Антитела к entpd2, виды комбинированной терапии и способы применения антител и видов комбинированной терапии

Авторы патента:

Изобретение относится к биотехнологии. Предложены антитело или его антигенсвязывающий фрагмент, которые специфично связываются с белком эктонуклеозидтрифосфатдифосфогидролазой 2 (ENTPD2) человека. Также предложены нуклеиновая кислота, кодирующая указанное антитело или его антигенсвязывающий фрагмент, вектор экспрессии, содержащий указанную нуклеиновую кислоту, клетка, содержащая нуклеиновую кислоту или вектор экспрессии. Также предложена фармацевтическая композиция для лечения рака, характеризующегося сверхэкспрессией ENTPD2, содержащая антитело или его антигенсвязывающий фрагмент, нуклеиновую кислоту, вектор или клетку. Также предложены способ лечения рака, характеризующегося сверхэкспрессией ENTPD2, у субъекта и способ стимуляции иммунного ответа у субъекта, предусматривающие введение субъекту указанных антитела или антигенсвязывающего фрагмента, нуклеиновой кислоты, вектора, клетки или фармацевтической композиции. Изобретение может быть использовано в терапии рака, характеризующегося сверхэкспрессией ENTPD2. 12 н. и 27 з.п. ф-лы, 17 ил., 30 табл., 14 пр.



Настоящая заявка испрашивает преимущество по предварительной заявке на патент США № 62/677850, поданной 30 мая 2018 г., содержание которой включено в данный документ посредством ссылки во всей своей полноте.


В настоящем изобретении предусмотрены антитела или их антигенсвязывающие фрагменты, например, моноклональные антитела или их антигенсвязывающие фрагменты, которые специфично связываются с эктоферментом эктонуклеозидтрифосфатдифосфогидролазой 2 (ENTPD2), и способы применения этих антител или антигенсвязывающих фрагментов.

Настоящее изобретение также относится к видам комбинированной терапии, предусматривающим антитело к ENTPD2 человека или его антигенсвязывающий фрагмент и по меньшей мере одно дополнительное терапевтическое средство.


Настоящая заявка содержит перечень последовательностей, который был подан в электронном виде в формате ASCII и включен в данный документ посредством ссылки во всей своей полноте. Указанная копия в формате ASCII, созданная 5 апреля 2019 г., имеет название PAT058145-WO-PCT_SL.txt, и ее размер составляет 635873 байта.


Клеточный стресс и апоптоз инициируют высвобождение ATP во внеклеточное пространство. Увеличение концентрации ATP содействует быстрому развитию воспаления, что приводит к усилению передачи сигнала в T-клетках, ингибированию регуляторных T-клеток (Treg) и содействию активации инфламмасом в дендритных клетках и макрофагах. Эктофермент эктонуклеозидтрифосфатдифосфогидролаза 2 (ENTPD2) является членом семейства эктонуклеозидаз, которые гидролизуют 5'-трифосфаты, и представляет собой интегральный мембранный белок, который участвует в пуринергической передаче сигнала. ENTPD2 катализирует превращение аденозинтрифосфата (ATP) в аденозиндифосфат (ADP) и аденозинмонофосфат (AMP). В свою очередь, превращение AMP в аденозин катализируется кластером дифференцировки 73 (CD73), также известным как экто-5'-нуклеотидаза (экто-5'-NT). Молекула AMP взаимодействует с несколькими рецепторами, в том числе аденозиновыми рецепторами A1, A2A, A2B и A3. Рецептор A2A получил особое внимание ввиду его обширной экспрессии на иммунных клетках. AMP характеризуется плейотропными эффектами в микроокружении опухоли, включающими размножение регуляторных Т-клеток (Treg), ингибирование ответов с участием эффекторных Т-клеток (Teff), опосредованных интерфероном (IFN)-γ, и размножение супрессорных клеток миелоидного происхождения (MDSC). См., например, Allard B, et al., Curr Opin Pharmacol 29:7-16 (2016) и Allard D, et al., Immunotherapy 8:145-163 (2016).

В мышиной модели гепатоцеллюлярной карциномы было показано, что ENTPD2 обеспечивает превращение внеклеточного ATP в AMP, который предотвращает дифференцировку моноцитарных супрессорных клеток миелоидного происхождения (MDSC) в дендритные клетки, содействуя таким образом поддержанию численности MDSC in vitro и in vivo (Chiu et al., Nat Commun. 8:517-28 (2017).

ENTPD2 экспрессируется на раковых клетках, как описано в данном документе. Новые композиции и способы для регуляции активности ENTPD2 и соответствующие терапевтические средства являются весьма желательными.


В данном документе предусмотрены антитела или их антигенсвязывающие фрагменты, например, моноклональные антитела или их антигенсвязывающие фрагменты, которые специфично связываются с эктоферментом эктонуклеозидтрифосфатдифосфогидролазой 2 (ENTPD2). Антитела к ENTPD2 или их антигенсвязывающие фрагменты применимы для лечения заболеваний, ассоциированных с ENTPD2, таких как рак.

В одном аспекте в данном документе предусмотрены антитела или их антигенсвязывающие фрагменты, которые специфично связываются с белком ENTPD2 человека, где антитело или его антигенсвязывающий фрагмент содержат область 1, определяющую комплементарность, тяжелой цепи (HCDR1), область 2, определяющую комплементарность, тяжелой цепи (HCDR2), область 3, определяющую комплементарность, тяжелой цепи (HCDR3), область 1, определяющую комплементарность, легкой цепи (LCDR1), область 2, определяющую комплементарность, легкой цепи (LCDR2) и область 3, определяющую комплементарность, легкой цепи (LCDR3) из любого антитела или антигенсвязывающего фрагмента, приведенных в таблице 1. В некоторых вариантах осуществления HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3 из таких антител или антигенсвязывающих фрагментов выбраны из последовательностей HCDR1, HCDR2, HCDR3, LCDR1, LCDR2 и LCDR3, приведенных в таблице 1. В некоторых вариантах осуществления такие антитела или антигенсвязывающие фрагменты содержат вариабельную область тяжелой цепи (VH), приведенную в таблице 1. В некоторых вариантах осуществления такие антитела или антигенсвязывающие фрагменты содержат вариабельную область легкой цепи (VL), приведенную в таблице 1.

В другом аспекте в данном документе предусмотрены антитела или антигенсвязывающие фрагменты, выбранные из любого из следующих:

1) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 1,

последовательность HCDR2, содержащую SEQ ID NO: 2,

последовательность HCDR3, содержащую SEQ ID NO: 3,

последовательность LCDR1, содержащую SEQ ID NO: 14,

последовательность LCDR2, содержащую SEQ ID NO: 15, и

последовательность LCDR3, содержащую SEQ ID NO: 16;

2) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 4,

последовательность HCDR2, содержащую SEQ ID NO: 5,

последовательность HCDR3, содержащую SEQ ID NO: 3,

последовательность LCDR1, содержащую SEQ ID NO: 17,

последовательность LCDR2, содержащую SEQ ID NO: 18, и

последовательность LCDR3, содержащую SEQ ID NO: 19;

3) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 7,

последовательность HCDR2, содержащую SEQ ID NO: 8,

последовательность HCDR3, содержащую SEQ ID NO: 9,

последовательность LCDR1, содержащую SEQ ID NO: 20,

последовательность LCDR2, содержащую SEQ ID NO: 18, и

последовательность LCDR3, содержащую SEQ ID NO: 16;

4) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 37,

последовательность HCDR2, содержащую SEQ ID NO: 38,

последовательность HCDR3, содержащую SEQ ID NO: 39,

последовательность LCDR1, содержащую SEQ ID NO: 50,

последовательность LCDR2, содержащую SEQ ID NO: 51, и

последовательность LCDR3, содержащую SEQ ID NO: 52;

5) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 40,

последовательность HCDR2, содержащую SEQ ID NO: 41,

последовательность HCDR3, содержащую SEQ ID NO: 39,

последовательность LCDR1, содержащую SEQ ID NO: 53,

последовательность LCDR2, содержащую SEQ ID NO: 54, и

последовательность LCDR3, содержащую SEQ ID NO: 55;

6) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 43,

последовательность HCDR2, содержащую SEQ ID NO: 44,

последовательность HCDR3, содержащую SEQ ID NO: 45,

последовательность LCDR1, содержащую SEQ ID NO: 56,

последовательность LCDR2, содержащую SEQ ID NO: 54, и

последовательность LCDR3, содержащую SEQ ID NO: 52;

7) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 37,

последовательность HCDR2, содержащую SEQ ID NO: 38,

последовательность HCDR3, содержащую SEQ ID NO: 39,

последовательность LCDR1, содержащую SEQ ID NO: 61,

последовательность LCDR2, содержащую SEQ ID NO: 51, и

последовательность LCDR3, содержащую SEQ ID NO: 52;

8) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 40,

последовательность HCDR2, содержащую SEQ ID NO: 41,

последовательность HCDR3, содержащую SEQ ID NO: 39,

последовательность LCDR1, содержащую SEQ ID NO: 62,

последовательность LCDR2, содержащую SEQ ID NO: 54, и

последовательность LCDR3, содержащую SEQ ID NO: 55;

9) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 43,

последовательность HCDR2, содержащую SEQ ID NO: 44,

последовательность HCDR3, содержащую SEQ ID NO: 45,

последовательность LCDR1, содержащую SEQ ID NO: 63,

последовательность LCDR2, содержащую SEQ ID NO: 54, и

последовательность LCDR3, содержащую SEQ ID NO: 52;

10) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 37,

последовательность HCDR2, содержащую SEQ ID NO: 38,

последовательность HCDR3, содержащую SEQ ID NO: 68,

последовательность LCDR1, содержащую SEQ ID NO: 50,

последовательность LCDR2, содержащую SEQ ID NO: 51, и

последовательность LCDR3, содержащую SEQ ID NO: 52;

11) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 40,

последовательность HCDR2, содержащую SEQ ID NO: 41,

последовательность HCDR3, содержащую SEQ ID NO: 68,

последовательность LCDR1, содержащую SEQ ID NO: 53,

последовательность LCDR2, содержащую SEQ ID NO: 54, и

последовательность LCDR3, содержащую SEQ ID NO: 55;

12) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 43,

последовательность HCDR2, содержащую SEQ ID NO: 44,

последовательность HCDR3, содержащую SEQ ID NO: 69,

последовательность LCDR1, содержащую SEQ ID NO: 56,

последовательность LCDR2, содержащую SEQ ID NO: 54, и

последовательность LCDR3, содержащую SEQ ID NO: 52;

13) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 82,

последовательность HCDR2, содержащую SEQ ID NO: 83,

последовательность HCDR3, содержащую SEQ ID NO: 84,

последовательность LCDR1, содержащую SEQ ID NO: 95,

последовательность LCDR2, содержащую SEQ ID NO: 96, и

последовательность LCDR3, содержащую SEQ ID NO: 97;

14) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 85,

последовательность HCDR2, содержащую SEQ ID NO: 86,

последовательность HCDR3, содержащую SEQ ID NO: 84,

последовательность LCDR1, содержащую SEQ ID NO: 98,

последовательность LCDR2, содержащую SEQ ID NO: 99, и

последовательность LCDR3, содержащую SEQ ID NO: 100;

15) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 88,

последовательность HCDR2, содержащую SEQ ID NO: 89,

последовательность HCDR3, содержащую SEQ ID NO: 90,

последовательность LCDR1, содержащую SEQ ID NO: 101,

последовательность LCDR2, содержащую SEQ ID NO: 99, и

последовательность LCDR3, содержащую SEQ ID NO: 97;

16) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 106,

последовательность HCDR2, содержащую SEQ ID NO: 107,

последовательность HCDR3, содержащую SEQ ID NO: 108,

последовательность LCDR1, содержащую SEQ ID NO: 119,

последовательность LCDR2, содержащую SEQ ID NO: 120, и

последовательность LCDR3, содержащую SEQ ID NO: 121;

17) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 109,

последовательность HCDR2, содержащую SEQ ID NO: 110,

последовательность HCDR3, содержащую SEQ ID NO: 108,

последовательность LCDR1, содержащую SEQ ID NO: 122,

последовательность LCDR2, содержащую SEQ ID NO: 99, и

последовательность LCDR3, содержащую SEQ ID NO: 123;

18) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 112,

последовательность HCDR2, содержащую SEQ ID NO: 113,

последовательность HCDR3, содержащую SEQ ID NO: 114,

последовательность LCDR1, содержащую SEQ ID NO: 124,

последовательность LCDR2, содержащую SEQ ID NO: 99, и

последовательность LCDR3, содержащую SEQ ID NO: 121;

19) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 106,

последовательность HCDR2, содержащую SEQ ID NO: 129,

последовательность HCDR3, содержащую SEQ ID NO: 108,

последовательность LCDR1, содержащую SEQ ID NO: 119,

последовательность LCDR2, содержащую SEQ ID NO: 120, и

последовательность LCDR3, содержащую SEQ ID NO: 121;

20) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 109,

последовательность HCDR2, содержащую SEQ ID NO: 130,

последовательность HCDR3, содержащую SEQ ID NO: 108,

последовательность LCDR1, содержащую SEQ ID NO: 122,

последовательность LCDR2, содержащую SEQ ID NO: 99, и

последовательность LCDR3, содержащую SEQ ID NO: 123;

21) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 112,

последовательность HCDR2, содержащую SEQ ID NO: 131,

последовательность HCDR3, содержащую SEQ ID NO: 114,

последовательность LCDR1, содержащую SEQ ID NO: 124,

последовательность LCDR2, содержащую SEQ ID NO: 99, и

последовательность LCDR3, содержащую SEQ ID NO: 121;

22) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 136,

последовательность HCDR2, содержащую SEQ ID NO: 137,

последовательность HCDR3, содержащую SEQ ID NO: 138,

последовательность LCDR1, содержащую SEQ ID NO: 149,

последовательность LCDR2, содержащую SEQ ID NO: 150, и

последовательность LCDR3, содержащую SEQ ID NO: 151;

23) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 139,

последовательность HCDR2, содержащую SEQ ID NO: 140,

последовательность HCDR3, содержащую SEQ ID NO: 138,

последовательность LCDR1, содержащую SEQ ID NO: 152,

последовательность LCDR2, содержащую SEQ ID NO: 153, и

последовательность LCDR3, содержащую SEQ ID NO: 154;

24) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 142,

последовательность HCDR2, содержащую SEQ ID NO: 143,

последовательность HCDR3, содержащую SEQ ID NO: 144,

последовательность LCDR1, содержащую SEQ ID NO: 155,

последовательность LCDR2, содержащую SEQ ID NO: 153, и

последовательность LCDR3, содержащую SEQ ID NO: 151;

25) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 160,

последовательность HCDR2, содержащую SEQ ID NO: 161,

последовательность HCDR3, содержащую SEQ ID NO: 162,

последовательность LCDR1, содержащую SEQ ID NO: 173,

последовательность LCDR2, содержащую SEQ ID NO: 150, и

последовательность LCDR3, содержащую SEQ ID NO: 174;

26) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 163,

последовательность HCDR2, содержащую SEQ ID NO: 164,

последовательность HCDR3, содержащую SEQ ID NO: 162,

последовательность LCDR1, содержащую SEQ ID NO: 175,

последовательность LCDR2, содержащую SEQ ID NO: 153, и

последовательность LCDR3, содержащую SEQ ID NO: 176;

27) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 166,

последовательность HCDR2, содержащую SEQ ID NO: 167,

последовательность HCDR3, содержащую SEQ ID NO: 168,

последовательность LCDR1, содержащую SEQ ID NO: 177,

последовательность LCDR2, содержащую SEQ ID NO: 153, и

последовательность LCDR3, содержащую SEQ ID NO: 174;

28) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 37,

последовательность HCDR2, содержащую SEQ ID NO: 220,

последовательность HCDR3, содержащую SEQ ID NO: 221,

последовательность LCDR1, содержащую SEQ ID NO: 61,

последовательность LCDR2, содержащую SEQ ID NO: 51, и

последовательность LCDR3, содержащую SEQ ID NO: 52;

29) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 40,

последовательность HCDR2, содержащую SEQ ID NO: 222,

последовательность HCDR3, содержащую SEQ ID NO: 221,

последовательность LCDR1, содержащую SEQ ID NO: 62,

последовательность LCDR2, содержащую SEQ ID NO: 54, и

последовательность LCDR3, содержащую SEQ ID NO: 55;

30) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 43,

последовательность HCDR2, содержащую SEQ ID NO: 223,

последовательность HCDR3, содержащую SEQ ID NO: 224,

последовательность LCDR1, содержащую SEQ ID NO: 63,

последовательность LCDR2, содержащую SEQ ID NO: 54, и

последовательность LCDR3, содержащую SEQ ID NO: 52;

31) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 37,

последовательность HCDR2, содержащую SEQ ID NO: 220,

последовательность HCDR3, содержащую SEQ ID NO: 68,

последовательность LCDR1, содержащую SEQ ID NO: 61,

последовательность LCDR2, содержащую SEQ ID NO: 51, и

последовательность LCDR3, содержащую SEQ ID NO: 52;

32) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 40,

последовательность HCDR2, содержащую SEQ ID NO: 222,

последовательность HCDR3, содержащую SEQ ID NO: 68,

последовательность LCDR1, содержащую SEQ ID NO: 62,

последовательность LCDR2, содержащую SEQ ID NO: 54, и

последовательность LCDR3, содержащую SEQ ID NO: 55;

33) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 43,

последовательность HCDR2, содержащую SEQ ID NO: 223,

последовательность HCDR3, содержащую SEQ ID NO: 69,

последовательность LCDR1, содержащую SEQ ID NO: 63,

последовательность LCDR2, содержащую SEQ ID NO: 54, и

последовательность LCDR3, содержащую SEQ ID NO: 52;

34) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 1,

последовательность HCDR2, содержащую SEQ ID NO: 245,

последовательность HCDR3, содержащую SEQ ID NO: 246,

последовательность LCDR1, содержащую SEQ ID NO: 254,

последовательность LCDR2, содержащую SEQ ID NO: 15, и

последовательность LCDR3, содержащую SEQ ID NO: 255;

35) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 4,

последовательность HCDR2, содержащую SEQ ID NO: 247,

последовательность HCDR3, содержащую SEQ ID NO: 246,

последовательность LCDR1, содержащую SEQ ID NO: 17,

последовательность LCDR2, содержащую SEQ ID NO: 18, и

последовательность LCDR3, содержащую SEQ ID NO: 256;

36) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 7,

последовательность HCDR2, содержащую SEQ ID NO: 248,

последовательность HCDR3, содержащую SEQ ID NO: 249,

последовательность LCDR1, содержащую SEQ ID NO: 20,

последовательность LCDR2, содержащую SEQ ID NO: 18, и

последовательность LCDR3, содержащую SEQ ID NO: 255;

37) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 1,

последовательность HCDR2, содержащую SEQ ID NO: 261,

последовательность HCDR3, содержащую SEQ ID NO: 262,

последовательность LCDR1, содержащую SEQ ID NO: 254,

последовательность LCDR2, содержащую SEQ ID NO: 15, и

последовательность LCDR3, содержащую SEQ ID NO: 16;

38) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 4,

последовательность HCDR2, содержащую SEQ ID NO: 247,

последовательность HCDR3, содержащую SEQ ID NO: 262,

последовательность LCDR1, содержащую SEQ ID NO: 17,

последовательность LCDR2, содержащую SEQ ID NO: 18, и

последовательность LCDR3, содержащую SEQ ID NO: 19;

39) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 7,

последовательность HCDR2, содержащую SEQ ID NO: 248,

последовательность HCDR3, содержащую SEQ ID NO: 263,

последовательность LCDR1, содержащую SEQ ID NO: 20,

последовательность LCDR2, содержащую SEQ ID NO: 18, и

последовательность LCDR3, содержащую SEQ ID NO: 16;

40) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 272,

последовательность HCDR2, содержащую SEQ ID NO: 273,

последовательность HCDR3, содержащую SEQ ID NO: 274,

последовательность LCDR1, содержащую SEQ ID NO: 254,

последовательность LCDR2, содержащую SEQ ID NO: 285, и

последовательность LCDR3, содержащую SEQ ID NO: 16;

41) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 275,

последовательность HCDR2, содержащую SEQ ID NO: 276,

последовательность HCDR3, содержащую SEQ ID NO: 274,

последовательность LCDR1, содержащую SEQ ID NO: 17,

последовательность LCDR2, содержащую SEQ ID NO: 286, и

последовательность LCDR3, содержащую SEQ ID NO: 19;

42) антитела или его антигенсвязывающего фрагмента, содержащих:

последовательность HCDR1, содержащую SEQ ID NO: 278,

последовательность HCDR2, содержащую SEQ ID NO: 279,

последовательность HCDR3, содержащую SEQ ID NO: 280,

последовательность LCDR1, содержащую SEQ ID NO: 20,

последовательность LCDR2, содержащую SEQ ID NO: 286, и

последовательность LCDR3, содержащую SEQ ID NO: 16.

В другом аспекте в данном документе предусмотрены антитела или антигенсвязывающие фрагменты, выбранные из любого из следующих:

1) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 10 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 21 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

2) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 25 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 29 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

3) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 33 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 29 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

4) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 46 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 57 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

5) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 46 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 64 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

6) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 70 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 74 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

7) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 25 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 78 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

8) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 91 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 102 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

9) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 115 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 125 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

10) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 132 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 125 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

11) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 145 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 156 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

12) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 169 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 178 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

13) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 225 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 229 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

14) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 233 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 237 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

15) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 241 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 229 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

16) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 250 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 257 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

17) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 264 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 268 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей; или

18) антитела или его антигенсвязывающего фрагмента, содержащих VH, содержащую SEQ ID NO: 281 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и VL, содержащую SEQ ID NO: 287 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей.

В другом аспекте в данном документе предусмотрены антитела или антигенсвязывающие фрагменты, выбранные из любого из следующих:

1) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 12 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 23 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

2) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 27 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 31 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

3) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 35 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 31 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

4) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 48 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 59 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

5) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 48 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 66 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

6) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 72 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 76 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

7) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 27 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 80 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

8) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 93 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 104 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

9) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 117 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 127 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

10) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 134 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 127 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

11) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 147 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 158 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

12) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 171 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 180 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

13) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 227 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 231 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

14) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 235 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 239 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

15) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 243 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 231 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

16) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 252 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 259 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей;

17) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 266 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 270 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей; или

18) антитела, содержащего тяжелую цепь, содержащую SEQ ID NO: 283 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей, и легкую цепь, содержащую SEQ ID NO: 289 или последовательность, на по меньшей мере приблизительно 95% или больше идентичную ей.

В данном документе также предусмотрены антитела или их антигенсвязывающие фрагменты, которые специфично связываются с эпитопом в ENTPD2 человека, где эпитоп содержит по меньшей мере один (например, по меньшей мере два, по меньшей мере три, по меньшей мере четыре, по меньшей мере пять, по меньшей мере шесть, по меньшей мере семь, по меньшей мере восемь, по меньшей мере девять, по меньшей мере десять, по меньшей мере одиннадцать, по меньшей мере двенадцать, по меньшей мере тринадцать, по меньшей мере четырнадцать, по меньшей мере пятнадцать, по меньшей мере двадцать) из следующих остатков: His50, Asp76, Pro78, Gly79, Gly80, Tyr85, Asp87, Asn88, Gly91, Gln94, Ser95, Gly98, Glu101, Gln102, Gln105, Asp106, Arg245, Thr272, Gln273, Leu275, Asp278, Arg298, Ala347, Ala350, Thr351, Arg392, Ala393, Arg394 или Tyr398.

В данном документе также предусмотрены антитела или их антигенсвязывающие фрагменты, которые специфично связываются с эпитопом в ENTPD2 человека, где эпитоп содержит по меньшей мере один (например, по меньшей мере два, по меньшей мере три, по меньшей мере четыре, по меньшей мере пять, по меньшей мере шесть, по меньшей мере семь, по меньшей мере восемь, по меньшей мере девять, по меньшей мере десять, по меньшей мере одиннадцать, по меньшей мере двенадцать, по меньшей мере тринадцать, по меньшей мере четырнадцать, по меньшей мере пятнадцать, по меньшей мере двадцать) из следующих остатков: Gly79, Gln250, Leu253, Trp266, Arg268, Gly269, Phe270, Ser271, Thr272, Gln273, Val274, Leu275, Asp278, Arg298, Ser300, Ser302, Gly303, Thr380, Trp381, Ala382, Gly390, Gln391, Arg392, Ala393, Arg394 или Asp397.

В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, описанные в данном документе, относятся к изотипу IgG1, IgG2, IgG3 или IgG4. В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, описанные в данном документе, относятся к изотипу IgG1. В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, описанные в данном документе, содержат Fc-область, выбранную из Fc-области IgG1, Fc-области IgG2, Fc-области IgG4 или гибридной Fc-области IgG2/IgG4 . В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, описанные в данном документе, содержат Fc-область, выбранную из Fc-области IgG1. В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, описанные в данном документе, содержат модифицированную Fc-область. В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, описанные в данном документе, содержат модифицированную Fc-область, характеризующуюся сниженной активностью антителозависимой клеточной цитотоксичности (ADCC) или комплементзависимой цитотоксичности (CDC) по сравнению с исходным антителом.

В другом аспекте в данном документе предусмотрены антитела или их антигенсвязывающие фрагменты, которые конкурируют с любым антителом или антигенсвязывающим фрагментом, приведенными в таблице 1, за связывание с белком ENTPD2 человека.

В другом аспекте в данном документе предусмотрены антитела или их антигенсвязывающие фрагменты, которые связываются по сути с тем же эпитопом ENTPD2, что и любое антитело или антигенсвязывающий фрагмент, приведенные в таблице 1.

В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, описанные в данном документе, связываются с белком ENTPD2 человека с константой диссоциации (KD), составляющей менее 10 нМ, например, с KD, составляющей менее 5 нМ, или с KD, составляющей менее 3 нМ, например, согласно измерению с помощью Biacore. В некоторых вариантах осуществления константу диссоциации антител или их антигенсвязывающих фрагментов, описанных в данном документе, для ENTPD2 человека измеряют с помощью Biacore при 25ºC.

В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, описанные в данном документе, ингибируют ферментативную активность ENTPD2 человека на по меньшей мере 40%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 80% или по меньшей мере 90%. В некоторых вариантах осуществления ферментативную активность ENTPD2 человека измеряют с помощью анализа FRET in vitro, в котором измеряется гидролиз ATP до ADP под действием рекомбинантного ENTPD2 либо ENTPD2, экспрессирующегося на поверхности клеток.

В некоторых вариантах осуществления антитела к ENTPD2 человека или их антигенсвязывающие фрагменты, описанные в данном документе, ингибируют способность ENTPD2 к гидролизу аденозинтрифосфата (ATP). В некоторых вариантах осуществления способность ENTPD2 к гидролизу ATP измеряют с помощью анализа FRET in vitro, в котором измеряется гидролиз ATP до ADP под действием рекомбинантного ENTPD2 либо ENTPD2, экспрессирующегося на поверхности клеток.

В некоторых вариантах осуществления антитела к ENTPD2 человека или их антигенсвязывающие фрагменты, описанные в данном документе, препятствуют связыванию ATP с ENTPD2 или удерживают ATP в каталитическом домене ENTPD2. В некоторых вариантах осуществления способность ENTPD2 к гидролизу ATP измеряют с помощью анализа FRET in vitro, в котором измеряется гидролиз ATP до ADP под действием рекомбинантного ENTPD2 либо ENTPD2, экспрессирующегося на поверхности клеток.

В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, описанные в данном документе, представляют собой человеческие или гуманизированные антитела или их фрагменты.

В другом аспекте в данном документе предусмотрены нуклеиновые кислоты, кодирующие антитело к ENTPD2 человека или его антигенсвязывающий фрагмент, описанные в данном документе. Такие нуклеиновые кислоты могут кодировать полипептиды, содержащие сегменты или домены антител к ENTPD2 или их антигенсвязывающих фрагментов, описанных в данном документе.

Также предусмотрены векторы, содержащие такие нуклеиновые кислоты, кодирующие антитело к ENTPD2 человека или его антигенсвязывающий фрагмент, описанные в данном документе. В некоторых вариантах осуществления вектор выбран из ДНК-вектора, РНК-вектора, плазмиды, космиды или вирусного вектора. В некоторых вариантах осуществления вектор представляет собой вирусный вектор на основе любого из следующих вирусов: лентивируса, аденовируса, аденоассоциированного вируса (AAV), вируса простого герпеса (HSV), парвовируса, ретровируса, вируса осповакцины, вируса Синдбис, вируса гриппа, реовируса, вируса ньюкаслской болезни (NDV), вируса кори, вируса везикулярного стоматита (VSV), полиовируса, поксвируса, вируса Сенека-Валли, вируса Коксаки, энтеровируса, вируса миксомы или вируса Мараба. В некоторых вариантах осуществления вектор представляет собой вектор на основе AAV. В некоторых вариантах осуществления вектор представляет собой лентивирусный вектор. В некоторых вариантах осуществления вектор дополнительно содержит промотор, например, тканеспецифичный промотор. В некоторых вариантах осуществления вектор дополнительно содержит выявляемый маркер.

Также в данном документе предусмотрены клетки, содержащие нуклеиновую кислоту или набор нуклеиновых кислот, кодирующие антитело к ENTPD2 человека или его антигенсвязывающий фрагмент, описанные в данном документе, или вектор, содержащий такие нуклеиновую кислоту или набор нуклеиновых кислот.

В другом аспекте в данном документе предусмотрены фармацевтические композиции, содержащие антитело к ENTPD2 человека или его антигенсвязывающий фрагмент, описанные в данном документе, нуклеиновую кислоту, кодирующую такие антитело или антигенсвязывающий фрагмент, вектор, содержащий такие нуклеиновую кислоту или набор нуклеиновых кислот, или клетку, содержащую нуклеиновую кислоту или наборы нуклеиновых кислот или вектор, описанные в данном документе, и фармацевтически приемлемый носитель.

В другом аспекте в данном документе предусмотрены способы получения антитела к ENTPD2 человека или его антигенсвязывающего фрагмента путем культивирования клетки, содержащей нуклеиновую кислоту или наборы нуклеиновых кислот, кодирующие антитело к ENTPD2 человека или его антигенсвязывающий фрагмент, или вектор, содержащий такие нуклеиновую кислоту или наборы нуклеиновых кислот, и сбор антитела или его антигенсвязывающего фрагмента из культуральной среды.

В другом аспекте в данном документе предусмотрены способы лечения рака у субъекта, нуждающегося в этом, путем введения субъекту терапевтически эффективного количества антитела к ENTPD2 человека или антигенсвязывающего фрагмента, описанного в данном документе, нуклеиновой кислоты или наборов нуклеиновых кислот, кодирующих такие антитело или антигенсвязывающий фрагмент, вектора, содержащего нуклеиновую кислоту, кодирующую такие антитело или антигенсвязывающий фрагмент, клетки, содержащей такие нуклеиновую кислоту или наборы нуклеиновых кислот или вектор, или фармацевтической композиции, содержащей такие антитело или антигенсвязывающий фрагмент, нуклеиновую кислоту или наборы нуклеиновых кислот, вектор или клетку. В некоторых вариантах осуществления антитело или его антигенсвязывающий фрагмент, нуклеиновую кислоту или наборы нуклеиновых кислот, вектор, клетку или фармацевтическую композицию вводят субъекту посредством внутривенного, внутриопухолевого или подкожного путей.

В другом аспекте в данном документе предусмотрены способы стимуляции иммунного ответа у субъекта путем введения субъекту антитела к ENTPD2 человека или антигенсвязывающего фрагмента, описанного в данном документе, нуклеиновой кислоты или наборов нуклеиновых кислот, кодирующих такие антитело или антигенсвязывающий фрагмент, вектора, содержащего нуклеиновую кислоту, кодирующую такие антитело или антигенсвязывающий фрагмент, клетки, содержащей такие нуклеиновую кислоту или наборы нуклеиновых кислот или вектор, или фармацевтической композиции, содержащей такие антитело или антигенсвязывающий фрагмент, нуклеиновую кислоту или наборы нуклеиновых кислот, вектор или клетку, в количестве, эффективном для стимуляции иммунного ответа.

В некоторых вариантах осуществления такие способы могут дополнительно включать введение субъекту по меньшей мере одного дополнительного терапевтического средства.

В некоторых вариантах осуществления такие способы могут дополнительно включать введение субъекту по меньшей мере двух дополнительных терапевтических средств.

В другом аспекте в данном документе предусмотрены антитело или его антигенсвязывающий фрагмент, описанные в данном документе, нуклеиновая кислота или набор нуклеиновых кислот, кодирующие такие антитело или его антигенсвязывающий фрагмент, вектор или клетка, содержащие такие нуклеиновую кислоту или набор нуклеиновых кислот, или фармацевтическая композиция, содержащая такие антитело или его антигенсвязывающий фрагмент, нуклеиновую кислоту или набор нуклеиновых кислот, вектор или клетку, для применения в качестве лекарственного препарата.

В другом аспекте в данном документе предусмотрены антитело или его антигенсвязывающий фрагмент, описанные в данном документе, нуклеиновая кислота, кодирующая такие антитело или его антигенсвязывающий фрагмент, вектор или клетка, содержащие такие нуклеиновую кислоту или набор нуклеиновых кислот, или фармацевтическая композиция, содержащая такие антитело или его антигенсвязывающий фрагмент, нуклеиновую кислоту или набор нуклеиновых кислот, вектор или клетку, для применения в лечении рака.

В другом аспекте в данном документе предусмотрены фармацевтическая композиция, содержащая антитело или его антигенсвязывающий фрагмент, описанные в данном документе, и по меньшей мере одно дополнительное терапевтическое средство или процедура.

В некоторых вариантах осуществления по меньшей мере одно дополнительное терапевтическое средство или процедура выбраны из одного или нескольких из химиотерапии, таргетной противораковой терапии, онколитического лекарственного средства, цитотоксического средства, иммунотерапии, цитокина, хирургической процедуры, процедуры облучения, активатора костимулирующей молекулы, ингибитора ингибирующей молекулы, вакцины или клеточной терапии.

В некоторых вариантах осуществления по меньшей мере одно дополнительное терапевтическое средство является ингибитором PD-1, например, антителом к PD-1. В некоторых вариантах осуществления ингибитор PD-1 выбран из PDR001, ниволумаба, пембролизумаба, пидилизумаба, MEDI0680, REGN2810, TSR-042, PF-06801591 или AMP-224.

В некоторых вариантах осуществления по меньшей мере одно дополнительное терапевтическое средство является ингибитором PD-L1, например, антителом к PD-L1. В некоторых вариантах осуществления ингибитор PD-L1 выбран из FAZ053, атезолизумаба, авелумаба, дурвалумаба или BMS-936559.

В некоторых вариантах осуществления по меньшей мере одно дополнительное терапевтическое средство является антагонистом A2AR. В некоторых вариантах осуществления антагонист A2AR выбран из:

i. молекулы антитела к CD73 или ее антигенсвязывающего фрагмента, где антитело к CD73 необязательно выбрано из:

a. молекулы антитела к CD73, содержащей вариабельную область тяжелой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 295, и вариабельную область легкой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 296, или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или больше идентичную по отношению к SEQ ID NO: 295 или 296;

b. молекулы антитела к CD73, содержащей вариабельную область тяжелой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 299, и вариабельную область легкой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 300, или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или больше идентичную по отношению к SEQ ID NO: 299 или 300;

c. молекулы антитела к CD73, содержащей вариабельную область тяжелой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 302, и вариабельную область легкой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 303, или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или больше идентичную по отношению к SEQ ID NO: 302 или 303;

d. молекулы антитела к CD73, содержащей вариабельную область тяжелой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 304, и вариабельную область легкой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 305, или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или больше идентичную по отношению к SEQ ID NO: 304 или 305;

e. молекулы антитела к CD73, содержащей вариабельную область тяжелой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 306, и вариабельную область легкой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 307, или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или больше идентичную по отношению к SEQ ID NO: 306 или 307; или

f. молекулы антитела к CD73, содержащей вариабельную область тяжелой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 308, и вариабельную область легкой цепи, содержащую аминокислотную последовательность под SEQ ID NO: 309, или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или больше идентичную по отношению к SEQ ID NO: 308 или 309; или

ii. PBF509/NIR178, CPI444/V81444, AZD4635/HTL-1071, випаденанта, GBV-2034, AB928, теофиллина, истрадефиллина, тозаденанта/SYN-115, KW-6356, ST-4206 и преладенанта/SCH-420814; или

iii. 5-бром-2,6-ди-(1H-пиразол-1-ил)пиримидин-4-амина или его фармацевтически приемлемой соли; (S)-7-(5-метилфуран-2-ил)-3-((6-(((тетрагидрофуран-3-ил)окси)метил)пиридин-2-ил)метил)-3H-[1,2,3]триазоло[4,5-d]пиримидин-5-амина или его фармацевтически приемлемой соли; (R)-7-(5-метилфуран-2-ил)-3-((6-(((тетрагидрофуран-3-ил)окси)метил)пиридин-2-ил)метил)-3H-[1,2,3]триазоло[4,5-d]пиримидин-5-амина, или его рацемата, или его фармацевтически приемлемой соли; 7-(5-метилфуран-2-ил)-3-((6-(((тетрагидрофуран-3-ил)окси)метил)пиридин-2-ил)метил)-3H-[1,2,3]триазоло[4,5-d]пиримидин-5-амина или его фармацевтически приемлемой соли и 6-(2-хлор-6-метилпиридин-4-ил)-5-(4-фторфенил)-1,2,4-триазин-3-амина или его фармацевтически приемлемой соли.

В некоторых вариантах осуществления по меньшей мере одно дополнительное терапевтическое средство выбрано из:

i. ингибитора CTLA-4, где ингибитор CTLA-4 необязательно выбран из ипилимумаба или тремелимумаба;

ii. ингибитора TIM-3, где ингибитор TIM-3 необязательно выбран из MBG453, TSR-022 или LY3321367;

iii. ингибитора LAG-3, где ингибитор LAG-3 необязательно выбран из LAG525, BMS-986016, TSR-033, MK-4280 или REGN3767;

iv. агониста GITR, где агонист GITR необязательно выбран из GWN323, BMS-986156, MK-4166, MK-1248, TRX518, INCAGN1876, AMG 228 или INBRX-110;

v. молекулы полиспецифического антитела к CD3, где молекула полиспецифического антитела к CD3 необязательно представляет собой молекулу биспецифического антитела к CD3 и CD123 (например, XENP14045) или молекулу биспецифического антитела к CD3 и CD20 (например, XENP13676);

vi. молекулы цитокина, где молекула цитокина необязательно представляет собой IL-15 в комплексе с растворимой формой альфа-субъединицы рецептора IL-15 (IL-15Ra);

vii. ингибитора макрофагального колониестимулирующего фактора (M-CSF), где ингибитор M-CSF необязательно представляет собой MCS110;

viii. ингибитора CSF-1R, где ингибитор CSF-1R необязательно представляет собой BLZ945;

ix. ингибитора индоламин-2,3-диоксигеназы (IDO) и/или триптофан-2,3-диоксигеназы (TDO);

x. ингибитора TGF-β;

xi. онколитического вируса;

xii. средства терапии на основе T-клеток с химерным антигенным рецептором (CAR).

В некоторых вариантах осуществления по меньшей мере одно дополнительное терапевтическое средство выбрано из: 1) ингибитора протеинкиназы C (PKC); 2) ингибитора белка теплового шока 90 (HSP90); 3) ингибитора фосфоинозитид-3-киназы (PI3K) и/или мишени рапамицина (mTOR); 4) ингибитора цитохрома P450 (например, ингибитора CYP17 или ингибитора 17-альфа-гидроксилазы/C17-20-лиазы); 5) железохелатирующего средства; 6) ингибитора ароматазы; 7) ингибитора р53, например, ингибитора взаимодействия р53/Mdm2; 8) индуктора апоптоза; 9) ингибитора ангиогенеза; 10) ингибитора альдостеронсинтазы; 11) ингибитора рецептора Smoothened (SMO); 12) ингибитора рецептора пролактина (PRLR); 13) ингибитора сигнального пути Wnt; 14) ингибитора CDK4/6; 15) ингибитора рецептора 2 фактора роста фибробластов (FGFR2)/рецептора 4 фактора роста фибробластов (FGFR4); 16) ингибитора макрофагального колониестимулирующего фактора (M-CSF); 17) ингибитора одного или нескольких из c-KIT, высвобождения гистамина, Flt3 (например, FLK2/STK1) или PKC; 18) ингибитора одного или нескольких из VEGFR-2 (например, FLK-1/KDR), PDGFR-бета, c-KIT или Raf-киназы C; 19) агониста соматостатина и/или ингибитора высвобождения гормона роста; 20) ингибитора киназы анапластической лимфомы (ALK); 21) ингибитора рецептора инсулиноподобного фактора роста 1 (IGF-1R); 22) ингибитора P-гликопротеина 1; 23) ингибитора рецептора фактора роста эндотелия сосудов (VEGFR); 24) ингибитора киназы BCR-ABL; 25) ингибитора FGFR; 26) ингибитора CYP11B2; 27) ингибитора HDM2, например, ингибитора взаимодействия HDM2-p53; 28) ингибитора тирозинкиназы; 29) ингибитора c-MET; 30) ингибитора JAK; 31) ингибитора DAC; 32) ингибитора 11β-гидроксилазы; 33) ингибитора IAP; 34) ингибитора PIM-киназы; 35) ингибитора поркупина; 36) ингибитора BRAF, например, BRAF V600E или BRAF дикого типа; 37) ингибитора HER3; 38) ингибитора MEK; 39) ингибитора липидкиназы или одного или нескольких средств, приведенных в таблице 16.

В некоторых вариантах осуществления антитело или антигенсвязывающий фрагмент, нуклеиновую кислоту или набор нуклеиновых кислот, вектор, клетку или фармацевтическую композицию вводят параллельно с по меньшей мере одним дополнительным терапевтическим средством, до него или после него.

В некоторых вариантах осуществления введение антитела или антигенсвязывающего фрагмента, нуклеиновой кислоты или набора нуклеиновых кислот, вектора, клетки или фармацевтической композиции обеспечивает один или несколько из следующих эффектов:

(a) увеличение количества CD45+ CD4- CD8+ CD69+ CD25+ клеток в очаге опухоли или поражения у субъекта;

(b) увеличение количества CD45+ CD8- CD4+ FOXP3- CD69+ CD25+ клеток в очаге опухоли или поражения у субъекта;

(c) уменьшение уровня MCP1 или IL-1β в плазме крови субъекта или

(d) увеличение уровня MCP1 в очаге опухоли или поражения у субъекта.

