Мутантная п-гидроксифенилпируватдиоксигеназа, нуклеиновая кислота, кодирующая ее, и их применение




Владельцы патента RU 2781830:

ЦИНДАО КИНГАГРУТ КЕМИКАЛ КОМПАУНД КО., ЛТД. (CN)

Изобретение относится к мутантному белку п-гидроксифенилпируватдиоксигеназы (HPPD) или его биологически активному фрагменту, который придает растениям устойчивость или толерантность к HPPD-ингибирующим гербицидам. Также предложены выделенный полинуклеотид, содержащий последовательность нуклеиновой кислоты, кодирующую мутантную HPPD или ее биологически активный фрагмент, слитый белок, конструкция нуклеиновой кислоты, экспрессионный вектор и клетка-хозяин, содержащая полинуклеотид. Также предложен способ получения растения, обладающего повышенной устойчивостью или толерантностью к HPPD-ингибирующему гербициду по сравнению с растением с генами HPPD дикого типа, растение, полученное способом, а также способ повышения устойчивости или толерантности растительной клетки, ткани растения, части растения или растения к гербициду, ингибирующему HPPD, по сравнению с растительной клеткой, тканью растения, частью растения или растением с генами HPPD дикого типа, включающий экспрессию мутантную HPPD, или ее биологически активного фрагмента, или вышеуказанного слитого белка. Изобретение позволяет получить растения, обладающие устойчивостью или толерантностью к гербицидам, ингибирующим HPPD, при этом указанная мутантная HPPD сохраняет или усиливает способность катализировать превращение пара-гидроксифенилпирувата (HPP) в гомогенизат и значительно менее чувствительна к гербицидам, ингибирующим HPPD, чем HPPD дикого типа. 11 н. и 11 з.п. ф-лы, 17 ил., 14 табл., 10 пр.

 

Область техники

Настоящее изобретение относится к области сельскохозяйственной генной инженерии и, в частности, относится к новой мутантной п-гидроксифенилпируватдиоксигеназе (HPPD), которая придает растениям устойчивость или толерантность к гербицидам, ингибирующим HPPD, нуклеиновой кислоте, кодирующей ее, и их применению.

Уровень техники

п-Гидроксифенилпируватдиоксигеназы (HPPD) представляют собой ферменты, которые катализируют реакцию, в которой гидроксифенилпируват (HPP) превращается в гомогентизат. Эта реакция протекает в присутствии связанного с ферментом железа и кислорода. Гербициды, которые функционируют посредством ингибирования HPPD, хорошо известны и включают различные типы, такие как изоксазолы, дикетонитрилы, трикетоны и соли пиразолина. Ингибирование HPPD блокирует биосинтез пластохинона (PQ) из тирозина. PQ является важным кофактором в биосинтезе каротиноидных пигментов, необходимых для фотозащиты фотосинтетического центра. Гербициды, ингибирующие HPPD, представляют собой обесцвечиващие агенты, которые могут передвигаться по флоэме, в результате чего новые меристемы и листья, подвергающиеся воздействию света, становятся свелыми. В отсутствие каротиноидов хлорофилл подвергается фоторазрушению и сам становится агентом фотохимического расщепления за счет фотосенсибилизации синглетного кислорода.

Технические пути и способы получения растений, устойчивых к гербицидам, ингибирующим HPPD, также известны, включая сверхэкспрессию фермента HPPD для обеспечения продукции количественного уровня фермента HPPD в растении, который полностью соответствуют данному гербициду, чтобы растение имело доступный достаточно функциональный фермент, несмотря на присутствие его ингибитора, или мутирование целевого фермента HPPD в функциональный фермент HPPD, который менее чувствителен к гербициду. Гербициды, ингибирующие HPPD, представляют собой большой класс соединений, охватывающий множество различных типов. Хотя данный фермент HPPD может обеспечивать пригодный уровень толерантности к некоторым гербицидам, ингибирующим HPPD, он может быть совершенно неадекватным для обеспечения коммерческих уровней толерантности к другому, более желательному гербициду, ингибирующему HPPD (см., например, публикацию заявки на патент США №2004/0058427; и публикацию международной заявки РСТ WO 98/20144 и WO 02/46387; см. также публикацию заявки на патент США №2005/0246800, которая относится к идентификации и маркировке сортов сои, которые относительно устойчивы к HPPD). Более того, различные гербициды, ингибирующие HPPD, могут различаться по кругу сорняков, которые они контролируют, объектам сельскохозяйственных культур, на которых они применяются, производственным затратам и экологическим преимуществам каждого из них. Следовательно, в данной области все еще существует потребность в новых мутантных HPPD, которые придают устойчивость/толерантность различным культурам и сортам сельскохозяйственных культур, к гербицидам, ингибирующим HPPD,

Трансгенный метод широко используется в создании толерантных к гербицидам культур и сортов сельскохозяйственных культур. Однако использование трансгенных культур ограничивалось за счет высокой стоимости регистрации, и эта ситуация может измениться благодаря достижениям в методах редактирования генов, среди которых система CRISPR/Cas9 является репрезенативной. Система CRISPR/Cas9 представляет собой новый способ сайт-направленного редактирования генов, появившийся с 2012 г. (Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J.A. and Charpentier, E. 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337: 816-821.; Cong L., Ran F.A., Cox D., Lin S., Barretto R., Habib N., Hsu P.D., Wu X., Jiang W., Marraffini L. A. and Zhang F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science, 339: 819-823; Li J. F., Norville J. E., Aach J., Mccormack M., Zhang D., Bush J., Church G.M. and Sheen, J. 2013. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat. Biotechnol., 31: 688.; Mali P., Yang L., Esvelt K.M., Aach J., Guell M., Dicarlo J.E., Norville J.E. and Church G.M. 2013. RNA-guided human genome engineering via Cas9. Science. 339: 823). Распознавание редактированной мишени системой CRISPR/Cas9 основано на спаривании оснований между молекулами нуклеиновых кислот. Система может редактировать любую целевую последовательность размером 20 п.н., непосредственно смежную с PAM (NGG). Кроме того, система CRISPR/Cas9 проста в применении, и для нее требуется только заменить 20-30 п.н. целевой нуклеотидной последовательности в исходном векторе для каждого нацеливания, что подходит для высокопроизводительной операции. Система может одновременно редактировать несколько сайтов одного и того же гена, а также несколько разных генов. В настоящее время этот способ показал большие перспективы для применения в биомедицине, функциональной геномике, улучшении признаков и создании новых признаков у животных и растений, и он играет революционную роль в содействии развитию селекции животных и растений (Hui Zhang, Jinshan Zhang, Zhaobo Lang, Jose Ramon Botellad, and Jian-Kang Zhu. 2017. Genome Editing-Principles and Applications for Functional Genomics Research and Crop Improvement, Critical Reviews in Plant Sciences, 36:4, 291-309, DOI:10.1080/07352689.2017. 1402989).

Система CRISPR/Cas9 представляет инструмент редактирования генов третьего поколения, которая реализует сайт-направленное редактирование тремя основными путями. Во-первых, сайт-направленный нокаут гена для получения мутантов. В частности, Cas9 распознает и расщепляет сайты-мишени под руководством направляющей РНК (gRNA) с образованием двухцепочечных разрывов ДНК. Разрывы ДНК обычно подвергаются репарации посредством негомологичного соединения концов (NHEJ), и в процессе репарации легко возникают мутации сдвига рамки считывания, что приводит к разрушению гена. Эффективность сайт-направленного нокаута гена высока. Во-вторых, гомологичное замещение мишени для замены целевой последовательности или достижение сайт-направленной вставки. В случае, когда образуются двухцепочечные разрывы ДНК, если рядом находится гомологичная репарационная матрица, то может происходить гомологичное замещение или сайт-направленная инсерция. Эффективность гомологичной замены ниже и становится еще ниже по мере увеличения длины заменяемой последовательности. В-третьих, еще одним подходом является редактирование оснований (Komor A.C., Kim Y.B., Packer M.S., Zuris J.A., Liu D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature, 2016 May 19; 533(7603):420-4. doi: 10.1038/nature17946; Gaudelli N.M., Komor A.C., Rees H.A., Packer M.S., Badran A.H., Bryson D.I., Liu D.R. Programmable base editing of A⋅T to G⋅C in genomic DNA without DNA cleavage. Nature, 2017 Nov. 23; 551(7681): 464-471. doi: 10.1038/nature 24644. Epub 2017 Oct 25. Erratum in: Nature, 2018 May 2). Редактирование оснований представляет собой метод редактирования генов, в котором используется система CRISPR/Cas9 для нацеливания дезаминазы на определенный сайт в геноме для модификации определенного основания. Данный метод успешно применялся для риса. Например, Yan F., Kuang Y., Ren B., Wang J., Zhang D., Lin H., Yang B., Zhou X., and Zhou H. (2018). High-efficient A·T to G·C base editing by Cas9n-guided tRNA adenosine deaminase in rice. Mol. Plant. doi: 10.1016/j.molp. 2018.02.008).

Кроме того, систему CRISPR/Cpf1 также можно использовать для редактирования генов (Zetsche B., Gootenberg J. S., Abudayyeh O.O., Slaymaker I.M., Makarova K.S., Essletzbichler P., Volz S.E., Joung J., Oost J., Regev A., Koonin E.V. and Zhang F. 2015. Cpf1 is a single RNA-guided endonuclease of a Class 2 CRISPR Cas system. Cell, 163: 759-771; Endo A., Masafumi M., Kaya H. and Toki S. 2016a. Efficient targeted mutagenesis of rice and tobacco genomes usingCpf1 from Francisella novicida. Sci. Rep. 6: 38169). Система CRISPR/Cpf1 содержит два основных компонента: фермент Cpf1 и crRNA, которая определяет специфичность системы. Несмотря на то, что система CRISPR/Cpf1 похожа на систему CRISPR/Cas9, между ними имеются определенные важные различия (Hui Zhang, Jinshan Zhang, Zhaobo Lang, José Ramón Botella & Jian-Kang Zhu (2017) Genome Editing - Principles and Applications for Functional Genomics Research and Crop Improvement, Critical Reviews in Plant Sciences, 36:4, 291-309, DOI:10.1080/07352689.2017.1402989). Во-первых, для системы CRISPR/Cpf1 не требуется транс-активирующая crRNA (tracrRNA), которая необходима для системы CRSIPR/Cas9. Во-вторых, система CRISPR/Cpf1 является относительно короткой и содержит всего 42-44 нуклеотида, включая повтор из 19 нуклеотидов и спейсер из 23-25 нуклеотидов. В-третьих, в отличие от Cas9, которая расщепляет двойную цепь ДНК в одном и том же положении (3-4 п.н. выше от PAM), с получением тупого конца, Cpf1 расщепляет целевую последовательность на 23 п.н. ниже от последовательности PAM и нецелевую одиночную цепь в 18 п.н. ниже последовательности от PAM, с получением липкого конца с выступом из 5 п.н. Образующийся липкий конец может повысить эффективность HDR-опосредованного встраивания донорной ДНК в сайты расщепления Cpf1. В-четвертых, для системы CRISPR/Cpf1 требуется только один промотор для регуляции многими массивами малых crRNA при редактировании нескольких мишеней или генов, что делает ее идеальной для редактирования многих мишеней. В-пятых, для системы CRISPR/Cas9 требуется G-богатая последовательность PAM (5'-NGG-3') на 3'-конце целевой последовательности, тогда как для CRISPR/Cpf1 требуется T-богатая (5'-TTTN-3' или 5'-TTN-3') последовательность PAM на 5'-конце целевой последовательности, и она подходит для редактирования нескольких A/T ДНК или генов. В настоящее время разработаны три сконструированные системы CRISPR/Cpf1, включая FnCpf1 из Francisella novicida, AsCpf1 из Acidaminococcus sp. и LbCpf1 из Lachnospiraceae bacterium. Все три системы Cpf1 использовались для редактирования генома растений нескольких видов, включая рис, Arabidopsis, табак и сою (Endo A., Masafumi M., Kaya H. and Toki, S. 2016a. Efficient targeted mutagenesis of rice and tobacco genomes usingCpf1 from Francisella novicida. Sci. Rep., 6: 38169; Kim H., Kim S.T., Ryu J., Kang B.C., Kim J.S. and Kim S.G. 2017. CRISPR/Cpf1-mediated DNA-free plant genome editing. Nat. Commun., 8: 14406.; Tang X., Lowder L.G., Zhang T., Malzahn A.A., Zheng X., Voytas D. F., Zhong Z., Chen Y., Ren Q. and Li Q. 2017. A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat. Plants, 3: 17018.; Wang M., Mao Y., Lu Y., Tao X. and Zhu J. K. 2017a. Multiplex gene editing in rice using the CRISPR-Cpf1 system. Mol. Plant, 10: 1011-1013).

В настоящее время одним из ведущих направлений исследований в области редактирования генов является повышение устойчивости важных сельскохозяйственных культур к гербицидам посредством гомологичного замещения, опосредованного редактированием генов, сайт-направленной модификации или редактирования по одному основанию, при этом сообщалось о нескольких успешных примерах, однако большинство из них сосредоточено на толерантности к гербицидам, ингибирующим ацетолактатсинтазу (ALS) (Yongwei Sun, Xin Zhang, Chuanyin Wu, Ubing He, Youzhi Ma, Han Hou, Xiuping Guo, Wenming Du, Yunde Zhao and Lanqin Xia. 2016. Engineering Herbicide-Resistant Rice Plants through CRISPR/Cas9-Mediated Homologous Recombination of Acetolactate Synthase. Molecular Plant, 9,628-631 doi.org/10.1016/j.molp.2016.01.001; Yiyu Chen, Zhiping Wang, Hanwen Ni, Yong Xu, Qijun Chen, Linjian Jiang. 2017. CRISPR/Cas9-mediated base-editing system efficiently generates gain-of-function mutations in Arabidopsis. Sci China Life Sci, 60. doi: 10.1007/s11427-017-9021-5) и гербицидам на основе глифосата (WO 2017028768 A1). Следовательно, существует потребность в том, чтобы ученые продолжали исследования и разрабатывали новые подходы для повышения устойчивости сельскохозяйственных культур к различным типам гербицидов.

Сущность изобретения

С учетом вышеизложенного, настоящее изобретение относится к мутантной п-гидроксифенилпируватдиоксигеназе (HPPD), которая придает растениям устойчивость или толерантность к гербицидам, ингибирующим HPPD, где указанная мутантная HPPD сохраняет или усиливает способность катализировать превращение пара-гидроксифенилпирувата (HPP) в гомогентизат и значительно менее чувствительна к гербицидам, ингибирующим HPPD, чем HPPD дикого типа. Настоящее изобретение также относится к биологически активному фрагменту мутантной п-гидроксифенилпируватдиоксигеназы, полинуклеотиду, кодирующему ее белок или фрагмент, и к их применению.

Следовательно, в одном аспекте настоящее изобретение относится к мутантному белку п-гидроксифенилпируватдиоксигеназы (HPPD), который имеет одну или более мутаций, выбранных из группы, состоящей из 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G и 431L, в одном или более положениях, соответствующих положениям 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 и 431 аминокислотной последовательности п-гидроксифенилпируватдиоксигеназы риса дикого типа, показанной в SEQ ID NO: 2. Предпочтительно аминокислотная последовательность мутантного белка п-гидроксифенилпируватдиоксигеназы также имеет, по меньшей мере, 80%, по меньшей мере, 85%, по меньшей мере, 90%, по меньшей мере, 95%, по меньшей мере, 96%, по меньшей мере, 97%, по меньшей мере, 98% или, по меньшей мере, 99% идентичность последовательности с аминокислотной последовательностью, показанной в SEQ ID NO: 2. Более предпочтительно мутантный белок п-гидроксифенилпируватдиоксигеназы имеет аминокислотную последовательность, показанную в SEQ ID NO: 2, за исключением того, что он содержит одну или более аминокислотных мутаций, выбранных из группы, состоящей из 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G и 431L, в одном или более положениях, соответствующих положениям 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 и 431 аминокислотной последовательности белка п-гидроксифенилпируватдиоксигеназы риса дикого типа, показанной в SEQ ID NO: 2.

В другом аспекте настоящее изобретение относится к биологически активному фрагменту мутантного белка п-гидроксифенилпируватдиоксигеназы (HPPD), где в данном фрагменте отсутствует группа из одного или более (например, 1-50, 1-25, 1-10 или 1-5, например, 1, 2, 3, 4 или 5) аминокислотных остатков на N- и/или C-конце белка, но который по-прежнему сохраняет желаемую биологическую активность полноразмерного белка, т.е. фрагмент сохраняет или усиливает способность катализировать превращение п-гидроксифенилпирувата (HPP) в гомогентизат и значительно менее чувствителен к гербицидам, ингибирующим HPPD, чем HPPD дикого типа или ее соответствующий биологически активный фрагмент.

Настоящее изобретение также относится к слитому белку, содержащему мутантный белок п-гидроксифенилпируватдиоксигеназы (HPPD) или его биологически активный фрагмент по настоящему изобретению, и дополнительный компонент, который слит с ним, например, пептидный или полипептидный компонент. Предпочтительно компонент придает слитому белку желаемые свойства, например, облегчая его выделение и очистку, повышая его стабильность, увеличивая период полураспада, обеспечивая дополнительную биологическую активность и направляя слитый белок HPPD в целевую область, такую как пластиды, например хлоропласты. Варианты соответствующего компонента хорошо известны специалистам в данной области.

В еще одном аспекте настоящее изобретение относится к выделенному полинуклеотиду, содержащему последовательность нуклеиновой кислоты, кодирующую мутантный белок п-гидроксифенилпируватдиоксигеназы (HPPD) или его биологически активный фрагмент или слитый белок.

Настоящее изобретение дополнительно относится к конструкции нуклеиновой кислоты, содержащей полинуклеотид и функционально связанный с ним регуляторный элемент.

В дополнительном аспекте настоящее изобретение относится к экспрессионному вектору, содержащему полинуклеотид и функционально связанный с ним регуляторный элемент экспрессии.

В еще одном аспекте изобретение относится к клетке-хозяину, содержащей полинуклеотид, конструкцию нуклеиновой кислоты или экспрессионный вектор.

Настоящее изобретение также относится к способу получения растения, обладающего повышенной устойчивостью или толерантностью к гербицидам, ингибирующим HPPD.

Настоящее изобретение также относится к растению, полученному вышеуказанным способом.

Настоящее изобретение также относится к способу повышения устойчивости или толерантности растения к гербицидам, ингибирующим HPPD, включающему экспрессию мутантного белка п-гидроксифенилпируватдиоксигеназы (HPPD) или его биологически активного фрагмента или слитого белка по настоящему изобретению в растении.

Настоящее изобретение также относится к способу повышения устойчивости или толерантности растения к гербицидам, ингибирующим HPPD, включающему скрещивание растения, экспрессирующего мутантный белок п-гидроксифенилпируватдиоксигеназы (HPPD) или его биологически активный фрагмент, или слитый белок по настоящему изобретению, с другим растением.

Настоящее изобретение также относится к способу повышения устойчивости или толерантности растения к гербицидам, ингибирующим HPPD, включающему геномное редактирование гена эндогенного белка HPPD растительной клетки, ткани растения, части растения или растения.

Настоящее изобретение дополнительно относится к применению мутантного белка п-гидроксифенилпируватдиоксигеназы (HPPD) или его биологически активного фрагмента или слитого белка по настоящему изобретению для повышения устойчивости или толерантности растения к гербицидам, ингибирующим HPPD.

Настоящее изобретение также относится к способу борьбы с сорняками на участке выращивания растений, включающему нанесение на участок, содержащий растение или семена по настоящему изобретению, гербицидно эффективного количества одного или более гербицидов, ингибирующих HPPD, без значительного отрицательного воздействия на растение.

Краткое описание фигур

На фиг. 1 показана цветная реакция культуральной среды рекомбинантной E.coli, трансформированной геном дикого типа или мутантным геном HPPD риса, культивированной в 96-луночном планшете, где рекомбинантная E.coli экспрессирует HPPD риса дикого типа (WT) или одну из односайтовых мутантных HPPD риса, и рекомбинантная E. coli культивируется в культуральной среде, содержащей гербицид темботрион (слева) или продукт метаболизма фенпиразона (справа, имеющий структурную формулу

в разных концентрациях, показывая разную степень изменения цвета. В лунках с гербицидом в одинаковой концентрации, чем темнее цвет, тем выше устойчивость/толерантность к этому гербициду.

На фиг. 2 показана цветная реакция культуральной среды рекомбинантной E.coli, трансформированной геном дикого типа или мутантным геном HPPD риса, культивированной в 96-луночном планшете, где рекомбинантная E.coli экспрессирует HPPD риса дикого типа (WT) или каждую из односайтовых мутантных HPPD риса, и рекомбинантная E. coli культивируется в культуральной среде, содержащей гербицид ципирафлуон (слева) или топрамезон (справа) в различных концентрациях, показывая разную степень изменения цвета. В лунках с гербицидом в одинаковой концентрации, чем темнее цвет, тем выше устойчивость/толерантность к этому гербициду.

На фиг. 3 показана цветная реакция культуральной среды рекомбинантной E.coli, трансформированной геном дикого типа или мутантным геном HPPD риса, культивированной в 96-луночном планшете, где рекомбинантная E.coli экспрессирует HPPD риса дикого типа (WT) или каждую из односайтовых мутантных HPPD риса, и рекомбинантная E. coli культивируется в культуральной среде, содержащей гербицид мезотрион в различных концентрациях, показывая разную степень изменения цвета. В лунках с гербицидом в одинаковой концентрации, чем темнее цвет, тем выше устойчивость/толерантность к этому гербициду.

На фиг. 4 показана цветная реакция культуральной среды рекомбинантной E.coli, трансформированной геном дикого типа или мутантным геном HPPD риса, культивированной в 96-луночном планшете, где рекомбинантная E. coli экспрессирует HPPD риса дикого типа (WT) или односайтовую мутантную HPPD, содержащую мутацию H141R, G342D или D370N или их комбинацию, и рекомбинантная E. coli культивируется в культуральной среде, содержащей гербицид темботрион (вверху) или продукт метаболизма фенпиразона (внизу), в различных концентрациях, показывая разную степень изменения цвета. В лунках с гербицидом в одинаковой концентрации, чем темнее цвет, тем выше устойчивость/толерантность к этому гербициду.

На фиг. 5 показана цветная реакция культуральной среды рекомбинантной E.coli, трансформированной геном дикого типа или мутантным геном HPPD риса, культивированной в 96-луночном планшете, где рекомбинантная E.coli экспрессирует HPPD риса дикого типа (WT) или односайтовую мутантную HPPD, содержащую мутацию H141R, G342D или D370N или их комбинацию (где 141+342 представляет собой H141R/G342D; 141+370 представляет собой H141R/D370N; 342+370 представляет собой G342D/D370D; и 141+ 342+370 представляет H141R/G342D/D370N), и рекомбинантная E. coli культивируется в культуральной среде, содержащей гербицид ципирафлуон (вверху) или продукт метаболизма топрамезона (внизу), в различных концентрациях, показывая разную степень изменения цвета. В лунках с гербицидом в одинаковой концентрации, чем темнее цвет, тем выше устойчивость/толерантность к этому гербициду.

На фиг. 6 показана цветная реакция культуральной среды рекомбинантной E.coli, трансформированной геном дикого типа или мутантным геном HPPD риса, культивированной в 96-луночном планшете, где рекомбинантная E.coli экспрессирует HPPD риса дикого типа (WT) или односайтовую мутантную HPPD, содержащую мутацию H141R, G342D или D370N или их комбинацию, в культуральную среду, и рекомбинантная E. coli культивируется в культуральной среде, содержащей гербицид мезотрион в различных концентрациях, показывая разную степень изменения цвета. В лунках с гербицидом в одинаковой концентрации, чем темнее цвет, тем выше устойчивость/толерантность к этому гербициду.

На фиг. 7 показаны все аминокислотные мутации, отмеченные в белке HPPD риса дикого типа.

На фиг. 8 показана цветная реакция культуральной среды рекомбинантной E. coli, трансформированной мутантным геном HPPD риса, культивированной в 96-луночном планшете, где рекомбинантная E. coli экспрессирует мутантную HPPD, содержащую различные комбинации мутаций в близких положениях 336-338-342-346, и комбинацию 141R+342D+370N (где 336D, 338D, 338S, 338Y, 342D, 346C, 346H и 346S представляет собой P336D, N338D, N338S, N338Y, G342D, R346C, R346H и R346H и R346H соответственно; 141R+342D+370N представляет собой H141R/G342D/D370N), в культуральную среду, и рекомбинантная E. coli культивируется в культуральной среде, содержащей гербицид продукт метаболизма бипиразона (с кодовым номером 101, имеющий структурную формулу

в различных концентрациях, показывая разную степень изменения цвета. В лунках с гербицидом в одинаковой концентрации, чем темнее цвет, тем выше устойчивость/толерантность к этому гербициду.

На фиг. 9 показана цветная реакция культуральной среды рекомбинантной E. coli, трансформированной мутантным геном HPPD риса, культивированной в 96-луночном планшете, где рекомбинантная E. coli экспрессирует мутантную HPPD, содержащую различные комбинации мутаций в положениях 3 или 4 (где 141R, 336D, 338D, 338S, 338Y, 342D, 346C, 346S, 346H, 370N, 418P и 419F представляют собой H141R, P336D, N338D, N338S, N338Y, G342D, R346C, R346S318P, R346H, G419F соответственно) в культуральную среду, и рекомбинантная E.coli культивируется в культуральной среде, содержащей гербицид продукт метаболизма бипиразона, в различных концентрациях, показывая разную степень изменения цвета. В лунках с гербицидом в одинаковой концентрации, чем темнее цвет, тем выше устойчивость/толерантность к этому гербициду.

