Модулирующие полинуклеотиды



Модулирующие полинуклеотиды
Модулирующие полинуклеотиды
C12N2310/14 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2758488:

ВОЯДЖЕР ТЕРАПЬЮТИКС, ИНК. (US)

Изобретение относится к биотехнологии. Описан модулирующий полинуклеотид для снижения или ингибирования экспрессии гена в клетке, где указанный модулирующий полинуклеотид содержит: (a) стебель и петлю, которые образуют структуру «стебель-петля», (b) первую фланкирующую область, расположенную в направлении 5' от указанной сопровождающей цепи, где указанная первая фланкирующая область содержит 5'-концевую фланкирующую последовательность и 5'-концевую спейсерную последовательность, где первая фланкирующая область содержит нуклеотидную последовательность, которая по меньшей мере на 90% идентична SEQ ID NO:5, и (c) вторую фланкирующую область, расположенную в направлении 3' от указанной направляющей цепи, где указанная вторая фланкирующая область содержит 3'-концевую спейсерную последовательность и 3'-концевую фланкирующую область, где указанная вторая фланкирующая область содержит нуклеотидную последовательность, которая по меньшей мере на 90% идентична SEQ ID NO:21. Изобретение расширяет арсенал средств для лечения заболевания центральной нервной системы (ЦНС). 10 н. и 18 з.п. ф-лы, 2 ил., 4 табл., 4 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА СВЯЗАННЫЕ ЗАЯВКИ

[0001] По настоящей заявке испрашивается приоритет временной патентной заявки США № 62/338137, поданной 18 мая 2016 года, которая озаглавлена «Modulatory Polynucleotides», и временной патентной заявки США № 62/485050, поданной 13 апреля 2017 года, которая озаглавлена «Modulatory Polynucleotides», содержание каждой из которых включено в настоящее описание посредством ссылки во всей их полноте.

ССЫЛКА НА СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

[0002] Настоящую заявку подают вместе со списком последовательностей в электронном формате. Информация о списке последовательностей в электронном формате включена в настоящее описание посредством ссылки в полном объеме.

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

[0003] Изобретение относится к композициям, способам, процессам, наборам и устройствам для разработки, получения, изготовления и/или формулирования модулирующих полинуклеотидов. В некоторых вариантах осуществления такие модулирующие полинуклеотиды можно кодировать с помощью или в рекомбинантных аденоассоциированных вирусах (AAV), и они могут содержать искусственные микроРНК, искусственные пре-микроРНК и/или искусственные первичные микроРНК.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

[0004] МикроРНК (или мкРНК или miR) представляют собой небольшие, некодирующие, одноцепочечные молекулы рибонуклеиновой кислоты (РНК), которые обычно составляют 19-25 нуклеотидов в длину. В геномах млекопитающих идентифицировано больше тысячи микроРНК. Зрелые микроРНК в первую очередь связываются с 3'-нетранслируемой областью (3'-UTR) целевых информационных РНК (мРНК) через частичное или полное образование пар с комплементарными последовательностями целевых мРНК, содействуя разрушению целевых мРНК на посттранскрипционном уровне, и в некоторых случаях, ингибируя инициацию трансляции. МикроРНК играют важную роль во многих ключевых биологических процессах, таких как регуляция клеточного цикла и роста, апоптоз, клеточная пролиферация и развитие тканей.

[0005] Гены мкРНК в целом транскрибируют в виде длинных первичных транскриптов мкРНК (т. е. первичной мкРНК). Первичная мкРНК расщепляется на предшественник мкРНК (т. е. пре-мкРНК), который дополнительно проходит процессинг для формирования зрелой и функциональной мкРНК.

[0006] Хотя во многих стратегиях экспрессии мишеней используют модальности на основе нуклеиновых кислот, остается потребность в усовершенствованных модальностях нуклеиновых кислот, которые обладают более высокой специфичностью и менее выраженными эффектами ложной мишени.

[0007] Настоящее изобретение предусматривает такие усовершенствованные модальности в форме искусственных первичных, пре- и зрелых микроРНК конструкций и способы их разработки. Эти новые конструкции могут представлять собой синтетические обособленные молекулы или могут быть закодированы в плазмиде или экспрессирующем векторе для доставки в клетки. Такие векторы включают, но не ограничиваясь этим, аденоассоциированные вирусные векторы, такие как геномы векторов любых из серотипов AAV, или другие вирусные носители доставки, такие как лентивирус и т. д.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

[0008] В настоящем описании описаны композиции, способы, процессы, наборы и устройства для разработки, получения, изготовления и/или формулирования модулирующих полинуклеотидов.

[0009] В некоторых вариантах осуществления такие модулирующие полинуклеотиды можно кодировать с помощью или включать в плазмиды или векторы или рекомбинантные аденоассоциированные вирусы (AAV), и они могут содержать искусственные микроРНК, искусственные пре-микроРНК и/или искусственные первичные микроРНК.

[00010] Подробности о различных вариантах осуществления изобретения изложены в описании далее. Другие признаки, цели и преимущества изобретения будут видны из описания и фиг., а также из формулы изобретения.

КРАТКОЕ ОПИСАНИЕ ФИГУР

[0010] Вышеуказанные и другие цели, признаки и преимущества будут видны из следующего описания конкретных вариантов осуществления изобретения, как проиллюстрировано на сопроводительных рисунках, на которых схожие условные обозначения относятся к одним и тем же частям на всем протяжении различных видов. Фиг. не обязательно изображены с соблюдением масштаба, вместо него упор сделан на иллюстрирование принципов различных вариантов осуществления изобретения.

[0011] На фиг. 1 представлена схема искусственной первичной микроРНК, которая является частью вирусного генома, упакованного в AAV вектор в соответствии с настоящим изобретением. На фиг. 1 раскрыта SEQ ID NO:943.

[0012] На фиг. 2 представлена диаграмма, показывающая местоположение модулирующего полинуклеотида (MP) по отношению к ITR, интрону (I) и полиА (P).

ПОДРОБНОЕ ОПИСАНИЕ

I. КОМПОЗИЦИИ ПО ИЗОБРЕТЕНИЮ

Модулирующие полинуклеотиды

[0013] В соответствии с настоящим изобретением предусмотрены модулирующие полинуклеотиды, которые выполняют функцию искусственных микроРНК. Как используют в настоящем описании, «модулирующий полинуклеотид» представляет собой любой полимер нуклеиновой кислоты, который функционирует для того, чтобы модулировать (повышать или снижать) уровень или количество целевого гена. Модулирующие полинуклеотиды включают молекулы-предшественники, которые проходят процессинг внутри клетки перед модуляцией. Модулирующие полинуклеотиды или их процессированные формы можно кодировать в плазмиде, векторе, геноме или другом экспрессирующем векторе нуклеиновой кислоты для доставки в клетку.

[0014] В одном из вариантов осуществления модулирующие полинуклеотиды могут содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну молекулу миРНК. Нуклеиновые кислоты могут, независимо если имеет место больше 1, кодировать 1, 2, 3, 4, 5, 6, 7, 8, 9 или больше чем 9 молекул миРНК.

[0015] В некоторых вариантах осуществления модулирующие полинуклеотиды разрабатывают в виде первичных микроРНК (первичных miR) или предшественников микроРНК (предшественников miR), которые проходят процессинг в клетке с образованием искусственных микроРНК с высокой специфичностью.

[0016] Модулирующие полинуклеотиды, в частности, искусственные микроРНК по изобретению, можно разрабатывать на основе каркаса последовательности или структуры канонической или известной микроРНК, первичной микроРНК или пре-микроРНК. Такие последовательности могут соответствовать любой известной микроРНК или ее предшественнику, например, тем, которые изложены в публикации США US2005/0261218 и публикации США US2005/0059005, содержание которых включено в данное описание посредством ссылки в полном объеме.

[0017] микроРНК (или мкРНК или miR) представляют собой некодирующую РНК 19-25 нуклеотидов в длину, которая связывается с 3′UTR молекул нуклеиновой кислоты и осуществляет понижающую регуляцию экспрессии гена или посредством снижения стабильности молекулы нуклеиновой кислоты или посредством ингибирования трансляции. Модулирующие полинуклеотиды по изобретению могут содержать одну или несколько последовательностей микроРНК, микроРНК затравок или искусственных микроРНК, например, последовательности, которые выполняют функцию микроРНК.

[0018] Последовательность микроРНК содержит область «затравки», т. е. последовательность в области в положениях 2-9 зрелой микроРНК, эта последовательность обладает безупречной комплементарностью по Уотсону-Крику с целевой последовательностью мкРНК. микроРНК затравка может содержать положения 2-8 или 2-7 или 2-9 зрелой микроРНК. В некоторых вариантах осуществления микроРНК затравка может содержать 7 нуклеотидов (например, нуклеотиды 2-8 зрелой микроРНК), где комплементарный затравке сайт в соответствующей мкРНК мишени фланкирует аденин (A), лежащий против положения 1 в микроРНК. В некоторых вариантах осуществления микроРНК затравка может содержать 6 нуклеотидов (например, нуклеотиды 2-7 зрелой микроРНК), где комплементарный затравке сайт в соответствующей мкРНК мишени фланкирует аденин (A), лежащий против положения 1 в микроРНК. См., например, Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6;27(1):91-105; каждый из которых включен в настоящее описание посредством ссылки в полном объеме. Во встречаемой в природе микроРНК основания микроРНК затравки обладают полной комплементарностью с целевой последовательностью.

[0019] Как изложено в настоящем описании, параметры или правила разработки идентифицированы и применены к разработке модулирующих полинуклеотидов (например, искусственных микроРНК), которые обладают превосходными свойствами модуляции целевого гена при ограниченных эффектах ложной мишени.

[0020] В одном из вариантов осуществления молекулярный каркас модулирующего полинуклеотида, описанного в настоящем описании, можно разрабатывать и оптимизировать для того, чтобы создавать модулирующий полинуклеотид, который обладает желаемыми свойствами модуляции целевого гена. В качестве неограничивающего примера, модулирующий полинуклеотид может обладать превосходными свойствами модуляции целевого гена при ограниченных эффектах ложной мишени.

[0021] В одном из вариантов осуществления модулирующие полинуклеотиды по изобретению, такие как искусственные miR, состоят из модульных элементов или мотивов последовательностей, которые собраны в соответствии с набором правил, которые ведут к распознаванию мишени с высокой специфичностью и низкому соотношению направляющих/сопровождающих. Такие модули или мотивы последовательностей включают, но не ограничиваясь этим, двухцепочечные области, фланкирующие области, петли, оптимизированные петли, петли UGUG, домены GU, спейсеры (чтобы управлять расстоянием до проксимального и дистального мотива или модуля или вводить структурные элементы, такие как повороты, петли или выпячивания), мотивы CNNC и области термодинамической aсимметрии, которые могут охватывать петли, выпячивания, несовпадения, качания и/или их сочетания. Неограничивающие примеры правил, которые можно применять отдельно или в комбинации при конструировании искусственных miR, включают те, которые изложены в Seitz et al. Silence 2011, 2:4; Gu, et al., Cell 151, 900-911, 9 ноября 2012 года; Schwartz, et al., Cell, том 115, 199-208, 17 октября 2003 года; Park, et al., Nature, том 475, 101, 14 июля 2011 года; Ketley et al., 2013, PLoS one 8(6); Liu, et al., Nucleic Acids Research, 2008, том 36, № 9 2811-2824; Dow, et al., 2013, Nat Protoc.; 7(2): 374-393. doi:10.1038/nprot.2011.446; Auyeung, et al., Cell 152, 844-858, 14 февраля 2013 года; Gu et al., Cell, 9 ноября 2012 года, 151(4):900-11; Fellmann et al. Molecular Cell 41, 733-746, 2011; Han et al. Cell 125, 887-907, 2006; Betancur et al. Frontiers in Genetics, том 3, Art. 127, 1-6 July 2012; Schwarz et al. Cell, том 115, 199-208, 2003; содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме.

[0022] В одном из вариантов осуществления любые из известных RNAi конструкций или RNAi средств могут служить в качестве стартовой конструкции для разработки сопровождающей и/или направляющей цепи модулирующих полинуклеотидов или искусственных микроРНК по изобретению. Они включают каноническую миРНК, малые интерферирующие РНК (миРНК), двухцепочечную РНК (дцРНК), инвертированные повторы, короткие шпилечные РНК (кшРНК), малые временно регулируемые РНК (stRNA), кластерную ингибирующую РНК (кРНК), в том числе радиальную кластерную ингибирующую РНК, асимметричную кластерную ингибирующую РНК, линейную кластерную ингибирующую РНК и комплекс или соединение кластерных ингибирующих РНК, субстраты дайсера, ДНК-направляемую RNAi (ddRNAi), одноцепочечную RNAi (оцРНКi), антагонисты микроРНК (мкРНК), миметики микроРНК, агонисты микроРНК, блокмиры («blockmir», также известны как Xmir), миметики микроРНК, микроРНК с присоединениями («addback»), supermiR, олигомерные конструкции, раскрытые в публикации PCT WO/2005/013901, содержание которой включены в настоящее описание в полном объеме, трехчастные RNAi конструкции, такие как те, что раскрыты в публикации США 20090131360, содержание которой включено в настоящее описание в полном объеме, конструкции solo-rxRNA, раскрытые в публикации PCT WO/2010/011346, содержание которой включено в данное описание посредством ссылки в полном объеме; конструкции sd-rxRNA, раскрытые в публикации PCT WO/2010/033247, содержание которой включено в данное описание посредством ссылки в полном объеме, RNAi конструкции двойного действия, которые снижают уровни РНК, а также модулируют иммунный ответ, как раскрыто в публикациях PCT WO/2010/002851 и WO/2009/141146, содержание которых включено в данное описание посредством ссылки в полном объеме, и антигенные РНК (agRNA) или малые активирующие РНК (saRNA), которые увеличивают экспрессию мишени, для которой их разрабатывают, раскрытые в публикациях PCT WO/2006/130201, WO/2007/086990, WO/2009/046397, WO/2009/149182, WO/2009/086428, содержание которых включено в данное описание посредством ссылки в полном объеме.

[0023] Аналогичным образом, любые первичные микроРНК или предшественники пре-микроРНК перечисленных выше микроРНК также может служить в качестве молекулярного каркаса модулирующих полинуклеотидов по изобретению.

[0024] В одном из вариантов осуществления стартовую конструкцию можно извлекать у любых релевантных видов, таких как, без ограничения, мышь, крыса, собака, обезьяна или человек.

[0025] В одном из вариантов осуществления модулирующий полинуклеотид можно располагать в экспрессирующем векторе ниже промотора, такого как, но не ограничиваясь этим, промотор CMV, U6, H1, CBA или CBA с SV40 или интроном β-глобина человека. Кроме того, модулирующий полинуклеотид также можно располагать выше последовательности полиаденилирования в экспрессирующем векторе. В качестве неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве другого неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или больше чем 25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве другого неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе.

[0026] В одном из вариантов осуществления модулирующий полинуклеотид можно располагать выше последовательности полиаденилирования в экспрессирующем векторе. Кроме того, модулирующий полинуклеотид можно располагать ниже промотора, такого как, но не ограничиваясь этим, промотор CMV, U6, H1, CBA или CBA с SV40 или интроном β-глобина человека в экспрессирующем векторе. В качестве неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве другого неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или больше чем 25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве другого неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе.

[0027] В одном из вариантов осуществления модулирующий полинуклеотид можно располагать в scAAV.

[0028] В одном из вариантов осуществления модулирующий полинуклеотид можно располагать в ssAAV.

[0029] В одном из вариантов осуществления модулирующий полинуклеотид можно располагать около 5'-конца флип-конфигурации ITR в экспрессирующем векторе. В другом варианте осуществления модулирующий полинуклеотид можно располагать около 3'-конца флип-конфигурации ITR в экспрессирующем векторе. В еще одном другом варианте осуществления, модулирующий полинуклеотид можно располагать около 5'-конца флоп-конфигурации ITR в экспрессирующем векторе. В еще одном другом варианте осуществления, модулирующий полинуклеотид можно располагать около 3'-конца флоп-конфигурации ITR в экспрессирующем векторе. В одном из вариантов осуществления модулирующий полинуклеотид можно располагать между 5'-концом флип-конфигурации ITR и 3'-концом флоп-конфигурации ITR в экспрессирующем векторе. В одном из вариантов осуществления модулирующий полинуклеотид можно располагать между (например, посредине между 5'-концом флип-конфигурации ITR и 3'-концом флоп-конфигурации ITR или 3'-концом флоп-конфигурации ITR и 5'-концом флип-конфигурации ITR), 3'-концом флип-конфигурации ITR и 5'-концом флип-конфигурации ITR в экспрессирующем векторе. В качестве неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов ниже от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR) в экспрессирующем векторе. В качестве неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов выше от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR) в экспрессирующем векторе. В качестве другого неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR) в экспрессирующем векторе. В качестве другого неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 выше от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR) в экспрессирующем векторе. В качестве неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или больше чем 25% нуклеотидов выше от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR) в экспрессирующем векторе. В качестве другого неограничивающего примера, модулирующий полинуклеотид можно располагать в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% ниже от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR) в экспрессирующем векторе.

[0030] В дополнение к модулям или мотивам последовательностей, модулирующие полинуклеотиды содержат по меньшей мере одну или обе из сопровождающей и направляющей цепей. Сопровождающая и направляющая цепи могут быть расположены или находиться на 5'-плече или 3'-плече структуры «стебель-петля» модулирующего полинуклеотида.

[0031] В одном из вариантов осуществления 3'-плечо стебля модулирующих полинуклеотидов может иметь 11 нуклеотидов ниже 3'-конца направляющей цепи, которые обладают комплементарностью с 11 из 13 нуклеотидов выше 5'-конца сопровождающей цепи в 5'-плече стебля.

[0032] В одном из вариантов осуществления модулирующие полинуклеотиды могут иметь цистеин, который находится на 6 нуклеотидов ниже 3'-конца 3'-плеча стебля модулирующего полинуклеотида.

[0033] В одном из вариантов осуществления модулирующие полинуклеотиды содержат затравочное совпадение мкРНК для направляющей цепи. В другом варианте осуществления модулирующие полинуклеотиды содержат затравочное совпадение мкРНК для сопровождающей цепи. В еще одном другом варианте осуществления, модулирующие полинуклеотиды не содержат затравочное совпадение для направляющей или сопровождающей цепи.

[0034] В одном из вариантов осуществления модулирующие полинуклеотиды могут почти не иметь значимых полноразмерных ложных мишеней для направляющей цепи. В другом варианте осуществления модулирующие полинуклеотиды могут почти не иметь значимых полноразмерных ложных мишеней для сопровождающей цепи. В еще одном другом варианте осуществления, модулирующие полинуклеотиды могут почти не иметь значимых полноразмерных ложных мишеней для направляющей цепи или сопровождающей цепи.

[0035] В одном из вариантов осуществления модулирующие полинуклеотиды могут иметь высокую активность in vitro. В другом варианте осуществления модулирующие полинуклеотиды могут иметь низкую активность in vitro. В еще одном другом варианте осуществления, модулирующие полинуклеотиды могут иметь высокую активность направляющей цепи и низкую активность сопровождающей цепи in vitro.

[0036] В одном из вариантов осуществления модулирующие полинуклеотиды имеют высокую активность направляющей цепи и низкую активность сопровождающей цепи in vitro. Нокдаун мишени (KD) с помощью направляющей цепи может составлять по меньшей мере 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99,5% или 100%. Нокдаун мишени с помощью направляющей цепи может составлять 60-65%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 60-99%, 60-99,5%, 60-100%, 65-70%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 65-99%, 65-99,5%, 65-100%, 70-75%, 70-80%, 70-85%, 70-90%, 70-95%, 70-99%, 70-99,5%, 70-100%, 75-80%, 75-85%, 75-90%, 75-95%, 75-99%, 75-99,5%, 75-100%, 80-85%, 80-90%, 80-95%, 80-99%, 80-99,5%, 80-100%, 85-90%, 85-95%, 85-99%, 85-99,5%, 85-100%, 90-95%, 90-99%, 90-99,5%, 90-100%, 95-99%, 95-99,5%, 95-100%, 99-99,5%, 99-100% или 99,5-100%. В качестве неограничивающего примера, нокдаун мишени (KD) с помощью направляющей цепи составляет больше чем 70%.

[0037] В одном из вариантов осуществления IC50 сопровождающей цепи для ближайшей ложной мишени больше чем в 100 раз превышает IC50 направляющей цепи для мишени. В качестве неограничивающего примера, если IC50 сопровождающей цепи для ближайшей ложной мишени больше чем в 100 раз превышает IC50 направляющей цепи для мишени, то говорят, что модулирующий полинуклеотид имеет высокую активность направляющей цепи и низкую активность сопровождающей цепи in vitro.

[0038] В одном из вариантов осуществления 5'-процессинг направляющей цепи имеет правильный старт (n) на 5'-конце по меньшей мере 75%, 80%, 85%, 90%, 95%, 99% или 100% времени in vitro или in vivo. В качестве неограничивающего примера, 5'-процессинг направляющей цепи является точным и имеет правильный старт (n) на 5'-конце по меньшей мере 99% времени in vitro. В качестве неограничивающего примера, 5'-процессинг направляющей цепи является точным и имеет правильный старт (n) на 5'-конце по меньшей мере 99% времени in vivo.

[0039] В одном из вариантов осуществления соотношение направляющих и сопровождающих (G:P) цепей составляет 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1;1, 2:10, 2:9, 2:8, 2:7, 2:6, 2:5, 2:4, 2:3, 2:2, 2:1, 3:10, 3:9, 3:8, 3:7, 3:6, 3:5, 3:4, 3:3, 3:2, 3:1, 4:10, 4:9, 4:8, 4:7, 4:6, 4:5, 4:4, 4:3, 4:2, 4:1, 5:10, 5:9, 5:8, 5:7, 5:6, 5:5, 5:4, 5:3, 5:2, 5:1, 6:10, 6:9, 6:8, 6:7, 6:6, 6:5, 6:4, 6:3, 6:2, 6:1, 7:10, 7:9, 7:8, 7:7, 7:6, 7:5, 7:4, 7:3, 7:2, 7:1, 8:10, 8:9, 8:8, 8:7, 8:6, 8:5, 8:4, 8:3, 8:2, 8:1, 9:10, 9:9, 9:8, 9:7, 9:6, 9:5, 9:4, 9:3, 9:2, 9:1, 10:10, 10:9, 10:8, 10:7, 10:6, 10:5, 10:4, 10:3, 10:2, 10:1, 1:99, 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5 или 99:1 in vitro или in vivo.

[0040] Соотношение направляющих и сопровождающих относится к соотношению направляющих цепей и сопровождающих цепей после вырезания направляющей цепи. Например, соотношение направляющих и сопровождающих 80:20 соответствует 8 направляющим цепям на каждые 2 сопровождающие цепи, которые вырезаны из предшественника. В качестве неограничивающего примера, соотношение направляющих и сопровождающих цепей составляет 8:2 in vitro. В качестве неограничивающего примера, соотношение направляющих и сопровождающих цепей составляет 8:2 in vivo. В качестве неограничивающего примера, соотношение направляющих и сопровождающих цепей составляет 9:1 in vitro. В качестве неограничивающего примера, соотношение направляющих и сопровождающих цепей составляет 9:1 in vivo.

[0041] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет больше чем 1.

[0042] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет больше чем 2.

[0043] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет больше чем 5.

[0044] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет больше чем 10.

[0045] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет больше чем 20.

[0046] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет больше чем 50.

[0047] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет по меньшей мере 3:1.

[0048] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет по меньшей мере 5:1.

[0049] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет по меньшей мере 10:1.

[0050] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет по меньшей мере 20:1.

[0051] В одном из вариантов осуществления выраженное соотношение направляющих и сопровождающих (G:P) (также обозначаемых как антисмысловые и смысловые) цепей составляет по меньшей мере 50:1.

[0052] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1;1, 2:10, 2:9, 2:8, 2:7, 2:6, 2:5, 2:4, 2:3, 2:2, 2:1, 3:10, 3:9, 3:8, 3:7, 3:6, 3:5, 3:4, 3:3, 3:2, 3:1, 4:10, 4:9, 4:8, 4:7, 4:6, 4:5, 4:4, 4:3, 4:2, 4:1, 5:10, 5:9, 5:8, 5:7, 5:6, 5:5, 5:4, 5:3, 5:2, 5:1, 6:10, 6:9, 6:8, 6:7, 6:6, 6:5, 6:4, 6:3, 6:2, 6:1, 7:10, 7:9, 7:8, 7:7, 7:6, 7:5, 7:4, 7:3, 7:2, 7:1, 8:10, 8:9, 8:8, 8:7, 8:6, 8:5, 8:4, 8:3, 8:2, 8:1, 9:10, 9:9, 9:8, 9:7, 9:6, 9:5, 9:4, 9:3, 9:2, 9:1, 10:10, 10:9, 10:8, 10:7, 10:6, 10:5, 10:4, 10:3, 10:2, 10:1, 1:99, 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5 или 99:1 in vitro или in vivo. Соотношение сопровождающих и направляющих относится к соотношению сопровождающих цепей и направляющих цепей после вырезания направляющей цепи. Например, соотношение сопровождающих и направляющих 80:20 соответствует 8 сопровождающим цепям на каждые 2 направляющие цепи, которые вырезаны из предшественника. В качестве неограничивающего примера, соотношение сопровождающих и направляющих цепей составляет 80:20 in vitro. В качестве неограничивающего примера, соотношение сопровождающих и направляющих цепей составляет 80:20 in vivo. В качестве неограничивающего примера, соотношение сопровождающих и направляющих цепей составляет 8:2 in vitro. В качестве неограничивающего примера, соотношение сопровождающих и направляющих цепей составляет 8:2 in vivo. В качестве неограничивающего примера, соотношение сопровождающих и направляющих цепей составляет 9:1 in vitro. В качестве неограничивающего примера, соотношение сопровождающих и направляющих цепей составляет 9:1 in vivo.

[0053] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет больше чем 1.

[0054] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет больше чем 2.

[0055] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет больше чем 5.

[0056] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет больше чем 10.

[0057] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет больше чем 20.

[0058] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет больше чем 50.

[0059] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет по меньшей мере 3:1.

[0060] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет по меньшей мере 5:1.

[0061] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет по меньшей мере 10:1.

[0062] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет по меньшей мере 20:1.

[0063] В одном из вариантов осуществления выраженное соотношение сопровождающих и направляющих (P:G) (также обозначаемых как смысловые и антисмысловые) цепей составляет по меньшей мере 50:1.

