или популяция PH4 является идентичной клетке из (a), где тестирование включает в себя инфекцию дополнительной клетки или популяции PH4 вирусом из указанного образца, выжидание периода времени, чтобы позволить происходить любому росту клетки-хозяина, и определение того, является ли предопределенная активность дополнительной клетки или популяции PH4 (например, рост или жизнеспособность клеток) модифицированной (например, уменьшенной, такой как уменьшенный рост или жизнеспособность клетки-хозяина*), или возникает ли, где вирус внутри клетки, или клетки, обладают дерепрессированной транскрипцией первой HM-crРНК и/или активности первой HM-crРНК в течение указанного периода времени.

* Это можно тестировать с использованием стандартного анализа образования бляшек, когда вирус из образца добавляют к клеткам или PH4, рассеянным на агаре).

6. Способ по любому из предшествующих абзацев 5, где все клетки-хозяева представляют собой клетки микроорганизмов (например, клетки бактерий или архей), и модификация первой последовательности-мишени уменьшает рост или жизнеспособность клетки-хозяина, и указанное определение определяет, что противомикробная активность** возникла.

**Это можно определять с использованием стандартного анализа бляшек.

7. Способ из абзаца 5 или 6, где период времени составляет по меньшей мере одну, 5, 10, 30, 60 или 120 минут.

8. Способ по любому из абзацев 5-7, где клетка из (a) и необязательно, клетки PH1, PH2 и/или PH3 не содержат первую последовательность-мишень, где дополнительная клетка или популяция клеток PH4 содержат первую последовательность-мишень.

9. Способ по любому из абзацев 1-8, где клетка из (a) и необязательно, клетки PH1, PH2 и/или PH3 не содержат ген, придающий устойчивость к первому антибиотику, где первая последовательность-мишень представляет собой последовательность-мишень из такого гена; необязательно где дополнительная клетка или популяция клеток PH4 содержат указанный ген.

10. Способ по любому из абзацев 1-7, где клетка из (a) и необязательно, клетки PH1, PH2 и/или PH3 содержат ген, придающий устойчивость к первому антибиотику, где первая последовательность-мишень представляет собой последовательность-мишень из такого гена.

11. Способ по любому из предшествующих абзацев, где все клетки-хозяева представляют собой клетки микроорганизмов (например, клетки бактерий или архей), и модификация первой последовательности-мишени уменьшает рост или жизнеспособность клетки-хозяина, или уменьшает устойчивость клетки-хозяина к антибиотику.

12. Способ по любому из предшествующих абзацев, где все клетки-хозяева являются патогенами инфекционного заболевания человека, животного (например, не относящегося к человеку животного) или растения.

13. Способ по любому из предшествующих абзацев, где все клетки-хозяева принадлежат к одному и тому же виду, например, выбранному из видов Escherichia (например, E coli O157:H7 или O104: H4), Shigella (например, dysenteriae), Salmonella (например, typhi или enterica, например, серотип typhimurium, например, DT 104), Erwinia, Yersinia (например, pestis), Bacillus, Vibrio, Legionella (например, pneumophilia), Pseudomonas (например, aeruginosa), Neisseria (например, gonnorrhoea или meningitidis), Bordetella (например, pertussus), Helicobacter (например, pylori), Listeria (например, monocytogenes), Agrobacterium, Staphylococcus (например, aureus, например, MRSA), Streptococcus (например, pyogenes или thermophilus), Enterococcus, Clostridium (например, dificile или botulinum), Corynebacterium (например, amycolatum), Mycobacterium (например, tuberculosis), Treponema, Borrelia (например, burgdorferi), Francisella, Brucella, Campylobacter (например, jejuni), Klebsiella (например, pneumoniae), Frankia, Bartonella, Rickettsia, Shewanella, Serratia, Enterobacter, Proteus, Providencia, Brochothrix, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Lactobacillus, Pediococcus, Leuconostoc, Vibrio (например, cholera, например, O139, или vulnificus), Haemophilus (например, influenzae), Brucella (например, abortus), Franciscella, Xanthomonas, Erlichia (например, chaffeensis), Chlamydia (например, pneumoniae), Parachlamydia, Enterococcus (например, faecalis или faceim, например, устойчивые к линезолиду), Oenococcus и Acinetoebacter (например, baumannii, например, с множественной лекарственной устойчивостью).

14. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Staphylococcus aureus, например, устойчивые к антибиотику, выбранному из метициллина, ванкомицина и тейкопланина.

15. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Pseudomonas aeuroginosa, например, устойчивые к антибиотику, выбранному из цефалоспоринов (например, цефтазидима), карбапенемов (например, имипенема или меропенема), фторхинолонов, аминогликозидов (например, гентамицина или тобрамицина) и колистина.

16. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Klebsiella (например, pneumoniae), например, устойчивые к карбапенему.

17. Способ по пункту 13, где все клетки-хозяева представляют собой Streptoccocus (например, pneumoniae или pyogenes) клетки, например, устойчивые к антибиотику, выбранному из эритромицина, клиндамицина, бета-лактама, макролида, амоксициллина, азитромицина и пенициллина.

18. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Salmonella (например, серотип Typhi), например, устойчивые к антибиотику, выбранному из цефтриаксона, азитромицина и ципрофлоксацина.

19. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Shigella, например, устойчивые к антибиотику, выбранному из ципрофлоксацина и азитромицина.

20. Способ по пункту 13, где все клетки-хозяева представляют собой клетки mycobacterium tuberculosis, например, устойчивые к антибиотику, выбранному из изониазида (INH), рифампицина (RMP), фторхинолона, амикацина, канамицина и капреомицина.

21. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Enterococcus, например, устойчивые к ванкомицину.

22. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Enterobacteriaceae, например, устойчивые к антибиотику, выбранному из цефалоспорина и карбапенема.

23. Способ по пункту 13, где все клетки-хозяева представляют собой клетки E. coli, например, устойчивые к антибиотику, выбранному из триметоприма, нитрофурантоина, цефалексина и амоксициллина.

24. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Clostridium (например, dificile), например, устойчивые к антибиотику, выбранному из антибиотиков фторхинолона и карбапенема.

25. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Neisseria gonnorrhoea, например, устойчивые к антибиотику, выбранному из цефиксима (например, перорального цефалоспорина), цефтриаксона (пригодного для инъекций цефалоспорина), азитромицина и тетрациклина.

26. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Acinetoebacter baumannii, например, устойчивые к антибиотику, выбранному из бета-лактама, меропенема и карбапенема.

27. Способ по пункту 13, где все клетки-хозяева представляют собой клетки Campylobacter, например, устойчивые к антибиотику, выбранному из ципрофлоксацина и азитромицина.

28. Способ по любому из предшествующих абзацев, где клетки-хозяева продуцируют бета (β)-лактамазу.

29. Способ по любому из предшествующих абзацев, где клетки-хозяева являются устойчивыми к антибиотику из перечисленных в любом из абзацев 14-27.

30. Способ из абзаца 29, где первая последовательность-мишень представляет собой последовательность из гена, кодирующего продукт, придающий клетке-хозяину устойчивость к указанному антибиотику.

31. Способ по любому из предшествующих абзацев, где первая последовательность-мишень представляет собой последовательность из гена устойчивости к антибиотику (т.е., для придания клетке-хозяину устойчивости к антибиотику например, устойчивости к метициллину) и/или одна, несколько или все из популяции PH1, популяции PH2, популяции PH3 и популяции PH4 являются устойчивыми к антибиотику или указанному антибиотику (например, к антибиотику из перечисленных в любом из абзацев 13-27).

32. Способ по любому из предшествующих абзацев, где дерепрессированный вирус из популяции вируса PV1 или PV2 обладает противомикробной активностью (например, антибактериальной активностью, например, когда вирус представляет собой фаг); необязательно, где клетка-хозяин или клетки-хозяева содержат первую последовательность-мишень, как перечислено в абзаце 30, где модификация первой мишени обеспечивает указанную противомикробный активность.

33. Способ по любому из предшествующих абзацев, зависимых от абзаца 5, где клетки из PH4 являются устойчивыми к антибиотику (например, к антибиотику из перечисленных в любом из абзацев 13-27) и клетки из (a) и PH2 не являются устойчивыми к указанному антибиотику. Это способствует изготовлению вируса для применения в лекарственном средстве, поскольку культивирование и размножение можно проводить относительно безопасно без риска вынужденной работы с устойчивыми к антибиотику клетками-хозяевами (и, например, риска их неадекватного удерживания и утечки с предприятия-изготовителя лекарственного средства). В то же время, тестирование против PH4 можно проводить в лаборатории с системой защиты или в другом отделе, оборудованном для применения устойчивых к антибиотику штаммов-хозяев. При тестировании против PH4, первая HM-crРНК является дерепрессированной, так что является возможной модификация гена устойчивости в клетках-хозяевах посредством HM-массива по изобретению.

34. Способ по любому из предшествующих абзацев, где система CRISPR/Cas хозяина представляет собой систему типа I, II или III, и последовательность-мишень представляет собой нуклеотидную последовательность, консервативную в указанном типе системы по меньшей мере в одном, двух или трех дополнительных штаммах-хозяевах или видах-хозяевах такого же рода, как клетка-хозяин (a).

35. Способ по любому из предшествующих абзацев, где вирус представляет собой фаг или фагмиду.

36. Способ из абзаца 35, где the вирус из (b) представляет собой вирус Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Myoviridae, Podoviridae, Siphoviridae или Tectiviridae.

37. Способ из абзаца 35 или 36, где вирус из (b) представляет собой природный фаг, например, фаг, индуцированный в клетке, которая относится к такому же штамму, как клетка из (a).

38. Способ из абзаца 35, 36 или 37, где фаг из (b) представляет собой мутантный фаг, полученный посредством селективного давления с использованием устойчивой к фагу бактерии.

39. Способ по любому из предшествующих абзацев, где в (b)

(iv) указанные один или несколько HM-массивов содержат HM-массив, кодирующий вторую HM-crРНК, содержащую HM-спейсер, который является способным гибридизоваться с второй последовательностью-мишенью хозяина для направления Cas на вторую мишень в клетке-хозяине для модификации последовательности-мишени, где вторая последовательность-мишень представляет собой нуклеотидную последовательность из системы CRISPR/Cas хозяина, в результате чего вторая HM-crРНК направляет Cas на вторую мишень для модификации системы CRISPR/Cas хозяина в клетке-хозяине, где модификация второй последовательности-мишени уменьшает или исключает функционирование системы CRISPR/Cas хозяина; и

(v) где HM-массив из (iv) является активным в клетке из (a) для транскрипции второй HM-crРНК, способной гибридизоваться с второй последовательностью-мишенью хозяина.

В одном варианте осуществления, HM-массив из (ii) и (iv) представляют собой один и тот же HM-массив. В другом варианте осуществления, они представляют собой различные HM-массивы (например, массивы из различных типов CRISPR/Cas, например, типов I и II, или типов II и III, или типов I и III, или различные массивы типа II).

40. Способ из абзаца 39, где клетки из любой или всех из PH1-4 содержат указанную вторую последовательность-мишень.

41. Способ из абзаца 39 или 40, где вторая последовательность-мишень является идентичной последовательности системы CRISPR/Cas из рода или вида клеток, как перечислено в любом из абзацев 11-24 (например, S thermophilus или S pyogenes, или S aureus).

42. Способ по любому из абзацев 39-41, где вторая последовательность-мишень содержится в последовательности, выбранной из группы, состоящей из SEQ ID NO: 1-44, или комплементарной ей последовательности.

43. Способ по любому из абзацев 39-42, где вторая последовательность-мишень содержит

A. последовательность повтора ДНК или РНК (например, где повтор представляет собой наиболее близкий к 5'-концу повтор (первый повтор) в указанном массиве CRISPR хозяина;

B. последовательность tracrРНК или последовательность ДНК, кодирующую tracrРНК; лидерную последовательность массива CRISPR;

C. промотор гена Cas (например, промотор Cas1, Cas2 или Csn2);

D. последовательность лидерного промотора массива CRISPR; или

E. последовательность ДНК или РНК, кодирующую Cas (например, где Cas представляет собой Cas9, Cas1, Cas2 или Csn2).

44. Способ по любому из абзацев 39-43, где вторая последовательность-мишень содержит

F. последовательность лидера или лидерного промотора массива CRISPR, смежную с наиболее близким к 5'-концу нуклеотидом из первого повтора (и необязательно, содержащую указанный наиболее близкий к 5'-концу нуклеотид из повтора);

G. последовательность из вплоть до 20 смежных нуклеотидов непосредственно на 5'-конце первого повтора;

H. последовательность из вплоть до 20 смежных нуклеотидов из наиболее близких к 5'-концу нуклеотидов из первого повтора; или

I. последовательность из вплоть до 20 смежных нуклеотидов непосредственно на 3'-конце повтора первого спейсера (и необязательно где последовательность содержит наиболее близкий к 3'-концу нуклеотид из первого спейсера).

45. Способ по любому из абзацев 39-44, где

J. вторая HM-crРНК содержит структуру или состоит из структуры R-S-R, где R=повтор CRISPR и S=спейсер CRISPR, где S содержит, (в направлении от 5' к 3') V-HR или HR-V, где V=последовательность, по меньшей мере на 95, 96, 97, 98 или 99% идентичная последовательности ДНК вируса из (b) и HR=последовательность ДНК повтора CRISPR из указанной системы CRISPR/Cas клетки-хозяина;

K. где последовательность HR является непосредственно смежной с последовательностью V в системе CRISPR/Cas хозяина; и

L. где вторая HM-crРНК является способной гибридизоваться со спейсером из системы CRISPR/Cas хозяина для направления Cas на спейсер для модификации (например, разрезания или инактивации) системы CRISPR/Cas хозяина в клетке.

46. Способ из абзаца 45, где V=один или вплоть до 40 (например, вплоть до 15) смежных нуклеотидов из ДНК вируса.

47. Способ по любому из абзацев 39-46, где вторая HM-crРНК по существу не гибридизуется с нуклеиновой кислотой вируса из (b).

48. Способ по любому из абзацев 45-47, где

a. система CRISPR/Cas хозяина является способной узнавать родственный PAM;

b. где нуклеиновая кислота вируса из (b) содержит такой PAM непосредственно на 3' от последовательности протоспейсера;

c. где V=один или вплоть до 40 (например, вплоть до 15) нуклеотидов протоспейсера; и

d. где HR=последовательность, идентичная смежной последовательности из повтора из системы CRISPR/Cas хозяина.

49. Способ из абзаца 48, где указанная непрерывная последовательность из повтора из системы хозяина представляет собой последовательность из по меньшей мере 50% повтора хозяина (например, включая наиболее близкий к 5'-концу или наиболее близкий к 3'-концу нуклеотид из повтора хозяина).

50. Способ из абзаца 45 или 46, где V=от 1 до 40 (например, вплоть до 15) из наиболее близких к 3'-концу протоспейсера смежных нуклеотидов; и необязательно, указанная непрерывная последовательность из повтора включает наиболее близкий к 5'-концу нуклеотид из повтора хозяина.

51. Способ из абзаца 48 или 49, где V=от 1 до 40 (например, вплоть до 15) из наиболее близких к 5'-концу протоспейсера смежных нуклеотидов; и необязательно, указанная непрерывная последовательность из повтора включает наиболее близкий к 3'-концу нуклеотид из повтора хозяина.

52. Способ по любому из абзацев 45-51, где R=повтор, узнаваемый системой CRISPR/Cas хозяина.

53. Способ по любому из предшествующих абзацев, где эта или каждая HM-CRISPR содержит (в направлении от 5' к 3') последовательность первого повтора, первую спейсерную последовательность и последовательность второго повтора, где спейсерная последовательность содержит последовательность, которая способна гибридизоваться с соответствующей последовательностью-мишенью в клетке-хозяине, где массив дополнительно содержит промотор для транскрипции повторов и спейсера в клетке-хозяине, и необязательно, нуклеиновая кислота вируса из (b) содержит последовательность, кодирующую нуклеазу Cas, и/или последовательность, кодирующую tracrРНК для кодирования функциональной последовательности Cas и/или tracrРНК в клетке-хозяине, где последовательность tracrРНК содержит последовательность, комплементарную первому или второму повтору.

54. Способ по любому из предшествующих абзацев, где этот или каждый HM-массив CRISPR содержит (в направлении от 5' к 3') последовательность первого повтора, первую спейсерную последовательность и последовательность второго повтора, где спейсерная последовательность содержит последовательность, которая способна гибридизоваться с соответствующей последовательностью-мишенью в клетке-хозяине, где массив дополнительно содержит промотор для транскрипции повторов и спейсера в клетке-хозяине, и где вектор не содержит последовательность, кодирующую нуклеазу Cas, и/или последовательность, кодирующую tracrРНК, для кодирования последовательности tracrРНК в клетке-хозяине, где последовательность tracrРНК содержит последовательность комплементарную первому или второму повтору, где HM-массив CRISPR является функциональным в клетке-хозяине для направления Cas (например, эндогенной нуклеазы Cas хозяина) на соответствующий участок-мишень хозяина, необязательно, с использованием tracrРНК хозяина.

55. Способ из абзаца 53 или 54, где повторы являются идентичными повторам в системе CRISPR/Cas хозяина, где этот или каждый HM-массив CRISPR не содержит PAM, узнаваемый Cas (например, нуклеазой Cas, например, Cas9) из системы CRISPR/Cas хозяина.

56. Способ по любому из предшествующих абзацев, где этот или каждый HM-массив CRISPR содержит более одной копии HM-спейсера (например, по меньшей мере 2, 3 или 4 копии).

57. Способ по любому из предшествующих абзацев с кодированием второй или третьей HM-crРНК (дополнительной HM-crРНК), где дополнительная HM-crРНК содержит нуклеотидную последовательность, которая способна гибридизоваться с последовательностью-мишенью хозяина для направления Cas на мишень в клетке-хозяине; необязательно где последовательность-мишень представляет собой нуклеотидную последовательность жизненно важного гена, гена вирулентности или гена устойчивости клетки-хозяина, или жизненно важного компонента системы CRISPR/Cas клетки-хозяина.

58. Способ по любому из предшествующих абзацев, где этот или каждый HM-массив CRISPR содержит последовательности повторов CRISPR, которые являются идентичными эндогенным последовательностям повторов CRISPR клетки-хозяина для продукции соответствующей HM-crРНК в клетке-хозяине.

59. Способ по любому из предшествующих абзацев, где вирус из (b) содержит нуклеотидную последовательность, кодирующую Cas (Cas не из хозяина), которая является функциональной в клетке-хозяине из (a) (например, где Cas не из хозяина представляет собой систему Cas типа I, где система хозяина принадлежит к типу II или III; систему Cas типа II, где система хозяина принадлежит к типу I или III; или систему Cas типа III, где система хозяина принадлежит к типу I или II), необязательно, где клетка-хозяин не содержит или не экспрессирует Cas типа, который является таким же, как тип Cas не из хозяина.

60. Способ по любому из предшествующих абзацев, где вирус из (b) содержит нуклеотидную последовательность, кодирующую последовательность tracrРНК, необязательно, где последовательность tracrРНК и первая HM-crРНК содержатся в одиночной направляющей РНК (gРНК)).

61. Способ по любому из предшествующих абзацев, где эта или каждая HM-crРНК содержится в соответствующей одиночной направляющей РНК (gРНК).

62. Способ по любому из предшествующих абзацев, где первый HM-массив является способным функционировать, чтобы вызывать разрезание Cas в первой последовательности-мишени, активацию первой последовательности-мишени (или гена, содержащего первую последовательность-мишень), нокдаун первой последовательности-мишени (или гена, содержащего первую последовательность-мишень) или мутацию первой последовательности-мишени.

63. Вирус, клетка-хозяин или популяция вируса, которые можно получать способом по любому из предшествующих абзацев, необязательно, где популяция является идентичной PV1 или PV2, или вирус можно получать из такой популяции.

64. Популяция клеток-хозяев (например, бактериальных клеток), которую можно получать способом по любому из предшествующих абзацев, необязательно, где популяция является идентичной PH1, PH2, PH3 или PH4, или культивированной популяции клеток из перечисленных в любом из предшествующих абзацев.

65. Популяция клеток-хозяев из абзаца 64 где популяция не содержит нуклеиновую кислоту вируса из (b), или не содержит указанный первый HM-массив или указанный второй HM-массив (например, как определено посредством ПЦР).

66. Вирус, клетка-хозяин или популяция по любому из абзацев 63-65, для медицинского или стоматологического или офтальмологического применения (например, для лечения или предотвращения инфекции в организме или ограничения распространения инфекции в организме.

67. Композиция, содержащая вирус, клетку-хозяина или популяцию по любому из абзацев 63-66 для применения в пищевом продукте, напитке, молочном продукте или косметическом продукте (например, для применения в косметическом продукте, например, для макияжа), или для гигиенического применения (например, для применения в гигиеническом продукте, например, мыле).

68. Применение композиции вируса, клетки-хозяина или популяции по любому из абзацев 63-67, в медицине или для терапевтического или профилактического применения в стоматологии.

69. Применение композиции вируса, клетки-хозяина или популяции по любому из абзацев 63-68, для косметического применения (например, для применения в косметическом продукте, например, для макияжа), или для гигиенического применения (например, для применения в гигиеническом продукте, например, в мыле).

70. Применение, вирус, клетка-хозяин или популяция по любому из абзацев 63-69 для модификации клетки-хозяина микроорганизма (например, для уничтожения или уменьшения роста клетки или культуры клеток микроорганизмов).

71. Способ, вирус или популяция вируса по любому из абзацев 1-63 и 66-70, где вирус или вирус в указанной популяции экспрессирует холин и/или эндолизин для лизиса клетки-хозяина, необязательно где эндолизин представляет собой эндолизин фага phi11, фага Twort, фага P68, фага phiWMY или фага K (например, эндолизин MV-L или эндолизин P-27/HP).

72. Способ, вирус или популяция вируса по любому из абзацев 1-63 и 66-70, где вирус или вирус в указанной популяции не экспрессирует холин и/или эндолизин для лизиса клетки-хозяина.

73. Способ, вирус или популяция вируса по любому из абзацев 1-63 и 66-70, где вирус (например, вирус из (b)) или вирус в каждой указанной популяции присутствует в комбинации с противомикробным средством, функциональным в клетке-хозяине из (a), например, антибиотическим средством, например, бета-лактамным антибиотиком (например, антибиотиком из перечисленных в любом из абзацев 13-27).

КОНТРОЛЬ Коррозии, БиопленОк И БиообрастаниЯ

Изобретение относится, среди прочего, к способам контроля коррозии под воздействием микроорганизмов (MIC) или биообрастания субстрата или жидкости в промышленной или бытовой системе. Изобретение также относится к обработанным жидкостям и векторам для применения в способах.

Коррозия является результатом серии химических, физических и (микро)биологических процессов, приводящих к порче материалов, таких как металл (например, сталь или железо), пластик и камень. Это представляет собой общемировую проблему с большими социальными и экономическими последствиями. Современные способы контроля коррозии, основанные на химически полученных продуктах, находятся под увеличивающимся давлением строгих нормативов относительно окружающей среды. Более того, они являются довольно неэффективными и могут быть затруднены устойчивостью микроорганизмов (например, бактерий) к используемым средствам. Таким образом, существует срочная необходимость в подходящих для окружающей среды и надежных способах контроля коррозии. На коррозию влияют комплексные процессы в различных микроорганизмах, осуществляющих различные электрохимические реакции и секретирующих белки и метаболиты, которые могут оказывать вторичные эффекты.

Серьезность процессов коррозии под воздействием микроорганизмов очевидна из того факта, что множество используемых в промышленности и быту металлов и сплавов, таких как нержавеющая сталь, сплавы на основе никеля и алюминия, и такие материалы, как бетон, асфальт и полимеры, легко поддаются деградации под воздействием микроорганизмов. Защитные покрытия, ингибиторы, масла и эмульсии также подвергаются деградации под воздействием микроорганизмов.

Коррозия под воздействием микроорганизмов (MIC) является дорогостоящей проблемой, затрагивающей оборудование для получения и переработки углеводородов, водораспределительные системы, суда, железнодорожные вагоны и другие типы металлических и неметаллических промышленных и бытовых систем. В частности, известно, что MIC вызывает значительное повреждение инфраструктуры для углеводородного топлива, включая системы для получения, транспортировки и хранения, что часто приводит к катастрофическому загрязнению окружающей среды. Около 40% коррозии труб в нефтедобывающей промышленности приписывают микробиологической коррозии, и это приводит к огромным финансовым потерям при получении, транспортировке и хранении нефти каждый год. Биопленки в трубах могут вызывать уменьшение скорости жидкости в оборудовании из-за процесса инкрустации на стенках. Более того, возникают протечки труб в результате коррозии, с последующим воздействием на окружающую среду и производительность.

MIC имеет место в окружающей среде, такой как почва, пресная вода и морская вода, и оценивают, что она ответственна за более, чем 30 процентов от всего повреждения из-за коррозии. MIC происходит из-за прикрепления микроорганизмов, таких как бактерии, высвобождения метаболитов и, как правило, формирования биопленок, индуцирующих или ускоряющих процесс коррозии. Среди групп бактерий, вовлеченных в процесс коррозии, включены: серо- или сульфатвосстанавливающие бактерии (SRB), продуцирующие внеклеточные полимерные вещества бактерии (EPSB), кислотообразующие бактерии (APB), серо- или сульфидокисляющие бактерии (SOB); железо- или марганецокисляющие бактерии (IOB), продуцирующие аммиак бактерии (AmPB) и продуцирующие ацетат бактерии (AcPB). Обзоры пиросеквенирования гена малой субъединицы рибосомальной РНК показывают, что образующие уксусную кислоту бактерии (виды Acetobacter и виды Gluconacetobacter) преобладают в окружающей среде, подвергнутой воздействию этанола топливной квалификации и воды.

Рост микроорганизмов в условиях окружающей среды влияет на электрохимические реакции напрямую или опосредованно. Взаимодействия микроорганизма-субстрата приводят к первоначальной адгезии и формированию биопленки. Присоединение микроорганизмов, таких как бактерии, к субстрату, высвобождение метаболитов и формирование биопленок влияет на электрохимические условия на поверхностях субстратов, индуцирующие или ускоряющие процесс коррозии, таким образом, опосредующие процесс MIC. Формирование бактериальной биопленки на металлический субстрат включает в себя следующие стадии: I - формирование пленки, посредством адсорбции органических и неорганических молекул на металле, которая опосредует распределение заряда на металлических поверхностях, а также служит источником питательных веществ для бактерий, облегчающим адгезию свободно плавающих микроорганизмов, присутствующих в жидкости; II - адгезия и размножение аэробных бактерий, формирующих микроколонии; III - продукция внеклеточных полимерных веществ (EPS) некоторыми прикрепленными бактериями; IV - колонизация аэробными свободно плавающими клетками микроорганизмов, которые могут потреблять кислород посредством дыхания, создавая локальное анаэробное окружение в биопленки, как необходимо для строго анаэробных бактерий и ; V - увеличение толщины биопленки, которое может способствовать осыпанию внешних слоев. EPS, продуцируемые бактериями, проявившими адгезию к биопленке, связывают жизненно важные ионы для их роста; их используют в качестве средств для присоединения и защиты бактерий против биоцидов, препятствующих механизмам коррозии, способствуя образованию областей дифференциальной аэрации, помимо этого, служащих источником питательных веществ в случае низкой доступности питательных веществ. Процесс коррозии посредством дифференциальной аэрации происходит из-за неравномерного распределения биопленки на металлическом субстрате с областями аэрации (окружающими биопленку) и областями без аэрации (под биопленкой). Формирование биопленки на металлических поверхностях уменьшает содержание кислорода, достигая уровней почти полного анаэробиоза. Pseudomonas является основным родом-продуцентом EPS.

Пример процесса биокоррозии MIC, опосредованного корродирующими бактериями, является следующим: (A) аэробные корродирующие бактерии из пресной воды, морской воды, промышленных/бытовых систем или резервуаров для хранения достигают оборудования и трубопроводов из промышленных или бытовых систем, обладающих кондиционируемой пленкой на поверхности. (B) продуцирующие EPS бактерии прикрепляются к стенкам оборудования/трубопровода и продуцируют EPS, которые создают благоприятную окружающую среду для адгезии других микроорганизмов. (C) Имеет место адгезия других групп корродирующих бактерий к стенкам трубопровода, которые высвобождают свои метаболиты, развиваясь до микроколонии посредством деления клеток, потребляя доступный кислород. Действие железоокисляющих бактерий приводит к большому накоплению осадков соединений железа, приводящих к блокированию оборудования/трубопровода; серная кислота, высвобождаемая сероокисляющими бактериями способствует закислению окружающей среды. (D) Низкая концентрация кислорода и органические кислоты, высвобождаемые кислотообразующими бактериями, благоприятствуют прикреплению и развитию сульфатвосстанавливающих бактерий, продуцирующих сульфид водорода (H2S), таким образом, ускоряя процесс коррозии и снижение локального pH. (E) Это приводит в результате к корродированному оборудованию/трубопроводу, частично блокированнному осадками железа, с микропротечками и содержащему бактериальную биопленку. H2S обладает серьезным риском для здоровья персонала, управляющего пораженной системой. Кроме того, образование толстых биопленок и шламов приводит к биообрастанию и затруднению функционирования системы.

Подобным образом, популяции бактерий могут размножаться в жидкостях, таких как запасы или резервуары воды (например, в питьевой воде или в воде из систем охлаждения), таким образом, опосредуя биообрастание жидкости. Это можно также обозначать как закисление жидкости. Пример представляет собой закисление водных путей или резервуара питьевой воды.

Изобретение нацелено на такие проблемы MIC и биообрастание посредством представления следующих аспектов 1 и далее:-

1. Способ контроля коррозии под воздействием микроорганизмов (MIC) или биообрастание субстрата в промышленной или бытовой системе, где поверхность субстрата находится в контакте с популяцией первых клеток-хозяев из первого вида микроорганизмов, опосредующего MIC или биообрастание субстрата, где способ включает в себя

(i) приведение популяции в контакт со множеством векторов, способных трансформировать или трансдуцировать клетки, где каждый вектор содержит массив CRISPR в результате чего массивы CRISPR вводят в клетки-хозяева, где

(a) каждый массив CRISPR содержит одну или несколько нуклеотидных последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине; и

(b) каждая crРНК является способной гибридизоваться с последовательностью-мишенью из клетки-хозяина для направления Cas (например, нуклеазы Cas, например, Cas9 или Cpf1) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); последовательность-мишень представляет собой последовательность гена для обеспечения жизнеспособности клетки-хозяина; и

(ii) обеспечение экспрессии указанных cРНК в присутствии of Cas в клетках-хозяевах, таким образом, модификации последовательностей-мишеней в клетках-хозяевах, приводящей к уменьшению жизнеспособности клетки-хозяина и контролю MIC или биообрастания указанного субстрата.

В одном примере, система содержит оборудование (например, для применение в промышленном процессе), и поверхность представляет собой поверхность указанного оборудования. В одном примере, каждый массив представляет собой сконструированный массив, например, любой сконструированный массив, описанный в настоящем документе. В одном варианте осуществления, вектор представляет собой сконструированный вектор на основе нуклеиновой кислоты с CRISPR, как описано в настоящем документе. В одном примере, биообрастание включает в себя формирование биопленки и/или шлама из микроорганизмов, пролиферацию или поддержание микроорганизмов. В одном примере, первые клетки-хозяева являются прикрепленными. В одном примере из аспекта 1 или 4 (ниже), «контроль» включает в себя предотвращение, уменьшение или исключение указанных MIC или биообрастания, или уменьшение распространения указанных MIC или биообрастания в системе. Неограничивающие примеры того, как бактерии опосредуют MIC или биообрастание, описаны выше. Рост или пролиферация, или поддержание клеток представляет собой, например, характеристику жизнеспособности клеток. Таким образом, в одном примере, способом уменьшают пролиферацию и/или поддержание клетки-хозяина. В одном примере, способом уничтожают клетки-хозяева.

2. Способ из аспекта 1, где указанные клетки-хозяева содержатся в биопленке из микроорганизмов, которая находится в контакте с указанным субстратом.

3. Способ из любого предшествующего аспекта, где указанные поверхности и клетки-хозяева находятся в контакте с жидкостью, такой как водосодержащая жидкость (например, морская вода, пресная вода, запасенная вода или питьевая вода). Пресная вода представляет собой природную воду на поверхности земли в ледниковых покровах, ледниковых шапках, ледниках, айсбергах, болотах, прудах, озерах, реках и ручьях, и под землей в форме грунтовых вод в водоносных пластах и подземных потоках. Пресная вода, как правило, характеризуется наличием низких концентраций растворенных солей и всех других растворенных твердых веществ. Термин конкретно исключает морскую воду и солончаковую воду, хотя он включает в себя богатые минералами воды, такие как железистые источники. В одном примере указанная пресная вода принадлежит к любому из этих типов пресной воды. Питьевая вода представляет собой воду для потребления человеком или животным (например, скотом). В одном примере, жидкость выбрана из промышленной охлаждающей воды, где система представляет собой систему охлаждения; сточных вод, где система представляет собой систему для обработки или хранения сточных вод; питьевой воды, где система представляет собой систему для переработки, хранения, транспортировки или доставки питьевой воды; воды для бумажного производства, где система представляет собой систему для изготовления или переработки бумаги; воды для плавательного бассейна, где система представляет собой плавательный бассейн или систему для обработки или хранения воды для плавательного бассейна; воды для противопожарного устройства, где система представляет собой противопожарную систему; или воды для промышленного процесса в любой трубе, баке, колодце, пруду или канале.

4. Способ контроля биообрастания микроорганизмами жидкости в промышленной или бытовой системе (например, для контроля бактериального закисления жидкости в резервуаре или контейнере), где жидкость содержит популяцию первых клеток-хозяев из первого вида микроорганизмов, опосредующего указанное биообрастание, где способ включает в себя (i) приведение популяции в контакт со множеством векторов, способных трансформировать или трансдуцировать клетки, где каждый вектор содержит a массив CRISPR, в результате чего массивы CRISPR вводят в клетки-хозяева, где

(a) каждый массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и a промотор для транскрипции последовательности(последовательностей) в клетке-хозяине; и

(b) каждая crРНК является способной гибридизоваться с последовательностью-мишенью из клетки-хозяина для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); где последовательность-мишень представляет собой последовательность гена для обеспечения жизнеспособности клетки-хозяина; и где способ включает в себя обеспечение экспрессии указанных cРНК в присутствии Cas в клетках-хозяевах, таким образом, модификации последовательностей-мишеней в клетках-хозяевах, приводящей к уменьшению жизнеспособности клетки-хозяина и контролю указанного биообрастания.

В одном примере, жидкость представляет собой текучую среду. В одном примере, жидкость представляет собой газообразную среду.