На фиг. 10 показаны кривые ингибирования OsHPPD WT и различных мутантов продуктом метаболизма бипиразона, где на абсциссе указана концентрация соединения 101, на оси ординат указана остаточная активность фермента при различных концентрациях соединения 101, где уровень реакции составляет 100% при концентрации ингибитора 0, и цифры на фигуре представляют различные сайты мутации. По данным фигуры следует, что фермент дикого типа высокочувствителен к соединению 101, и активность полностью ингибируется при концентрации соединения 101 примерно 60 мкМ, и каждый мутант демонстрирует существенно повышенную устойчивость. На основании этих результатов можно рассчитать значение IC50, выражающее ингибирование активности каждого мутанта соединением 101, аналогичным образом подтверждая, что каждый мутант демонстрирует значительно повышенную устойчивость по сравнению с OsHPPD дикого типа (где 141R, 338D, 342D, 346C, 346H, 370N, 386T, 418P, 419F и 420S представляют собой H141R, N338D, G342D, R346C, R346H, D370N, P386T, K418P, G419F и N420S соответственно).

На фиг. 11 показана чувствительность трансгенного риса (Zhonghua 11) к ингибирующему HPPD гербициду темботриону. Рис, экспрессирующий мутант OsHPPD3M (H141R/G342D/D370N), способен оставаться зеленым в культуральной среде, содержащей 3 мкМ темботриона, но проростки, экспрессирующие mCherry, использованные в качестве отрицательного контроля (СК), также сильно обесцвечивались в культуральной среде с концентрацией 1,0 мкМ темботриона (фитотоксичность).

На фиг. 12 показана толерантность трансгенного риса (Zhonghua 11) к гербициду, ингибирующему HPPD, бипиразону. Растения поколения T0, экспрессирующие мутантный OsHPPD3M риса, толерантны к 8-16 г бипиразона в виде действующего вещества на 1 му, и нетрансгенные контроли (CK) погибали вскоре после сильного осветления (A, B); растения поколения Т1, экспрессирующие мутантную OsHPPD3M риса, толерантны к 32-64 г бипиразона в виде действующего вещества на 1 му, но нетрансгенные контрольные растения погибают вскоре после сильного осветления (C, D).

На фиг. 13 показан вектор для редактирования оснований гена HPPD риса.

На фиг. 14 показан проросток риса, полученный с редактированием основания, и анализ последовательности мишени H141R (CAC > CGC).

A: проростки, полученные редактированием основания: в культуральной среде, содержащей 0,4 мкМ темботриона, неудачно редактированные проростки становятся светлыми (фитотоксичность), и успешно редактированные остаются зелеными.

B: последовательность редактированной основанием мишени: аминокислота в положении 141 HPPD риса дикого типа представляет собой гистидин (His), и соответствующий кодон представляет CAC верхняя панель), тогда как после редактирования соответствующая аминокислота представляет аргинин (Arg), и соответствующий кодон представляет CGC (пример представляет гибрид, и имеет место двойной пик).

На фиг. 15 показана структура гена hppd риса (Oshppd> NC029257.1), показывающая два экзона, один интрон, три сайта мутации (141, 342, 370) и сконструированные целевые сайты расщепления (gRNA1-2, gRNA2-1).

На фиг. 16 показана структура ДНК-матрицы, где длина области замещения ядра для трех мутантных аминокислот 141-342-370 составляет 1056 п.н., левое и правое плечо гомологии имеют длину 350 п.н., длина каждого из которых составляет 6 п.н. слева на каждом из левого и правого концов после отщепления от вектора, и общая длина матрицы составляет 1768 п.н.; для облегчения быстрого генотипирования продукта ПЦР после ПЦР-амплификации, сайт расщепления NcoI удален; и для предупреждения повторного расщепления после замены, также удален PAM (NGG) в исходном сайте расщепления в матрице.

На фиг. 17 показаны три гомологически замещенных сайта мутации (H141R-G342D-D370N) гена HPPD риса.

A: проростки риса с редактированным геном HPPD: в культуральной среде, содержащей 0,4 мкМ темботриона, неудачно редактированные проростки (дикого типа WT) становятся светлыми (фитотоксичность), и успешно отредактированные (два проростка: AW2 и AW3) остаются зелеными;

B: после гомологичного замещения кодоны, соответствующие аминокислотным положениям 342 и 370, изменяются, т.е. GGC становится GAC, и GAC становится AAC (гибрид; приводит к частичным G342D и D370N); H141R (CAC > CGC) также успешно редактируется (последовательность на фигуре не указана).

Подробное описание изобретения

Некоторые термины, используемые в описании, определяются следующим образом.

В рамках настоящего изобретения, термин «гербицид, ингибирующий HPPD» относится к соединению, обладающему гербицидной активностью как таковому, или к соединению, которое используется в комбинации с другими гербицидами и/или добавками, которые могут изменять его действие, и соединение может функционировать посредством ингибирование HPPD. Соединения, которые способны проявлять гербицидную активность за счет ингибирования HPPD, хорошо известны в данной области, включая многие типы: 1) трикетоны, например, сулкотрион (номер CAS: 99105-77-8), мезотрион (номер CAS: 104206-82-8), бициклопирон (номер CAS: 352010-68-5), темботрион (номер CAS: 335104-84-2), тефурилтрион (номер CAS: 473278-76-1), бензобициклон (номер CAS: 156963-66-5); 2) дикетонитрилы, например 2-циано-3-циклопропил-1-(2-метилсульфонил-4-трифторметилфенил)пропан-1,3-дион (номер CAS: 143701-75-1), 2-циано-3-циклопропил-1-(2-метилсульфонил-3,4-дихлорфенил)пропан-1,3-дион (номер CAS: 212829-55-5), 2-циано-1-[4-(метилсульфонил)-2-трифторметилфенил]-3-(1-метилциклопропил)пропан-1,3-дион (номер CAS: 143659-52-3); 3) изоксазолы, например изоксафлутол (номер CAS: 141112-29-0); изоксахлортол (номер CAS: 141112-06-3), кломазон (номер CAS: 81777-89-1); 4) пиразолы, например топрамезон (номер CAS: 210631-68-8); пирасульфотол (номер CAS: 365400-11-9), пиразоксифен (номер CAS: 71561-11-0); пиразолат (номер CAS: 58011-68-0), бензофенап (номер CAS: 82692-44-2), бипиразон (номер CAS: 1622908-18-2), толпиралат (номер CAS: 1101132-67-5), фенпиразон (номер CAS: 1992017-55-6), ципирафлуон (номер CAS: 1855929-45-1), трипирасульфон (номер CAS: 1911613-97-2); 5) бензофеноны; 6) другие: ланкотрион (номер CAS: 1486617-21-3), фенхинотрион (номер CAS: 1342891-70-6). Предпочтительно указанные гербициды представляют собой темботрион, фенпиразон, ципирафлуон, топрамезон, мезотрион, бипиразон или любые их комбинации и т.п.

Растения, обладающие «повышенной толерантностью к гербицидам, ингибирующим HPPD» или «повышенной устойчивостью к гербицидам, ингибирующим HPPD», относятся к таким растениям, которые обладают более высокой толерантностью или устойчивостью к указанным гербицидам, ингибирующим HPPD, по сравнению с растениями с генами HPPD дикого типа. Ферменты HPPD, имеющие «повышенную толерантность к гербицидам, ингибирующим HPPD» или «повышенную устойчивость к гербицидам, ингибирующим HPPD», относятся к таким ферментам HPPD, которые проявляют ферментативную активность, по меньшей мере, на 10%, предпочтительно, по меньшей мере, на 15%, более предпочтительно, по меньшей мере, на 20% выше, чем ферменты HPPD дикого типа, при концентрациях гербицидов, которые, как известно, ингибируют активность соответствующего белка фермента HPPD дикого типа. В рамках настоящего изобретения, термины «толерантность к гербицидам, ингибирующим HPPD» и «устойчивость к гербицидам, ингибирующим HPPD» используются взаимозаменяемо, и оба относятся к толерантности к гербицидам, ингибирующим HPPD, и к устойчивости к гербицидам, ингибирующим HPPD.

Термин «дикий тип» относится к существующей молекуле нуклеиновой кислоты или белку, которые можно найти в природе.

В рамках настоящего изобретения, термины «белок», «полипептид» и «пептид» могут использоваться взаимозаменяемо и относятся к полимеру из аминокислотных остатков, включая полимеры из химических аналогов, в которых один или более аминокислотных остатков являются природными аминокислотными остатками. Белки и полипептиды по настоящему изобретению могут быть получены рекомбинантно или синтезированы химическим путем. Термин «мутированный белок» или «мутантный белок» относится к белку, имеющему замены, инсерции, делеции и/или добавления одного или более аминокислотных остатков по сравнению с аминокислотной последовательностью соответствующего белка дикого типа.

Термины «полинуклеотид» и «нуклеиновая кислота» используются взаимозаменяемо, и включают ДНК, РНК или их гибриды, которые являются либо двухцепочечными, либо одноцепочечными.

В рамках настоящего изобретения, под термином «организм-хозяин» следует понимать любой одноклеточный или многоклеточный организм, в который может быть введена нуклеиновая кислота, кодирующая мутантный белок HPPD, включая, например, бактерии, такие как Eescherichia coli, грибы, такие как дрожжи (например, Saccharomyces cerevisiae), плесени (например, Aspergillus), растительные клетки, растения и тому подобное.

В рамках настоящего изобретения, под термином «растение» следует понимать любой дифференцированный многоклеточный организм, способный осуществлять фотосинтез, в частности однодольные или двудольные растения, например (1) пищевые культуры: Oryza spp., такие как Oryza sativa, Oryza latifolia, Oryza sativa, Oryza glaberrima; Triticum spp., такие как Triticum aestivum, T. turgidumssp. durum; Hordeum spp., такие как Hordeum vulgare, Hordeum arizonicum; Secale cereale; Avena spp., такие как Avena sativa, Avena fatua, Avena byzantine, Avena fatua var. sativa, Avena hybrida; Echinochloa spp., такие как Pennisetum glaucum, сорго, Sorghum bicolor, Sorghum vulgare, тритикале, маис или кукуруза, просо, рис, Foxtail millet, Proso millet, Sorghum bicolor, Panicum, Fagopyrum spp., Panicum miliaceum, Setanicum miliaceum, Eragrostis tef, Panicum miliaceum, Eleusine coracana; (2) бобовые культуры: Glycine spp. такие как Glycine max, Soja hispida, Soja max, Vicia spp., Vigna spp., Pisum spp., полевые бобы, Lupinus spp., Vicia, Tamarindus indica, Lens culinaris, Lathyrus spp., Lablab, широкая фасоль, маш, красная фасоль, нут; (3) масличные культуры: Arachis hypogaea, Arachis spp, Sesamum spp., Helianthus spp., такие как Helianthus annuus, Elaeis, такие как Eiaeis guineensis, Elaeis oleifera, соевые бобы, Brassicanapus, Brassica oleracea, Sesamum orientale, Brassica juncea, масличный рапс, Camellia oleifera, масличная пальма, оливки, клещевина, Brassica napus L., канола (4) волокнистые культуры: Agave sisalana, Gossypium spp., такие как Gossypium, Gossypium barbadense, Gossypium hirsutum, Hibiscus cannabinus, Agave sisalana, Musa textilis Nee, Linum usitatissimum, Corchorus capsularis L, Boehmeria nivea (L.), Cannabis sativa, Cannabis sativa; (5) плодовые культуры: Ziziphus spp., Cucumis spp., Passiflora edulis, Vitis spp., Vaccinium spp., Pyrus communis, Prunus spp., Psidium spp., Punica granatum, Malus spp., Citrullus lanatus, Citrus spp., Ficus carica, Fortunella spp., Fragaria spp., Crataegus spp., Diospyros spp., Eugenia unifora, Eriobotrya japonica, Dimocarpus longan, Carica papaya, Cocos spp., Averrhoa carambola, Actinidia spp., Prunus amygdalus, Musa spp. (musa acuminate), Persea spp. (Persea Americana), Psidium guajava, Mammea Americana, Mangifera indica, Canarium album (Oleaeuropaea), Caricapapaya, Cocos nucifera, Malpighia emarginata, Manilkara zapota, Ananas comosus, Annona spp., Citrus reticulars (Citrus spp.), Artocarpus spp., Litchi chinensis, Ribes spp., Rubus spp., груша, персик, абрикос, слива, восковница, лимон, кумкват, дуриан, апельсин, клубника, черника, дыня хами, дыня, финиковая пальма, ореховое дерево, вишня; (6) корневищные культуры: Manihot spp., Ipomoea batatas, Colocasia esculenta, клубневая горчица, Allium cepa (лук репчатый), Eleocharis tuberose (водяной каштан), Cyperus rotundus, Rhizoma dioscoreae; (7) овощные культуры: Spinacia spp., Phaseolus spp., Lactuca sativa, Momordica spp., Petroselinum crispum, Capsicum spp., Solanum spp. (такие как Solanum tuberosum, Solanum integrifolium, Solanum lycopersicum), Lycopersicon spp. (такие как Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Kale, Luffa acutangula, чечевица, окра, лук, картофель, артишок, спаржа, брокколи, брюссельская капуста, белокачанная капуста, морковь, цветная капуста, сельдерей, капуста листовая, кабачки, Benincasa hispida, Asparagus officinalis, Apium graveolens, Amaranthus spp., Allium spp., Abelmoschus spp., Cichorium endivia, Cucurbita spp., Coriandrum sativum, B.carinata, Rapbanus sativus, Brassica spp. (например, Brassica napus, Brassica rapa ssp., канола, масличный рапс, репа маслиничная, репа маслиничная, листовая горчица, капуста, черная горчица, канола (рапсовое семя), брюссельская капуста, пасленовые (баклажаны), перец (сладкий перец), огурец, люффа, пекинская капуста, рапс, капуста, тыква, лук китайский, лотус, корень лотоса, салат; (8) цветочные культуры: Tropaeolum minus, Tropaeolum majus, Canna indica, Opuntia spp., Tagetes spp., Cymbidium (орхидеи), Crinum asiaticum L., Clivia, Hippeastrum rutilum, Rosa rugosa, Rosa Chinensis, Jasminum sambac, Tulipa gesneriana L., Cerasus sp., Pharbitis nil L. Choisy, Calendula officinalis L., Nelumbo sp., Bellis perennis L., Dianthus caryophyllus, Petunia hybrida, Tulipa gesneriana L., Lilium brownie, Prunus mume, Narcissus tazetta L., Jasminum nudiflorum Lindl., Primula malacoides, Daphne odora, Camellia japonica, Michelia alba, Magnolia liliiflora, Viburnum macrocephalum, Clivia miniata, Malus spectabilis, Paeonia suffruticosa, Paeonia lactiflora, Syzygium aromaticum, Rhododendron simsii, Rhododendron hybridum, Michelia figo (Lour.) Spreng., Cercis chinensis, Kerria japonica, Weigela florida, Fructus forsythiae, Jasminum mesnyi, Parochetus communis, Cyclamen persicum Mill., Phalaenophsis hybrid, Dendrobium nobile, Hyacinthus orientalis, Iris tectorum Maxim, Zantedeschia aethiopica, Calendula officinalis, Hippeastrum rutilum, Begonia semperflorenshybr, Fuchsia hybrida, Begonia maculataRaddi, герань; (9) лекарственные культуры: Carthamus tinctorius, Mentha spp., Rheum rhabarbarum, Crocus sativus, Lycium chinense, Polygonatum odoratum, Polygonatum kingianum, Anemarrhena asphodeloides Bunge, Radix ophiopogonis, Fritillaria cirrhosa, Curcuma aromatica, Amomum villosum Lour., Polygonum multiflorum, Rheum officinale, Glycyrrhiza uralensis Fisch, Astragalus membranaceus, Panax ginseng, Panax notoginseng, Acanthopanax gracilistylus, Angelica sinensis, Ligusticum wallichii, Bupleurum sinenses DC., Datura stramonium Linn., Datura metel L., Mentha haplocalyx, Leonurus sibiricus L., Agastache rugosus, Scutellaria baicalensis, Prunella vulgaris L., Pyrethrum carneum, Ginkgo biloba L., Cinchona ledgeriana, Hevea brasiliensis (wild), Medicago sativa Linn, Piper Nigrum L.; (10) сырьевые культуры: Hevea brasiliensis, Ricinus communis, Vernicia fordii, Morus alba L., Hops Humulus lupulus, Betula, Alnus cremastogyne Burk., Rhus verniciflua stokes; (11) пастбищные культуры: Agropyron spp., Trifolium spp., Miscanthus sinensis, Pennisetum sp., Phalaris arundinacea, Panicum virgatum, степные травы, индийская трава, большая голубостебельная трава, Phleum prairiegrasses, дерновая трава, cyperaceae (Kobresia pygmaea, Carex pediformis, Carex humilis), Medicago sativa Linn, Phleum pratense L., Medicago sativa, Melilotus suavcolen, Astragalus sinicus, Crotalaria juncea, Sesbania cannabina, Azolla imbircata, Eichhornia crassipes, Amorpha fruticosa, Lupinus micranthus, Trifolium, Astragalus adsurgens pall, Pistia stratiotes linn, Alternanthera philoxeroides, плевел; (12) сахарные культуры: Saccharum spp., Beta vulgaris; (13) культуры для производства напитков: Camellia sinensis, Camellia Sinensis, чай, кофе (Coffea spp.), Theobroma cacao, Humulus lupulus Linn; (14) газонные растения: Ammophila arenaria, Poa spp. (Poa pratensis (мятлик луговой)), Agrostis spp. (Agrostis matsumurae, Agrostis palustris), Lolium spp. (плевел), Festuca spp. (Festuca ovina L.), Zoysia spp. (Zoysiajaponica), Cynodon spp. (Cynodon dactylon/bermudagrass), Stenotaphrum secunda tum (Stenotaphrum secundatum), Paspalum spp., Eremochloa ophiuroides (сороконожка), Axonopus spp. (моллюго мутовчатое), Bouteloua dactyloides (трава буйвола), Bouteloua var. spp. (Bouteloua gracilis), Digitaria sanguinalis, Cyperusrotundus, Kyllingabrevifolia, Cyperusamuricus, Erigeron canadensis, Hydrocotylesibthorpioides, Kummerowiastriata, Euphorbia humifusa, Viola arvensis, Carex rigescens, Carex heterostachya, дерн; (15) древесные культуры: Pinus spp., Salix spp., Acer spp., Hibiscus spp., Eucalyptus spp., Ginkgo biloba, Bambusa sp., Populus spp., Prosopis spp., Quercus spp., Phoenix spp., Fagus. spp., Ceiba pentandra, Cinnamomum spp., Corchorus spp., Phragmites australis, Physalis spp., Desmodium spp., Populus, Hedera helix, Populus tomentosa Carr, Viburnum odoratissinum, Ginkgo biloba L., Quercus, Ailanthus. Ilex pur-purea, Platanus acerifolia, Ligustrum lucidum, Buxus megistophylla Levl., Dahurian larch, Acacia mearnsii, Pinus massoniana, Pinus khasys, Pinus yunnanensis, Pinus finlaysoniana, Pinus tabuliformium, Pinus koraiensis, Juglans nigra, Citrus limon, Platanus acerifolia, Syzygium jambos, Davidia invucrate, Bombax malabarica L., Ceiba pentandra (L.), Bauhinia blakeana, Albizia saman, Albizzia julibrissin, Erythrina corallodendron, Erythrina indica, Magnolia gradiflora, Cycas revolute, Lagerstruiferoemia indica, хвойные, макрофанерофиты, кустарники; (16) ореховые культуры: Bertholletia excelsea, Castanea spp., Corylus spp., Carya spp., Juglans spp., Pistacia vera, Anacardium occidentale, Macadamia (Macadamia integrifolia), Carya illinoensis Koch, Macadamia, Pistachio, другие растения, дающие орехи; (17) другие культуры: Arabidopsis thaliana, Bra chiaria eruciformis, Cenchrus echinatus, Setaria faberi, Eleusine indica, Cadaba farinose, водоросли, Carex elata, декоративные растения, Carissa macrocarpa, Cynara spp., Daucus carota, Dioscorea spp., Erianthus sp., Festuca arundinacea, Hemerocallis fulva, Lotus spp., Luzula sylvatica, Medicago sativa, Melilotus spp., Morus nigra, Nicotiana spp., Olea spp., Ornithopus spp., Pastinaca sativa, Sambucus spp., Synapis sp., Syzygium spp., Tripsacum dactyloides, Triticosecale rimpaui, Viola odorata и тому подобное.

В рамках настоящего изобретения, термин «ткань растения» или «часть растения» включает клетки растений, протопласты, культуры тканей растений, каллус растений, блоки растений и зародыши растений, пыльцу, семяпочки, семена, листья, стебли, цветы, ветви, проростки, плоды, сердцевины, шипы, корни, кончики корней, пыльники и т.д.

В рамках настоящего изобретения, под термином «растительная клетка» следует понимать любую клетку, полученную из растения или обнаруженную в нем, которая способна образовывать, например, недифференцированную ткань, такую как каллус, дифференцированную ткань, такую как зародыш, часть растения, растение или семя.

В отношении терминов, касающихся аминокислотных замен, используемых в описании, то первая буква обозначает встречающуюся в природе аминокислоту в определенном положении в определенной последовательности, следующее число представляет положение, соответствующее положению в SEQ ID NO: 2, и вторая буква обозначает другую аминокислоту, заменяющую встречающуюся в природе аминокислоту. Например, A103S означает, что аланин в положении 103 замещается на серин относительно аминокислотной последовательности SEQ ID NO: 2. Для аминокислотной замены, для которой первая буква отсутствует, это означает, что относительно аминокислотной последовательности белка дикого типа, встречающаяся в природе аминокислота в положении, соответствующем положению в SEQ ID NO: 2, замещается аминокислотой, представленной второй буквой после числа. Для двойных или множественных мутаций каждая мутация разделяется «/». Например, H141R/G342D/D370N означает, что относительно аминокислотной последовательности SEQ ID NO: 2 гистидин в положении 141 замещается аргинином, глицин в положении 342 замещается аспарагиновой кислотой и аспарагиновая кислота в положении 370 замещается аспарагином, и все три мутации присутствуют в определенном мутантном белке HPPD.

В одном аспекте настоящее изобретение относится к мутантному белку HPPD или его биологически активному фрагменту, который сохраняет способность катализировать превращение п-гидроксифенилпирувата (HPP) в гомогентизат, одновременно имея повышенную устойчивость или толерантность к гербицидам, ингибирующим HPPD, по сравнению с белком п-гидроксифенилпируватдиоксигеназы дикого типа. В частности, мутантный белок п-гидроксифенилпируватдиоксигеназы (HPPD) по настоящему изобретению имеет одну или более мутаций, выбранных из группы, состоящей из 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G и 431L в одном или более положениях, соответствующих положениям 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 и 431 аминокислотной последовательности белка п-гидроксифенилпируватдиоксигеназы риса дикого типа, показанной в SEQ ID NO: 2. Предпочтительно аминокислотная последовательность мутантного белка п-гидроксифенилпируватдиоксигеназы также имеет, по меньшей мере, 80%, по меньшей мере, 85%, по меньшей мере, 90%, по меньшей мере, 95%, по меньшей мере, 96%, по меньшей мере, 97%, по меньшей мере, 98% или, по меньшей мере, 99% идентичность последовательности с аминокислотной последовательностью, показанной в SEQ ID NO: 2. Более предпочтительно мутантный белок п-гидроксифенилпируватдиоксигеназы имеет аминокислотную последовательность, показанную в SEQ ID NO: 2, за исключением того, что он содержит одну или более аминокислотных мутаций, выбранных из группы, состоящей из 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G и 431L в одном или более положениях, соответствующих положениям 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 и 431 в аминокислотной последовательности белка п-гидроксифенилпируватдиоксигеназы риса дикого типа, показанной в SEQ ID NO: 2.

В одном варианте осуществления аминокислотная последовательность мутантного белка п-гидроксифенилпируватдиоксигеназы по настоящему изобретению дополнительно имеет, по меньшей мере, 80%, по меньшей мере, 85%, по меньшей мере, 90%, по меньшей мере, 95%, по меньшей мере, 96%, по меньшей мере, 97%, по меньшей мере, 98% или, по меньшей мере, 99% идентичность последовательности с аминокислотной последовательностью белка п-гидроксифенилпируватдиоксигеназы риса дикого типа, показанной в SEQ ID NO: 2, и содержит одну или более аминокислотных мутаций, выбранных из группы, состоящей из 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G и 431L в одном или более положениях, соответствующих положениям 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 и 431 в аминокислотной последовательности белка п-гидроксифенилпируватдиоксигеназы риса дикого типа, показанной в SEQ ID NO: 2. Предпочтительно мутантный белок п-гидроксифенилпируватдиоксигеназы имеет аминокислотную последовательность, показанную в SEQ ID NO: 2, за исключением того, что он содержит одну или более мутаций, выбранных из группы, состоящей из R93S, A103S, H141R, H141K, H141T, A165V, V191I, R220K, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, G342D, R346C, R346D, R346H, R346S, R346Y, D370N, I377C, P386T, L390I, M392L, E403G, K410I, K418P, G419F, G419L, G419V, N420S, N420T, E430G и Y431L в одном или более положениях, соответствующих положениям 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 и 431 в аминокислотной последовательности белка п-гидроксифенилпируватдиоксигеназы риса дикого типа, показанной в SEQ ID NO: 2.

