Противораковые вакцины

Изобретение относится к области биотехнологии. Предложена мультиантигенная конструкция, индуцирующая иммунный ответ против раковой клетки у млекопитающего, а также вектор, композиция, фармацевтическая композиция и способ лечения рака. Изобретение может быть использовано в медицине для увеличения иммунного ответа на рак. 5 н. и 46 з.п. ф-лы, 20 табл., 7 пр.

 

ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

По настоящей заявке испрашивается приоритет временной заявки на патент США № 62/280636, поданной 19 января 2016, и временной заявки на патент США № 62/419190, поданной 8 ноября 2016. Полное содержание каждой из вышеприведенных заявок включено в настоящее описание посредством ссылки.

ОБЛАСТЬ ТЕХНИКИ

Настоящее изобретение в целом относится к иммунотерапии, и в частности, к вакцинам и способам лечения или профилактики неопластических заболеваний.

УРОВЕНЬ ТЕХНИКИ

Злокачественные новообразования являются основной причиной смертности во всем мире. Они могут возникать в различных органах, таких как поджелудочная железа, яичники, молочная железа, легкие, толстая кишка и прямая кишка. Рак поджелудочной железы является четвертой по распространенности причиной смерти от злокачественных новообразований в Соединенных Штатах. Рак поджелудочной железы может возникать в экзокринном или эндокринном компоненте поджелудочной железы. Экзокринные злокачественные опухоли включают (1) аденокарциному поджелудочной железы, которая на сегодняшний день является наиболее распространенным типом, (2) карциному ацинарных клеток, которая составляет 5% экзокринных опухолей поджелудочной железы, (3) цистаденокарциному, которая составляет 1% злокачественных опухолей поджелудочной железы, и (4) другие редкие формы рака, такие как панкреатобластома, аденосквамозные карциномы, перстневидно-клеточный рак, гепатоидные карциномы, коллоидные карциномы, недифференцированные карциномы и недифференцированные карциномы с остеокластно-подобными гигантскими клетками.

Рак яичников составляет приблизительно 3% случаев злокачественных новообразований у женщин, но вызывает больше смертей, чем любое другое злокачественное новообразование женской репродуктивной системы. Рак яичников включает (1) эпителиальные типы рака, такие как эпителиальные карциномы яичников; (2) герминогенные злокачественные новообразования, такие как незрелые тератомы; и (3) стромальные типы рака, такие как гранулезоклеточные опухоли.

Рак молочной железы является вторым наиболее распространенным раком у американских женщин и второй ведущей причиной смерти от рака у женщин. Рак молочной железы можно классифицировать на основании наличия рецепторов гормонов и статуса HER2/neu, например (1) гормон-рецептор-позитивные типы рака (при котором раковые клетки содержат либо рецепторы эстрогена, либо рецепторы прогестерона); (2) гормон-рецептор-негативные типы рака (при котором раковые клетки не содержат на рецепторов эстрогена, ни рецепторов прогестерона); (3) HER2/neu позитивные (если злокачественные опухоли имеют избыточное содержание белка HER2/neu или дополнительные копии гена HER2/neu); (4) HER2/neu негативные типы рака (когда злокачественные опухоли не обладают избыточным содержанием HER2/neu); (5) тройной негативный тип рака (при котором раковые клетки молочной железы не содержат ни рецепторов эстрогена, ни рецепторов прогестерона, ни избыточного HER2); и (6) тройной позитивный тип рака (когда злокачественные опухоли позитивны по рецептору эстрогена, позитивны по рецептору прогестерона и содержа избыток HER2).

Рак легких составляет более четверти всех смертей от рака и на сегодняшний день является главной причиной смерти от рака среди мужчин и женщин. Наиболее распространенным типом рака легкого является немелкоклеточный рак легкого (NSCLC), на долю которого приходится приблизительно 85%-90% случаев рака легких. NSCLC можно дополнительно классифицировать по нескольким подтипам, таким как плоскоклеточная (эпидермоидная) карцинома, аденокарцинома, крупноклеточная (недифференцированная) карцинома, аденосквамозная карцинома и саркоматоидная карцинома. Вторым распространенным типом рака легких является мелкоклеточный рак легкого (SCLC), на долю которого приходится приблизительно 10-15% случаев рака легких.

Колоректальный рак (CRC) является второй по значимости причиной смертей от рака в Соединенных Штатах, если учитывать как мужчин, так и женщин. Аденокарцинома является наиболее распространенным типом CRC, на долю которого приходится более 95% случаев колоректального рака. Другие менее распространенные типы CRC включают карциноидные опухоли, желудочно-кишечные стромальные опухоли (GIST), лимфомы и саркому.

Рак желудка является третьей по распространенности причиной смерти от рака в мире. Он трудно поддается лечению, прежде всего потому, что у большинства пациентов представлен на прогрессирующей стадии заболевания. В США рак желудка в настоящее время является 15ым среди наиболее распространенных злокачественных заболеваний. Приблизительно 90-95% случаев рака желудка являются аденокарциномой; другие менее распространенные типы включают лимфому (4%), GIST и карциноидные опухоли (3%).

Традиционные схемы борьбы с раком были успешны при контроле выбранной группы циркулирующего и солидного рака. Однако многие виды рака устойчивы к традиционным подходам. В последние годы изучают иммунотерапию рака, в частности, противораковые вакцины и терапию антителами. Один из подходов в иммунотерапии рака включает введение иммуногена для продукции активного системного иммунного ответа на опухолевый антиген (ТАА) на раковой клетке-мишени. Хотя было идентифицировано большое число опухолевых антигенов, и многие из этих антигенов были исследованы в качестве противовирусных, противобактериальных, белковых, пептидных или ДНК- вакцин для лечения или профилактики злокачественных новообразований, большинство клинических испытаний до настоящего времени не смогли создать терапевтический продукт. Следовательно, существует потребность в иммуногене, который может быть использован для лечения или профилактики рака.

Настоящее описание относится к иммуногенам, полученным из опухолевых антигенов MUC1, Мезотелина и TERT, а также к композициям, содержащим такие иммуногены для применения в иммунотерапии рака.

Муцин 1 человека (MUC1; также известен как эписиалин, PEM, H23Ag, EMA, CA15-3 и MCA) представляет собой полиморфный трансмембранный гликопротеин, экспрессируемый на апикальных поверхностях простого и железистого эпителия. Ген MUC1 кодирует предшественник с одной полипептидной цепью, который включает последовательность сигнального пептида. Сразу после трансляции последовательность сигнального пептида удаляется, а оставшаяся часть предшественника MUC1 дополнительно расщепляется на два пептидных фрагмента: более длинную N-концевую субъединицу (MUC1-N или MUC1α) и более короткую C-концевую субъединицу (MUC1-C или MUC1β). Зрелый MUC1 содержит MUC1-N и MUC1-C, связанные посредством стабильных водородных связей. MUC1-N, который является внеклеточным доменом, содержит от 25 до 125 тандемных повторов с переменным числом (VNTR) из 20 аминокислотных остатков. MUC1-C содержит короткую внеклеточную область (приблизительно 53 аминокислоты), трансмембранный домен (приблизительно 28 аминокислот) и цитоплазматический хвост (приблизительно 72 аминокислоты). Цитоплазматический хвост MUC1 (MUC1-CT) содержит высококонсервативные остатки серина и тирозина, которые фосфорилируются с помощью рецепторов фактора роста и внутриклеточных киназ. MUC1 человека существует в нескольких изоформах, возникающих в результате различных типов альтернативного сплайсинга РНК MUC1. В SEQ ID NO: 1 представлена аминокислотная последовательность полноразмерного белка-предшественника MUC1 человека с изоформой 1 (изоформа 1, Uniprot P15941-1) («ссылочный полипептид MUC1 изоформы 1»). До сих пор сообщалось по меньшей мере о 16 других изоформах MUC-1 человека (Uniprot P15941-2-P15941-17), которые включают различные вставки, делеции или замены по сравнению с последовательностью изоформы 1. Эти изоформы известны как изоформы 2, 3, 4, 5, 6, Y, 8, 9, F, Y-LSP, S2, M6, ZD, T10, E2 и J13 (Uniprot P15941-2-P15941-17, соответственно). Полноразмерный белок-предшественник MUC1 человека с изоформой 1 состоит из 1255 аминокислот и включает последовательность сигнального пептида от 1 до 23 аминокислоты. Домены MUC1-N и MUC1-C зрелого белка MUC1 состоят из аминокислот 24-1097 и 1098-1255, соответственно.

Мезотелин (также известен как MSLN) представляет собой мембранно-связанный гликопротеин, присутствующий на поверхности клеток, выстилающих плевру, брюшину и перикард, и сверхэкспрессируется в нескольких опухолях человека, включая мезотелиому, аденокарциному яичников и поджелудочной железы. Ген мезотелина кодирует белок-предшественник длиной 71 килодальтон (кДа), который процессируется в белок мезотелин длиной 40 кДа и секретируемый белок потенцирующего фактора мегакариоцитов (MPF) (Chang, et al., Proc Natl Acad Sci USA (1996) 93:136-40). Альтернативный сплайсинг гена MSLN приводит к по меньшей мере четырем изоформам мезотелина. На сайте Uniprot (www.uniprot.org) доступны аминокислотные последовательности изоформы 1 (Uniprot Q13421-1), изоформы 2 (Uniprot Q13421-3), изоформы 3 (Uniprot Q13421-2) и изоформы 4 (Uniprot Q13421-4). Аминокислотная последовательность полноразмерного белка-предшественника MSLN человека с изоформой 2 (идентификатор Uniprot Q13421-3), который состоит из 622 аминокислот, представлен в SEQ ID NO:2 («ссылочный полипептид-предшественник мезотелина изоформы 2»). Цитоплазматическая часть MSLN содержит аминокислотные остатки от 37 до 597 SEQ ID NO:2. Изомформа 2 является основной формой MSLN. Изоформа 1, которая состоит из 630 аминокислот, отличается от изоформы 2 наличием 8 аминокислот (PQAPRRPL) в положении 409 последовательности изоформы 2. Изоформа 3 имеет альтернативный C-конец (в положениях 593-622 изоформы 2), а изоформа 4 имеет делецию аминокислоты 44 по сравнению с изоформой 2. Изоформа 2 первоначально транслируется как предшественник длиной 622 аминокислоты, который содержит последовательность сигнального пептида (аминокислоты 1-36) на N-конце и последовательность GPI-якоря на С-конце. Последовательность сигнального пептида и последовательность GPI-якоря могут быть отщеплены в зрелом мезотелине.

Теломеразная обратная транскриптаза (или TERT) является каталитическим компонентом теломеразы, которая представляет собой рибонуклеопротеидную полимеразу, ответственную за поддержание теломеразных концов путем добавления теломеразного повтора TTAGGG. Кроме TERT теломераза также включает компонент РНК, который служит матрицей для теломеразного повтора. Ген TERT человека кодирует 1132 аминокислотный белок. Существует несколько изоформ TERT человека, которые являются результатом альтернативного сплайсинга. Аминокислотные последовательности изоформы 1, изоформы 2, изоформы 3 и изоформы 4 доступны на сайте Uniprot (<www.uniprot.org>; индикаторы Uniprot O14746-1, O14746-2, O14746-3 и O14746-4, соответственно). Аминокислотная последовательность полноразмерного белка TERT человека изоформы 1 (изоформа 1, Genbank AAD30037, Uniprot O14746-1) также приведена в настоящем документе как SEQ ID NO: 3 («ссылочный полипептид TERT изоформы 1»). По сравнению с изоформой TERT 1 (O14746-1) изоформа 2 (O14746-2) имеет замену аминокислот 764-807 (STLTDLQPYM...LNEASSGLFD→LRPVPGDPAG...AGRAAPAFGG) и делеции С-концевых аминокислот 808-1132), изоформа 3 (O14746-3) имеет делецию аминокислот 885-947, и изоформа 4 (O14746-4) имеет делеции аминокислот 711-722 и 808- 1132 и замену аминокислот 764-807 (STLTDLQPYM...LNEASSGLFD→LRPVPGDPAG...AGRAAPAFGG).

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

В некоторых аспектах настоящее описание относится к выделенным иммуногенным полипептидам, полученным из MUC1, MSLN и TERT, которые эффективны, например, для индукции иммунного ответа in vivo (например, у животного, включая человека), или для применения в качестве компонента в вакцинах для лечения злокачественного новообразования.

В других аспектах настоящее изобретение относится к молекулам нуклеиновой кислоты, которые кодируют иммуногенный полипептид по настоящему изобретению. В некоторых вариантах осуществления настоящее изобретение относится к мультиантигенным конструкциям нуклеиновых кислот, каждая из которых кодирует два, три или более иммуногенных полипептида.

Описание также относится к векторам, содержащим одну или более молекул нуклеиновых кислот по изобретению. Векторы могут использоваться для клонирования или экспрессии иммуногенных полипептидов TAA, кодируемых молекулами нуклеиновых кислот, или для доставки молекул нуклеиновых кислот в композиции, такой как вакцина, в клетку-хозяин или в хозяин, которым является животное или человек.

В некоторых других аспектах настоящее изобретение относится к композициям, содержащим один или более иммуногенных полипептидов TAA, выделенных молекул нуклеиновых кислот, кодирующих иммуногенные полипептиды TAA, или вектора или плазмиды, содержащие молекулы нуклеиновых кислот, кодирующие иммуногенные полипептиды TAA. В некоторых вариантах осуществления композиция представляет собой иммуногенную композицию, которая может использоваться для индукции иммунного ответа против ТАА у млекопитающего, такого как мышь, собака, обезьяна или человек. В некоторых вариантах осуществления композиция представляет собой вакцинную композицию, которая может использоваться для иммунизации млекопитающего, например человека, для ингибирования патологической клеточной пролиферации, для предотвращения развития злокачественного новообразования (используется в качестве профилактического средства) или для лечения расстройств (используется в качестве терапевтического средства), связанных со сверхэкспрессией TAA, например злокачественного новообразования, в частности рака поджелудочного железы, яичников и тройного-негативного рака молочной железы.

В других аспектах настоящее изобретение относится к способам применения иммуногенных полипептидов TAA, выделенных молекул нуклеиновых кислот и композиций, содержащих иммуногенный полипептид TAA или выделенные молекулы нуклеиновых кислот, как описано выше. В некоторых вариантах осуществления настоящее изобретение относится к способу индукции иммунного ответа против ТАА у млекопитающего, в частности, человека, включающему введение млекопитающему эффективного количества полипептида по изобретению, который является иммуногенным против мишеневого ТАА, эффективного количества выделенной молекулы нуклеиновой кислоты, кодирующей такой иммуногенный полипептид, или композиции, содержащую такой иммуногенный полипептид TAA или выделенную молекулу нуклеиновой кислоты, кодирующую такой иммуногенный полипептид TAA. Вакцины на основе полипептидов или нуклеиновых кислот могут использоваться вместе с одним или несколькими адъювантами или иммуномодуляторами.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

A. ОПРЕДЕЛЕНИЯ

Термин «адъювант» относится к веществу, которое способно усиливать, ускорять или пролонгировать иммунный ответ, вызванный вакцинным иммуногеном.

Термин «агонист» относится к веществу, которое способствует (индуцирует, вызывает, усиливает или увеличивает) активность другой молекулы (такой как рецептор). Термин агонист включает вещества, которые связываются с рецептором, и вещества, которые усиливают рецепторную функцию, не связываясь с рецептором.

Термин «антагонист» или «ингибитор» относится к веществу, которое частично или полностью блокирует, ингибирует или нейтрализует биологическую активность другой молекулы или рецептора.

Термин "совместное введение" относится к введению двух или более агентов одному и тому же индивиду в период лечения. Два или более агентов могут быть включены в одну композицию и, таким образом, вводиться одновременно. Альтернативно, два или более агента могут находится в разных физических составах и вводиться по отдельности, либо последовательно, либо одновременно индивиду. Термин «вводятся одновременно» или «одновременное введение» означает, что введение первого агента и второго агента совпадают по времени друг с другом, а термин «вводятся последовательно» или «последовательное введение» означает, что введение первого агента и второго агента не совпадают по времени друг с другом.

Термин «цитозольный» или «цитоплазматический» означает, что после того, как нуклеотидная последовательность, кодирующая конкретный полипептид, экспрессируется клеткой-хозяином, предполагается, что экспрессированный полипептид будет сохранен внутри клетки-хозяина.

Термин «вырожденные варианты» относится к последовательностям нуклеиновых кислот, которые имеют замены оснований, но кодируют один и тот же полипептид.

Термин «эффективное количество» относится к количеству, вводимому млекопитающему, которое является достаточным для того, чтобы вызвать желаемый эффект у млекопитающего.

Термин «фрагмент» заданного полипептида относится к полипептиду, который короче, чем заданный полипептид, и который на 100% идентичен последовательности заданного полипептида.

Термин «функциональный вариант» иммуногенного полипептида ТАА относится к полипептиду, который содержит 90%-110% от числа аминокислот ссылочного иммуногенного полипептида ТАА, меньше чем на 100%, но больше чем на 95% идентичен аминокислотной последовательности ссылочного полипептида TAA и обладает теми же или сходными иммуногенными свойствами ссылочного иммуногенного полипептида TAA.

Термин «идентичный» относится к двум или более нуклеиновым кислотам или к двум или более полипептидам, которые имеют ту же самую последовательность нуклеотидов или аминокислот, соответственно. Термин «процентная идентичность» описывает уровень сходства двух или более нуклеиновых кислот или полипептидов. Если две последовательности выровнены с помощью биоинформационного программного обеспечения, то «процентная идентичность» вычисляется путем умножения числа точных нуклеотидных/аминокислотных совпадений в последовательностях на 100 и путем деления на длину выровненной области, включая пробелы. Например, два полипептида длиной 100 аминокислот, у которых имеется 10 ошибочных спариваний при выравнивании, считаются на 90% идентичными.

Термин «энхансер иммунной эффекторной клетки» или «энхансер IEC», относится к веществу, способному увеличивать и/или усиливать число, качество и/или функцию одного или нескольких типов иммунных эффекторных клеток млекопитающего. Примеры иммунных эффекторных клеток включают цитолитические CD8 Т-клетки, CD4 Т-клетки, NK-клетки и В-клетки.

Термин «иммунный модулятор» относится к веществу, способному изменять (например, ингибировать, уменьшать, увеличивать, усиливать или стимулировать) работу или функцию любого компонента врожденной, гуморальной или клеточной иммунной системы млекопитающего. Таким образом, термин "иммунный модулятор" включает "энхансер иммунной эффекторной клетки", как определено в настоящем документе, и "ингибитор иммунной супрессорной клетки", как определено в настоящем документе, а также вещество, которое воздействует на любые другие компоненты иммунной системы млекопитающего.

Термин "иммунный ответ" относится к любому обнаруживаемому ответу на конкретное вещество (например, антиген или иммуноген) иммунной системой позвоночного-хозяина, включая, но не ограничиваясь ими, врожденные иммунные ответы (например, активацию сигнального каскада Toll-подобного рецептора), клеточные иммунные ответы (например, ответы, опосредуемые Т-клетками, такими как антиген-специфические Т-клетки и неспецифические клетки иммунной системы) и гуморальные иммунные ответы (например, ответы, опосредованные В-клетками, такие как продукция и секреция антител в плазму, лимфу и/или тканевые жидкости). Примеры иммунных ответов включают изменение (например, увеличение) активации Toll-подобных рецепторов, экспрессию или секрецию лимфокинов (например, цитокинов (например, цитокинов типа Th1, Th2 или Th17) или хемокинов), активацию макрофагов, активацию дендритных клеток, активацию Т-клеток (например, CD4+ или CD8+ Т-клеток), активацию NK-клеток, активацию B-клеток (например, выработку и/или секрецию антител), связывание иммуногена (например, антигена, иммуногенного полипептида) с молекулой MHC, индукцию цитотоксического ответа Т-лимфоцитов («CTL»), индукцию В-клеточного ответа (например, продукцию антител), и увеличение количества (например, рост популяции клеток) клеток иммунной системы (например, Т-клеток и В-клеток), а также усиление процессинга и презентации антигена антиген-презентирующими клетками. Термин «иммунный ответ» также включает в себя любой обнаруживаемый ответ на конкретное вещество (такое как антиген или иммуноген) одним или несколькими компонентами иммунной системы позвоночного животного in vitro.

Термин «иммуноген» относится к веществу, которое является иммуногенным.

Термин «иммуногенный» относится к способности вещества при введении млекопитающему (например, человеку) вызывать, активировать, стимулировать или индуцировать иммунный ответ или улучшать, усиливать, увеличивать или продлевать ранее существовавший иммунные ответ на конкретный антиген у млекопитающего, независимо от того, представлен ли он в чистом виде или связан с носителем, в присутствии или в отсутствие адъюванта.

Термин «иммуногенная композиция» относится к композиции, которая является иммуногенной.

Термин «иммуногенный полипептид MUC1» относится к полипептиду, который является иммуногенным в отношении нативного белка MUC1 человека или клеток, экспрессирующих нативный белок MUC1 человека. Полипептид может иметь такую же аминокислотную последовательность как и нативный белок MUC1 человека, или обнаруживать одну или несколько мутаций по сравнению с аминокислотной последовательностью нативного белка MUC1 человека.

Термин «иммуногенный полипептид MSLN» относится к полипептиду, который является иммуногенным в отношении нативного белка MSLN человека или клеток, экспрессирующих нативный белок MSLN человека. Полипептид может иметь такую же аминокислотную последовательность как и нативный белок MLSN человека, или обнаруживать одну или несколько мутаций по сравнению с аминокислотной последовательностью нативного белка MLNS человека.

Термин «иммуногенный полипептид TERT» относится к полипептиду, который является иммуногенным в отношении нативного белка TERT человека или клеток, экспрессирующих нативный белок TERT человека. Полипептид может иметь такую же аминокислотную последовательность как и нативный белок TERT человека, или обнаруживать одну или несколько мутаций по сравнению с аминокислотной последовательностью белка TERT человека.

Термин «иммуногенный полипептид TAA» относится к «иммуногенному полипептиду MSLN», «иммуногенному полипептиду MUC1» или «иммуногенному полипептиду TERT», каждый из которых был определен выше.

Термин «иммуногенная молекула нуклеиновой кислоты MUC1» относится к молекуле нуклеиновой кислоты, которая кодирует «иммуногенный полипептид MUC1», который определен в настоящем описании.

Термин «иммуногенная молекула нуклеиновой кислоты MSLN» относится к молекуле нуклеиновой кислоты, которая кодирует «иммуногенный полипептид MSLN», который определен в настоящем описании.

Термин «иммуногенная молекула нуклеиновой кислоты TERT» относится к молекуле нуклеиновой кислоты, которая кодирует «иммуногенный полипептид TERT», который определен в настоящем описании.

Термин «иммуногенная молекула нуклеиновой кислоты TAA» относится к молекуле нуклеиновой кислоты, которая кодирует «иммуногенный полипептид MUC1», «иммуногенный полипептид MSLN» или «иммуногенный полипептид TERT», которые определены выше.

Термин «ингибитор иммунных супрессорных клеток» или «ISC ингибитор» относится к веществу, способному снижать и/или подавлять количество и/или функцию иммунных супрессорных клеток млекопитающего. Примеры иммунных супрессорных клеток включают регуляторные Т-клетки («Treg»), супрессорные клетки миелоидного происхождения и макрофаги опухоли.

Термин «млекопитающее» относится к любым видам животных класса Mammalia. Примеры млекопитающих включают: людей; нечеловеческих приматов, таких как обезьяны; лабораторных животных, таких как крысы, мыши, морские свинки; домашних животных, таких как кошки, собаки, кролики, крупный рогатый скот, овцы, козы, лошади и свиньи; и находящихся в неволе диких животных, таких как львы, тигры, слоны и тому подобное.

Термин «мембрано-связанный» означает, что после того, как нуклеотидная последовательность, кодирующая конкретный полипептид, экспрессируется клеткой-хозяином, экспрессированный полипептид связан, присоединен или иным образом ассоциирован с мембраной клетки.

Термин «неопластическое расстройство» относится к состоянию, при котором пролиферация клеток протекает на патологически высоком и некотролируемом уровне, этот уровень превышает и не согласован с уровнем пролиферации окружающих нормальных тканей. Это обычно приводит к солидному патологическому изменению или уплотнению, известной как «опухоль». Этот термин включает в себя доброкачественные и злокачественные неопластические расстройства. Термин «злокачественное неопластическое расстройство», которое в настоящем описании используется как синоним термину «рак», относится к новообразованию, отличающемуся способностью опухолевых клеток распространяться в другие места организма (называется «метастаз»). Термин «доброкачественное неопластическое расстройство" относится к новообразованию, в котором опухолевые клетки не способны к метастазированию.

Термин «мутация» относится к делеции, добавлению или замене аминокислотных остатков в аминокислотной последовательности белка или полипептида по сравнению с аминокислотной последовательностью стандартного белка или полипептида.

Термин «функционально связанный» относится к непосредственному соседству, в котором описанные компоненты находятся во взаимосвязи, позволяющей им функционировать предполагаемым образом. Контрольную последовательность, «функционально связанную» с трансгеном, лигируют таким образом, чтобы достигалась экспрессия трансгена в условиях, совместимых с контрольными последовательностями.

Термин «фармацевтическая композиция» относится к твердой или жидкой композиции, подходящей для введения субъекту (например, человеку) для активации желаемого физиологического, фармакологического или терапевтического эффекта. Кроме содержащегося одного или нескольких активных ингредиентов, фармацевтическая композиция может содержать один или несколько фармацевтически приемлемых вспомогательных веществ.

Термин «фармацевтически приемлемое вспомогательное вещество» относится к веществу в иммуногенной, фармацевтической или вакцинной композиции, отличному от активных ингредиентов (например, антигена, антиген-кодирующей нуклеиновой кислоты, иммуномодулятора или адъюванта), которое совместимо с активными ингредиентами и не вызывает значительного неблагоприятного эффекта у субъектов, которым его вводят.

Термины «пептид», «полипептид» и «белок» используются в настоящем документе как синонимы, и относятся к полимерной форме аминокислот любой длины, которая может включать кодируемые и некодируемые аминокислоты, химически или биохимически модифицированные аминокислоты и полипептиды или производные аминокислот и полипептидов, имеющие модифицированные полипептидные скелеты.

Термин «предупреждение» или «предупреждать» относится к (а) предотвращению возникновения расстройства или (b) задержке возникновения расстройства или возникновения симптомов расстройства.

Термин «секретируемый» в контексте полипептида означает, что после того, как нуклеотидная последовательность, кодирующая полипептид, экспрессируется клеткой-хозяином, экспрессированный полипептид секретируется за пределы клетки-хозяина.

Термин «субоптимальная доза» при использовании для описания количества иммуномодулятора, такого как ингибитор протеинкиназы, относится к дозе иммуномодулятора, которая ниже минимального количества, требуемого для получения желаемого терапевтического эффекта при лечении заболевания, если пациенту вводят исключительно иммуномодулятор.

Термин «субъект» относится к человеку или не относящемуся к человеку млекопитающему.

Термин «лечение» или «лечить» относится к прекращению расстройства, уменьшению тяжести расстройства или уменьшению степени тяжести или частоты проявления симптома расстройства.

Термин "опухолевый антиген» или «TAA» относится к антигену, который специфически экспрессируется опухолевыми клетками или экспрессируется на более высоком уровне или с большей плотностью опухолевыми клетками, чем неопухолевыми клетками того же типа ткани. Опухолевые антигены могут быть антигенами, в норме не экспрессируемыми хозяином; они могут быть мутированными, усеченными, неправильно свернутыми или иным образом проявляющими патологию молекулами, экспрессируемыми в норме хозяином; они могут быть идентичны молекулам, экспрессируемым в норме, но экспрессируемыми на патологически высоких уровнях; или они могут быть экспрессированы в условиях или в среде, которые являются патологическими. Опухолевые антигены могут быть, например, белками или фрагментами белков, сложными углеводами, ганглиозидами, гаптенами, нуклеиновыми кислотами или любой комбинацией этих или других биологических молекул.

Термин «вакцина» относится к иммуногенной композиции для введения млекопитающему (например, человеку) для активации защитного иммунного ответа против конкретного антигена или антигенов. Основным активным ингредиентом вакцины является иммуноген(ы).

Термин «вектор» относится к молекуле нуклеиновой кислоты или модифицированному микроорганизму, которые способны осуществлять транспорт или переносить чужую молекулу нуклеиновой кислоты в клетку-хозяин. Чужеродную молекулу нуклеиновой кислоты называют «вставкой» или «трансгеном». Вектор обычно состоит из вставки и большей последовательности, которая служит скелетом вектора. Основываясь на структуре или происхождении векторов, основные типы векторов включают плазмидные векторы, космидные векторы, фаговые векторы (такие как лямбда-фаг), вирусные векторы (такие как аденовирусные векторы), искусственные хромосомы и бактериальные векторы.

B. Иммуногенные полипептиды опухолевых антигенов (tAA)

В некоторых аспектах настоящее изобретение относится к выделенным иммуногенным полипептидам MUC1, полипептидам TERT и полипептидам MSLN, которые могут быть эффективны, например, для активации иммунного ответа in vivo (например, у животного, включая человека) или in vitro, активируя эффекторные Т-клетки или продукция антитела, специфичные для MUC1, TERT и MSLN, соответственно, или для применения в качестве компонента в вакцинах для лечения рака, такого как рак поджелудочной железы, яичника и молочной железы, в частности тройного негативного рака молочной железы.

Эти иммуногенные полипептиды TAA могут быть получены способами, известными в данной области в свете настоящего описания. Способность полипептидов индуцировать иммунный ответ может быть измерена в in vitro анализах или in vivo анализах. In vitro анализы для определения способности полипептида или конструкции ДНК активировать иммунные реакции известны в данной области. Один из примеров такого in vitro анализа предназначен для измерения способности полипептида или нуклеиновой кислоты, экспрессирующей полипептид, стимулировать Т-клеточный ответ, как раскрыто в патенте США 7387882, описание которого включено в настоящую заявку. Способ оценки включает стадии: (1) приведения антиген-презентирующих клеток в контакт антигеном в культуре, так чтобы антиген может быть захвачен и процессирован антиген-презентирующими клетками, продуцируя один или несколько процессированных антигенов; (2) приведения в контакт антиген-презентирующих клеток с Т-клетками в условиях, достаточных для того, чтобы Т-клетки прореагировали на один или несколько процессированных антигенов; (3) определение того, прореагировала ли Т-клетки на один или несколько процессированных антигенов. Используемыми Т-клетками могут быть CD8+ Т-клетки или CD4+ Т-клетки. Т-клеточный ответ может быть определен измерением высвобождения одного из большего числа цитокинов, таких как интерферон-гамма и интерлейкин-2, и лизиса антиген-презентирующих клеток (опухолевых клеток). В-клеточный ответ может быть определен измерением продукции антител.

B-1. Иммуногенные полипептиды MUC1

В одном из аспектов настоящее описание относится к выделенным иммуногенным полипептидам MUC1, происходящим из нативных MUC1 человека, причем полипептиды MUC1 обнаруживают одну или несколько введенных мутаций относительно нативного белка MUC1 человека. Примеры мутаций включают делецию некоторых, но не всех, тандемных повторов 20 аминокислот в области VNTR белка MUC1, делецию последовательности сигнального пептида, полностью или частично, и делецию аминокислот неконсенсусных аминокислотных последовательностей, обнаруживаемых в изоформах MUC1. Таким образом, в некоторых вариантах осуществления иммуногенные полипептиды MUC1, представленные в настоящем изобретении, включают (1) аминокислотную последовательность из 3-30 тандемных повторов 20 аминокислот белка MUC1 человека и (2) аминокислотные последовательности белка MUC1 человека, которые фланкируют область VNTR. В некоторых конкретных вариантах осуществления иммуногенные полипептиды MUC1 содержат (1) аминокислотную последовательность из 5-25 тандемных повторов MUC1 человека и (2) аминокислотные последовательности белка MUC1 человека, которые фланкируют область VNTR. В некоторых других вариантах осуществления иммуногенные полипептиды MUC1 находятся в цитоплазматической форме (или «цMUC1»). Термин «цитоплазматическая форма» относится к иммуногенному полипептиду MUC1, в котором отсутствует вся или часть секреторной последовательности (аминокислоты 1-23; также известны как «последовательность сигнального пептида») нативного белка MUC1 человека. Предполагается, что удаление аминокислот секреторной последовательности предотвратит вхождение полипептида в секреторный путь, так как он экспрессируется в клетках. В некоторых других вариантах осуществления иммуногенные полипептиды MUC1 содержат аминокислотную последовательность мембранно-связанной формы MUC1.

Иммуногенные полипептиды MUC1 по настоящему изобретению могут быть извлечены, сконструированы или получены из аминокислотной последовательности любой из изоформ MUC1 человека, известных в данной области или найденных в будущем, включая, например, изоформы Uniprot 1, 2, 3, 4, 5, 6, Y, 8, 9, F, Y-LSP, S2, M6, ZD, T10, E2 и J13 (Uniprot с P15941-1 по P15941-17, соответственно). В некоторых вариантах осуществления иммуногенные полипептиды MUC1 содержат аминокислотную последовательность, которая является частью белка 1 MUC1 человека изоформы 1, причем аминокислотная последовательность изоформы 1 MUC1 человека представлена в SEQ ID NO:1. В конкретном варианте осуществления иммуногенный полипептид MUC1 содержит аминокислоты 24-225 и 1098-1255 аминокислотной последовательности SEQ ID NO:1. В другом конкретном варианте осуществления иммуногенный полипептид MUC1 содержит аминокислоты 22-225 и 946-1255 аминокислотной последовательности SEQ ID NO:1. В некоторых других конкретных вариантах осуществления иммуногенный полипептид MUC1 включает или состоит из аминокислотной последовательности, выбранной из группы, состоящей из:

(1) аминокислотной последовательности SEQ ID NO:8 (полипептид плазмиды 1027);

(2) аминокислотной последовательности, содержащей аминокислоты 4-537 SEQ ID NO:8;

(3) аминокислотной последовательности, содержащей аминокислоты 24-537 SEQ ID NO:8;

(4) аминокислотной последовательности SEQ ID NO:16 (полипептид плазмиды 1197);

(5) аминокислотной последовательности, содержащей аминокислоты 4-517 SEQ ID NO:16; и

(6) аминокислотной последовательности, содержащей аминокислоты 4-517 SEQ ID NO:16, причем в SEQ ID NO:16 аминокислота в положении 513 представляет собой T.

В некоторых конкретных вариантах осуществления иммуногенные полипептиды MUC1 содержат аминокислотную последовательность SEQ ID NO:8 (полипептид плазмиды 1027) или SEQ ID NO:16 (полипептид плазмиды 1197).

B-2. Иммуногенные полипептиды MSLN

В одном из аспектов настоящее изобретение относится к выделенным иммуногенным полипептидам MSLN, происходящим из предшественника MSLN человека, в котором произведена делеция части или всей последовательности сигнального пептида предшественника MSLN. Таким образом, иммуногенные полипептиды MSLN содержат аминокислотную последовательность нативного предшественника MSLN человека, в котором отсутствует часть или вся последовательность сигнального пептида предшественника MSLN. В некоторых вариантах осуществления в иммуногенном полипептиде MSLN также отсутствует часть или вся якорная последовательность GPI нативного MSLN человека (то есть, аминокислоты 598-622 SEQ ID NO:2). Как используется в настоящем документе, термин «MSLN человека» включает в себя любую изоформу MSLN человека, такую как изоформа 1, 2, 3 или 4. В некоторых конкретных вариантах осуществления MSLN человека представляет собой изоформу 2 MSLN человека.

В некоторых конкретных вариантах осуществления выделенный иммуногенный полипептид MSLN выбран из группы, состоящей из:

1) полипептида, содержащего или состоящего из аминокислот 37-597 аминокислотной последовательности SEQ ID NO:2;

2) полипептида, содержащего аминокислотную последовательность, которая по меньшей мере на 90%, 95%, 98% или 99% идентична аминокислотной последовательности, состоящей из аминокислот 37-597 аминокислотной последовательности SEQ ID NO:2;

3) полипептида, содержащего или состоящего из аминокислотной последовательности SEQ ID NO: 6 или аминокислот 4-564 аминокислотной последовательности SEQ ID NO: 6; и

4) полипептида, содержащего аминокислотную последовательность, которая по меньшей мере на 93%-99%, 94%-98% или 94%-97% идентична аминокислотной последовательности SEQ ID NO: 6 («полипептид плазмиды 1103»).

B-3. Иммуногенные полипептиды TERT

В еще одном аспекте настоящее описание относится к выделенным иммуногенным полипептидам TERT, происходящим из белка TERT человека, в котором произведена делеция вплоть до 600 аминокислот N-конца белка TERT. Таким образом, в некоторых вариантах осуществления иммуногенные полипептиды TERT содержат аминокислотную последовательность изоформы 1 TERT, представленную в SEQ ID NO: 3, в которой отсутствуют вплоть до приблизительно 600 аминокислот N-конца (аминоконец) аминокислотной последовательности TERT изоформы 1. В иммуногенном полипептиде TERT может отсутствовать любое количество аминокислот, вплоть до 600, на N-конце TERT изоформы 1. Например, в иммуногенном полипептиде TERT могут отсутствовать N-концевые аминокислоты от положения 1 до положения 50, 100, 50, 200, 245, 300, 350, 400, 450, 500, 550 или 600 изоформы 1 TERT SEQ ID NO:3. Таким образом, иммуногенный полипептид TERT по настоящему изобретению может содержать аминокислоты 51-1132, 101-1132, 151-1132, 201-1132, 251-1132, 301-1132, 351-1132, 401-1132, 451-1132, 501-1132 или 551-1132 SEQ ID NO: 3. Иммуногенные полипептиды TERT также могут быть сконструированы из других изоформ TERT. Однако, если полипептиды сконструированы из изоформ TERT с C-концевыми усечениями, то, предпочтительно, чтобы несколько аминокислот были удалены с N-конца.

В некоторых других вариантах осуществления иммуногенный полипептид TERT дополнительно содержит одну или несколько аминокислотных мутаций, которые инактивируют каталитический домен TERT. Примеры таких аминокислотных мутаций включают замену аспарагиновой кислоты на аланин в положении 712 SEQ ID NO:3 (D712A) и замену валина на изолейцин в положении 713 SEQ ID NO:3 (V713I). В некоторых вариантах осуществления иммуногенный полипептид TERT содержит и мутацию D712A, и мутацию V713I.

В некоторых конкретных вариантах осуществления настоящее описание относится к иммуногенному полипептиду TERT, выбранному из группы, состоящей из:

1) полипептида, содержащего аминокислотную последовательность SEQ ID NO: 10 или аминокислоты 2-892 SEQ ID NO: 10 («полипептид плазмиды 1112»), или функционального варианта полипептида;

2), полипептида, содержащего аминокислотную последовательность SEQ ID NO: 14 или аминокислоты 3-789 SEQ ID NO: 14 («полипептид плазмиды 1326»), или функционального варианта полипептида; и

3) полипептида, содержащего аминокислотную последовательность SEQ ID NO: 12 или аминокислоты 4-591 SEQ ID NO: 12 («полипептид плазмиды 1330»), или функционального варианта полипептида.

C. Молекулы нуклеиновой кислоты, кодирующие иммуногенные полипептиды TAA

В некоторых аспектах настоящее изобретение относится к молекулам нуклеиновых кислот, каждая из которых кодируют один, два, три или более независимых иммуногенных полипептидов TAA по настоящему изобретению. Молекулы нуклеиновых кислот могут быть дезоксирибонуклеотидами (ДНК) или рибонуклеотидами (РНК). Таким образом, молекула нуклеиновой кислоты может содержать описанную в настоящем документе нуклеотидную последовательность, в которой тимидин (Т) также может быть урацилом (U), что отражает различия между химическими структурами ДНК и РНК. Молекулы нуклеиновых кислот могут быть модифицированными формами, одно- или двухцепочечными формами, линейными или кольцевыми формами. Молекулы нуклеиновых кислот могут быть получены способами, известными в данной области в свете настоящего описания.