Системы: пример системы по любому аспекту выбран из группы, состоящей из:-

Системы для получения, переработки, хранения или транспортировки нефтехимических продуктов; системы для получения, переработки, хранения или транспортировки углеводородов; системы для получения, переработки, хранения или транспортировки нефти; системы для получения, переработки, хранения или транспортировки природного газа (например, нефтяной скважины, нефтевышки, оборудования для бурения нефти, системы для перекачивания нефти, нефтепровода, газодобывающей установки, оборудования для добычи газа, оборудования для перекачивания газа, газопровода, нефтяного танкера, газового танкера, оборудования для хранения нефти или оборудования для хранения газа); оборудования для переработки или хранения воды; резервуара для воды (например, резервуара для питьевой воды); оборудования для кондиционирования (например, охлаждения или нагревания) воздуха или воды, например, трубы для подачи холодоносителя, конденсатора или теплообменника; медицинского или хирургического оборудования; оборудования для обработки окружающей среды (например, почвы, водных путей или воздуха); оборудование для изготовления или переработки бумаги; электростанции, например, тепловой или атомной электростанции; оборудования для хранения топлива (например, углеводородного топлива, например, нефтяного, дизельного или LPG); горнодобывающей или металлургической системы, системы получения полезных ископаемых или регенерации топлива, например, шахты или горно-шахтного оборудования; инженерной системы; оборудования для перевозки; грузового оборудования или складского оборудования для товаров (например, грузового контейнера); оборудования для изготовления, или упаковки пищевых продуктов или напитков; оборудования для очистки (например, оборудования для прачечных, например, стиральной машины или посудомоечной машины); оборудования для ресторанного обслуживания (например, бытового или коммерческого ресторанного обслуживания); сельскохозяйственного оборудования; строительного оборудования (например, для конструирования зданий, вспомогательной инфраструктуры или дорог); авиационного оборудования; авиакосмического оборудования; транспортного оборудования (например, автотранспортного средства (например, автомобиля, грузовика или фургона); железнодорожного вагона; воздушного судна (например, самолета) или морского или водного транспорта (например, лодки или судна, подводной лодки или судна на воздушной подушке)); упаковочного оборудования, например, упаковочного оборудования для потребительских товаров; или упаковочного оборудования для пищевых продуктов или напитков; электронных устройств (например, компьютера или мобильного телефона, или их электронных компонентов); или оборудования для изготовления или упаковки электронных устройств; стоматологического оборудования; промышленных или бытовых трубопроводов (например, подводного трубопровода) или сосуда для хранения (например, бака для воды или бака для топлива (например, бензобака, например, бензобака транспортного средства)); подземного оборудования; здания (например, жилого помещения или офисного или торгового помещения, или завода или электростанции); дороги; моста; сельскохозяйственного оборудования; фабричной системы; оборудования для разведки сырой нефти или природного газа; офисной системы; и хозяйственно-бытовой системы.

В одном примере, систему используют в промышленности или бизнесе, выбранных из группы, состоящей из сельского хозяйства, производства нефти или нефтепродуктов, производства пищевых продуктов или напитков, швейной промышленности, упаковочной промышленности, электронной промышленности, компьютерной промышленности, экологической промышленности, химической промышленности, аэрокосмической промышленности, автомобильной промышленности, биотехнологической промышленности, медицинской промышленности, индустрии здравоохранения, стоматологической промышленности, энергетической промышленности, производства потребительских товаров, фармацевтической промышленности, горнодобывающей промышленности, индустрии очистки, лесной промышленности, рыбодобывающей промышленности, индустрии досуга, перерабатывающей промышленности, косметической промышленности, производства пластмасс, производства пульпы или бумаги, текстильной промышленности, швейной промышленности, производства кожи или замши или шкур животных, табачной промышленности и сталелитейной промышленности. В одном примере, поверхности или жидкости, подлежащие обработке, представляют собой поверхности или жидкости из оборудования, используемого в указанной выбранной промышленности. В одном примере, систему используют в производстве сырой нефти. В одном примере, систему используют в производстве природного газа. В одном примере, систему используют в производстве нефтепродуктов. В одном примере, система представляет собой морской контейнер, платформу или установку (например, нефтяную или газовую платформу или установку для применения в открытом море или в открытом море), на судне или в лодке. В одном варианте осуществления, такая система стоит на якоре в открытом море; например, постоянно стоит на якоре в открытом море, например, стоит на якоре в открытом море в течение 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или более месяцев (например, последовательных месяцев). В одном варианте осуществления, такая система находится в водах страны или штата; например, постоянно находится в открытом море в таких водах, например, находится в водах указанной страны в течение 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или более месяцев (например, последовательных месяцев).

В одном примере, поверхность субстрата, подлежащая обработке, включает в себя нержавеющую сталь, углеродистая сталь, медь, никель, латунь, алюминий, бетон, пластик или дерево. В одном примере, субстрат представляет собой наплавленный или наварной металл. В одном примере, поверхность представляет собой металлическую (например, сталь или железо) или неметаллическую (например, пластик, бетон, асфальт, дерево, резина или камень) поверхность. В одном примере, металл представляет собой сплав (например, нержавеющую сталь, латунь или никелевый, цинковый, медный, никелевый или алюминиевый сплав). В одном примере, поверхность представляет собой a рукотворную полимерную поверхность. В одном примере, поверхность представляет собой покрытие субстрата. В одном примере, субстрат находится в контакте с почвой, пресной водой или морской водой. В одном примере, жидкость представляет собой питьевую воду; водные пути; солончаковую воду; или жидкое топливо, например, бензин или дизельное топливо (например, для автомобиля или моторного средства передвижения), LPG, керосин, спирт (например, этанол, метанол или бутанол), жидкий водород или жидкий аммиак), в одном примере, топливо представляет собой находящееся на хранении жидкое топливо. В одном примере жидкость представляет собой масляную или неводосодержащую жидкость. В одном примере, жидкость представляет собой жидкость, содержащуюся в водных путях или водоеме, например, в морской воде, в пресной воде, в питьевой воде, в реке, в ручье, в пруду, в озере, в резервуаре, в запасенной воде (например, в резервуаре для воды или в оборудовании для охлаждения), в грунтовых водах, в воде в скважине, в воде в горных породах, в воде в почве или в дождевой воде. В одном примере, жидкость представляет собой морскую воду. В одном примере, субстрат находится в контакте с жидкостью, упомянутой в этом абзаце. В одном примере, жидкость или текучая среда выбрана из группы, состоящей из масла, водного раствора, жидкости для гидроразрыва, топлива, диоксида углерода, природного газа, смеси масла/воды, смеси топлива/воды, содержащей соли воды, океанической или морской воды, солончаковой воды, источников пресной воды, озер, рек, ручьев, болот, прудов, затопляемых почв, стоков после таяния снега или льда, родники, грунтовых вод, водоносных пластов, осадка, любого вещества, которое является жидким при температуре окружающей среды (например, при rtp), и является гидрофобным, но растворимым в органических растворителях, гексанах, бензоле, толуоле, хлороформе, диэтиловом эфире, растительных маслах, нефтехимических маслах, нефти, очищенных нефтехимических продуктах, летучих эфирных маслах, ископаемом топливе, бензине, смеси углеводородов, реактивном топливе, ракетном топливе, биотопливе. В одном примере жидкость представляет собой смесь масла/воды.

Термины «коррозия под воздействием микроорганизмов» или «MIC», как применяют в настоящем документе, если не указано иначе, относятся к процессам, в которых любой элемент (субстрат) системы структурно повреждается из-за действия по меньшей мере одного члена популяции микроорганизмов, например, популяции бактерий или архей. Термин «биообрастание», как применяют в настоящем документе, если не указано иначе, относится к процессам, в которых микроорганизмы (такие как бактерии и/или археи) накапливаются на поверхности субстрата в контакте с жидкостью (например, водой или водосодержащей жидкостью или углеводородом или нефтехимическим продуктом). Включено также нежелательное накопление и пролиферация микроорганизмов (таких как бактерии и/или археи) в жидкости (например, в воде или водосодержащей жидкости, или углеводороде, или нефтехимическом продукте), т.е., «закисление» жидкости. В одном примере, бактерии содержатся в балластной воде судна или лодки, и бактерии являются нежелательными для окружающей среды. Термин «субстрат», как применяют в настоящем документе, относится к любому типу поверхности, на которой клетки могут прикрепляться, и биопленка может формироваться и расти, или на которой может возникать биообрастание (например, формирование ила или шлама). Субстрат может представлять собой «промышленный» субстрат, такой как поверхность оборудования в нефтехимической, топливной системе, системе нефтепровода или газопровода, или «не промышленный» (например, бытовой, например, в домашнем хозяйстве или в офисе) субстрат, такой как субстрат на кухонной стойке или в душе, или садовый субстрат.

Альтернативно, в любом из аспектов, вместо популяции бактериальных клеток-хозяев, популяция представляет собой популяцию клетки архей из первого вида.

5. Способ из аспекта 4, где указанная жидкость представляет собой водосодержащую жидкость (например, морскую воду, пресную воду, запасенную воду или питьевую воду).

6. Способ по любому из аспектов 3-5, где способ включает в себя смешивание жидкости с векторами, таким образом, приведение клеток-хозяев в контакт с векторами. Например, векторы можно предварительно смешивать с жидкостью (необязательно, также с антибиотиком или биоцидом), и затем смесь добавлять в жидкость, которая находится в контакте с поверхностью (аспект 1) или в жидкость из аспекта 4.

7. Способ по любому из аспектов 1-6, где каждая последовательность-мишень представляет собой последовательность гена вирулентности, гена устойчивости или жизненно важного гена клетки-хозяина, например, его экзон или регуляторную последовательность. Устойчивость может представлять собой устойчивость к антибиотику. В одном примере, клетки-хозяева приводят в контакт с указанным антибиотиком и указанными векторами для уменьшения жизнеспособности клетки-хозяина.

8. Способ по любому из аспектов 1-7, где модификация последовательности-мишени приводит к уничтожению клетки-хозяина и/или к уменьшению роста или пролиферации клетки-хозяина. Пролиферация представляет собой, например, размножение клеток или распространение клеток в контакте с поверхностью.

9. Способ по любому из аспектов 1-8, где векторы содержат идентичные массивы CRISPR.

10. Способ по любому из аспектов 1-9, где клетки-хозяева представляют собой клетки бактерий или архей. Альтернативно, вместо этого, первые клетки представляют собой клетки водорослей.

11. Способ по любому из аспектов 1-10, где первые клетки-хозяева представляют собой клетки сульфатвосстанавливающих бактерий (SRB) (например, клетки Desulfovibrio или Desulfotomaculum). В одном примере, клетки выбраны из группы, состоящей из клеток Desulfotomaculum nigrificans, Desulfacinum infernum, Thermodesulfobacterium mobile, Thermodesulforhabdus norvegicus, Archaeoglobus fulgidus, Desulfomicrobium apsheronum, Desulfovibrio gabonensis, Desulfovibrio longus, Desulfovibrio vietnamensis, Desulfobacterium cetonicum, Desulphomaculum halophilum, Desulfobacter vibrioformis и Desulfotomaculum thermocisternum. В одном примере, популяция содержит смесь из двух или более из этих видов клеток.

12. Способ из аспекта 11, где поверхность или жидкость содержится в оборудовании для получения, переработки, хранения или транспортировки сырой нефти, газа или нефтехимических продуктов. Сырая нефть является одним из наиболее важных энергетических ресурсов в мире. Ее используют в качестве сырьевого материала во многих видах промышленности, включая нефтеперерабатывающую-нефтехимическую промышленность, где нефть перерабатывают посредством различных технологических процессов в потребительские товары, такие как бензин, масла, парафиновое масло, смазывающие средства, асфальт, бытовое жидкое топливо, вазелин и полимеры. Полученные из нефти продукты также являются общеупотребительными во многих других химических процессах. Альтернативно, жидкость представляет собой указанный потребительский товар, или поверхность находится в контакте с таким потребительским товаром.

13. Способ из аспекта 11 или 12, где поверхность находится в контакте с морской водой, жидкостью для гидроразрыва или жидкостью в скважине; или где жидкость представляет собой морскую воду, жидкость для гидроразрыва или жидкость в скважине.

14. Способ по любому из аспектов 1-13, где стадия (i) способа включает в себя предоставление популяции клеток микроорганизмов из второго вида (вторых клеток-хозяев), где вторые клетки содержат указанные векторы, где векторы являются способными к переносу от вторых клеток-хозяев к первым клеткам-хозяевам; и объединение вторых клеток-хозяев с первыми клетками-хозяевами, в результате чего векторы вводят в первые клетки-хозяева. В одном примере, вторая клетка(клетки) являются приемлемыми с точки зрения окружающей среды, промышленности или с бытовой точки зрения, в окружающей среде (например, в окружающей среде воды или почвы), и первая клетка-хозяин(клетки-хозяева) являются неприемлемыми в окружающей среде.

15. Способ из 14, где первые клетки-хозяева содержатся в смеси клеток микроорганизмов (например, содержащейся в биопленке из микроорганизмов) перед контактом с указанными векторами, где смесь содержит клетки из указанного второго вида.

16. Способ из аспекта 14 или 15, где указанный второй вид представляет собой вид Bacillus или нитратвосстанавливающих бактерий, или нитратвосстанавливающих сульфидокисляющих бактерий (NRB).

17. Способ из аспекта 16, где NRB выбрана из группы, состоящей из видов Campylobacter, видов Nitrobacter, видов Nitrosomonas, видов Thiomicrospira, видов Sulfurospirillum, видов Thauera, видов Paracoccus, видов Pseudomonas, видов Rhodobacter и видов Desulfovibrio; или содержит по меньшей мере 2 из указанных видов.

18. Способ из аспекта 17 где NRB выбрана из группы, состоящей из Nitrobacter vulgaris, Nitrosomonas europea, Pseudomonas stutzeri, Pseudomonas aeruginosa, Paracoccus denitrificans, Sulfurospirillum deleyianum и Rhodobacter sphaeroides.

19. Способ по любому из аспектов 1-18, где способ включает в себя приведение клеток-хозяев из указанного первого вида в контакт с биоцидом, одновременно или последовательно с указанными векторами. В одном примере, векторы и биоцид предоставляют предварительно смешанными в композиции, которую приводят в контакт с клетками-хозяевами.

20. Способ из аспекта 19, где биоцид выбран из группы, состоящей из сульфата тетракисгидроксиметилфосфония (THPS), глутаральдегида, монооксида хлора, диоксида хлора, гипохлорита кальция, гипохлорита калия, гипохлорита натрия, дибромонитрилопропионамида (DBNPA), метилен-бис(тиоцианата) (MBT), 2-(тиоцианометилтио)бензотиазола (TCMTB), бронопола, 2- бром-2-нитро-1,3-пропандиола (BNPD), хлорида трибутилтетрадецилфосфония (TTPC), тауринамида и его производных, фенолов, солей четвертичного аммония, содержащих хлор средств, солей хинальдина, лактонов, органических красителей, тиосемикарбазонов, хинонов, карбаматов, мочевины, салициламида, карбанилида, гуанида, амидинов, имидазолинов, уксусной кислоты, бензойной кислоты, сорбиновой кислоты, пропионовый кислоты, борной кислоты, дегидроуксусной кислоты, сернистой кислоты, ванилиновой кислоты, сложных эфиров п-гидроксибензоата, изопропанола, пропиленгликоля, бензилового спирта, хлорбутанола, фенилэтилового спирта, формальдегида, иода и его растворов, повидон-иода, гексаметилентетрамина, нокситиолина, хлорида 1-(3-хлораллил)-3,5,7-триазо-l-азониаадамантана, тауролидина, таурултама, N-(5-нитро-2-фурфурилиден)-l-амино-гидантоина, 5-нитро-2-фуральдегида семикарбазона, 3,4,4'-трихлоркарбанилида, 3,4',5-трибромсалициланилида, 3-трифторметил-4,4'-дихлоркарбанилида, 8-гидроксихинолина, l-циклопропил-6-фтор-l,4-дигидро-4-оксо-7-(l-пиперазинил)-3-хинолинкарбоновой кислоты, 1,4-дигидро-1-этил-6-фтор-4-оксо-7-(l-пиперазинил)-3-хинолинкарбоновой кислоты, пероксида водорода, перуксусной кислоты, оксихлорозина натрия, парахлорметаксиленола, 2,4,4'-трихлор-2'-гидроксидифенола, тимола, хлоргексидина, хлорида бензалкония, хлорида цетилпиридиния, сульфадиазина серебра, нитрата серебра, брома, озона, изотиазолoнов, дихлорид полиоксиэтилен(диметилимино)этилен(диметилимино)этилена, 2-(трет-бутиламино)-4-хлор-6-этиламино-5'-триазина (тербутилазина), и их комбинаций. В одном примере биоцид представляет собой сульфат тетракисгидроксиметилфосфония (THPS). В одном примере, биоцид представляет собой соединение четвертичного аммония.

21. Способ по любому из аспектов 1-20, где систему используют в промышленном процессе, выбранном из группы, состоящей из горнодобывающих работ; перевозки; получения или переработки нефти, газа или нефтехимических продуктов; гидроразрыва; нагревания или охлаждения воздуха или воды; получения, хранения или доставки питьевой воды; транспортировки углеводородов; и обработки сточных вод.

22. Способ из аспекта 21, где поверхность представляет собой поверхность оборудования, используемого в указанной выбранной промышленности; или где жидкость представляет собой жидкость, содержащуюся в оборудовании, используемом в указанной выбранной промышленности.

23. Способ по любому из аспектов 1-22, где поверхность представляет собой поверхность кухонного, банного или садового оборудования; или где жидкость содержится в кухонном, банном или садовом оборудовании. Например, оборудование используют в бытовых условиях.

24. Способ по любому из аспектов 1-23, зависимых от аспекта 3, где жидкость представляет собой питьевую жидкость, содержащуюся в контейнере (например, баке или бутыли для воды), и поверхность представляет собой поверхность контейнера в контакте с жидкостью.

25. Способ по любому из аспектов 1-24, где каждый вектор содержит мобильный генетический элемент (MGE), где MGE содержит точку начала переноса (oriT) и указанный массив CRISPR; где MGE является способным к переносу между клеткой-хозяином из указанного первого вида и дополнительной клеткой-хозяином микроорганизма в указанной промышленной или бытовой системе. Например, дополнительная клетка(клетки) являются приемлемыми с точки зрения окружающей среды, промышленности или с бытовой точки зрения, в окружающей среде (например, в окружающей среде воды или почвы) и первая клетка-хозяин(клетки-хозяева) являются неприемлемыми в окружающей среде.

26. Способ из аспекта 25, где oriT является функциональным в первых и дополнительных клетках-хозяевах.

27. Способ из аспекта 25 или 26, где указанные первые и дополнительные клетки-хозяева содержатся в биопленки из жидкости в контакте с указанными поверхностями; или где указанные клетки содержатся в указанной жидкости.

28. Способ из аспекта 25, 26 или 27, где указанная дополнительная клетка представляет собой клетку из видов, как перечислено в любом из аспектов 16-18. В одном примере, MGE является способным к переносу от дополнительной клетки к первой клетке-хозяину и/или наоборот.

29. Способ по любому из аспектов 25-27, где дополнительная клетка представляет собой клетку из указанного первого вида. Например, в этом варианте осуществления MGE является способным к переносу среди первых клеток в популяции в указанной системе. Когда MGE оставляет свою копию в процессе переноса в другую клетку, это затем обеспечивает средства для размножения и распространения MGE и таким образом, массивов CRISPR, среди популяций клеток в системе, таким образом, распространяя эффект модификации последовательности-мишени посредством массивов. Это может являться эффективным, например, для получения распределения массивов в биопленке в контакте с поверхностью или в жидкости, и это можно использовать, поскольку проницаемость биопленок для общепринятых биоцидов может являться субоптимальной.

30. Способ по любому из аспектов 25-29, где каждый MGE представляет собой или содержит интегративный и конъюгативный элемент (ICE); или где каждый вектор представляет собой фаг, который является способным к инфекции клеток-хозяев из указанного первого вида, и каждый MGE представляет собой нуклеиновую кислоту фага, способную к указанному переносу между клетками.

31. Способ из аспекта 30, где каждый ICE представляет собой транспозон, например, конъюгативный транспозон.

32. Способ по любому из аспектов 1-31, где каждый вектор представляет собой плазмиду, необязательно, содержащую MGE по любому из аспектов 25-31.

33. Способ по любому из аспектов 25-32, где первая и/или дополнительная клетка содержит нуклеотидные последовательности, кодирующие белки, способные функционировать для переноса MGE в другую клетку, где последовательности не содержатся в MGE.

34. Способ из аспекта 33, где последовательности не содержатся в векторе.

35. Способ из аспекта 33, где последовательности содержатся в конъюгативном транспозоне из первой клетки и/или из дополнительной клетки.

36. Способ из аспекта 35, где транспозон является способным функционировать в транс-положении для переноса MGE между первыми и дополнительными клетками.

37. Способ по любому из аспектов 25-36, где oriT из MGE является таким же, как oriT, содержащаяся в ICE из первой клетки и/или дополнительной клетки, где ICE является способным функционировать в транс-положении для переноса MGE между первыми и дополнительными клетками.

38. Способ по любому из аспектов 25-37, где oriT вектор представляет собой oriT из транспозона SRB или NRB.

39. Способ по любому из аспектов 25-38, где каждый MGE содержит последовательности первого и второго концевого повтора и указанный массив CRISPR между последовательностями повторов.

40. Способ по любому из аспектов 25-39, где MGE оставляет копию массива CRISPR (1) в геноме первой клетки-хозяина, когда он переносится в указанную дополнительную клетку-хозяина; или (2) в указанной дополнительной клетке-хозяине, когда он переносится в первую клетку-хозяина. Например, копия содержится в транспозоне или профаге, оставленном в геноме клетки, перенос из которой имеет место.

41. Способ по любому из аспектов 25-40, где первые и дополнительные клетки представляют собой бактериальные клетки из различных видов (например, клетки SRB и NRB; или SRB и Bacillus, соответственно).

42. Способ по любому из аспектов 25-41, зависимых от аспекта 30 в комбинации с транспозазой для мобилизации MGE.

43. Способ по любому из аспектов 1-42, где вектор или MGE содержит модуль токсина-антитоксина, который является способным функционировать в клетке-хозяине из указанного первого вида; необязательно, где модуль токсина-антитоксина содержит ген антитоксина, который неспособен функционировать или обладает уменьшенной функциональностью в клетках из другого вида. Эти варианты осуществления можно использовать для создания селективного давления, благоприятствующего поддержанию вектора/MGE (и таким образом, массивов CRISPR) в первых клетках-хозяевах, содержащих последовательности-мишени.

44. Способ по любому из аспектов 1-43, где вектор или MGE содержит модуль токсина-антитоксина, который является способным функционировать в указанной второй или дополнительной клетке; необязательно, где модуль токсина-антитоксина содержит ген антитоксина, который неспособен функционировать или обладает уменьшенной функциональностью в клетках, отличных от второй или дополнительной клетки. Это является полезным для поддержания популяции массивов CRISPR во вторых или дополнительных клетках (например, когда такие клетки присутствуют в биопленке, содержащей также первые клетки), но где модуль токсина-антитоксина обеспечивает дополнительное уничтожение (в дополнение к действию модификации последовательности-мишени) в первых клетках-хозяевах. В одном примере, вектор или MGE содержит модуль токсина-антитоксина, который является способным функционировать в первой клетке-хозяине и в указанной второй или дополнительной клетке.

45. Способ по любому из аспектов 43 или 44, где модуль токсина-антитоксина является неспособным функционировать или обладает уменьшенной функциональностью в клетках, отличных от первых и вторых или дополнительных клеток. Таким образом, может присутствовать селективное давление как в первых, так и во вторых (или в дополнительных) клетках для поддержания массивов CRISPR. Полезно, что это затем обеспечивает резервуар для горизонтального переноса массивов в MGE между клетками в смешанной популяции (например, в биопленке, контактирующей с поверхностью или в популяции, содержащейся в жидкости).

46. Способ по любому из аспектов 25-45, где первые и вторые клетки (или первые и дополнительные клетки) принадлежат к одному и тому же филуму (например, и те, и другие являются бактериальными клетками) и вектор является способным реплицироваться или функционировать (A) в первой клетке и/или во второй (или дополнительной) клетке, но не в другой клетке из того же самого филума; (B) в первой клетке и/или во второй (или дополнительной) клетке, но не в другой клетке из того же самого порядка; (C) в первой клетке и/или во второй (или дополнительной) клетке, но не в другой клетке из того же самого класса; (D) в первой клетке и/или во второй (или дополнительной) клетке, но не в другой клетке из того же самого порядка; (E) в первой клетке и/или во второй (или дополнительной) клетке, но не в другой клетке из того же самого семейства; (F) в первой клетке и/или во второй (или дополнительной) клетке, но не в другой клетке из того же самого рода; или (G) в первой клетке и/или во второй (или дополнительной) клетке, но не в другой клетке из того же самого вида.

47. Способ из аспекта 25 или из любого из аспектов 26-46, зависимых от аспекта 25, где каждый MGE представляет собой конъюгативный транспозон, oriT является функциональным в первых и дополнительных (или вторых) клеток-хозяев, MGE содержит последовательности первого и второго концевого повтора, и указанный массив CRISPR между последовательностями повторов, и где первые и дополнительные (или вторые) клетки представляют собой бактериальные клетки, где участок-мишень содержится в первых клетках, но не в дополнительных (или вторых) клетках, и где указанная модификация осуществляет инактивацию или понижающую регуляцию гена или регуляторной последовательности, содержащих указанную мишень, в первых клетках, приводящие к уменьшению жизнеспособности первых клеток-хозяев и контроль указанных MIC или биообрастания.

48. Способ по любому из аспектов 1-47, где каждый массив CRISPR содержит последовательность R1-S1-R1' для экспрессии и продукции соответствующей crРНК в первой клетке-хозяине, (i) где R1 представляет собой первый повтор CRISPR, R1' представляет собой второй повтор CRISPR, и R1 или R1' является необязательным; и (ii) S1 представляет собой первый спейсер CRISPR, который содержит нуклеотидную последовательность или состоит из нуклеотидной последовательности, на 95% или более идентичной последовательности-мишени из указанной первой клетки-хозяина.

49. Способ из аспекта 48, где R1 и R1' являются по меньшей мере на 95, 96, 97, 98 или 99% идентичными, соответственно, последовательностям первого и второго повтора из массива CRISPR из первого вида клеток-хозяев. В одном варианте осуществления, присутствуют оба R1 и R1'.

50. Способ из аспекта 48 или 49, где R1 и R1' являются функциональными с системой CRISPR/Cas указанных клеток-хозяев из указанного первого вида для модификации последовательностей-мишеней.

51. Способ по любому из аспектов 48-50, где первые клетки-хозяева представляют собой клетки сульфатвосстанавливающих бактерий (SRB), и R1 и R1' являются по меньшей мере на 95, 96, 97, 98 или 99% идентичными, соответственно, последовательности повтора (например, первого повтора) из массива CRISPR из первого вида клеток-хозяев.

52. Способ из аспекта 51, где R1 и R1' являются по меньшей мере на 95, 96, 97, 98 или 99% идентичными, соответственно, последовательности повтора, выбранного из группы, состоящей из SEQ ID NO: 50-74. См. таблицу 1. В одном варианте осуществления, присутствуют оба R1 и R1'.

53. Способ из аспекта 51, где R1 и R1' являются по меньшей мере на 95, 96, 97, 98 или 99% идентичными, соответственно, последовательности повтора, выбранного из группы, состоящей из SEQ ID NO: 51, 54 и 69. SEQ ID NO: 51, 54 и 69 обнаружены более, чем в одном виде SRB. Это является особенно полезным для нацеливания на более, чем один тип SRB, с использованием массива CRISPR по изобретению, например, когда типы SRB сосуществуют в промышленной или бытовой системе, подлежащей обработке, например, сосуществуют в популяции или биопленке, которые находятся в контакте с субстратом, или в жидкости, подлежащей обработке. В одном варианте осуществления, присутствуют оба R1 и R1'.

54. Способ по любому из аспектов 48-53, где последовательности R1 и R1' являются идентичными.

55. Способ по любому из аспектов 1-54, где каждый массив, введенный в первую клетку-хозяина, вводят в комбинации с одной или несколькими нуклеазой(нуклеазами) Cas (например, Cas9 и/или Cfp1), которые функционируют с соответствующей crРНК в клетке-хозяине для модификации ее последовательности-мишени.

В одном примере, Cas в любой конфигурации в настоящем документе обладает инактивированной активностью нуклеазы и необязательно, содержит активатор или дерепрессор последовательности-мишени. Cas 9 в настоящем документе представляет собой, например, Cas9 S pyogenes или S aureus.

56. Способ по любому из аспектов 1-55, где каждый массив, введенный в первую клетку-хозяина, вводят в комбинации с последовательностью(последовательностями) нуклеиновой кислоты, кодирующими одну или несколько нуклеазу(нуклеаз) Cas (например, Cas9 и/или Cfp1), которые функционируют с соответствующей crРНК в клетке-хозяине для модификации последовательности-мишени.

57. Способ по любому из аспектов 48-56, где R1 и R1' являются функциональными с нуклеазой Cas9 типа II для модификации последовательности-мишени в указанной первой клетке-хозяине, необязательно, где способ дополнительно соответствует аспекту 55 или 56, где Cas представляет собой указанную Cas9.

58. Способ по любому из аспектов 1-57, где все или некоторые из указанных векторов или MGE не содержат последовательность, кодирующую нуклеазу Cas, способную функционировать с соответствующим массивом.

59. Способ из аспекта 58, где каждый указанный соответствующий массив является способным функционировать с эндонуклеазой Cas, обнаруженной в клетках из первого вида.

60. Способ из аспекта 25, или из любого из аспектов 26-59, зависимых от аспекта 25, где каждый MGE лишен последовательности, кодирующей эндонуклеазу Cas, которая может функционировать с последовательностями повторов из массива, и где соответствующий вектор содержит такую последовательность (например, кодирующую Cas9 из Cfp1) вне MGE.

61. Способ контроля коррозии под воздействием микроорганизмов (MIC) или биообрастания субстрата, содержащегося в оборудовании для получения, переработки, хранения или транспортировки нефти, газа или нефтехимических продуктов (например, танкере для неочищенной нефти, нефтевышке или оборудовании для бурения нефти), где поверхность субстрата находится в контакте с популяцией первых клеток-хозяев, где первые клетки-хозяева представляют собой серо- или сульфатвосстанавливающие бактерии (SRB), продуцирующие внеклеточные полимерные вещества бактерии (EPSB), кислотообразующие бактерии (APB), серо- или сульфидокисляющие бактерии (SOB), железоокисляющие бактерии (IOB), марганецокисляющие бактерии (MOB), продуцирующие аммиак бактерии (AmPB) или продуцирующие ацетат бактерии (AcPB) из первых видов, опосредующих MIC или биообрастание субстрата, где поверхности и популяция клеток находятся в контакте с жидкостью, выбранной из морской воды, пресной воды, жидкости для гидроразрыва или жидкости в скважине (например, скважине для нефти или природного газа), где способ включает в себя

(i) приведение популяции клеток в контакт с векторами посредством смешивания жидкости со множеством векторов, способных трансформировать или трансдуцировать первые клетки-хозяева, где каждый вектор содержит массив CRISPR в результате чего массивы CRISPR вводят в клетки-хозяева, где

(a) каждый массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине;

(b) каждая crРНК является способной гибридизоваться с последовательностью-мишенью из клетки-хозяина для направления Cas (например, нуклеазы Cas, например, Cas9 или Cfp1) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); последовательность-мишень представляет собой последовательность гена для обеспечения жизнеспособности клетки-хозяина;

(c) где каждая последовательность из (a) содержит последовательность R1-S1-R1' для экспрессии и продукции соответствующей crРНК в первой клетке-хозяине, где R1 представляет собой первый повтор CRISPR, R1' представляет собой второй повтор CRISPR, и R1 или R1' является необязательным; и S1 представляет собой первый спейсер CRISPR, который содержит нуклеотидную последовательность или состоит из нуклеотидной последовательности, на 70, 75, 80, 85, 90 или 95% или более идентичной последовательности-мишени из указанной первой клетки-хозяина и

(ii) обеспечение экспрессии указанных cРНК в присутствии Cas в клетках-хозяевах, таким образом, модификации последовательностей-мишеней в клетках-хозяевах, приводящей к уменьшению жизнеспособности клетки-хозяина и контролю MIC или биообрастания указанного субстрата. В одном варианте осуществления присутствуют оба R1 и R1'.

62. Способ из аспекта 61, где способ соответствует аспекту 1 или любому предшествующему аспекту, зависимому от аспекта 1.

63. Способ из аспекта 61 или 62, где каждый вектор представляет собой фаг, способный к инфекции первой клетки-хозяина, или представляет собой вектор, содержащий MGE (например, транспозон), который содержит указанный массив CRISPR, где MGE является способным к переносу в первую клетку-хозяина.

64. Способ из аспекта 61, 62 или 63, где первые клетки представляют собой клетки сульфатвосстанавливающих бактерий (SRB), например, клетки Desulfovibrio или Desulfotomaculum.

65. Способ из аспекта 64, где R1 и R1' являются по меньшей мере на 95, 96, 97, 98 или 99% идентичными, соответственно, последовательности повтора (например, первого повтора) из массива CRISPR из первого вида клеток-хозяев, и массивы вектора являются способными функционировать с эндонуклеазой Cas, обнаруженной в клетках из первого вида. В одном примере, R1 и R1' представляют собой идентичные последовательности.

66. Способ из аспекта 65, где R1 и R1' являются по меньшей мере на 95, 96, 97, 98 или 99% идентичными, соответственно, последовательности повтора, выбранной из группы, состоящей из SEQ ID NO: 50-74. В одном примере, R1 и R1' представляют собой идентичные последовательности.

67. Способ из аспекта 66, где R1 и R1' являются по меньшей мере на 95, 96, 97, 98 или 99% идентичными, соответственно, последовательности повтора, выбранной из группы, состоящей из SEQ ID NO: 51, 54 и 69. См. таблицу 1. Это является особенно полезным для нацеливания на более одного типа SRB с использованием массив CRISPR по изобретению, например, когда типы SRB сосуществуют в промышленной или бытовой системе, подлежащей обработке, например, сосуществуют в популяции или биопленке, которые находятся в контакте с субстратом, или в жидкости, подлежащей обработке. В одном примере, R1 и R1' представляют собой идентичные последовательности.

68. Способ по любому из аспектов 1-67, где указанное множество векторов содержат дополнительные векторы, где каждый дополнительный вектор содержит один или несколько массивов CRISPR для нацеливания на дополнительные клетки-хозяева, содержащиеся в указанной популяции, где дополнительные виды клетки-хозяина отличаются от вида первых клеток-хозяев, где на стадии (i) указанные дополнительные клетки из популяции приводят в контакт с множеством указанных дополнительных векторов, способных трансформировать или трансдуцировать дополнительные клетки, где каждый вектор содержит массив CRISPR, в результате чего массивы CRISPR вводят в дополнительные клетки-хозяева, где

(a) каждый массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине; и

(b) каждая crРНК является способной гибридизоваться с последовательностью-мишенью из указанной дополнительной клетки-хозяина для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); последовательность-мишень представляет собой последовательность гена для обеспечения жизнеспособности клетки-хозяина; и стадия (ii) включает в себя обеспечение экспрессии указанных cРНК в присутствии Cas в указанных дополнительных клетках-хозяева, таким образом, модификацию последовательностей-мишеней в дополнительных клетки-хозяева.

69. Способ из аспекта 68, где дополнительные клетки-хозяева опосредуют MIC или биообрастание указанного субстрата или жидкости, где стадия (ii) приводит к уменьшению жизнеспособности дополнительной клетки-хозяина и контролю MIC или биообрастания указанных субстрата или жидкости.