Конкретное аминокислотное положение (нумерация) в белке по настоящему изобретению определяется выравниванием аминокислотной последовательности представляющего интерес белка с SEQ ID NO: 2 с использованием стандартного инструмента выравнивания последовательностей, например алгоритма Смита-Ватермана или алгоритма Clustal, которые используются для выравнивания двух последовательностей, где последовательности считаются выровненными, когда оценка выравнивания является наиболее высокой. Оценку выравнивания можно вычислить в соответствии с методом, описанным в публикации Wilbur W.J. and Lipman D.J. (1983), «Rapid similarity searches of nucleic acid and protein data banks», Proc. Natl. Acad. Sci. USA, 80: 726-730. Параметры по умолчанию, используемые в алгоритме ClustalW2 (1.82), предпочтительно представляют: штраф за открытие гэпа в белке = 10,0; штраф за удлинение гэпа в белке = 0,2; матрица белка = ряд Гоннета; концевой гэп белок/ДНК = -1; и белок/ДНК GAPDIST = 4.

Предпочтительно использовать программу AlignX (часть приложения Vector NTI) для сопоставления параметров по умолчанию для множественного выравнивания (штраф за открытие гэпа: 10 og, штраф за удлинение гэпа: 0,05), и положение конкретной аминокислоты в белке по настоящему изобретению определяют выравниванием аминокислотной последовательности белка с SEQ ID NO: 2.

Идентичность аминокислотных последовательностей можно определить обычными методами, например, используя алгоритмы Смита-Ватермана (1981, Adv. Appl. Math., 2: 482, Pearson & Lipman, 1988, Proc. Natl. Acad. Sci. USA, 85: 2444), компьютерные алгоритмы Thompson et al. (1994, Nucleic Acids Res 22: 467380 и т. д., с использованием компьютерных программ (GAP, BESTFIT, FASTA и TFASTA, Genetics Computer Group в пакете программного обеспечения Wisconsin Genetics)), или можно определить с использованием алгоритма BLAST (Altschul et al. al., 1990, Mol. Biol. 215: 403-10), общедоступного на портале Национального центра биотехнологической информации www.ncbi.nlm.nih.gov/) с параметрами по умолчанию.

В еще одном варианте осуществления мутантный белок п-гидроксифенилпируватдиоксигеназы по настоящему изобретению имеет аминокислотную последовательность, показанную в SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82 или SEQ ID NO: 84.

В еще одном варианте осуществления мутантный белок п-гидроксифенилпируватдиоксигеназы (HPPD) по настоящему изобретению имеет следующие аминокислотные мутации в его аминокислотной последовательности: H141R/G342D, H141R/D370N, G342D/D370N, H141R/N338D, H141R/G342D, N338D/G342D, K418P/G419F, G419F/N420S, G342D/R346C, G342D/R346H, H141R/N420S, G338D/K418P, P277N/N338D, L276W/P277N, H141R/G342D/D370N, H141R/N338D/N420S, H141R/N338S/N420S, P336D/N338D/G342D, P336D/N338S/G342D, P336D/N338Y/G342D, N338D/G342D/R346C, N338D/G342D/R346H, N338D/G342D/R346S, N338S/G342D/R346C, N338S/G342D/R346H, N338S/G342D/R346S, N338Y/G342D/R346C, N338Y/G342D/R346H, N338Y/G342D/R346S, P336D/G342D/R346C, P336D/G342D/R346H, P336D/G342D/R346S, P336D/N338D/R346C, P336D/N338D/R346H, P336D/N338D/R346S, P336D/N338S/R346C, P336D/N338S/R346H, P336D/N338S/R346S, P336D/N338Y/R346C, P336D/N338Y/R346H, P336D/N338Y/R346S, H141R/N338D/G342D, H141R/G342D/K418P, H141R/G342D/G419F, H141R/G342D/P386T, K418P/G419F/N420T, K418T/G419F/N420T, H141R/G342D/R346C, H141R/G342D/R346H, H141R/G342D/N420S, H141R/G342D/P277N, H141R/G342D/P336D, H141R/G342D/L276W, H141R/G342D/R346S, H141R/G342D/L390I, H141R/G342D/I377C, H141R/G342D/M392L, H141R/P337A/G342D, H141R/N338S/G342D, H141R/N338Y/G342D, P277N/N338D/G342D, P277N/G342D/R346C, P277N/N338D/N420S, N338D/G342D/K418P, H141R/N338D/G342D/K418P, H141R/N338D/G342D/G419F, H141R/N338D/G342D/P386T, H141R/N338D/G342D/R346C, H141R/N338D/G342D/R346H, H141R/G342D/K418P/G419F, H141R/G342D/L276W/P277N, P336D/N338D/G342D/R346C, P336D/N338D/G342D/R346H, P336D/N338D/G342D/R346S, P336D/N338S/G342D/R346C, P336D/N338S/G342D/R346H, P336D/N338S/G342D/R346S, P336D/N338Y/G342D/R346C, P336D/N338Y/G342D/R346H, P336D/N338Y/G342D/R346S, P277N/P336D/N338D/G342D, P277N/N338D/G342D/R346C, P277N/N338D/K418P/G419F, H141R/N338D/G342D/K418P/G419F, H141R/N338D/G342D/G419F/N420S, H141R/G336D/G342D/K418P/G419F/N420S, H141R/N338D/G342D/K418P/G419F/N420S, H141R/N338D/G342D/K418P/G419F/N420T, H141R/N338D/G342D/R346C/K418P/G419F/N420S, H141R/N338D/G342D/R346H/K418P/G419F/N420S, H141R/P277N/N338D/G342D/K418P/G419F/N420S или H141R/P277N/P336D/N338D/G342D/K418P/G419F/N420S.

В еще одном варианте осуществления мутантный белок п-гидроксифенилпируватдиоксигеназы по настоящему изобретению имеет аминокислотную последовательность, показанную в SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 240, SEQ ID NO: 242, SEQ ID NO: 244, SEQ ID NO: 246, SEQ ID NO: 248, SEQ ID NO: 250, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 256, SEQ ID NO: 258 или EQ ID NO: 260.

В рамках настоящего изобретения, белок п-гидроксифенилпируватдиоксигеназы дикого типа может быть получен из любого растения, в частности, из вышеуказанных однодольных или двудольных растений. Последовательности некоторых белков п-гидроксифенилпируватдиоксигеназы дикого типа из других источников и их кодирующие последовательности раскрыты в документах предшествующей технической литературы, которые включены в настоящее описание посредством ссылки.

Предпочтительно белок п-гидроксифенилпируватдиоксигеназы дикого типа по настоящему изобретению происходит из Oryza, в частности, Oryza sativa. Более предпочтительно белок п-гидроксифенилпируватдиоксигеназы дикого типа имеет аминокислотную последовательность, показанную в SEQ ID NO: 2, или имеет, по меньшей мере, 80%, по меньшей мере, 85%, по меньшей мере, 90%, по меньшей мере, 95%, по меньшей мере, 96%, по меньшей мере, 97%, по меньшей мере, 98% или, по меньшей мере, 99% идентичность последовательности с аминокислотной последовательностью, показанной в SEQ ID NO: 2.

Для специалистов в данной области также будет очевидно, что структура белка может быть изменена без отрицательного влияния на его активность и функциональность, например, одну или более консервативных аминокислотных замен можно ввести в аминокислотную последовательность белка, не влияя отрицательно на активность и/или трехмерную конфигурацию молекулы белка. Специалистам в данной области известны примеры и варианты консервативных аминокислотных замен. В частности, аминокислотный остаток в определенном сайте может быть заменен другим аминокислотным остатком, относящимся к той же группе, что и заменяемая аминокислота, т.е. неполярный аминокислотный остаток заменяется другим неполярным аминокислотным остатком, полярный незаряженный аминокислотный остаток заменяется другим полярным незаряженным аминокислотным остатком, основный аминокислотный остаток заменяется другим основным аминокислотным остатком, и кислый аминокислотный остаток заменяется кислым аминокислотным остатком. При условии, что замена не нарушает биологическую активность белка, такая консервативная замена, при которой одна аминокислота заменяется другой аминокислотой, относящейся к той же группе, входит в объем настоящего изобретения.

Следовательно, мутантный белок HPPD по настоящему изобретению может дополнительно содержать одну или более других мутаций, таких как консервативные замены в аминокислотной последовательности, в дополнение к вышеуказанным мутациям. Кроме того, изобретение также охватывает мутантные белки HPPD, которые дополнительно содержат одну или более других неконсервативных замен, при условии, что неконсервативные замены не оказывают существенного влияния на желаемую функцию и биологическую активность белка по настоящему изобретению.

Как хорошо известно в данной области, один или более аминокислотных остатков могут быть делецированы с N- и/или C-конца белка, и белок будет по-прежнему сохранять свою функцию и активность. Следовательно, в еще одном аспекте настоящее изобретение также относится к фрагментам, в которых отсутствует один или более аминокислотных остатков на N- и/или C-конце мутантного белка п-гидроксифенилпируватдиоксигеназы (HPPD), одновременно сохраняя желаемую функцию и активность. В рамках изобретения, фрагменты относятся к биологически активным фрагментам. В рамках настоящего изобретения, термин «биологически активный фрагмент» относится к части мутантного белка HPPD по настоящему изобретению, который сохраняет биологическую активность мутантного белка HPPD по настоящему изобретению, в то же время обладая повышенной устойчивостью или толерантностью к ингибиторам HPPD по сравнению с фрагментом HPPD, не содержащим мутации(й). Например, биологически активный фрагмент мутантного белка HPPD может представлять собой биологически активный фрагмент, в котором отсутствует группа из одного или более (например, 1-50, 1-25, 1-10 или 1-5, например, 1, 2, 3, 4 или 5) аминокислотных остатков на N-и/или C-конце белка, но который по-прежнему сохраняет желаемую биологическую активность полноразмерного белка.

Настоящее изобретение также относится к слитому белку, содержащему мутантный белок HPPD или его биологически активный фрагмент по настоящему изобретению, и дополнительный компонент, который слит с ним. В одном предпочтительном варианте осуществления дополнительный компонент представляет собой пластид-направленный пептид, такой как хлоропласт-направленный пептид, который позволяет мутированному белку HPPD нацеливаться на хлоропласт. В еще одном варианте дополнительный компонент представляет собой пептидную метку, такую как 6His. В еще одном варианте осуществления дополнительный компонент представляет собой пептид, который способствует повышению растворимости мутантного белка HPPD, такой как пептид NusA.

В еще одном аспекте настоящее изобретение относится к выделенному полинуклеотиду, содержащему последовательность нуклеиновой кислоты, кодирующую вышеописанный мутантный белок п-гидроксифенилпируватдиоксигеназы (HPPD) или его биологически активный фрагмент, или его комплементарной последовательности. Термин «выделенный» полинуклеотид означает, что полинуклеотид по существу не содержит компонентов, обычно ассоциированных с ним в естественной среде. В одном варианте осуществления аминокислотная последовательность мутантного белка п-гидроксифенилпируватдиоксигеназы (HPPD) имеет, по меньшей мере, 80%, по меньшей мере, 85%, по меньшей мере, 90%, по меньшей мере, 95%, по меньшей мере, 96%, по меньшей мере, 97%, по меньшей мере, 98% или, по меньшей мере, 99% идентичность последовательности с аминокислотной последовательностью, показанной в SEQ ID NO: 2, и также содержит одну или более аминокислотных мутаций, выбранных из группы, состоящей из 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G и 431L в одном или более положениях, соответствующих положениям 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346 , 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 и 431 аминокислотной последовательности белка п-гидроксифенилпируватдиоксигеназы риса дикого типа, показанной в SEQ ID NO: 2. Предпочтительно мутация представляет собой одну или более мутаций, выбранных из группы, состоящей из R93S, A103S, H141R, H141K, H141T, A165V, V191I, R220K, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, G342D, R346C, R346D, R346H, R346S, R346Y, D370N, I377C, P386T, L390I, M392L, E403G, K410I, K418P, G419F, G419L, G419V, N420S, N420T, E430G и Y431L. Более предпочтительно мутантный белок п-гидроксифенилпируватдиоксигеназы (HPPD) или его биологически активный фрагмент происходит из белка HPPD риса и имеет одну или более аминокислотных замен, выбранных из вышеуказанных замен.

Для специалистов в данной области техники будет очевидно, что множество различных последовательностей нуклеиновых кислот может кодировать аминокислотные последовательности, раскрытые здесь, за счет вырожденности генетических кодов. Специалисты в данной области могут создать дополнительные последовательности нуклеиновых кислот, кодирующие один и тот же белок, и, таким образом, настоящее изобретение охватывает последовательности нуклеиновых кислот, кодирующие одну и ту же аминокислотную последовательность за счет вырожденности генетических кодов. Например, для достижения высокой экспрессии гетерологичного гена в организме-хозяине, таком как растение, ген может быть оптимизирован с использованием предпочтительных для хозяина кодонов для лучшей экспрессии.

Следовательно, в некоторых вариантах осуществления полинуклеотид по настоящему изобретению имеет последовательность нуклеиновой кислоты, выбранную из:

(1) последовательности нуклеиновой кислоты, кодирующей аминокислотную последовательность, показанную в: SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 240, SEQ ID NO: 242, SEQ ID NO: 244, SEQ ID NO: 246, SEQ ID NO: 248, SEQ ID NO: 250, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 256, SEQ ID NO: 258 или SEQ ID NO: 260, или ее комплементарной последовательности;

(2) последовательности нуклеиновой кислоты, показанной в: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, SEQ ID NO: 235, SEQ ID NO: 237, SEQ ID NO: 239, SEQ ID NO: 241, SEQ ID NO: 243, SEQ ID NO: 245, SEQ ID NO: 247, SEQ ID NO: 249, SEQ ID NO: 251, SEQ ID NO: 253, SEQ ID NO: 255, SEQ ID NO: 257 или SEQ ID NO: 259, или ее комплементарной последовательности.

(3) последовательности нуклеиновой кислоты, которая гибридизуется с последовательностью, показанной в пп. (1) или (2), в жестких условиях; и

(4) последовательности нуклеиновой кислоты, кодирующей аминокислотную последовательность, аналогичную последовательности, показанной в пп. (1) или (2), за счет вырожденности генетического кода, или ее комплементарной последовательности.

Кроме того, предпочтительно полинуклеотид по настоящему изобретению имеет последовательность нуклеиновой кислоты, выбранную из последовательности нуклеиновой кислоты, показанной в: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, SEQ ID NO: 235, SEQ ID NO: 237, SEQ ID NO: 239, SEQ ID NO: 241, SEQ ID NO: 243, SEQ ID NO: 245, SEQ ID NO: 247, SEQ ID NO: 249, SEQ ID NO: 251, SEQ ID NO: 253, SEQ ID NO: 255, SEQ ID NO: 257 or SEQ ID NO: 259, или ее комплементарной последовательности.

Предпочтительно жесткие условия могут относиться к условиям, включающим 6 M мочевины, 0,4% SDS и 0,5×SSC, или эквивалентным им условиям гибридизации, и также могут относиться к условиям с более высокой степенью жесткости, таким как 6 M мочевина, 0,4% SDS, 0,1×SSC, или эквивалентным им условиям гибридизации. В различных условиях температура может быть выше примерно 40°C, например, когда требуются условия с более высокой жесткостью, то температура может составлять, например, примерно 50°C, и, кроме того, может составлять примерно 65°C.

Более предпочтительно кодоны дикого типа и мутантные кодоны, соответствующие сайтам аминокислотных мутаций, представлены в таблице ниже:

Сайты мутации аминокислоты Кодоны дикого типа Мутантные кодоны
A103S GCC TCG;TCA;TCC;TCT;AGC;AGT
H141R CAC CCG;CGA;CGC;CGT;AGG;AGA
H141K CAC AAG;AAA
H141T CAC ACC;ACT;ACA;ACG
A165V GCG GTG;GTA;GTC;GTT
V191I GTC ATA;ATC;ATT
R220K CGG AAG;AAA
G342D GGC GAC;GAT
D370N GAC AAC;AAT
K410I AAG ATA;ATC;ATT
R93S CGC AGC;AGT;TCA;TCC;TCG;TCT
G226H GGC CAC;CAT
L276W CTG TGG
P277N CCG AAC;AAT
P336D CCG GAT;GAC
P337A CCC GCA;GCC;GCG;CGT
N338D AAC GAC;GAT
N338S AAC AGC;TCG;TCA;TCC;TCT;AGT
N338Y AAC TAC;TAT
G342D GGC GAC;GAT

R346C CGC TGC;TGT
R346H CGC CAC;CAT
R346S CGC AGC;TCG;TCA;TCC;TCT;AGT
R346D CGC GAC;GAT
R346Y CGC TAC;TAT
I377C ATC TGC;TGT
P386T CCA ACA;ACC;ACG;ACT
L390I TTG ATA;ATC;ATT
M392L ATG CTA;CTC;CTG;CTT;TTA;TTG
E403G GAG GGA;GGC;GGG;GGT
P418P AAG CCA;CCC;CCG;CCT
G419F GGC TTC;TTT
G419L GGC CTA;CTC;CTG;CTT;TTA;TTG
G419V GGC GTA;GTC;GTG;GTT
N420S AAC AGC;TCG;TCA;TCC;TCT;AGT
N420T AAC ACA;ACC;ACG;ACT
E430G GAG GGA;GGC;GGG;GGT
Y431L TAT CTA;CTC;CTG;CTT;TTA;TTG

Настоящее изобретение также относится к конструкции нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую мутантный белок п-гидроксифенилпируватдиоксигеназы или его биологически активный фрагмент, или его слитый белок по настоящему изобретению, и один или более регуляторных элементов, функционально связанных с ней. В рамках настоящего изобретения, термин «регуляторный элемент» относится к последовательности нуклеиновой кислоты, способной модулировать транскрипцию и/или трансляцию нуклеиновой кислоты, функционально связанной с ней.

Регуляторный элемент может представлять собой подходящую промоторную последовательность, которая распознается клеткой-хозяином для экспрессии последовательности нуклеиновой кислоты, кодирующей белок по настоящему изобретению. Промоторная последовательность включает транскрипционную регуляторную последовательность, которая опосредует экспрессию белка. Промотор может представлять собой любую нуклеотидную последовательность, которая проявляет транскрипционную активность в выбранной клетке-хозяине, включая мутантные, усеченные и гибридные промоторы, и может быть получена из генов, кодирующих внеклеточные и внутриклеточные полипептиды, гомологичные или гетерологичные по отношению к гену клетки-хозяина. В качестве промотора, экспрессируемого в растительной клетке или растении, можно использовать встречающийся в природе промотор п-гидроксифенилпируватдиоксигеназы или гетерологичный промотор, обладающий активностью в растении. Промотор может приводить к конститутивной экспрессии или индуцибельной экспрессии. Примеры промотора включают, например, промотор гена гистона, промотор гена актина риса, промотор вируса растений, такой как промотор вируса мозаики цветной капусты, и тому подобное.

Регуляторным элементом также может быть подходящая последовательность терминатора транскрипции, которая распознается клеткой-хозяином для остановки транскрипции. Последовательность терминатора функционально связана с 3'-концом последовательности нуклеиновой кислоты, кодирующей белок по изобретению. В настоящем изобретении можно использовать любой терминатор, который функционирует в выбранной клетке-хозяине.

Регуляторный элемент также может представлять собой подходящую лидерную последовательность, т.е. нетранслируемую область мРНК, которая важна для трансляции в клетке-хозяине. Лидерная последовательность функционально связана с 5'-концом последовательности нуклеиновой кислоты, кодирующей белок по изобретению. В настоящем изобретении можно использовать любую лидерную последовательность, которая функционирует в выбранной клетке-хозяине.

Регуляторный элемент также может представлять собой последовательность полиаденилирования, т.е. последовательность, функционально связанную с 3'-концом последовательности нуклеиновой кислоты и распознаваемую клеткой-хозяином в качестве сигнала для добавления остатков полиадениловой кислоты к транскрибируемой мРНК во время транскрипции. В настоящем изобретении можно использовать любую последовательность полиаденилирования, которая функционирует в выбранной клетке-хозяине.

Регуляторным элементом может также быть область, кодирующая сигнальный пептид, которая кодирует аминокислотную последовательность, связанную с аминоконцом белка, и направляет кодированный белок на секреторный путь в клетках. 5'-конец кодирующей области последовательности нуклеиновой кислоты изначально может содержать область, кодирующую сигнальный пептид, которая нативно связана с кодирующей областью, кодирующей секретированный полипептид, в рамке считывания трансляции. Альтернативно, 5'-конец кодирующей последовательности может содержать область, кодирующую сигнальный пептид, которая является чужеродной для кодирующей последовательности. Чужеродная область, кодирующая сигнальный пептид, может потребоваться, если кодирующая последовательность изначально не включает область, кодирующую сигнальный пептид. Альтернативно, чужеродная область, кодирующая сигнальный пептид, может просто заменить нативную область, кодирующую сигнальный пептид, для облегчения секреции полипептида. В любом случае, в настоящем изобретении можно использовать любую область, кодирующую сигнальный пептид, которая направляет экспрессированный полипептид на секреторный путь в выбранной клетке-хозяине, т.е. секрецию полипептида в культуральную среду.

Также могут быть соответствующим образом добавлены регуляторные последовательности, которые позволяют регулировать экспрессию полипептида в соответствии с ростом клетки-хозяина. Регуляторные системы включают, например, регуляторные системы, которые позволяют «включать» или «выключать» экспрессию генов в ответ на химические или физические стимулы (включая присутствие регуляторных соединений), такие как системы lac-, tec- и tip-оперонов, системы ADH2 или системы GAL1 и тому подобное. Примерами других регуляторных последовательностей являются такие, которые обеспечивают амплификацию гена. В эукариотической системе они включают ген дигидрофолатредуктазы, который амплифицируется в присутствии метотрексата, и ген металлотионеина, который амплифицируется в результате присутствия тяжелых металлов. В этих случаях нуклеотидная последовательность, кодирующая полипептид, будет функционально связана с регуляторной последовательностью.

В рамках настоящего изобретения, регуляторный элемент также может быть активатором транскрипции, т.е. энхансером, например, активатором трансляции вируса табачной мозаики, описанным в WO87/07644, или интроном и т.д., таким как интрон гена adh1 кукурузы, интрон гена bronze-1 кукурузы или интрон 1 гена актина риса. Они могут усиливать экспрессию мутантного белка HPPD, его биологически активного фрагмента или слитого белка по настоящему изобретению в трансгенном растении.

Настоящее изобретение также относится к экспрессионному вектору, содержащему последовательность нуклеиновой кислоты, кодирующую мутантный белок п-гидроксифенилпируватдиоксигеназы или его биологически активный фрагмент, или слитый белок по настоящему изобретению, и функционально связанный с ним регуляторный элемент экспрессии. Экспрессионный вектор также содержит, по меньшей мере, один ориджин репликации для саморепликации. Выбор вектора обычно будет зависеть от совместимости вектора с клеткой-хозяином, в которую вектор должен быть введен. Вектор может представлять собой автономно реплицирующийся вектор, т.е. вектор, который находится в виде внехромосомного элемента, и его репликация не зависит от хромосомной репликации, такой как плазмиды, внехромосомные элементы, минихромосомы или искусственные хромосомы. Вектор может включать любой элемент, обеспечивающий саморепликацию. В качестве альтернативы вектор может представлять собой вектор, который интегрируется в геном клетки-хозяина при введении в клетку-хозяин, и реплицируется вместе с хромосомой, в которую он интегрирован. Кроме того, можно использовать один вектор или одну плазмиду, или два или несколько векторов или плазмид, вместе с содержащейся полной ДНК для введения в геном клетки-хозяина, или транспозон. Альтернативно, вектор также может быть вектором для геномного редактирования эндогенного гена HPPD клетки-хозяина.

Вектор может представлять собой плазмиду, вирус, космиду или фаг и т.п., что хорошо известно специалистам в данной области и неоднократно описано в данной области. Предпочтительно экспрессионный вектор в настоящем изобретении представляет собой плазмиду. Экспрессионный вектор может содержать промотор, сайт связывания рибосомы для инициации трансляции, сайт полиаденилирования, терминатор транскрипции, энхансер и т.п. Такой селектируемый маркер включает ген, кодирующий дигидрофолатредуктазу, ген, придающий устойчивость к неомицину, ген, придающий устойчивость к тетрациклину или ампициллину, и тому подобное.