C-1. Моноантигенные конструкции

В одном аспекте настоящее изобретение относится к выделенной молекуле нуклеиновой кислоты, которая содержит нуклеотидную последовательность, кодирующую один иммуногенный полипептид MUC1, один иммуногенный полипептид MSLN или один иммуногенный полипептид TERT, как описано в настоящем изобретении. Молекула нуклеиновой кислоты, которая кодирует только один иммуногенный полипептид TAA, такой как иммуногенный полипептид MUC1, иммуногенный полипептид MSLN или иммуногенный полипептид TERT, также называется в настоящем описании «моноантигенной конструкцией».

C-1a. MUC1 моноантигенные конструкции

В некоторых вариантах осуществления настоящее изобретение относится к выделенным молекулам нуклеиновых кислот, которые кодируют иммуногенный полипептид MUC1 по настоящему изобретению. Иммуногенный полипептид MUC1, кодируемый молекулой нуклеиновой кислоты, может находиться в цитоплазматической форме (или цMUC1) или в «мембрано-связанной форме" (или мMUC1). Термин «мембрано-связанная форма» относится к иммуногенному полипептиду MUC1, который, после того, как был экспрессирован кодирующей нуклеиновой кислотой в клетке-хозяине, связан, присоединен или иным образом ассоциирован с мембраной клетки хозяина.

В некоторых конкретных вариантах осуществления выделенные молекулы нуклеиновых кислот по настоящему изобретению содержат нуклеотидную последовательность, которая кодирует иммуногенный полипептид MUC1, выбранный из группы, состоящей из:

(1) иммуногенного полипептида MUC1, содержащего аминокислотную последовательность SEQ ID NO:8 (полипептид плазмиды 1027);

(2) имунногенного полипептида MUC1, содержащего аминокислоты 4-537 SEQ ID NO:8;

(3) имунногенного полипептида MUC1, содержащего аминокислоты 24-537 SEQ ID NO: 8;

(4) иммуногенного полипептида MUC1, содержащего аминокислотную последовательность SEQ ID NO:16 (полипептид плазмиды 1197);

(5) имунногенного полипептида MUC1, содержащего аминокислоты 4-517 SEQ ID NO:16;

(6) имунногенного полипептида MUC1, содержащего аминокислоты 4-517 SEQ ID NO:16, причем аминокислота в положении 513 представляет собой T; и

(7) имунногенного полипептида MUC1, содержащего аминокислоты 24-225 и 946-1255 SEQ ID NO: 1.

В некоторых других конкретных вариантах осуществления выделенные молекулы нуклеиновых кислот по настоящему изобретению содержат нуклеотидную последовательность или ее производное, выбранные из группы, состоящей из:

(1) нуклеотидной последовательности SEQ ID NO:7 (плазмида 1027);

(2) нуклеотидной последовательности, содержащей нуклеотиды 10-1611 SEQ ID NO: 7;

(3) нуклеотидной последовательности SEQ ID NO: 15 (плазмида 1197); и

(4) нуклеотидной последовательности, содержащей нуклеотиды 10-1551 SEQ ID NO: 15;

С-1b. MSLN моноантигенные конструкции

В некоторых вариантах осуществления настоящее изобретение относится к выделенным молекулам нуклеиновых кислот, которые кодируют иммуногенный полипептид MSLN по настоящему изобретению.

В некоторых конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты кодирует иммуногенный полипептид MSLN, выбранный из группы, состоящей из:

1) иммуногенного полипептида MSLN, содержащего или состоящего из аминокислот 37-597 аминокислотной последовательности SEQ ID NO:2;

2) иммуногенного полипептида MSLN, содержащего аминокислотную последовательность, которая по меньшей мере на 90%, 95%, 98% или 99% идентична аминокислотной последовательности, состоящей из аминокислот 37-597 аминокислотной последовательности SEQ ID NO:2;

3) иммуногенного полипептида MSLN, содержащего или состоящего из аминокислотной последовательности SEQ ID NO: 6; и

4) иммуногенного полипептида MSLN, содержащего аминокислотную последовательность, которая по меньшей мере на 93%-99%, 94%-98% или 94%-97% идентична аминокислотной последовательности SEQ ID NO: 6 («полипептид плазмиды 1103»).

В некоторых других конкретных вариантах осуществления выделенные молекулы нуклеиновых кислот по настоящему изобретению содержат нуклеотидную последовательность или ее производное, выбранные из группы, состоящей из:

(1) нуклеотидной последовательности SEQ ID NO: 5; и

(2) нуклеотидной последовательности, содержащей нуклеотиды 10-1692 SEQ ID NO: 5.

С-1c. TERT моноантигенные конструкции

В некоторых других вариантах осуществления настоящее изобретение относится к выделенным молекулам нуклеиновых кислот, которые кодируют иммуногенный полипептид TERT по настоящему изобретению.

Иммуногенный полипептид TERT, кодируемый нуклеиновой кислотой по настоящему изобретению, может содержать делецию вплоть до 600 аминокислот на N-конце аминокислотной последовательности TERT изоформы 1. Как правило, можно ожидать, что иммуногенный полипептид TERT обладает более сильной иммуногенностью, если у него имеется делеция нескольких аминокислот на N-конце белка TERT. Число N-концевых аминокислот, которые могут быть делетированы в белке TERT, можно определить на основании того, как предполагается использовать или доставлять молекулу нуклеиновой кислоты, кодирующую полипептид. Например, если молекулу нуклеиновой кислоты предполагается доставлять с помощью конкретного вирусного вектора, то делецию можно определить в зависимости от емкости используемого вектора.

В некоторых вариантах осуществления иммуногенные полипептиды TERT, кодируемые молекулами нуклеиновых кислот, содержат одну или несколько аминокислотных мутаций, которые инактивируют каталитический домен TERT. Примеры таких аминокислотных мутаций включают замену аспарагиновой кислоты на аланин в положении 712 SEQ ID NO:3 (D712A) и замену валина на изолейцин в положении 713 SEQ ID NO:3 (V713I). В некоторых вариантах осуществления иммуногенный полипептид TERT содержит и мутацию D712A, и мутацию V713I.

В некоторых конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты кодирует иммуногенный полипептид TERT, выбранный из группы, состоящей из:

1) иммуногенного полипептида TERT, содержащего аминокислотную последовательность SEQ ID NO: 10 или аминокислоты 2-892 SEQ ID NO: 10 («полипептид плазмиды 1112»), или функционального варианта полипептида;

2) иммуногенного полипептида TERT, содержащего аминокислотную последовательность SEQ ID NO: 14 или аминокислоты 3-789 SEQ ID NO: 14 («полипептид плазмиды 1326»), или функционального варианта полипептида; и

3) иммуногенного полипептида TERT, содержащего аминокислотную последовательность SEQ ID NO: 12 или аминокислоты 4-591 SEQ ID NO: 12 («полипептид плазмиды 1330»), или функционального варианта полипептида.

В некоторых конкретных вариантах осуществления выделенные молекулы нуклеиновых кислот содержат нуклеотидную последовательность или ее производное, выбранные из группы, состоящей из:

(1) нуклеотидной последовательности SEQ ID NO: 9 (TERT240);

(2) нуклеотидной последовательности, содержащей нуклеотиды 4-2679 SEQ ID NO: 9;

(3) нуклеотидной последовательности SEQ ID NO: 11 (TERT541);

(4) нуклеотидной последовательности, содержащей нуклеотиды 10-1782 SEQ ID NO: 11;

(5) нуклеотидной последовательности SEQ ID NO: 13 (TERT342); и

(6) нуклеотидной последовательности, содержащей нуклеотиды 7-2373 SEQ ID NO: 13.

C-2. Мультиантигенные конструкции

В еще одном аспекте настоящее описание относится к молекулам нуклеиновых кислот, каждая из которых кодирует два, три или более различных иммуногенных полипептидов TAA. Молекула нуклеиновой кислоты, которая кодирует более одного иммуногенного полипептида TAA, также называется в настоящем описании «мультиантигенной конструкцией», «мультиантигенной вакциной», «мультиантигенной плазмидой» и тому подобное. В настоящем описании молекула нуклеиновой кислоты, которая кодирует два различных иммуногенных полипептида TAA, также называется «двойная антигенная конструкция», «двойная антигенная вакцина» или «двойная антигенная плазмида» и тому подобное. В настоящем описании молекула нуклеиновой кислоты, которая кодирует три различных иммуногенных полипептида TAA, также называется «тройная антигенная конструкция», «тройная антигенная вакцина» или «тройная антигенная плазмида».

Мультиантигенные конструкции по настоящему изобретению могут быть получены различными способами, известными в данной области в свете настоящего описания. Например, мультиантигенная конструкция может быть сконструирована путем включения нескольких независимых промоторов в одну плазмиду (Huang, Y., Z. Chen, et al. (2008). "Design, construction, and characterization of a dual-promoter multigenic DNA vaccine directed against an HIV-1 subtype C/B' recombinant." J Acquir Immune Defic Syndr 47(4): 403-411; Xu, K., Z. Y. Ling, et al. (2011). "Broad humoral and cellular immunity elicited by a bivalent DNA vaccine encoding HA and NP genes from an H5N1 virus." Viral Immunol 24(1): 45-56). Плазмиду можно сконструировать для переноса множества кассет экспрессии, каждая из которых состоит из а) эукариотического промотора для инициации транскрипции, зависящей от РНК-полимеразы, содержащего или не содержащего энхансерный элемент, b) гена, кодирующего мишеневый антиген, и с) последовательности терминатора транскрипции. При доставке плазмиды в трансфицированное клеточное ядро транскрипция начинается с каждого промотора, что приводит к получению отдельных мРНК, каждая из которых кодирует один из мишеневый антиген. мРНК независимо транслируются, тем самым давая желаемые антигены.

Конструкции с множественными антигенами по настоящему изобретению также могут быть сконструированы с помощью вирусных пептидов 2А (Szymczak, A.L. and D.A. Vignali (2005). "Development of 2A peptide-based strategies in the design of multicistronic vectors." Expert Opin Biol Ther 5(5): 627-638; de Felipe, P., G. A. Luke, et al. (2006). "E unum pluribus: multiple proteins from a self-processing polyprotein." Trends Biotechnol 24(2): 68-75; Luke, G. A., P. de Felipe, et al. (2008). "Occurrence, function and evolutionary origins of '2A-like' sequences in virus genomes." J Gen Virol 89(Pt 4): 1036-1042; Ibrahimi, A., G. Vande Velde, et al. (2009). "Highly efficient multicistronic lentiviral vectors with peptide 2A sequences." Hum Gene Ther 20(8): 845-860; Kim, J. H., S. R. Lee, et al. (2011). "High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice." PLoS One 6(4): e18556). Эти пептиды, также называемые расщепляемыми кассетами или CHYSEL (цис-действующие гидролазные элементы), составляют в длину приблизительно 20 аминокислот и имеют высококонсервативный карбокси-концевой мотив D-V/I-EXNPGP (Таблица 19). Эти пептиды редко встречаются в природе, чаще всего обнаруживаются в таких вирусах, как вирус ящура (FMDV), вирус лошадиного ринита A (ERAV), вирус лошадиного ринита B (ERBV), вирус энцефаломиокардита (EMCV), свиной тошевирус (PTV) и вирус Thosea asigna (TAV) (Luke, GA, P. de Felipe, et al. (2008). "Occurrence, function and evolutionary origins of '2A-like' sequences in virus genomes." J Gen Virol 89(Pt 4): 1036-1042). С помощью стратегии экспрессии множественных антигенов на основе 2А, гены, кодирующие несколько мишеневых антигенов, связаны друг с другом в одной открытой рамке считывания, разделенной последовательностями, кодирующими вирусные пептиды 2А. Вся открытая рамка считывания может быть клонирована в вектор с единственным промотором и терминатором. После доставки конструкций в клетку-хозяина, мРНК, кодирующая множественные антигены, будет транскрибироваться и транслироваться как единый полипротеин. Во время трансляции пептидов 2А, рибосомы пропускают связь между С-концевым глицином и пролином. Рибосомальное проскальзывание действует как котрансляционное автокаталитическое «расщепление», которое освобождает последовательности пептидов, находящиеся в направлении 3'-5' от пептида 2А, от последовательностей, которые находятся в направлении 5'-3'. Встраивание пептида 2А между двумя белковыми антигенами может привести к добавлению ~20 аминокислот к С-концу полипептида, расположенного в направлении 3'-5', и 1 аминокислоты (пролина) к N-концу белка, расположенного в направлении 5'-3'. При применении этой методики сайты расщепления протеазой могут быть введены на N-конец кассеты 2А, так что повсеместно распространенные протеазы будут расщеплять кассету в направлении 3'-5' белка (Fang, J., S. Yi, et al. (2007). "An antibody delivery system for regulated expression of therapeutic levels of monoclonal antibodies in vivo." Mol Ther 15(6): 1153-1159).

Другая стратегия конструирования мультиантигенных конструкций по настоящему изобретению включает применение участка внутренней посадки рибосомы, или IRES. Участки внутренней посадки рибосом представляют собой РНК-элементы, обнаруживаемые в 5'-нетранслируемых областях некоторых молекул РНК (Bonnal, S., C. Boutonnet, et al. (2003). "IRESdb: the Internal Ribosome Entry Site database." Nucleic Acids Res 31(1): 427-428). Они привлекают рибосомы эукариот к РНК для облегчения трансляции открытых рамок считывания. В отличие от нормальной трансляции, зависимой от 7-метилгуанозинового кэпа, IRES-опосредованная трансляция может быть инициирована на кодонах AUG, находящихся глубоко внутри молекулы РНК. Высокоэффективный процесс может быть использован для применения в мультицистронных векторах экспрессии (Bochkov, Y. A. and A. C. Palmenberg (2006). "Translational efficiency of EMCV IRES in bicistronic vectors is dependent upon IRES sequence and gene location." Biotechniques 41(3): 283-284, 286, 288). Как правило, два трансгена вводят в вектор между промотором и терминатором транскрипции в виде двух отдельных открытых рамок считывания, разделенных IRES. После доставки конструкций в клетку-хозяин, будет транскрибироваться один длинный транскрипт, кодирующий оба трансгена. Первая ORF транслируется традиционным кэп-зависимым образом, заканчиваясь стоп-кодоном в направлении 3'-5' от IRES. Вторая ORF транслируется кэп-независимым образом, используя IRES. Таким образом, из одной мРНК, транскрибируемой из вектора с единственной экспрессионной кассетой, могут быть получены два независимых белка.

В некоторых аспектах настоящее описание относится к двойной антигенной конструкции, содержащей две кодирующие нуклеотидные последовательности, причем каждая из кодирующих нуклеотидных последовательностей кодирует отдельный иммуногенный полипептид TAA. Структура такой двойной антигенной конструкции показана в формуле (I):

TAA1-СПЕЙСЕР1-TAA2 (I),

где в формуле (I):

(i) TAA1 и TAA2 представляют собой нуклеотидные последовательности, каждая из которых кодирует иммуногенные полипептиды TAA, выбранные из группы, состоящей из иммуногенного полипептида MUC1, иммуногенного полипептида MSLN и иммуногенного полипептида TERT, где TAA1 и TAA 2 кодируют различные иммуногенные полипептиды TAA; и

(ii) СПЕЙСЕР1 представляет собой спейсерную нуклеотидную последовательностью и может отсутствовать.

В некоторых вариантах осуществления настоящее изобретение относится к двойной антигенной конструкции формулы (I), где в формуле (I) TAA1 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MUC1, и TAA2 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MSLN или иммуногенный полипептид TERT.

В некоторых других вариантах осуществления настоящее изобретение относится к двойной антигенной конструкции формулы (I), где в формуле (I) TAA1 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MSLN, и TAA2 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MUC1 или иммуногенный полипептид TERT.

В некоторых других вариантах осуществления настоящее изобретение относится к двойной антигенной конструкции формулы (I), где в формуле (I) TAA1 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид TERT, и TAA2 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MUC1 или иммуногенный полипептид MSLN.

В некоторых конкретных вариантах осуществления настоящее описание относится к двойной антигенной конструкции формулы, выбранной из группы, состоящей из:

(1) MUC1-2A-TERT (II)

(2) MUC1-2A-MSLN (III)

(3) MSLN-2A-TERT (IV)

(4) MSLN-2A-MUC1 (V)

(5) TERT-2A-MSLN (VI)

(6) TERT-2A-MUC1 (VII)

где в каждой из формул (II)-(VII): (i) MUC1, MSLN и TERT представляют собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MUC1, иммуногенный полипептид MSLN и иммуногенный полипептид TERT, соответственно, и (ii) 2A представляет собой нуклеотидную последовательность, кодирующую пептид 2A.

В некоторых других аспектах настоящее описание относится к тройной антигенной конструкции, содержащей три кодирующие нуклеотидные последовательности, где каждая из кодирующих нуклеотидных последовательностей экспрессирует различные независимые иммуногенные полипептиды TAA. Структура тройной антигенной конструкции показана в формуле (VIII):

TAA1-СПЕЙСЕР1-TAA2-СПЕЙСЕР2-TAA3 (VIII)

где в формуле (VIII):

(i) каждый TAA1 и TAA3 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид TAA, выбранный из группы, состоящей из иммуногенного полипептида MUC1, иммуногенного полипептида MSLN и иммуногенного полипептида TERT, где TAA1, TAA2 и TAA3 кодируют различные иммуногенные полипептиды TAA; и

(ii) СПЕЙСЕР1 и СПЕЙСЕР2 представляют собой спейсерную нуклеотидную последовательность, причем (a) СПЕЙСЕР1 и СПЕЙСЕР2 могут быть одинаковыми или различными и (b) либо СПЕЙСЕР1 может отсутствовать, либо СПЕЙСЕР2 может отсутствовать, либо и СПЕЙСЕР1, и СПЕЙСЕР2 могут отсутствовать.

Термин «спейсерная нуклеотидная последовательность», используемый в настоящем описании, относится к нуклеотидной последовательности, которая введена между двух кодирующих последовательностей или трансгенами в открытую рамку считывания молекулы нуклеиновой кислоты и функционирует, обеспечивая соэкспрессию или трансляцию двух отдельных генным продуктов из молекулы нуклеиновой кислоты. Примеры спейсерных нуклеотидных последовательностей, которые могут быть использованы в мультиантигенных конструкциях по настоящему изобретению, включают в себя эукариотические промоторы, нуклеотидные последовательности, кодирующие пептид 2A, и участки внутренней посадки рибосомы (IRES). Примеры пептидов 2А включают пептид 2А вируса ящура (FMD2A), пептид 2A вируса лошадиного ринита A (ERA2A), пептид 2А вируса лошадиного ринита B (ERB2A), пептид 2А вируса энцефаломиокардита (EMC2A), пептид 2А свиного тошевируса (PT2A) и пептид 2А вируса Thosea asigna (T2A). Последовательности этих пептидов 2А представлены в Таблице 19.

В некоторых вариантах осуществления СПЕЙСЕР1 и СПЕЙСЕР2 независимо представляют собой нуклеотидную последовательность, кодирующую пептид 2A, или нуклеотидную последовательность, кодирующую GGSGG.

В некоторых вариантах осуществления настоящее изобретение относится к тройной антигенной конструкции формулы (VIII), где в формуле (VIII) (i) TAA1 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MUC1, (ii) TAA2 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MSLN, и (iii) TAA3 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид TERT.

В некоторых других вариантах осуществления настоящее описание относится к тройной антигенной конструкции формулы (VIII), где в формуле (VIII) (i) TAA1 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MUC1, (ii) TAA2 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид TERT и (iii) TAA3 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MSLN.

В некоторых других вариантах осуществления настоящее описание относится к тройной антигенной конструкции формулы (VIII), где в формуле (VIII) (i) TAA1 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MSLN, (ii) TAA2 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид TERT и (iii) TAA3 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MUC1.

В некоторых вариантах осуществления настоящее изобретение относится к тройной антигенной конструкции формулы (VIII), где в формуле (VIII) (i) TAA1 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MSLN, (ii) TAA2 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MUC1, и (iii) TAA3 представляет собой нуклеотидную последовательность, кодирующую иммуногенный полипептид TERT.

В некоторых конкретных вариантах осуществления настоящее описание относится к тройной антигенной конструкции формулы, выбранной из группы, состоящей из:

(1) MUC1-2A-MSLN-2A-TERT (IX)

(2) MUC1-2A-TERT-2A-MSLN (X)

(3) MSLN-2A-MUC1-2A-TERT (XI)

(4) MSLN-2A-TERT-2A-MUC1 (XII)

(5) TERT-2A-MUC1-2A-MSLN (XIII)

(6) TERT-2A-MSLN-2A-MUC1 (XIV)

где в каждой из формул (IX)-(XIV): (i) MUC1, MSLN и TERT представляют собой нуклеотидную последовательность, кодирующую иммуногенный полипептид MUC1, иммуногенный полипептид MSLN и иммуногенный полипептид TERT, соответственно, и (ii) 2A представляет собой нуклеотидную последовательность, кодирующую пептид 2A.

Иммуногенный полипептид MSLN, кодируемый мультиантигенной конструкцией, может представлять собой полноразмерный MSLN-белок или его фрагмент, такой как цитоплазматический, секретируемый или связанный с мембраной фрагмент. В некоторых вариантах осуществления мультиантигенная конструкция содержит нуклеотидную последовательность, кодирующую иммуногенный полипептид MSLN, выбранный из группы, состоящей из:

1) полипептида, содержащего или состоящего из аминокислот 37-597 аминокислотной последовательности SEQ ID NO:2;

2) полипептида, содержащего аминокислотную последовательность, которая по меньшей мере на 90%, 95%, 98% или 99% идентична аминокислотной последовательности, состоящей из аминокислот 37-597 аминокислотной последовательности SEQ ID NO:2;

3) полипептида, содержащего или состоящего из аминокислотной последовательности SEQ ID NO: 6 или аминокислот 4-564 аминокислотной последовательности SEQ ID NO: 6; и

4) полипептида, содержащего аминокислотную последовательность, которая по меньшей мере на 93%-99%, 94%-98% или 94%-97% идентична аминокислотной последовательности SEQ ID NO: 8 («полипептид плазмиды 1103»).

В некоторых конкретных вариантах осуществления мультиантигенная конструкция содержит нуклеотидную последовательность SEQ ID NO: 5 или ее вырожденный вариант.

Иммуногенный полипептид MUC1, кодируемый мультиантигенной конструкцией может содержать (1) аминокислотную последовательность из 3-30 тандемных повторов из 20 аминокислот белка MUC1 человека и (2) аминокислотные последовательности белка MUC1 человека, который фланкирует область VNTR. В некоторых вариантах осуществления мультиантигенная конструкция содержит нуклеотидную последовательность, кодирующую иммуногенный полипептид MUC1, где иммуногенный полипептид MUC1 содержит аминокислотную последовательность, выбранную из группы, состоящей из:

(1) аминокислотной последовательности SEQ ID NO:8 (полипептид плазмиды 1027);

(2) аминокислотной последовательности, содержащей аминокислоты 4-537 SEQ ID NO:8;

(3) аминокислотной последовательности, содержащей аминокислоты 24-537 SEQ ID NO:8;

(4) аминокислотной последовательности SEQ ID NO:16 (полипептид плазмиды 1197);

(5) аминокислотной последовательности, содержащей аминокислоты 4-517 SEQ ID NO:16; и

(6) аминокислотной последовательности, содержащей аминокислоты 4-517 SEQ ID NO: 16, при условии, что аминокислота в положении 513 представляет собой T.

В некоторых конкретных вариантах осуществления мультиантигенная конструкция содержит нуклеотидную последовательность SEQ ID NO: 7, нуклеотидную последовательность SEQ ID NO: 15 или вырожденный вариант нуклеотидной последовательности SEQ ID NO: 7 или 15.

Иммуногенный полипептид TERT, кодируемый мультиантигенной конструкцией, может представлять собой полноразмерный белок или любую усеченную форму. Ожидается, что полноразмерный белок TERT будет давать более сильные иммунные ответы, чем усеченная форма. Однако в зависимости от конкретного вектора, выбранного для доставки конструкции, вектор может не обладать возможностью нести ген, кодирующий полноразмерный белок TERT. Поэтому в белке могут бы проведены делеции некоторых аминокислот так, чтобы трансгены подходили для конкретного вектора. Делеции аминокислот могут быть проведены с N-конца, С-конца или в любом месте последовательности белка TERT. Для удаления сигнала ядерной локализации могут быть проведены дополнительные делеции, тем самым превращая полипептиды в цитоплазматические, повышая доступ к механизмам процессинга/презентации клеточного антигена. В некоторых вариантах осуществления в иммунных полипептидах TERT отсутствуют аминокислоты вплоть до положения 200, 300, 400, 500 или 600 N-конца. Для инактивации каталитического домена TERT могут быть введены мутации дополнительных аминокислот. Примеры таких мутаций включают D712A и V713T.

В некоторых других вариантах осуществления мультиантигенная конструкция содержит нуклеотидную последовательность, кодирующую иммуногенный полипептид TERT, где иммуногенный полипептид TERT содержит или состоит из аминокислотной последовательности, выбранной из группы, состоящей из:

1) аминокислотной последовательности SEQ ID NO:10 («полипептид плазмиды 1112»; TERT 240);

(2) аминокислотной последовательности SEQ ID NO:12 ("полипептид плазмиды 1330"; TERT 541); и

3) аминокислотной последовательности SEQ ID NO: 14 («полипептид плазмиды 1326», TERT 343).

В некоторых конкретных вариантах осуществления мультиантигенная конструкция содержит нуклеотидную последовательность SEQ ID NO: 9, 11 или 13 или вырожденный вариант нуклеотидной последовательности SEQ ID NO: 9, 11 или 13.

В некоторых конкретных вариантах осуществления настоящее изобретение относится к двойной антигенной конструкции, кодирующей иммуногенный полипептид MUC1 и иммуногенный полипептид MSLN, который содержит нуклеотидную последовательность, выбранную из группы, состоящей из:

(1) нуклеотидной последовательности, кодирующей аминокислотную последовательность SEQ ID NO: 18, 20, 22 или 24;

(2) нуклеотидной последовательности SEQ ID NO: 17, 19, 21 или 23; и

(3) вырожденного варианта нуклеотидной последовательности SEQ ID NO: 17, 19, 21 или 23.

В некоторых других вариантах осуществления настоящее изобретение относится к двойной антигенной конструкции, кодирующей иммуногенный полипептид MUC1 и иммуногенный полипептид TERT, который содержит нуклеотидную последовательность, выбранную из группы, состоящей из:

(1) нуклеотидной последовательности, кодирующей аминокислотную последовательность SEQ ID NO: 26, 28, 30, 32 или 34;

(2) нуклеотидной последовательности SEQ ID NO: 25, 27, 29, 31 или 33; и

(3) вырожденного варианта нуклеотидной последовательности SEQ ID NO: 25, 27, 29, 31 или 33.

В некоторых других вариантах осуществления настоящее изобретение относится к двойной антигенной конструкции, кодирующей иммуногенный полипептид MSLN и иммуногенный полипептид TERT, который содержит нуклеотидную последовательность, выбранную из группы, состоящей из:

(1) нуклеотидной последовательности, кодирующей аминокислотную последовательность SEQ ID NO: 36, 38, 40 или 42;

(2) нуклеотидной последовательности SEQ ID NO: 35, 37, 39 или 41; и

(3) вырожденного варианта нуклеотидной последовательности SEQ ID NO: 35, 37, 39 или 41.

В некоторых других вариантах осуществления настоящее изобретение относится к тройной антигенной конструкции, кодирующей иммуногенный полипептид MUC1, иммуногенный полипептид MSLN и иммуногенный полипептид TERT, который содержит нуклеотидную последовательность, выбранную из группы, состоящей из:

(1) нуклеотидной последовательности, кодирующей аминокислотную последовательность SEQ ID NO: 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64 или 66;

(2) нуклеотидной последовательности SEQ ID NO: 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 или 65; и

(3) вырожденного варианта нуклеотидной последовательности SEQ ID NO: 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 или 65.

D. Векторы, содержащие молекулу нуклеиновой кислоты, кодирующую иммуногенный полипептид TAA

В другом аспекте изобретение относится к векторам, содержащим одну или несколько любых молекул нуклеиновых кислот по настоящему изобретению, включая моноантигенные конструкции, двойные антигенные конструкции, тройные антигенные конструкции и другие мультиантигенные конструкции. Векторы могут использоваться для клонирования или экспрессии иммуногенных полипептидов TAA, кодируемых молекулами нуклеиновых кислот, или для доставки молекул нуклеиновых кислот в композиции, такой как вакцина, в клетку-хозяин или в хозяин, которым является животное, например человек. В некоторых конкретных вариантах осуществления вектор содержит тройную антигенную конструкцию, кодирующую иммуногенный полипептид MUC1, иммуногенный полипептид MSLN и иммуногенный полипептид TERT, где тройная антигенная конструкция содержит нуклеотидную последовательность, выбранную из группы, состоящей из:

(1) нуклеотидной последовательности, кодирующей аминокислотную последовательность SEQ ID NO: 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64 или 66;

(2) нуклеотидной последовательности SEQ ID NO: 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 или 65; и

(3) вырожденного варианта нуклеотидной последовательности SEQ ID NO: 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 или 65.

Большое разнообразие векторов может быть получено и содержать и экспрессировать молекулу нуклеиновой кислоты по изобретению, например плазмидные векторы, космидные векторы, фаговые векторы и вирусные векторы.

В некоторых вариантах осуществления изобретение относится к вектору на основе плазмиды, содержащему молекулу нуклеиновой кислоты по изобретению. Примеры подходящих плазмидных векторов включают pBR325, pUC18, pSKF, pET23D и pGB-2. Другие примеры плазмидных векторов, а также способ конструирования таких векторов описаны в патентах США 5580859, 5589466, 5688688, 5814482 и 5580859.

В других вариантах осуществления настоящее изобретение относится к векторам, которые сконструированы из вирусов, таких как ретровирусы, альфавирусы и аденовирусы. Примеры ретровирусных векторов описаны в патентах США №№ 5219740, 5716613, 5851529, 5591624, 5716826, 5716832 и 5817491. Типичные примеры векторов, которые могут быть получены из альфавирусов, описаны в патентах США №№ 5091309 и 5217879, 5843723 и 5789245.

В некоторых конкретных вариантах осуществления настоящее изобретение относится к аденовирусным векторам, полученным из аденовирусов приматов, отличных от человека, таких как аденовирусы обезьяны. Примеры таких аденовирусных векторов, а также их получение, описаны в публикациях заявок PCT WO 2005/071093 и WO 2010/086189 и включают в себя нереплицирующие векторы, сконструированные из аденовирусов обезьян, таких как ChAd3, ChAd4, ChAd5, ChAd7, ChAd8, ChAd9, ChAd10, ChAd11, ChAd16, ChAd17, ChAd19, ChAd20, ChAd22, ChAd24, ChAd26, ChAd30, ChAd31, ChAd37, ChAd38, ChAd44, ChAd63, ChAd68, ChAd82, ChAd55, ChAd73, ChAd83, ChAd146, ChAd147, PanAd1, Pan Ad2 и Pan Ad3, и грамотрицательные векторы, сконструированные из аденовирусов Ad4 или Ad7 обезьян. Предпочтительно, при конструировании аденовирусных векторов из аденовирусов обезьян один или несколько ранних генов геномной области вируса, выбранных из E1A, E1B, E2A, E2B, E3 и E4, были либо удалены, либо оказались нефункциональными за счет делеции или мутации. В конкретном варианте осуществления вектор сконструирован из ChAd3 или ChAd68. Подходящие векторы также могут быть получены из других вирусов, таких как: (1) вирусы оспы, такие как вирус оспы канареек или вирус осповакцины (Fisher-Hoch et al., PNAS 86: 317-321, 1989; Flexner et al., Ann. N.Y. Acad. Sci. 569:86-103, 1989; Flexner et al., Vaccine 8:17-21, 1990; патенты США №№ 4603112, 4769330 и 5017487; WO 89/01973); (2) SV40 (Mulligan et al., Nature 277:108-114, 1979); (3) герпес (Kit, Adv. Exp. Med. Biol. 215: 219-236, 1989; патент США № № 5288641); и (4) лентивирус, такой как ВИЧ (Poznansky, J. Virol. 65: 532-536, 1991).

Способы конструирования векторов хорошо известны в данной области. Векторы экспрессии обычно включают один или несколько контрольных элементов, которые функционально связаны с экспрессируемой последовательностью нуклеиновой кислоты. Термин «контрольные элементы» относится в совокупности к промоторным областям, сигналам полиаденилирования, последовательностям терминации транскрипции, регуляторным доменам, расположенным в направлении 3'-5', точкам начала репликации, участкам внутренней посадки рибосомы («IRES»), энхансерам и тому подобное, которые в совокупности обеспечивают репликацию, транскрипцию и трансляцию кодирующей последовательности в клетке-реципиенте. Если выбранная кодирующая последовательность способна реплицироваться, транскрибироваться и транслироваться в соответствующей клетке-хозяине, то не все из этих контрольных элементов должны всегда присутствовать. Контрольные элементы выбирают на основе ряда факторов, известных специалистам в данной области, таких как конкретные клетки-хозяева и источник или структуры других векторных компонентов. Для усиления экспрессии иммуногенного полипептида TAA в направлении 3'-5' от последовательности, кодирующей иммуногенный полипептид TAA, может присутствовать последовательность Козака. Для позвоночных известная последовательность Козака представляет собой (GCC)NCCATGG, где N является A или G, а GCC менее консервативна. Примеры последовательностей Козака, которые могут быть использованы, включают GAACATGG, ACCAUGG и ACCATGG.

E. Композиции, содержащие иммуногенный полипептид TAA (полипептидные композиции)

В еще одном аспекте настоящее изобретение относится к полипептидным композициям, которые содержат один или несколько выделенных иммуногенных полипептидов TAA по настоящему изобретению («полипептидная композиция»). В некоторых вариантах осуществления полипептидная композиция представляет собой иммуногенную композицию, которая может использоваться для индукции иммунного ответа против белка ТАА у млекопитающего, такого как мышь, собака, приматы, не относящиеся к человеку, или человек. В некоторых других вариантах осуществления полипептидная композиция представляет собой фармацевтическую композицию для введения человеку. В еще других вариантах осуществления полипептидная композиция представляет собой вакцинную композицию, подходящую для иммунизации млекопитающего, такого как человек, для ингибирования патологической клеточной пролиферации, для защиты от развития рака (используется в качестве профилактической вакцины) или для лечения расстройств (используется в качестве терапевтической вакцины), связанных со сверхэкспрессией ТАА, например рака.

Полипептидная композиция по настоящему изобретению может содержать иммуногенный полипептид TAA одного типа, такой как иммуногенный полипептид MSLN, иммуногенный полипептид MUC1 или иммуногенный полипептид TERT. Композиция также может содержать комбинацию двух или более различных типов иммуногенных полипептидов ТАА. Например, полипептидная композиция может содержать иммуногенные полипептиды TAA в любой из следующих комбинаций:

1) иммуногенный полипептид MSLN и иммуногенный полипептид MUC1;

2) иммуногенный полипептид MSLN и полипептид TERT; или

3) иммуногенный полипептид MSLN, иммуногенный полипептид MUC1 и полипептид TERT.

В некоторых вариантах осуществления полипептидная композиция по настоящему изобретению, например иммуногенная композиция, фармацевтическая композиция или вакцинная композиция, дополнительно содержит фармацевтически приемлемое вспомогательное вещество. Фармацевтически приемлемые вспомогательные вещества, подходящие для иммуногенных, фармацевтических или вакцинных композиций, известны в данной области. Примеры подходящих вспомогательных веществ, которые могут быть использованы в композициях, включают биосовместимые масла, такие как масло из рапсового масла, подсолнечное масло, арахисовое масло, масло семян хлопчатника, масло жожоба, сквалан, сквален, физиологический солевой раствор, консерванты и средства для контроля осмотического давления, газ-носители, агенты, регулирующие рН, органические растворители, гидрофобные агенты, ингибиторы ферментов, водопоглощающие полимеры, поверхностно-активные вещества, стимуляторы абсорбции, модификаторы рН и антиоксидантные агенты.

Иммуногенный полипептид TAA в композиции, в частности иммуногенной композиции или вакцинной композиции, может быть связан, конъюгирован или иным образом включен в носитель для введения реципиенту. Термин «носитель» относится к веществу или структуре, к которой иммуногенный полипептид может быть присоединен или с которой он может быть иным образом связан для доставки иммуногенного полипептида реципиенту (например, пациенту). Носитель сам может быть иммуногенным. Примеры носителей включают иммуногенные полипептиды, иммунные CpG-островки, гемоцианин лимфы улитки (KLH), столбнячный токсоид (TT), субъединицу В холерного токсина (CTB), бактерию или бактериальные "тени", липосому, хитосому, виросомы, микросферы, дендритные клетки или тому подобное. Одна или несколько иммуногенных молекул полипептида ТАА могут быть связаны с одной молекулой-носителем. Способы связывания иммуногенного полипептида с носителем известны в данной области.

Вакцинную композицию или иммуногенную композицию по настоящему изобретению можно использовать в сочетании или в комбинации с одним или несколькими иммуномодуляторами или адъювантами. Иммуномодуляторы или адъюванты могут быть получены независимо от вакцинной композиции или иммуногенной композиции или они могут быть частью одного и того же состава композиции. Таким образом, в некоторых вариантах осуществления настоящее изобретение относится к вакцинной композиции, которая дополнительно содержит один или несколько иммуномодуляторов или адъювантов. Примеры иммуномодуляторов и адъювантов приведены ниже.

Полипептидные композиции, включая иммуногенные и вакцинные композиции, могут быть получены в любых подходящих дозированных формах, таких как жидкие формы (например, растворы, суспензии или эмульсии) и твердые формы (например, капсулы, таблетки или порошок) и способами, известными специалистам в данной области.

F. Композиции, содержащие иммуногенную молекулу нуклеиновой кислоты TAA (композиции нуклеиновых кислот)

Настоящее изобретение также относится к композициям нуклеиновых кислот, которые содержат выделенную молекулу нуклеиновой кислоты или вектор по настоящему изобретению («композиция нуклеиновой кислоты»). Композиции нуклеиновых кислот могут использоваться для индукции иммунного ответа против белка ТАА in vitro или in vivo у млекопитающего, включая человека. В некоторых вариантах осуществления композиции нуклеиновых кислот представляют собой иммуногенные композиции или фармацевтические композиции.

В некоторых конкретных вариантах осуществления композиция нуклеиновой кислоты представляет собой ДНК-вакцинную композицию для введения человеку для (1) ингибирования патологической пролиферации клеток, обеспечивая защиту от развития рака (используется в качестве профилактического средства), (2) лечения рака (используется в качестве терапевтического средства), связанного со сверхэкспрессией TAA, или (3) индукции иммунного ответа против конкретного TAA человека, например MSLN, MUC1 или TERT. Молекула нуклеиновой кислоты в композиции может быть «голой» молекулой нуклеиновой кислоты, то есть просто в форме выделенной ДНК, свободной от элементов, которые способствуют трансфекции или экспрессии. Альтернативно, молекулу нуклеиновой кислоты в композиции вводят в вектор, такой как плазмидный вектор или вирусный вектор.

Композиция нуклеиновой кислоты по настоящему изобретению может содержать отдельные выделенные молекулы нуклеиновой кислоты, каждая из которых кодирует только один тип иммуногенного полипептида TAA, такой как иммуногенный полипептид MSLN, иммуногенный полипептид MUC1 или иммуногенный полипептид TERT.

Композиция нуклеиновой кислоты может содержать мультиантигенную конструкцию, которая кодирует два или более типов иммуногенных полипептидов TAA. Например, мультиантигенная конструкция может кодировать два или более иммуногенных полипептида TAA в любой из следующих комбинаций:

(1) иммуногенный полипептид MSLN и иммуногенный полипептид MUC1;

(2) иммуногенный полипептид MSLN и иммуногенный полипептид TERT;

(3) иммуногенный полипептид MUC1 и иммуногенный полипептид TERT; и

(4) иммуногенный полипептид MSLN, иммуногенный полипептид MUC1 и иммуногенный полипептид TERT.

В некоторых конкретных вариантах осуществления композиции по настоящему изобретению содержат двойную антигенную конструкцию, содержащую нуклеотидную последовательность, выбранную из группы, состоящей из:

(1) нуклеотидной последовательности, кодирующей аминокислотную последовательность SEQ ID NO: 18, 20, 22 или 24, 26, 28, 30, 32 или 34, 36, 38, 30, 40 или 42;

(2) нуклеотидной последовательности SEQ ID NO: 17, 19, 21 или 23, 25, 27, 29, 31 или 33, 35, 37, 39 или 41; и

(3) вырожденного варианта нуклеотидной последовательности SEQ ID NO: 17, 19, 21 или 23, 25, 27, 29, 31 или 33, 35, 37, 39 или 41.