[0064] В одном из вариантов осуществления дуплекс сопровождающей и направляющей цепей считают эффективным, когда первичные или пре-микроРНК демонстрируют, с помощью способов, известных в данной области и описанных в настоящем описании, больше чем 2-кратное соотношение направляющих и сопровождающих цепей при измерении процессинга. В качестве неограничивающих примеров, первичные или пре-микроРНК демонстрируют более чем 2-кратное, 3-кратное, 4-кратное, 5-кратное, 6-кратное, 7-кратное, 8-кратное, 9-кратное, 10-кратное, 11-кратное, 12-кратное, 13-кратное, 14-кратное, 15-кратное, или 2-5-кратное, 2-10-кратное, 2-15-кратное, 3-5-кратное, 3-10-кратное, 3-15-кратное, 4-5-кратное, 4-10-кратное, 4-15-кратное, 5-10-кратное, 5-15-кратное, 6-10-кратное, 6-15-кратное, 7-10-кратное, 7-15-кратное, 8-10-кратное, 8-15-кратное, 9-10-кратное, 9-15-кратное, 10-15-кратное, 11-15-кратное, 12-15-кратное, 13-15-кратное или 14-15-кратное соотношение направляющих и сопровождающих цепей при измерении процессинга.

[0065] В одном из вариантов осуществления целостность генома вектора составляет по меньшей мере 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или больше чем 99% от полной длины конструкции.

Целевые нуклеиновые кислоты

[0066] Модулирующие полинуклеотиды по изобретению можно направлять на любой ген или конструкцию нуклеиновой кислоты, включая кодирующие и не кодирующие гены. Можно направленно воздействовать на гены (ДНК или мРНК), которые кодируют белки человека или приматов. Кроме того, также можно направленно воздействовать на не кодирующие гены, например, длинную не кодирующую РНК (lncRNA).

[0067] Примеры таких молекул lncRNA и RNAi конструкций, разработанных для направленного воздействия на такие lncRNA, на любые из которых можно направленно воздействовать с помощью или кодировать в модулирующих полинуклеотидах, соответственно, изложены в международной публикации WO2012/018881 A2, содержание которой включено в данное описание посредством ссылки в полном объеме.

[0068] В одном из вариантов осуществления модулирующие полинуклеотиды по изобретению могут направленно воздействовать на любой ген, известный в данной области. В качестве неограничивающего примера, геном может быть SOD1.

[0069] В одном из вариантов осуществления модулирующие полинуклеотиды по изобретению могут направленно воздействовать на любой ген, известный в данной области. В качестве неограничивающего примера, геном может быть Htt.

[0070] В одном из вариантов осуществления модулирующий полинуклеотид можно разрабатывать для направленного воздействия на любой ген или мРНК в геноме человека, например, гены, связанные с нарушениями CNS, таким как, но не ограничиваясь этим, хорея Гентингтона, ALS и т. п.

Молекулярные каркасы

[0071] В некоторых вариантах осуществления стартовый молекулярный каркас модулирующего полинуклеотида представляет собой известную или первичную дикого типа или пре-микроРНК. В других вариантах осуществления молекулярный каркас модулирующих полинуклеотидов разрабатывают ab initio. (См. Cullen, Gene Therapy (2006) 13, 503-508, работу с miR30; Chung, et al., Nucleic Acids Research, 2006, том 34, № 7, работу с miR-155; содержание которых включено в настоящее описание посредством ссылки в полном объеме).

[0072] Как используют в настоящем описании, «молекулярный каркас» представляет собой каркас или стартовую молекулу, которая формирует последовательность или структурную основу, на которой разрабатывают или создают последующую молекулу.

[0073] Модулирующие полинуклеотиды по настоящему изобретению можно разрабатывать в виде первичной miR, как показано на фиг. 1. На фиг. показан первичный miR молекулярный каркас. Модулирующий полинуклеотид, который содержит полезную нагрузку (например, миРНК, мкРНК или другое RNAi средство, описанное в настоящем описании), содержит лидирующую 5'-фланкирующую последовательность, которая может быть любой длины и которую можно извлекать целиком или частично из последовательности микроРНК дикого типа или которая может быть полностью искусственной.

[0074] В одном из вариантов осуществления молекулярный каркас содержит по меньшей мере одну 5'-фланкирующую область. В качестве неограничивающего примера, 5'-фланкирующая область может содержать 5'-фланкирующую последовательность, которая может быть любой длины и которую можно извлекать целиком или частично из последовательности микроРНК дикого типа или которая может быть полностью искусственной последовательностью.

[0075] В одном из вариантов осуществления молекулярный каркас содержит по меньшей мере одну 3'-фланкирующую область. В качестве неограничивающего примера, 3'-фланкирующая область может содержать 3'-фланкирующую последовательность, которая может быть любой длины и которую можно извлекать целиком или частично из последовательности микроРНК дикого типа или которая может быть полностью искусственной последовательностью.

[0076] В одном из вариантов осуществления молекулярный каркас содержит по меньшей мере одну область мотива петли. В качестве неограничивающего примера, область мотива петли может содержать последовательность, которая может быть любой длины.

[0077] В одном из вариантов осуществления молекулярный каркас содержит 5'-фланкирующую область, область мотива петли и/или 3'-фланкирующую область.

[0078] В одном из вариантов осуществления по меньшей мере одну полезную нагрузку (например, миРНК, мкРНК или другое RNAi средство, описанное в настоящем описании) можно кодировать модулирующим полинуклеотидом, который также может содержать по меньшей мере один молекулярный каркас. Молекулярный каркас может содержать 5'-фланкирующую последовательность и/или 3'-фланкирующую последовательность, которая может быть любой длины и которую можно извлекать целиком или частично из последовательности микроРНК дикого типа или которая может быть полностью искусственной. 3'-фланкирующая последовательность может зеркально отражать 5'-фланкирующую последовательность в размере и происхождении. Любая фланкирующая последовательность может отсутствовать. 3'-фланкирующая последовательность необязательно может содержать один или несколько мотивов CNNC, где «N» представляет любой нуклеотид.

[0079] Показано, что формирование стебля структуры «стебель-петля» является минимумом модулирующего полинуклеотида, кодирующего по меньшей мере одну последовательность полезной нагрузки. В некоторых вариантах осуществления последовательность полезной нагрузки содержит по меньшей мере одну последовательность нуклеиновой кислоты, которая находится в части, комплементарной или способной гибридизоваться с целевой последовательностью. В некоторых вариантах осуществления полезная нагрузка представляет собой микроРНК дикого типа. В некоторых вариантах осуществления полезная нагрузка представляет собой молекулу миРНК или фрагмент молекулы миРНК. В некоторых вариантах осуществления полезная нагрузка представляет собой по существу двухцепочечную конструкцию которая может содержать одну или несколько микроРНК, искусственных микроРНК или миРНК.

[0080] В некоторых вариантах осуществления 5'-плечо стебля петли модулирующего полинуклеотида содержит последовательность нуклеиновой кислоты, кодирующую сопровождающую цепь. Эта цепь также известна как смысловая цепь в том отношении, что она отражает идентичность с мишенью. Сопровождающая цепь может составлять 15-30 нуклеотидов в длину. Она может составлять 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов в длину.

[0081] В некоторых вариантах осуществления 3'-плечо стебля петли модулирующего полинуклеотида содержит последовательность нуклеиновой кислоты, кодирующую направляющую цепь. Эта цепь также известна как антисмысловая цепь в том отношении, что она отражает гомологию с мишенью. Направляющая цепь может составлять 15-30 нуклеотидов в длину, 21-25 нуклеотидов или 22 нуклеотида в длину. Она может составлять 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов в длину. Направляющая цепь, в некоторых случаях, содержит нуклеотид «G» на самом 5'-конце.

[0082] В некоторых вариантах осуществления, где направляющая цепь содержит микроРНК или искусственные микроРНК, направляющая цепь может содержать одну или несколько последовательностей микроРНК затравок. Последовательность затравки можно располагать в положениях 2-7, 2-8 или 2-9 направляющей цепи относительно первого 5'-нуклеотида направляющей цепи или относительно сайта расщепления дайсера.

[0083] В других вариантах осуществления сопровождающая цепь может находиться на 3'-плече, тогда как направляющая цепь находится на 5'-плече стебля структуры «стебель-петля» модулирующего полинуклеотида.

[0084] Сопровождающие и направляющие цепи могут быть полностью комплементарными на протяжении существенной части их длины. В других вариантах осуществления сопровождающая цепь и направляющая цепь могут быть по меньшей мере на 70, 80, 90, 95 или 99% комплементарными на протяжении независимо по меньшей мере 50, 60, 70, 80, 85, 90, 95 или 99% длины цепей.

[0085] Ни идентичность сопровождающей цепи, ни гомология направляющей цепи не обязаны быть 100% комплементарными целевой последовательности.

[0086] В одном из вариантов осуществления сопровождающую и направляющую цепь структуры «стебель-петля» модулирующего полинуклеотида разделяет последовательность петли (также известная как мотив петли, линкер или линкерный мотив). Последовательность петли может быть любой длины, 4-30 нуклеотидов, 4-20 нуклеотидов, 4-15 нуклеотидов, 5-15 нуклеотидов, 6-12 нуклеотидов, 6 нуклеотидов, 7, нуклеотиды, 8 нуклеотидов, 9 нуклеотидов, 10 нуклеотидов, 11 нуклеотидов, 12 нуклеотидов, 13 нуклеотидов, 14 нуклеотидов и/или 15 нуклеотидов.

[0087] В некоторых вариантах осуществления последовательность петли содержит последовательность нуклеиновой кислоты, кодирующую по меньшей мере один мотив UGUG. В некоторых вариантах осуществления последовательность нуклеиновой кислоты, кодирующую мотив UGUG, располагают на 5'-конце последовательности петли.

[0088] В одном из вариантов осуществления спейсерные области могут присутствовать в модулирующем полинуклеотиде для того, чтобы отделять один или несколько модулей (например, 5'-фланкирующую область, область мотива петли, 3'-фланкирующую область, смысловые последовательности, антисмысловую последовательность) друг от друга. Могут иметь место одна или несколько таких спейсерных областей.

[0089] В одном из вариантов осуществления спейсерная область в 8-20, т. е. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 нуклеотидов может присутствовать между сопровождающей цепью и последовательностью фланкирующей области.

[0090] В одном из вариантов осуществления длина спейсерной области составляет 13 нуклеотидов, и она располагается между 5'-концом сопровождающей цепи и 3'-концом фланкирующей последовательности. В одном из вариантов осуществления спейсер имеет достаточную длину для того, чтобы формировать приблизительно один оборот спирали последовательности.

[0091] В одном из вариантов осуществления спейсерная область в 8-20, т. е. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 нуклеотидов может присутствовать между направляющей цепью и фланкирующей последовательностью.

[0092] В одном из вариантов осуществления спейсерная последовательность составляет 10-13, т. е. 10, 11, 12 или 13 нуклеотидов и располагается между 3'-концом направляющей цепи и 5'-концом фланкирующей последовательности. В одном из вариантов осуществления спейсер имеет достаточную длину для того, чтобы формировать приблизительно один оборот спирали последовательности.

[0093] В одном из вариантов осуществления модулирующий полинуклеотид содержит по меньшей мере один мотив UG в основании стебля, в соответствии с чем нуклеотид G образует пару и нуклеотид U не образует пару. В некоторых вариантах осуществления неспаренный нуклеотид U располагается во фланкирующей последовательности.

[0094] В одном из вариантов осуществления модулирующий полинуклеотид содержит, в направлении от 5' к 3', 5'-фланкирующую последовательность, 5'-плечо, мотив петли, 3'-плечо и 3'-фланкирующую последовательность. В качестве неограничивающего примера, 5'-плечо может содержать сопровождающую цепь и 3'-плечо содержит направляющую цепь. В другом неограничивающем примере, 5'-плечо содержит направляющую цепь и 3'-плечо содержит сопровождающую цепь.

[0095] В одном из вариантов осуществления последовательность 5'-плеча, полезной нагрузки (например, сопровождающей и/или направляющей цепи), мотива петли и/или 3'-плеча можно изменять (например, заменять 1 или больше нуклеотидов, добавлять нуклеотиды и/или удалять нуклеотиды). Изменение может вызывать полезное изменение функции конструкции (например, увеличение нокдауна целевой последовательности, снижение разрушения конструкции, снижение эффекта ложной мишени, увеличение эффективности полезной нагрузки и уменьшение разрушения полезной нагрузки).

[0096] В одном из вариантов осуществления последовательность сопровождающей цепи можно изменять (например, заменять 1 или больше нуклеотидов, добавлять нуклеотиды и/или удалять нуклеотиды). В качестве неограничивающего примера, последовательность сопровождающей цепи может содержать 1 или 2 замены в пределах последних 4 нуклеотидов последовательности (например, C заменяет G). В качестве другого неограничивающего примера, последовательность сопровождающей цепи может содержать 1 или 2 замен в пределах 7-15 нуклеотидов от 5'-конца последовательности (например, U заменяет A или C заменяет G).

[0097] В одном из вариантов осуществления последовательность цепи 3'-плеча можно изменять (например, заменять 1 или больше нуклеотидов, добавлять нуклеотиды и/или удалять нуклеотиды). В качестве неограничивающего примера, последовательность 3'-плеча может содержать 1 или 2 замены в первых 4 нуклеотидах последовательности (например, A заменяет U).

[0098] В одном из вариантов осуществления молекулярный каркас конструкции полезной нагрузки может содержать 5'-фланкирующую область, мотив петли и 3'-фланкирующую область. Между 5'-фланкирующей областью и мотивом петли может иметь место первая область полезной нагрузки и между мотивом петли и 3'-фланкирующей областью может иметь место вторая область полезной нагрузки. Первая и вторая области полезной нагрузки могут содержать миРНК, мкРНК или другие RNAi средства, фрагменты или варианты, описанные в настоящем описании. Первая и вторая области полезной нагрузки также могут содержать последовательности, которые являются одинаковыми, отличающимися или комплементарными друг другу. В качестве неограничивающего примера, последовательность первой области полезной нагрузки может представлять собой сопровождающую цепь конструкции миРНК и последовательность второй области полезной нагрузки может представлять собой направляющую цепь конструкции миРНК. Сопровождающая и направляющая последовательности могут быть по существу комплементарными друг другу. В качестве другого неограничивающего примера, последовательность первой области полезной нагрузки может представлять собой направляющую цепь конструкции миРНК и последовательность второй области полезной нагрузки может представлять собой сопровождающую цепь конструкции миРНК. Сопровождающая и направляющая последовательности могут быть по существу комплементарными друг другу.

[0099] В одном из вариантов осуществления молекулярный каркас модулирующих полинуклеотидов, описанных в настоящем описании, может содержать 5'-фланкирующую область, область мотива петли и 3'-фланкирующую область. Неограничивающие примеры последовательностей для 5'-фланкирующей области, области мотива петли и 3'-фланкирующей области, которые можно кодировать модулирующим полинуклеотидом, описанным в настоящем описании, приведены в таблицах 1-3.

Таблица 1. 5'-фланкирующие области для молекулярного каркаса

Название 5'-фланкирующей области Последовательность 5'-фланкирующей области SEQ ID NO:5'-фланкирующей области
5F1 UUUAUGCCUCAUCCUCUGAGUGCUGAAGGCUUGCUGUAGGCUGUAUGCUG 1
5F2 GUGCUGGGCGGGGGGCGGCGGGCCCUCCCGCAGAACACCAUGCGCUCUUCGGAA 2
5F3 GAAGCAAAGAAGGGGCAGAGGGAGCCCGUGAGCUGAGUGGGCCAGGGACUGGGAGAAGGAGUGAGGAGGCAGGGCCGGCAUGCCUCUGCUGCUGGCCAGA 3
5F4 GUGCUGGGCGGGGGGCGGCGGGCCCUCCCGCAGAACACCAUGCGCUCUUCGGGA 4
5F5 GUGCUGGGCGGGGGGCGGCGGGCCCUCCCGCAGAACACCAUGCGCUCCACGGAA 5
5F6 GGGCCCUCCCGCAGAACACCAUGCGCUCCACGGAA 6
5F7 CUCCCGCAGAACACCAUGCGCUCCACGGAA 7
5F8 GUGCUGGGCGGGGGGCGGCGGGCCCUCCCGCAGAACACCAUGCGCUCCACGGAAG 8
5F9 GUGCUGGGCGGGGGGCGGCGGGCCCUCCCGCAGAACACCAUGCGCUCCUCGGAA 9

Таблица 2. Области мотива петли для молекулярного каркаса

Название области мотива петли Последовательность области мотива петли SEQ ID NO:области мотива петли
L1 UGUGACCUGG 10
L2 UGUGAUUUGG 11
L3 UAUAAUUUGG 12
L4 CCUGACCCAGU 13
L5 GUCUGCACCUGUCACUAG 14
L6 GUGACCCAAG 15
L7 GUGGCCACUGAGAAG 16
L8 GUGACCCAAU 17
L9 GUGACCCAAC 18
L10 GUGGCCACUGAGAAA 19

Таблица 3. 3'-фланкирующие области для молекулярного каркаса

Название 3'-фланкирующей области Последовательность 3'-фланкирующей области SEQ ID NO:3'-фланкирующей области
3F1 AGUGUAUGAUGCCUGUUACUAGCAUUCACAUGGAACAAAUUGCUGCCGUG 20
3F2 CUGAGGAGCGCCUUGACAGCAGCCAUGGGAGGGCCGCCCCCUACCUCAGUGA 21
3F3 CUGUGGAGCGCCUUGACAGCAGCCAUGGGAGGGCCGCCCCCUACCUCAGUGA 22
3F4 UGGCCGUGUAGUGCUACCCAGCGCUGGCUGCCUCCUCAGCAUUGCAAUUCCUCUCCCAUCUGGGCACCAGUCAGCUACCCUGGUGGGAAUCUGGGUAGCC 23
3F5 GGCCGUGUAGUGCUACCCAGCGCUGGCUGCCUCCUCAGCAUUGCAAUUCCUCUCCCAUCUGGGCACCAGUCAGCUACCCUGGUGGGAAUCUGGGUAGCC 24
3F6 UCCUGAGGAGCGCCUUGACAGCAGCCAUGGGAGGGCCGCCCCCUACCUCAGUGA 25
3F7 CUGAGGAGCGCCUUGACAGCAGCCAUGGGAGGGCC 26
3F8 CUGCGGAGCGCCUUGACAGCAGCCAUGGGAGGGCCGCCCCCUACCUCAGUGA 27

[00100] Любые из областей, описанных в таблицах 1-3, где U соответствует T, можно использовать в качестве модулей в молекулярных каркасах, описанных в настоящем описании.

[00101] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область, перечисленную в таблице 1. В качестве неограничивающего примера, 5'-фланкирующая область может представлять собой 5F1, 5F2, 5F3, 5F4, 5F5, 5F6, 5F7, 5F8 или 5F9.

[00102] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1.

[00103] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2.

[00104] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3.

[00105] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4.

[00106] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5.

[00107] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6.

[00108] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7.

[00109] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8.

[00110] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9.

[00111] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли, перечисленную в таблице 2. В качестве неограничивающего примера, область мотива петли может представлять собой L1, L2, L3, L4, L5, L6, L7, L8, L9 или L10.

[00112] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1.

[00113] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2.

[00114] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3.

[00115] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4.

[00116] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5.

[00117] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L6.

[00118] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L7.

[00119] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L8.

[00120] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L9.

[00121] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L10.

[00122] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область, перечисленную в таблице 3. В качестве неограничивающего примера, молекулярный каркас может содержать 3'-фланкирующую область 3F1, 3F2, 3F3, 3F4, 3F5, 3F6, 3F7 или 3F8.

[00123] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 3F1.

[00124] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 3F2.

[00125] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 3F3.

[00126] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 3F4.

[00127] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 3F5.

[00128] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 3F6.

[00129] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 3F7.

[00130] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 3F8.

[00131] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область и по меньшей мере одну область мотива петли, как приведено в таблицах 1 и 2. В качестве неограничивающего примера, 5'-фланкирующая область и область мотива петли могут представлять собой 5F1 и L1, 5F1 и L2, 5F1 и L3, 5F1 и L4, 5F1 и L5, 5F1 и L6, 5F1 и L7, 5F1 и L8, 5F1 и L9, 5F1 и L10, 5F1 и L11, 5F2 и L1, 5F2 и L2, 5F2 и L3, 5F2 и L4, 5F2 и L5, 5F2 и L6, 5F2 и L7, 5F2 и L8, 5F2 и L9, 5F2 и L10, 5F2 и L11, 5F3 и L1, 5F3 и L2, 5F3 и L3, 5F3 и L4, 5F3 и L5, 5F3 и L6, 5F3 и L7, 5F3 и L8, 5F3 и L9, 5F3 и L10, 5F3 и L11, 5F4 и L1, 5F4 и L2, 5F4 и L3, 5F4 и L4, 5F4 и L5, 5F4 и L6, 5F4 и L7, 5F4 и L8, 5F4 и L9, 5F4 и L10, 5F4 и L11, 5F5 и L1, 5F5 и L2, 5F5 и L3, 5F5 и L4, 5F5 и L5, 5F5 и L6, 5F5 и L7, 5F5 и L8, 5F5 и L9, 5F5 и L10, 5F5 и L11, 5F6 и L1, 5F6 и L2, 5F6 и L3, 5F6 и L4, 5F6 и L5, 5F6 и L6, 5F6 и L7, 5F6 и L8, 5F6 и L9, 5F6 и L10, 5F6 и L11, 5F7 и L1, 5F7 и L2, 5F7 и L3, 5F7 и L4, 5F7 и L5, 5F7 и L6, 5F7 и L7, 5F7 и L8, 5F7 и L9, 5F7 и L10, 5F7 и L11, 5F8 и L1, 5F8 и L2, 5F8 и L3, 5F8 и L4, 5F8 и L5, 5F8 и L6, 5F8 и L7, 5F8 и L8, 5F8 и L9, 5F8 и L10, 5F8 и L11, 5F9 и L1, 5F9 и L2, 5F9 и L3, 5F9 и L4, 5F9 и L5, 5F9 и L6, 5F9 и L7, 5F9 и L8, 5F9 и L9, 5F9 и L10 или 5F9 и L11.

[00132] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну 3'-фланкирующую область и по меньшей мере одну область мотива петли, как приведено в таблицах 2 и 3. В качестве неограничивающего примера, молекулярный каркас может содержать 3F1 и L1, 3F1 и L2, 3F1 и L3, 3F1 и L4, 3F1 и L5, 3F1 и L6, 3F1 и L7, 3F1 и L8, 3F1 и L9, 3F1 и L10, 3F1 и L11, 3F2 и L1, 3F2 и L2, 3F2 и L3, 3F2 и L4, 3F2 и L5, 3F2 и L6, 3F2 и L7, 3F2 и L8, 3F2 и L9, 3F2 и L10, 3F2 и L11, 3F3 и L1, 3F3 и L2, 3F3 и L3, 3F3 и L4, 3F3 и L5, 3F3 и L6, 3F3 и L7, 3F3 и L8, 3F3 и L9, 3F3 и L10, 3F3 и L11, 3F4 и L1, 3F4 и L2, 3F4 и L3, 3F4 и L4, 3F4 и L5, 3F4 и L6, 3F4 и L7, 3F4 и L8, 3F4 и L9, 3F4 и L10, 3F4 и L11, 3F5 и L1, 3F5 и L2, 3F5 и L3, 3F5 и L4, 3F5 и L5, 3F5 и L6, 3F5 и L7, 3F5 и L8, 3F5 и L9, 3F5 и L10, 3F5 и L11, 3F6 и L1, 3F6 и L2, 3F6 и L3, 3F6 и L4, 3F6 и L5, 3F6 и L6, 3F6 и L7, 3F6 и L8, 3F6 и L9, 3F6 и L10, 3F6 и L11, 3F7 и L1, 3F7 и L2, 3F7 и L3, 3F7 и L4, 3F7 и L5, 3F7 и L6, 3F7 и L7, 3F7 и L8, 3F7 и L9, 3F7 и L10, 3F7 и L11, 3F8 и L1, 3F8 и L2, 3F8 и L3, 3F8 и L4, 3F8 и L5, 3F8 и L6, 3F8 и L7, 3F8 и L8, 3F8 и L9, 3F8 и L10 или 3F8 и L11.

[00133] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1.

[00134] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2.

[00135] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3.

[00136] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4.

[00137] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5.

[00138] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L6.

[00139] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L7.

[00140] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L8.

[00141] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L9.

[00142] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L10.

[00143] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L11.

[00144] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1.

[00145] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2.

[00146] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3.

[00147] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4.

[00148] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5.

[00149] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L6.

[00150] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L7.

[00151] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L8.

[00152] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L9.

[00153] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L10.

[00154] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L11.

[00155] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1.

[00156] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2.

[00157] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3.

[00158] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4.

[00159] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5.

[00160] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L6.

[00161] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L7.

[00162] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L8.

[00163] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L9.

[00164] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L10.

[00165] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L11.

[00166] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1.

[00167] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2.

[00168] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3.

[00169] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4.

[00170] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5.

[00171] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L6.

[00172] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L7.

[00173] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L8.

[00174] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L9.

[00175] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L10.

[00176] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L11.

[00177] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1.

[00178] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2.

[00179] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3.

[00180] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4.

[00181] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5.

[00182] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L6.

[00183] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L7.

[00184] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L8.

[00185] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L9.

[00186] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L10.

[00187] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L11.

[00188] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1.

[00189] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2.

[00190] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3.

[00191] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4.

[00192] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5.

[00193] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L6.

[00194] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L7.

[00195] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L8.

[00196] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L9.

[00197] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L10.

[00198] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L11.

[00199] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1.

[00200] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2.

[00201] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3.

[00202] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4.

[00203] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5.

[00204] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L6.

[00205] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L7.

[00206] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L8.

[00207] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L9.

[00208] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L10.

[00209] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L11.

[00210] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1.

[00211] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2.

[00212] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3.

[00213] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4.

[00214] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5.

[00215] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L6.

[00216] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L7.

[00217] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L8.

[00218] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L9.

[00219] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L10.

[00220] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L11.

[00221] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1.

[00222] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2.

[00223] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3.

[00224] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4.

[00225] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5.

[00226] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L6.

[00227] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L7.

[00228] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L8.

[00229] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L9.

[00230] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L10.

[00231] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L11.

[00232] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере 3'-фланкирующую область, как приведено в таблицах 1 и 3. В качестве неограничивающего примера, молекулярный каркас может содержать 5F1 и 3F1, 5F1 и 3F2, 5F1 и 3F3, 5F1 и 3F4, 5F1 и 3F5, 5F1 и 3F6, 5F1 и 3F7, 5F1 и 3F8, 5F2 и 3F1, 5F2 и 3F2, 5F2 и 3F3, 5F2 и 3F4, 5F2 и 3F5, 5F2 и 3F6, 5F2 и 3F7, 5F2 и 3F8, 5F3 и 3F1, 5F3 и 3F2, 5F3 и 3F3, 5F3 и 3F4, 5F3 и 3F5, 5F3 и 3F6, 5F3 и 3F7, 5F3 и 3F8, 5F4 и 3F1, 5F4 и 3F2, 5F4 и 3F3, 5F4 и 3F4, 5F4 и 3F5, 5F4 и 3F6, 5F4 и 3F7, 5F4 и 3F8, 5F5 и 3F1, 5F5 и 3F2, 5F5 и 3F3, 5F5 и 3F4, 5F5 и 3F5, 5F5 и 3F6, 5F5 и 3F7, 5F5 и 3F8, 5F6 и 3F1, 5F6 и 3F2, 5F6 и 3F3, 5F6 и 3F4, 5F6 и 3F5, 5F6 и 3F6, 5F6 и 3F7, 5F6 и 3F8, 5F7 и 3F1, 5F7 и 3F2, 5F7 и 3F3, 5F7 и 3F4, 5F7 и 3F5, 5F7 и 3F6, 5F7 и 3F7, 5F7 и 3F8, 5F8 и 3F1, 5F8 и 3F2, 5F8 и 3F3, 5F8 и 3F4, 5F8 и 3F5, 5F8 и 3F6, 5F8 и 3F7, 5F8 и 3F8, 5F9 и 3F1, 5F9 и 3F2, 5F9 и 3F3, 5F9 и 3F4, 5F9 и 3F5, 5F9 и 3F6, 5F9 и 3F7 или 5F9 и 3F8.