70. Способ контроля бактериального биообрастания в балластной воде судна или лодки, где вода содержит популяцию первых клеток-хозяев из первого вида микроорганизмов, опосредующего указанное биообрастание, где способ включает в себя

(i) приведение популяции в контакт со множеством векторов, способных трансформировать или трансдуцировать клетки, где каждый вектор содержит массив CRISPR, в результате чего массивы CRISPR вводят в клетки-хозяева, где

(a) каждый массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине; и

(b) каждая crРНК является способной гибридизоваться с последовательностью-мишенью из клетки-хозяина для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); последовательность-мишень представляет собой последовательность гена для обеспечения жизнеспособности клетки-хозяина; и

(ii) обеспечение экспрессии указанных cРНК в присутствии Cas в клетках-хозяевах, таким образом, модификации последовательностей-мишеней в клетках-хозяевах, приводящей к уменьшению жизнеспособности клетки-хозяина и контроля указанного биообрастания.

71. Способ из аспекта 70, где первые клетки-хозяева представляют собой клетки видов Vibrio cholerae, E coli или Enterococci.

72. Способ из аспекта 70 или 71, где стадия (i) включает в себя смешивание балластной воды с векторами, например, в корпусе судна или лодки.

73. Способ по любому из аспектов 70-72, где судно или лодка представляет собой морской транспорт, и вода представляет собой морскую воду.

74. Способ по любому из аспектов 70-72, где вместо судна или лодки, балластная вода содержится в контейнере или в буровой платформе в открытом море, например, нефтяной платформе или нефтевышке. В одном примере, судно, лодка, контейнер, платформа или установка стоит на якоре в открытом море (т.е., постоянно в их местоположении).

75. Способ спуска балластной воды из судна или лодки, где спущенная балластная вода содержит воду, обработанную способом по любому из аспектов 70-74.

76. Способ из аспекта 75, где воду спускают в водоем, например, в море, океан или водные пути (например, в реку, канал, озеро или резервуар) или в контейнер.

77. Балластная морская вода, содержащая массивы CRISPR, где балластная вода получена или может быть получена способом по любому из аспектов 70-76.

78. Судно, лодка, контейнер или установка, содержащие балластную морскую воду из аспекта 77.

79. Вектор для применения в способе по любому из аспектов 61-69, где первые клетки представляют собой клетки сульфатвосстанавливающих бактерий (SRB), например, клетки Desulfovibrio или Desulfotomaculum, где каждый вектор содержит один или несколько массивов CRISPR для нацеливания на SRB, где каждый массив является таким, как определено в (a)-(c) из аспекта 61.

80. Вектор из аспекта 79, где R1 и R1' соответствуют любому из аспектов 65-67.

81. Вектор для применения в способе по любому из аспектов 70-76, где первые клетки представляют собой клетки видов Cholera (например, vibrio, например, O1 или O139), E coli или Enterococci sp, где вектор содержит один или несколько массивов CRISPR для нацеливания на клетки, где каждый массив является таким, как определено в (a) и (b) из аспекта 70.

82. Вектор по любому из аспектов 79-81, где вектор представляет собой бактериофаг, способный инфицировать указанную клетку.

83. Вектор по любому из аспектов 79-81, где вектор представляет собой транспозон или MGE, способные к переносу в указанную клетку.

84. Множество векторов, где каждый вектор соответствует аспекту 82 или 83, необязательно, в комбинации с биоцидом или антибиотиком, способным к уменьшению жизнеспособности указанных клеток.

Бактерии, опосредующие MIC или биообрастание: В одном примере, первые клетки-хозяева выбраны из группы, состоящей из серо- или сульфатвосстанавливающих бактерий (SRB), продуцирующих внеклеточные полимерные вещества бактерий (EPSB, например, Pseudomonas), кислотообразующих бактерий (APB), серо- или сульфидокисляющих бактерий (SOB); железо- или марганецокисляющих бактерий (IOB), продуцирующих аммиак бактерий (AmPB) и продуцирующих ацетат бактерий (AcPB). Например, первые клетки-хозяева представляют собой AcPB (например, виды Acetobacter и/или виды Gluconacetobacter) и поверхность находится в контакте с углеводородным топливом (например, этанолом топливной квалификации) и/или водой.

Ниже приведены примеры соответствующих бактерий по настоящему изобретению (в одном примере, первые клетки-хозяева представляют собой клетки из любого из следующих видов). Бактерии Acidithiobacillus продуцируют серную кислоту. Acidithiobacillus thiooxidans, подрод Acidithiobacillus бактерии, часто разрушает канализационные трубы. Ferrobacillus ferrooxidans непосредственно окисляет железо до оксидов железа и гидроксидов железа. Другие бактерии продуцируют различные кислоты, как органические, так и неорганические, или аммиак. В присутствии кислорода, аэробные бактерии, подобные Thiobacillus thiooxidans, Thiobacillus thioparus и Thiobacillus concretivorus, где все три являются широко распространенными в окружающей среде, являются общераспространенными вызывающими коррозию факторами, приводящими к биогенной сульфидной коррозии. Без присутствия кислорода, анаэробные бактерии, особенно Desulphovibrio и Desulphotomaculum, являются общераспространенными. Desulphovibrio salixigens требует по меньшей мере 2,5% концентрацию хлорида натрия, но D. vulgaris и D. desulphuricans могут расти как в пресной, так и в соленой воде. D. africanus является другим общераспространенным вызывающим коррозию микроорганизмом. Род Desulphotomaculum содержит сульфатвосстанавливающие спорообразующие бактерии. Desulphotomaculum orientis и nigrificans вовлечены в процессы коррозиии. Сульфатвосстанавливающие организмы требуют восстанавливающей окружающей среды, и электродный потенциал по меньшей мере -100 мВ необходим им для развития. Однако, даже небольшое количества продуцированного сульфида водорода может обеспечить этот сдвиг, так что рост, однажды начавшись, проявляет тенденцию к ускорению.

В одном примере первые клетки-хозяева представляют собой клетки Serratia marcescens, видов Gallionella, видов Pseudomonas, видов Bacillus (например, B. subtilis, B. cereus, B. pumilus или B. megaterium), видов Thiobacillus, видов Sulfolobus, Klebsiella oxytoca, Pseudomonas aeruginosa, P. stutzeri, Micrococcus, Enterococcus, Staphylococcus (например, S. aureus), E. faecalis или M. luteus. В одном примере, первые клетки-хозяева содержат смесь из двух или более из указанных видов. Эти виды были выделены из дизельного топлива и трубопроводов для транспортировки нафты, локализованных в северо-западных и юго-западных районах Индии; подтверждена ассоциация с локализованной коррозией стали трубопровода в присутствии этих сообществ. Совместный проект различных европейских авиастроителей подтвердил вовлечение изолятов из родов Micrococcus, Enterococcus, Staphylococcus и Bacillus в сильное коррозионное повреждение алюминиевого сплава, общеупотребительного в самолетостроении. Эти бактерии могут создавать кислое микроокружение (кислотообразующие бактерии), благоприятствующее развитию других бактерий, или продуцировать EPS, благоприятствующие формированию биопленки (продуцирующие EPS бактерии). Таким образом, в одном варианте осуществления изобретения, поверхность (например, поверхность стали) системы, подлежащая обработке, находится в контакте с дизельным топливом или нафтой, или жидкость, подлежащая обработке, представляет собой дизельное топливо или нафту (и необязательно, первые клетки-хозяева представляют собой один или несколько видов, определенных в этом абзаце). В одном варианте осуществления изобретения, поверхность (например, содержащая алюминий поверхность, например, поверхность воздушного судна) системы, подлежащие обработке, находится в контакте с одним, двумя, тремя или всеми родами: Micrococcus, Enterococcus, Staphylococcus и Bacillus (первые клетки-хозяева). В одном примере любого варианта осуществления в этом абзаце, поверхность представляет собой поверхность стального или алюминиевого компонента системы.

Кислотообразующие бактерии: Аэробные бактерии являются способными продуцировать органические кислоты с короткими цепями, такие как уксусная, муравьиная, молочная, пропионовая и масляная кислоты, в качестве продуктов их метаболизма при ферментативном метаболизме органических материалов. Они являются также первоначальными колонизаторами из-за аэробного метаболизма. Эти микроорганизмы присутствуют во множестве видов окружающей среды, включая автозаправочные станции и масла. Органические кислоты служат в качестве субстратов для SRB, ускоряя процесс коррозии, помимо уменьшения pH окружающей среды. Более того, большое количество продуцированной органической кислоты действует на деполяризацию металла, начиная локальный корродирующий процесс.

Сероокисляющие бактерии: Сероокисляющие бактерии представляют собой аэробные и факультативно анаэробные микроорганизмы, которые получают энергию, необходимую для роста, из окисления неорганических соединений серы, таких как сульфид, сульфит, тиосульфат и, в некоторых случаях, сера. Окислительный метаболизм приводит к продукции серной кислоты, способствующей окислению окружающей среды. Эта группа включает в себя много родов, где род Acidithiobacillus является наиболее изученным. Группа включает в себя также виды бактерий из родов Sulfolobus, Thiomicrospira, Beggiatoa, Acidithiobacillus и Thiothrix, так же как виды Thiosphaera pantotropha и Paracoccus denitrificans. В одном примере, первые клетки-хозяева представляют собой клетки любого из этих видов.

Железоокисляющие бактерии: Железоокисляющие бактерии представляют собой аэробные микроорганизмы, принадлежащие к большой и разнообразной группе, которые получают энергию, необходимую для их метаболизма, от окисления железа. Следовательно, происходит формирование гидроксидов железа, которые, как правило, формируют нерастворимый преципитат на поверхностях субстрата, образуя области с различными уровнями кислорода. Их часто обнаруживают в воде из рек, озер и при нефтедобыче. Они в основном обладают обеспечивающей подвижность оболочкой, и их присутствие можно детектировать по большому накоплению осадков соединений железа в качестве продукта коррозии. Это накопление или неорганическое загрязнение приводит к проблемам с промышленным оборудованием, таким как блокирование нефтепроводы. Среди наиболее распространенных присутствуют: Thiobacillus ferrooxidans и роды Crenothrix, Gallionella, Leptothrix и Spherotillus. В одном примере, первые клетки-хозяева представляют собой клетки любого из этих видов.

Серо- или сульфатвосстанавливающие бактерии (SRB): SRB формируют морфологически- и филогенетически гетерогенную группу, которая включает в себя бактерии и ограничена анаэробными архебактериями, хотя некоторые виды обладают значительной устойчивостью к кислороду. Они представляют собой в основном грамотрицательные бактерии, мезофильные и некоторые термофильные, в основном спорообразующие. Эти микроорганизмы являются способными окислять различные органические соединения низкой молекулярной массы, включая моно- или дикарбоновые алифатические кислоты, спирты, углеводороды и ароматические соединения, с использованием ионов сульфата или других соединений серы (тиосульфата, сульфита и т.д.) в качестве акцепторов электронов. Ацетат, лактат, пируват и этанол присутствуют среди наиболее общеупотребительных субстратов для SRB. Стимуляция роста SRB обусловлена существующими анаэробными состояниями в биопленках, объясняемыми накоплением продуктов коррозии в комбинации с микроорганизмами и, в ходе нефтедобычи, где присутствует закачивание водной среды, такой как морская вода, богатой сульфатом. Могут образовываться большие количества биогенного сульфида водорода; большинство H2S, образованного в трубопроводах и другом оборудовании для получения, переработки, хранения или транспортировки нефти, газа или нефтехимических продуктов, происходит от метаболической активности SRB. Другим экономическим влиянием на нефтедобывающую промышленность является окисление нефти и газа посредством H2S.

Принимая во внимание многочисленные экономические потери, связанные с метаболической активностью SRB, усилия были направлены на применение опасных для окружающей среды и токсичных ингибиторов метаболизма, таких как молибдат, нитрат и нитрит, и применение биоцидов, помогающих контролировать метаболическую активность SRB и впоследствии ингибировать биогенную продукцию H2S.

Несколько механизмов вносят вклад в сдерживание процесса формирования биогенного H2S с использованием ингибиторов метаболизма: I - конкуренция между SRB и гетеротрофными бактериями, являющимися восстановителями нитрита или нитрата посредством обычных доноров электронов, приводящая к конкурентному исключению SRB; II - увеличение окислительно-восстановительного потенциала из-за присутствия промежуточных продуктов восстановления нитрата (оксида азота и окиси азота), поскольку биологическая продукция H2S возникает только при низком окислительно-восстановительном потенциале (ниже -100 мВ); III - изменение энергетического метаболизма некоторых SRB, восстановление нитрата вместо сульфата; IV - сульфидокисляющие бактерии и восстанавливающие нитрат или нитрит бактерии, использующие нитрат или нитрит для повторного окисления H2S, что приводит к удалению H2S; V - ингибирование диссимиляционной сульфитредуктазы посредством нитрита для ингибирования конечной ферментативного восстановления сульфата в SRB.

В конкретных вариантах осуществления настоящего изобретения, популяцию клеток-хозяев в контакте с субстратом, подлежащую обработке, или содержащуюся в жидкости, подлежащей обработке, приводят также в контакт с одним или несколькими нитратами и/или с одним или несколькими нитритами в присутствии векторами по изобретению. Например, на стадии (i) одновременно или последовательно с векторами, нитрат/нитрит и векторы объединяют с нефтью, газом, нефтехимическими продуктами, водой или другими жидкостями, содержащимися в промышленной или бытовой системе (например, закачивают в них). Подобным образом, дополнительно или альтернативно, молибдаты можно также использовать в этих системах в качестве контрольного механизма для SRB. Таким образом, в одном варианте осуществления, популяцию клеток-хозяев в контакте с субстратом, подлежащую обработке, или содержащуюся в жидкости, подлежащей обработке, приводят также в контакт с одним или несколькими молибдатами в присутствии векторов по изобретению. Например, на стадии (i) одновременно или последовательно с векторами, молибдат(ы) и векторы объединяют с нефтью, газом, нефтехимическими продуктами или другими жидкостями, содержащимися в промышленной или бытовой системе (например, закачивают в них).

В других вариантах осуществления, популяцию приводят в контакт с нитратвосстанавливающими бактериями и/или нитратвосстанавливающими сульфидокисляющими бактериями (NRSOB) (в настоящем документе, совместно, «NRB») в присутствии векторов по изобретению. Например, одновременно или последовательно с векторами, NRB объединяют с нефтью, газом, нефтехимическими продуктами, водой или другими жидкостями, содержащимися в промышленной или бытовой системе (например, закачивают в них). В одном примере, NRB содержат векторы по изобретению, где векторы являются способными к переносу от клеток NRB к первым клеткам-хозяевам (клеткам SRB); и после объединения клеток NRB и SRB, векторы вводят в клетки SRB. В одном примере, клетки SRB содержатся в смеси клеток микроорганизмов (например, содержащихся в биопленке микроорганизмов) перед контактом с указанными векторами, где смесь содержит клетки из видов NRB. Таким образом, в этом случае изобретение относится к приведению клеток SRB в контакт с клетками NRB (содержащими векторы), где виды клеток NRB уже сосуществуют с SRB в биопленке, подлежащей нацеливанию, что, таким образом, увеличивает совместимость и шанс включения содержащих вектор NRB в популяцию клеток биопленки. Это является полезным для увеличения шансов поглощения векторов биопленкой, таким образом, увеличивая шансы эффективной модификации клеток SRB и шансы размножения массивов CRISPR по изобретению внутри биопленки (особенно, когда массивы содержатся в мобильных генетических элементах, таких как транспозоны, или содержатся в фаге, как описано в настоящем документе).

SRB и NRB как правило, конкурируют за один и тот же неполимерный источник углерода (такой как ацетаты), присутствующий в конкретных месторождениях нефти и промышленных водных системах, необходимый для роста бактерий. Посредством увеличения скорости роста NRB по сравнению с SRB, NRB могут побеждать в конкуренции с SRB за потребление доступных неполимерных источников углерода, лишая SRB их способности расти и образовывать нежелательные сульфиды и уменьшая скорость коррозии. Кроме того, посредством ингибирования скорости роста SRB, NRB могут преобладать, снова побеждая в конкуренции с SRB за доступный неполимерный углерод в системе, например, месторождении нефти или промышленной водной системе. Таким образом, приведение клеток SRB в популяции в контакт с NRB может способствовать уменьшению жизнеспособности клеток SRB посредством увеличения соотношения NRB к SRB в популяции.

В одном варианте осуществления, изобретение содержит приведение популяции, содержащей первую клетку-хозяина (например, SRB) в контакте с органическими и/или неорганическими нитратами и нитритами. Это служит для стимуляции роста присутствующих NRB, таким образом, помогая NRB побеждать в конкуренции с SRB. Органические и неорганические нитраты или неорганические нитриты можно использовать закачанными в конкретные месторождения нефти и промышленные водные системы. Неорганические нитраты и неорганические нитриты, доступные для применения по настоящему описанию, включают в себя, например, нитрат калия, нитрит калия, нитрат натрия, нитрит натрия, нитрата аммония, и их смеси. Эти органические и неорганические нитраты и неорганические нитриты являются общедоступными, но не являются ограничивающими, и можно использовать любой подходящий нитрат или нитрит.

Количество используемого органического или неорганического нитрата или нитрита, зависит от ряда факторов, включая количество сульфата и/или органических кислот, присутствующих в популяции в системе, и ожидаемое количество NRB, необходимое для противодействия SRB. В конкретном варианте осуществления, для обработки субстрата MIC в контакте с жидкостью, или для обработки биообрастания жидкости по изобретению, где концентрация используемого органического или неорганического нитрата или нитрита составляет менее 2000 м.д. по массе жидкости, альтернативно, 500-1600 м.д. по массе или альтернативно, между приблизительно 900 и 1100 м.д. по массе при применении с использованием способа периодического применения. При применении посредством непрерывного действия, концентрация органического или неорганического нитрата или нитрита может составлять менее 500 м.д. по массе, альтернативно, между 10 и 500 м.д., или альтернативно, между 10 и 100 м.д. жидкости.

В одном варианте осуществления, популяцию приводят в контакт с векторами по изобретению и, одновременно или последовательно, с NRB (например, содержащими векторы) и нитратом и/или нитритом.

Пригодные NRB включают в себя любой тип бактерий, способных осуществлять анаэробное восстановление нитрата, таких как гетеротрофные нитратвосстанавливающие бактерии и нитратвосстанавливающие сульфидокисляющие бактерии. В одном примере, NRB содержат одну, две, три или более (например, одну или несколько) NRB, выбранных из группы, состоящей из видов Campylobacter, видов Nitrobacter, видов Thiobacillus, видов Nitrosomonas, видов Thiomicrospira, видов Sulfurospirillum, видов Thauera, видов Paracoccus, видов Pseudomonas и видов Rhodobacter. Например, NRB выбрана из одной или нескольких из Nitrobacter vulgaris, Nitrosomonas europea, Pseudomonas stutzeri, Pseudomonas aeruginosa, Paracoccus denitrificans, Sulfurospirillum deleyianum и Rhodobacter sphaeroides.

В конкретных вариантах осуществления, NRB представляет собой штамм NRB, обнаруженный в системе для получения, переработки, транспортировки или хранения нефти, газа, нефтехимических продуктов или воды (например, в оборудовании из нее), или обнаруженный в подземной формации, такой как вода или нефтяная скважина. NRB можно оптимизировать для метаболизма в условиях системы. NRB, например, выбирают из библиотеки штаммов NRB, или их можно культивировать из системы, подлежащей обработке, или сходной системы.

Количество NRB, приведенных в контакт с клетками SRB в системе, может зависеть от ряда факторов, включая ожидаемое количество SRB, так же как любой биоцид, который может присутствовать. При закачивании в подземную формацию, можно учитывать также проницаемость и пористость подземной формации. В конкретных вариантах осуществления по настоящему описанию, количество NRB, закачанной в жидкость, представляет собой между 1 и 108 бактерий/мл жидкости, или альтернативно, между 10 и 104 бактерий/мл жидкости.

В дополнение к стимуляции NRB для победы в конкуренции с SRB, может являться желательным для введения дополнительных ингибиторов SRB в конкретных вариантах осуществления по настоящему описанию вместе с нитратами. В одном примере, SRB приводят в контакт с один или несколькими ингибиторами SRB, выбранными из группы, состоящей из 9,10-антрахинона, молибдатов (таких как молибдат натрия и/или молибдат лития) и их смеси. В конкретных вариантах осуществления по настоящему описанию, молибдат добавляют в жидкость в диапазоне от 5 до 100 м.д. по массе жидкости.

В одном примере, векторы по изобретению и один или несколько биоцидов (т.е., биоцидов против первых клеток-хозяев, таких как биоциды против SRB) смешивают перед приведением первых клеток в контакт со смесью, например, посредством закачивания смеси в жидкость, которая находится в контакте с поверхностью, подлежащей обработке, или закачивания смеси в жидкость, подлежащую обработке.

Дополнительно или альтернативно к клеткам NRB, содержащим векторы, изобретение относится к применению видов клеток Bacillus, содержащих векторы по изобретению.

В одном варианте осуществления, векторы представляют собой бактериофаги, способные к инфекции SRB, и фаг приводят в контакт с первыми клетками-хозяевами (например, SRB), в результате чего массивы CRISPR, содержащиеся в фаге, вводят в первые клетки-хозяева для их модификации по изобретению. В одном варианте осуществления, когда первые клетки представляют собой SRB, SRB также приводят в контакт с фаговыми векторами по изобретению и, одновременно или последовательно, с NRB. Вместо или в дополнение к приведению в контакт с NRB, SRB приводят в контакт с нитратом и/или нитритом.

Примеры механизмов, вовлеченных в MIC, являются следующими; в одном варианте осуществления, «контроль» с использованием способа включает в себя уменьшение действия механизма, выбранного из:

□ Стимуляции посредством микроорганизмов (например, бактерий) биоминерализации из-за накопления гидроксидов железа на металлической поверхности, модифицирующей электрохимические процессы на поверхности раздела металл/раствор, включая коррозию;

□ Продукции EPS, благоприятствующую формированию биопленки;

□ Стимуляции посредством микроорганизмов (например, бактерий) деградации нефтепродуктов из-за высвобождения фермента арил-углеводород-гидроксилазы (AHH), который действует на коррозию металлов;

□ Продукции серной кислоты, усиливающей процесс коррозии; и

□ Окисления серы.

В одном варианте осуществления, способ включает в себя уменьшение действия механизма, выбранного из:

□ Стимуляции посредством бактерий биоминерализации из-за накопления гидроксидов железа на поверхности, где поверхность представляет собой металлическую поверхность;

□ Продукции EPS;

□ Стимуляции посредством бактерий деградации нефтепродуктов в системе из-за высвобождения фермента арил-углеводород-гидроксилазы (AHH), где поверхность представляет собой металлическую поверхность;

□ Продукции серной кислоты; и

□ Окисления серы.

ПРИМЕРЫ, ПРИМЕНИМЫЕ ДЛЯ КОНТРОЛЯ MIC ИЛИ БИООБРАСТАНИЯ

Существуют конкретные примеры применений, предусмотренных по настоящему изобретению для уменьшения коррозии и/или биообрастания, ассоциированных с бактериями. Применения, описанные ниже, не предназначены для ограничения концепции по настоящему изобретению, и являются просто иллюстрациями того, как изобретение можно использовать для контроля индуцированной бактериями коррозии или для уменьшения загрязнения окружающей среды.

Дренаж кислых шахтных вод: При дренаже кислых шахтных вод, рост бактерий может увеличивать кислотность в окружающей среде. Существует схема реакции для образования кислоты и, таким образом, потенциального повреждения окружающей среды. Проблема дренажа кислых шахтных вод известна во всем мире как серьезная проблема для окружающей среды. Источником дренажа кислых шахтных вод является выветривание и окисление пиритных и других содержащих сульфид минералов. Шахтный дренаж образуется, когда пирит, сульфид железа, подвергается воздействию воздуха и воды и вступает с ними в реакцию с образованием серной кислоты и растворенного железа. Некоторое количество или все из этого железа может осаждаться с формированием красных, оранжевых, или желтых отложений на дне ручьев, содержащих шахтный дренаж. Кислый сток далее растворяет тяжелые металлы, такие как медь, свинец, ртуть, в грунтовой или поверхностной воде. Скорость и степень развития дренажа кислых шахтных вод может увеличиваться под действие конкретных бактерий.

В одном примере, система, таким образом, представляет собой шахту или содержится в шахте. Жидкость представляет собой жидкость шахтного дренажа и способом уменьшают количество серной кислоты, образованной шахтным дренажем. В одном примере, поверхность находится в контакте с жидкостью шахтного дренажа.

В одном примере, первые клетки-хозяева представляют собой клетки Acidithiobacillus ferrooxidans, Acidithiobacillus thiooxidans, Acidithiobacillus denitrificans, Leptospirillum ferrooxidans или Sulfobacillus thermosulfidooxidans или смесь двух или более из них.

Гидроразрыв: Гидроразрыв представляет собой способ разлома горных пород для облегчения добычи газа и других углеводородов. По существу, после идентификации несущей газ формации, в земле бурят скважины как в вертикальном, так и в горизонтальном направлениях для доступа к газу. Затем скважины используют для разлома сланца с использованием воды под высоким давлением, песка и множества химических веществ для поддержания разломов и трещин от закрывания посредством интенсивного давления перегрузки после завершения гидроразрыва. Миллионы галлонов воды используют для разрыва скважины. Между 30% и 70% жидкости для разрыва возвращается на поверхность как «вынос». Вынос содержит любые вещества, растворенные в воде для разрыва, включая соль. Что именно растворено, зависит от локализации. Вынос содержат в выстланных пластиком колодцах в участок расположения скважины до его погрузки и обработки перед утилизацией. В некоторой временной точке вода с высокой текучестью и относительно низкой соленостью превращается в «добываемую воду» с более низкой текучестью, но намного более высокой соленостью, что отличает ее от «выносной» воды.

В любом случае, существует проблема коррозии под воздействием микроорганизмов (MIC). Особенный интерес представляет SRB. В одном примере, таким образом, система представляет собой систему при гидроразрыве, и жидкость представляет собой жидкость при гидроразрыве (например, выносную воду или добываемую воду) или поверхности, подлежащие обработке, находится в контакте с такой жидкостью. Способом, например, уменьшают жизнеспособность SRB (например, уничтожают SRB и/или уменьшают пролиферацию SRB в жидкости), и первые клетки-хозяева are SRB.

Например, первые клетки-хозяева представляют собой клетки бактерий Acidithiobacillus, Acidithiobacillus thiooxidans, Ferrobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus thioparus, Thiobacillus concretivorus, Desulphovibrio (например, salixigens, vulgaris, desulphuricans или africanus) или Desulphotomaculum (например, orientis или nigrificans), или смесь двух или более из этих видов.

Оборудование для охлаждения (например, охлаждающие башни): Присутствие бактерии в оборудовании для охлаждения, таких как охлаждающие башни, может оказывать неблагоприятное воздействие на функцию охлаждения несколькими путями. Например, SRB поддерживают образование кислых условий на стенках охлаждающих башень, теплообменников и т.д., что приводит к коррозии и потенциальному отключению системы охлаждения на время ремонтных работ. Кроме того, биопленки на стенках, например, теплообменников, уменьшает коэффициент теплопередачи теплообменников, что приводит к уменьшенной функциональной эффективности системы охлаждения.

Кроме того, коррозия содержащих железо компонентов может являться особенно неблагоприятной. Может иметь место Окисление железа до железа(II) и восстановление сульфата до иона сульфида с образованием в результате осадка сульфида железа и образованием корродирующих ионов водорода in situ посредством SRB. Коррозия железо посредством сульфатвосстанавливающих бактерий является быстрой и, в отличие от обычного ржавления, не является самоограничивающейся. Наросты, образуемые Desulphovibrio, состоят из внешней оболочки из красного оксида железа, смешанного с черным магнитным оксидом железа, содержащим мягкую, черную сердцевину из сульфида железа.

В одном примере, таким образом, система представляет собой систему охлаждения, и жидкость представляет собой жидкость (например, воду или водосодержащую жидкость), содержащуюся в системе, или поверхность, подлежащая обработке, представляет собой поверхность оборудования для охлаждения в контакте с такой жидкостью. В одном примере, первые клетки-хозяева представляют собой SRB (например, любые SRB, описанные в настоящем документе). В одном примере, поверхность представляет собой содержащие железо поверхности.

В одном примере, первые клетки-хозяева представляют собой клетки Legionella. Такие виды являются неблагоприятными для здоровья человека и размножаются в оборудовании для охлаждения, нагревания, переработки или хранения воды. В одном примере, таким образом, система представляет собой такое оборудование.

Коррозия трубопроводов: Трубопроводы для углеводородов и нефтехимических продуктов часто содержат достаточно влаги, чтобы позволять рост бактерий, приводящих к MIC например, вызванную SRB. MIC часто вызывают биопленки аэробных бактерий, защищающие SRB, которые являются анаэробными и находятся в непосредственном контакте с внутренними поверхностями трубопровода. Это создает кислые условия и другие вызывающие коррозию металла условия, которые могут приводить к локализованной коррозии и в конечном счете, к повреждению трубопровода.

В одном примере, система содержит оборудование поверхности (например, трубопровода или бурового оборудования), содержащее поверхности в контакте с первыми клетками-хозяевами (например, SRB). Например, система представляет собой систему для получения, переработки, хранения или транспортировки нефти, углеводородов, нефтехимических продуктов (например, дизельного топлива или нефтепродуктов), газа или воды. Например, трубопровод представляет собой трубопровод для нефтехимических продуктов. Например, трубопровод содержится в установке для нефти или газа. Например, поверхность трубопровода находится в контакте с морской водой. Например, трубопровод находится в контакте с нефтехимическими жидкостями, нефтью или природным газом.

Обработка сточных вод: Обработка сточных вод включает в себя добавление активированного шлама ниже установки для обработки сточных вод, для удаления органических загрязнителей. Таким образом, после обработки воды в установке для очистки сточных вод, присутствует множество органических загрязнителей, которые можно «расщеплять» посредством бактерий. Таким образом, активированный шлам добавляют к обработанной воде в баке/контейнере для обработки стока из установки для очистки сточных вод.

Однако, иногда бактерии в баке/контейнере (независимо от того, происходят ли они из активированного шлама, собственно сточных вод или окружающей среды), могут доминировать и расти очень быстро. Такой быстрый рост может приводить к росту бактерий в форме волокон. Волокна могут формировать вплоть до 20-30% из популяции бактерий в баке или контейнере, и они всплывают. Рост этих волокон приводит к тому, что известно как объемистый шлам. Настоящее изобретение можно использовать для контроля объемистого шлама, что является важным аспектом при обработке сточных вод.

Таким образом, в одном примере, система представляет собой систему для обработки воды, и поверхность представляет собой поверхность контейнера из системы, где поверхность находится в контакте с водой и первыми клетками-хозяевами; или жидкость, подлежащая обработке, содержит указанные воду и клетки. В одном примере, способом контролируют рост бактерий в шламе из системы сточных вод.

Судоходство и транспорт: Суда и лодки могут подвергаться MIC на их внешних поверхностях (например, корпусах) в контакте с морской водой или водными путями (например, реками, озерами, прудами или пресной водой). Внутренние поверхности корпуса также могут подвергаться MIC, поскольку они, как правило, находятся в контакте с влажностью или жидкостью, которые могут содержать опосредующие MIC микроорганизмы, такие как бактерии, например, в контакте с балластной водой. Например, морская вода часто содержится в корпусах судов (таких как нефтяные танкеры) для обеспечения стабильности в открытом море; такая морская воды содержит бактерии, которые могут опосредовать SRB. Другие транспортные средства, такие как моторные средства передвижения (автомобили, вагонетки, фургоны или грузовики), поезда, космические корабли и воздушные суда также могут являться чувствительными.

Таким образом, в одном примере, система представляет собой транспортное средство (например, для транспортировки товаров и/или людей или скота, например, автомобиль, вагонетку, фургон или грузовик, поезд, космический корабль или воздушное судно). Например, транспортное средство представляет собой судно или лодку, например, нефть, газ или нефтехимические продукты морское судно (например, нефтяной танкер). В одном примере, поверхность, подлежащая обработке, находится в контакте с морской водой. В одном примере, поверхность представляет собой внешнюю поверхность корпуса судна или лодки. В одном примере, поверхность представляет собой внутреннюю поверхность корпуса судна или лодки.

Персистенция или рост бактерий (биообрастание) в балластных водах: Конкретное применение по изобретению представляет собой обработку балластной воды морского транспортного средства (например, судна или лодки) для уменьшения количества нежелательных бактерий, таких как виды Vibrio cholerae, E coli и/или Enterococci.

Судоходство перемещает более 90% грузов во всем мире и является ответственным за глобальное перемещение приблизительно 2-3 миллиардов тонн балластной воды, которую обычно переносят суда для поддержания их равновесия. Сходный объем балластной воды может также переноситься в национальном масштабе внутри стран и областей каждый год (GloBallast Partnerships, www.globallast.imo.org). Балластные воды известны как основной источник инвазивных морских организмов, угрожающих естественно эволюционирующему биоразнообразию, понимание последствий чего увеличивается (Anil et al. 2002). Непреднамеренное введение вызывающих заболевания патогенных бактерий, транспортированных от места возникновения или образованных в ходе транспортировки, может оказывать непосредственное влияние на общество и здоровье людей. В балластных баках судов содержатся различные инородные позвоночные, беспозвоночные, растения, микроскопические водоросли, бактерии и т.д. (Williams et al. 1988; Carlton and Geller 1993; Smith et al. 1996; Ruiz et al. 2000; Drake et al. 2002, 2005, 2007; Mimura et al. 2005). Микроорганизмы, такие как бактерии, вводят в чужеродную окружающую среду в больших количествах, чем другие организмы, из-за их высокой распространенности в природе, способности формировать покоящиеся стадии, и способности выдерживать широкий диапазон условий окружающей среды. Хотя все организмы, взятые на борт в балластных баках, могут не выжить, бактерии и микроводоросли обладают хорошей способностью к переживанию продолжительных периодов неблагоприятных условий посредством формирования цист, спор, или других физиологически покоящихся стадий (Roszak et al. 1983; Hallegraeff and Bolch 1992; Anil et al. 2002; Carney et al. 2011). После высвобождения эти микроорганизмы хорошо подходят, чтобы являться инвазивными из-за их малого размера, который облегчает их пассивное распространение, и более простых требований для выживания, чем у многоклеточных (Deming 1997). Концентрации клеток видов Vibrio в исследованных образцах балласта из судов в гавани Сингапура лежали в диапазоне 1,1-3,9 × 104 мл-1 (Joachimsthal et al. 2004). Непреднамеренное введение вызывающих заболевания патогенных бактерий может оказывать непосредственное влияние на общество, включая влияние на здоровье людей. В более раннем исследовании обнаружено, что большинство патогенов, введенных в Чесапикский залив, происходят из бактерий, ассоциированных с планктоном, а не из собственно слоя воды (Ruiz et al. 2000). Таким образом, микроорганизмы из балластной воды, такие бактерии и археи, вызывают главные опасения в программах обработки/управления для балластной воды.

Международная морская организация (IMO) разработала конвенцию, нацеленную на предотвращение этих опасных эффектов, приняв Международная конвенцию о контроле судовых балластных вод и отложений и управлении ими (Конвенцию по управлению балластными водами) в 2004 г. В США, Окончательный регламент управления балластными водами Береговой охраны Соединенных Штатов, вступивший в силу в июне 2012 г., применим к спуску балластной воды в водах США.

Замену балластных вод в открытом море не считают идеальным способом управления балластными водами, и значительные усилия прилагают для разработки способов обработки. Эти способы должны соответствовать стандарту D-2 Конвенции по управлению балластными водами от IMO. В стандарте D2 указано, что обработанные и спускаемые балластные воды должны иметь:

□ менее десяти жизнеспособных организмов, больших или равных 50 микрометров, в минимальном измерении, на кубический метр

□ менее десяти жизнеспособных организмов, меньших 50 микрометров в минимальном измерении, и больших или равных 10 микрометров, в минимальном измерении на миллилитр.