В некоторых других конкретных вариантах осуществления композиции по настоящему изобретению содержат тройную антигенную конструкцию, содержащую нуклеотидную последовательность, выбранную из группы, состоящей из:

(1) нуклеотидной последовательности, кодирующей аминокислотную последовательность SEQ ID NO: 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64 или 66;

(2) нуклеотидной последовательности SEQ ID NO: 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 или 65; и

(3) вырожденного варианта нуклеотидной последовательности SEQ ID NO: 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 или 65.

Композиции нуклеиновых кислот, такие как фармацевтическая композиция или ДНК-вакцинная композиция, могут дополнительно содержать фармацевтически приемлемое вспомогательное вещество. Фармацевтические приемлемые вспомогательные вещества, подходящие для композиций нуклеиновых кислот, в том числе для ДНК-вакцинных композиций, хорошо известны специалистам в данной области. Такими вспомогательными веществами могут быть водные или неводные растворы, суспензии и эмульсии. Примеры неводных вспомогательных веществ включают пропиленгликоль, полиэтиленгликоль, растительные масла, такие как оливковое масло, и органические сложные эфиры для инъекций, такие как этилолеат. Примеры водного вспомогательного вещества включают воду, спиртовые/водные растворы, эмульсии или суспензии, включая физиологический раствор и буферную среду. Подходящие вспомогательные вещества также включают вещества, которые способствуют клеточному захвату молекулы полинуклеотида. Примеры таких агентов являются (i) химические вещества, которые изменяют проницаемость клеточной стенки, такие как бупивакаин, (ii) липосомы или вирусные частицы для инкапсуляции полинуклеотида или (iii) катионные липиды или диоксид кремния, золото или микрочастицы вольфрама, которые сами связываются с полинуклеотидами. Анионные и нейтральные липосомы хорошо известны в данной области (см., например, Liposomes: A Practical Approach, RPC New Ed, IRL press (1990), где подробно описаны способы создания липосом) и их можно использовать для доставки большого числа продуктов, включая полинуклеотиды. Катионные липиды также известны в данной области и их обычно использую для доставки генов. Такие липиды включают липофектин.ТМ., также известный как DOTMA (N-[I-(2,3-диолеилокси)пропил N,N, N-триметиламмония хлорид), DOTAP (1,2-бис(олеилокси)-3 (триметиламмонио)пропан), DDAB (диметилдиоктадецил-аммоний бромид), DOGS (диоктадециламидоглицил спермин) и производные холестерина, такие как DCChol (3-бета-(N-(N',N'-диметил аминометан)карбамоил) холестерин). Описание этих катионных липидов можно найти в ЕР 187702, WO 90/11092, патенте США № 5283185, WO 91/15501, WO 95/26356 и патенте США № 5527928. Конкретным эффективным составом катионного липида, который может использоваться вместе с нуклеиновой вакциной по настоящему изобретению, является VAXFECTIN, который представляет собой смесь катионного липида (GAP-DMORIE) и нейтрального фосфолипида (DPyPE), который при объединении в водном носителе, самостоятельно собирается с образованием липосом. Катионные липиды для доставки генов предпочтительно используют в сочетании с нейтральным липидом, таким как DOPE (диолеил фосфатидилэтаноламин), как описано в WO 90/11092 в качестве примера. Кроме того, конструкцию нуклеиновой кислоты, такую как конструкция ДНК, также можно получить вместе с неионным блок-сополимером, таким как CRL1005.

Вакцинную композицию нуклеиновой кислоты или иммуногенную композицию нуклеиновой кислоты по настоящему изобретению можно использовать в сочетании или в комбинации с одним или несколькими иммуномодуляторами. Вакцинную композицию нуклеиновой кислоты или иммуногенную композицию нуклеиновой кислоты по настоящему изобретению также можно использовать в сочетании или в комбинации с одним или несколькими адъювантами. Кроме того, вакцинную композицию нуклеиновой кислоты или иммуногенную композицию нуклеиновой кислоты по настоящему изобретению можно использовать в сочетании или в комбинации с одним или несколькими иммуномодуляторами и одним или несколькими адъювантами. Иммуномодуляторы или адъюванты могут быть введены в состав независимо от нуклеиновой композиции или они могут быть частью того же состава композиции. Таким образом, в некоторых вариантах осуществления настоящее изобретение относится к вакцинной композиции нуклеиновой кислоты, которая дополнительно содержит один или несколько иммуномодуляторов и/или один или несколько адъювантов. Примеры иммуномодуляторов и адъювантов приведены ниже.

Композиции нуклеиновых кислот, включая вакцинные композиции, могут быть получены в любых подходящих дозированных формах, таких как жидкие формы (например, растворы, суспензии или эмульсии) и твердые формы (например, капсулы, таблетки или порошок) и способами, известными специалистам в данной области.

G. Применение иммуногенных полипептидов TAA, молекул нуклеиновых кислот и композиций

В других аспектах настоящее изобретение относится к способам использования иммуногенных полипептидов TAA, выделенных молекул нуклеиновой кислоты и композиций, описанных выше.

В одном из аспектов настоящее изобретение относится к способу индукции иммунного ответа против ТАА у млекопитающего, в частности у человека, включающему введение млекопитающему эффективного количества (1) иммуногенного полипептида TAA, который является иммуногенным против мишеневого ТАА, (2) выделенной молекулы нуклеиновой кислоты, кодирующей один или несколько иммуногенных полипептидов TAA, (3) композиции, содержащей один или несколько иммуногенных полипептидов TAA, или (4) композиции, содержащей выделенную молекулу нуклеиновой кислоты, кодирующую один или несколько иммуногенных полипептидов TAA. В некоторых вариантах осуществления настоящее изобретение относится к способу индукции иммунного ответа против MSLN у человека, включающему введение человеку эффективного количества иммуногенной композиции MSLN по настоящему изобретению, где иммуногенная композиция MSLN выбрана из: (1) иммуногенного полипептида MSLN, (2) выделенной молекулы нуклеиновой кислоты, кодирующей иммуногенный полипептид MSLN, (3) композиции, содержащей иммуногенный полипептид MSLN, или (4) композиции, содержащей выделенную молекулу нуклеиновой кислоты, кодирующую иммуногенный полипептид MSLN. В некоторых других вариантах осуществления изобретение относится к способу индукции иммунного ответа против MUC1 у человека, включающему введение человеку эффективного количества иммуногенной композиции MUC1 по настоящему изобретению, где иммуногенная композиция MUC1 выбрана из: (1) иммуногенного полипептида MUC1, (2) выделенной молекулы нуклеиновой кислоты, кодирующей иммуногенный полипептид MUC1, (3) композиции, содержащей иммуногенный полипептид MUC1, или (4) композиции, содержащей выделенную молекулу нуклеиновой кислоты, кодирующую иммуногенный полипептид MUC1. В некоторых вариантах осуществления настоящее изобретение относится к способу индукции иммунного ответа против TERT у человека, включающему введение человеку эффективного количества иммуногенной композиции TERT по настоящему изобретению, где иммуногенная композиция TERT выбрана из: (1) иммуногенного полипептида TERT, (2) выделенной молекулы нуклеиновой кислоты, кодирующей иммуногенный полипептид TERT, (3) композиции, содержащей иммуногенный полипептид TERT, или (4) композиции, содержащей выделенную молекулу нуклеиновой кислоты, кодирующую иммуногенный полипептид TERT.

В другом аспекте настоящее изобретение относится к способу ингибирования патологической пролиферации клеток у человека, где патологическая пролиферация клеток связана со сверхэкспрессией ТАА. Способ включает введение человеку эффективного количества иммуногенной композиции ТАА по настоящему изобретению, которая является иммуногенной против сверхэкспрессированного ТАА. Композиция иммуногенного ТАА может быть (1) иммуногенным полипептидом TAA, (2) выделенной молекулой нуклеиновой кислоты, кодирующей один или несколько иммуногенных полипептидов TAA, (3) композицией, содержащую иммуногенный полипептид TAA, или (4) композицией, содержащую выделенную нуклеиновую кислоту, кодирующую один или несколько иммуногенных полипептидов TAA. Патологическая пролиферация клеток может быть в любом органе или тканях человека, таких как грудь, желудок, яичники, легкие, мочевой пузырь, толстый кишечник (например, толстая кишка и прямая кишка), почки, поджелудочная железа и простата. В некоторых вариантах осуществления способ предназначен для ингибирования патологической пролиферации клеток в молочной железе, яичниках, поджелудочной железе, толстой кишке, легком, желудке и прямой кишке.

В другом аспекте настоящее изобретение относится к способу лечения рака у человека, где рак связан со сверхэкспрессией ТАА. Способ включает введение человеку эффективного количества композиции иммуногенного ТАА, способной вызывать иммунный ответ против сверхэкспрессированного ТАА. Композиция иммуногенного ТАА может быть (1) иммуногенным полипептидом TAA, (2) выделенной молекулой нуклеиновой кислоты, кодирующей один или несколько иммуногенных полипептидов TAA, (3) композицией, содержащую иммуногенный полипептид TAA, или (4) композицией, содержащую выделенную нуклеиновую кислоту, кодирующую один или несколько иммуногенных полипептидов TAA.

В некоторых вариантах осуществления настоящее изобретение относится к способу лечения рака у человека, включающему введение человеку эффективного количества композиции нуклеиновой кислоты, представленной выше. Нуклеиновые кислоты в композиции могут быть моноантигенной конструкцией, кодирующей только один конкретный иммуногенный полипептид TAA, такой как иммуногенный полипептид MSLN, иммуногенный полипептид MUC1 или иммуногенный полипептид TERT. Нуклеиновые кислоты в композиции также могут быть мультиантигенной конструкцией, кодирующей два, три или более различных иммуногенных полипептида TAA.

В некоторых конкретных вариантах осуществления изобретение относится к способу лечения рака у человека, включающему введение человеку эффективного количества композиции, содержащей двойную антигенную конструкцию. Двойная антигенная конструкция может кодировать любые два различных иммуногенных полипептида TAA, выбранных из: (1) иммуногенного полипептида MSLN и иммуногенного полипептида MUC1; (2) иммуногенного полипептида MSLN и иммуногенного полипептида TERT; (3) иммуногенного полипептида TERT и иммуногенного полипептида MUC1.

В некоторых других конкретных вариантах осуществления изобретение относится к способу лечения рака у человека, где рак связан со сверхэкспрессией одного или нескольких ТАА, выбранных из MUC1, MSLN и TERT, где способ включает введение человеку эффективного количества композиции, содержащей тройную антигенную конструкцию, кодирующую иммуногенный полипептид MSLN, иммуногенный полипептид MUC1 и иммуногенный полипептид TERT.

Любой рак со сверхэкспрессией опухолевого антигена MUC1, MSLN и/или TERT можно лечить способом по настоящему изобретению. Примеры рака включают рак молочной железы, рак яичников, рак легкого (например, мелкоклеточный рак легкого и немелкоклеточный рак легких), колоректальный рак, рак желудка и рак поджелудочной железы. В некоторых конкретных вариантах осуществления настоящее изобретение относится к способу лечения рака у человека, который включает введение человеку эффективного количества композиции, содержащей тройную антигенную конструкцию, где рак представляет собой (1) рак молочной железы, такой как тройной негативный рак молочной железы, (2) рак поджелудочной железы, такой как аденокарцинома поджелудочной железы или (3) рак яичников, такой как аденокарцинома яичника.

Композиции полипептидов и нуклеиновых кислот можно вводить животному, включая человека, рядом подходящих способов, известных в данной области. Примеры подходящих способов включают: (1) внутримышечное, внутрикожное, внутриэпидермальное или подкожное введение, (2) пероральное введение и (3) местное применение (например, введение в глаза, интраназальное и внутривагинальное применение). Один из конкретных способов внутрикожного или внутриэпидермального введения вакцинной композиции нуклеиновой кислоты, которая может быть использована, представляет собой доставку с помощью генной пушки, используя устройство для эпидермальной доставки, опосредованной частицами (PMEDTM), для доставки вакцины, коммерчески доступное от PowderMed. PMED является безыгольный способ введения вакцин животным или людям. Система PMED включает осаждение ДНК на микроскопические частицы золота, которые затем выталкиваются газом гелия в эпидермис. Частицы золота, покрытые ДНК, доставляются в APC и кератиноциты эпидермиса, и после того, как они попадают в ядро этих клеток ДНК элюируются с золота и становится транскрипционно-активным, продуцируя кодированный белок. Одним из конкретных способов внутримышечного введения вакцины нуклеиновой кислотой является электропорация. Электропорация использует контролируемые электрические импульсы для создания временных пор в клеточной мембране, что облегчает клеточный захват вакцины нуклеиновой кислоты, вводимой в мышцу. Если в комбинации с вакциной на основе нуклеиновой кислоты используется CpG, то CpG и вакцина на основе нуклеиновой кислоты могут быть включены вместе в один состав, и состав вводят внутримышечно электропорацией.

Эффективное количество иммуногенного полипептида TAA или нуклеиновой кислоты, кодирующей иммуногенный полипептид TAA в вводимой композиции в этом способе по настоящему изобретению, может быть легко определено специалистом в данной области и будет зависеть от ряда факторов. В способе лечения рака, такого как рак поджелудочной железы, рак яичников и рак молочной железы, факторы, которые могут быть учтены при определении эффективного количества иммуногенного полипептида TAAP или нуклеиновой кислоты, включают, но не ограничиваются: (1) субъекта, получающего лечение, (2) тяжесть или стадию рака, подлежащего лечению, (3) используемые или экспрессируемые специфические иммуногенные полипептиды TAA, (4) степень желаемой защиты или лечения (5) путь и схему введения и (6) другие используемые терапевтические агенты (такие как адъюванты или иммуномодуляторы). В случае вакцинных композиций на основе нуклеиновых кислот, включая мультиантигенную вакцинную композицию, способ их составления и доставки является одним из ключевых факторов для определения дозы нуклеиновой кислоты, необходимой для индукции эффективного иммунного ответа. Например, эффективные количества нуклеиновой кислоты могут находиться в диапазоне от 2 мкг/доза до 10 мг/доза, если композиция вакцины нуклеиновой кислоты составлена в виде водного раствора и вводится инъекцией иглой для подкожных инъекций или пневматической инъекцией, при этом если нуклеиновую кислоту получают в виде золотых бусин с покрытием и вводят с помощью технологии генной пушки, то может потребоваться от 16 нг/доза до 16 мкг/доза. Диапазон доз для вакцины на основе нуклеиновой кислоты, вводимой электропорацией, обычно составляет от 0,5 до 10 мг/доза. В случае, если вакцину на основе нуклеиновой кислоты вводят вместе с CpG путем электропорации в одном составе, то доза вакцины на основе нуклеиновой кислоты может находиться в диапазоне от 0,5 до 5 мг/доза, а доза CpG обычно находится в диапазоне от 0,05 мг до 5 мг/доза, например 0,05, 0,2, 0,6 или 1,2 мг/доза на персону.

Композиции вакцин на основе нуклеиновых кислот или полипептидов по настоящему изобретению могут быть использованы в стратегии праймирование-стимулирование для индукции стабильного и долговременного иммунного ответа. Протоколы праймирования и стимулирования вакцинации, основанные на повторных инъекциях одной и той же иммуногенной конструкцией, хорошо известны. В общем, первая доза может не вызывать защитный иммунитет, а только «праймировать/сенсибилизровать» иммунную систему. Защитная иммунная реакция развивается после второй или третьей дозы («стимулирующие»). Стимулирование выполняют в соответствии с общепринятыми методиками и они могут быть дополнительно оптимизированы эмпирически с учетом графика введения, пути введения, выбора адъюванта, дозы и возможные последствия при введении другой вакцины. В одном из вариантов осуществления изобретения вакцины на основе нуклеиновой кислоты или полипептидов по настоящему изобретению используются в обычной гомологичной стратегии праймирования-стимулирования, при которой одна и та же вакцина вводится животному в нескольких дозах. В другом варианте осуществления вакцинные композиции на основе нуклеиновых кислот или полипептидов используют при гетерологичной вакцинации по типу праймирования-стимулирования, в которой различные типы вакцин, содержащие одни и те же антигены, вводят с заранее определенными временными интервалами. Например, конструкцию нуклеиновой кислоты можно вводить в виде плазмиды в начальной дозе («праймирование») и как часть вектора в последующих дозах («стимулирование») или наоборот.

Вакцинные композиции на основе полипептидов или нуклеиновых кислот по настоящему изобретению можно использовать вместе с одним или несколькими адъювантами. Примеры подходящих адъювантов включают: (1) эмульсионные составы "масло-в-воде" (с или без других специфических иммуностимулирующих агентов, таких как мурамиловые полипептиды или компоненты бактериальной клеточной стенки), такие как (а) MF59™ (публикация PCT WO 90/14837; Глава 10 в Vaccine design: the subunit and adjuvant approach, eds. Powell & Newman, Plenum Press, 1995), содержащая 5% сквален, 0,5% Tween 80 (полиоксиэтилен сорбит моноолеат) и 0,5% Span 85 (сорбитан триолеат), составленный в субмикронные частицы с использованием микрофлюидизатора, (b) SAF, содержащий 10% сквалена, 0,4% Tween 80, 5% плюрнового-блокированного полимера L121 и thr-MDP, либо микрофлюидизированный в субмикронную эмульсию, либо перемешанный на Vortex с образованием эмульсии с частицами большего размера, и (c) адъювантная система RIBI™ (RAS) (Ribi Immunochem, Гамильтон, МТ), содержащая 2% сквален, 0,2% Tween 80 и один или несколько компонентов бактериальной клеточной стенки, таких как монофосфорилипид А (MPL), трегалоза димиколат (TDM) и скелет клеточной стенки (CWS); (2) сапониновые адъюванты, такие как QS21, STIMULON™ (Cambridge Bioscience, Worcester, MA), Abisco® (Isconova, Sweden) или Iscomatrix® (Commonwealth Serum Laboratories, Australia); (3) полный адъювант Фрейнда (CFA) и неполный адъювант Фрейнда (IFA); (4) цитокины, такие как интерлейкины (например, IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (публикация PCT WO 99/44636), и тому подобное), интерфероны (например, гамма-интерферон), макрофагальный колониестимулирующий фактор (M-CSF) и фактор некроза опухоли (TNF); (5) монофосфорил липид A (MPL) или 3-O-деацилированный MPL (3dMPL), (WO 00/56358); (6) комбинации 3dMPL с эмульсиями QS21 и/или "масло-в-воде" (EP-A-0835318, EP-A-0735898, EP-A-0761231); (7) олигонуклеотиды, содержащие мотивы CpG, то есть содержащие по меньшей мере один CG динуклеотид, где цитозин не метилирован (WO 98/40100, WO 98/55495, WO 98/37919 и WO 98/52581); (8) полиоксиэтиленовый эфир или полиоксиэтиленовый эфир (WO 99/52549); (9) поверхностно-активное вещество сложный эфир полиоксиэтиленсорбита в комбинации с октоксинолом (WO 01/21207) или полиоксиэтиленалкиловым эфиром или поверхностно-активное вещество сложного эфира в комбинации по меньшей мере с одним дополнительным неионным поверхностно-активным веществом, таким как октоксинол (WO01/21152); (10) сапонин и иммуностимулирующий олигонуклеотид (например, CpG-олигонуклеотид) (WO00/62800); (11) соль металла, включая соли алюминия (квасцы), такие как фосфат алюминия и гидроксид алюминия; (12) сапонин и эмульсия "масло-в-воде" (WO 99/11241); и; (13) комбинация сапонина (например, QS21), 3dMPL и IM2 (WO 98/57659).

Кроме того, для лечения неопластического расстройства, включая рак, у млекопитающего, можно вводить полипептидные композиции или композиции на основе нуклеиновых кислот, включая вакцинные композиции, по настоящему изобретению, вместе с одним или несколькими иммуномодуляторами. Иммуномодулятор может быть ингибитором иммунных супрессивных клеток (ингибитор ISC) или энхансером иммунных эффекторных клетоки (энхансер IEC). Кроме того, один или несколько ингибиторов ISC могут использоваться в комбинации с одним или несколькими энхансерами IEC. Иммуномодуляторы можно вводить любыми подходящими способами и путями, включая (1) системное введение, такое как внутривенное, внутримышечное или пероральное введение, и (2) местное введение, такое как внутрикожное и подкожное введение. В соответствующих или приемлемых случаях, местное применение обычно предпочтительнее системного введения. Местное применение любых иммуномодуляторов может быть осуществлено в любом месте организма млекопитающего, которое подходит для местного применения лекарственных средств; однако, более предпочтительно, эти иммуномодуляторы вводят местно в непосредственной близости от лимфоузла, дренирующего место введения вакцины.

Композиции, такие как вакцина, могут вводиться одновременно или последовательно с любым или всеми используемыми иммуномодуляторами. Аналогично, если используют два или более иммуномодулятора, их можно вводить одновременно или последовательно друг относительно друга. В некоторых вариантах осуществления вакцину вводят одновременно (например, в смеси) с одним иммуномодулятором, но последовательно с одним или несколькими дополнительным иммуномодуляторами. Совместное введение вакцины и иммуномодуляторов может включать случаи, когда вакцина и по меньшей мере один иммуномодулятор вводят таким образом, что каждый присутствует в месте введения, например, в лимфоузле, дренирующем место введения вакцины, при этом антиген и иммуномодуляторы не вводят одновременно. Одновременное введение вакцины и иммуномодуляторов также может включать случаи, когда происходит клиренс вакцины или иммунного модулятора с места введения, но по меньшей мере один клеточный эффект очищенной вакцины или иммуномодулятора сохраняется на месте введения, например, в лимофузле, дренирующем место введения вакцины, по крайней мере, до тех пор, пока один или несколько дополнительных иммуномодуляторов не будут введены в сайт введения. В тех случаях, когда вакцину на основе нуклеиновой кислоты вводят в комбинации с CpG, вакцина и CpG могут находится в одном составе и вводиться вместе любым подходящим способом. В некоторых вариантах осуществления вакцина на основе нуклеиновой кислоты и CpG в общем препарате (смеси) вводят внутримышечной инъекцией в сочетании с электропорацией.

В некоторых вариантах осуществления иммуномодулятор, который используется в комбинации с композицией на основе полипептида или нуклеиновой кислоты, является ингибитором ISC.

Примеры ингибиторов SIC включают (1) ингибиторы протеинкиназы, такие как иматиниб, сорафениб, лапатиниб, BIRB-796 и AZD-1152, AMG706, Zactima (ZD6474), MP-412, сорафениб (BAY 43-9006), дазатиниб, CEP-701 (лестауртиниб), XL647, XL999, Tykerb (лапатиниб), MLN518, (ранее известный как CT53518), PKC412, ST1571, AEE 788, OSI-930, OSI-817, сунитиниб малат (SUTENT), акситиниб (AG-013736), эрлотиниб, гефитиниб, акситиниб, босутиниб, темсиролимус и нилотиниб (AMN107). В некоторых конкретных вариантах осуществления ингибитор тирозинкиназы представляет собой сунитиниб, сорафениб или фармацевтически приемлемую соль или производное (такое как малат или тозилат) сунитиниба или сорафениба; (2) ингибиторы циклооксигеназы-2 (СОХ-2), такие как целекоксиб и рофекоксиб; (3) ингибиторы фосфодиэстеразы типа 5 (PDE5), такие как примеры ингибиторов PDE5, включают в себя: аванафил, лоденафил, мироденафил, силденафил, тадалафил, варденафил, уденафил и запринаст и (4) перекрестно-связывающие ДНК линкеры, такие как циклофосфамид.

В некоторых вариантах осуществления иммуномодулятор, который используется в комбинации с композицией на основе полипептида или нуклеиновой кислоты, является энхансером IEC. Два или более энхансера IEC могут использоваться вместе.

Примеры энхансеров IEC, которые могут быть использованы, включают: (1) агонисты TNFR, такие как агонисты OX40, 4-1BB (такие как BMS-663513), GITR (например, TRX518) и CD40 (такие как антитела-агонисты CD40); (2) ингибиторы CTLA-4, такие как ипилимумаб и тремелимумаб; (3) агонисты TLR, такие как CpG 7909 (5' TCGTCGTTTTGTCGTTTTGTCGTT3'), CpG 24555 (5' TCGTCGTTTTTCGGTGCTTTT3' (CpG 24555); и CpG 10103 (5' TCGTCGTTTTTCGGTCGTTTT3'); (4) ингибиторы белка 1 программируемой клеточной гибели (PD-1), такие как ниволумаб и пембролизумаб; и (5) ингибиторы PD-L1, такие как атезолизумаб, дурвалумаб и велумаб; и (6) ингибиторы IDO1.

В некоторых вариантах осуществления энхансер IEC является антителом-агонистом против CD40, которое может быть человеческим, гуманизированном или частично человеческим химерным антителом против CD40. Примеры конкретных антител-агонистов против CD40 включают моноклональные антитела G28-5, mAb89, EA-5 или S2C6, и CP870893. CP-870893 представляет собой полностью человеческое агонистическое моноклональное антитело против CD40 (mAb), которое было клинически исследовалось в качестве противоопухолевой терапии. Структура и получение CP870893 раскрыты в WO2003041070 (где антитело идентифицировано по внутреннему идентификатору «21.4.1», а аминокислотные последовательности тяжелой цепи и легкой цепи антитела представлены как SEQ ID NO: 40 и SEQ ID NO: 41, соответственно). Для применения в комбинации с композицией по настоящему изобретению, СР-870893 можно вводить любым подходящим путем, таким как внутрикожная, подкожная или внутримышечная инъекция. Эффективное количество CP870893 обычно находится в пределах от 0,01 до 0,25 мг/кг. В некотором варианте осуществления CP870893 вводят в количестве от 0,05 до 0,1 мг/кг.

В некоторых других вариантах осуществления энхансер IEC является ингибитором CTLA-4, таким как ипилимумаб и тремелимумаб. Ипилимумаб (также известный как MEX-010 или MDX-101), доступный на рынке как YERVOY, представляет собой человеческое антитело против CTLA-4 человека. Ипилимумаб также может упоминаться в реестре CAS под номером 477202-00-9 и описано как антитело 10DI в публикации PCT WO 01/14424. Тремелимумаб (также известный как CP-675206) является полностью человеческим моноклональным антителом IgG2 и имеет номер CAS 745013-59-6. Тремелимумаб раскрыт в патенте США № 6682736, который включен в настоящий документ в качестве ссылки в полном объеме, где он идентифицирован как антитело 11.2.1, и аминокислотные последовательности его тяжелой цепи и легкой цепи представлены как SEQ ID NO: 42 и 43, соответственно. Для применения в комбинации с композицией по настоящему изобретению, тремилимумаб можно вводить любым подходящим путем, таким как внутрикожная, подкожная или внутримышечная инъекция. Эффективное количество тремелимумаба, вводимое внутрикожно или подкожно, обычно находится в пределах от 5 до 200 мг/доза на человека. В некоторых вариантах осуществления эффективное количество тремелимумаба находится в диапазоне от 10 до 150 мг/доза на человека на дозу. В некоторых конкретных вариантах осуществления эффективное количество тремелимумаба составляет около 10, 25, 50, 75, 100, 125, 150, 175 или 200 мг/доза на человека.

В некоторых других вариантах иммунный модулятор представляет собой ингибитор PD-1 или ингибитор PD-L1, такой как ниволумаб, пембролизумаб, RN888 (антитело против PD-1), атезолизумаб (PD-L1-специфичные mAb от Roche), дурвалумаб (PD-L1-специфичные mAb от Astra Zeneca) и авелумаб (PD-L1-специфичные mAb от Merck). (Okazaki T et al., International Immunology (2007);19,7:813-824, Sunshine J et al., Curr Opin Pharmacol. 2015 август; 23:32-8).

В других вариантах осуществления настоящее описание относится к применению иммуномодулятора вместе с вакциной, включая противораковые вакцины, причем иммуномодулятор представляет собой ингибитор индолеамин 2,3-диоксигеназы 1 (также известной как «IDO1»). Было обнаружено, что IDO1 модулирует функцию иммунных клеток до супрессивного фенотипа и, как полагают, частично связан с выходом опухоли из иммунного контроля хозяина. Фермент деградирует незаменимый аминокислотный триптофан в кинуренин и другие метаболиты. Было обнаружено, что эти метаболиты и нехватка триптофана приводят к подавлению эффекторной функции Т-клеток и усиленной дифференцировке регуляторных Т-клеток. Ингибиторами IDO1 могут быть высокомолекулярные молекулы, такие как антитело, или низкомолекулярные молекулы, такие как химическое соединение.

В некоторых конкретных вариантах осуществления композиция на основе полипептида или нуклеиновой кислоты по настоящему изобретению, используется в комбинации с ингибитором на основе 1,2,5-оксадиазолового производного IDO1M, раскрытым в WO 2010/005958. Примеры специфического 1,2,5-оксадиазоловых производных в качестве ингибиторов IDO1 включают следующие соединения:

4-({2-[(аминосульфонил)амино]этил}амино)-N-(3-бром-4-фторфенил)-N'-гидрокси-1,2,5-оксадиазол-3-карбоксимидамид;

4-({2-[(аминосульфонил)амино]этил}амино)-N-(3-хлор-4-фторфенил)-N'-гидрокси-1,2,5-оксадиазол-3-карбоксимидамид;

4-({2-[(аминосульфонил)амино]этил}амино)-N-[4-фтор-3-трифторметил)фенил]-N'-гидрокси-1,2,5-оксадиазол-3-карбоксимидамид;

4-({2-[(аминосульфонил)амино]этил}амино)-N'-гидрокси-N-[3-(трифторметил)фенил]-1,2,5-оксадиазол-3-карбоксимидамид;

4-({2-[(аминосульфонил)амино]этил}амино)-N-(3-циано-4-фторфенил)-N'-гидрокси-1,2,5-оксадиазол-3-карбоксимидамид;

4-({2-[(аминосульфонил)амино]этил}амино)-N-[(4-бром-2-фурил)метил]-N'-гидрокси-1,2,5-оксадиазол-3-карбоксимидамид; или

4-({2-[(аминосульфонил)амино]этил}амино)-N-[(4-хлор-2-фурил)метил]-N'-гидрокси-1,2,5-оксадиазол-3-карбоксимидамид.

1,2,5-оксадиазоловые производные в качестве ингибиторов IDO1 обычно вводят перорально один или два раза в день, и эффективное количество при пероральном введении составляет обычно 25 мг-1000 мг на дозу на пациента, например 25 мг, 50 мг, 100 мг, 200 мг, 300 мг, 400 мг, 500 мг, 600 мг, 700 мг, 800 мг или 1000 мг. В конкретном варианте осуществления композиция на основе полипептида или нуклеиновой кислоты по настоящему изобретению используется в комбинации с 4-({2-[(аминосульфонил)амино]этил}амино)-N-(3-бром-4-фторфенил)-N'-гидрокси-1,2,5-оксадиазол-3-карбоксимидамидом, вводимым перорально дважды в день при 25 мг или 50 мг на дозу. 1,2,5-оксадиазольные производные могут быть синтезированы, как описано в патенте США № 8088803, который полностью включен в настоящее описание в качестве ссылки.

В некоторых других конкретных вариантах осуществления композиция на основе полипептида или нуклеиновой кислоты по настоящему изобретению, используется в комбинации с ингибитором IDO1M на основе пирролидин-2,5-дионового производного, описанного в WO2015/173764. Примеры конкретных ингибиторов на основе пирролидин-2,5-дионлового производного включают следующие соединения:

3-(5-фтор-1Н-индол-3-ил)пирролидин-2,5-дион;

(3-2Н)-3-(5-фтор-1Н-индол-3-ил)пирролидин-2,5-дион;

(-)-(R)-3-(5-фтор-1Н-индол-3-ил)пирролидин-2,5-дион;

3-(1H-индол-3-ил)пирролидин-2,5-дион;

(-)-(R)-3-(1H-индол-3-ил)пирролидин-2,5-дион;

3-(5-хлор-1Н-индол-3-ил)пирролидин-2,5-дион;

(-)-(R)-3-(5-хлор-1H-индол-3-ил)пирролидин-2,5-дион;

3-(5-бром-1H-индол-3-ил)пирролидин-2,5-дион;

3-(5,6-дифтор-1Н-индол-3-ил)пирролидин-2,5-дион; и

3-(6-хлор-1Н-индол-3-ил)пирролидин-2,5-дион.

Ингибиторы IOD1 на основе пирролидин-2,5-дионового производного обычно вводят перорально один или два раза в день, и эффективное количество при пероральном введении обычно составляет от 50 до 1000 мг на дозу на пациента, например 125 мг, 250 мг, 500 мг, 750 мг или 1000 мг. В конкретном варианте осуществления, композиция на основе полипептида или нуклеиновой кислоты по настоящему изобретению используется в комбинации с 3-(5-фтор-1Н-индол-3-ил)пирролидин-2,5-дионом, вводимым перорально один раз в день при 125-100 мг на дозу на пациента. Пирролидин-2,5-дионовые производные могут быть синтезированы, как описано в публикации патентной заявки США US2015329525, которая включена в настоящий документ в качестве ссылки в полном объеме.

H. ПРИМЕРЫ

Следующие примеры приведены для иллюстрации некоторых вариантов осуществления изобретения. Они не должны быть истолкованы как ограничивающие объем изобретения каким-либо образом. Из приведенного выше описания и этих примеров специалист в данной области сможет определить существенные признаки изобретения и не отходить от сущности и объема изобретения, сможет внести различные изменения и модификации изобретения, чтобы адаптировать его к различным условиям использования и условиям.

ПРИМЕР 1. КОНСТРУИРОВАНИЕ МОНОАНТИГЕННЫХ, ДВОЙНЫХ АНТИГЕННЫХ И ТРОЙНЫХ АНТИГЕННЫХ КОНСТРУКЦИЙ

Пример 1 иллюстрирует построение моноантигенных конструкций, двойных антигенных конструкций и тройных антигенных конструкций. Если не указано иного, ссылка на аминокислотные положения или остатки белка MUC1, MSLN и TERT относится к аминокислотной последовательности белка-предшественника изоформы 1 MUC1 человека, как представлено в SEQ ID NO:1, аминокислотной последовательности белка-предшественника мезотелина человека изоформы 2 (MSLN), как представлено в SEQ ID NO:2, и аминокислотной последовательности белка-предшественника TERT человека изоформы 1, как представлено в SEQ ID NO:3, соответственно.

1A. МОНОАНТИГЕННЫЕ КОНСТРУКЦИИ

Плазмида 1027 (MUC1). Плазмиду 1027 получали с использованием методов генного синтеза и обмена рестрикционными фрагментами. Аминокислотную последовательность MUC1 человека с 5х тандемными повторами области VNTR подавали в GeneArt для оптимизации и синтеза генов. Ген, кодирующий полипептид, был оптимизирован для экспрессии, синтеза и клонирования. Открытую рамку считывания MUC-1 вырезали из вектора GeneArt путем расщепления NheI и BglII и встраивали в аналогично расщепленную плазмиду pPJV7563. Нуклеотидная последовательность открытой рамки (ORF) плазмиды 1027 представлена в SEQ ID NO:7. Аминокислотная последовательность, кодируемая плазмидой 1027, представлена в SEQ ID NO:8.

Плазмида 1103 (cMSLN). Плазмиду 1103 строили с использованием методов ПЦР и обмена рестрикционными фрагментами. Сначала, ген, кодирующий аминокислоты 37-597 предшественника мезотелина, амплифицировали с помощью ПЦР из плазмиды 1084 с праймерами MSLN34 и MSLN598, что приводило к добавлению сайтов рестрикции NheI и BglII на 5'- и 3'-концах ампликона, соответственно. Ампликон расщепляли NheI и Bgl II и встраивали в аналогично расщепленную плазмиду pPJV7563. Нуклеотидная последовательность открытой рамки плазмиды 1103 представлена в SEQ ID NO:5. Аминокислотная последовательность, кодируемая плазмидой 1103, представлена в SEQ ID NO:6.

Плазмида 1112 (TERT240). Плазмиду 1112 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 241-1132 белка TERT, амплифицировали с помощью ПЦР из плазмиды 1065 с праймерами а pmed TERT 241G и r TERT co# pMed. Ампликон клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой плазменной плазмы 1112 представлена в SEQ ID NO:9. Аминокислотная последовательность, кодируемая плазмидой 1112, представлена в SEQ ID NO:10.

Плазмида 1197 (цМUC1). Плазмиду 1197 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 22-225, 946-1255 белка MUC1, амплифицировали с помощью ПЦР из плазмиды 1027 с праймерами ID1197F и ID1197R. Ампликон клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1197 представлена в SEQ ID NO:15. Аминокислотная последовательность, кодируемая плазмидой 1197, представлена в SEQ ID NO:16.

Плазмида 1326 (TERT343). Плазмиду 1326 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 344-1132 белка TERT, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами Tert343-F и Tert-R. Ампликон клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой плазменной плазмы 1326 представлена в SEQ ID NO:13. Аминокислотная последовательность, кодируемая плазмидой 1326, представлена в SEQ ID NO:14.

Плазмида 1330 (TERT541). Плазмиду 1330 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 542-1132 белка TERT амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами Tert541-F и Tert-R. Ампликон клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1330 представлена в SEQ ID NO:11. Аминокислотная последовательность, кодируемая плазмидой 1330, представлена в SEQ ID NO:12.

1B. ДВОЙНЫЕ АНТИГЕННЫЕ КОНСТРУКЦИИ

Плазмида 1158 (cMSLN-PT2A-Muc1). Плазмиду 1158 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 37-597 предшественника мезотелина, амплифицировали с помощью ПЦР из плазмиды 1103 с праймерами f pmed Nhe cMSLN и r PTV2A Bamh cMSLN. Ген, кодирующий аминокислоты 2-225, 946-1255 муцина 1 человека, амплифицировали ПЦР из плазмиды 1027 с праймерами f1 PTV2A Muc, f2 PTV2A и r pmed Bgl Muc. ПЦР приводило к добавлению перекрывающихся последовательностей PTV 2A на 3'-конец cMSLN и 5'-конец Muc1. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1158 представлена в SEQ ID NO:23. Аминокислотная последовательность, кодируемая плазмидой 1158, представлена в SEQ ID NO:24.

Плазмида 1159 (Muc1-PT2A-cMSLN). Плазмиду 1159 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 37-597 предшественника мезотелина, амплифицировали с помощью ПЦР из плазмиды 1103 с праймерами f1 PTV2A cMSLN, f2 PTV2A и r pmed Bgl cMSLN. Ген, кодирующий аминокислоты 2-225, 946-1255 муцина 1 человека, амплифицировали ПЦР из плазмиды 1027 с праймерами f pmed Nhe Muc и r PTV2A Bamh Muc. ПЦР приводило к добавлению перекрывающихся последовательностей PTV 2A на 5'-конец cMSLN и 3'-конец Muc1. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1159 представлена в SEQ ID NO:21. Аминокислотная последовательность, кодируемая плазмидой 1159, представлена в SEQ ID NO:22.

Плазмида 1269 (Muc1-Ter240). Плазмиду 1269 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами f tg link Ter240 и r pmed Bgl Ter240. Ген, кодирующий аминокислоты 2-225, 946-1255 муцина 1 человека амплифицировали ПЦР из плазмиды 1027 с праймерами f pmed Nhe Muc и r link Muc. ПЦР приводило к добавлению перекрывающегося линкера GGSGG на 5'-конец Tert и 3'-конец Muc1. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1269 представлена в SEQ ID NO:25. Аминокислотная последовательность, кодируемая плазмидой 1269, представлена в SEQ ID NO:26.

Плазмида 1270 (Muc1-ERB2A-Ter240). Плазмиду 1270 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами f2 ERBV2A, f1 ERBV2A Ter240 и r pmed Bgl Ter240. Ген, кодирующий аминокислоты 2-225, 946-1255 муцина 1 человека амплифицировали ПЦР из плазмиды 1027 с праймерами f pmed Nhe Muc и r ERB2A Bamh Muc. ПЦР приводило к добавлению перекрывающихся последовательностей ERBV 2A на 5'-конец Tert и 3'-конец Muc1. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1270 представлена в SEQ ID NO:27. Аминокислотная последовательность, кодируемая плазмидой 1270, представлена в SEQ ID NO:28.