[00233] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00234] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00235] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00236] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00237] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00238] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00239] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00240] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00241] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00242] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00243] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00244] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00245] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00246] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00247] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00248] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00249] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00250] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00251] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00252] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00253] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00254] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00255] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00256] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00257] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00258] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00259] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00260] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00261] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00262] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00263] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00264] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00265] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00266] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00267] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00268] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00269] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00270] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00271] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00272] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00273] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00274] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00275] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00276] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00277] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00278] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00279] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00280] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00281] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00282] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00283] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00284] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00285] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00286] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00287] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00288] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00289] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00290] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00291] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00292] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00293] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00294] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00295] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00296] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00297] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00298] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00299] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00300] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00301] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00302] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00303] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00304] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00305] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну 5'-фланкирующую область, по меньшей мере одну область мотива петли и по меньшей мере одну 3'-фланкирующую область. В качестве неограничивающего примера, молекулярный каркас может содержать 5F1, L1 и 3F1; 5F1, L1 и 3F2; 5F1, L1 и 3F3; 5F1, L1 и 3F4; 5F1, L1 и 3F5; 5F1, L1 и 3F6; 5F1, L1 и 3F7; 5F1, L1 и 3F8; 5F2, L1 и 3F1; 5F2, L1 и 3F2; 5F2, L1 и 3F3; 5F2, L1 и 3F4; 5F2, L1 и 3F5; 5F2, L1 и 3F6; 5F2, L1 и 3F7; 5F2, L1 и 3F8; 5F3, L1 и 3F1; 5F3, L1 и 3F2; 5F3, L1 и 3F3; 5F3, L1 и 3F4; 5F3, L1 и 3F5; 5F3, L1 и 3F6; 5F3, L1 и 3F7; 5F3, L1 и 3F8; 5F4, L1 и 3F1; 5F4, L1 и 3F2; 5F4, L1 и 3F3; 5F4, L1 и 3F4; 5F4, L1 и 3F5; 5F4, L1 и 3F6; 5F4, L1 и 3F7; 5F4, L1 и 3F8; 5F5, L1 и 3F1; 5F5, L1 и 3F2; 5F5, L1 и 3F3; 5F5, L1 и 3F4; 5F5, L1 и 3F5; 5F5, L1 и 3F6; 5F5, L1 и 3F7; 5F5, L1 и 3F8; 5F6, L1 и 3F1; 5F6, L1 и 3F2; 5F6, L1 и 3F3; 5F6, L1 и 3F4; 5F6, L1 и 3F5; 5F6, L1 и 3F6; 5F6, L1 и 3F7; 5F6, L1 и 3F8; 5F7, L1 и 3F1; 5F7, L1 и 3F2; 5F7, L1 и 3F3; 5F7, L1 и 3F4; 5F7, L1 и 3F5; 5F7, L1 и 3F6; 5F7, L1 и 3F7; 5F7, L1 и 3F8; 5F8, L1 и 3F1; 5F8, L1 и 3F2; 5F8, L1 и 3F3; 5F8, L1 и 3F4; 5F8, L1 и 3F5; 5F8, L1 и 3F6; 5F8, L1 и 3F7; 5F8, L1 и 3F8; 5F9, L1 и 3F1; 5F9, L1 и 3F2; 5F9, L1 и 3F3; 5F9, L1 и 3F4; 5F9, L1 и 3F5; 5F9, L1 и 3F6; 5F9, L1 и 3F7; 5F9, L1 и 3F8; 5F1, L2 и 3F1; 5F1, L2 и 3F2; 5F1, L2 и 3F3; 5F1, L2 и 3F4; 5F1, L2 и 3F5; 5F1, L2 и 3F6; 5F1, L2 и 3F7; 5F1, L2 и 3F8; 5F2, L2 и 3F1; 5F2, L2 и 3F2; 5F2, L2 и 3F3; 5F2, L2 и 3F4; 5F2, L2 и 3F5; 5F2, L2 и 3F6; 5F2, L2 и 3F7; 5F2, L2 и 3F8; 5F3, L2 и 3F1; 5F3, L2 и 3F2; 5F3, L2 и 3F3; 5F3, L2 и 3F4; 5F3, L2 и 3F5; 5F3, L2 и 3F6; 5F3, L2 и 3F7; 5F3, L2 и 3F8; 5F4, L2 и 3F1; 5F4, L2 и 3F2; 5F4, L2 и 3F3; 5F4, L2 и 3F4; 5F4, L2 и 3F5; 5F4, L2 и 3F6; 5F4, L2 и 3F7; 5F4, L2 и 3F8; 5F5, L2 и 3F1; 5F5, L2 и 3F2; 5F5, L2 и 3F3; 5F5, L2 и 3F4; 5F5, L2 и 3F5; 5F5, L2 и 3F6; 5F5, L2 и 3F7; 5F5, L2 и 3F8; 5F6, L2 и 3F1; 5F6, L2 и 3F2; 5F6, L2 и 3F3; 5F6, L2 и 3F4; 5F6, L2 и 3F5; 5F6, L2 и 3F6; 5F6, L2 и 3F7; 5F6, L2 и 3F8; 5F7, L2 и 3F1; 5F7, L2 и 3F2; 5F7, L2 и 3F3; 5F7, L2 и 3F4; 5F7, L2 и 3F5; 5F7, L2 и 3F6; 5F7, L2 и 3F7; 5F7, L2 и 3F8; 5F8, L2 и 3F1; 5F8, L2 и 3F2; 5F8, L2 и 3F3; 5F8, L2 и 3F4; 5F8, L2 и 3F5; 5F8, L2 и 3F6; 5F8, L2 и 3F7; 5F8, L2 и 3F8; 5F9, L2 и 3F1; 5F9, L2 и 3F2; 5F9, L2 и 3F3; 5F9, L2 и 3F4; 5F9, L2 и 3F5; 5F9, L2 и 3F6; 5F9, L2 и 3F7; 5F9, L2 и 3F8; 5F1, L3 и 3F1; 5F1, L3 и 3F2; 5F1, L3 и 3F3; 5F1, L3 и 3F4; 5F1, L3 и 3F5; 5F1, L3 и 3F6; 5F1, L3 и 3F7; 5F1, L3 и 3F8; 5F2, L3 и 3F1; 5F2, L3 и 3F2; 5F2, L3 и 3F3; 5F2, L3 и 3F4; 5F2, L3 и 3F5; 5F2, L3 и 3F6; 5F2, L3 и 3F7; 5F2, L3 и 3F8; 5F3, L3 и 3F1; 5F3, L3 и 3F2; 5F3, L3 и 3F3; 5F3, L3 и 3F4; 5F3, L3 и 3F5; 5F3, L3 и 3F6; 5F3, L3 и 3F7; 5F3, L3 и 3F8; 5F4, L3 и 3F1; 5F4, L3 и 3F2; 5F4, L3 и 3F3; 5F4, L3 и 3F4; 5F4, L3 и 3F5; 5F4, L3 и 3F6; 5F4, L3 и 3F7; 5F4, L3 и 3F8; 5F5, L3 и 3F1; 5F5, L3 и 3F2; 5F5, L3 и 3F3; 5F5, L3 и 3F4; 5F5, L3 и 3F5; 5F5, L3 и 3F6; 5F5, L3 и 3F7; 5F5, L3 и 3F8; 5F6, L3 и 3F1; 5F6, L3 и 3F2; 5F6, L3 и 3F3; 5F6, L3 и 3F4; 5F6, L3 и 3F5; 5F6, L3 и 3F6; 5F6, L3 и 3F7; 5F6, L3 и 3F8; 5F7, L3 и 3F1; 5F7, L3 и 3F2; 5F7, L3 и 3F3; 5F7, L3 и 3F4; 5F7, L3 и 3F5; 5F7, L3 и 3F6; 5F7, L3 и 3F7; 5F7, L3 и 3F8; 5F8, L3 и 3F1; 5F8, L3 и 3F2; 5F8, L3 и 3F3; 5F8, L3 и 3F4; 5F8, L3 и 3F5; 5F8, L3 и 3F6; 5F8, L3 и 3F7; 5F8, L3 и 3F8; 5F9, L3 и 3F1; 5F9, L3 и 3F2; 5F9, L3 и 3F3; 5F9, L3 и 3F4; 5F9, L3 и 3F5; 5F9, L3 и 3F6; 5F9, L3 и 3F7; 5F9, L3 и 3F8; 5F1, L4 и 3F1; 5F1, L4 и 3F2; 5F1, L4 и 3F3; 5F1, L4 и 3F4; 5F1, L4 и 3F5; 5F1, L4 и 3F6; 5F1, L4 и 3F7; 5F1, L4 и 3F8; 5F2, L4 и 3F1; 5F2, L4 и 3F2; 5F2, L4 и 3F3; 5F2, L4 и 3F4; 5F2, L4 и 3F5; 5F2, L4 и 3F6; 5F2, L4 и 3F7; 5F2, L4 и 3F8; 5F3, L4 и 3F1; 5F3, L4 и 3F2; 5F3, L4 и 3F3; 5F3, L4 и 3F4; 5F3, L4 и 3F5; 5F3, L4 и 3F6; 5F3, L4 и 3F7; 5F3, L4 и 3F8; 5F4, L4 и 3F1; 5F4, L4 и 3F2; 5F4, L4 и 3F3; 5F4, L4 и 3F4; 5F4, L4 и 3F5; 5F4, L4 и 3F6; 5F4, L4 и 3F7; 5F4, L4 и 3F8; 5F5, L4 и 3F1; 5F5, L4 и 3F2; 5F5, L4 и 3F3; 5F5, L4 и 3F4; 5F5, L4 и 3F5; 5F5, L4 и 3F6; 5F5, L4 и 3F7; 5F5, L4 и 3F8; 5F6, L4 и 3F1; 5F6, L4 и 3F2; 5F6, L4 и 3F3; 5F6, L4 и 3F4; 5F6, L4 и 3F5; 5F6, L4 и 3F6; 5F6, L4 и 3F7; 5F6, L4 и 3F8; 5F7, L4 и 3F1; 5F7, L4 и 3F2; 5F7, L4 и 3F3; 5F7, L4 и 3F4; 5F7, L4 и 3F5; 5F7, L4 и 3F6; 5F7, L4 и 3F7; 5F7, L4 и 3F8; 5F8, L4 и 3F1; 5F8, L4 и 3F2; 5F8, L4 и 3F3; 5F8, L4 и 3F4; 5F8, L4 и 3F5; 5F8, L4 и 3F6; 5F8, L4 и 3F7; 5F8, L4 и 3F8; 5F9, L4 и 3F1; 5F9, L4 и 3F2; 5F9, L4 и 3F3; 5F9, L4 и 3F4; 5F9, L4 и 3F5; 5F9, L4 и 3F6; 5F9, L4 и 3F7; 5F9, L4 и 3F8; 5F1, L5 и 3F1; 5F1, L5 и 3F2; 5F1, L5 и 3F3; 5F1, L5 и 3F4; 5F1, L5 и 3F5; 5F1, L5 и 3F6; 5F1, L5 и 3F7; 5F1, L5 и 3F8; 5F2, L5 и 3F1; 5F2, L5 и 3F2; 5F2, L5 и 3F3; 5F2, L5 и 3F4; 5F2, L5 и 3F5; 5F2, L5 и 3F6; 5F2, L5 и 3F7; 5F2, L5 и 3F8; 5F3, L5 и 3F1; 5F3, L5 и 3F2; 5F3, L5 и 3F3; 5F3, L5 и 3F4; 5F3, L5 и 3F5; 5F3, L5 и 3F6; 5F3, L5 и 3F7; 5F3, L5 и 3F8; 5F4, L5 и 3F1; 5F4, L5 и 3F2; 5F4, L5 и 3F3; 5F4, L5 и 3F4; 5F4, L5 и 3F5; 5F4, L5 и 3F6; 5F4, L5 и 3F7; 5F4, L5 и 3F8; 5F5, L5 и 3F1; 5F5, L5 и 3F2; 5F5, L5 и 3F3; 5F5, L5 и 3F4; 5F5, L5 и 3F5; 5F5, L5 и 3F6; 5F5, L5 и 3F7; 5F5, L5 и 3F8; 5F6, L5 и 3F1; 5F6, L5 и 3F2; 5F6, L5 и 3F3; 5F6, L5 и 3F4; 5F6, L5 и 3F5; 5F6, L5 и 3F6; 5F6, L5 и 3F7; 5F6, L5 и 3F8; 5F7, L5 и 3F1; 5F7, L5 и 3F2; 5F7, L5 и 3F3; 5F7, L5 и 3F4; 5F7, L5 и 3F5; 5F7, L5 и 3F6; 5F7, L5 и 3F7; 5F7, L5 и 3F8; 5F8, L5 и 3F1; 5F8, L5 и 3F2; 5F8, L5 и 3F3; 5F8, L5 и 3F4; 5F8, L5 и 3F5; 5F8, L5 и 3F6; 5F8, L5 и 3F7; 5F8, L5 и 3F8; 5F9, L5 и 3F1; 5F9, L5 и 3F2; 5F9, L5 и 3F3; 5F9, L5 и 3F4; 5F9, L5 и 3F5; 5F9, L5 и 3F6; 5F9, L5 и 3F7; или 5F9, L5 и 3F8.

[00306] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00307] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00308] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00309] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00310] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00311] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00312] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00313] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00314] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00315] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00316] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00317] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00318] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00319] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00320] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00321] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00322] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00323] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00324] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00325] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00326] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00327] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00328] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00329] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00330] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00331] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00332] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00333] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00334] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00335] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00336] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00337] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00338] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00339] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00340] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00341] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00342] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00343] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00344] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00345] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00346] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00347] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00348] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00349] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00350] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00351] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00352] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00353] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00354] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00355] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00356] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00357] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00358] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00359] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00360] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00361] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00362] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00363] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00364] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00365] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00366] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00367] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00368] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00369] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00370] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00371] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00372] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00373] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00374] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00375] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00376] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00377] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L1, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00378] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00379] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00380] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00381] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00382] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00383] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00384] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00385] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00386] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00387] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00388] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00389] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00390] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00391] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00392] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00393] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00394] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00395] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00396] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00397] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00398] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00399] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00400] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00401] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00402] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00403] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00404] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00405] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00406] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00407] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00408] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00409] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00410] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00411] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00412] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00413] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00414] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00415] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00416] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00417] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00418] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00419] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00420] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00421] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00422] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00423] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00424] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00425] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00426] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00427] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00428] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00429] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00430] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00431] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00432] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00433] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00434] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00435] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00436] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00437] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00438] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00439] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00440] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00441] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00442] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00443] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00444] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00445] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00446] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00447] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00448] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00449] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L2, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00450] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00451] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00452] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00453] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00454] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00455] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00456] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00457] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00458] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00459] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00460] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00461] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00462] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00463] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00464] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00465] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00466] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00467] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00468] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00469] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00470] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00471] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00472] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00473] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00474] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00475] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00476] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00477] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00478] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00479] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00480] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00481] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00482] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00483] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00484] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00485] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00486] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00487] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00488] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00489] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00490] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00491] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00492] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00493] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00494] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00495] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00496] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00497] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00498] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00499] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00500] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00501] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00502] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00503] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00504] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00505] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00506] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00507] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00508] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00509] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00510] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00511] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00512] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00513] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00514] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00515] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00516] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00517] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00518] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00519] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00520] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00521] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L3, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00522] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00523] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00524] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00525] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00526] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00527] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00528] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00529] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00530] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00531] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00532] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00533] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00534] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00535] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00536] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00537] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00538] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00539] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00540] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00541] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00542] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00543] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00544] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00545] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00546] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00547] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00548] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00549] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00550] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00551] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00552] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00553] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00554] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00555] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00556] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00557] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00558] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00559] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00560] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00561] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00562] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00563] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00564] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00565] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00566] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00567] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00568] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00569] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00570] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00571] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00572] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00573] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00574] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00575] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00576] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00577] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00578] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00579] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00580] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00581] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00582] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00583] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00584] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00585] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00586] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00587] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00588] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00589] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00590] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00591] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00592] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00593] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L4, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00594] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00595] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00596] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00597] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00598] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00599] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00600] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00601] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F1, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00602] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00603] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00604] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00605] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00606] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00607] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00608] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00609] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F2, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00610] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00611] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00612] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00613] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00614] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00615] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00616] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00617] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F3, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00618] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00619] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00620] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00621] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00622] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00623] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00624] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00625] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F4, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00626] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00627] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00628] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00629] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00630] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00631] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00632] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00633] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F5, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00634] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00635] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00636] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00637] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00638] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00639] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00640] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00641] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F6, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00642] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00643] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00644] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00645] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00646] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00647] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00648] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00649] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F7, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00650] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00651] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00652] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00653] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00654] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00655] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00656] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00657] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F8, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00658] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F1.

[00659] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F2.

[00660] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F3.

[00661] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F4.

[00662] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F5.

[00663] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F6.

[00664] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F7.

[00665] В одном из вариантов осуществления молекулярный каркас может содержать по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 5'-фланкирующую область 5F9, по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну область мотива петли L5, и по меньшей мере одну последовательность нуклеиновой кислоты, кодирующую по меньшей мере одну 3'-фланкирующую область 3F8.

[00666] В одном из вариантов осуществления молекулярный каркас может содержать один или несколько линкеров, известных в данной области. Линкеры могут отделять области или один молекулярный каркас от другого. В качестве неограничивающего примера, молекулярный каркас может быть полицистронным.

[00667] В одном из вариантов осуществления модулирующий полинуклеотид разрабатывают с использованием по меньшей мере одного из следующих свойств: вариант петли, вариант несовпадения/выпячивания/качания затравки, несовпадение стебля, вариант петли и вариант несовпадения основания стебля, несовпадение затравки и вариант несовпадения основания стебля, несовпадение стебля и вариант несовпадения основания стебля, качание затравки и вариант качания основания стебля или вариант последовательности стебля.

[00668] В одном из вариантов осуществления молекулярный каркас можно располагать между двумя ITR экспрессирующего вектора. В качестве неограничивающего примера, молекулярный каркас можно вставлять в экспрессирующий вектор в по меньшей мере одном из шести различных местоположений, как показано на фиг. 2. На фиг. 2 «ITR» представляет инвертированный концевой повтор, «I» представляет интрон, «P» представляет полиА и «MP» представляет модулирующий полинуклеотид.

[00669] В одном из вариантов осуществления молекулярный каркас можно располагать ниже промотора, такого как, но не ограничиваясь этим, промотор CMV, U6, H1, CBA или CBA с SV40 или интроном β-глобина человека. Кроме того, молекулярный каркас также можно располагать выше последовательности полиаденилирования. В качестве неограничивающего примера, молекулярный каркас можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве другого неограничивающего примера, молекулярный каркас можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве неограничивающего примера, молекулярный каркас можно располагать в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или больше чем 25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве другого неограничивающего примера, молекулярный каркас можно располагать в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% ниже промотора и/или выше последовательности полиаденилирования.

[00670] В одном из вариантов осуществления молекулярный каркас можно располагать выше последовательности полиаденилирования. Кроме того, молекулярный каркас можно располагать ниже промотора, такого как, но не ограничиваясь этим, промотор CMV, U6, H1, CBA или CBA с SV40 или интроном β-глобина человека. В качестве неограничивающего примера, молекулярный каркас можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве другого неограничивающего примера, молекулярный каркас можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве неограничивающего примера, молекулярный каркас можно располагать в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или больше чем 25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве другого неограничивающего примера, молекулярный каркас можно располагать в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% ниже промотора и/или выше последовательности полиаденилирования.

[00671] В одном из вариантов осуществления молекулярный каркас можно располагать в scAAV.

[00672] В одном из вариантов осуществления молекулярный каркас можно располагать в ssAAV.

[00673] В одном из вариантов осуществления молекулярный каркас можно располагать около 5'-конца флип-конфигурации ITR. В другом варианте осуществления молекулярный каркас можно располагать около 3'-конца флип-конфигурации ITR. В еще одном другом варианте осуществления, молекулярный каркас можно располагать около 5'-конца флоп-конфигурации ITR. В еще одном другом варианте осуществления, молекулярный каркас можно располагать около 3'-конца флоп-конфигурации ITR. В одном из вариантов осуществления молекулярный каркас можно располагать между 5'-концом флип-конфигурации ITR и 3'-концом флоп-конфигурации ITR. В одном из вариантов осуществления молекулярный каркас можно располагать между (например, посредине между 5'-концом флип-конфигурации ITR и 3'-концом флоп-конфигурации ITR или 3'-конец флоп-конфигурации ITR и 5'-конец флип-конфигурации ITR), 3'-конец флип-конфигурации ITR и 5'-конец флип-конфигурации ITR. В качестве неограничивающего примера, молекулярный каркас можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов ниже от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR). В качестве неограничивающего примера, молекулярный каркас можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов выше от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR). В качестве другого неограничивающего примера, молекулярный каркас можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR). В качестве другого неограничивающего примера, молекулярный каркас можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 выше от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR). В качестве неограничивающего примера, молекулярный каркас можно располагать в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или больше чем 25% нуклеотидов выше от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR). В качестве другого неограничивающего примера, молекулярный каркас можно располагать в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% ниже от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурация ITR).

Векторы

[00674] В некоторых вариантах осуществления молекулы миРНК, описанные в настоящем описании, можно кодировать с помощью векторов, таких как плазмиды или вирусные векторы. В одном из вариантов осуществления молекулы миРНК кодируют с помощью вирусных векторов. Вирусные векторы могут представлять собой, но не ограничиваясь этим, герпесвирусные (HSV) векторы, ретровирусные векторы, аденовирусные векторы, аденоассоциированные вирусные векторы, лентивирусные векторы и т. п. В некоторых конкретных вариантах осуществления вирусные векторы представляют собой AAV векторы.

Ретровирусные векторы

[00675] В некоторых вариантах осуществления дуплекс миРНК, направленный на ген SOD1 или HTT, можно кодировать с помощью ретровирусного вектора (см., например, патенты США №№ 5399346; 5124263; 4650764 и 4980289; содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме).

Аденовирусные векторы

[00676] Аденовирусы представляют собой эукариотические ДНК вирусы, которые можно модифицировать для эффективной доставки нуклеиновой кислоты в клетки различных типов in vivo и которые широко использовали в протоколах генной терапии, в том числе чтобы направлять гены в нервные клетки. Описаны различные репликационно-дефектные аденовирусные и минимальные аденовирусные векторы для терапевтических средств из нуклеиновых кислот (см., например, публикацию патента PCT №№ WO199426914, WO 199502697, WO199428152, WO199412649, WO199502697 и WO199622378; содержание каждого из которых включено посредством ссылки в полном объеме). Такие аденовирусные векторы также можно использовать для того, чтобы доставлять молекулы миРНК по настоящему изобретению в клетки.

Аденоассоциированные вирусные (AAV) векторы

[00677] Аденоассоциированный вирус (AAV) представляет собой зависимый парвовирус (подобно другим парвовирусам), который представляет собой одноцепочечный безоболочечный ДНК вирус, имеющий геном приблизительно 5000 нуклеотидов в длину и содержащий две открытые рамки считывания, кодирующие белки, отвечающие за репликацию (Rep) и структурный белок капсида (Cap). Открытые рамки считывания фланкированы двумя последовательностями инвертированных концевых повторов (ITR), которые служат в качестве участка начала репликации вирусного генома. Кроме того, геном AAV содержит упаковочную последовательность, позволяющую упаковывать вирусный геном в капсид AAV. AAV вектору нужен помощник (например, аденовирус), чтобы подвергаться продуктивной инфекции в инфицированных клетках. В отсутствие таких хелперных функций, вирионы AAV по существу проникают в клетки-хозяева, но не встраиваются в геном клетки.

[00678] В силу нескольких уникальных признаков, проводили исследования AAV векторов для доставки миРНК. Неограничивающие примеры признаков включают (i) способность инфицировать делящиеся и не делящиеся клетки; (ii) широкий спектр хозяев для инфекционности, в том числе клетки человека; (iii) AAV дикого типа не связан с каким-либо заболеванием и не демонстрирует репликацию в инфицированных клетках; (iv) отсутствие клеточно-опосредованного иммунного ответа против вектора и (v) неспособность встраиваться в хромосому организма-хозяина, тем самым снижая потенциал долгосрочных генетических изменений. Кроме того, инфекция AAV векторами оказывает минимальное влияние на изменение паттерна экспрессии генов клетки (Stilwell and Samulski et al., Biomethods, 2003, 34, 148).

[00679] Обычно, AAV векторы для доставки миРНК могут представлять собой рекомбинантные вирусные векторы, которые репликационно-дефектны, поскольку у них отсутствуют последовательности, кодирующие функциональные белки Rep и Cap в вирусном геноме. В некоторых случаях, дефектные AAV векторы могут не содержать большинство или все кодирующие последовательности и по существу только содержат одну или две последовательности ITR AAV и упаковочную последовательность.

[00680] В одном из вариантов осуществления AAV векторы, содержащие последовательность нуклеиновой кислоты, кодирующую молекулы миРНК по настоящему изобретению, можно вводить в клетки млекопитающих.

[00681] AAV векторы можно модифицировать для того, чтобы повышать эффективность доставки. Таие модифицированные AAV векторы, содержащие последовательность нуклеиновой кислоты, кодирующую молекулы миРНК по настоящему изобретению, можно эффективно упаковывать и использовать для успешного инфицирования целевых клеток с высокой частотой и минимальной токсичностью.

[00682] В некоторых вариантах осуществления AAV вектор, содержащий последовательность нуклеиновой кислоты, кодирующую молекулы миРНК по настоящему изобретению, может представлять собой AAV вектор серотипа человека. Такой AAV вектор человека можно извлекать из любого известного серотипа, например, из любого одного из серотипов AAV1-AAV11. В качестве неограничивающих примеров, AAV векторы могут представлять собой векторы, содержащие полученный из AAV1 геном в полученном из AAV1 капсиде; векторы, содержащие полученный из AAV2 геном в полученном из AAV2 капсиде; векторы, содержащие полученный из AAV4 геном в полученном из AAV4 капсиде; векторы, содержащие полученный из AAV6 геном в полученном из AAV6 капсиде, или векторы, содержащие полученный из AAV9 геном в полученном из AAV9 капсиде.