Кроме того, в стандарте D2 указано, что спуск индикаторных микроорганизмов, не должен превышать указанных концентраций следующим образом:

□ токсиногенный Vibrio cholerae (O1 и O139) с менее, чем одной колониеобразующей единицей (КОЕ) на 100 миллилитров, или с менее чем 1 КОЕ на 1 грамм (массы во влажном состоянии) образцов зоопланктона

Escherichia coli с менее, чем 250 КОЕ на 100 миллилитров

□ кишечные Enterococci с менее, чем 100 КОЕ на 100 миллилитров.

Существуют индикаторные микроорганизмы, в качестве стандарта для здоровья человека, но они не ограничены этими типами. Действительно, предположили, что фактически, в некоторых случаях, используемая обработка балластной воды может ухудшить положение. Посредством удаления небольших организмов, питающихся бактериями, некоторые системы обработки превращают балластные баки в инкубаторы для бактерий, так что обработанные спуски систематически содержат более высокие концентрации бактерий, в некоторых исследованиях, в тысячи раз выше, чем спуски, оставленные без обработки. Бактерии с увеличенным количеством могут включать в себя патогены человека.

В одном примере по изобретению (например, по аспекту 70 или по аспекту, зависимому от аспекта 70), таким образом, система представляет собой судно или лодку, или морское транспортное средство (например, судно или лодку, например, нефтяной танкер в гавани, в доке или в открытом море). В одном примере, жидкость, содержащая первые клетки-хозяева, представляет собой балластную воду морского транспортного средства судна или лодки (например, балластную воду судна или лодка, например, балластную воду нефтяного танкера). В одном примере, система представляет собой морской контейнер или платформу, или установку (например, нефтяную или газовую установку), например, в открытом море. В одном примере, жидкость представляет собой балластную воду из такого контейнера, платформы или установки.

В одном варианте осуществления, неблагоприятные бактерии (первые клетки-хозяева по изобретению, например, по аспекту 70 или по аспекту, зависимому от аспекта 70) принадлежат к видам, выбранным из группы, состоящей из Vibrio cholerae; Vibrio rumoiensis; видов Vibrio; E coli; видов Enterococcus; Pseudomonas synxantha; Pseudomonas stutzeri; Vibrio lentus; Pseudoalteromonas marina, Pseudoalteromonas tetraodonis; видов Pseudoalteromonas; Pseudomonas putida; Pseudomonas oleovorans; Vibrio splendidus; Vibrio cyclitrophicus; Enterococcus hirae; Enterococcus faecium, Vibrio rotiferianus; Pseudoalteromonas undina; Serratia plymuthica; Pseudomonas fulva; Pseudomonas tolaasii; Pseudomonas stutzeri; Pseudomonas stutzeri; Vibrio tubiashii; Halomonas venusta; Idiomarina loihiensis; Vibrio cyclitrophicus; Vibrio tubiashii; Serratia plymuthica; видов Pseudoalteromonas; Pseudoalteromonas atlantica; Pseudomonas synxantha; Pseudomonas stutzeri; Pseudoalteromonas carrageenovora; видов Tenacibaculum; Bacillus mycoides; Vibrio natriegens; Bacillus baekryungensis; Enterococcus hirae; Lactobacillus pentosus; Pseudoalteromonas carrageenovora; и Pseudomonas aeruginosa.

В одном примере, первые клетки-хозяева представляют собой аэробные гетеротрофные бактерии. В одном примере, первые клетки-хозяева представляют собой клетки Vibrio cholerae (например, штамма O1 и/или O139). В одном примере, первые клетки-хозяева представляют собой клетки E coli. В одном примере, первые клетки-хозяева представляют собой клетки видов Enterococcus клетки.

В «Characterization of Bacteria in Ballast Water Using MALDI-TOF Mass Spectrometry», Kaveh E et al, PLoS One. 2012; 7(6): e38515; Published online 2012 Jun 7. doi: 10,1371/journal.pone.0038515 (содержание которого приведено в настоящем документе в качестве ссылки) описан пригодный быстрый и экономически эффективный способ мониторирования бактерий в балластной воде.

Конкретный пример по изобретению является следующим:-

Способ контроля бактериального биообрастания в балластной воде судна или лодки, где вода содержит популяцию первых клеток-хозяев из первого вида микроорганизмов (таких как виды Cholera, E coli или Enterococci sp), опосредующих указанное биообрастание, где способ включает в себя (i) приведение популяции в контакт со множеством векторов, способных трансформировать или трансдуцировать клетки, где каждый вектор содержит массив CRISPR, в результате чего массивы CRISPR вводят в клетки-хозяева, где

(a) каждый массив CRISPR содержит одну или несколько последовательностей для экспрессии crРНК и промотор для транскрипции последовательности(последовательностей) в клетке-хозяине; и

(b) каждая crРНК является способной гибридизоваться с последовательностью-мишенью из клетки-хозяина для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); последовательность-мишень представляет собой последовательность гена для обеспечения жизнеспособности клетки-хозяина; и

(ii) обеспечение экспрессии указанных cРНК в присутствии Cas в клетках-хозяевах, таким образом, модификации последовательностей-мишеней в клетках-хозяевах, приводящей к уменьшению жизнеспособности клетки-хозяина и контролю указанного биообрастания.

В одном примере, стадия (i) включает в себя смешивание балластной воды с векторами, например, в корпусе судна или лодки.

В одном примере, судно или лодка представляет собой морское транспортное средство, и вода представляет собой морскую воду. Вместо судна или лодки, альтернативно, балластная вода содержится в контейнере или буровой платформе в открытом море, например, нефтяной платформе или нефтевышке.

Изобретение относится также к способу спуска балластной воды из судна или лодки, где спущенная балластная вода содержит воду, обработанную способом из конкретного примера выше. В одном примере, воду спускают в водоем, например, в море, океан или водные пути (например, в реку, канал, озеро или резервуар).

Изобретение относится также к балластной воде судна или лодки, содержащей массивы CRISPR, где балластная вода получена или может быть получена посредством конкретного примера выше. Изобретение относится также к балластной воде морского контейнера, содержащей массивы CRISPR, где балластная вода получена или может быть получена посредством конкретного примера выше. Изобретение относится также к балластной воде из платформы или установки (например, нефтяной или газовой установки) в открытом море, где вода содержит массивы CRISPR, где балластная вода получена или может быть получена посредством конкретного примера выше. Массивы являются такими, как перечислено в (a) и (b) из конкретного примера.

Ссылки:

1. Anil AC, Venkat K, Sawant SS, Dileepkumar M, Dhargalkar VK, Ramaiah N, Harkantra SN and Ansari ZA (2002) Marine bioinvasion: Concern for Ecology and Shipping. Current Science 83(3): 214-218;

2. Azam F and Malfatti F (2007) Microbial structuring of marine ecosystems. Nature Reviews Microbiology 5: 782-791;

3. Belkin S and Colwell RR (2005) Ocean and health: pathogens in the marine environment. New York, NY:Springer;

4. Carlton JT and Geller JB (1993) Ecological roulette: the global transfer of non-indigenous marine organisms. Science 261: 78-82;

5. Carman KR and Dobbs FC (1997) Epibiotic microorganisms in copepods and other marine crustaceans. Microscopy Research and Technique 37: 116-135;

6. Carney KJ, Delany JE, Sawant SS, Mesbahi E (2011) The effects of prolonged darkness on temperate and tropical marine phytoplankton, and their implications for ballast water risk management. Marine Pollution Bulletin 62(6):1233-1244;

7. Colwell RR (1996) Global climate and infectious disease: the cholera paradigm. Science 274: 2025-2031;

8. Conway DVP, White RG, Hugues-Dit-Ciles J, Gallienne CP, Robins DB (2003) Guide to the coastal and surface zooplankton of the southwestern Indian Ocean. In: Marine Biological Association of the United Kingdom Occasional Publication. UKDEFRA Darwin Initiative Project 162/09/004 Zooplankton of the Mascarene Plateau, vol 15, pp 1-354;

9. Daley RJ and Hobbie JE (1975) Direct counts of aquatic bacteria by a modified epifluorescence technique. Limnology and Oceanography 20: 875-882;

10. Deming JW (1997) Unusual or extreme high-pressure marine environments. In: ASM Manual of Environmental Microbiology, Hurst CJ, Knudsen GR, McInerney MJ, Stetzenbach LD, Walter MV (editors), Washington, DC: ASM Press, pp 366-376;

11. Drake LA, Ruiz GM, Galil BS, Mullady TL, Friedmann DO and Dobbs FC (2002) Microbial ecology of ballast water during a transoceanic voyage and the effects of open-ocean exchange. Marine Ecology Progress Series 233: 13-20;

12. Drake LA, Meyer AE, Forsberg RL, Baier RE, Doblin MA, Heinemann S, Johnson WP, Koch M, Rublee PA and Dobbs FC (2005) Potential invasion of microorganisms and pathogens via 'interior hull fouling': biofilms inside ballast water tanks. Biological Invasions 7: 969-982;

13. Drake LA, Doblin MA and Dobbs FC (2007) Potential microbial bioinvasions via ship's ballast water, sediment and biofilm. Marine Pollution Bulletin 55: 333-341;

14. Dawson MP, Humphrey BA and Marshall KC (1981) Adhesion: A tactic in the survival strategy of a marine Vibrio during starvation. Current Microbiology 6: 195-199;

15. Foladori P, Bruni L, Andreottola G and Ziglio G (2007) Effects of sonication on bacteria viability in wastewater treatment plants evaluated by flow cytometry-fecal indictors, wastewater and activated sludge. Water Research 41: 235-243;

16. Hallegraeff GM and Bolch CJ (1992) Transport of diatoms and dinoflagellate resting spores in ships ballast water: implications for plankton biogeography and aquaculture. Journal of Plankton Research 14(8): 1067-1084;

17. Harris JM (1993) The presence, nature and role of gut microflora in aquatic invertebrates: a synthesis. Microbial Ecology 25: 195-231;

18. Heidelberg JF, Heidelberg KB and Colwell RR (2002) Bacteria of the gamma-subclass Proteobacteria associated with zooplankton in Chesapeake Bay. Applied and Environmental Microbiology 68: 5498-5507;

19. Hood MA, Ness GE, Rodrick GE, Blake NJ (1984) The ecology of Vibrio cholerae in two Florida estuaries. In: Vibrios in the Environment, Colwell R (editor), New York, NY: Wiley, pp 399-409;

20. Huq A, West PA, Small EB and Colwell RR (1984) Influence of water temperature, salinity and pH on survival and growth of toxigenic Vibrio cholerae serovar O1 associated with live copepods in laboratory microcosms. Applied and Environmental Microbiology 48: 420-424;

21. International Maritime Organization (IMO) (2004) International convention for the control and management of ships' ballast water and sediments. London: International Maritime Organization;

22. Joachimsthal EL, Ivanov V, Tay ST-L and Tay J-H (2004) Bacteriological examination of ballast water in Singapore Harbour by flow cytometry with FISH. Marine Pollution Bulletin 49: 334-343;

23. Jyoti KK and Pandit AB (2001) Water disinfection by acoustic and hydrodynamic cavitation. Biochemical Engineering Journal 7: 201-212;

24. Kasturirangan LR (1963) A key for the identification of the more common planktonic copepoda of Indian coastal waters. In: Indian National Committee on Oceanic Research, Panikkar NK (editor), New Delhi: Council of Scientific and Industrial Research, p 87;

25. Khandeparker L & Anil AC; Ecohealth. 2013 Sep;10(3):268-76. doi: 10.1007/s10393-013-0857-z. Epub 2013 Jul 12, «Association of bacteria with marine invertebrates: implications for ballast water management»;

26. Krieg NR (1984) Bergey's manual of systematic bacteriology, Vol 1. Williams & Wilkins, Baltimore;

27. Lee BG and Fisher NS (1992) Decomposition and release of elements from zooplankton debris. Marine Ecology Progress Series 88: 117-128;

28. Lloyd's Register (2010) Ballast water treatment technology guide;

29. McFall-Ngai MJ and Ruby EG (1991) Symbiont recognition and subsequent morphogenesis as early events in an animal-bacterial mutualism. Science 254: 1491-1494;

30. Mimura H, Katakura R and Ishida H (2005) Changes of microbial populations in a ship's ballast water and sediments on a voyage from Japan to Qatar. Marine Pollution Bulletin 50: 751-757;

31. Munro PM and Colwell RR (1996) Fate of Vibrio cholerae O1 in sea water microcosms. Water Research 30(1): 47-50;

32. Pfeffer C and Oliver DJ (2003) A comparison of thiosulphate-citrate-bile salts-sucrose (TCBS) agar and thiosulphate-chloride-iodide (TCI) agar for the isolation of Vibrio species from estuarine environments. Letters in Applied Microbiology 36: 150-151;

33. Peter H and Sommaruga R (2008) An evaluation of methods to study the gut bacterial community composition of fresh water zooplankton. Journal of Plankton Research 30: 997-1006;

34. Polz MF, Distel DL, Zarda B, Amann R, Felbeck H, Ott JA and Cavanaugh CM (1994) Phylogenetic analysis of a highly specific association between ectosymbiotic, sulfuroxidizing bacteria and a marine nematode. Applied and Environmental Microbiology. 60: 4461-4467;

35. Pruzzo C, Vezzulli L and Colwell RR (2008) Global impact of Vibrio cholerae interactions with chitin. Environmental Microbiology 10(6):1400-1410;

36. Rehnstam-Holm A-S, Godhe A, Härnström K, Raghunath P, Saravanan V, Collin B, Karunasagar I and Karunasagar I (2010) Association between phytoplankton and Vibrio spp. along the southwest coast of India: a mesocosm experiment. Aquatic Microbial Ecology 58: 127-139;

37. Richard C (1993) Chromobacterium violaceum, opportunistic pathogenic bacteria in tropical and subtropical regions. Bulletin de la Société de Pathologie exotique 86: 169-173;

38. Roszak DB, Grimes DJ and Colwell RR (1983) Viable but nonrecoverable stage of Salmonella enteritidis aquatic systems. Canadian Journal of Microbiology 30: 334-338;

39. Ruiz GM, Rawlings TK, Dobbs FC, Drake LA, Mullady T, Huq A and Colwell RR (2000) Global spread of microorganisms by ships-Ballast water discharged from vessels harbours a cocktail of potential pathogens. Nature 408: 49-50;

40. Sawant SS, Anil AC, Krishnamurthy V, Gaonkar C, Kolwalkar J, Khandeparker L, Desai DV, Mahulkar AV, Ranade VV and Pandit AB (2008) Effect of hydrodynamic cavitation on zooplankton: A tool for disinfection. Biochemical Engineering Journal 42: 320-328;

41. Seth N, Chakravarty P, Khandeparker L, Anil AC and Pandit AB (2010) Quantification of the energy required for the destruction of Balanus amphitrite larva by ultrasonic treatment. Journal of the Marine Biological Association of the United Kingdom 90 (7):1475-1482;

42. Smith LD, Wonham MJ, McCann LD, Reid DM, Carlton JT, Ruiz GM (1996) Biological Invasions by Nonindigenous Species in United States Waters: Quantifying the Role of Ballast Water and Sediments. Parts I and II. Report Number CG-D-02-97, Groton, CT: US Coast Guard Research and Development Center;

43. Tang KW (2005) Copepods as microbial hotspots in the ocean: effects of host feeding activities on attached bacteria. Aquatic Microbial Ecology 38: 31-40;

44. Tang KW, Freund CS and Schweitzer CL (2006) Occurrence of copepod carcasses in the lower Chesapeake Bay and their decomposition by ambient microbes. Estuarine, Coastal and Shelf Science 68: 499-508;

45. Tang KW, Dziallas C, Hutalle-Schmelzer K and Grossart HP (2009) Effects of food on bacterial community composition associated with the copepod Acartia tonsa Dana. Biological Letters 5: 549-553;

46. Thompson CC, Thompson FL, Vandemeulebroecke K, Hoste B, Dawyndt P and Swings J (2004) Use of recA as an alternative phylogenetic marker in the family Vibrionaceae. International Journal of Systematic and Evolutionary Microbiology 54:919-929;

47. Todd CD, Laverack MS, Boxshall GA (1966) Coastal marine zooplankton: A practical manual for students, London, UK: The Natural History Museums, p 106;

48. Diovisalvi NR and Cepeda GD (2010) Individual biovolume of some dominant copepod species in coastal waters off Buenos Aires Province, Argentine sea. Brazilian Journal of Oceanography 58(2): 177-181;

49. Williams RJ, Griffiths FB, Van der Wal EJ and Kelly J (1988) Cargo vessel ballast water as a vector for the transport of nonindigenous marine species. Estuarine, Coastal and Shelf Science 26: 409-420.

Изобретение относится также к следующим векторам и массивам CRISPR.

85. Вектор, содержащий массив CRISPR для введения в бактериальную клетку-хозяина, где бактерия является способной к переносу через воду, где

(a) массив CRISPR содержит последовательность для экспрессии crРНК и промотор для транскрипции последовательности в указанной клетке-хозяине;

(b) crРНК является способной гибридизоваться с последовательностью-мишенью клетки-хозяина для направления Cas (например, нуклеазы Cas) в клетке-хозяине для модификации последовательности-мишени (например, для разрезания последовательности-мишени); где последовательность-мишень представляет собой нуклеотидную последовательность (например, ген или регуляторную последовательность) для обеспечения жизнеспособности клетки-хозяина;

(c) где последовательность из (a) содержит последовательность R1-S1-R1' для экспрессии и продукции crРНК, где R1 представляет собой первый повтор CRISPR, R1' представляет собой второй повтор CRISPR, и R1 или R1' является необязательным; и S1 представляет собой первый спейсер CRISPR, который содержит нуклеотидную последовательность или состоит из нуклеотидной последовательности, на 80% или более идентичной (например, на 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичной) последовательности-мишени клетки-хозяина.

Под «передачей через воду» понимают, что клетки указанной бактерии являются способными к распространению в воде или водосодержащей жидкости между различными организмами, внутри организма, между различными окружающими средами, или между организмом и окружающей средой. Примеры представляют собой Vibro cholera, виды Enterococcus и E coli. Vibrio cholerae представляет собой грамотрицательную бактерию в форме запятой с полярным жгутиком. Она принадлежит к классу протеобактерий гамма. Существует два главных биотипа V. cholerae, классический и El Tor, и многочисленные серогруппы. V. cholerae является этиологическим агентом холеры, тяжелой бактериальной инфекции тонкого кишечника, и основной причины смерти в развивающихся странах. Гены патогенности V. cholerae являются представляющими интерес мишенями для детекции и для исследования инфекций V. cholerae. Большинство из этих генов локализованы в двух островках патогенности, названных TCP (совместно регулируемого с токсином пиля) и CTX (холерных токсинов), организованных в форме профагов 1,2. TCP содержит кластер генов, валеченных в адгезию хозяина посредством пиля, в то время как гены CTX вовлечены в синтез холерного токсина 3.

В одном варианте осуществления, вектор представляет собой выделенный вектор (т.е., вектор не в указанной клетке-хозяине). В одном примере, вектор представляет собой сконструированный или синтетический вектор (т.е., неприродный вектор).

В одном примере, массив представляет собой массив ICP1, т.е., массив фага ICP1 V cholerae, например, где фаг представляет собой ICP1_2003_A, ICP1_2004_A, ICP1_2005_A, ICP1_2006_E или ICP1_20011_A. В одном примере массив представляет собой массив CR1 или CR2 фага ICP1, например, сконструированное или неприродное производное такого массива.

В одном примере, массив CRISPR и Cas принадлежат к системе типа 1-E или типа 1-F, например, подтипа 17.

В одном примере, массив CRISPR содержит множество последовательностей, где каждая предназначена для экспрессии соответствующей crРНК и является ассоциированной с промотором для транскрипции последовательности в указанной клетке-хозяине.

В одном примере, этот вектор или каждый вектор содержит множество (например, 2, 3, 4, 5, 6, 7, 8, 9, 10 или более) указанных массивов CRISPR.

В одном примере, вектор содержит нуклеотидную последовательность, кодирующую указанную Cas.

В другом примере, вектор лишен такой последовательности. Например, в этом случае, массив(ы) являются способными функционировать с одной или несколькими Cas, продуцированными клеткой-хозяином.

86. Вектор из аспекта 85, где клетка представляет собой клетку Vibrio cholerae, Enterococcus или E coli.

87. Вектор из аспекта 85 или 86, где вектор лишен нуклеотидной последовательности, способной экспрессировать указанную Cas.

В одном примере, таким образом, вектор не кодирует нуклеазу Cas. Альтернативно, вектор кодирует указанную Cas.

88. Вектор из аспекта 85, 86 или 87, где последовательность-мишень представляет собой последовательность протоспейсера из 17-45 смежных нуклеотидов, например, 18, 19, 20 или 21 смежных нуклеотидов.

В одном примере, каждый спейсер (S1) представляет собой нуклеотидную последовательность из 17-45 смежных нуклеотидов, например, 18, 19, 20, 21, 30, 31, 32 или 33 смежных нуклеотидов. Последовательность протоспейсера для V cholerae PLE составляет, например, 32 смежных нуклеотидов, и нацеленный на нее вектор может, например, обладать спейсерной последовательностью из 32 смежных нуклеотидов, которая является на 100% или по меньшей мере на 80, 90 или 95% идентичной последовательности PLE из 32 нуклеотидов. Когда вектор содержит множество спейсеров, спейсеры могут представлять собой смесь из различных спейсеров, или могут представлять собой идентичные спейсеры. Например, массив содержит множество спейсеров, где подгруппа спейсеров являются идентичными. Идентичные спейсеры могут являться гомологичными последовательности протоспейсера из гена, кодирующего, например, фактор патогенности клетки-хозяина. Использование множества спейсеров может являться преимущественным, если хозяин разрезает один или несколько спейсеров при нахождении вектора внутри клетки - неразрезанные спейсеры все еще являются способными формировать crРНК и нацеливаться на последовательности-мишени. Использование смеси различных спейсеров в векторе или в массиве является преимущественным для минимизации риска адаптации хозяина к проникающему вектору, таким образом, минимизации устойчивости.

89. Вектор по любому из аспектов 85-88, где последовательность-мишень представляет собой последовательность из гена вирулентности, гена устойчивости или жизненно важного гена. В одном примере, последовательность-мишень представляет собой последовательность подобного PICI элемента (PLE), например, PLE V. cholerae. Например, PLE1.

90. Вектор по любому из аспектов 85-89, где последовательность-мишень представляет собой последовательность островка патогенности, необязательно, где клетка-хозяин представляет собой клетку Vibrio cholera, и последовательность-мишень представляет собой последовательность TCP, CTX или VPI. В одном примере (например, где хозяин представляет собой Vibrio) островок патогенности представляет собой TCP (совместно регулируемого с токсином пиля) или CTX (холерных токсинов). островок патогенности Vibrio (VPI) содержит гены, в первую очередь вовлеченные в образование совместно регулируемого с токсином пиля (TCP). Это представляет собой большой генетический элемент (приблизительно 40 т.п.о.), фланкированный двумя областями повторов (подобные att участки), напоминающий по структуре геном фага. VPI содержит два кластера генов, кластер TCP, и кластер ACF, вместе с несколькими другими генами. Кластер acf состоит из четырех генов: acfABCD. Кластер tcp состоит из 15 генов: tcpABCDEFHIJPQRST и регуляторный ген toxT.

91. Вектор по любому из аспектов 85-90, где клетка-хозяин представляет собой Vibrio cholera, и последовательность-мишень представляет собой последовательность гена CTXφ. Гены для холерного токсина несет CTXphi (CTXφ), умеренный бактериофаг, вставленный в геном V. cholerae. CTXφ может переносит гены холерных токсинов от одного штамма V. cholerae к другому, в одной из форм горизонтального переноса генов. Гены для совместно регулируемого с токсином пиля кодирует островок патогенности VPI (VPI).

92. Вектор по любому из аспектов 85-90, где клетка-хозяин представляет собой Vibrio cholera, и последовательность-мишень представляет собой последовательность ctxB, tcpA, ctxA, tcpB, wbet, hlyA, hapR, rstR, mshA или tcpP.

93. Вектор по любому из аспектов 85-92, где последовательность-мишень составляет 17-45 смежных нуклеотидов (например, 18, 19, 20 или 21 смежных нуклеотидов) и по меньшей мере на 80% (например, на 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100% идентичности) идентична последовательности индуцируемого фагом хромосомного островка (PICI) грамположительной бактерии, например, островка патогенности Staphylococcus aureus (SaPI). Примеры спейсерных последовательностей фага ICP1 (также известного как родственный ICP1 фаг), представлены ниже. Эти спейсерные последовательности являются гомологичными последовательностям-мишеням (последовательностям протоспейсера) в V cholera.

94. Вектор по любому из аспектов 85-93, где клетка-хозяин представляет собой Vibrio cholera, и crРНК является способной гибридизоваться с последовательностью-мишенью внутри 5, 4 или 3 нуклеотидов из мотива, смежного с протоспейсером (PAM), в клетке Vibrio cholerae, где PAM представляет собой GA.

95. Вектор по любому из аспектов 85-94, где клетка-хозяин представляет собой Vibrio cholera, и клетка представляет собой клетку Vibrio cholerae El Tor, O1 или O139. В одном примере, V. cholerae принадлежит к серотипу O1 El Tor N16961; El Tor биотипа 18; или El Tor штамма MJ-1236. В одном примере, клетка-хозяин представляет собой клетку E. coli O157:H7.

96. Вектор по любому из аспектов 85-95, где вектор представляет собой бактериофаг, который является способным к инфекции указанной клетки-хозяина. В одном примере, клетка-хозяин представляет собой E coli, и фаг представляет собой фаг лямбда или T4. В одном примере, клетка-хозяин представляет собой клетку Enterococcus, и фаг представляет собой фаг IME-EF1, phiEF24C, ϕEf1 или EFDG1 Enterococcus (см. Appl Environ Microbiol. 2015 Apr;81(8):2696-705. doi: 10,1128/AEM.00096-15. Epub 2015 Feb 6, «Targeting Enterococcus faecalis biofilms with phage therapy», Khalifa L et al).

97. Вектор из аспекта 96, где клетка-хозяин представляет собой Vibrio cholera, и вектор представляет собой бактериофаг, способный к инфекции клетки Vibrio cholerae.

98. Вектор из аспекта 97, где бактериофаг выбран из фага CTXφ, ICPI и миовируса, например, где фаг представляет собой ICP1_2003_A, ICP1_2004_A, ICP1_2005_A, ICP1_2006_E или ICP1_20011_A, необязательно, сконструированный и неприродный фаг.

99. Вектор по любому из аспектов 85-98, где вектор представляет собой или содержит ICE, например, транспозон. ICE может обладать любым из признаков ICE, описанных в настоящем документе.

100. Вектор из аспекта 99, где транспозон представляет собой конъюгативный транспозон, способный к переносу от первой к второй указанной клетке-хозяину.

101. Вектор из аспекта 99 или 100, где транспозон оставляет копию массива CRISPR в первой клетке.

102. Вектор по любому из аспектов 85-101, где этот или каждый массив содержится в соответствующем мобильном генетическом элементе (MGE), где MGE содержит точку начала переноса (oriT), способную функционировать в клетке-хозяине. MGE может представлять собой любой MGE, описанный в настоящем документе.

103. Вектор по любому из аспектов 85-102, где вектор представляет собой сконструированный вектор.

104. Композиция для обработки воды или пищевого продукта, содержащая множество векторов по любому из аспектов 85-103.

В одном примере, вода представляет собой балластную воду, морскую воду, солончаковую воду, пресную воду, питьевую воду, воду из водных путей (например, воду из устья) или промышленную воду. В одном примере, вода представляет собой воду в жидкости GI тракта человека.

В одном примере, клетка-хозяин содержится в моллюске, рыбе, рисе или зерно. В одном примере, композиция предназначена для обработки пищевых продуктов, и клетка-хозяин представляет собой клетку E. coli O157:H7. В одном примере, the последовательность-мишень представляет собой последовательность, кодирующую токсин Shiga в клетке-хозяине E coli (например, O157:H7). Альтернативно, для передающихся через воду видов, описанных до настоящего времени, клетка-хозяин представляет собой клетку Salmonella или Listeria.

105. Лекарственное средство для лечения или предотвращения инфекции Vibrio cholerae у человека, где лекарственное средство содержит множество векторов по любому из аспектов 85-103. Альтернативно, изобретение относится к лекарственному средству для лечения или предотвращения инфекции E coli у человека, где лекарственное средство содержит множество векторов по изобретению. Альтернативно, изобретение относится к лекарственному средству для лечения или предотвращения инфекции Enterococcus у человека, где лекарственное средство содержит множество векторов по изобретению.

106. Композиция или лекарственное средство из аспекта 104 или 105, дополнительно содержащие антибиотик против клетки-хозяина или биоцид против клетки-хозяина.

Пример 5 ниже представляет собой пример, относящийся к холере.

Любой из общих признаков (см. ниже) также можно применять для настоящей конфигурация (шестой конфигурации). Любая конфигурация ниже является сочетаемой с настоящей конфигурацией, например, для обеспечения комбинации признаков для включения в один или несколько пунктов формулы изобретения в настоящем документе.

РЕГУЛЯЦИЯ активности Cas

Эти аспекты по изобретению можно использовать для регуляции активности Cas, например, в клетке или in vitro. Изобретение включает в себя нацеливание на кодирующий Cas ген для ограничения активности Cas, что является преимущественным для временной регуляции Cas. Изобретение можно также использовать в условиях, где увеличенная строгость активности Cas является желательной, например, для уменьшения шансов нецелевого разрезания Cas при модификации генома клетки. Существуют применения, например, при модификации клеток человека, животных или растений, где нецелевые эффекты необходимо минимизировать или исключить, например, для генотерапии или нацеливания на гены клетки или ткани или организма, содержащего клетку. Например, очень высокая строгость необходима при использовании модификации Cas для получения желательных изменений в клетке человека (например, клетке iPS), предназначенной для введения пациенту для генотерапии или для лечения или предотвращения заболевания или состояния у человека. Описание относится к этим применениям в качестве части способов и продуктов по изобретению.

Изобретение таким образом, относится к следующим пунктам:-

1. Способ модификации поддающегося экспрессии гена, кодирующего первую Cas, где способ включает в себя

(a) объединение направляющей РНК (gРНК1) с геном Cas в присутствии первой Cas, которая экспрессируется с указанного гена; и

(b) обеспечение гибридизации gРНК1 с последовательностью указанного гена Cas (например, его промотором или кодирующей первую Cas последовательностью ДНК) и направления первой Cas на ген, в результате чего Cas модифицирует ген Cas.

В одном примере, способ представляет собой бесклеточный способ (например, способ рекомбинационной инженерии) in vitro. В другом примере, способ осуществляют в клетке, например, где ген разрезают посредством Cas, которую саму он кодирует (т.е., эндогенную Cas используют для разрезания гена).

2. Способ по пункту 1, где Cas представляет собой нуклеазу, и ген Cas разрезают.

3. Способ по пункту 1 или 2, где ген Cas подвергают мутации, понижающей регуляции или инактивации.

4. Способ по любому из пунктов 1-3, где первая Cas представляет собой Cas9.

5. Способ по любому из пунктов 1-4, где gРНК1 представляет собой одиночную направляющую РНК.

6. Способ по любому из пунктов 1-5, где способ осуществляют в клетке-хозяине.

7. Способ по пункту 6, где клетка представляет собой прокариотическую клетку, например, клетку бактерий или архей (например, клетку E coli).

8. Способ по пункту 6, где способ представляет собой способ рекомбинационной инженерии.

9. Способ по пункту 6, 7 или 8, где клетка принадлежит к патогенным видам или штаммам для человека или не относящегося к человеку животного (например, S aureus).

10. Способ по любому из пунктов 6-9, где клетка представляет собой клетку из видов микробиома человека, например, видов микробиома кишечника человека.

11. Способ по любому из пунктов 6-10, где ген Cas содержится в системе CRISPR/Cas хозяина.

Необязательно, экзогенную первую кодирующую Cas последовательность не используют в способе, например, когда клетка-хозяин содержит эндогенную нуклеазу Cas дикого типа, которая является родственной gРНК1.

12. Способ по пункту 6, где клетка представляет собой эукариотическую клетку (например, клетку человека, не относящегося к человеку животного, дрожжей или растений).

13. Способ по пункту 12, где способ осуществляют в не относящемся к человеку эмбрионе; в не относящейся к человеку зиготе; в не относящейся к человеку зародышевой клетке; или у человека или животного (например, где способ представляет собой косметический способ); необязательно, где способ не является способом лечения организма человека или животного посредством хирургии или терапии, или диагностики.

14. Способ по любому из пунктов 6-3, где ген Cas содержится в нуклеиновой кислоте, которую вводят в клетку на стадии (a).

15. Способ по любому из пунктов 6-4 для уменьшения развития устойчивости клетки-хозяина к трансформации вектором на основе нуклеиновой кислоты или для поддержания вектора на основе нуклеиновой кислоты в клетке-хозяине.

16. Способ по любому из пунктов 1-15, или нуклеиновая кислота или ее клеточный продукт для медицинской терапии, профилактики или диагностики для человека или животного (например, для генотерапии человека или животного, клетки человека или животного, когда способ осуществляют в клетке человека или животного; или для лечения или предотвращения бактериальной инфекции у человека или животного, когда способ осуществляют в бактериальной клетке).

17. Способ по любому из пунктов 1-6, где способ осуществляют in vitro.

18. Способ по любому из пунктов 1-16, где способ осуществляют in vivo, необязательно, не в эмбрионе человека и необязательно, где способ не является способом лечения организма человека или животного посредством хирургии или терапии, или диагностики.

19. Способ по любому из пунктов 1-18, где gРНК1 получают посредством транскрипции с первой нуклеиновой кислотой, которую объединяют с геном Cas на стадии (a).

20. Способ по пункту 19, где способ осуществляют в клетке, и первую нуклеиновую кислоту, кодирующую gРНК1, вводят в клетку на стадии (a); или первую нуклеиновую кислоту, кодирующую crРНК вводят в клетку на стадии (a) где crРНК формирует gРНК1 с tracrРНК в клетке.

21. Способ по пункту 19 или 20, где ген Cas объединяют с нуклеиновой кислотой-мишенью, содержащей участок-мишень (CS-t), подлежащий модификации посредством первой Cas, и где

I. ген Cas содержит первый протоспейсер (PS1), смежный с PAM (P1), который является родственным первой Cas, где PS1 модифицируют (например, разрезают) в первом участке (CS1) посредством первой Cas;

II. gРНК1 содержит последовательность, комплементарную PS1, для направления первой Cas, где PS1 модифицируют в CS1 на стадии (b);

III. нуклеиновая кислота-мишень содержит последовательность протоспейсера (PS-t), смежную с PAM (P-t), где P-t является родственным первой Cas;

IV. до или во время стадии (b) способ включает в себя объединение направляющей РНК (gРНК-t) с нуклеиновой кислотой-мишенью, и первая Cas экспрессируется с указанного гена, где gРНК-t гибридизуется с PS-t и направляет первую Cas для модификации CS-t; и

V. способ, необязательно, включает в себя выделение или секвенирование модифицированной нуклеиновой кислоты-мишени.

22. Способ по пункту 21, где gРНК-t получают посредством транскрипции с нуклеиновой кислоты (например, указанной первой нуклеиновой кислоты), которую объединяют с Cas на стадии IV.