Вектор по настоящему изобретению может содержать элементы, которые позволяют интегрировать вектор в геном клетки-хозяина или обеспечивают автономную репликацию независимо от генома в клетке. Для интеграции в геном клетки-хозяина вектор может «опираться» на полинуклеотидную последовательность, кодирующую полипептид или любой другой элемент вектора, который подходящим образом интегрируется в геном посредством гомологичной или негомологичной рекомбинации. Альтернативно, вектор может содержать дополнительную нуклеотидную последовательность для направленной интеграции вектора в геном клетки-хозяина в точном месте хромосомы посредством гомологичной рекомбинации. Для повышения вероятности интеграции в точном положении, элемент интеграции предпочтительно должен содержать достаточное количество нуклеотидов, например от 100 до 10000 п.о., предпочтительно от 400 до 10000 п.о., более предпочтительно от 800 до 10000 п.о., которые в высокой степени идентичны соответствующей целевой последовательности, для повышения вероятности гомологичной рекомбинации. Элемент интеграции может представлять собой любую последовательность, гомологичную целевой последовательности в геноме клетки-хозяина. Кроме того, элемент интеграции может представлять собой некодирующую или кодирующую нуклеотидную последовательность. В еще одном аспекте вектор может быть интегрирован в геном клетки-хозяина посредством негомологичной рекомбинации. Для автономной репликации вектор может дополнительно содержать ориджин репликации, позволяющий вектору автономно реплицироваться в клетке-хозяине. Ориджин репликации может представлять собой любой репликон плазмиды, который опосредует автономную репликацию и функционирует в клетке. Термин «ориджин репликации» или «репликон плазмиды» определяется здесь как нуклеотидная последовательность, которая позволяет плазмиде или вектору реплицироваться in vivo.

Полинуклеотид с более чем одной копией по настоящему изобретению вставляют в клетку-хозяин для повышения выхода продукта гена. Увеличение числа копий полинуклеотида может достигаться посредством интеграции последовательности, по меньшей мере, с одной дополнительной копией в геном клетки-хозяина или посредством объединения амплифицируемого селектируемого маркерного гена с полинуклеотидом. В последнем случае клетка, содержащая ген селектируемого маркера с амплифицированной копией и полинуклеотид с дополнительной копией, может быть подвергнута скринингу посредством искусственного культивирования клетки в присутствии подходящего селектируемого состава.

Последовательность нуклеиновой кислоты по настоящему изобретению может быть вставлена в вектор различными способами, например, расщеплением вставки и вектора подходящей эндонуклеазой рестрикции и последующим проведением лигирования. В данной области известны различные методы клонирования, которые находятся в пределах знаний специалистов в данной области.

Векторы, подходящие для применения в настоящем изобретении, включают коммерчески доступные плазмиды, например, не ограничиваясь этим, pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Швеция), GEM1 (Promega Biotec, Madison, WI, США), pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174 pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG и pSVL (Pharmacia) и т.п.

Изобретение также относится к клетке-хозяину, содержащей последовательность нуклеиновой кислоты, конструкцию нуклеиновой кислоты или экспрессионный вектор по настоящему изобретению. Вектор по настоящему изобретению вводится в клетку-хозяин таким образом, чтобы вектор находился в виде части хромосомного интегранта или в виде внехромосомного вектора для саморепликации, как описано выше, или вектор может генетически редактировать эндогенный ген HPPD в клетке-хозяине. Клеткой-хозяином может быть любая клетка-хозяин, известная специалистам в данной области, включая прокариотические клетки и эукариотические клетки, такие как бактериальные клетки, грибковые клетки, дрожжевые клетки, клетки млекопитающих, клетки насекомых или клетки растений, примерами которых являются E. coli, Streptomyces, Bacillus subtilis, Salmonella typhimurium, Pseudomonas, Streptomyces, Staphylococcus, Spodoptera Sf9, CHO, COS и т.д. Специалисты в данной области техники могут выбрать подходящую клетку-хозяин.

В рамках настоящего изобретения, термин «клетка-хозяин» также охватывает любое потомство родительской клетки, которое не полностью идентично родительской клетке за счет мутаций, возникающих во время репликации.

Последовательность нуклеиновой кислоты, конструкция нуклеиновой кислоты или экспрессионный вектор по настоящему изобретению могут быть введены в клетку-хозяин различными способами, включая трансформацию, трансфекцию, трансдукцию, вирусную инфекцию, генную пушку или доставку гена, опосредованную Ti-плазмидой, и трансфекцию с использованием фосфата кальция, трансфекцию, опосредованную DEAE-декстраном, липофекцию или электропорацию и т.п. (см. Davis L., Dibner M., Battey I., Basic Methods in Molecular Biology, 1986).

В конкретном варианте осуществления мутантный белок HPPD по настоящему изобретению может быть нацелен на пластиду в растении, такую как хлоропласт. Это может достигаться лигированием последовательности нуклеиновой кислоты, кодирующей мутантный белок HPPD по настоящему изобретению, в рамку считывания последовательности нуклеиновой кислоты, кодирующей пластид-направленный пептид, такой как хлоропласт-направленный пептид, или это может быть достигнуто прямо, трансформацией полинуклеотида, конструкции нуклеиновой кислоты или экспрессионного вектора по настоящему изобретению в геном хлоропласта растительной клетки. Специалистам в данной области известны векторы и методы, которые можно использовать для трансформации геномов хлоропластов растительных клеток. Например, последовательность нуклеиновой кислоты, кодирующая мутантный белок HPPD по настоящему изобретению, может быть интегрирована бомбардировкой листьев целевого растения ионами, покрытыми ДНК, и посредством гомологичной рекомбинации или негомологичной рекомбинации.

Там где это целесообразно, трансформированные клетки-хозяева можно культивировать в обычных питательных средах. После трансформации подходящей клетки-хозяина и культивирования клетки-хозяина до соответствующей плотности клеток, выбранный промотор можно индуцировать подходящим методом, таким как изменение температуры или химическая индукция, и клетки можно культивировать в течение дополнительного периода времени для получения мутанта белка HPPD или его биологически активного фрагмент, или слитого белка по настоящему изобретению.

Следовательно, настоящее изобретение также относится к способу получения мутантного белка HPPD или его биологически активного фрагмента, или слитого белка по настоящему изобретению, включающему: (а) культивирование указанной клетки-хозяина в условиях, способствующих продукции указанного мутантного белка HPPD или его биологически активного фрагмента, или слитого белка; и (b) выделение мутантного белка HPPD или его биологически активного фрагмента, или слитого белка.

В способе получения по настоящему изобретению клетки культивируют на питательной среде, подходящей для получения полипептида, способами, хорошо известными в данной области. Например, клетки выращивают культивированием в качалочных колбах и маломасштабной или крупномасштабной ферментацией (включая непрерывную, периодическую ферментацию, периодическую ферментацию с подпиткой или твердофазную ферментацию) в подходящей культуральной среде в лабораторных или промышленных ферментерах в условиях, которые обеспечивают экспрессию и/или выделение полипептида. Культивирование проводят на подходящей питательной среде, содержащей источники углерода и азота и неорганические соли, с помощью процедур, известных в данной области. Подходящие среды можно приобрести у поставщиков или составить в соответствии с раскрытыми композициями (например, теми, что указаны в каталоге Американской коллекции типовых культур). Если полипептид секретируется в питательную среду, то полипептид можно непосредственно выделить из культуральной среды. Если полипептид не секретируется в среду, то его можно выделить из клеточных лизатов.

Полипептид можно детектировать способами, которые известны в данной области как специфичные для полипептида. Эти методы детектирования могут включать использование специфических антител, образование продуктов ферментных реакций или расход субстратов ферментных реакций.

Полученный полипептид можно выделить методами, известными в данной области. Например, клетки можно собрать центрифугированием и разрушить физическими или химическими методами, и полученный неочищенный экстракт хранят для дальнейшей очистки. Трансформированные клетки-хозяева, экспрессирующие мутантный белок HPPD или его биологически активный фрагмент, или слитый белок по настоящему изобретению, можно лизировать любыми удобными способами, включая циклы замораживания-оттаивания, обработку ультразвуком, механическое разрушение или использование агента, лизирующего клетки. Эти методы хорошо известны специалистам в данной области. Мутантный белок HPPD или его биологически активный фрагмент по настоящему изобретению можно выделить и очистить из культуры трансформированной клетки-хозяина, и используемый метод включает осаждение сульфатом аммония или этанолом, экстракцию кислотой, анионообменную или катионообменную хроматографию, фосфоцеллюлозную хроматографию, хроматографию гидрофобного взаимодействия, аффинную хроматографию, хроматографию на гидроксиапатите и хроматографию на фитогемагглютинине и тому подобное.

Изобретение также относится к способу получения организма-хозяина, в частности, растительной клетки, ткани растения, части растения или растения, которые являются толерантными или устойчивыми к гербициду, ингибирующим HPPD, включающему трансформацию организма-хозяина последовательностью нуклеиновой кислоты, кодирующей мутантный белок HPPD или его биологически активный фрагмент по настоящему изобретению, или структурой нуклеиновой кислоты, или экспрессионным вектором, содержащим последовательность нуклеиновой кислоты. Способы трансформации клетки-хозяина, такой как клетка растения, известны в данной области, включая, например, трансформацию протопластов, слияние, инъекцию, электропорацию, ПЭГ-опосредованную трансформацию, ионную бомбардировку, вирусную трансформацию, Agrobacterium-опосредованную трансформацию, электропорацию с перфорацией или бомбардировкой и тому подобное. Ряд таких способов трансформации описан на предшествующем уровне техники, например методика трансформации сои, описанная в EP1186666, и подходящие методы трансформации однодольных растений, в частности риса, описанные в WO 92/09696. Также преимущественно культивировать эксплантаты растений с Agrobacterium tumefaciens или Agrobacterium rhizogenes для переноса ДНК в клетку растения. Затем можно регенерировать целое растение из инфицированной части растительного материала (например, фрагментов листьев, сегментов стебля, корней и протопластов или суспензии культивированных клеток) в подходящей культуральной среде, которая может содержать антибиотики или пестициды для селекции. Трансформированные клетки выращивают в растениях обычным образом, где они могут образовывать зародышевые клетки и передавать трансформированные признаки растениям-потомкам. Такие растения можно культивировать обычным способом и скрещивать с растениями, имеющими аналогичные трансформированные генетические факторы или другие генетические факторы. Полученные гибридные особи обладают соответствующими фенотипическими свойствами.

Изобретение также относится к способу получения организма-хозяина, в частности, растительной клетки, ткани растения, части растения или растения, которые являются толерантными или устойчивыми к гербициду, ингибирующим HPPD, включающему интеграцию нуклеиновой кислоты, кодирующей мутантный белок п-гидроксифенилпируватдиоксигеназы или его биологически активный фрагмент по настоящему изобретению в геном организма-хозяина, и экспрессию нуклеиновой кислоты. Подходящие векторы и селектируемые маркеры хорошо известны специалистам в данной области, например, способ интеграции в геном табака описан в WO06/108830, и содержащиеся в ней описания включены здесь посредством ссылки. Представляющий интерес ген(ы) предпочтительно экспрессируется конститутивными или индуцибельными промоторами в растительной клетке. После экспрессии мРНК транслируется в белки, в результате чего в белок включаются представляющие интерес аминокислоты. Гены, кодирующие белок, экспрессированный в клетках растений, могут находиться под контролем конститутивного промотора, тканеспецифического промотора или индуцибельного промотора. Например, можно использовать промоторы бактериального происхождения, такие как промотор октопинсинтазы, промотор нопалинсинтазы и промотор маннопинсинтазы; промоторы вирусного происхождения, такие как промотор вируса мозаики цветной капусты (35S и 19S), 35T (который является реконструированным промотором 35S, см. патент США №6166302, в частности, пример 7E). Также можно использовать регуляторные промоторные элементы растений, которые включают, не ограничиваясь этим, промотор малой субъединицы (ssu) рибулоза-1,6-бисфосфат (RUBP) карбоксилазы, промотор β-конглицинина, промотор β-фазеолина, промотор ADH, промоторы теплового шока и тканеспецифические промоторы. Также можно использовать конститутивные регуляторные промоторные элементы, тем самым обеспечивая непрерывную экспрессию генов во всех типах клеток и все время (например, актин, убиквитин, CaMV 35S и т.п.). Тканеспецифические регуляторные промоторные элементы ответственны за экспрессию генов в определенных типах клеток или тканей, таких как листья или семена (например, зеин, олеозин, напин, ACP, глобулин и т.п.), и они также могут быть использованы в настоящем изобретении. Регуляторные промоторные элементы также могут быть активными (или неактивными) на определенной стадии развития растения. Примеры таких промоторов включают, не ограничиваясь этим, специфические для пыльцы, специфические для зародыша, специфические для кукурузных рыльцев, специфические для хлопкового волокна, корнеспецифические, специфические для эндосперма семян или регуляторные промоторные элементы, специфические для вегетативной фазы, и т.п. При определенных обстоятельствах может быть желательным использовать индуцибельный регуляторный промоторный элемент, который отвечает за экспрессию генов в ответ на определенный сигнал, такой как: физический стимул (гены теплового шока), свет (RUBP-карбоксилаза), гормон (Em), метаболиты, химические вещества (отвечающие на тетрациклин) и стресс. Могут быть использованы другие желательные элементы транскрипции и трансляции, которые функционируют в растениях.

Настоящее изобретение также относится к способу повышения устойчивости или толерантности растительной клетки, ткани растения, части растения или растения к гербициду, ингибирующему HPPD, включающему трансформацию растения или части растения молекулой нуклеиновой кислоты, содержащей последовательность нуклеиновой кислоты, кодирующую мутантный белок HPPD или его биологически активный фрагмент, или слитый белок по настоящему изобретению, и экспрессию молекулы нуклеиновой кислоты. Молекула нуклеиновой кислоты может быть экспрессирована в виде внехромосомного элемента или может быть экспрессирована посредством ее интеграции в геном растительной клетки, в частности, может быть экспрессирована ее интеграцией в положение эндогенного гена растительной клетки посредством гомологичной рекомбинации. Все эти варианты осуществления находятся в пределах объема настоящего изобретения.

Настоящее изобретение также относится к способу повышения устойчивости или толерантности растения или его части к гербициду, ингибирующему HPPD, включающему скрещивание растения, экспрессирующего мутантный белок п-гидроксифенилпируватдиоксигеназы (HPPD) или его биологически активный фрагмент, или слитый белок по настоящему изобретению с другим растением, и скрининг на растение, обладающее повышенной устойчивостью и толерантностью к гербицидам, ингибирующим HPPD.

Настоящее изобретение также относится к способу повышения устойчивости или толерантности растительной клетки, ткани растения, части растения или растения к гербициду, ингибирующему HPPD, включающему геномное редактирование эндогенного гена белка HPPD растительной клетки, ткани растения, части растения или растения для достижения экспрессии мутантного белка п-гидроксифенилпируватдиоксигеназы (HPPD) или его биологически активного фрагмента, или слитого белка по настоящему изобретению.

Настоящее изобретение также относится к способу получения растения, которое является толерантным или устойчивым к гербициду, традиционными методами селекции, который включает самоскрещивание или скрещивание растения, в котором последовательность нуклеиновой кислоты, кодирующая мутантный белок п-гидроксифенилпируватдиоксигеназы или его биологически активный фрагмент по настоящему изобретению, интегрирована в геном, и скринирование потомства, содержащего гетерозиготную или гомозиготную последовательность нуклеиновой кислоты.

Изобретение также относится к растительной клетке, ткани растения, части растения и растению, полученным вышеуказанным способом, и их потомкам.

Предпочтительно растительная клетка, ткань растения или часть растения, трансформированные полинуклеотидом по настоящему изобретению, могут быть регенерированы в целое растение. Настоящее изобретение включает клеточные культуры, в том числе, тканевые клеточные культуры, жидкие культуры и культуры на твердых подложках. Семена, полученные от растений по настоящему изобретению и/или используемые для регенерации растений по настоящему изобретению, также включаются в объем настоящего изобретения. Другие ткани и части растений также включаются в настоящее изобретение. Настоящее изобретение также включает способ получения растения или клетки, содержащей молекулу нуклеиновой кислоты по настоящему изобретению. Предпочтительный способ получения такого растения, включает посев семян по настоящему изобретению. Растение, трансформированное таким образом, может быть обеспечено устойчивостью к различным гербицидам, имеющим разные механизмы действия.

Например, для трансформации растительных клеток с использованием Agrobacterium, эксплантаты можно объединить и инкубировать с трансформированными Agrobacterium в течение времени, достаточного для их трансформации. После трансформации индуцируют гибель Agrobacteria селекцией с использованием соответствующего антибиотика, и клетки растений культивируют в соответствующей селективной среде. После образования каллусов образование побегов можно стимулировать посредством использования соответствующих фитогормонов согласно методам, хорошо известным в области культивирования растительной ткани и регенерации растений. Однако промежуточная стадия получения каллуса не всегда является необходимой. После образования побегов указанные растительные клетки можно перенести в среду, которая способствует корнеобразованию, тем самым завершая регенерацию растений. Затем растения можно выращивать для получения семян, и указанные семена можно использовать для получения будущих поколений. Независимо от метода трансформации ген, кодирующий бактериальный белок, предпочтительно включают в вектор для переноса гена, адаптированный для экспрессии указанного гена в растительной клетке, посредством включения в вектор растительного регуляторного промоторного элемента, а также 3'-нетранслируемых областей терминации транскрипции, таких как Nos и им подобные.

Настоящее изобретение также относится к способу борьбы с сорняками на участке выращивания растений, включающему нанесение на участок, содержащий растения или семена по настоящему изобретению, гербицидно эффективного количества одного или более гербицидов, ингибирующих HPPD.

В рамках настоящего изобретения, термин «участок выращивания» включает участок, на котором выращивают растения по настоящему изобретению, такой как почва, и также включает, например, семена растений, саженцы растений и выращенные растения. Термин «гербицидно эффективное количество» означает количество гербицида, достаточное для воздействия на рост или развитие целевых сорняков, например, предупреждение или подаление роста или развития целевых сорняков или уничтожение сорняков. Преимущественно указанное гербицидно эффективное количество не оказывает существенного воздействия на рост и/или развитие семян растений, саженцев растений или растений по настоящему изобретению. Специалисты в данной области могут определить такое гербицидно эффективное количество с помощью обычных экспериментов.

Настоящее изобретение также относится к способу получения мутантного белка п-гидроксифенилпируватдиоксигеназы (HPPD), который сохраняет или усиливает способность катализировать превращение пара-гидроксифенилпирувата (HPP) в гомогентизат и значительно менее чувствителен к гербицидам, ингибирующим HPPD, чем HPPD дикого типа, включающему стадии: мутирования нуклеиновой кислоты, кодирующей HPPD дикого типа, последовательно слияния и лигирования мутированной нуклеиновой кислоты в рамке считывания с последовательностью нуклеиновой кислоты, кодирующей компонент, повышающий растворимость, в экспрессионном векторе с образованием последовательности, кодирующей слитый белок, трансформации полученного рекомбинантного экспрессионного вектора в клетку-хозяин, экспрессии слитого белка в подходящих условиях, содержащих гербицид, ингибирующий HPPD, и ферментативный субстрат HPPD, и скрининга мутантного белка п-гидроксифенилпируватдиоксигеназы (HPPD), который сохраняет или усиливает способность катализировать превращение п-гидроксифенилпирувата (HPP) в гомогентизат и значительно снижает чувствительность к гербициду, ингибирующему HPPD. Предпочтительно компонент, увеличивающий растворимость, выбран из NusA, который образует слитый белок с мутантным белком HPPD по настоящему изобретению. Более предпочтительно экспрессионный вектор выбран из вектора pET-44a. Клетка-хозяин выбрана из бактериальной клетки, грибковой клетки или растительной клетки.

Если специально не указано или не подразумевается иное, то используемые здесь термины «а», «ан» и «the» означают «по меньшей мере, один». Все патенты, заявки на патенты и публикации, упомянутые или цитированные в данном документе, полностью включены в настоящий документ посредством ссылки, и степень их цитирования такая же, как в каждом отдельном случае цитирования.

Подробное описание изобретения

Настоящее изобретение будет дополнительно описано в сочетании с нижеприведенными примерами. Все методы и процедуры, описанные в примерах, приведены в качестве примеров и не должны рассматриваться в качестве ограничения. В отношении методов манипуляции с ДНК, см. монографии «Current Protocols in Molecular Biology», Volumes 1 and 2, Ausubel F.M., Greene Publishing Associates and Wiley Interscience, 1989, «Molecular Cloning», T. Maniatis et al., 1982, или Sambrook J. and Russell D., 2001, «Molecular Cloning: a laboratory manual», version 3.

Примеры

Пример 1. Клонирование гена HPPD риса (OsHPPD)

Ген 4-гидроксифенилпируватдиоксигеназы (HPPD) риса (Oryza sativa, Japonica Group) располагается в сайте второй хромосомы, Os02g0168100. Кодирующую область ДНК (OsHPPD) (General Biosystems, Chuzhou, Anhui Province, Китай) синтезировали прямо согласно соответствующей последовательности кДНК (идентификационный номер NCBI XP_015626163.1) и использовали в качестве матрицы для ПЦР. Конструировали и синтезировали праймеры NusOsF: acgattgatgacgacgacaag ATGCCTCCCACTCCCACCCC и NusOsR: tccacgagctcccggactc TTA CTAGGATCCTTGAACTGTAG в соответствии с последовательностями вектора pET-44a (Novagen) и XP_015626163. ПЦР-амплификацию проводили с использованием указанных праймеров, синтезированной матрицы и ДНК-полимеразы Q5 (NEB, New England Biolabs, Boston, США). Амплификацию проводили в следующих условиях: 98°C в течение 2 мин; затем 98°C в течение 20 с, 65°C в течение 30 с и 72°C в течение 60 с, 35 циклов; и 72°C в течение 2 мин. При электрофорезе в агарозном геле было показано, что амплифицированный фрагмент имеет размер 1,3 т.п.н., и концентрацию его ДНК определяли по поглощению ультрафиолетового света после выделения.

Плазмиду pET-44a (Novagen) расщепляли с использованием BoxI (Thermo Fisher Scientific, Shanghai, Китай) при 37°C в течение 1 ч, и затем нагревали до 65°C для инактивации BoxI. Фрагмент ДНК OsHPPD смешивали с вектором, линеаризованным BoxI, pET-44a в равных количествах, к смеси добавляли равный объем 2×Gibson Assembly Master Mix (Hanbio Biotechnology Co., Ltd., Shanghai, Китай), перемешивали и инкубировали при 50°C в течение одного часа; 5 мкл продукта лигирования использовали для трансформации компетентных клеток E. coli DH5a, и бактериальный раствор наносили на поверхность чашки с твердой средой LB, содержащей 100 ppm ампициллина, и культивировали в течение ночи при 37°C. На следующий день, после подтверждения правильности клонов с помощью ПЦР отдельных бактериальных колоний, три правильных клона культивировали в течение ночи при 37°C, экстрагировали достаточное количество плазмидной ДНК и отправляли в Qingke Biotechnology Co., Ltd. (Пекин, Китай) для секвенирования методом секвенирования по Сэнгеру. Результаты секвенирования подтвердили, что была получена правильная полноразмерная кодирующая область ДНК HPPD риса.

Пример 2. Насыщенная случайная мутация каждой аминокислоты в белке HPPD риса (OsHPPD)

Полноразмерный фермент OsHPPD риса содержит 446 аминокислот, и его аминокислотная последовательность представлена в SEQ ID NO: 2, где полагается, что аминокислоты 1-50 составляют сигнальный пептид, который ответственен за направление в хлоропласт (Siehl et al. Plant Physiol. 2014 Nov.; 166(3): 1162-1176). Следовательно, вводили насыщенную случайную мутацию от аминокислоты в положении 51 до аминокислоты в положении 466, для каждой аминокислоты. Это достигалось проведением мостиковой ПЦР с использованием праймера, содержащего кодирующую последовательность аминокислоты, которая должна быть мутирована в NNK, и другого подходящего стандартного праймера. В NNK N представляет собой A/T/G/C, и K представляет G/T, и кодон NNK может кодировать любую из 20 аминокислот или терминаторов. Следовательно, мутация представляла собой насыщенную мутацию. Пожалуйста, см.: Kille S., Acevedo-Rocha C.G., Parra L.P., Zhang Z.G., Opperman D.J., Reetz M.T., Acevedo J.P. (2013) Reducing codon redundancy and screening effort of combinatorial protein libraries created by saturation mutagenesis. ACS Synth Biol 2(2):83-92; Directed Evolution Library Creation: methods and protocols 2nd ed. Edited by Elizabeth M.J. Gillam, Janine N. Copp and David F. Ackerley New York, NY United States: Springer, 2014. doi:10.1007/978-1-4939-1053-3. Должно быть получено большое количество мутантов. Мутант клонировали в линеаризованный вектор pET-44a и трансформировали в E. coli, которую культивировали с использованием 96-луночного планшета в культуральном растворе 2×YT, содержащем гербицид, ингибирующий HPPD (такой как 1-2 мкМ темботриона) и субстрат тирозин (1 г/л), на шейкере при 28°C и 150 об/мин в течение 24 ч для экспрессии, и затем мутанты быстро скринировали по их потемнению. С помощью этой процедуры было отобрано 10 мутантов по одной аминокислоте, A103S, H141R, H141K, H141T, A165V, V191I, R220K, G342D, D370N и K410I. Цветная реакция этих устойчивых мутантов в присутствии темботриона и продукта метаболизма фенпиразона по сравнению с реакцией продукта дикого типа была, как показано на фиг. 1. Среди них изменения цвета H141R и G342D были наиболее значительными и, очевидно, более выраженными, чем у дикого типа.

Способ по настоящему патенту приводил к повышению растворимости HPPD, экспрессированной в бактериях, посредством слияния NusA с белком HPPD риса, в результате чего белок мог экспрессироваться, и ферментативная реакция могла выполняться одновременно при 28°C, что значительно экономило время и стадии скрининга.

Аналогичным образом оценивали цветную реакцию этих мутантов в присутствии трех других гербицидов, ингибирующих HPPD, ципирафлуона, топрамезона и мезотриона, см. фиг. 2 и 3. Устойчивость/толерантность каждого из мутантов к пяти гербицидам ориентировочно оценивали на основе изменения цвета, и результаты приведены в таблице 1. Чем выше число со знаком плюс «+», тем насыщеннее цвет и выше устойчивость/толерантность по сравнению с диким типом.