[00683] В других вариантах осуществления AAV вектор, содержащий последовательность нуклеиновой кислоты для кодирования молекулы миРНК по настоящему изобретению, может представлять собой псевдотипированный гибридный или химерный AAV вектор, который содержит последовательности и/или компоненты, происходящие из по меньшей мере двух различных серотипов AAV. Псевдотипированные AAV векторы могут представлять собой векторы, содержащие геном AAV, полученный из AAV одного серотипа, и капсидный белок, полученный по меньшей мере частично из AAV другого серотипа. В качестве неограничивающих примеров, такие псевдотипированные AAV векторы могут представлять собой векторы, содержащие полученный из AAV2 геном в полученном из AAV1 капсиде; или векторы, содержащие полученный из AAV2 геном в полученном из AAV6 капсиде; или векторы, содержащие полученный из AAV2 геном в полученном из AAV4 капсиде; или полученный из AAV2 геном в полученном из AAV9 капсиде. Схожим образом, настоящее изобретение предусматривает любой гибридный или химерный AAV вектор.

[00684] В других вариантах осуществления AAV векторы, содержащие последовательность нуклеиновой кислоты, кодирующую молекулы миРНК по настоящему изобретению, можно использовать для того, чтобы доставлять молекулы миРНК в центральную нервную систему (например, патент США № 6180613; содержание которого включено в настоящее описание посредством ссылки в полном объеме).

[00685] В некоторых аспектах AAV векторы, содержащие последовательность нуклеиновой кислоты, кодирующую молекулы миРНК по настоящему изобретению, дополнительно могут содержать модифицированный капсид, содержащий пептиды не вирусного происхождения. В других аспектах, AAV вектор может содержать химерный капсид со специфичностью к CNS, чтобы содействовать доставке кодируемых дуплексов миРНК в головной мозг и спинной мозг. Например, можно создавать выравнивание нуклеотидных последовательностей cap из вариантов AAV, проявляющих тропизм к CNS, чтобы идентифицировать последовательность и структуру вариабельной области (VR).

[00686] В одном из вариантов осуществления AAV вектор, содержащий последовательность нуклеиновой кислоты, кодирующую молекулы миРНК по настоящему изобретению, может кодировать молекулы миРНК, которые представляют собой полицистронные молекулы. Молекулы миРНК дополнительно могут содержать один или несколько линкеров между областями молекул миРНК.

Самокомплементарные и одноцепочечные векторы

[00687] В одном из вариантов осуществления AAV вектор, используемый в настоящем изобретении, представляет собой одноцепочечный вектор (ssAAV).

[00688] В другом варианте осуществления AAV векторы могут представлять собой самокомплементарные AAV векторы (scAAV). scAAV векторы содержат обе цепи ДНК, которые ренатурируют друг с другом с образованием двухцепочечной ДНК. Пропуская синтез второй цепи, scAAV делают возможной быструю экспрессию в клетке.

[00689] В одном из вариантов осуществления AAV вектор, используемый в настоящем изобретении, представляет собой scAAV.

[00690] В данной области раскрыты способы получения и/или модификации AAV векторов, таких как псевдотипированные AAV векторы (международные публикации патентов №№ WO200028004; WO200123001; WO2004112727; WO 2005005610 и WO 2005072364, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме).

Серотипы AAV

[00691] AAV частицы по настоящему изобретению могут содержать любой природный или рекомбинантный серотип AAV или могут быть получены из него. В соответствии с настоящим изобретением, в AAV частицах можно использовать или их можно основывать на серотипе, выбранном из любых из следующих AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV44.1, AAV44.2, AAV44.5, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV1-7/rh.48, AAV1-8/rh.49, AAV2-15/rh.62, AAV2-3/rh.61, AAV2-4/rh.50, AAV2-5/rh.51, AAV3.1/hu.6, AAV3.1/hu.9, AAV3-9/rh.52, AAV3-11/rh.53, AAV4-8/r11.64, AAV4-9/rh.54, AAV4-19/rh.55, AAV5-3/rh.57, AAV5-22/rh.58, AAV7.3/hu.7, AAV16.8/hu.10, AAV16.12/hu.11, AAV29.3/bb.1, AAV29.5/bb.2, AAV106.1/hu.37, AAV114.3/hu.40, AAV127.2/hu.41, AAV127.5/hu.42, AAV128.3/hu.44, AAV130.4/hu.48, AAV145.1/hu.53, AAV145.5/hu.54, AAV145.6/hu.55, AAV161.10/hu.60, AAV161.6/hu.61, AAV33.12/hu.17, AAV33.4/hu.15, AAV33.8/hu.16, AAV52/hu.19, AAV52.1/hu.20, AAV58.2/hu.25, AAVA3.3, AAVA3.4, AAVA3.5, AAVA3.7, AAVC1, AAVC2, AAVC5, AAV-DJ, AAV-DJ8, AAVF3, AAVF5, AAVH2, AAVrh.72, AAVhu.8, AAVrh.68, AAVrh.70, AAVpi.1, AAVpi.3, AAVpi.2, AAVrh.60, AAVrh.44, AAVrh.65, AAVrh.55, AAVrh.47, AAVrh.69, AAVrh.45, AAVrh.59, AAVhu.12, AAVH6, AAVLK03, AAVH-1/hu.1, AAVH-5/hu.3, AAVLG-10/rh.40, AAVLG-4/rh.38, AAVLG-9/hu.39, AAVN721-8/rh.43, AAVCh.5, AAVCh.5R1, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVCy.5R1, AAVCy.5R2, AAVCy.5R3, AAVCy.5R4, AAVcy.6, AAVhu.1, AAVhu.2, AAVhu.3, AAVhu.4, AAVhu.5, AAVhu.6, AAVhu.7, AAVhu.9, AAVhu.10, AAVhu.11, AAVhu.13, AAVhu.15, AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.20, AAVhu.21, AAVhu.22, AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29, AAVhu.29R, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AAVhu.39, AAVhu.40, AAVhu.41, AAVhu.42, AAVhu.43, AAVhu.44, AAVhu.44R1, AAVhu.44R2, AAVhu.44R3, AAVhu.45, AAVhu.46, AAVhu.47, AAVhu.48, AAVhu.48R1, AAVhu.48R2, AAVhu.48R3, AAVhu.49, AAVhu.51, AAVhu.52, AAVhu.54, AAVhu.55, AAVhu.56, AAVhu.57, AAVhu.58, AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu.14/9, AAVhu.t 19, AAVrh.2, AAVrh.2R, AAVrh.8, AAVrh.8R, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.46, AAVrh.48, AAVrh.48.1, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, мутант A586R AAVrh8R, R533A мутант AAVrh8R, AAAV, BAAV, AAV козы, AAV коровы, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhER1.16, AAVhER1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-пре-мкРНК-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV Shuffle 100-1, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV Shuffle 100-2, AAV SM 10-1, AAV SM 10-8, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8/rh.64, AAVLG-9/hu.39, AAV54.5/hu.23, AAV54.2/hu.22, AAV54.7/hu.24, AAV54.1/hu.21, AAV54.4R/hu.27, AAV46.2/hu.28, AAV46.6/hu.29, AAV128.1/hu.43, AAV подлинного типа (ttAAV), UPENN AAV 10, японских серотипов AAV 10, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAV CHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10, AAV CKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B1, AAV CKd-B2, AAV CKd-B3, AAV CKd-B4, AAV CKd-B5, AAV CKd-B6, AAV CKd-B7, AAV CKd-B8, AAV CKd-H1, AAV CKd-H2, AAV CKd-H3, AAV CKd-H4, AAV CKd-H5, AAV CKd-H6, AAV CKd-N3, AAV CKd-N4, AAV CKd-N9, AAV CLg-F1, AAV CLg-F2, AAV CLg-F3, AAV CLg-F4, AAV CLg-F5, AAV CLg-F6, AAV CLg-F7, AAV CLg-F8, AAV CLv-1, AAV CLv1-1, AAV Clv1-10, AAV CLv1-2, AAV CLv-12, AAV CLv1-3, AAV CLv-13, AAV CLv1-4, AAV Clv1-7, AAV Clv1-8, AAV Clv1-9, AAV CLv-2, AAV CLv-3, AAV CLv-4, AAV CLv-6, AAV CLv-8, AAV CLv-D1, AAV CLv-D2, AAV CLv-D3, AAV CLv-D4, AAV CLv-D5, AAV CLv-D6, AAV CLv-D7, AAV CLv-D8, AAV CLv-E1, AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-L5, AAV CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1, AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11, AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV CSp-6, AAV CSp-7, AAV CSp-8, AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV.hu.48R3, AAV.VR-355, AAV3B, AAV4, AAV5, AAVF1/HSC1, AAVF11/HSC11, AAVF12/HSC12, AAVF13/HSC13, AAVF14/HSC14, AAVF15/HSC15, AAVF16/HSC16, AAVF17/HSC17, AAVF2/HSC2, AAVF3/HSC3, AAVF4/HSC4, AAVF5/HSC5, AAVF6/HSC6, AAVF7/HSC7, AAVF8/HSC8, AAVF9/HSC9, AAV-PHP.B (PHP.B), AAV-PHP.A (PHP.A), G2B-26, G2B-13, TH1.1-32 и/или TH1.1-35 и их вариантов. В качестве неограничивающего примера, капсид рекомбинантного AAV вируса представляет собой AAV2. В качестве неограничивающего примера, капсид рекомбинантного AAV вируса представляет собой AAVrh10. В качестве неограничивающего примера, капсид рекомбинантного AAV вируса представляет собой AAV9(hu14). В качестве неограничивающего примера, капсид рекомбинантного AAV вируса представляет собой AAV-DJ. В качестве неограничивающего примера, капсид рекомбинантного AAV вируса представляет собой AAV9.47. В качестве неограничивающего примера, капсид рекомбинантного AAV вируса представляет собой AAV-DJ8. В качестве неограничивающего примера, капсид рекомбинантного AAV вируса представляет собой AAV-PHP.B. В качестве неограничивающего примера, капсид рекомбинантного AAV вируса представляет собой AAV-PHP.A.

[00692] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в публикации США № US20030138772, содержание которой включено в настоящее описание посредством ссылки в полном объеме, такую как, но не ограничиваясь этим, AAV1 (SEQ ID NO:6 и 64 из US20030138772), AAV2 (SEQ ID NO:7 и 70 из US20030138772), AAV3 (SEQ ID NO:8 и 71 из US20030138772), AAV4 (SEQ ID NO:63 из US20030138772), AAV5 (SEQ ID NO:114 из US20030138772), AAV6 (SEQ ID NO:65 из US20030138772), AAV7 (SEQ ID NO:1-3 из US20030138772), AAV8 (SEQ ID NO:4 и 95 из US20030138772), AAV9 (SEQ ID NO:5 и 100 из US20030138772), AAV10 (SEQ ID NO:117 из US20030138772), AAV11 (SEQ ID NO:118 из US20030138772), AAV12 (SEQ ID NO:119 из US20030138772), AAVrh10 (аминокислоты с 1 до 738 из SEQ ID NO:81 из US20030138772), AAV16.3 (US20030138772 SEQ ID NO:10), AAV29.3/bb.1 (US20030138772 SEQ ID NO:11), AAV29.4 (US20030138772 SEQ ID NO:12), AAV29.5/bb.2 (US20030138772 SEQ ID NO:13), AAV1.3 (US20030138772 SEQ ID NO:14), AAV13.3 (US20030138772 SEQ ID NO:15), AAV24.1 (US20030138772 SEQ ID NO:16), AAV27.3 (US20030138772 SEQ ID NO:17), AAV7.2 (US20030138772 SEQ ID NO:18), AAVC1 (US20030138772 SEQ ID NO:19), AAVC3 (US20030138772 SEQ ID NO:20), AAVC5 (US20030138772 SEQ ID NO:21), AAVF1 (US20030138772 SEQ ID NO:22), AAVF3 (US20030138772 SEQ ID NO:23), AAVF5 (US20030138772 SEQ ID NO:24), AAVH6 (US20030138772 SEQ ID NO:25), AAVH2 (US20030138772 SEQ ID NO:26), AAV42-8 (US20030138772 SEQ ID NO:27), AAV42-15 (US20030138772 SEQ ID NO:28), AAV42-5b (US20030138772 SEQ ID NO:29), AAV42-1b (US20030138772 SEQ ID NO:30), AAV42-13 (US20030138772 SEQ ID NO:31), AAV42-3a (US20030138772 SEQ ID NO:32), AAV42-4 (US20030138772 SEQ ID NO:33), AAV42-5a (US20030138772 SEQ ID NO:34), AAV42-10 (US20030138772 SEQ ID NO:35), AAV42-3b (US20030138772 SEQ ID NO:36), AAV42-11 (US20030138772 SEQ ID NO:37), AAV42-6b (US20030138772 SEQ ID NO:38), AAV43-1 (US20030138772 SEQ ID NO:39), AAV43-5 (US20030138772 SEQ ID NO:40), AAV43-12 (US20030138772 SEQ ID NO:41), AAV43-20 (US20030138772 SEQ ID NO:42), AAV43-21 (US20030138772 SEQ ID NO:43), AAV43-23 (US20030138772 SEQ ID NO:44), AAV43-25 (US20030138772 SEQ ID NO:45), AAV44.1 (US20030138772 SEQ ID NO:46), AAV44.5 (US20030138772 SEQ ID NO:47), AAV223.1 (US20030138772 SEQ ID NO:48), AAV223.2 (US20030138772 SEQ ID NO:49), AAV223.4 (US20030138772 SEQ ID NO:50), AAV223.5 (US20030138772 SEQ ID NO:51), AAV223.6 (US20030138772 SEQ ID NO:52), AAV223.7 (US20030138772 SEQ ID NO:53), AAVA3.4 (US20030138772 SEQ ID NO:54), AAVA3.5 (US20030138772 SEQ ID NO:55), AAVA3.7 (US20030138772 SEQ ID NO:56), AAVA3.3 (US20030138772 SEQ ID NO:57), AAV42.12 (US20030138772 SEQ ID NO:58), AAV44.2 (US20030138772 SEQ ID NO:59), AAV42-2 (US20030138772 SEQ ID NO:9) или их варианты.

[00693] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в публикации США № US20150159173, содержание которой включено в настоящее описание посредством ссылки в полном объеме, такой как, но не ограничиваясь этим, AAV2 (SEQ ID NO:7 и 23 из US20150159173), rh20 (SEQ ID NO:1 из US20150159173), rh32/33 (SEQ ID NO:2 из US20150159173), rh39 (SEQ ID NO:3, 20 и 36 из US20150159173), rh46 (SEQ ID NO:4 и 22 из US20150159173), rh73 (SEQ ID NO:5 из US20150159173), rh74 (SEQ ID NO:6 из US20150159173), AAV6.1 (SEQ ID NO:29 из US20150159173), rh.8 (SEQ ID NO:41 из US20150159173), rh.48.1 (SEQ ID NO:44 из US20150159173), hu.44 (SEQ ID NO:45 из US20150159173), hu.29 (SEQ ID NO:42 из US20150159173), hu.48 (SEQ ID NO:38 из US20150159173), rh54 (SEQ ID NO:49 из US20150159173), AAV2 (SEQ ID NO:7 из US20150159173), cy.5 (SEQ ID NO:8 и 24 из US20150159173), rh.10 (SEQ ID NO:9 и 25 из US20150159173), rh.13 (SEQ ID NO:10 и 26 из US20150159173), AAV1 (SEQ ID NO:11 и 27 из US20150159173), AAV3 (SEQ ID NO:12 и 28 из US20150159173), AAV6 (SEQ ID NO:13 и 29 из US20150159173), AAV7 (SEQ ID NO:14 и 30 из US20150159173), AAV8 (SEQ ID NO:15 и 31 из US20150159173), hu.13 (SEQ ID NO:16 и 32 из US20150159173), hu.26 (SEQ ID NO:17 и 33 из US20150159173), hu.37 (SEQ ID NO:18 и 34 из US20150159173), hu.53 (SEQ ID NO:19 и 35 из US20150159173), rh.43 (SEQ ID NO:21 и 37 из US20150159173), rh2 (SEQ ID NO:39 из US20150159173), rh.37 (SEQ ID NO:40 из US20150159173), rh.64 (SEQ ID NO:43 из US20150159173), rh.48 (SEQ ID NO:44 из US20150159173), ch.5 (SEQ ID NO:46 из US20150159173), rh.67 (SEQ ID NO:47 из US20150159173), rh.58 (SEQ ID NO:48 из US20150159173) или их варианты, включая в качестве неограничивающих примеров Cy5R1, Cy5R2, Cy5R3, Cy5R4, rh.13R, rh.37R2, rh.2R, rh.8R, rh.48.1, rh.48.2, rh.48.1.2, hu.44R1, hu.44R2, hu.44R3, hu.29R, ch.5R1, rh64R1, rh64R2, AAV6.2, AAV6.1, AAV6.12, hu.48R1, hu.48R2 и hu.48R3.

[00694] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в патенте США № US 7198951, содержание которого включено в настоящее описание посредством ссылки в полном объеме, такой как, но не ограничиваясь этим, AAV9 (SEQ ID NO:1-3 из US 7198951), AAV2 (SEQ ID NO:4 из US 7198951), AAV1 (SEQ ID NO:5 из US 7198951), AAV3 (SEQ ID NO:6 из US 7198951), и AAV8 (SEQ ID NO:7 из US7198951).

[00695] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь мутацию в последовательности AAV9, как описано в N Pulicherla et al. (Molecular Therapy 19(6):1070-1078 (2011), включенном в настоящее описание посредством ссылки в полном объеме), такую как, но не ограничиваясь этим, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.

[00696] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в патенте США № US 6156303, содержание которого включено в настоящее описание посредством ссылки в полном объеме, такой как, но не ограничиваясь этим, AAV3B (SEQ ID NO:1 и 10 из US 6156303), AAV6 (SEQ ID NO:2, 7 и 11 из US 6156303), AAV2 (SEQ ID NO:3 и 8 из US 6156303), AAV3A (SEQ ID NO:4 и 9 из US 6156303) или их производные.

[00697] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в публикации США № US20140359799, содержание которой включено в настоящее описание посредством ссылки в полном объеме, такой как, но не ограничиваясь этим, AAV8 (SEQ ID NO:1 из US20140359799), AAVDJ (SEQ ID NO:2 и 3 из US20140359799) или их варианты.

[00698] В некоторых вариантах осуществления серотип может быть AAVDJ или его вариантом, таким как AAVDJ8 (или AAV-DJ8), как описано в Grimm et al. (Journal of Virology 82(12): 5887-5911 (2008), включенной в настоящее описание посредством ссылки в полном объеме). Аминокислотная последовательность AAVDJ8 может содержать две или больше мутаций для того, чтобы удалять гепаринсвязывающий домен (HBD). В качестве неограничивающего примера, последовательность AAV-DJ, описанная как SEQ ID NO:1 в патенте США № 7588772, содержание которого включено в настоящее описание посредством ссылки в полном объеме, может содержать две мутации: (1) R587Q, где аргинин (R; Arg) в аминокислоте 587 изменяют на глутамин (Q; Gln) и (2) R590T, где аргинин (R; Arg) в аминокислоте 590 изменяют на треонин (T; Thr). В качестве другого неограничивающего примера, может содержать три мутации: (1) K406R, где лизин (K; Lys) в аминокислоте 406 изменяют на аргинин (R; Arg), (2) R587Q, где аргинин (R; Arg) в аминокислоте 587 изменяют на глутамин (Q; Gln) и (3) R590T, где аргинин (R; Arg) в аминокислоте 590 изменяют на треонин (T; Thr).

[00699] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность AAV4, как описано в международной публикации № WO1998011244, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV4 (SEQ ID NO:1-20 из WO1998011244).

[00700] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь мутацию в последовательности AAV2 для того, чтобы создавать AAV2G9, как описано в международной публикации № WO2014144229, которая включена в настоящее описание посредством ссылки в полном объеме.

[00701] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в международной публикации № WO2005033321, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV3-3 (SEQ ID NO:217 из WO2005033321), AAV1 (SEQ ID NO:219 и 202 из WO2005033321), AAV106.1/hu.37 (SEQ ID NO:10 из WO2005033321), AAV114.3/hu.40 (SEQ ID NO:11 из WO2005033321), AAV127.2/hu.41 (SEQ ID NO:6 и 8 из WO2005033321), AAV128.3/hu.44 (SEQ ID NO:81 из WO2005033321), AAV130.4/hu.48 (SEQ ID NO:78 из WO2005033321), AAV145.1/hu.53 (SEQ ID NO:176 и 177 из WO2005033321), AAV145.6/hu.56 (SEQ ID NO:168 и 192 из WO2005033321), AAV16.12/hu.11 (SEQ ID NO:153 и 57 из WO2005033321), AAV16.8/hu.10 (SEQ ID №: 156 и 56 из WO2005033321), AAV161.10/hu.60 (SEQ ID NO:170 из WO2005033321), AAV161.6/hu.61 (SEQ ID NO:174 из WO2005033321), AAV1-7/rh.48 (SEQ ID NO:32 из WO2005033321), AAV1-8/rh.49 (SEQ ID №№ 103 и 25 из WO2005033321), AAV2 (SEQ ID NO:211 и 221 из WO2005033321), AAV2-15/rh.62 (SEQ ID NO:33 и 114 из WO2005033321), AAV2-3/rh.61 (SEQ ID NO:21 из WO2005033321), AAV2-4/rh.50 (SEQ ID NO:23 и 108 из WO2005033321), AAV2-5/rh.51 (SEQ ID NO:104 и 22 из WO2005033321), AAV3.1/hu.6 (SEQ ID NO:5 и 84 из WO2005033321), AAV3.1/hu.9 (SEQ ID NO:155 и 58 из WO2005033321), AAV3-11/rh.53 (SEQ ID NO:186 и 176 из WO2005033321), AAV3-3 (SEQ ID NO:200 из WO2005033321), AAV33.12/hu.17 (SEQ ID NO:4 из WO2005033321), AAV33.4/hu.15 (SEQ ID NO:50 из WO2005033321), AAV33.8/hu.16 (SEQ ID NO:51 из WO2005033321), AAV3-9/rh.52 (SEQ ID NO:96 и 18 из WO2005033321), AAV4-19/rh.55 (SEQ ID NO:117 из WO2005033321), AAV4-4 (SEQ ID NO:201 и 218 из WO2005033321), AAV4-9/rh.54 (SEQ ID NO:116 из WO2005033321), AAV5 (SEQ ID NO:199 и 216 из WO2005033321), AAV52.1/hu.20 (SEQ ID NO:63 из WO2005033321), AAV52/hu.19 (SEQ ID NO:133 из WO2005033321), AAV5-22/rh.58 (SEQ ID NO:27 из WO2005033321), AAV5-3/rh.57 (SEQ ID NO:105 из WO2005033321), AAV5-3/rh.57 (SEQ ID NO:26 из WO2005033321), AAV58.2/hu.25 (SEQ ID NO:49 из WO2005033321), AAV6 (SEQ ID NO:203 и 220 из WO2005033321), AAV7 (SEQ ID NO:222 и 213 из WO2005033321), AAV7.3/hu.7 (SEQ ID NO:55 из WO2005033321), AAV8 (SEQ ID NO:223 и 214 из WO2005033321), AAVH-1/hu.1 (SEQ ID NO:46 из WO2005033321), AAVH-5/hu.3 (SEQ ID NO:44 из WO2005033321), AAVhu.1 (SEQ ID NO:144 из WO2005033321), AAVhu.10 (SEQ ID NO:156 из WO2005033321), AAVhu.11 (SEQ ID NO:153 из WO2005033321), AAVhu.12 (WO2005033321 SEQ ID NO:59), AAVhu.13 (SEQ ID NO:129 из WO2005033321), AAVhu.14/AAV9 (SEQ ID NO:123 и 3 из WO2005033321), AAVhu.15 (SEQ ID NO:147 из WO2005033321), AAVhu.16 (SEQ ID NO:148 из WO2005033321), AAVhu.17 (SEQ ID NO:83 из WO2005033321), AAVhu.18 (SEQ ID NO:149 из WO2005033321), AAVhu.19 (SEQ ID NO:133 из WO2005033321), AAVhu.2 (SEQ ID NO:143 из WO2005033321), AAVhu.20 (SEQ ID NO:134 из WO2005033321), AAVhu.21 (SEQ ID NO:135 из WO2005033321), AAVhu.22 (SEQ ID NO:138 из WO2005033321), AAVhu.23.2 (SEQ ID NO:137 из WO2005033321), AAVhu.24 (SEQ ID NO:136 из WO2005033321), AAVhu.25 (SEQ ID NO:146 из WO2005033321), AAVhu.27 (SEQ ID NO:140 из WO2005033321), AAVhu.29 (SEQ ID NO:132 из WO2005033321), AAVhu.3 (SEQ ID NO:145 из WO2005033321), AAVhu.31 (SEQ ID NO:121 из WO2005033321), AAVhu.32 (SEQ ID NO:122 из WO2005033321), AAVhu.34 (SEQ ID NO:125 из WO2005033321), AAVhu.35 (SEQ ID NO:164 из WO2005033321), AAVhu.37 (SEQ ID NO:88 из WO2005033321), AAVhu.39 (SEQ ID NO:102 из WO2005033321), AAVhu.4 (SEQ ID NO:141 из WO2005033321), AAVhu.40 (SEQ ID NO:87 из WO2005033321), AAVhu.41 (SEQ ID NO:91 из WO2005033321), AAVhu.42 (SEQ ID NO:85 из WO2005033321), AAVhu.43 (SEQ ID NO:160 из WO2005033321), AAVhu.44 (SEQ ID NO:144 из WO2005033321), AAVhu.45 (SEQ ID NO:127 из WO2005033321), AAVhu.46 (SEQ ID NO:159 из WO2005033321), AAVhu.47 (SEQ ID NO:128 из WO2005033321), AAVhu.48 (SEQ ID NO:157 из WO2005033321), AAVhu.49 (SEQ ID NO:189 из WO2005033321), AAVhu.51 (SEQ ID NO:190 из WO2005033321), AAVhu.52 (SEQ ID NO:191 из WO2005033321), AAVhu.53 (SEQ ID NO:186 из WO2005033321), AAVhu.54 (SEQ ID NO:188 из WO2005033321), AAVhu.55 (SEQ ID NO:187 из WO2005033321), AAVhu.56 (SEQ ID NO:192 из WO2005033321), AAVhu.57 (SEQ ID NO:193 из WO2005033321), AAVhu.58 (SEQ ID NO:194 из WO2005033321), AAVhu.6 (SEQ ID NO:84 из WO2005033321), AAVhu.60 (SEQ ID NO:184 из WO2005033321), AAVhu.61 (SEQ ID NO:185 из WO2005033321), AAVhu.63 (SEQ ID NO:195 из WO2005033321), AAVhu.64 (SEQ ID NO:196 из WO2005033321), AAVhu.66 (SEQ ID NO:197 из WO2005033321), AAVhu.67 (SEQ ID NO:198 из WO2005033321), AAVhu.7 (SEQ ID NO:150 из WO2005033321), AAVhu.8 (WO2005033321 SEQ ID NO:12), AAVhu.9 (SEQ ID NO:155 из WO2005033321), AAVLG-10/rh.40 (SEQ ID NO:14 из WO2005033321), AAVLG-4/rh.38 (SEQ ID NO:86 из WO2005033321), AAVLG-4/rh.38 (SEQ ID NO:7 из WO2005033321), AAVN721-8/rh.43 (SEQ ID NO:163 из WO2005033321), AAVN721-8/rh.43 (SEQ ID NO:43 из WO2005033321), AAVpi.1 (WO2005033321 SEQ ID NO:28), AAVpi.2 (WO2005033321 SEQ ID NO:30), AAVpi.3 (WO2005033321 SEQ ID NO:29), AAVrh.38 (SEQ ID NO:86 из WO2005033321), AAVrh.40 (SEQ ID NO:92 из WO2005033321), AAVrh.43 (SEQ ID NO:163 из WO2005033321), AAVrh.44 (WO2005033321 SEQ ID NO:34), AAVrh.45 (WO2005033321 SEQ ID NO:41), AAVrh.47 (WO2005033321 SEQ ID NO:38), AAVrh.48 (SEQ ID NO:115 из WO2005033321), AAVrh.49 (SEQ ID NO:103 из WO2005033321), AAVrh.50 (SEQ ID NO:108 из WO2005033321), AAVrh.51 (SEQ ID NO:104 из WO2005033321), AAVrh.52 (SEQ ID NO:96 из WO2005033321), AAVrh.53 (SEQ ID NO:97 из WO2005033321), AAVrh.55 (WO2005033321 SEQ ID NO:37), AAVrh.56 (SEQ ID NO:152 из WO2005033321), AAVrh.57 (SEQ ID NO:105 из WO2005033321), AAVrh.58 (SEQ ID NO:106 из WO2005033321), AAVrh.59 (WO2005033321 SEQ ID NO:42), AAVrh.60 (WO2005033321 SEQ ID NO:31), AAVrh.61 (SEQ ID NO:107 из WO2005033321), AAVrh.62 (SEQ ID NO:114 из WO2005033321), AAVrh.64 (SEQ ID NO:99 из WO2005033321), AAVrh.65 (WO2005033321 SEQ ID NO:35), AAVrh.68 (WO2005033321 SEQ ID NO:16), AAVrh.69 (WO2005033321 SEQ ID NO:39), AAVrh.70 (WO2005033321 SEQ ID NO:20), AAVrh.72 (WO2005033321 SEQ ID NO:9) или их варианты, включая в качестве неограничивающих примеров, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVcy.6, AAVrh.12, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.25/42 15, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh14. Неограничивающие примеры вариантов включают SEQ ID NO:13, 15, 17, 19, 24, 36, 40, 45, 47, 48, 51-54, 60-62, 64-77, 79, 80, 82, 89, 90, 93-95, 98, 100, 101, 109-113, 118-120, 124, 126, 131, 139, 142, 151, 154, 158, 161, 162, 165-183, 202, 204-212, 215, 219, 224-236 из WO2005033321, содержание которой включено в настоящее описание посредством ссылки в полном объеме.