Плазмида 1271 (Ter240-ERB2A-Muc1). Плазмиду 1271 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами f pmed Nhe Ter240 и r ERB2A Bamh Ter240. Ген, кодирующий аминокислоты 2-225, 946-1255 муцина 1 человека, амплифицировали ПЦР из плазмиды 1027 с праймерами f2 ERBV2A, f1 ERBV2A Muc и r pmed Bgl Muc. ПЦР приводило к добавлению перекрывающихся последовательностей ERBV 2A на 3'-конец Tert и 5'-конец Muc1. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1271 представлена в SEQ ID NO:29. Аминокислотная последовательность, кодируемая плазмидой 1271, представлена в SEQ ID NO:30.

Плазмида 1272 (Ter240-T2A-cMSLN). Плазмиду 1272 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами f pmed Nhe Ter240 и r T2A Tert240. Ген, кодирующий аминокислоты 37-597 предшественника мезотелина амплифицировали с помощью ПЦР из плазмиды 1103 с праймерами f2 T2A, f1 T2A cMSLN, and r pmed Bgl cMSLN. ПЦР приводило к добавлению перекрывающихся последовательностей TAV 2A на 3'-конец Tert и 5'-конец cMSLN. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1272 представлена в SEQ ID NO:35. Аминокислотная последовательность, кодируемая плазмидой 1272, представлена в SEQ ID NO:36.

Плазмида 1273 (Tert240-cMSLN). Плазмиду 1273 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами f pmed Nhe Ter240 и r link Tert240. Ген, кодирующий аминокислоты 37-597 предшественника мезотелина амплифицировали с помощью ПЦР из плазмиды 1103 с праймерами f tert ink cMSLN и r pmed Bgl cMSLN. ПЦР приводило к добавлению перекрывающегося линкера GGSGG на 3'-конце Tert и 5'-конце cMSLN. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1273 представлена в SEQ ID NO:37. Аминокислотная последовательность, кодируемая плазмидой 1273, представлена в SEQ ID NO:38.

Плазмида 1274 (cMSLN-T2A-Tert240). Плазмиду 1274 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами f2 T2A, f1 T2A Tert240 и r pmed Bgl Ter240. Ген, кодирующий аминокислоты 37-597 предшественника мезотелина амплифицировали с помощью ПЦР из плазмиды 1103 с праймерами f pmed Nhe cMSLN и r T2A Bamh cMSLN. ПЦР приводило к добавлению перекрывающихся последовательностей TAV 2A на 5'-конец Tert и 3'-конец cMSLN. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1274 представлена в SEQ ID NO:39. Аминокислотная последовательность, кодируемая плазмидой 1274, представлена в SEQ ID NO:40.

Плазмида 1275 (cMSLN-Tert240). Плазмиду 1275 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами f tg link Ter240 и r pmed Bgl Ter240. Ген, кодирующий аминокислоты 37-597 предшественника мезотелина амплифицировали с помощью ПЦР из плазмиды 1103 с праймерами f pmed Nhe cMSLN и r link cMSLN. ПЦР приводило к добавлению перекрывающегося линкера GGSGG на 5'-конец Tert и 3'-конец cMSLN. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1275 представлена в SEQ ID NO:41. Аминокислотная последовательность, кодируемая плазмидой 1275, представлена в SEQ ID NO:42.

Плазмида 1286 (cMuc1-ERB2A-Tert240). Плазмиду 1286 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами f2 ERBV2A, f1 ERBV2A Ter240 и r pmed Bgl Ter240. Ген, кодирующий аминокислоты 22-225, 946-1255 муцина 1 человека амплифицировали ПЦР из плазмиды 1197 с праймерами f pmed Nhe cytMuc и r ERB2A Bamh Muc. ПЦР приводило к добавлению перекрывающихся последовательностей ERBV 2A на 5'-конец Tert и 3'-конец Muc1. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1286 представлена в SEQ ID NO:31. Аминокислотная последовательность, кодируемая плазмидой 1286, представлена в SEQ ID NO:32.

Плазмида 1287 (Tert240-ERB2A-cMuc1). Плазмиду 1287 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами f pmed Nhe Ter240 и r ERB2A Bamh Ter240. Ген, кодирующий аминокислоты 22-225, 946-1255 муцина 1 человека амплифицировали ПЦР из плазмиды 1197 с праймерами f2 ERBV2A, f1 ERBV2A Muc и r pmed Bgl Muc. ПЦР приводило к добавлению перекрывающихся последовательностей ERBV 2A на 3'-конец Tert и 5'-конец Muc1. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1287 представлена в SEQ ID NO:33. Аминокислотная последовательность, кодируемая плазмидой 1287, представлена в SEQ ID NO:34.

Плазмида 1313 (Muc1-EMC2A-cMSLN). Плазмиду 1313 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 37-597 предшественника мезотелина, амплифицировали с помощью ПЦР из плазмиды 1103 с праймерами EMCV_cMSLN_F-33, EMCV2A_F-34 и pMED_cMSLN_R-37. Ген, кодирующий аминокислоты человека Mucin-1 2-225, 946-1255, амплифицировали с помощью ПЦР из плазмиды 1027 с праймерами pMED_MUC1_F-31, EMCV2A_R-36 и EMCV_Muc1_R-35. ПЦР приводило к добавлению перекрывающихся последовательностей EMCV 2A на 5'-конец cMSLN и 3'-конец Muc1. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1313 представлена в SEQ ID NO:19. Аминокислотная последовательность, кодируемая плазмидой 1313, представлена в SEQ ID NO:20.

Плазмида 1316 (cMSLN-EMC2A-Muc1). Плазмиду 1316 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 37-597 предшественника мезотелина человека амплифицировали с помощью ПЦР из плазмиды 1103 с праймерами f pmed Nhe cMSLN и r EM2A Bamh cMSLN. Ген, кодирующий аминокислоты 2-225, 946-1255, муцина 1 человека амплифицировали ПЦР из плазмиды 1027 с праймерами f1 EM2A Muc, f2 EMCV2A, and r pmed Bgl Muc. ПЦР приводило к добавлению перекрывающихся последовательностей EMCV 2A на 3'-конец cMSLN и 5'-конец Muc1. Ампликоны смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1316 представлена в SEQ ID NO:17. Аминокислотная последовательность, кодируемая плазмидой 1316, представлена в SEQ ID NO:18.

1C. ТРОЙНЫЕ АНТИГЕННЫЕ КОНСТРУКЦИИ

Плазмида 1317 (Muc1-EMC2A-cMSLN-T2A-Tert240). Плазмиду 1317 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, гены, кодирующие аминокислоты 2-225, 946-1255 муцина-1 человека, пептид EMCV 2A и аминоконцевую половину предшественника мезотелина, амплифицировали с помощью ПЦР из плазмиды 1313 с праймерами f pmed Nhe Muc and r MSLN 1051-1033. Гены, кодирующие карбоксильную концевую часть предшественника мезотелина, пептид TAV 2A и аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1274 с праймерами f MSLN 1028-1051 и r pmed Bgl Ter240. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1317 представлена в SEQ ID NO:43. Аминокислотная последовательность, кодируемая плазмидой 1317, представлена в SEQ ID NO:44.

Плазмиду 1318 (Muc1-ERB2A-Tert240-T2A-cMSLN). Плазмиду 1318 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, гены, кодирующие аминокислоты 2-225, 946-1255 муцина-1 человека, пептид ERBV 2A и аминоконцевую половину теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1270 с праймерами f pmed Nhe Muc и r tert 1602 -1579. Гены, кодирующие карбоксильную концевую половину теломеразы, пептид TAV 2A и аминокислоты 37-597 предшественника мезотелина человека, амплифицировали ПЦР из плазмиды 1272 с праймерами f tert 1584 -1607 и r pmed Bgl cMSLN. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1318 представлена в SEQ ID NO:45. Аминокислотная последовательность, кодируемая плазмидой 1318, представлена в SEQ ID NO:46.

Плазмида 1319 (cMSLN-EMC2A-Muc1-ERB2A-Tert240). Плазмиду 1319 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, гены, кодирующие аминокислоты 37-597 предшественники мезотелина человека, пептид EMCV 2A и аминоконцевую половину муцина-1 человека, амплифицировали с помощью ПЦР из плазмиды 1316 с праймерами f pmed Nhe cMSLN и r muc 986-963. Гены, кодирующие карбоксильную концевую часть муцина 1, пептид ERBV 2A и аминокислоты 241-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1270 с праймерами f Muc 960-983 и r pmed Bgl Ter240. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1319 представлена в SEQ ID NO:47. Аминокислотная последовательность, кодируемая плазмидой 1319, представлена в SEQ ID NO:48.

Плазмида 1320 (cMSLN-T2A-Tert240-ERB2A-Muc1). Плазмиду 1320 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, гены, кодирующие аминокислоты 37-597 предшественники мезотелина человека, пептид TAV 2A и аминоконцевую половину теломеразы человека амплифицировали с помощью ПЦР из плазмиды 1274 с праймерами f pmed Nhe cMSLN и r muc 1602-1579. Гены, кодирующие карбоксиконцевую половину теломеразы, пептид ERBV 2A и аминокислоты 2-225, 946-1255 муцина-1 человека, амплифицировали с помощью ПЦР из плазмиды 1271 с праймерами f tert 1584 -1607 и r pmed Bgl Muc. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1320 представлена в SEQ ID NO:49. Аминокислотная последовательность, кодируемая плазмидой 1320, представлена в SEQ ID NO:50.

Плазмида 1321 (Tert240-T2A-cMSLN-EMC2A-Muc1). Плазмиду 1321 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминоконцевую половину теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1112 с праймерами а pmed Nhe Ter240 и r tert 1602-1579. Гены, кодирующие карбоксильную концевую половину теломеразы, пептид TAV 2A и аминоконцевую часть предшественника мезотелина человека амплифицировали ПЦР из плазмиды 1272 с праймерами f tert 1584 -1607 и r MSLN 1051-1033. Гены, кодирующие карбоксиконцевую часть предшественника мезотелина человека, пептид EMCV 2A и аминокислоты 2-225, 946-1255 муцина-1 человека, амплифицировали с помощью ПЦР из плазмиды 1316 с праймерами f MSLN 1028-1051 и r pmed Bgl Muc. Три частично перекрывающихся ампликона смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1321 представлена в SEQ ID NO:51. Аминокислотная последовательность, кодируемая плазмидой 1321, представлена в SEQ ID NO:52.

Плазмида 1322 (Tert240-ERB2A-Muc1-EMC2A-cMSLN). Плазмиду 1322 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, гены, кодирующие аминокислоты 241-1132 теломеразы человека, пептид ERBV 2A и аминоконцевую половину муцина-1 человека, амплифицировали с помощью ПЦР из плазмиды 1271 с праймерами а pmed Nhe Ter240 и r muc 986-963. Гены, кодирующие карбоксиконцевую половину муцина-1, пептид EMCV 2A и аминокислоты 37-597 предшественника мезотелина человека амплифицировали ПЦР из плазмиды 1313 с праймерами f Muc 960-983 и r pmed Bgl cMSLN. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1322 представлена в SEQ ID NO:53. Аминокислотная последовательность, кодируемая плазмидой 1322, представлена в SEQ ID NO:54.

Плазмида 1351 (Muc1-EMC2A-cMSLN-T2A-Tert541). Плазмиду 1351 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, гены, кодирующие аминокислоты 2-225, 946-1255 муцина-1 человека, пептид EMCV 2A и предшественник мезотелина человека, амплифицировали с помощью ПЦР из плазмиды 1313 с праймерами f pmed Nhe Muc and T2A Bamh cMSLN. Гены, кодирующие пептид TAV 2A и аминокислоты 541-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1330 с праймерами f1 T2A Tert d541, f2 T2A и r pmed Bgl Ter240. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1351 представлена в SEQ ID NO:55. Аминокислотная последовательность, кодируемая плазмидой 1351, представлена в SEQ ID NO:56.

Плазмида 1352 (cMSLN-EMC2A-Muc1-ERB2A-Tert541). Плазмиду 1352 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, гены, кодирующие аминокислоты 37-597 предшественники мезотелина человека, пептид EMCV 2A и муцин-1 человека, амплифицировали с помощью ПЦР из плазмиды 1316 с праймерами f pmed Nhe cMSLN и r ERB2A Bamh Muc. Гены, кодирующие пептид ERBV 2A и аминокислоты 541-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1330 с праймерами f1 ERBV2A Tert d541, f2 ERBV2A, and r pmed Bgl Ter240. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1352 представлена в SEQ ID NO:57. Аминокислотная последовательность, кодируемая плазмидой 1352, представлена в SEQ ID NO:58.

Плазмида 1353 (cMSLN-T2A-Tert541-ERB2A-Muc1). Плазмиду 1353 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 37-597 предшественника мезотелина человека, амплифицировали с помощью ПЦР из плазмиды 1103 с праймерами f pmed Nhe cMSLN, r2 T2A, и r T2A Bamh cMSLN. Гены, кодирующие пептид TAV 2A, аминокислоты теломеразы человека 541-1132, пептид ERBV 2A и аминокислоты 2-225, 946-1255 муцина-1 человека, амплифицировали ПЦР из плазмиды 1271 с праймерами f1 T2A Tert d541 и r pmed Bgl Muc. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1353 представлена в SEQ ID NO:59. Аминокислотная последовательность, кодируемая плазмидой 1353, представлена в SEQ ID NO:60.

Плазмида 1354 (Muc1-EMC2A-cMSLN-T2A-Tert342). Плазмиду 1354 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, гены, кодирующие аминокислоты 2-225, 946-1255 муцина-1 человека, пептид EMCV 2A и предшественник мезотелина человека, амплифицировали с помощью ПЦР из плазмиды 1313 с праймерами f pmed Nhe Muc and T2A Bamh cMSLN. Гены, кодирующие пептид TAV 2A и аминокислоты 342-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1326 с праймерами f1 T2A Tert d342, f2 T2A и r pmed Bgl Ter240. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1354 представлена в SEQ ID NO:61. Аминокислотная последовательность, кодируемая плазмидой 1354, представлена в SEQ ID NO:62.

Плазмида 1355 (cMSLN-EMC2A-Muc1-ERB2A-Tert342). Плазмиду 1355 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, гены, кодирующие аминокислоты 37-597 предшественники мезотелина человека, пептид EMCV 2A и муцин-1 человека, амплифицировали с помощью ПЦР из плазмиды 1316 с праймерами f pmed Nhe cMSLN и r ERB2A Bamh Muc. Гены, кодирующие пептид ERBV 2A и аминокислоты 342-1132 теломеразы человека, амплифицировали с помощью ПЦР из плазмиды 1326 с праймерами f1 ERBV2A Ter d342, f2 ERBV2A, and r pmed Bgl Ter240. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1355 представлена в SEQ ID NO:63. Аминокислотная последовательность, кодируемая плазмидой 1355, представлена в SEQ ID NO:64.

Плазмида 1356 (cMSLN-T2A-Tert342-ERB2A-Muc1). Плазмиду 1356 строили с использованием методов ПЦР и бесшовного клонирования. Сначала, ген, кодирующий аминокислоты 37-597 предшественника мезотелина человека, амплифицировали с помощью ПЦР из плазмиды 1103 с праймерами f pmed Nhe cMSLN, r2 T2A, и r T2A Bamh cMSLN. Гены, кодирующие пептид TAV 2A, аминокислоты теломеразы человека 342-1132, пептид ERBV 2A и аминокислоты 2-225, 946-1255 муцина-1 человека, амплифицировали ПЦР из плазмиды 1271 с праймерами f1 T2A Tert d342 и r pmed Bgl Muc. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Полученный клон № 3 содержал непреднамеренную одиночную мутацию основания. Чтобы исправить мутацию, ПЦР и бесшовное клонирование повторяли, используя клона № 3 в качестве матрицы. Гены, кодирующие аминокислоты 37-597 предшественника мезотелина человека, пептид TAV 2A и аминоконцевую половину теломеразы человека, амплифицировали с помощью ПЦР из клона № 3 с праймерами f pmed Nhe cMSLN и r muc 1602-1579. Гены, кодирующие карбоксиконцевую половину теломеразы, пептид ERBV 2A и аминокислоты 2-225, 946-1255 муцина-1 человека, амплифицировали с помощью ПЦР из клона № 3 с праймерами f tert 1584 -1607 и r pmed Bgl Muc. Частично перекрывающиеся ампликоны расщепляли Dpn I, смешивали вместе и клонировали в сайты Nhe I/Bgl II pPJV7563 путем бесшовного клонирования. Нуклеотидная последовательность открытой рамки плазмиды 1356 представлена в SEQ ID NO:65. Аминокислотная последовательность, кодируемая плазмидой 1356, представлена в SEQ ID NO:66.

1D. КОНСТРУИРОВАНИЕ ВЕКТОРА

Векторы для экспрессии моно- или мультиантигенных конструкций конструировали из геномных последовательностей аденовируса шимпанзе Ad68. Были созданы три варианта скелета AdC68 без трансгенов (так называемые «пустые векторы») in silico. Векторы отличались только длиной делеций E1 и E3, которые были сконструированы в вирусах для того, чтобы сделать их репликацию несостоятельной и создать пространство для встраивания трансгена. Векторы AdC68W и AdC68X описаны в международной патентной заявке WO2015/063647A1. Вектор AdC68Y, несущий делеции оснований 456-3256 и 27476-31831, был сконструирован для улучшения свойств роста по сравнению с AdC68X и с большей пропускной способностью трансгена, чем AdC68W. Все три пустые вектора были биохимически синтезированы в многостадийном процессе, использующем in vitro олиго-синтез, и последующие промежуточные соединения, опосредованные рекомбинацией, собирались в Escherichia coli (E. coli) и дрожжах. Открытые рамки считывания, кодирующие различные иммуногенные полипептиды TAA, амплифицировали с помощью ПЦР из плазмид, описанных в примерах. Открытые рамки считывания затем встраивали в пустые векторные бакмиды. Рекомбинантные вирусные геномы вырезали из бакмид путем обработки ферментом PacI, а линеаризованные нуклеиновые кислоты трансфицировали в E1-комплементарную клеточную линию HEK293. При видимых цитопатических эффектах и образовании очагов аденовируса культуры собирали несколькими циклами замораживания/оттаивания для удаления вируса из клеток. Вирусы амплифицировали и очищали стандартными методиками.

ПРИМЕР 2. ИММУНОГЕННОСТЬ ИММУНОГЕННЫХ МОНОГЕННЫХ КОНСТРУКЦИЙ НА ОСНОВЕ MUC1

Исследование на мышах HLA-A2/DR1

План клинического исследования. Двенадцать мышей HLA-A2/DR1 разного пола праймировали в 0-ой день и стимулировали на 14-ый день с помощью ДНК-конструкции плазмиды 1027 (которая кодирует связанно-связанный полипептид MUC1 с SEQ ID NO:8) или плазмиды 1197 (которая кодирует цитозольный иммуногенный полипептид MUC1 с SEQ ID NO:16), используя способ PMED. На 21-ый день мышей умерщвляли и оценивали спленоциты на MUC1-специфическую клеточную иммуногенность в анализе ELISpot с интерфероном гамма (IFN-γ) и внутриклеточного цитокинового окрашивания (ICS).

Эпидермальная доставка, опосредованная частицами (PMED). PMED представляет собой безыгольчатый способ введения вакцин на основе нуклеиновых кислот животному или человеку. Система PMED включает осаждение ДНК на микроскопические частицы золота, которые затем выталкиваются газом гелия в эпидермис. В ND10, одноразовое устройство, используется спрессованный гелий из внутреннего цилиндра для доставки частиц золота, а в X15, устройстве средстве-повторителе, используется внешний гелиевый резервуар, который соединен с X15 через шланг высокого давления для доставки частиц золота. Оба эти устройства использовали в исследованиях доставки плазмид на основе ДНК MUC1. Частица золота обычно составляла 1-3 мкм в диаметре, и рецептура с частицами была составлена чтобы на 2 мкг антигенной ДНК плазмиды приходился 1 мг частиц золота. (Sharpe, M. et al.: P. Protection of mice from H5N1 influenza challenge by prophylactic DNA vaccination using particle mediated epidermal delivery. Vaccine, 2007, 25(34): 6392-98: Roberts LK, et al.: Clinical safety and efficacy of a powdered Hepatitis B nucleic acid vaccine delivered to the epidermis by a commercial prototype device. Vaccine, 2005; 23(40):4867-78).

Анализ ELISpot с IFN-γ. Спленоциты каждого животного совместно инкубировали в трех повторах с каждым Ag-специфическим пептидом (каждый пептид при 2-10 мкг/мл, 2,5-5e5 клеток на лунку) или объединяли с 15-мерными Ag-специфическими пептидами (перекрытие по 11 аминокислотам, покрывающее всю Ag-специфическую аминокислотную последовательность; каждый пептид при 2-5 мкг/мл, 1,25-5e5 клеток на лунку) в планшетах IFN-γ ELISPOT (см. также таблицу пептидных пулов (Таблица 18) и Таблицы 15-17). Планшеты инкубировали в течение ~16 ч при 37°C, 5% CO2, затем промывали и проявляли согласно инструкциям производителя. Количество клеток, образующих IFN-γ пятна (SFC), подсчитывали на ридере CTL. Вычисляли среднее значение трех повторов и отбирали отрицательные контрольные лунки, которые не содержали пептидов. Затем значения SFC нормировали для описания ответа на 1e6 спленоциты. Антиген-специфические ответы в таблицах представляют собой сумму ответов на Ag-специфические пептиды или пулы пептидов.

Анализ ICS. Спленоциты каждого животного совместно инкубировали с H-2b-, HLA-A2- или HLA-A24-ограниченными Ag-специфическими пептидами (каждый пептид при 5-10 мкг/мл, 1-2e6 спленоцитов на лунку) или пулы 15-мерных Ag-специфических пептидов (перекрытие по 11 аминокислотами, покрывающее всю Ag-специфическую аминокислотную последовательность; каждый пептид при 2-5 мкг/мл, 1-2e6 спленоцитов на лунку) в планшетах для культивирования ткани с U-образным дном и 96 лунками (см. также таблицу пептидных пулов (Таблица 18) и Таблицы 15-17). Планшеты инкубировали ~16 часов при 37°C, 5% CO2. Затем клетки окрашивали для детекции внутриклеточный экспрессии IFN-γ в CD8+ Т-клетках и фиксировали. Клетки обнаруживали на проточном цитометре. Данные представляли для каждого животного как частота пептида(ов) Ag- или пептидного пула Ag-специфичных IFN-γ+ CD8+ Т-клеток после вычитания ответов, полученных в отрицательных контрольных лунках, которые не содержали пептида.

Анализ сэндвич-ELISA. Стандартный сэндвич-анализ ELISA проводили с использованием инструментов автоматизации Tecan Evo, Biomek FxP и BioTek 405 Select TS. 384-луночные микропланшеты (плоскодонные, с высоким связыванием) покрывали 25 мкл/лунку 1,0 мкг/мл белком MUC1 человека или белком MSLN человека (антиген) в 1×PBS и инкубировали в течение ночи при 4°C. На следующее утро планшеты блокировали в течение часа при комнатной температуре с 5% FBS в PBS с 0,05% Tween 20 (PBS-T). Сыворотки мыши получали при начальном разбавлении 1/100 в PBS-T в 96-луночных планшетах с U-образным дном. Станция Tecan Evo осуществляла ½log серийные разведения в PBS-T по 9-и точкам с увеличением разведения, а затем штамповала по 25 мкл/лунка разведенной сыворотки из 96-луночных планшетов в 384-луночные планшеты. Планшеты из 384 лунок инкубировали в течение 1 часа при комнатной температуре на шейкере при 600 об/мин, затем, используя промыватель для планшетов BioTek EL 405 Select TS, планшеты промывали 4 раза в PBS-T. Второе мышиное анти-IgG-HRP антитело разводили до соответствующего разведения и штамповали с помощью Biomek FxP при 25 мкл/лунка в 384 луночные планшеты и инкубировали в течение 1 часа при комнатной температуре на шейкере при 600 об/мин, а затем промывку повторяли 5 раз. Используя Biomek FxP, планшеты штамповали при 25 мкл/лунка субстрата RT TMB и инкубировали в темноте при комнатной температуре в течение 30 минут, затем штамповали 25 мкл/лунка 1н кислоты H2SO4 для того, чтобы остановить ферментативную реакцию. Планшеты считывали на Molecular Devices, Spectramax 340PC/384 Plus при длине волны 450 нм. Данные представляли как рассчитанные титры при OD 1,0 с пределом обнаружения 99,0. Антиген-специфическое коммерческое моноклональное антитело использовали в каждом планшете в качестве положительного контроля для отслеживания различий в характеристиках от планшета к планшету; в качестве отрицательного контроля использовали нерелевантную вакцинированную сыворотку мыши, а для контроля фона неспецифического связывания использовали только лунки PBS-T. Титры в таблицах представляют собой антиген-специфические титры IgG, индуцированные у каждого животного.

Результаты. В таблице 1 приведены данные ELISpot и ICS спленоцитов HLA-A2/DR1, культивированных с пулами пептидов, полученных из библиотеки пептидов MUC1 (см. также Таблицы 15 и 18) или пептида MUC1 а.к.516-530, соответственно. Числа в столбце 3 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пулами пептидов MUC1 и вычитания фона. Числа в столбце 4 представляют собой число CD8+ Т-клеток, которые являются IFN-γ+ после рестимуляции пептидом MUC1 а.к.516-530 и вычитания фона. Положительный ответ определен как имеющий SFC > 100 и число IFN-γ+ CD8+ Т-клеток > 0,05%. Как показано в таблице 1, иммуногенные полипептиды MUC1, полученные с использованием полноразмерных мембранных (плазмида 1027) и цитозольных (плазмида 1197) MUC1 конструкций, описанных выше в примере 1А, способны индуцировать MUC1-специфические ответы Т-клеток, включая специфические CD8+ Т-клеточные ответы на HLA-A2 рестриктированный пептид MUC1 а.к.516-530. Цитозольный формат антигена MUC1 индуцировал наивысшую величину ответов Т-клеток. Важно отметить, что было показано, что ответы Т-клеток больных раком на пептид MUC1 а.к.516-530, коррелируют с противоопухолевой эффективностью in vitro (Jochems C et al., Cancer Immunol Immunother (2014) 63:161-174), демонстрируя важность повышения клеточных ответов на этот специфический эпитоп.

Таблица 1. Т-клеточный ответ, индуцированный моноантигенными конструкциями на основе ДНК MUC1 (плазмида 1027 и плазмида 1197) у мышей HLA-A2/DR1
ID Конструкции Номер животного число IFN-γ пятен/106 спленоцитов %CD8+ T клеток, являющихся IFN-γ+
Плазмида 1027 31 494 2,25
32 277 1,44
33 475 0,10
34 1096 0,84
35 282 1,45
36 649 1,36
Плазмида 1197 43 569 4,69
44 1131 2,15
45 122 2,81
46 373 1,73
47 503 1,80
48 2114 5,52

Исследование на мышах HLA-A24

План клинического исследования. Мышей HLA-A24 разного пола праймировали в 0-ой день и стимулировали на 14-ый, 28-ой и 42-ой дни ДНК-конструкцией плазмиды 1027 путем PMED введения. На 21-й день мышей умерщвляли и оценивали спленоциты на MUC1-специфическую клеточную иммуногенность (ELISpot).

Результаты. В таблице 2 приведены данные ELISpot спленоцитов HLA-A24, культивированных с пулами пептидов, полученных из библиотеки пептидов MUC1 (см. также таблицу пулов пептидов (Таблица 18) и Таблица 15). Числа в столбце 3 представляют # IFN-γ пятен/106 спленоцитов после рестимуляции пулами пептидов MUC1 и вычитания фона. Число, выделенное жирным шрифтом, указывает на то, что по крайней мере 1 исследованный пул пептидов был слишком большим для подсчета, поэтому истинной цифрой является по крайней мере указанное значение. Положительный ответ определен как имеющий SFC > 100. Как показано в таблице 2, конструкция на основе мембрано-связанного MUC1, способна индуцировать MUC1-специфические клеточные ответы.

Таблица 2. Т-клеточный ответ, индуцированный моноантигенной конструкцией на основе ДНК. Плазмида 1027, кодирующая нативный полноразмерный мембранно-связанный антиген MUC1 человека у мышей HLA-A24
ID Конструкции Номер животного Число IFN-γ пятен/106 спленоцитов
Плазмида 1027 8 3341
9 3181
10 6207
11 3112
12 3346
13 3699

Исследование на обезьянах

План клинического исследования. 14 китайских макак крабоедов праймировали аденовирусным вектором AdC68W, кодирующим цитозольный (плазмида 1197) или полноразмерный мембранно-связанный антиген MUC1 (плазмида 1027), в количестве 2e11 вирусных частиц путем двусторонней внутримышечной инъекции (всего-1 мкл). Через 29 дней животных стимулировали ДНК, кодирующей цитозольный или полноразмерный мембранно-связанный антиген MUC1, вводимым путем двусторонней внутримышечной электропорации (всего-2 мкл). Анти-CTLA-4 вводили подкожно на 1-й день (32 мг) и 29-ой день (50 мг). Через 14 дней после последней иммунизации у животных брали кровь, и РВМС и сыворотку выделяли для оценки MUC1-специфических клеточных (ELISpot, ICS) и гуморальных (ELISA) ответов, соответственно.

NHP-специфические иммунные анализы.

Анализ ELISpot. РВМС каждого животного совместно инкубировали в двух повторах с пулами 15-мерных Ag-специфических пептидов (перекрытие по 11 аминокислотам, охват всей Ag-специфической аминокислотной последовательности), каждый пептид в количестве 2 мкг/мл, 4e5 клеток на лунку, в планшетах IFN-y ELISPOT (см. также таблицу пептидных пулов (Таблица 18) и Таблицы 15-17). Планшеты инкубировали в течение ~16 ч при 37° C, 5% CO2, затем промывали и проявляли согласно инструкциям производителя. Количество клеток, образующих IFN-γ пятна (SFC), подсчитывали на ридере CTL. Вычисляли среднее значение двух повторов и вычитали отрицательные контрольные лунки, которые не содержали пептидов. Затем значения SFC нормировали для описания ответа на 1e6 PBMC. Антиген-специфические ответы в таблицах представляют собой сумму ответов на Ag-специфические пептидные пулы.

Анализ ICS. РВМС каждого животного совместно инкубировали с пулами 15-мерных пептидов MUC1 (перекрытие по 11 аминокислотам, охват всей нативной полноразмерной аминокислотной последовательности MUC1; см. Таблицу 15), каждый пептид в количестве 2 мкг/мл, 1,5-2e6 PBMC на лунку, в 96-луночных планшетах с U-образным дном для культур тканей. Планшеты инкубировали в течение ~16 часов при 37°C, 5% CO2, а затем окрашивали для детекции внутриклеточной экспрессии IFN-γ CD8 T-клеток. После фиксации клетки детектировали на проточном цитометре. Результаты представлены для каждого животного как количество MUC1, MSLN или TERT-специфических IFN-γ+ CD8+ Т-клеток после вычитания ответов, полученных в отрицательных контрольных лунках, которые не содержали пептида, и нормировали с 1е6 CD8+ Т-клетками.

Анализ сэндвич-ELISA. Стандартный сэндвич-анализ ELISA проводили с использованием инструментов автоматизации Tecan Evo, Biomek FxP и BioTek 405 Select TS. 384-луночные микропланшеты (плоскодонные, с высоким связыванием) покрывали 25 мкл/лунку 1,0 мкг/мл белком MUC1 человека или белком MSLN человека (антиген) в 1×PBS и инкубировали в течение ночи при 4°C. На следующее утро планшеты блокировали в течение часа при комнатной температуре с 5% FBS в PBS с 0,05% Tween 20 (PBS-T). Сыворотки китайских макак крабоедов получали при начальном разбавлении 1/100 в PBS-T в 96-луночных планшетах с U-образным дном. С помощью станции Tecan Evo осуществляли ½ log серийные разведения в PBS-T по 9-и точкам с увеличением разведения, а затем штамповали в количестве 25 мкл/лунка разведенную сыворотку из 96-луночных планшетов в 384-луночные планшеты. Планшеты с 384 лунками инкубировали в течение 1 часа при комнатной температуре на шейкере при 600 об/мин, затем, используя промыватель для планшетов BioTek EL 405 Select TS, планшеты промывали 4 раза в PBS-T. Второе резус анти-IgG-HRP антитело, которое перекрестно связывалось с Ig макак крабоедов, разводили до соответствующего разведения и штамповали с помощью Biomek FxP в количестве 25 мкл/лунка в 384 луночные планшеты и нкубировали в течение 1 часа при комнатной температуре на шейкере при 600 об/мин, а затем промывку повторяли 5 раз. Используя Biomek FxP, планшеты штамповали в количестве 25 мкл/лунка субстратом RT TMB и инкубировали в темноте при комнатной температуре в течение 30 минут, затем штамповали 25 мкл/лунка 1н кислоты H2SO4 для того, чтобы остановить ферментативную реакцию. Планшеты считывали на Molecular Devices, Spectramax 340PC/384 Plus при длине волны 450 нм. Данные представляли как рассчитанные титры при OD 1,0 с пределом обнаружения 99,0. Антиген-специфическое коммерческое моноклональное антитело использовали в каждом планшете в качестве положительного контроля для отслеживания различий в характеристиках от планшета к планшету; в качестве отрицательного контроля использовали нерелевантную вакцинированную сыворотку мыши, а для контроля фона неспецифического связывания использовали лунки только с PBS-T. Титры в таблицах представляют собой антиген-специфические титры IgG, индуцированные у каждого животного.

Результаты. В таблице 3 приведены данные ELISpot и ICS для PMBC китайских макак крабоедов, культивированных с пептидными пулами, полученными из библиотеки пептидов MUC1 (см. также таблицу пептидных пулов (Таблица 18) и Таблица 15) и данные ELISA сыворотки китайских макак крабоедов. Числа в столбце 3 представляют число IFN-γ пятен/106 PBMC после рестимуляции пептидными пулами MUC1 и вычитания фона. Числа в столбце 4 представляют число IFN-γ+ CD8+ Т-клетки/106 CD8+ Т-клеток после рестимуляции пептидными пулами MUC1 и вычитания фона. Числа в столбце 5 представляют собой IgG-титр антитела против MUC1 (оптическая плотность (OD)=1, предел детекции (LOD)=99,0). Положительный ответ определен как имеющий SFC > 50, IFN-γ+ CD8+ Т-клетки/1e6 CD8+ Т-клетки > 50 и IgG-титры > 99. Как показано в таблице 3, иммуногенные полипептиды MUC1, полученные с помощью конструкций на основе цитозольного (1197) и нативного полноразмерного мембранно-связанного (1027) MUC1, способны индуцировать MUC1-специфичные T- и B-клеточные ответы. Было показано, что конструкция на основе нативного полноразмерная мембранно-связанного MUC1 (1027) индуцирует общий наилучший MUC1-специфический клеточный и гуморальный ответ.

Таблица 3. T- и B-клеточные ответы, индуцированные моноантигенной аденовирусной конструкцией AdC68W и моноантигенной ДНК-конструкцией (плазмида 1197, плазмида 1027), у китайских макак крабоедов
ID конструкции Номер животного Число IFN-γ пятен/106 спленоцитов Число IFN-γ+ CD8+T-клеток/1e6 CD8+ T-клеток IgG-титр
Плазмида 1197 4001 0 0,0 8589,7
4002 38 1549,0 4245,9
4003 17 0,0 2631,9
4501 165 4792,3 614,6
4502 1703 47727,4 1882,8
4503 0 802,8 4366,4
4504 373 1857,0 4419,3
Плазмида 1027 5001 797 813,5 5332,2
5002 1013 312,9 16233,5
5003 1011 9496,9 6885,8
5004 175 170,2 48759,0
5501 214 4803,3 13010,4
5502 306 8367,6 13115,3
5503 405 0,0 89423,0

ПРИМЕР 3. ИММУНОГЕННОСТЬ MSLN МОНОАНТИГЕННЫХ КОНСТРУКЦИЙ

Исследование иммунного ответа у мышей Пастера (HLA-A2/DR1)

План клинического исследования. Двенадцать самок мышей HLA-A2/DR1 праймировали аденовирусным вектором AdC68W, кодирующим мембранно-связанный (плазмида 1084) или цитозольный антиген MSLN (плазмида 1103), в количестве 1e10 вирусных частиц путем внутримышечной инъекции (50 мкл). Через 28 дней животных стимулировали моноантигенной ДНК-конструкцией, кодирующей иммуногенный полипептид MSLN, используя способ PMED, как описано в примере 2. Антиген-специфический Т-клеточный ответ измеряли через семь дней IFN-γ ELISPOT и ICS.

Результаты. В таблице 4 приведены данные ELISpot и ICS для спленоцитов HLA-A2/DR1, культивированных с пептидными пулами, полученными из библиотеки пептидов MUC1 (см. также таблицу пептидных пулов (Таблица 18) и Таблица 16) или пептидов MSLN а.к.50-64, а.к.102-116 и а.к.542-556, соответственно. Числа в столбце 3 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пептидными пулами MSLN и вычитания фона. Числа в столбце 4 представляют собой число CD8+ Т-клеток, которые являются IFN-γ+, после рестимуляции пептидами MSLN а.к.50-64, а.к.102-116 и а.к.542-556 и вычитания фона. Положительный ответ определен как имеющий SFC > 100 и количество IFN-γ+ CD8+ Т-клеток > 0,05%. Как показано в таблице 4, иммуногенные полипептиды MSLN, полученные с помощью конструкций на основе мембранно-связанного (1084) и цитозольного (1103) MSLN, описанных выше в примере 1А, способны индуцировать MSLN-специфические Т-клеточные ответы. Антиген MSLN в цитозольном формате индуцировал наивысшую величину MSLN-специфических Т-клеточных ответов.

Таблица 4. Т-клеточный ответ, индуцированный моноантигенной аденовирусной AdC68W конструкцией и моноантигенной ДНК-конструкцией у мышей HLA-A2/DR1
ID конструкции Номер животного Число IFN-γ пятен/106 спленоцитов % CD8+ T-клеток, являющихся IFN-γ+
Плазмида 1084 37 1744 1,07
38 3488 3,13
39 1905 0,19
40 1649 2,47
41 1900 0,09
42 1108 1,87
Плазмида 1103 49 4839 2,34
50 4685 13,49
51 2508 3,69
52 1865 2,09
53 708 0,38
54 2525 4,41

Исследование иммунного ответа у мышей HLA A24

План клинического исследования. Двенадцать мышей HLA-A24 смешанных гендерных групп иммунизировали ДНК-конструкциями на основе мембранно-связанного (1084) или цитозольного (1103) MSLN, используя способ PMED в режиме праймирования/стимуляции/стимуляции/стимуляции с перерывом в две недели между вакцинациями. MSLN-специфичные Т-клеточные ответы измеряли через 7 дней после последней иммунизации в анализе IFN-γ ELISpot и ICS.

Результаты. В таблице 5 приведены данные ELISpot и ICS для спленоцитов HLA-A24, культивированных с пептидными пулами, полученными из библиотеки пептидов MSLN (см. также таблицу пептидных пулов (Таблица 18) и Таблица 16) или пептидов MSLN а.к.130-144 и а.к.230-244, соответственно. Числа в столбце 3 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пептидными пулами MSLN и вычитания фона. Числа в столбце 4 представляют собой число CD8+ Т-клеток, которые являются IFN-γ+, после рестимуляции пептидами MSLN а.к.130-144 и а.к.230-244 и вычитания фона. Положительный ответ определен как имеющий SFC > 100 и количество IFN-γ+ CD8+ Т-клеток > 0,05%. Как показано в таблице 5, иммуногенные полипептиды MSLN, полученные с помощью конструкций на основе мембранно-связанного (1084) и цитозольного (1103) MSLN, способны индуцировать MSLN-специфичные Т-клеточные ответы. Антиген MSLN в цитозольном формате индуцировал наивысшую величину MSLN-специфических Т-клеточных ответов.