В другом аспекте в данном документе предусмотрено применение антитела или его антигенсвязывающего фрагмента, описанных в данном документе, нуклеиновой кислоты, кодирующей такие антитело или его антигенсвязывающий фрагмент, вектора или клетки, содержащих такую нуклеиновую кислоту, или фармацевтической композиции, содержащей такие антитело или его антигенсвязывающий фрагмент, нуклеиновую кислоту, вектор или клетку, в изготовлении лекарственного препарата для лечения рака.

В другом аспекте в данном документе предусмотрены способы лечения рака у субъекта, нуждающегося в этом, при этом такой способ включает введение субъекту терапевтически эффективного количества антитела к ENTPD2 человека или антигенсвязывающего фрагмента, описанных в данном документе, в комбинации со вторым терапевтическим средством, выбранным из ингибитора PD-1 или ингибитора PD-L1.

В другом аспекте в данном документе предусмотрены способы стимуляции иммунного ответа у субъекта, при этом такой способ включает введение субъекту терапевтически эффективного количества антитела к ENTPD2 человека или антигенсвязывающего фрагмента, описанных в данном документе, в комбинации со вторым терапевтическим средством, выбранным из ингибитора PD-1 или ингибитора PD-L1.

В другом аспекте в данном документе предусмотрены композиции, содержащие антитело к ENTPD2 человека или антигенсвязывающий фрагмент, описанные в данном документе, для применения в комбинации со вторым терапевтическим средством, выбранным из ингибитора PD-1 или ингибитора PD-L1, в лечении рака у субъекта.

В другом аспекте в данном документе предусмотрены композиции, содержащие антитело к ENTPD2 человека или антигенсвязывающий фрагмент, описанные в данном документе, в комбинации со вторым терапевтическим средством, выбранным из ингибитора PD-1 или ингибитора PD-L1, для применения в лечении рака у субъекта.

В некоторых вариантах осуществления ингибитор PD-1 представляет собой антитело к PD-1. В некоторых вариантах осуществления ингибитор PD-1 выбран из PDR001, ниволумаба, пембролизумаба, пидилизумаба, MEDI0680, REGN2810, TSR-042, PF-06801591 или AMP-224.

В некоторых вариантах осуществления ингибитор PD-L1 представляет собой антитело к PD-L1. В некоторых вариантах осуществления ингибитор PD-L1 выбран из FAZ053, атезолизумаба, авелумаба, дурвалумаба или BMS-936559.

В некоторых вариантах осуществления рак представляет собой ENTPD2+ рак. В некоторых вариантах осуществления рак представляет собой рак ободочной и прямой кишки (CRC), рак желудка (например, аденокарциному желудка, карциному желудка), рак пищевода (например, плоскоклеточную карциному пищевода (ESCC)), рак легкого (например, мелкоклеточный рак легкого), рак молочной железы (например, аденокарциному молочной железы) или рак яичника.

Все публикации, патенты и номера доступа, упомянутые в данном документе, включены в данный документ посредством ссылки во всей своей полноте, как если бы каждая отдельная публикация или патент были конкретно и отдельно указаны как включенные посредством ссылки.


На фиг. 1A изображена экспрессия ENTPD2 в иллюстративных линиях раковых клеток, определенная с помощью проточной цитометрии. Фиг. 1B представляет собой таблицу (таблицу 20), в которой показана плотность рецепторов ENTPD2 в иллюстративных линиях раковых клеток.

На фиг. 2 изображены иллюстративные изображения IHC-окрашивания на ENTPD2 в фиксированных в формалине и залитых в парафин тканях первичных опухолей ободочной и прямой кишки, пищевода и яичника.

На фиг. 3A показаны аминокислотные последовательности тяжелой цепи (SEQ ID NO: 330) и легкой цепи (SEQ ID NO: 334) FAb22 антитела к ENTPD2 человека, при этом CDR подчеркнуты (согласно определению по Kabat), и остатки, расположенные в области контакта антитела и антигена, отмечены в каждом Fab как (*). На фиг. 3B показаны аминокислотные последовательности тяжелой цепи (SEQ ID NO: 336) и легкой цепи (SEQ ID NO: 239) FAb23 антитела к ENTPD2 человека, при этом CDR подчеркнуты (согласно определению по Kabat), и остатки, расположенные в области контакта антитела и антигена, отмечены как (*). На фиг. 3C показаны аминокислотные последовательности тяжелой цепи (SEQ ID NO: 338) и легкой цепи (SEQ ID NO: 340) FAb24 антитела к ENTPD2 мыши, при этом CDR подчеркнуты (согласно определению по Kabat), и остатки, расположенные в области контакта антитела и антигена, отмечены как (*).

На фиг. 4A показана аминокислотная последовательность рекомбинантного ENTPD2 человека (остатки 29-462, с мутацией Y350A), используемого в кристаллографических исследованиях (SEQ ID NO: 1014), при этом элементы вторичной структуры показаны ниже аминокислотной последовательности. Прямоугольниками представлены α-спирали, а стрелками представлены β-тяжи. Неотмеченные стрелки и прямоугольники, соответствующие разрывам при форматировании последовательности, являются смежными с предшествующими отмеченными структурными элементами. Неструктурированные области не указаны. Растворимый внеклеточный домен ENTPD2 человека охватывает остатки 29-462. В конструкции используются N-концевой пептид GP67, являющийся сигналом секреции (первые 38 остатков выделены серым цветом), с сайтом отщепления сигнального пептида после последнего остатка и C-концевая гексагистидиновая (SEQ ID NO: 1010) металлоаффинная метка для облегчения очистки. Asn129, Asn294, Asn378 и Asn443 представляют собой предсказанные сайты N-связанного гликозилирования, для которых наблюдается гликозилирование в кристаллических структурах и которые показаны курсивом. Asn64 также представляет собой предсказанный сайт N-связанного гликозилирования, не наблюдаемый в этих кристаллических структурах. Остатки, расположенные в области контакта антигена и Fab в комплексах FAb22 и FAb23, указаны соответственно символами (*) и (:) ниже аминокислотной последовательности. На фиг. 4B показана аминокислотная последовательность рекомбинантного ENTPD2 мыши (остатки 29-462), используемого в кристаллографических исследованиях (SEQ ID NO: 1015), при этом элементы вторичной структуры показаны ниже аминокислотной последовательности. Прямоугольниками представлены α-спирали, а стрелками представлены β-тяжи. Неотмеченные стрелки и прямоугольники, соответствующие разрывам строки, являются смежными с предшествующими отмеченными структурными элементами. Неструктурированные области не указаны. Зрелый ENTPD2 мыши начинается с Thr29. В конструкции используются N-концевой пептид GP67, являющийся сигналом секреции (остатки 1-38), с сайтом отщепления сигнального пептида после остатка 38 и C-концевая гексагистидиновая (SEQ ID NO: 1010) металлоаффинная метка для облегчения очистки. Asn129, Asn294, Asn378 и Asn443 представляют собой потенциальные сайты N-связанного гликозилирования, показанные курсивом. Остатки, расположенные в области контакта антигена и FAb24, указаны символом (#) под аминокислотной последовательностью.

На фиг. 5A показано графическое изображение кристаллической структуры апо-формы эктодомена ENTPD2 человека с показанными остатками 33-453. Две проекции повернуты друг к другу под углом в 90 градусов. Отмечены последовательные элементы вторичной структуры. Дисульфидные связи показаны квадратными скобками. Амино- и карбокси-концы отмечены как NT и CT соответственно. Мембранопроксимальная доля содержит как N-, так и C-конец (субдомен 1: Pro36-Ser161 и Lys427-Phe461) и заштрихована более темным цветом, чем мембранодистальная доля (субдомен 2: Gly162-Gln426). ATP-субстрат прочно связывается в междолевой щели. Местоположение ATP-связывающего участка проиллюстрировано на фиг. 5B. Показан аналог ATP AMP-PNP, наложенный на активный центр ENTPD2 человека, из коструктуры ENTPD2 крысы (PDB 3CJA).

На фиг. 6 проиллюстрирован общий вид FAb22 антитела к ENTPD2 человека в комплексе с ENTPD2 человека. Две проекции показаны на расстоянии в 90 градусов друг от друга. AMP-PNP смоделирован в активном центре ENTPD2 на основе наложения из коструктуры ENTPD2 крысы PDB 3CJA. Тяжелая цепь Fab заштрихована более темным цветом.

На фиг. 7 проиллюстрирован общий вид FAb23 антитела к ENTPD2 человека в комплексе с ENTPD2 человека. Две проекции показаны на расстоянии в 90 градусов друг от друга. AMP-PNP смоделирован в активном центре ENTPD2 на основе наложения из коструктуры ENTPD2 крысы PDB 3CJA. Тяжелая цепь Fab заштрихована более темным цветом.

На фиг. 8 проиллюстрирован общий вид FAb24 антитела к ENTPD2 мыши в комплексе с ENTPD2 мыши. AMP-PNP смоделирован в активном центре ENTPD2 на основе наложения из коструктуры ENTPD2 крысы PDB 3CJA. Тяжелая цепь Fab заштрихована более темным цветом.

Фиг. 9 представляет собой диаграмму, иллюстрирующую долговременную эффективность антитела mAb13 к ENTPD2 мыши в комбинации с Ab к PD-1 в сингенной модели опухоли из клеток B16LM3.

Фиг. 10A-10C представляют собой графики, иллюстрирующие эффективность антитела mAb13 к ENTPD2 мыши в комбинации с Ab к PD-1 в сингенной модели опухоли B16F10, связанную с увеличенным притоком активированных CD8+ и CD4+ T-клеток-хелперов в очаг опухоли в день 8 после обработки.

На фиг. 11A-11B изображено определение характеристик модели из клеток B16LM3 клона B5, сконструированной для экспрессии ENTPD2 человека, в которой иллюстрируется экспрессия ENTPD2 человека с помощью FACS in vitro и устойчивость экспрессии ENTPD2 человека в опухолях in vivo с помощью IHC с использованием Ab к CD39L1 человека от Novus (в разведении 1:40).

Фиг. 12A-12B представляют собой графики, иллюстрирующие дозозависимую эффективность антител mAb1 и mAb6 к ENTPD2 человека в комбинации с Ab к PD-1 в модели из клеток B16LM3 клона B5, сконструированной для экспрессии ENTPD2 человека.

Фиг. 13A-13B представляют собой точечные диаграммы, на которых показаны уровни IL-1b (фиг. 13A) и MCP-1 (фиг. 13B) в плазме крови после обработки с помощью антитела mAb1 к ENTPD2 человека или изотипического контроля в ксенотрансплантатной модели из клеток B16LM3 клона B5, сконструированной для экспрессии ENTPD2 человека, на мышах C57BL/6. Фиг. 13C-13D представляют собой точечные диаграммы, на которых показаны уровни IL-1β (фиг. 13C) и MCP-1 (фиг. 13D) в опухоли после обработки с помощью антитела mAb1 к ENTPD2 человека или изотипического контроля в ксенотрансплантатной модели из клеток B16LM3 клона B5, сконструированной для экспрессии ENTPD2 человека, на мышах C57BL/6.

Фиг. 14 представляет собой график, на котором показана эффективность антитела mAb1 к ENTPD2 в комбинации с антагонистом A2AR NIR178 in vivo в ксенотрансплантатной модели из клеток B16LM3, сконструированной для экспрессии ENTPD2 человека, на мышах C57BL/6.

Фиг. 15 представляет собой график, на котором показана иллюстративная активность Ab к ENTPD2 в биохимическом функциональном анализе ENTPD2 человека. Антитела mAb1, mAb17, mAb19 и mAb21 к ENTPD2 человека сильно ингибируют каталитическую активность рекомбинантного ENTPD2 человека.

На фиг. 16A-16B изображена иллюстративная активность Ab к ENTPD2 человека в функциональном анализе с использованием клеток NIH/3T3 или RKO, экспрессирующих ENTPD2 человека или макака-крабоеда.

На фиг. 17 изображен график, иллюстрирующий функциональную активность антител mAb13, mAb14, mAb15 к ENTPD2 мыши in vitro в функциональном анализе с использованием клеток NIH/3T3, экспрессирующих ENTPD2 мыши.


В данном документе предусмотрены антитела или их антигенсвязывающие фрагменты, например, моноклональные антитела или их антигенсвязывающие фрагменты, которые специфично связываются с эктоферментом эктонуклеозидтрифосфатдифосфогидролазой 2 (например, белком ENTPD2 человека). Антитела к ENTPD2 или их антигенсвязывающие фрагменты применимы для лечения заболеваний, ассоциированных с ENTPD2, таких как рак.


Используемая в описании и формуле изобретения форма единственного числа включает ссылки на форму множественного числа, если контекст явно не указывает на иное. Например, термин "клетка" включает множество клеток, в том числе их смеси.

Во всем данном описании и нижеследующей формуле изобретения, если контекст не требует иного, слово "содержать" и его варианты, такие как "содержит" и "содержащий", используются в данном документе в их открытом и неограничивающем смысле, если не указано иное.

При использовании в данном документе "состоящий из" исключает любые элемент, стадию или ингредиент, не указанные в аспекте, варианте осуществления и/или элементе формулы изобретения. При использовании в данном документе "состоящий по сути из" не исключает материалы или стадии, которые существенно не влияют на основные и новые характеристики аспекта, варианта осуществления и/или пункта формулы изобретения.

В каждом случае в данном документе любой из терминов "содержащий", "состоящий по сути из" и "состоящий из" может быть заменен любым из других двух терминов.

Все числовые обозначения, например, pH, температура, время, концентрация и молекулярная масса, в том числе диапазоны, являются приближенными значениями, которые варьируются в сторону (+) или (-) с шагом 0,1. Следует понимать, хотя это не всегда указано в явной форме, что всем числовым обозначениям предшествует термин "приблизительно". Также следует понимать, хотя это не всегда указано в явной форме, что реагенты, описанные в данном документе, представляют собой лишь примеры и что соответствующие им эквиваленты известны из уровня техники.

Как используется в данном документе, эктонуклеозидтрифосфатдифосфогидролаза 2 (ENTPD2) (также известная как белок 1, подобный антигену CD39, CD39-подобный белок 1, CD39L1, экто-ATP-дифосфогидролаза 2, экто-ATPаза, экто-ATPаза 2, экто-ATPDаза 2, NTPDаза-2, NTPDаза 2) относится к ферменту типа 2 из семейства эктонуклеозидтрифосфатдифосфогидролаз (E-NTPDаз), которое представляет собой семейство эктонуклеозидаз, гидролизующих 5'-трифосфаты. Фермент ENTPD2 кодируется геном ENTPD2. Ген ENTPD2 человека картирован на хромосоме в местоположении 9q34.3, и геномную последовательность гена ENTPD2 человека можно найти в GenBank под номером NC_000009.12. Последовательности мРНК и белка для вариантов транскриптов ENTPD2 человека можно найти в GenBank под следующими №№ доступа:

Изоформа 1: NM_203468.2 (мРНК) → NP_982293.1 (белок с 495 аминокислотами)

Изоформа 2: NM_001246.3 (мРНК) → NP_001237.1 (белок с 472 аминокислотами)

Эктонуклеозидтрифосфатдифосфогидролаза 2, изоформа 1 [Homo sapiens, NP_982293.1]


Эктонуклеозидтрифосфатдифосфогидролаза 2 Homo sapiens (ENTPD2), вариант транскрипта 1, мРНК [NM_203468.2]

1 ggctccccgc actctccggg tccacgcatc gtcctcccgc gcgcccgccc gcccatggcc

61 gggaaggtgc ggtcactgct gccgccgctg ctgctggccg ccgcgggcct cgccggcctc

121 ctactgctgt gcgtccccac ccgcgacgtc cgggagccgc ccgccctcaa gtatggcatc

181 gtcctggacg ctggttcttc acacacgtcc atgtttatct acaagtggcc ggcagacaag

241 gagaacgaca caggcattgt gggccagcac agctcctgtg atgttccagg tgggggcatc

301 tccagctatg cagacaaccc ttctggggcc agccagagtc ttgttggatg cctcgaacag

361 gcgcttcagg atgtgcccaa agagagacac gcgggcacac ccctctacct gggagccaca

421 gcgggtatgc gcctgctcaa cctgaccaat ccagaggcct cgaccagtgt gctcatggca

481 gtgactcaca cactgaccca gtaccccttt gacttccggg gtgcacgcat cctctcgggc

541 caggaagagg gggtgtttgg ctgggtgact gccaactacc tgctggagaa cttcatcaag

601 tacggctggg tgggccggtg gttccggcca cggaagggga cactgggggc catggacctg

661 gggggtgcct ctacccagat cacttttgag acaaccagtc cagctgagga cagagccagc

721 gaggtccagc tgcatctcta cggccagcac taccgagtct acacccacag cttcctctgc

781 tatggccgtg accaggtcct ccagaggctg ctggccagcg ccctccagac ccacggcttc

841 cacccctgct ggccgagggg cttttccacc caagtgctgc tcggggatgt gtaccagtca

901 ccatgcacca tggcccagcg gccccagaac ttcaacagca gtgccagggt cagcctgtca

961 gggagcagtg acccccacct ctgccgagat ctggtttctg ggctcttcag cttctcctcc

1021 tgccccttct cccgatgctc tttcaatggg gtcttccagc ccccagtggc tgggaacttt

1081 gtggccttct ctgccttctt ctacactgtg gactttttgc ggacttcgat ggggctgccc

1141 gtggccaccc tgcagcagct ggaggcagcc gcagtgaatg tctgcaacca gacctgggct

1201 cagctgcaag ctcgggtgcc agggcaacgg gcccgcctgg ccgactactg cgccggggcc

1261 atgttcgtgc agcagctgct gagtcgcggc tacggcttcg acgagcgcgc cttcggcggc

1321 gtgatcttcc agaagaaggc cgcggacact gcagtgggct gggcgctcgg ctacatgctg

1381 aacctgacca acctgatccc cgccgacccg ccggggctgc gcaagggcac agacttcagc

1441 tcctgggtcg tcctcctgct gctcttcgcc tccgcgctcc tggctgcgct tgtcctgctg

1501 ctgcgtcagg tgcactccgc caagctgcca agcaccattt aggggccgac gggggcagct

1561 gccccatccc tcccccaacc cctgtatccc caccccgtac tcccacccct cccacaaccc

1621 ctgtacctcc cacccctgta tccccacccc tccacccacc cctctcccaa cctctctccc

1681 cgcccctgta tcctgcattc ctccacccac cctctatccc ccaccgctcc accccaccac

1741 tgtcttctcc atccttccac cccaccctca gcgtctctgc ccctaaggca gcccaggaaa

1801 taggaactga gactctggta cccacaggag cctgggtggg caaagagcgc tcaatccagc

1861 tccttgaacc cctccagccc gcttcagcct gggcatcact gcaggccccg tgctcctcct

1921 cctcctcctc agggctgggt ctccagagag tggggccttg gtcctgagaa tcagccctta

1981 gaggctcctt ctgtgtagtc tgggtctgta ctggggaggg tcacagccca cgggctggca

2041 gccagcccag cacctacttg taaaaatttt gtaataaaaa gtttttccta gagacgtgaa

2101 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaa (SEQ ID NO: 292)

Эктонуклеозидтрифосфатдифосфогидролаза 2, изоформа 2 [Homo sapiens, NP_001237.1]


Эктонуклеозидтрифосфатдифосфогидролаза 2 Homo sapiens (ENTPD2), вариант транскрипта 2, мРНК [NM_001246.3]

1 ggctccccgc actctccggg tccacgcatc gtcctcccgc gcgcccgccc gcccatggcc

61 gggaaggtgc ggtcactgct gccgccgctg ctgctggccg ccgcgggcct cgccggcctc

121 ctactgctgt gcgtccccac ccgcgacgtc cgggagccgc ccgccctcaa gtatggcatc

181 gtcctggacg ctggttcttc acacacgtcc atgtttatct acaagtggcc ggcagacaag

241 gagaacgaca caggcattgt gggccagcac agctcctgtg atgttccagg tgggggcatc

301 tccagctatg cagacaaccc ttctggggcc agccagagtc ttgttggatg cctcgaacag

361 gcgcttcagg atgtgcccaa agagagacac gcgggcacac ccctctacct gggagccaca

421 gcgggtatgc gcctgctcaa cctgaccaat ccagaggcct cgaccagtgt gctcatggca

481 gtgactcaca cactgaccca gtaccccttt gacttccggg gtgcacgcat cctctcgggc

541 caggaagagg gggtgtttgg ctgggtgact gccaactacc tgctggagaa cttcatcaag

601 tacggctggg tgggccggtg gttccggcca cggaagggga cactgggggc catggacctg

661 gggggtgcct ctacccagat cacttttgag acaaccagtc cagctgagga cagagccagc

721 gaggtccagc tgcatctcta cggccagcac taccgagtct acacccacag cttcctctgc

781 tatggccgtg accaggtcct ccagaggctg ctggccagcg ccctccagac ccacggcttc

841 cacccctgct ggccgagggg cttttccacc caagtgctgc tcggggatgt gtaccagtca

901 ccatgcacca tggcccagcg gccccagaac ttcaacagca gtgccagggt cagcctgtca

961 gggagcagtg acccccacct ctgccgagat ctggtttctg ggctcttcag cttctcctcc

1021 tgccccttct cccgatgctc tttcaatggg gtcttccagc ccccagtggc tgggaacttt

1081 gtggccttct ctgccttctt ctacactgtg gactttttgc ggacttcgat ggggctgccc

1141 gtggccaccc tgcagcagct ggaggcagcc gcagtgaatg tctgcaacca gacctgggct

1201 cagcagctgc tgagtcgcgg ctacggcttc gacgagcgcg ccttcggcgg cgtgatcttc

1261 cagaagaagg ccgcggacac tgcagtgggc tgggcgctcg gctacatgct gaacctgacc

1321 aacctgatcc ccgccgaccc gccggggctg cgcaagggca cagacttcag ctcctgggtc

1381 gtcctcctgc tgctcttcgc ctccgcgctc ctggctgcgc ttgtcctgct gctgcgtcag

1441 gtgcactccg ccaagctgcc aagcaccatt taggggccga cgggggcagc tgccccatcc

1501 ctcccccaac ccctgtatcc ccaccccgta ctcccacccc tcccacaacc cctgtacctc

1561 ccacccctgt atccccaccc ctccacccac ccctctccca acctctctcc ccgcccctgt

1621 atcctgcatt cctccaccca ccctctatcc cccaccgctc caccccacca ctgtcttctc

1681 catccttcca ccccaccctc agcgtctctg cccctaaggc agcccaggaa ataggaactg

1741 agactctggt acccacagga gcctgggtgg gcaaagagcg ctcaatccag ctccttgaac

1801 ccctccagcc cgcttcagcc tgggcatcac tgcaggcccc gtgctcctcc tcctcctcct

1861 cagggctggg tctccagaga gtggggcctt ggtcctgaga atcagccctt agaggctcct

1921 tctgtgtagt ctgggtctgt actggggagg gtcacagccc acgggctggc agccagccca

1981 gcacctactt gtaaaaattt tgtaataaaa agtttttcct agagacgtga aaaaaaaaaa

2041 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaa (SEQ ID NO: 294)

Как используется в данном документе, белок ENTPD2 человека также охватывает белки, которые по всей своей длине характеризуются по меньшей мере приблизительно 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или 100% идентичностью последовательности с любой из изоформ ENTPD2. Последовательности белков ENTPD2 мыши, макака-крабоеда и других животных известны из уровня техники.

Используемый в данном документе термин "антитело" относится к последовательности белка или полипептида, полученной из молекулы иммуноглобулина, которая специфично связывается с антигеном. Антитела могут являться поликлональными или моноклональными, многоцепочечными или одноцепочечными или интактными иммуноглобулинами и могут быть получены из природных источников или из рекомбинантных источников. Например, встречающееся в природе антитело IgG может представлять собой гликопротеин, содержащий по меньшей мере две тяжелые (H) цепи и две легкие (L) цепи, соединенные между собой посредством дисульфидных связей. Каждая тяжелая цепь состоит из вариабельной области тяжелой цепи (сокращенно обозначаемой в данном документе как VH) и константной области тяжелой цепи. Константная область тяжелой цепи состоит из трех доменов - CH1, CH2 и CH3. Каждая легкая цепь состоит из вариабельной области легкой цепи (сокращенно обозначаемой в данном документе как VL) и константной области легкой цепи. Константная область легкой цепи состоит из одного домена - CL. VH- и VL-области могут быть дополнительно подразделены на области гипервариабельности, называемые областями, определяющими комплементарность (CDR), которые чередуются с более консервативными областями, называемыми каркасными областями (FR). Каждая VH и VL состоит из трех CDR и четырех FR, расположенных от амино-конца к карбоксильному концу в следующем порядке: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Вариабельные области тяжелой и легкой цепей содержат связывающий домен, который взаимодействует с антигеном. Константные области антител могут опосредовать связывание иммуноглобулина с тканями или факторами хозяина, в том числе с различными клетками иммунной системы (например, эффекторными клетками) и первым компонентом (C1q) классического пути активации системы комплемента. Антитело может представлять собой моноклональное антитело, человеческое антитело, гуманизированное антитело, камелизированное антитело или химерное антитело. Антитела могут относиться к любому изотипу (например, IgG, IgE, IgM, IgD, IgA и IgY), классу (например, IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2) или подклассу.

Термин "фрагмент антитела" или "антигенсвязывающий фрагмент" относится к по меньшей мере одной части антитела, которая сохраняет способность специфично взаимодействовать (например, посредством связывания, стерического несоответствия, стабилизации/дестабилизации, пространственного распределения) с эпитопом антигена. Примеры фрагментов антител включают без ограничения Fab-, Fab'-, F(ab')2-, Fv-фрагменты, scFv-фрагменты антител, Fv, стабилизированные дисульфидными связями (sdFv), Fd-фрагмент, состоящий из VH- и CH1-доменов, линейные антитела, однодоменные антитела, такие как sdAb (либо VL, либо VH), VHH-домены верблюдовых, полиспецифические антитела, образованные из фрагментов антител, таких как бивалентный фрагмент, содержащий два Fab-фрагмента, связанных дисульфидным мостиком в шарнирной области, и выделенную CDR или другие эпитопсвязывающие фрагменты антитела. Антигенсвязывающий фрагмент также может быть включен в состав однодоменных антител, максиантител, миниантител, нанотел, интрател, диател, триател, тетрател, v-NAR и бис-scFv (см., например, Hollinger and Hudson, Nature Biotechnology 23:1126-1136, 2005). Антигенсвязывающие фрагменты также могут быть привиты на остовы на основе полипептидов, таких как фибронектин III типа (Fn3) (см. патент США № 6703199, в котором описаны миниантитела на основе полипептида фибронектина). Термин "scFv" относится к слитому белку, который содержит по меньшей мере один фрагмент антитела, содержащий вариабельную область легкой цепи, и по меньшей мере один фрагмент антитела, содержащий вариабельную область тяжелой цепи, где вариабельные области легкой и тяжелой цепей непрерывно связаны друг с другом, например, посредством синтетического линкера, например, короткого гибкого полипептидного линкера, и способны экспрессироваться в виде одноцепочечного полипептида, и где scFv сохраняет специфичность интактного антитела, из которого он получен. Если не указано иное, то используемый в данном документе scFv может иметь вариабельные VL- и VH-области в любом порядке, например, относительно N-конца и С-конца полипептида scFv может содержать VL-линкер-VH или может содержать VH-линкер-VL.

Используемые в данном документе термины "область, определяющая комплементарность" или "CDR" относятся к последовательностям аминокислот в пределах вариабельных областей антитела, которые придают специфичность к антигену и аффинность связывания. Например, как правило, три CDR находятся в каждой вариабельной области тяжелой цепи (например, HCDR1, HCDR2 и HCDR3), и три CDR находятся в каждой вариабельной области легкой цепи (например, LCDR1, LCDR2 и LCDR3). Точные границы аминокислотной последовательности указанной CDR можно определить с помощью любой из ряда широко известных схем, в том числе описанных в Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (схема нумерации "по Kabat"), Al-Lazikani et al., (1997) JMB 273, 927-948 (схема нумерации "по Chothia") или их комбинации и схемы нумерации ImMunoGenTics (IMGT) (Lefranc, M.-P., The Immunologist, 7, 132-136 (1999); Lefranc, M.-P. et al., Dev. Comp. Immunol., 27, 55-77 (2003) (схема нумерации "IMGT"). Согласно комбинированной схеме нумерации по Kabat и Chothia для указанной CDR-области (например, CDR1 HC, CDR2 HC, CDR3 HC, CDR1 LC, CDR2 LC или CDR3 LC) в некоторых вариантах осуществления CDR соответствуют аминокислотным остаткам, которые определены как часть CDR по Kabat, вместе с аминокислотными остатками, которые определены как часть CDR по Chothia. Как используется в данном документе, CDR, определенные в соответствии со схемой нумерации "по Chothia", также иногда называют "гипервариабельными петлями".

Например, согласно Kabat аминокислотные остатки CDR в вариабельном домене тяжелой цепи (VH) нумеруются как 31-35 (HCDR1) (например, со вставкой(вставками) после положения 35), 50-65 (HCDR2) и 95-102 (HCDR3); и аминокислотные остатки CDR в вариабельном домене легкой цепи (VL) нумеруются как 24-34 (LCDR1) (например, со вставкой(вставками) после положения 27), 50-56 (LCDR2) и 89-97 (LCDR3). В качестве другого примера, согласно Chothia аминокислоты CDR в VH нумеруются как 26-32 (HCDR1) (например, со вставкой(вставками) после положения 31), 52-56 (HCDR2) и 95-102 (HCDR3); и аминокислотные остатки в VL нумеруются как 26-32 (LCDR1) (например, со вставкой(вставками) после положения 30), 50-52 (LCDR2) и 91-96 (LCDR3). При объединении определений CDR по Kabat и Chothia CDR содержат, например, аминокислотные остатки 26-35 (HCDR1), 50-65 (HCDR2) и 95-102 (HCDR3) в человеческой VH и аминокислотные остатки 24-34 (LCDR1), 50-56 (LCDR2) и 89-97 (LCDR3) в человеческой VL или состоят из них. Согласно IMGT аминокислотные остатки CDR в VH нумеруются как примерно 26-35 (CDR1), 51-57 (CDR2) и 93-102 (CDR3), и аминокислотные остатки CDR в VL нумеруются как примерно 27-32 (CDR1), 50-52 (CDR2) и 89-97 (CDR3) (нумерация "в соответствии с Kabat"). Согласно IMGT CDR-области антитела можно определять с помощью программы IMGT/DomainGap Align. Как правило, если конкретно не указано иное, молекулы антител могут содержать любую комбинацию из одной или нескольких CDR по Kabat и/или CDR по Chothia.

Термин "эпитоп" включает любую белковую детерминанту, способную специфично связываться с иммуноглобулином или иным образом взаимодействовать с молекулой. Эпитопные детерминанты обычно состоят из химически активных поверхностных групп молекул, таких как аминокислоты или углеводные или сахарные боковые цепи, и могут обладать специфическими характеристиками трехмерной структуры, а также специфическими характеристиками заряда. Эпитоп может быть "линейным" или "конформационным". Конформационные и линейные эпитопы отличаются тем, что связывание с первым, но не с последним, утрачивается в присутствии денатурирующих растворителей.

Термин "одновалентное антитело", используемый в данном документе, относится к антителу, которое связывается с одним эпитопом в молекуле-мишени.

Термин "двухвалентное антитело", используемый в данном документе, относится к антителу, которое связывается с двумя эпитопами в по меньшей мере двух идентичных молекулах-мишенях. Двухвалентное антитело может также перекрестно связывать молекулы-мишени друг с другом. "Двухвалентное антитело" также относится к антителу, которое связывается с двумя разными эпитопами в по меньшей мере двух идентичных молекулах-мишенях.

Термин "поливалентное антитело" относится к отдельной связывающей молекуле с "валентностью", превышающей единицу, где "валентность" описывается как количество антигенсвязывающих компонентов на молекулу конструкции антитела. Таким образом, отдельная связывающая молекула может связываться с более чем одним связывающим участком в молекуле-мишени. Примеры поливалентных антител включают без ограничения двухвалентные антитела, трехвалентные антитела, четырехвалентные антитела, пятивалентные антитела и т. п., равно как и биспецифические антитела и бипаратопные антитела. Например, в случае с ENTPD2 поливалентное антитело (например, бипаратопное антитело к ENTPD2) имеет связывающий компонент для двух доменов ENTPD2 соответственно.

Термин "поливалентное антитело" также относится к отдельной связывающей молекуле, которая имеет более одного антигенсвязывающего компонента для двух отдельных молекул-мишеней. Например, это относится к антителу, которое связывается с ENTPD2 (например, белком ENTPD2 человека) и второй молекулой-мишенью, отличной от ENTPD2. В одном варианте осуществления поливалентное антитело представляет собой четырехвалентное антитело, которое имеет четыре эпитопсвязывающих домена. Четырехвалентная молекула может быть биспецифической и двухвалентной для каждого связывающего участка в данной молекуле-мишени.

Термин "биспецифическое антитело", используемый в данном документе, относится к антителу, которое связывается с двумя или более разными эпитопами. В некоторых вариантах осуществления биспецифическое антитело связывается с двумя разными мишенями. В некоторых вариантах осуществления биспецифическое антитело связывается с двумя разными эпитопами в одной молекуле-мишени. Антитело, которое связывается с двумя разными эпитопами в одной молекуле-мишени, также известно как "бипаратопное антитело".

Фразы "моноклональное антитело" или "композиция на основе моноклональных антител", используемые в данном документе, относятся к полипептидам, в том числе антителам, биспецифическим антителам и т. д., которые имеют по существу идентичную аминокислотную последовательность или получены из одного и того же генетического источника. Данный термин также охватывает препараты на основе молекул антител одного молекулярного состава. Композиция на основе моноклональных антител проявляет один тип специфичности и аффинности связывания в отношении конкретного эпитопа.

Используемая в данном документе фраза "человеческое антитело" охватывает антитела, имеющие вариабельные области, в которых как каркасные области, так и CDR-области получены из последовательностей человеческого происхождения. Кроме того, если антитело содержит константную область, то константная область также получена из таких человеческих последовательностей, например, человеческих последовательностей зародышевого типа, или мутантных вариантов человеческих последовательностей зародышевого типа, или антитела, содержащего консенсусные последовательности каркасных областей, полученные в результате анализа последовательностей человеческих каркасных областей, например, как описано в Knappik, et al. (2000. J Mol Biol 296, 57-86). Структуры и местоположения вариабельных доменов иммуноглобулина, например, CDR, можно определить с помощью хорошо известных схем нумерации, например, схемы нумерации по Kabat, схемы нумерации по Chothia или комбинации схем нумерации по Kabat и Chothia и схемы нумерации ImMunoGenTics (IMGT) (см., например, Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services (1991), eds. Kabat et al.; Al Lazikani et al., (1997) J. Mol. Bio. 273:927-948; Kabat et al., (1991) Sequences of Proteins of Immunological Interest, 5th edit., NIH Publication no. 91-3242 U.S. Department of Health and Human Services; Chothia et al., (1987) J. Mol. Biol. 196:901-917; Chothia et al., (1989) Nature 342:877-883; Al-Lazikani et al., (1997) J. Mal. Biol. 273:927-948 и Lefranc, M.-P., The Immunologist, 7, 132-136 (1999); Lefranc, M.-P. et al., Dev. Comp. Immunol., 27, 55-77 (2003)).

Человеческие антитела по настоящему изобретению могут содержать аминокислотные остатки, которые не закодированы в человеческих последовательностях (например, мутации, введенные посредством случайного или сайт-специфического мутагенеза in vitro или благодаря соматическим мутациям in vivo, или консервативную замену, которая содействует стабильности или изготовлению). Однако подразумевается, что используемый в данном документе термин "человеческое антитело" не включает антитела, в которых последовательности CDR, полученные из последовательностей зародышевого типа от другого вида млекопитающего, такого как мышь, были привиты на последовательности человеческих каркасных областей.

Фраза "рекомбинантное человеческое антитело", используемая в данном документе, включает все человеческие антитела, полученные, экспрессированные, созданные или выделенные посредством рекомбинантных способов, такие как антитела, выделенные из животного (например, мыши), которое является трансгенным или трансхромосомным по генам человеческих иммуноглобулинов, или гибридомы, полученной из него, антитела, выделенные из клетки-хозяина, трансформированной для экспрессии человеческого антитела, например, из трансфектомы, антитела, выделенные из рекомбинантной комбинаторной библиотеки человеческих антител, и антитела, полученные, экспрессированные, созданные или выделенные с помощью любых других способов, которые включают сплайсинг всех последовательностей гена человеческого иммуноглобулина или их части с получением других последовательностей ДНК. Такие рекомбинантные человеческие антитела имеют вариабельные области, в которых каркасные области и CDR-области получены из последовательностей человеческого иммуноглобулина зародышевого типа. Однако в определенных вариантах осуществления такие рекомбинантные человеческие антитела могут быть подвергнуты мутагенезу in vitro (или, в случае использования животного, трансгенного по последовательностям человеческого Ig, соматическому мутагенезу in vivo), и, таким образом, аминокислотные последовательности VH- и VL-областей рекомбинантных антител представляют собой последовательности, которые, хотя и получены из человеческих последовательностей VH и VL зародышевого типа и являются родственными им, могут не существовать в естественных условиях в репертуаре человеческих антител зародышевого типа in vivo.

Термин "Fc-область", используемый в данном документе, относится к полипептиду, содержащему CH3, CH2 и по меньшей мере часть шарнирной области константного домена антитела. Fc-область может необязательно содержать CH4-домен, присутствующий в некоторых классах антител. Fc-область может содержать всю шарнирную область константного домена антитела. В одном варианте осуществления в настоящем изобретении предусмотрены Fc-область и CH1-область антитела. В одном варианте осуществления в настоящем изобретении предусмотрена CH3-область Fc-области антитела. В другом варианте осуществления в настоящем изобретении предусмотрены Fc-область, CH1-область и C-каппа/лямбда-область константного домена антитела. В одном варианте осуществления связывающая молекула по настоящему изобретению содержит константную область, например, константную область тяжелой цепи. В одном варианте осуществления такая константная область является модифицированной по сравнению с константной областью дикого типа. Иными словами, полипептиды по настоящему изобретению, раскрытые в данном документе, могут содержать изменения или модификации одного или нескольких из трех константных доменов тяжелой цепи (CH1, CH2 или CH3) и/или домена константной области легкой цепи (CL). Примеры модификаций включают добавления, делеции или замены одной или нескольких аминокислот в одном или нескольких доменах. Такие изменения могут быть включены с целью оптимизации эффекторной функции, периода полужизни и т. д.

Используемый в данном документе термин "аффинность" относится к силе взаимодействия между антителом и антигеном в отдельных антигенных сайтах. В пределах каждого антигенного сайта вариабельная область "плеча" антитела взаимодействует с антигеном посредством слабых сил нековалентного взаимодействия во многих сайтах; при этом чем больше взаимодействий, тем сильнее аффинность. Используемый в данном документе термин "высокая аффинность" в отношении антитела IgG или его фрагмента (например, Fab-фрагмента) относится к антителу, характеризующемуся нокдауном антигена-мишени, составляющим 10-8 M или меньше, 10-9 M или меньше, или 10-10 M, или 10-11 M или меньше, или 10-12 M или меньше, или 10-13 M или меньше. Однако, высокоаффинное связывание может варьироваться в случае с другими изотипами антител. Например, высокоаффинное связывание для изотипа IgM относится к антителу, которое характеризуется нокдауном, составляющим 10-7 M или меньше или 10-8 M или меньше.

Используемый в данном документе термин "авидность" относится к информативной мере общей стабильности или прочности комплекса антитело-антиген. Она контролируется тремя основными факторами: аффинностью антитела к эпитопу; валентностью как антигена, так и антитела; а также структурным расположением взаимодействующих частей. В конечном итоге данные факторы определяют специфичность антитела, другими словами, вероятность того, что конкретное антитело свяжется с определенным антигенным эпитопом.

Термин "специфичность связывания", используемый в данном документе, относится к способности отдельного антигенсвязывающего центра антитела вступать в реакцию с одной антигенной детерминантой, а не с другой антигенной детерминантой. Антигенсвязывающий центр антитела располагается в Fab-части молекулы и сформирован из гипервариабельных областей тяжелой и легкой цепей. Аффинность связывания антитела представляет собой силу реакции между одной антигенной детерминантой и одним антигенсвязывающим центром антитела. Она представляет собой сумму сил притяжения и отталкивания, действующих между антигенной детерминантой и антигенсвязывающим центром антитела.

Термин "лечить" или "лечение" относится как к терапевтическому лечению, так и к профилактическим или предупредительным мерам, где целью является предупреждение или замедление нежелательного физиологического изменения или нарушения. Для целей настоящего изобретения благоприятные или необходимые клинические результаты включают без ограничения выявляемое или невыявляемое ослабление симптомов, уменьшение степени выраженности заболевания, стабилизацию (т. е. отсутствие ухудшения) состояния заболевания, задержку или замедление прогрессирования заболевания, облегчение или смягчение болезненного состояния и ремиссию (частичную либо полную). "Лечение" может также означать продление выживаемости по сравнению с ожидаемой выживаемостью при отсутствии получения лечения. В других вариантах осуществления термины "лечить", "лечение" и "осуществление лечения" относятся к ингибированию прогрессирования пролиферативного нарушения физическим путем, например, посредством стабилизации различимого симптома, физиологическим путем, например, посредством стабилизации физического параметра, либо ими обоими. В других вариантах осуществления термины "лечить", "лечение" и "осуществление лечения" относятся к снижению или стабилизации размера опухоли или количества раковых клеток.

Термин "субъект" относится к животному, являющемуся человеком или отличному от человека, для которого проводят лечение в соответствии со способами по настоящему изобретению. Предусматриваются ветеринарные и неветеринарные пути применения. Данный термин включает без ограничения млекопитающих, например, людей, других приматов, свиней, грызунов, таких как мыши и крысы, кроликов, морских свинок, хомяков, коров, лошадей, кошек, собак, овец и коз. Типичные субъекты включают людей, сельскохозяйственных животных и домашних питомцев, таких как кошки и собаки. В некоторых вариантах осуществления субъектом является человек.