23. Способ по пункту 22, где способ осуществляют в клетке, и нуклеиновая кислота кодирует crРНК, где crРНК формирует gРНК-t с tracrРНК в клетке.

24. Способ по любому из пунктов 21-23, где продукция gРНК1 начинается после продукции gРНК-t, в результате чего PS-t модифицируют (например, разрезают) в копии нуклеиновой кислоты-мишени, до того, как PS1 модифицируют (например, разрезают) для понижающей регуляции или инактивации экспрессии первой Cas.

25. Способ по любому из пунктов 1-24, дополнительно включающий в себя объединение разрезанной нуклеиновой кислоты-мишени с дополнительной нуклеиновой кислотой, в результате чего имеет место гомологичная рекомбинация между нуклеиновыми кислотами, и

(i) нуклеотидную последовательность нуклеиновой кислоты-мишени делетируют;

(ii) нуклеотидную последовательность дополнительной нуклеиновой кислоты делетируют;

(iii) нуклеотидную последовательность нуклеиновой кислоты-мишени вставляют в дополнительную нуклеиновую кислоту; и/или

(iv) нуклеотидную последовательность дополнительной нуклеиновой кислоты вставляют в нуклеиновую кислоту- мишень.

26. Способ по пункту 25, где (i) имеет место, таким образом, инактивируя нуклеотидную последовательность или регуляторный элемент нуклеиновой кислоты-мишени.

27. Способ по пункту 25, где (i) имеет место, таким образом, активируя нуклеотидная последовательность или регуляторный элемент нуклеиновой кислоты-мишени.

28. Способ по пункту 25, 26 или 27, где (ii) имеет место, таким образом, инактивируя нуклеотидную последовательность или регуляторный элемент дополнительной нуклеиновой кислоты.

29. Способ по пункту 25, 26 или 27, где (ii) имеет место, таким образом, активируя нуклеотидную последовательность или регуляторный элемент дополнительной нуклеиновой кислоты.

30. Способ по любому из пунктов 25-29, где (iii) имеет место, необязательно, помещая вставленную последовательность в функциональную взаимосвязь с регуляторным элементом дополнительной нуклеиновой кислоты и/или создавая новую маркерную последовательность.

31. Способ по любому из пунктов 25-30, где (iv) имеет место, необязательно, помещая вставленную последовательность в функциональную взаимосвязь с регуляторным элементом нуклеиновой кислоты-мишени и/или создавая новую маркерную последовательность.

32. Способ по пункту 30 или 31, дополнительно включающий в себя детекцию новой маркерной последовательности или продукта ее экспрессии для определения того, что гомологичная рекомбинация имеет место.

33. Способ по любому из пунктов 21-32, дополнительно включающий в себя выделение или секвенирование продукта нуклеиновой кислоты-мишени, продукта дополнительной нуклеиновой кислоты и/или продукта первого вектора.

34. Способ по любому из пунктов 1-33, где первый вектор является таким, как определено по любому из пунктов 35-55.

35. Первый (например, выделенный) вектор на основе нуклеиновой кислоты или комбинация векторов, например, для применения в способе по пункту 1, где

(a) первый вектор или вектор из указанной комбинации содержит поддающуюся экспрессии нуклеотидную последовательность, кодирующую направляющую РНК (gРНК1, например, a одиночную gРНК), которая является комплементарной предопределенной последовательности протоспейсера (PS1) для направления первой Cas для модификации PS1 в первом участке (CS1), где PS1 является смежным с PAM (P1), который является родственным первой Cas; или поддающаяся экспрессии последовательность кодирует crРНК, которая формирует gРНК1 с tracrРНК; и

(b) PS1 и P1 представляют собой последовательности из поддающегося экспрессии гена, кодирующего первую Cas, и PS1 способен подвергаться модификации в CS1 посредством первой Cas.

Каждый вектор в настоящем документе в любой конфигурации может представлять собой линейную или кольцевую (например, замкнутую кольцевую, необязательно, суперскрученную) ДНК, несущую указанную последовательность(последовательности).

36. Вектор или комбинация по пункту 35, где первая Cas представляет собой нуклеазу, где CS1 способен подвергаться разрезанию нуклеазой.

37. Вектор или комбинация по пункту 35 или 36, где первая Cas представляет собой Cas9.

38. Вектор или комбинация по любому из пунктов 35-37, где gРНК1 представляет собой одиночную направляющую РНК.

39. Вектор или комбинация по любому из пунктов 35-38, где нуклеотидная последовательность поддается экспрессии в прокариотической клетке (например, клетке бактерий или архей) для получения gРНК1.

40. Набор для рекомбинационной инженерии, содержащий вектор или комбинацию по пункту 39 (например, где клетка представляет собой позволяющую рекомбинационную инженерию клетку E coli).

41. Вектор или комбинация по любому из пунктов 35-38, где нуклеотидная последовательность поддается экспрессии в эукариотической клетке (например, клетке человека, животного, растения или дрожжей) для получения gРНК1.

42. Вектор или комбинация по любому из пунктов 35-41, где первый вектор или вектор из указанной комбинации (например, второй вектор) содержит поддающуюся экспрессии нуклеотидную последовательность, кодирующую направляющую РНК (gРНК-t, например, одиночную gРНК), которая является комплементарной предопределенной последовательности протоспейсера (PS-t) нуклеиновой кислоты-мишени для направления первой Cas для модификации (например, разрезания) PS-t; или поддающаяся экспрессии последовательность кодирует crРНК, которая формирует gРНК-t с tracrРНК; нуклеиновая кислота-мишень содержит PS-t, смежный с PAM (P-t), где P-t является родственным первой Cas для модификации PS-t.

43. Вектор или комбинация по пункту 42, дополнительно в комбинации с указанной нуклеиновой кислотой-мишенью.

44. Вектор или комбинация по пункту 43, где указанная нуклеиновая кислота-мишень представляет собой хромосомную или эписомную нуклеиновую кислоту в клетке.

45. Вектор или комбинация по пункту 44, где клетка представляет собой клетку патогенного вида или штамма для человека или не относящегося к человеку животного (например, S aureus).

46. Вектор или комбинация по пункту 44 или 45, где клетка представляет собой клетку из видов микробиома человека, например, из видов микробиома кишечника человека.

47. Вектор или комбинация по любому из пунктов 44-46, где PS-t содержится последовательности жизненно важного гена, гена вирулентности или гена устойчивости к антибиотику в клетке (например, прокариотической клетке).

48. Вектор или комбинация по пункту 47, где ген подвергается понижающей регуляции или инактивации, когда первая Cas модифицирует (например, разрезает) PS-t.

49. Вектор или комбинация по пункту 47, где ген подвергается повышающей регуляции или активации, когда первая Cas модифицирует PS-t.

50. Вектор или комбинация по любому из пунктов 35-49 в комбинации с указанным геном, кодирующим первую Cas (например, содержащемся в первом векторе).

51. Вектор или комбинация по любому из пунктов 35-50 внутри клетки, где клетка содержит систему CRISPR/Cas, содержащую указанный ген, кодирующий первую Cas.

52. Вектор или комбинация по любому из пунктов 35-51 for для лечения, предотвращения или диагностики заболевания или состояния у человека или не относящегося к человеку животного, например, для генотерапии человека или животного, клетки человека или животного, когда способ осуществляют в клетке человека или животного; или для лечения или предотвращения бактериальной инфекции у человека или животного, когда способ осуществляют в бактериальной клетке.

53. Пищевой продукт, ингредиент или предшественник ингредиента пищевого продукта, напиток, вода (например, предназначенные для употребления человеком), вещество в промышленности или окружающей среде (например, нефть, нефтепродукт, почва или водные пути или резервуар; или оборудование для получения или переработки нефтепродукта, почвы, воды, пищевого продукта, ингредиента или предшественника пищевого продукта, или напитка, или ингредиента или предшественника напитка), содержащие первый вектор или комбинацию по любому из пунктов 35-52.

54. Антибиотическая (например, антибактериальная или направленная против архей) композиция первого вектора или комбинации по любому из пунктов 35-52.

55. Лекарственное средство для лечения или предотвращения заболевания или состояния (например, бактериальной инфекции или ожирения) у человека или животного, где лекарственное средство содержит a первый вектор или комбинацию по любому из пунктов 35-52.

В одном примере, вектор, комбинация, лекарственное средство или антибиотик содержатся в медицинском устройстве или медицинском контейнере (например, в шприце, ингаляторе или IV пакете).

Любой из общих признаков (см. ниже) также можно применять для настоящей конфигурация. Любую конфигурацию ниже можно комбинировать с настоящей конфигурацией, например, для обеспечения комбинаций признаков для включения в один или несколько пунктов формулы изобретения в настоящем документе.

ОБЩЕПРИМЕНИМЫЕ ПРИЗНАКИ

Следующие признаки применяют для любой конфигурации (например, в любом из ее аспектов, вариантов осуществления, концепций, абзацев или примеры) по изобретению:-

В одном примере, последовательность-мишень представляет собой хромосомную последовательность, эндогенную последовательность клетки-хозяина, последовательность клетки-хозяина дикого типа, невирусную хромосомную последовательность клетки-хозяина, не экзогенную последовательность и/или нефаговую последовательность (т.е., одну, несколько или все из них), например, последовательность представляет собой последовательность хромосомы клетки-хозяина, такую как последовательность гена устойчивости к антибиотику или жизненно важного гена, содержащаяся в хромосоме клетки-хозяина. В одном примере, последовательность представляет собой последовательность плазмиды клетки-хозяина, например, последовательность гена устойчивости к антибиотику.

В одном примере, по меньшей мере две последовательности-мишени модифицируют посредством Cas, например, ген устойчивости к антибиотику и жизненно важный ген. Множественное нацеливание, таким образом, можно использовать для уменьшения эволюционного ускользания мутантных клеток-хозяев.

В одном примере, Cas представляет собой эндогенную нуклеазу Cas клетки-хозяина дикого типа и/или каждая клетка-хозяин представляет собой клетку-хозяина дикого типа. Таким образом, в одном варианте осуществления по изобретению используют клетки-хозяева без необходимости предварительной дерепрессии эндогенной Cas для обеспечения соответствующей активности Cas. В одном примере, каждая клетка-хозяин обладает конститутивной активностью нуклеазы Cas, например, конститутивной активностью нуклеазы Cas дикого типа. В одном примере, клетка-хозяин представляет собой клетку бактерий; в одном примере клетка-хозяин представляет собой клетку архей. Применение эндогенной Cas является преимущественным, поскольку это позволяет высвобождение места в векторах, кодирующих HM- или PM-cРНК или gРНК. Например, нуклеотидная последовательность Cas9 типа II является большой, и применение вместо нее эндогенной Cas клетки-хозяина является преимущественным в том случае, когда систему CRISPR/Cas типа II используют для модификации клетки-хозяина по настоящему изобретению. Наиболее часто применяемая Cas9, размером 4,2 тысячи пар оснований (т.п.о.), происходит из S pyogenes. В то время как она является эффективной нуклеазой, длина молекулы вынуждает ограничивать то, насколько много генетического материала может вместить вектор, создавая препятствия для использования CRISPR в тканях живых животных и в других условиях, описанных в настоящем документе (см. F.A. Ran et al., «In vivo genome editing using Staphylococcus aureus Cas9», Nature, doi:10,1038/nature14299, 2015). Таким образом, в одном варианте осуществления, вектор по изобретению представляет собой вектор AAV или обладает емкостью для вставки экзогенной ДНК, не большей, чем вектор AAV, и Cas представляет собой эндогенную Cas клетки-хозяина, где клетка представляет собой клетку бактерий или архей.

Нуклеотидная последовательность Cas9 S thermophilus (UniProtKB - G3ECR1 (CAS9_STRTR)) имеет размер 1,4 т.п.о.

В одном варианте осуществления, таким образом, изобретение относится к

Вектору на основе нуклеиновой кислоты, содержащему более 1,4 т.п.о. или более 4,2 т.п.о. экзогенной последовательности ДНК, кодирующей компоненты системы CRISPR/Cas, где последовательность содержит сконструированный массив или сконструированную последовательность (необязательно, как описано в настоящем документе) для экспрессии одной или несколько HM- или PM-crРНК или gРНК в клетках-хозяевах (любых клетках в настоящем документе, например, клетках-хозяевах человека, животного, или бактерий или архей), где массив или сконструированная последовательность не содержит нуклеотидную последовательность, кодирующую нуклеазу Cas, родственную cРНК(нескольким cРНК) или gРНК(нескольким gРНК); необязательно, где по меньшей мере 2, 3 или 4 cРНК или gРНК кодированы экзогенной ДНК. В одном варианте осуществления, клетка-хозяин представляет собой клетку бактерий или архей, экспрессирующую нуклеазу Cas, родственную crРНК или gРНК. В другом примере, например, для применения с клетками человека или животного (например, грызуна, крысы или мыши), нуклеазу Cas кодирует отличный вектор на основе нуклеиновой кислоты. В одном примере, где клетка представляет собой клетку человека или животного, вектор представляет собой AAV или лентивирусный вектор. В одном примере, изобретение относится к клетке-хозяину, содержащей такой вектор, где клетка-хозяин экспрессирует указанную Cas. В одном примере, клетка-хозяин представляет собой клетку человека или животного ex vivo.

Изобретение относится также к

Вектору на основе нуклеиновой кислоты, содержащему более 1,4 т.п.о. или более 4,2 т.п.о. экзогенной последовательности ДНК, где экзогенная ДНК кодирует один или несколько компонентов системы CRISPR/Cas и содержит сконструированный массив или последовательность (например, любые из описанных в настоящем документе) для экспрессии одной или нескольких HM-crРНК или gРНК в клетках-хозяевах, где экзогенная последовательность лишена нуклеотидной последовательности, кодирующей нуклеазу Cas, родственную cРНК(нескольким cРНК) или gРНК(нескольким gРНК); необязательно, где по меньшей мере 2 различные cРНК или gРНК кодированы экзогенной ДНК. В одном примере, изобретение относится к клетке-хозяину, содержащей такой вектор, где клетка-хозяин экспрессирует указанную Cas. В одном примере, cРНК или gРНК являются способными гибридизоваться в клетках-хозяевах с соответствующими последовательностями-мишенями протоспейсера, где каждая последовательность протоспейсера содержится в гене устойчивости к антибиотику или жизненно важном гене хозяина. Это проиллюстрировано посредством рабочих примеров в настоящем документе, где авторы настоящего изобретения показывают избирательное ингибирование роста клетки-хозяина по меньшей мере в 10 раз в смешанной и не смешанной популяции клеток. Смесь имитирует комбинацию видов и штаммов, обнаруженных в микробиоте человека.

Под «экзогенной последовательностью ДНК, кодирующей компоненты системы CRISPR/Cas», понимают ДНК, вставленную в остов вектора, или такую ДНК в потомстве вектора, в котором указанная вставка ранее имела место (например, с использованием технологии рекомбинантной ДНК, такой как рекомбинационная инженерия). В одном примере, экзогенная ДНК составляет 95, 90, 80, 85, 70 или 60% от емкости вектора для вставки.

В одном примере, вектор представляет собой вирусный вектор. Вирусные векторы обладают особенно ограниченной емкостью для вставки экзогенной ДНК, таким образом, необходимо учитывать емкость вируса для упаковки. Необходимо оставлять пространство для последовательностей, кодирующих жизненно важные функции вируса, например, для экспрессии белков оболочки и полимеразы. В одном примере, вектор представляет собой фаговый вектор или AAV, или лентивирусный вектор. Фаговые вектор можно использовать, когда хозяин представляет собой бактериальную клетку.

Изобретение относится к комбинированному набору продуктов (например, для лечения или предотвращения заболевания или состояния у субъекта - человека или животного, как описано в настоящем документе), где набор содержит массив, вектор, систему, клетку, сконструированную кодирующую cРНК или gРНК последовательность или cРНК, или gРНК, которая присутствует в комбинации с антибиотиком (первым антибиотиком), где cРНК или gРНК является способной гибридизоваться с последовательностью протоспейсера, содержащейся в гене устойчивости к антибиотику бактериальной клетки-хозяина, где антибиотик представляет собой указанный первый антибиотик. Антибиотик может представлять собой любой антибиотик, описанный в настоящем документе. В одном варианте осуществления, антибиотик комбинируют в составе с массивом, вектором, системой, клеткой, сконструированной кодирующей cРНК или gРНК последовательностью или с cРНК или gРНК. В одном примере, набор содержит антибиотик в контейнере, отдельном от контейнера, содержащего массив, вектор, систему, клетку, сконструированную кодирующую cРНК или gРНК последовательность, или cРНК или gРНК.

В одном варианте осуществления, если не указано иначе, эта или каждая клетка представляет собой клетку бактерии, клетку археи, клетку водоросли, клетку гриба, клетку простейшего, клетку беспозвоночного, клетку позвоночного, клетку рыбы, клетку птицы, клетку млекопитающего, клетку животного-компаньона, клетку собаки, клетку кошки, клетку лошади, клетку мыши, клетку крысы, клетку кролика, эукариотическую клетку, прокариотическую клетку, клетку человека, клетку животного, клетку грызуна, клетку насекомого или клетку растения. Кроме того, в этом случае предпочтительно, чтобы клетки принадлежали к одному и тому же филуму, порядку, семейству или роду.

При применении термина «сконструированный» специалисту в данной области ясно очевидно, что массив, последовательность, вектор, MGE или любые другие конфигурация, концепция, аспект, вариант осуществления, абзац или пример, и т.д. по изобретению не встречается в природе. Например, MGE, вектор или массив содержит одну или несколько последовательностей или компонентов, не обнаруженные в природе вместе с другими последовательностями или компонентами MGE, вектора или массива. Например, массив является рекомбинантным, искусственным, синтетическим или экзогенным (т.е., не эндогенным или не относящимся к дикому типу) для этой или каждой клетки-хозяина.

В одном примере, массив или вектор по изобретению является выделенным, например, выделенным из клетки-хозяина. В одном примере, массив или вектор не присутствует в комбинации с кодирующей эндонуклеазу Cas последовательностью, обнаруженной в природе в клетке вместе с последовательностями повторов из массива.

В одном примере, вектор, MGE или массив не присутствует в комбинации с кодирующей эндонуклеазу Cas последовательностью, когда не находится в клетке-хозяине. В одном примере, вектор или MGE не содержит кодирующую эндонуклеазу Cas последовательность.

В одном примере, модификацию или разрезание мишени осуществляют посредством нуклеазы дцДНК Cas (например, Cas9, например, spCas9 или saCas9), в результате чего репарация разреза происходит посредством соединения негомологичных концов (NHEJ). Это, как правило, вводит мутации (инделы) в участке репарации, которые можно использовать для инактивации участка-мишени (например, гена или регуляторного элемента фага, такого как его жизненно важный ген или регуляторный элемент). В другом примере, разрезание мишени осуществляют посредством нуклеазы оцДНК нуклеазы Cas (например, нуклеазы Cas9), которая разрезает по одной цепи (но не осуществляет двухцепочечных разрезов ДНК). Это является полезным, чтобы способствовать репарации HDR разреза, что уменьшает шансы инделов. Это можно использовать, когда участок-мишень (или содержащий его ген или регуляторный элемент) является желательным, например, когда HM- или PM-ДНК вставляют в участок-мишень для желательной модификации участка. Например, в этом случае, модифицированный ген образует слитый белок, содержащий кодируемые HM-ДНК аминокислоты, слитые с последовательностью, кодируемой ДНК хозяина, или кодируемую PM-ДНК аминокислотную последовательность, слитую с последовательностью, кодируемой ДНК фага. Изобретение относится также к последовательности, кодирующей слитый белок, которая получена или может быть получена таким способом. В другом примере, HM- или PM-ДНК содержит регуляторный элемент (например, промотор, энхансер, репрессор или индуцируемый переключатель для регуляции экспрессии гена), так что продукт слияния содержит указанную ДНК, слитую с ДНК гена или регуляторного элемента хозяина или фага, таким образом образуя слитый ген. Изобретение относится также к слитому гену, который получен или может быть получен таким способом. В одном варианте осуществления, изобретение относится к вектору (например, вирусу, вириону, фагу, фагмиде, профагу или плазмиде), содержащему такой слитый ген, необязательно, где вектор содержится в бактериальной клетке (например, в клетке прокариот, эукариот, бактерий, архей или дрожжей). В одном примере, клетка присутствует in vitro.

В одном примере, HM- или PM-ДНК представляет собой ДНК вектора внутри клетки. Например, HM-или PM-ДНК в векторе может быть фланкирована участками для сайт-специфической рекомбинации (например, участками frt или lox), которые разрезаются под действием сайт-специфической рекомбиназы, кодируемой последовательностью либо клетки-хозяина, либо вектора. В другом примере, вектор содержит ДНК, которая транскрибируется в РНК-копии HM- или PM-ДНК, и обратную транскриптазу (например, кодируемую последовательностью нуклеиновой кислоты вектора) для получения HM- или PM-ДНК из РНК. Это является полезным для получения множества копий желательной HM- или PM-ДНК для увеличения шансов действенного и эффективного введения в один или несколько участков-мишеней. В другом варианте осуществления, HM- или PM-ДНК является, или является кодированной, нуклеиновой кислой второго вектора (например, второго фага или плазмиды), которым трансдуцируют или трансформируют клетку-хозяина. Например, это может быть фаг-помощник (который может также кодировать один или несколько белков оболочки, необходимых для упаковки первого фагового вектора). В другом примере, ДНК представлена в ДНК вектора и фланкирована плечами, где 5'-плечо содержит PAM, узнаваемый нуклеазой Cas, когда вектор содержится в клетке-хозяине, и 3'-плечо фланкировано непосредственно ниже (3') таким PAM, в результате чего в клетке-хозяине расщепление Cas высвобождает HM- или PM-ДНК с фланкирующими ее плечами, которые можно конструировать, чтобы они являлись гомологичными последовательностям хозяина, фланкирующим разрез в последовательности-мишени хозяина, в результате чего HM-ДНК интегрируют в геном хозяина, или PM-ДНК интегрируют в геном фага. В одном аспекте изобретение относится к нуклеиновой кислоте, содержащей такую HM- или PM-ДНК и плечи, или к вектору (например, фагу или упакованному фагу), содержащему такую нуклеиновую кислоту, необязательно где вектор содержится в клетке-хозяине. Необязательно, HM-ДНК присутствует в комбинации с HM-массивом, как определено в настоящем документе. Необязательно, PM-ДНК присутствует в комбинации с PM-массивом, как определено в настоящем документе.

Конкретным применением изобретения является изменение доли бактерий Bacteroidetes (например, Bacteroides) в смешанной популяции бактерий ex- или in vivo. Как обсуждают выше, это можно использовать для обработки окружающей среды, такой как обработка водных путей или питьевой воды, инфицированных нежелательными Bacteroidetes, или для благоприятствования полезным комменсальным или симбиотическим Bacteroidetes у человека или животных, например, для получения культур бактерий для введения человеку или животным для такой цели. В одном примере последнего, изобретение можно использовать для увеличения относительного соотношения Bacteroidetes к Firmicutes, которое ассоциировано с уменьшением массы тела, и таким образом, находит применение для лечения или предотвращения ожирения для медицинских или косметических целей.

Исследования позволяют предполагать, что Bacteroides играют роль в предотвращении инфекции Clostridium difficile. Развитие иммунного ответа, который ограничивают проникновение и пролиферацию потенциальных патогенов, сильно зависит от B fragilis. Также, белки клеток Панета могут образовывать антибактериальные пептиды в ответ на стимуляцию посредством B thetaiotomicron, и эти молекулы могут предотвращать колонизацию кишечника патогенами. Кроме того, B thetaiotomicron может индуцировать клетки Панета для продукции бактерицидного лектина, RegIII, который оказывает свой противомикробный эффект посредством связывания с пептидогликаном грамположительных организмов. Таким образом, применение изобретения в любой из его конфигураций для увеличения доли Bacteroides (например, thetaiotomicron и/или fragalis) в смешанной популяции бактерий кишечника можно использовать для ограничения колонизации патогенными бактериями популяции или кишечника человека или не относящегося к человеку животного.

Hooper et al показали, что B thetaiotomicron может модифицировать фукозилирование в кишечнике в комплексном взаимодействии, опосредованном геном репрессора фукозы и системой передачи сигналов. С использованием анализа транскрипции показано, что B thetaiotaomicron может модулировать экспрессию множества генов хозяина, включая гены, вовлеченные в абсорбцию питательных веществ, укрепление барьера слизистых оболочек и продукцию ангиогенных факторов.

В одном варианте осуществления, смешанная популяция состоит из первых и вторых бактерий (т.е., без дополнительной популяции бактерий).

В одном примере, этот или каждый массив представляет собой рекомбинантный массив в векторе и/или выделенный массив в векторе. В одном примере, массив содержится в клетке-хозяине (например, в клетке микроорганизмов, бактерий или архей).

В одном примере, указанная Cas представляет собой эндогенную нуклеазу Cas (например, Cas9) клетки-хозяина. Посредством использования Cas хозяина, это обеспечивает эффективное использование повторов типа хозяина в массиве и возможность использования эндогенной crРНК для высвобождения емкости, которая в ином случае является ограниченной в векторах, таких как вирусы или фаги (следует отметить, что последовательность гена Cas, такой как Cas9 типа II, является большой).

В одном примере, система CRISPR/Cas хозяина представляет собой систему типа I. В одном примере, система CRISPR/Cas хозяина представляет собой систему типа II. В одном примере, система CRISPR/Cas хозяина представляет собой систему типа III.

Cas, направляемая посредством HM-crРНК или gРНК по изобретению, представляет собой эндогенную Cas хозяина или кодируемую вектором Cas, совместимую с PAM в последовательности-мишени.

Необязательно, хозяин (или первые и/или вторые бактерии) представляет собой грамотрицательную бактерию (например, спириллу или вибрион). Необязательно, хозяин (или первые и/или вторые бактерии) представляет собой грамположительную бактерию. Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой микоплазму, хламидию, спирохету или микобактерию. Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Streptococcus (например, pyogenes или thermophilus). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Staphylococcus (например, aureus, например, MRSA). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина E. coli (например, O157: H7), например, где Cas является кодированной вектором или активность эндогенной нуклеазы Cas хозяина является дерепрессированной. Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Pseudomonas (например, aeruginosa). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Vibro (например, cholerae (например, O139) или vulnificus). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Neisseria (например, gonnorrhoeae или meningitidis). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Bordetella (например, pertussis). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Haemophilus (например, influenzae). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Shigella (например, dysenteriae). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Brucella (например, abortus). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Francisella. Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Xanthomonas. Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Agrobacterium. Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Erwinia. Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Legionella (например, pneumophila). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Listeria (например, monocytogenes). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Campylobacter (например, jejuni). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Yersinia (например, pestis). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Borelia (например, burgdorferi). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Helicobacter (например, pylori). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Clostridium (например, dificile или botulinum). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Erlichia (например, chaffeensis). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Salmonella (например, typhi или enterica, например, серотип typhimurium, например, DT 104). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Chlamydia (например, pneumoniae). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Parachlamydia. Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Corynebacterium (например, amycolatum). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Klebsiella (например, pneumoniae). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Enterococcus (например, faecalis или faecim, например, устойчивые к линезолиду). Необязательно, хозяин (или первые и/или вторые бактерии) представляют собой хозяина Acinetobacter (например, baumannii, например, с множественной лекарственной устойчивостью).

В одном примере, клетка представляет собой прокариотическую клетку. В одном примере, клетка представляет собой бактериальную клетку. В одном примере, клетка представляет собой клетку архей. В одном примере, клетка представляет собой клетку микрорганизма. В одном примере, клетка представляет собой клетку простейших. В одном примере, клетка представляет собой клетку рыбы. В одном примере, клетка представляет собой клетку птицы. В одном примере, клетка представляет собой клетку рептилии. В одном примере, клетка представляет собой клетку паукообразного. В одном примере, клетка представляет собой клетку дрожжей (например, клетку Saccharomyces). В одном примере, клетка-хозяин представляет собой клетку растения. В одном примере, клетка-хозяин представляет собой клетку животного (например, не являющуюся клеткой человека, например, не являющуюся клеткой грызуна). В одном примере, клетка-хозяин представляет собой клетку человека (например, не являющуюся клеткой в эмбрионе или в организме человека), например, клетку-хозяина in vitro. В одном примере, клетка представляет собой клетку животного из клетки скота или животного-компаньона (например, клетку коровы, свиньи, козы, овцы, лошади, собаки, кошки или кролика). В одном примере, клетка-хозяин представляет собой клетку насекомого (насекомого на любой стадии его жизненного цикла, например, яйца, личинки или куколки). В одном примере, клетка-хозяин представляет собой клетку простейших. В одном примере, клетка представляет собой клетку головоногих.

Необязательно, массив, система, сконструированная нуклеотидная последовательность или нуклеиновая кислота вектора дополнительно содержит (например, один, два или более) сигнал ядерной локализации (NLS), например, для нацеливания на ядро, когда клетка-хозяин представляет собой эукариотическую клетку, например, растения или животного. В одном примере, NLS фланкирует каждый конец кодирующей Cas последовательности нуклеиновой кислоты по изобретению и/или массив по изобретению - в частности, для использования для нацеливания в эукариотической клетке-хозяине.

Последовательность tracrРНК можно исключать из массива или вектора по изобретению, например, для систем Cas того типа, который не использует tracrРНК.

В одном примере, Cas, нацеленная на мишень, представляет собой экзонуклеазу. Необязательно, никаза, как упомянуто в настоящем документе, представляет собой двойную никазу.

Примером никазы является никаза Cas9, т.е., Cas9, обладающая инактивированным одним из двух доменов нуклеазы - доменом RuvC и/или HNH.

Необязательно, система хозяина представляет собой систему типа I (и необязательно, массив, HM-crРНК или gРНК принадлежат к различным системам CRISPR, например, типа II или III). Необязательно, массив или сконструированная последовательность присутствует в комбинации в вирусе или плазмиде с нуклеотидной последовательностью, кодирующей Cas из той же самой системы, что и массив, HM-crРНК или gРНК, например, где Cas не функционирует или не функционирует эффективно с системой хозяина. Необязательно, система хозяина представляет собой систему типа II (и необязательно, массив, HM-crРНК или gРНК принадлежат к различным системам CRISPR, например, типа I или III). Необязательно, массив или сконструированная последовательность присутствует в комбинации в вирусе или плазмиде с нуклеотидной последовательностью, кодирующей Cas из той же самой системы, что и массив, HM-crРНК или gРНК, например, где Cas не функционирует или не функционирует эффективно с системой хозяина. Необязательно, система хозяина представляет собой систему типа III (и необязательно, массив, HM-crРНК или gРНК принадлежат к различным системам CRISPR, например, типа I или II). Необязательно, массив из сконструированной последовательности присутствует в комбинации в вирусе или плазмиде с нуклеотидной последовательностью, кодирующей Cas из той же самой системы, что и массив, например, где Cas не функционирует или не функционирует эффективно с системой хозяина.

Упоминание в настоящем документе использования ДНК вектора можно также, в альтернативном варианте осуществления, применять, с соответствующими изменениями, к РНК вектора, где позволяет контекст. Например, где вектор представляет собой РНК-вектор. Все признаки по изобретению, таким образом, альтернативно описаны, и следует читать «РНК» вместо «ДНК» при ссылке на ДНК вектора в настоящем документе, где позволяет контекст. В одном примере, этот или каждый вектор кодирует также обратную транскриптазу.

В одном примере, этот или каждый массив, или сконструированную нуклеотидную последовательность предоставляют посредством вектора на основе наночастиц или в липосомах.

В одном примере, Cas представляет собой нуклеазу Cas для разрезания, Cas смерти (dCas) для прерывания или dCas, конъюгированную с активатором транскрипции, для активации мишени.

В одном примере, система CRISPR/Cas хозяина содержит массив CRISPR хозяина и родственную Cas хозяина для нацеливания на нуклеотидную последовательность в хозяине. В одном примере, последовательность-мишень хозяина содержит по меньшей мере 5, 6, 7, 8, 9, 10, 20, 30 или 40 смежных нуклеотидов. В одном примере, последовательность-мишень разрезают посредством Cas, например, Cas9. В одном варианте осуществления, последовательность не содержится в спейсере.

В одном примере, этот или каждый массив, или сконструированная последовательность содержит экзогенный промотор, функциональный для транскрипции crРНК или gРНК в хозяине.

В одном примере, повторы этого или каждого массива являются идентичными повторам в массиве хозяина, где массив CRISPR не содержит PAM, узнаваемый Cas (например, нуклеазой Cas, например, Cas9) из системы CRISPR/Cas хозяина. Это применимо, с соответствующими изменениями, к последовательности повторов из HM-crРНК и gРНК. Этот вариант осуществления является преимущественным, поскольку он просто позволяет массиву CRISPR использовать эндогенную Cas хозяина для нацеливания на последовательность-мишень хозяина. Это затем является эффективным, поскольку массив подгоняют для использования аппаратом хозяина, и таким образом, способствуют функционированию в клетке-хозяине. Дополнительно или альтернативно (например, где массив предоставляют в комбинации с экзогенной (не эндогенной для хозяина) кодирующей Cas последовательностью), этот вариант осуществления позволяет массиву CRISPR использовать кодируемую эндогенно tracrРНК, поскольку повторы массива CRISPR могут гибридизоваться с эндогенной tracrРНК для продукции пре-crРНК и процессинга до зрелой crРНК, которая гибридизуется с последовательностью-мишенью хозяина. Последний комплекс может затем направлять эндогенную нуклеазу Cas (например, Cas9) или направлять Cas, продуцируемую с последовательности, содержащейся в массиве CRISPR. Этот вариант осуществления, таким образом, обеспечивает гибкость простого конструирования вектора (например, упакованного вируса или фага), содержащего массив CRISPR, но не содержащего tracrРНК- и/или последовательность, кодирующую нуклеазу Cas. Это более просто для конструирования вектора, а также это высвобождает ценное пространство в векторе (например, вирусе или фаге), которое можно использовать с учетом ограничения емкости для векторов, в частности, вирусных векторов (например, фагов). Дополнительное пространство можно использовать, например, чтобы позволять включение намного большего количества спейсеров в массиве, например, для нацеливания на геном хозяина для модификации, например, для инактивации генов хозяина или внесения желательных не относящихся к хозяину последовательностей для экспрессии в хозяине. Дополнительно или альтернативно, пространство можно использовать для включения множества массивов CRISPR в вектор. Это может, например, представлять собой аранжировку, где первый массив принадлежит к первому типу CRISPR/Cas (например, типу II или типу II-A), и второй массив может принадлежать ко второму типу (например, типу I или III, или типу II-B). Дополнительно или альтернативно, массив может использовать различные нуклеазы Cas в хозяине (например, один массив является способным функционировать с нуклеазой Cas хозяина, и второй массив является способным функционировать с экзогенной нуклеазой Cas (т.е., кодируемой вектором нуклеазой)). Эти аспекты обеспечивают аппарат для нацеливания в хозяине после введения вектора, что является преимущественным для уменьшения устойчивости хозяина к вектору, поскольку хозяину затем необходимо нацеливание на больший диапазон элементов. Например, если хозяин сможет приобрести новый спейсер на основе последовательности первого массива CRISPR, второй массив CRISPR все еще может функционировать в хозяине для нацеливания на соответствующую последовательность-мишень в клетке-хозяине. Таким образом, этот вариант осуществления можно использовать для уменьшения адаптации хозяина к вектору.