Таблица 5. Т-клеточный ответ, индуцированный моноантигенной ДНК-конструкцией, у мышей HLA-A24
ID конструкции Номер животного Число IFN-γ пятен/106 спленоцитов % CD8+ T-клеток,
являющихся IFN-γ+
Плазмида 1084 1 47 Не определено
2 161 Не определено
3 13 Не определено
7 105 Не определено
8 232 Не определено
9 151 Не определено
Плазмида 1103 13 2440 0,00
14 2345 0,17
15 1789 0,00
19 3184 0,64
21 5463 1,62
22 2324 0,39

Исследование иммунного ответа у обезьян

План клинического исследования. 14 Китайских макак крабоедов праймировали аденовирусным вектором AdC68W, кодирующим мембрано-связанный (плазмида 1084) или цитозольный антиген MSLN (плазмида 1103), в количестве 2e11 вирусных частиц путем двусторонней внутримышечной инъекции (всего-1 мкл). Через 29 дней животных стимулировали ДНК, кодирующей мембранно-связанный (1084) или цитозольный антиген MSLN (1103), двухсторонней внутримышечной электропорацией (всего-2 мкл). Анти-CTLA-4 вводили подкожно на 1-й день (32 мг) и 29-ой день (50 мг). Через 14 дней после последней иммунизации у животных брали кровь, и РВМС и сыворотку выделяли для оценки MSLN-специфических клеточных (ELISpot, ICS) и гуморальных (ELISA) ответов, соответственно.

Результаты. В таблице 6 приведены данные ELISpot и ICS для PMBC китайских макак крабоедов, культивированных с пептидными пулами, полученными из библиотеки пептидов MSLN (см. также таблицу пептидных пулов (Таблица 18) и Таблица 16), и данные ELISA сыворотки китайского макака крабоеда. Числа в столбце 3 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пептидными пулами MSLN и вычитания фона. Числа в столбце 4 представляют число IFN-γ+ CD8+ Т-клеток/106 CD8+ Т-клеток после рестимуляции пептидными пулами MSLN и вычитания фона. Числа в столбце 5 представляют собой титр антитела против MSLN (оптическая плотность (OD)=1, предел детекции (LOD)=99,0). Положительный ответ определен как имеющий SFC > 50, IFN-γ+ CD8+ Т-клетки/1e6 CD8+ Т-клетки > 50 и титры IgG > 99. Как показано в таблице 6, иммуногенные полипептиды MSLN, полученные с помощью конструкций, на основе мембранно-связанного (1084) и цитозольного (1103) MSLN, способны индуцировать MSLN-специфические Т-и В-клеточные ответы. Было показано, что конструкция на основе цитоплазматического MSLN (плазмида 1103) индуцирует наиболее сильный MSLN-специфический клеточный ответ; напротив, было показано, что конструкция на основе мембранно-связанного MSLN (плазмида 1084) индуцирует самый сильный MSLN-специфический гуморальный ответ.

Таблица 6. T- и B-клеточные ответы, индуцированные моноантигенной аденовирусной AdC68W конструкцией и моноантигенной ДНК-конструкцией, у китайских макак крабоедов
ID конструкции Номер животного Число IFN-γ пятен/106 спленоцитов Число IFN-γ+ CD8+ T-клеток/1e6 CD8+ T-клеток IgG-титр
Плазмида 1084 1001 390 181,4 40886,6
1002 787 512,0 41476,1
1003 2083 5642,6 11948,1
1501 894 1083,7 41248,3
1502 1789 6501,0 42668,3
1503 2358 37238,3 42026,5
1504 269 1340,9 43023,6
Плазмида 1103 2001 2131 15318,5 1459,3
2002 2818 7163,4 99,0
2003 1115 2291,0 2393,2
2004 948 3602,6 1948,0
2501 2477 13741,4 1751,7
2502 2082 9318,7 15412,5
2503 831 1797,8 99,0

ПРИМЕР 4. ИММУНОГЕННОСТЬ TERT МОНОАНТИГЕННЫХ КОНСТРУКЦИЙ

Исследование иммунных ответов у мышей Пастера

План клинического исследования. Шесть мышей HLA-A2/DR1 смешанных гендерных групп праймировали аденовирусным вектором AdC68W, кодирующим усеченный (Δ240) цитозольный иммуногенный полипептид TERT (плазмида 1112), в количестве 1e10 вирусных частиц путем внутримышечной инъекции (50 мкл). Через 28 дней животных стимулировали внутримышечно 50 мкг ДНК, вводимой двухсторонней инъекцией с помощью электропорации (2×20 мкл), кодирующей усеченный (Δ240) цитозольный антиген TERT (плазмида 1112). Антиген-специфический Т-клеточный ответ измеряли через семь дней в анализе IFN-γ ELISPOT и ICS.

Результаты. В таблице 7 приведены данные ELISpot и ICS спленоцитов HLA-A2/DR1, культивированных с пептидными пулами, полученными из библиотеки пептидов TERT (см. также таблицу пулов пептидов (Таблица 18) и Таблица 17) или пептидов TERT а.к.861-875, соответственно. Числа в столбце 3 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пептидными пулами TERT и вычитания фона. Числа в столбце 4 представляют собой число CD8+ Т-клеток, которые являются IFN-γ+, после рестимуляции пептидом TERT а.к.861-875 и вычитания фона. Положительный ответ определен как имеющий SFC > 100 и количество IFN-γ+ CD8+ Т-клеток > 0,05%. Как показано в таблице 7, иммуногенный полипептид TERT, полученный из конструкции на основе усеченного (Δ240) цитозольного TERT, как описанной выше в примере 1А, способен индуцировать HLA-A2-рестриктированные TERT-специфические CD8 T-клеточные ответы.

Таблица 7. Т-клеточный ответ, индуцированный моноантигенной аденовирусной AdC68W конструкцией и моноантигенной ДНК-конструкцией (плазмида 1112), кодирующей усеченный (Δ240) цитозольный антиген TERT человека, у мышей HLA-A2/DR1
ID конструкции Номер животного Число IFN-γ пятен/106 спленоцитов % CD8+ T-клеток, являющихся IFN-γ+
Плазмида 1112 13 2851 32,79
14 2691 13,60
15 3697 7,87
16 2984 21,30
17 1832 26,40
18 1385 3,16

Исследование иммунных ответов у мышей HLA A24

План клинического исследования. Восемь мышей HLA-A24 смешанных гендерных групп праймировали аденовирусным вектором AdC68W, кодирующим усеченный (Δ240) цитозольный антиген TERT (плазмида 1112), в общем количестве 1e10 вирусных частиц путем двусторонней внутримышечной инъекции (50 мкл в каждую переднюю большеберцовую мышцу). Через 14 дней животных стимулировали внутримышечно 50 мкг ДНК, вводимой двухсторонней инъекцией с помощью электропорации (2×20 мкл), кодирующей усеченный (Δ240) цитозольный антиген TERT (плазмида 1112). Антиген-специфический Т-клеточный ответ измеряли через семь дней в IFN-γ ELISPOT и ICS.

Результаты. В таблице 8 приведены IFN-γ данные ELISpot и ICS для спленоцитов HLA-A24, культивированных с пептидными пулами, полученными из библиотеки пептидов TERT (см. также таблицу пептидных пулов (Таблица 18) и Таблица 17) или пептидов TERT а.к.841-855), соответственно. Числа в столбце 3 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пептидными пулами TERT и вычитания фона. Числа в столбце 4 представляют собой число CD8+ Т-клеток, которые являются IFN-γ+, после рестимуляции пептидом TERT а.к.841-855 и вычитания фона. Число, выделенное жирным шрифтом, указывает на то, что по крайней мере 1 исследованный пептидный пул был слишком велик для подсчета, поэтому истинной цифрой является по крайней мере указанное значение. Положительный ответ определен как имеющий SFC > 100 и количество IFN-γ+ CD8+ Т-клеток > 0,1%. Как показано в таблице 8, иммуногенный полипептид TERT, полученный из конструкции на основе усеченного (Δ240) цитозольного TERT (1112), способен индуцировать HLA-A24-рестриктированные TERT-специфические CD8+ T-клеточные ответы.

Таблица 8. Т-клеточный ответ, индуцированный моноантигенной аденовирусной AdC68W конструкцией и моноантигенной ДНК-конструкцией (плазмида 1112), кодирующей усеченный (Δ240) цитозольный антиген TERT человека, у мышей HLA-A24
ID конструкции Номер животного Число IFN-γ пятен/106 спленоцитов % CD8+ T-клеток, являющихся IFN-γ+
Плазмида 1112 17 4233 41,5
18 2643 3,34
19 1741 31,5
20 3407 3,05
21 3213 0,0903
22 596 0
23 1875 13,8
24 2011 19,8

Исследование иммунных ответов у обезьян

План клинического исследования. Восемь китайских макак крабоедов праймировали аденовирусным вектором AdC68W, кодирующим усеченный (Δ240) цитозольный антиген TERT (плазмида 1112), в количестве 2e11 вирусных частиц путем двусторонней внутримышечной инъекции (всего-1 мкл). Через 30 и 64 дня животных стимулировали ДНК (плазмида 1112), кодирующей усеченный (Δ240) цитозольный антиген TERT, путем двухсторонней внутримышечной электропорации (всего-2 мкл). Анти-CTLA-4 вводили подкожно на 1-й день (32 мг), 31 (50 мг) и 65 (75 мг). Через 14 дней после последней иммунизации у животных брали кровь, и РВМС выделяли для оценки TERT-специфических клеточных (ELISpot, ICS) ответов.

Результаты. В таблице 9 приведены данные ELISpot и ICS для PMBC китайского макак крабоеда, культивированных с пептидными пулами, полученными из библиотеки пептидов TERT (см. также таблицу пептидных пулов (Таблица 18) и Таблица 17). Числа в столбце 3 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пептидными пулами TERT и вычитания фона. Числа в столбце 4 представляют количества IFN-γ+ CD8+ Т-клеток/106 CD8+ Т-клеток после рестимуляции пептидными пулами TERT и вычитания фона. Положительный ответ определен как имеющий SFC > 50 и IFN-γ+ CD8+ Т-клетки/1e6 CD8+ Т-клетки > 50. Как показано в таблице 9, иммуногенный полипептид TERT, полученный с помощью конструкции на основе усеченного (Δ240) цитозольного TERT (1112), способен индуцировать TERT-специфические T-клеточные ответы.

Таблица 9. T-клеточный ответ, индуцированный TERT-моноантигенной аденовирусной AdC68W конструкцией и TERT-моноантигенной ДНК-конструкцией, у китайских макак крабоедов
ID конструкции Номер животного Число IFN-γ пятен/106 спленоцитов # IFN-γ+ CD8+ T-клеток/1e6 CD8+ T-клеток
Плазмида 1112 1001 3487 29472,2
1002 1130 4906,6
1003 2077 2984,2
1004 133 337,8
1501 3157 5325,1
1502 2037 653,2
1503 2697 16953,4
1504 1208 1178,9

ПРИМЕР 5. ИММУНОГЕННОСТЬ ДВОЙНЫХ АНТИГЕННЫХ КОНСТРУКЦИЙ

Исследование иммунного ответа у обезьян

План клинического исследования. 24 Китайских макак крабоедов праймировали двойными антигенными аденовирусными векторами AdC68W, кодирующими нативный полноразмерный мембранно-связанный MUC1 (MUC1) человека и усеченный (Δ240) цитозольный антиген TERT человека (TERTΔ240), в количестве 2e11 вирусных частиц путем двусторонней внутримышечной инъекции (всего 1 мкл). Через 30 и 64 дней животных стимулировали двойными антигенными ДНК-конструкциями (плазмиды 1270, 1271 и 1269), кодирующими те же два антигена, вводимыми двухсторонней внутримышечной электропорации (всего-2 мкл). Анти-CTLA-4 вводили подкожно на 1-й день (32 мг), 31 (50 мг) и 65 (75 мг). Через 14 дней после последней иммунизации у животных брали кровь, и РВМС и сыворотку выделяли для оценки MUC1- и TERT-специфических клеточных (ELISpot, ICS) и MUC1-специфических гуморальных (ELISA) ответов, соответственно. В целом оценивали три различные двойные антигенные вакцинные конструкции, которые соэкспрессировали оба антигена: a) MUC1-2A-TERTΔ240 (плазмида 1270), вектор AdC68W и ДНК-плазмида, кодирующая MUC1 и TERT, связанные с помощью пептида 2A; b) TERTΔ240-2A-MUC1 (плазмида 1271), вектор AdC68W и ДНК-плазмида, кодирующая TERT и MUC1, связанные 2А-пептидом; c) MUC1-TERTΔ240 (плазмида 1269), вектор AdC68W и DNA-плазмида, кодирующая слитый белок MUC1-TERT (см. также Таблицу Конструкций).

Результаты. В таблице 10 приведены данные ELISpot и ICS для PMBC китайского макака крабоеда, культивированных с пептидными пулами, полученными из библиотек пептидов MUC1 и TERT (см. также таблицу пептидных пулов (Таблица 18) и Таблица 15 и 17), и данные ELISA сыворотки китайского макака крабоеда. Положительный ответ определен как имеющий SFC > 50, IFN-γ+ CD8+ Т-клетки/1e6 CD8+ Т-клетки > 50 и титры IgG > 99. Числа в столбце 3 и 6 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пептидными пулами MUC1 и TERT и вычитания фона, соответственно. Числа, выделенные жирным шрифтом, указывают на то, что по крайней мере 1 исследованный пептидный пул был слишком велик для подсчета, поэтому истинной цифрой является по крайней мере указанное значение. Числа в столбцах 4 и 7 представляют число IFN-γ+ CD8+ Т-клеток/106 CD8+Т-клеток после рестимуляции пептидными пулами MUC1 и пептидными пулами TERT, соответственно, и вычитания фона. Числа в столбце 5 представляют собой IgG-титр антитела против MUC1 (оптическая плотность (OD)=1, предел детекции (LOD)=99,0). Как показано в таблице 10, иммуногенные полипептиды MUC1 и TERT, полученные с помощью двойных антигенных конструкций, экспрессирующих MUC1 и TERT (плазмиды 1270, 1271 и 1269), способны индуцировать MUC1- и TERT-специфические Т-клеточные ответы и MUC1-специфические В-клеточные ответы. Показано, что двойная антигенная конструкция 1269, кодирующая слитый белок MUC1-TERT, индуцирует наиболее сильный общий MUC1-специфический клеточный ответ; напротив, было показано, что двойная конструкция плазмиды 1271 (TERT-2A-MUC1) индуцирует наиболее сильный общий TERT-специфический клеточный ответ. Было показано, что все три двойные антигенные конструкции вызывают сравнимый MUC1-специфичный гуморальный ответ.

Таблица 10. T и B-клеточные ответы, индуцированные двойной антигенной аденовирусной AdC68W конструкцией и моноантигенной ДНК-конструкцией (плазмида 1270, 1271 и 1269), кодирующей иммуногенный полипептид MUC1 и/или TERT, у китайских макак крабоедов
ID констр. Номер животн. MUC1 TERT
число IFN-γ пятен/106 спленоцитов # IFN-γ+ CD8+ T-клеток/
1e6 CD8+ T-клеток
IgG-титр Число IFN-γ пятен/106 спленоцитов число IFN-γ+ CD8+ T-клеток/ 1e6 CD8+ T-клеток
Плазмида 1270 5001 813 1024,4 10725,8 307 436,9
5002 2778 14740,6 27090,7 1573 423,0
5003 217 1198,7 19339,6 1687 40680,3
5004 298 исключено 3980,3 252 805,3
5501 2287 6255,7 16278,9 692 0,0
5502 760 0,0 6496,2 3010 13302,0
5503 1315 199,8 6446,4 3702 7259,3
5504 500 281,8 39868,0 2005 13727,8
Плазмида 1271 6001 1037 0,0 11770,3 2937 63106,1
6002 185 0,0 13925,4 1295 194,8
6003 372 267,4 15439,7 2138 46023,2
6004 203 97,1 10530,7 1562 8424,0
6501 1315 2137,3 43487,3 3794 20358,2
6502 1008 179,2 8742,0 2955 1503,5
6503 552 226,4 35183,4 1797 50008,6
6504 2200 162,8 35539,9 4402 24058,6
Плазмида 1269 7001 193 0,0 14868,3 3320 7321,5
7002 1353 2153,2 7546,6 870 736,2
7003 1253 133,5 21277,4 2750 25827,7
7004 1858 20846,7 10359,9 3230 19664,0
7501 2138 773,6 31272,8 927 332,0
7502 2177 10547,7 16635,5 2640 7527,3
7503 1460 5086,2 5465,1 2362 938,6
7504 922 0,0 38530,4 2875 2949,3

ПРИМЕР 6. ИММУНОГЕННОСТЬ ТРОЙНЫХ АНТИГЕННЫХ КОНСТРУКЦИЙ

Пример 6 иллюстрирует способность тройных антигенных аденовирусных конструкций и вакцинных конструкций на основе нуклеиновых кислот, экспрессирующих нативный полноразмерный мембранно-связанный антиген MUC1 человека (MUC1), цитозольный антиген MSLN человека (cMSLN) и усеченный (Δ240) цитозольный антиген TERT человека (TERTΔ240 или TERTΔ541) индуцировать Ag-специфичные Т-и В-клеточные ответы на все три кодированных раковых антигена.

Исследование иммунного ответа у мышей C57BL/6J с использованием электропорации

План клинического исследования. 48 самок мышей C57BL/6J иммунизировали тройными антигенными ДНК-конструкциями, кодирующими MUC1, cMSLN и TERTΔ240 человека. Тройную антигенную ДНК-вакцину (100 мкг) вводили путем двусторонней внутримышечной инъекции (всего 20 мкл в каждую переднюю большеберцовую мышцу) сопутствующей электропорацией в режиме праймирования/стимуляции с интервалом две недели между вакцинациями. MUC1-, MSLN- и TERT-специфические клеточные ответы, и MUC1- и MSLN-специфические гуморальные ответы измеряли через 7 дней после последней иммунизации в анализе IFN-γ ELISpot и ELISA, соответственно. В общей сложности шесть различных тройных антигенных ДНК-конструкций, кодирующих все три антигена, связанных пептидами 2А, использовали следующим образом: MUC1-2A-cMSLN-2A-TERTΔ240 (плазмида 1317), MUC1-2A-TERTΔ240-2A-cMSLN (плазмида 1318), cMSLN-2A-MUC1-2A-TERTΔ240 (плазмида 1319), cMSLN-2A-TERTΔ240-2A-MUC1 (плазмида 1320), TERTΔ240-2A-cMSLN-2A-MUC1 (плазмида 1321), TERTΔ240-2A-MUC1-2A-cMSLN (плазмида 1322) (см. также Таблицу конструкций).

Результаты. В таблице 11 приведены данные ELISpot для спленоцитов C57BL/6J, культивированных с пептидными пулами, полученными из библиотек пептидов MUC1, MSLN и TERT (см. также таблицу пептидных пулов (Таблица 18) и Таблицы 15-17), и данные ELISA сыворотки C57BL/6J мышей. Положительный ответ определяли как имеющий SFC > 100 и IgG титры > 99. Числа в столбце 3, 5 и 7 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пептидными пулами MUC1, MSLN и TERT и вычитания фона, соответственно. Числа, выделенные жирным шрифтом, указывают на то, что по крайней мере 1 исследованный пептидный пул был слишком велик для подсчета, поэтому истинной цифрой является по крайней мере указанное значение. Числа в столбцах 4 и 6 представляют собой титр антитела IgG против MUC1 и MSLN (оптическая плотность (O.D)=1, предел детекции (L.O.D)=99,0). Как показано в таблице 11, иммуногенные полипептиды MUC1, MSLN и TERT, полученные с помощью тройных антигенных MUC1-, MSLN- и TERT-экспрессирующих конструкций, способны индуцировать Т-клеточные ответы против всех трех антигенов, и В-клеточные ответы против MUC1; напротив, только тройные антигенные конструкции плазмид 1317, 1318 и 1322 способны индуцировать В-клеточные ответы против MSLN.

Таблица 11. T- и B-клеточные ответы, индуцированные тройными антигенными ДНК-конструкциями (1317-1322), кодирующими нативный полноразмерный мембрано-связанный антиген MUC1 человека, цитозольный MSLN человека и усеченный (Δ240) цитозольный TERT человека, у мышей C57BL/6J
ID констр. Животн. MUC1 MSLN TERT
Число IFN-γ пятен/106 спленоц. IgG-титр число IFN-γ пятен/106 спленоц. IgG-титр число IFN-γ пятен/106 спленоц.
Плазмида 1317 1 1433 1772,7 369 3069,8 2920
2 1979 5214,6 2764 9420,3 3133
3 1729 3229,9 464 6205,6 2413
4 1570 3220,1 1108 3892,8 3255
5 1023 3837,1 497 11621,6 2293
6 1509 5573,0 898 2804,0 2817
7 1095 3905,2 163 1745,6 2311
8 1778 5147,2 2140 7709,5 3233
Плазмида 1319 9 842 7873,1 652 99,0 2875
10 1443 8987,3 760 99,0 3652
11 2832 7789,4 343 99,0 3510
12 1797 13430,0 603 99,0 3863
13 1351 9923,4 901 99,0 3443
14 1626 3242,3 917 99,0 3541
15 829 7361,0 563 99,0 3003
16 1165 6143,4 871 99,0 3080
Плазмида 1318 17 475 1352,7 160 194,3 704
18 1027 6933,6 188 99,0 2413
19 1424 1886,9 557 213,2 2244
20 2241 3864,1 597 326,3 2799
21 1447 5095,6 240 1926,4 2787
22 789 3992,6 116 1198,2 2455
23 700 4968,0 195 3040,2 2221
24 1584 5403,9 231 3017,3 3310
Плазмида 1320 25 2043 4173,3 908 99,0 4896
26 2307 4158,6 1609 99,0 4532
27 2271 10258,5 1281 99,0 3807
28 829 6768,5 243 99,0 2420
29 1355 7163,9 624 99,0 2993
30 1938 7404,1 673 99,0 3214
31 1373 3941,5 386 99,0 3139
32 1581 7843,7 393 99,0 3745
Плазмида 1321 33 964 5579,2 225 99,0 2500
34 690 6364,0 141 99,0 2674
35 923 8861,3 99 99,0 2492
36 767 10270,5 573 99,0 2467
37 1039 3211,9 148 99,0 1785
38 1283 8614,10 308 99,0 2042
39 1929 15147,2 276 99,0 2805
40 529 3581,12 199 99,0 1412
Плазмида 1322 41 1017 5933,07 281 7430,2 2702
42 1936 5333,3 271 112,5 3317
43 1719 3113,3 484 7054,2 3711
44 994 4422,0 254 4499,5 2797
45 1824 3902,0 1710 3246,3 5541
46 1435 1189,9 416 1122,6 4654
47 2430 686,7 613 99,0 4548
48 1931 7288,6 1665 2088,1 4408

Исследование иммунного ответа у мышей C57BL/6J с использованием аденовирусных векторов

План клинического исследования. 36 самок мышей C57BL/6J праймировали тройными антигенными аденовирусными векторами, кодирующими MUC1, цMSLN, и TERTΔ240 или TERTΔ541, в количестве 1е10 вирусных частиц путем внутримышечной инъекции (50 мкл). Через 28 дней животных праймировали тройными антигенными ДНК-конструкциями (50 мкг) двойной внутримышечной (всего 20 мкл в каждую переднюю большеберцовую мышцу) сопутствующей электропорацией. MUC1-, MSLN- и TERT-специфические клеточные ответы, и MUC1- и MSLN-специфические гуморальные ответы измеряли через 7 дней после последней иммунизации в анализе IFN-γ ELISpot и ICS, и в анализе ELISA, соответственно. В общей сложности три тройных антигенных конструкций на основе аденовируса и ДНК, кодирующей MUC1, cMSLN и TERTΔ240, связанные пептидами 2А, и три тройных антигенных конструкций на основе аденовируса и ДНК, кодирующей MUC1, cMSLN и TERTΔ541, связанные пептидами 2А, использовали следующим образом: MUC1-2A-cMSLN-2A-TERTΔ240 (плазмида 1317),cMSLN-2A-MUC1-2A-TERTΔ240 (плазмида 1319),cMSLN-2A-TERTΔ240-2A-MUC1 (плазмида 1320), и MUC1-2A-cMSLN-2A-TERTΔ541 (плазмида 1351), cMSLN-2A-MUC1-2A-TERTΔ541 (плазмида 1352),cMSLN-2A-TERTΔ541-2A-MUC1(плазмида 1353) (см. также Таблицу конструкций).

Результаты. В таблице 12 приведены данные ELISpot для спленоцитов C57BL/6J, культивированных с пептидными пулами, полученными из библиотек пептидов MUC1, MSLN и TERT (см. также таблицу пептидных пулов (Таблица 18) и Таблицы 15-17), данные ICS для спленоцитов C57BL/6J, культурированных с пептидом TERT а.к.1025-1039, и данные ELISA сыворотки C57BL/6J мышей. Положительный ответ определен как имеющий SFC > 100, количество IFN-γ+ CD8+ Т-клеток > 0,1% и IgG-титры > 99. Числа в столбце 3, 5 и 7 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пептидными пулами MUC1, MSLN и TERT и вычитания фона, соответственно. Числа, выделенные жирным шрифтом, указывают на то, что по крайней мере 1 исследованный пул пептидов был слишком велик для подсчета, поэтому истинной цифрой является по крайней мере указанное значение. Числа в столбце 8 представляют число IFN-γ+ CD8+ T клеток/106 CD8+ T клеток после рестимуляции TERT-специфическим пептидом TERT а.к.1025-1039 и вычитания фона. Числа в столбцах 4 и 6 представляют собой титр антитела IgG против MUC1 и MSLN (оптическая плотность (O.D)=1, предел детекции (L.O.D)=99,0). Как показано в таблице 12, иммуногенные полипептиды MUC1, MSLN и TERT, полученные с помощью тройных антигенных MUC1-, MSLN- и TERT-экспрессирующих конструкций, способны индуцировать Т-клеточные ответы против всех трех антигенов, и В-клеточные ответы против MUC1; напротив, только тройные антигенные конструкции 1317 и 1351 способны индуцировать В-клеточные ответы против MSLN.

Таблица 12А. MUC1-специфичные ответы T и B-клеток, индуцированные тройными антигенными конструкциями на основе аденовируса AdC68Y и ДНК (плазмиды 1317, 1319 и 1320), кодирующей нативный полноразмерный мембранно-связанный антиген MUC1 человека, цитозольный антиген MSLN человека и усеченный (Δ240) цитозольный антиген TERT человека, и тройными антигенными конструкциями на основе аденовируса AdC68Y и ДНК (плазмиды 1351-1353), кодирующей нативный полноразмерный мембранно-связанный антиген MUC1 человека, цитозольный антиген MSLN человека и усеченный (Δ541) цитозольный антиген TERT человека, у мышей C57BL/6J
ID конструкции Номер животного MUC1
число IFN-γ пятен/106 спленоцитов IgG-титр
Плазмида 1317 19 3119 11653,4
20 3347 11941,0
21 1712 7287,2
22 3604 14391,7
23 2349 12599,0
24 2457 12969,1
Плазмида 1319 25 1865 15018,2
26 1661 8836,8
27 1657 13335,1
28 1933 17854,1
29 1293 10560,2
30 2035 10477,6
Плазмида 1320 31 2377 2667,4
32 1629 11322,4
33 1632 9562,9
34 1259 7092,0
35 2024 11306,8
36 861 1785,1
Плазмида 1351 37 2615 10253,1
38 1595 13535,4
39 1889 14557,4
40 1869 15470,1
41 1979 11944,4
42 1892 18093,0
Плазмида 1352 43 1593 22002,4
44 2133 11821,6
45 1341 48297,5
46 1673 8682,2
47 1933 11621,7
48 1767 19318,1
Плазмида 1353 49 1859 4826,7
50 1845 3060,0
51 1784 4499,9
52 2209 2940,9
53 2177 7738,32
54 1821 2985,5
Таблица 12B. MSLN-специфичные Т- и B-клеточные ответы, индуцированные тройной антигенной аденовирусной конструкцией на основе AdC68Y и ДНК (плазмиды 1317, 1319 и 1320), кодирующей нативный полноразмерный мембранно-связанный антиген MUC1 человека, цитозольный антиген MSLN человека и усеченный (Δ240) цитозольный антиген TERT человека, и тройной антигенной конструкцией на основе AdC68Y и ДНК (плазмиды 1351-1353), кодирующей нативный полноразмерный мембранно-связанный антиген MUC1 человека, цитозольный антиген MSLN человека и усеченный (Δ541) цитозольный антиген TERT человека, у мышей C57BL/6J
ID конструкции Номер животного MSLN
число IFN-γ пятен/106 спленоцитов IgG-титр
Плазмида 1317 19 856 99,0
20 911 1581,9
21 336 1401,2
22 820 767,3
23 721 99,0
24 1067 99,0
Плазмида 1319 25 708 99,0
26 368 99,0
27 769 99,0
28 1620 99,0
29 880 99,0
30 427 99,0
Плазмида 1320 31 424 99,0
32 399 99,0
33 289 99,0
34 321 99,0
35 540 99,0
36 316 99,0
Плазмида 1351 37 685 99,0
38 804 281,3
39 505 155,8
40 333 99,0
41 285 2186,7
42 444 99,0
Плазмида 1352 43 1504 99,0
44 421 99,0
45 1293 99,0
46 581 99,0
47 747 99,0
48 821 99,0
Плазмида 1353 49 984 99,0
50 740 99,0
51 412 99,0
52 1266 99,0
53 764 99,0
54 432 99,0
Таблица 12С. TERT-специфичные Т-клеточные ответы, индуцированные тройными антигенными конструкциями на основе аденовируса AdC68Y и ДНК (плазмиды 1317, 1319 и 1320), кодирующей нативный полноразмерный мембранно-связанный антиген MUC1 человека, цитозольный антиген MSLN человека и усеченный (Δ240) цитозольный антиген TERT человека, и тройными антигенными конструкциями на основе аденовируса AdC68Y и ДНК (плазмиды 1351-1353), кодирующей нативный полноразмерный мембранно-связанный антиген MUC1 человека, цитозольный антиген MSLN человека и усеченный (Δ541) цитозольный антиген TERT человека, у мышей C57BL/6J
ID конструкции Номер животного TERT
число IFN-γ пятен/106 спленоцитов % CD8+ T-клеток, являющихся IFN-γ+
Плазмида 1317 19 5730 4,1
20 4119 2,0
21 4587 4,9
22 5522 4,3
23 5120 3,6
24 4383 4,5
Плазмида 1319 25 4995 3,1
26 4628 7,1
27 2892 2,7
28 4977 4,7
29 3913 5,2
30 3153 2,9
Плазмида 1320 31 3732 3,6
32 4308 4,3
33 4153 1,4
34 5067 5,2
35 5351 5,1
36 3268 5,0
Плазмида 1351 37 3766 2,4
38 5805 7,7
39 4391 4,7
40 3401 2,7
41 3874 4,0
42 3260 2,5
Плазмида 1352 43 5235 5,0
44 2853 3,4
45 2876 3,5
46 2610 3,3
47 3275 2,8
48 3009 3,3
Плазмида 1353 49 5806 9,1
50 6114 6,1
51 4759 6,5
52 5157 4,8
53 3999 2,9
54 4719 3,3

Исследование иммунного ответа у мышей HLA-A24

План клинического исследования. Восемь мышей HLA-A24 смешанных гендерных групп праймировали тройной антигенной аденовирусной конструкцией AdC68Y (плазмида 1317; MUC1-2A-cMSLN-2A-TERTΔ240), кодирующей MUC1, cMSLN и TERTΔ240 человека, в количестве 1е10 вирусных частиц путем внутримышечной инъекции (50 мкл в каждую переднюю большеберцовую мышцу). Через 14 дней животных праймировали тройными антигенными ДНК-конструкциями, 50 мкг (плазмида 1317), кодирующими те же три антигена (20 мкл в каждую переднюю большеберцовую мышцу сопутствующей электропорацией). HLA-A24-рестриктированные MUC1-специфические клеточные ответы измеряли через 7 дней после последней иммунизации в анализе IFN-γ ELISpot.

Результаты. В таблице 13 приведены данные ELISpot для спленоцитов HLA-A24, культивированных с пептидом MUC1 а.к.524-532. Положительный ответ определен как имеющий SFC > 50. Числа в столбце 3 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пулами пептидов MUC1 а.к.524-532 и вычитания фона. Как показано в таблице 13, иммуногенные полипептиды MUC1, полученные из тройной антигенной конструкции 1317, экспрессирующей MUC1, MSLN и TERT, способны индуцировать HLA-A24-рестриктированный MUC1 а.к.524-532-специфические CD8+ Т-клеточные ответы. Важно отметить, что было показано, что Т-клеточные ответы больных раком на пептид MUC1 коррелируют с противоопухолевой эффективностью in vitro(Jochems C et al., Cancer Immunol Immunother (2014) 63:161-174), демонстрируя важность повышения клеточных ответов на этот специфический эпитоп.

Таблица 13. Специфичные T-клеточные ответы против HLA-A24-рестриктированного пептида MUC1 а.к.524-532, индуцированные тройными антигенными ДНК-конструкциями плазмиды 1317 (MUC1-2A-cMSLN-2A-TERTΔ240), кодирующей нативный полноразмерный мембранно-связанный антиген MUC1 человека, цитозольный антиген MSLN человека и усеченный (Δ240) цитозольный антиген TERT человека, у мышей HLA-A24
ID конструкции Номер животного число IFN-γ пятен/106 спленоцитов
Плазмида 1317 89 89
90 289
91 291
92 207
93 83
94 295
95 82
96 100

Исследование иммунного ответа у обезьян

План клинического исследования. 24 китайских макак крабоедов праймировали аденовирусными векторами AdC68Y, кодирующими нативный полноразмерный мембранно-связанный антиген MUC1 (MUC1) человека, цитоплазматический антиген MSLN (цMSLN) человека и усеченный (Δ240) цитозольный антиген TERT человека (TERTΔ240), в количестве 2e11 вирусных частиц путем двусторонней внутримышечной инъекции (всего 1 мкл). Через 28 и 56 дней животных праймировали ДНК, кодирующей те же три антигена, внутримышечно посредством электропорации (всего 2 мкл). Анти-CTLA-4 вводили подкожно на 1-й день (32 мг), 29 (50 мг) и 57 (75 мг). Через 21 дней после последней иммунизации у животных брали кровь, и РВМС и сыворотку выделяли для оценки MUC1-, MSLN- и TERT-специфических клеточных (ELISpot, ICS) и MUC1- и MSLN-специфических гуморальных (ELISA) ответов, соответственно. В общей сложности оценивали три тройных антигенных конструкций на основе аденовируса и ДНК, кодирующей MUC1, cMSLN и TERTΔ240, связанных пептидами 2А: MUC1-2A-cMSLN-2A-TERTΔ240 (плазмида 1317), цMSLN-2A-MUC1-2A-TERTΔ240 (плазмида 1319), и cMSLN-2A-TERTΔ240-2A-MUC1 (плазмида 1320).

Результаты. В таблицах 14А, 14В и 14С приведены данные ELISpot и ICS для PMBC китайского макака крабоеда, культивированных с пептидными пулами, полученными из библиотек пептидов MUC1, MSLN и TERT (см. также таблицу пептидных пулов (Таблица 18) и Таблица 15-17) и данные ELISA сыворотки китайского макака крабоеда. Положительный ответ определен как имеющий SFC > 50, IFN-γ+ CD8+ Т-клетки/1e6 CD8+ Т-клетки > 50 и титры IgG > 99. Числа в столбце 3, 6 и 9 представляют число IFN-γ пятен/106 спленоцитов после рестимуляции пептидными пулами MUC1, MSLN и TERT и вычитания фона. Числа, выделенные жирным шрифтом, указывают на то, что по крайней мере 1 исследованный пул пептидов был слишком велик для подсчета, поэтому истинной цифрой является по крайней мере указанное значение. Числа в столбцах 4, 7 и 10 представляют число IFN-γ+ CD8+ T клеток/106 CD8+ T клеток после рестимуляции пептидными пулами MUC1, MSLN, и TERT, соответственно, и вычитая фона. Числа в столбцах 5 и 8 представляют собой Ig-титр антител против MUC1 и антител против MSLN (оптическая плотность (O.D)=1, предел детекции (L.O.D)=99,0), соответственно. Как показано в таблице 14, иммуногенные полипептиды MUC1, MSLN и TERT, полученные с помощью тройных антигенных MUC1-, MSLN- и TERT-экспрессирующих конструкций, способны индуцировать клеточные ответы против всех трех антигенов, и гуморальные ответы против MUC1. Однако только тройная антигенная конструкция 1317 способна индуцировать значительные MSLN-специфичные В-клеточные ответы.