"Эффективное количество" относится к количеству, достаточному для достижения благоприятных или необходимых результатов. Например, терапевтическое количество представляет собой такое количество, при котором достигается необходимый терапевтический эффект. Данное количество может быть таким же, как и профилактически эффективное количество, которое представляет собой количество, необходимое для предупреждения начала проявления заболевания или симптомов заболевания, или отличным от него. Эффективное количество можно вводить посредством одного или нескольких введений, применений или доз. "Терапевтически эффективное количество" терапевтического соединения (т. е. эффективная доза) зависит от выбранных терапевтических соединений. Композиции можно вводить с частотой от одного или нескольких раз в день до одного или нескольких раз в неделю. Специалист в данной области поймет, что на дозу и временные рамки, требуемые для эффективного лечения субъекта, могут влиять определенные факторы, в том числе без ограничения тяжесть заболевания или нарушения, предыдущие виды лечения, общее состояние здоровья и/или возраст субъекта и наличие других заболеваний. Более того, лечение субъекта терапевтически эффективным количеством терапевтических соединений, описанных в данном документе, может включать одну процедуру лечения или курс лечения.

Термин "нуклеиновая кислота" или "полинуклеотид" относится к дезоксирибонуклеиновым кислотам (ДНК) или рибонуклеиновым кислотам (РНК) и их полимерам в однонитевой или двухнитевой форме. Термин "набор нуклеиновых кислот" может, например, включать отдельные выделенные нуклеиновые кислоты, кодирующие легкую цепь и тяжелую цепь антитела или домены биспецифического или полиспецифического антитела. Если конкретно не ограничено, термин охватывает нуклеиновые кислоты, содержащие известные аналоги природных нуклеотидов, которые имеют свойства связывания, подобные свойствам эталонной нуклеиновой кислоты, и метаболизируются способом, подобным способу для встречающихся в природе нуклеотидов. Если не указано иное, конкретная последовательность нуклеиновой кислоты также в неявной форме охватывает ее варианты с консервативными модификациями (например, с заменами кодонов вырожденными кодонами), аллели, ортологи, SNP и комплементарные последовательности, а также указанную в явной форме последовательность. В частности, замены вырожденными кодонами можно осуществлять посредством создания последовательностей, в которых в третьем положении одного или нескольких выбранных (или всех) кодонов произведена замена любым из канонических оснований и/или дезоксиинозиновыми остатками (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); и Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

Термины "пептид", "полипептид" и "белок" используются взаимозаменяемо и относятся к соединению, состоящему из аминокислотных остатков, ковалентно связанных пептидными связями. Белок или пептид должен содержать по меньшей мере две аминокислоты, и не установлено ограничение на максимальное количество аминокислот, которые может содержать последовательность белка или пептида. Полипептиды включают любой пептид или белок, содержащий две или более аминокислоты, соединенные друг с другом пептидными связями. Используемый в данном документе термин относится как к коротким цепям, которые также, как правило, называются в данной области техники, например, пептидами, олигопептидами и олигомерами, так и к более длинным цепям, которые обычно называются в данной области техники белками, которых существует множество типов. "Полипептиды" включают, например, среди прочего, биологически активные фрагменты, по существу гомологичные полипептиды, олигопептиды, гомодимеры, гетеродимеры, варианты полипептидов, модифицированные полипептиды, производные, аналоги, слитые белки. Полипептид включает природный пептид, рекомбинантный пептид или их комбинацию.

Термин "консервативные модификации последовательности" относится к аминокислотным модификациям, которые не оказывают значительного влияния на характеристики связывания антитела или фрагмента антитела, содержащих данную аминокислотную последовательность, или значительно не изменяют их. Такие консервативные модификации включают аминокислотные замены, добавления и делеции. Модификации могут быть введены в антитело или фрагмент антитела по настоящему изобретению с помощью стандартных методик, известных из уровня техники, таких как сайт-направленный мутагенез и ПЦР-опосредованный мутагенез. Консервативные аминокислотные замены представляют собой замены, при которых аминокислотный остаток заменяется аминокислотным остатком, имеющим сходную боковую цепь. Семейства аминокислотных остатков, имеющих сходные боковые цепи, были определены в уровне техники. Эти семейства включают аминокислоты с основными боковыми цепями (например, лизин, аргинин, гистидин), кислыми боковыми цепями (например, аспарагиновая кислота, глутаминовая кислота), незаряженными полярными боковыми цепями (например, глицин, аспарагин, глутамин, серин, треонин, тирозин, цистеин, триптофан), неполярными боковыми цепями (например, аланин, валин, лейцин, изолейцин, пролин, фенилаланин, метионин), бета-разветвленными боковыми цепями (например, треонин, валин, изолейцин) и ароматическими боковыми цепями (например, тирозин, фенилаланин, триптофан, гистидин).

Термины "гомологичный" или "идентичность" относятся к идентичности последовательностей субъединиц двух полимерных молекул, например, двух молекул нуклеиновой кислоты, таких как две молекулы ДНК или две молекулы РНК, или двух молекул полипептидов. Если положение субъединицы в обеих из двух молекул занимает одна и та же мономерная субъединица, например, если положение в каждой из двух молекул ДНК занято аденином, то они являются гомологичными или идентичными по данному положению. Гомология между двумя последовательностями находится в прямой зависимости от количества совпадающих или гомологичных положений; например, если половина (например, пять положений в полимере длиной десять субъединиц) положений в двух последовательностях являются гомологичными, то эти две последовательности являются гомологичными на 50%; если 90% положений (например, 9 из 10) являются совпадающими или гомологичными, то эти две последовательности являются гомологичными на 90%. Процент "идентичности последовательностей" можно определить путем сравнения двух оптимально выровненных последовательностей в пределах окна сравнения, при этом для оптимального выравнивания этих двух последовательностей фрагмент аминокислотной последовательности в окне сравнения может содержать добавления или делеции (например, гэпы или выступы) по сравнению с эталонной последовательностью (которая не содержит добавлений или делеций). Процент можно рассчитать путем определения количества положений, в которых в обеих последовательностях встречается идентичный аминокислотный остаток, с получением количества совпадающих положений, деления количества совпадающих положений на общее количество положений в окне сравнения и умножения результата на 100 с получением процента идентичности последовательностей. Результатом является процент идентичности рассматриваемой последовательности относительно запрашиваемой последовательности.

Термин "выделенный" означает измененный относительно природного состояния или извлеченный из него. Например, нуклеиновая кислота или пептид, в естественных условиях присутствующие в живом животном, не являются "выделенными", однако те же нуклеиновая кислота или пептид, частично или полностью отделенные от материалов, сопутствующих им в их природном состоянии, являются "выделенными". Выделенные нуклеиновая кислота или белок могут находиться в по существу очищенной форме или могут находиться в ненативной среде, такой как, например, клетка-хозяин. Выделенное антитело по существу не содержит других антител, имеющих другие типы антигенной специфичности (например, выделенное антитело, которое специфично связывается с ENTPD2, по существу не содержит антител, которые специфично связываются с антигенами, отличными от ENTPD2). Выделенное антитело, которое специфично связывается с молекулой-мишенью, может, однако, характеризоваться перекрестной реактивностью с теми же антигенами из других видов, например, выделенное антитело, которое специфично связывается с ENTPD2, может связываться с молекулами ENTPD2 из других видов. Более того, выделенное антитело может по существу не содержать других клеточного материала и/или химических веществ.

Если не указано иное, все технические и научные термины, используемые в данном документе, имеют то же значение, которое обычно понятно специалисту обычной квалификации в области техники, к которой относится настоящее изобретение. Хотя при осуществлении на практике настоящего изобретения можно применять способы и материалы, подобные или эквивалентные тем, которые описаны в данном документе, ниже описаны подходящие способы и материалы. Все публикации, заявки на патент, патенты и другие литературные источники, упомянутые в данном документе, включены посредством ссылки во всей своей полноте. В случае противоречия настоящее описание, включая определения, будет иметь преимущественную силу. Кроме того, материалы, способы и примеры являются исключительно иллюстративными и не предполагаются как ограничивающие.

Подробности одного или нескольких вариантов осуществления настоящего изобретения изложены в прилагаемых графических материалах и описании ниже. Другие признаки, цели и преимущества настоящего изобретения будут очевидны из описания и графических материалов, а также из формулы изобретения.

Антитела и их антигенсвязывающие фрагменты, которые специфично связываются с ENTPD2 человека

В одном аспекте в данном документе предусмотрены антитела или их антигенсвязывающие фрагменты, например, моноклональные антитела или их антигенсвязывающие фрагменты, которые специфично связываются с белком ENTPD2 ("антитела к ENTPD2 или антигенсвязывающие фрагменты" или "антитела против ENTPD2 или антигенсвязывающие фрагменты"). В некоторых вариантах осуществления в данном документе предусмотрены антитела или их антигенсвязывающие фрагменты, например, моноклональные антитела или их антигенсвязывающие фрагменты, которые специфично связываются с белком ENTPD2 человека ("человеческие антитела к ENTPD2 или антигенсвязывающие фрагменты" или "антитела к ENTPD2 человека или антигенсвязывающие фрагменты").

В некоторых вариантах осуществления антитела к ENTPD2 или их антигенсвязывающие фрагменты (например, антитела к ENTPD2 человека или антигенсвязывающие фрагменты), предусмотренные в данном документе, содержат CDR1 тяжелой цепи (HCDR1), CDR2 тяжелой цепи (HCDR2), CDR3 тяжелой цепи (HCDR3), а также CDR1 легкой цепи (LCDR1), CDR2 легкой цепи (LCDR2) и CDR3 легкой цепи (LCDR3). В некоторых вариантах осуществления антитела к ENTPD2 или антигенсвязывающие фрагменты (например, антитела к ENTPD2 человека или антигенсвязывающие фрагменты), предусмотренные в данном документе, содержат вариабельную область тяжелой цепи (VH), содержащую CDR1, CDR2 и CDR3, и вариабельную область легкой цепи (VL), содержащую CDR1, CDR2 и CDR3. В некоторых вариантах осуществления антитела к ENTPD2 или их антигенсвязывающие фрагменты (например, антитела к ENTPD2 человека или антигенсвязывающие фрагменты), предусмотренные в данном документе, содержат последовательность полноразмерной тяжелой цепи (HC) и последовательность полноразмерной легкой цепи (LC).

В таблице 1 перечислены последовательности иллюстративных антител к ENTPD2 или их антигенсвязывающих фрагментов, которые специфично связываются с белком ENTPD2 человека.

Таблица 1. Последовательности иллюстративных моноклональных антител (MAB) и фрагментов антител (FAB), которые связываются с ENTPD2 человека

Антитело MAB1 к ENTPD2 человека
Антитело MAB2 к ENTPD2 человека
Антитело MAB3 к ENTPD2 человека
Антитело MAB4 к ENTPD2 человека
Антитело MAB5 к ENTPD2 человека
Антитело MAB6 к ENTPD2 человека
Антитело MAB7 к ENTPD2 человека
Антитело MAB8 к ENTPD2 человека
Антитело MAB9 к ENTPD2 человека
Антитело MAB10 к ENTPD2 человека
Антитело MAB11 к ENTPD2 человека
Антитело MAB12 к ENTPD2 человека
Антитело MAB16 к ENTPD2 человека
Антитело MAB17 к ENTPD2 человека
Антитело MAB18 к ENTPD2 человека
Антитело MAB19 к ENTPD2 человека
Антитело MAB20 к ENTPD2 человека
Антитело MAB21 к ENTPD2 человека
FAB22 антитела к ENTPD2 человека
SEQ ID NO: 222 HCDR2 (Chothia) SYDGD
SEQ ID NO: 42 HCDR1 (комбинация) GYSITSGYYWN
SEQ ID NO: 54 LCDR2 (Chothia) AAS
SEQ ID NO: 55 LCDR3 (Chothia) SNEDPP
SEQ ID NO: 51 LCDR2 (комбинация) AASNLES
SEQ ID NO: 52 LCDR3 (комбинация) QQSNEDPPT
FAB23 антитела к ENTPD2 человека

В некоторых вариантах осуществления антитело или фрагмент антитела (например, антигенсвязывающий фрагмент) к ENTPD2 человека содержат VH-домен, имеющий аминокислотную последовательность любого VH-домена, описанного в таблице 1. Другие подходящие антитела или фрагменты антител (например, антигенсвязывающие фрагменты) к ENTPD2 человека могут содержать аминокислоты, которые были подвергнуты мутации, но при этом они характеризуются по меньшей мере 80-, 85-, 90-, 95-, 96-, 97-, 98- или 99-процентной идентичностью в VH-домене с VH-областями, показанными в последовательностях, описанных в таблице 1. В определенных вариантах осуществления в настоящем изобретении также предусмотрены антитела или фрагменты антител (например, антигенсвязывающие фрагменты), которые специфично связываются с ENTPD2 человека, где антитела или фрагменты антител (например, антигенсвязывающие фрагменты) содержат CDR VH, имеющую аминокислотную последовательность любой из CDR VH, перечисленных в таблице 1. В конкретных вариантах осуществления в настоящем изобретении предусмотрены антитела или фрагменты антител (например, антигенсвязывающие фрагменты), которые специфично связываются с ENTPD2 человека, содержащие одну, две, три, четыре, пять или больше CDR VH, имеющих аминокислотную последовательность любой из CDR VH, перечисленных в таблице 1 (или, в качестве альтернативы, состоящие из них).

В некоторых вариантах осуществления антитело или фрагмент антитела (например, антигенсвязывающий фрагмент) к ENTPD2 человека содержат VL-домен, имеющий аминокислотную последовательность любого VL-домена, описанного в таблице 1. Другие подходящие антитела или фрагменты антител (например, антигенсвязывающие фрагменты) к ENTPD2 человека могут содержать аминокислоты, которые были подвергнуты мутации, но при этом они характеризуются по меньшей мере 80-, 85-, 90-, 95-, 96-, 97-, 98- или 99-процентной идентичностью в VL-домене с VL-областями, показанными в последовательностях, описанных в таблице 1. В настоящем изобретении также предусмотрены антитела или фрагменты антител (например, антигенсвязывающие фрагменты), которые специфично связываются с ENTPD2 человека, при этом антитела или фрагменты антител (например, антигенсвязывающие фрагменты) содержат CDR VL, имеющую аминокислотную последовательность любой из CDR VL, перечисленных в таблице 1. В частности, в настоящем изобретении предусмотрены антитела или фрагменты антител (например, антигенсвязывающие фрагменты), которые специфично связываются с ENTPD2 человека, содержащие одну, две, три или больше CDR VL, имеющих аминокислотную последовательность любой из CDR VL, перечисленных в таблице 1 (или, в качестве альтернативы, состоящие из них).

Другие антитела или фрагменты антител (например, антигенсвязывающий фрагмент) к ENTPD2 человека, раскрытые в данном документе, содержат аминокислоты, которые были подвергнуты мутации, но при этом они характеризуются по меньшей мере 80-, 85-, 90-, 95-, 96-, 97-, 98- или 99-процентной идентичностью в CDR-областях с CDR-областями, показанными в последовательностях, описанных в таблице 1. В некоторых вариантах осуществления они содержат мутантные аминокислотные последовательности, в которых не более 1, 2, 3, 4 или 5 аминокислот были подвергнуты мутации в CDR-областях по сравнению с CDR-областями, показанными в последовательности, описанной в таблице 1.

В данном документе также предусмотрены последовательности нуклеиновых кислот, которые кодируют VH, VL, полноразмерную тяжелую цепь и полноразмерную легкую цепь антител и их антигенсвязывающих фрагментов, которые специфично связываются с ENTPD2 человека, например, последовательности нуклеиновых кислот из таблицы 1. Такие последовательности нуклеиновых кислот могут быть оптимизированы для экспрессии в клетках млекопитающих.

Другие антитела к ENTPD2 человека, раскрытые в данном документе, включают антитела, в которых аминокислоты или нуклеиновые кислоты, кодирующие аминокислоты, были подвергнуты мутации, но при этом они характеризуются по меньшей мере 80-, 85-, 90-, 95-, 96-, 97-, 98- или 99-процентной идентичностью с последовательностями, описанными в таблице 1. В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты содержат мутантные аминокислотные последовательности, где не более 1, 2, 3, 4 или 5 аминокислот были подвергнуты мутации в вариабельных областях по сравнению с вариабельными областями, показанными в последовательности, описанной в таблице 1, при этом они сохраняют по существу такую же терапевтическую активность.

Поскольку каждое предусмотренное антитело связывается с ENTPD2 человека, последовательности (аминокислотные последовательности и нуклеотидные последовательности, кодирующие аминокислотные последовательности) VH, VL, полноразмерной легкой цепи и полноразмерной тяжелой цепи можно подвергать "смешиванию и подбору" для создания других ENTPD2-связывающих антител, раскрытых в данном документе. Такие подвергнутые "смешиванию и подбору" ENTPD2-связывающие антитела можно тестировать с помощью анализов связывания, известных из уровня техники (например, разновидностей ELISA, анализов, описанных в иллюстративных примерах). В случае, когда цепи подвергают смешиванию и подбору, последовательность VH из конкретной пары VH/VL следует заменить структурно сходной последовательностью VH. Последовательность полноразмерной тяжелой цепи из конкретной пары полноразмерная тяжелая цепь/полноразмерная легкая цепь следует заменить структурно сходной последовательностью полноразмерной тяжелой цепи. Последовательность VL из конкретной пары VH/VL следует заменить структурно сходной последовательностью VL. Последовательность полноразмерной легкой цепи из конкретной пары полноразмерная тяжелая цепь/полноразмерная легкая цепь следует заменить структурно сходной последовательностью полноразмерной легкой цепи.

Соответственно, в одном варианте осуществления в настоящем изобретении предусмотрены выделенное моноклональное антитело или его антигенсвязывающий фрагмент, имеющие вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность, выбранную из любой из SEQ ID NOs: 10, 25, 33, 46, 70, 91, 115, 132, 145, 169, 225, 233, 241, 250, 264, 281, 328; и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность, выбранную из любой из SEQ ID NOs: 21, 29, 57, 64, 74, 78, 102, 125, 156, 178, 229, 237, 257, 268, 287, 332; где антитело специфично связывается с ENTPD2 человека.

В другом варианте осуществления в настоящем изобретении предусмотрены (i) выделенное моноклональное антитело, имеющее полноразмерную тяжелую цепь (HC), содержащую аминокислотную последовательность, выбранную из любой из SEQ ID NOs: 12, 27, 35, 48, 72, 93, 117, 134, 147, 171, 227, 235, 243, 252, 266, 283, 330; и полноразмерную легкую цепь (LC), содержащую аминокислотную последовательность, выбранную из любой из SEQ ID NOs: 23, 31, 59, 66, 76, 80, 104, 127, 158, 180, 231, 239, 259, 270, 289, 334; или (ii) функциональный белок, содержащий его антигенсвязывающую часть.

В другом варианте осуществления в настоящем изобретении предусмотрены антитела, связывающиеся с ENTPD2 человека, или их фрагменты антител, которые содержат CDR1, CDR2 и CDR3 тяжелой цепи и CDR1, CDR2 и CDR3 легкой цепи, описанные в таблице 1, или их комбинации. Аминокислотные последовательности CDR1 VH антител показаны под SEQ ID NOs: 1, 4, 6, 7, 37, 40, 42, 43, 82, 85, 87, 88, 106, 109, 111, 112, 136, 139, 141, 142, 160, 163, 165, 166, 185, 187, 188, 206, 207, 208, 213, 214, 215, 272, 275, 277. Аминокислотные последовательности CDR2 VH антител показаны под SEQ ID NOs: 2, 5, 8, 38, 41, 44, 83, 86, 89, 107, 110, 113, 129, 130, 131, 137, 140, 143, 161, 164, 167, 186, 189, 220, 222, 223, 245, 247, 248, 261, 273, 276, 279. Аминокислотные последовательности CDR3 VH антител показаны под SEQ ID NO: 3, 39, 68, 84, 108, 138, 162, 221, 246, 262, 277, 274, 9, 45, 69, 90, 114, 144, 168, 190, 224, 249, 263, 274, 280. Аминокислотные последовательности CDR1 VL антител показаны под SEQ ID NOs: 14, 17, 20, 50, 53, 56, 61, 62, 63, 95, 98, 101, 119, 122, 124, 149, 152, 155, 173, 175, 177, 198, 201, 254. Аминокислотные последовательности CDR2 VL антител показаны под SEQ ID NOs: 15, 18, 51, 54, 96, 99, 120, 150, 153, 199, 285, 286. Аминокислотные последовательности CDR3 VL антител показаны под SEQ ID NOs: 16, 19, 52, 55, 97, 100, 121, 123, 151, 154, 174, 176, 200, 255, 256.

С учетом того, что каждое из антител связывается с ENTPD2 человека и что специфичность связывания с антигеном обеспечивается преимущественно CDR1-, CDR2- и CDR3-областями, последовательности CDR1, CDR2 и CDR3 VH и последовательности CDR1, CDR2 и CDR3 VL можно подвергнуть "смешиванию и подбору" (т. е. CDR из различных антител можно подвергнуть смешиванию и подбору), при том что каждое антитело должно содержать CDR1, CDR2 и CDR3 VH и CDR1, CDR2 и CDR3 VL, для создания других антител, связывающихся с ENTPD2 человека, раскрытых в данном документе. Такие "подвергнутые смешиванию и подбору" ENTPD2-связывающие антитела можно тестировать с помощью анализов связывания, известных из уровня техники и описанных в разделе "Примеры" (например, разновидностей ELISA). В случае, когда последовательности CDR VH подвергают смешиванию и подбору, последовательность CDR1, CDR2 и/или CDR3 из конкретной последовательности VH следует заменить структурно сходной(сходными) последовательностью(последовательностями) CDR. Аналогичным образом, в случае, когда последовательности CDR VL подвергают смешиванию и подбору, последовательность CDR1, CDR2 и/или CDR3 из конкретной последовательности VL следует заменить структурно сходной(сходными) последовательностью(последовательностями) CDR. Специалисту обычной квалификации в данной области будет совершенно очевидно, что новые последовательности VH и VL можно создавать путем замены одной или нескольких последовательностей CDR-областей VH и/или VL структурно сходными последовательностями из последовательностей CDR, показанных в данном документе для моноклональных антител по настоящему изобретению.

Соответственно, в настоящем изобретении предусмотрены выделенное моноклональное антитело или его антигенсвязывающая область, содержащие CDR1 тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 1, 4, 6, 7, 37, 40, 42, 43, 82, 85, 87, 88, 106, 109, 111, 112, 136, 139, 141, 142, 160, 163, 165, 166, 182, 187, 188, 206, 207, 208, 213, 214, 215, 272, 275, 277; CDR2 тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 2, 5, 8, 38, 41, 44, 83, 86, 89, 107, 110, 113, 129, 130, 131, 137, 140, 143, 161, 164, 167, 183, 189, 220, 222, 223, 245, 247, 248, 261, 273, 276; CDR3 тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 3, 39, 68, 84, 108, 138, 162, 221, 246, 262, 277, 274, 9, 45, 69, 90, 114, 144, 168, 190, 224, 249, 263, 274, 280; CDR1 легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 14, 17, 20, 50, 53, 56, 61, 62, 63, 95, 98, 101, 119, 122, 124, 149, 152, 155, 173, 175, 177, 195, 201, 254; CDR2 легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 15, 18, 51, 54, 96, 99, 120, 150, 153, 196, 285, 286; и CDR3 легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 16, 19, 52, 55, 97, 100, 121, 123, 151, 154, 174, 176, 197, 255, 256; где антитело специфично связывается с ENTPD2 человека.

В определенных вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, представляет собой антитело или фрагмент антитела (например, антигенсвязывающий фрагмент), которые описаны в таблице 1.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат область 1, определяющую комплементарность, тяжелой цепи (HCDR1), содержащую аминокислотную последовательность под SEQ ID NO: 1, 4, 6 или 7; область 2, определяющую комплементарность, тяжелой цепи (HCDR2), содержащую аминокислотную последовательность под SEQ ID NO: 2, 5 или 8; область 3, определяющую комплементарность, тяжелой цепи (HCDR3), содержащую аминокислотную последовательность под SEQ ID NO: 3 или 9; область 1, определяющую комплементарность, легкой цепи (LCDR1), содержащую аминокислотную последовательность под SEQ ID NO: 14, 17 или 20; область 2, определяющую комплементарность, легкой цепи (LCDR2), содержащую аминокислотную последовательность под SEQ ID NO: 15 или 18; и область 3, определяющую комплементарность, легкой цепи (LCDR3), содержащую аминокислотную последовательность под SEQ ID NO: 16 или 19.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 1; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 2; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 3; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 14; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 15; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 4; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 5; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 3; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 17; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 18; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 19.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 6; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 2; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 3; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 14; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 15; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 7; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 8; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 9; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 20; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 18; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 37, 40, 42 или 43; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 38, 41 или 44; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 39 или 45; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 50, 53 или 56; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51 или 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52 или 55.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 37; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 38; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 39; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 50; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 40; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 41; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 39; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 53; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 55.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 42; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 38; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 39; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 50; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 43; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 44; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 45; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 56; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 37, 40, 42 или 43; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 38, 41 или 44; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 39 или 45; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 61, 62 или 63; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51 или 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52 или 55.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 37; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 38; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 39; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 61; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 40; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 41; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 39; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 62; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 55.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 42; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 38; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 39; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 61; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 43; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 44; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 45; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 63; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 37, 40, 42 или 43; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 38, 41 или 44; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 68 или 69; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 50, 53 или 56; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51 или 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52 или 55.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 37; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 38; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 68; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 50; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 40; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 41; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 68; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 53; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 55.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 42; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 38; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 68; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 50; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 43; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 44; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 69; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 56; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 82, 85, 87 или 88; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 83, 86 или 89; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 84 или 90; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 95, 98 или 101; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 96 или 99; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 97 или 100.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 82; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 83; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 84; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 95; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 96; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 97.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 85; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 86; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 84; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 98; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 99; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 100.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 87; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 83; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 84; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 95; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 96; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 97.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 88; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 89; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 90; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 101; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 99; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 97.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 106, 109, 111 или 112; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 107, 110 или 113; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 108 или 114; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 119, 122 или 124; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 99 или 120; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 121 или 123.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 106; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 107; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 108; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 119; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 120; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 121.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 109; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 110; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 108; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 122; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 99; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 123.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 111; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 107; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 119; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 120; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 121; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 108.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 112; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 113; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 114; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 124; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 99; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 121.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 106, 109, 111 или 112; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 129, 130 или 131; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 108 или 114; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 119, 122 или 124; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 99 или 120; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 121 или 123.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 106; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 129; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 108; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 119; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 120; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 121.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 109; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 130; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 108; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 122; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 99; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 123.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 111; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 129; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 108; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 119; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 120; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 121.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 112; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 131; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 114; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 124; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 99; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 121.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 136, 139, 141 или 142; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 137, 140 или 143; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 138 или 144; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 149, 152 или 155; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 150 или 153; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 151 или 154.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 136; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 137; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 138; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 149; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 150; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 151.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 139; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 140; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 138; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 152; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 153; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 154.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 141; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 137; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 138; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 149; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 150; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 151.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 142; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 143; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 144; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 155; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 153; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 151.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 160, 163, 165 или 166; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 161, 164 или 167; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 162 или 168; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 173, 175 или 177; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 150 или 153; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 174 или 176.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 160; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 161; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 162; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 173; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 150; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 174.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 163; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 164; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 162; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 175; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 153; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 176.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 165; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 161; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 162; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 173; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 150; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 174.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 166; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 167; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 168; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 177; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 153; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 174.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 37, 40, 42 или 43; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 220, 222 или 223; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 221 или 224; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 61, 62 или 63; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51 или 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52 или 55.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 37; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 220; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 221; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 61; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 40; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 222; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 221; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 62; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 55.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 42; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 220; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 221; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 61; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 43; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 223; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 224; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 63; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 37, 40, 42 или 43; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 220, 222 или 223; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 68 или 69; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 61, 62 или 63; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51 или 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52 или 55.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 37; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 220; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 68; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 61; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 40; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 222; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 68; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 62; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 55.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 42; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 220; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 68; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 61; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 51; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 43; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 223; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 69; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 63; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 54; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 52.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 1, 4, 6 или 7; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 245, 247 или 248; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 246 или 249; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 17, 20 или 254; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 15 или 18; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 255 или 256.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 1; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 245; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 246; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 254; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 15; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 255.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 4; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 247; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 246; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 17; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 18; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 256.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 6; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 254; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 246; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 254; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 15; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 255.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 7; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 248; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 249; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 20; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 18; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 255.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 1, 4, 6 или 7; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 247, 248 или 261; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 262 или 263; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 17, 20 или 254; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 15 или 18; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16 или 19.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 1; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 261; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 262; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 254; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 15; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 4; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 247; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 262; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 17; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 18; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 19.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 6; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 261; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 262; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 254; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 15; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 7; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 248; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 263; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 20; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 18; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 272, 275 или 278; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 273, 276 или 279; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 274, 277 или 280; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 17, 20 или 254; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 285 или 286; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16 или 19.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 272; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 273; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 274; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 254; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 285; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 275; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 276; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 274; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 17; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 286; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 19.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 277; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 273; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 274; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 254; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 285; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат HCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 278; HCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 279; HCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 280; LCDR1, содержащую аминокислотную последовательность под SEQ ID NO: 20; LCDR2, содержащую аминокислотную последовательность под SEQ ID NO: 286; и LCDR3, содержащую аминокислотную последовательность под SEQ ID NO: 16.

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 10 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 21 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 25 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 29 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 33 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 29 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 46 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 57 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 46 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 64 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 70 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 74 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 25 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 78 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 91 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 102 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 115 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 125 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 132 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 125 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 145 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 156 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 169 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 178 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 225 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 229 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 233 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 237 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 241 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 229 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 250 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 257 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 264 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 268 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело или его антигенсвязывающая область, которые специфично связываются с ENTPD2 человека, содержат вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность под SEQ ID NO: 281 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность под SEQ ID NO: 287 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 12 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 23 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 27 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 31 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 35 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 31 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 48 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 59 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 48 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 66 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 72 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 76 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 27 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 80 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 93 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 104 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 117 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 127 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 134 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 127 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 147 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 158 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 171 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую SEQ ID NO: 180 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 227 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 231 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 235 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 239 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 243 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 231 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 252 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 259 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 266 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 270 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления антитело, которое специфично связывается с ENTPD2 человека, содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 283 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации), и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 289 (или последовательность, на по меньшей мере приблизительно 90%, 95%, 99% или больше идентичную ей и/или имеющую одну, две, три или более замены, вставки, делеции или модификации).

В некоторых вариантах осуществления в настоящем изобретении предусмотрены антитело или его антигенсвязывающий фрагмент, которые связываются с белком ENTPD2 человека с константой диссоциации (KD), составляющей менее 10 нМ, например, с KD, составляющей менее 9 нМ, менее 8 нМ, менее 7 нМ, менее 6 нМ, менее 5 нМ, менее 4 нМ, менее 3 нМ, менее 2 нМ, менее 1 нМ, например, согласно измерению с помощью Biacore. В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, предусмотренные в данном документе, связываются с белком ENTPD2 человека с константой диссоциации (KD), составляющей менее 5 нМ, например, согласно измерению с помощью Biacore. В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, предусмотренные в данном документе, связываются с белком ENTPD2 человека с константой диссоциации (KD), составляющей менее 3 нМ, например, согласно измерению с помощью Biacore. В некоторых вариантах осуществления антитела или их антигенсвязывающие фрагменты, предусмотренные в данном документе, связываются с белком ENTPD2 человека с константой диссоциации (KD), составляющей менее 1 нМ, например, согласно измерению с помощью Biacore. В некоторых вариантах осуществления константу диссоциации антител или их антигенсвязывающих фрагментов, описанных в данном документе, для ENTPD2 человека измеряют с помощью Biacore при 25ºC.

В данном документе также предусмотрены антитела или их антигенсвязывающие фрагменты, которые специфично связываются с эпитопом в ENTPD2 человека, где эпитоп содержит по меньшей мере один (например, по меньшей мере два, по меньшей мере три, по меньшей мере четыре, по меньшей мере пять, по меньшей мере шесть, по меньшей мере семь, по меньшей мере восемь, по меньшей мере девять, по меньшей мере десять, по меньшей мере одиннадцать, по меньшей мере двенадцать, по меньшей мере тринадцать, по меньшей мере четырнадцать, по меньшей мере пятнадцать, по меньшей мере двадцать) из следующих остатков: His50, Asp76, Pro78, Gly79, Gly80, Tyr85, Asp87, Asn88, Gly91, Gln94, Ser95, Gly98, Glu101, Gln102, Gln105, Asp106, Arg245, Thr272, Gln273, Leu275, Asp278, Arg298, Ala347, Ala350, Thr351, Arg392, Ala393, Arg394 или Tyr398. В некоторых вариантах осуществления такие антитела или антигенсвязывающие фрагменты включают без ограничения MAb1, MAb2, MAb3, MAb7, MAb17, MAb19, MAb20, MAb21 и Fab23, раскрытые в таблице 1.

В данном документе также предусмотрены антитела или их антигенсвязывающие фрагменты, которые специфично связываются с эпитопом в ENTPD2 человека, где эпитоп содержит по меньшей мере один (например, по меньшей мере два, по меньшей мере три, по меньшей мере четыре, по меньшей мере пять, по меньшей мере шесть, по меньшей мере семь, по меньшей мере восемь, по меньшей мере девять, по меньшей мере десять, по меньшей мере одиннадцать, по меньшей мере двенадцать, по меньшей мере тринадцать, по меньшей мере четырнадцать, по меньшей мере пятнадцать, по меньшей мере двадцать) из следующих остатков: Gly79, Gln250, Leu253, Trp266, Arg268, Gly269, Phe270, Ser271, Thr272, Gln273, Val274, Leu275, Asp278, Arg298, Ser300, Ser302, Gly303, Thr380, Trp381, Ala382, Gly390, Gln391, Arg392, Ala393, Arg394 или Asp397. В некоторых вариантах осуществления такие антитела или антигенсвязывающие фрагменты включают без ограничения MAb4, MAb5, MAb6, MAb16, MAb18 и Fab22, раскрытые в таблице 1.

После определения необходимого эпитопа в антигене можно создавать антитела к этому эпитопу, например, с помощью методик, описанных в настоящем изобретении. В качестве альтернативы в ходе процесса разработки при создании антител и определения их характеристик может выясняться информация о необходимых эпитопах. На основании этой информации можно затем провести конкурентный скрининг антител в отношении связывания с одним и тем же эпитопом. Подход к достижению этого заключается в проведении исследований перекрестной конкуренции с целью обнаружения антител, которые конкурентно связываются друг с другом, например, антител, конкурирующих за связывание с антигеном. Высокопроизводительный способ "сортировки" антител на основании их перекрестной конкуренции описан в международной заявке на патент № WO 2003/48731. Как будет понятно специалисту в данной области, практически все, с чем может специфично связываться антитело, может представлять собой эпитоп. Эпитоп может содержать те остатки, с которыми связывается антитело.

В целом, антитела, специфичные в отношении конкретного антигена-мишени, будут преимущественно распознавать эпитоп в антигене-мишени в сложной смеси белков и/или макромолекул.

Области данного полипептида, которые содержат эпитоп, могут быть идентифицированы с помощью множества методик картирования эпитопов, хорошо известных из уровня техники. См., например, Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996, Humana Press, Totowa, N.J). Например, линейные эпитопы могут быть определены, например, посредством параллельного синтеза большого количества пептидов на твердых подложках, при этом пептиды соответствуют частям молекулы белка, и осуществления реакции пептидов с антителами, когда пептиды все еще прикреплены к подложкам. Такие методики известны из уровня техники и описаны, например, в патенте США. № 4708871; Geysen et al., (1984) Proc. Natl. Acad. Sci. USA 8:3998-4002; Geysen et al., (1985) Proc. Natl. Acad. Sci. USA 82:78-182; Geysen et al., (1986) Mol. Immunol. 23:709-715. Аналогичным образом, конформационные эпитопы без труда идентифицируют путем определения пространственной конформации аминокислот, как, например, с помощью рентгеновской кристаллографии и двумерного ядерного магнитного резонанса. См., например, Epitope Mapping Protocols выше. Антигенные области белков также могут быть идентифицированы с помощью стандартных графиков антигенности и гидропатичности, таких как графики, построенные с помощью, например, программы из системы программного обеспечения Omiga версии 1.0, доступной от Oxford Molecular Group. В этой компьютерной программе используются способ Хоппа-Вудса, Hopp et al., (1981) Proc. Natl. Acad. Sci USA 78:3824-3828; для определения профилей антигенности и методика Кайта-Дулиттла, Kyte et al., (1982) J. Mol. Biol. 157:105-132; для построения графиков гидропатичности.

Молекула антитела может представлять собой поликлональное или моноклональное антитело. Моноклональное антитело может быть получено с помощью гибридомной технологии или с помощью способов, в которых не используется гибридомная технология (например, рекомбинантных способов). В некоторых вариантах осуществления антитело может быть получено рекомбинантным путем, например, может быть получено с помощью фагового дисплея или с помощью комбинаторных способов.

Фаговый дисплей и комбинаторные способы для создания антител известны из уровня техники (как описано, например, в Ladner et al., патент США № 5223409; Kang et al., международная публикация № WO 92/18619; Dower et al., международная публикация № WO 91/17271; Winter et al., международная публикация WO 92/20791; Markland et al., международная публикация № WO 92/15679; Breitling et al., международная публикация WO 93/01288; McCafferty et al., международная публикация № WO 92/01047; Garrard et al., международная публикация № WO 92/09690; Ladner et al., международная публикация № WO 90/02809; Fuchs et al. (1991) Bio/Technology 9:1370-1372; Hay et al. (1992) Hum Antibod Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281; Griffiths et al. (1993) EMBO J 12:725-734; Hawkins et al. (1992) J Mol Biol 226:889-896; Clackson et al. (1991) Nature 352:624-628; Gram et al. (1992) PNAS 89:3576-3580; Garrard et al. (1991) Bio/Technology 9:1373-1377; Hoogenboom et al. (1991) Nuc Acid Res 19:4133-4137 и Barbas et al. (1991) PNAS 88:7978-7982).

В одном варианте осуществления антитело представляет собой полностью человеческое антитело (например, антитело, полученное в организме мыши, которая была модифицирована методами генной инженерии для продуцирования антитела из последовательности человеческого иммуноглобулина) или антитело, не являющееся человеческим, например, антитело грызуна (мыши или крысы), козы, примата (например, обезьяны), верблюда.

Антитело может представлять собой антитело, в котором вариабельная область или ее часть, например, CDR, получены в организме, отличном от человеческого, например, в организме крысы или мыши. Химерные антитела, антитела с привитыми CDR и гуманизированные антитела находятся в пределах объема настоящего изобретения. Антитела, полученные в организме, отличном от человеческого, например, в организме крысы или мыши, и затем подвергнутые модификации, например, в каркасной части вариабельной области или константной области, для уменьшения антигенности у человека, находятся в пределах объема настоящего изобретения.

Химерные и/или гуманизированные антитела могут быть сконструированы для минимизации иммунного ответа пациента-человека на антитела, продуцируемые у субъектов, отличных от человека, или полученные в результате экспрессии генов, кодирующих антитела, отличные от человеческих. Химерные антитела содержат вариабельную область антитела животного, отличного от человека, и константную область человеческого антитела. Такие антитела сохраняют специфичность связывания с эпитопом исходного моноклонального антитела, но могут быть менее иммуногенными при введении людям и, следовательно, с большей вероятностью будут переносимыми для пациента. Например, каждая из одной или всех (например, одной, двух или трех) вариабельных областей легкой(легких) цепи(цепей) и/или одной или всех (например, одной, двух или трех) вариабельных областей тяжелой(тяжелых) цепи(цепей) антитела мыши (например, моноклонального антитела мыши) могут быть соединены с человеческой константной областью, такой как без ограничения человеческая константная область IgG1. Химерные моноклональные антитела могут быть получены с помощью методик рекомбинантных ДНК, известных из уровня техники. Например, ген, кодирующий константную область молекулы антитела, отличного от человеческого, может быть заменен геном, кодирующим человеческую константную область (см. Robinson et al., PCT-публикация заявки на патент PCT/US86/02269; Akira, et al., заявка на европейский патент 184187; или Taniguchi, M., заявка на европейский патент 171496). Кроме того, другие подходящие методики, которые можно применять для получения химерных антител, описаны, например, в патентах США №№ 4816567; 4,978,775; 4975369 и 4816397.

Химерное антитело может быть дополнительно "гуманизировано" путем замены частей вариабельной области, не участвующих в связывании с антигеном, эквивалентными частями из человеческих вариабельных областей. Гуманизированные антитела содержат в вариабельной области тяжелой и/или легкой цепи одну или несколько человеческих каркасных областей вместе с областями, определяющими комплементарность (CDR), отличными от человеческих (например, из мыши, крысы или хомяка). В некоторых вариантах осуществления гуманизированное антитело содержит последовательности, являющиеся полностью человеческими, за исключением CDR-областей. Гуманизированные антитела, как правило, являются менее иммуногенными для людей по сравнению с негуманизированными антителами и, таким образом, обеспечивают благоприятные терапевтические эффекты в определенных ситуациях. Гуманизированные антитела к ENTPD2 могут быть получены с помощью способов, известных из уровня техники. См., например, Hwang et al., Methods 36:35, 2005; Queen et al., Proc. Natl. Acad. Sci. U.S.A. 86:10029-10033, 1989; Jones et al., Nature 321:522-25, 1986; Riechmann et al., Nature 332:323-27, 1988; Verhoeyen et al., Science 239:1534-36, 1988; Orlandi et al., Proc. Natl. Acad. Sci. U.S.A. 86:3833-3837, 1989; патенты США №№ 5225539; 5530101; 5585089; 5693761; 5693762 и 6180370; а также WO 90/07861.