Таблица 1
Односайтовые мутанты HPPD риса и их относительная устойчивость к 5 различным гербицидам, ингибирующим HPPD
Сайт Аминокислотный остаток дикого типа Мутантный аминокислотный остаток Темботрион Продукт метаболизма фенпиразона Ципирафлуон Топрамезон Мезотрион
Дикий тип -- -- + + + + +
103 A S 2+ 2+ + 2+ 3+
141 H R; K; T 141R: 6+ 141R: 6+ 141R: 6+ 141R: 2+ 141R: 5+
165 A V 3+ 3+ 5+ 2+ 5+
191 V I 2+ 2+ 3+ 2+ 4+
220 R K 2+ 2+ 3+ 2+ 4+
342 G D 6+ 6+ 3+ 2+ 2+
370 D N 2+ 2+ 3+ 2+ 2+
410 K I 2+ 2+ 2+ 2+ 1+

Полностью процесс показан на примере получения и скрининга мутанта H141R.

1. ПЦР-амплификацию проводили с использованием NusOsF и OsHPPD-H141R-R: CACCGCGAGGCCGTGGTCC в качестве праймеров, синтезированной полноразмерной матрицы OsHPPD и ДНК-полимеразы Q5 (NEB, New England Biolabs, Boston, США) с получением первого фрагмента ДНК. Амплификацию проводили в следующих условиях: 98°C/ 2 мин; 98°C/20 с → 65°C/30 с → 72°C/60 с (35 циклов); и 72°C/2 с. После детектирования электрофорезом в агарозном геле выделяли полосы с правильным размером, и концентрации определяли по поглощению ультрафиолетового света. Аналогичным образом, ПЦР-амплификацию проводили с помощью NusOsR и OsHPPD-H141R-F: CACGGCCTCGCGGTGNNKGCCGTGGCGC TGCGCG в качестве праймеров, синтезированной полноразмерной матрицы OsHPPD и ДНК-полимеразы Q5 (NEB, New England Biolabs) с получением второго фрагмента ДНК.

2. Первый и второй фрагменты имеют 19 перекрывающихся оснований в середине (OsHPPD-H141R-F и OsHPPD-H141R-R). Следовательно, два фрагмента смешивали в эквимолярных количествах, к смеси добавляли равный объем 2×Glodstar MasterMix (ComWin Biotechnology Co., Ltd., Пекин), и добавляли 10 пмоль NusOsF и NusOsR в качестве праймеров для проведения реакции мостиковой ПЦР. Амплификацию проводили в условиях: 96°C в течение 2 мин; 96°C в течение 20 с, 65°C в течение 30 с и 72°C в течение 60 с (30 циклов); и 72°C в течение 5 мин. После детектирования электрофорезом в агарозном геле выделяли полосы с правильным размером (1,3 т.п.н.), и концентрации определяли по поглощению ультрафиолетового света.

3. Фрагмент ДНК OsHPPDMut смешивали с вышеуказанным линеаризованным вектором pET-44a в равных количествах, к смеси добавляли равный объем 2×Glodstar MasterMix (ComWin Biotechnology Co., Ltd.), и инкубировали при 50°C в течение 1 ч; 5 мкл продукта лигирования использовали для трансформации компетентных клеток E. coli DH5a, и бактериальный раствор наносили на поверхность чашки с твердой средой LB, содержащей 100 ppm ампициллина, и культивировали в течение ночи при 37°C. Все клоны (колонии) на чашке собирали, плазмиды экстрагировали и ДНК количественно определяли по поглощению УФ-света. 100 нг плазмид трансформировали в компетентные клетки BL21 (DE3), планшет покрывали и культивирование проводили в течение ночи при 37°C. Планшет с трансформированной E. coli временно хранили при 4°C для скрининга мутантов.

4. Скрининг мутантов, устойчивых к гербицидам, ингибирующим HPPD, по цветной реакции

Гербициды, ингибирующие HPPD, подавляли ферментативную активность HPPD. Когда тирозин превращался в 4-гидроксифенилпируват (HPP) под действием тирозинтрансаминазы, то инактивированная HPPD не способна окислять 4-гидроксифенилпируват с образованием гомогентизовой кислоты (HGA). HGA имеет темно-коричневый цвет. Следовательно, если мутант HPPD был устойчивым или толерантным к гербициду, то после экспрессии в E. coli мутант также мог окислять 4-гидроксифенилпируват до гомогентизиновой кислоты, в результате чего появлялось темно-коричневое окрашивание. Следовательно, E.coli культивировали в культуральной среде 2×YT, содержащей гербицид, ингибирующий HPPD, и субстрат тирозин, используя 96-луночный планшет для экспрессии HPPD, и эти мутанты быстро подвергали скринингу по изменению цвета реакционной смеси.

(1) Приготовление культуральной среды 2×YT (добавляли 1 г/л L-Tyr, 0,1 мМ IPTG, 0,01 мМ MnCl2 и 100 мг/л ампициллина).

(2) 0,1 мл вышеуказанной среды добавляли в каждую лунку 96-луночного планшета, и клоны, экспрессирующие OsHPPD дикого типа или мутант (OsHPPD Mut), из планшета с E. coli, полученной вышеуказанной трансформацией, подвергали культивированию в жидкой среде в 96-луночном планшете. Ингибиторы HPPD, имеющие конечную концентрацию 1-20 мкМ, добавляли в зависимости от различных выбранных агентов, например, конечная концентрация темботриона составляла 1,7 мкМ, и мезотриона составляла 10 мкМ. После добавления всех компонентов в качестве покрытия использовали прочную газопроницаемую герметизирующую пленку (Suolaibao Biological Agent Company, Пекин, Китай).

(3) 96-луночный планшет инкубировали на шейкере при 28°C и 150 об/мин в течение 24 ч. Визуализировали или детектировали поглощение света культуры при 400 нм, и клоны, которые достоверно продуцировали черные пигменты, отбирали с помощью инокуляционной петли и затем культивировали. Плазмидную ДНК экстрагировали, секвенировали и использовали для дальнейших исследований, таких как экспрессия, очистка и анализ ферментативной активности белка OsHPPD.

Односайтовые мутанты A103S, A165V, V191I, R220K, D370N, K410I и трехсайтовые мутанты H141R/G342D/D370N получали с праймерами, показанными в таблице 2, с использованием того же метода, соответственно.

Таблица 2
Праймеры, использованные в получении мутантов HPPD
Название праймера Последовательность праймера (5'-3')
NusOsF acg att gat gac gac gac aag ATGCCTCCCACTCCCACCCC
NusOsR tccacgagctcccggactcTTA CTAGGATCCTTGAACTGTAG
OsHPPD-H141R-F CACGGCCTCGCGGTGNNKGCCGTGGCGCTGCGCG
OsHPPD-H141R-R CACCGCGAGGCCGTGGTCC
OsHPPD-A103S-F GCGTTCCTCTTCACCNNKCCCTACGGCGGCGACCACG
OsHPPD-A103S-R GGTGAAGAGGAACGCGACGGAGGC
OsHPPD-A165V-F TCGCGGCCGGTGCGCGCCCGNNKTTCCAGCCCG
OsHPPD-A165V-R CGGGCGCGCACCGGCCGCGAC
OsHPPD-V191I-F GTCGTGCTCCGCTTCNNKAGCCACCCGG
OsHPPD-V191I-R GAAGCGGAGCACGACGTCGCC
OsHPPD-R220K-F CGCCGTGGACTACGGCCTCCGCNNKTTCGACCACG
OsHPPD-R220K-R GCGGAGGCCGTAGTCCACGGCGC
OsHPPD-D370N-F CTCGTGGACAGGGATNNKCAGGGGGTGTTGCTCCAGATCT
OsHPPD-D370N-R ATCCCTGTCCACGAGCACCCC
OsHPPD-K410I-F TGGGCAGGAGTACCAGNNKGGCGGCTGCGGCG
OsHPPD-K410I-R CTGGTACTCCTGCCCACTCTCATCC
OsHPPD-H141R/G342D/D370N-F GGCCTCAACTCGGTGGTGCTCG
OsHPPD-H141R/G342D/D370N-R GCGAGCACCACCGAGTTGAGGC

Кроме того, некоторые двухсайтовые мутанты, включающие комбинацию односайтовых мутаций, такие как H141R/G342D, H141R/ D370N и G342D/D370N, также получали способом, аналогичным мостиковой ПЦР.

Пример 3. Комбинации мультисайтовых мутаций белков HPPD риса (OsHPPD)

В настоящем изобретении также тестировали по цветной реакции H141R, G342D, D370N, а также мутантные белки HPPD, содержащие их комбинацию, с пятью различными гербицидами, ингибирующими HPPD, например, темботрионом, продуктом метаболизма фенпиразона, ципирафлуоном, топрамезоном и мезотрионом в различное время и в разных 96-луночных планшетах. Результаты испытаний показаны на фиг. 4, 5 и 6. В таблице 3 показана устойчивость/толерантность этих мутантов к соответствующим гербицидам, оцененная по оттенкам их цветных реакций. По данным таблицы 3 следует, что двухсайтовые мутанты и трехсайтовые мутанты также обладают высокой толерантностью к гербицидам, доказывая, что комбинации аминокислотных мутаций могут присутствовать в белке HPPD риса (OsHPPD) в комбинациях, которые также обеспечивают высокую устойчивость/толерантность к гербицидам, ингибирующим HPPD.

Таблица 3
Устойчивость односайтовых и мультисайтовых мутантных HPPD риса к 5 гербицидам
Комплексные сайты темботрион продукт метаболизма фенпиразона ципирафлуон топрамезон мезотрион
Дикий тип (WT) + + + + +
H141R 2+ 5+ 20+ 15+ 20+
G342D 3+ 5+ 10+ 7+ 20+
D370N 1.5+ 2+ 5+ 5+ 5+
H141R/G342D 10+ 10+ 30+ 25+ 30+
H141R/D370N 3+ 4+ 20+ 20+ 10+
G342D/D370N 2+ 4+ 5+ 5+ 6+
H141R/G342D/D370N 10+ 10+ 30+ 30+ 30+

Пример 4. Дополнительная насыщенная мутация на основе трехсайтового мутанта H141R-G342D-D370N

1. При постановке цветной реакции трехсайтового мутанта OsHPPD H141R-G342D-D370N, экспрессированного в E. coli, когда для ингибирования использовали бипиразон (код соединения 101), требовалась концентрация этого соединения 120 мкМ, чтобы отсутствовала выраженная цветная реакция. Следовательно, для первоначального скрининга была выбрана концентрация 120 мкМ соединения 101. С использованием вышеописанной экспериентальной процедуры конструировали пару праймеров для каждой аминокислоты в аминокислотных положениях 51-446 (за исключением сайтов 141R, 342D и 370N), соответственно, и один из которых был представлен NNK в аминокислотном сайте, который был предназначен для насыщенной мутации. С помощью ПЦР-амплификации получали серию мутантов, затем экспрессировали в E. coli BL21 (DE3) и повторно скринировали с использованием 120 мкМ соединения 101. После скрининга всех односайтовых мутаций было получено 18 новых сайтов мутации. Новыми сайтами были: R93S, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, R346C, R346D, R346H, R346S, R346Y, I377C, P386T, L390I, M394VL19, G402, G40, G18, G40, G390I, M394L19, G40, G40, G3, N420S, N420T, E430G, Y431L. Аминокислотные и нуклеотидные (основания) замены для этих новых сайтов мутаций, а также праймеры, использованные для создания этих новых сайтов мутаций, приведены в таблице 4, и последовательности праймеров приведены в таблице 5. В итоге, как показано на фиг. 7, в целом было получено 26 сайтов мутаций в результате скрининга, где одна исходная аминокислота в некоторых сайтах могла быть заменена на несколько различных аминокислот, например, H141R, K,T; N338D, S,Y; R346C, D,H, S,Y; G419F, L,V и N420S, T.

Таблица 4
Все новые скринированные сайты мутаций, изменения аминокислот и оснований и использованные праймеры
Сайт WT Мутация Праймер
Аминокислота Основание Аминокислота Основание
93 R CGC S TCC 93F
93R
226 G GGC H CAC 226F
226R
276 L CTG W TGG 276F
276R
277 P CCG N AAT 277F
277R
336 P CCG D GAT 336F
336R
337 P CCC A GCC 337F
337R
338 N AAC D, S,Y GAC, AGC,TAC 338F
338R
346 R CGC C, H,S, D,Y TGC, CAC,AGC, GAC,TAT 346F
346R
377 I ATC C TGC 377F
377R
386 P CCA T ACA 386F
386R
390 L TTG I ATT 390F
390R
392 M ATG L CTG 392F
392R
403 E GAG G GGG 403F
403R
418 K AAG P CCG 418F
418R
419 G GGC F, L,V TTC, TTG,GTG 419F
419R
420 N AAC S, T AGC, ACC 420F
420R
430 E GAG G GGG 430F
430R
431 Y TAT L CTG 431F
431R

Таблица 5
Все новые скринированные сайты мутаций и использованные последовательности праймеров
Аминокислотное положение Праймер и последовательность (5’→3’)
93 93-F:CGCACGCCTCCCTCCTCCTCNNKTCCGCCTCCGTCGCGTTCCTC
93-R:GAGGAGGAGGGAGGCGTGCG
226 226-F:GCCGGTTCGACCACGTCGTCNNKAACGTGCCGG
226-R:GACGACGTGGTCGAACCGGC
276 276-F:ACAACGCGGAGACCGTGCTGNNKCCGCTCAACG
276-R:CAGCACGGTCTCCGCGTTGT
277 277-F:ACGCGGAGACCGTGCTGCTGNNKCTCAACGAGCCGGTGCACGG
277-R:CAGCAGCACGGTCTCCGCGTTG
336 336-F:TCGAGTTCTTGGCGCCGCCGNNKCCCAACTACTACGACGGCGTG
336-R:CGGCGGCGCCAAGAACTCGAAG
337 337-F:AGTTCTTGGCGCCGCCGCCGNNKAACTACTACGACGGCGTGCG
337-R:CGGCGGCGGCGCCAAGAACTC
338 338-F:TCTTGGCGCCGCCGCCGCCCNNKTACTACGACGGCGTGCGGCG
338-R:GGGCGGCGGCGGCGCCAAGAAC
346 346-F:ACTACGACGGCGTGCGGCGGNNKGCCGGGGACGTGCTCTCGGAG
346-R:CCGCCGCACGCCGTCGTAGTAG
377 377-F:ACCAGGGGGTGTTGCTCCAGNNKTTCACCAAGC
377-R:CTGGAGCAACACCCCCTGGT
386 386-F:CCAAGCCAGTAGGAGACAGGNNKACCTTTTTCTTGGAGATGATAC
386-R:CCTGTCTCCTACTGGCTTGG
390 390-F:GAGACAGGCCAACCTTTTTCNNKGAGATGATAC
390-R:GAAAAAGGTTGGCCTGTCTC
392 392-F:AGGCCAACCTTTTTCTTGGAGNNKATACAAAGGA
392-R:CTCCAAGAAAAAGGTTGGCCTG
403 403-F:TTGGGTGCATGGAGAAGGATNNKAGTGGGCAGGAGTACCAGAAG
403-R:ATCCTTCTCCATGCACCCAATC
418 418-F:GCGGCTGCGGCGGGTTTGGGNNKGGCAACTTCTCGGAGCTGTTC
418-R:CCCAAACCCGCCGCAGCCGC
419 419-F:GGCTGCGGCGGGTTTGGGAAGNNKAACTTCTCGGAGCTGTTCAAG
419-R:CTTCCCAAACCCGCCGCAGCC
420 420-F:GCGGCGGGTTTGGGAAGGGCNNKTTCTCGGAGCTGTTCAAGTC
420-R:GCCCTTCCCAAACCCGCCGC
430 430-F:AGCTGTTCAAGTCCATTGAGNNKTATGAGAAATCCCTTGAAGC
430-R:CTCAATGGACTTGAACAGCTC
431 431-F:TGTTCAAGTCCATTGAGGAGNNKGAGAAATCCCTTGAAGCCAAG
431-R:CTCCTCAATGGACTTGAACAG

Пример 5. Комбинации сайтов мутации

Сайты мутаций объединяли на основе следующих трех принципов: сайты были близкими для облегчения гомологичного замещания при редактировании генов, и эффективность редактирования была высокой; изменение оснований было таким: A→G/T→C или C→T/G→A для облегчения редактирования оснований; и устойчивые сайты были как можно небольшими для облегчения редактирования и предупреждения возможных негативных эффектов. В соответствии с вышеуказанными принципами были разработаны комбинации, соответствующие праймеры и прокариотические экспрессионные векторы, и затем проведен скрининг с помощью цветных реакций, чтобы найти высокоустойчивую комбинацию, подходящую для редактирования для выполнения редактирования генов.

(1) В целом было сконструировано 33 комбинации согласно принципу близкого расстояния, из которых 24 комбинации имели 3 сайта мутации, и 9 комбинаций имели 4 сайта мутации. В таблице 6 показаны эти комбинации и используемые последовательности праймеров.

Таблица 6
Комбинации сайтов мутации (3 или 4 сайта мутации), сконструированные по принципу близкого расстояния
Комбинации 3/4 сайтов мутации Праймеры и последовательности (5'→3')
P336D/N338D/G342D 1-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCGAC TACTACGACGACG
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/N338S/G342D 1-338S-F1: TCTTGGCGCCGCCGGATCCCAGCTACTAC GACGACGTGCGGCG
1-338S-R1: GGGATCCGGCGGCGCCAAG
P336D/N338Y/G342D 1-338Y-F2: TCTTGGCGCCGCCGGATCCCTACTACTACGACGACGTGCGGCG
1-338S-R1: GGGATCCGGCGGCGCCAAG
N338D/G342D/R346C 346-F-2: CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG
346-R-2: CCGCCGCACGTCGTCGTAG
N338D/G342D/R346H 346-F-3: CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG
346-R-2: CCGCCGCACGTCGTCGTAG
N338D/G342D/R346S 1-346S-F1: CTACGACGACGTGCGGCGGAGCGCCGGGGACGTGCTCTCG
346-R-2: CCGCCGCACGTCGTCGTAG
N338S/G342D/R346C 2-338S-F1: CTTGGCGCCGCCGCCGCCCAGCTACTACGACGACGTGCGGC
2-338S-R1: GGGCGGCGGCGGCGCCAAG
N338S/G342D/R346H 2-338S-F1: CTTGGCGCCGCCGCCGCCCAGCTACTACGACGACGTGCGGC
2-338S-R1: GGGCGGCGGCGGCGCCAAG
N338S/G342D/R346S 2-338S-F1: CTTGGCGCCGCCGCCGCCCAGCTACTACGACGACGTGCGGC
2-338S-R1: GGGCGGCGGCGGCGCCAAG
N338Y/G342D/R346C 2-338Y-F2: CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGTGCGGC
2-338S-R1: GGGCGGCGGCGGCGCCAAG
N338Y/G342D/R346H 2-338Y-F2: CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGTGCGGC
2-338S-R1: GGGCGGCGGCGGCGCCAAG
N338Y/G342D/R346S 2-338Y-F2: CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGTGCGGC
2-338S-R1: GGGCGGCGGCGGCGCCAAG
P336D/G342D/R346C 2-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCAACTACTACGACGAC
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/G342D/R346H 2-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCAACTACTACGACGAC
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/G342D/R346S 2-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCAACTACTACGACGAC
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/N338D/R346C 2-346C-F2: CTACGACGGCGTGCGGCGGTGCGCCGGGGACGTGCTCTCGG
2-346C-R2: CCGCCGCACGCCGTCGTAG
P336D/N338D/R346H 2-346H-F2: ACTACGACGGCGTGCGGCGGCACGCCGGGGACGTGCTCTCGG
2-346C-R2: CCGCCGCACGCCGTCGTAG
P336D/N338D/R346S 2-346S-F2: ACTACGACGGCGTGCGGCGGAGCGCCGGGGACGTGCTCTCGG
2-346C-R2: CCGCCGCACGCCGTCGTAG
P336D/N338S/R346C 2-346C-F2: CTACGACGGCGTGCGGCGGTGCGCCGGGGACGTGCTCTCGG
2-346C-R2: CCGCCGCACGCCGTCGTAG
P336D/N338S/R346H 2-346H-F2: ACTACGACGGCGTGCGGCGGCACGCCGGGGACGTGCTCTCGG
2-346C-R2: CCGCCGCACGCCGTCGTAG
P336D/N338S/R346S 2-346S-F2: ACTACGACGGCGTGCGGCGGAGCGCCGGGGACGTGCTCTCGG
2-346C-R2: CCGCCGCACGCCGTCGTAG
P336D/N338Y/R346C 2-346C-F2: CTACGACGGCGTGCGGCGGTGCGCCGGGGACGTGCTCTCGG
2-346C-R2: CCGCCGCACGCCGTCGTAG
P336D/N338Y/R346H 2-346H-F2: ACTACGACGGCGTGCGGCGGCACGCCGGGGACGTGCTCTCGG
2-346C-R2: CCGCCGCACGCCGTCGTAG
P336D/N338Y/R346S 2-346S-F2: ACTACGACGGCGTGCGGCGGAGCGCCGGGGACGTGCTCTCGG
2-346C-R2: CCGCCGCACGCCGTCGTAG
P336D/N338D/G342D/R346C 1-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTAC GACGACG
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/N338D/G342D/R346H 1-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTACGACGACG
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/N338D/G342D/R346S 1-336D-F1: TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTACGACGACG
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/N338S/G342D/R346C 2-336D-F2: TCGAGTTCTTGGCGCCGCCGGATCCCAGCTACTACGACGACG
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/N338S/G342D/R346H 2-336D-F2: TCGAGTTCTTGGCGCCGCCGGATCCCAGCTACTACGACGACG
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/N338S/G342D/R346S 2-336D-F2: TCGAGTTCTTGGCGCCGCCGGATCCCAGCTACTACGACGACG
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/N338Y/G342D/R346C 3-336D-F3: TCGAGTTCTTGGCGCCGCCGGATCCCTACTACTACGACGACG
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/N338Y/G342D/R346H 3-336D-F3: TCGAGTTCTTGGCGCCGCCGGATCCCTACTACTACGACGACG
1-336D-R1: CGGCGGCGCCAAGAACTCG
P336D/N338Y/G342D/R346S 3-336D-F3: TCGAGTTCTTGGCGCCGCCGGATCCCTACTACTACGACGACG
1-336D-R1: CGGCGGCGCCAAGAACTCG

Как показано на фиг. 8, различные комбинации этих близких сайтов мутации клонировали, экспрессировали и сравнивали по цветным реакциям, и было обнаружено, что три комбинации с сайтами мутации N338D/G342D/R346C, N338D/G342D/R346H и N338S/ G342D/R346C, соответственно, имели наиболее высокую устойчивость, и они по-прежнему демонстрировали значительные цветные реакции в присутствии 1000-1500 мкМ продукта метаболизма бипиразона 101, и затем следовали две комбинации с четырьмя близкими сайтами мутации P336D/N338D/G342D/R346C и P336D/N338D/G342D/R346H соответственно.

(2) Было сконструировано шесть комбинаций в соответствии с принципом облегчения редактирования оснований, т.е. H141R/N338D/ N420S, H141R/N338S/N420S, H141R/N338D и H141R/N420S, соответствующие таким же A → G/T → C, и G342D/R346C и G342D/R346H, соответствующие таким же C → T/G → A. Праймеры для получения этих комбинаций и их последовательности приведены в таблице 7.

Таблица 7
Комбинации сайтов мутаций, сконструированные по принципу облегчения редактирования оснований
Комбинации сайтов мутации Праймеры и последовательности (5'→3')
H141R/N338D/N420S 420-AGC-F:GCGGCGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCAAGTC
420-R:GCCCTTCCCAAACCCGCCGC
H141R/N338S/N420S 338-AGC-F:TCTTGGCGCCGCCGCCGCCCAGCTACTACGACGGCGTGCGGCG
338-R:GGGCGGCGGCGGCGCCAAGAAC
H141R/N338D 338-GAC-F:TCTTGGCGCCGCCGCCGCCCGACTACTACGACGGCGTGCGGCG
338-R:GGGCGGCGGCGGCGCCAAGAAC
H141R/N420S 420-AGC-F:GCGGCGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCAAGTC
420-R:GCCCTTCCCAAACCCGCCGC
G342D/R346C 346-F-2:CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG
346-R-2:CCGCCGCACGTCGTCGTAG
G342D/R346H 346-F-3:CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG
346-R-2:CCGCCGCACGTCGTCGTAG

После детектирования было установлено, что цветная реакция шести вышеуказанных комбинаций также была выраженной, и цветную реакцию можно было различить в культуральном растворе E. coli, содержащем гербицид 101 в концентрации 600-1000 мкМ.

(3) Другие комбинации приведены в таблице 8.