Таблица 14А. MUC1-специфические T- и B-клеточные ответы, индуцированные тройными антигенными конструкциями на основе аденовируса AdC68Y и ДНК (плазмиды 1317, 1319 и 1320), кодирующей нативный полноразмерный мембранно-связанный антиген MUC1, цитоплазматический антиген MSLN человека и усеченный (Δ240) цитозольный антиген TERT человека, у китайских макак крабоедов
ID конструкции Номер животного MUC1
число IFN-γ пятен/106
спленоцитов
число IFN-γ+ CD8+ T-клеток/1e6 CD8+ T-клеток IgG-титр
Плазмида 1317 4001 1319 0,0 27565,9
4002 2664 48690,6 55784,5
4003 373 322,3 16151,0
4004 1617 8476,8 29970,0
4501 2341 1359,0 24289,1
4502 1157 0,0 21841,4
4503 2286 3071,1 63872,6
4504 1638 2172,4 45515,2
Плазмида 1319 5001 88 0,0 22857,2
5002 1308 0,0 29024,8
5003 294 0,0 13356,0
5004 527 468,8 15029,1
5501 1296 2088,2 44573,6
5502 1377 6624,2 23185,5
5503 1302 0,0 25699,1
5504 2499 10403,1 14456,8
Плазмида 1320 6001 486 0,0 24454,1
6002 1742 412,3 31986,3
6003 1369 1154,9 23966,8
6004 1129 561,6 39738,0
6501 1673 447,4 21119,6
6502 1215 0,0 18092,2
6503 1817 3332,4 16364,6
6504 1212 1157,1 17340,2
Таблица 14B. MSLN-специфические Т-клеточные и В-клеточные ответы, индуцированные тройными антигенными конструкциями на основе аденовируса AdC68Y и ДНК (плазмиды 1317, 1319 и 1320), кодирующей нативный полноразмерный мембранно-связанный антиген MUC1 человека, цитоплазматический антиген MSLN человека и усеченный (Δ240) цитозольный антиген TERT человека, у китайских макак крабоедов
ID конструкции Номер животного MSLN
число IFN-γ пятен/106 спленоцитов # IFN-γ+ CD8+
T-клеток/1e6 CD8+ T-клеток
IgG-титр
Плазмида 1317 4001 1479 3732,4 7683,9
4002 1587 1795,3 6147,4
4003 648 884,7 3197,3
4004 164 0,0 4561,3
4501 2279 15469,0 6350,0
4502 1930 22480,2 11699,5
4503 1234 865,1 19065,6
4504 1543 2348,1 4492,7
Плазмида 1319 5001 258 426,6 99,0
5002 1855 2030,9 232,0
5003 1505 642,8 99,0
5004 1275 2410,4 243,3
5501 282 0,0 99,0
5502 732 558,6 418,4
5503 2070 4529,3 130,9
5504 871 3466,9 99,0
Плазмида
1320
6001 2446 6723,2 1381
6002 1953 3185,0 184,8
6003 2045 4053,7 99,0
6004 395 0,0 419,3
6501 1742 5813,1 322,7
6502 1617 12311,5 99,0
6503 448 0,0 285,6
6504 338 0,0 168,8
Таблица 14C. TERT-специфические T-клеточные ответы, индуцированные тройными антигенными конструкциями на основе аденовируса AdC68Y и ДНК (плазмиды 1317, 1319 и 1320), кодирующей нативный полноразмерный мембранно-связанный антиген MUC1, цитоплазматический антиген MSLN человека и усеченный (Δ240) цитозольный антиген TERT человека, у китайских макак крабоедов
ID конструкции Номер животного TERT
Число IFN-γ пятен/106
спленоцитов
число IFN-γ+ CD8+ T-клеток/1e6 CD8+ T-клеток
Плазмида 1317 4001 1723 8843,8
4002 870 658,1
4003 2128 5976,1
4004 420 0,0
4501 2136 999,1
4502 2342 1195,6
4503 1966 6701,1
4504 2436 6985,5
Плазмида 1319 5001 1018 1724,4
5002 2121 713,8
5003 2184 324,3
5004 822 714,4
5501 462 1851,4
5502 325 692,9
5503 401 0,0
5504 517 0,0
Плазмида 1320 6001 3011 8615,5
6002 2825 2002,0
6003 1489 1235,8
6004 2272 2462,2
6501 2428 1362,2
6502 1875 4649,5
6503 2515 8493,2
6504 2584 5171,0

Таблица 15. Библиотеки пептидов MUC1 человека и соответствующие аминокислотные последовательности
Аминокислотная последовательность Номер пептида SEQ ID NO
MASTPGTQSPFFLLL 1aAS 132
TPGTQSPFFLLLLLT 1bAS 133
TQSPFFLLLLLTVLT 2 134
FFLLLLLTVLTVVTG 3 135
LLLTVLTVVTGSGHA 4 136
VLTVVTGSGHASSTP 5 137
VTGSGHASSTPGGEK 6 138
GHASSTPGGEKETSA 7 139
STPGGEKETSATQRS 8 140
GEKETSATQRSSVPS 9 141
TSATQRSSVPSSTEK 10 142
QRSSVPSSTEKNAVS 11 143
VPSSTEKNAVSMTSS 12 144
TEKNAVSMTSSVLSS 13 145
AVSMTSSVLSSHSPG 14 146
TSSVLSSHSPGSGSS 15 147
LSSHSPGSGSSTTQG 16 148
SPGSGSSTTQGQDVT 17 149
GSSTTQGQDVTLAPA 18 150
TQGQDVTLAPATEPA 19 151
DVTLAPATEPASGSA 20 152
APATEPASGSAATWG 21 153
EPASGSAATWGQDVT 22 154
GSAATWGQDVTSVPV 23 155
TWGQDVTSVPVTRPA 24 156
DVTSVPVTRPALGST 25 157
VPVTRPALGSTTPPA 26 158
RPALGSTTPPAHDVT 27 159
GSTTPPAHDVTSAPD 28 160
PPAHDVTSAPDNKPA 29 161
DVTSAPDNKPAPGST 30 162
APDNKPAPGSTAPPA 31 163
KPAPGSTAPPAHGVT 32 164
GSTAPPAHGVTSAPD 33 165
PPAHGVTSAPDTRPA 34 166
GVTSAPDTRPAPGST 35 167
APDTRPAPGSTAPPA 36 168
RPAPGSTAPPAHGVT 37 169
GVTSAPDTRPALGST 55 170
APDTRPALGSTAPPV 56 171
RPALGSTAPPVHNVT 57 172
GSTAPPVHNVTSASG 58 173
PPVHNVTSASGSASG 59 174
NVTSASGSASGSAST 60 175
ASGSASGSASTLVHN 61 176
ASGSASTLVHNGTSA 62 177
ASTLVHNGTSARATT 63 178
VHNGTSARATTTPAS 64 179
TSARATTTPASKSTP 65 180
ATTTPASKSTPFSIP 66 181
PASKSTPFSIPSHHS 67 182
STPFSIPSHHSDTPT 68 183
SIPSHHSDTPTTLAS 69 184
HHSDTPTTLASHSTK 70 185
TPTTLASHSTKTDAS 71 186
LASHSTKTDASSTHH 72 187
STKTDASSTHHSSVP 73 188
DASSTHHSSVPPLTS 74 189
THHSSVPPLTSSNHS 75 190
SVPPLTSSNHSTSPQ 76 191
LTSSNHSTSPQLSTG 77 192
NHSTSPQLSTGVSFF 78 193
SPQLSTGVSFFFLSF 79 194
STGVSFFFLSFHISN 80 195
SFFFLSFHISNLQFN 81 196
LSFHISNLQFNSSLE 82 197
ISNLQFNSSLEDPST 83 198
QFNSSLEDPSTDYYQ 84 199
SLEDPSTDYYQELQR 85 200
PSTDYYQELQRDISE 86 201
YYQELQRDISEMFLQ 87 202
LQRDISEMFLQIYKQ 88 203
ISEMFLQIYKQGGFL 89 204
FLQIYKQGGFLGLSN 90 205
YKQGGFLGLSNIKFR 91 206
GFLGLSNIKFRPGSV 92X 207
LSNIKFRPGSVVVQL 93X 208
KFRPGSVVVQLTLAF 94X 209
GSVVVQLTLAFREGT 95X 210
VVVQLTLAFREGTIN 95XX 211
QLTLAFREGTINVHD 96 212
AFREGTINVHDVETQ 97 213
GTINVHDVETQFNQY 98 214
VHDVETQFNQYKTEA 99 215
ETQFNQYKTEAASRY 100 216
NQYKTEAASRYNLTI 101 217
TEAASRYNLTISDVS 102 218
SRYNLTISDVSVSDV 103 219
LTISDVSVSDVPFPF 104 220
DVSVSDVPFPFSAQS 105 221
SDVPFPFSAQSGAGV 106 222
FPFSAQSGAGVPGWG 107 223
AQSGAGVPGWGIALL 108 224
AGVPGWGIALLVLVC 109 225
GWGIALLVLVCVLVA 110 226
ALLVLVCVLVALAIV 111 227
LVCVLVALAIVYLIA 112 228
LVALAIVYLIALAVC 113 229
AIVYLIALAVCQCRR 114 230
LIALAVCQCRRKNYG 115 231
AVCQCRRKNYGQLDI 116 232
CRRKNYGQLDIFPAR 117 233
NYGQLDIFPARDTYH 118 234
LDIFPARDTYHPMSE 119 235
PARDTYHPMSEYPTY 120 236
TYHPMSEYPTYHTHG 121 237
MSEYPTYHTHGRYVP 122 238
PTYHTHGRYVPPSST 123 239
THGRYVPPSSTDRSP 124 240
YVPPSSTDRSPYEKV 125 241
SSTDRSPYEKVSAGN 126 242
RSPYEKVSAGNGGSS 127 243
EKVSAGNGGSSLSYT 128 244
AGNGGSSLSYTNPAV 129 245
GSSLSYTNPAVAAAS 130 246
LSYTNPAVAAASANL 131 247

Таблица 16. Пептидные пулы библиотек пептидов MSLN человека и соответствующие аминокислотные последовательности
Аминокислотная последовательность Номер пептида SEQ ID NO
MASLPTARPLLGSCG 1aS 248
TARPLLGSCGTPALG 2 249
LLGSCGTPALGSLLF 3 250
CGTPALGSLLFLLFS 4 251
ALGSLLFLLFSLGWV 5 252
LLFLLFSLGWVQPSR 6 253
LFSLGWVQPSRTLAG 7 254
GWVQPSRTLAGETGQ 8 255
PSRTLAGETGQEAAP 9 256
TLAGETGQEAAPLDG 10X 257
TGQEAAPLDGVLANP 11 258
AAPLDGVLANPPNIS 12 259
DGVLANPPNISSLSP 13 260
ANPPNISSLSPRQLL 14 261
NISSLSPRQLLGFPC 15 262
LSPRQLLGFPCAEVS 16 263
QLLGFPCAEVSGLST 17 264
FPCAEVSGLSTERVR 18 265
EVSGLSTERVRELAV 19 266
LSTERVRELAVALAQ 20 267
RVRELAVALAQKNVK 21 268
LAVALAQKNVKLSTE 22 269
LAQKNVKLSTEQLRC 23 270
NVKLSTEQLRCLAHR 24 271
STEQLRCLAHRLSEP 25 272
LRCLAHRLSEPPEDL 26 273
AHRLSEPPEDLDALP 27 274
SEPPEDLDALPLDLL 28 275
EDLDALPLDLLLFLN 29 276
ALPLDLLLFLNPDAF 30 277
DLLLFLNPDAFSGPQ 31 278
FLNPDAFSGPQACTR 32 279
DAFSGPQACTRFFSR 33 280
GPQACTRFFSRITKA 34 281
CTRFFSRITKANVDL 35 282
FSRITKANVDLLPRG 36 283
TKANVDLLPRGAPER 37 284
VDLLPRGAPERQRLL 38 285
PRGAPERQRLLPAAL 39 286
PERQRLLPAALACWG 40 287
RLLPAALACWGVRGS 41 288
AALACWGVRGSLLSE 42 289
CWGVRGSLLSEADVR 43 290
RGSLLSEADVRALGG 44 291
LSEADVRALGGLACD 45 292
DVRALGGLACDLPGR 46 293
LGGLACDLPGRFVAE 47 294
ACDLPGRFVAESAEV 48 295
PGRFVAESAEVLLPR 49 296
VAESAEVLLPRLVSC 50 297
AEVLLPRLVSCPGPL 51 298
LPRLVSCPGPLDQDQ 52 299
VSCPGPLDQDQQEAA 53 300
GPLDQDQQEAARAAL 54 301
QDQQEAARAALQGGG 55 302
EAARAALQGGGPPYG 56 303
AALQGGGPPYGPPST 57 304
GGGPPYGPPSTWSVS 58 305
PYGPPSTWSVSTMDA 59 306
PSTWSVSTMDALRGL 60 307
SVSTMDALRGLLPVL 61 308
MDALRGLLPVLGQPI 62 309
RGLLPVLGQPIIRSI 63 310
PVLGQPIIRSIPQGI 64 311
QPIIRSIPQGIVAAW 65 312
RSIPQGIVAAWRQRS 66 313
QGIVAAWRQRSSRDP 67 314
AAWRQRSSRDPSWRQ 68 315
QRSSRDPSWRQPERT 69 316
RDPSWRQPERTILRP 70 317
WRQPERTILRPRFRR 71 318
ERTILRPRFRREVEK 72 319
LRPRFRREVEKTACP 73 320
FRREVEKTACPSGKK 74 321
VEKTACPSGKKAREI 75 322
ACPSGKKAREIDESL 76 323
GKKAREIDESLIFYK 77 324
REIDESLIFYKKWEL 78 325
ESLIFYKKWELEACV 79 326
FYKKWELEACVDAAL 80 327
WELEACVDAALLATQ 81 328
ACVDAALLATQMDRV 82 329
AALLATQMDRVNAIP 83 330
ATQMDRVNAIPFTYE 84 331
DRVNAIPFTYEQLDV 85 332
AIPFTYEQLDVLKHK 86 333
TYEQLDVLKHKLDEL 87 334
LDVLKHKLDELYPQG 88 335
KHKLDELYPQGYPES 89 336
DELYPQGYPESVIQH 90 337
PQGYPESVIQHLGYL 91 338
PESVIQHLGYLFLKM 92 339
IQHLGYLFLKMSPED 93 340
GYLFLKMSPEDIRKW 94 341
LKMSPEDIRKWNVTS 95 342
PEDIRKWNVTSLETL 96 343
RKWNVTSLETLKALL 97 344
VTSLETLKALLEVNK 98 345
ETLKALLEVNKGHEM 99 346
ALLEVNKGHEMSPQV 100 347
VNKGHEMSPQVATLI 101 348
HEMSPQVATLIDRFV 102 349
PQVATLIDRFVKGRG 103 350
TLIDRFVKGRGQLDK 104 351
RFVKGRGQLDKDTLD 105 352
GRGQLDKDTLDTLTA 106 353
LDKDTLDTLTAFYPG 107 354
TLDTLTAFYPGYLCS 108 355
LTAFYPGYLCSLSPE 109 356
YPGYLCSLSPEELSS 110 357
LCSLSPEELSSVPPS 111 358
SPEELSSVPPSSIWA 112 359
LSSVPPSSIWAVRPQ 113 360
PPSSIWAVRPQDLDT 114 361
IWAVRPQDLDTCDPR 115 362
RPQDLDTCDPRQLDV 116 363
LDTCDPRQLDVLYPK 117 364
DPRQLDVLYPKARLA 118 365
LDVLYPKARLAFQNM 119 366
YPKARLAFQNMNGSE 120 367
RLAFQNMNGSEYFVK 121 368
QNMNGSEYFVKIQSF 122 369
GSEYFVKIQSFLGGA 123 370
FVKIQSFLGGAPTED 124 371
QSFLGGAPTEDLKAL 125 372
GGAPTEDLKALSQQN 126 373
TEDLKALSQQNVSMD 127 374
KALSQQNVSMDLATF 128 375
QQNVSMDLATFMKLR 129 376
SMDLATFMKLRTDAV 130 377
ATFMKLRTDAVLPLT 131 378
KLRTDAVLPLTVAEV 132 379
DAVLPLTVAEVQKLL 133 380
PLTVAEVQKLLGPHV 134 381
AEVQKLLGPHVEGLK 135 382
KLLGPHVEGLKAEER 136 383
PHVEGLKAEERHRPV 137 384
GLKAEERHRPVRDWI 138 385
EERHRPVRDWILRQR 139 386
RPVRDWILRQRQDDL 140 387
DWILRQRQDDLDTLG 141 388
RQRQDDLDTLGLGLQ 142 389
DDLDTLGLGLQGGIP 143 390
TLGLGLQGGIPNGYL 144 391
GLQGGIPNGYLVLDL 145 392
GIPNGYLVLDLSMQE 146 393
YLVLDLSMQEALSGT 147XX 394
LDLSMQEALSGTPCL 148 395
MQEALSGTPCLLGPG 149 396
LSGTPCLLGPGPVLT 150 397
PCLLGPGPVLTVLAL 151 398
GPGPVLTVLALLLAS 152 399
PVLTVLALLLASTLA 153 400

Таблица 17. Библиотеки пептидов TERT человека и соответствующие аминокислотные последовательности
Аминокислотная последовательность Номер пептида SEQ ID NO
RRGAAPEPERTPVGQ 61 401
APEPERTPVGQGSWA 62 402
ERTPVGQGSWAHPGR 63 403
VGQGSWAHPGRTRGP 64 404
SWAHPGRTRGPSDRG 65 405
PGRTRGPSDRGFCVV 66 406
RGPSDRGFCVVSPAR 67 407
DRGFCVVSPARPAEE 68 408
CVVSPARPAEEATSL 69 409
PARPAEEATSLEGAL 70 410
AEEATSLEGALSGTR 71 411
TSLEGALSGTRHSHP 72 412
GALSGTRHSHPSVGR 73 413
GTRHSHPSVGRQHHA 74 414
SHPSVGRQHHAGPPS 75 415
VGRQHHAGPPSTSRP 76 416
HHAGPPSTSRPPRPW 77 417
PPSTSRPPRPWDTPC 78 418
SRPPRPWDTPCPPVY 79 419
RPWDTPCPPVYAETK 80 420
TPCPPVYAETKHFLY 81 421
PVYAETKHFLYSSGD 82 422
ETKHFLYSSGDKEQL 83 423
FLYSSGDKEQLRPSF 84 424
SGDKEQLRPSFLLSS 85 425
EQLRPSFLLSSLRPS 86 426
PSFLLSSLRPSLTGA 87 427
LSSLRPSLTGARRLV 88 428
RPSLTGARRLVETIF 89 429
TGARRLVETIFLGSR 90 430
RLVETIFLGSRPWMP 91 431
TIFLGSRPWMPGTPR 92 432
GSRPWMPGTPRRLPR 93 433
WMPGTPRRLPRLPQR 94 434
TPRRLPRLPQRYWQM 95 435
LPRLPQRYWQMRPLF 96 436
PQRYWQMRPLFLELL 97 437
WQMRPLFLELLGNHA 98 438
PLFLELLGNHAQCPY 99 439
ELLGNHAQCPYGVLL 100 440
NHAQCPYGVLLKTHC 101 441
CPYGVLLKTHCPLRA 102 442
VLLKTHCPLRAAVTP 103 443
THCPLRAAVTPAAGV 104 444
LRAAVTPAAGVCARE 105 445
VTPAAGVCAREKPQG 106 446
AGVCAREKPQGSVAA 107 447
AREKPQGSVAAPEEE 108 448
PQGSVAAPEEEDTDP 109 449
VAAPEEEDTDPRRLV 110 450
EEEDTDPRRLVQLLR 111 451
TDPRRLVQLLRQHSS 112 452
RLVQLLRQHSSPWQV 113 453
LLRQHSSPWQVYGFV 114 454
HSSPWQVYGFVRACL 115 455
WQVYGFVRACLRRLV 116 456
GFVRACLRRLVPPGL 117 457
ACLRRLVPPGLWGSR 118 458
RLVPPGLWGSRHNER 119 459
PGLWGSRHNERRFLR 120 460
GSRHNERRFLRNTKK 121 461
NERRFLRNTKKFISL 122 462
FLRNTKKFISLGKHA 123 463
TKKFISLGKHAKLSL 124 464
ISLGKHAKLSLQELT 125 465
KHAKLSLQELTWKMS 126 466
LSLQELTWKMSVRDC 127 467
ELTWKMSVRDCAWLR 128 468
KMSVRDCAWLRRSPG 129 469
RDCAWLRRSPGVGCV 130 470
WLRRSPGVGCVPAAE 131 471
SPGVGCVPAAEHRLR 132 472
GCVPAAEHRLREEIL 133 473
AAEHRLREEILAKFL 134 474
RLREEILAKFLHWLM 135 475
EILAKFLHWLMSVYV 136 476
KFLHWLMSVYVVELL 137 477
WLMSVYVVELLRSFF 138 478
VYVVELLRSFFYVTE 139 479
ELLRSFFYVTETTFQ 140 480
SFFYVTETTFQKNRL 141 481
VTETTFQKNRLFFYR 142 482
TFQKNRLFFYRKSVW 143 483
NRLFFYRKSVWSKLQ 144 484
FYRKSVWSKLQSIGI 145 485
SVWSKLQSIGIRQHL 146 486
KLQSIGIRQHLKRVQ 147 487
IGIRQHLKRVQLREL 148 488
QHLKRVQLRELSEAE 149 489
RVQLRELSEAEVRQH 150 490
RELSEAEVRQHREAR 151 491
EAEVRQHREARPALL 152 492
RQHREARPALLTSRL 153 493
EARPALLTSRLRFIP 154 494
ALLTSRLRFIPKPDG 155 495
SRLRFIPKPDGLRPI 156 496
FIPKPDGLRPIVNMD 157 497
PDGLRPIVNMDYVVG 158 498
RPIVNMDYVVGARTF 159 499
NMDYVVGARTFRREK 160 500
VVGARTFRREKRAER 161 501
RTFRREKRAERLTSR 162 502
REKRAERLTSRVKAL 163 503
AERLTSRVKALFSVL 164 504
TSRVKALFSVLNYER 165 505
KALFSVLNYERARRP 166 506
SVLNYERARRPGLLG 167 507
YERARRPGLLGASVL 168 508
RRPGLLGASVLGLDD 169 509
LLGASVLGLDDIHRA 170 510
SVLGLDDIHRAWRTF 171 511
LDDIHRAWRTFVLRV 172 512
HRAWRTFVLRVRAQD 173 513
RTFVLRVRAQDPPPE 174 514
LRVRAQDPPPELYFV 175 515
AQDPPPELYFVKVDV 176 516
PPELYFVKVDVTGAY 177 517
YFVKVDVTGAYDTIP 178 518
VDVTGAYDTIPQDRL 179 519
GAYDTIPQDRLTEVI 180 520
TIPQDRLTEVIASII 181 521
DRLTEVIASIIKPQN 182 522
EVIASIIKPQNTYCV 183 523
SIIKPQNTYCVRRYA 184 524
PQNTYCVRRYAVVQK 185 525
YCVRRYAVVQKAAHG 186 526
RYAVVQKAAHGHVRK 187 527
VQKAAHGHVRKAFKS 188 528
AHGHVRKAFKSHVST 189 529
VRKAFKSHVSTLTDL 190 530
FKSHVSTLTDLQPYM 191 531
VSTLTDLQPYMRQFV 192 532
TDLQPYMRQFVAHLQ 193 533
PYMRQFVAHLQETSP 194 534
QFVAHLQETSPLRDA 195 535
HLQETSPLRDAVVIE 196 536
TSPLRDAVVIEQSSS 197 537
RDAVVIEQSSSLNEA 198 538
VIEQSSSLNEASSGL 199 539
SSSLNEASSGLFDVF 200 540
NEASSGLFDVFLRFM 201 541
SGLFDVFLRFMCHHA 202 542
DVFLRFMCHHAVRIR 203 543
RFMCHHAVRIRGKSY 204 544
HHAVRIRGKSYVQCQ 205 545
RIRGKSYVQCQGIPQ 206 546
KSYVQCQGIPQGSIL 207 547
QCQGIPQGSILSTLL 208 548
IPQGSILSTLLCSLC 209 549
SILSTLLCSLCYGDM 210 550
TLLCSLCYGDMENKL 211 551
SLCYGDMENKLFAGI 212 552
GDMENKLFAGIRRDG 213 553
NKLFAGIRRDGLLLR 214 554
AGIRRDGLLLRLVDD 215 555
RDGLLLRLVDDFLLV 216 556
LLRLVDDFLLVTPHL 217 557
VDDFLLVTPHLTHAK 218 558
LLVTPHLTHAKTFLR 219 559
PHLTHAKTFLRTLVR 220 560
HAKTFLRTLVRGVPE 221 561
FLRTLVRGVPEYGCV 222 562
LVRGVPEYGCVVNLR 223 563
VPEYGCVVNLRKTVV 224 564
GCVVNLRKTVVNFPV 225 565
NLRKTVVNFPVEDEA 226 566
TVVNFPVEDEALGGT 227 567
FPVEDEALGGTAFVQ 228 568
DEALGGTAFVQMPAH 229 569
GGTAFVQMPAHGLFP 230 570
FVQMPAHGLFPWCGL 231 571
PAHGLFPWCGLLLDT 232 572
LFPWCGLLLDTRTLE 233 573
CGLLLDTRTLEVQSD 234 574
LDTRTLEVQSDYSSY 235 575
TLEVQSDYSSYARTS 236 576
QSDYSSYARTSIRAS 237 577
SSYARTSIRASLTFN 238 578
RTSIRASLTFNRGFK 239 579
RASLTFNRGFKAGRN 240 580
TFNRGFKAGRNMRRK 241 581
GFKAGRNMRRKLFGV 242 582
GRNMRRKLFGVLRLK 243 583
RRKLFGVLRLKCHSL 244 584
FGVLRLKCHSLFLDL 245 585
RLKCHSLFLDLQVNS 246 586
HSLFLDLQVNSLQTV 247 587
LDLQVNSLQTVCTNI 248 588
VNSLQTVCTNIYKIL 249 589
QTVCTNIYKILLLQA 250 590
TNIYKILLLQAYRFH 251 591
KILLLQAYRFHACVL 252 592
LQAYRFHACVLQLPF 253 593
RFHACVLQLPFHQQV 254 594
CVLQLPFHQQVWKNP 255 595
LPFHQQVWKNPTFFL 256 596
QQVWKNPTFFLRVIS 257 597
KNPTFFLRVISDTAS 258 598
FFLRVISDTASLCYS 259 599
VISDTASLCYSILKA 260 600
TASLCYSILKAKNAG 261 601
CYSILKAKNAGMSLG 262 602
LKAKNAGMSLGAKGA 263 603
NAGMSLGAKGAAGPL 264 604
SLGAKGAAGPLPSEA 265 605
KGAAGPLPSEAVQWL 266 606
GPLPSEAVQWLCHQA 267 607
SEAVQWLCHQAFLLK 268 608
QWLCHQAFLLKLTRH 269 609
HQAFLLKLTRHRVTY 270 610
LLKLTRHRVTYVPLL 271 611
TRHRVTYVPLLGSLR 272 612
VTYVPLLGSLRTAQT 273 613
PLLGSLRTAQTQLSR 274 614
SLRTAQTQLSRKLPG 275 615
AQTQLSRKLPGTTLT 276 616
LSRKLPGTTLTALEA 277 617
LPGTTLTALEAAANP 278 618
TLTALEAAANPALPS 279 619
LEAAANPALPSDFKT 280 620
AANPALPSDFKTILD 281 621

Таблица 18. Пептидные пулы
Антиген Пептидные пулы
MUC1 116 последовательных 15-мерных пептидов, перекрывающихся по 11 аминокислотам, охватывающим аминокислоты 1-224 и 945-1255 белка-предшественника MUC1 SEQ ID NO:1 (аминокислотная последовательность SEQ ID NO:8)
MSLN 153 последовательных 15-мерных пептидов, перекрывающихся по 11 аминокислотам, охватывающим последовательность всего белка-предшественника MSLN SEQ ID NO:2.
TERT 221 последовательных 15-мерных пептидов, перекрывающихся по 11 аминокислотам, охватывающим последовательность белка TERTΔ240 SEQ ID NO:10 (аминокислоты 239-1132 SEQ ID NO:3 (всего 894 аминокислот (исключая первые 238 аминокислот нативного полноразмерного белка-предшественника TERT SEQ ID NO: 3)

Таблица 19. Пептиды 2A
Пептид 2A Аминокислотная последовательность
FMD2A QTLNFDLLKLAGDVESNPGP
T2A EGRGSLLTCGDVEENPGP
EMC2A HYAGYFADLLIHDIETNPGP
ERA2A QCTNYALLKLAGDVESNPGP
ERB2A TILSEGATNFSLLKLAGDVELNPGP
PT2A ATNFSLLKQAGDVEENPGP

ПРИМЕР 7. КОМБИНАЦИЯ ВАКЦИН С ИММУННЫМИ МОДУЛЯТОРАМИ

Следующий пример приведен для иллюстрации усиленных эффектов ингибирования роста опухоли, когда противораковая вакцина вводилась в комбинации с антителом против антигена цитотоксического Т-лимфоцита (CTLA4) и/или с ингибитором индоламин 2,3-диоксигеназы 1 (IDO1).

Методики исследования.

Мышам BALB-neuT имплантировали в 0-ой день опухолевые клетками TUBO путем подкожной инъекции. Мышам вводили 200 мг/кг 3-(5-фтор-1Н-индол-3-ил) пирролидин-2,5-диона (ингибитор IDO1) или носитель два раза в день на 7-ой день с использованием перорального желудочного зоба. Группам сравнения вводили ложные дозы носителя, начиная с 7-го дня. Определенных мышей иммунизировали на 10-й день исследования аденовирусным вектором, созданным для экспрессии крысиного HER2 (rHER2) (вакцина rHER2), или вектором, лишенным трансгена rHER2 (контрольная вакцина), в количестве 1е10 вирусных частиц внутримышечной инъекцией. Затем, подкожно вводили 250 мкг антитела против CTLA4 (мышиное моноклонального антитела против CTLA-4, клон 9D9) или IgG2-изотип контрольного моноклонального антитела в непосредственной близости от лимфатических узлов, дренирующих место инъекции аденовирусного вектора. Через каждые две недели мышей иммунизировали 100 мкг ДНК-плазмиды, кодирующей rHER2 (вакцина rHER2), или ДНК-плазмиды, лишенной трансгена rHER2 (контрольная вакцина), путем электропорации. После введения ДНК-плазмиды, 250 мкг анти-CTLA4-антитела вводили подкожно в непосредственной близости от лимфатических узлов, дренирующих место инъекции ДНК-плазмиды. Чтобы отслеживать прогрессирование опухоли, объемы подкожной опухоли измеряли два раза в неделю на протяжении всего исследования. Животные с объемами подкожной опухоли, достигающих 2000 мм3 или проявляющие необратимые симптомы заболевания, подвергали эвтаназии.

Результаты.

Объемы подкожных опухолей каждого животного в каждой группе лечения представлены в Таблицах 20-A-20-H.

У мышей, получавших только антитела против CTLA4 или только с ингибитором IDO1, не было эффекта на рост опухоли. Тем не менее, более медленные темпы роста наблюдали у некоторых животных, получавших только вакцину rHER2. У мышей, получавшие вакцину rHER2 в комбинации с антителом против CTLA4, и мыши, получавшие вакцину rHER2 в комбинации с ингибитором IDO1, уменьшалась скорость роста опухоли по сравнению с соответствующими контрольными животными. Ингибирование роста опухолей было наиболее выраженным у мышей, получавших вакцину rHER2, антитело против CTLA4 и ингибитор IDO1.

Таблица 20-A. Объемы подкожных опухолей мышей BALB-neuT, которым вводили вакцину rHER2, изотипичное контрольное антитело и носитель

ID животного
День
Иссл.
001 002 003 004 005 006 007 008 009 010 011 012 013
7 15,28 24,88 25,22 43,22 20,92 23,31 54,61 18,97 15,63 7,26 34,97 23,85 26,51
11 59,85 51,25 32,16 70,17 53,95 33,47 58,64 27,65 23,43 24,93 52,01 30,46 64,37
14 69,49 58,15 44,48 92,14 77,00 48,03 94,39 35,07 28,64 28,73 95,93 60,86 76,06
18 121,53 105,11 69,57 162,26 147,15 89,85 200,97 64,56 54,34 48,57 268,43 62,34 99,72
21 177,93 109,81 78,17 182,61 145,82 106,58 194,34 63,14 71,46 88,39 254,23 83,27 137,39
24 209,82 89,80 80,60 186,71 130,91 120,51 309,21 70,57 101,02 90,27 340,71 80,33 151,06
27 251,78 178,06 145,48 172,65 203,23 132,37 304,55 129,14 107,72 127,13 324,79 113,27 147,59
32 288,46 299,49 182,91 299,93 228,06 119,13 357,37 132,57 171,17 155,00 466,10 139,30 163,84
35 442,65 518,22 233,63 307,12 283,16 209,64 434,25 208,03 213,44 233,02 481,62 260,75 261,80
39 419,12 503,33 442,52 345,36 355,59 231,06 432,68 318,63 315,93 286,47 572,77 298,59 303,23
42 379,48 513,54 449,02 340,25 362,51 254,14 487,55 294,58 349,26 379,28 626,35 286,86 319,48
46 601,65 778,43 637,73 453,39 899,49 292,45 519,25 294,40 531,22 342,83 642,31 445,75 300,56
49 525,83 682,34 768,94 337,45 594,31 291,11 632,67 388,48 639,75 491,05 631,72 408,40 308,73
53 618,09 893,01 932,23 391,25 576,25 280,96 657,04 503,44 829,63 456,57 606,13 491,55 447,34
56 793,23 1309,26 1085,82 411,50 412,62 350,51 750,48 685,26 1125,76 612,29 700,58 616,91 526,88
60 739,94 1422,57 1373,49 551,40 804,04 337,95 707,31 785,59 1195,66 563,75 843,39 638,94 693,70
63 741,90 1467,32 1450,32 446,17 1078,52 366,30 677,67 875,47 1369,64 687,52 845,94 700,93 563,40
66 866,83 1933,07 1695,44 407,94 1033,35 329,52 871,66 1274,41 1664,40 748,11 844,09 755,00 658,18
70 906,91 2055,70 454,26 1128,39 377,46 857,93 1429,06 1902,09 899,02 977,86 1151,34 739,87
74 1050,44 510,24 1176,17 431,46 953,57 1316,47 1008,84 1082,74 1132,80 737,69
77 1053,86 487,54 1454,97 504,43 974,43 1218,43 1062,30 1010,54 809,49
80 1195,52 560,59 1461,63 527,31 1298,82 1316,89 1165,74 1123,06
83 1211,15 591,58 1883,74 529,70 1530,85 1405,59 1132,02 1269,96
88 1999,58 680,13 489,05 1515,67 1704,43 1117,78
91 676,45 468,02 1731,76 1139,45
94 742,06 547,24 1340,71
98 848,97 778,30 1455,98
102 878,51 1299,14 1594,26
105 941,87 1052,06 1687,50
109 1033,39 1954,73
112
116
119
123
130

Таблица 20-В. Объемы подкожных опухолей мышей BALB-neuT, которым вводили вакцину rHER2, анти-CTL4 антитело и носитель

ID животного
День иссл. 014 015 016 017 018 019 020 021 022 023 024 025 026
7 13,95 22,56 18,32 15,62 11,30 23,49 18,30 31,84 9,95 19,57 33,34 16,69 65,80
11 34,59 36,30 43,55 30,54 62,36 47,97 41,74 74,32 25,47 36,62 50,96 29,98 154,10
14 41,04 48,08 62,76 42,47 80,69 57,69 51,46 96,98 43,76 43,28 47,76 38,12 130,87
18 67,89 80,31 110,34 86,72 183,17 111,21 105,15 128,14 61,38 44,66 65,32 95,87 166,62
21 99,74 87,70 116,80 63,01 202,53 131,95 170,80 144,47 74,50 81,06 95,35 96,24 225,45
24 100,18 104,47 126,72 123,72 199,19 174,90 181,60 189,93 79,15 104,51 107,09 138,34 229,64
27 138,24 115,05 170,33 106,01 207,56 164,46 196,44 218,62 82,23 134,48 146,91 157,49 324,63
32 196,50 135,98 189,16 163,10 293,78 208,00 248,90 280,19 114,59 185,61 191,56 183,81 337,93
35 300,50 169,60 305,77 181,56 291,73 245,74 290,40 320,25 111,99 184,88 184,57 176,67 380,74
39 348,00 183,57 256,74 228,53 263,61 223,27 360,65 295,43 100,52 194,95 192,31 190,70 367,56
42 390,91 204,84 371,25 210,94 300,94 254,67 476,59 322,83 133,90 191,45 219,12 210,83 422,25
46 421,06 239,56 459,18 283,40 311,32 342,97 627,22 297,13 153,38 228,26 252,46 338,26 514,20
49 570,42 242,71 444,89 285,69 254,99 300,41 686,74 284,73 156,78 285,33 230,83 351,06 418,01
53 564,06 227,19 491,62 296,54 257,35 357,26 800,42 310,23 193,53 335,75 222,12 356,37 601,40
56 733,33 228,06 627,11 472,36 259,93 418,71 1013,00 302,14 219,62 383,69 241,56 449,13 609,87
60 897,14 267,39 607,90 517,19 312,72 420,79 1308,77 320,64 239,16 515,83 299,24 489,26 749,84
63 1057,26 268,83 660,87 445,35 316,86 483,64 1291,15 287,14 232,50 662,34 282,33 535,65 896,13
66 1300,92 322,12 896,63 481,50 348,28 488,58 1429,48 306,39 233,64 847,54 266,11 657,11 1007,19
70 1405,80 390,93 904,47 478,25 348,24 601,13 1420,89 382,32 315,81 804,92 268,72 760,97 977,72
74 1663,99 530,06 1051,68 520,03 404,21 658,56 367,96 440,99 955,16 344,38 794,70 1421,67
77 1926,01 573,89 1219,67 601,49 470,28 749,73 412,46 464,76 1194,80 329,63 901,75 1329,51
80 739,80 1349,40 718,31 394,95 752,93 420,98 495,99 1263,58 373,06 946,52 1232,01
83 877,75 1653,19 910,62 466,02 820,70 448,59 566,16 1553,21 438,83 942,35 1298,75
88 954,88 1265,55 846,03 937,01 414,87 788,55 1916,96 495,65 1301,75 2002,26
91 961,42 1174,80 866,62 954,49 491,20 846,32 581,42 1283,15
94 1053,93 1399,91 1002,14 1078,80 408,20 933,39 495,83 1539,79
98 1477,19 1785,93 1094,65 1355,24 480,75 1020,62 695,49
102 2005,53 2455,90 1132,60 1506,85 617,31 1196,80 1049,34
105 1137,28 1646,70 558,65 1519,06 973,46
109 1629,53 2411,79 567,21 1927,56 1376,50
112 1610,74 659,07 1331,93
116 1903,32 736,53 2020,97
119 843,09
123 812,58
130

Таблица 20-С. Объемы подкожных опухолей мышей BALB-neuT, которым вводили вакцину rHER2, изотипичное моноклональное антитело и ингибитор IDO1

ID животного
День иссл. 027 028 029 030 031 032 033 034 035 036 037 038 039
7 22,57 18,54 24,25 23,74 62,87 47,26 26,06 19,89 10,02 28,07 9,21 19,87 26,44
11 27,87 26,90 25,69 35,75 109,91 55,24 54,27 30,68 16,48 75,34 18,47 66,24 42,82
14 32,46 29,47 31,95 40,32 144,26 47,57 54,29 58,07 25,83 92,84 31,83 58,95 71,17
18 37,10 57,13 44,48 94,60 278,87 90,96 63,91 74,80 44,97 129,98 43,36 94,67 123,44
21 50,62 96,30 64,33 124,60 392,48 143,92 101,50 73,61 71,45 153,08 63,58 123,83 111,42
24 55,76 109,72 75,91 174,47 438,38 161,19 115,11 79,60 109,91 174,26 64,08 93,15 128,18
27 55,49 118,93 95,32 178,96 542,65 202,58 154,54 105,80 127,26 195,71 79,97 106,00 144,12
32 113,02 157,60 160,49 235,16 717,70 252,81 233,30 127,84 188,83 260,21 93,05 177,97 137,99
35 92,45 185,58 176,42 257,51 786,70 368,98 292,35 142,96 309,08 262,68 119,74 194,95 127,66
39 128,29 276,68 279,74 333,07 937,96 457,17 284,18 216,33 363,62 340,70 113,68 234,56 162,13
42 200,60 308,88 309,27 411,98 1141,65 546,41 378,60 193,55 445,98 279,28 139,47 238,77 171,63
46 245,58 362,11 390,14 554,66 1129,43 699,15 522,13 211,14 579,92 446,04 163,31 271,10 171,35
49 185,53 407,07 389,34 678,29 1357,08 663,42 435,48 199,16 548,74 496,65 256,92 327,15 158,18
53 234,92 572,92 472,69 760,44 1657,89 764,79 576,68 195,14 749,50 403,22 271,69 340,39 179,89
56 315,08 654,90 527,02 970,81 1830,37 918,21 811,53 215,44 1080,73 535,72 398,94 394,64 240,12
60 358,46 802,56 733,00 1126,99 2337,11 943,99 973,45 235,27 1169,89 727,24 431,20 437,25 219,66
63 329,23 988,22 686,07 1326,18 1114,22 1180,40 205,89 1491,79 749,53 706,03 443,52 228,26
66 419,20 1116,22 720,64 1550,51 1367,74 2093,28 183,53 1747,57 1500,11 948,51 536,57 249,72
70 474,17 1374,23 967,99 1760,87 227,05 1478,26 1065,41 623,91 248,73
74 624,62 1772,89 1197,73 2006,03 233,91 1494,91 1316,37 622,88 374,49
77 647,51 1989,96 1262,15 253,71 1990,94 1897,98 714,20 486,35
80 1539,37 247,06 746,30 361,49
83 2002,66 221,28 947,06 470,06
88 302,35 1049,34 607,71
91 283,62 1094,29 584,53
94 240,95 1223,56 707,49
98 267,69 1157,88 819,76
102 332,05 1588,42 1166,09
105
109
112
116
119
123
130

Таблица 20-D. Объемы подкожных опухолей мышей BALB-neuT, которым вводили вакцину rHER2, антитело против CTL4 и ингибитор IDO1