Человеческие антитела к ENTPD2 могут быть получены с помощью способов, известных из уровня техники. Например, технологию "гуманиринга" применяют для превращения антител, отличных от человеческих, в сконструированные человеческие антитела. В публикации заявки на патент США № 20050008625 описан осуществляемый in vivo способ замены вариабельной области антитела, отличного от человеческого, человеческой вариабельной областью в антителе с сохранением тех же или обеспечением лучших характеристик связывания по сравнению с таковыми у антитела, отличного от человеческого. Способ основывается на определяемой эпитопом замене вариабельных областей эталонного антитела, отличного от человеческого, таковыми из полностью человеческого антитела. Полученное в результате человеческое антитело в целом является структурно неродственным эталонному антителу, отличному от человеческого, но связывается с тем же эпитопом в том же антигене, что и эталонное антитело. Вкратце, подход с последовательной определяемой эпитопом комплементарной заменой обеспечивается благодаря созданию в клетках конкуренции между "конкурентом" и библиотекой разнообразных гибридных форм эталонного антитела ("тестируемых антител") за связывание с антигеном, находящимся в ограниченных количествах, в присутствии репортерной системы, которая реагирует на связывание тестируемого антитела с антигеном. Конкурентом может быть эталонное антитело или его производное, такое как одноцепочечный Fv-фрагмент. Конкурентом также может быть природный или искусственный лиганд антигена, который связывается с тем же эпитопом, что и эталонное антитело. Единственные требования к конкуренту заключаются в том, чтобы он связывался с тем же эпитопом, что и эталонное антитело, и чтобы он конкурировал с эталонным антителом за связывание с антигеном. Тестируемые антитела имеют одну общую антигенсвязывающую V-область из эталонного антитела, отличного от человеческого, и другую V-область, отобранную случайным образом из иного источника, такого как репертуарная библиотека человеческих антител. Общая V-область из эталонного антитела служит в качестве указателя, располагая тестируемые антитела на одном и том же эпитопе в антигене и в одной и той же ориентации для того, чтобы отбор склонялся в сторону наиболее высокого качества связывания с антигеном относительно эталонного антитела.

Много типов репортерных систем можно применять для выявления необходимых взаимодействий между тестируемыми антителами и антигеном. Например, дополняющие друг друга репортерные фрагменты могут быть связаны соответственно с антигеном и тестируемым антителом для того, чтобы активация репортера при дополнении фрагментов происходила только тогда, когда тестируемое антитело связывается с антигеном. Если продукты слияния антитело-репортерный фрагмент и антиген-репортерный фрагмент экспрессируются совместно с конкурентом, то активация репортера становится зависимой от способности тестируемого антитела конкурировать с конкурентом, которая является пропорциональной аффинности тестируемого антитела в отношении антигена. Другие репортерные системы, которые можно применять, включают реактиватор самоингибируемой системы реактивации репортера (RAIR), раскрытый в заявке на патент США с регистрационным № 10/208730 (публикация № 20030198971), или систему конкурентной активации, раскрытую в заявке на патент США с регистрационным № 10/076845 (публикация № 20030157579).

При использовании системы последовательной определяемой эпитопом комплементарной замены проводят отбор для идентификации клеток, экспрессирующих одно тестируемое антитело вместе с конкурентом, антигеном и компонентами репортера. В этих клетках каждое тестируемое антитело конкурирует индивидуально с конкурентом за связывание с антигеном, находящимся в ограниченном количестве. Активность репортера является пропорциональной количеству антигена, связавшегося с тестируемым антителом, которое, в свою очередь, является пропорциональным аффинности тестируемого антитела в отношении антигена и стабильности тестируемого антитела. Тестируемые антитела изначально отбирают на основании их активности по сравнению с активностью эталонного антитела при экспрессии в качестве тестируемого антитела. Результатом первого цикла отбора является набор "гибридных" антител, каждое из которых состоит из одной и той же V-области, отличной от человеческой, из эталонного антитела и человеческой V-области из библиотеки, и каждое из которых связывается с тем же эпитопом в антигене, что и эталонное антитело. Одно или несколько гибридных антител, отобранных в первом цикле, будут характеризоваться аффинностью в отношении антигена, сравнимой с таковой у эталонного антитела или превышающей ее.

На второй стадии замены V-области человеческие V-области, отобранные на первой стадии, используют в качестве указателя для отбора человеческих заменяющих фрагментов для остальной части V-области эталонного антитела, отличного от человеческого, с использованием разнообразной библиотеки когнатных человеческих V-областей. Гибридные антитела, отобранные в первом цикле, также можно применять в качестве конкурентов для второго цикла отбора. Результатом второго цикла отбора является набор полностью человеческих антител, которые структурно отличаются от эталонного антитела, но которые конкурируют с эталонным антителом за связывание с одним и тем же антигеном. Некоторые из отобранных человеческих антител связываются с тем же эпитопом в том же антигене, что и эталонное антитело. Среди этих отобранных человеческих антител одно или несколько связываются с одним и тем же эпитопом с аффинностью, которая является сравнимой с таковой у эталонного антитела или превышает ее.

При использовании мышиного или химерного антитела к ENTPD2 можно получить человеческие антитела, которые связываются с ENTPD2 человека с такой же специфичностью связывания и такой же или лучшей аффинностью связывания. Кроме того, такие человеческие антитела к ENTPD2 также могут быть получены коммерческим путем от компаний, которые обычно производят человеческие антитела, например, KaloBios, Inc. (Маунтин-Вью, Калифорния).

В некоторых вариантах осуществления в настоящем изобретении предусмотрены антитело или его антигенсвязывающий фрагмент, которые связываются с белком ENTPD2 человека и модулируют одну или несколько форм активности/функций ENTPD2, например, ингибируют формы ферментативной активности ENTPD2 человека, например, на по меньшей мере 40%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 80% или по меньшей мере 90%. В некоторых вариантах осуществления ферментативную активность ENTPD2 человека измеряют с помощью анализа FRET in vitro, в котором измеряется гидролиз ATP до ADP под действием рекомбинантного ENTPD2 либо ENTPD2, экспрессирующегося на поверхности клеток.

В некоторых вариантах осуществления антитела к ENTPD2 человека или их антигенсвязывающие фрагменты, описанные в данном документе, ингибируют способность ENTPD2 к гидролизу аденозинтрифосфата (ATP). В некоторых вариантах осуществления способность ENTPD2 к гидролизу ATP измеряют с помощью анализа FRET in vitro, в котором измеряется гидролиз ATP до ADP под действием рекомбинантного ENTPD2 либо ENTPD2, экспрессирующегося на поверхности клеток.

В некоторых вариантах осуществления антитела к ENTPD2 человека или их антигенсвязывающие фрагменты, описанные в данном документе, препятствуют связыванию ATP с ENTPD2 или удерживают ATP в каталитическом домене ENTPD2. В некоторых вариантах осуществления препятствование связыванию ATP с ENTPD2 или удерживание ATP в каталитическом домене ENTPD2 измеряют с помощью анализа FRET in vitro, в котором измеряется гидролиз ATP до ADP под действием рекомбинантного ENTPD2 либо ENTPD2, экспрессирующегося на поверхности клеток.

Антитела и их антигенсвязывающие фрагменты, которые специфично связываются с ENTPD2 мыши

В данном документе также предусмотрены антитела или их антигенсвязывающие фрагменты, например, моноклональные антитела или их антигенсвязывающие фрагменты, которые специфично связываются с белком ENTPD2 мыши. В таблице 26 перечислены последовательности иллюстративных антител к ENTPD2 или их антигенсвязывающих фрагментов, которые специфично связываются с белком ENTPD2 мыши.

Таблица 26. Последовательности иллюстративных моноклональных антител (MAB) и фрагментов антител (FAB), которые связываются с ENTPD2 мыши

Антитело MAB13 к ENTPD2 мыши
Антитело MAB14 к ENTPD2 мыши
Антитело MAB15 к ENTPD2 мыши
FAB24 антитела к ENTPD2 мыши

В некоторых вариантах осуществления антитело или фрагмент антитела (например, антигенсвязывающий фрагмент) к ENTPD2 мыши содержат VH-домен, имеющий аминокислотную последовательность любого VH-домена, описанного в таблице 26. Другие подходящие антитела или фрагменты антител (например, антигенсвязывающие фрагменты) к ENTPD2 мыши могут содержать аминокислоты, которые были подвергнуты мутации, но при этом они характеризуются по меньшей мере 80-, 85-, 90-, 95-, 96-, 97-, 98- или 99-процентной идентичностью в VH-домене с VH-областями, показанными в последовательностях, описанных в таблице 26. В определенных вариантах осуществления в настоящем изобретении также предусмотрены антитела или фрагменты антител (например, антигенсвязывающие фрагменты), которые специфично связываются с ENTPD2 мыши, где антитела или фрагменты антител (например, антигенсвязывающие фрагменты) содержат CDR VH, имеющую аминокислотную последовательность любой из CDR VH, перечисленных в таблице 26. В конкретных вариантах осуществления в настоящем изобретении предусмотрены антитела или фрагменты антител (например, антигенсвязывающие фрагменты), которые специфично связываются с ENTPD2 мыши, содержащие одну, две, три, четыре, пять или больше CDR VH, имеющих аминокислотную последовательность любой из CDR VH, перечисленных в таблице 26 (или, в качестве альтернативы, состоящие из них).

В некоторых вариантах осуществления антитело или фрагмент антитела (например, антигенсвязывающий фрагмент) к ENTPD2 мыши содержат VL-домен, имеющий аминокислотную последовательность любого VL-домена, описанного в таблице 26. Другие подходящие антитела или фрагменты антител (например, антигенсвязывающие фрагменты) к ENTPD2 мыши могут содержать аминокислоты, которые были подвергнуты мутации, но при этом они характеризуются по меньшей мере 80-, 85-, 90-, 95-, 96-, 97-, 98- или 99-процентной идентичностью в VL-домене с VL-областями, показанными в последовательностях, описанных в таблице 26. В настоящем изобретении также предусмотрены антитела или фрагменты антител (например, антигенсвязывающие фрагменты), которые специфично связываются с ENTPD2 мыши, при этом антитела или фрагменты антител (например, антигенсвязывающие фрагменты) содержат CDR VL, имеющую аминокислотную последовательность любой из CDR VL, перечисленных в таблице 26. В частности, в настоящем изобретении предусмотрены антитела или фрагменты антител (например, антигенсвязывающие фрагменты), которые специфично связываются с ENTPD2 мыши, содержащие одну, две, три или больше CDR VL, имеющих аминокислотную последовательность любой из CDR VL, перечисленных в таблице 26 (или, в качестве альтернативы, состоящие из них).

Другие антитела или фрагменты антител (например, антигенсвязывающий фрагмент) к ENTPD2 мыши, раскрытые в данном документе, содержат аминокислоты, которые были подвергнуты мутации, но при этом они характеризуются по меньшей мере 80-, 85-, 90-, 95-, 96-, 97-, 98- или 99-процентной идентичностью в CDR-областях с CDR-областями, показанными в последовательностях, описанных в таблице 26. В некоторых вариантах осуществления они содержат мутантные аминокислотные последовательности, в которых не более 1, 2, 3, 4 или 5 аминокислот были подвергнуты мутации в областях CDR при сравнении с областями CDR, показанными в последовательности, описанной в таблице 26.

В данном документе также предусмотрены последовательности нуклеиновых кислот, которые кодируют VH, VL, полноразмерную тяжелую цепь и полноразмерную легкую цепь антител и их антигенсвязывающих фрагментов, которые специфично связываются с ENTPD2 мыши, например, последовательности нуклеиновых кислот из таблицы 26. Такие последовательности нуклеиновых кислот могут быть оптимизированы для экспрессии в клетках млекопитающих.

В данном документе также предусмотрены антитела или их антигенсвязывающие фрагменты, которые специфично связываются с эпитопом в ENTPD2 мыши, где эпитоп содержит по меньшей мере один (например, по меньшей мере два, по меньшей мере три, по меньшей мере четыре, по меньшей мере пять, по меньшей мере шесть, по меньшей мере семь, по меньшей мере восемь, по меньшей мере девять, по меньшей мере десять, по меньшей мере одиннадцать, по меньшей мере двенадцать, по меньшей мере тринадцать, по меньшей мере четырнадцать, по меньшей мере пятнадцать, по меньшей мере двадцать) из следующих остатков: Ser74, Cys75, Asp76, Tyr349, Tyr350, Asp353, Phe354, Thr357, Val358, Gly360, Gln385, Ala386, Arg387, Val388, Pro389, Gly390, Gln391, Thr393, Arg394 или Tyr398.

Каркасные области и сконструированные или модифицированные антитела

Антитело по настоящему изобретению также можно получить при использовании антитела, имеющего одну или несколько из последовательностей VH и/или VL, в качестве исходного материала для конструирования модифицированного антитела, при этом данное модифицированное антитело может иметь измененные свойства по сравнению с исходным антителом. Антитело может быть сконструировано посредством модификации одного или нескольких остатков в пределах одной или обеих вариабельных областей (т. е. VH и/или VL), например, в пределах одной или нескольких CDR-областей и/или в пределах одной или нескольких каркасных областей. Дополнительно или в качестве альтернативы, антитело может быть сконструировано посредством модификации остатков в пределах константной(константных) области(областей), например, для изменения эффекторной (эффекторных) функции (функций) антитела.

Один тип конструирования вариабельной области, который можно осуществлять, представляет собой прививание CDR. Антитела взаимодействуют с антигенами-мишенями преимущественно посредством аминокислотных остатков, которые расположены в шести областях, определяющих комплементарность (CDR), тяжелой и легкой цепей. По этой причине аминокислотные последовательности в пределах CDR являются более разнообразными среди отдельных антител, чем последовательности за пределами CDR. Поскольку последовательности CDR отвечают за большинство взаимодействий антитело-антиген, можно экспрессировать рекомбинантные антитела, которые имитируют свойства конкретных встречающихся в природе антител, посредством конструирования векторов экспрессии, которые содержат последовательности CDR из конкретного встречающегося в природе антитела, привитые на последовательности каркасных областей из другого антитела с другими свойствами (см., например, Riechmann, L. et al., 1998 Nature 332:323-327; Jones, P. et al., 1986 Nature 321:522-525; Queen, C. et al., 1989 Proc. Natl. Acad., U.S.A. 86:10029-10033; патент США № 5225539 авторства Winter и патенты США №№ 5530101; 5585089; 5693762 и 6180370 авторства Queen et al.).

Такие последовательности каркасных областей можно получить из общедоступных баз данных ДНК или опубликованных литературных источников, которые содержат последовательности генов антител зародышевого типа или перегруппированные последовательности антител. Например, последовательности ДНК зародышевого типа для генов вариабельной области человеческих тяжелой и легкой цепей можно найти в базе данных человеческих последовательностей зародышевого типа "VBase" (доступной в Интернете по адресу www.mrc-cpe.cam.ac.uk/vbase), а также в Kabat, E. A., et al., 1991 Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242; Tomlinson, I. M., et al., 1992 J. Mol. Biol. 227:776-798; и Cox, J. P. L. et al., 1994 Eur. J Immunol. 24:827-836. Например, последовательности ДНК зародышевого типа для генов вариабельной области человеческих тяжелой и легкой цепей и перегруппированные последовательности антител можно найти в базе данных "IMGT" (доступной в Интернете по адресу www.imgt.org; см. Lefranc, M.P. et al., 1999 Nucleic Acids Res. 27:209-212).

Примером последовательностей каркасных областей для применения в антителах и их антигенсвязывающих фрагментах по настоящему изобретению являются последовательности, которые являются структурно сходными с последовательностями каркасных областей, применяемыми в отобранных антителах и их антигенсвязывающих фрагментах по настоящему изобретению, например, консенсусные последовательности и/или последовательности каркасных областей, применяемые в моноклональных антителах по настоящему изобретению. Последовательности CDR1, 2 и 3 VH и последовательности CDR1, 2 и 3 VL могут быть привиты на каркасные области, которые имеют последовательность, идентичную той, что обнаруживается в гене иммуноглобулина зародышевого типа, из которого получена последовательность каркасной области, или последовательности CDR могут быть привиты на каркасные области, которые содержат одну или несколько мутаций по сравнению с последовательностями зародышевого типа. Например, было обнаружено, что в определенных случаях благоприятной является мутация остатков в пределах каркасных областей для сохранения или повышения способности антитела к связыванию с антигеном (см., например, патенты США №№ 5530101; 5585089; 5693762 и 6180370 авторства Queen et al.).

Другой тип модификации вариабельной области заключается в мутации аминокислотных остатков в пределах CDR1-, CDR2- и/или CDR3-областей VH и/или VL с улучшением таким образом одного или нескольких свойств связывания (например, аффинности) антитела, представляющего интерес, что известно как "созревание аффинности". Для введения мутации(мутаций) можно осуществлять сайт-направленный мутагенез или ПЦР-опосредованный мутагенез, и эффект в отношении связывания антитела или другого функционального свойства, представляющего интерес, можно оценивать в анализах in vitro или in vivo, описанных в данном документе и приведенных в разделе "Примеры". Можно вводить консервативные модификации (которые обсуждались выше). Мутации могут представлять собой аминокислотные замены, добавления или делеции. Более того, как правило, изменяют не более одного, двух, трех, четырех или пяти остатков в пределах CDR-области.

Можно использовать широкий спектр каркасных структур или остовов антител/иммуноглобулинов при условии, что полученный в результате полипептид содержит по меньшей мере одну связывающую область, которая специфично связывается с ENTPD2 (например, белком ENTPD2 человека). Такие каркасные структуры или остовы включают 5 основных идиотипов человеческих иммуноглобулинов, их антигенсвязывающих фрагментов и включают иммуноглобулины других видов животных, предпочтительно имеющие гуманизированные составляющие. Антитела с одной тяжелой цепью, такие как идентифицированные у верблюдовых, представляют особый интерес в этом отношении. Специалисты в данной области продолжают обнаруживать и разрабатывать новые каркасные структуры, остовы и фрагменты.

В одном аспекте настоящее изобретение относится к способу получения неиммуноглобулиновых антител с использованием неиммуноглобулиновых остовов, на которые можно привить CDR по настоящему изобретению. Можно использовать известные или будущие неиммуноглобулиновые каркасные структуры и остовы, при условии, что они содержат связывающую область, специфичную в отношении белка-мишени ENTPD2. Известные неиммуноглобулиновые каркасные структуры или остовы включают без ограничения фибронектин (Compound Therapeutics, Inc., Уолтем, Массачусетс), анкирин (Molecular Partners AG, Цюрих, Швейцария), доменные антитела (Domantis, Ltd., Кембридж, Массачусетс и Ablynx NV, Звейнарде, Бельгия), липокалин (Pieris Proteolab AG, Фрайзинг, Германия), небольшие модульные иммунофармацевтические средства (Trubion Pharmaceuticals Inc., Сиэтл, Вашингтон), максиантитела (Avidia, Inc., Маунтин-Вью, Калифорния), белок A (Affibody AG, Швеция) и аффилин (гамма-кристаллин или убиквитин) (Scil Proteins GmbH, Галле, Германия).

Фибронектиновые остовы имеют в своей основе домен фибронектина III типа (например, десятый модуль фибронектина III типа (10 домен Fn3)). Домен фибронектина III типа имеет 7 или 8 бета-тяжей, которые распределены между двумя бета-складчатыми слоями, которые сами упакованы внахлест друг с другом с образованием сердцевины белка и при этом дополнительно содержат петли (аналогичные CDR), которые соединяют бета-тяжи друг с другом и являются доступными для растворителя. По меньшей мере три такие петли присутствуют на каждом краю сэндвича из бета-складчатых слоев, где край представляет собой границу белка, перпендикулярную направлению бета-тяжей (см. патент США № 6818418). Эти остовы на основе фибронектина не относятся к иммуноглобулинам, хотя их общая укладка близко сходна с таковой у наименьшего функционального фрагмента антитела - вариабельной области тяжелой цепи, которая содержит полную антигенраспознающую единицу в IgG верблюда и ламы. Благодаря этой структуре неиммуноглобулиновое антитело имитирует свойства связывания с антигеном, которые являются сходными по своей природе и аффинности со свойствами антител. Эти остовы можно применять в стратегии случайного выбора и перетасовки петель in vitro, которая является сходной с процессом созревания аффинности антител in vivo. Эти молекулы на основе фибронектина можно применять в качестве остовов, при этом петлевые области молекулы могут быть заменены на CDR по настоящему изобретению с помощью стандартных методик клонирования.

Анкириновая технология основана на применении белков с модулями с анкириновыми повторами в качестве остовов для переноса вариабельных областей, которые можно применять для связывания с различными мишенями. Модуль с анкириновым повтором представляет собой полипептид из 33 аминокислот, состоящий из двух антипараллельных альфа-спиралей и бета-изгиба. Связывание вариабельных областей оптимизируют главным образом путем применения рибосомного дисплея.

Авимеры получают из природного белка, содержащего A-домен, такого как LRP-1. Эти домены используются по своей природе для белок-белковых взаимодействий, и у человека более 250 белков имеют в основе своей структуры A-домены. Авимеры состоят из ряда различных мономерных (2-10) "A-доменов", связанных посредством аминокислотных линкеров. Авимеры, которые могут связываться с антигеном-мишенью, можно создавать с помощью методики, описанной, например, в публикациях заявок на патент США №№ 20040175756; 20050053973; 20050048512 и 20060008844.

Аффинные лиганды-аффитела представляют собой небольшие простые белки, состоящие из трехспирального пучка на основе остова из одного из IgG-связывающих доменов белка A. Белок A представляет собой поверхностный белок бактерии Staphylococcus aureus. Этот доменный остов состоит из 58 аминокислот, 13 из которых выбраны случайным образом для создания библиотек аффител с большим количеством вариантов лигандов (см., например, патент США № 5831012). Молекулы аффител имитируют антитела, они имеют молекулярную массу 6 кДа в сравнении с молекулярной массой антител, которая составляет 150 кДа. Несмотря на свой небольшой размер, связывающий участок в молекулах аффител является сходным с таковым у антитела.

Антикалины представляют собой продукты, разработанные компанией Pieris ProteoLab AG. Их получают из липокалинов - широко распространенной группы небольших и устойчивых белков, которые обычно участвуют в физиологическом транспорте или запасании химически чувствительных или нерастворимых соединений. Несколько природных липокалинов встречаются в тканях или биологических жидкостях человека. Архитектура белков напоминает иммуноглобулины с гипервариабельными петлями поверх жесткого каркаса. Тем не менее, в противоположность антителам или их рекомбинантным фрагментам липокалины состоят из одной полипептидной цепи со 160-180 аминокислотными остатками, при этом они лишь незначительно превышают по размеру один домен иммуноглобулина. Набор из четырех петель, которые образуют связывающий карман, проявляет выраженную структурную пластичность и допускает наличие ряда боковых цепей. Таким образом, связывающий участок можно видоизменить с помощью фирменного способа для того, чтобы распознавать заданные молекулы-мишени различной формы с высокой аффинностью и специфичностью. Один белок из семейства липокалинов - билин-связывающий белок (BBP) из Pieris brassicae - применяли для разработки антикалинов посредством осуществления мутагенеза набора из четырех петель. Одним примером заявки на патент, в которой описываются антикалины, является PCT-публикация № WO 199916873.

Молекулы аффилинов представляют собой небольшие белки, отличные от иммуноглобулинов, которые разработаны с конкретными видами аффинности в отношении белков и малых молекул. Новые молекулы аффилинов можно очень быстро отобрать из двух библиотек, каждая из которых имеет в своей основе отличный от других каркасный белок человеческого происхождения. Молекулы аффилинов не проявляют какой-либо структурной гомологии с белками, представляющими собой иммуноглобулины. В настоящее время используется два аффилиновых остова, один из которых представляет собой гамма-кристаллин, являющийся структурным белком хрусталика глаза человека, а другой представляет собой белок из суперсемейства "убиквитинов". Оба человеческих остова являются весьма небольшими, проявляют стабильность при высоких температурах и являются наиболее устойчивыми к изменениям pH и денатурирующим средствам. Эта высокая стабильность в основном обусловлена развернутой бета-складчатой структурой белков. Примеры белков, полученных из гамма-кристаллина, описаны в WO 200104144, а примеры "убиквитиноподобных" белков описаны в WO 2004106368.

Миметики эпитопов белков (PEM) представляют собой циклические пептидоподобные молекулы среднего размера (MW 1-2 кДа), имитирующие бета-шпилечные вторичные структуры белков - основную вторичную структуру, участвующую в белок-белковых взаимодействиях.

Сконструированные антитела и их антигенсвязывающие фрагменты по настоящему изобретению включают те, в которых были осуществлены модификации в остатках каркасных областей в пределах VH и/или VL, например, для улучшения свойств антитела. Как правило, такие модификации каркасных областей осуществляют для уменьшения иммуногенности антитела. Например, один подход заключается в осуществлении "обратной мутации" одного или нескольких остатков каркасных областей с восстановлением соответствующей последовательности зародышевого типа. Более конкретно, антитело, которое подверглось соматической мутации, может содержать остатки каркасных областей, которые отличаются от последовательности зародышевого типа, из которой получено антитело. Такие остатки могут быть идентифицированы посредством сравнения последовательностей каркасных областей антитела с последовательностями зародышевого типа, из которых получено антитело. Для возвращения последовательностей каркасных областей к их конфигурации зародышевого типа можно осуществлять "обратные" соматические мутации с восстановлением последовательности зародышевого типа посредством, например, сайт-направленного мутагенеза. Также предполагается, что такие "подвергнутые обратной мутации" антитела охватываются настоящим изобретением.

Другой тип модификации каркасной области предусматривает мутацию одного или нескольких остатков в пределах каркасной области или даже в пределах одной или нескольких CDR-областей для удаления T-клеточных эпитопов со снижением таким образом потенциальной иммуногенности антитела. Данный подход также называется "деиммунизацией" и более подробно описан в публикации заявки на патент США № 20030153043 авторства Carr et al.

В качестве дополнения или альтернативы модификациям, осуществляемым в пределах каркасных или CDR-областей, антитела по настоящему изобретению можно конструировать таким образом, чтобы они содержали модификации в пределах Fc-области, как правило, для изменения одного или нескольких функциональных свойств антитела, таких как период полужизни в сыворотке крови, фиксация комплемента, связывание с Fc-рецептором и/или антигензависимая клеточная цитотоксичность. Кроме того, антитело по настоящему изобретению может быть химически модифицировано (например, к антителу могут быть присоединены один или несколько химических компонентов), или оно может быть модифицировано с изменением характера его гликозилирования, опять-таки для изменения одного или нескольких функциональных свойств антитела. Каждый из этих вариантов осуществления более подробно описан ниже. Нумерация остатков в Fc-области производится согласно EU-индексу по Kabat.

В одном варианте осуществления шарнирную область CH1 модифицируют таким образом, что изменяется число цистеиновых остатков в шарнирной области, например, увеличивается или уменьшается. Этот подход дополнительно описан в патенте США № 5677425 авторства Bodmer et al. Число цистеиновых остатков в шарнирной области CH1 изменяют, например, с целью облегчения сборки легких и тяжелых цепей или с целью увеличения или уменьшения стабильности антитела.

В другом варианте осуществления фрагмент Fc-шарнирная область антитела подвергают мутации для уменьшения биологического периода полужизни антитела. Более конкретно, одну или несколько аминокислотных мутаций вводят в область контакта между доменами CH2-CH3 фрагмента Fc-шарнирная область, вследствие чего антитело характеризуется нарушенным связыванием с белком A стафилококка (SpA) по сравнению со связыванием нативного домена Fc-шарнирная область с SpA. Этот подход описан более подробно в патенте США № 6165745 авторства Ward et al.

В другом варианте осуществления антитело модифицируют для увеличения его биологического периода полужизни. Возможны различные подходы. Например, можно вводить одну или несколько из следующих мутаций: T252L, T254S, T256F, как описано в патенте США № 6277375 авторства Ward. В качестве альтернативы для увеличения биологического периода полужизни антитело можно изменить в пределах CH1- или CL-области таким образом, чтобы оно содержало эпитоп связывания рецептора реутилизации, образованный двумя петлями CH2-домена Fc-области IgG, как описано в патентах США №№ 5869046 и 6121022 авторства Presta et al.

В одном варианте осуществления Fc-область изменяют посредством замены по меньшей мере одного аминокислотного остатка другим аминокислотным остатком с целью изменения эффекторных функций антитела. Например, одну или несколько аминокислот можно заменить другим аминокислотным остатком таким образом, чтобы антитело характеризовалось измененной аффинностью в отношении эффекторного лиганда, но сохраняло способность к связыванию с антигеном исходного антитела. Эффекторный лиганд, аффинность в отношении которого изменяют, может представлять собой, например, Fc-рецептор или компонент C1 системы комплемента. Этот подход описан более подробно в патентах США №№ 5624821 и 5648260, оба авторства Winter et al.

В другом варианте осуществления одну или несколько аминокислот, выбранных из аминокислотных остатков, можно заменить другим аминокислотным остатком таким образом, чтобы антитело характеризовалось измененным связыванием с C1q и/или сниженной или устраненной комплементзависимой цитотоксичностью (CDC). Этот подход описан более подробно в патенте США № 6194551 авторства Idusogie et al.

В другом варианте осуществления один или несколько аминокислотных остатков изменяют, чтобы таким образом изменить способность антитела к фиксации комплемента. Этот подход дополнительно описан в PCT-публикации WO 94/29351 авторства Bodmer et al.

В некоторых вариантах осуществления ENTPD2-связывающие антитела или их антигенсвязывающие фрагменты содержат константную область IgG1 человека. В некоторых вариантах осуществления константная область IgG1 человека включает в себя Fc-область.

В некоторых вариантах осуществления Fc-область ENTPD2-связывающих антител или их антигенсвязывающих фрагментов содержит одну или несколько мутаций, опосредующих сниженную или отсутствующую антителозависимую клеточную цитотоксичность (ADCC) или комплементзависимую цитотоксичность (CDC). В некоторых вариантах осуществления аминокислотные остатки L234 и L235 в константной области IgG1 заменены на A234 и A235. В некоторых вариантах осуществления аминокислотный остаток N267 в константной области IgG1 заменен на A267. В некоторых вариантах осуществления аминокислотные остатки D265 и P329 в константной области IgG1 заменены на A265 и A329. В определенных вариантах осуществления Fc-область необязательно содержит мутацию или комбинацию мутаций, придающие сниженную эффекторную функцию, выбранные из любой из D265A, P329A, P329G, N297A, D265A/P329A, D265A/N297A, L234/L235A, P329A/L234A/L235A, и P329G/L234A/L235A. В некоторых вариантах осуществления Fc-область содержит мутацию или комбинацию мутаций, придающие сниженную эффекторную функцию, выбранные из любой из D265A, P329A, P329G, N297A, D265A/P329A, D265A/N297A, L234/L235A, P329A/L234A/L235A, и P329G/L234A/L235A (все положения указаны согласно нумерации EU).

В еще одном варианте осуществления Fc-область модифицируют для увеличения способности антитела опосредовать антителозависимую клеточную цитотоксичность (ADCC) и/или для увеличения аффинности антитела в отношении Fc-гамма-рецептора посредством модификации одной или нескольких аминокислот. Этот подход дополнительно описан в PCT-публикации WO 00/42072 авторства Presta. Более того, связывающие участки в IgG1 человека для Fc-гамма RI, Fc-гамма RII, Fc-гамма RIII и FcRn были картированы, и были описаны варианты с улучшенным связыванием (см. Shields, R. L. et al., 2001 J. Biol. Chem. 276:6591-6604). Например, Fc-область может содержать мутацию или комбинацию мутаций, придающие увеличенную эффекторную функцию, выбранные из любой из S239D, I332E, A330L, S298A, E333A, E333S, K334A, K236A, K236W, F243L, P247I, D280H, K290S, R292P, S298D, S298V, Y300L, V305I, A339D, A339Q, A339T, P396L (все положения указаны согласно нумерации EU).

В еще одном варианте осуществления модифицируют характер гликозилирования антитела. Например, может быть получено агликозилированное антитело (т. е. антитело без гликозилирования). Характер гликозилирования можно изменять, например, для увеличения аффинности антитела в отношении антигена. Такие модификации углеводов можно осуществлять, например, посредством изменения одного или нескольких сайтов гликозилирования в пределах последовательности антитела. Например, можно произвести одну или несколько аминокислотных замен, которые приводят к устранению одного или нескольких сайтов гликозилирования в каркасной части вариабельной области, устраняя таким образом гликозилирование в этом сайте. Такое агликозилирование может увеличивать аффинность антитела в отношении антигена. Такой подход описан более подробно в патентах США №№ 5714350 и 6350861 авторства Co et al.

Дополнительно или в качестве альтернативы может быть получено антитело, которое характеризуется измененным типом гликозилирования, как, например, гипофукозилированное антитело, имеющее уменьшенные количества фукозильных остатков, или антитело, имеющее увеличенное содержание структур с остатком GlcNAc в точке ветвления. Было продемонстрировано, что такие измененные паттерны гликозилирования увеличивают способность антител к ADCC. Такие модификации углеводов можно осуществлять, например, посредством экспрессии антитела в клетке-хозяине с измененным механизмом гликозилирования. Клетки с измененным механизмом гликозилирования были описаны в уровне техники, и их можно использовать в качестве клеток-хозяев, в которых экспрессируются рекомбинантные антитела по настоящему изобретению, с получением таким образом антитела с измененным характером гликозилирования. Например, в EP 1176195 авторства Hang et al. описывается линия клеток с функциональным нарушением гена FUT8, который кодирует фукозилтрансферазу, вследствие чего антитела, экспрессирующиеся в такой линии клеток, демонстрируют гипофукозилирование. В PCT-публикации WO 03/035835 авторства Presta описывается вариант линии клеток CHO - клетки Lecl3 с пониженной способностью к присоединению фукозы к углеводам, связанным с Asn(297), что также приводит к гипофукозилированию антител, экспрессирующихся в такой клетке-хозяине (см. также Shields, R. L. et al., 2002 J. Biol. Chem. 277:26733-26740). В PCT-публикации WO 99/54342 авторства Umana et al. описываются линии клеток, сконструированные для экспрессии гликозилтрансфераз, модифицирующих гликопротеины (например, бета-(1,4)-N-ацетилглюкозаминилтрансферазы III (GnTIII)), благодаря чему антитела, экспрессирующиеся в сконструированных линиях клеток, демонстрируют увеличенное содержание структур с остатком GlcNAc в точке ветвления, что приводит к увеличению активности ADCC у антител (см. также Umana et al., 1999 Nat. Biotech. 17:176-180).

В некоторых вариантах осуществления антитело к ENTPD2 относится к изотипу IgG1 с одной или несколькими мутациями (например, по сравнению с Fc-областью дикого типа того же изотипа). В некоторых вариантах осуществления одна или несколько мутаций выбраны из N297A, N297Q (Bolt S et al. (1993) Eur J Immunol 23:403-411), D265A, L234A, L235A (McEarchern et al., (2007) Blood, 109:1185-1192), C226S, C229S (McEarchern et al., (2007) Blood, 109:1185-1192), P238S (Davis et al., (2007) J Rheumatol, 34:2204-2210), E233P, L234V (McEarchern et al., (2007) Blood, 109:1185-1192), P238A, A327Q, A327G, P329A (Shields RL. et al., (2001) J Biol Chem. 276(9):6591-604), K322A, L234F, L235E (Hezareh et al., (2001) J Viral 75, 12161-12168; Oganesyan et al., (2008). Acta Crystallographica 64, 700-704), P331S (Oganesyan et al., (2008) Acta Crystallographica 64, 700-704), T394D (Wilkinson et al. (2013) MAbs 5(3): 406-417), A330L, M252Y, S254T и/или T256E, где положение аминокислоты указано в соответствии с системой нумерации EU или Kabat. В определенных вариантах осуществления Fc-область дополнительно содержит аминокислотную делецию в положении, соответствующем глицину 236 в соответствии с системой нумерации EU или Kabat.

В некоторых вариантах осуществления антитело относится к изотипу IgG1 и имеет константную область тяжелой цепи, которая содержит мутацию C220S в соответствии с системой нумерации EU или Kabat.

В некоторых вариантах осуществления Fc-область содержит одну или несколько мутаций, выбранных из L234F, L235E, P331S, D265A и/или N297Q, в соответствии с системой нумерации EU или Kabat. В некоторых вариантах осуществления Fc-область содержит одну или несколько мутаций, выбранных из L234A, L235A, D265A, P329A, N297A, N297Q в соответствии с системой нумерации EU или Kabat.

В определенных вариантах осуществления антитело относится к изотипу IgG2. В некоторых вариантах осуществления антитело содержит константную область IgG2 человека. В некоторых вариантах осуществления константная область IgG2 человека включает в себя Fc-область. В некоторых вариантах осуществления Fc-область содержит одну или несколько модификаций. Например, в некоторых вариантах осуществления Fc-область содержит одну или несколько мутаций (например, по сравнению с Fc-областью дикого типа того же изотипа). В некоторых вариантах осуществления одна или несколько мутаций выбраны из V234A, G237A, P238S, H268A, H268E, H268Q, V309L, N297A, N297Q, V309L, A330S, P331S, C232S, C233S, M252Y, S254T, и/или T256E, где положение аминокислоты указано в соответствии с системой нумерации EU или Kabat.

В определенных вариантах осуществления антитело относится к изотипу IgG4. В некоторых вариантах осуществления антитело содержит константную область IgG4 человека. В некоторых вариантах осуществления константная область IgG4 человека включает в себя Fc-область. В некоторых вариантах осуществления Fc-область содержит одну или несколько модификаций. Например, в некоторых вариантах осуществления Fc-область содержит одну или несколько мутаций (например, по сравнению с Fc-областью дикого типа того же изотипа). В некоторых вариантах осуществления одна или несколько мутаций выбраны из E233P, F234V, L234A, L235A, G237A, E318A (Hutchins et al. (1995) Proc Natl Acad Sci USA, 92:11980-11984), S228P, L236E, S241P, L248E (Reddy et al., (2000) J Immunol,164:1925-1933; Angal et al., (1993) Mol Immunol. 30(1):105-8; US 8614299 B2), T394D, M252Y, S254T, T256E, N297A и/или N297Q, где положение аминокислоты указано в соответствии с системой нумерации EU или Kabat.

В некоторых вариантах осуществления Fc-область дополнительно содержит одну или несколько дополнительных мутаций, выбранных из M252Y, S254T и/или T256E, где положение аминокислоты указано в соответствии с системой нумерации EU или Kabat.

В некоторых вариантах осуществления один или несколько вариантов IgG1, описанных в данном документе, можно использовать в комбинации с мутацией A330L (Lazar et al., (2006) Proc Natl Acad Sci USA, 103:4005-4010) или одной или несколькими из мутаций L234F, L235E и/или P331S (Sazinsky et al., (2008) Proc Natl Acad Sci USA, 105:20167-20172), где положение аминокислоты указано в соответствии с системой нумерации EU или Kabat, для устранения активации комплемента. В некоторых вариантах осуществления варианты IgG, описанные в данном документе, можно использовать в комбинации с одной или несколькими мутациями для улучшения периода полужизни антитела в сыворотке крови человека (например, мутациями M252Y, S254T, T256E в соответствии с системой нумерации EU или Kabat) (Dall'Acqua et al., (2006) J Biol Chem, 281:23514-23524; и Strohl et al., (2009) Current Opinion in Biotechnology, 20:685-691).

В некоторых вариантах осуществления вариант IgG4 по настоящему изобретению можно использовать в комбинации с мутацией S228P в соответствии с системой нумерации EU или Kabat (Angal et al., (1993) Mol Immunol, 30:105-108) и/или с одной или несколькими мутациями, описанными в Peters et al., (2012) J Biol Chem. 13;287(29):24525-33) для улучшения стабилизации антитела.

В некоторых вариантах осуществления антитело имеет Fc-область, выбранную из Fc-области IgG2, Fc-области IgG4 или гибридной Fc-области IgG2/IgG4.

Антитела верблюдовых

У белков, представляющих собой антитела, полученные из представителей семейства, к которому относятся двугорбые верблюды и одногорбые верблюды (Camelus bactrianus и Camelus dromaderius), в том числе представителей из Нового Света, таких как виды лам (Lama pacos, Lama glama и Lama vicugna), были определены характеристики размера, сложности структуры и антигенности у субъектов-людей. В определенных антителах IgG из этого семейства млекопитающих, которые обнаруживаются в природе, отсутствуют легкие цепи, и, следовательно, они по своей структуре отличаются от типичной четырехцепочечной четвертичной структуры, имеющей две тяжелые и две легкие цепи, в антителах от других животных. См. PCT/EP93/02214 (WO 94/04678, опубликованная 3 марта 1994 г.).

Область антитела верблюдовых, которая представляет собой небольшой отдельный вариабельный домен, идентифицированный как VHH, можно получить с помощью генной инженерии с получением небольшого белка, характеризующегося высокой аффинностью в отношении мишени, что дает в результате полученный из антитела низкомолекулярный белок, известный как "нанотело верблюдовых". См. патент США № 5759808, выданный 2 июня 1998 г.; см. также Stijlemans, B. et al., 2004 J Biol Chem 279: 1256-1261; Dumoulin, M. et al., 2003 Nature 424: 783-788; Pleschberger, M. et al. 2003 Bioconjugate Chem 14: 440-448; Cortez-Retamozo, V. et al. 2002 Int J Cancer 89: 456-62; и Lauwereys, M. et al. 1998 EMBO J 17: 3512-3520. Сконструированные библиотеки антител и фрагментов антител верблюдовых являются коммерчески доступными, например, от Ablynx, Гент, Бельгия. Как и в случае с другими антителами и их антигенсвязывающими фрагментами, происходящими из организма, отличного от человека, аминокислотную последовательность антитела верблюдовых можно изменить рекомбинантным путем с получением последовательности, которая более близко напоминает человеческую последовательность, т. е. нанотело можно "гуманизировать". Таким образом можно дополнительно снижать природную низкую антигенность антител верблюдовых у людей.

Нанотело верблюдовых имеет молекулярную массу, составляющую примерно одну десятую от массы молекулы IgG человека, и данный белок имеет физический диаметр, составляющий лишь несколько нанометров. Одним следствием небольшого размера является способность нанотел верблюдовых связываться с антигенными сайтами, которые являются функционально невидимыми для белков, представляющих собой антитела, большего размера, т. е. нанотела верблюдовых являются применимыми в качестве реагентов для выявления антигенов, которые в ином случае являются скрытыми при использовании классических иммунологических методик, и в качестве возможных терапевтических средств. Таким образом, еще одним следствием небольшого размера является то, что нанотело верблюдовых может осуществлять ингибирование в результате связывания с конкретным сайтом в бороздке или узкой щели белка-мишени и, следовательно, может служить в роли, которая более близко напоминает функцию классического низкомолекулярного лекарственного средства, чем таковую у классического антитела.