[00702] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в международной публикации № WO2015168666, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAVrh8R (SEQ ID NO:9 из WO2015168666), мутант A586R AAVrh8R (SEQ ID NO:10 из WO2015168666), R533A мутант AAVrh8R (SEQ ID NO:11 из WO2015168666) или их варианты.

[00703] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в патенте США № US9233131, содержание которого включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAVhE1.1 (SEQ ID NO:44 из US9233131), AAVhEr1.5 (SEQ ID NO:45 из US9233131), AAVhER1.14 (SEQ ID NO:46 из US9233131), AAVhEr1.8 (SEQ ID NO:47 из US9233131), AAVhER1.16 (SEQ ID NO:48 из US9233131), AAVhER1.18 (SEQ ID NO:49 из US9233131), AAVhEr1.35 (SEQ ID NO:50 из US9233131), AAVhEr1.7 (SEQ ID NO:51 из US9233131), AAVhEr1.36 (SEQ ID NO:52 из US9233131), AAVhEr2.29 (SEQ ID NO:53 из US9233131), AAVhEr2.4 (SEQ ID NO:54 из US9233131), AAVhEr2.16 (SEQ ID NO:55 из US9233131), AAVhEr2.30 (SEQ ID NO:56 из US9233131), AAVhEr2.31 (SEQ ID NO:58 из US9233131), AAVhEr2.36 (SEQ ID NO:57 из US9233131), AAVhER1.23 (SEQ ID NO:53 из US9233131), AAVhEr3.1 (SEQ ID NO:59 из US9233131), AAV2.5T (SEQ ID NO:42 из US9233131) или их варианты.

[00704] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в публикации патента США № US20150376607, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV-PAEC (SEQ ID NO:1 из US20150376607), AAV-LK01 (SEQ ID NO:2 из US20150376607), AAV-LK02 (SEQ ID NO:3 из US20150376607), AAV-LK03 (SEQ ID NO:4 из US20150376607), AAV-LK04 (SEQ ID NO:5 из US20150376607), AAV-LK05 (SEQ ID NO:6 из US20150376607), AAV-LK06 (SEQ ID NO:7 из US20150376607), AAV-LK07 (SEQ ID NO:8 из US20150376607), AAV-LK08 (SEQ ID NO:9 из US20150376607), AAV-LK09 (SEQ ID NO:10 из US20150376607), AAV-LK10 (SEQ ID NO:11 из US20150376607), AAV-LK11 (SEQ ID NO:12 из US20150376607), AAV-LK12 (SEQ ID NO:13 из US20150376607), AAV-LK13 (SEQ ID NO:14 из US20150376607), AAV-LK14 (SEQ ID NO:15 из US20150376607), AAV-LK15 (SEQ ID NO:16 из US20150376607), AAV-LK16 (SEQ ID NO:17 из US20150376607), AAV-LK17 (SEQ ID NO:18 из US20150376607), AAV-LK18 (SEQ ID NO:19 из US20150376607), AAV-LK19 (SEQ ID NO:20 из US20150376607), AAV-PAEC2 (SEQ ID NO:21 из US20150376607), AAV-PAEC4 (SEQ ID NO:22 из US20150376607), AAV-PAEC6 (SEQ ID NO:23 из US20150376607), AAV-PAEC7 (SEQ ID NO:24 из US20150376607), AAV-PAEC8 (SEQ ID NO:25 из US20150376607), AAV-PAEC11 (SEQ ID NO:26 из US20150376607), AAV-PAEC12 (SEQ ID NO:27, из US20150376607) или их варианты.

[00705] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в патенте США № US9163261, содержание которого включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV-2-пре-мкРНК-101 (SEQ ID NO:1 US9163261) или ее варианты.

[00706] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в публикации патента США № US20150376240, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV-8h (SEQ ID NO:6 из US20150376240), AAV-8b (SEQ ID NO:5 из US20150376240), AAV-h (SEQ ID NO:2 из US20150376240), AAV-b (SEQ ID NO:1 из US20150376240) или их варианты.

[00707] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в публикации патента США № US20160017295, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV SM 10-2 (SEQ ID NO:22 из US20160017295), AAV Shuffle 100-1 (SEQ ID NO:23 из US20160017295), AAV Shuffle 100-3 (SEQ ID NO:24 из US20160017295), AAV Shuffle 100-7 (SEQ ID NO:25 из US20160017295), AAV Shuffle 10-2 (SEQ ID NO:34 из US20160017295), AAV Shuffle 10-6 (SEQ ID NO:35 из US20160017295), AAV Shuffle 10-8 (SEQ ID NO:36 из US20160017295), AAV Shuffle 100-2 (SEQ ID NO:37 из US20160017295), AAV SM 10-1 (SEQ ID NO:38 из US20160017295), AAV SM 10-8 (SEQ ID NO:39 из US20160017295), AAV SM 100-3 (SEQ ID NO:40 из US20160017295), AAV SM 100-10 (SEQ ID NO:41 из US20160017295) или их варианты.

[00708] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в публикации патента США № US20150238550, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, BNP61 AAV (SEQ ID NO:1 из US20150238550), BNP62 AAV (SEQ ID NO:3 из US20150238550), BNP63 AAV (SEQ ID NO:4 из US20150238550) или их варианты.

[00709] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в публикации патента США № US20150238550, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, BNP61 AAV (SEQ ID NO:1 из US20150238550), BNP62 AAV (SEQ ID NO:3 из US20150238550), BNP63 AAV (SEQ ID NO:4 из US20150238550) или их варианты.

[00710] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в международной публикации № WO2015121501, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV подлинного типа (ttAAV) (SEQ ID NO:2 из WO2015121501), «UPenn AAV10» (SEQ ID NO:8 из WO2015121501), «японский AAV10» (SEQ ID NO:9 из WO2015121501) или их варианты.

[00711] В соответствии с настоящим изобретением, серотип капсида AAV можно выбирать или использовать из множества видов. В одном из вариантов осуществления AAV может представлять собой AAV птицы (AAAV). Серотип AAAV может представлять собой или иметь последовательность, как описано в патенте США № US 9238800, содержание которого включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAAV (SEQ ID NO:1, 2, 4, 6, 8, 10, 12, и 14 из US 9238800) или ее варианты.

[00712] В одном из вариантов осуществления AAV может представлять собой AAV коровы (BAAV). Серотип BAAV может представлять собой или иметь последовательность, как описано в патенте США № US 9193769, содержание которого включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, BAAV (SEQ ID NO:1 и 6 из US 9193769) или ее варианты. Серотип BAAV может представлять собой или иметь последовательность, как описано в патенте США № US7427396, содержание которого включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, BAAV (SEQ ID NO:5 и 6 из US7427396) или ее варианты.

[00713] В одном из вариантов осуществления AAV может представлять собой AAV козы. Серотип AAV козы может представлять собой или иметь последовательность, как описано в патенте США № US7427396, содержание которого включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV козы (SEQ ID NO:3 из US7427396) или ее варианты.

[00714] В других вариантах осуществления AAV можно конструировать в виде гибридного AAV из двух или больше родительских серотипов. В одном из вариантов осуществления AAV может представлять собой AAV2G9, который содержит последовательности из AAV2 и AAV9. AAV2G9 серотип AAV может представлять собой или иметь последовательность, как описано в публикации патента США № US20160017005, содержание которой включено в настоящее описание посредством ссылки в полном объеме.

[00715] В одном из вариантов осуществления AAV может представлять собой серотип, созданный с помощью библиотеки капсидов AAV9 с мутациями в аминокислотах 390-627 (нумерация VP1), как описано в Pulicherla et al. (Molecular Therapy 19(6):1070-1078 (2011), содержание которого включено в настоящее описание посредством ссылки в полном объеме. Серотип и соответствующие замены нуклеотидов и аминокислот могут представлять собой, но не ограничиваясь этим, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A и T1436X; V473D и I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T125C и A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAV9.33 (A1667C; D556A), AAV9.34 (A1534G, C1794T; N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C; T450S), AAV9.44 (A1684C, A1701T, A1737G; N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W509R, L517V), 9,47 (G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G1301A, A1405C, C1664T, G1811T; R134Q, S469R, A555V, G604V), AAV9.54 (C1531A, T1609A; L511I, L537M), AAV9.55 (T1605A; F535L), AAV9.58 (C1475T, C1579A; T492I, H527N), AAV.59 (T1336C; Y446H), AAV9.61 (A1493T; N498I), AAV9.64 (C1531A, A1617T; L511I), AAV9.65 (C1335T, T1530C, C1568A; A523D), AAV9.68 (C1510A; P504T), AAV9.80 (G1441A, G481R), AAV9.83 (C1402A, A1500T; P468T, E500D), AAV9.87 (T1464C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91 (T1316G, A1583T, C1782G, T1806C; L439R, K528I), AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T; M559L) и AAV9.95 (T1605A; F535L).

[00716] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в международной публикации № WO2016049230, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAVF1/HSC1 (SEQ ID NO:2 и 20 из WO2016049230), AAVF2/HSC2 (SEQ ID NO:3 и 21 из WO2016049230), AAVF3/HSC3 (SEQ ID NO:5 и 22 из WO2016049230), AAVF4/HSC4 (SEQ ID NO:6 и 23 из WO2016049230), AAVF5/HSC5 (SEQ ID NO:11 и 25 из WO2016049230), AAVF6/HSC6 (SEQ ID NO:7 и 24 из WO2016049230), AAVF7/HSC7 (SEQ ID NO:8 и 27 из WO2016049230), AAVF8/HSC8 (SEQ ID NO:9 и 28 из WO2016049230), AAVF9/HSC9 (SEQ ID NO:10 и 29 из WO2016049230), AAVF11/HSC11 (SEQ ID NO:4 и 26 из WO2016049230), AAVF12/HSC12 (SEQ ID NO:12 и 30 из WO2016049230), AAVF13/HSC13 (SEQ ID NO:14 и 31 из WO2016049230), AAVF14/HSC14 (SEQ ID NO:15 и 32 из WO2016049230), AAVF15/HSC15 (SEQ ID NO:16 и 33 из WO2016049230), AAVF16/HSC16 (SEQ ID NO:17 и 34 из WO2016049230), AAVF17/HSC17 (SEQ ID NO:13 и 35 из WO2016049230) или их варианты или производные.

[00717] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в патенте США № US 8734809, содержание которого включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV CBr-E1 (SEQ ID NO:13 и 87 из US8734809), AAV CBr-E2 (SEQ ID NO:14 и 88 из US8734809), AAV CBr-E3 (SEQ ID NO:15 и 89 из US8734809), AAV CBr-E4 (SEQ ID NO:16 и 90 из US8734809), AAV CBr-E5 (SEQ ID NO:17 и 91 из US8734809), AAV CBr-e5 (SEQ ID NO:18 и 92 из US8734809), AAV CBr-E6 (SEQ ID NO:19 и 93 из US8734809), AAV CBr-E7 (SEQ ID NO:20 и 94 из US8734809), AAV CBr-E8 (SEQ ID NO:21 и 95 из US8734809), AAV CLv-D1 (SEQ ID NO:22 и 96 из US8734809), AAV CLv-D2 (SEQ ID NO:23 и 97 из US8734809), AAV CLv-D3 (SEQ ID NO:24 и 98 из US8734809), AAV CLv-D4 (SEQ ID NO:25 и 99 из US8734809), AAV CLv-D5 (SEQ ID NO:26 и 100 из US8734809), AAV CLv-D6 (SEQ ID NO:27 и 101 из US8734809), AAV CLv-D7 (SEQ ID NO:28 и 102 из US8734809), AAV CLv-D8 (SEQ ID NO:29 и 103 из US8734809), AAV CLv-E1 (SEQ ID NO:13 и 87 из US8734809), AAV CLv-R1 (SEQ ID NO:30 и 104 из US8734809), AAV CLv-R2 (SEQ ID NO:31 и 105 из US8734809), AAV CLv-R3 (SEQ ID NO:32 и 106 из US8734809), AAV CLv-R4 (SEQ ID NO:33 и 107 из US8734809), AAV CLv-R5 (SEQ ID NO:34 и 108 из US8734809), AAV CLv-R6 (SEQ ID NO:35 и 109 из US8734809), AAV CLv-R7 (SEQ ID NO:36 и 110 из US8734809), AAV CLv-R8 (SEQ ID NO:37 и 111 из US8734809), AAV CLv-R9 (SEQ ID NO:38 и 112 из US8734809), AAV CLg-F1 (SEQ ID NO:39 и 113 из US8734809), AAV CLg-F2 (SEQ ID NO:40 и 114 из US8734809), AAV CLg-F3 (SEQ ID NO:41 и 115 из US8734809), AAV CLg-F4 (SEQ ID NO:42 и 116 из US8734809), AAV CLg-F5 (SEQ ID NO:43 и 117 из US8734809), AAV CLg-F6 (SEQ ID NO:43 и 117 из US8734809), AAV CLg-F7 (SEQ ID NO:44 и 118 из US8734809), AAV CLg-F8 (SEQ ID NO:43 и 117 из US8734809), AAV CSp-1 (SEQ ID NO:45 и 119 из US8734809), AAV CSp-10 (SEQ ID NO:46 и 120 из US8734809), AAV CSp-11 (SEQ ID NO:47 и 121 из US8734809), AAV CSp-2 (SEQ ID NO:48 и 122 из US8734809), AAV CSp-3 (SEQ ID NO:49 и 123 из US8734809), AAV CSp-4 (SEQ ID NO:50 и 124 из US8734809), AAV CSp-6 (SEQ ID NO:51 и 125 из US8734809), AAV CSp-7 (SEQ ID NO:52 и 126 из US8734809), AAV CSp-8 (SEQ ID NO:53 и 127 из US8734809), AAV CSp-9 (SEQ ID NO:54 и 128 из US8734809), AAV CHt-2 (SEQ ID NO:55 и 129 из US8734809), AAV CHt-3 (SEQ ID NO:56 и 130 из US8734809), AAV CKd-1 (SEQ ID NO:57 и 131 из US8734809), AAV CKd-10 (SEQ ID NO:58 и 132 из US8734809), AAV CKd-2 (SEQ ID NO:59 и 133 из US8734809), AAV CKd-3 (SEQ ID NO:60 и 134 из US8734809), AAV CKd-4 (SEQ ID NO:61 и 135 из US8734809), AAV CKd-6 (SEQ ID NO:62 и 136 из US8734809), AAV CKd-7 (SEQ ID NO:63 и 137 из US8734809), AAV CKd-8 (SEQ ID NO:64 и 138 из US8734809), AAV CLv-1 (SEQ ID NO:35 и 139 из US8734809), AAV CLv-12 (SEQ ID NO:66 и 140 из US8734809), AAV CLv-13 (SEQ ID NO:67 и 141 из US8734809), AAV CLv-2 (SEQ ID NO:68 и 142 из US8734809), AAV CLv-3 (SEQ ID NO:69 и 143 из US8734809), AAV CLv-4 (SEQ ID NO:70 и 144 из US8734809), AAV CLv-6 (SEQ ID NO:71 и 145 из US8734809), AAV CLv-8 (SEQ ID NO:72 и 146 из US8734809), AAV CKd-B1 (SEQ ID NO:73 и 147 из US8734809), AAV CKd-B2 (SEQ ID NO:74 и 148 из US8734809), AAV CKd-B3 (SEQ ID NO:75 и 149 из US8734809), AAV CKd-B4 (SEQ ID NO:76 и 150 из US8734809), AAV CKd-B5 (SEQ ID NO:77 и 151 из US8734809), AAV CKd-B6 (SEQ ID NO:78 и 152 из US8734809), AAV CKd-B7 (SEQ ID NO:79 и 153 из US8734809), AAV CKd-B8 (SEQ ID NO:80 и 154 из US8734809), AAV CKd-H1 (SEQ ID NO:81 и 155 из US8734809), AAV CKd-H2 (SEQ ID NO:82 и 156 из US8734809), AAV CKd-H3 (SEQ ID NO:83 и 157 из US8734809), AAV CKd-H4 (SEQ ID NO:84 и 158 из US8734809), AAV CKd-H5 (SEQ ID NO:85 и 159 из US8734809), AAV CKd-H6 (SEQ ID NO:77 и 151 из US8734809), AAV CHt-1 (SEQ ID NO:86 и 160 из US8734809), AAV CLv1-1 (SEQ ID NO:171 из US8734809), AAV CLv1-2 (SEQ ID NO:172 из US8734809), AAV CLv1-3 (SEQ ID NO:173 из US8734809), AAV CLv1-4 (SEQ ID NO:174 из US8734809), AAV Clv1-7 (SEQ ID NO:175 из US8734809), AAV Clv1-8 (SEQ ID NO:176 из US8734809), AAV Clv1-9 (SEQ ID NO:177 из US8734809), AAV Clv1-10 (SEQ ID NO:178 из US8734809), AAV.VR-355 (SEQ ID NO:181 из US8734809), AAV.hu.48R3 (SEQ ID NO:183 из US8734809) или их варианты или производные.

[00718] В некоторых вариантах осуществления серотип AAV может представлять собой или иметь последовательность, как описано в международной публикации № WO2016065001, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV CHt-P2 (SEQ ID NO:1 и 51 из WO2016065001), AAV CHt-P5 (SEQ ID NO:2 и 52 из WO2016065001), AAV CHt-P9 (SEQ ID NO:3 и 53 из WO2016065001), AAV CBr-7.1 (SEQ ID NO:4 и 54 из WO2016065001), AAV CBr-7.2 (SEQ ID NO:5 и 55 из WO2016065001), AAV CBr-7.3 (SEQ ID NO:6 и 56 из WO2016065001), AAV CBr-7.4 (SEQ ID NO:7 и 57 из WO2016065001), AAV CBr-7.5 (SEQ ID NO:8 и 58 из WO2016065001), AAV CBr-7.7 (SEQ ID NO:9 и 59 из WO2016065001), AAV CBr-7.8 (SEQ ID NO:10 и 60 из WO2016065001), AAV CBr-7.10 (SEQ ID NO:11 и 61 из WO2016065001), AAV CKd-N3 (SEQ ID NO:12 и 62 из WO2016065001), AAV CKd-N4 (SEQ ID NO:13 и 63 из WO2016065001), AAV CKd-N9 (SEQ ID NO:14 и 64 из WO2016065001), AAV CLv-L4 (SEQ ID NO:15 и 65 из WO2016065001), AAV CLv-L5 (SEQ ID NO:16 и 66 из WO2016065001), AAV CLv-L6 (SEQ ID NO:17 и 67 из WO2016065001), AAV CLv-K1 (SEQ ID NO:18 и 68 из WO2016065001), AAV CLv-K3 (SEQ ID NO:19 и 69 из WO2016065001), AAV CLv-K6 (SEQ ID NO:20 и 70 из WO2016065001), AAV CLv-M1 (SEQ ID NO:21 и 71 из WO2016065001), AAV CLv-M11 (SEQ ID NO:22 и 72 из WO2016065001), AAV CLv-M2 (SEQ ID NO:23 и 73 из WO2016065001), AAV CLv-M5 (SEQ ID NO:24 и 74 из WO2016065001), AAV CLv-M6 (SEQ ID NO:25 и 75 из WO2016065001), AAV CLv-M7 (SEQ ID NO:26 и 76 из WO2016065001), AAV CLv-M8 (SEQ ID NO:27 и 77 из WO2016065001), AAV CLv-M9 (SEQ ID NO:28 и 78 из WO2016065001), AAV CHt-P1 (SEQ ID NO:29 и 79 из WO2016065001), AAV CHt-P6 (SEQ ID NO:30 и 80 из WO2016065001), AAV CHt-P8 (SEQ ID NO:31 и 81 из WO2016065001), AAV CHt-6.1 (SEQ ID NO:32 и 82 из WO2016065001), AAV CHt-6.10 (SEQ ID NO:33 и 83 из WO2016065001), AAV CHt-6.5 (SEQ ID NO:34 и 84 из WO2016065001), AAV CHt-6.6 (SEQ ID NO:35 и 85 из WO2016065001), AAV CHt-6.7 (SEQ ID NO:36 и 86 из WO2016065001), AAV CHt-6.8 (SEQ ID NO:37 и 87 из WO2016065001), AAV CSp-8.10 (SEQ ID NO:38 и 88 из WO2016065001), AAV CSp-8.2 (SEQ ID NO:39 и 89 из WO2016065001), AAV CSp-8.4 (SEQ ID NO:40 и 90 из WO2016065001), AAV CSp-8.5 (SEQ ID NO:41 и 91 из WO2016065001), AAV CSp-8.6 (SEQ ID NO:42 и 92 из WO2016065001), AAV CSp-8.7 (SEQ ID NO:43 и 93 из WO2016065001), AAV CSp-8.8 (SEQ ID NO:44 и 94 из WO2016065001), AAV CSp-8.9 (SEQ ID NO:45 и 95 из WO2016065001), AAV CBr-B7.3 (SEQ ID NO:46 и 96 из WO2016065001), AAV CBr-B7.4 (SEQ ID NO:47 и 97 из WO2016065001), AAV3B (SEQ ID NO:48 и 98 из WO2016065001), AAV4 (SEQ ID NO:49 и 99 из WO2016065001), AAV5 (SEQ ID NO:50 и 100 из WO2016065001) или их варианты или производные.

[00719] В одном из вариантов осуществления AAV может представлять собой серотип, содержащий по меньшей мере один эпитоп капсида AAV для CD8+ T-клетки. В качестве неограничивающего примера, серотип может быть AAV1, AAV2 или AAV8

[00720] В одном из вариантов осуществления AAV может представлять собой серотип, выбранный из любых, которые можно найти в в таблице 4.

[00721] В одном из вариантов осуществления AAV может содержать последовательность, ее фрагмент или вариант, из последовательностей в таблице 4.

[00722] В одном из вариантов осуществления AAV можно кодировать с помощью последовательности, фрагмента или варианта, как приведено в таблице 4.