ID животного
День иссл. 040 041 042 043 044 045 046 047 048 049 050 051 052
7 54,10 39,35 23,64 21,18 12,84 21,67 20,25 19,96 25,33 36,98 36,19 31,76 23,13
11 44,01 62,51 25,95 22,00 20,61 29,61 22,93 31,30 54,95 60,31 40,28 64,26 35,48
14 82,71 61,84 44,03 41,17 27,61 39,84 31,52 50,27 53,59 167,13 39,13 71,77 46,37
18 109,42 104,01 70,45 47,24 39,37 43,45 46,45 64,50 96,05 118,82 86,60 117,11 52,67
21 156,97 122,98 122,03 88,69 39,10 79,80 74,00 59,76 126,21 150,23 67,16 106,50 64,01
24 161,80 181,51 136,55 66,17 83,81 80,21 101,01 78,26 212,63 154,56 83,75 155,85 83,60
27 193,79 191,62 257,40 93,98 102,01 129,31 84,05 104,26 160,51 139,11 77,42 167,41 92,72
32 243,54 263,07 273,35 158,04 101,16 150,00 98,57 156,07 255,04 162,11 101,56 203,30 114,82
35 312,75 361,78 504,87 164,62 144,05 120,50 122,05 142,97 316,54 172,90 114,17 218,18 132,22
39 396,82 323,31 582,32 242,63 157,89 232,03 95,33 154,30 425,09 257,83 149,53 267,35 168,35
42 413,28 367,59 663,21 254,92 250,62 281,01 169,40 159,04 427,33 259,24 151,88 259,86 147,14
46 442,03 400,06 833,78 245,54 247,14 265,42 196,92 188,31 582,82 304,99 146,35 227,25 171,42
49 499,68 458,65 692,49 269,68 303,80 298,85 239,11 199,54 582,63 363,70 147,05 184,65 192,15
53 602,85 388,55 832,63 319,74 338,88 350,68 147,19 189,14 683,19 425,27 141,44 180,96 175,06
56 678,49 583,14 1172,40 313,88 375,36 490,44 121,54 250,75 1015,63 421,92 193,75 223,80 167,34
60 716,23 566,05 1993,58 297,92 405,37 488,16 168,02 276,09 1016,18 568,77 192,25 253,13 176,65
63 763,88 694,35 360,21 477,42 576,05 214,59 394,42 1118,06 623,54 160,79 259,78 142,51
66 903,52 896,37 398,70 639,62 743,61 272,91 395,65 1444,51 200,21 264,16 219,92
70 1067,20 981,05 432,21 590,19 768,14 239,03 427,52 1594,41 193,97 320,82 183,68
74 991,59 1190,31 573,68 743,70 903,33 222,29 428,53 1656,59 188,48 308,71 167,55
77 1018,46 1567,97 556,19 716,08 967,81 309,27 484,64 1917,82 194,87 253,57 162,01
80 1195,74 1390,97 574,12 1102,62 277,63 627,19 261,80 367,28 201,87
83 1331,93 1884,11 579,14 1695,16 256,90 690,39 292,88 325,23 199,87
88 772,39 1995,92 276,57 645,27 363,61 379,12 210,81
91 751,29 320,68 626,20 350,28 428,39 224,19
94 1288,49 335,59 627,27 402,96 462,28 238,84
98 1164,73 337,65 830,60 438,33 581,69 298,47
102 1324,12 409,66 1014,27 505,42 602,90 427,80
105 1202,44 467,05 1140,43 521,30 712,86 411,28
109 2079,90 483,78 1218,84 757,14 707,01 544,77
112 579,36 1346,57 607,66 873,67 598,32
116 814,25 1570,94 721,33 1148,33 658,27
119 782,56 1999,79 784,41 1318,46 601,06
123 661,23 664,85 1320,43 626,48
130 1027,75 883,59 1979,35 671,05

Таблица 20-E. Объемы подкожных опухолей мышей BALB-neuT, которым вводили контрольную вакцину, изотипичное моноклональное антитело и носитель

ID животного
Study Day 053 054 055 056 057 058 059 060 061 062 063 064 065
7 15,08 18,70 72,45 17,86 31,00 18,49 33,40 29,51 67,11 24,58 10,81 23,92 19,49
11 58,60 54,25 123,35 30,28 58,33 33,39 50,68 123,50 101,88 40,82 37,88 46,17 54,79
14 66,13 57,25 141,53 59,92 51,27 38,54 69,03 149,25 115,84 59,04 60,55 47,41 60,04
18 100,35 127,83 169,74 108,08 98,62 74,59 93,79 221,58 216,32 66,67 150,77 88,44 96,81
21 104,51 155,77 207,70 135,72 129,89 107,63 104,90 323,75 280,31 81,26 154,01 106,39 153,56
24 164,46 178,17 273,86 194,10 166,70 130,99 108,08 428,86 388,16 121,42 204,26 240,02 179,89
27 173,12 266,11 433,12 274,20 221,81 175,65 208,91 501,03 393,66 143,97 228,35 196,57 262,10
32 240,12 374,31 702,18 390,43 326,57 241,87 243,68 603,91 567,21 223,65 309,24 290,32 450,62
35 372,09 483,08 708,07 543,61 542,74 318,46 343,70 890,20 705,62 251,46 424,33 286,92 397,85
39 455,22 657,38 939,28 588,96 567,05 467,47 473,88 956,11 993,67 395,46 526,97 308,71 620,57
42 585,12 765,03 1120,45 666,99 688,37 555,97 607,03 951,75 1173,89 463,83 672,59 469,69 773,08
46 791,60 1105,75 1323,69 1128,15 1155,17 702,22 789,24 1616,22 1451,45 639,83 934,86 479,77 927,62
49 1097,81 1189,35 2028,49 1236,32 1244,71 1014,51 1016,09 1914,25 2034,67 749,54 1173,78 707,56 1212,93
53 1363,43 1631,61 1657,80 1743,67 1081,25 1316,46 1274,45 1667,48 790,81 1474,56
56 1483,62 1904,26 1771,67 1688,79 1183,68 1311,02 1098,40 1953,44 960,80 1659,31
60 1901,83 2068,50 2061,22 1286,21 2034,92 1705,47 1061,59 1779,08
63 1517,04 1642,50 1308,21
66 1902,74 1940,74 1450,05
70
74
77
80
83
88
91
94
98
102
105
109
112
116
119
123
130

Таблица 20-F Объемы подкожных опухолей мышей BALB-neuT, которым вводили контрольную вакцину, анти-CTLA4 антитело и носитель

ID животного
Study Day 066 067 068 069 070 071 072 073 074 075 076 077 078
7 31,57 16,81 19,84 26,53 31,95 45,30 30,22 15,04 28,27 24,27 18,27 23,86 26,78
11 65,01 42,45 77,71 42,97 36,94 69,07 53,78 18,79 28,90 60,85 35,20 33,73 35,30
14 67,75 52,64 58,52 59,81 51,64 133,54 50,06 18,81 54,38 56,90 38,19 43,61 42,69
18 107,43 80,43 24,77 75,41 120,27 138,58 113,91 32,23 72,21 86,65 63,99 61,86 79,41
21 108,33 122,66 58,44 99,93 115,49 169,67 108,74 33,66 68,85 81,49 66,19 88,88 92,80
24 135,87 142,73 205,72 138,58 195,34 245,58 199,84 38,82 78,26 111,41 115,74 81,24 114,15
27 202,52 136,92 233,44 218,55 257,60 249,39 215,05 76,57 102,07 177,24 146,52 118,63 158,62
32 265,16 246,28 392,99 523,97 289,01 453,52 389,26 119,16 173,75 215,29 168,01 195,78 237,85
35 268,11 307,75 523,86 498,69 338,58 411,31 536,87 158,61 254,89 319,28 282,80 305,00 330,57
39 409,74 488,72 621,93 678,35 518,57 665,59 568,49 234,62 508,87 394,05 315,21 347,86 518,94
42 497,76 579,50 613,71 650,46 604,07 786,51 635,44 267,01 515,71 498,47 474,74 425,11 661,10
46 568,07 779,30 807,17 846,95 842,44 866,45 856,31 300,02 602,44 740,77 583,16 507,16 874,70
49 870,94 998,56 1070,92 1642,07 1027,26 1066,57 957,73 354,92 833,74 770,76 792,40 839,43 1103,46
53 924,06 1547,25 1372,06 2026,49 1295,16 1430,84 1522,16 498,99 1122,50 971,82 967,85 1050,27 1374,42
56 1119,84 1615,70 1971,09 1602,07 1567,94 598,49 1087,10 1101,63 1179,51 1148,98 1930,34
60 1734,81 2275,56 1953,31 2130,99 821,52 1460,04 1371,70 1568,95 1543,35
63 2187,87 881,14 1613,94 1944,88 1672,95
66 1097,85 2080,38 2213,55
70 1476,50
74 1925,13
77
80
83
88
91
94
98
102
105
109
112
116
119
123
130

Таблица 20-G. Объемы подкожных опухолей мышей BALB-neuT, которым вводили контрольную вакцину, изотипичное моноклональное антитело и ингибитор IDO1

ID животного
Study Day 079 080 081 082 083 084 085 086 087 088 089 090 091
7 27,80 36,46 21,11 15,78 34,61 12,22 14,78 20,72 28,62 21,87 32,40 18,45 21,99
11 50,27 46,02 29,32 42,34 66,59 21,18 19,13 51,22 33,59 28,63 52,20 24,65 50,36
14 66,16 39,75 31,22 43,83 99,08 27,42 36,76 53,21 62,59 35,08 54,92 44,31 85,94
18 87,17 73,84 62,25 84,25 115,90 47,77 40,28 81,38 130,43 43,33 77,07 67,44 136,82
21 91,03 75,81 78,22 89,04 182,85 58,23 54,88 135,90 127,97 64,93 113,76 113,10 163,91
24 161,46 100,08 101,79 140,26 284,27 88,35 55,22 110,30 155,81 92,35 169,45 127,09 198,49
27 163,11 125,82 123,19 186,49 361,01 112,48 80,13 147,33 241,15 110,42 171,37 129,44 240,05
32 252,04 251,57 194,14 275,98 541,91 153,38 110,90 184,76 321,37 173,28 301,94 202,21 337,79
35 324,53 262,56 246,60 364,82 598,92 209,97 141,15 244,33 521,30 260,28 306,58 377,96 401,70
39 414,72 434,13 389,39 471,60 671,98 338,06 192,15 328,32 572,30 343,13 512,15 430,30 596,09
42 603,00 551,64 463,99 601,50 820,44 340,52 268,88 441,62 676,89 408,33 574,86 574,25 680,54
46 660,63 696,77 782,22 933,81 997,91 431,11 345,63 682,81 1060,91 604,23 818,67 719,57 909,66
49 685,30 917,68 1138,52 1124,52 1219,32 609,28 470,15 807,07 1164,50 629,55 940,30 942,51 1045,76
53 864,42 1073,56 1288,73 1449,44 1275,84 735,98 547,89 1167,81 1618,54 792,50 1373,25 1139,13 1614,31
56 943,28 1323,69 1631,81 1937,45 2064,17 952,77 893,91 1714,64 1754,98 1128,21 1630,88 1431,28 1471,68
60 1384,35 1653,35 1673,55 1107,86 928,10 1923,35 1918,84 1450,47 1946,29
63 1600,66 2089,13 1682,01 1426,67 938,92 1652,48
66 1776,61 1982,89 1416,50 1198,20 1985,40
70 2186,37 1974,53 1804,46
74 1816,96
77 2039,55
80
83
88
91
94
98
102
105
109
112
116
119
123
130

Таблица 20-H. Объемы подкожных опухолей мышей BALB-neuT, которым вводили контрольную вакцину, анти-CTLA4 антитело и ингибитор IDO1

ID животного
Study Day 092 093 094 095 096 097 098 099 100 101 102 103 104
7 23,50 79,61 37,58 33,69 19,24 51,28 54,39 19,99 17,96 31,15 41,65 32,98 14,52
11 45,95 175,07 60,28 42,51 34,51 127,99 62,57 55,07 51,65 88,69 90,89 44,64 17,86
14 63,89 163,67 77,18 67,42 37,76 116,30 79,39 64,35 48,63 82,68 82,10 61,33 31,37
18 97,30 243,40 197,71 102,33 112,32 153,27 92,24 113,19 68,81 140,37 217,09 87,60 42,00
21 160,23 249,28 155,64 109,24 159,77 171,07 124,87 141,01 104,12 184,89 223,66 124,77 52,28
24 214,44 358,20 178,52 146,05 155,75 189,29 160,00 185,05 133,44 222,78 308,93 149,93 65,39
27 240,41 415,24 198,00 191,28 267,39 298,20 231,41 157,93 191,15 238,17 416,37 211,67 87,13
32 513,57 601,62 385,73 344,44 444,06 376,94 324,54 244,96 328,38 365,22 635,31 358,92 99,41
35 616,99 692,22 389,96 455,32 417,99 484,35 441,24 264,56 333,93 437,71 813,28 385,04 177,23
39 715,16 1023,24 500,83 638,78 601,10 775,30 639,05 308,73 509,92 543,97 905,65 530,66 235,25
42 717,28 1165,74 503,20 815,34 596,80 798,96 795,51 361,27 438,96 638,64 1106,64 673,19 239,49
46 1123,80 1329,85 768,11 1034,27 895,57 1266,07 1001,88 500,68 781,21 813,68 1270,88 827,87 352,48
49 1401,34 1734,62 1016,27 1222,00 945,71 1346,31 1044,92 712,92 1214,73 954,08 1780,32 843,85 571,40
53 1589,06 2021,70 1176,32 1559,52 1296,01 1620,80 1558,21 958,70 1154,16 2036,34 931,60 673,63
56 2311,25 1343,46 1818,39 1465,17 2067,77 1760,94 1195,69 1541,24 1296,52 901,88
60 1631,83 2068,78 1667,99 1626,18 1630,40 1783,77 1468,55 1185,11
63 1969,65 1571,44 1651,73 2028,86 1737,96 1296,69
66 1927,56 1929,80
70
74
77
80
83
88
91
94
98
102
105
109
112
116
119
123
130

ПРЕДВАРИТЕЛЬНЫЙ ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

SEQ ID NO:1. Белок MUC1 изоформа 1 (ссылочный полипептид; Uniprot P15941-1) (человек)

MTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDNRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAATSANL

SEQ ID NO:2. Белок-предшественника мезотелина изоформа 2 (ссылочный полипептид; Uniprot Q13421-3) (человек)

MALPTARPLLGSCGTPALGSLLFLLFSLGWVQPSRTLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALSGTPCLLGPGPVLTVLALLLASTLA

SEQ ID NO:3. Белок TERT изоформа 1 (ссылочный полипептид; Genbank AAD30037, Uniprot O14746-1) (человек)

MPRAPRCRAVRSLLRSHYREVLPLATFVRRLGPQGWRLVQRGDPAAFRALVAQCLVCVPWDARPPPAAPSFRQVSCLKELVARVLQRLCERGAKNVLAFGFALLDGARGGPPEAFTTSVRSYLPNTVTDALRGSGAWGLLLRRVGDDVLVHLLARCALFVLVAPSCAYQVCGPPLYQLGAATQARPPPHASGPRRRLGCERAWNHSVREAGVPLGLPAPGARRRGGSASRSLPLPKRPRRGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVDVTGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:4. AdC68Y пустой

ccatcttcaataatatacctcaaactttttgtgcgcgttaatatgcaaatgaggcgtttgaatttggggaggaagggcggtgattggtcgagggatgagcgaccgttaggggcggggcgagtgacgttttgatgacgtggttgcgaggaggagccagtttgcaagttctcgtgggaaaagtgacgtcaaacgaggtgtggtttgaacacggaaatactcaattttcccgcgctctctgacaggaaatgaggtgtttctgggcggatgcaagtgaaaacgggccattttcgcgcgaaaactgaatgaggaagtgaaaatctgagtaatttcgcgtttatggcagggaggagtatttgccgagggccgagtagactttgaccgattacgtgggggtttcgattaccgtgtttttcacctaaatttccgcgtacggtgtcaaagtccggtgtttttactactgtaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctgtccctatcagtgatagagatctccctatcagtgatagagagtttagtgaaccgtcagatccgctagggtaccgcgatcgcaCctcgagctgatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaccaggtgccgagcctgcgagtgcggagggaagcatgccaggttccagcccgtgtgtgtggatgtgacggaggacctgcgacccgatcatttggtgttgccctgcaccgggacggagttcggttccagcggggaagaatctgactagagtgagtagtgttctggggcgggggaggacctgcatgagggccagaataactgaaatctgtgcttttctgtgtgttgcagcagcatgagcggaagcggctcctttgagggaggggtattcagcccttatctgacggggcgtctcccctcctgggcgggagtgcgtcagaatgtgatgggatccacggtggacggccggcccgtgcagcccgcgaactcttcaaccctgacctatgcaaccctgagctcttcgtcgttggacgcagctgccgccgcagctgctgcatctgccgccagcgccgtgcgcggaatggccatgggcgccggctactacggcactctggtggccaactcgagttccaccaataatcccgccagcctgaacgaggagaagctgttgctgctgatggcccagctcgaggccttgacccagcgcctgggcgagctgacccagcaggtggctcagctgcaggagcagacgcgggccgcggttgccacggtgaaatccaaataaaaaatgaatcaataaataaacggagacggttgttgattttaacacagagtctgaatctttatttgatttttcgcgcgcggtaggccctggaccaccggtctcgatcattgagcacccggtggatcttttccaggacccggtagaggtgggcttggatgttgaggtacatgggcatgagcccgtcccgggggtggaggtagctccattgcagggcctcgtgctcgggggtggtgttgtaaatcacccagtcatagcaggggcgcagggcatggtgttgcacaatatctttgaggaggagactgatggccacgggcagccctttggtgtaggtgtttacaaatctgttgagctgggagggatgcatgcggggggagatgaggtgcatcttggcctggatcttgagattggcgatgttaccgcccagatcccgcctggggttcatgttgtgcaggaccaccagcacggtgtatccggtgcacttggggaatttatcatgcaacttggaagggaaggcgtgaaagaatttggcgacgcctttgtgcccgcccaggttttccatgcactcatccatgatgatggcgatgggcccgtgggcggcggcctgggcaaagacgtttcgggggtcggacacatcatagttgtggtcctgggtgaggtcatcataggccattttaatgaatttggggcggagggtgccggactgggggacaaaggtaccctcgatcccgggggcgtagttcccctcacagatctgcatctcccaggctttgagctcggagggggggatcatgtccacctgcggggcgataaagaacacggtttccggggcgggggagatgagctgggccgaaagcaagttccggagcagctgggacttgccgcagccggtggggccgtagatgaccccgatgaccggctgcaggtggtagttgagggagagacagctgccgtcctcccggaggaggggggccacctcgttcatcatctcgcgcacgtgcatgttctcgcgcaccagttccgccaggaggcgctctccccccagggataggagctcctggagcgaggcgaagtttttcagcggcttgagtccgtcggccatgggcattttggagagggtttgttgcaagagttccaggcggtcccagagctcggtgatgtgctctacggcatctcgatccagcagacctcctcgtttcgcgggttgggacggctgcgggagtagggcaccagacgatgggcgtccagcgcagccagggtccggtccttccagggtcgcagcgtccgcgtcagggtggtctccgtcacggtgaaggggtgcgcgccgggctgggcgcttgcgagggtgcgcttcaggctcatccggctggtcgaaaaccgctcccgatcggcgccctgcgcgtcggccaggtagcaattgaccatgagttcgtagttgagcgcctcggccgcgtggcctttggcgcggagcttacctttggaagtctgcccgcaggcgggacagaggagggacttgagggcgtagagcttgggggcgaggaagacggactcgggggcgtaggcgtccgcgccgcagtgggcgcagacggtctcgcactccacgagccaggtgaggtcgggctggtcggggtcaaaaaccagtttcccgccgttctttttgatgcgtttcttacctttggtctccatgagctcgtgtccccgctgggtgacaaagaggctgtccgtgtccccgtagaccgactttatgggccggtcctcgagcggtgtgccgcggtcctcctcgtagaggaaccccgcccactccgagacgaaagcccgggtccaggccagcacgaaggaggccacgtgggacgggtagcggtcgttgtccaccagcgggtccaccttttccagggtatgcaaacacatgtccccctcgtccacatccaggaaggtgattggcttgtaagtgtaggccacgtgaccgggggtcccggccgggggggtataaaagggtgcgggtccctgctcgtcctcactgtcttccggatcgctgtccaggagcgccagctgttggggtaggtattccctctcgaaggcgggcatgacctcggcactcaggttgtcagtttctagaaacgaggaggatttgatattgacggtgccggcggagatgcctttcaagagcccctcgtccatctggtcagaaaagacgatctttttgttgtcgagcttggtggcgaaggagccgtagagggcgttggagaggagcttggcgatggagcgcatggtctggtttttttccttgtcggcgcgctccttggcggcgatgttgagctgcacgtactcgcgcgccacgcacttccattcggggaagacggtggtcagctcgtcgggcacgattctgacctgccagccccgattatgcagggtgatgaggtccacactggtggccacctcgccgcgcaggggctcattagtccagcagaggcgtccgcccttgcgcgagcagaaggggggcagggggtccagcatgacctcgtcgggggggtcggcatcgatggtgaagatgccgggcaggaggtcggggtcaaagtagctgatggaagtggccagatcgtccagggcagcttgccattcgcgcacggccagcgcgcgctcgtagggactgaggggcgtgccccagggcatgggatgggtaagcgcggaggcgtacatgccgcagatgtcgtagacgtagaggggctcctcgaggatgccgatgtaggtggggtagcagcgccccccgcggatgctggcgcgcacgtagtcatacagctcgtgcgagggggcgaggagccccgggcccaggttggtgcgactgggcttttcggcgcggtagacgatctggcggaaaatggcatgcgagttggaggagatggtgggcctttggaagatgttgaagtgggcgtggggcagtccgaccgagtcgcggatgaagtgggcgtaggagtcttgcagcttggcgacgagctcggcggtgactaggacgtccagagcgcagtagtcgagggtctcctggatgatgtcatacttgagctgtcccttttgtttccacagctcgcggttgagaaggaactcttcgcggtccttccagtactcttcgagggggaacccgtcctgatctgcacggtaagagcctagcatgtagaactggttgacggccttgtaggcgcagcagcccttctccacggggagggcgtaggcctgggcggccttgcgcagggaggtgtgcgtgagggcgaaagtgtccctgaccatgaccttgaggaactggtgcttgaagtcgatatcgtcgcagcccccctgctcccagagctggaagtccgtgcgcttcttgtaggcggggttgggcaaagcgaaagtaacatcgttgaagaggatcttgcccgcgcggggcataaagttgcgagtgatgcggaaaggttggggcacctcggcccggttgttgatgacctgggcggcgagcacgatctcgtcgaagccgttgatgttgtggcccacgatgtagagttccacgaatcgcggacggcccttgacgtggggcagtttcttgagctcctcgtaggtgagctcgtcggggtcgctgagcccgtgctgctcgagcgcccagtcggcgagatgggggttggcgcggaggaaggaagtccagagatccacggccagggcggtttgcagacggtcccggtactgacggaactgctgcccgacggccattttttcgggggtgacgcagtagaaggtgcgggggtccccgtgccagcgatcccatttgagctggagggcgagatcgagggcgagctcgacgagccggtcgtccccggagagtttcatgaccagcatgaaggggacgagctgcttgccgaaggaccccatccaggtgtaggtttccacatcgtaggtgaggaagagcctttcggtgcgaggatgcgagccgatggggaagaactggatctcctgccaccaattggaggaatggctgttgatgtgatggaagtagaaatgccgacggcgcgccgaacactcgtgcttgtgtttatacaagcggccacagtgctcgcaacgctgcacgggatgcacgtgctgcacgagctgtacctgagttcctttgacgaggaatttcagtgggaagtggagtcgtggcgcctgcatctcgtgctgtactacgtcgtggtggtcggcctggccctcttctgcctcgatggtggtcatgctgacgagcccgcgcgggaggcaggtccagacctcggcgcgagcgggtcggagagcgaggacgagggcgcgcaggccggagctgtccagggtcctgagacgctgcggagtcaggtcagtgggcagcggcggcgcgcggttgacttgcaggagtttttccagggcgcgcgggaggtccagatggtacttgatctccaccgcgccattggtggcgacgtcgatggcttgcagggtcccgtgcccctggggtgtgaccaccgtcccccgtttcttcttgggcggctggggcgacgggggcggtgcctcttccatggttagaagcggcggcgaggacgcgcgccgggcggcaggggcggctcggggcccggaggcaggggcggcaggggcacgtcggcgccgcgcgcgggtaggttctggtactgcgcccggagaagactggcgtgagcgacgacgcgacggttgacgtcctggatctgacgcctctgggtgaaggccacgggacccgtgagtttgaacctgaaagagagttcgacagaatcaatctcggtatcgttgacggcggcctgccgcaggatctcttgcacgtcgcccgagttgtcctggtaggcgatctcggtcatgaactgctcgatctcctcctcttgaaggtctccgcggccggcgcgctccacggtggccgcgaggtcgttggagatgcggcccatgagctgcgagaaggcgttcatgcccgcctcgttccagacgcggctgtagaccacgacgccctcgggatcgcGggcgcgcatgaccacctgggcgaggttgagctccacgtggcgcgtgaagaccgcgtagttgcagaggcgctggtagaggtagttgagcgtggtggcgatgtgctcggtgacgaagaaatacatgatccagcggcggagcggcatctcgctgacgtcgcccagcgcctccaaacgttccatggcctcgtaaaagtccacggcgaagttgaaaaactgggagttgcgcgccgagacggtcaactcctcctccagaagacggatgagctcggcgatggtggcgcgcacctcgcgctcgaaggcccccgggagttcctccacttcctcttcttcctcctccactaacatctcttctacttcctcctcaggcggcagtggtggcgggggagggggcctgcgtcgccggcggcgcacgggcagacggtcgatgaagcgctcgatggtctcgccgcgccggcgtcgcatggtctcggtgacggcgcgcccgtcctcgcggggccgcagcgtgaagacgccgccgcgcatctccaggtggccgggggggtccccgttgggcagggagagggcgctgacgatgcatcttatcaattgccccgtagggactccgcgcaaggacctgagcgtctcgagatccacgggatctgaaaaccgctgaacgaaggcttcgagccagtcgcagtcgcaaggtaggctgagcacggtttcttctggcgggtcatgttggttgggagcggggcgggcgatgctgctggtgatgaagttgaaataggcggttctgagacggcggatggtggcgaggagcaccaggtctttgggcccggcttgctggatgcgcagacggtcggccatgccccaggcgtggtcctgacacctggccaggtccttgtagtagtcctgcatgagccgctccacgggcacctcctcctcgcccgcgcggccgtgcatgcgcgtgagcccgaagccgcgctggggctggacgagcgccaggtcggcgacgacgcgctcggcgaggatggcttgctggatctgggtgagggtggtctggaagtcatcaaagtcgacgaagcggtggtaggctccggtgttgatggtgtaggagcagttggccatgacggaccagttgacggtctggtggcccggacgcacgagctcgtggtacttgaggcgcgagtaggcgcgcgtgtcgaagatgtagtcgttgcaggtgcgcaccaggtactggtagccgatgaggaagtgcggcggcggctggcggtagagcggccatcgctcggtggcgggggcgccgggcgcgaggtcctcgagcatggtgcggtggtagccgtagatgtacctggacatccaggtgatgccggcggcggtggtggaggcgcgcgggaactcgcggacgcggttccagatgttgcgcagcggcaggaagtagttcatggtgggcacggtctggcccgtgaggcgcgcgcagtcgtggatgctctatacgggcaaaaacgaaagcggtcagcggctcgactccgtggcctggaggctaagcgaacgggttgggctgcgcgtgtaccccggttcgaatctcgaatcaggctggagccgcagctaacgtggtattggcactcccgtctcgacccaagcctgcaccaaccctccaggatacggaggcgggtcgttttgcaacttttttttggaggccggatgagactagtaagcgcggaaagcggccgaccgcgatggctcgctgccgtagtctggagaagaatcgccagggttgcgttgcggtgtgccccggttcgaggccggccggattccgcggctaacgagggcgtggctgccccgtcgtttccaagaccccatagccagccgacttctccagttacggagcgagcccctcttttgttttgtttgtttttgccagatgcatcccgtactgcggcagatgcgcccccaccaccctccaccgcaacaacagccccctccacagccggcgcttctgcccccgccccagcagcaacttccagccacgaccgccgcggccgccgtgagcggggctggacagagttatgatcaccagctggccttggaagagggcgaggggctggcgcgcctgggggcgtcgtcgccggagcggcacccgcgcgtgcagatgaaaagggacgctcgcgaggcctacgtgcccaagcagaacctgttcagagacaggagcggcgaggagcccgaggagatgcgcgcggcccggttccacgcggggcgggagctgcggcgcggcctggaccgaaagagggtgctgagggacgaggatttcgaggcggacgagctgacggggatcagccccgcgcgcgcgcacgtggccgcggccaacctggtcacggcgtacgagcagaccgtgaaggaggagagcaacttccaaaaatccttcaacaaccacgtgcgcaccctgatcgcgcgcgaggaggtgaccctgggcctgatgcacctgtgggacctgctggaggccatcgtgcagaaccccaccagcaagccgctgacggcgcagctgttcctggtggtgcagcatagtcgggacaacgaagcgttcagggaggcgctgctgaatatcaccgagcccgagggccgctggctcctggacctggtgaacattctgcagagcatcgtggtgcaggagcgcgggctgccgctgtccgagaagctggcggccatcaacttctcggtgctgagtttgggcaagtactacgctaggaagatctacaagaccccgtacgtgcccatagacaaggaggtgaagatcgacgggttttacatgcgcatgaccctgaaagtgctgaccctgagcgacgatctgggggtgtaccgcaacgacaggatgcaccgtgcggtgagcgccagcaggcggcgcgagctgagcgaccaggagctgatgcatagtctgcagcgggccctgaccggggccgggaccgagggggagagctactttgacatgggcgcggacctgcactggcagcccagccgccgggccttggaggcggcggcaggaccctacgtagaagaggtggacgatgaggtggacgaggagggcgagtacctggaagactgatggcgcgaccgtatttttgctagatgcaacaacaacagccacctcctgatcccgcgatgcgggcggcgctgcagagccagccgtccggcattaactcctcggacgattggacccaggccatgcaacgcatcatggcgctgacgacccgcaaccccgaagcctttagacagcagccccaggccaaccggctctcggccatcctggaggccgtggtgccctcgcgctccaaccccacgcacgagaaggtcctggccatcgtgaacgcgctggtggagaacaaggccatccgcggcgacgaggccggcctggtgtacaacgcgctgctggagcgcgtggcccgctacaacagcaccaacgtgcagaccaacctggaccgcatggtgaccgacgtgcgcgaggccgtggcccagcgcgagcggttccaccgcgagtccaacctgggatccatggtggcgctgaacgccttcctcagcacccagcccgccaacgtgccccggggccaggaggactacaccaacttcatcagcgccctgcgcctgatggtgaccgaggtgccccagagcgaggtgtaccagtccgggccggactacttcttccagaccagtcgccagggcttgcagaccgtgaacctgagccaggctttcaagaacttgcagggcctgtggggcgtgcaggccccggtcggggaccgcgcgacggtgtcgagcctgctgacgccgaactcgcgcctgctgctgctgctggtggcccccttcacggacagcggcagcatcaaccgcaactcgtacctgggctacctgattaacctgtaccgcgaggccatcggccaggcgcacgtggacgagcagacctaccaggagatcacccacgtgagccgcgccctgggccaggacgacccgggcaacctggaagccaccctgaactttttgctgaccaaccggtcgcagaagatcccgccccagtacgcgctcagcaccgaggaggagcgcatcctgcgttacgtgcagcagagcgtgggcctgttcctgatgcaggagggggccacccccagcgccgcgctcgacatgaccgcgcgcaacatggagcccagcatgtacgccagcaaccgcccgttcatcaataaactgatggactacttgcatcgggcggccgccatgaactctgactatttcaccaacgccatcctgaatccccactggctcccgccgccggggttctacacgggcgagtacgacatgcccgaccccaatgacgggttcctgtgggacgatgtggacagcagcgtgttctccccccgaccgggtgctaacgagcgccccttgtggaagaaggaaggcagcgaccgacgcccgtcctcggcgctgtccggccgcgagggtgctgccgcggcggtgcccgaggccgccagtcctttcccgagcttgcccttctcgctgaacagtatccgcagcagcgagctgggcaggatcacgcgcccgcgcttgctgggcgaagaggagtacttgaatgactcgctgttgagacccgagcgggagaagaacttccccaataacgggatagaaagcctggtggacaagatgagccgctggaagacgtatgcgcaggagcacagggacgatccccgggcgtcgcagggggccacgagccggggcagcgccgcccgtaaacgccggtggcacgacaggcagcggggacagatgtgggacgatgaggactccgccgacgacagcagcgtgttggacttgggtgggagtggtaacccgttcgctcacctgcgcccccgtatcgggcgcatgatgtaagagaaaccgaaaataaatgatactcaccaaggccatggcgaccagcgtgcgttcgtttcttctctgttgttgttgtatctagtatgatgaggcgtgcgtacccggagggtcctcctccctcgtacgagagcgtgatgcagcaggcgatggcggcggcggcgatgcagcccccgctggaggctccttacgtgcccccgcggtacctggcgcctacggaggggcggaacagcattcgttactcggagctggcacccttgtacgataccacccggttgtacctggtggacaacaagtcggcggacatcgcctcgctgaactaccagaacgaccacagcaacttcctgaccaccgtggtgcagaacaatgacttcacccccacggaggccagcacccagaccatcaactttgacgagcgctcgcggtggggcggccagctgaaaaccatcatgcacaccaacatgcccaacgtgaacgagttcatgtacagcaacaagttcaaggcgcgggtgatggtctcccgcaagacccccaatggggtgacagtgacagaggattatgatggtagtcaggatgagctgaagtatgaatgggtggaatttgagctgcccgaaggcaacttctcggtgaccatgaccatcgacctgatgaacaacgccatcatcgacaattacttggcggtggggcggcagaacggggtgctggagagcgacatcggcgtgaagttcgacactaggaacttcaggctgggctgggaccccgtgaccgagctggtcatgcccggggtgtacaccaacgaggctttccatcccgatattgtcttgctgcccggctgcggggtggacttcaccgagagccgcctcagcaacctgctgggcattcgcaagaggcagcccttccaggaaggcttccagatcatgtacgaggatctggaggggggcaacatccccgcgctcctggatgtcgacgcctatgagaaaagcaaggaggatgcagcagctgaagcaactgcagccgtagctaccgcctctaccgaggtcaggggcgataattttgcaagcgccgcagcagtggcagcggccgaggcggctgaaaccgaaagtaagatagtcattcagccggtggagaaggatagcaagaacaggagctacaacgtactaccggacaagataaacaccgcctaccgcagctggtacctagcctacaactatggcgaccccgagaagggcgtgcgctcctggacgctgctcaccacctcggacgtcacctgcggcgtggagcaagtctactggtcgctgcccgacatgatgcaagacccggtcaccttccgctccacgcgtcaagttagcaactacccggtggtgggcgccgagctcctgcccgtctactccaagagcttcttcaacgagcaggccgtctactcgcagcagctgcgcgccttcacctcgcttacgcacgtcttcaaccgcttccccgagaaccagatcctcgtccgcccgcccgcgcccaccattaccaccgtcagtgaaaacgttcctgctctcacagatcacgggaccctgccgctgcgcagcagtatccggggagtccagcgcgtgaccgttactgacgccagacgccgcacctgcccctacgtctacaaggccctgggcatagtcgcgccgcgcgtcctctcgagccgcaccttctaaatgtccattctcatctcgcccagtaataacaccggttggggcctgcgcgcgcccagcaagatgtacggaggcgctcgccaacgctccacgcaacaccccgtgcgcgtgcgcgggcacttccgcgctccctggggcgccctcaagggccgcgtgcggtcgcgcaccaccgtcgacgacgtgatcgaccaggtggtggccgacgcgcgcaactacacccccgccgccgcgcccgtctccaccgtggacgccgtcatcgacagcgtggtggcCgacgcgcgccggtacgcccgcgccaagagccggcggcggcgcatcgcccggcggcaccggagcacccccgccatgcgcgcggcgcgagccttgctgcgcagggccaggcgcacgggacgcagggccatgctcagggcggccagacgcgcggcttcaggcgccagcgccggcaggacccggagacgcgcggccacggcggcggcagcggccatcgccagcatgtcccgcccgcggcgagggaacgtgtactgggtgcgcgacgccgccaccggtgtgcgcgtgcccgtgcgcacccgcccccctcgcacttgaagatgttcacttcgcgatgttgatgtgtcccagcggcgaggaggatgtccaagcgcaaattcaaggaagagatgctccaggtcatcgcgcctgagatctacggccctgcggtggtgaaggaggaaagaaagccccgcaaaatcaagcgggtcaaaaaggacaaaaaggaagaagaaagtgatgtggacggattggtggagtttgtgcgcgagttcgccccccggcggcgcgtgcagtggcgcgggcggaaggtgcaaccggtgctgagacccggcaccaccgtggtcttcacgcccggcgagcgctccggcaccgcttccaagcgctcctacgacgaggtgtacggggatgatgatattctggagcaggcggccgagcgcctgggcgagtttgcttacggcaagcgcagccgttccgcaccgaaggaagaggcggtgtccatcccgctggaccacggcaaccccacgccgagcctcaagcccgtgaccttgcagcaggtgctgccgaccgcggcgccgcgccgggggttcaagcgcgagggcgaggatctgtaccccaccatgcagctgatggtgcccaagcgccagaagctggaagacgtgctggagaccatgaaggtggacccggacgtgcagcccgaggtcaaggtgcggcccatcaagcaggtggccccgggcctgggcgtgcagaccgtggacatcaagattcccacggagcccatggaaacgcagaccgagcccatgatcaagcccagcaccagcaccatggaggtgcagacggatccctggatgccatcggctcctagtcgaagaccccggcgcaagtacggcgcggccagcctgctgatgcccaactacgcgctgcatccttccatcatccccacgccgggctaccgcggcacgcgcttctaccgcggtcataccagcagccgccgccgcaagaccaccactcgccgccgccgtcgccgcaccgccgctgcaaccacccctgccgccctggtgcggagagtgtaccgccgcggccgcgcacctctgaccctgccgcgcgcgcgctaccacccgagcatcgccatttaaactttcgccTgctttgcagatcaatggccctcacatgccgccttcgcgttcccattacgggctaccgaggaagaaaaccgcgccgtagaaggctggcggggaacgggatgcgtcgccaccaccaccggcggcggcgcgccatcagcaagcggttggggggaggcttcctgcccgcgctgatccccatcatcgccgcggcgatcggggcgatccccggcattgcttccgtggcggtgcaggcctctcagcgccactgagacacacttggaaacatcttgtaataaaccAatggactctgacgctcctggtcctgtgatgtgttttcgtagacagatggaagacatcaatttttcgtccctggctccgcgacacggcacgcggccgttcatgggcacctggagcgacatcggcaccagccaactgaacgggggcgccttcaattggagcagtctctggagcgggcttaagaatttcgggtccacgcttaaaacctatggcagcaaggcgtggaacagcaccacagggcaggcgctgagggataagctgaaagagcagaacttccagcagaaggtggtcgatgggctcgcctcgggcatcaacggggtggtggacctggccaaccaggccgtgcagcggcagatcaacagccgcctggacccggtgccgcccgccggctccgtggagatgccgcaggtggaggaggagctgcctcccctggacaagcggggcgagaagcgaccccgccccgatgcggaggagacgctgctgacgcacacggacgagccgcccccgtacgaggaggcggtgaaactgggtctgcccaccacgcggcccatcgcgcccctggccaccggggtgctgaaacccgaaaagcccgcgaccctggacttgcctcctccccagccttcccgcccctctacagtggctaagcccctgccgccggtggccgtggcccgcgcgcgacccgggggcaccgcccgccctcatgcgaactggcagagcactctgaacagcatcgtgggtctgggagtgcagagtgtgaagcgccgccgctgctattaaacctaccgtagcgcttaacttgcttgtctgtgtgtgtatgtattatgtcgccgccgccgctgtccaccagaaggaggagtgaagaggcgcgtcgccgagttgcaagatggccaccccatcgatgctgccccagtgggcgtacatgcacatcgccggacaggacgcttcggagtacctgagtccgggtctggtgcagtttgcccgcgccacagacacctacttcagtctggggaacaagtttaggaaccccacggtggcgcccacgcacgatgtgaccaccgaccgcagccagcggctgacgctgcgcttcgtgcccgtggaccgcgaggacaacacctactcgtacaaagtgcgctacacgctggccgtgggcgacaaccgcgtgctggacatggccagcacctactttgacatccgcggcgtgctggatcggggccctagcttcaaaccctactccggcaccgcctacaacagtctggcccccaagggagcacccaacacttgtcagtggacatataaagccgatggtgaaactgccacagaaaaaacctatacatatggaaatgcacccgtgcagggcattaacatcacaaaagatggtattcaacttggaactgacaccgatgatcagccaatctacgcagataaaacctatcagcctgaacctcaagtgggtgatgctgaatggcatgacatcactggtactgatgaaaagtatggaggcagagctcttaagcctgataccaaaatgaagccttgttatggttcttttgccaagcctactaataaagaaggaggtcaggcaaatgtgaaaacaggaacaggcactactaaagaatatgacatagacatggctttctttgacaacagaagtgcggctgctgctggcctagctccagaaattgttttgtatactgaaaatgtggatttggaaactccagatacccatattgtatacaaagcaggcacagatgacagcagctcttctattaatttgggtcagcaagccatgcccaacagacctaactacattggtttcagagacaactttatcgggctcatgtactacaacagcactggcaatatgggggtgctggccggtcaggcttctcagctgaatgctgtggttgacttgcaagacagaaacaccgagctgtcctaccagctcttgcttgactctctgggtgacagaacccggtatttcagtatgtggaatcaggcggtggacagctatgatcctgatgtgcgcattattgaaaatcatggtgtggaggatgaacttcccaactattgtttccctctggatgctgttggcagaacagatacttatcagggaattaaggctaatggaactgatcaaaccacatggaccaaagatgacagtgtcaatgatgctaatgagataggcaagggtaatccattcgccatggaaatcaacatccaagccaacctgtggaggaacttcctctacgccaacgtggccctgtacctgcccgactcttacaagtacacgccggccaatgttaccctgcccaccaacaccaacacctacgattacatgaacggccgggtggtggcgccctcgctggtggactcctacatcaacatcggggcgcgctggtcgctggatcccatggacaacgtgaaccccttcaaccaccaccgcaatgcggggctgcgctaccgctccatgctcctgggcaacgggcgctacgtgcccttccacatccaggtgccccagaaatttttcgccatcaagagcctcctgctcctgcccgggtcctacacctacgagtggaacttccgcaaggacgtcaacatgatcctgcagagctccctcggcaacgacctgcgcacggacggggcctccatctccttcaccagcatcaacctctacgccaccttcttccccatggcgcacaacacggcctccacgctcgaggccatgctgcgcaacgacaccaacgaccagtccttcaacgactacctctcggcggccaacatgctctaccccatcccggccaacgccaccaacgtgcccatctccatcccctcgcgcaactgggccgccttccgcggctggtccttcacgcgtctcaagaccaaggagacgccctcgctgggctccgggttcgacccctacttcgtctactcgggctccatcccctacctcgacggcaccttctacctcaaccacaccttcaagaaggtctccatcaccttcgactcctccgtcagctggcccggcaacgaccggctcctgacgcccaacgagttcgaaatcaagcgcaccgtcgacggcgagggctacaacgtggcccagtgcaacatgaccaaggactggttcctggtccagatgctggcccactacaacatcggctaccagggcttctacgtgcccgagggctacaaggaccgcatgtactccttcttccgcaacttccagcccatgagccgccaggtggtggacgaggtcaactacaaggactaccaggccgtcaccctggcctaccagcacaacaactcgggcttcgtcggctacctcgcgcccaccatgcgccagggccagccctaccccgccaactacccctacccgctcatcggcaagagcgccgtcaccagcgtcacccagaaaaagttcctctgcgacagggtcatgtggcgcatccccttctccagcaacttcatgtccatgggcgcgctcaccgacctcggccagaacatgctctatgccaactccgcccacgcgctagacatgaatttcgaagtcgaccccatggatgagtccacccttctctatgttgtcttcgaagtcttcgacgtcgtccgagtgcaccagccccaccgcggcgtcatcgaggccgtctacctgcgcacccccttctcggccggtaacgccaccacctaagctcttgcttcttgcaagccatggccgcgggctccggcgagcaggagctcagggccatcatccgcgacctgggctgcgggccctacttcctgggcaccttcgataagcgcttcccgggattcatggccccgcacaagctggcctgcgccatcgtcaacacggccggccgcgagaccgggggcgagcactggctggccttcgcctggaacccgcgctcgaacacctgctacctcttcgaccccttcgggttctcggacgagcgcctcaagcagatctaccagttcgagtacgagggcctgctgcgccgcagcgccctggccaccgaggaccgctgcgtcaccctggaaaagtccacccagaccgtgcagggtccgcgctcggccgcctgcgggctcttctgctgcatgttcctgcacgccttcgtgcactggcccgaccgccccatggacaagaaccccaccatgaacttgctgacgggggtgcccaacggcatgctccagtcgccccaggtggaacccaccctgcgccgcaaccaggaggcgctctaccgcttcctcaactcccactccgcctactttcgctcccaccgcgcgcgcatcgagaaggccaccgccttcgaccgcatgaatcaagacatgtaaaccgtgtgtgtatgttaaatgtctttaataaacagcactttcatgttacacatgcatctgagatgatttatttagaaatcgaaagggttctgccgggtctcggcatggcccgcgggcagggacacgttgcggaactggtacttggccagccacttgaactcggggatcagcagtttgggcagcggggtgtcggggaaggagtcggtccacagcttccgcgtcagttgcagggcgcccagcaggtcgggcgcggagatcttgaaatcgcagttgggacccgcgttctgcgcgcgggagttgcggtacacggggttgcagcactggaacaccatcagggccgggtgcttcacgctcgccagcaccgtcgcgtcggtgatgctctccacgtcgaggtcctcggcgttggccatcccgaagggggtcatcttgcaggtctgccttcccatggtgggcacgcacccgggcttgtggttgcaatcgcagtgcagggggatcagcatcatctgggcctggtcggcgttcatccccgggtacatggccttcatgaaagcctccaattgcctgaacgcctgctgggccttggctccctcggtgaagaagaccccgcaggacttgctagagaactggttggtggcgcacccggcgtcgtgcacgcagcagcgcgcgtcgttgttggccagctgcaccacgctgcgcccccagcggttctgggtgatcttggcccggtcggggttctccttcagcgcgcgctgcccgttctcgctcgccacatccatctcgatcatgtgctccttctggatcatggtggtcccgtgcaggcaccgcagcttgccctcggcctcggtgcacccgtgcagccacagcgcgcacccggtgcactcccagttcttgtgggcgatctgggaatgcgcgtgcacgaagccctgcaggaagcggcccatcatggtggtcagggtcttgttgctagtgaaggtcagcggaatgccgcggtgctcctcgttgatgtacaggtggcagatgcggcggtacacctcgccctgctcgggcatcagctggaagttggctttcaggtcggtctccacgcggtagcggtccatcagcatagtcatgatttccatacccttctcccaggccgagacgatgggcaggctcatagggttcttcaccatcatcttagcgctagcagccgcggccagggggtcgctctcgtccagggtctcaaagctccgcttgccgtccttctcggtgatccgcaccggggggtagctgaagcccacggccgccagctcctcctcggcctgtctttcgtcctcgctgtcctggctgacgtcctgcaggaccacatgcttggtcttgcggggtttcttcttgggcggcagcggcggcggagatgttggagatggcgagggggagcgcgagttctcgctcaccactactatctcttcctcttcttggtccgaggccacgcggcggtaggtatgtctcttcgggggcagaggcggaggcgacgggctctcgccgccgcgacttggcggatggctggcagagccccttccgcgttcgggggtgcgctcccggcggcgctctgactgacttcctccgcggccggccattgtgttctcctagggaggaacaacaagcatggagactcagccatcgccaacctcgccatctgcccccaccgccgacgagaagcagcagcagcagaatgaaagcttaaccgccccgccgcccagccccgccacctccgacgcggccgtcccagacatgcaagagatggaggaatccatcgagattgacctgggctatgtgacgcccgcggagcacgaggaggagctggcagtgcgcttttcacaagaagagatacaccaagaacagccagagcaggaagcagagaatgagcagagtcaggctgggctcgagcatgacggcgactacctccacctgagcgggggggaggacgcgctcatcaagcatctggcccggcaggccaccatcgtcaaggatgcgctgctcgaccgcaccgaggtgcccctcagcgtggaggagctcagccgcgcctacgagttgaacctcttctcgccgcgcgtgccccccaagcgccagcccaatggcacctgcgagcccaacccgcgcctcaacttctacccggtcttcgcggtgcccgaggccctggccacctaccacatctttttcaagaaccaaaagatccccgtctcctgccgcgccaaccgcacccgcgccgacgcccttttcaacctgggtcccggcgcccgcctacctgatatcgcctccttggaagaggttcccaagatcttcgagggtctgggcagcgacgagactcgggccgcgaacgctctgcaaggagaaggaggagagcatgagcaccacagcgccctggtcgagttggaaggcgacaacgcgcggctggcggtgctcaaacgcacggtcgagctgacccatttcgcctacccggctctgaacctgccccccaaagtcatgagcgcggtcatggaccaggtgctcatcaagcgcgcgtcgcccatctccgaggacgagggcatgcaagactccgaggagggcaagcccgtggtcagcgacgagcagctggcccggtggctgggtcctaatgctagtccccagagtttggaagagcggcgcaaactcatgatggccgtggtcctggtgaccgtggagctggagtgcctgcgccgcttcttcgccgacgcggagaccctgcgcaaggtcgaggagaacctgcactacctcttcaggcacgggttcgtgcgccaggcctgcaagatctccaacgtggagctgaccaacctggtctcctacatgggcatcttgcacgagaaccgcctggggcagaacgtgctgcacaccaccctgcgcggggaggcccggcgcgactacatccgcgactgcgtctacctctacctctgccacacctggcagacgggcatgggcgtgtggcagcagtgtctggaggagcagaacctgaaagagctctgcaagctcctgcagaagaacctcaagggtctgtggaccgggttcgacgagcgcaccaccgcctcggacctggccgacctcattttccccgagcgcctcaggctgacgctgcgcaacggcctgcccgactttatgagccaaagcatgttgcaaaactttcgctctttcatcctcgaacgctccggaatcctgcccgccacctgctccgcgctgccctcggacttcgtgccgctgaccttccgcgagtgccccccgccgctgtggagccactgctacctgctgcgcctggccaactacctggcctaccactcggacgtgatcgaggacgtcagcggcgagggcctgctcgagtgccactgccgctgcaacctctgcacgccgcaccgctccctggcctgcaacccccagctgctgagcgagacccagatcatcggcaccttcgagttgcaagggcccagcgaaggcgagggttcagccgccaaggggggtctgaaactcaccccggggctgtggacctcggcctacttgcgcaagttcgtgcccgaggactaccatcccttcgagatcaggttctacgaggaccaatcccatccgcccaaggccgagctgtcggcctgcgtcatcacccagggggcgatcctggcccaattgcaagccatccagaaatcccgccaagaattcttgctgaaaaagggccgcggggtctacctcgacccccagaccggtgaggagctcaaccccggcttcccccaggatgccccgaggaaacaagaagctgaaagtggagctgccgcccgtggaggatttggaggaagactgggagaacagcagtcaggcagaggaggaggagatggaggaagactgggacagcactcaggcagaggaggacagcctgcaagacagtctggaggaagacgaggaggaggcagaggaggaggtggaagaagcagccgccgccagaccgtcgtcctcggcgggggagaaagcaagcagcacggataccatctccgctccgggtcggggtcccgctcgaccacacagtagatgggacgagaccggacgattcccgaaccccaccacccagaccggtaagaaggagcggcagggatacaagtcctggcgggggcacaaaaacgccatcgtctcctgcttgcaggcctgcgggggcaacatctccttcacccggcgctacctgctcttccaccgcggggtgaactttccccgcaacatcttgcattactaccgtcacctccacagcccctactacttccaagaagaggcagcagcagcagaaaaagaccagcagaaaaccagcagctagaaaatccacagcggcggcagcaggtggactgaggatcgcggcgaacgagccggcgcaaacccgggagctgaggaaccggatctttcccaccctctatgccatcttccagcagagtcgggggcaggagcaggaactgaaagtcaagaaccgttctctgcgctcgctcacccgcagttgtctgtatcacaagagcgaagaccaacttcagcgcactctcgaggacgccgaggctctcttcaacaagtactgcgcgctcactcttaaagagtagcccgcgcccgcccagtcgcagaaaaaggcgggaattacgtcacctgtgcccttcgccctagccgcctccacccatcatcatgagcaaagagattcccacgccttacatgtggagctaccagccccagatgggcctggccgccggtgccgcccaggactactccacccgcatgaattggctcagcgccgggcccgcgatgatctcacgggtgaatgacatccgcgcccaccgaaaccagatactcctagaacagtcagcgctcaccgccacgccccgcaatcacctcaatccgcgtaattggcccgccgccctggtgtaccaggaaattccccagcccacgaccgtactacttccgcgagacgcccaggccgaagtccagctgactaactcaggtgtccagctggcgggcggcgccaccctgtgtcgtcaccgccccgctcagggtataaagcggctggtgatccggggcagaggcacacagctcaacgacgaggtggtgagctcttcgctgggtctgcgacctgacggagtcttccaactcgccggatcggggagatcttccttcacgcctcgtcaggccgtcctgactttggagagttcgtcctcgcagccccgctcgggtggcatcggcactctccagttcgtggaggagttcactccctcggtctacttcaaccccttctccggctcccccggccactacccggacgagttcatcccgaacttcgacgccatcagcgagtcggtggacggctacgattgaatgtcccatggtggcgcagctgacctagctcggcttcgacacctggaccactgccgccgcttccgctgcttcgctcgggatctcgccgagtttgcctactttgagctgcccgaggagcaccctcagggcccggcccacggagtgcggatcgtcgtcgaagggggcctcgactcccacctgcttcggatcttcagccagcgtccgatcctggtcgagcgcgagcaaggacagacccttctgactctgtactgcatctgcaaccaccccggcctgcatgaaagtctttgttgtctgctgtgtactgagtataataaaagctgagatcagcgactactccggacttccgtgtgtTTAAACtcacccccttatccagtgaaataaagatcatattgatgatgattttacagaaataaaaaataatcatttgatttgaaataaagatacaatcatattgatgatttgagtttaacaaaaaaataaagaatcacttacttgaaatctgataccaggtctctgtccatgttttctgccaacaccacttcactcccctcttcccagctctggtactgcaggccccggcgggctgcaaacttcctccacacgctgaaggggatgtcaaattcctcctgtccctcaatcttcattttatcttctatcagatgtccaaaaagcgcgtccgggtggatgatgacttcgaccccgtctacccctacgatgcagacaacgcaccgaccgtgcccttcatcaacccccccttcgtctcttcagatggattccaagagaagcccctgggggtgttgtccctgcgactggccgaccccgtcaccaccaagaacggggaaatcaccctcaagctgggagagggggtggacctcgattcctcgggaaaactcatctccaacacggccaccaaggccgccgcccctctcagtttttccaacaacaccatttcccttaacatggatcaccccttttacactaaagatggaaaattatccttacaagtttctccaccattaaatatactgagaacaagcattctaaacacactagctttaggttttggatcaggtttaggactccgtggctctgccttggcagtacagttagtctctccacttacatttgatactgatggaaacataaagcttaccttagacagaggtttgcatgttacaacaggagatgcaattgaaagcaacataagctgggctaaaggtttaaaatttgaagatggagccatagcaaccaacattggaaatgggttagagtttggaagcagtagtacagaaacaggtgttgatgatgcttacccaatccaagttaaacttggatctggccttagctttgacagtacaggagccataatggctggtaacaaagaagacgataaactcactttgtggacaacacctgatccatcaccaaactgtcaaatactcgcagaaaatgatgcaaaactaacactttgcttgactaaatgtggtagtcaaatactggccactgtgtcagtcttagttgtaggaagtggaaacctaaaccccattactggcaccgtaagcagtgctcaggtgtttctacgttttgatgcaaacggtgttcttttaacagaacattctacactaaaaaaatactgggggtataggcagggagatagcatagatggcactccatataccaatgctgtaggattcatgcccaatttaaaagcttatccaaagtcacaaagttctactactaaaaataatatagtagggcaagtatacatgaatggagatgtttcaaaacctatgcttctcactataaccctcaatggtactgatgacagcaacagtacatattcaatgtcattttcatacacctggactaatggaagctatgttggagcaacatttggggctaactcttataccttctcatacatcgcccaagaatgaacactgtatcccaccctgcatgccaacccttcccaccccactctgtggaacaaactctgaaacacaaaataaaataaagttcaagtgttttattgattcaacagttttacaggattcgagcagttatttttcctccaccctcccaggacatggaatacaccaccctctccccccgcacagccttgaacatctgaatgccattggtgatggacatgcttttggtctccacgttccacacagtttcagagcgagccagtctcgggtcggtcagggagatgaaaccctccgggcactcccgcatctgcacctcacagctcaacagctgaggattgtcctcggtggtcgggatcacggttatctggaagaagcagaagagcggcggtgggaatcatagtccgcgaacgggatcggccggtggtgtcgcatcaggccccgcagcagtcgctgccgccgccgctccgtcaagctgctgctcagggggtccgggtccagggactccctcagcatgatgcccacggccctcagcatcagtcgtctggtgcggcgggcgcagcagcgcatgcggatctcgctcaggtcgctgcagtacgtgcaacacagaaccaccaggttgttcaacagtccatagttcaacacgctccagccgaaactcatcgcgggaaggatgctacccacgtggccgtcgtaccagatcctcaggtaaatcaagtggtgccccctccagaacacgctgcccacgtacatgatctccttgggcatgtggcggttcaccacctcccggtaccacatcaccctctggttgaacatgcagccccggatgatcctgcggaaccacagggccagcaccgccccgcccgccatgcagcgaagagaccccgggtcccggcaatggcaatggaggacccaccgctcgtacccgtggatcatctgggagctgaacaagtctatgttggcacagcacaggcatatgctcatgcatctcttcagcactctcaactcctcgggggtcaaaaccatatcccagggcacggggaactcttgcaggacagcgaaccccgcagaacagggcaatcctcgcacagaacttacattgtgcatggacagggtatcgcaatcaggcagcaccgggtgatcctccaccagagaagcgcgggtctcggtctcctcacagcgtggtaagggggccggccgatacgggtgatggcgggacgcggctgatcgtgttcgcgaccgtgtcatgatgcagttgctttcggacattttcgtacttgctgtagcagaacctggtccgggcgctgcacaccgatcgccggcggcggtctcggcgcttggaacgctcggtgttgaaattgtaaaacagccactctctcagaccgtgcagcagatctagggcctcaggagtgatgaagatcccatcatgcctgatggctctgatcacatcgaccaccgtggaatgggccagacccagccagatgatgcaattttgttgggtttcggtgacggcgggggagggaagaacaggaagaaccatgattaacttttaatccaaacggtctcggagtacttcaaaatgaagatcgcggagatggcacctctcgcccccgctgtgttggtggaaaataacagccaggtcaaaggtgatacggttctcgagatgttccacggtggcttccagcaaagcctccacgcgcacatccagaaacaagacaatagcgaaagcgggagggttctctaattcctcaatcatcatgttacactcctgcaccatccccagataattttcatttttccagccttgaatgattcgaactagttcCtgaggtaaatccaagccagccatgataaagagctcgcgcagagcgccctccaccggcattcttaagcacaccctcataattccaagatattctgctcctggttcacctgcagcagattgacaagcggaatatcaaaatctctgccgcgatccctgagctcctccctcagcaataactgtaagtactctttcatatcctctccgaaatttttagccataggaccaccaggaataagattagggcaagccacagtacagataaaccgaagtcctccccagtgagcattgccaaatgcaagactgctataagcatgctggctagacccggtgatatcttccagataactggacagaaaatcgcccaggcaatttttaagaaaatcaacaaaagaaaaatcctccaggtggacgtttagagcctcgggaacaacgatgaagtaaatgcaagcggtgcgttccagcatggttagttagctgatctgtagaaaaaacaaaaatgaacattaaaccatgctagcctggcgaacaggtgggtaaatcgttctctccagcaccaggcaggccacggggtctccggcgcgaccctcgtaaaaattgtcgctatgattgaaaaccatcacagagagacgttcccggtggccggcgtgaatgattcgacaagatgaatacacccccggaacattggcgtccgcgagtgaaaaaaagcgcccgaggaagcaataaggcactacaatgctcagtctcaagtccagcaaagcgatgccatgcggatgaagcacaaaattctcaggtgcgtacaaaatgtaattactcccctcctgcacaggcagcaaagcccccgatccctccaggtacacatacaaagcctcagcgtccatagcttaccgagcagcagcacacaacaggcgcaagagtcagagaaaggctgagctctaacctgtccacccgctctctgctcaatatatagcccagatctacactgacgtaaaggccaaagtctaaaaatacccgccaaataatcacacacgcccagcacacgcccagaaaccggtgacacactcaaaaaaatacgcgcacttcctcaaacgcccaaaactgccgtcatttccgggttcccacgctacgtcatcaaaacacgactttcaaattccgtcgaccgttaaaaacgtcacccgccccgcccctaacggtcgcccgtctctcagccaatcagcgccccgcatccccaaattcaaacacctcatttgcatattaacgcgcacaaaaagtttgaggtatattattgatgatgg