Низкая молекулярная масса и компактный размер дополнительно приводят к тому, что нанотела верблюдовых являются чрезвычайно термостабильными, стабильными к экстремальным значениям pH и к протеолитическому расщеплению и характеризуются слабой антигенностью. Другим следствием является то, что нанотела верблюдовых легко перемещаются из кровеносной системы в ткани и даже пересекают гематоэнцефалический барьер и могут обеспечивать лечение нарушений, которые поражают нервную ткань. Нанотела могут дополнительно способствовать транспорту лекарственных средств через гематоэнцефалический барьер. См. заявку на патент США 20040161738, опубликованную 19 августа 2004 г. Эти признаки в сочетании с низкой антигенностью у людей указывают на большой терапевтический потенциал. Кроме того, эти молекулы могут полностью экспрессироваться в прокариотических клетках, таких как E. coli, и они экспрессируются в виде слитых белков с белками бактериофага и являются функциональными.

Соответственно, признаком настоящего изобретения является антитело или нанотело верблюдовых, характеризующееся высокой аффинностью в отношении ENTPD2. В одном варианте осуществления в данном документе антитело или нанотело верблюдовых продуцируется в естественных условиях у животного из семейства верблюдовых, т. е. оно продуцируется верблюдовыми после иммунизации с помощью ENTPD2 или его пептидного фрагмента с применением методик, описанных в данном документе для других антител. В качестве альтернативы ENTPD2-связывающее нанотело верблюдовых конструируют, т. е. получают посредством отбора, например, из фаговой библиотеки, в которой отображены подвергнутые соответствующему мутагенезу белки, представляющие собой нанотела верблюдовых, с применением процедур пэннинга с ENTPD2 в качестве мишени, как описано в примерах в данном документе. Сконструированные нанотела можно дополнительно адаптировать к конкретным требованиям с помощью генной инженерии так, чтобы они имели период полужизни у получающего их субъекта, составляющий от 45 минут до двух недель. В конкретном варианте осуществления антитело или нанотело верблюдовых получают посредством прививания последовательностей CDR тяжелой или легкой цепей человеческих антител по настоящему изобретению на последовательности каркасных областей нанотела или однодоменного антитела, как описано, например, в PCT/EP93/02214.

Биспецифические молекулы и поливалентные антитела

В другом аспекте настоящее изобретение относится к биспецифическим или полиспецифическим молекулам, содержащим ENTPD2-связывающее антитело или его фрагмент по настоящему изобретению. Антитело по настоящему изобретению или его антигенсвязывающие области можно дериватизировать или связать с другой функциональной молекулой, например, с другим пептидом или белком (например, другим антителом или лигандом рецептора) с получением биспецифической молекулы, которая связывается с по меньшей мере двумя различными связывающими участками или молекулами-мишенями. Антитело по настоящему изобретению фактически можно дериватизировать или связать с более чем одной другой функциональной молекулой с получением полиспецифических молекул, которые связываются с более чем двумя различными связывающими участками и/или молекулами-мишенями; также предполагается, что такие полиспецифические молекулы охватываются используемым в данном документе термином "биспецифическая молекула". Для создания биспецифической молекулы по настоящему изобретению антитело по настоящему изобретению можно функционально связать (например, посредством химического связывания, генетического слияния, нековалентной ассоциации или иным образом) с одной или несколькими другими связывающими молекулами, такими как другое антитело, фрагмент антитела, пептид или связывающий миметик, в результате чего получают биспецифическую молекулу.

Соответственно, настоящее изобретение включает биспецифические молекулы, содержащие по меньшей мере один первый элемент, обеспечивающий специфичность связывания с ENTPD2, и второй элемент, обеспечивающий специфичность связывания со вторым эпитопом-мишенью. Например, второй эпитоп-мишень представляет собой другой эпитоп ENTPD2, отличающийся от первого эпитопа-мишени.

Кроме того, в настоящем изобретении, в котором биспецифическая молекула является полиспецифической, молекула может дополнительно содержать третий элемент, обеспечивающий специфичность связывания, в дополнение к таковым для первого и второго эпитопов-мишеней.

В одном варианте осуществления биспецифические молекулы по настоящему изобретению содержат в качестве элемента, обеспечивающего специфичность связывания, по меньшей мере одно антитело или его фрагмент антитела, в том числе, например, Fab, Fab', F(ab')2, Fv или одноцепочечный Fv. Антитело также может представлять собой димер легких цепей или тяжелых цепей или любой их минимальный фрагмент, такой как Fv или одноцепочечная конструкция, которая описана в Ladner et al., патент США № 4946778.

Диатела представляют собой двухвалентные биспецифические молекулы, в которых VH- и VL-домены экспрессируются в одной полипептидной цепи и соединены линкером, который является слишком коротким, чтобы обеспечивать возможность спаривания между двумя доменами в одной и той же цепи. VH- и VL-домены спариваются с комплементарными доменами другой цепи, создавая таким образом два антигенсвязывающих участка (см., например, Holliger et al., 1993 Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak et al., 1994 Structure 2:1121-1123). Диатела можно получать посредством экспрессии двух полипептидных цепей со структурой VHA-VLB и VHB-VLA (конфигурация VH-VL) либо VLA-VHB и VLB-VHA (конфигурация VL-VH) в одной и той же клетке. Большинство из них могут экспрессироваться в растворимой форме у бактерий. Одноцепочечные диатела (scDb) получают путем соединения двух полипептидных цепей, образующих диатело, с линкером размером примерно 15 аминокислотных остатков (см. Holliger and Winter, 1997 Cancer Immunol. Immunother., 45 (3-4):128-30; Wu et al., 1996 Immunotechnology, 2 (1):21-36). scDb могут экспрессироваться у бактерий в растворимой активной мономерной форме (см. Holliger and Winter, 1997 Cancer Immunol. Immunother., 45 (34): 128-30; Wu et al., 1996 Immunotechnology, 2 (1):21-36; Pluckthun and Pack, 1997 Immunotechnology, 3 (2): 83-105; Ridgway et al., 1996 Protein Eng., 9 (7):617-21). Диатело можно сливать с Fc с получением "дидиатела" (см. Lu et al., 2004 J. Biol. Chem., 279 (4):2856-65).

Другие антитела, которые могут использоваться в биспецифических молекулах по настоящему изобретению, представляют собой мышиные, химерные и гуманизированные моноклональные антитела.

Биспецифические молекулы по настоящему изобретению можно получить посредством конъюгирования составляющих элементов, обеспечивающих специфичность связывания, с помощью способов, известных из уровня техники. Например, каждый элемент, обеспечивающий специфичность связывания, в биспецифической молекуле можно получить отдельно, а затем конъюгировать с другими. Если элементы, обеспечивающие специфичность связывания, представляют собой белки или пептиды, то для ковалентного конъюгирования можно применять ряд связывающих или сшивающих средств. Примеры сшивающих средств включают белок A, карбодиимид, N-сукцинимидил-5-ацетилтиоацетат (SATA), 5,5'-дитиобис(2-нитробензойную кислоту) (DTNB), о-фенилендималеимид (oPDM), N-сукцинимидил-3-(2-пиридилдитио)пропионат (SPDP) и сульфосукцинимидил-4-(N-малеимидометил)циклогексан-1-карбоксилат (сульфо-SMCC) (см., например, Karpovsky et al., 1984 J. Exp. Med. 160:1686; Liu, M A et al., 1985 Proc. Natl. Acad. Sci. USA 82:8648). Другие способы включают способы, описанные в Paulus, 1985 Behring Ins. Mitt. No. 78, 118-132; Brennan et al., 1985 Science 229:81-83, и Glennie et al., 1987 J. Immunol. 139: 2367-2375. Конъюгирующие средства представляют собой SATA и сульфо-SMCC, оба из которых доступны от Pierce Chemical Co. (Рокфорд, Иллинойс).

Если элементы, обеспечивающие специфичность связывания, представляют собой антитела, их можно конъюгировать посредством образования связей между сульфгидрильными группами C-концевых шарнирных областей двух тяжелых цепей. В конкретном варианте осуществления шарнирную область модифицируют таким образом, чтобы она содержала нечетное количество остатков с сульфгидрильной группой, например, один, перед конъюгированием.

В качестве альтернативы оба элемента, обеспечивающие специфичность связывания, могут быть закодированы в одном и том же векторе и могут экспрессироваться и собираться в одной и той же клетке-хозяине. Этот способ является особенно применимым в случае, когда биспецифическая молекула представляет собой слитый белок mAb X mAb, mAb X Fab, Fab X F(ab')2 или лиганд X Fab. Биспецифическая молекула по настоящему изобретению может представлять собой одноцепочечную молекулу, содержащую одно одноцепочечное антитело и детерминанту связывания, или одноцепочечную биспецифическую молекулу, содержащую две детерминанты связывания. Биспецифические молекулы могут содержать по меньшей мере две одноцепочечные молекулы. Способы получения биспецифических молекул описаны, например, в патенте США № 5260203; патенте США № 5455030; патенте США № 4881175; патенте США № 5132405; патенте США № 5091513; патенте США № 5476786; патенте США № 5013653; патенте США № 5258498 и патенте США № 5482858.

Связывание биспецифических молекул со своими специфическими мишенями можно подтвердить, например, с помощью твердофазного иммуноферментного анализа (ELISA), радиоиммунологического анализа (REA), FACS-анализа, биологического анализа (например, ингибирования роста) или вестерн-блот-анализа. В каждом из этих анализов обычно выявляют наличие комплексов белок-антитело, представляющих особый интерес, путем использования меченого реагента (например, антитела), специфичного в отношении комплекса, представляющего интерес.

В другом аспекте в настоящем изобретении предусмотрены поливалентные соединения, содержащие по меньшей мере две идентичные или отличающиеся антигенсвязывающие части антител и их антигенсвязывающих фрагментов по настоящему изобретению, связывающиеся с ENTPD2. Антигенсвязывающие части могут быть связаны друг с другом посредством слияния белков или ковалентной или нековалентной связи. В качестве альтернативы способы связывания были описаны для биспецифических молекул. Четырехвалентные соединения можно получить, например, путем сшивания антител и их антигенсвязывающих фрагментов по настоящему изобретению с антителом или антигенсвязывающим фрагментом, которые связываются с константными областями антител и их антигенсвязывающих фрагментов по настоящему изобретению, например, Fc или шарнирной областью.

Тримеризующий домен описан, например, в патенте EP 1012280B1, принадлежащем Borean. Пентамеризующие модули описаны, например, в PCT/EP97/05897.

В некоторых вариантах осуществления ENTPD2-связывающие антитела или их антигенсвязывающие фрагменты представляют собой биспецифические антитела, которые распознают первый антиген и второй антиген. В некоторых вариантах осуществления первый антиген представляет собой ENTPD2 человека или его встречающийся в природе вариант. В некоторых вариантах осуществления второй антиген может представлять собой белок, липид, полисахарид или гликолипид, экспрессирующийся на одной или нескольких опухолевых клетках.

Антитела с удлиненным периодом полужизни

В настоящем изобретении предусмотрены антитела, которые специфично связываются с ENTPD2 (например, белком ENTPD2 человека) и характеризуются удлиненным периодом полужизни in vivo.

Многие факторы могут влиять на период полужизни белка in vivo. Например, к ним относятся фильтрация в почках, метаболизм в печени, разрушение посредством протеолитических ферментов (протеаз) и иммунные ответы (например, нейтрализация белка посредством антител и поглощение макрофагами и дендритными клетками). Для продления периода полужизни антител и их антигенсвязывающих фрагментов по настоящему изобретению можно применять ряд стратегий. Например, это можно осуществлять посредством химического связывания с полиэтиленгликолем (PEG), PEG ReCODE, остовом антитела, полисиаловой кислотой (PSA), гидроксиэтилкрахмалом (HES), альбуминсвязывающими лигандами и углеводными защитными фрагментами; посредством генетического слияния с белками, связывающимися с белками сыворотки крови, такими как альбумин, IgG, FcRn и трансферрин; посредством связывания (генетического или химического) с другими связывающими компонентами, которые связываются с белками сыворотки крови, такими как нанотела, Fab, дарпины, авимеры, аффитела и антикалины; посредством генетического слияния с rPEG, альбумином, доменом альбумина, альбуминсвязывающими белками и Fc; или посредством включения в наноносители, составы с медленным высвобождением или медицинские устройства.

Для продления циркуляции антител в сыворотке крови in vivo молекулы инертного полимера, такого как высокомолекулярный PEG, могут быть присоединены к антителам или их фрагментам с использованием или без использования линкера с несколькими функциональными группами посредством сайт-специфического конъюгирования PEG с N- или С-концом антител либо посредством эпсилон-аминогрупп, присутствующих в лизиновых остатках. Для пегилирования антитела, как правило, осуществляют реакцию антитела, его антигенсвязывающего фрагмента с полиэтиленгликолем (PEG), таким как реакционноспособный сложный эфир или альдегидное производное PEG, в условиях, при которых одна или несколько групп PEG присоединяются к антителу или фрагменту антитела. Пегилирование можно осуществлять посредством реакции ацилирования или реакции алкилирования с реакционноспособной молекулой PEG (или аналогичным реакционноспособным водорастворимым полимером). Предполагается, что используемый в данном документе термин "полиэтиленгликоль" охватывает любую из форм PEG, которые применялись для дериватизации других белков, как, например, моно(C1-C10)алкокси- или арилоксиполиэтиленгликоль или полиэтиленгликоль-малеимид. В одном варианте осуществления антитело, которое должно быть пегилировано, представляет собой агликозилированное антитело. Будет применяться дериватизация с помощью линейного или разветвленного полимера, которая приводит к минимальной потере биологической активности. Степень конъюгирования можно тщательно контролировать посредством SDS-PAGE и масс-спектрометрии для обеспечения надлежащего конъюгирования молекул PEG с антителами. Непрореагировавший PEG можно отделить от конъюгатов антитело-PEG посредством эксклюзионной или ионообменной хроматографии. PEG-дериватизированные антитела можно тестировать в отношении активности связывания, а также в отношении эффективности in vivo с применением способов, хорошо известных специалистам в данной области, например, посредством иммунологических анализов, описанных в данном документе. Способы пегилирования белков известны из уровня техники и могут применяться по отношению к антителам и их антигенсвязывающим фрагментам по настоящему изобретению. См., например, EP 0154316 авторства Nishimura et al. и EP 0401384 авторства Ishikawa et al.

Другие модифицированные технологии пегилирования включают преобразующую технологию химически ортогонального направленного конструирования (PEG ReCODE), при которой химически определенные боковые цепи включаются в состав биосинтетических белков посредством преобразующей системы, которая содержит тРНК-синтетазу и тРНК. Данная технология позволяет включать более чем 30 новых аминокислот в состав биосинтетических белков в клетках E. coli, дрожжей и млекопитающих. тРНК включает стандартную аминокислоту в любом месте, где расположен янтарный стоп-кодон, преобразовывая янтарный стоп-кодон в кодон, который сигнализирует о включении химически определенной аминокислоты.

Технология рекомбинантного пегилирования (rPEG) также может применяться для удлинения периода полужизни в сыворотке крови. Данная технология предусматривает генетическое слияние неструктурированного белкового хвоста из 300-600 аминокислот с существующим фармацевтическим белком. Поскольку кажущаяся молекулярная масса такой неструктурированной белковой цепи в приблизительно 15 раз превышает ее фактическую молекулярную массу, период полужизни белка в сыворотке крови значительно увеличивается. В отличие от традиционного пегилирования, для которого требуется химическое конъюгирование и повторная очистка, способ изготовления значительно упрощается, и продукт является однородным.

Полисиалирование представляет собой другую технологию, в которой используется природный полимер полисиаловая кислота (PSA) для продления периода активности и улучшения стабильности терапевтических пептидов и белков. PSA представляет собой полимер сиаловой кислоты (сахара). При применении для доставки лекарственных средств на основе белков и терапевтических пептидов полисиаловая кислота обеспечивает защитную микросреду при конъюгировании. Это увеличивает период активности терапевтического белка в кровотоке и предотвращает его распознавание иммунной системой. Полимер PSA в естественных условиях обнаруживается в организме человека. Его начали использовать некоторые бактерии, которые эволюционировали на протяжении миллионов лет, для покрытия им своих клеточных стенок. Эти полисиалированные в естественных условиях бактерии вследствие этого были способны благодаря молекулярной мимикрии противодействовать защитной системе организма. PSA можно с легкостью получить из таких бактерий в больших количествах и с заданными физическими характеристиками. Бактериальная PSA является полностью неиммуногенной, даже в случае, когда она связана с белками, так как она является химически идентичной PSA в организме человека.

Другая технология предусматривает применение производных гидроксиэтилкрахмала ("HES"), связанных с антителами. HES представляет собой модифицированный природный полимер, полученный из крахмала восковидной кукурузы, и может метаболизироваться посредством ферментов организма. Растворы HES обычно вводят для восполнения недостающего объема крови и улучшения реологических свойств крови. Модификация антитела с помощью HES позволяет продлить период полужизни в кровотоке благодаря увеличению стабильности молекулы, а также благодаря снижению почечного клиренса, что приводит к увеличению биологической активности. Изменяя различные параметры, такие как молекулярная масса HES, можно адаптировать к конкретным требованиям широкий спектр конъюгатов HES-антитело.

Антитела, характеризующиеся увеличенным периодом полужизни in vivo, также можно получать путем введения одной или нескольких аминокислотных модификаций (т. е. замен, вставок или делеций) в константный домен IgG или его FcRn-связывающий фрагмент (предпочтительно Fc или фрагмент домена шарнирная область-Fc). См., например, международную публикацию № WO 98/23289; международную публикацию № WO 97/34631 и патент США № 6277375.

Кроме того, антитела можно конъюгировать с альбумином, чтобы сделать антитело или фрагмент антитела более стабильными in vivo или чтобы они характеризовались более длительным периодом полужизни in vivo. Методики являются хорошо известными из уровня техники, см., например, международные публикации №№ WO 93/15199, WO 93/15200 и WO 01/77137 и европейский патент № EP 413622.

Стратегии по увеличению периода полужизни являются особенно применимыми для нанотел, связывающих средств на основе фибронектина и других антител или белков, для которых необходим увеличенный период полужизни in vivo.

Конъюгаты антител

В настоящем изобретении предусмотрены антитела или их антигенсвязывающие фрагменты, которые специфично связываются с внеклеточным доменом ENTPD2 (например, белка ENTPD2 человека), рекомбинантно слитые или химически конъюгированные (в том числе посредством как ковалентного, так и нековалентного конъюгирования) с гетерологичным белком или полипептидом (или его антигенсвязывающим фрагментом, предпочтительно с полипептидом размером по меньшей мере 10, по меньшей мере 20, по меньшей мере 30, по меньшей мере 40, по меньшей мере 50, по меньшей мере 60, по меньшей мере 70, по меньшей мере 80, по меньшей мере 90 или по меньшей мере 100 аминокислот) с получением слитых белков. В частности, в настоящем изобретении предусмотрены слитые белки, содержащие антигенсвязывающий фрагмент антитела, описанного в данном документе (например, Fab-фрагмент, Fd-фрагмент, Fv-фрагмент, F(ab)2-фрагмент, VH-домен, CDR VH, VL-домен или CDR VL) и гетерологичный белок, полипептид или пептид. Способы слияния или конъюгирования белков, полипептидов или пептидов с антителом или фрагментом антитела известны из уровня техники. См., например, патенты США №№ 5336603, 5622929, 5359046, 5349053, 5447851 и 5112946; европейские патенты №№ EP 307434 и EP 367166; международные публикации №№ WO 96/04388 и WO 91/06570; Ashkenazi et al., 1991, Proc. Natl. Acad. Sci. USA 88: 10535-10539; Zheng et al., 1995, J. Immunol. 154:5590-5600; и Vil et al., 1992, Proc. Natl. Acad. Sci. USA 89:11337-11341.

Дополнительные слитые белки можно получать посредством методик перетасовки генов, перетасовки мотивов, перетасовки экзонов и/или перетасовки кодонов (в совокупности называемых "перетасовкой ДНК"). Перетасовку ДНК можно использовать для изменения форм активности антител и их антигенсвязывающих фрагментов по настоящему изобретению (например, для получения антител и их антигенсвязывающих фрагментов с более высокими значениями аффинности и более низкими значениями скорости диссоциации). См. в целом патенты США №№ 5605793, 5811238, 5830721, 5834252 и 5837458; Patten et al., 1997, Curr. Opinion Biotechnol. 8:724-33; Harayama, 1998, Trends Biotechnol. 16(2):76-82; Hansson, et al., 1999, J. Mol. Biol. 287:265-76; и Lorenzo and Blasco, 1998, Biotechniques 24(2):308-313. Антитела и их антигенсвязывающие фрагменты или кодируемые антитела и их антигенсвязывающие фрагменты можно изменять посредством воздействия на них случайного мутагенеза с помощью ПЦР с внесением ошибок, случайной вставки нуклеотидов или других способов перед рекомбинацией. Полинуклеотид, кодирующий антитело, его антигенсвязывающий фрагмент, которые специфично связываются с ENTPD2 (например, белком ENTPD2 человека), может быть подвергнут рекомбинации с одним или несколькими компонентами, мотивами, секциями, частями, доменами, фрагментами и т. д. одной или нескольких гетерологичных молекул.

Более того, антитела и их антигенсвязывающие фрагменты можно слить с маркерными последовательностями, такими как пептид, для облегчения очистки. В одном варианте осуществления маркерная аминокислотная последовательность представляет собой гексагистидиновый пептид (SEQ ID NO: 1010), такой как метка, представленная в векторе pQE (QIAGEN, Inc., 9259 Eton Avenue, Чатсворт, Калифорния, 91311), среди прочих, многие из которых являются коммерчески доступными. Например, как описано в Gentz et al., 1989, Proc. Natl. Acad. Sci. USA 86:821-824, гексагистидин (SEQ ID NO: 1010) обеспечивает удобную очистку слитого белка. Другие пептидные метки, применимые для очистки, включают без ограничения гемагглютининовую ("HA") метку, которая соответствует эпитопу, полученному из белка гемагглютинина вируса гриппа (Wilson et al., 1984, Cell 37:767), и "FLAG"-метку.

В одном варианте осуществления антитела и их антигенсвязывающие фрагменты по настоящему изобретению конъюгированы с диагностическим или выявляемым средством. Такие антитела могут быть применимыми для контроля или прогнозирования начала проявления, развития, прогрессирования и/или степени тяжести заболевания или нарушения в рамках процедуры клинического тестирования, такой как определение эффективности конкретной терапии. Такую диагностику и выявление можно осуществлять посредством связывания антитела с выявляемыми веществами, в том числе без ограничения с различными ферментами, такими как без ограничения пероксидаза хрена, щелочная фосфатаза, бета-галактозидаза или ацетилхолинэстераза; простетическими группами, такими как без ограничения стрептавидин/биотин и авидин/биотин; флуоресцентными материалами, такими как без ограничения умбеллиферон, флуоресцеин, флуоресцеинизотиоцианат, родамин, дихлортриазиниламинофлуоресценин, дансилхлорид или фикоэритрин; люминесцентными материалами, такими как без ограничения люминол; биолюминесцентными материалами, такими как без ограничения люцифераза, люциферин и экворин; радиоактивными материалами, такими как без ограничения йод (131I, 125I, 123I и 121I), углерод (14C), сера (35S), тритий (3H), индий (115In, 113In, 112In и 111In), технеций (99Tc), таллий (201Ti), галлий (68Ga, 67Ga), палладий (103Pd), молибден (99Mo), ксенон (133Xe), фтор (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re, 142Pr, 105Rh, 97Ru, 68Ge, 57Co, 65Zn, 85Sr, 32P, 153Gd, 169Yb, 51Cr, 54Mn, 75Se, 113Sn и олово-117; и позитронно-активными металлами, применяющимися в различных методах позитронно-эмиссионной томографии, а также ионами нерадиоактивных парамагнитных металлов.

Кроме того, антитело, его антигенсвязывающий фрагмент могут быть конъюгированы с терапевтическим компонентом или компонентом, представляющим собой лекарственное средство. Терапевтические компоненты или компоненты, представляющие собой лекарственные средства, не следует рассматривать как ограниченные классическими химическими терапевтическими средствами. Например, компонент, представляющий собой лекарственное средство, может представлять собой белок, пептид или полипептид, обладающие необходимой биологической активностью. Такие белки могут включать, например, токсин, такой как абрин, рицин A, экзотоксин синегнойной палочки, холерный токсин или дифтерийный токсин; белок, такой как фактор некроза опухоли, интерферон альфа, интерферон бета, фактор роста нервов, фактор роста тромбоцитов, тканевой активатор плазминогена, проапоптотическое средство, антиангиогенное средство или модификатор биологического ответа, такой как, например, лимфокин.

Более того, антитело можно конъюгировать с терапевтическими компонентами, такими как ион радиоактивного металла, как, например, излучатель альфа-частиц, такой как 213Bi, или с макроциклическими хелаторами, применимыми для конъюгирования ионов радиоактивных металлов, в том числе без ограничения 131In, 131Lu, 131Y, 131Ho, 131Sm, с полипептидами. В одном варианте осуществления макроциклический хелатор представляет собой 1,4,7,10-тетраазациклододекан-N, N',N'',N'''-тетрауксусную кислоту (DOTA), которая может быть присоединена к антителу посредством линкерной молекулы. Такие линкерные молекулы являются широко известными из уровня техники и описаны в Denardo et al., 1998, Clin Cancer Res. 4 (10):2483-90; Peterson et al., 1999, Bioconjug. Chem. 10 (4):553-7; и Zimmerman et al., 1999, Nucl. Med. Biol. 26 (8):943-50, каждая из которых включена посредством ссылки во всей своей полноте.

Методики конъюгирования терапевтических компонентов с антителами являются хорошо известными, см., например, Amon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", в Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", в Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", в Monoclonal Antibodies 84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", в Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), и Thorpe et al., 1982, Immunol. Rev. 62:119-58.

Антитела также могут быть прикреплены к твердым подложкам, которые являются особенно применимыми для иммунологических анализов или очистки антигена-мишени. Такие твердые подложки включают без ограничения стекло, целлюлозу, полиакриламид, нейлон, полистирол, поливинилхлорид или полипропилен.

Нуклеиновые кислоты, кодирующие антитела, векторы и клетки-хозяева

Также в данном документе предусмотрены нуклеиновые кислоты, кодирующие антитело или его антигенсвязывающий фрагмент, описанные в данном документе. Такие нуклеиновые кислоты могут кодировать полипептиды, содержащие сегменты или домены антител к ENTPD2 или их антигенсвязывающих фрагментов, описанных выше. Такие нуклеиновые кислоты или полинуклеотиды могут кодировать по меньшей мере одну CDR-область и обычно все три CDR-области из тяжелой или легкой цепи антител к ENTPD2, описанных в данном документе. Такие нуклеиновые кислоты или полинуклеотиды также могут кодировать всю или по существу всю последовательность вариабельной области тяжелой цепи и/или легкой цепи антител к ENTPD2, описанных в данном документе. Такие нуклеиновые кислоты или полинуклеотиды также могут кодировать как вариабельную область, так и константную область антитела. Вследствие вырожденности генетического кода каждая из аминокислотных последовательностей иммуноглобулинов будет кодироваться рядом последовательностей нуклеиновых кислот. Например, настоящее изобретение относится к первой и второй нуклеиновым кислотам, кодирующим соответственно вариабельные области тяжелой и легкой цепей молекулы антитела к ENTPD2 человека, выбранной из одной или нескольких молекул антител, раскрытых в данном документе. Нуклеиновая кислота может содержать нуклеотидную последовательность, представленную в таблице 1, или последовательность, по существу идентичную ей (например, последовательность, которая характеризуется по меньшей мере приблизительно 85%, 90%, 95% или 99% идентичностью последовательности по отношению к ней или которая отличается на не более чем 3, 6, 15, 30 или 45 нуклеотидов от последовательностей, показанных в таблице 1).

В определенных вариантах осуществления нуклеиновая кислота может содержать нуклеотидную последовательность, кодирующую по меньшей мере одну, две или три CDR или гипервариабельные петли из вариабельной области тяжелой цепи, имеющей аминокислотную последовательность, представленную в таблице 1, или последовательность, по существу гомологичную ей (например, последовательность, которая характеризуется по меньшей мере приблизительно 85%, 90%, 95% или 99% идентичностью последовательности по отношению к ней и/или которая имеет одну или несколько замен, например, консервативных замен). В других вариантах осуществления нуклеиновая кислота может содержать нуклеотидную последовательность, кодирующую по меньшей мере одну, две или три CDR или гипервариабельные петли из вариабельной области легкой цепи, имеющей аминокислотную последовательность, представленную в таблице 1, или последовательность, по существу гомологичную ей (например, последовательность, которая характеризуется по меньшей мере приблизительно 85%, 90%, 95% или 99% идентичностью последовательности по отношению к ней и/или которая имеет одну или несколько замен, например, консервативных замен). В еще одном другом варианте осуществления нуклеиновая кислота может содержать нуклеотидную последовательность, кодирующую по меньшей мере одну, две, три, четыре, пять или шесть CDR или гипервариабельных петель из вариабельных областей тяжелой и легкой цепей, имеющих аминокислотную последовательность, представленную в таблице 1, или последовательность, по существу гомологичную ей (например, последовательность, которая характеризуется по меньшей мере приблизительно 85%, 90%, 95% или 99% идентичностью последовательности по отношению к ней и/или которая имеет одну или несколько замен, например, консервативных замен).

В определенных вариантах осуществления нуклеиновая кислота может содержать нуклеотидную последовательность, кодирующую по меньшей мере одну, две или три CDR или гипервариабельные петли из вариабельной области тяжелой цепи, имеющую нуклеотидную последовательность, представленную в таблице 1, или последовательность, по существу гомологичную ей (например, последовательность, которая характеризуется по меньшей мере приблизительно 85%, 90%, 95% или 99% идентичностью последовательности по отношению к ней). В другом варианте осуществления нуклеиновая кислота может содержать нуклеотидную последовательность, кодирующую по меньшей мере одну, две или три CDR или гипервариабельные петли из вариабельной области легкой цепи, имеющую нуклеотидную последовательность, представленную в таблице 1, или последовательность, по существу гомологичную ей (например, последовательность, которая характеризуется по меньшей мере приблизительно 85%, 90%, 95% или 99% идентичностью последовательности по отношению к ней). В еще одном варианте осуществления нуклеиновая кислота может содержать нуклеотидную последовательность, кодирующую по меньшей мере одну, две, три, четыре, пять или шесть CDR или гипервариабельных петель из вариабельных областей тяжелой и легкой цепей, имеющую нуклеотидную последовательность, представленную в таблице 1, или последовательность, по существу гомологичную ей (например, последовательность, которая характеризуется по меньшей мере приблизительно 85%, 90%, 95% или 99% идентичностью последовательности по отношению к ней).

Полинуклеотидные последовательности можно получать с помощью твердофазного синтеза ДНК de novo или с помощью ПЦР-мутагенеза существующей последовательности, кодирующей ENTPD2-связывающее антитело или его связывающий фрагмент. Прямой химический синтез нуклеиновых кислот можно осуществлять с помощью способов, известных из уровня техники, таких как фосфотриэфирный способ из Narang et al., 1979, Meth. Enzymol. 68:90; фосфодиэфирный способ из Brown et al., Meth. Enzymol. 68:109, 1979; диэтилфосфорамидитный способ из Beaucage et al., Tetra Lett., 22:1859, 1981; и способ с использованием твердой подложки из патента США № 4458066. Введение мутаций в полинуклеотидную последовательность с помощью ПЦР можно осуществлять, как описано, например, в PCR Technology: Principles and Applications for DNA Amplification, H. A. Erlich (Ed.), Freeman Press, NY, N.Y., 1992; PCR Protocols: A Guide to Methods and Applications, Innis et al. (Ed.), Academic Press, San Diego, Calif., 1990; Mattila et al., Nucleic Acids Res. 19:967, 1991; и Eckert et al., PCR Methods and Applications 1:17, 1991.

Также в данном документе предусмотрены векторы (например, векторы экспрессии), содержащие нуклеиновую кислоту, кодирующую полипептид, содержащий сегмент или домен антител к ENTPD2 или их антигенсвязывающих фрагментов, описанных в данном документе. Такие векторы можно использовать для экспрессии и/или получения ENTPD2-связывающих антител или их антигенсвязывающих фрагментов. Термин "вектор экспрессии" относится к молекуле нуклеиновой кислоты-переносчика, в которую может быть вставлена необходимая кодирующая последовательность для введения в клетку, где она может экспрессироваться. Вектор может представлять собой ДНК-вектор, РНК-вектор, плазмиду, космиду, или вирусный вектор, или искусственные хромосомы (см., например, Harrington et al., Nat Genet 15:345, 1997). Например, невирусные векторы, применимые для экспрессии ENTPD2-связывающих антител или их антигенсвязывающих фрагментов в клетках млекопитающих (например, человека), включают pThioHis A, B и C, pcDNA3.1/His, pEBVHis A, B и C (Invitrogen, Сан-Диего, Калифорния), векторы на основе MPSV и многочисленные другие векторы, известные из уровня техники, для экспрессии белков. Например, в одном классе векторов используются ДНК-элементы, которые получены из вирусов животных, таких как, например, вирус папилломы крупного рогатого скота, вирус полиомы, аденовирус, вирус осповакцины, бакуловирус, ретровирусы (вирус саркомы Рауса, MMTV или MOMLV) или вирус SV40. В другом классе векторов используются РНК-элементы, полученные из РНК-содержащих вирусов, таких как вирус леса Семлики, вирус восточного энцефалита лошадей и флавивирусы.

Применимые вирусные векторы включают векторы на основе любых из следующих вирусов: ретровирусов, лентивирусов, аденовирусов, аденоассоциированных вирусов, вирусов герпеса (например, вируса простого герпеса (HSV)), векторов на основе SV40, вируса папилломы, вируса Эпштейна-Барр HBP, вируса осповакцины, вируса Синдбис, вируса гриппа, реовируса, вируса ньюкаслской болезни (NDV), вируса кори, вируса везикулярного стоматита (VSV), парвовируса, полиовируса, поксвируса, вируса Сенека-Валли, вируса Коксаки, энтеровируса, вируса миксомы, вируса Мараба или вируса леса Семлики (SFV). См. Brent et al., выше; Smith, Annu. Rev. Microbiol. 49:807, 1995; и Rosenfeld et al., Cell 68:143, 1992.

В некоторых вариантах осуществления вектор представляет собой лентивирусный вектор. Векторы, полученные из ретровирусов, таких как лентивирус, являются подходящими инструментами для осуществления долговременного переноса генов, поскольку они обеспечивают долговременную стабильную интеграцию трансгена и его размножение в дочерних клетках. Лентивирусные векторы обладают дополнительным преимуществом по сравнению с векторами, полученными из онкоретровирусов, таких как вирусы лейкоза мышей, заключающимся в том, что ими можно трансдуцировать непролиферирующие клетки, такие как гепатоциты. Они также обладают дополнительным преимуществом, заключающимся в низкой иммуногенности. Ретровирусный вектор также может представлять собой, например, гамма-ретровирусный вектор. Гамма-ретровирусный вектор может содержать, например, промотор, сигнал упаковки (ψ), сайт связывания праймера (PBS), один или несколько (например, два) длинных концевых повторов (LTR) и трансген, представляющий интерес, например, ген, кодирующий CAR. В гамма-ретровирусном векторе могут отсутствовать структурные гены вирусов, такие как gag, pol и env. Иллюстративные гамма-ретровирусные векторы включают вирус лейкоза мышей (MLV), вирус некроза селезенки (SFFV) и вирус миелопролиферативной саркомы (MPSV), а также векторы, полученные из них. Другие гамма-ретровирусные векторы описаны, например, в Tobias Maetzig et al., "Gammaretroviral Vectors: Biology, Technology and Application" Viruses. 2011 Jun; 3(6): 677-713.

В некоторых вариантах осуществления вектор представляет собой вектор на основе аденоассоциированного вируса (AAV), например, вектор на основе рекомбинантного AAV (rAAV). "AAV" представляет собой аббревиатуру для аденоассоциированного вируса и может применяться в отношении самого вируса или его производных. Термин охватывает все подтипы как встречающихся в природе, так и рекомбинантных форм, за исключением случаев, когда требуется иное. Аббревиатура "rAAV" относится к рекомбинантному аденоассоциированному вирусу, также называемому вектором на основе рекомбинантного AAV (или "вектором на основе rAAV"). Термин "AAV" включает, например, AAV 1 типа (AAV1), AAV 2 типа (AAV2), AAV 3 типа (AAV3), AAV 4 типа (AAV4), AAV 5 типа (AAV5), AAV 6 типа (AAV6), AAV 7 типа (AAV7), AAV 8 типа (AAV8), AAV 9 типа (AAV9), AAV 10 типа (AAV10, в том числе AAVrh10), AAV 12 типа (AAV12), AAV птиц, AAV крупного рогатого скота, AAV собак, AAV лошадей, AAV приматов, AAV млекопитающих, отличных от приматов, и AAV овец. "AAV приматов" относится к AAV, который инфицирует приматов, "AAV млекопитающих, отличных от приматов" относится к AAV, который инфицирует млекопитающих, отличных от приматов, "AAV крупного рогатого скота" относится к AAV, который инфицирует млекопитающих, относящихся к крупному рогатому скоту, и т. д.

Геномные последовательности различных серотипов AAV, а также последовательности нативных инвертированных концевых повторов (ITR), белков Rep и субъединиц капсида известны из уровня техники. Такие последовательности можно найти в литературе или в общедоступных базах данных, таких как GenBank. См., например, №№ доступа в GenBank NC-002077 (AAV1), AF063497 (AAV1), NC-001401 (AAV2), AF043303 (AAV2), NC-001729 (AAV3), NC-001829 (AAV4), U89790 (AAV4), NC-006152 (AAV5), AF513851 (AAV7), AF513852 (AAV8) и NC-006261 (AAV8) или в публикациях, таких как WO2005033321 (AAV1-9), раскрытия которых включены в данный документ посредством ссылки. См. также, например, Srivastava et al. (1983) J. Virology 45:555; Chiorini et al. (1998) J. Virology 71:6823; Chiorini et al. (1999) J. Virology 73: 1309; Bantel-Schaal et al. (1999) J. Virology 73:939; Xiao et al. (1999) J. Virology 73:3994; Muramatsu et al. (1996) Virology 221:208; Shade et al. (1986) J. Virol. 58:921; Gao et al. (2002) Proc. Nat. Acad. Sci. USA 99: 11854; Moris et al. (2004) Virology 33:375-383; публикации международных заявок на патент WO 00/28061, WO 99/61601, WO 98/11244 и патент США № 6156303.

Используемый в данном документе термин "вектор на основе rAAV" относится к вектору на основе AAV, содержащему полинуклеотидную последовательность, происходящую не от AAV (т. е. полинуклеотид, гетерологичный по отношению к AAV), как правило, последовательность, представляющую интерес для генетической трансформации клетки. В некоторых вариантах осуществления гетерологичный полинуклеотид может быть фланкирован по меньшей мере одной и иногда двумя последовательностями инвертированных концевых повторов (ITR) AAV. Термин "вектор на основе rAAV" охватывает как векторные частицы на основе rAAV, так и векторные плазмиды на основе rAAV. Вектор на основе rAAV может быть однонитевым (ssAAV) либо самокомплементарным (scAAV). "Вирус AAV", или "вирусная частица AAV", или "векторная частица на основе rAAV" относится к вирусной частице, состоящей из по меньшей мере одного капсидного белка AAV (как правило, из всех капсидных белков AAV дикого типа) и заключенного в капсид полинуклеотидного вектора на основе rAAV. Если частица содержит гетерологичный полинуклеотид (т. е. полинуклеотид, отличный от генома AAV дикого типа, такой как трансген, который должен быть доставлен в клетку млекопитающего), она, как правило, называется "векторной частицей на основе rAAV" или просто "вектором на основе rAAV". Таким образом, получение частицы rAAV обязательно включает получение вектора на основе rAAV, такого как вектор, содержащийся в частице rAAV.

В некоторых вариантах осуществления вектор может представлять собой рекомбинантную молекулу ДНК, содержащую нуклеиновую кислоту, кодирующую антитело, которое связывается с белком ENTPD2 человека. Используемый в данном документе термин "рекомбинантный" означает, что вектор, полинуклеотид, полипептид или клетка представляют собой продукт различных комбинаций стадий клонирования, рестрикции или лигирования (например, в отношении полинуклеотида или полипептида, содержащегося в них) и/или других процедур, которые приводят к получению конструкции, отличающейся от продукта, обнаруживаемого в природе. Рекомбинантный вирус или вектор представляет собой вирусную частицу, содержащую рекомбинантный полинуклеотид. Данные термины соответственно включают продукты репликации исходной полинуклеотидной конструкции и дочерние продукты исходной вирусной конструкции.

Рекомбинантный вектор, как правило, содержит одну или несколько регуляторных последовательностей, функционально связанных с последовательностью нуклеиновой кислоты, которая должна экспрессироваться. Термин "регуляторная последовательность" включает промоторы, энхансеры и другие элементы, контролирующие экспрессию (например, сигналы полиаденилирования). Регуляторные последовательности включают последовательности, которые управляют конститутивной экспрессией нуклеотидной последовательности, а также тканеспецифичные регуляторные и/или индуцируемые последовательности. Векторы экспрессии могут также содержать элементы, предназначенные для оптимизации стабильности матричной РНК и ее способности к трансляции в клетках-хозяевах, и/или маркеры для отбора по чувствительности к лекарственному средству для создания постоянных стабильных клеточных клонов, экспрессирующих антитело, которое связывается с белком ENTPD2 человека. Конструкция вектора экспрессии может зависеть от таких факторов, как выбор клетки-хозяина, которая должна быть трансформирована, необходимый уровень экспрессии белка и т. п. Общие способы создания таких рекомбинантных векторов экспрессии можно найти в Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; сериях Ausubel et al. eds. (2007 г., с дополнениями и исправлениями до 2010 г.) Current Protocols in Molecular Biology, среди других, известных из уровня техники.

"Промотор" представляет собой контролирующую последовательность, которая представляет собой область последовательности нуклеиновой кислоты, с помощью которой контролируются инициация и скорость транскрипции. Он может содержать генетические элементы, с которыми могут связываться регуляторные белки и молекулы, такие как РНК-полимераза, и другие факторы транскрипции. Фразы "функционально расположенный", "функционально связанный", "под контролем" и "под транскрипционным контролем" означают, что промотор находится в надлежащих функциональных местоположении и/или ориентации по отношению к последовательности нуклеиновой кислоты для контроля инициации транскрипции и/или экспрессии этой последовательности. Промотор можно использовать или не использовать в сочетании с "энхансером", который относится к цис-действующей регуляторной последовательности, участвующей в активации транскрипции последовательности нуклеиновой кислоты.