Другим преимуществом является то, что является возможным (например, в этой аранжировке) включать в массив CRISPR (или распределять среди множества таких массивов в векторе) множество копий одного и того же спейсера (например, спейсера, используемого для нацеливания на участок-мишень в клетке-хозяине). Это является преимущественным, поскольку предположили, что адаптация хозяев, таких как бактерии и археи, может включать в себя потерю спейсеров из их массивов, когда спейсеры нацелены на преимущественную для хозяина ДНК (PLoS Genet. 2013;9(9):e1003844. doi: 10,1371/journal.pgen.1003844. Epub 2013 Sep 26, «Dealing with the evolutionary downside of CRISPR immunity: bacteria and beneficial plasmids», Jiang W et al). считают, что удаление единиц спейсер-повтор происходит посредством рекомбинации последовательностей повторов. Таким образом, по настоящему аспекту по изобретению, представлено один, два, три, четыре, пять, шесть или более массивов CRISPR или сконструированных последовательностей по изобретению, содержащих множество (например, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100 или более) копий спейсера для гибридизации с последовательностью-мишенью хозяина. Это уменьшает шансы на потерю всех из этих спейсеров посредством рекомбинации в клетке-хозяине. В дополнительном применении по этому аспекту, массивы CRISPR содержат первый массив, содержащий одну или несколько (например, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90 или более) копий спейсера, и второй массив, содержащий одну или несколько (например, 2, 3, 4 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90 или более) идентичных копий спейсера, где каждая из копий спейсера в первом массиве фланкирована первыми повторами, и каждая из идентичных копий спейсера во втором массиве фланкирована вторыми повторами, где первые повторы отличаются от вторых повторов. Это обладает тем преимуществом, что можно выбирать по меньшей мере один из первого и второго повтора, не узнаваемый нуклеазой Cas хозяина (или той же самой нуклеазой Cas хозяина), для уменьшения шансов адаптации хозяина, затрагивающей более одного массива. В одном примере, первый массив присутствует в комбинации с последовательностью нуклеазы Cas, которая не кодирована клеткой-хозяином и которая является родственной Cas для первых повторов. Необязательно, также второй массив присутствует в комбинации с последовательностью нуклеазы Cas (например, одинаковой или отличной от последовательности для первого массива), которая не кодирована клеткой-хозяином и которая является родственной Cas для вторых повторов.

Один из вариантов осуществления относится к первому массиву, содержащемуся в первом векторе, и к второму массиву, содержащемуся во втором векторе, который не содержит первый массив (например, где векторы представляют собой плазмиды или вирионы (например, из одного и того же типа вируса) или упакованный фаг (например, из одного и того же типа фага). Это является полезным, поскольку векторы можно одновременно или последовательно вводить в одну и ту же клетку-хозяина. Таким образом, когда хозяин приобретает устойчивость к первому массиву, второй вводят для предоставления второго массива, с которым устойчивый хозяин (например, бактерия или архея) ранее не эволюционировал совместно, таким образом, обеспечивая вторую волну модификации (например, нокдауна) против клетки-хозяина. Это также обеспечивает гибкость, поскольку третий такой вектор, содержащий спейсер или массив, который отличается от первого и второго массивов и спейсеров, можно вводить в клетку-хозяина одновременно или последовательно с вторым вектором для обеспечения дополнительного пути для модификации клетки-хозяина, который ранее не присутствовал в ходе эволюции хозяев, устойчивых к спейсеру в первом массиве. Вместо массивов, можно использовать сконструированные нуклеотидные последовательности по изобретению.

Таким образом, в одном варианте осуществления, изобретение относится к композиции для модификации клетки-хозяина, где композиция относится к любому массиву или сконструированной последовательности, как описано в настоящем документе. Таким образом, в одном варианте осуществления, изобретение относится к композиции для модификации клетки-хозяина, где композиция относится к первому массиву, как описано в настоящем документе, в первом векторе (например, вирионе или упакованном фаге), и к второму такому массиву, как описано в настоящем документе, во втором векторе (например, вирионе или упакованном фаге, соответственно), где второй массив содержит один или несколько спейсеров, который нацелен на одну или несколько последовательностей-мишеней хозяина и который не содержится/не содержатся в первом массиве. Вместо массивов, можно использовать сконструированные нуклеотидные последовательности по изобретению.

В одном варианте осуществления массив или сконструированная последовательность содержится в вирофаговом векторе, и хозяин, альтернативно, представляет собой вирус, который может инфицировать клетку. Например, хозяин представляет собой большой вирус, которым можно инфицировать клетку амебы. Например, хозяин представляет собой вирус Спутник, питовирус, мимивирус, мамавирус, мегавирус или пандоравирус, например, где вирус находится в воде. В одном примере этого варианта осуществления, изобретение предназначено для обработки воды или сточных вод (например, очистки, например, обработки водных путей, реки, озера, пруда или моря).

В одном варианте осуществления, этот или каждый вектор или сконструированная последовательность представляет собой фаг ΦNM1 или содержится в фаге ΦNM1, например, где клетка-хозяин(клетки-хозяева) представляет собой клетку S. aureus (например, MRSA).

Общие признаки относятся также к следующим пунктам:-

1. Противомикробная композиция (например, антибиотик, например, лекарственное средство, дезинфицирующее средство или ополаскиватель для ротовой полости), содержащая массив, сконструированную последовательность, вирус, вирион, фаг, фагмиду, профаг, популяцию или коллекцию по любому аспекту изобретения.

2. Композиция по пункту 1 для медицинского или стоматологического или офтальмологического применения (например, для лечения или предотвращения инфекции в организме или ограничения распространения инфекции в организме.

В одном примере, организм представляет собой растение или животное, например, позвоночное (например, любое млекопитающее или человека, описанного в настоящем документе) или сельскохозяйственное или пищевое растение.

3. Композиция, содержащая массив, сконструированную последовательность, систему, коллекцию, вирус, вирион, фаг, фагмиду, профаг, композицию, популяцию, коллекцию, применение или способ по изобретению для косметического применения (например, для применения в косметическом продукте, например, для макияжа), или для гигиенического применения (например, для применения в гигиеническом продукте, например, в мыле).

4. Применение композиции, содержащей массив, сконструированную последовательность, коллекцию, вирус, вирион, фаг, фагмиду, профаг, популяцию или коллекцию по любому из пунктов 1-35, в медицине или для стоматологического терапевтического или профилактического применения.

5. Применение композиции, содержащей массив, сконструированную последовательность, коллекцию, систему, вирус, вирион, фаг, фагмиду, профаг, композицию, популяцию, коллекцию, применение или способ по изобретению, для косметического применения (например, для применения в косметическом продукте, например, для макияжа), или для гигиенического применения (например, для применения в гигиеническом продукте, например, мыле).

6. Применение массива, сконструированной последовательности, системы, коллекции, вируса, вириона, фага, фагмиды, профага, композиции, популяции или коллекции по изобретению в модифицирующей хозяина (HM) системе CRISPR/Cas9 (например, типа I, II или III), способной к модификации нуклеотидной последовательности-мишени из клетки-хозяина, где массив, сконструированная последовательность, система, вирус, вирион, фаг, фагмида, профаг, популяция или коллекция находится в соответствии с настоящим изобретением.

7. Применение по пункту 4, 5 или 6, где массив, сконструированная последовательность, система, коллекция, вирус, вирион, фаг, фагмида, профаг, популяция или коллекция не присутствует в клетке-хозяине.

8. Применение по пункту 5 или 6, где массив, сконструированная последовательность, коллекция, система, вирус, вирион, фаг, фагмида, профаг, популяция или коллекция присутствует в клетке-хозяине (например, в клетке микроорганизма, бактерии или археи).

9. Применение по любому из пунктов 4-6 для модификации клетки микроорганизма (например, для уничтожения или уменьшения роста клетки или культуры клеток микроорганизмов).

10. Способ модификации нуклеотидной последовательности-мишени в клетке-хозяине (например, микроорганизма бактерии или археи), где способ включает в себя трансформацию клетки-хозяина с использованием массива, сконструированной последовательности, системы, коллекции, вируса, вириона, фага, фагмиды, популяции или коллекции в соответствии с настоящим изобретением, в результате чего нуклеотидную последовательность-мишень модифицируют посредством Cas, где последовательность-мишень хозяина представляет собой нуклеотидную последовательность из системы CRISPR/Cas клетки-хозяина.

11. Способ уменьшения развития устойчивости клетки-хозяина к трансформации вектором на основе нуклеиновой кислоты или поддержания вектора на основе нуклеиновой кислоты в клетке-хозяине, где клетка-хозяин содержит нуклеотидную последовательность-мишень, где способ включает в себя трансформацию клетки-хозяина с использованием массива, сконструированной последовательности, коллекции, системы, вируса, вириона, фага, фагмиды, популяциия или коллекции по изобретению, в результате чего нуклеотидную последовательность-мишень модифицируют посредством Cas (например, подвергают разрезанию, мутации или нокдауну).

12. Способ по пункту 11, где вектор представляет собой вирус, который является способным к инфекции клетки-хозяина, и стадия включает в себя инфекцию клетки-хозяина вектором.

13. Способ по пункту 11 или 12, где клетка-хозяин представляет собой клетку бактерий или архей, и вектор представляет собой фаг или фагмиду.

14. Способ по любому из пунктов 11-13, где последовательность-мишень хозяина является необходимой для опосредованного CRISPR/Cas хозяина приобретения последовательностей спейсеров вектора.

15. Массив, сконструированная последовательность, система, вектор, клетка, коллекция, композиция, применение или способ по любому предшествующему пункту, где по меньшей мере компонент (ii) содержится в вирусе (например, фаге), который является способным экспрессировать эндолизин для лизиса клетки-хозяина, необязательно, где эндолизин представляет собой эндолизин фага phi11, фага Twort, фага P68, фага phiWMY или фага K (например, эндолизин MV-L или эндолизин P-27/HP).

16. Массив, сконструированная последовательность, система, вектор, коллекция, клетка, композиция, применение или способ по пункту 15 в комбинации с эндолизином для лизиса клетки-хозяина, например, в комбинации с эндолизином MV-L или эндолизином P-27/HP, или его функциональным гомологом.

17. Массив, сконструированная последовательность, система, вектор, коллекция, клетка, композиция, применение или способ по любому предшествующему пункту в комбинации с противомикробным средством, например, антибиотическим средством, например, бета-лактамным антибиотиком.

18. Массив, сконструированная последовательность, система, вектор, коллекция, клетка, композиция, применение или способ по любому предшествующему пункту, где клетка-хозяин представляет собой клетку-хозяина Staphylococcus, Streptococcus, Pseudomonas, Salmonella, Listeria, E coli, Desulfovibrio или Clostridium.

19. Массив, сконструированная последовательность, система, вектор, коллекция, клетка, композиция, применение или способ по любому предшествующему пункту, где клетка-хозяин представляет собой клетка-хозяин Staphylococcus (например, S aureus) и по меньшей мере компонент (ii) содержится в фаге (например, упакованном фага) Staphylococcus класса I, II или III, необязательно, в фаге Caudovirales или Myoviridae.

20. Массив, сконструированная последовательность, система, вектор, клетка, коллекция, композиция, применение или способ по любому предшествующему пункту, где клетка-хозяин представляет собой устойчивый к бета-лактамному антибиотику Streptococcus aureus, устойчивый к метициллину Streptococcus aureus (MRSA), устойчивый к ванкомицину Streptococcus aureus или устойчивый к тейкопланину Streptococcus aureus, и необязательно, последовательность-мишень представляет собой последовательность гена устойчивости к бета-лактамному антибиотику, гена устойчивости к метициллину, гена устойчивости к ванкомицину или гена устойчивости к тейкопланину хозяина, соответственно.

Пригодные способы получения и тестирования фаговых векторов по изобретению представляют собой, например, общие способы, описанные в WO2014/124226.

Мобильные генетические элементы, транспозоны и носители (для любой конфигурации по изобретению)

Плазмиды являются очень распространенными в видах Bacteroides и обнаружены в 20-50% штаммов. Многие плазмиды обладают oriT и трансдействующим геном мобилизации, позволяющими им подвергаться переносу посредством конъюгации. Таким образом, в одном примере, вектор представляет собой плазмиду, содержащую oriT и/или ген мобилизации, например, где первые или вторые бактерии представляют собой Bacteroides. В одном примере, сконструированная последовательность содержится в таком векторе.

В одном примере, клетки-хозяева, или первые или вторые бактерии естественным образом содержат транспозоны. Транспозоны, как мобилизуемые, так и конъюгативные, не реплицируются независимо; вместо этого, они вырезаются из хромосомной ДНК и интегрируют в хромосомную ДНК, и копируются вместе с хромосомной ДНК. Конъюгативные транспозоны обладают механизмом вырезания и интеграции, который напоминает некоторые признаки как плазмиды, так и бактериофага. Конъюгативные транспозоны являются практически повсеместно распространенными среди Bacteroides: более 80% штаммов Bacteroides содержат по меньшей мере один конъюгативный транспозон. Конъюгативные транспозоны Bacteroides принадлежат по меньшей мере к двум семействам; CTnDot является описанным лучше всего. Часто, наименование штамма, в которм они обнаружены, добавляют к обозначению (например, CTnDot, обнаруженный в DOT B thetaiotaomicron). В дополнение к способности к вставке в хромосому, конъюгативные транспозоны Bacteroides могут вставляться в совместно присутствующие плазмиды и мобилизовать их в цис-положении (т.е., они могут действовать на объекты, которые являются физически смежными) посредством собственной интеграции в плазмиду и облегчения переноса гибрида плазмида-конъюгативный транспозон в другую клетку. Они могут также мобилизовывать совместно присутствующие плазмиды «в транс-положении» посредством предоставления факторов, необходимых для облегчения переноса плазмиды, в то же время оставаясь физически отдельными от плазмиды.

Конъюгативные транспозоны не исключают друг друга, как это делают плазмиды, так что штамм может накапливать более одного конъюгативного транспозона. Более того, существуют некоторые доказательства того, что присутствие более одной копии конъюгативного транспозона в штамме приводит к стимуляции транспозиции (трансактивации). Теоретически, это позволяет предполагать, что с накоплением большего количества конъюгативных транспозонов в окружающей среде, перенос генов транспозонов к другим бактериям может также увеличиваться, и может присутствовать значительное нарастание по спирали распространения генов. Множество из транспозонов Bacteroides несут ген tetQ и таким образом, придают устойчивость к тетрациклину. Кроме того, самоперенос и другие виды активности значительно стимулируются посредством низких уровней тетрациклина, что регулируется посредством оперона tetQ-rteA-rteB. Тетрациклин увеличивает транскрипцию rteA и -B, кодирующих компоненты сенсора и активатора двух-компонентной регуляторной системы. В свою очередь, RteB активирует экспрессию rteC, который является необходимым для самопереноса.

В одном примере, вектор (например, где вектор содержит сконструированную последовательность) содержит транспозон, где транспозон содержит сконструированную последовательность, HM- или PM-массив по изобретению, где транспозон является способным функционировать в клетке-хозяине(клетках-хозяевах) или в первом или втором видах бактериальных клеток-хозяев. В одном варианте осуществления, транспозон представляет собой транспозон Bactroides (например, транспозон CTnDot, например, транспозон CTnDot B thetaiotaomicron или B fragalis), и клетки-хозяева, или the первые или вторые бактерии представляют собой или содержат Bacteroides (например, из того же самого вида, что и указанный транспозон CTnDot). В одном примере, транспозон представляет собой конъюгативный транспозон. В одном примере, транспозон представляет собой мобилизуемый транспозон. В одном примере, транспозон является способным к переносу между клетками Bacteroides. В одном примере, транспозон содержит последовательность intDOT. В одном примере, транспозон содержит oriT. В одном примере, транспозон кодирует один или несколько белков конъюгационной поры для конъюгативного переноса транспозонов между клетками-хозяевами.

В одном примере, изобретение относится к транспозону, содержащему ген tetQ Bacteroides. В одном примере, транспозон дополнительно содержит оперон tetQ-rteA-rteB Bacteroides. В одном примере, первые или вторые бактерии представляют собой Bacteroides. В одном примере, транспозон представляет собой транспозон CTnDot Bacteroides, который кодирует один или несколько белков конъюгационной поры для конъюгативного переноса транспозона между клетками-хозяевами и содержит один или несколько массивов или сконструированных последовательностей по изобретению, oriT, последовательность intDOT и оперон tetQ-rteA-rteB, и необязательно, является предназначенным для введения или введенным указанному человеку или не относящемуся к человеку животному, как упомянуто в настоящем документе, в комбинации с тетрациклином. Перенос большинства CTn Bacteroides стимулируют посредством тетрациклина. Транспозон является способным функционировать с интегразой в клетке-хозяине или является способным функционировать с экзогенной интегразой, которую несет тот же самый вектор, что и транспозон, или другой вектор. В одном варианте осуществления, вектор представляет собой фаг (например, упакованный фаг), содержащий транспозон и нуклеотидную последовательность, кодирующую родственную интегразу. Фаг является способным к инфекции бактериальной клетки-хозяина для репликации и вырезания транспозона, например, для конъюгативного переноса в соседние клетки-хозяева в смешанной популяции бактерий (например, в популяции микробиоты кишечника).

В одном варианте осуществления, транспозон содержится в векторе, несущем одну или несколько gene последовательностей генов, необходимых для переноса транспозона между клетками-хозяевами, где указанные последовательности генов находятся вне транспозона в нуклеиновой кислоте вектора. Например, вектор представляет собой упакованный фаг, который является способным к инфекции клетки-хозяина (например, клетки-хозяина Bacteroides), где нуклеиновая кислота фага содержит указанный транспозон, содержащий массив по изобретению и, выше или ниже транспозона, один или несколько генов, способных функционировать для конъюгативного переноса транспозона (например, один или несколько генов, кодирующих релаксазы, белки сопряжения и/или белки конъюгационного мостика для конъюгативного переноса транспозон; и/или один или оба из оперонов mob и tra), где один, несколько или все из этих генов не содержатся в транспозоне. В одном примере, эти гены представляют собой гены для вырезания транспозона из хромосомной ДНК внутри первой клетки-хозяина. Таким образом, транспозон является способным к мобилизации внутри клетки и переносит вместе с ним гены, необходимые для последующего конъюгативного переноса во вторую клетку-хозяина. Посредством предоставления некоторых из генов транспозона таким образом на векторе вне транспозона, это высвобождает пространство в транспозоне для включения сконструированной последовательности или массива ДНК по изобретению, так что их можно размещать и переносить посредством мобилизованных транспозонов. Изобретение относится к такому вектору, содержащему один или несколько таких транспозонов, для применения в способе, применении или системе по изобретению или в общем для введения в бактериальные клетки (в этом случае, вместо нацеливания на фаговую последовательность, массив, включенный в транспозон, можно нацеливать на бактериальную последовательность-мишень для модификации этой последовательности, например, ее разрезания с использованием Cas в клетке, несущей транспозон).

Молекулярные механизмы вырезания и интеграции CTnDot более близко напоминают механизмы бактериофага, чем транспозицию. Интеграза и белки вырезания CTnDOT сами по себе являются достаточно сходными с белками бактериофага. Таким образом, в одном варианте осуществления, функцию одного или нескольких из интегразы и/или белков вырезания транспозона по изобретению осуществляют посредством интегразы и/или белков вырезания фага соответственно, и транспозон не содержит соответствующего гена(генов), кодирующих такую интегразу или белки вырезания, функции которых обеспечены посредством белков фага.

В одном примере, транспозон содержит rteC и оперон xis2c-xis2d-orf3-exc. Необязательно, кроме того, вектор содержит опероны mob и tra вне транспозона (например, выше или ниже транспозона в нуклеиновой кислоте вектора). Таким образом, это высвобождает пространство в транспозоне для предоставления последовательности массива CRISPR или сконструированной последовательности по изобретению.

Множество конъюгативных транспозонов являются способными к мобилизации других элементов. Например, множество совместно присутствующих плазмид мобилизуется посредством конъюгативного транспозона в транс-положении. Это происходит, когда плазмида, содержащая oriT, использует предоставленные CTn белки конъюгационной поры для переноса в клетку-реципиента. Показано также, что CTn Bacteroides мобилизуют элементы, когда присутствуют в цис-положении, признак, который не является типичным для CTn. Например, если CTnDOT вырезан из хромосомы и интегрирован в плазмиду, он может обеспечивать конъюгационную пору, oriT, и белки для мобилизации (релаксазу/белки сопряжения), позволяя перенос целой плазмиды посредством действия «в цис-положении». Эта способность использовать как транс-, так и цис-механизмы мобилизации, является необычной и позволяет предполагать, что CTn Bacteroides обладают большей способностью к мобилизации других элементов.

В одном примере, вектор по изобретению представляет собой плазмиду, содержащую одну или несколько сконструированных последовательностей или массивов по изобретению и oriT, родственную транспозону CTnDot вида клетки-хозяина, который кодирует белки конъюгационной поры, в результате чего плазмида является способной к мобилизации в клетке-хозяине, содержащей указанный транспозон CTnDot. Таким образом, плазмида является способной к горизонтальному переносу между клетками-хозяевами, таким образом, распространяя массивы по изобретению в популяции таких клеток-хозяев (например, клеток Bacteroides). В одном примере, изобретение относится к композиции, содержащей популяцию бактерий-носителей, где бактерии-носители являются совместимыми с таким плазмидным вектором по изобретению, в результате чего вектор является способным к горизонтальному переносу в клетки-хозяева бактерий-реципиентов (например, клетки Bacteroides или Firmicutes, например, Streptococcus), содержащие родственные транспозоны CTnDot, когда бактерии-носители и бактерии-реципиенты смешивают. В одном примере, бактерии-носители содержатся в напитке (например, пробиотическом напитке, таком как описанный в настоящем документе) или пищевом продукте для употребления человеком или не относящимся к человеку животным, в результате чего бактерии-носители могут смешиваться с бактериями-реципиентами, содержащимися у человека или животного (например, в ротовой полости или в кишечнике). Другие транспозоны внутри подобного CTnDOT семейства включают в себя CTnERL и CTn341, хотя эти элементы отличаются от CTnDOT, и таким образом, вместо транспозона CTnDot, транспозон в общем аспекте по изобретению может представлять собой транспозон CTnERL или CTn341, несущий один или несколько желательных массивов CRISPR или сконструированных последовательностей для нацеливания на один или несколько бактериальных или фаговых нуклеотидных участков-мишеней, когда транспозон содержится в клетке-хозяине бактерий или архей.

Чтобы произошел перенос конъюгативного транспозона, существуют три основных стадии, которые имеют место. Первая стадия представляет собой вырезание из хромосомы с формированием ковалентно замкнутого кольцевого промежуточного продукта. Во-вторых, одноцепочечная копия затем переносится через конъюгационную пору в клетку-реципиента, после чего эта копия становится двухцепочечной. В-третьих, интактный двухцепочечный CTn интегрирует в хромосому реципиента. Конъюгационная транспозиция является репликативной, поскольку копия CTn сохраняется в клетке-доноре. Поскольку элемент содержится в хромосоме, он переносится также вертикально к клеткам-потомкам. Это является важным, поскольку, когда желательные массивы CRISPR или сконструированные последовательности (и необязательно, последовательность Cas) присутствуют в CTn, они не только легко переносятся внутри популяции, но они также очень стабильно сохраняются от поколения к поколению. Это является таким, как наблюдают, например, при сохранении детерминант устойчивости к антибиотикам. Кроме того, считают, что Bacteroides могут служить в качестве резервуара детерминант устойчивости к антибиотикам, который распространяет эти гены к другим организмам вне рода Bacteroides, возможно, даже переносит эти элементы к организмам, которые временно проходят через кишечник. Подобным образом, резервуар массивов или сконструированных последовательностей по изобретению можно создавать с использованием векторов по изобретению, которые вводят человеку или не относящемуся к человеку животному, например, для лечения или предотвращения ожирения, диабета или IBD или любого другого заболевания или состояния, описанного в настоящем документе.

В одном примере, можно использовать резервуар желательных массивов CRISPR или сконструированных последовательностей посредством использования одного или нескольких массивов или последовательностей, содержащихся в транспозоне (например, a CTnDot), способном к переносу клетками Bacteroides (например, в кишечнике или ротовой полости человека или не относящегося к человеку животного), где массив(ы)/последовательность(последовательности) не нацелены на последовательность клетки-хозяина Bacteroides, но нацелены на нуклеотидную последовательность, содержащуюся в клетках микробиоты кишечника (например, бактериальных клетках) из различных видов (например, в клетке Firmicutes или в клетке патогенной бактерии, например, в клетке Streptococcus, C dificile, H pylori, Salmonella, Listeria, Yersinia, Shigella или Campylobacter). Благодаря этому, таким образом, перенос массивов или последовательностей по изобретению к соседним патогенным или нежелательным бактериям-реципиентам может иметь место, и при попадании внутрь клетки-реципиента массив(ы) по изобретению являются способными функционировать для направления Cas на соответствующий участок-мишень в клетке-хозяине для модификации (например, разрезания) участка. В этом случае, массив/последовательность могут содержать последовательности повторов, обнаруженные в представляющей интерес клетке-реципиенте, так что массив/последовательность может функционировать с эндогенной системой CRISPR/Cas внутри клетки-реципиента. Это исключает необходимость включения последовательностей, кодирующих Cas и/или tracrРНК, в вектор, сконструированную последовательность или транспозон по изобретению, таким образом, высвобождая пространство и упрощая конструирование. Увеличенное пространство можно использовать для обеспечения включения большего количества спейсеров для нацеливания на большее количество участков-мишеней в клетке-реципиенте. Альтернативно, массив(ы) или последовательность(последовательности) транспозона содержат последовательность, кодирующую Cas9 типа II, и родственные последовательности повторов. Например, Cas9 (любая Cas9, упомянутая в настоящем документе) представляет собой Cas9 S pyogenes, S thermophilus или S aureus и может, необязательно, представлять собой никазу или dCas9 («Cas9 смерти»). Поскольку Bacteroides являются облигатными анаэробами (или обладают сильным предпочтением анаэробной окружающей среды) и как правило, являются патогенными вне окружающей среды кишечника, может являться нежелательным использовать клетки Bacteroides в качестве носителей для векторов или транспозонов по изобретению, например, при введении в кишечник или ротовую полость человека или животного. Для решения этого, изобретение относится к популяции-носителю из бактерий, несущих векторы, сконструированную последовательность(последовательности) или транспозоны по изобретению, где бактерии-носители являются совместимыми с такими вектором, последовательностью или транспозоном, в результате чего вектор, последовательность или транспозон являются способными к горизонтальному переносу в клетки-хозяева бактерии-реципиента (например, Bacteroides) в микробиоте кишечника, когда бактерии-носители и бактерии-реципиенты смешивают. В одном примере, бактерии-носители содержатся в напитке (например, пробиотическом напитке, таком как напиток, описанный в настоящем документе) или пищевом продукте для употребления человеком или не относящимся к человеку животным, в результате чего бактерии-носители могут смешиваться с бактериями-реципиентами, содержащимися у человека или животного (например, в ротовой полости или в кишечнике). В одном варианте осуществления, векторы, последовательности или транспозоны содержат массивы CRISPR по изобретению, где массивы нацелены на нуклеотидные последовательности, содержащиеся в клетках-реципиентах для модификации последовательностей-мишеней, например, посредством разрезания последовательностей для инактивации генов, содержащих последовательности-мишени. Альтернативно, векторы, последовательности или транспозоны являются способными к горизонтальному переносу (например, переносу конъюгативного транспозона) к второй популяции бактерий-реципиентов, которые принадлежат к видам, отличным от первых бактерий-реципиентов, где нуклеотидная последовательность участков-мишеней содержатся во вторых бактериях-реципиентах, но не содержатся в первых бактериях-реципиентах, в результате чего участок-мишень модифицируют посредством Cas во вторых бактериях-реципиентах (клетках-хозяевах).

В одном примере, первые бактерии-реципиенты представляют собой бактерии Bacteroides, и вторые бактерии-реципиенты представляют собой Firmicutes или патогенные бактерии, например, бактерии кишечника. В одном примере, бактерии-носители содержат векторы по изобретению (например, фаги или плазмиды), содержащие один или несколько конъюгативных транспозонов (например, транспозонов CTnDot), способных к переносу посредством бактерий-носителей, первых бактерий и вторых бактерий, например, где транспозоны содержат oriT и бактерии-носители, первые бактерии и вторые бактерии являются совместимыми с oriT.

Альтернативно, бактерии-носители являются способными к переносу вектора, сконструированной последовательности или транспозона по изобретению напрямую к Firmicutes или патогенным бактериям, например, у человека или не относящегося к человеку животного, например, в кишечнике, ротовой полости, или системно (например, в крови). В одном примере, патогенные бактерии представляют собой бактерии C dificile, H pylori, патогеные бактерии E coli, бактерии Salmonella, Listeria, Yersinia, Shigella, S aureus, Streptococcus или Campylobacter.

В одном примере, бактерии-носители представляют собой бактерии одного или нескольких видов, выбранных из группы, состоящей из видов Lactobacillus (например, acidophilus (например, La-5, La-14 или NCFM), brevis, bulgaricus, plantarum, rhammosus, fermentum, caucasicus, helveticus, lactis, reuteri или casei например, casei Shirota), видов Bifidobacterium species (например, bifidum, breve, longum или infantis), Streptococcus thermophilus и Enterococcus faecium. Например, бактерии представляют собой бактерии L acidophilus.

Мобилизуемые транспозоны, подобно мобилизуемым плазмидам, не способны к самопереносу, но способны к переносу между клетками в присутствии вспомогательного элемента TcR. Наиболее часто обсуждаемые транспозоны Bacteroides из этого класса включают в себя Tn4399, Tn4555 и нереплицирующиеся единицы Bacteroides. Мобилизуемый транспозон Tn4555, например, впервые детектировали в ходе исследований трансмиссивной устойчивости к цефокситину в клиническом изоляте Bacteroides vulgatus. В одном варианте осуществления, таким образом, транспозон по изобретению представляет собой мобилизуемый транспозон (например, мобилизуемый транспозон Bacteroides), например, Tn4399 или Tn4555, содержащий один или несколько массивов или последовательностей по изобретению. Транспозон присутствует в комбинации с вспомогательным элементом TcR.

В одном примере, транспозон по изобретению представляет собой транспозон Tn916 Enterococcus или транспозон Tn1546 грамположительных организмов. Транспозон (например, такой как транспозон CTnDot, Tn4399 или Tn4555) можно характеризовать, например, по его концевым повторам и/или последовательности(последовательностям), кодирующим транспозазу или резольвазу. В альтернативном примере, вектор или транспозон содержит точку начала репликации, выбранную из pMB1, pBR322, ColE1, R6K (в комбинации с геном pir), p15A, pSC101, F1 и pUC. В одном примере, транспозон присутствует в комбинации с фактором (например, антибиотиком, например, тетрациклином), который является необходимым для мобилизации или переноса транспозона. В одном примере, транспозон содержит ген устойчивости к антибиотику (например, ген устойчивости к тетрациклину устойчивость), и транспозон присутствует в комбинации с указанным антибиотиком (например, его вводят человеку одновременно или последовательно с указанным антибиотиком). В одном примере, транспозон представляет собой транспозон piggyBac, Mariner или Sleeping Beauty в комбинации с родственной транспозазой. В одном примере, транспозон представляет собой транспозон класса I. В одном примере, транспозон представляет собой транспозон класса II. В одном примере, транспозон представляет собой транспозон семейства Tn.

НАЦЕЛИВАНИЕ НА УСТОЙЧИВОСТЬ К АНТИБИОТИКАМ У БактериальныХ ХОЗЯЕВ

Устойчивость к антибиотику является общемировой проблемой. Новые формы устойчивости к антибиотику могут пересекать международные границы и легко распространяться между континентами. Многие формы устойчивости распространяются с заметной скоростью. Лидеры мирового здравоохранения описывают устойчивые к антибиотикам микроорганизмы как «кошмарные бактерии», «представляющие катастрофическую угрозу» для людей в каждой стране мира. Каждый год в Соединенных Штатах, по меньшей мере 2 миллионов человек приобретают серьезные инфекции бактериями, которые являются устойчивыми к одному или нескольким антибиотикам, разработанным для лечения этих инфекций. По меньшей мере 23000 человек умирают каждый год в качестве прямого результата этих устойчивых к антибиотикам инфекций. Намного больше умирают от других состояний, осложняемых устойчивыми к антибиотикам инфекциями. Кроме того, почти 250000 каждый год требуют госпитализации из-за инфекций Clostridium difficile (C. difficile). При большинстве из этих инфекций, применение антибиотиков являлось главным способствующим фактором, приводящим к заболеванию. По меньшей мере 14000 человек умирают каждый год в Соединенных Штатах от инфекций C. difficile. Многие из этих инфекций можно было предотвратить. Устойчивые к антибиотикам инфекции добавляют значительные и устранимые затраты к уже перегруженным системе здравоохранения США и другим системам здравоохранения. В большинстве случаев, устойчивые к антибиотикам инфекции требуют длительного и/или затратного лечения, длительной госпитализации, вынужденных дополнительных врачебных осмотров и использования системы здравоохранения, и приводят к большему количеству случаев инвалидности и смерти по сравнению с инфекциями, легко поддающимися лечению с использованием антибиотиков. Общие экономические затраты из-за устойчивости к антибиотику в экономике США сложно рассчитать. Оценки меняются, но лежат в диапазоне, настолько высоком, как $20 миллиардов прямых избыточных затрат на здравоохранение, с дополнительными общественными затратами из-за низкой производительности, настолько высокими, как $35 миллиардов в год (в долларах на 2008 г.). Применение антибиотиков является единственным наиболее важным фактором, приводящим к устойчивости к антибиотику по всему миру. Антибиотики присутствуют среди наиболее часто назначаемых лекарственных средств, используемых в медицине для человека. Однако, вплоть до 50% от всех антибиотиков, назначаемых людям, не являются необходимыми или не являются оптимально эффективными, как назначено. Антибиотики также являются общеупотребительными для животных, используемых для производства пищевых продуктов, для предотвращения, контроля и лечения заболеваний, и для стимуляции роста животных, используемых для производства пищевых продуктов. Применение антибиотиков для стимуляции роста не является необходимым, и эту практику следует прекратить. В недавнем руководстве от Управления США по надзору за качеством пищевых продуктов и лекарственных средств (FDA) описаны пути для достижения этой цели. Является сложным прямое сравнение количества лекарственных средств, используемого для животных, используемых для производства пищевых продуктов, с количеством, используемым для человека, но существуют доказательства того, что больше антибиотиков используют при производстве пищевых продуктов.

Другим главным фактором в росте устойчивости к антибиотику является распространение устойчивых штаммов бактерий от человека к человеку, или от не относящихся к человеку источников в окружающей среде, включая пищевые продукты. Существуют четыре вида основных действий, которые могут помогать бороться с этими смертельными инфекциями: 1. предотвращение инфекций и предотвращение распространения устойчивости; 2. отслеживание устойчивых бактерий; 3. улучшение применение современных антибиотиков; и 4. стимуляция разработки новых антибиотиков и разработки новых диагностических тестов для устойчивых бактерий. Бактерии неизбежно будут находить способы устойчивости к разрабатываемым человеком антибиотикам, что является причиной того, почему необходимы агрессивные действия для сдерживания развития новой устойчивости и для предотвращения уже существующей устойчивости от распространения.

Изобретение относится к улучшенным способам для нацеливания на устойчивые к антибиотику хозяева и для уменьшения вероятности развития у хозяев дополнительной устойчивости к композициям по изобретению.