Таблица 8
Комбинации двух, трех, четырех или более сайтов мутации
Комбинации сайтов мутации Праймеры и последовательности (5'→3')
H141R/N338D 338-GAC-F:TCTTGGCGCCGCCGCCGCCCGACTACTACGACGGCGTGCGGCG
338-R:GGGCGGCGGCGGCGCCAAGAAC
H141R/G342D 342-GAC-F:CGCCGCCCAACTACTACGACGACGTGCGGCGGCGCGCCGGGGAC
342-R:GTCGTAGTAGTTGGGCGGCG
N338D/G342D 338-GAC-342-GAC-F:TCTTGGCGCCGCCGCCGCCCGACTACTACGACGACGTGCGGCG
338-R:GGGCGGCGGCGGCGCCAAGAAC
K418P/G419F 418-CCG-419-TTC-F:CGGCTGCGGCGGGTTTGGGCCGTTCAACTTCTCGGAGCTGTTCAAG
418-R:CCCAAACCCGCCGCAGCCGC
G419F/N420S 419-TTC-420-TCG-F:GCGGCGGGTTTGGGAAGTTCTCGTTCTCGGAGCTGTTCAAG
419-TTC-420-TCG-R:GAACTTCCCAAACCCGCCGC
G342D/R346C 346-F-2:CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG
346-R-2:CCGCCGCACGTCGTCGTAG
G342D/R346H 346-F-3:CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG
346-R-2:CCGCCGCACGTCGTCGTAG
H141R/N420S 420-AGC-F:GCGGCGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCAAGTC
420-R:GCCCTTCCCAAACCCGCCGC
G338D/K418P 418-CCG-F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGCTGTTC
418-R:CCCAAACCCGCCGCAGCCGC
P277N/N338D 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG
277-R:CAGCAGCACGGTCTCCGCGTTGTTG
L276W/P277N 276-TGG-F:CAACGCGGAGACCGTGCTGTGGCCGCTCAACGAGCCGGTGC
276-R:CAGCACGGTCTCCGCGTTGTTGGCG
H141R/N338D/G342D 338-GAC-342-GAC-F:TCTTGGCGCCGCCGCCGCCCGACTACTACGACGACGTGCGGCG
338-R:GGGCGGCGGCGGCGCCAAGAAC
H141R/G342D/K418P 418-CCG-F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGCTGTTC
418-R:CCCAAACCCGCCGCAGCCGC
H141R/G342D/G419F 419-TTC-F:GCTGCGGCGGGTTTGGGAAGTTCAACTTCTCGGAGCTGTTCAAG
419-R:CTTCCCAAACCCGCCGCAGC
H141R/G342D/P386T 338-AAC-F:TCTTGGCGCCGCCGCCGCCCAACTACTACGACGGCGTGCGGCG
338-R:GGGCGGCGGCGGCGCCAAGAAC
K418P/G419F/N420T 418-419-420-ACT-F:GCGGCGGGTTTGGGCCGTTCACTTTCTCGGAGCTGTTCAAGTC
418-419-420-R:GAACGGCCCAAACCCGCCGC
K418T/G419F/N420T 418-419-420-ACT-F:GCGGCGGGTTTGGGCCGTTCACTTTCTCGGAGCTGTTCAAGTC
418-419-420-R:GAACGGCCCAAACCCGCCGC
H141R/G342D/R346C 346-F-2:CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG
346-R-2:CCGCCGCACGTCGTCGTAG
H141R/G342D/R346H 346-F-3:CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG
346-R-2:CCGCCGCACGTCGTCGTAG
H141R/G342D/N420S 420-AGC-F:GCGGCGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCAAGTC
420-R:GCCCTTCCCAAACCCGCCGC
H141R/G342D/P277N 277-AAT-FGCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG
277-R:CAGCAGCACGGTCTCCGCGTTGTTG
H141R/G342D/P336D 336-GAC-F:GAGTTCTTGGCGCCGCCGGATCCCAACTACTACGACGACG
336-R:CGGCGGCGCCAAGAACTCGAAGCCGC
H141R/G342D/L276W 276-TGG-F:CAACGCGGAGACCGTGCTGTGGCCGCTCAACGAGCCGGTGC
276-R:CAGCACGGTCTCCGCGTTGTTGGCG
H141R/G342D/R346S 346-AGC-F:CTACGACGACGTGCGGCGGAGTGCCGGGGACGTGCTCTC
346-R:CCGCCGCACGTCGTCGTAGTAG
H141R/G342D/L390I 390-ATT-F:GAGACAGGCCAACCTTTTTCATTGAGATGATACAAAGGATTGG
390-R:GAAAAAGGTTGGCCTGTCTC
H141R/G342D/I377C 377-TGT-F:ACCAGGGGGTGTTGCTCCAGTGTTTCACCAAGCCAGTAGGAGAC
377-R:CTGGAGCAACACCCCCTGGTC
H141R/G342D/M392L 392-CTG-F:GGCCAACCTTTTTCTTGGAGCTGATACAAAGGATTGGGTGCATG
392-R:CTCCAAGAAAAAGGTTGGCC
H141R/P337A/G342D 337-GCC-F:AGTTCTTGGCGCCGCCGCCGGCCAACTACTACGACGACGTGCG
337-R:CGGCGGCGGCGCCAAGAACTC
H141R/N338S/G342D 338-AGC-F:TCTTGGCGCCGCCGCCGCCCAGCTACTACGACGGCGTGCGGCG
338-R:GGGCGGCGGCGGCGCCAAGAAC
H141R/N338Y/G342D 338-TAC-F:CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGTGCG
338-R:GGGCGGCGGCGGCGCCAAGAACTCG
P277N/N338D/G342D 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG
277-R:CAGCAGCACGGTCTCCGCGTTGTTG
P277N/G342D/R346C 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG
277-R:CAGCAGCACGGTCTCCGCGTTGTTG
P277N/N338D/N420S 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG
277-R:CAGCAGCACGGTCTCCGCGTTGTTG
N338D/G342D/K418P 418-CCG-F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGCTGTTC
418-R:CCCAAACCCGCCGCAGCCGC
H141R/N338D/G342D/K418P 418-CCG-F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGCTGTTC
418-R:CCCAAACCCGCCGCAGCCGC
H141R/N338D/G342D/G419F 419-TTC-F:GCTGCGGCGGGTTTGGGAAGTTCAACTTCTCGGAGCTGTTCAAG
419-R:CTTCCCAAACCCGCCGCAGC
H141R/N338D/G342D/P386T 370-GAC-F:GGGTGCTCGTGGACAGGGATGACCAGGGGGTGTTGCTCCAGATC
370-R:ATCCCTGTCCACGAGCACCC
H141R/N338D/G342D/R346C 346-F-2:CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG
346-R-2:CCGCCGCACGTCGTCGTAG
H141R/N338D/G342D/R346H 346-F-3:CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG
346-R-2:CCGCCGCACGTCGTCGTAG
H141R/G342D/K418P/G419F 418-CCG-419-TTC-F:CGGCTGCGGCGGGTTTGGGCCGTTCAACTTCTCGGAGCTGTTCAAG
418-R:CCCAAACCCGCCGCAGCCGC
H141R/G342D/L276W/P277N 276-TGG-277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG
276-277-R:CCACAGCACGGTCTCCGCGTTGTTGGC
H141R/N338D/G342D/K418P/G419F 418-CCG-419-TTC-F:CGGCTGCGGCGGGTTTGGGCCGTTCAACTTCTCGGAGCTGTTCAAG
418-R:CCCAAACCCGCCGCAGCCGC
H141R/N338D/G342D/G419F/N420S 419-TTC-420-TCG-F:GCGGCGGGTTTGGGAAGTTCTCGTTCTCGGAGCTGTTCAAG
419-TTC-420-TCG-R:GAACTTCCCAAACCCGCCGC
H141R/N338D/G342D/K418P/G419F/N420S 418-419-420-TCG-F:GCGGCGGGTTTGGGCCGTTCTCGTTCTCGGAGCT GTTCAAGTC
418-419-420-R:GAACGGCCCAAACCCGCCGC
H141R/N338D/G342D/K418P/G419F/N420T 418-419-420-ACT-F:GCGGCGGGTTTGGGCCGTTCACTTTCTCGGAGCTGTTC AAGTC
418-419-420-R:GAACGGCCCAAACCCGCCGC
H141R/N338D/G342D/R346C/K418P/G419F/N420S 346-F-2:CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG
346-R-2:CCGCCGCACGTCGTCGTAG
H141R/N338D/G342D/R346H/K418P/G419F/N420S 346-F-3:CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG
346-R-2:CCGCCGCACGTCGTCGTAG
P277N/P336D/N338D/G342D 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG
277-R:CAGCAGCACGGTCTCCGCGTTGTTG
P277N/N338D/G342D/R346C 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG
277-R:CAGCAGCACGGTCTCCGCGTTGTTG
P277N/N338D/K418P/G419F 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG
277-R:CAGCAGCACGGTCTCCGCGTTGTTG
H141R/P277N/N338D/G342D/K418P/G419F/N420S 277-AAT-F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG
277-R:CAGCAGCACGGTCTCCGCGTTGTTG
H141R/P277N/P336D/N338D/G342D/K418P/G419F/N420S 1-336D-F1:TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTACGACGACG
1-336D-R1:CGGCGGCGCCAAGAACTCG
H141R/G336D/G342D/K418P/G419F/N420S 336-GAC-F:GAGTTCTTGGCGCCGCCGGATCCCAACTACTACGACGACG
336-R:CGGCGGCGCCAAGAACTCGAAGCCGC

После детектирования было обнаружено, что видимая невооруженным глазом цветная реакция для всех вышеуказанных комбинаций двух сайтов мутации была слабой при 100 мкМ соединения 101; в комбинациях из трех, четырех или более сайтов цветная реакция H141R/G342D/N338D/R346C, H141R/G342D/N338D/ R346H, H141R/G342D/N338D/K418P, H141R/G342D/N338D14/G419F и H342D/N338D/G419F/N420S была сильной, и окрашивание имело место даже при концентрации соединения 101 1000-2000 мкМ (как показано на фиг. 9).

Суммируя вышеизложенное, односайтовые мутации обеспечивали устойчивость при 10-20 мкМ; комбинации из двух сайтов мутации обеспечивали устойчивость примерно при 20-120 мкМ, и устойчивость была выше, чем у односайтовых мутаций, и цвет был более светлым при 100 мкМ; комбинации трех сайтов мутации, т.е. H141R/N338D/G342D, H141R/G342D/K418P, H141R/G342D/G419F, 338D/342D/346C/H, H141R/G342D/N420S, H141R/N338D/N4 показали хорошую устойчивость, и все еще оставалось светлое окрашивание до 1000 мкМ; комбинации четырех или более сайтов мутаций, т.е. H141R/N338D/G342D/K418P, H141R/G342D/K418P/G419F, H141R/N338D/G342D/R346C, H141R/N338D/G342D/R346H, H14D/K141R/G346H, H141R/G419F, H141R/ N338D/G342D/G419F/N420S, H141R/N338D/G342D/K418P/G419F/N420S и подобные показали более высокую устойчивость, и окрашивание все еще было значительным при концентрации соединения 101 до 2500 мкМ.

Пример 6. Экспрессия, выделение и очистка белка OsHPPD

Белок OsHPPD риса и гомогентизат-1,2-диоксигеназу риса (HGD) получали гетерологичной экспрессией в E.coli, где ген вставляли в экспрессионный вектор pET-15b и экспрессировали в экспрессионном штамме BL21 (DE3), и очищали с использованием смолы Ni-NTA.

(1) Открытую рамку считывания HPPD (ORF) положительного клона клонировали в вектор pET-15b с получением экспрессионного вектора 6His-HPPD и трансформировали в клетки BL21 (DE3). Экспрессионный штамм инокулировали в 10 мл культуральной среды 2×YT и культивировали в течение ночи на шейкере при 37°C и 200 об/мин. 10 мл культуры инокулировали в 1 л культуральной среды 2×YT и культивировали до достижения OD600 0,6-0,8, охлаждали до температуры 16°C и подвергали индуцированной экспрессии с использованием 0,2 мМ IPTG (изопропилтиогалактозида) в течение ночи. Штаммы собирали центрифугированием при 2800×g.

(2) Собранные штаммы ресуспендировали в буфере A (50 мМ Трис, pH 8,0, 500 мМ NaCl, 20 мМ имидазола), добавляли PMSF (фенилметансульфонилфторид) в конечной концентрации 1 мМ и 250 мкл смеси ингибиторов протеаз (т.е. смесь нескольких ингибиторов протеаз) и перемешивали. Клетки разрушали ультразвуком на ледяной бане (общая мощность 40%, работа в течение 3 с/6 с интервал, 2×30 мин (Ningbo Scientz Biotechnology Co., Ltd., Ningbo, Китай)) и центрифугировали при 12000 об/мин при 4°C в течение 30 мин; и супернатант фильтровали через 0,22 мкм мембранный фильтр.

(3) Очистка с использованием колонки Ni-NTA: супернатант подвергали контакту со смолой Ni-NTA, затем промывали буфером A, содержащим 50 мМ имидазола, для удаления примесей, и, наконец, элюировали буфером для элюирования, содержащим 400 мМ имидазола.

(4) Примерную чистоту представляющего интерес белка анализировали с помощью SDS-PAGE. Элюаты, содержащие белок, представляющий интерес, объединяли и концентрировали с помощью устройства для ультрафильтрации (отсечение по молекулярной массе 10 кДа, Amicon Ultra). Раствор заменяли раствором, содержащим 20 мМ трис-HCl и имеющим pH 7,5, по меньшей мере, 3 раза для обессоливания. Концентрацию общего белка определяли методом BCA. Все экспрессированные и очищенные HPPD риса дикого типа и различные ее мутанты приведены в таблице 9.

Таблица 9
HPPD риса дикого типа (WT) и различные комбинации сайтов мутации
Мутант
1 WT
2 H141R/G342D/G419F
3 H141R/N338D/G342D
4 H141R/G342D/K418P
5 H141R/N338D/G342D/P386T
6 N338D/G342D/R346C
7 N338D/G342D/R346H
8 H141R/N338D/G342D/R346C
9 H141R/N338D/G342D/R346H
10 H141R/N338D/G342D/K418P
11 H141R/N338D/G342D/K418P/G419F/N420S
12 H141R/G342D/P277N
13 N338D/G342D
14 G342D/R346C
15 H141R/N338D/N420S

(5) Диализ или пропускание через колонку для обессоливания: буфер заменяли на стоковый раствор из 50 мМ Трис, pH 8,0 и 500 мМ NaCl. Концентрацию определяли методом BCA. После упаковки и быстрой заморозки жидким азотом элюат хранили в холодильнике при -80°C.

Пример 7. Оценка влияния соединений на различные ферментативные параметры белков OsHPPD

1. Активность фермента HPPD определяли детектированием превращения 4-гидроксифенилпирувата (4-HPP) в гомогентизиновую кислоту (HGA), которое катализируется ферментом HPPD, и превращением HGA в малеилацетоацетат (MAA), катализируемого гомогентизатдиоксигеназой. Малеилацетоацетат имеет максимум поглощения при 318 нм и константу поглощения 14,7 OD М-1 см-1.

2. 6 мкл 4-гидроксифенилпирувата (4-HPP), имеющего концентрацию, которая в 50 раз превышала конечную концентрацию субстрата, вносили в планшет для постановки ELSA, и затем одномоментно добавляли 294 мкл гидроксиэтилпиперазинэтансульфоновой кислоты (HEPES) с конечной концентрации 25 мМ и pH 7, 2 мМ витамина С, 10 мМ FeSO4, 50 нМ гомогентизатдиоксигеназы и от 5 до 240 нМ фермента HPPD. Конечная концентрация реакционного субстрата 4-HPP обычно составляла от 1 до 100 мкМ.

3. Изменения оптической плотности реакционных лунок при 318 нм непрерывно отслеживали УФ-детектором для ELISA (полноволновый ридер для микропланшетов с фотопоглощением ReadMax 1900) (Шанхай).

4. Определение Km, Kcat и Kcat/Km OsHPDs.

Vmax представляет собой максимальную скорость каталитической реакции, которая достигается при ферментативном катализе. Константа Михаэлиса Km является концентрацией субстрата, необходимой для достижения ферментом, который катализирует реакцию, половины от максимальной скорости (Vmax). Значение Km является постоянным и не зависит от концентрации фермента и изменяется в зависимости от типа субстрата, температуры реакции, pH и ионной силы. Kcat представляет собой каталитическую константу фермента и относится к количеству молекул субстрата, которые могут катализироваться молекулой фермента или активным центром фермента в секунду. Отношение Kcat/Km представляет собой каталитическую эффективность фермента. Определяли ферментативные параметры HPPD (WT) риса дикого типа и различных мутантов, приведенные в таблице 10. Из данных таблицы следует, что каталитическая эффективность большинства мутантов HPPD была выше.

Таблица 10
Определение максимальной скорости реакции Vmax и константы Михаэлиса Km
OsHPPD Kcat Km Kcat/Km
WT 914 6,7 136
H141R/G342D/D370N 1596 10,9 146
H141R/G342D/G419F 3211 7,9 406
H141R/N338D/G342D 2730 6,3 433
H141R/G342D/K418P 2999 30,6 98
H141R/N338D/G342D/P386T 3018 9,7 311
N338D/G342D/R346C 980 9,5 103
N338D/G342D/R346H 941 6,3 149
H141R/N338D/G342D/R346C 1739 7,4 235
H141R/N338D/G342D/R346H 2151 7,6 283
H141R/N338D/G342D/K418P 2001 18,8 106
H141R/N338D/G342D/K418P/G419F/N420S 935 23 41
H141R/G342D/P277N 186 1,1 169
N338D/G342D 206 2,1 98
G342D/R346C 220 5,9 37
H141R/N338D/N420S 823 5,1 161

5. Определение ингибирующей активности (IC50) гербицида 101 и ципирафлуона для белков OsHPPD

Определяли ингибирующую активность продукта метаболизма бипиразона и ципирафлуона для белков риса дикого типа (WT) и различных мутантных белков OsHPPD, как показано на фиг.10 и в таблице 11, из которых можно видеть, что значения IC50 соединения 101 и гербицида ципирафлуона для различных мутантов очевидно были выше по сравнению с таковыми для дикого типа. Например, значение IC50 гербицидного соединения 101 для мутанта H141R/N338D/G342D/K418P/G419F/N420S было в 13,7 раза выше по сравнению с таковым для дикого типа, в то время как значение IC50 ципирафлуона для мутанта было в 1,8 раза выше. Увеличение значения IC50 указывает на то, что толерантность этих мутантов к гербицидам HPPD повысилась. За счет уникальных свойств каждого из соединения 101 и ципирафлуона степень повышения значения IC50 не полностью совпадает для двух HPPD-гербицидов.

Таблица 11
Значения IC50 ингибиторов HPPD соединения 101 и ципирафлуона для белка дикого типа и различных мутантных OsHPPD
OsHPPD IC50
Соединение 101 (мкМ) Кратное увеличение Ципирафлуон Кратное увеличение
Дикий тип 7,6 1,0 1,1 1,0
H141R/G342D/D370N 41 5,4 8,7 7,9
H141R/G342D/G419F 43 5,7 4,1 3,7
H141R/N338D/G342D 24 3,2 4,9 4,5
H141R/G342D/K418P 72 9,5 13 11,8
H141R/N338D/G342D/P386T 51 6,7 14 12,7
N338D/G342D/R346C 50 6,6 5,9 5,4
N338D/G342D/R346H 85 11,2 8,7 7,9
H141R/N338D/G342D/R346C 57 7,5 4,8 4,4
H141R/N338D/G342D/R346H 72 9,5 6,8 6,2
H141R/N338D/G342D/K418P 93 12,2 6,0 5,5
H141R/N338D/G342D/K418P/G419F/N420S 104 13,7 2,0 1,8
H141R/G342D/P277N 93 12,2 27,0 24,5
N338D/G342D 122 16,1 15,0 13,6
G342D/R346C 44 5,8 3,1 2,8
H141R/N338D/N420S 18 2,4 1,0 0,9

6. Определение ферментативной приспособленности белков OsHPPD к ингибиторам

Приспособленность фермента является показателем способности фермента адаптироваться к ингибитору, и чем выше это значение, тем сильнее устойчивость фермента к ингибитору. Поскольку концентрация субстрата во время реакции была намного выше, чем значение Km, а условия реакции для различных мутантов OsHPPD были одинаковыми, то значение Kcat может быть заменено на Vmax, достигаемую катализом при одинаковой концентрации фермента (500 нМ). Приспособленность ферментов = Kcat × Km-1 × Ki, Ki=IC50/(1+S/Km) (константа ингибирования). Определяли константы ингибирования гербицидного соединения 101 и ципирафлуона для HPPD WT риса и различных мутантов и соответствующую ферментативную приспособленнось к ним для дальнейшей оценки толерантности этих мутантов к гербицидам. Результаты, приведенные в таблице 12, показывают, что ферментативная приспособленность всех мутантов имеет разные уровни усиления по сравнению с диким типом, подтверждая их повышенную толерантность.

Таблица 12
Определение ферментативной приспособленности OsHPPD к различным соединениям
OsHPPD Kcat Km Kcat/Km Ki Приспособленность фермента
соединение 101 ципирафлуон соединение 101 ципирафлуон
WT 914 6,7 136 0,25 0,036 34 4,9
H141R/G342D/D370N 1596 10,9 146 2,12 0,450 310 66
H141R/G342D/G419F 3211 7,9 406 1,63 0,156 664 63
H141R/N338D/G342D 2730 6,3 433 0,73 0,150 318 65
H141R/G342D/K418P 2999 30,6 98 9,55 1,725 936 169
H141R/N338D/G342D/P386T 3018 9,7 311 2,36 0,648 734 201
N338D/G342D/R346C 980 9,5 103 2,27 0,268 234 28
N338D/G342D/R346H 941 6,3 149 2,60 0,266 388 40
H141R/N338D/G342D/R346C 1739 7,4 235 2,03 0,171 478 40
H141R/N338D/G342D/R346H 2151 7,6 283 2,64 0,249 746 70
H141R/N338D/G342D/K418P 2001 18,8 106 7,99 0,516 851 55
H141R/N338D/G342D/K418PG419F/N420S 935 23 41 10,73 0,206 436 8,4
H141R/G342D/P277N 186 1,1 169 0,25 0,036 86,0 25,0
N338D/G342D 206 2,1 98 0,51 0,148 124,4 15,3
G342D/R346C 220 5,9 37 1,27 0,156 47,0 3,3
H141R/N338D/N420S 823 5,1 161 1,26 0,089 72,2 4,0

Суммируя вышеизложенное, результаты серии ферментативных тестов подтвердили, что толерантность мутантов OsHPPD риса к гербицидам была выше по сравнению с диким типом (WT). Среди них четырехсайтовый мутант H141R/N338D/G342D/K418P, который показал самую высокую устойчивость по данным оценки цветной реакции, также показал более высокую устойчивость в экспериментах по активности ферментов in vitro. Кроме того, полученные результаты показали, что мутанты, имеющие мутацию K418P, проявляли значительно более высокую устойчивость, но пониженную аффинность к субстрату (Km). Мутант H141R/G342D/P277N и мутант H141R/N338D/G342D/K418P имели сопоставимую устойчивость, и их аффинность к субстрату (Km) не снижалась. Кроме того, трехсайтовый мутант H141R/N338D/G342D и четырехсайтовый мутант H141R/N338D/G342D/P386T также имели относительно высокую устойчивость, и значение их Km не уменьшалось. Самый короткий тройной мутант N338D/G342D/R346H также обладал хорошей устойчивостью и легко редактировался.

N338D/G342D/R346H (самый короткий, подходит для гомологичного замещения HDR), H141R/N338D/G342D (более короткий, также подходит для гомологичного замещения) и H141R/N338D/N420S (подходит для редактирования оснований, более высокая устойчивость) были выбраны в качстве предпочтительных для проведения дальнейших тестов. После трансгеноза и редактирования генов, растения оценивали в отношении изменения толерантности.

Пример 8. Сверхэкспрессия трехсайтового мутанта OsHPPD3M в трансгенном рисе

1. Конструирование вектора сверхэкспрессии

1) Праймеры: праймеры конструировали в соответствии с выбранными сайтами рестрикции и нуклеотидной последовательностью самого гена для амплификации трехсайтовой мутантной HPPD (H141R/G342D/D370N) (OsHPPD3M). Сконструированные праймеры были синтезированы компанией Beijing Qingke Biotechnology Co., Ltd.: HPPD-F, GATAGCCGGTACGGGTTCGAGCCACC ATGCCTCCCACT CCCACCC, HPPD-R, CATCTTTGTAATCGGGGTACCTAGGATCCTTGAACTGTAGG GGC.

2) ПЦР-амплификация: представляющий интерес ген амплифицировали с использованием синтезированного праймера и ДНК-полимеразы Q5 (NEB, New England Biolabs, Boston, США). Амплифицированный продукт анализировали электрофорезом в агарозном геле, и продукт выделяли в соответствии с инструкциями по применению, прилагаемыми к набору для очистки TIANquick Midi Purification. После завершения выделения концентрацию экстрагированной ДНК определяли на приборе Nanodrop.

3) Конструирование вектора сверхэкспрессии риса: вектор сверхэкспрессии риса pCAMBIA1301-OsHPPD3M конструировали с выделенными фрагментами HPPD и плазмидой pCAMBIA1301, расщепленной KpnI и HindIII, с использованием набора для бесшовного клонирования HB-in fusion™ производства HanBio Biotechnology Co., Ltd. (Шанхай), и затем трансформировали в компетентные клетки E. coli DH5α для получения положительного клона; положительный клон трансформировали в Agrobacterium после секвенирования и расщепления эндонуклеазой рестрикции.