SEQ ID NO:5. Плазмида 1103 ORF (цMSLN)

atggctagcctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctg

SEQ ID NO:6. Плазмида 1103, полипептид (цMSLN)

MASLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEAL

SEQ ID NO:7. Плазмида 1027 ORF (MUC1)

atggctagcacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctg

SEQ ID NO:8. Плазмида 1027, полипептид (537 а.к.) (MUC1)

MASTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANL

SEQ ID NO:9. Плазмида 1112 ORF (TERT240)

atgggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:10. Плазмида 1112, полипептид (TERT240)

MGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:11. Плазмида 1330 ORF (TERT541)

atggctagcgccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:12. Плазмида 1330, полипептид (TERT541)

MASAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:13. Плазмида 1326 ORF (TERT343)

atggctagcttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:14. Плазмида 1326, полипептид (TERT343)

MASFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:15. Плазмид 1197 ORF (цМUC1)

atggctagcacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctg

SEQ ID NO:16. Плазмида 1197, полипептид) (цМUC1)

MASTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANL

SEQ ID NO:17. Плазмида 1316 ORF

atggctagcctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggatccggcagaatcttcaacgcccactacgccggctacttcgccgacctgctgatccacgacatcgagacaaaccctggccccacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctg

SEQ ID NO:18. Плазмида 1316, полипептид

MASLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALGSGRIFNAHYAGYFADLLIHDIETNPGPTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANL

SEQ ID NO:19. Плазмида 1313 ORF

atggctagcacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggatccggcagaatcttcaacgcccactacgccggctacttcgccgacctgctgatccacgacatcgagacaaaccctggccccctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctg

SEQ ID NO:20. Плазмида 1313, полипептид

MASTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGSGRIFNAHYAGYFADLLIHDIETNPGPLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEAL

SEQ ID NO:21. Плазмида 1159 ORF

atggctagcacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggatccggcgccaccaatttcagcctgctgaaacaggccggcgacgtggaagagaaccctggccctctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctg

SEQ ID NO:22. Плазмида 1159, полипептид

MASTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGSGATNFSLLKQAGDVEENPGPLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEAL

SEQ ID NO:23. Плазмида 1158 ORF

atggctagcctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggatccggcgccaccaatttcagcctgctgaaacaggccggcgacgtggaagagaaccctggccctacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctg

SEQ ID NO:24. Плазмида 1158, полипептид

MASLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALGSGATNFSLLKQAGDVEENPGPTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANL

SEQ ID NO:25. Плазмида 1269 ORF

atggctagcacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggaggctccggcggaggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:26. Плазмида 1269, полипептид

MASTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGGSGGGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:27. Плазмида 1270 ORF

atggctagcacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggatccggcacaatcctgtctgagggcgccaccaacttcagcctgctgaaactggccggcgacgtggaactgaaccctggccctggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:28. Плазмида 1270, полипептид

MASTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGSGTILSEGATNFSLLKLAGDVELNPGPGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:29. Плазмида 1271 ORF

atggctagcggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggacggatccggcacaatcctgtctgagggcgccaccaacttcagcctgctgaaactggccggcgacgtggaactgaaccctggccctacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctg

SEQ ID NO:30. Плазмида 1271, полипептид

MASGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILDGSGTILSEGATNFSLLKLAGDVELNPGPTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANL

SEQ ID NO:31. Плазмида 1286 ORF

atggctagcacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggatccggcacaatcctgtctgagggcgccaccaacttcagcctgctgaaactggccggcgacgtggaactgaaccctggccctggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:32. Плазмида 1286, полипептид

MASTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGSGTILSEGATNFSLLKLAGDVELNPGPGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:33. Плазмида 1287 ORF

atggctagcggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggacggatccggcacaatcctgtctgagggcgccaccaacttcagcctgctgaaactggccggcgacgtggaactgaaccctggccctacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctg

SEQ ID NO:34. Плазмида 1287, полипептид

MASGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILDGSGTILSEGATNFSLLKLAGDVELNPGPTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANL

SEQ ID NO:35. Плазмида 1272 ORF

atggctagcggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggacggatccggcgagggcagaggcagcctgctgacatgtggcgacgtggaagagaaccctggccccctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctg

SEQ ID NO:36. Плазмида 1272, полипептид

MASGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILDGSGEGRGSLLTCGDVEENPGPLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEAL

SEQ ID NO:37. Плазмида 1273 ORF

atggctagcggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggacggaggctccggcggactggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctg

SEQ ID NO:38. Плазмида 1273, полипептид

MASGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILDGGSGGLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEAL

SEQ ID NO:39. Плазмида 1274 ORF

atggctagcctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggatccggcgagggcagaggcagcctgctgacatgtggcgacgtggaagagaaccctggccccggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:40. Плазмида 1274, полипептид

MASLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALGSGEGRGSLLTCGDVEENPGPGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:41. Плазмида 1275 ORF

atggctagcctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggaggctccggcggaggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:42. Плазмида 1275, полипептид

MASLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALGGSGGGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO 43. Плазмида 1317 ORF

atggctagcacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggatccggcagaatcttcaacgcccactacgccggctacttcgccgacctgctgatccacgacatcgagacaaaccctggccccctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggatccggcgagggcagaggcagcctgctgacatgtggcgacgtggaagagaaccctggccccggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO: 44. Плазмида 1317, полипептид

MASTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGSGRIFNAHYAGYFADLLIHDIETNPGPLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALGSGEGRGSLLTCGDVEENPGPGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:45. Плазмида 1318 ORF

atggctagcacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggatccggcacaatcctgtctgagggcgccaccaacttcagcctgctgaaactggccggcgacgtggaactgaaccctggccctggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggacggatccggcgagggcagaggcagcctgctgacatgtggcgacgtggaagagaaccctggccccctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctg

SEQ ID NO:46. Плазмида 1318, полипептид

MASTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGSGTILSEGATNFSLLKLAGDVELNPGPGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILDGSGEGRGSLLTCGDVEENPGPLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEAL

SEQ ID NO:47. Плазмида 1319 ORF

atggctagcctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggatccggcagaatcttcaacgcccactacgccggctacttcgccgacctgctgatccacgacatcgagacaaaccctggccccacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggatccggcacaatcctgtctgagggcgccaccaacttcagcctgctgaaactggccggcgacgtggaactgaaccctggccctggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:48. Плазмида 1319, полипептид

MASLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALGSGRIFNAHYAGYFADLLIHDIETNPGPTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGSGTILSEGATNFSLLKLAGDVELNPGPGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:49. Плазмида 1320 ORF

atggctagcctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggatccggcgagggcagaggcagcctgctgacatgtggcgacgtggaagagaaccctggccccggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggacggatccggcacaatcctgtctgagggcgccaccaacttcagcctgctgaaactggccggcgacgtggaactgaaccctggccctacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctg

SEQ ID NO:50. Плазмида 1320, полипептид

MASLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALGSGEGRGSLLTCGDVEENPGPGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILDGSGTILSEGATNFSLLKLAGDVELNPGPTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANL

SEQ ID NO:51. Плазмида 1321 ORF

atggctagcggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggacggatccggcgagggcagaggcagcctgctgacatgtggcgacgtggaagagaaccctggccccctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggatccggcagaatcttcaacgcccactacgccggctacttcgccgacctgctgatccacgacatcgagacaaaccctggccccacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctg

SEQ ID NO:52. Плазмида 1321, полипептид

MASGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILDGSGEGRGSLLTCGDVEENPGPLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALGSGRIFNAHYAGYFADLLIHDIETNPGPTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANL

SEQ ID NO:53. Плазмида 1322 ORF

atggctagcggagctgccccggagccggagaggacccccgttggccagggatcgtgggcccatccgggacgcaccaggggaccatccgacaggggattctgtgtggtgtcaccggccaggccagcagaagaggcaaccagcctcgagggagcgttgtctggaaccagacattcccacccgtcggtgggccggcagcaccacgcgggaccaccgtccacttccagaccgccacggccatgggacaccccttgcccgcctgtgtatgccgagactaaacacttcctgtactcatccggagacaaggaacagcttcggccgtccttcctcctgtcgtcgctcagaccgagcctgaccggagcacgcagattggtggaaactatcttccttgggtcacgtccgtggatgccaggtaccccacggcgcctcccgcgcctcccacagagatactggcagatgcggcctctgttcctggaattgctgggaaaccacgctcagtgcccgtacggagtcctgctcaagactcactgccctctgagggcggcggtcactccggcggccggagtgtgcgcacgggagaagccccagggaagcgtggcagctccggaagaggaggacaccgatccgcgccgcctcgtgcaacttctgcgccagcactcctcgccctggcaagtctacgggttcgtccgcgcctgcctgcgccgcctggtgccgcctgggctctggggttcccggcataacgagcgccgcttcctgagaaatactaagaagtttatctcacttggaaaacatgccaagttgtcgctgcaagaactcacgtggaagatgtcagtccgcgattgcgcctggctgcgccgctcgccgggcgtcgggtgtgttccagctgcagaacaccgcctgagagaagaaattctggccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggacggatccggcacaatcctgtctgagggcgccaccaacttcagcctgctgaaactggccggcgacgtggaactgaaccctggccctacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggatccggcagaatcttcaacgcccactacgccggctacttcgccgacctgctgatccacgacatcgagacaaaccctggccccctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctg

SEQ ID NO:54. Плазмида 1322, полипептид

MASGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILDGSGTILSEGATNFSLLKLAGDVELNPGPTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGSGRIFNAHYAGYFADLLIHDIETNPGPLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEAL

SEQ ID NO:55. Плазмида 1351 ORF

atggctagcacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggatccggcagaatcttcaacgcccactacgccggctacttcgccgacctgctgatccacgacatcgagacaaaccctggccccctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggatccggcgagggcagaggcagcctgctgacatgtggcgacgtggaagagaaccctggccccgccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:56. Плазмида 1351, полипептид

MASTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGSGRIFNAHYAGYFADLLIHDIETNPGPLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALGSGEGRGSLLTCGDVEENPGPAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:57. Плазмида 1352 ORF

atggctagcctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggatccggcagaatcttcaacgcccactacgccggctacttcgccgacctgctgatccacgacatcgagacaaaccctggccccacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctgggatccggcacaatcctgtctgagggcgccaccaacttcagcctgctgaaactggccggcgacgtggaactgaaccctggccctgccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggac

SEQ ID NO:58. Плазмида 1352, полипептид

MASLAGETGQEAAPLDGVLANPPNISSLSPRQLLGFPCAEVSGLSTERVRELAVALAQKNVKLSTEQLRCLAHRLSEPPEDLDALPLDLLLFLNPDAFSGPQACTRFFSRITKANVDLLPRGAPERQRLLPAALACWGVRGSLLSEADVRALGGLACDLPGRFVAESAEVLLPRLVSCPGPLDQDQQEAARAALQGGGPPYGPPSTWSVSTMDALRGLLPVLGQPIIRSIPQGIVAAWRQRSSRDPSWRQPERTILRPRFRREVEKTACPSGKKAREIDESLIFYKKWELEACVDAALLATQMDRVNAIPFTYEQLDVLKHKLDELYPQGYPESVIQHLGYLFLKMSPEDIRKWNVTSLETLKALLEVNKGHEMSPQVATLIDRFVKGRGQLDKDTLDTLTAFYPGYLCSLSPEELSSVPPSSIWAVRPQDLDTCDPRQLDVLYPKARLAFQNMNGSEYFVKIQSFLGGAPTEDLKALSQQNVSMDLATFMKLRTDAVLPLTVAEVQKLLGPHVEGLKAEERHRPVRDWILRQRQDDLDTLGLGLQGGIPNGYLVLDLSMQEALGSGRIFNAHYAGYFADLLIHDIETNPGPTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSSVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAAASANLGSGTILSEGATNFSLLKLAGDVELNPGPAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVAITGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD

SEQ ID NO:59. Плазмида 1353 ORF

atggctagcctggctggcgagacaggacaggaagccgctcctctggacggcgtgctggccaaccctcccaatatcagcagcctgagccccagacagctgctgggattcccttgtgccgaggtgtccggcctgagcacagagagagtgcgggaactggctgtggccctggcccagaaaaacgtgaagctgagcaccgagcagctgcggtgcctggcccacagactgtctgagcctcccgaggatctggacgccctgcctctggatctgctgctgttcctgaaccccgacgccttcagcggacctcaggcctgcacccggttcttcagcagaatcaccaaggccaacgtggacctgctgcccagaggcgcccctgagagacagagactgctgcctgctgctctggcctgttggggagtgcggggctctctgctgtctgaagctgatgtgcgggccctgggaggcctggcttgtgatctgcctggaagattcgtggccgagagcgccgaagtgctgctgcctagactggtgtcctgtcccggccctctggaccaggatcagcaggaagctgccagagctgctctgcagggcggaggccctccttatggacctcctagcacttggagcgtgtccaccatggatgccctgaggggcctgctgccagtgctgggccagcctatcatcagatccatcccacagggcatcgtggccgcctggcggcagagaagctctagagatccctcttggcggcagcccgagcggacaatcctgcggcccaggtttcggagagaggtggaaaagaccgcctgcccctctggcaagaaggccagagagatcgacgagagcctgatcttctacaagaagtgggagctggaagcctgcgtggacgccgctctgctggccacccagatggacagagtgaacgccatccccttcacctatgagcagctggacgtgctgaagcacaagctggatgagctgtacccccagggctaccccgagagcgtgatccagcacctgggctacctgtttctgaagatgagccccgaggacatccggaagtggaacgtgaccagcctggaaaccctgaaggccctgctggaagtgaacaagggccacgagatgtccccccaggtggccacactgatcgacagattcgtgaagggcagaggccagctggacaaggacaccctggatacactgaccgccttctaccccggctatctgtgcagcctgtcccccgaggaactgagcagcgtgccacctagctctatctgggctgtgcggccccaggacctggatacctgcgatcctagacagctggatgtgctgtatcccaaggcccggctggccttccagaacatgaacggcagcgagtacttcgtgaagatccagtccttcctgggcggagcccctaccgaggacctgaaagctctgagccagcagaacgtgtccatggatctggccacctttatgaagctgcggaccgacgccgtgctgcctctgacagtggctgaggtgcagaaactgctgggcccccatgtggaagggctgaaggccgaagaacggcacagacccgtgcgcgactggatcctgaggcagagacaggatgacctggacacactgggcctgggactgcaggggggcatccctaatggctacctggtgctggacctgagcatgcaggaagccctgggatccggcgagggcagaggcagcctgctgacatgtggcgacgtggaagagaaccctggccccgccaaatttctgcattggctgatgtcagtgtacgtggtcgagctgctgcgctcctttttctacgtcactgagactacctttcaaaagaaccgcctgttcttctaccgcaaatctgtgtggagcaagctgcagtcaatcggcattcgccagcatctgaagagggtgcagctgcgggaactttccgaggcagaagtccgccagcaccgggaggcccggccggcgcttctcacgtcgcgtctgagattcatcccaaagcccgacgggctgaggcctatcgtcaacatggattacgtcgtgggcgctcgcacctttcgccgtgaaaagcgggccgaacgcttgacctcacgggtgaaggccctcttctccgtgctgaactacgagagagcaagacggcctggcctgctgggagcttcggtgctgggactggacgatatccaccgggcttggcggacctttgttctccgggtgagagcccaagaccctccgccggaactgtacttcgtgaaggtggcgatcaccggagcctatgatactattccgcaagatcgactcaccgaagtcatcgcctcgatcatcaaaccgcagaacacttactgcgtcaggcggtacgccgtggtccagaaggccgcgcatggccacgtgagaaaggcgttcaagtcgcacgtgtccactctcaccgacctccagccttacatgaggcaattcgttgcgcatttgcaagagacttcgcccctgagagatgcggtggtcatcgagcagagctccagcctgaacgaagcgagcagcggtctgtttgacgtgttcctccgcttcatgtgtcatcacgcggtgcgaatcaggggaaaatcatacgtgcagtgccagggaatcccacaaggcagcattctgtcgactctcttgtgttccctttgctacggcgatatggaaaacaagctgttcgctgggatcagacgggacgggttgctgctcagactggtggacgacttcctgctggtgactccgcacctcactcacgccaaaacctttctccgcactctggtgaggggagtgccagaatacggctgtgtggtcaatctccggaaaactgtggtgaatttccctgtcgaggatgaggcactcggaggaaccgcatttgtccaaatgccagcacatggcctgttcccatggtgcggtctgctgctggacacccgaactcttgaagtgcagtccgactactccagctatgcccggacgagcatccgcgccagcctcactttcaatcgcggctttaaggccggacgaaacatgcgcagaaagcttttcggagtcctccggcttaaatgccattcgctctttctcgatctccaagtcaattcgctgcagaccgtgtgcacgaacatctacaagatcctgctgctccaagcctaccggttccacgcttgcgtgcttcagctgccgtttcaccaacaggtgtggaagaacccgaccttctttctgcgggtcattagcgatactgcctccctgtgttactcaatcctcaaggcaaagaacgccggaatgtcgctgggtgcgaaaggagccgcgggacctcttcctagcgaagcggtgcagtggctctgccaccaggctttcctcctgaagctgaccaggcacagagtgacctacgtcccgctgctgggctcgctgcgcactgcacagacccagctgtctagaaaactccccggcaccaccctgaccgctctggaagccgccgccaacccagcattgccgtcagatttcaagaccatcttggacggatccggcacaatcctgtctgagggcgccaccaacttcagcctgctgaaactggccggcgacgtggaactgaaccctggccctacccctggaacccagagccccttcttccttctgctgctgctgaccgtgctgactgtcgtgacaggctctggccacgccagctctacacctggcggcgagaaagagacaagcgccacccagagaagcagcgtgccaagcagcaccgagaagaacgccgtgtccatgaccagctccgtgctgagcagccactctcctggcagcggcagcagcacaacacagggccaggatgtgacactggcccctgccacagaacctgcctctggatctgccgccacctggggacaggacgtgacaagcgtgccagtgaccagacctgccctgggctctacaacaccccctgcccacgatgtgaccagcgcccctgataacaagcctgcccctggaagcacagcccctccagctcatggcgtgacctctgccccagataccagaccagccccaggatctacagccccacccgcacacggcgtgacaagtgcccctgacacaagacccgctccaggctctactgctcctcctgcccatggcgtgacaagcgctcccgatacaaggccagctcctggctccacagcaccaccagcacatggcgtgacatcagctcccgacactagacctgctcccggatcaaccgctccaccagctcacggcgtgaccagcgcacctgataccagacctgctctgggaagcaccgcccctcccgtgcacaatgtgacatctgcttccggcagcgccagcggctctgcctctacactggtgcacaacggcaccagcgccagagccacaacaaccccagccagcaagagcacccccttcagcatccctagccaccacagcgacacccctaccacactggccagccactccaccaagaccgatgcctctagcacccaccactccagcgtgccccctctgaccagcagcaaccacagcacaagcccccagctgtctaccggcgtctcattcttctttctgtccttccacatcagcaacctgcagttcaacagcagcctggaagatcccagcaccgactactaccaggaactgcagcgggatatcagcgagatgttcctgcaaatctacaagcagggcggcttcctgggcctgagcaacatcaagttcagacccggcagcgtggtggtgcagctgaccctggctttccgggaaggcaccatcaacgtgcacgacgtggaaacccagttcaaccagtacaagaccgaggccgccagccggtacaacctgaccatctccgatgtgtccgtgtccgacgtgcccttcccattctctgcccagtctggcgcaggcgtgccaggatggggaattgctctgctggtgctcgtgtgcgtgctggtggccctggccatcgtgtatctgattgccctggccgtgtgccagtgccggcggaagaattacggccagctggacatcttccccgccagagacacctaccaccccatgagcgagtaccccacataccacacccacggcagatacgtgccacccagctccaccgacagatccccctacgagaaagtgtctgccggcaacggcggcagctccctgagctacacaaatcctgccgtggccgctgcctccgccaacctg

SEQ ID NO:60. Плазмида 1353, полипептид

MASLAGETGQEAAPLDGVLANPPNISSL