Таблица 4. Серотипы AAV

Серотип SEQ ID № Справочная информация
AAV1 28 US20150159173 SEQ ID NO:11, US20150315612 SEQ ID NO:202
AAV1 29 US20160017295 SEQ ID NO:1US20030138772 SEQ ID NO:64, US20150159173 SEQ ID NO:27, US20150315612 SEQ ID NO:219, US7198951 SEQ ID NO:5
AAV1 30 US20030138772 SEQ ID NO:6
AAV1.3 31 US20030138772 SEQ ID NO:14
AAV10 32 US20030138772 SEQ ID NO:117
AAV10 33 WO2015121501 SEQ ID NO:9
AAV10 34 WO2015121501 SEQ ID NO:8
AAV11 35 US20030138772 SEQ ID NO:118
AAV12 36 US20030138772 SEQ ID NO:119
AAV2 37 US20150159173 SEQ ID NO:7, US20150315612 SEQ ID NO:211
AAV2 38 US20030138772 SEQ ID NO:70, US20150159173 SEQ ID NO:23, US20150315612 SEQ ID NO:221, US20160017295 SEQ ID NO:2, US6156303 SEQ ID NO:4, US7198951 SEQ ID NO:4, WO2015121501 SEQ ID NO:1
AAV2 39 US6156303 SEQ ID NO:8
AAV2 40 US20030138772 SEQ ID NO:7
AAV2 41 US6156303 SEQ ID NO:3
AAV2.5T 42 US9233131 SEQ ID NO:42
AAV223.10 43 US20030138772 SEQ ID NO:75
AAV223.2 44 US20030138772 SEQ ID NO:49
AAV223.2 45 US20030138772 SEQ ID NO:76
AAV223.4 46 US20030138772 SEQ ID NO:50
AAV223.4 47 US20030138772 SEQ ID NO:73
AAV223.5 48 US20030138772 SEQ ID NO:51
AAV223.5 49 US20030138772 SEQ ID NO:74
AAV223.6 50 US20030138772 SEQ ID NO:52
AAV223.6 51 US20030138772 SEQ ID NO:78
AAV223.7 52 US20030138772 SEQ ID NO:53
AAV223.7 53 US20030138772 SEQ ID NO:77
AAV29.3 54 US20030138772 SEQ ID NO:82
AAV29.4 55 US20030138772 SEQ ID NO:12
AAV29.5 56 US20030138772 SEQ ID NO:83
AAV29.5 (AAVbb.2) 57 US20030138772 SEQ ID NO:13
AAV3 58 US20150159173 SEQ ID NO:12
AAV3 59 US20030138772 SEQ ID NO:71, US20150159173 SEQ ID NO:28, US20160017295 SEQ ID NO:3, US7198951 SEQ ID NO:6
AAV3 60 US20030138772 SEQ ID NO:8
AAV3.3b 61 US20030138772 SEQ ID NO:72
AAV3-3 62 US20150315612 SEQ ID NO:200
AAV3-3 63 US20150315612 SEQ ID NO:217
AAV3a 64 US6156303 SEQ ID NO:5
AAV3a 65 US6156303 SEQ ID NO:9
AAV3b 66 US6156303 SEQ ID NO:6
AAV3b 67 US6156303 SEQ ID NO:10
AAV3b 68 US6156303 SEQ ID NO:1
AAV4 69 US20140348794 SEQ ID NO:17
AAV4 70 US20140348794 SEQ ID NO:5
AAV4 71 US20140348794 SEQ ID NO:3
AAV4 72 US20140348794 SEQ ID NO:14
AAV4 73 US20140348794 SEQ ID NO:15
AAV4 74 US20140348794 SEQ ID NO:19
AAV4 75 US20140348794 SEQ ID NO:12
AAV4 76 US20140348794 SEQ ID NO:13
AAV4 77 US20140348794 SEQ ID NO:7
AAV4 78 US20140348794 SEQ ID NO:8
AAV4 79 US20140348794 SEQ ID NO:9
AAV4 80 US20140348794 SEQ ID NO:2
AAV4 81 US20140348794 SEQ ID NO:10
AAV4 82 US20140348794 SEQ ID NO:11
AAV4 83 US20140348794 SEQ ID NO:18
AAV4 84 US20030138772 SEQ ID NO:63, US20160017295 SEQ ID NO:4, US20140348794 SEQ ID NO:4
AAV4 85 US20140348794 SEQ ID NO:16
AAV4 86 US20140348794 SEQ ID NO:20
AAV4 87 US20140348794 SEQ ID NO:6
AAV4 88 US20140348794 SEQ ID NO:1
AAV42.2 89 US20030138772 SEQ ID NO:9
AAV42.2 90 US20030138772 SEQ ID NO:102
AAV42.3b 91 US20030138772 SEQ ID NO:36
AAV42.3B 92 US20030138772 SEQ ID NO:107
AAV42.4 93 US20030138772 SEQ ID NO:33
AAV42.4 94 US20030138772 SEQ ID NO:88
AAV42.8 95 US20030138772 SEQ ID NO:27
AAV42.8 96 US20030138772 SEQ ID NO:85
AAV43.1 97 US20030138772 SEQ ID NO:39
AAV43.1 98 US20030138772 SEQ ID NO:92
AAV43.12 99 US20030138772 SEQ ID NO:41
AAV43.12 100 US20030138772 SEQ ID NO:93
AAV43.20 101 US20030138772 SEQ ID NO:42
AAV43.20 102 US20030138772 SEQ ID NO:99
AAV43.21 103 US20030138772 SEQ ID NO:43
AAV43.21 104 US20030138772 SEQ ID NO:96
AAV43.23 105 US20030138772 SEQ ID NO:44
AAV43.23 106 US20030138772 SEQ ID NO:98
AAV43.25 107 US20030138772 SEQ ID NO:45
AAV43.25 108 US20030138772 SEQ ID NO:97
AAV43.5 109 US20030138772 SEQ ID NO:40
AAV43.5 110 US20030138772 SEQ ID NO:94
AAV4-4 111 US20150315612 SEQ ID NO:201
AAV4-4 112 US20150315612 SEQ ID NO:218
AAV44.1 113 US20030138772 SEQ ID NO:46
AAV44.1 114 US20030138772 SEQ ID NO:79
AAV44.5 115 US20030138772 SEQ ID NO:47
AAV44.5 116 US20030138772 SEQ ID NO:80
AAV4407 117 US20150315612 SEQ ID NO:90
AAV5 118 US7427396 SEQ ID NO:1
AAV5 119 US20030138772 SEQ ID NO:114
AAV5 120 US20160017295 SEQ ID NO:5, US7427396 SEQ ID NO:2, US20150315612 SEQ ID NO:216
AAV5 121 US20150315612 SEQ ID NO:199
AAV6 122 US20150159173 SEQ ID NO:13
AAV6 123 US20030138772 SEQ ID NO:65, US20150159173 SEQ ID NO:29, US20160017295 SEQ ID NO:6, US6156303 SEQ ID NO:7
AAV6 124 US6156303 SEQ ID NO:11
AAV6 125 US6156303 SEQ ID NO:2
AAV6 126 US20150315612 SEQ ID NO:203
AAV6 127 US20150315612 SEQ ID NO:220
AAV6.1 128 US20150159173
AAV6.12 129 US20150159173
AAV6.2 130 US20150159173
AAV7 131 US20150159173 SEQ ID NO:14
AAV7 132 US20150315612 SEQ ID NO:183
AAV7 133 US20030138772 SEQ ID NO:2, US20150159173 SEQ ID NO:30, US20150315612 SEQ ID NO:181, US20160017295 SEQ ID NO:7
AAV7 134 US20030138772 SEQ ID NO:3
AAV7 135 US20030138772 SEQ ID NO:1, US20150315612 SEQ ID NO:180
AAV7 136 US20150315612 SEQ ID NO:213
AAV7 137 US20150315612 SEQ ID NO:222
AAV8 138 US20150159173 SEQ ID NO:15
AAV8 139 US20150376240 SEQ ID NO:7
AAV8 140 US20030138772 SEQ ID NO:4, US20150315612 SEQ ID NO:182
AAV8 141 US20030138772 SEQ ID NO:95, US20140359799 SEQ ID NO:1, US20150159173 SEQ ID NO:31, US20160017295 SEQ ID NO:8, US7198951 SEQ ID NO:7, US20150315612 SEQ ID NO:223
AAV8 142 US20150376240 SEQ ID NO:8
AAV8 143 US20150315612 SEQ ID NO:214
AAV-8b 144 US20150376240 SEQ ID NO:5
AAV-8b 145 US20150376240 SEQ ID NO:3
AAV-8h 146 US20150376240 SEQ ID NO:6
AAV-8h 147 US20150376240 SEQ ID NO:4
AAV9 148 US20030138772 SEQ ID NO:5
AAV9 149 US7198951 SEQ ID NO:1
AAV9 150 US20160017295 SEQ ID NO:9
AAV9 151 US20030138772 SEQ ID NO:100, US7198951 SEQ ID NO:2
AAV9 152 US7198951 SEQ ID NO:3
AAV9 (AAVhu.14) 153 US7906111 SEQ ID NO:3; WO2015038958 SEQ ID NO:11
AAV9 (AAVhu.14) 154 US7906111 SEQ ID NO:123; WO2015038958 SEQ ID NO:2
AAVA3.1 155 US20030138772 SEQ ID NO:120
AAVA3.3 156 US20030138772 SEQ ID NO:57
AAVA3.3 157 US20030138772 SEQ ID NO:66
AAVA3.4 158 US20030138772 SEQ ID NO:54
AAVA3.4 159 US20030138772 SEQ ID NO:68
AAVA3.5 160 US20030138772 SEQ ID NO:55
AAVA3.5 161 US20030138772 SEQ ID NO:69
AAVA3.7 162 US20030138772 SEQ ID NO:56
AAVA3.7 163 US20030138772 SEQ ID NO:67
AAV29.3 (AAVbb.1) 164 US20030138772 SEQ ID NO:11
AAVC2 165 US20030138772 SEQ ID NO:61
AAVCh.5 166 US20150159173 SEQ ID NO:46, US20150315612 SEQ ID NO:234
AAVcy.2 (AAV13.3) 167 US20030138772 SEQ ID NO:15
AAV24.1 168 US20030138772 SEQ ID NO:101
AAVcy.3 (AAV24.1) 169 US20030138772 SEQ ID NO:16
AAV27.3 170 US20030138772 SEQ ID NO:104
AAVcy.4 (AAV27.3) 171 US20030138772 SEQ ID NO:17
AAVcy.5 172 US20150315612 SEQ ID NO:227
AAV7.2 173 US20030138772 SEQ ID NO:103
AAVcy.5 (AAV7.2) 174 US20030138772 SEQ ID NO:18
AAV16.3 175 US20030138772 SEQ ID NO:105
AAVcy.6 (AAV16.3) 176 US20030138772 SEQ ID NO:10
AAVcy.5 177 US20150159173 SEQ ID NO:8
AAVcy.5 178 US20150159173 SEQ ID NO:24
AAVCy.5R1 179 US20150159173
AAVCy.5R2 180 US20150159173
AAVCy.5R3 181 US20150159173
AAVCy.5R4 182 US20150159173
AAVDJ 183 US20140359799 SEQ ID NO:3, US7588772 SEQ ID NO:2
AAVDJ 184 US20140359799 SEQ ID NO:2, US7588772 SEQ ID NO:1
AAVDJ-8 185 US7588772; Grimm et al 2008
AAVDJ-8 186 US7588772; Grimm et al 2008
AAVF5 187 US20030138772 SEQ ID NO:110
AAVH2 188 US20030138772 SEQ ID NO:26
AAVH6 189 US20030138772 SEQ ID NO:25
AAVhE1.1 190 US9233131 SEQ ID NO:44
AAVhER1.14 191 US9233131 SEQ ID NO:46
AAVhER1.16 192 US9233131 SEQ ID NO:48
AAVhER1.18 193 US9233131 SEQ ID NO:49
AAVhER1.23 (AAVhEr2.29) 194 US9233131 SEQ ID NO:53
AAVhEr1.35 195 US9233131 SEQ ID NO:50
AAVhEr1.36 196 US9233131 SEQ ID NO:52
AAVhEr1.5 197 US9233131 SEQ ID NO:45
AAVhEr1.7 198 US9233131 SEQ ID NO:51
AAVhEr1.8 199 US9233131 SEQ ID NO:47
AAVhEr2.16 200 US9233131 SEQ ID NO:55
AAVhEr2.30 201 US9233131 SEQ ID NO:56
AAVhEr2.31 202 US9233131 SEQ ID NO:58
AAVhEr2.36 203 US9233131 SEQ ID NO:57
AAVhEr2.4 204 US9233131 SEQ ID NO:54
AAVhEr3.1 205 US9233131 SEQ ID NO:59
AAVhu.1 206 US20150315612 SEQ ID NO:46
AAVhu.1 207 US20150315612 SEQ ID NO:144
AAVhu.10 (AAV16.8) 208 US20150315612 SEQ ID NO:56
AAVhu.10 (AAV16.8) 209 US20150315612 SEQ ID NO:156
AAVhu.11 (AAV16.12) 210 US20150315612 SEQ ID NO:57
AAVhu.11 (AAV16.12) 211 US20150315612 SEQ ID NO:153
AAVhu.12 212 US20150315612 SEQ ID NO:59
AAVhu.12 213 US20150315612 SEQ ID NO:154
AAVhu.13 214 US20150159173 SEQ ID NO:16, US20150315612 SEQ ID NO:71
AAVhu.13 215 US20150159173 SEQ ID NO:32, US20150315612 SEQ ID NO:129
AAVhu.136.1 216 US20150315612 SEQ ID NO:165
AAVhu.140.1 217 US20150315612 SEQ ID NO:166
AAVhu.140.2 218 US20150315612 SEQ ID NO:167
AAVhu.145.6 219 US20150315612 SEQ ID NO:178
AAVhu.15 220 US20150315612 SEQ ID NO:147
AAVhu.15 (AAV33.4) 221 US20150315612 SEQ ID NO:50
AAVhu.156.1 222 US20150315612 SEQ ID NO:179
AAVhu.16 223 US20150315612 SEQ ID NO:148
AAVhu.16 (AAV33.8) 224 US20150315612 SEQ ID NO:51
AAVhu.17 225 US20150315612 SEQ ID NO:83
AAVhu.17 (AAV33.12) 226 US20150315612 SEQ ID NO:4
AAVhu.172.1 227 US20150315612 SEQ ID NO:171
AAVhu.172.2 228 US20150315612 SEQ ID NO:172
AAVhu.173.4 229 US20150315612 SEQ ID NO:173
AAVhu.173.8 230 US20150315612 SEQ ID NO:175
AAVhu.18 231 US20150315612 SEQ ID NO:52
AAVhu.18 232 US20150315612 SEQ ID NO:149
AAVhu.19 233 US20150315612 SEQ ID NO:62
AAVhu.19 234 US20150315612 SEQ ID NO:133
AAVhu.2 235 US20150315612 SEQ ID NO:48
AAVhu.2 236 US20150315612 SEQ ID NO:143
AAVhu.20 237 US20150315612 SEQ ID NO:63
AAVhu.20 238 US20150315612 SEQ ID NO:134
AAVhu.21 239 US20150315612 SEQ ID NO:65
AAVhu.21 240 US20150315612 SEQ ID NO:135
AAVhu.22 241 US20150315612 SEQ ID NO:67
AAVhu.22 242 US20150315612 SEQ ID NO:138
AAVhu.23 243 US20150315612 SEQ ID NO:60
AAVhu.23.2 244 US20150315612 SEQ ID NO:137
AAVhu.24 245 US20150315612 SEQ ID NO:66
AAVhu.24 246 US20150315612 SEQ ID NO:136
AAVhu.25 247 US20150315612 SEQ ID NO:49
AAVhu.25 248 US20150315612 SEQ ID NO:146
AAVhu.26 249 US20150159173 SEQ ID NO:17, US20150315612 SEQ ID NO:61
AAVhu.26 250 US20150159173 SEQ ID NO:33, US20150315612 SEQ ID NO:139
AAVhu.27 251 US20150315612 SEQ ID NO:64
AAVhu.27 252 US20150315612 SEQ ID NO:140
AAVhu.28 253 US20150315612 SEQ ID NO:68
AAVhu.28 254 US20150315612 SEQ ID NO:130
AAVhu.29 255 US20150315612 SEQ ID NO:69
AAVhu.29 256 US20150159173 SEQ ID NO:42, US20150315612 SEQ ID NO:132
AAVhu.29 257 US20150315612 SEQ ID NO:225
AAVhu.29R 258 US20150159173
AAVhu.3 259 US20150315612 SEQ ID NO:44
AAVhu.3 260 US20150315612 SEQ ID NO:145
AAVhu.30 261 US20150315612 SEQ ID NO:70
AAVhu.30 262 US20150315612 SEQ ID NO:131
AAVhu.31 263 US20150315612 SEQ ID NO:1
AAVhu.31 264 US20150315612 SEQ ID NO:121
AAVhu.32 265 US20150315612 SEQ ID NO:2
AAVhu.32 266 US20150315612 SEQ ID NO:122
AAVhu.33 267 US20150315612 SEQ ID NO:75
AAVhu.33 268 US20150315612 SEQ ID NO:124
AAVhu.34 269 US20150315612 SEQ ID NO:72
AAVhu.34 270 US20150315612 SEQ ID NO:125
AAVhu.35 271 US20150315612 SEQ ID NO:73
AAVhu.35 272 US20150315612 SEQ ID NO:164
AAVhu.36 273 US20150315612 SEQ ID NO:74
AAVhu.36 274 US20150315612 SEQ ID NO:126
AAVhu.37 275 US20150159173 SEQ ID NO:34, US20150315612 SEQ ID NO:88
AAVhu.37 (AAV106.1) 276 US20150315612 SEQ ID NO:10, US20150159173 SEQ ID NO:18
AAVhu.38 277 US20150315612 SEQ ID NO:161
AAVhu.39 278 US20150315612 SEQ ID NO:102
AAVhu.39 (AAVLG-9) 279 US20150315612 SEQ ID NO:24
AAVhu.4 280 US20150315612 SEQ ID NO:47
AAVhu.4 281 US20150315612 SEQ ID NO:141
AAVhu.40 282 US20150315612 SEQ ID NO:87
AAVhu.40 (AAV114.3) 283 US20150315612 SEQ ID NO:11
AAVhu.41 284 US20150315612 SEQ ID NO:91
AAVhu.41 (AAV127.2) 285 US20150315612 SEQ ID NO:6
AAVhu.42 286 US20150315612 SEQ ID NO:85
AAVhu.42 (AAV127.5) 287 US20150315612 SEQ ID NO:8
AAVhu.43 288 US20150315612 SEQ ID NO:160
AAVhu.43 289 US20150315612 SEQ ID NO:236
AAVhu.43 (AAV128.1) 290 US20150315612 SEQ ID NO:80
AAVhu.44 291 US20150159173 SEQ ID NO:45, US20150315612 SEQ ID NO:158
AAVhu.44 (AAV128.3) 292 US20150315612 SEQ ID NO:81
AAVhu.44R1 293 US20150159173
AAVhu.44R2 294 US20150159173
AAVhu.44R3 295 US20150159173
AAVhu.45 296 US20150315612 SEQ ID NO:76
AAVhu.45 297 US20150315612 SEQ ID NO:127
AAVhu.46 298 US20150315612 SEQ ID NO:82
AAVhu.46 299 US20150315612 SEQ ID NO:159
AAVhu.46 300 US20150315612 SEQ ID NO:224
AAVhu.47 301 US20150315612 SEQ ID NO:77
AAVhu.47 302 US20150315612 SEQ ID NO:128
AAVhu.48 303 US20150159173 SEQ ID NO:38
AAVhu.48 304 US20150315612 SEQ ID NO:157
AAVhu.48 (AAV130.4) 305 US20150315612 SEQ ID NO:78
AAVhu.48R1 306 US20150159173
AAVhu.48R2 307 US20150159173
AAVhu.48R3 308 US20150159173
AAVhu.49 309 US20150315612 SEQ ID NO:209
AAVhu.49 310 US20150315612 SEQ ID NO:189
AAVhu.5 311 US20150315612 SEQ ID NO:45
AAVhu.5 312 US20150315612 SEQ ID NO:142
AAVhu.51 313 US20150315612 SEQ ID NO:208
AAVhu.51 314 US20150315612 SEQ ID NO:190
AAVhu.52 315 US20150315612 SEQ ID NO:210
AAVhu.52 316 US20150315612 SEQ ID NO:191
AAVhu.53 317 US20150159173 SEQ ID NO:19
AAVhu.53 318 US20150159173 SEQ ID NO:35
AAVhu.53 (AAV145.1) 319 US20150315612 SEQ ID NO:176
AAVhu.54 320 US20150315612 SEQ ID NO:188
AAVhu.54 (AAV145.5) 321 US20150315612 SEQ ID NO:177
AAVhu.55 322 US20150315612 SEQ ID NO:187
AAVhu.56 323 US20150315612 SEQ ID NO:205
AAVhu.56 (AAV145.6) 324 US20150315612 SEQ ID NO:168
AAVhu.56 (AAV145.6) 325 US20150315612 SEQ ID NO:192
AAVhu.57 326 US20150315612 SEQ ID NO:206
AAVhu.57 327 US20150315612 SEQ ID NO:169
AAVhu.57 328 US20150315612 SEQ ID NO:193
AAVhu.58 329 US20150315612 SEQ ID NO:207
AAVhu.58 330 US20150315612 SEQ ID NO:194
AAVhu.6 (AAV3.1) 331 US20150315612 SEQ ID NO:5
AAVhu.6 (AAV3.1) 332 US20150315612 SEQ ID NO:84
AAVhu.60 333 US20150315612 SEQ ID NO:184
AAVhu.60 (AAV161.10) 334 US20150315612 SEQ ID NO:170
AAVhu.61 335 US20150315612 SEQ ID NO:185
AAVhu.61 (AAV161.6) 336 US20150315612 SEQ ID NO:174
AAVhu.63 337 US20150315612 SEQ ID NO:204
AAVhu.63 338 US20150315612 SEQ ID NO:195
AAVhu.64 339 US20150315612 SEQ ID NO:212
AAVhu.64 340 US20150315612 SEQ ID NO:196
AAVhu.66 341 US20150315612 SEQ ID NO:197
AAVhu.67 342 US20150315612 SEQ ID NO:215
AAVhu.67 343 US20150315612 SEQ ID NO:198
AAVhu.7 344 US20150315612 SEQ ID NO:226
AAVhu.7 345 US20150315612 SEQ ID NO:150
AAVhu.7 (AAV7.3) 346 US20150315612 SEQ ID NO:55
AAVhu.71 347 US20150315612 SEQ ID NO:79
AAVhu.8 348 US20150315612 SEQ ID NO:53
AAVhu.8 349 US20150315612 SEQ ID NO:12
AAVhu.8 350 US20150315612 SEQ ID NO:151
AAVhu.9 (AAV3.1) 351 US20150315612 SEQ ID NO:58
AAVhu.9 (AAV3.1) 352 US20150315612 SEQ ID NO:155
AAV-LK01 353 US20150376607 SEQ ID NO:2
AAV-LK01 354 US20150376607 SEQ ID NO:29
AAV-LK02 355 US20150376607 SEQ ID NO:3
AAV-LK02 356 US20150376607 SEQ ID NO:30
AAV-LK03 357 US20150376607 SEQ ID NO:4
AAV-LK03 358 WO2015121501 SEQ ID NO:12, US20150376607 SEQ ID NO:31
AAV-LK04 359 US20150376607 SEQ ID NO:5
AAV-LK04 360 US20150376607 SEQ ID NO:32
AAV-LK05 361 US20150376607 SEQ ID NO:6
AAV-LK05 362 US20150376607 SEQ ID NO:33
AAV-LK06 363 US20150376607 SEQ ID NO:7
AAV-LK06 364 US20150376607 SEQ ID NO:34
AAV-LK07 365 US20150376607 SEQ ID NO:8
AAV-LK07 366 US20150376607 SEQ ID NO:35
AAV-LK08 367 US20150376607 SEQ ID NO:9
AAV-LK08 368 US20150376607 SEQ ID NO:36
AAV-LK09 369 US20150376607 SEQ ID NO:10
AAV-LK09 370 US20150376607 SEQ ID NO:37
AAV-LK10 371 US20150376607 SEQ ID NO:11
AAV-LK10 372 US20150376607 SEQ ID NO:38
AAV-LK11 373 US20150376607 SEQ ID NO:12
AAV-LK11 374 US20150376607 SEQ ID NO:39
AAV-LK12 375 US20150376607 SEQ ID NO:13
AAV-LK12 376 US20150376607 SEQ ID NO:40
AAV-LK13 377 US20150376607 SEQ ID NO:14
AAV-LK13 378 US20150376607 SEQ ID NO:41
AAV-LK14 379 US20150376607 SEQ ID NO:15
AAV-LK14 380 US20150376607 SEQ ID NO:42
AAV-LK15 381 US20150376607 SEQ ID NO:16
AAV-LK15 382 US20150376607 SEQ ID NO:43
AAV-LK16 383 US20150376607 SEQ ID NO:17
AAV-LK16 384 US20150376607 SEQ ID NO:44
AAV-LK17 385 US20150376607 SEQ ID NO:18
AAV-LK17 386 US20150376607 SEQ ID NO:45
AAV-LK18 387 US20150376607 SEQ ID NO:19
AAV-LK18 388 US20150376607 SEQ ID NO:46
AAV-LK19 389 US20150376607 SEQ ID NO:20
AAV-LK19 390 US20150376607 SEQ ID NO:47
AAV-PAEC 391 US20150376607 SEQ ID NO:1
AAV-PAEC 392 US20150376607 SEQ ID NO:48
AAV-PAEC11 393 US20150376607 SEQ ID NO:26
AAV-PAEC11 394 US20150376607 SEQ ID NO:54
AAV-PAEC12 395 US20150376607 SEQ ID NO:27
AAV-PAEC12 396 US20150376607 SEQ ID NO:51
AAV-PAEC13 397 US20150376607 SEQ ID NO:28
AAV-PAEC13 398 US20150376607 SEQ ID NO:49
AAV-PAEC2 399 US20150376607 SEQ ID NO:21
AAV-PAEC2 400 US20150376607 SEQ ID NO:56
AAV-PAEC4 401 US20150376607 SEQ ID NO:22
AAV-PAEC4 402 US20150376607 SEQ ID NO:55
AAV-PAEC6 403 US20150376607 SEQ ID NO:23
AAV-PAEC6 404 US20150376607 SEQ ID NO:52
AAV-PAEC7 405 US20150376607 SEQ ID NO:24
AAV-PAEC7 406 US20150376607 SEQ ID NO:53
AAV-PAEC8 407 US20150376607 SEQ ID NO:25
AAV-PAEC8 408 US20150376607 SEQ ID NO:50
AAVpi.1 409 US20150315612 SEQ ID NO:28
AAVpi.1 410 US20150315612 SEQ ID NO:93
AAVpi.2 411 US20150315612 SEQ ID NO:30
AAVpi.2 412 US20150315612 SEQ ID NO:95
AAVpi.3 413 US20150315612 SEQ ID NO:29
AAVpi.3 414 US20150315612 SEQ ID NO:94
AAVrh.10 415 US20150159173 SEQ ID NO:9
AAVrh.10 416 US20150159173 SEQ ID NO:25
AAV44.2 417 US20030138772 SEQ ID NO:59
AAVrh.10 (AAV44.2) 418 US20030138772 SEQ ID NO:81
AAV42.1B 419 US20030138772 SEQ ID NO:90
AAVrh.12 (AAV42.1b) 420 US20030138772 SEQ ID NO:30
AAVrh.13 421 US20150159173 SEQ ID NO:10
AAVrh.13 422 US20150159173 SEQ ID NO:26
AAVrh.13 423 US20150315612 SEQ ID NO:228
AAVrh.13R 424 US20150159173
AAV42.3A 425 US20030138772 SEQ ID NO:87
AAVrh.14 (AAV42.3a) 426 US20030138772 SEQ ID NO:32
AAV42.5A 427 US20030138772 SEQ ID NO:89
AAVrh.17 (AAV42.5a) 428 US20030138772 SEQ ID NO:34
AAV42.5B 429 US20030138772 SEQ ID NO:91
AAVrh.18 (AAV42.5b) 430 US20030138772 SEQ ID NO:29
AAV42.6B 431 US20030138772 SEQ ID NO:112
AAVrh.19 (AAV42.6b) 432 US20030138772 SEQ ID NO:38
AAVrh.2 433 US20150159173 SEQ ID NO:39
AAVrh.2 434 US20150315612 SEQ ID NO:231
AAVrh.20 435 US20150159173 SEQ ID NO:1
AAV42.10 436 US20030138772 SEQ ID NO:106
AAVrh.21 (AAV42.10) 437 US20030138772 SEQ ID NO:35
AAV42.11 438 US20030138772 SEQ ID NO:108
AAVrh.22 (AAV42.11) 439 US20030138772 SEQ ID NO:37
AAV42.12 440 US20030138772 SEQ ID NO:113
AAVrh.23 (AAV42.12) 441 US20030138772 SEQ ID NO:58
AAV42.13 442 US20030138772 SEQ ID NO:86
AAVrh.24 (AAV42.13) 443 US20030138772 SEQ ID NO:31
AAV42.15 444 US20030138772 SEQ ID NO:84
AAVrh.25 (AAV42.15) 445 US20030138772 SEQ ID NO:28
AAVrh.2R 446 US20150159173
AAVrh.31 (AAV223.1) 447 US20030138772 SEQ ID NO:48
AAVC1 448 US20030138772 SEQ ID NO:60
AAVrh.32 (AAVC1) 449 US20030138772 SEQ ID NO:19
AAVrh.32/33 450 US20150159173 SEQ ID NO:2
AAVrh.33 (AAVC3) 451 US20030138772 SEQ ID NO:20
AAVC5 452 US20030138772 SEQ ID NO:62
AAVrh.34 (AAVC5) 453 US20030138772 SEQ ID NO:21
AAVF1 454 US20030138772 SEQ ID NO:109
AAVrh.35 (AAVF1) 455 US20030138772 SEQ ID NO:22
AAVF3 456 US20030138772 SEQ ID NO:111
AAVrh.36 (AAVF3) 457 US20030138772 SEQ ID NO:23
AAVrh.37 458 US20030138772 SEQ ID NO:24
AAVrh.37 459 US20150159173 SEQ ID NO:40
AAVrh.37 460 US20150315612 SEQ ID NO:229
AAVrh.37R2 461 US20150159173
AAVrh.38 (AAVLG-4) 462 US20150315612 SEQ ID NO:7