Дополнительные примеры клеток-хозяев и нацеливания на устойчивость к антибиотику в таких клетках с использованием настоящее изобретение являются следующими:-

1. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Staphylococcus aureus, например, устойчивые к антибиотику, выбранному из метициллина, ванкомицина, линезолида, даптомицина, квинупристина, дальфопристина и тейкопланина, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

2. Необязательно клетка-хозяин(клетки-хозяева) представляют собой клетки Pseudomonas aeuroginosa, например, устойчивые к антибиотику, выбранному из цефалоспоринов (например, цефтазидима), карбапенемов (например, имипенема или меропенема), фторхинолонов, аминогликозидов (например, гентамицина или тобрамицина) и колистина, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

3. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Klebsiella (например, pneumoniae), например, устойчивые к карбапенему, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

4. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Streptoccocus (например, thermophilus, pneumoniae или pyogenes), например, устойчивые к антибиотику, выбранному из эритромицина, клиндамицина, бета-лактама, макролида, амоксициллина, азитромицина и пенициллина и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

5. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Salmonella (например, серотип Typhi), например, устойчивые к антибиотику, выбранному из цефтриаксона, азитромицина и ципрофлоксацина, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

6. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Shigella, например, устойчивые к антибиотику, выбранному из ципрофлоксацина и азитромицина, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

7. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки mycobacterium tuberculosis, например, устойчивые к антибиотику, выбранному из изониазида (INH), рифампицина (RMP), фторхинолона, амикацина, канамицина и капреомицина, и азитромицина, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

8. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Enterococcus, например, устойчивые к ванкомицину, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

9. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Enterobacteriaceae, например, устойчивые к антибиотику, выбранному из цефалоспорина и карбапенема, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

10. Необязательно клетка-хозяин(клетки-хозяева) представляют собой клетки E. coli клетки, например, устойчивые к антибиотику, выбранному из триметоприма, нитрофурантоина, цефалексина и амоксициллина, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

11. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Clostridium (например, dificile), например, устойчивые к антибиотику, выбранному из антибиотиков фторхинолона и карбапенема, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

12. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Neisseria gonnorrhoea, например, устойчивые к антибиотику, выбранному из цефиксима (например, перорального цефалоспорина), цефтриаксона (пригодного для инъекций цефалоспорина), азитромицина и тетрациклина, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

13. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Acinetoebacter baumannii, например, устойчивые к антибиотику, выбранному из бета-лактама, меропенема и карбапенема, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

14. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой клетки Campylobacter, например, устойчивые к антибиотику, выбранному из ципрофлоксацина и азитромицина, и участок-мишень хозяина (или один или несколько участков-мишеней) содержится в гене, придающем хозяину устойчивость к указанному антибиотику.

15. Необязательно, клетка-хозяин(клетки-хозяева) продуцирует бета (β)-лактамазу.

16. Необязательно, клетка-хозяин(клетки-хозяева) представляют собой бактериальные клетки-хозяева, которые являются устойчивыми к антибиотику из перечисленных в любом из примеров 1-14.

В одном варианте осуществления, клетка-хозяин представляет собой клетку S aureus штамма USA300.

В одном примере, эта или каждая последовательность-мишень хозяина содержится в плазмиде клетки-хозяина, например, в плазмиде S aureus (например, из штамма USA300), например, мишень содержится в плазмиде pUSA01, pUSA02 или pUSA03 из клеток S aureus. В одном примере, первая и/или вторая мишень содержится в последовательности гена mecA, mecA2 или sek хозяина (например, клетки штамма S aureus). В одном примере, первая и/или вторая мишень содержится в нуклеотидной последовательность (например, ДНК) островка патогенности хозяина. В одном примере, спейсер по изобретению содержит спейсер или состоит из спейсера, описанного в таблице 1 на странице 26 WO2014/124226, где спейсерные последовательности приведены в настоящем документе в качестве ссылок. В одном примере, сконструированная последовательность, HM-crРНК или gРНК содержит такой спейсер.

Композиция, применение, способ, система, вектор, коллекция, массив, сконструированная последовательность, вирус, фаг, фагмида, профаг или вирион по изобретению, которые являются эффективными для уменьшения количества или уничтожения, или ингибирования роста устойчивого к антибиотику бактериального хозяина в анализе колонизации кожи мышей (например, как описано в WO2014/124226, Kugelberg E, et al. Establishment of a superficial skin infection model in mice by using Staphylococcus aureus and Streptococcus pyogenes. Antimicrob Agents Chemother. 2005;49:3435-3441 или Pastagia M, et al. A novel chimeric lysin shows superiority to mupirocin for skin decolonization of methicillin-resistant and -sensitive Staphylococcus aureus strains. Antimicrob Agents Chemother. 2011;55:738-744) где первая и/или вторая мишень содержится в гене хозяина, придающем устойчивость к указанному антибиотику, например, где хозяин представляет собой хозяина S aureus (например, штамма USA300).

Эталонная последовательность S pyogenes является доступной под номером доступа в Genbank NC_002737, с геном cas9 в положениях 854757-858863. Аминокислотная последовательность Cas9 S pyogenes является доступной под номером NP_269215. Эти последовательности приведены в настоящем документе в качестве ссылок для применения по настоящему изобретению. Дополнительные последовательности, как описано в 20150079680, в явной форме или приведенные в том документе в качестве ссылки, также приведены в настоящем документе в качестве ссылки для применения по настоящему изобретению. Приведена также ссылка на описание последовательностей и способов в WO2013/176772, содержание которого приведено в настоящем документе в качестве ссылки. Примерами последовательностей tracrРНК являются последовательности, описанные на странице 15 WO2014/124226, содержание которой приведено в настоящем документе в качестве ссылки для применения по настоящему изобретению.

В одном примере, этот или каждый повтор имеет длину или состоит из 20-50 (например, от 24-47, например, 30, 29, 28, 27, 26, 25 или 24) смежных нуклеотидов.

В одном примере, этот или каждый спейсер имеет длину или состоит из 18-50 (например, 24-47, или 20-40, например, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18), например, 19 или 20 смежных нуклеотидов.

В одном примере, первый повтор (наиболее близкий к 5'-концу в HM-массиве по изобретению) находится на 5'-конце от спейсерной последовательность, которая является комплементарной последовательности, содержащей первую мишень хозяина. Это является полезным, с точки зрения наблюдения того, что недавно приобретенные спейсеры (например, из последовательности проникающего фага) обычно встраиваются в бактерии в этом положении, и таким образом, расположение первого спейсера по изобретению таким образом является полезным для стимуляции его использования.

В одном примере, нуклеиновая кислота вируса (например, фага) содержит точку начала репликации (ori) и участок упаковки. В одном примере, нуклеиновая кислота вируса содержит также один, несколько или все гены, кодирующие жизненно важные белки капсида, например, гены rinA, terS и terL. В одном примере, вместо этого, один, несколько или все из них содержатся в сопутствующем вирусе-помощнике (например, фаге-помощник), предназначенном для совместной инфекции с вирусом по изобретению - это высвобождает пространство в последнем для включения большего количества нуклеиновой кислоты HM-массива и/или большего количества нуклеиновой кислоты, кодирующей Cas, способной функционировать в хозяине. В одном примере, нуклеиновая кислота вируса содержит фрагмент генома фага дикого типа, где фрагмент состоит из последовательных нуклеотидов из генома, содержащих по меньшей мере гены rinA, terS и terL или эквивалентные гены, кодирующие белки фага.

В одном примере, клетка-хозяин принадлежит к штамму или виду, обнаруженному в микробиоте человека.

В одном примере, этот или каждый участок-мишень содержится в гене, опосредующем патогенную адгезию, колонизацию, инвазию, ингибирование иммунного ответа, вирулентность, экспрессию жизненно важного белка или функции, или образование токсина хозяина. В одном примере, ген представляет собой ген, кодирующий цитотоксин, альфа-гемолизин, бета-гемолизин, гамма-гемолизин, лейкоцидин, лейкоцидин Пантон-Валентина (PVL), экзотоксин, TSST-1, энтеротоксин, SEA, SEB, SECn, SED, SEE, SEG, SEH, SEI, эксфолиативный токсин, ETA или ETB, необязательно, где хозяин представляет собой S aureus, например, MRSA.

В одном примере, этот или каждый массив CRISPR представляет собой массив по любой из конфигураций, вариантов осуществления, примеров, концепций, аспектов, абзацев или пунктов, описанных в настоящем документе. В одном примере, эта или каждая сконструированная нуклеотидная последовательность представляет собой сконструированную нуклеотидную последовательность по любой из конфигураций, вариантов осуществления, примеров, концепций, аспектов, абзацев или пунктов, описанных в настоящем документе.

В одном примере, этот или каждый вектор представляет собой вектор по любой из конфигураций, вариантов осуществления, примеров, концепций, аспектов, абзацев или пунктов, описанных в настоящем документе.

В одном примере по любой из конфигураций, вариантов осуществления, примеров, аспектов, абзацев или пунктов, описанных в настоящем документе, вектор или MGE представляет собой или содержит каспозон. MGE дополнительно описаны ниже. В одном примере, каспозон представляет собой каспозон семейства 1, 2 или 3. В одном примере, MGE по изобретению содержит концевые инвертированные повторы каспозона и необязательно, кодирующую Cas1 последовательность каспозона. В одном примере, MGE по изобретению представляет собой или содержит a каспозон минус Cas1 и способен функционировать для мобилизации с Cas1 из клетки-хозяина. Подробно о каспозонах см. в BMC Biol. 2014 May 19;12:36. doi: 10,1186/1741-7007-12-36, «Casposons: a new superfamily of self-synthesizing DNA transposons at the origin of prokaryotic CRISPR-Cas immunity», Krupovic M et al.

ДОПОЛНИТЕЛЬНЫЕ примерЫ ПРИМЕНЕНИЙ по настоящему изобретению

В одном примере, композиция (например, HM-композиция или сконструированная последовательность в комбинации с антибиотиком) является такой, как в любом из следующего: В одном примере, композиция представляет собой медицинскую, офтальмологическую, стоматологическую или фармацевтическую композицию (например, содержащуюся в вакцине против хозяина). В одном примере, композиция представляет собой противомикробную композицию, например, антибиотическую или противовирусную, например, лекарственное средство, дезинфицирующее средство или ополаскиватель для ротовой полости. В одном примере, композиция представляет собой косметическую композицию (например, композицию для макияжа лицу или тела). В одном примере, композиция представляет собой гербицид. В одном примере, композиция представляет собой пестицид (например, когда хозяин представляет собой хозяина Bacillus (например, thuringiensis)). В одном примере, композиция представляет собой добавку к напитку (например, пиву, вину или алкогольному напитку). В одном примере, композиция представляет собой пищевую добавку (например, когда хозяин представляет собой хозяина E coli, Salmonella, Listeria или Clostridium (например, botulinum)). В одном примере, композиция представляет собой добавку к воде. В одном примере, композиция представляет собой добавку в окружающую среду для водных животных (например, в аквариум). В одном примере, композиция представляет собой композицию в нефтяной или нефтехимической промышленности или содержится в такой композиции (например, когда хозяин представляет собой хозяина - сульфатвосстанавливающую бактерию, например, Desulfovibrio). В одном примере, композиция представляет собой добавку для нефти или нефтехимическому продукту. В одном примере, композиция представляет собой химическую добавку. В одном примере, композиция представляет собой дезинфицирующее средство (например, для стерилизации оборудования для применения для человека или животного, например, для хирургического или медицинского применения или для детского питания). В одном примере, композиция представляет собой композицию для личной гигиены для применения для человека или животного. В одном примере, композиция представляет собой композицию для применения для окружающей среды, например, для обработки почвы или для очистки окружающей среды от загрязняющих примесей (например, из сточных вод, или из нефти, из нефтехимических продуктов или из химических веществ, например, когда хозяин представляет собой хозяина - сульфатвосстанавливающую бактерию, например, a Desulfovibrio). В одном примере, композиция представляет собой стимулятор роста растений. В одном примере, композиция представляет собой композицию для применения в добыче нефти, нефтехимических продуктов, металлов или полезных ископаемых. В одном примере, композиция предназначена для обработки или добавки для ткани. В одном примере, композиция предназначена для обработки или добавки для шкур животных, кожи или замши. В одном примере, композиция представляет собой добавку к красителю. В одном примере, композиция представляет собой добавку при пивоварении или ферментации напитка (например, пива или вина) (например, когда хозяин представляет собой хозяина Lactobacillus). В одном примере, композиция представляет собой добавку для воды. В одном примере, композиция представляет собой добавку для чернил. В одном примере, композиция представляет собой добавку для клея. В одном примере, композиция представляет собой композицию против паразитов человека или животного, или растения. В одном примере, композиция представляет собой добавку для воздуха (например, для воздуха, содержащегося или образующегося в оборудовании для кондиционирования воздуха, например, когда хозяин представляет собой хозяина Legionella). В одном примере, композиция представляет собой добавку-антифриз (например, когда хозяин представляет собой хозяина Legionella). В одном примере, композиция представляет собой композицию для промывания глаз или офтальмологическую композицию (например, жидкость для контактных линз). В одном примере, композиция содержится в молочном пищевом продукте (например, композиция содержится в молоке или молочном продукте или представляет собой молоко или молочный продукт; например, где хозяин представляет собой хозяина Lactobacillus, Streptococcus, Lactococcus или Listeria). В одном примере, композиция представляет собой бытовое или промышленное чистящее средство или содержится в бытовом или промышленном чистящем средстве (например, когда хозяин представляет собой хозяина E coli, Salmonella, Listeria или Clostridium (например, botulinum)). В одном примере, композиция содержится в топливе. В одном примере, композиция содержится в растворителе (например, отличном от воды). В одном примере, композиция представляет собой добавку для выпечки (например, пищевую добавку для выпечки). В одном примере, композиция представляет собой лабораторный реагент (например, для применения в биотехнологии или в технологии рекомбинантной ДНК или РНК). В одном примере, композиция содержится в средстве для замачивания пряжи. В одном примере, композиция предназначена для применения в способе синтеза витаминов. В одном примере, композиция представляет собой композицию против порчи сельскохозяйственных культур или растений (например, когда хозяин представляет собой хозяина - сапротрофную бактерию). В одном примере, композиция представляет собой антикоррозионное соединение, например, для предотвращения или уменьшения коррозии металлов (например, когда хозяин представляет собой хозяина - сульфатвосстанавливающую бактерию, например, Desulfovibrio, например, для применения для уменьшения или предотвращения коррозии оборудования для добычи, обработки или хранения нефти; оборудования для добычи, обработки или хранения металлов; или оборудования для добычи, обработки или хранения полезных ископаемых). В одном примере, композиция представляет собой композицию для сельского хозяйства или земледелия, или содержится в такой композиции. В одном примере, композиция представляет собой добавку для силоса. Изобретение относится к HM-массиву CRISPR, HM-системе CRISPR/Cas, HM-crРНК, HM-спейсеру, HM-ДНК, HM-Cas, HM-композиции или gРНК, как описано в настоящем документе, для применения в любой из композиций, описанных в этом абзаце или для использования для любого применения, описанного в этом абзаце, например, где клетка-хозяин представляет собой клетку микроорганизмов, или клетку бактерий или архей. Изобретение относится к способу для любого применения, описанного в этом абзаце, где способ включает в себя объединение HM-массива CRISPR, HM-системы CRISPR/Cas, HM-crРНК, HM-спейсера, HM-ДНК, HM-Cas, gРНК или HM-композиции по изобретению с клеткой-хозяином (например, клеткой микроорганизмов, бактерий или архей). В одном варианте осуществления, клетка-хозяин не присутствует в человеке или на человеке (или эмбрионе человека) или животном.

Любой аспект настоящего изобретения предназначен для промышленного или бытового применения, или его используют в способе для такого применения. Например, он предназначен для применения или его применяют в сельском хозяйстве, производстве нефти или нефтепродуктов, производстве пищевых продуктов или напитков, швейной промышленности, производстве упаковки, электронной промышленности, компьютерной промышленности, индустрии окружающей среды, химической промышленности, аэрокосмической промышленности, автомобильной промышленности, биотехнологической промышленности, медицинской промышленности, индустрии здравоохранения, стоматологической промышленности, энергетической промышленности, индустрии потребительских товаров, фармацевтической промышленности, горнодобывающей промышленности, индустрии очистки, лесной промышленности, рыбодобывающей промышленности, индустрии отдыха, перерабатывающей промышленности, косметической промышленности, производстве пластика, производстве пульпы или бумаги, текстильной промышленности, швейной промышленности, производстве кожи или замши, или шкур животных, табачной промышленности или сталелитейной промышленности.

В настоящем документе, при упоминании хозяина Desulfovibrio, вместо этого хозяин может представлять собой хозяина Desulfobulbus, Desulfobacter, Desulfobacterium, Desulfococcus, Desulfomonile, Desulfonema, Desulfobotulus или Desulfoarculus или любую другую серовосстанавливающую бактерию, описанную в настоящем документе. В одном варианте осуществления, для применения для нефти, воды, сточных вод или окружающей среды, хозяин представляет собой хозяина Desulfovibrio capillatus.

Интенсивный микробиологический анализ и секвенирование 16S рРНК показали, что род Desulfovibrio является предпоследним из приблизительно восьми различных групп сульфатвосстанавливающих эубактерий, которые можно выделить из окружающей среды. Семь из этих групп являются грамотрицательными, в то время как одна представляет грамположительные бактерии (Desulfotomaculum). Род Desulfovibrio обладает довольно небольшим геномом. Первоначальные оценки составляли 1,7 млн.п.о. и 1,6 млн.п.о. для геномов D. vulgaris и D. gigas (которые могут являться хозяевами по изобретению), соответственно. Это помогает идентификации желательных последовательностей-мишеней (например, последовательности жизненно важного гена или гена устойчивости) для применения по изобретению. Характеризация внутренней плазмиды D. desulfuricans (который может являться хозяином по изобретению), G200, позволила конструирование челночного вектора (Wall 1993, где вектор можно использовать в качестве вектора по настоящему изобретению), и выделение и характеризация двух бактериофагов из D. vulgaris Hildenborough (который может являться хозяином по изобретению) (Seyedirashti, 1992) может обеспечивать другие способы для эффективной генетической манипуляции с видами Desulfovibrio. В одном примере, вектор представляет собой бактериофаг мю или мю-подобный бактериофаг.

Примером хозяина является Desulfovibrio vulgaris, подвид vulgaris Postgate and Campbell (ATCC® 29579™), обозначение штамма: NCIB 8303 [DSM 644, Hildenborough].

Обработку бактерий митомицином C или УФ ранее использовали для индукции фага в бактериях (Driggers & Schmidt), и это представляет собой пригодный способ для получения подходящего соответствующего хозяину фага для получения вектора для применения в любом примере или аспекте настоящего изобретения.

Одним из применений изобретения является молочная промышленность (например, изготовление сыра или масла, или молочных продуктов) или ферментация (например, вина или уксуса или сои) или пивоварная или хлебопекарная промышленность. Например, для применения в молочной промышленности, способ по изобретению представляет собой способ получения молочных пищевых продуктов, включающий в себя ферментацию молочнокислых бактерий (например, клеток-хозяева Lactobacillus) в течение некоторого периода времени для продукции молочной кислоты из культуры, и затем ингибирование роста бактерий посредством вызова экспрессии crРНК из одного или нескольких массивов, систем, векторов, популяций или коллекций по изобретению, смешанных с бактериями, в результате чего продукцию молочной кислоты посредством бактерий уменьшают или ингибируют. Это является полезным для уменьшения порчи пищевых продуктов/напитков или нежелательного вкуса и/или запаха пищевых продуктов/напитков. Один из примеров в настоящем документе включает в себя индуцируемый HM-массив в бактериях, где способ включает в себя добавление индуцирующего средства после первого периода.

Ссылки

Wall, J. D., B. J. Rapp-Giles, and M. Rousset. 1993. «Characterization of a small plasmid from Desulfovibrio desulfuricans and its use for shuttle vector construction». J. Bacteriol. 175:4121-4128;

Seyedirashti S et al; J Gen Microbiol. 1992 Jul;138(7):1393-7, «Molecular characterization of two bacteriophages isolated from Desulfovibrio vulgaris NCIMB 8303 (Hildenborough)»;

Driggers & Schmidt, J. gen. Virol. (I97O), 6, 421-427, «Induction of Defective and Temperate Bacteriophages in Caulobacter».

КОНЦЕПЦИИ:

Изменения относительного соотношения субпопуляций первых и вторых бактерий в смешанной популяции бактерий, например, в микробиоте

1. Применение модифицирующей хозяина (HM) системы CRISPR/Cas для изменения относительного соотношения первой и второй субпопуляции бактерий в смешанной популяции бактерий, где вторые бактерии содержат клетки-хозяева,

где для каждой клетки-хозяина система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas;

(ii) последовательность-мишень клетки-хозяина и сконструированный модифицирующей хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая гибридизуется с последовательностью-мишенью клетки-хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК, экспрессирующая последовательность tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который трансформирует клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации системы CRISPR/Cas хозяина в клетке-хозяине; и

где последовательность-мишень модифицируют посредством Cas, в результате чего клетку-хозяина уничтожают или рост клетки-хозяина уменьшают.

2. Модифицирующая хозяина (HM) система CRISPR/Cas для применения из концепции 1 для модификации нуклеотидной последовательности-мишени бактериальной клетки-хозяина, где система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая нуклеазу Cas;

(ii) последовательность-мишень клетки-хозяина и сконструированный модифицирующей хозяина (HM) массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие HM-crРНК, где HM-crРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью хозяина для направления указанной Cas на мишень в клетке-хозяине для модификации последовательности-мишени;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК для экспрессии последовательности tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который может трансформировать клетку-хозяина, в результате чего HM-crРНК направляет Cas на мишень для модификации системы CRISPR/Cas хозяина в клетке-хозяине.

3. Система из концепции 2, где вектор или векторы лишены последовательности, кодирующей нуклеазу Cas (например, Cas9).

4. Применение или система из любой предшествующей концепции, где каждая клетка-хозяин принадлежит к штамму или виду, обнаруженному в микробиоте человека.

5. Применение из концепции 1 или 4 для (a) изменения доли бактерий Bacteroidetes в смешанной популяции бактерий; (b) уменьшения доли субпопуляции Firmicutes (клеток-хозяев) в смешанной популяции бактерий; (c) уменьшения доли первого вида Firmicutes (клеток-хозяев) в смешанной популяции, где смешанная популяция содержит второй вид Firmicutes, рост которого не ингибируют посредством указанной cРНК; (d) уменьшения доли первого грамположительного вида бактерий (клеток-хозяев) в смешанной популяции бактерий, где смешанная популяция содержит второй грамположительный вид бактерий, рост которого не ингибируют посредством указанной cРНК; (e) уменьшения доли вида бактерий (клеток-хозяев) в смешанной популяции бактерий, где смешанная популяция содержит другой вид бактерий, рост которого не ингибируют посредством указанной cРНК, где первый вид обладает последовательностью ДНК, кодирующей 16s рибосомальную РНК, которая является по меньшей мере на 80, 82, 83, 84, 85, 90 или 95% идентичной последовательности ДНК, кодирующей 16s рибосомальную РНК другого вида; (f) уменьшения доли первого вида бактерий микробиоты кишечника человека (клеток-хозяев, например, Firmicutes) в смешанной популяции бактерий, где смешанная популяция содержит другой вид бактерий, где другой вид представляет собой пробиотический вид кишечника человека, рост которого не ингибируют посредством указанной cРНК; или (g) уменьшения доли вида бактерий микробиоты кишечника человека ((клеток-хозяев, например, Firmicutes) в смешанной популяции бактерий, где смешанная популяция содержит другой вид бактерий, где другой вид представляет собой вид, комменсальный для кишечника человека, рост которого не ингибируют посредством указанной cРНК.

6. Система из концепции 2 или 3 для (a) изменения доли бактерий Bacteroidetes в смешанной популяции бактерий; (b) уменьшения доли субпопуляции Firmicutes (клеток-хозяев) в смешанной популяции бактерий; (c) уменьшения доли первого вида Firmicutes (клеток-хозяев) в смешанной популяции, где смешанная популяция содержит второй вид Firmicutes, рост которого не ингибируют посредством указанной cРНК; (d) уменьшения доли первого грамположительного вида бактерий (клеток-хозяев) в смешанной популяции бактерий, где смешанная популяция содержит второй грамположительный вид бактерий, рост которого не ингибируют посредством указанной cРНК; (e) уменьшения доли вида бактерий (клеток-хозяев) в смешанной популяции бактерий, где смешанная популяция содержит другой вид бактерий, рост которого не ингибируют посредством указанной cРНК, где первый вид обладает последовательностью ДНК, кодирующей 16s рибосомальную РНК, которая является по меньшей мере на 80, 82, 83, 84, 85, 90 или 95% идентичной последовательности ДНК, кодирующей 16s рибосомальную РНК другого вида; (f) уменьшения доли первого вида бактерий микробиоты кишечника человека (клеток-хозяев, например, a Firmicutes) в смешанной популяции бактерий, где смешанная популяция содержит другой вид бактерий, где другой вид представляет собой пробиотический вид из кишечника человека, рост которого не ингибируют посредством указанной cРНК; или (g) уменьшения доли вида бактерий микробиоты кишечника человека (клеток-хозяев, например, Firmicutes) в смешанной популяции бактерий, где смешанная популяция содержит другой вид бактерий, где другой вид представляет собой вид, комменсальный для кишечника человека, рост которого не ингибируют посредством указанной cРНК; где (a)-(g) предназначены для лечения или предотвращения у субъекта - человека или животного (i) инфекции микробиоты указанным видом бактерий, долю которого уменьшают; или (ii) заболевания или состояния, опосредованного указанным видом бактерий, долю которого уменьшают.

7. Применение или система из концепции 5 или 6 для увеличения относительного соотношения Bacteroidetes к Firmicutes.

8. Применение или система из любой предшествующей концепции, где указанная нуклеаза Cas предоставлена посредством эндогенной системы CRISPR/Cas типа II клетки.

9. Применение или система из любой предшествующей концепции, где компонент (i) является эндогенным для клетки-хозяина.

10. Применение или система из любой предшествующей концепции, где последовательность-мишень содержится в гене устойчивости к антибиотику, гене вирулентности или жизненно важном гене клетки-хозяина.

11. Применение или система из любой предшествующей концепции, где последовательность-мишень представляют собой хромосомную последовательность хозяина.

12. Применение или система из любой предшествующей концепции, где альтернативно, HM-crРНК и tracrРНК содержатся в одиночной направляющей РНК (gРНК), например, предоставленной посредством вектора.

13. Применение или система из любой предшествующей концепции, где клетка-хозяин содержит цепь дезоксирибонуклеиновой кислоты со свободным концом (HM-ДНК), кодирующую представляющую интерес последовательность HM, и/или где система содержит последовательность, кодирующую HM-ДНК, где HM-ДНК содержит последовательность или последовательности, которые являются гомологичными, соответственно, последовательности или последовательностям в последовательности-мишени или фланкирующим последовательность-мишень для вставки HM-ДНК в геном хозяина (например, в хромосомный или эписомный участок).

14. Сконструированный вектор на основе нуклеиновой кислоты для применения из концепции 1 для модификации бактериальной клетки-хозяина, содержащей эндогенную систему CRISPR/Cas, где вектор

(g) содержит последовательности нуклеиновой кислоты для экспрессии множества различных crРНК (например, содержащихся в gРНК) для применения в системе CRISPR/Cas или для применения в соответствии с любой предшествующей концепцией; и

(h) необязательно, лишен последовательности нуклеиновой кислоты, кодирующей нуклеазу Cas,

где первая из указанных crРНК является способной гибридизоваться с первой последовательностью нуклеиновой кислоты в указанной клетке-хозяине; и вторая из указанных crРНК является способной гибридизоваться с второй последовательностью нуклеиновой кислоты в указанной клетке-хозяине, где указанная вторая последовательность отличается от указанной первой последовательности; и

(i) первая последовательность содержится в гене устойчивости к антибиотику (или его РНК), и вторая последовательность содержится в гене устойчивости к антибиотику (или его РНК); необязательно где гены являются различными;

(j) первая последовательность содержится в гене устойчивости к антибиотику (или его РНК) и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК);

(k) первая последовательность содержится в жизненно важном гене (или его РНК), и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК); или

(l) первая последовательность содержится в гене вирулентности (или его РНК) и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК).

15. Вектор из концепции 14 внутри клетки-хозяина, содержащей одну или несколько Cas, которые являются способными функционировать с cРНК (например, одиночной направляющей РНК), кодируемой вектором.

16. Применение, система или вектор из любой предшествующей концепции, где HM-массив CRISPR содержит множество копий одного и того же спейсера.

17. Применение, система или вектор из любой предшествующей концепции, где вектор(ы) содержит множество HM-массивов CRISPR.

18. Применение, система или вектор из любой предшествующей концепции, где каждый вектор представляет собой вирус или фаг.

19. Применение, система или вектор из любой предшествующей концепции, где система или вектор содержит две, три или более копии последовательностей нуклеиновой кислоты, кодирующих crРНК (например, gРНК), где копии содержат одну и ту же спейсерную последовательность для нацеливания на последовательность клетки-хозяина (например, последовательность гена вирулентности, гена устойчивости или жизненно важного гена).

20. Применение, система или вектор из концепции 20, где копии разделены между двумя или более векторами с массивами CRISPR.

21. Бактериальная клетка-хозяин, содержащая систему или вектор, указанные в любой предшествующей концепции.

22. Применение, система, вектор или клетка из любой предшествующей концепции, где массив присутствует в комбинации с антибиотическим средством; или применение включает в себя подвергание клеток-хозяев воздействию первого антибиотика, где последовательность-мишень содержится в гене устойчивости к антибиотику для устойчивости к указанному первому антибиотику.

23. Применение, система, вектор или клетка из любой предшествующей концепции, где клетка-хозяин представляет собой клетку-хозяина Staphylococcus, Streptococcus, Pseudomonas, Salmonella, Listeria, E coli, Desulfovibrio или Clostridium.

24. Применение, система или клетка по любой из концепций 1-13 или 16-23, где каждый вектор соответствует концепции 14 или 15.

25. Применение, система, вектор или клетка из любой предшествующей концепции, где рост популяции клеток-хозяев уменьшают по меньшей мере в 5 раз по сравнению с ростом популяции указанных клеток-хозяев, не трансформированных указанным HM-массивом или нуклеотидной последовательностью, кодирующей указанную gРНК.

26. Применение, система, вектор или клетка из любой предшествующей концепции, где рост популяции клеток-хозяев на поверхности ингибируют. В одном примере, популяция находится в контакте с поверхностью ткани человека (например, с поверхностью ткани кишечника человека, например, in vivo или ex vivo.).

27. Применение, система, вектор или клетка из любой предшествующей концепции, где первые бактерии являются пробиотическими, комменсальными или симбиотическими для человека (например, в кишечнике человека).

28. Применение, система, вектор или клетка из любой предшествующей концепции, где первые и вторые бактерии обе представляют собой Firmicutes и представляют собой бактерии из различных видов или штаммов; или где первые бактерии представляют собой Enterobacteriaceae, и вторые бактерии представляют собой Firmicutes.

29. Применение, система, вектор или клетка из любой предшествующей концепции где клетки-хозяева представляют собой клетки архей вместо бактериальных клеток, или каждая популяция представляет собой популяцию архей вместо популяции бактерий.

30. Применение по любой из концепций 1, 4, 5, 7-13, 16-20 и 22-29 для обработки медицинской жидкости, поверхности, устройства или контейнера в промышленности или ex vivo; или для обработки водных путей, воды, напитка, пищевого продукта или косметического продукта, где клетка-хозяин(клетки-хозяева) содержатся в жидкости, поверхности, устройстве, контейнере, водных путях, воде, напитке, пищевом продукте или косметическом продукте или на них.

31. Применение, система, вектор или клетка из любой предшествующей концепции, где HM-cРНК или gРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью протоспейсера клетки-хозяина, которая является смежной с мотивом, смежным с протоспейсером (PAM), NNAGAAW или NGGNG.

32. Вектор на основе нуклеиновой кислоты по любой предшествующей концепции, или для использования в применении, системе или клетке из любой предшествующей концепции, где вектор содержит более 1,4 т.п.о. экзогенной последовательности ДНК, где экзогенная ДНК кодирует один или несколько компонентов системы CRISPR/Cas и содержит сконструированный массив для экспрессии HM-crРНК или gРНК в клетках-хозяевах, где экзогенная последовательность лишена нуклеотидной последовательности, кодирующей нуклеазу Cas, родственную cРНК(нескольким cРНК) или gРНК(нескольким gРНК); где по меньшей мере 2 различные cРНК или gРНК кодированы экзогенной ДНК (например, посредством по меньшей мере 2 HM-массивов CRISPR).

33. Вектор из концепции 32, где вектор представляет собой вирусный вектор, способный к трансформации клеток-хозяев.

34. Вектор из концепции 32 или 33, где cРНК или gРНК являются способными к гибридизации в клетках-хозяевах с соответствующими последовательностями-мишенями протоспейсера, где каждая последовательность протоспейсера содержится в гене устойчивости к антибиотику или жизненно важном гене хозяина.

35. Вектор по любой из концепций 34-36, где клетки-хозяева представляют собой клетки из видов микробиоты человека.

ВАРИАНТЫ ОСУЩЕСТВЛЕНИЯ:

Использование эндогенной Cas дикого типа для ингибирования роста популяции и обработки бактерий на поверхностях

1. Применение эндогенной активности нуклеазы Cas дикого типа бактериальной популяции клетки-хозяина для ингибирования роста популяции, где популяция содержит множество клеток-хозяев, и каждая клетка-хозяин обладает эндогенной системой CRISPR/Cas, обладающей активностью нуклеазы Cas дикого типа, где применение включает в себя трансформацию клеток-хозяев из популяции, где каждая трансформированная клетка-хозяин трансформирована сконструированной нуклеотидной последовательностью для обеспечения модифицирующей хозяина (HM) cРНК или направляющей РНК (gРНК) в клетке-хозяине, где HM-cРНК или gРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью протоспейсера клетки-хозяина для направления эндогенной Cas к мишени, где cРНК или gРНК является родственной эндогенной нуклеазе Cas клетки-хозяина, обладающей указанной активностью нуклеазы дикого типа, и после указанной трансформации клеток-хозяев рост популяции является ингибированным.

Клетки-хозяева могут принадлежать к одному и тому же вида или штамма.

2. Применение из варианта осуществления 1, где ингибирование роста популяции клеток-хозяев представляет собой уменьшение роста по меньшей мере в 5 раз по сравнению с ростом популяции указанных клеток-хозяев, н трансформированных указанной сконструированной нуклеотидной последовательностью.

3. Применение из варианта осуществления 1, где рост популяции на поверхности ингибируют.

4. Применение из варианта осуществления 2, где рост популяции на поверхности ингибируют.

5. Применение из варианта осуществления 1, где указанное ингибирование включает в себя использование HM-системы CRISPR/Cas для уничтожения или уменьшения роста указанных клеток-хозяев, где для каждой клетки-хозяина система содержит компоненты по (i)-(iv):-

(i) по меньшей мере одна последовательность нуклеиновой кислоты, кодирующая указанную нуклеазу Cas;

(ii) сконструированный модифицирующей хозяина HM-массив CRISPR, содержащий спейсерную последовательность (HM-спейсер) и повторы, кодирующие указанную HM-crРНК;

(iii) не обязательно, последовательность tracrРНК или последовательность ДНК, экспрессирующая последовательность tracrРНК;

(iv) где указанные компоненты системы разделены между клеткой-хозяином и по меньшей мере одним вектором на основе нуклеиновой кислоты, который трансформирует клетку-хозяина, в результате чего HM-crРНК направляет указанную Cas на мишень для модификации последовательности-мишени;

где последовательность-мишень модифицируют в клетках-хозяевах посредством Cas, в результате чего клетки-хозяева уничтожают или рост клетки-хозяина уменьшают.