Промотор может быть естественным образом связан с геном или последовательностью, а также может быть получен посредством выделения 5'-некодирующих последовательностей, расположенных выше кодирующего сегмента и/или экзона. Такой промотор может называться "эндогенным". Аналогичным образом, энхансер может быть естественным образом связан с последовательностью нуклеиновой кислоты и быть расположенным ниже или выше данной последовательности. В качестве альтернативы, определенные преимущества будут достигнуты посредством расположения кодирующего сегмента нуклеиновой кислоты под контролем рекомбинантного или гетерологичного промотора, который относится к промотору, обычно не связанному с последовательностью нуклеиновой кислоты в своей естественной среде. Рекомбинантный или гетерологичный энхансер также относится к энхансеру, обычно не связанному с последовательностью нуклеиновой кислоты в своей естественной среде. Такие промоторы или энхансеры могут включать промоторы или энхансеры из других генов, а также промоторы или энхансеры, выделенные из любой другой прокариотической клетки, вируса или эукариотической клетки, и промоторы или энхансеры, "не встречающиеся в природе", т. е. содержащие другие элементы других областей регуляции транскрипции и/или мутации, которые изменяют экспрессию. В дополнение к получению последовательностей нуклеиновых кислот промоторов и энхансеров синтетическим путем, последовательности можно получать с помощью технологии рекомбинантного клонирования и/или амплификации нуклеиновых кислот, например, ПЦР, совместно с композициями, раскрытыми в данном документе (см. US 4683202, US 5928906). Кроме того, предусматривается, что также можно использовать контролирующие последовательности, которые управляют транскрипцией и/или экспрессией последовательностей в неядерных органеллах, таких как митохондрии, хлоропласты и т. п.

Используемые промоторы могут быть конститутивными, индуцируемыми, синтетическими, ткане- или клеточноспецифичными и/или применимыми в подходящих условиях для управления экспрессией введенного сегмента ДНК на высоком уровне, что является преимущественным при крупномасштабном получении рекомбинантных белков и/или пептидов. Кроме того, также могут быть включены другие регуляторные элементы для улучшения экспрессии нуклеиновой кислоты, кодирующей антитело, которое связывается с белком ENTPD2 человека, например, энхансеры, сайт связывания рибосомы, последовательности терминации транскрипции и т. п.

В некоторых вариантах осуществления используется конститутивный промотор для обеспечения постоянной экспрессии антитела к ENTPD2 человека. Примеры конститутивного промотора включают без ограничения немедленно-ранний промотор цитомегаловируса (CMV), ранний промотор вируса обезьян 40 (SV40), промотор вируса опухоли молочной железы мышей (MMTV), промотор длинного концевого повтора (LTR) вируса иммунодефицита человека (HIV), промотор MoMuLV, промотор вируса лейкоза птиц, немедленно-ранний промотор вируса Эпштейна-Барр, промотор вируса саркомы Рауса, а также промоторы человеческих генов, такие как без ограничения промотор гена актина, промотор гена миозина, промотор гена фактора элонгации 1α, промотор гена гемоглобина и промотор гена креатинкиназы.

Индуцируемые промоторы также предусматриваются как часть настоящего изобретения. Использование индуцируемого промотора обеспечивает наличие молекулярного переключателя, способного включать экспрессию полинуклеотидной последовательности, с которой он функционально связан, если такая экспрессия требуется, или отключать экспрессию, если экспрессия не требуется. Примеры индуцируемых промоторов включают без ограничения металлотионеин-индуцируемый промотор, глюкокортикоид-индуцируемый промотор, прогестерон-индуцируемый промотор и тетрациклин-индуцируемый промотор.

В некоторых вариантах осуществления используется ткане- или клеточноспецифичный промотор для обеспечения экспрессии антитела к ENTPD2 человека только в конкретных тканях или клетках. Характерные особенности ткане- или клеточноспецифичных промоторов или элементов, а также анализы для определения характеристик их форм активности хорошо известны специалистам в данной области. Примеры включают промотор гена LIMK2 человека (Nomoto et al. 1999, Gene, 236(2):259-271), гена рецептора соматостатина 2 типа (Kraus et al., 1998, FEES Lett., 428(3): 165-170), гена эпидидимального белка, связывающего ретиноевую кислоту, мыши (Lareyre et al., 1999, J. Biol. Chem., 274(12):8282-8290), гена CD4 человека (Zhao-Emonet et al., 1998, Biochim. Biophys. Acta, 1442(2-3): 109-119), гена альфа-2-цепи коллагена (XI типа) мыши (Tsumaki, et al., 1998, J. Biol. Chem., 273(36):22861-22864), гена дофаминового рецептора D1A (Lee, et al., 1997, J. Auton. Nerv. Syst., 74(2-3):86-90), гена инсулиноподобного фактора роста II (Wu et al., 1997, Biochem. Biophys. Res. Commun., 233(1):221-226), гена тромбоцитарно-эндотелиальной молекулы 1 клеточной адгезии человека (Almendro et al., 1996, J. Immunol., 157(12):5411-5421), гена мышечной креатинкиназы (MCK) (Wang et al., Gene Ther. 2008 Nov;15(22):1489-99).

В некоторых вариантах осуществления используется синтетический промотор для обеспечения экспрессии антитела к ENTPD2 человека. Синтетические промоторы могут значительно превосходить природные промоторы по активности транскрипции. Например, можно выбрать синтетические промоторы, активность которых не отключается или не снижается под действием эндогенных клеточных механизмов или факторов. Другие элементы, в том числе сайты связывания транс-действующих факторов и энхансеры, могут быть вставлены в синтетический промотор для улучшения эффективности транскрипции. Синтетические промоторы можно рационально разработать и синтезировать химическим путем с объединением лучших признаков как синтетических, так и биологических промоторов. Синтетические олигонуклеотиды отжигают и лигируют посредством нескольких способов для создания полноразмерного химически синтезированного промотора. Синтетические промоторы могут представлять собой индуцируемые промоторы или промоторы, специфичные для типа клеток.

Для эффективной трансляции кодирующих последовательностей также может требоваться специфический сигнал инициации. Такие сигналы включают инициирующий кодон ATG или смежные последовательности. Может быть необходимым обеспечение наличия экзогенных сигналов контроля трансляции, в том числе инициирующего кодона ATG. Специалист обычной квалификации в данной области легко сможет определить это и обеспечить наличие необходимых сигналов. Хорошо известно, что инициирующий кодон должен быть "внутрирамочным" по отношению к рамке считывания необходимой кодирующей последовательности для обеспечения трансляции всей вставки. Экзогенные сигналы контроля трансляции и инициирующие кодоны могут быть природными либо синтетическими. Эффективность экспрессии можно усилить посредством включения подходящих элементов, представляющих собой энхансеры транскрипции.

Для экспрессии можно использовать любые подходящие клетки-хозяева, известные из уровня техники, например, клетки-хозяева, являющиеся клетками млекопитающих, бактериальные клетки-хозяева, дрожжевые клетки-хозяева, клетки-хозяева, являющиеся клетками насекомых, и т. д. Как прокариотические, так и эукариотические системы экспрессии являются широко доступными. В некоторых вариантах осуществления система экспрессии представляет собой систему экспрессии в клетках млекопитающих, такую как система экспрессии в клетках CHO. В некоторых вариантах осуществления нуклеиновая кислота может быть кодон-оптимизированной для облегчения экспрессии в необходимой клетке-хозяине. Будет важно использовать промотор и/или энхансер, который эффективно управляет экспрессией сегмента ДНК в типе клеток, органелле и организме, выбранных для экспрессии. Специалисты в области молекулярной биологии обычно знают об использовании комбинаций промоторов, энхансеров и типов клеток для экспрессии белков, например, см. Sambrook et al. (2001).

Большинство транскрибируемых эукариотических молекул РНК будут подвергаться сплайсингу РНК для удаления интронов из первичных транскриптов. При использовании векторов, содержащих геномные эукариотические последовательности, могут требоваться донорные и/или акцепторные сайты сплайсинга для обеспечения надлежащего процессинга транскрипта для экспрессии белка (см. Chandler et al., 1997, Proc. Natl. Acad. Sci. USA, 94(8):3596-601).

Векторы или конструкции по настоящему изобретению обычно будут содержать по меньшей мере один сигнал терминации. "Сигнал терминации" или "терминатор" состоит из последовательностей ДНК, участвующих в специфической терминации РНК-транскрипта РНК-полимеразой. Таким образом, в определенных вариантах осуществления предусматривается сигнал терминации, который завершает продуцирование РНК-транскрипта. Терминатор может быть необходим in vivo для достижения необходимых уровней первичного транскрипта. В эукариотических системах терминаторная область может также содержать специфические последовательности ДНК, которые позволяют осуществлять сайт-специфическое расщепление нового транскрипта таким образом, чтобы сделать доступным сайт полиаденилирования. Данные сигналы необходимы специализированной эндогенной полимеразе для добавления фрагмента из приблизительно 200 остатков A (поли-A) к 3'-концу транскрипта. Молекулы РНК, модифицированные с помощью данного поли-A-хвоста, по-видимому, являются более стабильными и транслируются более эффективно. Таким образом, в других вариантах осуществления, предусматривающих эукариот, предпочтительно, чтобы терминатор содержал сигнал для расщепления РНК, и более предпочтительно, чтобы сигнал терминатора способствовал полиаденилированию первичного транскрипта. Элементы терминатора и/или сайта полиаденилирования могут служить для повышения уровней первичного транскрипта и/или для сведения к минимуму сквозного прочитывания с переходом от кассеты к другим последовательностям. Терминаторы, предусмотренные для применения в настоящем изобретении, включают любой известный терминатор транскрипции, описанный в данном документе или известный специалисту обычной квалификации в данной области, в том числе без ограничения, например, терминирующие последовательности генов, такие как, например, терминатор гена гормона роста крупного рогатого скота или вирусные терминирующие последовательности, такие как, например, терминатор SV40. В определенных вариантах осуществления сигналом терминации может являться отсутствие транскрибируемой или транслируемой последовательности, например, вследствие усечения последовательности.

При экспрессии, в частности при эукариотической экспрессии, как правило, будет включен сигнал полиаденилирования для осуществления надлежащего полиаденилирования транскрипта. Считается, что природа сигнала полиаденилирования не имеет решающего значения для успешного осуществления настоящего изобретения на практике, и/или можно использовать любую такую последовательность. Предпочтительные варианты осуществления включают сигнал полиаденилирования SV40 и/или сигнал полиаденилирования гена гормона роста крупного рогатого скота, удобные и/или известные как хорошо функционирующие в различных клетках-мишенях. Полиаденилирование может увеличивать стабильность транскрипта или может облегчать цитоплазматический транспорт.

Для размножения вектора в клетке-хозяине он может содержать одну или несколько точек начала репликации (часто называемых "ori"), которые представляют собой специфическую последовательность нуклеиновой кислоты, в которой инициируется репликация. В качестве альтернативы можно использовать автономно реплицирующуюся последовательность (ARS), если клетка-хозяин представляет собой дрожжевую клетку.

В определенных вариантах осуществления настоящего изобретения клетки, содержащие конструкцию нуклеиновой кислоты по настоящему изобретению, можно идентифицировать in vitro или in vivo посредством включения маркера в вектор экспрессии. Такие маркеры будут придавать клетке идентифицируемое изменение, позволяющее легко идентифицировать клетки, содержащие вектор экспрессии. Обычно селектируемый маркер представляет собой маркер, который придает свойство, которое обеспечивает возможность отбора. Положительный селектируемый маркер представляет собой такой маркер, при котором наличие маркера обеспечивает возможность его отбора, тогда как отрицательный селектируемый маркер представляет собой такой маркер, при котором его наличие предотвращает его отбор. Пример положительного селектируемого маркера представляет собой маркер устойчивости к лекарственному средству.

Обычно включение селектируемого маркера для отбора по чувствительности к лекарственному средству способствует клонированию и идентификации трансформантов, например, гены, которые придают устойчивость к неомицину, пуромицину, гигромицину, DHFR, GPT, зеоцину и гистидинолу, являются применимыми селектируемыми маркерами. В дополнение к маркерам, придающим фенотип, который обеспечивает возможность установления различий между трансформантами на основе реализации условий, также предусматриваются другие типы маркеров, в том числе маркеры для скрининга, такие как GFP, применение которых основано на колориметрическом анализе. В качестве альтернативы можно использовать ферменты для скрининга, такие как тимидинкиназа вируса простого герпеса (HSV-tk) или хлорамфениколацетилтрансфераза (CAT). Специалист в данной области также будет знать, как использовать иммунологические маркеры, возможно в сочетании с FACS-анализом. Считается, что используемый маркер не важен при условии, что он способен экспрессироваться одновременно с нуклеиновой кислотой, кодирующей продукт гена. Дополнительные примеры селектируемых маркеров и маркеров для скрининга хорошо известны специалисту в данной области.

В векторах экспрессии также может быть предусмотрено положение последовательности сигнала секреции для образования слитого белка с полипептидами, кодируемыми вставленными последовательностями ENTPD2-связывающего антитела. Вставляемые последовательности ENTPD2-связывающего антитела чаще связывают с сигнальными последовательностями до включения в вектор. Векторы, которые должны использоваться для получения последовательностей, кодирующих вариабельные домены легкой и тяжелой цепей ENTPD2-связывающего антитела, иногда также кодируют константные области или их части. Такие векторы обеспечивают возможность экспрессии вариабельных областей в виде слитых белков с константными областями, что таким образом приводит к продуцированию интактных антител и их антигенсвязывающих фрагментов. Как правило, такие константные области являются человеческими.

При создании вектора экспрессии можно использовать вектор, содержащий сайт множественного клонирования (MCS), который представляет собой область нуклеиновой кислоты, содержащую несколько сайтов для рестрикционных ферментов, любой из которых можно использовать в сочетании со стандартной рекомбинантной технологией для расщепления вектора. См. Carbonelli et al., 1999, Levenson et al., 1998, и Cocea, 1997. "Расщепление рестрикционным ферментом" относится к каталитическому расщеплению молекулы нуклеиновой кислоты с помощью фермента, который функционирует только в конкретных местоположениях молекулы нуклеиновой кислоты. Множество таких рестрикционных ферментов являются коммерчески доступными. Применение таких ферментов широко известно специалистам в данной области. Часто вектор линеаризуют или фрагментируют с помощью рестрикционного фермента, который производит разрез в пределах MCS, для обеспечения лигирования экзогенных последовательностей с вектором. "Лигирование" относится к способу образования фосфодиэфирных связей между двумя фрагментами нуклеиновой кислоты, которые могут быть или не быть смежными друг с другом. Методики, предусматривающие рестрикционные ферменты и реакции лигирования, хорошо известны специалистам в области рекомбинантной технологии.

Способы введения векторов экспрессии, содержащих полинуклеотидные последовательности, представляющие интерес, варьируются в зависимости от типа клетки-хозяина. Например, трансфекцию с использованием хлорида кальция обычно используют для прокариотических клеток, тогда как обработку фосфатом кальция или электропорацию можно применять для других клеток-хозяев (см. в общих чертах Sambrook et al., выше). Другие способы включают, например, электропорацию, обработку фосфатом кальция, трансформацию, опосредованную липосомами, инъекцию и микроинъекцию, баллистические способы/генную пушку, виросомы, иммунолипосомы, конъюгаты поликатион:нуклеиновая кислота, "голую" ДНК, искусственные вирионы, слияние со структурным белком VP22 вируса герпеса, усиленное средством поглощение ДНК, трансдукцию ex vivo, слияние протопластов, ретровирусную трансдукцию, вирусную трансфекцию, липидную трансфекцию или другие традиционные методики. В случае слияния протопластов клетки выращивают в среде и подвергают скринингу в отношении соответствующей активности. Для долговременного получения рекомбинантных белков с высоким выходом зачастую будет необходима стабильная экспрессия. Например, линии клеток, которые стабильно экспрессируют полипептиды, можно получать с помощью векторов экспрессии, которые содержат вирусные точки начала репликации или эндогенные экспрессионные элементы и ген селектируемого маркера. После введения вектора клеткам можно предоставлять возможность роста в течение 1-2 дней в обогащенной среде перед их переносом в селективную среду. Задачей селектируемого маркера является придание устойчивости к факторам отбора, и его присутствие обеспечивает возможность роста клеток, которые успешно экспрессируют введенные последовательности, в селективной среде. Пролиферацию устойчивых стабильно трансфицированных клеток можно обеспечивать с применением методик культивирования тканей, соответствующих типу клеток. Способы и условия культивирования полученных в результате трансфицированных клеток и извлечения полученной молекулы антитела известны специалистам в данной области и могут быть изменены или оптимизированы в зависимости от конкретных используемых вектора экспрессии и клетки-хозяина, являющейся клеткой млекопитающего, исходя из настоящего описания.

Также в данном документе предусмотрены клетки, которые содержат любой из векторов экспрессии, описанных в данном документе. В некоторых вариантах осуществления настоящее изобретение относится к клетке-хозяину, которая содержит молекулу нуклеиновой кислоты, описанную в данном документе. Такие клетки могут представлять собой клетку-хозяина или терапевтическую клетку. Термины "клетка-хозяин" и "рекомбинантная клетка-хозяин" используются в данном документе взаимозаменяемо и относятся не только к конкретной рассматриваемой клетке, но и к потомству или потенциальному потомству такой клетки. Поскольку в последующих поколениях могут происходить определенные модификации из-за мутаций либо из-за влияний окружающей среды, такое потомство может в действительности не быть идентичным родительской клетке, но по-прежнему включаться в объем термина, используемого в данном документе.

В одном варианте осуществления клетки-хозяева модифицированы методами генной инженерии таким образом, что они содержат нуклеиновые кислоты, кодирующие молекулу антитела. В одном варианте осуществления клетки-хозяева модифицированы методами генной инженерии путем применения кассеты экспрессии. Фраза "кассета экспрессии" относится к нуклеотидным последовательностям, которые способны осуществлять экспрессию гена у хозяев, совместимых с такими последовательностями. Такие кассеты могут содержать промотор, открытую рамку считывания с интронами или без них и сигнал терминации. Также можно применять дополнительные факторы, необходимые или полезные при осуществлении экспрессии, такие как, например, индуцируемый промотор.

Клетки-хозяева, которые должны нести и экспрессировать цепи ENTPD2-связывающего антитела, могут представлять собой без ограничения эукариотическую клетку или прокариотическую клетку, такую как бактериальная клетка, клетка насекомого или клетка человека. E. coli является одним прокариотическим хозяином, применимым для клонирования и экспрессии полинуклеотидов по настоящему изобретению. Другие подходящие для применения микробные хозяева включают бацилл, таких как Bacillus subtilis, и других энтеробактерий, таких как Salmonella, Serratia и различные виды Pseudomonas. Для этих прокариотических хозяев также можно создать векторы экспрессии, которые, как правило, содержат последовательности, контролирующие экспрессию, совместимые с клеткой-хозяином (например, точку начала репликации). Кроме того, будет присутствовать любое количество разнообразных хорошо известных промоторов, как, например, лактозная промоторная система, триптофановая (trp) промоторная система, бета-лактамазная промоторная система или промоторная система из фага лямбда. Как правило, промоторы контролируют экспрессию, необязательно с помощью операторной последовательности, и имеют последовательности сайта связывания рибосомы и т. п. для инициации и завершения транскрипции и трансляции. Для экспрессии ENTPD2-связывающих полипептидов по настоящему изобретению также можно использовать другие микроорганизмы, такие как дрожжи. Также можно использовать клетки насекомых в комбинации с бакуловирусными векторами. Подходящие клетки насекомых включают без ограничения клетки Sf9.

В одном варианте осуществления клетки-хозяева, являющиеся клетками млекопитающих, используют для экспрессии и получения ENTPD2-связывающих антител по настоящему изобретению. Например, они могут представлять собой гибридомную линию клеток, экспрессирующих эндогенные гены иммуноглобулинов (например, клетку гибридомы из миеломы 1D6.C9), либо линию клеток млекопитающих, несущих экзогенный вектор экспрессии (например, клетку миеломы SP2/0). Они включают любую нормальную мортальную или нормальную или аномальную иммортальную клетку животного или человека. Например, был разработан ряд подходящих линий клеток-хозяев, способных секретировать интактные иммуноглобулины, в том числе линии клеток CHO, различные линии клеток Cos, клетки HeLa, линии клеток миеломы, трансформированные B-клетки и гибридомы. Применение тканевой культуры клеток млекопитающих для экспрессии полипептидов в общих чертах обсуждается, например, в Winnacker, From Genes to Clones, VCH Publishers, N.Y., N.Y., 1987. Векторы экспрессии для клеток-хозяев, являющихся клетками млекопитающих, могут содержать последовательности, контролирующие экспрессию, такие как точка начала репликации, промотор и энхансер (см., например, Queen, et al., Immunol. Rev. 89:49-68, 1986), а также необходимые сайты процессинга информации, такие как сайты связывания рибосомы, сайты сплайсинга РНК, сайты полиаденилирования и последовательности терминаторов транскрипции. Эти векторы экспрессии обычно содержат промоторы, полученные из генов млекопитающих или из вирусов млекопитающих. Подходящие промоторы могут быть конститутивными, специфичными для типа клеток, специфичными для стадии развития и/или модулируемыми или регулируемыми. Применимые промоторы включают без ограничения промотор гена металлотионеина, конститутивный большой поздний промотор аденовируса, дексаметазон-индуцируемый промотор MMTV, промотор SV40, промотор pol III MRP, конститутивный промотор MPSV, тетрациклин-индуцируемый промотор CMV (такой как немедленно-ранний промотор CMV человека), конститутивный промотор CMV и комбинации промотор-энхансер, известные из уровня техники.

Клетка-хозяин может использоваться для получения или экспрессии антитела, которое связывается с белком ENTPD2 человека. Соответственно, настоящее изобретение также относится к способам получения антитела, которое связывается с белком ENTPD2 человека, с помощью клетки-хозяина. В одном варианте осуществления способ включает культивирование клетки-хозяина (в которую был введен рекомбинантный вектор экспрессии, кодирующий антитело) в подходящей среде таким образом, чтобы продуцировалось антитело, которое связывается с белком ENTPD2 человека. В другом варианте осуществления способ дополнительно включает выделение антитела из среды или клетки-хозяина. Подходящие эукариотические клетки включают без ограничения клетки Vero, клетки HeLa, клетки COS, клетки CHO, клетки HEK293, клетки BHK и клетки MDCKII.

Получение моноклональных антител

Моноклональные антитела (mAb) можно получать с помощью ряда методик, в том числе традиционного способа получения моноклональных антител, например, стандартной методики гибридизации соматических клеток по Kohler and Milstein, 1975 Nature 256: 495. Можно использовать множество методик получения моноклонального антитела, например, вирусную или онкогенную трансформацию B-лимфоцитов.

Животная система для получения гибридом представляет собой мышиную систему. Получение гибридомы в организме мыши является хорошо отработанной процедурой. Протоколы иммунизации и методики выделения иммунизированных спленоцитов для слияния известны из уровня техники. Партнеры по слиянию (например, клетки миеломы мыши) и процедуры слияния также являются известными.

В некоторых вариантах осуществления антитела по настоящему изобретению представляют собой гуманизированные моноклональные антитела. Химерные или гуманизированные антитела и их антигенсвязывающие фрагменты по настоящему изобретению можно получить, исходя из последовательности моноклонального антитела мыши, полученного согласно описанному выше. ДНК, кодирующую тяжелую и легкую цепи иммуноглобулинов, можно получить из мышиной гибридомы, представляющей интерес, и сконструировать таким образом, чтобы она содержала последовательности иммуноглобулинов, отличные от мышиных (например, человеческие), с применением стандартных методик молекулярной биологии. Например, для создания химерного антитела мышиные вариабельные области можно связать с человеческими константными областями с применением способов, известных из уровня техники (см., например, патент США № 4816567 авторства Cabilly et al.). Для создания гуманизированного антитела мышиные CDR-области мыши можно вставить в человеческую каркасную область с применением способов, известных из уровня техники. См., например, патент США № 5225539 авторства Winter и патенты США №№ 5530101; 5585089; 5693762 и 6180370 авторства Queen et al.

В некоторых вариантах осуществления антитела по настоящему изобретению представляют собой человеческие моноклональные антитела. Такие человеческие моноклональные антитела, направленные против ENTPD2, можно получать с использованием трансгенных или трансхромосомных мышей, несущих части человеческой иммунной системы вместо мышиной системы. Эти трансгенные и трансхромосомные мыши включают мышей, называемых в данном документе соответственно мышами HuMAb и мышами KM, и они в совокупности называются в данном документе "мышами с человеческим Ig".

Мышь HuMAb® (Medarex, Inc.) содержит минилокусы генов человеческих иммуноглобулинов, которые кодируют не подвергшиеся перегруппировке последовательности тяжелых цепей (мю и гамма) и каппа-легкой цепи иммуноглобулина человека, вместе с целенаправленными мутациями, которые инактивируют эндогенные локусы мю- и каппа-цепей (см., например, Lonberg, et al., 1994 Nature 368 (6474): 856-859). Соответственно, мыши проявляют сниженную экспрессию IgM или K мыши, и в ответ на иммунизацию введенные трансгены, кодирующие человеческие тяжелые и легкие цепи, подвергаются переключению класса и соматической мутации с получением высокоаффинного моноклонального IgG-каппа человека (Lonberg, N. et al., 1994, выше; обзор в Lonberg, N., 1994 Handbook of Experimental Pharmacology 113:49-101; Lonberg, N. and Huszar, D., 1995 Intern. Rev. Immunol. 13: 65-93, и Harding, F. and Lonberg, N., 1995 Ann. N.Y. Acad. Sci. 764:536-546). Получение и использование мышей HuMAb, а также геномные модификации, которые несут такие мыши, дополнительно описываются в Taylor, L. et al., 1992 Nucleic Acids Research 20:6287-6295; Chen, J. et al., 1993 International Immunology 5: 647-656; Tuaillon et al., 1993 Proc. Natl. Acad. Sci. USA 94:3720-3724; Choi et al., 1993 Nature Genetics 4:117-123; Chen, J. et al., 1993 EMBO J. 12: 821-830; Tuaillon et al., 1994 J. Immunol. 152:2912-2920; Taylor, L. et al., 1994 International Immunology 579-591; и Fishwild, D. et al., 1996 Nature Biotechnology 14: 845-851. См. также патенты США №№ 5545806; 5569825; 5625126; 5633425; 5789650; 5877397; 5661016; 5814318; 5874299 и 5770429; все авторства Lonberg и Kay; патент США № 5545807 авторства Surani et al.; PCT-публикации №№ WO 92103918, WO 93/12227, WO 94/25585, WO 97113852, WO 98/24884 и WO 99/45962, все авторства Lonberg и Kay; и PCT-публикацию № WO 01/14424 авторства Korman et al.

В некоторых вариантах осуществления продуцирование человеческих антител по настоящему изобретению можно осуществлять с использованием мыши, которая несет последовательности человеческих иммуноглобулинов в трансгенах и трансхромосомах, как, например, мыши, которая несет трансген, кодирующий человеческую тяжелую цепь, и трансхромосому, кодирующую человеческую легкую цепь. Такие мыши, называемые в данном документе "мышами KM", подробно описаны в PCT-публикации WO 02/43478 авторства Ishida et al.

Более того, альтернативные трансгенные животные системы, экспрессирующие гены человеческих иммуноглобулинов, являются доступными из уровня техники, и их можно использовать для продуцирования ENTPD2-связывающих антител и их антигенсвязывающих фрагментов. Например, можно использовать альтернативную трансгенную систему, называемую Xenomouse (Abgenix, Inc.). Такие мыши описаны, например, в патентах США №№ 5939598; 6075181; 6114598; 6150584 и 6162963 авторства Kucherlapati et al.

Более того, альтернативные трансхромосомные животные системы, экспрессирующие гены человеческих иммуноглобулинов, являются доступными из уровня техники, и их можно использовать для продуцирования ENTPD2-связывающих антител по настоящему изобретению. Например, можно использовать мышей, несущих как трансхромосому, кодирующую человеческую тяжелую цепь, так и трансхромосому, кодирующую человеческую легкую цепь, называемых "мышами TC"; такие мыши описаны в Tomizuka et al., 2000 Proc. Natl. Acad. Sci. USA 97:722-727. Кроме того, в уровне техники были описаны коровы, несущие трансхромосомы, кодирующие человеческие тяжелые и легкие цепи (Kuroiwa et al., 2002 Nature Biotechnology 20:889-894), и их можно использовать для продуцирования ENTPD2-связывающих антител по настоящему изобретению.

Человеческие моноклональные антитела также можно получать с применением способов фагового дисплея для скрининга библиотек генов человеческих иммуноглобулинов. Такие способы фагового дисплея для выделения человеческих антител определены в уровне техники или описаны в примерах ниже. См., например, патенты США №№ 5223409; 5403484 и 5571698 авторства Ladner et al; патенты США №№ 5427908 и 5580717 авторства Dower et al; патенты США №№ 5969108 и 6172197 авторства McCafferty et al. и патенты США №№ 5885793; 6521404; 6544731; 6555313; 6582915 и 6593081 авторства Griffiths et al.

Человеческие моноклональные антитела по настоящему изобретению также можно получать с использованием мышей SCID, которым были перенесены человеческие иммунные клетки таким образом, что после иммунизации может формироваться ответ с образованием человеческих антител. Такие мыши описаны, например, в патентах США №№ 5476996 и 5698767 авторства Wilson et al.

Способы конструирования модифицированных антител

Как обсуждается выше, ENTPD2-связывающие антитела, имеющие последовательности VH и VL или последовательности полноразмерной тяжелой и легкой цепей, показанные в данном документе, можно использовать для создания новых ENTPD2-связывающих антител путем модификации последовательностей полноразмерной тяжелой цепи и/или легкой цепи, последовательностей VH и/или VL или константной(константных) области(областей), присоединенной(присоединенных) к ним. Таким образом, в другом аспекте настоящего изобретения структурные признаки ENTPD2-связывающего антитела по настоящему изобретению используются для создания структурно родственных ENTPD2-связывающих антител, которые сохраняют по меньшей мере одно функциональное свойство антител и их антигенсвязывающих фрагментов по настоящему изобретению, как, например, связывание с ENTPD2 человека и его ингибирование.

Например, одну или несколько CDR-областей антител и их антигенсвязывающих фрагментов по настоящему изобретению или их мутантных вариантов можно объединить рекомбинантным путем с известными каркасными областями и/или другими CDR с созданием дополнительных сконструированных рекомбинантным путем ENTPD2-связывающих антител и их антигенсвязывающих фрагментов по настоящему изобретению, как обсуждается выше. Другие типы модификаций включают модификации, описанные в предыдущем разделе. Исходным материалом для способа конструирования является одна или несколько из последовательностей VH и/или VL, предусмотренных в данном документе, или одна или несколько их CDR-областей. Для создания сконструированного антитела не обязательно фактически получать (т. е. экспрессировать в виде белка) антитело, имеющее одну или несколько последовательностей VH и/или VL, предусмотренных в данном документе, или одну или несколько их CDR-областей. Вместо этого информацию, содержащуюся в последовательности(последовательностях), используют в качестве исходного материала для получения последовательности(последовательностей) "второго поколения", полученной(полученных) из исходной(исходных) последовательности(последовательностей), а затем последовательность(последовательности) "второго поколения" получают и экспрессируют в виде белка.

Измененную последовательность антитела также можно получить посредством скрининга библиотек антител, имеющих фиксированные последовательности CDR3 или минимальные необходимые детерминанты связывания, которые описаны в US20050255552, и разнообразные последовательности CDR1 и CDR2. Скрининг можно осуществлять согласно любой технологии скрининга, подходящей для скрининга антител из библиотек антител, как, например, технологии фагового дисплея.

Стандартные методики молекулярной биологии можно применять для получения и экспрессии измененной последовательности антитела. Антитело, кодируемое измененной(измененными) последовательностью(последовательностями) антитела, представляет собой антитело, которое сохраняет одно, некоторые или все из функциональных свойств ENTPD2-связывающих антител, описанных в данном документе, при этом данные функциональные свойства включают без ограничения специфичное связывание с белком ENTPD2 человека и его стабилизацию.

Функциональные свойства измененных антител можно оценить с помощью стандартных анализов, доступных из уровня техники и/или описанных в данном документе, таких как анализы, изложенные в разделе "Примеры" (например, разновидности ELISA).

В некоторых вариантах осуществления способов конструирования антител и их антигенсвязывающих фрагментов по настоящему изобретению мутации можно вводить произвольным или избирательным образом по всей последовательности, кодирующей ENTPD2-связывающее антитело, или ее части, и полученные модифицированные ENTPD2-связывающие антитела можно подвергнуть скринингу в отношении активности связывания и/или других функциональных свойств, описанных в данном документе. Способы введения мутаций были описаны в уровне техники. Например, в PCT-публикации WO 02/092780 описываются способы создания и скрининга мутантных вариантов антител с применением насыщающего мутагенеза, сборки с лигированием синтезированных фрагментов или их комбинации. В качестве альтернативы в PCT-публикации WO 03/074679 описываются способы применения способов вычислительного скрининга для оптимизации физико-химических свойств антител.

Определение характеристик антител

Характеристики антител и их антигенсвязывающих фрагментов по настоящему изобретению могут быть определены с помощью различных функциональных анализов. Например, их характеристики могут быть определены по их способности к связыванию с белком ENTPD2 (например, белком ENTPD2 человека).

Способность антитела к связыванию с ENTPD2 (например, белком ENTPD2 человека) можно выявить прямым способом посредством мечения антитела, представляющего интерес, или антитело может быть немеченым, и связывание выявляют непрямым способом с применением различных форматов сэндвич-анализов, известных из уровня техники.

В некоторых вариантах осуществления ENTPD2-связывающие антитела и их антигенсвязывающие фрагменты по настоящему изобретению блокируют связывание эталонного ENTPD2-связывающего антитела с белком ENTPD2 (например, белком ENTPD2 человека) или конкурируют с ним за это связывание. Они могут представлять собой полностью человеческие или гуманизированные ENTPD2-связывающие антитела, описанные выше. Они также могут представлять собой другие человеческие, мышиные, химерные или гуманизированные ENTPD2-связывающие антитела, которые связываются с тем же эпитопом, что и эталонное антитело. Способность к блокированию связывания эталонного антитела или конкуренции с ним за это связывание указывает на то, что тестируемое ENTPD2-связывающее антитело связывается с тем же или сходным эпитопом по сравнению с эпитопом, определяемым эталонным антителом, или с эпитопом, который расположен достаточно близко к эпитопу, с которым связывается эталонное ENTPD2-связывающее антитело. Особенно вероятно, что такие антитела обладают преимущественными свойствами, идентифицированными для эталонного антитела. Способность к блокированию эталонного антитела или конкуренции с ним можно определить, например, с помощью конкурентного анализа связывания. В конкурентном анализе связывания тестируемое антитело исследуют в отношении способности к ингибированию специфичного связывания эталонного антитела с общим антигеном, таким как белок ENTPD2 (например, белок ENTPD2 человека). Тестируемое антитело конкурирует с эталонным антителом за специфичное связывание с антигеном, если избыток тестируемого антитела осуществляет значительное ингибирование связывания эталонного антитела. Значительное ингибирование означает, что тестируемое антитело обычно снижает специфичное связывание эталонного антитела на по меньшей мере 10%, 25%, 50%, 75% или 90%.

Существует ряд известных конкурентных анализов связывания, которые можно применять для оценки конкуренции антитела с эталонным антителом за связывание с конкретным белком, в данном случае с ENTPD2 (например, белком ENTPD2 человека). Они включают, например, твердофазный прямой или непрямой радиоиммунологический анализ (RIA), твердофазный прямой или непрямой иммуноферментный анализ (EIA), конкурентный сэндвич-анализ (см. Stahli et al., Methods in Enzymology 9:242-253, 1983); твердофазный прямой EIA с использованием комплекса биотин-авидин (см. Kirkland et al., J. Immunol. 137:3614-3619, 1986); твердофазный анализ с прямым мечением, твердофазный сэндвич-анализ с прямым мечением (см. Harlow & Lane, выше); твердофазный RIA с прямым мечением с использованием метки I-125 (см. Morel et al., Molec. Immunol. 25:7-15, 1988); твердофазный прямой EIA с использованием комплекса биотин-авидин (Cheung et al., Virology 176:546-552, 1990) и RIA с прямым мечением (Moldenhauer et al., Scand. J. Immunol. 32:77-82, 1990). Как правило, такой анализ включает применение очищенного антигена, связанного с твердой поверхностью, или клеток, несущих любой из них, немеченого тестируемого ENTPD2-связывающего антитела и меченого эталонного антитела. Конкурентное ингибирование измеряют путем определения количества метки, связавшейся с твердой поверхностью или клетками в присутствии тестируемого антитела. Обычно тестируемое антитело присутствует в избытке. Антитела, идентифицируемые с помощью конкурентного анализа (конкурирующие антитела), включают в себя антитела, связывающиеся с тем же эпитопом, что и эталонное антитело, и антитела, связывающиеся со смежным эпитопом, который расположен достаточно близко к эпитопу, с которым связывается эталонное антитело, чтобы имело место стерическое несоответствие.

Для определения того, связываются ли выбранные ENTPD2-связывающие моноклональные антитела с уникальными эпитопами, каждое антитело можно биотинилировать с помощью коммерчески доступных реагентов (например, реагентов от Pierce, Рокфорд, Иллинойс). Конкурентные исследования с использованием немеченых моноклональных антител и биотинилированных моноклональных антител можно осуществлять с использованием планшетов для ELISA, покрытых белком ENTPD2. Связывание биотинилированного MAb можно выявить с помощью зонда на основе конъюгата стрептавидина и щелочной фосфатазы. Для определения изотипа очищенного ENTPD2-связывающего антитела можно выполнять ELISA с определением изотипа. Например, лунки титрационных микропланшетов можно покрывать 1 мкг/мл антитела к IgG человека в течение ночи при 4°C. После блокирования с помощью 1% BSA в планшетах осуществляют реакцию с моноклональным ENTPD2-связывающим антителом в концентрации 1 мкг/мл или меньше или очищенными изотипическими контролями при температуре окружающей среды в течение одного-двух часов. Затем содержимое лунок можно приводить в реакцию со специфическими в отношении IgG1 человека либо IgM человека зондами, конъюгированными со щелочной фосфатазой. Планшеты затем проявляют и анализируют таким образом, чтобы можно было определить изотип очищенного антитела.

Для демонстрации связывания моноклональных ENTPD2-связывающих антител с живыми клетками, экспрессирующими белок ENTPD2 (например, белок ENTPD2 человека), можно применять проточную цитометрию. Вкратце, линии клеток, экспрессирующих ENTPD2 (выращиваемые при стандартных условиях роста), можно смешивать с различными концентрациями ENTPD2-связывающего антитела в PBS, содержащем 0,1% BSA и 10% фетальную телячью сыворотку крови, и инкубировать при 37°C в течение 1 часа. После промывания осуществляют реакцию клеток с антителом к IgG человека, меченным флуоресцеином, при тех же самых условиях, что и при окрашивании первичным антителом. Образцы можно анализировать с помощью прибора FACScan с использованием свойств светорассеяния и бокового рассеяния в целях гейтирования по отдельным клеткам. Можно применять альтернативный анализ с использованием флуоресцентной микроскопии (в дополнение к анализу или вместо анализа) методом проточной цитометрии. Клетки можно окрашивать точно так же, как описано выше, и исследовать с помощью флуоресцентной микроскопии. Этот способ позволяет визуализировать отдельные клетки, однако может характеризоваться сниженной чувствительностью в зависимости от плотности антигена.

ENTPD2-связывающие антитела и их антигенсвязывающие фрагменты по настоящему изобретению можно дополнительно тестировать в отношении реактивности с белком ENTPD2 (например, белком ENTPD2 человека) или антигенным фрагментом с помощью вестерн-блоттинга. Вкратце, очищенный белок ENTPD2 (например, белок ENTPD2 человека) или слитые белки на его основе или клеточные экстракты из клеток, экспрессирующих ENTPD2, можно получить и подвергнуть электрофорезу в полиакриламидном геле в присутствии додецилсульфата натрия. После электрофореза разделенные антигены переносят на нитроцеллюлозные мембраны, блокированные 10% фетальной телячьей сывороткой крови, и зондируют с помощью моноклональных антител, подлежащих тестированию. Связывание с IgG человека можно выявить с помощью антитела к IgG человека, конъюгированного с щелочной фосфатазой, и проявить с помощью субстрата BCIP/NBT в виде таблеток (Sigma Chem. Co., Сент-Луис, Миссури).

ENTPD2-связывающие антитела и их антигенсвязывающие фрагменты по настоящему изобретению можно дополнительно тестировать в отношении их способностей к модулированию одной или нескольких форм активности/функций ENTPD2.

ENTPD2-связывающие антитела и их антигенсвязывающие фрагменты по настоящему изобретению также можно тестировать с помощью любого из способов или анализов, описанных в разделе "Примеры".

Способы лечения и терапевтическое применение

Антитела по настоящему изобретению имеют многочисленные диагностические и терапевтические полезные свойства in vitro и in vivo, которые включают диагностику и лечение нарушений с ENTPD2-зависимыми патофизиологическими особенностями. Например, эти молекулы можно вводить в клетки в культуре in vitro или ex vivo или субъектам-людям, например, in vivo, для лечения, предупреждения и диагностики ряда нарушений с ENTPD2-зависимыми патофизиологическими особенностями. Соответственно, в одном аспекте в данном документе предусмотрены способы лечения рака у субъекта, нуждающегося в этом, путем введения субъекту терапевтически эффективного количества антитела или его антигенсвязывающего фрагмента, описанного в данном документе, нуклеиновой кислоты, кодирующей такие антитело или антигенсвязывающий фрагмент, вектора, содержащего нуклеиновую кислоту, кодирующую такие антитело или антигенсвязывающий фрагмент, клетки, содержащей такие нуклеиновую кислоту или вектор, или фармацевтической композиции, содержащей такие антитело или антигенсвязывающий фрагмент, нуклеиновую кислоту, вектор или клетку. В одном аспекте в настоящем изобретении предусмотрен способ ингибирования или снижения интенсивности роста опухолевых клеток у субъекта, включающий введение субъекту терапевтически эффективного количества антитела к ENTPD2 человека, раскрытого в данном документе.