AAVrh.38 (AAVLG-4) 463 US20150315612 SEQ ID NO:86
AAVrh.39 464 US20150159173 SEQ ID NO:20, US20150315612 SEQ ID NO:13
AAVrh.39 465 US20150159173 SEQ ID NO:3, US20150159173 SEQ ID NO:36, US20150315612 SEQ ID NO:89
AAVrh.40 466 US20150315612 SEQ ID NO:92
AAVrh.40 (AAVLG-10) 467 US20150315612 SEQ ID NO:14
AAVrh.43 (AAVN721-8) 468 US20150315612 SEQ ID NO:43, US20150159173 SEQ ID NO:21
AAVrh.43 (AAVN721-8) 469 US20150315612 SEQ ID NO:163, US20150159173 SEQ ID NO:37
AAVrh.44 470 US20150315612 SEQ ID NO:34
AAVrh.44 471 US20150315612 SEQ ID NO:111
AAVrh.45 472 US20150315612 SEQ ID NO:41
AAVrh.45 473 US20150315612 SEQ ID NO:109
AAVrh.46 474 US20150159173 SEQ ID NO:22, US20150315612 SEQ ID NO:19
AAVrh.46 475 US20150159173 SEQ ID NO:4, US20150315612 SEQ ID NO:101
AAVrh.47 476 US20150315612 SEQ ID NO:38
AAVrh.47 477 US20150315612 SEQ ID NO:118
AAVrh.48 478 US20150159173 SEQ ID NO:44, US20150315612 SEQ ID NO:115
AAVrh.48.1 479 US20150159173
AAVrh.48.1.2 480 US20150159173
AAVrh.48.2 481 US20150159173
AAVrh.48 (AAV1-7) 482 US20150315612 SEQ ID NO:32
AAVrh.49 (AAV1-8) 483 US20150315612 SEQ ID NO:25
AAVrh.49 (AAV1-8) 484 US20150315612 SEQ ID NO:103
AAVrh.50 (AAV2-4) 485 US20150315612 SEQ ID NO:23
AAVrh.50 (AAV2-4) 486 US20150315612 SEQ ID NO:108
AAVrh.51 (AAV2-5) 487 US20150315612 SEQ ID NO:22
AAVrh.51 (AAV2-5) 488 US20150315612 SEQ ID NO:104
AAVrh.52 (AAV3-9) 489 US20150315612 SEQ ID NO:18
AAVrh.52 (AAV3-9) 490 US20150315612 SEQ ID NO:96
AAVrh.53 491 US20150315612 SEQ ID NO:97
AAVrh.53 (AAV3-11) 492 US20150315612 SEQ ID NO:17
AAVrh.53 (AAV3-11) 493 US20150315612 SEQ ID NO:186
AAVrh.54 494 US20150315612 SEQ ID NO:40
AAVrh.54 495 US20150159173 SEQ ID NO:49, US20150315612 SEQ ID NO:116
AAVrh.55 496 US20150315612 SEQ ID NO:37
AAVrh.55 (AAV4-19) 497 US20150315612 SEQ ID NO:117
AAVrh.56 498 US20150315612 SEQ ID NO:54
AAVrh.56 499 US20150315612 SEQ ID NO:152
AAVrh.57 500 US20150315612 SEQ ID NO:26
AAVrh.57 501 US20150315612 SEQ ID NO:105
AAVrh.58 502 US20150315612 SEQ ID NO:27
AAVrh.58 503 US20150159173 SEQ ID NO:48, US20150315612 SEQ ID NO:106
AAVrh.58 504 US20150315612 SEQ ID NO:232
AAVrh.59 505 US20150315612 SEQ ID NO:42
AAVrh.59 506 US20150315612 SEQ ID NO:110
AAVrh.60 507 US20150315612 SEQ ID NO:31
AAVrh.60 508 US20150315612 SEQ ID NO:120
AAVrh.61 509 US20150315612 SEQ ID NO:107
AAVrh.61 (AAV2-3) 510 US20150315612 SEQ ID NO:21
AAVrh.62 (AAV2-15) 511 US20150315612 SEQ ID NO:33
AAVrh.62 (AAV2-15) 512 US20150315612 SEQ ID NO:114
AAVrh.64 513 US20150315612 SEQ ID NO:15
AAVrh.64 514 US20150159173 SEQ ID NO:43, US20150315612 SEQ ID NO:99
AAVrh.64 515 US20150315612 SEQ ID NO:233
AAVRh.64R1 516 US20150159173
AAVRh.64R2 517 US20150159173
AAVrh.65 518 US20150315612 SEQ ID NO:35
AAVrh.65 519 US20150315612 SEQ ID NO:112
AAVrh.67 520 US20150315612 SEQ ID NO:36
AAVrh.67 521 US20150315612 SEQ ID NO:230
AAVrh.67 522 US20150159173 SEQ ID NO:47, US20150315612 SEQ ID NO:113
AAVrh.68 523 US20150315612 SEQ ID NO:16
AAVrh.68 524 US20150315612 SEQ ID NO:100
AAVrh.69 525 US20150315612 SEQ ID NO:39
AAVrh.69 526 US20150315612 SEQ ID NO:119
AAVrh.70 527 US20150315612 SEQ ID NO:20
AAVrh.70 528 US20150315612 SEQ ID NO:98
AAVrh.71 529 US20150315612 SEQ ID NO:162
AAVrh.72 530 US20150315612 SEQ ID NO:9
AAVrh.73 531 US20150159173 SEQ ID NO:5
AAVrh.74 532 US20150159173 SEQ ID NO:6
AAVrh.8 533 US20150159173 SEQ ID NO:41
AAVrh.8 534 US20150315612 SEQ ID NO:235
AAVrh.8R 535 US20150159173, WO2015168666 SEQ ID NO:9
AAVrh.8R, мутант A586R 536 WO2015168666 SEQ ID NO:10
AAVrh.8R, мутант R533A 537 WO2015168666 SEQ ID NO:11
BAAV (AAV коровы) 538 US9193769 SEQ ID NO:8
BAAV (AAV коровы) 539 US9193769 SEQ ID NO:10
BAAV (AAV коровы) 540 US9193769 SEQ ID NO:4
BAAV (AAV коровы) 541 US9193769 SEQ ID NO:2
BAAV (AAV коровы) 542 US9193769 SEQ ID NO:6
BAAV (AAV коровы) 543 US9193769 SEQ ID NO:1
BAAV (AAV коровы) 544 US9193769 SEQ ID NO:5
BAAV (AAV коровы) 545 US9193769 SEQ ID NO:3
BAAV (AAV коровы) 546 US9193769 SEQ ID NO:11
BAAV (AAV коровы) 547 US7427396 SEQ ID NO:5
BAAV (AAV коровы) 548 US7427396 SEQ ID NO:6
BAAV (AAV коровы) 549 US9193769 SEQ ID NO:7
BAAV (AAV коровы) 550 US9193769 SEQ ID NO:9
BNP61 AAV 551 US20150238550 SEQ ID NO:1
BNP61 AAV 552 US20150238550 SEQ ID NO:2
BNP62 AAV 553 US20150238550 SEQ ID NO:3
BNP63 AAV 554 US20150238550 SEQ ID NO:4
AAV козы 555 US7427396 SEQ ID NO:3
AAV козы 556 US7427396 SEQ ID NO:4
AAV подлинного типа (ttAAV) 557 WO2015121501 SEQ ID NO:2
AAAV (AAV птицы) 558 US9238800 SEQ ID NO:12
AAAV (AAV птицы) 559 US9238800 SEQ ID NO:2
AAAV (AAV птицы) 560 US9238800 SEQ ID NO:6
AAAV (AAV птицы) 561 US9238800 SEQ ID NO:4
AAAV (AAV птицы) 562 US9238800 SEQ ID NO:8
AAAV (AAV птицы) 563 US9238800 SEQ ID NO:14
AAAV (AAV птицы) 564 US9238800 SEQ ID NO:10
AAAV (AAV птицы) 565 US9238800 SEQ ID NO:15
AAAV (AAV птицы) 566 US9238800 SEQ ID NO:5
AAAV (AAV птицы) 567 US9238800 SEQ ID NO:9
AAAV (AAV птицы) 568 US9238800 SEQ ID NO:3
AAAV (AAV птицы) 569 US9238800 SEQ ID NO:7
AAAV (AAV птицы) 570 US9238800 SEQ ID NO:11
AAAV (AAV птицы) 571 US9238800 SEQ ID NO:13
AAAV (AAV птицы) 572 US9238800 SEQ ID NO:1
AAV Shuffle 100-1 573 US20160017295 SEQ ID NO:23
AAV Shuffle 100-1 574 US20160017295 SEQ ID NO:11
AAV Shuffle 100-2 575 US20160017295 SEQ ID NO:37
AAV Shuffle 100-2 576 US20160017295 SEQ ID NO:29
AAV Shuffle 100-3 577 US20160017295 SEQ ID NO:24
AAV Shuffle 100-3 578 US20160017295 SEQ ID NO:12
AAV Shuffle 100-7 579 US20160017295 SEQ ID NO:25
AAV Shuffle 100-7 580 US20160017295 SEQ ID NO:13
AAV Shuffle 10-2 581 US20160017295 SEQ ID NO:34
AAV Shuffle 10-2 582 US20160017295 SEQ ID NO:26
AAV Shuffle 10-6 583 US20160017295 SEQ ID NO:35
AAV Shuffle 10-6 584 US20160017295 SEQ ID NO:27
AAV Shuffle 10-8 585 US20160017295 SEQ ID NO:36
AAV Shuffle 10-8 586 US20160017295 SEQ ID NO:28
AAV SM 100-10 587 US20160017295 SEQ ID NO:41
AAV SM 100-10 588 US20160017295 SEQ ID NO:33
AAV SM 100-3 589 US20160017295 SEQ ID NO:40
AAV SM 100-3 590 US20160017295 SEQ ID NO:32
AAV SM 10-1 591 US20160017295 SEQ ID NO:38
AAV SM 10-1 592 US20160017295 SEQ ID NO:30
AAV SM 10-2 593 US20160017295 SEQ ID NO:10
AAV SM 10-2 594 US20160017295 SEQ ID NO:22
AAV SM 10-8 595 US20160017295 SEQ ID NO:39
AAV SM 10-8 596 US20160017295 SEQ ID NO:31
AAV SM 100-10 587 US20160017295 SEQ ID NO:41
AAV SM 100-10 588 US20160017295 SEQ ID NO:33
AAV SM 100-3 589 US20160017295 SEQ ID NO:40
AAV SM 100-3 590 US20160017295 SEQ ID NO:32
AAV SM 10-1 591 US20160017295 SEQ ID NO:38
AAV SM 10-1 592 US20160017295 SEQ ID NO:30
AAV SM 10-2 593 US20160017295 SEQ ID NO:10
AAV SM 10-2 594 US20160017295 SEQ ID NO:22
AAV SM 10-8 595 US20160017295 SEQ ID NO:39
AAV SM 10-8 596 US20160017295 SEQ ID NO:31
AAVF1/HSC1 597 WO2016049230 SEQ ID NO:20
AAVF2/HSC2 598 WO2016049230 SEQ ID NO:21
AAVF3/HSC3 599 WO2016049230 SEQ ID NO:22
AAVF4/HSC4 600 WO2016049230 SEQ ID NO:23
AAVF5/HSC5 601 WO2016049230 SEQ ID NO:25
AAVF6/HSC6 602 WO2016049230 SEQ ID NO:24
AAVF7/HSC7 603 WO2016049230 SEQ ID NO:27
AAVF8/HSC8 604 WO2016049230 SEQ ID NO:28
AAVF9/HSC9 605 WO2016049230 SEQ ID NO:29
AAVF11/HSC11 606 WO2016049230 SEQ ID NO:26
AAVF12/HSC12 607 WO2016049230 SEQ ID NO:30
AAVF13/HSC13 608 WO2016049230 SEQ ID NO:31
AAVF14/HSC14 609 WO2016049230 SEQ ID NO:32
AAVF15/HSC15 610 WO2016049230 SEQ ID NO:33
AAVF16/HSC16 611 WO2016049230 SEQ ID NO:34
AAVF17/HSC17 612 WO2016049230 SEQ ID NO:35
AAVF1/HSC1 613 WO2016049230 SEQ ID NO:2
AAVF2/HSC2 614 WO2016049230 SEQ ID NO:3
AAVF3/HSC3 615 WO2016049230 SEQ ID NO:5
AAVF4/HSC4 616 WO2016049230 SEQ ID NO:6
AAVF5/HSC5 617 WO2016049230 SEQ ID NO:11
AAVF6/HSC6 618 WO2016049230 SEQ ID NO:7
AAVF7/HSC7 619 WO2016049230 SEQ ID NO:8
AAVF8/HSC8 620 WO2016049230 SEQ ID NO:9
AAVF9/HSC9 621 WO2016049230 SEQ ID NO:10
AAVF11/HSC11 622 WO2016049230 SEQ ID NO:4
AAVF12/HSC12 623 WO2016049230 SEQ ID NO:12
AAVF13/HSC13 624 WO2016049230 SEQ ID NO:14
AAVF14/HSC14 625 WO2016049230 SEQ ID NO:15
AAVF15/HSC15 626 WO2016049230 SEQ ID NO:16
AAVF16/HSC16 627 WO2016049230 SEQ ID NO:17
AAVF17/HSC17 628 WO2016049230 SEQ ID NO:13
AAV CBr-E1 629 US8734809 SEQ ID NO:13
AAV CBr-E2 630 US8734809 SEQ ID NO:14
AAV CBr-E3 631 US8734809 SEQ ID NO:15
AAV CBr-E4 632 US8734809 SEQ ID NO:16
AAV CBr-E5 633 US8734809 SEQ ID NO:17
AAV CBr-e5 634 US8734809 SEQ ID NO:18
AAV CBr-E6 635 US8734809 SEQ ID NO:19
AAV CBr-E7 636 US8734809 SEQ ID NO:20
AAV CBr-E8 637 US8734809 SEQ ID NO:21
AAV CLv-D1 638 US8734809 SEQ ID NO:22
AAV CLv-D2 639 US8734809 SEQ ID NO:23
AAV CLv-D3 640 US8734809 SEQ ID NO:24
AAV CLv-D4 641 US8734809 SEQ ID NO:25
AAV CLv-D5 642 US8734809 SEQ ID NO:26
AAV CLv-D6 643 US8734809 SEQ ID NO:27
AAV CLv-D7 644 US8734809 SEQ ID NO:28
AAV CLv-D8 645 US8734809 SEQ ID NO:29
AAV CLv-E1 646 US8734809 SEQ ID NO:13
AAV CLv-R1 647 US8734809 SEQ ID NO:30
AAV CLv-R2 648 US8734809 SEQ ID NO:31
AAV CLv-R3 649 US8734809 SEQ ID NO:32
AAV CLv-R4 650 US8734809 SEQ ID NO:33
AAV CLv-R5 651 US8734809 SEQ ID NO:34
AAV CLv-R6 652 US8734809 SEQ ID NO:35
AAV CLv-R7 653 US8734809 SEQ ID NO:36
AAV CLv-R8 654 US8734809 SEQ ID NO:37
AAV CLv-R9 655 US8734809 SEQ ID NO:38
AAV CLg-F1 656 US8734809 SEQ ID NO:39
AAV CLg-F2 657 US8734809 SEQ ID NO:40
AAV CLg-F3 658 US8734809 SEQ ID NO:41
AAV CLg-F4 659 US8734809 SEQ ID NO:42
AAV CLg-F5 660 US8734809 SEQ ID NO:43
AAV CLg-F6 661 US8734809 SEQ ID NO:43
AAV CLg-F7 662 US8734809 SEQ ID NO:44
AAV CLg-F8 663 US8734809 SEQ ID NO:43
AAV CSp-1 664 US8734809 SEQ ID NO:45
AAV CSp-10 665 US8734809 SEQ ID NO:46
AAV CSp-11 666 US8734809 SEQ ID NO:47
AAV CSp-2 667 US8734809 SEQ ID NO:48
AAV CSp-3 668 US8734809 SEQ ID NO:49
AAV CSp-4 669 US8734809 SEQ ID NO:50
AAV CSp-6 670 US8734809 SEQ ID NO:51
AAV CSp-7 671 US8734809 SEQ ID NO:52
AAV CSp-8 672 US8734809 SEQ ID NO:53
AAV CSp-9 673 US8734809 SEQ ID NO:54
AAV CHt-2 674 US8734809 SEQ ID NO:55
AAV CHt-3 675 US8734809 SEQ ID NO:56
AAV CKd-1 676 US8734809 SEQ ID NO:57
AAV CKd-10 677 US8734809 SEQ ID NO:58
AAV CKd-2 678 US8734809 SEQ ID NO:59
AAV CKd-3 679 US8734809 SEQ ID NO:60
AAV CKd-4 680 US8734809 SEQ ID NO:61
AAV CKd-6 681 US8734809 SEQ ID NO:62
AAV CKd-7 682 US8734809 SEQ ID NO:63
AAV CKd-8 683 US8734809 SEQ ID NO:64
AAV CLv-1 684 US8734809 SEQ ID NO:65
AAV CLv-12 685 US8734809 SEQ ID NO:66
AAV CLv-13 686 US8734809 SEQ ID NO:67
AAV CLv-2 687 US8734809 SEQ ID NO:68
AAV CLv-3 688 US8734809 SEQ ID NO:69
AAV CLv-4 689 US8734809 SEQ ID NO:70
AAV CLv-6 690 US8734809 SEQ ID NO:71
AAV CLv-8 691 US8734809 SEQ ID NO:72
AAV CKd-B1 692 US8734809 SEQ ID NO:73
AAV CKd-B2 693 US8734809 SEQ ID NO:74
AAV CKd-B3 694 US8734809 SEQ ID NO:75
AAV CKd-B4 695 US8734809 SEQ ID NO:76
AAV CKd-B5 696 US8734809 SEQ ID NO:77
AAV CKd-B6 697 US8734809 SEQ ID NO:78
AAV CKd-B7 698 US8734809 SEQ ID NO:79
AAV CKd-B8 699 US8734809 SEQ ID NO:80
AAV CKd-H1 700 US8734809 SEQ ID NO:81
AAV CKd-H2 701 US8734809 SEQ ID NO:82
AAV CKd-H3 702 US8734809 SEQ ID NO:83
AAV CKd-H4 703 US8734809 SEQ ID NO:84
AAV CKd-H5 704 US8734809 SEQ ID NO:85
AAV CKd-H6 705 US8734809 SEQ ID NO:77
AAV CHt-1 706 US8734809 SEQ ID NO:86
AAV CLv1-1 707 US8734809 SEQ ID NO:171
AAV CLv1-2 708 US8734809 SEQ ID NO:172
AAV CLv1-3 709 US8734809 SEQ ID NO:173
AAV CLv1-4 710 US8734809 SEQ ID NO:174
AAV Clv1-7 711 US8734809 SEQ ID NO:175
AAV Clv1-8 712 US8734809 SEQ ID NO:176
AAV Clv1-9 713 US8734809 SEQ ID NO:177
AAV Clv1-10 714 US8734809 SEQ ID NO:178
AAV.VR-355 715 US8734809 SEQ ID NO:181
AAV.hu.48R3 716 US8734809 SEQ ID NO:183
AAV CBr-E1 717 US8734809 SEQ ID NO:87
AAV CBr-E2 718 US8734809 SEQ ID NO:88
AAV CBr-E3 719 US8734809 SEQ ID NO:89
AAV CBr-E4 720 US8734809 SEQ ID NO:90
AAV CBr-E5 721 US8734809 SEQ ID NO:91
AAV CBr-e5 722 US8734809 SEQ ID NO:92
AAV CBr-E6 723 US8734809 SEQ ID NO:93
AAV CBr-E7 724 US8734809 SEQ ID NO:94
AAV CBr-E8 725 US8734809 SEQ ID NO:95
AAV CLv-D1 726 US8734809 SEQ ID NO:96
AAV CLv-D2 727 US8734809 SEQ ID NO:97
AAV CLv-D3 728 US8734809 SEQ ID NO:98
AAV CLv-D4 729 US8734809 SEQ ID NO:99
AAV CLv-D5 730 US8734809 SEQ ID NO:100
AAV CLv-D6 731 US8734809 SEQ ID NO:101
AAV CLv-D7 732 US8734809 SEQ ID NO:102
AAV CLv-D8 733 US8734809 SEQ ID NO:103
AAV CLv-E1 734 US8734809 SEQ ID NO:87
AAV CLv-R1 735 US8734809 SEQ ID NO:104
AAV CLv-R2 736 US8734809 SEQ ID NO:105
AAV CLv-R3 737 US8734809 SEQ ID NO:106
AAV CLv-R4 738 US8734809 SEQ ID NO:107
AAV CLv-R5 739 US8734809 SEQ ID NO:108
AAV CLv-R6 740 US8734809 SEQ ID NO:109
AAV CLv-R7 741 US8734809 SEQ ID NO:110
AAV CLv-R8 742 US8734809 SEQ ID NO:111
AAV CLv-R9 743 US8734809 SEQ ID NO:112
AAV CLg-F1 744 US8734809 SEQ ID NO:113
AAV CLg-F2 745 US8734809 SEQ ID NO:114
AAV CLg-F3 746 US8734809 SEQ ID NO:115
AAV CLg-F4 747 US8734809 SEQ ID NO:116
AAV CLg-F5 748 US8734809 SEQ ID NO:117
AAV CLg-F6 749 US8734809 SEQ ID NO:117
AAV CLg-F7 750 US8734809 SEQ ID NO:118
AAV CLg-F8 751 US8734809 SEQ ID NO:117
AAV CSp-1 752 US8734809 SEQ ID NO:119
AAV CSp-10 753 US8734809 SEQ ID NO:120
AAV CSp-11 754 US8734809 SEQ ID NO:121
AAV CSp-2 755 US8734809 SEQ ID NO:122
AAV CSp-3 756 US8734809 SEQ ID NO:123
AAV CSp-4 757 US8734809 SEQ ID NO:124
AAV CSp-6 758 US8734809 SEQ ID NO:125
AAV CSp-7 759 US8734809 SEQ ID NO:126
AAV CSp-8 760 US8734809 SEQ ID NO:127
AAV CSp-9 761 US8734809 SEQ ID NO:128
AAV CHt-2 762 US8734809 SEQ ID NO:129
AAV CHt-3 763 US8734809 SEQ ID NO:130
AAV CKd-1 764 US8734809 SEQ ID NO:131
AAV CKd-10 765 US8734809 SEQ ID NO:132
AAV CKd-2 766 US8734809 SEQ ID NO:133
AAV CKd-3 767 US8734809 SEQ ID NO:134
AAV CKd-4 768 US8734809 SEQ ID NO:135
AAV CKd-6 769 US8734809 SEQ ID NO:136
AAV CKd-7 770 US8734809 SEQ ID NO:137
AAV CKd-8 771 US8734809 SEQ ID NO:138
AAV CLv-1 772 US8734809 SEQ ID NO:139
AAV CLv-12 773 US8734809 SEQ ID NO:140
AAV CLv-13 774 US8734809 SEQ ID NO:141
AAV CLv-2 775 US8734809 SEQ ID NO:142
AAV CLv-3 776 US8734809 SEQ ID NO:143
AAV CLv-4 777 US8734809 SEQ ID NO:144
AAV CLv-6 778 US8734809 SEQ ID NO:145
AAV CLv-8 779 US8734809 SEQ ID NO:146
AAV CKd-B1 780 US8734809 SEQ ID NO:147
AAV CKd-B2 781 US8734809 SEQ ID NO:148
AAV CKd-B3 782 US8734809 SEQ ID NO:149
AAV CKd-B4 783 US8734809 SEQ ID NO:150
AAV CKd-B5 784 US8734809 SEQ ID NO:151
AAV CKd-B6 785 US8734809 SEQ ID NO:152
AAV CKd-B7 786 US8734809 SEQ ID NO:153
AAV CKd-B8 787 US8734809 SEQ ID NO:154
AAV CKd-H1 788 US8734809 SEQ ID NO:155
AAV CKd-H2 789 US8734809 SEQ ID NO:156
AAV CKd-H3 790 US8734809 SEQ ID NO:157
AAV CKd-H4 791 US8734809 SEQ ID NO:158
AAV CKd-H5 792 US8734809 SEQ ID NO:159
AAV CKd-H6 793 US8734809 SEQ ID NO:151
AAV CHt-1 794 US8734809 SEQ ID NO:160
AAV CHt-P2 795 WO2016065001 SEQ ID NO:1
AAV CHt-P5 796 WO2016065001 SEQ ID NO:2
AAV CHt-P9 797 WO2016065001 SEQ ID NO:3
AAV CBr-7.1 798 WO2016065001 SEQ ID NO:4
AAV CBr-7.2 799 WO2016065001 SEQ ID NO:5
AAV CBr-7.3 800 WO2016065001 SEQ ID NO:6
AAV CBr-7.4 801 WO2016065001 SEQ ID NO:7
AAV CBr-7.5 802 WO2016065001 SEQ ID NO:8
AAV CBr-7.7 803 WO2016065001 SEQ ID NO:9
AAV CBr-7.8 804 WO2016065001 SEQ ID NO:10
AAV CBr-7.10 805 WO2016065001 SEQ ID NO:11
AAV CKd-N3 806 WO2016065001 SEQ ID NO:12
AAV CKd-N4 807 WO2016065001 SEQ ID NO:13
AAV CKd-N9 808 WO2016065001 SEQ ID NO:14
AAV CLv-L4 809 WO2016065001 SEQ ID NO:15
AAV CLv-L5 810 WO2016065001 SEQ ID NO:16
AAV CLv-L6 811 WO2016065001 SEQ ID NO:17
AAV CLv-K1 812 WO2016065001 SEQ ID NO:18
AAV CLv-K3 813 WO2016065001 SEQ ID NO:19
AAV CLv-K6 814 WO2016065001 SEQ ID NO:20
AAV CLv-M1 815 WO2016065001 SEQ ID NO:21
AAV CLv-M11 816 WO2016065001 SEQ ID NO:22
AAV CLv-M2 817 WO2016065001 SEQ ID NO:23
AAV CLv-M5 818 WO2016065001 SEQ ID NO:24
AAV CLv-M6 819 WO2016065001 SEQ ID NO:25
AAV CLv-M7 820 WO2016065001 SEQ ID NO:26
AAV CLv-M8 821 WO2016065001 SEQ ID NO:27
AAV CLv-M9 822 WO2016065001 SEQ ID NO:28
AAV CHt-P1 823 WO2016065001 SEQ ID NO:29
AAV CHt-P6 824 WO2016065001 SEQ ID NO:30
AAV CHt-P8 825 WO2016065001 SEQ ID NO:31
AAV CHt-6.1 826 WO2016065001 SEQ ID NO:32
AAV CHt-6.10 827 WO2016065001 SEQ ID NO:33
AAV CHt-6.5 828 WO2016065001 SEQ ID NO:34
AAV CHt-6.6 829 WO2016065001 SEQ ID NO:35
AAV CHt-6.7 830 WO2016065001 SEQ ID NO:36
AAV CHt-6.8 831 WO2016065001 SEQ ID NO:37
AAV CSp-8.10 832 WO2016065001 SEQ ID NO:38
AAV CSp-8.2 833 WO2016065001 SEQ ID NO:39
AAV CSp-8.4 834 WO2016065001 SEQ ID NO:40
AAV CSp-8.5 835 WO2016065001 SEQ ID NO:41
AAV CSp-8.6 836 WO2016065001 SEQ ID NO:42
AAV CSp-8.7 837 WO2016065001 SEQ ID NO:43
AAV CSp-8.8 838 WO2016065001 SEQ ID NO:44
AAV CSp-8.9 839 WO2016065001 SEQ ID NO:45
AAV CBr-B7.3 840 WO2016065001 SEQ ID NO:46
AAV CBr-B7.4 841 WO2016065001 SEQ ID NO:47
AAV3B 842 WO2016065001 SEQ ID NO:48
AAV4 843 WO2016065001 SEQ ID NO:49
AAV5 844 WO2016065001 SEQ ID NO:50
AAV CHt-P2 845 WO2016065001 SEQ ID NO:51
AAV CHt-P5 846 WO2016065001 SEQ ID NO:52
AAV CHt-P9 847 WO2016065001 SEQ ID NO:53
AAV CBr-7.1 848 WO2016065001 SEQ ID NO:54
AAV CBr-7.2 849 WO2016065001 SEQ ID NO:55
AAV CBr-7.3 850 WO2016065001 SEQ ID NO:56
AAV CBr-7.4 851 WO2016065001 SEQ ID NO:57
AAV CBr-7.5 852 WO2016065001 SEQ ID NO:58
AAV CBr-7.7 853 WO2016065001 SEQ ID NO:59
AAV CBr-7.8 854 WO2016065001 SEQ ID NO:60
AAV CBr-7.10 855 WO2016065001 SEQ ID NO:61
AAV CKd-N3 856 WO2016065001 SEQ ID NO:62
AAV CKd-N4 857 WO2016065001 SEQ ID NO:63
AAV CKd-N9 858 WO2016065001 SEQ ID NO:64
AAV CLv-L4 859 WO2016065001 SEQ ID NO:65
AAV CLv-L5 860 WO2016065001 SEQ ID NO:66
AAV CLv-L6 861 WO2016065001 SEQ ID NO:67
AAV CLv-K1 862 WO2016065001 SEQ ID NO:68
AAV CLv-K3 863 WO2016065001 SEQ ID NO:69
AAV CLv-K6 864 WO2016065001 SEQ ID NO:70
AAV CLv-M1 865 WO2016065001 SEQ ID NO:71
AAV CLv-M11 866 WO2016065001 SEQ ID NO:72
AAV CLv-M2 867 WO2016065001 SEQ ID NO:73
AAV CLv-M5 868 WO2016065001 SEQ ID NO:74
AAV CLv-M6 869 WO2016065001 SEQ ID NO:75
AAV CLv-M7 870 WO2016065001 SEQ ID NO:76
AAV CLv-M8 871 WO2016065001 SEQ ID NO:77
AAV CLv-M9 872 WO2016065001 SEQ ID NO:78
AAV CHt-P1 873 WO2016065001 SEQ ID NO:79
AAV CHt-P6 874 WO2016065001 SEQ ID NO:80
AAV CHt-P8 875 WO2016065001 SEQ ID NO:81
AAV CHt-6.1 876 WO2016065001 SEQ ID NO:82
AAV CHt-6.10 877 WO2016065001 SEQ ID NO:83
AAV CHt-6.5 878 WO2016065001 SEQ ID NO:84
AAV CHt-6.6 879 WO2016065001 SEQ ID NO:85
AAV CHt-6.7 880 WO2016065001 SEQ ID NO:86
AAV CHt-6.8 881 WO2016065001 SEQ ID NO:87
AAV CSp-8.10 882 WO2016065001 SEQ ID NO:88
AAV CSp-8.2 883 WO2016065001 SEQ ID NO:89
AAV CSp-8.4 884 WO2016065001 SEQ ID NO:90
AAV CSp-8.5 885 WO2016065001 SEQ ID NO:91
AAV CSp-8.6 886 WO2016065001 SEQ ID NO:92
AAV CSp-8.7 887 WO2016065001 SEQ ID NO:93
AAV CSp-8.8 888 WO2016065001 SEQ ID NO:94
AAV CSp-8.9 889 WO2016065001 SEQ ID NO:95
AAV CBr-B7.3 890 WO2016065001 SEQ ID NO:96
AAV CBr-B7.4 891 WO2016065001 SEQ ID NO:97
AAV3B 892 WO2016065001 SEQ ID NO:98
AAV4 893 WO2016065001 SEQ ID NO:99
AAV5 894 WO2016065001 SEQ ID NO:100
AAVPHP.B или G2B-26 895 WO2015038958 SEQ ID NO:8 и 13; GenBankALU85156,1
AAVPHP.B 896 WO2015038958 SEQ ID NO:9
AAVG2B-13 897 WO2015038958 SEQ ID NO:12
AAVTH1.1-32 898 WO2015038958 SEQ ID NO:14
AAVTH1.1-35 899 WO2015038958 SEQ ID NO:15