2. Каллусы риса, инфицированные трансформированной Agrobacterium, и возникновение трансгенного объекта

1) Вектор сверхэкспрессии риса pCAMBIA1301-OsHPPD3M и пустой вектор pCAMBIA1301, который экспрессировал только mCherry (маркерный ген флуоресцентного белка), добавляли по 1 мкг каждого к компетентной Agrobacterium EH105, соответственно помещали на лед на 5 мин, быстро замораживали погружением в жидкий азот на 5 мин, выдерживали при 37°C в течение 5 мин и, наконец, помещали на лед на 5 мин; добавляли 500 мкл культурального раствора YEB (без антибиотиков) и культивировали на шейкере при 28°C и 200 об/мин в течение 2-3 ч; клетки собирали центрифугированием при 3500 об/мин, и собранные клетки наносили на чашку с YEB (каламицин + рифампицин) и культивировали в течение 2 дней в термостате при 28°C; отдельные клоны отбирали, культивировали в жидкой среде и хранили при -80°C.

2) Культивирование Agrobacterium: трансформированные моноклональные Agrobacterium собирали и культивировали в жидкой среде YEB (карамицин + рифампицин) при 28°C до OD600 0,5, колонии собирали центрифугированием при 3500 об/мин, разбавляли равным количеством AAM (1 мл AAM+1 мкл 1000× мкл AS) жидкой среды, используемой для инфицирования каллуса.

3) Индукция образования каллуса сорта риса Zhonghua 11: перед приготовлением Agrobacterium сначала готовили каллус риса. Семяна риса отшелушивали, промывали стерильной водой до тех пор, пока промывная вода не становилась прозрачной без ограничения во кратности промываний, дезинфицировали 70% спиртом в течение 30 с, и затем 5% гипохлоритом натрия, затем культивировали в горизонтальном шейкере в течение 20 мин, дезинфицировали гипохлоритом натрия и промывали стерильной водой 5 раз, помещали на стерильную впитывающую бумагу для высушивания на воздухе для удаления воды с поверхности семян и инокулировали в индукционную среду для культивирования каллуса при 28°C.

4) Инфицирование каллуса риса Agrobacterium: отбирали каллусы Huaidao №5 диаметром 3 мм и субкультивировали в течение 10 дней, и каллусы собирали в центрифужную пробирку емкостью 50 мл. Бактериальный раствор Agrobacterium с модулированной концентрацией вносили в центрифужную пробирку, содержащую каллусы, и центрифужную пробирку помещали на шейкер при 28°C и 200 об/мин для инфицирования на 20 мин; после завершения инфицирования бактериальный раствор удаляли, каллусы помещали на стерильную фильтровальную бумагу, высушивали на воздухе в течение примерно 20 мин и сокультивировали в планшете для совместного культивирования, в котором стерильная фильтровальная бумага была смочена AAM (1 мл AAM+30 мкл 1000×AS) и жидкую культуру накрывали; через 3 дня после заражения Agrobacterium отмывали и удаляли (т.е. промывали стерильной водой 5 раз, и затем промывали раствором антибиотика цефалоспорина 500 мг/л в течение 20 мин), и каллусы культивировали в среде для скрининга, содержащей 50 мг/л гигромицина.

5) Скрининг, дифференциация и укоренение устойчивых каллусов: сокультивированные каллусы переносили в среду для скрининга для первого раунда скрининга (2 недели); после первого раунда скрининга новые образовавшиеся каллусы переносили в среду для скрининга (содержащую 50 мг/л гигромицина) для второго раунда скрининга (2 недели); после завершения скрининга обесцвеченные каллусы с хорошим состоянием роста отбирали для дифференциации и добавляли 1-5 мкМ темботриона в среду для дифференциации для скрининга устойчивости к гербицидам. Через 3-4 недели получали пророски размером примерно 1 см. Дифференцированные проростки переносили в среду для укоренения культуры; укоренившиеся проростки подвергали акклиматизационной обработке и затем переносили в горшок с почвой для выращивания в теплице; и было получено 55 проростков или растений OsHPPD3M.

3. Предварительное определение устойчивости к гербицидам трансгенных проростков (поколение T0): 1-5 мкМ темботриона добавляли в среду для дифференцировки, и результаты показали, что проростки с пустым контрольным вектором не были толерантны к темботриону, в то время как трансформированные проростки, сверхэкспрессирующие трехсайтовый мутант HPPD (H141R/G342D/D370N), были толерантны к 3 мкМ темботриона, как показано на фиг. 11.

4. Повторное определение устойчивости трансгенных проростков к гербицидам (поколение T0): трансгенные проростки поколения T0 пересаживали в большие пластиковые ведра в теплице для получения семян поколения T1. Два объекта были случайным образом выбраны из сверхэкспрессированных мутантных объектов на стадии объединения, и была обнаружена устойчивость к гербицидам этих двух объектов и нетрансгенного сорта риса Zhonghua 11 на той же стадии роста, что и контроль. В качестве гербицида использовали бипиразон. Норма расхода бипиразона обычно составляет 4 г д.в./му. В этом тесте норма расхода бипиразона составляла 8 и 16 г на му.

Результаты определения устойчивости: на 5 день после опрыскивания (16 г/му) и на 7 день после опрыскивания (8 г/му) нетрансгенные проростки риса начали обесцвечиваться, но сверхэкспрессированные трансгенные мутанты, объект 1, объект 2, объект 3 и объект 4, были зелеными. Спустя 32 дня после опрыскивания нетрансгенные проростки, опрысканные гербицидом, практически погибали, но сверхэкспрессированные трансгенные мутанты, обработанные гербицидом в концентрации 8 г/му или 16 г/му, все еще были зелеными, росли нормально, и началось выбрасывание метелки (как показано на фиг. 12A и 12B).

5. Повторное определение устойчивости трансгенных проростков к гербицидам (поколение Т1):

a) Три объекта, выбранных из сверхэкспрессированных трансгенных мутантных HPPD, объект 20, объект 28 и объект 37 и нетрансгенный рис Huaidao №5 дикого типа (Huaidao №5 имеет более высокую естественную толерантность к ингибитору HPPD бипиразону, чем Zhonghua 11, и кратное повышение устойчивости не может быть рассчитано для Huaidao №5, и фактическая устойчивость должна быть выше).

b) Используемые нормы расхода бипиразона составляли 0, 4, 8, 16, 32 и 64 г/му. За счет низкой температуры и слабой освещенности в теплице зимой признаки фитотоксичности проявлялись медленно. На 14 день после опрыскивания у нетрансгенного риса Huaidao №5, обработанного гербицидом из расчета 32 и 64 г/му, проявились признаки увядания, но у трансгенных объектов признаки отсутствовали, и они оставались зелеными (фиг. 12C и 12D).

В заключение, сверхэкспрессированный трехсайтовый мутант OsHPPD3M (H141R/G342D/D370N) может повышать устойчивость трансгенных сортов риса к гербициду, ингибирующему HPPD, по меньшей мере, в 4 раза. По предварительным наблюдениям за ростом, развитием, цветением и плодоношением поколения T0 и поколения T1, можно было видеть, что большинство растений были нормальными.

Пример 9. Определение числа копий HPPD, сверхэкспрессированных в трансгенном рисе

Ген устойчивости к гигромицину: ген hppd риса (Oshppd) имеет высокое содержание GC, что оказывало влияние на эффективность ПЦР-амплификации. Кроме того, в рисе имеется эндогенная копия hppd. Следовательно, селективный маркерный ген hyg устойчивости к гигромицину, был выбран в качестве экзогенного гена, и ген сахарозофосфатсинтазы (SPS) был выбран в качестве эндогенного референсного гена для оценки числа копий. Ген SPS был специфическим для риса геном и представлял собой единственную копию, которая могла служить в качестве эндогенного референсного гена для риса (Ding Jiayu, Jia Junwei, Yang Li tao et al. Validation of a rice specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes. J. Agric. Food Chem., 2004, 52: 3372-7). Число копий сверхэкспрессированного hppd можно оценить опосредованно определением числа копий селективного маркерного гена устойчивости к гигромицину (hyg) трансгенного риса.

Геномная ДНК: экстрагировали геномную ДНК рисового листа и очищали с использованием набора для экстракции геномной ДНК растений производства Tian'gen Biotech (Beijing) Co., Ltd., и содержание и чистоту ДНК определяли на анализаторе для нуклеиновых кислот Nanodrop. Когда соотношение OD260/OD280 находилось в диапазоне 1,8-2,0 и чистота считалась хорошей, когда соотношение OD260/OD230 составляло примерно 2,0.

Праймеры: были сконструированы две пары праймеров: Hyg-F: 5'-GTACACAAATCGCCCGCAG-3' и Hyg-R: 5'-TCTATTTCTTTGCCCTCGGAC-3', которые использовали для амплификации фрагмента размером 111 п.н. гена устойчивости к гигромицину; Sps-F: 5'-GTACACAAATCGCCCGCAG-3' и Sps-R: 5'-TCTATTTCTTTGCCCTCGGAC-3' использовали для амплификации фрагмента гена сахарозофосфатсинтазы (SPS) размером 170 п.н.

Система количественной реакции ПЦР: реакционный раствор (20 мкл) готовили в соответствии с системой SYBR Premix ExTaq II для количественной ПЦР с флуоресцентным детектированием в режиме реального времени. Процедура ПЦР-амплификации: предварительная денатурация при 95°C/ 30 с, затем 95°C/5 с → 55°C/30 с → 72°C/30 с, 40 циклов.

Построение стандартной кривой: была отобрана последовательность гена SPS или HYG из 400 п.н., которая количественно содержала амплифицированный ПЦР фрагмент, соответственно, и они были лигированы вместе посредством гомологичной рекомбинации, и затем лигировали в вектор pClone007. Сконструированную стандартную плазмиду, содержащую ген HYG и ген SPS, расщепляли эндонуклеазой рестрикции PshaI в линеаризованные ДНК, анализировали детектором для белков и нуклеиновых кислот для определения их концентрации и разбавляли градиентом ddH2O до 106 копий/мкл, 105 копий/мкл, 104 копий/мкл, 103 копий/мкл и 102 копий/мкл. Пять стандартных образцов в различных разведениях и контроль амплифицировали одновременно, и для каждого образца было три опытных повтора. ПЦР-амплификацию проводили, как описано выше. Формула для преобразования концентрации и числа копий была следующей: число копий (копий/мл) = (6,02 × 1023 копий/моль) × (концентрация ДНК г/мл)/(MW/моль). Средняя молекулярная масса (MW г/моль): дцДНК = (число оснований) × (660 дальтон/ п.н.).

Расчет числа копий трансгена: каждый тестированный образец имел значение цикла Ct, когда он достигал порогового значения. Значение Ct подставляли в стандартную кривую с получением количества исходной матрицы в образце, отношение количества исходных матриц интересующего гена к количеству исходных матриц эндогенного гена исходного количества матрицы представляло количество копий интересующего гена. Данные, полученные в результате экспериментов, были экспортированы с помощью программного обеспечения и анализированы Excel.

Количественная оценка ПЦР с флуоресцентным детектированием в режиме реального времени: уровни экспрессии соответствующих генов в трансгенном рисе анализировали с помощью метода qRT-PCR для подтверждения эффективности сверхэкспрессии гена. Ген риса UBQ5 использовали в качестве эндогенного референсного гена. Готовили реакционный раствор для количественной ПЦР с флуоресцентным детектированием в режиме реального времени. Реакционный раствор (20 мкл) готовили согласно системе SYBR Premix ExTaq II. Процедура амплификации qRT-PCR описана ниже: предварительная денатурация при 95°C в течение 30 с; денатурация при 95°С в течение 5 с; отжиг при 60°С в течение 30 с; удлинение при 65°C в течение 5 мин, всего 40 циклов. Данные, полученные в эксперименте, экспортировали с помощью программного обеспечения и анализировали Excel. Относительные уровни экспрессии генов рассчитывали с использованием ΔΔCT. Для всех образцов было три независимых биологических повтора.

В этом тесте было отобрано 54 растения с положительным результатом ПЦР и 4 нетрансгенных растения, которые использовали в качестве контроля, и геномную ДНК экстрагировали с использованием набора для экстракции геномной ДНК растений. Каждый образец имел три повтора при количественной ПЦР для получения кривой амплификации, где порог флуоресценции был установлен таким же образом, как и для построения стандартной кривой для гена. Получали значение Ct образца, подлежащего тестированию, и число исходных матриц гена HYG в образце было рассчитано по уравнению: HYG0=10(-0,260CT+10,442), и число исходных матриц гена Sps в образце рассчитывали по формуле: SPS0=10(-0,260CT+10,172). Поскольку эндогенный референсный ген риса Sps был гомозиготным диплоидом, и вероятность того, что экзогенный ген трансгенного растения был гомозиготным, была очень мала, то число копий интересующего гена в геноме риса было равно значению, полученному умножением данных, полученных делением количества исходных матриц HYG на количество исходных матриц SPS на 2. Число исходных матриц интересующего гена Hyg сравнивали с числом исходных матриц эндогенного референсного гена Sps риса и результаты, приведенные в таблице 13, показывают, что среди 54 трансгенных растений 36 растений имели число копий 1, 13 растений имели число копий 2, 4 растения имели число копий 3, и 1 растение имело число копий 4, в то время как количество копий отрицательного контроля было равным 0.

Таблица 13
Определение числа копий интересующего гена в трансгенных растениях
Линия SPS0 HYG0 2×HYG0/SPS0 Число копий представляющего интерес гена
Zhonghua 11 314808,9 13585,07 0,086 0
WT-4 794343,5 5099,921 0,013 0
WT-7 82126,33 4772,3 0,116 0
WT-8 107315 3540,487 0,066 0
2-1 86158,95 70975,65 1,648 2
2-2 116048,5 97043,28 1,672 2
2-3 98298,14 52089,59 1,060 1
2-4 95761,67 48540,84 1,014 1
2-5 99197,34 49539,5 0,999 1
2-6 114053,7 180145,4 3,159 3
2-8 126539 105285,7 1,664 2
2-9 98094,43 98837,9 2,015 2
2-10 87087,68 116834,4 2,683 3
2-11 92351,87 144727,1 3,134 3
2-12 78140,72 83886,76 2,147 2
2-13 158780,3 113069,3 1,424 1
2-14 192380,3 58948,64 0,613 1
2-15 238932 74397,84 0,623 1
2-16 161045,9 85497,1 1,062 1
2-17 35298,61 17620,82 0,998 1
2-18 213886,9 61843,61 0,578 1
2-19 176775,1 57200,14 0,647 1
2-20 621936,9 368999,1 1,187 1
2-21 594530,9 305098,9 1,026 1
2-22 224816,7 117195,8 1,043 1
2-23 77450,64 40664,82 1,050 1
2-24 269156,5 150371,3 1,117 1
2-25 208228,7 75186,45 0,722 1
2-26 169627 60077,38 0,708 1
2-27 56297,91 34315,9 1,219 1
2-28 653765,2 400797,1 1,226 1
2-29 80636,42 39719,64 0,985 1
2-30 82451,61 36849,85 0,894 1
2-31 201228,8 71250,85 0,708 1
2-32 101126,2 45752,07 0,905 1
2-33 278596 162471,6 1,166 1
2-34 114698 91280,03 1,592 2
2-35 116576,8 52873,89 0,907 1
2-36 82680,12 37455,65 0,906 1
2-37 568452,8 344492,4 1,212 1
2-38 69154,81 85884,22 2,484 2
2-39 105306,9 87417,86 1,660 2
2-40 239703,1 371019,4 3,096 3
2-41 278420,5 545540,6 3,919 4
2-42 238414,5 124542,9 1,045 1
2-43 228641,5 127467,9 1,115 1
2-44 231265,5 119998,8 1,038 1
2-45 274609,7 136861,8 0,997 1
2-46 188432,1 99115,91 1,052 1
2-47 240136,8 197426,1 1,644 2
2-48 221332,8 230365,3 2,082 2
2-49 236717,4 131366 1,110 1
2-50 167319,1 77703,63 0,929 1
2-51 170851,6 197936,8 2,317 2
2-52 149266,1 132152,6 1,771 2
2-53 139016 135037 1,943 2
2-54 183699,9 77684,4 0,846 1
2-55 182604,6 98325,76 1,077 1

Примечание: HYG0 и SPS0 представляли собой число исходных матриц гена Hyg и Sps в реакции ПЦР, соответственно.

Пример 10. Сорта риса, толерантные к гербицидам, ингибирующим HPPD, полученные посредством редактирования генов

Ген HPPD риса мутировали и подвергали скринингу, получали три сайта мутации 141, 342 и 370 и их комбинации, и тестировали толерантность к гербицидам, ингибирующим HPPD, в условиях in vitro. На основе этого комбинированный мутант OsHPPD3M (H141R/G342D/D370N) сверхэкспрессировали в трансгенном рисе для подтверждения того, что мутант был высокотолерантным к гербицидам, ингибирующим HPPD. Затем ген HPPD подвергали геномному редактированию с целью получения нетрансгенных сортов риса, толерантных к гербицидам, ингибирующим HPPD, полученных редактированием генов. Прежде всего, три сайта, соответствующие аминокислотному положению 141, 342 или 370, были подвергнуты редактированию оснований соответственно, и три сайта, соответствующие аминокислотным положениям 141, 342 и 370, подвергали гомологичному замещению. Процесс редактирования гена и результаты были следующими.

(1) Редактирование оснований представляет метод редактирования генов, в котором используется система CRISPR/Cas9 для нацеливания дезаминазы на определенный сайт в геноме для модификации определенного основания. Этот метод был успешно применен на рисе. Например: Yan F., Kuang Y., Ren B., Wang J., Zhang D., Lin H., Yang B., Zhou X. and Zhou H. (2018). High-efficient A·T to G·C base editing by Cas9n-guided tRNA adenosine deaminase in rice. Mol. Plant, doi: 10.1016/j.molp.2018.02.008.

В данном примере редактировали сайт гена HPPD риса, расположенный в локусе Os02g0168100 второй хромосомы, соответствующий аминокислотному положению 141, 342 или 370, соответственно. Аминокислотный остаток гистидина (кодон CAC) в положении 141 HPPD риса был редактирован в аргинин (кодон CGC; исходный A был изменен на G) посредством редактирования основания. Аналогично аминокислотный остаток глицина (кодон GGC) в положении 342 был редактирован на аспарагиновую кислоту (кодон GAC; исходный G был изменен на A); аминокислотный остаток аспарагиновой кислоты (кодон GAC) в положении 370 был редактирован на аспарагин (кодон AAC; исходный G был изменен на A). Мутантный белок xCas9(3.7)-ABE белка Cas9 с более широкой совместимостью с PAM был выбран в качестве инструмента редактирования (Hu J.H. et al. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature, http://dx.doi.org/10.1038/nature26155 (2018)).

Сайт-мишень sgRNA конструировали в соответствии с последовательностью ДНК гена HPPD риса рядом с сайтом, соответствующим положению аминокислоты 141: GGTGCaCGCCGTGGCGCTGC-GCG, где a представляет сайт действия ABE для реализации редактирования G из A. PAM этой sgRNA представлял GCG, который соответствовал требованиям xCas9 (3.7).

Аналогично конструировали сайт-мишень sgRNA в соответствии с последовательностью ДНК гена HPPD риса рядом с сайтом, соответствующим положению аминокислоты 342: GCACGcCGTCGTAGTAGTTG GGC, где c представляет сайт действия CBE для реализации редактирования T из C. PAM этой sgRNA представлял собой GGC, который соответствовал требованиям xCas9 (3.7).

Последовательность ДНК гена HPPD риса рядом с сайтом, соответствующим положению аминокислоты 370, анализировали для конструирования сайта-мишени sgRNA: CCTGGTcATCCCTGTCCACG AGC, где c представляет сайт действия CBE для реализации редактирования T из C. PAM этой sgRNA был GGC, который соответствовал требованиям xCas9 (3.7).

Соответственно, синтезировали три пары праймеров: 141GE-F: ggcgGTGCaCGCCGTGGCGCTGC и 141GE-R: aaacGCAGCGCCACGGCGtGCAC; 342GE-F: ggcgCACGcCGTCGTAGTAGTTG и 342GE-R: aaacCAACTACTACGACGgCGTG; 370GE-F: ggcgCCTGGTcATCCCTGTCCACG и 370GE-R: aaacCGTGGACAGGGATgACCAGG, затем разбавляли до 10 мкМ ультрачистой водой и смешивали в равных количествах; смесь помещали на баню с кипящей водой и естественным образом охлаждали до комнатной температуры. 1 мкг вектора pQY000140 расщепляли ферментом BsaI при 37°C в течение одного часа; после анализа электрофорезом в агарозном геле выделяли целевой фрагмент, затем определяли концентрацию по поглощению ультрафиолетового света, смешивали с подвергшимся отжигу фрагментом в соотношении 1:10 и лигировали ДНК-лигазой Т4 (NEB, New England Biolabs, Boston, США) при 16°C в течение 2 ч и трансформировали в компетентные клетки Trans5a (TransGen Biotech., Пекин). Трансформированные клетки культивировали при 37°C в течение ночи. Моноклональный компонент секвенировали методом секвенирования по Сэнгеру для подтверждения правильности последовательности редактированного по одному основанию вектора. Сконструированный вектор pQY000141 показан на фиг. 13. Правильно секвенированную E. coli клонировали, плазмиду экстрагировали и трансформировали в EH105 Agrobacterium (Shanghai Weidi Biotechnology Co., Ltd.).

Каллусы Huaidao №5 (не менее 3000 каллусов) инфицировали в соответствии с вышеописанным методом инфицирования Agrobacterium каллусов риса. После инфицирования Agrobacterium инфицированные каллусы переносили в скрининговую среду с hyg в концентрации 50 мг/л для скрининга культуры. После трех раундов (15 дней × 3) скрининга отбирали светлые каллусы с хорошим состоянием роста для дифференциации в среде для дифференцировки, и в процессе дифференцировки добавляли 0,2 мкМ темботриона для скрининга. Через 3-4 недели получали примерно 1500 проростков размером примерно 1 см. В отношении примерно 1500 дифференцированных проростков, то подавляющее большинство из них обесцвечивалось, и только 4 проростка оставались нормально зелеными. 4 проростка пересаживали в среду для укоренения, содержащую 0,4 мкМ темботриона, и культивировали в течение 2 недель, при этом два проростка обесцвечивались, и два других проростка оставались зелеными (фиг. 14A). Небольшое количество листьев использовали для экстракции геномной ДНК методом CTAB. ПЦР проводили с использованием праймеров oshppd54F: TTCCACCACGTCGAGCTC и Oshppd356R: GGTGAACCCGGAGATGTACG. Амплифицированный продукт анализировали электрофорезом в 1% агарозе и секвенировали методом секвенирования по Сэнгеру.

Результаты секвенирования показали, что: оба из двух зеленых проростков (QY000141-1 и QY000141-2) были успешно подвергнуты редактированию (фиг. 14B) в положении аминокислоты 141, в то время как обесцвеченные проростки представляли собой проростки дикого типа.

(2) Гомологичное замещение мутанта HPPD риса, опосредованное CRISPR/cas9, для получения устойчивости к гербицидам

После того, как был получен трехсайтовый мутант H141R/G342D/ D370N, сверхэкспрессированный в трансгенном объекте, комбинацию трех сайтов мутации подвергали гомологичному замещению, чтобы получить нетрансгенный рис с устойчивостью к гербицидам.

Ген hppd риса имеет два экзона и один интрон. Три сайта-мишени H141, G342 и D370 располагаются в первом экзоне.

Конструирование gRNA: по меньшей мере, одну gRNA конструировали апстрим от H141 и даунстрим от D370, соответственно, и расщепляли один раз; и три сайта одновременно заменяли посредством гомологичного замещения. Последовательность экзона 1 помещали в http://crispor.tefor.net/ для оценки всех возможных gRNA. В соответствии с принципами, что конкретная оценочная ценность превышает 90 (Hsu P.D., Scott D.A., Weinstein J.A., Ran F.A., Konermann S., Agarwala V., Li Y., Fine E.J., Wu X., Shalem O., Cradick T.J., Marraffini L.A., Bao G., Zhang F. Nat. Biotechnol., 2013 Sep;31(9):827-32. doi: 10.1038/nbt.2647. Epub 2013 Jul. 21), нецелевой эффект предупреждается, и длина сокращается, насколько это возможно, были выбраны следующие две gRNA: OshppdgRNA-PAM1-2: 5'-GGAACGCGAGCGCCTGGAAC CGG-3' (GC=70%) (нижняя цепь); и OshppdgRNA-PAM2-1 (GC=39%): 5'-CACCTCTTTCATGATGAAAA TGG-3' (верхняя цепь), где подчеркнута последовательность PAM, и выделенный жирным шрифтом G обозначает, что при конструировании заменяемой матричной ДНК, этот G будет изменен на другие основания в матрице замещения для разрушения PAM и предупреждения повторного разрезания после замещения.

Распределение двух gRNA1-2 и gRNA2-1 в геномной ДНК риса было таким, как показано на фиг. 15.