В другом аспекте предусмотрен способ лечения субъекта, например, снижения интенсивности или облегчения гиперпролиферативного состояния или нарушения (например, рака), например, солидной опухоли, гематологического рака, опухоли мягких тканей или метастатического поражения у субъекта.

Соответственно, в одном варианте осуществления в настоящем изобретении предусмотрен способ ингибирования роста опухолевых клеток у субъекта, включающий введение субъекту терапевтически эффективного количества одной или нескольких молекул антитела к ENTPD2 человека или их функциональных фрагментов, описанных в данном документе, в отдельности или в комбинации с другими средствами, например, терапевтическими средствами, или терапевтическими методами.

В некоторых вариантах осуществления такие способы могут дополнительно включать стадию анализа уровней экспрессии ENTPD2 в образце, полученном от субъекта, например, в биоптате ткани субъекта.

Термин "рак" подразумевается как включающий все типы раковых образований или онкогенных процессов, метастатических тканей или злокачественно трансформированных клеток, тканей или органов независимо от гистопатологического типа или стадии инвазивности. Примеры раковых нарушений включают без ограничения солидные опухоли, опухоли мягких тканей и метастатические поражения. Примеры солидных опухолей включают злокачественные новообразования, например, формы саркомы, формы аденокарциномы и формы карциномы различных систем органов, как, например, те, которые поражают печень, легкое, молочную железу, лимфоидную ткань, желудочно-кишечный тракт (например, толстую кишку), мочеполовой тракт (например, клетки почки, уротелиальные клетки), предстательную железу и глотку. Формы аденокарциномы включают такие злокачественные новообразования, как большинство форм рака толстой кишки, рак прямой кишки, почечноклеточную карциному, рак печени (гепатокарциному, например, гепатокарциному на поздней стадии при наличии или отсутствии вирусной инфекции, например, хронического вирусного гепатита), немелкоклеточную карциному легкого, рак тонкой кишки и рак пищевода. Формы плоскоклеточной карциномы включают злокачественные новообразования, например, в легком, пищеводе, коже, области головы и шеи, полости рта, заднем проходе и шейке матки.

Метастатические поражения при вышеупомянутых формах рака также можно лечить или предупреждать с помощью способов и композиций по настоящему изобретению.

Иллюстративные формы рака, рост которых можно ингибировать с помощью молекул антител, раскрытых в данном документе, включают формы рака, как правило, отвечающие на иммунотерапию. Неограничивающие примеры предпочтительных форм рака для лечения включают рак желудочно-кишечного тракта (например, рак желудка (желудочный рак), рак ободочной и прямой кишки (CRC)), рак пищевода (например, плоскоклеточную карциному пищевода (ESCC)), рак поджелудочной железы и холангиокарциному. Кроме того, рефрактерные или рецидивирующие злокачественные новообразования можно лечить с помощью молекул антител, описанных в данном документе.

Примеры других форм рака, которые можно лечить, включают рак легкого (например, немелкоклеточный рак легкого (NSCLC) (например, NSCLC плоскоклеточного и/или неплоскоклеточного гистологического подтипа или NSCLC в форме аденокарциномы)), меланому (например, меланому на поздней стадии), рак почки (например, почечноклеточную карциному, например, светлоклеточную почечноклеточную карциному), рак печени, миелому (например, множественную миелому), рак предстательной железы, рак молочной железы (например, рак молочной железы, который не характеризуется экспрессией одного, двух или всех из эстрогенового рецептора, прогестеронового рецептора или Her2/neu, например, трижды негативный рак молочной железы), рак поджелудочной железы, рак головы и шеи (например, плоскоклеточную карциному головы и шеи (HNSCC)), рак анального канала, рак желудка и пищевода, рак щитовидной железы, рак шейки матки, лимфопролиферативное заболевание (например, посттрансплантационное лимфопролиферативное заболевание) или гематологический рак, T-клеточную лимфому, неходжкинскую лимфому или лейкоз (например, миелоидный лейкоз), рак костей, рак поджелудочной железы, рак кожи, рак головы и шеи, злокачественную меланому кожи или внутриглазную злокачественную меланому, рак матки, рак яичника, рак прямой кишки, рак анального канала, рак желудка и пищевода, рак желудка, рак яичка, рак матки, карциному фаллопиевых труб, карциному эндометрия, карциному шейки матки, карциному влагалища, карциному вульвы, болезнь Ходжкина, неходжкинскую лимфому, миелому (например, множественную миелому), рак пищевода, рак тонкой кишки, рак эндокринной системы, рак щитовидной железы, рак паращитовидной железы, рак надпочечника, саркому мягких тканей, рак уретры, рак полового члена, хронические или острые формы лейкоза, в том числе острый миелоидный лейкоз, хронический миелоидный лейкоз, острый лимфобластный лейкоз, хронический лимфоцитарный лейкоз, солидные опухоли детского возраста, лимфоцитарную лимфому, рак мочевого пузыря, рак почки (например, почечный рак, например, почечноклеточную карциному (RCC) (например, метастатическую RCC или светлоклеточную почечноклеточную карциному)), рак мочеточника, карциному почечной лоханки, неоплазию центральной нервной системы (CNS), первичную лимфому CNS, ангиогенез в опухоли, опухоль оси позвоночника, глиому ствола головного мозга, аденому гипофиза, саркому Капоши, эпидермоидный рак, плоскоклеточный рак, T-клеточную лимфому, формы рака, индуцированные факторами окружающей среды, в том числе индуцированные асбестом, и комбинации указанных форм рака.

В некоторых вариантах осуществления средства терапии, представленные в данном документе, можно применять для лечения пациента, у которого имеется (или который идентифицирован как имеющий) рак, ассоциированный с инфекцией, например, вирусной или бактериальной инфекцией. Иллюстративные формы рака включают рак шейки матки, рак анального канала, HPV-ассоциированный плоскоклеточный рак головы и шеи, HPV-ассоциированные формы папилломы пищевода, HHV6-ассоциированные формы лимфомы, EBV-ассоциированные формы лимфомы (в том числе лимфома Беркитта), MALT-лимфому желудка, другие формы MALT-лимфомы, ассоциированные с инфекцией, HCC и саркому Капоши.

В других вариантах осуществления рак представляет собой гематологическое злокачественное новообразование или рак, включающий без ограничения лейкоз или лимфому. Например, молекулу антитела к ENTPD2 человека или ее антигенсвязывающий фрагмент в отдельности или в комбинации с другими средствами, например, терапевтическими средствами, можно применять для лечения форм рака и злокачественных новообразований, в том числе без ограничения, например, форм острого лейкоза, в том числе без ограничения, например, B-клеточного острого лимфоидного лейкоза ("BALL"), T-клеточного острого лимфоидного лейкоза ("TALL"), острого лимфоидного лейкоза (ALL); одной или нескольких форм хронического лейкоза, в том числе без ограничения, например, хронического миелогенного лейкоза (CML), хронического лимфоцитарного лейкоза (CLL); дополнительных форм гематологического рака или гематологических состояний, в том числе без ограничения, например, B-клеточного пролимфоцитарного лейкоза, бластной плазмоцитоидной дендритноклеточной неоплазии, лимфомы Беркитта, диффузной крупноклеточной B-клеточной лимфомы, фолликулярной лимфомы, волосатоклеточного лейкоза, мелкоклеточной или крупноклеточной фолликулярной лимфомы, злокачественных лимфопролиферативных состояний, MALT-лимфомы, мантийноклеточной лимфомы, лимфомы из клеток маргинальной зоны, множественной миеломы, миелодисплазии и миелодиспластического синдрома, неходжкинской лимфомы, плазмобластной лимфомы, плазмоцитоидной дендритноклеточной неоплазии, макроглобулинемии Вальденстрема и "предлейкоза", который представляет собой разнообразную группу гематологических состояний, объединенных неэффективным образованием (или дисплазией) миелоидных клеток крови, и т. п.

В одном варианте осуществления рак выбран из рака ободочной кишки (например, рака ободочной и прямой кишки (CRC) или аденокарциномы ободочной и прямой кишки), рака желудка (например, аденокарциномы желудка, карциномы желудка), рака пищевода (например, плоскоклеточной карциномы пищевода (ESCC)), рака легкого (например, мелкоклеточного рака легкого), рака молочной железы (например, аденокарциномы молочной железы) или рака яичника.

В одном варианте осуществления рак представляет собой рак ободочной и прямой кишки (CRC) или аденокарциному ободочной и прямой кишки.

В другом варианте осуществления рак представляет собой рак желудка.

В еще одном варианте осуществления рак представляет собой плоскоклеточную карциному пищевода (ESCC).

В еще одном варианте осуществления рак характеризуется сверхэкспрессией ENTPD2 (является ENTPD2-положительным/ENTPD2+), как, например, ENTPD2+ CRC, ENTPD2+ рак желудка (например, ENTPD2-положительный рак желудка), ENTPD2+ плоскоклеточная карцинома пищевода (ENTPD2+ ESCC).

Антитело или его антигенсвязывающий фрагмент, описанные в данном документе, нуклеиновую кислоту, кодирующую такие антитело или антигенсвязывающий фрагмент, или вектор или клетку, содержащие нуклеиновую кислоту, кодирующую такие антитело или антигенсвязывающий фрагмент, или фармацевтическую композицию, содержащую такие антитело или антигенсвязывающий фрагмент, нуклеиновую кислоту, вектор или клетку, можно вводить субъекту посредством внутривенного, внутриопухолевого или подкожного путей. В некоторых вариантах осуществления такие антитело или его фрагмент, нуклеиновую кислоту, вектор, клетку или фармацевтическую композицию вводят внутривенно.

Также предусмотрены антитело или его антигенсвязывающий фрагмент, описанные в данном документе, фармацевтическая композиция, содержащая такие антитело или антигенсвязывающий фрагмент, нуклеиновая кислота, кодирующая такие антитело или антигенсвязывающий фрагмент, или вектор, содержащий нуклеиновую кислоту, кодирующую такие антитело или антигенсвязывающий фрагмент, для применения в лечении рака.

В настоящем изобретении также предусмотрены пути применения антитела или его антигенсвязывающего фрагмента, описанных в данном документе, фармацевтической композиции, содержащей такие антитело или антигенсвязывающий фрагмент, нуклеиновой кислоты, кодирующей такие антитело или антигенсвязывающий фрагмент, или вектора, содержащего нуклеиновую кислоту, кодирующую такие антитело или антигенсвязывающий фрагмент, в изготовлении лекарственного препарата для лечения рака.

Виды комбинированной терапии

Различные средства лечения, описанные выше, можно применять в комбинации с другим средством лечения. Настоящее изобретение также относится к фармацевтической композиции, содержащей комбинацию в соответствии с настоящим изобретением, описанную в данном документе, в частности, вместе с инструкциями по одновременному, раздельному или последовательному ее применению (особенно в случае совместной активности) в лечении рака. Например, антитела к ENTPD2 или их антигенсвязывающие фрагменты, описанные в данном документе, можно применять в комбинации с одним или несколькими средствами лечения, представляющими собой стандарт оказания медицинской помощи (например, при раке), другой молекулой антитела, иммуномодулятором (например, активатором костимулирующей молекулы или ингибитором коингибирующей молекулы); вакциной, например, терапевтической противораковой вакциной; или другими формами клеточной терапии, описанными ниже.

Соответственно, способы лечения рака, описанные в данном документе, могут дополнительно включать введение по меньшей мере одного дополнительного терапевтического средства субъекту, нуждающемуся в лечении. Также в данном документе предусмотрены способы лечения рака, включающие введение по меньшей мере двух дополнительных терапевтических средств субъекту, нуждающемуся в лечении.

Термин "комбинация" относится к фиксированной комбинации в одной единичной лекарственной форме либо к комбинированному введению, где соединение по настоящему изобретению и по меньшей мере одного партнера по комбинации (например, по меньшей мере одно другое лекарственное средство, которое поясняется ниже, также называемое "терапевтическим(терапевтическими) средством(средствами)" или "совместно применяемым(применяемыми) средством(средствами)") можно вводить независимо в одно и то же время или по отдельности в пределах временных промежутков, особенно если эти временные промежутки обеспечивают партнерам по комбинации возможность проявления кооперативного, например, синергического, эффекта. Отдельные компоненты могут быть упакованы в набор или предоставлены по отдельности. Один или оба компонента (например, порошки или жидкости) могут быть восстановлены или разбавлены до необходимой дозы перед введением. Термины "совместное введение" или "комбинированное введение" или им подобные, используемые в данном документе, подразумеваются как охватывающие введение выбранного партнера по комбинации одному субъекту, нуждающемуся в этом (например, пациенту), и предполагают включение режимов лечения, в которых средства не обязательно вводят одним и тем же путем введения или в одно и то же время. Термин "фармацевтическая комбинация", используемый в данном документе, означает продукт, полученный в результате смешивания или комбинирования более чем одного терапевтического средства, который включает как фиксированные, так и нефиксированные комбинации терапевтических средств. Термин "фиксированная комбинация" означает, что оба терапевтические средства, например, соединение по настоящему изобретению и партнера по комбинации, вводят пациенту одновременно в виде единого объекта или дозы. Термин "нефиксированная комбинация" означает, что терапевтические средства, например, соединение по настоящему изобретению и по меньшей мере одного партнера по комбинации, вводят пациенту в виде отдельных объектов одновременно, параллельно либо последовательно без конкретных временных ограничений, при этом такое введение обеспечивает терапевтически эффективные уровни по меньшей мере двух соединений в организме пациента. Последнее также применимо в отношении "коктейльной терапии", например, при введении трех или более терапевтических средств.

Используемый в данном документе термин "фармацевтическая комбинация" относится к фиксированной комбинации в одной единичной лекарственной форме либо нефиксированной комбинации или набору из частей для комбинированного введения, где два или более терапевтических средства можно вводить независимо в одно и то же время или по отдельности в пределах временных промежутков, особенно если эти временные промежутки обеспечивают партнерам по комбинации возможность проявления кооперативного, например, синергического, эффекта.

Термин "комбинированная терапия" относится к введению двух или более терапевтических средств для лечения терапевтического состояния или нарушения, описанного в настоящем изобретении. Такое введение охватывает совместное введение данных терапевтических средств по существу одновременно, как, например, в одной капсуле, имеющей фиксированное соотношение активных ингредиентов. В качестве альтернативы такое введение охватывает совместное введение в нескольких или в отдельных контейнерах (например, таблетках, капсулах, порошках и жидкостях) для каждого активного ингредиента. Порошки и/или жидкости могут быть восстановлены или разбавлены до требуемой дозы перед введением. Кроме того, такое введение также охватывает применение каждого типа терапевтического средства последовательно примерно в одно и то же время либо в разное время. В любом случае режим лечения будет обеспечивать благоприятные эффекты комбинации лекарственных средств при лечении состояний или нарушений, описанных в данном документе.

Молекулы антител к ENTPD2 можно применять в комбинации с другими средствами терапии. Например, комбинированная терапия может включать композицию по настоящему изобретению, совместно составленную и/или вводимую вместе с одним или несколькими дополнительными терапевтическими средствами, например, одним или несколькими противораковыми средствами, цитотоксическими или цитостатическими средствами, гормональными средствами лечения, вакцинами и/или другими средствами иммунотерапии. В других вариантах осуществления молекулы антител вводят в комбинации с другими методами терапевтического лечения, включающими хирургическое вмешательство, облучение, криохирургию и/или термотерапию. В таких видах комбинированной терапии можно преимущественно использовать более низкие дозы вводимых терапевтических средств, избегая таким образом возможных токсических эффектов или осложнений, связанных с различными видами монотерапии.

Термин "в комбинации с" не предполагает обозначение того, что вид терапии или терапевтические средства должны вводиться в одно и то же время и/или быть составлены для совместной доставки, хотя данные способы доставки находятся в пределах объема, описанного в данном документе.

Молекулы антител к ENTPD2 человека можно вводить параллельно с по меньшей мере одним или несколькими дополнительными видами терапии или терапевтическими средствами, до них или после них. Молекулу антитела к ENTPD2 человека и другое по меньшей мере одно средство или терапевтический протокол можно применять в любом порядке. Как правило, каждое средство будет вводиться в дозе и/или по временному графику, которые определены для данного средства. Также следует понимать, что по меньшей мере одно дополнительное терапевтическое средство, используемое в данной комбинации, можно вводить совместно в одной композиции или вводить по отдельности в разных композициях. В целом, ожидается, что дополнительные терапевтические средства, используемые в комбинации, будут использоваться на уровнях, которые не превышают уровни, на которых они используются по отдельности. В некоторых вариантах осуществления уровни, используемые в комбинации, будут ниже уровней при использовании по отдельности.

Настоящее изобретение, таким образом, помимо прочего, относится к комбинированному продукту для одновременного, раздельного или последовательного применения, такому как комбинированный препарат или фиксированная фармацевтическая комбинация, или к комбинации такого препарата и комбинации.

Иллюстративные антагонисты аденозинового рецептора A2A

В определенных вариантах осуществления молекулы антител к ENTPD2 человека, описанные в данном документе, вводят в комбинации с по меньшей мере одним антагонистом аденозинового рецептора A2A (A2AR). В определенных вариантах осуществления молекулы антител к ENTPD2 человека, описанные в данном документе, вводят в комбинации с по меньшей мере двумя антагонистами аденозинового рецептора A2A (A2AR). Иллюстративные антагонисты A2AR включают без ограничения, например, PBF509/NIR178 (Palobiofarma/Novartis), CPI444/V81444 (Corvus/Genentech), AZD4635/HTL-1071 (AstraZeneca/Heptares), випаденант (Redox/Juno), GBV-2034 (Globavir), AB928 (Arcus Biosciences), теофиллин, истрадефиллин (Kyowa Hakko Kogyo), тозаденант/SYN-115 (Acorda), KW-6356 (Kyowa Hakko Kogyo), ST-4206 (Leadiant Biosciences) и преладенант/SCH 420814 (Merck/Schering).

В определенных вариантах осуществления антагонист A2AR представляет собой PBF509/NIR178. PBF509/NIR178 и другие антагонисты A2AR раскрыты в US 8796284 и WO 2017/025918, включенных в данный документ посредством ссылки во всей своей полноте. В определенных вариантах осуществления антагонист A2AR представляет собой 5-бром-2,6-ди-(1H-пиразол-1-ил)пиримидин-4-амин или его фармацевтически приемлемую соль. В определенных вариантах осуществления антагонист A2AR имеет следующую структуру:

или его фармацевтически приемлемая соль.

В определенных вариантах осуществления антагонист A2AR представляет собой CPI444/V81444. CPI-444 и другие антагонисты A2AR раскрыты в WO 2009/156737, включенной в данный документ посредством ссылки во всей своей полноте. В определенных вариантах осуществления антагонист A2AR представляет собой (S)-7-(5-метилфуран-2-ил)-3-((6-(((тетрагидрофуран-3-ил)окси)метил)пиридин-2-ил)метил)-3H-[1,2,3]триазоло[4,5-d]пиримидин-5-амин или его фармацевтически приемлемую соль. В определенных вариантах осуществления антагонист A2AR представляет собой (R)-7-(5-метилфуран-2-ил)-3-((6-(((тетрагидрофуран-3-ил)окси)метил)пиридин-2-ил)метил)-3H-[1,2,3]триазоло[4,5-d]пиримидин-5-амин, или его рацемат, или его фармацевтически приемлемую соль. В определенных вариантах осуществления антагонист A2AR представляет собой 7-(5-метилфуран-2-ил)-3-((6-(((тетрагидрофуран-3-ил)окси)метил)пиридин-2-ил)метил)-3H-[1,2,3]триазоло[4,5-d]пиримидин-5-амин или его фармацевтически приемлемую соль. В определенных вариантах осуществления антагонист A2AR имеет следующую структуру:

или его фармацевтически приемлемая соль.

В определенных вариантах осуществления антагонист A2AR представляет собой AZD4635/HTL-1071. Антагонисты A2AR раскрыты в WO 2011/095625, включенной в данный документ посредством ссылки во всей своей полноте. В определенных вариантах осуществления антагонист A2AR представляет собой 6-(2-хлор-6-метилпиридин-4-ил)-5-(4-фторфенил)-1,2,4-триазин-3-амин или его фармацевтически приемлемую соль. В определенных вариантах осуществления антагонист A2AR имеет следующую структуру:

или его фармацевтически приемлемая соль.

В определенных вариантах осуществления антагонист A2AR представляет собой ST-4206 (Leadiant Biosciences). В определенных вариантах осуществления антагонист A2AR является антагонистом A2AR, описанным в US 9133197, включенном в данный документ посредством ссылки во всей своей полноте. В определенных вариантах осуществления антагонист A2AR имеет следующую структуру:

или его фармацевтически приемлемая соль.

В определенных вариантах осуществления антагонист A2AR является антагонистом A2AR, описанным в US8114845, US9029393, US20170015758 или US20160129108, включенных в данный документ посредством ссылки во всей своей полноте.

В определенных вариантах осуществления антагонист A2AR представляет собой истрадефиллин (регистрационный номер CAS: 155270-99-8). Истрадефиллин также известен как KW-6002 или 8-[(E)-2-(3,4-диметоксифенил)винил]-1,3-диэтил-7-метил-3,7-дигидро-1H-пурин-2,6-дион. Истрадефиллин раскрыт, например, в LeWitt et al. (2008) Annals of Neurology 63 (3): 295-302.

В определенных вариантах осуществления антагонист A2AR представляет собой тозаденант (Biotie). Тозаденант также известен как SYN115 или 4-гидрокси-N-(4-метокси-7-морфолин-4-ил-1,3-бензотиазол-2-ил)-4-метилпиперидин-1-карбоксамид. Тозаденант блокирует эффект эндогенного аденозина в отношении рецепторов А2А, что приводит к усилению эффекта дофамина в отношении рецептора D2 и ингибированию эффекта глутамата в отношении рецептора mGluR5. В некоторых вариантах осуществления антагонист A2AR представляет собой преладенант (регистрационный номер CAS: 377727-87-2). Преладенант также известен как SCH 420814 или 2-(2-фуранил)-7-[2-[4-[4-(2-метоксиэтокси)фенил]-1-пиперазинил]этил]7H-пиразоло[4,3-е][1,2,4]триазоло[1,5-с]пиримидин-5-амин. Преладенант был разработан как лекарственное средство, действующее в качестве сильного и избирательного антагониста аденозинового рецептора А2А.

В определенных вариантах осуществления антагонист A2AR представляет собой випаденант. Випаденант также известен как BIIB014, V2006 или 3-[(4-амино-3-метилфенил)метил]-7-(фуран-2-ил)триазоло[4,5-d]пиримидин-5-амин.

Другие иллюстративные антагонисты A2AR включают, например, ATL-444, MSX-3, SCH-58261, SCH-412348, SCH-442416, VER-6623, VER-6947, VER-7835, CGS-15943 или ZM-241385.

В некоторых вариантах осуществления антагонист A2AR является антагонистом сигнального пути A2AR, например, ингибитором CD-73, например, антителом к CD73. Целенаправленное воздействие на внеклеточное продуцирование аденозина под действием CD73 может ослаблять иммуносупрессивные эффекты аденозина. Антитела к CD73 характеризуются рядом форм активности, например, ингибированием активности эктонуклеотидазы CD73, ослаблением АМР-опосредованной супрессии лимфоцитов и ингибированием роста сингенных опухолей. Антитела к CD73 могут управлять изменениями как в миелоидных, так и лимфоидных популяциях инфильтрирующих лейкоцитов в микроокружении опухоли. Эти изменения включают, например, увеличение количества CD8+ эффекторных клеток и активированных макрофагов, а также снижение доли супрессорных клеток миелоидного происхождения (MDSC) и регуляторных Т-лимфоцитов. В одном варианте осуществления молекула антитела к CD73 представляет собой полную молекулу антитела или ее антигенсвязывающий фрагмент. В некоторых вариантах осуществления молекула антитела к CD73 выбрана из любой из молекул антител, перечисленных в таблице 2. В других вариантах осуществления молекула антитела к CD73 содержит последовательность вариабельного домена тяжелой цепи, последовательность вариабельного домена легкой цепи или их обе, раскрытые в таблице 2. В определенных вариантах осуществления молекула антитела к CD73 связывается с белком CD73 и снижает активность CD73, например, CD73 человека, например, ингибирует ее или оказывает на нее антагонистическое действие.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в WO 2016/075099, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 представляет собой MEDI 9447, например, раскрытый в WO 2016/075099. Альтернативные названия MEDI 9447 включают клон 10.3 или 73combo3. MEDI 9447 представляет собой антитело IgG1, которое ингибирует активность CD73, например, оказывает на нее антагонистическое действие. MEDI 9447 и другие молекулы антител к CD73 также раскрыты в WO 2016/075176 и US2016/0129108, полное содержание которых включено в данный документ посредством ссылки во всей своей полноте.

В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из MEDI 9477. Аминокислотная последовательность вариабельного домена тяжелой цепи MEDI 9477 раскрыта под SEQ ID NO: 295 (см. таблицу 2). Аминокислотная последовательность вариабельного домена легкой цепи MEDI 9477 раскрыта под SEQ ID NO: 296 (см. таблицу 2).

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в WO 2016/081748, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 представляет собой 11F11, например, раскрытый в WO 2016/081748. 11F11 представляет собой антитело IgG2, которое ингибирует активность CD73, например, оказывает на нее антагонистическое действие. Антитела, полученные из 11F11, например, CD73.4 и CD73.10; клоны 11F11, например, 11F11-1 и 11F11-2; и другие молекулы антител к CD73 раскрыты в WO 2016/081748 и US 9605080, полное содержание которых включено в данный документ посредством ссылки во всей своей полноте.

В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из 11F11-1 или 11F11-2. Аминокислотная последовательность вариабельного домена тяжелой цепи 11F11-1 раскрыта под SEQ ID NO: 302 (см. таблицу 2). Аминокислотная последовательность вариабельного домена легкой цепи 11F11-1 раскрыта под SEQ ID NO: 303 (см. таблицу 2). Аминокислотная последовательность вариабельного домена тяжелой цепи 11F11-2 раскрыта под SEQ ID NO: 299 (см. таблицу 2). Аминокислотная последовательность вариабельного домена легкой цепи 11F11-2 раскрыта под SEQ ID NO: 300 (см. таблицу 2). В одном варианте осуществления молекула антитела к CD73 содержит тяжелую цепь, легкую цепь или их обе из 11F11-1 или 11F11-2. Аминокислотные последовательности тяжелой и легкой цепей 11F11-1 раскрыты соответственно под SEQ ID NO: 297 и SEQ ID NO: 301 (см. таблицу 2). Аминокислотные последовательности тяжелой и легкой цепей 11F11-2 раскрыты соответственно под SEQ ID NO: 294 и SEQ ID NO: 298 (см. таблицу 2).

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое, например, в US 9605080, включенном в данный документ посредством ссылки во всей своей полноте.

В одном варианте осуществления молекула антитела к CD73 представляет собой CD73.4, например, раскрытый в US 9605080. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из CD73.4. Аминокислотная последовательность вариабельного домена тяжелой цепи CD73.4 раскрыта под SEQ ID NO: 304 (см. таблицу 2). Аминокислотная последовательность вариабельного домена легкой цепи 11F11-2 раскрыта под SEQ ID NO: 305 (см. таблицу 2).

В одном варианте осуществления молекула антитела к CD73 представляет собой CD73.10, например, раскрытый в US 9605080. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из CD73.10. Аминокислотная последовательность вариабельного домена тяжелой цепи CD73.10 раскрыта под SEQ ID NO: 306 (см. таблицу 2). Аминокислотная последовательность вариабельного домена легкой цепи CD73.10 раскрыта под SEQ ID NO: 307 (см. таблицу 2).

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в WO 2009/0203538, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 представляет собой 067-213, например, раскрытый в WO 2009/0203538.

В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из 067-213. Аминокислотная последовательность вариабельного домена тяжелой цепи 067-213 раскрыта под SEQ ID NO: 308 (см. таблицу 2). Аминокислотная последовательность вариабельного домена легкой цепи 067-213 раскрыта под SEQ ID NO: 309 (см. таблицу 2).

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в US 9090697, включенном в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 представляет собой TY/23, например, раскрытый в US 9090697. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из TY/23.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в WO 2016/055609, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из антитела к CD73, раскрытого в WO 2016/055609.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в WO 2016/146818, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из антитела к CD73, раскрытого в WO 2016/146818.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в WO 2004/079013, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из антитела к CD73, раскрытого в WO 2004/079013.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в WO 2012/125850, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из антитела к CD73, раскрытого в WO 2012/125850.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в WO 2015/004400, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из антитела к CD73, раскрытого в WO 2015/004400.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в WO 2007/146968, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из антитела к CD73, раскрытого в WO 2007146968.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в US2007/0042392, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из антитела к CD73, раскрытого в US2007/0042392.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в US2009/0138977, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из антитела к CD73, раскрытого в US2009/0138977.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое во Flocke et al., Eur J Cell Biol. 1992 Jun;58(1):62-70, включенной в данный документ посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из антитела к CD73, раскрытого во Flocke et al., Eur J Cell Biol. 1992 Jun;58(1):62-70.

В одном варианте осуществления молекула антитела к CD73 представляет собой антитело к CD73, раскрытое в Stagg et al., PNAS. 2010 Jan 107(4): 1547-1552, включенной в данный документ посредством ссылки во всей своей полноте. В некоторых вариантах осуществления молекула антитела к CD73 представляет собой TY/23 или TY11.8, раскрытый у Stagg et al. В одном варианте осуществления молекула антитела к CD73 содержит вариабельный домен тяжелой цепи, вариабельный домен легкой цепи или их оба из антитела к CD73, раскрытого у Stagg et al.

В одном варианте осуществления антитело к ENTPD2 человека, описанное в данном документе, вводят в комбинации с молекулой антитела к CD73, например, описанной в данном документе, и антагонистом A2AR, необязательно выбранным из группы, содержащей PBF509/NIR178, CPI444/V81444, AZD4635/HTL-1071, випаденант, GBV-2034, AB928, теофиллин, истрадефиллин, тозаденант/SYN-115, KW-6356, ST-4206 и преладенант/SCH 420814.

Таблица 2. Последовательности иллюстративных молекул антител к CD73

MEDI 9447
WO 2016/081748
WO 2016/081748

Молекулы антител к CD73, применяемые в видах комбинированной терапии, раскрытых в данном документе, могут содержать любую из последовательностей VH/VL, раскрытых в таблице 2, или аминокислотную последовательность, по существу идентичную ей (например, на по меньшей мере 80%, 85%, 90%, 95%, 99% или больше идентичную ей). Иллюстративные последовательности антител к CD73 включают:

(i) аминокислотные последовательности VH и VL из MEDI 9447, SEQ ID NO: 295-296 соответственно, или аминокислотную последовательность, по существу идентичную им (например, на по меньшей мере 80%, 85%, 90%, 95%, 99% или больше идентичную по отношению к SEQ ID NO: 295-296);

(ii) аминокислотные последовательности HC и LC из 11F11-2, SEQ ID NO: 297-298 соответственно, или аминокислотную последовательность, по существу идентичную им (например, на по меньшей мере 80%, 85%, 90%, 95%, 99% или больше идентичную по отношению к SEQ ID NO: 297-298);

(iii) аминокислотные последовательности VH и VL из 11F11-2, SEQ ID NO: 299-300 соответственно, или аминокислотную последовательность, по существу идентичную им (например, на по меньшей мере 80%, 85%, 90%, 95%, 99% или больше идентичную по отношению к SEQ ID NO: 299-300);

(iv) аминокислотные последовательности HC и LC из 11F11-1, SEQ ID NO: 297 и 301 соответственно, или аминокислотную последовательность, по существу идентичную им (например, на по меньшей мере 80%, 85%, 90%, 95%, 99% или больше идентичную по отношению к SEQ ID NO: 297 и 301);

(v) аминокислотные последовательности VH и VL из 11F11-1, SEQ ID NO: 302-303 соответственно, или аминокислотную последовательность, по существу идентичную им (например, на по меньшей мере 80%, 85%, 90%, 95%, 99% или больше идентичную по отношению к SEQ ID NO: 302-303);

(vi) аминокислотные последовательности VH и VL из CD73.4, SEQ ID NO: 304-305 соответственно, или аминокислотную последовательность, по существу идентичную им (например, на по меньшей мере 80%, 85%, 90%, 95%, 99% или больше идентичную по отношению к SEQ ID NO: 304-305);

(vii) аминокислотные последовательности VH и VL из CD73.10, SEQ ID NO: 306-307 соответственно, или аминокислотную последовательность, по существу идентичную им (например, на по меньшей мере 80%, 85%, 90%, 95%, 99% или больше идентичную по отношению к SEQ ID NO: 306-307); или

(viii) аминокислотные последовательности VH и VL из 067-213, SEQ ID NO: 308-309 соответственно, или аминокислотную последовательность, по существу идентичную им (например, на по меньшей мере 80%, 85%, 90%, 95%, 99% или больше идентичную по отношению к SEQ ID NO: 308-309).

Антитело к ENTPD2 человека, описанное в данном документе, можно применять в комбинации с ингибитором коингибирующей молекулы (например, ингибитором PD-1 (например, молекулой антитела к PD-1), ингибитором PD-L1 (например, молекулой антитела к PD-L1), ингибитором PD-L2 (например, молекулой антитела к PD-L2), ингибитором LAG-3 (например, молекулой антитела к LAG-3), ингибитором TIM-3 (например, молекулой антитела к TIM-3)), активатором костимулирующей молекулы (например, агонистом GITR (например, молекулой антитела к GITR)), цитокином (например, IL-15 в комплексе с растворимой формой альфа-субъединицы рецептора IL-15 (IL-15Ra)) или любой их комбинацией.

Ингибиторы PD-1

В определенных вариантах осуществления антитело к ENTPD2, описанное в данном документе, вводят в комбинации с ингибитором PD-1. В некоторых вариантах осуществления ингибитор PD-1 выбран из PDR001 (Novartis), ниволумаба (Bristol-Myers Squibb), пембролизумаба (Merck & Co), пидилизумаба (CureTech), MEDI0680 (Medimmune), REGN2810 (Regeneron), TSR-042 (Tesaro), PF-06801591 (Pfizer), BGB-A317 (Beigene), BGB-108 (Beigene), INCSHR1210 (Incyte) или AMP-224 (Amplimmune).

Иллюстративные ингибиторы PD-1

В одном варианте осуществления ингибитор PD-1 представляет собой молекулу антитела к PD-1. В одном варианте осуществления ингибитор PD-1 представляет собой молекулу антитела к PD-1, описанную в US 2015/0210769, опубликованной 30 июля 2015 г. под названием "Antibody Molecules to PD-1 and Uses Thereof", включенной посредством ссылки во всей своей полноте.

В одном варианте осуществления молекула антитела к PD-1 содержит по меньшей мере одну, две, три, четыре, пять или шесть областей, определяющих комплементарность (CDR) (или в совокупности все CDR), из вариабельной области тяжелой и легкой цепей, содержащей аминокислотную последовательность, показанную в таблице 3 (например, из последовательностей вариабельной области тяжелой и легкой цепей BAP049 клона E или BAP049 клона B, раскрытых в таблице 3), или кодируемой нуклеотидной последовательностью, показанной в таблице 3. В некоторых вариантах осуществления CDR указаны согласно определению по Kabat (например, как изложено в таблице 3). В некоторых вариантах осуществления CDR указаны согласно определению по Chothia (например, как изложено в таблице 3). В некоторых вариантах осуществления CDR указаны согласно комбинации определений CDR как по Kabat, так и по Chothia (например, как изложено в таблице 3). В одном варианте осуществления CDR1 VH согласно комбинации определений CDR по Kabat и Chothia содержит аминокислотную последовательность GYTFTTYWMH (SEQ ID NO: 541). В одном варианте осуществления одна или несколько CDR (или в совокупности все CDR) имеют одно, два, три, четыре, пять, шесть или больше изменений, например, аминокислотных замен (например, консервативных аминокислотных замен) или делеций, по сравнению с аминокислотной последовательностью, показанной в таблице 3 или кодируемой нуклеотидной последовательностью, показанной в таблице 3.

В одном варианте осуществления молекула антитела к PD-1 содержит вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность VHCDR1 под SEQ ID NO: 501, аминокислотную последовательность VHCDR2 под SEQ ID NO: 502 и аминокислотную последовательность VHCDR3 под SEQ ID NO: 503; и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность VLCDR1 под SEQ ID NO: 510, аминокислотную последовательность VLCDR2 под SEQ ID NO: 511 и аминокислотную последовательность VLCDR3 под SEQ ID NO: 512, каждая из которых раскрыта в таблице 3.

В одном варианте осуществления молекула антитела содержит VH, содержащую VHCDR1, кодируемую нуклеотидной последовательностью под SEQ ID NO: 524, VHCDR2, кодируемую нуклеотидной последовательностью под SEQ ID NO: 525, и VHCDR3, кодируемую нуклеотидной последовательностью под SEQ ID NO: 526; и VL, содержащую VLCDR1, кодируемую нуклеотидной последовательностью под SEQ ID NO: 529, VLCDR2, кодируемую нуклеотидной последовательностью под SEQ ID NO: 530, и VLCDR3, кодируемую нуклеотидной последовательностью под SEQ ID NO: 531, каждая из которых раскрыта в таблице 3.

В одном варианте осуществления молекула антитела к PD-1 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 506 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 506. В одном варианте осуществления молекула антитела к PD-1 содержит VL, содержащую аминокислотную последовательность под SEQ ID NO: 520 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 520. В одном варианте осуществления молекула антитела к PD-1 содержит VL, содержащую аминокислотную последовательность под SEQ ID NO: 516 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 516. В одном варианте осуществления молекула антитела к PD-1 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 506, и VL, содержащую аминокислотную последовательность под SEQ ID NO: 520. В одном варианте осуществления молекула антитела к PD-1 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 506, и VL, содержащую аминокислотную последовательность под SEQ ID NO: 516.

В одном варианте осуществления молекула антитела содержит VH, кодируемую нуклеотидной последовательностью под SEQ ID NO: 507 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 507. В одном варианте осуществления молекула антитела содержит VL, кодируемую нуклеотидной последовательностью под SEQ ID NO: 521 или 517 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 521 или 517. В одном варианте осуществления молекула антитела содержит VH, кодируемую нуклеотидной последовательностью под SEQ ID NO: 507, и VL, кодируемую нуклеотидной последовательностью под SEQ ID NO: 521 или 517.

В одном варианте осуществления молекула антитела к PD-1 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 508 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 508. В одном варианте осуществления молекула антитела к PD-1 содержит легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 522 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 522. В одном варианте осуществления молекула антитела к PD-1 содержит легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 518 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 518. В одном варианте осуществления молекула антитела к PD-1 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 508, и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 522. В одном варианте осуществления молекула антитела к PD-1 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 508, и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 518.

В одном варианте осуществления молекула антитела содержит тяжелую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 509 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 509. В одном варианте осуществления молекула антитела содержит легкую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 523 или 519 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 523 или 519. В одном варианте осуществления молекула антитела содержит тяжелую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 509, и легкую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 523 или 519.

Молекулы антител, описанные в данном документе, можно получать с использованием векторов, клеток-хозяев и способов, описанных в US 2015/0210769, включенной посредством ссылки во всей своей полноте.