6. Применение по любому предшествующему варианту осуществления, для изменения относительного соотношения первой и второй субпопуляции бактерий в смешанной популяции бактерий, где вторые бактерии содержат указанные клетки-хозяева.

7. Применение из варианта осуществления 6, где клетки-хозяева принадлежат к штамму или виду, обнаруженному в микробиота человека.

8. Применение из варианта осуществления 6 или 7, где клетки-хозяева являются смешанными с клетками из различных штаммов или видов, где различные клетки представляют собой Enterobacteriaceae или бактерии, которые являются пробиотическими, комменсальными или симбиотическими для человека (например, в кишечнике человека).

9. Применение по любому предшествующему варианту осуществления для изменения доли бактерий Bacteroidetes в смешанной популяции бактерий, содержащей бактерии Bacteroidetes и другие бактерии, необязательно, для увеличения относительного соотношения Bacteroidetes по сравнению с одним, несколькими или всеми видам Firmicutes (например, по сравнению с Streptococcus) в популяции.

10. Применение по любому предшествующему варианту осуществления для изменения относительного соотношения первых бактерий и вторых бактерий в смешанной популяции, где первые и вторые бактерии обе представляют собой Firmicutes и представляют собой бактерии из различных видов или штаммов, где вторые бактерии содержат клетки-хозяева. В одном примере, применение увеличивает долю первых бактерий относительно вторых бактерий.

11. Применение из варианта осуществления 1, где сконструированная нуклеотидная последовательность не присутствует в комбинации с экзогенной последовательностью, кодирующей нуклеазу Cas.

12. Применение из варианта осуществления 5, где вектор или векторы лишены последовательности, кодирующей нуклеазу Cas.

13. Применение из варианта осуществления 1, где каждая клетка-хозяин принадлежит к штамму или виду, обнаруженного в микробиоте человека.

14. Применение из варианта осуществления 6, где каждая клетка-хозяин принадлежит к штамму или виду, обнаруженному в микробиоте человека.

15. Применение из варианта осуществления 13, где каждая клетка-хозяин является смешанной с клетками из различных штаммов или видов, где различные клетки представляют собой Enterobacteriaceae или бактерии, которые являются пробиотическими, комменсальными или симбиотическими для человека (например, в кишечнике человека).

16. Применение из варианта осуществления 1, где применение изменяет долю бактерий Bacteroidetes в смешанной популяции бактерий, содержащей бактерии Bacteroidetes и другие бактерии, необязательно, где применение изменяет относительное соотношение Bacteroidetes по сравнению с одним, несколькими или всеми видами Firmicutes (например, Streptococcus) в популяции.

17. Применение из варианта осуществления 1, где как первые, так и вторые бактерии представляют собой Firmicutes, и применение изменяет относительное соотношение первых бактерий относительно вторых бактерий в смешанной популяции. В одном примере, применение увеличивает долю первых бактерий относительно вторые бактерии.

18. Применение из варианта осуществления 1, где указанную нуклеазу Cas предоставляют посредством эндогенной системы CRISPR/Cas типа II клетки-хозяина, и/или HM-cРНК или gРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью протоспейсера клетки-хозяина, которая является смежной с мотивом 5'-NNAGAAW-3', смежным с протоспейсером, (PAM).

19. Применение из варианта осуществления 5, где указанная нуклеаза Cas предоставлена посредством эндогенной системы CRISPR/Cas типа II клетки-хозяина.

20. Применение из варианта осуществления 5, где компонент (iii) является эндогенным для клетки-хозяина.

21. Применение из варианта осуществления 5, где каждая трансформированная клетка-хозяин содержит эндогенную РНКазу III, которая может функционировать с компонентом (ii) для продукции указанной HM-crРНК в клетке.

22. Применение из варианта осуществления 1, где последовательность-мишень содержится в гене устойчивости к антибиотику, гене вирулентности или жизненно важном гене клетки-хозяина.

23. Применение из варианта осуществления 1, где сконструированная нуклеотидная последовательность присутствует в комбинации с антибиотическим средством.

24. Применение из варианта осуществления 5, где HM-crРНК и tracrРНК содержатся в одиночной направляющей РНК (gРНК).

25. Применение из варианта осуществления 1, где каждая из трансформированных клеток-хозяев содержит цепь дезоксирибонуклеиновой кислоты со свободным концом (HM-ДНК), кодирующую представляющую интерес последовательность HM, где HM-ДНК содержит последовательность или последовательности, которые являются гомологичными, соответственно, последовательности или последовательностям в последовательности-мишени или фланкирующим последовательность-мишень для вставки HM-ДНК в геном хозяина, где последовательности HM-ДНК вставляют в геномы клеток-хозяев.

26. Применение из варианта осуществления 1, включающее в себя экспрессию в клетках-хозяевах множества различных crРНК (или gРНК) для гибридизации с последовательностями-мишенями протоспейсера клетки-хозяина; где первая из указанных crРНК (или gРНК) является способной гибридизоваться с первой последовательностью нуклеиновой кислоты протоспейсера; и вторая из указанных crРНК (или gРНК) является способной гибридизоваться с второй последовательностью нуклеиновой кислоты протоспейсера, где указанная вторая последовательность отличается от указанной первой последовательности; и

(a) первая последовательность содержится в гене устойчивости к антибиотику (или его РНК), и вторая последовательность содержится в гене устойчивости к антибиотику (или его РНК); необязательно, где гены являются различными;

(b) первая последовательность содержится в гене устойчивости к антибиотику (или его РНК), и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК);

(c) первая последовательность содержится в жизненно важном гене (или его РНК), и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК); или

(d) первая последовательность содержится в гене вирулентности (или его РНК), и вторая последовательность содержится в жизненно важном гене или гене вирулентности (или его РНК).

27. Применение из варианта осуществления 6, где клетки-хозяева содержатся в смешанной популяции бактерий, содержащейся у субъекта человека или животного, и применение (i) осуществляет лечение у субъекта инфекции посредством указанных клеток-хозяев, содержащихся в смешанной популяции; (ii) осуществляет лечение или уменьшает риск у субъекта состояния или заболевания, опосредованного указанными клетками-хозяевами; (iii) уменьшает запах тела человека, вызванный или опосредованный указанными клетками-хозяевами; или (iv) представляет собой обработку для личной гигиены человека.

28. Применение из варианта осуществления 1, где применение осуществляет лечение или уменьшает риск инфекции указанными клетками-хозяевами у субъекта - человека или животного, где каждые клетки-хозяева содержат ген устойчивости к антибиотику (для устойчивости к первому антибиотику), содержащий указанную последовательность-мишень протоспейсера, где применение включает в себя введение сконструированной нуклеотидной последовательности и первого антибиотика субъекта, где инфекцию уменьшают или предотвращают у субъекта.

29. Применение из варианта осуществления 1, где каждая сконструированная нуклеотидная последовательность дополнительно содержит ген устойчивости к антибиотику, где HM-crРНК или gРНК не нацелена на ген устойчивости к антибиотику, и применение включает в себя подвергание популяции воздействию указанного антибиотика и множества указанных сконструированных последовательностей, таким образом, способствование поддержанию последовательностей, кодирующих HM-crРНК или gРНК, в клетках-хозяевах.

30. Применение из варианта осуществления 1, где клетки-хозяева представляют собой грамположительные клетки или клетки Streptococcus, Staphylococcus, Pseudomonas, Salmonella, Listeria, E coli, Desulfovibrio, V cholerae или Clostridium.

31. Применение из варианта осуществления 1 для обработки промышленных или медицинских жидкости, поверхности, устройства или контейнера; или для обработки водных путей, воды, напитка, пищевого продукта или косметического продукта, где клетки-хозяева содержатся в жидкости, поверхности, устройстве, контейнере, водных путях, воде, напитке, пищевом продукте или косметическом продукте или на их поверхности, и где рост популяции клетки-хозяина, таким образом, ингибируют посредством осуществления указанной обработки.

Альтернативно, любой вариант осуществления является зависимым от любого предшествующего варианта осуществления.

АСПЕКТЫ:

Горизонтальный перенос между клетками-носителями и клетками-хозяевами в смешанных популяций

1. Способ получения смешанной популяции бактерий, содержащей бактерии-носители, где популяция содержит первую и вторую субпопуляции первых и вторых бактерий, соответственно, где субпопуляции представляют собой бактерии первого и второго видов, которые отличаются друг от друга, и вторые бактерии содержат множество клеток-хозяев, где бактерии-носители представляют собой первые бактериальные клетки, где каждая содержит сконструированную нуклеотидную последовательность для предоставления модифицирующих клетку-хозяина (HM) cРНК или направляющей РНК (gРНК) в клетках-хозяевах, где HM-cРНК или gРНК содержит последовательность, которая способна гибридизоваться с последовательностью-мишенью протоспейсера клетки-хозяина для направления первой нуклеазы Cas на мишень для модификации мишени, где бактерии-носители не содержат последовательность-мишень, где способ включает в себя

a. Предоставление множества нуклеиновых кислот, где каждая содержит указанную сконструированную нуклеотидную последовательность;

b. Объединение указанного множества нуклеиновых кислот с первой смешанной популяцией, содержащей первую и вторую субпопуляции первого и второго видов бактерий, соответственно, где вторая субпопуляция содержит клетки-хозяева;

c. Обеспечение трансформации нуклеиновыми кислотами клеток из указанной первой субпопуляции в присутствии клеток-хозяев, таким образом, получение второй смешанной популяции, содержащей указанные клетки-носители и указанные клетки-хозяева, где указанная сконструированная нуклеотидная последовательность, содержащаяся в клетках-носителях, является способной к горизонтальному переносу к клеткам-хозяевам для трансформации клеток-хозяев для продукции указанной HM-cРНК или gРНК в трансформированных клетках-хозяевах.

2. Способ по аспекту 1, дополнительно включающий в себя получение второй смешанной популяции.

3. Способ по аспекту 1, дополнительно включающий в себя выделение множество клеток-носителей из второй смешанной популяции.

4. Способ по аспекту 1, дополнительно включающий в себя продукцию указанной HM-cРНК или gРНК в трансформированных клетках-хозяевах, где указанная последовательность HM-crРНК или gРНК гибридизуется с последовательностью-мишенью протоспейсера в указанных трансформированных клетках-хозяевах и направляет первую нуклеазу Cas на мишень, таким образом, модифицируя мишень с использованием первой нуклеазы Cas.

5. Способ по аспекту 4, дополнительно включающий в себя получение клеток-хозяев, содержащих указанную модификацию мишени (например, где клетки-хозяева содержатся в смешанной популяции, содержащей указанный первый вид бактерий).

6. Способ по аспекту 1, где cРНК или gРНК является родственной эндогенной нуклеазе Cas клеток-хозяев, где нуклеаза представляет собой указанную первую нуклеазу Cas.

7. Способ по аспекту 1, где cРНК или gРНК является родственной эндогенной нуклеазе Cas из клеток-носителей, где нуклеаза представляет собой указанную первую нуклеазу Cas.

8. Способ по аспекту 7, где нуклеаза обладает активностью нуклеазы дикого типа.

9. Способ по аспекту 1, 6, 7 или 8, где первая нуклеаза Cas представляет собой Cas9.

10. Способ по аспекту 9, где Cas9 представляет собой Streptococcus Cas9.

11. Способ по аспекту 1, где каждая сконструированная нуклеотидная последовательность содержится в соответствующем векторе на основе нуклеиновой кислоты, где векторы являются способными к горизонтальному переносу между клетками-носителями и клетками-хозяевами.

12. Способ по аспекту 1 или 11, где каждая сконструированная последовательность содержится в соответствующем мобильном генетическом элементе, например, в транспозоне или плазмиде.

13. Способ по аспекту 1, где после указанной трансформации клеток-хозяев, рост субпопуляции клеток-хозяев ингибируют.

14. Способ по аспекту 13, где ингибирование роста популяции клеток-хозяев является по меньшей мере 5-кратным по сравнению с ростом популяции указанных клеток-хозяев, не трансформированных указанной сконструированной нуклеотидной последовательностью.

15. Способ по аспекту 13 или 14, где рост популяции клеток-хозяев на поверхности ингибируют.

Альтернативно, любой аспект является зависимым от любого предшествующего аспекта.

В одном примере, способ представляет собой способ лечения или предотвращения заболевания или состояние у субъекта - человека, животного или растения, например, как описано в настоящем документе, где способом осуществляют указанное лечение или предотвращение. Изобретение относится к смешанной популяции бактерий, которая получена или может быть получена этим способом для такого способа лечения или предотвращения.

В одном примере, способ осуществляют для смешанной популяции бактерий из окружающей среды, оборудования, устройства, контейнера, водных путей, воды, жидкости, пищевого продукта, напитка, микробиоты, микробиома или косметического средства, например, как описано в настоящем документе, где способом уменьшают долю клеток-хозяев по сравнению с первыми клетками.

В одном примере, продукт способа предназначен для введения в кишечник человека или не относящегося к человеку животного для лечения или предотвращения ожирения, диабета или IBD у человека или животного.

В одном примере, первый и второй виды представляют собой виды бактерий, комменсальных или симбиотических для кишечника человека или не относящегося к человеку животного.

Продукт способ является полезным, поскольку его можно вводить (например, интраназально) человеку или животному, так что бактерии заселяют один или несколько микробиомов (например, микробиом кишечника) человека или животного. Первые клетки действуют в качестве носителей, особенно когда эти клетки являются непатогенными для человека или животного (например, непатогенными в микробиоме кишечнике). Микробиом может представлять собой любой другой микробиом или популяцию микробиоты, описанные в настоящем документе.

В одном примере, первый и второй виды бактерий являются способными к заселению микробиоты кишечника человека или не относящегося к человеку животного, и первые бактерии являются комменсальными или симбиотическими для человека или животных. Полезно, что первые бактерии можно безопасно вводить человеку или животному, и они могут действовать в качестве носителя для переноса затем сконструированных последовательностей в клетки-хозяева из микробиоты.

В одном примере, сконструированная последовательность содержится в любом массиве или векторе, описанном в настоящем документе. В одном примере, в способе используют любую систему CRISPR/Cas, описанную в настоящем документе.

В одном примере первая клетка представляет собой клетку Bacteroidetes (например, Bacteroidales или Bacteroides); клетку Lactobacillus (например, acidophilus (например, La-5, La-14 или NCFM), brevis, bulgaricus, plantarum, rhammosus, fermentum, caucasicus, helveticus, lactis, reuteri или casei например, casei Shirota); Bifidobacterium (например, bifidum, breve, longum или infantis); Streptococcus thermophiles; Enterococcus faecium; Alistipes; Alkaliflexus; Parabacteroides; Tannerella; E coli; или Xylanibacter.

В одном примере, клетки-хозяева принадлежат к виду из микробиоты человека, и клетки-носители представляют собой клетки из вида, который является непатогенным в указанной микробиоте человека, где последовательность-мишень не содержится в геноме клеток-носителей, сконструированная последовательность содержится в MGE, содержащем oriT, который является способным функционировать в клетке-носителе и в клетках-хозяевах, где MGE является способным к горизонтальному переносу от клетки-носителя к клетке-хозяину. В одном примере, сконструированная последовательность, MGE или вектор содержатся в бактериофаге, где бактериофаг является способным к инфекции первых клеток (носителей) для введения MGE в первые клетки (носители). Затем MGE является способным к горизонтальному переносу к клеткам-хозяевам.

В одном примере, первые клетки представляют собой клетки Bacteroidetes или Prevotella; необязательно, где MGE является способным к горизонтальному переносу от первого вида клеток к виду Firmicutes (клеткам-хозяевам) из указанной микробиоты человека. Последние можно использовать, например, для лечения или предотвращения ожирения у человека, когда последовательность-мишень содержится в Firmicutes, но не в первых клетках (носителях).

ДОПОЛНИТЕЛЬНЫЕ ПРИМЕРЫ

ПРИМЕР 1: Обработка или очистка от загрязняющих примесей окружающей среды

Индустрия нефти, металлов и полезных ископаемых

В одном варианте осуществления, клетка-хозяин присутствует в шахте для полезных ископаемых или в месторождении полезных ископаемых; в шахте для металла или в месторождении металла; в месторождении нефти или в нефти или в нефтехимических продуктов (например, для любого из них, когда хозяин представляет собой хозяина - анаэробную сульфатвосстанавливающую бактерию, например, бактерию Desulfovibrio). В одном примере, эта композиция содержит окисляющее средство (например, гипохлорит натрия), соединение четвертичного аммония или изотиазолон, или ее вводят одновременно или последовательно с гипохлоритом натрия, соединением четвертичного аммония или изотиазолоном. Примером подходящего вектора для применения по настоящему изобретению для модификации бактериального хозяина Desulfovibrio является бактериофаг. В ссылках ниже описаны пригодные способы выделения фага из насекомого Desulfovibrio. Для применения в качестве вектора по настоящему изобретению, можно использовать бактериофаг, описанный в любой из ссылок. Альтернативно, вектор предоставляют посредством наночастиц.

Heidelberg et al описывают две копии почти идентичного мю-подобного бактериофага DVUO189-221, DVU2847-79, DVU2688-733 и потомки бактериофага присутствуют в геноме Desufovibrio vulgaris Hildenborough. Такой фаг может являться основой для разработки фагового вектора для применения по настоящему изобретению.

Ссылки:

Seyedirashti S et al, J Gen Microbiol. 1991 Jul;137(7):1545-9, «Induction and partial purification of bacteriophages from Desulfovibrio vulgaris (Hildenborough) and Desulfovibrio desulfuricans ATCC 13541;

Seyedirashti S et al, J Gen Microbiol. 1992 Jul;138(7):1393-7, «Molecular characterization of two bacteriophages isolated from Desulfovibrio vulgaris NCIMB 8303 (Hildenborough)»;

*Walker CB et al ; Environ Microbiol. 2006 Nov;8(11):1950-9, «Recovery of temperate Desulfovibrio vulgaris bacteriophage using a novel host strain»;

Miranda et al, Corrosion Science 48 (2006) 2417-2431, «Biocorrosion of carbon steel alloys by an hydrogenotrophic sulfate-reducing bacterium Desulfovibrio capillatus isolated from a Mexican oil field separator»;

Eydal et al, The ISME Journal (2009) 3, 1139-1147; doi:10.1038/ismej.2009.66; published online 11 June 2009, «Bacteriophage lytic to Desulfovibrio aespoeensis isolated from deep groundwater»;

Walker CB et al ; Environ Microbiol. 2009 Sep;11(9):2244-52. doi: 10.1111/j.1462-2920.2009.01946.x, «Contribution of mobile genetic elements to Desulfovibrio vulgaris genome plasticity».

*[Последовательности, описанные в этой статье, депонированы в GenBank под No. доступа DQ826728-DQ826732, содержание которого приведено в настоящем документе в качестве ссылки]

ПРИМЕР 2: Обработка воды или сточных вод, или очистка окружающей среды (например, почвы) от загрязняющих примесей металлов

Альтернативное применение изобретения относится к массиву HM-CRISPR, системе HM-CRISPR/Cas, HM-crРНК, HM-спейсеру, HM-ДНК, HM-Cas или HM-композиции, как описано в настоящем документе, для обработки воды или сточных вод, например, где хозяин представляет собой сульфатвосстанавливающую бактерию, например, бактерию Desulfovibrio.

В одном примере, нуклеотидная последовательность-мишень у хозяина представляет собой последовательность гена устойчивости к тяжелым металлам. Необязательно также, хозяин представляет собой бактерию Desulfovibrio, например, D vulgaris.

ПРИМЕР 3: Медицинское применение

Альтернативное применение изобретения относится к массиву HM-массив CRISPR, системе HM-CRISPR/Cas, HM-crРНК, HM-спейсеру, HM-ДНК, HM-Cas или HM-композиции, как описано в настоящем документе, для лечения, предотвращения или уменьшения (например, уменьшение распространения или углубления) бактериальной инфекции у человека или животного.

В первом примере, инфекция вызвана клетками-хозяевами MRSA у человека. Клетка-хозяин представляет собой клетку-хозяина Staphylococcus aureus, и массив HM по изобретению содержится в популяции упакованного фага Staphylococcus класса I, II или III (фага Caudovirales или Myoviridae). Популяцию фага вводят инфицированному MRSA пациенту в присутствии или в отсутствие метициллина или ванкомицина. В одном исследовании, HM-массивы фагов нацелены на (i) область из 20 нуклеотидов на 3'-конце лидерного промотора массивов CRISPR эндогенного S aureus и (ii) гены устойчивости к метициллину в клетках-хозяевах. При введении ванкомицина, более низкую дозу, чем обычно, вводят пациенту. Ожидают, что произойдет нокаут инфекции клетки-хозяина, и устойчивость к лекарственному средству на основе фагов не разовьется или будет развиваться с более низкой скоростью или тяжестью, чем обычно. В других исследованиях, дизайн является идентичным, за исключением того, что фаг в этих исследованиях нацелен также на жизненно важный ген ftsZ S aureus (Liang et al, Int J Infect Dis. 2015 Jan;30:1-6. doi: 10,1016/j.ijid.2014,09,015. Epub 2014 Nov 5, «Inhibiting the growth of methicillin-resistant Staphylococcus aureus in vitro with antisense peptide nucleic acid conjugates targeting the ftsZ gene»).

Дальнейшее исследование повторяло вышеописанные исследования, но эндолизин фага K вводили в добавление к метициллину или вместо метициллина.

Ссылки

1. Jiang W et al, Nucleic Acids Res. 2013 Nov;41(20):e188. doi: 10.1093/nar/gkt780. Epub 2013 Sep 2, «Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice»;

2. Seed KD et al, Nature. 2013 Feb 28;494(7438):489-91. doi: 10.1038/nature11927, «A bacteriophage encodes its own CRISPR/Cas adaptive response to evade host innate immunity»;

3. Semenova E et al, Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10098-103. doi: 10.1073/pnas.1104144108. Epub 2011 Jun 6, «Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence»;

4. Heler R et al, Mol Microbiol. 2014 Jul;93(1):1-9. doi: 10.1111/mmi.12640. Epub 2014 Jun 4, «Adapting to new threats: the generation of memory by CRISPR-Cas immune systems»;

5. Gomaa A et al, MBio. 2014 Jan 28;5(1):e00928-13. doi: 10.1128/mBio.00928-13, «Programmable removal of bacterial strains by use of genome-targeting CRISPR-Cas systems»;

6. Fineran PC et al, Proc Natl Acad Sci U S A. 2014 Apr 22;111(16):E1629-38. doi: 10.1073/pnas.1400071111. Epub 2014 Apr 7, «Degenerate target sites mediate rapid primed CRISPR adaptation»;

7. Wiedenheft et al, Nature. 2011 Sep 21;477(7365):486-9. doi: 10.1038/nature10402, «Structures of the RNA-guided surveillance complex from a bacterial immune system;

8. Bondy-Denomy et al, Nature 493, 429-432 (17 January 2013) doi:10.1038/nature11723, « Bacteriophage genes that inactivate the CRISPR/Cas bacterial immune system»;

9. et al, Nature. 2015 Mar 12;519(7542):193-8. doi: 10.1038/nature14237. Epub 2015 Feb 18, «Integrase-mediated spacer acquisition during CRISPR-Cas adaptive immunity».

ПРИМЕР 4: Изменение соотношения бактерий в смешанной популяции микробиоты кишечника

Изменение соотношения бактерий проводят в соответствии с настоящим примером, описанным по отношению к нокауту бактерий Clostridium dificile в образце смешанной микробиоты кишечника. Образец может содержать субпопуляции Bacteroides и устойчивого к метронидазолу (MTZ) C dificile штамма 630. Смешанную популяцию объединяют ex vivo с популяцией бактерий-носителей (Lactobacillus acidophilus La-14 и/или La-5), сконструированных по изобретению, чтобы содержать массивы CRISPR.

Каждый массив CRISPR содержится в плазмиде, совместимой с бактерией-носителем и клетками C dificile. Массив содержится в транспозоне Bacteroides thetaiotamicron CTnDot, который содержит также oriT, последовательность intDOT, оперон tetQ-rteA-rteB, rteC и оперон xis2c-xis2d-orf3-exc. В одном эксперименте, опероны mob и tra исключают (основываясь вместо этого на оперонах, предоставляемых клетками Bacteroides, в которые транспозоны переносят в смеси, объединенной с бактериями-носителями). В другом эксперименте, опероны mob и tra включают в транспозоны.

Перенос белка через цитоплазматическую мембрану является жизненно важным процессом во всех бактериях. Система Sec, содержащая в своем коре АТФазу, SecA и мембранный канал, SecYEG, является ответственной за большую часть этого транспорта белка. Вторая параллельная система Sec описана в ряде грамположительных видов. Эта вспомогательная система Sec характеризуется присутствием второй копии снабжающей энергией АТФазы, SecA2; где это исследовали, SecA2 является ответственной за перенос подгруппы субстратов Sec. Подобно многим патогенным грамположительным видам, Clostridium difficile обладает двумя копиями SecA. Экспорт белков S-слоя (SLP) и дополнительного белка клеточной стенки (CwpV) зависит от SecA2. Накопление цитоплазматического предшественника SLP SlpA и других белков клеточной стенки наблюдают в клетках, экспрессирующих доминантно-отрицательные аллели secA1 или secA2, с сопутствующим уменьшением уровней зрелых SLP в клеточной стенке. Кроме того, экспрессия любого из доминантно-отрицательных аллелей или нокдаун SecA1 или SecA2 посредством антисмысловой РНК очень сильно нарушает рост, показывая, что обе системы Sec являются жизненно необходимыми в C. difficile.

C. difficile штамма 630 (эпидемического типа X) обладает единственной кольцевой хромосомой из 4290252 п.о. (содержание G+C =29,06%) и кольцевой плазмидой из 7881 п.о. (содержание G+C =27,9%). Полный геном секвенирован и обнаружено, что 11% генома состоит из мобильных генетических элементов, таких как конъюгативные транспозоны. Эти элементы обеспечивают C. difficile генами, ответственными за их устойчивость к противомикробным средствам, вирулентность, взаимодействие с хозяином и образование поверхностных структур. Например, ген cdeA C. difficile приводит к образованию насоса для откачивания множества лекарственных средств, как показано, гомологичному известным откачивающим транспортерам из семейства для вытеснения множества лекарственных средств и токсичных соединений (MATE). Белок облегчает энергозависимое и сопряженное с натрием откачивание лекарственных средств из клеток. Кроме того, показано, что ген cme C. difficile обеспечивает множественную лекарственную устойчивость к лекарственным средствам в других бактериях.

Массив содержит единицу R1-S1-R1' CRISPR для нацеливания на последовательность в жизненно важном гене (SecA2) в клетках C dificile. В другом эксперименте, нацеливание на ген cdeA в присутствии MTZ и необязательно, одного или нескольких других антибиотиков против C dificile. Каждый спейсер (S) содержит 20-членную нуклеотидную последовательность из гена SecA или cdeA, где последовательность содержит PAM из системы CRISPR/Cas C dificile штамма 630, родственный последовательностям повторов. Каждый повтор является идентичным повтору из C dificile штамма 630 и обладает последовательностью

5'- ATTTACATACCACTTAGTTAATATAAAAC-3' (SEQ ID NO: 118)

В альтернативном наборе экспериментов, следующую последовательность используют для повторов:

5'- GTTTTATATTAACTAAGTGGTATGTAAAT-3' (SEQ ID NO: 119)

Повторы функционируют с Cas, которая является эндогенной для клеток C dificile в смешанной популяции. Смешанную популяцию бактерий выделяют в форме образца ex vivo из образца кала пациента-человека, страдающего инфекцией C dificile. Смешанную популяцию смешивают с бактериями-носителями in vitro и инкубируют при 37 градусах Цельсия в анаэробных условиях для имитации условий кишечника в присутствии тетрациклина. Ожидают, что транспозоны, содержащие массивы CRISPR, будут переноситься к клеткам Bacteroides и C dificile в смеси. Более того, ожидают, что участки-мишени в последних клетках будут разрезаться под действием нуклеазы Cas, таким образом, уменьшая долю C dificile в смешанной популяции (и увеличивая соотношение Bacteroides к C dificile).

В последующем эксперименте, получен напиток, содержащий бактерии-носители, и его употребляет пациент-человек один или два раза в течение нескольких последовательных суток. Пациенту вводят также тетрациклин в течение периода лечения. Ожидают, что анализ кала будет выявлять, что доля C dificile в образцах кала уменьшается (и соотношение Bacteroides к C dificile увеличивается).

ПРИМЕР 5: Лечение или предотвращение холеры

Приведена ссылка на Информационный бюллетень Всемирной Организации Здравоохранения (ВОЗ) о профилактике холеры №107 (обновлен в июле 2015 г.). Холера представляет собой острую вызывающую диарею инфекцию, вызванную проглатыванием пищи или воды, загрязненной бактерией Vibrio cholerae. Исследователи оценивают, что каждый год возникает 1,4-4,3 миллиона случаев холеры, и от 28000 до 142000 смертей в год по всему миру обусловлено холерой. Короткий инкубационный период от 2 часов до 5 суток, является фактором, запускающим потенциально взрывной характер вспышек. Холера является необычайно вирулентным заболеванием. Она поражает как детей, так и взрослых, и может убивать в течение нескольких часов. Приблизительно у 80% людей, инфицированных V. cholerae, не развивается никаких симптомов, хотя бактерии присутствуют в их фекалиях в течение 1-10 суток после инфекции и выбрасываются обратно в окружающую среду, потенциально инфицируя других людей. Среди людей, у которых развиваются симптомы, 80% обладают мягкими или умеренными симптомами, в то время как у приблизительно 20% развивается острая водянистая диарея с тяжелой дегидратацией. Это может привести к смерти, если оставить без лечения.

Две серогруппы V. cholerae - O1 и O139 - вызывают вспышки. V. cholerae O1 вызывает большинство вспышек, в то время как O139 - впервые идентифицированный в Бангладеш в 1992 г. -ограничен Юго-Восточной Азией. V. cholerae, не относящиеся к O1 и не относящиеся к O139, могут вызывать слабую диарею, но не приводят к эпидемиям. Недавно новые варианты штаммов детектированы в нескольких частях Азии и Африки. Наблюдения позволяют предполагать, что эти штаммы вызывают более тяжелую холеру с более высокой частотой смертности. Основными резервуарами V. cholerae являются источники передачи через людей и воду, такие как солончаковая вода и устья, часто ассоциированные с «цветением», вызванным водорослями.

Приведена ссылка на Nature. 2013 Feb 28;494(7438):489-91. doi: 10,1038/nature11927, «A bacteriophage encodes its own CRISPR/Cas adaptive response to evade host innate immunity», Seed KD et al (содержание которой приведено в настоящем документе в качестве ссылки), в которой описано, что Vibrio cholerae серогруппы O1 является первичным этиологическим фактором тяжелого вызывающего диарею заболевания холеры, и что литические фаги V. cholerae вовлечены в воздействие на нагрузку заболевания, в частности, в эндемическом районе, окружающем Бенгальский залив. Авторы описали выделение родственных ICP1 (International Centre for Diarrhoeal Disease Research, Bangladesh cholera phage 1), специфических для V. cholerae O1 вирулентных миовирусов, присутствующих во всех образцах кала в виде рисового отвара от пациентов с холерой, собранных от 2001 до 201114, и в исследовании, описанном в их публикации.

Авторы объясняют, что система CRISPR/Cas ICP1 состоит из двух локусов CRISPR (обозначенных CR1 и CR2) и шести генов cas, организация и белковые продукты которых являются наиболее гомологичными белкам Cas из системы типа 1-F (Yersinia pestis) подтипа 17. V. cholerae разделен на два биотипа, классический и El Tor, первый из которых ассоциирован с более ранними пандемиями, и с тех пор заменен на El Tor биотипа 18. Классический штамм, V. cholerae O395, обладает системой CRISPR/Cas, принадлежащей к типу I-E (Escherichia coli) подтипа 17, и до настоящего времени не представлено какого-либо описания штаммов El Tor, обладающих системой CRISPR/Cas. Таким образом, источник системы CRISPR/Cas в фаге ICP1 является неизвестным.

Последовательность РНК консенсусного прямого повтора CR1 и CR2 с подчеркнутой частично палиндромной последовательностью, формирующей предсказанный стебель в crРНК, является следующей:-

GUUAGCAGCCGCAUAGGCUGCUUAAAUA [SEQ ID NO: 75]

В одном примере по изобретению, этот или каждый повтор в массиве содержит последовательность или состоит из последовательности, которая является по меньшей мере на 80, 90, 95, 96, 97, 98 или 99% идентичной SEQ ID NO: 75 (или является идентичной SEQ ID NO: 75).

Для большинства спейсеров в CRISPR ICP1 показана 100% идентичность последовательностям внутри островка 18 т.о., обнаруженного в подгруппе штаммов V. cholerae, включающей в себя классический штамм O395, выделенный в Индии в 1964 г., штамм El Tor MJ-1236, выделенный в Бангладеш в 1994, и несколько штаммов El Tor, собранных в ICDDR,B, между 2001 и 2011 гг. Островок 18 т.о. напоминает индуцируемые фагами хромосомные островки (PICI) грамположительных бактерий, включая островки патогенности (SaPI) прототипа Staphylococcus aureus. SaPI индуцируются для вырезания, циркуляции и репликации после инфекции конкретными фагами. Они используют различные механизмы для создания помех циклу репродукции фага, чтобы обеспечить свое собственное повсеместное распространение, и это может защищать окружающую популяцию бактерий от дальнейшего истребления фагами. Организация островка 18 т.о. V. cholerae, на который нацелена система CRISPR/Cas ICP1, является сходной по длине, составу оснований и организации с организацией подгруппы SaPI из PICI, с гомологом интегразы на одном конце и с содержанием GC, более низким, чем у видов-хозяев (37% по сравнению с 47,5%). Элемент 18 п.о., таким образом, обозначен как PICI-подобный элемент (PLE) V. cholerae.

[нуклеотидная последовательность= SEQ ID NO: 76 (последовательность протоспейсера 32 п.о. (SEQ ID NO: 77) закрашена серым, настоящее описание включает последовательность, которая начинается на первом T, закрашенном серым, и заканчивается на последнем C, закрашенном серым; и аминокислотная последовательность=SEQ ID NO: 78]

Seed et al определили, что массивы CR1 и CR2 действуют посредством узнавания последовательности GA PAM. Seed et al обнаружили также, что большинство спейсеров в исследованных родственных ICP1 фаговых массивах CRISPR обладают идентичностью с PLE V. cholera. Спейсеры показаны в следующей таблице 3; S1 в массиве по изобретению, например, выбран из любой из этих последовательностей. В одном варианте осуществления, S1 выбран из любой из подчеркнутых последовательностей.

В одном примере, массив по изобретению (или каждый массив) представляет собой сконструированный массив, содержащий одну, несколько или все из подчеркнутых спейсерных последовательностей. Спейсеры массивов могут содержать неприродную аранжировку следующим образом:-

Например, массив содержит спейсер типа 8a и/или 9a, и 0, 1, 2, 3, 4, 5 или 6 (но не 7) из типов 1a-7a. Например, массив содержит спейсер типа 4b, и 0, 1 или 2, 3 (но не 3 или более) из 1b-3b. Например, массив содержит спейсер типа 8a и один, несколько или все из 9a, 4b, 1c, 3d, 1e и 3e. Например, массив содержит спейсер типа 9a и один, несколько или все из 8a, 4b, 1c, 3d, 1