Конструкция донорной ДНК-матрицы показана на фиг. 16: согласно тестам, проведенным лабораторией Zhaoyunde Lab (Sun Y., Zhang X., Wu C., He Y., Ma Y., Hou H., Guo X., Du W., Zhao Y., Xia L. Engineering Herbicide-Resistant Rice Plants through CRISPR/Cas9-Mediated Homologous Recombination of Acetolactate Synthase. Mol. Plant., 2016 Apr. 4; 9(4): 628-31. doi: 10.1016/j.molp.2016.01.001. Epub 2016 Jan. 6) сначала конструировали гомологичное плечо на 350 п.н.; с целью увеличения возможности гомологичного замещения конструировали две версии донорной матрицы для каждого редактирующего вектора; матрицу непосредственно присоединяли к редактирующему вектору, так что gRNA, Cas9 и матрица могли входить в одну и ту же клетку одновременно. После того, как клеточную геномную целевую ДНК расщепляли Cas9 и gRNA, донорная ДНК-матрица могла подвергнуться репарации вовремя. Другой вариант представлял собой свободную донорную ДНК-матрицу, полученную ПЦР-амплификацией. Эти дополнительные матрицы репарации смешивали с редактирующим вектором в соотношении 20:1 (молярное соотношение свободных матриц репарации:редактирующий вектор), и затем подвергли бомбардировке с помощью генной пушки. Длина области замены ядра для трех мутантных аминокислот 141-342-370 определялась двумя выбранными РНК-направляющими сайтами расщепления (т.е. 1056 п.н.), левое и правое плечо гомологии каждое имели длину 350 п.н., 6 п.н. оставалось на каждом из левого и правого концов после отщепления от вектора, и общая длина матрицы составляла 1768 п.н. для облегчения быстрого генотипирования продукта ПЦР после ПЦР-амплификации сайт расщепления, NcoI удаляли; и для предупреждения повторного расщепления после замены, PAM (NGG) на исходном сайте расщепления в матрице также удаляли.

Редактирующий вектор: gRNA1-2 и gRNA2-1 экспрессировались соответственно промотором U3 риса. Две экспрессионные кассеты gRNA лигировали вместе с матрицей и отправляли в GenScript (Nanjing) Co., Ltd. для синтеза. Синтезированный фрагмент ДНК лигировали в вектор pCXUN-Cas9 в KpnI с использованием техники бесшовного клонирования (от Huazhong Agricultural University and Dr. Yu Bing, Mol. Plant, 2016 Apr. 4; 9(4): 628-31. doi: 10.1016/J.molp.2016.01.001. Epub 2016 Jan. 6) для поучения редактирующего вектора.

Трансформация с помощью генной пушки, скрининг, дифференциация, укоренение и культивирование в почве проростков: сконструированный, как описано выше, редактирующий вектор подтверждали секвенированием и мультиферментными расщеплениями, и смешивали со свободной донорной ДНК-матрицей, полученной с помощью ПЦР-амплификации при 20:1 (молярное соотношение свободной репарационной матрицы:редактирующий вектор, молярное соотношение) и каллусы Huaidao №5 трансформировали с помощью генной пушки. Трансформировали примерно 3000 каллусов и переносили в скрининговую среду с hyg в концентрации 50 мг/л для скрининга культуры с целью получения трансгенных растений. После трех раундов скрининга (15 дней × 3) обесцвеченные каллусы с хорошим состоянием роста отбирали для дифференциации в среде для дифференцировки, и в процессе дифференцировки добавляли 0,2 мкМ темботриона для скрининга. Через 3-4 недели получали примерно 1000 проростков размером примерно 1 см. В отношении примерно 1000 дифференцированных проростков, то их подавляющее большинство обесцвечивалось, и только 21 проросток оставался зеленым. 21 проросток пересаживали в среду для укоренения, содержащую 0,4 мкМ темботриона, и непрерывно культивировали так, чтобы способствовать росту корней. Через две недели 19 проростков обесцвечивалось. Оставшиеся 2 зеленых проростка (AW2 и AW3) пересаживали в горшок и выращивали в теплице. Фотографии зеленых саженцев, сделанные перед трансплантацией, показаны на фиг. 17A.

Идентификация генотипа hppd проростков, подвергшихся редактированию: для идентификации генотипа конструировали три пары праймеров ПЦР для амплификации области 342-370 сайтов мутации, области 342-370 плюс часть даунстрим последовательности геномной ДНК и один сайт 141 соответственно. Эти пары праймеров представляли собой: 290-F: AGATACAGACGTACCTGGACCACCA и 1553-R: GCCGGCAAAAAGGAACTGGG (область из 342-370 сайтов мутации); 90-F: AGATACAGACGTACCTGGACCACCA и вне донора-R: AGTGATTGTACCATCATTTGTC (область 342-370 плюс часть даунстрим последовательностей геномной ДНК); и 54-F: TTCCACCACGTCGAGCTC и 356-R: GGTGAACCCGGAGATGTACG (один сайт 141).

Результаты идентификации показали, что: два зеленых проростка были успешно редактированы (фиг. 17B). Полосы, полученные при расщеплении продукта ПЦР ферментом NcoI, имели ожидаемые размеры. Результаты секвенирования также показали, что гистидин His дикого типа замещался на аргинин Arg в положении 141 (этот кодон был изменен из CAC на CGC), глицин Gly дикого типа замещался на аспартат Asp в положении 342 (кодон был изменен из GGC на GAC), и аспарагиновая кислота дикого типа Asp замещалась на аспарагин Asn в положении 370 (этот кодон был изменен из GAC на AAC).

В то же время во многих исследованиях было установлено, что введение гена по настоящему изобретению в модельное растение, такое как Arabidopsis thaliana и Brachypodium distachyon, приводит к повышению соответствующей устойчивости к гербицидам. Также применялось редактирование вышеуказанных сайтов мутации и их комбинаций с помощью системы CRISPR/Cpf1. Следовательно, когда трансгенная технология или метод редактирования генов применяется к вышеуказанным растениям, таким как пищевые культуры, бобовые культуры, масличные культуры, волокнистые культуры, плодовые культуры, корневищные культуры, овощные культуры, цветочные культуры, лекарственные культуры, технические культуры, пастбищные культуры, сахарные культуры, культуры для производства напитков, газонные культуры, древесные культуры, ореховые культуры и т.п., то будут получены соответствующие признаки устойчивости, имеющие большое промышленное значение.

Все публикации и патентные заявки, упомянутые в описании, включены здесь посредством ссылки, так если бы каждая публикация или патентная заявка отдельно или конкретно была включена здесь посредством ссылки.

Хотя вышеизложенное изобретение было подробно описано с помощью иллюстраций и примеров для четкого понимания, очевидно, что некоторые изменения и модификации могут быть реализованы в пределах объема прилагаемой формулы изобретения. Такие изменения и модификации находятся в пределах объема настоящего изобретения.

--->

Список последовательностей

<110> QINGDAO KINGAGROOT CHEMICAL COMPOUNDS CO., LTD.

<120> Мутантная п-гидроксифенилпируватдиоксигеназа, нуклеиновая кислота,

кодирующая ее, и их применение

<130> IEC190057

<160> 260

<170> PatentIn version 3.3

<210> 1

<211> 1341

<212> ДНК

<213> Последовательность ORF гена hppd риса дикого типа (Oshppd_WT)

<400> 1

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 2

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность белка HPPD риса дикого типа

(OsHPPD_WT)

<400> 2

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 3

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_A103S)

<400> 3

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgctc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcacctccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcat tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 4

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_A103S)

<400> 4

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ser Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ser Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 5

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R)

<400> 5

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 6

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_H141R)

<400> 6

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 7

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_A165V)

<400> 7

atgcctccca ctcccacccc caccgccacc accggcgccg cctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca tgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcaccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggttttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 8

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_A165V)

<400> 8

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Ala Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Thr Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Val Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 9

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_V191I)

<400> 9

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac tttctcaagc tcaagtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc atcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 10

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_V191I)

<400> 10

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His Phe Leu Lys Leu Lys Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Ile Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 11

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_R220K)

<400> 11

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccaccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagt tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcacgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgcaag 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 12

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_R220K)

<400> 12

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His His

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Phe Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Thr Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Lys Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 13

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_D370N)

<400> 13

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggataac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 14

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_D370N)

<400> 14

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asn Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 15

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_K410I)

<400> 15

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagatt ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 16

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_K410I)

<400> 16

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Ile Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 17

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141K)

<400> 17

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

aaggccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 18

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_H141K)

<400> 18

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Lys Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 19

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141T)

<400> 19

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

accgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 20

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_H141T)

<400> 20

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Thr Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 21

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_G342D)

<400> 21

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 22

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_G342D)

<400> 22

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 23

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R/D370N)

<400> 23

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggataac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 24

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/D370N)

<400> 24

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asn Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 25

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R/G342D)

<400> 25

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 26

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D)

<400> 26

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 27

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_G342D/D370N)

<400> 27

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggataac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 28

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_G342D/D370N)

<400> 28

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asn Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 29

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R/G342D/D370N)

<400> 29

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggataac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 30

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/D370N)

<400> 30

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asn Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 31

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_R93S)

<400> 31

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctctcct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 32

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_R93S)

<400> 32

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Ser Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 33

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_G226H)

<400> 33

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtccacaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 34

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_G226H)

<400> 34

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val His Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 35

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_L276W)

<400> 35

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgtggcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 36

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_L276W)

<400> 36

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Trp Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 37

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_P277N)

<400> 37

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 38

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_P277N)

<400> 38

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 39

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_P336D)

<400> 39

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 40

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_P336D)

<400> 40

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 41

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_P337A)

<400> 41

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccggc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 42

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_P337A)

<400> 42

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Ala Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 43

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_N338D)

<400> 43

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 44

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса (OsHPPD_N338D)

<400> 44

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 45

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N338S)

<400> 45

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 46

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_N338S)

<400> 46

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Ser Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 47

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N338Y)

<400> 47

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc ctactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 48

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_N338Y)

<400> 48

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Tyr Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 49

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_R346C)

<400> 49

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 50

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_R346C)

<400> 50

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Cys Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 51

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_R346H)

<400> 51

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 52

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_R346H)

<400> 52

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg His Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 53

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_R346S)

<400> 53

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 54

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_R346S)

<400> 54

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Ser Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 55

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_R346D)

<400> 55

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcgggacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 56

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_R346D)

<400> 56

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Asp Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 57

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_R346Y)

<400> 57

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggtacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 58

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_R346Y)

<400> 58

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Tyr Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 59

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_I377C)

<400> 59

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagtg cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 60

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_I377C)

<400> 60

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Cys Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 61

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_P386T)

<400> 61

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggacaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 62

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_P386T)

<400> 62

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Thr Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 63

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_L390I)

<400> 63

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcatt gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 64

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_L390I)

<400> 64

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Ile Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 65

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_M392L)

<400> 65

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagctgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 66

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_M392L)

<400> 66

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Leu Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 67

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_K418P)

<400> 67

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 68

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_K418P)

<400> 68

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 69

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_G419F)

<400> 69

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 70

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_G419F)

<400> 70

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 71

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_G419L)

<400> 71

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttgaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 72

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_G419L)

<400> 72

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Leu Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 73

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_G419V)

<400> 73

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaaggtgaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 74

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_G419V)

<400> 74

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Val Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 75

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N420S)

<400> 75

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 76

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_N420S)

<400> 76

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 77

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N420T)

<400> 77

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcacc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 78

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_N420T)

<400> 78

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Thr Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 79

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_E403G)

<400> 79

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatggga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 80

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_E403G)

<400> 80

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Gly Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 81

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_E430G)

<400> 81

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgagggg tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 82

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_E430G)

<400> 82

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Gly Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 83

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_Y431L)

<400> 83

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag ttggagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 84

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса(OsHPPD_Y431L)

<400> 84

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Leu Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 85

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/N338D)

<400> 85

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 86

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D)

<400> 86

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 87

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/G342D)

<400> 87

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 88

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D)

<400> 88

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 89

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N338D/G342D)

<400> 89

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 90

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_N338D/G342D)

<400> 90

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 91

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_K418P/G419F)

<400> 91

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 92

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_K418P/G419F)

<400> 92

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 93

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_G419F/N420S)

<400> 93

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 94

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_G419F/N420S)

<400> 94

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 95

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_G342D/R346C)

<400> 95

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 96

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_G342D/R346C)

<400> 96

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 97

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_G342D/R346H)

<400> 97

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 98

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_G342D/R346H)

<400> 98

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 99

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R/N420S)

<400> 99

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 100

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N420S)

<400> 100

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 101

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_G338D/K418P)

<400> 101

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 102

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_G338D/K418P)

<400> 102

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 103

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_P277N/N338D)

<400> 103

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 104

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_P277N/N338D)

<400> 104

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 105

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_L276W/P277N)

<400> 105

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgtggaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 106

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_L276W/P277N)

<400> 106

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Trp Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 107

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D)

<400> 107

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 108

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D)

<400> 108

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 109

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R/G342D/K418P)

<400> 109

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 110

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/K418P)

<400> 110

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 111

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R/G342D/G419F)

<400> 111

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 112

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/G419F)

<400> 112

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 113

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/G342D/P386T)

<400> 113

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggacaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 114

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/P386T)

<400> 114

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Thr Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 115

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_K418P/G419F/N420T)

<400> 115

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcacc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 116

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_K418P/G419F/N420T)

<400> 116

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Thr Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 117

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_K418T/G419F/N420T)

<400> 117

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaccttcacc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 118

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_K418T/G419F/N420T)

<400> 118

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Thr Phe Thr Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 119

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R/G342D/R346C)

<400> 119

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 120

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/R346C)

<400> 120

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 121

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R/G342D/R346H)

<400> 121

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 122

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/R346H)

<400> 122

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 123

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R/G342D/N420S)

<400> 123

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 124

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/N420S)

<400> 124

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 125

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/G342D/P277N)

<400> 125

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 126

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/P277N)

<400> 126

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 127

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/G342D/P336D)

<400> 127

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 128

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/P336D)

<400> 128

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 129

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса (Oshppd_H141R/G342D/L276W)

<400> 129

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgtggcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 130

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/L276W)

<400> 130

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Trp Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 131

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/G342D/R346S)

<400> 131

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 132

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/R346S)

<400> 132

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Ser Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 133

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/G342D/L390I)

<400> 133

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcatt gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 134

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/L390I)

<400> 134

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Ile Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 135

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/G342D/I377C)

<400> 135

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagtg cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 136

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/I377C)

<400> 136

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Cys Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 137

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/G342D/M392L)

<400> 137

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagctgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 138

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/M392L)

<400> 138

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Leu Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 139

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/P337A/G342D)

<400> 139

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccggc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 140

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/P337A/G342D)

<400> 140

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Ala Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 141

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/N338S/G342D)

<400> 141

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 142

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338S/G342D)

<400> 142

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Ser Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 143

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/N338Y/G342D)

<400> 143

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc ctactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 144

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338Y/G342D)

<400> 144

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Tyr Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 145

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_P277N/N338D/G342D)

<400> 145

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 146

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_P277N/N338D/G342D)

<400> 146

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 147

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_P277N/G342D/R346C)

<400> 147

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 148

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_P277N/G342D/R346C)

<400> 148

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 149

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_P277N/N338D/N420S)

<400> 149

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 150

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_P277N/N338D/N420S)

<400> 150

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 151

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N338D/G342D/K418P)

<400> 151

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 152

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_N338D/G342D/K418P)

<400> 152

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 153

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/N338D/N420S)

<400> 153

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 154

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/N420S)

<400> 154

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 155

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_H141R/N338S/N420S)

<400> 155

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 156

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338S/N420S)

<400> 156

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Ser Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 157

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/K418P)

<400> 157

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 158

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/K418P)

<400> 158

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 159

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/G419F)

<400> 159

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 160

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/G419F)

<400> 160

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 161

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/P386T)

<400> 161

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggacaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 162

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/P386T)

<400> 162

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Thr Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 163

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/R346C)

<400> 163

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 164

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/R346C)

<400> 164

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 165

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/R346H)

<400> 165

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 166

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/R346H)

<400> 166

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 167

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/G342D/K418P/G419F)

<400> 167

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 168

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/K418P/G419F)

<400> 168

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 169

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/G342D/L276W/P277N)

<400> 169

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgtggaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 170

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G342D/L276W/P277N)

<400> 170

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Trp Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 171

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/K418P/G419F)

<400> 171

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 172

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/K418P/G419F)

<400> 172

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 173

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/G419F/N420S)

<400> 173

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagttcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 174

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/G419F/N420S)

<400> 174

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 175

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/K418P/G419F/N420S)

<400> 175

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 176

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/K418P/G419F/N420S)

<400> 176

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 177

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/K418P/G419F/N420T)

<400> 177

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcacc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 178

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/K418P/G419F/N420T)

<400> 178

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Thr Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 179

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/R346C/K418P/G419F/N420S)

<400> 179

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 180

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/R346C/K418P/G419F/N420S)

<400> 180

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 181

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/N338D/G342D/R346H/K418P/G419F/N420S)

<400> 181

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 182

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/N338D/G342D/R346H/K418P/G419F/N420S)

<400> 182

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 183

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_P277N/P336D/N338D/G342D)

<400> 183

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 184

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_P277N/P336D/N338D/G342D)

<400> 184

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 185

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_P277N/N338D/G342D/R346C)

<400> 185

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 186

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_P277N/N338D/G342D/R346C)

<400> 186

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 187

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_P277N/N338D/K418P/G419F)

<400> 187

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacggcgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 188

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_P277N/N338D/K418P/G419F)

<400> 188

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Gly Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 189

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/P277N/N338D/G342D/K418P/G419F/N420S)

<400> 189

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 190

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/P277N/N338D/G342D/K418P/G419F/N420S)

<400> 190

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 191

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/P277N/P336D/N338D/G342D/K418P/G419F/N420S)

<400> 191

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgaa tctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 192

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/P277N/P336D/N338D/G342D/K418P/G419F/N420S)

<400> 192

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Asn Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 193

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса

(Oshppd_H141R/G336D/G342D/K418P/G419F/N420S)

<400> 193

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cgcgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc caactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gccgttcagc 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 194

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_H141R/G336D/G342D/K418P/G419F/N420S)

<400> 194

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val Arg Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp

325 330 335

Pro Asn Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Pro Phe Ser Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 195

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_P336D/N338D/G342D)

<400> 195

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cgactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 196

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_P336D/N338D/G342D)

<400> 196

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 197

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_P336D/N338S/G342D)

<400> 197

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc cagctactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 198

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_P336D/N338S/G342D)

<400> 198

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp

325 330 335

Pro Ser Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 199

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_P336D/N338Y/G342D)

<400> 199

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccggatcc ctactactac 1020

gacgacgtgc ggcggcgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 200

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_P336D/N338Y/G342D)

<400> 200

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Asp

325 330 335

Pro Tyr Tyr Tyr Asp Asp Val Arg Arg Arg Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 201

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N338D/G342D/R346C)

<400> 201

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 202

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_N338D/G342D/R346C)

<400> 202

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 203

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N338D/G342D/R346H)

<400> 203

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct tcgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggcgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcggcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 204

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_N338D/G342D/R346H)

<400> 204

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 205

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N338D/G342D/R346S)

<400> 205

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cgactactac 1020

gacgacgtgc ggcggagcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 206

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_N338D/G342D/R346S)

<400> 206

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Asp Tyr Tyr Asp Asp Val Arg Arg Ser Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 207

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N338S/G342D/R346C)

<400> 207

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020

gacgacgtgc ggcggtgcgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 208

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_N338S/G342D/R346C)

<400> 208

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Ser Tyr Tyr Asp Asp Val Arg Arg Cys Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 209

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N338S/G342D/R346H)

<400> 209

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgctgcgcgt cgccgacgcg gccgacgcct tccgcgccag cgtcgcagcc 480

ggtgcgcgcc cggcgttcca gcccgccgac ctcggcggtg gcttcggcct cgcggaggtg 540

gagctctacg gcgacgtcgt gctccgcttc gtcagccacc cggacggcgc cgacgcgccc 600

ttcctcccgg gtttcgaggg cgtcagcaac ccgggcgccg tggactacgg cctccgccgg 660

ttcgaccacg tcgtcggcaa cgtgccggag ctcgctccgg tagccgcgta catctccggg 720

ttcaccgggt tccacgagtt cgccgagttc accgccgagg acgtgggcac cgccgagagc 780

ggcctcaact cggtggtgct cgccaacaac gcggagaccg tgctgctgcc gctcaacgag 840

ccggtgcacg gcaccaagcg gcggagccag atacagacgt acctggacca ccacggcggc 900

ccgggggtgc agcacatcgc gctggccagc gacgacgtgc tcgggacgct gagggagatg 960

cgggcgcgct ccgccatggg cggcttcgag ttcttggcgc cgccgccgcc cagctactac 1020

gacgacgtgc ggcggcacgc cggggacgtg ctctcggagg agcagatcaa cgagtgccag 1080

gagctcgggg tgctcgtgga cagggatgac cagggggtgt tgctccagat cttcaccaag 1140

ccagtaggag acaggccaac ctttttcttg gagatgatac aaaggattgg gtgcatggag 1200

aaggatgaga gtgggcagga gtaccagaag ggcggctgcg gcgggtttgg gaagggcaac 1260

ttctcggagc tgttcaagtc cattgaggag tatgagaaat cccttgaagc caagcaagcc 1320

cctacagttc aaggatccta g 1341

<210> 210

<211> 446

<212> БЕЛОК

<213> Аминокислотная последовательность мутантной HPPD риса

(OsHPPD_N338S/G342D/R346H)

<400> 210

Met Pro Pro Thr Pro Thr Pro Thr Ala Thr Thr Gly Ala Val Ser Ala

1 5 10 15

Ala Ala Ala Ala Gly Glu Asn Ala Gly Phe Arg Leu Val Gly His Arg

20 25 30

Arg Phe Val Arg Ala Asn Pro Arg Ser Asp Arg Phe Gln Ala Leu Ala

35 40 45

Phe His His Val Glu Leu Trp Cys Ala Asp Ala Ala Ser Ala Ala Gly

50 55 60

Arg Phe Ala Phe Ala Leu Gly Ala Pro Leu Ala Ala Arg Ser Asp Leu

65 70 75 80

Ser Thr Gly Asn Ser Ala His Ala Ser Leu Leu Leu Arg Ser Ala Ser

85 90 95

Val Ala Phe Leu Phe Thr Ala Pro Tyr Gly Gly Asp His Gly Val Gly

100 105 110

Ala Asp Ala Ala Thr Thr Ala Ser Ile Pro Ser Phe Ser Pro Gly Ala

115 120 125

Ala Arg Arg Phe Ala Ala Asp His Gly Leu Ala Val His Ala Val Ala

130 135 140

Leu Arg Val Ala Asp Ala Ala Asp Ala Phe Arg Ala Ser Val Ala Ala

145 150 155 160

Gly Ala Arg Pro Ala Phe Gln Pro Ala Asp Leu Gly Gly Gly Phe Gly

165 170 175

Leu Ala Glu Val Glu Leu Tyr Gly Asp Val Val Leu Arg Phe Val Ser

180 185 190

His Pro Asp Gly Ala Asp Ala Pro Phe Leu Pro Gly Phe Glu Gly Val

195 200 205

Ser Asn Pro Gly Ala Val Asp Tyr Gly Leu Arg Arg Phe Asp His Val

210 215 220

Val Gly Asn Val Pro Glu Leu Ala Pro Val Ala Ala Tyr Ile Ser Gly

225 230 235 240

Phe Thr Gly Phe His Glu Phe Ala Glu Phe Thr Ala Glu Asp Val Gly

245 250 255

Thr Ala Glu Ser Gly Leu Asn Ser Val Val Leu Ala Asn Asn Ala Glu

260 265 270

Thr Val Leu Leu Pro Leu Asn Glu Pro Val His Gly Thr Lys Arg Arg

275 280 285

Ser Gln Ile Gln Thr Tyr Leu Asp His His Gly Gly Pro Gly Val Gln

290 295 300

His Ile Ala Leu Ala Ser Asp Asp Val Leu Gly Thr Leu Arg Glu Met

305 310 315 320

Arg Ala Arg Ser Ala Met Gly Gly Phe Glu Phe Leu Ala Pro Pro Pro

325 330 335

Pro Ser Tyr Tyr Asp Asp Val Arg Arg His Ala Gly Asp Val Leu Ser

340 345 350

Glu Glu Gln Ile Asn Glu Cys Gln Glu Leu Gly Val Leu Val Asp Arg

355 360 365

Asp Asp Gln Gly Val Leu Leu Gln Ile Phe Thr Lys Pro Val Gly Asp

370 375 380

Arg Pro Thr Phe Phe Leu Glu Met Ile Gln Arg Ile Gly Cys Met Glu

385 390 395 400

Lys Asp Glu Ser Gly Gln Glu Tyr Gln Lys Gly Gly Cys Gly Gly Phe

405 410 415

Gly Lys Gly Asn Phe Ser Glu Leu Phe Lys Ser Ile Glu Glu Tyr Glu

420 425 430

Lys Ser Leu Glu Ala Lys Gln Ala Pro Thr Val Gln Gly Ser

435 440 445

<210> 211

<211> 1341

<212> ДНК

<213> Последовательность ORF мутантного hppd риса(Oshppd_N338S/G342D/R346S)

<400> 211

atgcctccca ctcccacccc caccgccacc accggcgccg tctcggccgc tgcggcggcg 60

ggggagaacg cggggttccg cctcgtcggg caccgccgct ttgtccgcgc caacccgcgg 120

agcgaccggt tccaggcgct cgcgttccac cacgtcgagc tctggtgcgc cgacgccgcg 180

tccgccgcgg gccggttcgc cttcgccctg ggcgcgccgc tcgccgccag gtccgacctc 240

tccacgggga actccgcgca cgcctccctc ctcctccgct ccgcctccgt cgcgttcctc 300

ttcaccgccc cctacggtgg cgaccacggc gtcggcgcgg acgcggccac caccgcctcc 360

atcccttcct tctccccagg cgccgcgcgg aggttcgccg cggaccacgg cctcgcggtg 420

cacgccgtgg cgct