Таблица 3. Аминокислотные и нуклеотидные последовательности иллюстративных молекул антител к PD-1

HC BAP049 клона B
SEQ ID NO: 501 (Kabat) HCDR1 TYWMH
SEQ ID NO: 504 (Chothia) HCDR1 GYTFTTY
SEQ ID NO: 505 (Chothia) HCDR2 YPGTGG
SEQ ID NO: 507 ДНК, кодирующая VH Gaggtgcagctggtgcagtcaggcgccgaagtgaagaagcccggcgagtcactgagaattagctgtaaaggttcaggctacaccttcactacctactggatgcactgggtccgccaggctaccggtcaaggcctcgagtggatgggtaatatctaccccggcaccggcggctctaacttcgacgagaagtttaagaatagagtgactatcaccgccgataagtctactagcaccgcctatatggaactgtctagcctgagatcagaggacaccgccgtctactactgcactaggtggactaccggcacaggcgcctactggggtcaaggcactaccgtgaccgtgtctagc
SEQ ID NO: 509 ДНК, кодирующая тяжелую цепь gaggtgcagctggtgcagtcaggcgccgaagtgaagaagcccggcgagtcactgagaattagctgtaaaggttcaggctacaccttcactacctactggatgcactgggtccgccaggctaccggtcaaggcctcgagtggatgggtaatatctaccccggcaccggcggctctaacttcgacgagaagtttaagaatagagtgactatcaccgccgataagtctactagcaccgcctatatggaactgtctagcctgagatcagaggacaccgccgtctactactgcactaggtggactaccggcacaggcgcctactggggtcaaggcactaccgtgaccgtgtctagcgctagcactaagggcccgtccgtgttccccctggcaccttgtagccggagcactagcgaatccaccgctgccctcggctgcctggtcaaggattacttcccggagcccgtgaccgtgtcctggaacagcggagccctgacctccggagtgcacaccttccccgctgtgctgcagagctccgggctgtactcgctgtcgtcggtggtcacggtgccttcatctagcctgggtaccaagacctacacttgcaacgtggaccacaagccttccaacactaaggtggacaagcgcgtcgaatcgaagtacggcccaccgtgcccgccttgtcccgcgccggagttcctcggcggtccctcggtctttctgttcccaccgaagcccaaggacactttgatgatttcccgcacccctgaagtgacatgcgtggtcgtggacgtgtcacaggaagatccggaggtgcagttcaattggtacgtggatggcgtcgaggtgcacaacgccaaaaccaagccgagggaggagcagttcaactccacttaccgcgtcgtgtccgtgctgacggtgctgcatcaggactggctgaacgggaaggagtacaagtgcaaagtgtccaacaagggacttcctagctcaatcgaaaagaccatctcgaaagccaagggacagccccgggaaccccaagtgtataccctgccaccgagccaggaagaaatgactaagaaccaagtctcattgacttgccttgtgaagggcttctacccatcggatatcgccgtggaatgggagtccaacggccagccggaaaacaactacaagaccacccctccggtgctggactcagacggatccttcttcctctactcgcggctgaccgtggataagagcagatggcaggagggaaatgtgttcagctgttctgtgatgcatgaagccctgcacaaccactacactcagaagtccctgtccctctccctggga
LC BAP049 клона B
SEQ ID NO: 514 (Chothia) LCDR2 WAS
SEQ ID NO: 515 (Chothia) LCDR3 DYSYPY
SEQ ID NO: 517 ДНК, кодирующая VL Gagatcgtcctgactcagtcacccgctaccctgagcctgagccctggcgagcgggctacactgagctgtaaatctagtcagtcactgctggatagcggtaatcagaagaacttcctgacctggtatcagcagaagcccggtaaagcccctaagctgctgatctactgggcctctactagagaatcaggcgtgccctctaggtttagcggtagcggtagtggcaccgacttcaccttcactatctctagcctgcagcccgaggatatcgctacctactactgtcagaacgactatagctacccctacaccttcggtcaaggcactaaggtcgagattaag
SEQ ID NO: 519 ДНК, кодирующая легкую цепь Gagatcgtcctgactcagtcacccgctaccctgagcctgagccctggcgagcgggctacactgagctgtaaatctagtcagtcactgctggatagcggtaatcagaagaacttcctgacctggtatcagcagaagcccggtaaagcccctaagctgctgatctactgggcctctactagagaatcaggcgtgccctctaggtttagcggtagcggtagtggcaccgacttcaccttcactatctctagcctgcagcccgaggatatcgctacctactactgtcagaacgactatagctacccctacaccttcggtcaaggcactaaggtcgagattaagcgtacggtggccgctcccagcgtgttcatcttcccccccagcgacgagcagctgaagagcggcaccgccagcgtggtgtgcctgctgaacaacttctacccccgggaggccaaggtgcagtggaaggtggacaacgccctgcagagcggcaacagccaggagagcgtcaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcataaggtgtacgcctgcgaggtgacccaccagggcctgtccagccccgtgaccaagagcttcaacaggggcgagtgc
HC BAP049 клона E
SEQ ID NO: 501 (Kabat) HCDR1 TYWMH
SEQ ID NO: 504 (Chothia) HCDR1 GYTFTTY
SEQ ID NO: 505 (Chothia) HCDR2 YPGTGG
SEQ ID NO: 507 ДНК, кодирующая VH Gaggtgcagctggtgcagtcaggcgccgaagtgaagaagcccggcgagtcactgagaattagctgtaaaggttcaggctacaccttcactacctactggatgcactgggtccgccaggctaccggtcaaggcctcgagtggatgggtaatatctaccccggcaccggcggctctaacttcgacgagaagtttaagaatagagtgactatcaccgccgataagtctactagcaccgcctatatggaactgtctagcctgagatcagaggacaccgccgtctactactgcactaggtggactaccggcacaggcgcctactggggtcaaggcactaccgtgaccgtgtctagc
SEQ ID NO: 509 ДНК, кодирующая тяжелую цепь gaggtgcagctggtgcagtcaggcgccgaagtgaagaagcccggcgagtcactgagaattagctgtaaaggttcaggctacaccttcactacctactggatgcactgggtccgccaggctaccggtcaaggcctcgagtggatgggtaatatctaccccggcaccggcggctctaacttcgacgagaagtttaagaatagagtgactatcaccgccgataagtctactagcaccgcctatatggaactgtctagcctgagatcagaggacaccgccgtctactactgcactaggtggactaccggcacaggcgcctactggggtcaaggcactaccgtgaccgtgtctagcgctagcactaagggcccgtccgtgttccccctggcaccttgtagccggagcactagcgaatccaccgctgccctcggctgcctggtcaaggattacttcccggagcccgtgaccgtgtcctggaacagcggagccctgacctccggagtgcacaccttccccgctgtgctgcagagctccgggctgtactcgctgtcgtcggtggtcacggtgccttcatctagcctgggtaccaagacctacacttgcaacgtggaccacaagccttccaacactaaggtggacaagcgcgtcgaatcgaagtacggcccaccgtgcccgccttgtcccgcgccggagttcctcggcggtccctcggtctttctgttcccaccgaagcccaaggacactttgatgatttcccgcacccctgaagtgacatgcgtggtcgtggacgtgtcacaggaagatccggaggtgcagttcaattggtacgtggatggcgtcgaggtgcacaacgccaaaaccaagccgagggaggagcagttcaactccacttaccgcgtcgtgtccgtgctgacggtgctgcatcaggactggctgaacgggaaggagtacaagtgcaaagtgtccaacaagggacttcctagctcaatcgaaaagaccatctcgaaagccaagggacagccccgggaaccccaagtgtataccctgccaccgagccaggaagaaatgactaagaaccaagtctcattgacttgccttgtgaagggcttctacccatcggatatcgccgtggaatgggagtccaacggccagccggaaaacaactacaagaccacccctccggtgctggactcagacggatccttcttcctctactcgcggctgaccgtggataagagcagatggcaggagggaaatgtgttcagctgttctgtgatgcatgaagccctgcacaaccactacactcagaagtccctgtccctctccctggga
LC BAP049 клона E
SEQ ID NO: 514 (Chothia) LCDR2 WAS
SEQ ID NO: 515 (Chothia) LCDR3 DYSYPY
SEQ ID NO: 521 ДНК, кодирующая VL Gagatcgtcctgactcagtcacccgctaccctgagcctgagccctggcgagcgggctacactgagctgtaaatctagtcagtcactgctggatagcggtaatcagaagaacttcctgacctggtatcagcagaagcccggtcaagcccctagactgctgatctactgggcctctactagagaatcaggcgtgccctctaggtttagcggtagcggtagtggcaccgacttcaccttcactatctctagcctggaagccgaggacgccgctacctactactgtcagaacgactatagctacccctacaccttcggtcaaggcactaaggtcgagattaag
SEQ ID NO: 523 ДНК, кодирующая легкую цепь Gagatcgtcctgactcagtcacccgctaccctgagcctgagccctggcgagcgggctacactgagctgtaaatctagtcagtcactgctggatagcggtaatcagaagaacttcctgacctggtatcagcagaagcccggtcaagcccctagactgctgatctactgggcctctactagagaatcaggcgtgccctctaggtttagcggtagcggtagtggcaccgacttcaccttcactatctctagcctggaagccgaggacgccgctacctactactgtcagaacgactatagctacccctacaccttcggtcaaggcactaaggtcgagattaagcgtacggtggccgctcccagcgtgttcatcttcccccccagcgacgagcagctgaagagcggcaccgccagcgtggtgtgcctgctgaacaacttctacccccgggaggccaaggtgcagtggaaggtggacaacgccctgcagagcggcaacagccaggagagcgtcaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcataaggtgtacgcctgcgaggtgacccaccagggcctgtccagccccgtgaccaagagcttcaacaggggcgagtgc
HC BAP049 клона B
LC BAP049 клона B
HC BAP049 клона E
LC BAP049 клона E

Другие иллюстративные ингибиторы PD-1

В одном варианте осуществления молекула антитела к PD-1 представляет собой ниволумаб (Bristol-Myers Squibb), также известный как MDX-1106, MDX-1106-04, ONO-4538, BMS-936558 или OPDIVO®. Ниволумаб (клон 5C4) и другие антитела к PD-1 раскрыты в US 8008449 и WO 2006/121168, включенных посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к PD-1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи ниволумаба, например, раскрытые в таблице 4.

В одном варианте осуществления молекула антитела к PD-1 представляет собой пембролизумаб (Merck & Co), также известный как ламбролизумаб, MK-3475, MK03475, SCH-900475 или KEYTRUDA®. Пембролизумаб и другие антитела к PD-1 раскрыты в Hamid, O. et al. (2013) New England Journal of Medicine 369 (2): 134-44, US 8354509 и WO 2009/114335, включенных посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к PD-1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи пембролизумаба, например, раскрытые в таблице 4.

В одном варианте осуществления молекула антитела к PD-1 представляет собой пидилизумаб (CureTech), также известный как CT-011. Пидилизумаб и другие антитела к PD-1 раскрыты в Rosenblatt, J. et al. (2011) J Immunotherapy 34(5): 409-18, US 7695715, US 7332582 и US 8686119, включенных посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к PD-1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи пидилизумаба, например, раскрытые в таблице 4.

В одном варианте осуществления молекула антитела к PD-1 представляет собой MEDI0680 (Medimmune), также известный как AMP-514. MEDI0680 и другие антитела к PD-1 раскрыты в US 9205148 и WO 2012/145493, включенных посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к PD-1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи MEDI0680.

В одном варианте осуществления молекула антитела к PD-1 представляет собой REGN2810 (Regeneron). В одном варианте осуществления молекула антитела к PD-1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи REGN2810.

В одном варианте осуществления молекула антитела к PD-1 представляет собой PF-06801591 (Pfizer). В одном варианте осуществления молекула антитела к PD-1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи PF-06801591.

В одном варианте осуществления молекула антитела к PD-1 представляет собой BGB-A317 или BGB-108 (Beigene). В одном варианте осуществления молекула антитела к PD-1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи BGB-A317 или BGB-108.

В одном варианте осуществления молекула антитела к PD-1 представляет собой INCSHR1210 (Incyte), также известный как INCSHR01210 или SHR-1210. В одном варианте осуществления молекула антитела к PD-1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи INCSHR1210.

В одном варианте осуществления молекула антитела к PD-1 представляет собой TSR-042 (Tesaro), также известный как ANB011. В одном варианте осуществления молекула антитела к PD-1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи TSR-042.

Дополнительные известные антитела к PD-1 включают антитела, описанные, например, в WO 2015/112800, WO 2016/092419, WO 2015/085847, WO 2014/179664, WO 2014/194302, WO 2014/209804, WO 2015/200119, US 8735553, US 7488802, US 8927697, US 8993731 и US 9102727, включенных посредством ссылки во всей своей полноте.

В одном варианте осуществления антитело к PD-1 представляет собой антитело, которое конкурирует за связывание и/или связывается с тем же эпитопом в PD-1, что и одно из антител к PD-1, описанных в данном документе.

В одном варианте осуществления ингибитор PD-1 представляет собой пептид, который ингибирует сигнальный путь PD-1, например, как описано в US 8907053, включенном посредством ссылки во всей своей полноте. В одном варианте осуществления ингибитор PD-1 представляет собой иммуноадгезин (например, иммуноадгезин, который содержит внеклеточную или PD-1-связывающую часть PD-L1 или PD-L2, слитую с константной областью (например, Fc-областью последовательности иммуноглобулина)). В одном варианте осуществления ингибитор PD-1 представляет собой AMP-224 (B7-DCIg (Amplimmune), например, раскрытый в WO 2010/027827 и WO 2011/066342, включенных посредством ссылки во всей своей полноте).

Таблица 4. Аминокислотные последовательности других иллюстративных молекул антител к PD-1


В одном варианте осуществления антитело к ENTPD2 человека, описанное в данном документе, вводят в комбинации с по меньшей мере одним ингибитором PD-1, описанным в данном документе, и по меньшей мере одним антагонистом рецептора A2A, описанным в данном документе.

Ингибиторы PD-L1

В определенных вариантах осуществления антитело к ENTPD2 человека, описанное в данном документе, вводят в комбинации с ингибитором PD-L1. Ингибитор PD-L1 может представлять собой антитело, его антигенсвязывающий фрагмент, иммуноадгезин, слитый белок или олигопептид. В некоторых вариантах осуществления ингибитор PD-L1 выбран из FAZ053 (Novartis), атезолизумаба, также известного как Tecentriq® (Genentech/Roche), авелумаба, также известного как Bavencio® (Merck Serono и Pfizer), дурвалумаба, также известного как Imfinzi® (MedImmune/AstraZeneca) или BMS-936559 (Bristol-Myers Squibb).

Иллюстративные ингибиторы PD-L1

В одном варианте осуществления ингибитор PD-L1 представляет собой молекулу антитела к PD-L1. В одном варианте осуществления ингибитор PD-L1 представляет собой молекулу антитела к PD-L1, раскрытую в US 2016/0108123, опубликованной 21 апреля 2016 г. под названием "Antibody Molecules to PD-L1 and Uses Thereof", включенной посредством ссылки во всей своей полноте.

В одном варианте осуществления молекула антитела к PD-L1 содержит по меньшей мере одну, две, три, четыре, пять или шесть областей, определяющих комплементарность (CDR) (или в совокупности все CDR), из вариабельной области тяжелой и легкой цепей, содержащей аминокислотную последовательность, показанную в таблице 5 (например, из последовательностей вариабельной области тяжелой и легкой цепей BAP058 клона O или BAP058 клона N, раскрытых в таблице 5), или кодируемой нуклеотидной последовательностью, показанной в таблице 5. В некоторых вариантах осуществления CDR указаны согласно определению по Kabat (например, как изложено в таблице 5). В некоторых вариантах осуществления CDR указаны согласно определению по Chothia (например, как изложено в таблице 5). В некоторых вариантах осуществления CDR указаны согласно комбинации определений CDR как по Kabat, так и по Chothia (например, как изложено в таблице 5). В одном варианте осуществления CDR1 VH согласно комбинации определений CDR по Kabat и Chothia содержит аминокислотную последовательность GYTFTSYWMY (SEQ ID NO: 647). В одном варианте осуществления одна или несколько CDR (или в совокупности все CDR) имеют одно, два, три, четыре, пять, шесть или больше изменений, например, аминокислотных замен (например, консервативных аминокислотных замен) или делеций, по сравнению с аминокислотной последовательностью, показанной в таблице 5 или кодируемой нуклеотидной последовательностью, показанной в таблице 5.

В одном варианте осуществления молекула антитела к PD-L1 содержит вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность VHCDR1 под SEQ ID NO: 601, аминокислотную последовательность VHCDR2 под SEQ ID NO: 602 и аминокислотную последовательность VHCDR3 под SEQ ID NO: 603; и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность VLCDR1 под SEQ ID NO: 609, аминокислотную последовательность VLCDR2 под SEQ ID NO: 610 и аминокислотную последовательность VLCDR3 под SEQ ID NO: 611, каждая из которых раскрыта в таблице 5.

В одном варианте осуществления молекула антитела к PD-L1 содержит VH, содержащую VHCDR1, кодируемую нуклеотидной последовательностью под SEQ ID NO: 628, VHCDR2, кодируемую нуклеотидной последовательностью под SEQ ID NO: 629, и VHCDR3, кодируемую нуклеотидной последовательностью под SEQ ID NO: 630; и VL, содержащую VLCDR1, кодируемую нуклеотидной последовательностью под SEQ ID NO: 633, VLCDR2, кодируемую нуклеотидной последовательностью под SEQ ID NO: 634, и VLCDR3, кодируемую нуклеотидной последовательностью под SEQ ID NO: 635, каждая из которых раскрыта в таблице 5.

В одном варианте осуществления молекула антитела к PD-L1 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 606 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 606. В одном варианте осуществления молекула антитела к PD-L1 содержит VL, содержащую аминокислотную последовательность под SEQ ID NO: 616 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 616. В одном варианте осуществления молекула антитела к PD-L1 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 620 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 620. В одном варианте осуществления молекула антитела к PD-L1 содержит VL, содержащую аминокислотную последовательность под SEQ ID NO: 624 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 624. В одном варианте осуществления молекула антитела к PD-L1 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 606, и VL, содержащую аминокислотную последовательность под SEQ ID NO: 616. В одном варианте осуществления молекула антитела к PD-L1 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 620, и VL, содержащую аминокислотную последовательность под SEQ ID NO: 624.

В одном варианте осуществления молекула антитела содержит VH, кодируемую нуклеотидной последовательностью под SEQ ID NO: 607 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 607. В одном варианте осуществления молекула антитела содержит VL, кодируемую нуклеотидной последовательностью под SEQ ID NO: 617 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 617. В одном варианте осуществления молекула антитела содержит VH, кодируемую нуклеотидной последовательностью под SEQ ID NO: 621 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 621. В одном варианте осуществления молекула антитела содержит VL, кодируемую нуклеотидной последовательностью под SEQ ID NO: 625 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 625. В одном варианте осуществления молекула антитела содержит VH, кодируемую нуклеотидной последовательностью под SEQ ID NO: 607, и VL, кодируемую нуклеотидной последовательностью под SEQ ID NO: 617. В одном варианте осуществления молекула антитела содержит VH, кодируемую нуклеотидной последовательностью под SEQ ID NO: 621, и VL, кодируемую нуклеотидной последовательностью под SEQ ID NO: 625.

В одном варианте осуществления молекула антитела к PD-L1 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 608 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 608. В одном варианте осуществления молекула антитела к PD-L1 содержит легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 618 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 618. В одном варианте осуществления молекула антитела к PD-L1 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 622 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 622. В одном варианте осуществления молекула антитела к PD-L1 содержит легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 626 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 626. В одном варианте осуществления молекула антитела к PD-L1 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 608, и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 618. В одном варианте осуществления молекула антитела к PD-L1 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 622, и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 626.

В одном варианте осуществления молекула антитела содержит тяжелую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 615 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 615. В одном варианте осуществления молекула антитела содержит легкую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 619 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 619. В одном варианте осуществления молекула антитела содержит тяжелую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 623 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 623. В одном варианте осуществления молекула антитела содержит легкую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 627 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 627. В одном варианте осуществления молекула антитела содержит тяжелую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 615, и легкую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 619. В одном варианте осуществления молекула антитела содержит тяжелую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 623, и легкую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 627.

Молекулы антител, описанные в данном документе, можно получать с использованием векторов, клеток-хозяев и способов, описанных в US 2016/0108123, включенной посредством ссылки во всей своей полноте.

Таблица 5. Аминокислотные и нуклеотидные последовательности иллюстративных молекул антител к PD-L1

HC BAP058 клона O
SEQ ID NO: 601 (Kabat) HCDR1 SYWMY
SEQ ID NO: 604 (Chothia) HCDR1 GYTFTSY
SEQ ID NO: 605 (Chothia) HCDR2 DPNSGS
LC BAP058 клона O
SEQ ID NO: 612 (Chothia) LCDR1 SQDVGTA
SEQ ID NO: 613 (Chothia) LCDR2 WAS
SEQ ID NO: 614 (Chothia) LCDR3 YNSYPL
HC BAP058 клона N
SEQ ID NO: 601 (Kabat) HCDR1 SYWMY
SEQ ID NO: 604 (Chothia) HCDR1 GYTFTSY
SEQ ID NO: 605 (Chothia) HCDR2 DPNSGS
LC BAP058 клона N
SEQ ID NO: 612 (Chothia) LCDR1 SQDVGTA
SEQ ID NO: 613 (Chothia) LCDR2 WAS
SEQ ID NO: 614 (Chothia) LCDR3 YNSYPL
HC BAP058 клона O
SEQ ID NO: 628 (Kabat) HCDR1 agctactggatgtac
SEQ ID NO: 629 (Kabat) HCDR2 agaatcgaccctaatagcggctctactaagtataacgagaagtttaagaat
SEQ ID NO: 630 (Kabat) HCDR3 gactatagaaagggcctgtacgctatggactac
SEQ ID NO: 631 (Chothia) HCDR1 ggctacaccttcactagctac
SEQ ID NO: 632 (Chothia) HCDR2 gaccctaatagcggctct
SEQ ID NO: 630 (Chothia) HCDR3 gactatagaaagggcctgtacgctatggactac
LC BAP058 клона O
SEQ ID NO: 633 (Kabat) LCDR1 aaagcctctcaggacgtgggcaccgccgtggcc
SEQ ID NO: 634 (Kabat) LCDR2 tgggcctctactagacacacc
SEQ ID NO: 635 (Kabat) LCDR3 cagcagtataatagctaccccctgacc
SEQ ID NO: 636 (Chothia) LCDR1 tctcaggacgtgggcaccgcc
SEQ ID NO: 637 (Chothia) LCDR2 tgggcctct
SEQ ID NO: 638 (Chothia) LCDR3 tataatagctaccccctg
HC BAP058 клона N
SEQ ID NO: 628 (Kabat) HCDR1 agctactggatgtac
SEQ ID NO: 629 (Kabat) HCDR2 agaatcgaccctaatagcggctctactaagtataacgagaagtttaagaat
SEQ ID NO: 630 (Kabat) HCDR3 gactatagaaagggcctgtacgctatggactac
SEQ ID NO: 631 (Chothia) HCDR1 ggctacaccttcactagctac
SEQ ID NO: 632 (Chothia) HCDR2 gaccctaatagcggctct
SEQ ID NO: 630 (Chothia) HCDR3 gactatagaaagggcctgtacgctatggactac
LC BAP058 клона N
SEQ ID NO: 633 (Kabat) LCDR1 aaagcctctcaggacgtgggcaccgccgtggcc
SEQ ID NO: 634 (Kabat) LCDR2 tgggcctctactagacacacc
SEQ ID NO: 635 (Kabat) LCDR3 cagcagtataatagctaccccctgacc
SEQ ID NO: 636 (Chothia) LCDR1 tctcaggacgtgggcaccgcc
SEQ ID NO: 637 (Chothia) LCDR2 tgggcctct
SEQ ID NO: 638 (Chothia) LCDR3 tataatagctaccccctg

Другие иллюстративные ингибиторы PD-L1

В одном варианте осуществления молекула антитела к PD-L1 представляет собой атезолизумаб (Genentech/Roche), также известный как MPDL3280A, RG7446, RO5541267, YW243.55.S70 или TECENTRIQ™. Атезолизумаб и другие антитела к PD-L1 раскрыты в US 8217149, включенном посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к PD-L1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи атезолизумаба, например, раскрытые в таблице 6.

В одном варианте осуществления молекула антитела к PD-L1 представляет собой авелумаб (Merck Serono и Pfizer), также известный как MSB0010718C или Bavencio®. Авелумаб и другие антитела к PD-L1 раскрыты в WO 2013/079174, включенной посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к PD-L1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи авелумаба, например, раскрытые в таблице 6.

В одном варианте осуществления молекула антитела к PD-L1 представляет собой дурвалумаб (MedImmune/AstraZeneca), также известный как MEDI4736 или Imfinzi®. Дурвалумаб и другие антитела к PD-L1 раскрыты в US 8779108, включенном посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к PD-L1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи дурвалумаба, например, раскрытые в таблице 6.

В одном варианте осуществления молекула антитела к PD-L1 представляет собой BMS-936559 (Bristol-Myers Squibb), также известный как MDX-1105 или 12A4. BMS-936559 и другие антитела к PD-L1 раскрыты в US 7943743 и WO 2015/081158, включенных посредством ссылки во всей своей полноте. В одном варианте осуществления молекула антитела к PD-L1 содержит одну или несколько последовательностей CDR (или в совокупности все последовательности CDR), последовательность вариабельной области тяжелой цепи или легкой цепи или последовательность тяжелой цепи или легкой цепи BMS-936559, например, раскрытые в таблице 6.

Дополнительные известные антитела к PD-L1 включают антитела, описанные, например, в WO 2015/181342, WO 2014/100079, WO 2016/000619, WO 2014/022758, WO 2014/055897, WO 2015/061668, WO 2013/079174, WO 2012/145493, WO 2015/112805, WO 2015/109124, WO 2015/195163, US 8168179, US 8552154, US 8460927 и US 9175082, включенных посредством ссылки во всей своей полноте.

В одном варианте осуществления антитело к PD-L1 представляет собой антитело, которое конкурирует за связывание и/или связывается с тем же эпитопом в PD-L1, что и одно из антител к PD-L1, описанных в данном документе.

Таблица 6. Аминокислотные последовательности других иллюстративных молекул антител к PD-L1


В одном варианте осуществления антитело к ENTPD2 человека, описанное в данном документе, вводят в комбинации с по меньшей мере одним ингибитором PD-L1, описанным в данном документе, и по меньшей мере одним антагонистом рецептора A2A, описанным в данном документе.

Ингибиторы LAG-3

В определенных вариантах осуществления антитело к ENTPD2 человека, описанное в данном документе, вводят в комбинации с ингибитором LAG-3. Ингибитор LAG-3 может представлять собой антитело, его антигенсвязывающий фрагмент, иммуноадгезин, слитый белок или олигопептид. В некоторых вариантах осуществления ингибитор LAG-3 выбран из LAG525 (Novartis), BMS-986016 (Bristol-Myers Squibb), TSR-033 (Tesaro), MK-4280 (Merck & Co) или REGN3767 (Regeneron).

Иллюстративные ингибиторы LAG-3

В одном варианте осуществления ингибитор LAG-3 представляет собой молекулу антитела к LAG-3. В одном варианте осуществления ингибитор LAG-3 представляет собой молекулу антитела к LAG-3, раскрытую в US 2015/0259420, опубликованной 17 сентября 2015 г. под названием "Antibody Molecules to LAG-3 and Uses Thereof", включенной посредством ссылки во всей своей полноте.

В одном варианте осуществления молекула антитела к LAG-3 содержит по меньшей мере одну, две, три, четыре, пять или шесть областей, определяющих комплементарность (CDR) (или в совокупности все CDR), из вариабельной области тяжелой и легкой цепей, содержащей аминокислотную последовательность, показанную в таблице 7 (например, из последовательностей вариабельной области тяжелой и легкой цепей BAP050 клона I или BAP050 клона J, раскрытых в таблице 7), или кодируемой нуклеотидной последовательностью, показанной в таблице 7. В некоторых вариантах осуществления CDR указаны согласно определению по Kabat (например, как изложено в таблице 7). В некоторых вариантах осуществления CDR указаны согласно определению по Chothia (например, как изложено в таблице 7). В некоторых вариантах осуществления CDR указаны согласно комбинации определений CDR как по Kabat, так и по Chothia (например, как изложено в таблице 7). В одном варианте осуществления CDR1 VH согласно комбинированной схеме нумерации CDR по Kabat и Chothia содержит аминокислотную последовательность GFTLTNYGMN (SEQ ID NO: 766). В одном варианте осуществления одна или несколько CDR (или в совокупности все CDR) имеют одно, два, три, четыре, пять, шесть или больше изменений, например, аминокислотных замен (например, консервативных аминокислотных замен) или делеций, по сравнению с аминокислотной последовательностью, показанной в таблице 7 или кодируемой нуклеотидной последовательностью, показанной в таблице 7.

В одном варианте осуществления молекула антитела к LAG-3 содержит вариабельную область тяжелой цепи (VH), содержащую аминокислотную последовательность VHCDR1 под SEQ ID NO: 701, аминокислотную последовательность VHCDR2 под SEQ ID NO: 702 и аминокислотную последовательность VHCDR3 под SEQ ID NO: 703; и вариабельную область легкой цепи (VL), содержащую аминокислотную последовательность VLCDR1 под SEQ ID NO: 710, аминокислотную последовательность VLCDR2 под SEQ ID NO: 711 и аминокислотную последовательность VLCDR3 под SEQ ID NO: 712, каждая из которых раскрыта в таблице 7.

В одном варианте осуществления молекула антитела к LAG-3 содержит VH, содержащую VHCDR1, кодируемую нуклеотидной последовательностью под SEQ ID NO: 736 или 737, VHCDR2, кодируемую нуклеотидной последовательностью под SEQ ID NO: 738 или 739, и VHCDR3, кодируемую нуклеотидной последовательностью под SEQ ID NO: 740 или 741; и VL, содержащую VLCDR1, кодируемую нуклеотидной последовательностью под SEQ ID NO: 746 или 747, VLCDR2, кодируемую нуклеотидной последовательностью под SEQ ID NO: 748 или 749, и VLCDR3, кодируемую нуклеотидной последовательностью под SEQ ID NO: 750 или 751, каждая из которых раскрыта в таблице 7. В одном варианте осуществления молекула антитела к LAG-3 содержит VH, содержащую VHCDR1, кодируемую нуклеотидной последовательностью под SEQ ID NO: 758 или 737, VHCDR2, кодируемую нуклеотидной последовательностью под SEQ ID NO: 759 или 739, и VHCDR3, кодируемую нуклеотидной последовательностью под SEQ ID NO: 760 или 741; и VL, содержащую VLCDR1, кодируемую нуклеотидной последовательностью под SEQ ID NO: 746 или 747, VLCDR2, кодируемую нуклеотидной последовательностью под SEQ ID NO: 748 или 749, и VLCDR3, кодируемую нуклеотидной последовательностью под SEQ ID NO: 750 или 751, каждая из которых раскрыта в таблице 7.

В одном варианте осуществления молекула антитела к LAG-3 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 706 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 706. В одном варианте осуществления молекула антитела к LAG-3 содержит VL, содержащую аминокислотную последовательность под SEQ ID NO: 718 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 718. В одном варианте осуществления молекула антитела к LAG-3 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 724 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 724. В одном варианте осуществления молекула антитела к LAG-3 содержит VL, содержащую аминокислотную последовательность под SEQ ID NO: 730 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 730. В одном варианте осуществления молекула антитела к LAG-3 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 706, и VL, содержащую аминокислотную последовательность под SEQ ID NO: 718. В одном варианте осуществления молекула антитела к LAG-3 содержит VH, содержащую аминокислотную последовательность под SEQ ID NO: 724, и VL, содержащую аминокислотную последовательность под SEQ ID NO: 730.

В одном варианте осуществления молекула антитела содержит VH, кодируемую нуклеотидной последовательностью под SEQ ID NO: 707 или 708 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 707 или 708. В одном варианте осуществления молекула антитела содержит VL, кодируемую нуклеотидной последовательностью под SEQ ID NO: 719 или 720 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 719 или 720. В одном варианте осуществления молекула антитела содержит VH, кодируемую нуклеотидной последовательностью под SEQ ID NO: 725 или 726 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 725 или 726. В одном варианте осуществления молекула антитела содержит VL, кодируемую нуклеотидной последовательностью под SEQ ID NO: 731 или 732 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 731 или 732. В одном варианте осуществления молекула антитела содержит VH, кодируемую нуклеотидной последовательностью под SEQ ID NO: 707 или 708, и VL, кодируемую нуклеотидной последовательностью под SEQ ID NO: 719 или 720. В одном варианте осуществления молекула антитела содержит VH, кодируемую нуклеотидной последовательностью под SEQ ID NO: 725 или 726, и VL, кодируемую нуклеотидной последовательностью под SEQ ID NO: 731 или 732.

В одном варианте осуществления молекула антитела к LAG-3 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 709 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 709. В одном варианте осуществления молекула антитела к LAG-3 содержит легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 721 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 721. В одном варианте осуществления молекула антитела к LAG-3 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 727 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 727. В одном варианте осуществления молекула антитела к LAG-3 содержит легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 733 или аминокислотную последовательность, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичную по отношению к SEQ ID NO: 733. В одном варианте осуществления молекула антитела к LAG-3 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 709, и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 721. В одном варианте осуществления молекула антитела к LAG-3 содержит тяжелую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 727, и легкую цепь, содержащую аминокислотную последовательность под SEQ ID NO: 733.

В одном варианте осуществления молекула антитела содержит тяжелую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 716 или 717 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 716 или 717. В одном варианте осуществления молекула антитела содержит легкую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 722 или 723 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 722 или 723. В одном варианте осуществления молекула антитела содержит тяжелую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 728 или 729 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 728 или 729. В одном варианте осуществления молекула антитела содержит легкую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 734 или 735 или нуклеотидной последовательностью, на по меньшей мере 85%, 90%, 95% или 99% или больше идентичной по отношению к SEQ ID NO: 734 или 735. В одном варианте осуществления молекула антитела содержит тяжелую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 716 или 717, и легкую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 722 или 723. В одном варианте осуществления молекула антитела содержит тяжелую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 728 или 729, и легкую цепь, кодируемую нуклеотидной последовательностью под SEQ ID NO: 734 или 735.

Молекулы антител, описанные в данном документе, можно получать с использованием векторов, клеток-хозяев и способов, описанных в US 2015/0259420, включенной посредством ссылки во всей своей полноте.

Таблица 7. Аминокислотные и нуклеотидные последовательности иллюстративных молекул антител к LAG-3

HC BAP050 клона I
SEQ ID NO: 701 (Kabat) HCDR1 NYGMN
SEQ ID NO: 704 (Chothia) HCDR1 GFTLTNY
SEQ ID NO: 705 (Chothia) HCDR2 NTDTGE
SEQ ID NO: 707 ДНК, кодирующая VH Caagtgcagctggtgcagtcgggagccgaagtgaagaagcctggagcctcggtgaaggtgtcgtgcaaggcatccggattcaccctcaccaattacgggatgaactgggtcagacaggcccggggtcaacggctggagtggatcggatggattaacaccgacaccggggagcctacctacgcggacgatttcaagggacggttcgtgttctccctcgacacctccgtgtccaccgcctacctccaaatctcctcactgaaagcggaggacaccgccgtgtactattgcgcgaggaacccgccctactactacggaaccaacaacgccgaagccatggactactggggccagggcaccactgtgactgtgtccagc
SEQ ID NO: 716 ДНК, кодирующая тяжелую цепь caagtgcagctggtgcagtcgggagccgaagtgaagaagcctggagcctcggtgaaggtgtcgtgcaaggcatccggattcaccctcaccaattacgggatgaactgggtcagacaggcccggggtcaacggctggagtggatcggatggattaacaccgacaccggggagcctacctacgcggacgatttcaagggacggttcgtgttctccctcgacacctccgtgtccaccgcctacctccaaatctcctcactgaaagcggaggacaccgccgtgtactattgcgcgaggaacccgccctactactacggaaccaacaacgccgaagccatggactactggggccagggcaccactgtgactgtgtccagcgcgtccactaagggcccgtccgtgttccccctggcaccttgtagccggagcactagcgaatccaccgctgccctcggctgcctggtcaaggattacttcccggagcccgtgaccgtgtcctggaacagcggagccctgacctccggagtgcacaccttccccgctgtgctgcagagctccgggctgtactcgctgtcgtcggtggtcacggtgccttcatctagcctgggtaccaagacctacacttgcaacgtggaccacaagccttccaacactaaggtggacaagcgcgtcgaatcgaagtacggcccaccgtgcccgccttgtcccgcgccggagttcctcggcggtccctcggtctttctgttcccaccgaagcccaaggacactttgatgatttcccgcacccctgaagtgacatgcgtggtcgtggacgtgtcacaggaagatccggaggtgcagttcaattggtacgtggatggcgtcgaggtgcacaacgccaaaaccaagccgagggaggagcagttcaactccacttaccgcgtcgtgtccgtgctgacggtgctgcatcaggactggctgaacgggaaggagtacaagtgcaaagtgtccaacaagggacttcctagctcaatcgaaaagaccatctcgaaagccaagggacagccccgggaaccccaagtgtataccctgccaccgagccaggaagaaatgactaagaaccaagtctcattgacttgccttgtgaagggcttctacccatcggatatcgccgtggaatgggagtccaacggccagccggaaaacaactacaagaccacccctccggtgctggactcagacggatccttcttcctctactcgcggctgaccgtggataagagcagatggcaggagggaaatgtgttcagctgttctgtgatgcatgaagccctgcacaaccactacactcagaagtccctgtccctctccctggga
LC BAP050 клона I
SEQ ID NO: 713 (Chothia) LCDR1 SQDISNY
SEQ ID NO: 714 (Chothia) LCDR2 YTS
SEQ ID NO: 715 (Chothia) LCDR3 YYNLPW
SEQ ID NO: 719 ДНК, кодирующая VL Gatattcagatgactcagtcacctagtagcctgagcgctagtgtgggcgatagagtgactatcacctgtagctctagtcaggatatctctaactacctgaactggtatctgcagaagcccggtcaatcacctcagctgctgatctactacactagcaccctgcacctgggcgtgccctctaggtttagcggtagcggtagtggcaccgagttcaccctgactatctctagcctgcagcccgacgacttcgctacctactactgtcagcagtactataacctgccctggaccttcggtcaaggcactaaggtcgagattaag
SEQ ID NO: 722 ДНК, кодирующая легкую цепь Gatattcagatgactcagtcacctagtagcctgagcgctagtgtgggcgatagagtgactatcacctgtagctctagtcaggatatctctaactacctgaactggtatctgcagaagcccggtcaatcacctcagctgctgatctactacactagcaccctgcacctgggcgtgccctctaggtttagcggtagcggtagtggcaccgagttcaccctgactatctctagcctgcagcccgacgacttcgctacctactactgtcagcagtactataacctgccctggaccttcggtcaaggcactaaggtcgagattaagcgtacggtggccgctcccagcgtgttcatcttcccccccagcgacgagcagctgaagagcggcaccgccagcgtggtgtgcctgctgaacaacttctacccccgggaggccaaggtgcagtggaaggtggacaacgccctgcagagcggcaacagccaggagagcgtcaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcataaggtgtacgcctgcgaggtgacccaccagggcctgtccagccccgtgaccaagagcttcaacaggggcgagtgc
HC BAP050 клона J
SEQ ID NO: 701 (Kabat) HCDR1 NYGMN
SEQ ID NO: 704 (Chothia) HCDR1 GFTLTNY
SEQ ID NO: 705 (Chothia) HCDR2 NTDTGE
SEQ ID NO: 725 ДНК, кодирующая VH Caggtgcagctggtgcagtcaggcgccgaagtgaagaaacccggcgctagtgtgaaagtcagctgtaaagctagtggcttcaccctgactaactacgggatgaactgggtccgccaggccccaggtcaaggcctcgagtggatgggctggattaacaccgacaccggcgagcctacctacgccgacgactttaagggcagattcgtgtttagcctggacactagtgtgtctaccgcctacctgcagatctctagcctgaaggccgaggacaccgccgtctactactgcgctagaaaccccccctactactacggcactaacaacgccgaggctatggactactggggtcaaggcactaccgtgaccgtgtctagc
SEQ ID NO: 728 ДНК, кодирующая тяжелую цепь caggtgcagctggtgcagtcaggcgccgaagtgaagaaacccggcgctagtgtgaaagtcagctgtaaagctagtggcttcaccctgactaactacgggatgaactgggtccgccaggccccaggtcaaggcctcgagtggatgggctggattaacaccgacaccggcgagcctacctacgccgacgactttaagggcagattcgtgtttagcctggacactagtgtgtctaccgcctacctgcagatctctagcctgaaggccgaggacaccgccgtctactactgcgctagaaaccccccctactactacggcactaacaacgccgaggctatggactactggggtcaaggcactaccgtgaccgtgtctagcgctagcactaagggcccgtccgtgttccccctggcaccttgtagccggagcactagcgaatccaccgctgccctcggctgcctggtcaaggattacttcccggagcccgtgaccgtgtcctggaacagcggagccctgacctccggagtgcacaccttccccgctgtgctgcagagctccgggctgtactcgctgtcgtcggtggtcacggtgccttcatctagcctgggtaccaagacctacacttgcaacgtggaccacaagccttccaacactaaggtggacaagcgcgtcgaatcgaagtacggcccaccgtgcccgccttgtcccgcgccggagttcctcggcggtccctcggtctttctgttcccaccgaagcccaaggacactttgatgatttcccgcacccctgaagtgacatgcgtggtcgtggacgtgtcacaggaagatccggaggtgcagttcaattggtacgtggatggcgtcgaggtgcacaacgccaaaaccaagccgagggaggagcagttcaactccacttaccgcgtcgtgtccgtgctgacggtgctgcatcaggactggctgaacgggaaggagtacaagtgcaaagtgtccaacaagggacttcctagctcaatcgaaaagaccatctcgaaagccaagggacagccccgggaaccccaagtgtataccctgccaccgagccaggaagaaatgactaagaaccaagtctcattgacttgccttgtgaagggcttctacccatcggatatcgccgtggaatgggagtccaacggccagccggaaaacaactacaagaccacccctccggtgctggactcagacggatccttcttcctctactcgcggctgaccgtggataagagcagatggcaggagggaaatgtgttcagctgttctgtgatgcatgaagccctgcacaaccactacactcagaagtccctgtccctctccctggga
LC BAP050 клона J
SEQ ID NO: 713 (Chothia) LCDR1 SQDISNY
SEQ ID NO: 714 (Chothia) LCDR2 YTS
SEQ ID NO: 715 (Chothia) LCDR3 YYNLPW
SEQ ID NO: 731 ДНК, кодирующая VL Gatattcagatgactcagtcacctagtagcctgagcgctagtgtgggcgatagagtgactatcacctgtagctctagtcaggatatctctaactacctgaactggtatcagcagaagcccggtaaagcccctaagctgctgatctactacactagcaccctgcacctgggaatcccccctaggtttagcggtagcggctacggcaccgacttcaccctgactattaacaatatcgagtcagaggacgccgcctactacttctgtcagcagtactataacctgccctggaccttcggtcaaggcactaaggtcgagattaag
SEQ ID NO: 734 ДНК, кодирующая легкую цепь Gatattcagatgactcagtcacctagtagcctgagcgctagtgtgggcgatagagtgactatcacctgtagctctagtcaggatatctctaactacctgaactggtatcagcagaagcccggtaaagcccctaagctgctgatctactacactagcaccctgcacctgggaatcccccctaggtttagcggtagcggctacggcaccgacttcaccctgactattaacaatatcgagtcagaggacgccgcctactacttctgtcagcagtactataacctgccctggaccttcggtcaaggcactaaggtcgagattaagcgtacggtggccgctcccagcgtgttcatcttcccccccagcgacgagcagctgaagagcggcaccgccagcgtggtgtgcctgctgaacaacttctacccccgggaggccaaggtgcagtggaaggtggacaacgccctgcagagcggcaacagccaggagagcgtcaccgagcaggacagcaaggactccacctacagcctgagcagcaccctgaccctgagcaaggccgactacgagaagcataaggtgtacgcctgcgaggtgacccaccagggcctgtccagccccgtgaccaagagcttcaacaggggcgagtgc
HC BAP050 клона I
SEQ ID NO: 736 (Kabat) HCDR1 aattacgggatgaac
SEQ ID NO: 738 (Kabat) HCDR2 tggattaacaccgacaccggggagcctacctacgcggacgatttcaaggga
SEQ ID NO: 740 (Kabat) HCDR3 aacccgccctactactacggaaccaacaacgccgaagccatggactac
SEQ ID NO: 742 (Chothia) HCDR1 ggattcaccctcaccaattac
SEQ ID NO: 744 (Chothia) HCDR2 aacaccgacaccggggag
SEQ ID NO: 740 (Chothia) HCDR3 aacccgccctactactacggaaccaacaacgccgaagccatggactac
LC BAP050 клона I
SEQ ID NO: 746 (Kabat) LCDR1 agctctagtcaggatatctctaactacctgaac
SEQ ID NO: 748 (Kabat) LCDR2 tacactagcaccctgcacctg
SEQ ID NO: 750 (Kabat) LCDR3 cagcagtactataacctgccctggacc
SEQ ID NO: 752 (Chothia) LCDR1 agtcaggatatctctaactac
SEQ ID NO: 753 (Chothia)