[0010] Каждое из патентов, заявок и/или публикаций, перечисленных в таблице 11, включено, таким образом, посредством ссылки в полном объеме.

[00723] В одном из вариантов осуществления серотип AAV может представлять собой или может иметь последовательность, как описано в международной публикации патента WO2015038958, содержание которой включено в настоящее описание посредством ссылки в полном объеме, например, но не ограничиваясь этим, AAV9 (SEQ ID NO:2 и 11 из WO2015038958 или SEQ ID NO:153 и 154, соответственно, в настоящем описании), PHP.B (SEQ ID NO:8 и 9 из WO2015038958, в настоящем описании SEQ ID NO:895 и 896), G2B-13 (SEQ ID NO:12 из WO2015038958, в настоящем описании SEQ ID NO:897), G2B-26 (SEQ ID NO:13 из WO2015038958, в настоящем описании SEQ ID NO:895 и 896), TH1.1-32 (SEQ ID NO:14 из WO2015038958, в настоящем описании SEQ ID NO:898), TH1.1-35 (SEQ ID NO:15 из WO2015038958, в настоящем описании SEQ ID NO:899) или их варианты. Кроме того, любые из направленных пептидов или аминокислотных вставок, описанных в WO2015038958, можно вставлять в любой родительский серотип AAV, такой как, но не ограничиваясь этим, AAV9 (SEQ ID NO:153 для последовательности ДНК и SEQ ID NO:154 для аминокислотной последовательности). В одном из вариантов осуществления аминокислотную вставку вставляют между аминокислотами 586-592 родительского AAV (например, AAV9). В другом варианте осуществления аминокислотную вставку вставляют между аминокислотами 588-589 последовательности родительского AAV. Аминокислотная вставка может представлять собой, но не ограничиваясь этим, любую из следующих аминокислотных последовательностей, TLAVPFK (SEQ ID NO:1 из WO2015038958; в настоящем описании SEQ ID NO:900), KFPVALT (SEQ ID NO:3 из WO2015038958; в настоящем описании SEQ ID NO:901), LAVPFK (SEQ ID NO:31 из WO2015038958; в настоящем описании SEQ ID NO:902), AVPFK (SEQ ID NO:32 из WO2015038958; в настоящем описании SEQ ID NO:903), VPFK (SEQ ID NO:33 из WO2015038958; в настоящем описании SEQ ID NO:904), TLAVPF (SEQ ID NO:34 из WO2015038958; в настоящем описании SEQ ID NO:905), TLAVP (SEQ ID NO:35 из WO2015038958; в настоящем описании SEQ ID NO:906), TLAV (SEQ ID NO:36 из WO2015038958; в настоящем описании SEQ ID NO:907), SVSKPFL (SEQ ID NO:28 из WO2015038958; в настоящем описании SEQ ID NO:908), FTLTTPK (SEQ ID NO:29 из WO2015038958; в настоящем описании SEQ ID NO:909), MNATKNV (SEQ ID NO:30 из WO2015038958; в настоящем описании SEQ ID NO:910), QSSQTPR (SEQ ID NO:54 из WO2015038958; в настоящем описании SEQ ID NO:911), ILGTGTS (SEQ ID NO:55 из WO2015038958; в настоящем описании SEQ ID NO:912), TRTNPEA (SEQ ID NO:56 из WO2015038958; в настоящем описании SEQ ID NO:913), NGGTSSS (SEQ ID NO:58 из WO2015038958; в настоящем описании SEQ ID NO:914), или YTLSQGW (SEQ ID NO:60 из WO2015038958; в настоящем описании SEQ ID NO:915). Неограничивающие примеры нуклеотидных последовательностей, которые могут кодировать аминокислотные вставки, включают следующее, AAGTTTCCTGTGGCGTTGACT (для SEQ ID NO:3 из WO2015038958; в настоящем описании SEQ ID NO:916), ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO:24 и 49 из WO2015038958; в настоящем описании SEQ ID NO:917), AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO:25 из WO2015038958; в настоящем описании SEQ ID NO:918), TTTACGTTGACGACGCCTAAG (SEQ ID NO:26 из WO2015038958; в настоящем описании SEQ ID NO:919), ATGAATGCTACGAAGAATGTG (SEQ ID NO:27 из WO2015038958; в настоящем описании SEQ ID NO:920), CAGTCGTCGCAGACGCCTAGG (SEQ ID NO:48 из WO2015038958; в настоящем описании SEQ ID NO:921), ATTCTGGGGACTGGTACTTCG (SEQ ID NO:50 и 52 из WO2015038958; в настоящем описании SEQ ID NO:922), ACGCGGACTAATCCTGAGGCT (SEQ ID NO:51 из WO2015038958; в настоящем описании SEQ ID NO:923), AATGGGGGGACTAGTAGTTCT (SEQ ID NO:53 из WO2015038958; в настоящем описании SEQ ID NO:924), или TATACTTTGTCGCAGGGTTGG (SEQ ID NO:59 из WO2015038958; в настоящем описании SEQ ID NO:925).

[00724] В одном из вариантов осуществления можно конструировать серотип AAV, который содержит по меньшей мере один эпитоп капсида AAV для CD8+ T-клетки. Hui et al. (Molecular Therapy - Methods & Clinical Development (2015) 2, 15029 doi:10.1038/mtm.2015,29; содержание которого включено в настоящее описание посредством ссылки в полном объеме) идентифицировали специфические эпитопы капсида AAV для CD8+ T-клеток в AAV1 и AAV2 (см., например, таблица 2 в публикации). В качестве неограничивающего примера, специфический эпитоп капсида для CD8+ T-клеток может быть для серотипа AAV2. В качестве неограничивающего примера, специфический эпитоп капсида для CD8+ T-клеток может быть для серотипа AAV1.

[00725] В одном из вариантов осуществления можно конструировать серотип AAV, который содержит по меньшей мере один эпитоп капсида AAV для CD8+ T-клетки для AAV2, такой как, но не ограничиваясь этим, SADNNNSEY (SEQ ID NO:926), LIDQYLYYL (SEQ ID NO:927), VPQYGYLTL (SEQ ID NO:928), TTSTRTWAL (SEQ ID NO:929), YHLNGRDSL (SEQ ID NO:930), SQAVGRSSF (SEQ ID NO:931), VPANPSTTF (SEQ ID NO:932), FPQSGVLIF (SEQ ID NO:933), YFDFNRFHCHFSPRD (SEQ ID NO:934), VGNSSGNWHCDSTWM (SEQ ID NO:935), QFSQAGASDIRDQSR (SEQ ID NO:936), GASDIRQSRNWLP (SEQ ID NO:937) и GNRQAATADVNTQGV (SEQ ID NO:938).

[00726] В одном из вариантов осуществления можно конструировать серотип AAV, который содержит по меньшей мере один эпитоп капсида AAV для CD8+ T-клетки для AAV1, такой как, но не ограничиваясь этим, LDRLMNPLI (SEQ ID NO:939), TTSTRTWAL (SEQ ID NO:929), и QPAKKRLNF (SEQ ID NO:940)).

[00727] В одном из вариантов осуществления пептиды для включения в серотип AAV можно идентифицировать с использованием способов, описанных в Hui et al. (Molecular Therapy - Methods & Clinical Development (2015) 2, 15029 doi:10.1038/mtm.2015.29; содержание которого включено в настоящее описание посредством ссылки в полном объеме). В качестве неограничивающего примера, процедура включает выделение спленоцитов человека, повторную стимуляцию спленоцитов in vitro с использованием индивидуальных пептидов, покрывающих аминокислотную последовательность белка капсида AAV, IFN-γ ELISpot с индивидуальными пептидами, которые используют для повторной стимуляции in vitro, биоинформационный анализ для определения HLA-рестрикции 15-меров, идентифицированных с помощью IFN-γ ELISpot, идентификацию кандидатных реактивных 9-членных эпитопов для заданного аллеля HLA, синтез кандидатных 9-меров, второй IFN-γ ELISpot скрининг спленоцитов от субъектов, несущих аллели HLA, с которыми предсказано связывание идентифицированных AAV эпитопов, определение реактивных эпитопов капсида AAV для CD8+ T-клеток и определение частоты субъектов, реагирующих на заданный эпитоп AAV.

[00728] В одном из вариантов осуществления AAV может представлять собой серотип, создаваемый с помощью направленной эволюции AAV на основе Cre-рекомбинации (CREATE), как описано в Deverman et al., (Nature Biotechnology 34(2):204-209 (2016)), содержание которой включено в настоящее описание посредством ссылки в полном объеме. В одном из вариантов осуществления серотипы AAV, создаваемые таким образом, имеют усовершенствованную трансдукцию CNS и/или нейрональный и астроцитарный тропизм, по сравнению с другими серотипами AAV. В качестве неограничивающих примеров, серотип AAV может представлять собой PHP.B, PHP.B2, PHP.B3, PHP.A, G2A12, G2A15. В одном из вариантов осуществления эти серотипы AAV могут представлять собой AAV9 (SEQ ID NO:153 и 154) производные с 7-аминокислотной вставкой между аминокислотами 588-589. Неограничивающие примеры этих 7-аминокислотных вставок включают TLAVPFK (SEQ ID NO:900), SVSKPFL (SEQ ID NO:908), FTLTTPK (SEQ ID NO:909), YTLSQGW (SEQ ID NO:915), QAVRTSL (SEQ ID NO:941) и/или LAKERLS (SEQ ID NO:942).

[00729] В одном из вариантов осуществления серотип AAV може представлять собой то, что описано в Jackson et al (Frontiers in Molecular Neuroscience 9:154 (2016)), содержание которого включено в настоящее описание посредством ссылки в полном объеме. В некоторых вариантах осуществления серотип AAV представляет собой PHP.B или AAV9. В некоторых вариантах осуществления серотип AAV образует пару с промотором синапсина для усиления нейрональной трансдукции, по сравнению с использованием более повсеместных промоторов (т. е. CBA или CMV).

[00730] В одном из вариантов осуществления пептиды для включения в серотип AAV можно идентифицировать посредством выделения спленоцитов человека, повторной стимуляции спленоцитов in vitro с использованием индивидуальных пептидов, покрывающих аминокислотную последовательность белка капсида AAV, IFN-γ ELISpot с индивидуальными пептидами, которые используют для повторной стимуляции in vitro, биоинформационного анализа для определения заданной аллельной рестрикции 15-меров, идентифицированных с помощью IFN-γ ELISpot, идентификации кандидатных реактивных 9-членных эпитопов для заданного аллеля, синтеза кандидатных 9-меров, второго IFN-γ ELISpot скрининга спленоцитов от субъекта, несущего конкретные аллели, с которыми предсказано связывание идентифицированных AAV эпитопов, определения реактивных эпитопов капсида AAV для CD8+ T-клеток и определения частоты субъектов, реагирующих на заданный эпитоп AAV.

[00731] AAV векторы, содержащие последовательность нуклеиновой кислоты для молекул миРНК, можно получать или извлекать из различных серотипов AAV, включая в качестве неограничивающих примеров AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV-PHP.A и/или AAV-PHP.B. В некоторых случаях, другие серотипы AAV можно смешивать вместе или с вирусами других типов, чтобы получать химерные AAV векторы. В качестве неограничивающего примера, AAV вектор получают из серотипа AAV9.

Компонент вирусного генома: инвертированные концевые повторы (ITR)

[00732] AAV частицы по настоящему изобретению содержат вирусный геном с по меньшей мере одной областью ITR и областью полезной нагрузки. В одном из вариантов осуществления вирусный геном содержит два ITR. Эти два ITR фланкируют область полезной нагрузки на 5'- и 3'-концах. ITR выполняют функцию участков начала репликации, которые содержат участки узнавания для репликации. ITR содержат области последовательностей, которые могут быть комплементарными и симметрично расположенными. ITR, встроенные в вирусные геномы по изобретению, могут содержать встречаемые в природе полинуклеотидные последовательности или рекомбинантно полученные полинуклеотидные последовательности.

[00733] ITR можно извлекать из того же серотипа, что и капсид, выбранного из любых серотипов, перечисленных в таблице 6, или их производных. ITR могут быть другого серотипа, нежели капсид. В одном из вариантов осуществления AAV частица имеет больше чем один ITR. В неограничивающем примере, AAV частица имеет вирусный геном, содержащий два ITR. В одном из вариантов осуществления ITR относится к тому же серотипу, что и другой ITR. В другом варианте осуществления ITR относятся к разным серотипам. Неограничивающие примеры включают 0, 1 или 2 ITR, имеющих тот же серотип, что и капсид. В одном из вариантов осуществления оба ITR вирусного генома AAV частицы представляют собой AAV2 ITR.

[00734] Независимо, каждый ITR может составлять приблизительно от 100 приблизительно до 150 нуклеотидов в длину. ITR может составлять приблизительно 100-105 нуклеотидов в длину, 106-110 нуклеотидов в длину, 111-115 нуклеотидов в длину, 116-120 нуклеотидов в длину, 121-125 нуклеотидов в длину, 126-130 нуклеотидов в длину, 131-135 нуклеотидов в длину, 136-140 нуклеотидов в длину, 141-145 нуклеотидов в длину или 146-150 нуклеотидов в длину. В одном из вариантов осуществления ITR составляют 140-142 нуклеотиды в длину. Неограничивающие примеры длины ITR представляют собой 102, 140, 141, 142, 145 нуклеотидов в длину и те, которые обладают по меньшей мере 95% идентичностью с ними.

[00735] В одном из вариантов осуществления кодируемую молекулу миРНК можно располагать около 5'-конца флип-конфигурации ITR в экспрессирующем векторе. В другом варианте осуществления кодируемую молекулу миРНК можно располагать около 3'-конца флип-конфигурации ITR в экспрессирующем векторе. В еще одном другом варианте осуществления кодируемую молекулу миРНК можно располагать около 5'-конца флоп-конфигурации ITR в экспрессирующем векторе. В еще одном другом варианте осуществления, кодируемую молекулу миРНК можно располагать около 3'-конца флоп-конфигурации ITR в экспрессирующем векторе. В одном из вариантов осуществления кодируемую молекулу миРНК можно располагать между 5'-концом флип-конфигурации ITR и 3'-концом флоп-конфигурации ITR в экспрессирующем векторе. В одном из вариантов осуществления кодируемую молекулу миРНК можно располагать между (например, посредине между 5'-концом флип-конфигурации ITR и 3'-концом флоп-конфигурации ITR или 3'-концом флоп-конфигурации ITR и 5'-концом флип-конфигурации ITR) 3'-концом флип-конфигурации ITR и 5'-концом флип-конфигурации ITR в экспрессирующем векторе. В качестве неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов ниже от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурации ITR) в экспрессирующем векторе. В качестве неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов выше от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурации ITR) в экспрессирующем векторе. В качестве другого неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурации ITR) в экспрессирующем векторе. В качестве другого неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 выше от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурации ITR) в экспрессирующем векторе. В качестве неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или больше чем 25% нуклеотидов выше от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурации ITR) в экспрессирующем векторе. В качестве другого неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% ниже от 5'- или 3'-конца ITR (например, флип- или флоп-конфигурации ITR) в экспрессирующем векторе.

Компонент вирусного генома: промоторы

[00736] Специалист в данной области может признать, что целевая клетка может требовать конкретного промотора, включая в качестве неограничивающих примеров промотор, который обладает видовой специфичностью, специфичностью в клеточном цикле, является индуцибельным или тканеспецифическим (Parr et al., Nat. Med.3:1145-9 (1997); содержание которого включено в настоящее описание посредством ссылки в полном объеме).

[00737] В одном из вариантов осуществления промотор представляет собой промотор, который полагают эффективным для управления экспрессией модулирующего полинуклеотида.

[00738] В одном из вариантов осуществления промотор представляет собой промотор, имеющий тропизм к клетке, подлежащей направленному воздействию.

[00739] В одном из вариантов осуществления промотор представляет собой слабый промотор, который обеспечивает экспрессию полезной нагрузки, например, модулирующего полинуклеотида, например, миРНК или дцРНК, в течение определенного периода времени в целевых тканях, таких как, но не ограничиваясь этим, ткани нервной системы. Экспрессия может происходить в течение периода в 1 час, 2, часа, 3 часа, 4 часа, 5 часов, 6 часов, 7 часов, 8 часов, 9 часов, 10 часов, 11 часов, 12 часов, 13 часов, 14 часов, 15 часов, 16 часов, 17 часов, 18 часов, 19 часов, 20 часов, 21 час, 22 часа, 23 часа, 1 сутки, 2 суток, 3 суток, 4 суток, 5 суток, 6 суток, 1 неделя, 8 суток, 9 суток, 10 суток, 11 суток, 12 суток, 13 суток, 2 недели, 15 суток, 16 суток, 17 суток, 18 суток, 19 суток, 20 суток, 3 недели, 22 суток, 23 суток, 24 суток, 25 суток, 26 суток, 27 суток, 28 суток, 29 суток, 30 суток, 31 сутки, 1 месяц, 2 месяца, 3 месяца, 4 месяца, 5 месяцев, 6 месяцев, 7 месяцев, 8 месяцев, 9 месяцев, 10 месяцев, 11 месяцев, 1 год, 13 месяцев, 14 месяцев, 15 месяцев, 16 месяцев, 17 месяцев, 18 месяцев, 19 месяцев, 20 месяцев, 21 месяц, 22 месяца, 23 месяца, 2 года, 3 года, 4 года, 5 лет, 6 лет, 7 лет, 8 лет, 9 лет, 10 лет или больше чем 10 лет. Экспрессия может происходить в течение 1-5 часов, 1-12 часов, 1-2 суток, 1-5 суток, 1-2 недель, 1-3 недель, 1-4 недель, 1-2 месяцев, 1-4 месяцев, 1-6 месяцев, 2-6 месяцев, 3-6 месяцев, 3-9 месяцев, 4-8 месяцев, 6-12 месяцев, 1-2 лет, 1-5 лет, 2-5 лет, 3-6 лет, 3-8 лет, 4-8 лет или 5-10 лет. В качестве неограничивающего примера, промотор представляет собой слабый промотор для длительной экспрессии полезной нагрузки в нервной ткани.

[00740] В одном из вариантов осуществления промотор может представлять собой промотор, который составляет меньше 1 т. о. Промотор может иметь длину 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 или больше чем 800. Промотор может иметь длину 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 или 700-800.

[00741] В одном из вариантов осуществления промотор может представлять собой комбинацию двух или больше компонентов, таких как, но не ограничиваясь этим, CMV и CBA. Каждый компонент может иметь длину 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 или больше чем 800. Каждый компонент может иметь длину 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 или 700-800. В качестве неограничивающего примера, промотор представляет собой комбинацию из энхансерной последовательности CMV в 382 нуклеотида и последовательности промотора CBA в 260 нуклеотидов.

[00742] В одном из вариантов осуществления геном вектора содержит по меньшей мере один элемент для повышения специфичности мишени и экспрессии (см., например, Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; содержание которого включено в настоящее описание посредством ссылки в полном объеме). Неограничивающие примеры элементов для увеличения специфичности мишени трансгена и экспрессии включают промоторы, эндогенную мкРНК, посттранскрипционные регуляторные элементы (PRE), последовательности сигналов полиаденилирования (полиА) и расположенные выше по направлению считывания энхансеры (USE), энхансеры CMV и интроны.

[00743] В одном из вариантов осуществления геном вектора содержит по меньшей мере один элемент для увеличения специфичности мишени и экспрессии (см., например, Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; содержание которого включено в настоящее описание посредством ссылки в полном объеме), такой как промоторы.

[00744] Промоторы, для которых усиление экспрессии происходит в большинстве тканей, относятся к, но не ограничиваясь этим, 1α-субъединице фактора элонгации человека (EF1α), предраннему цитомегаловируса (CMV), β-актину курицы (CBA) и его производному CAG, β-глюкуронидазе (GUSB) или убиквитину C (UBC). Тканеспецифические экспрессионные элементы можно использовать для ограничения экспрессии определенными типами клеток, такими как, но не ограничиваясь этим, промоторы нервной системы, которые можно использовать для ограничения экспрессии нейронами, астроцитами или олигодендроцитами. Неограничивающий пример тканеспецифических экспрессионных элементов для нейронов включает промоторы нейрон-специфической енолазы (NSE), тромбоцитарного фактора роста (PDGF), B-цепи тромбоцитарного фактора роста (PDGF-β), синапсина (Syn), метил-CpG-связывающего белка 2 (MeCP2), CaMKII, mGluR2, NFL, NFH, nβ2, PPE, Enk и EAAT2. Неограничивающий пример тканеспецифических экспрессионных элементов для астроцитов включает промоторы глиофибриллярного кислого белка (GFAP) и EAAT2. Неограничивающий пример тканеспецифического экспрессионного элемента для олигодендроцитов включает промотор основного белка миелина (MBP).

[00745] В одном из вариантов осуществления геном вектора содержит повсеместный промотор. Неограничивающие примеры повсеместных промоторов включают H1, U6, CMV, CBA (в том числе производные CAG, CBh и т. д.), EF-1α, PGK, UBC, GUSB (hGBp) и UCOE (промотор HNRPA2B1-CBX3). Yu et al. (Molecular Pain 2011, 7:63; содержание которого включено в настоящее описание посредством ссылки в полном объеме) оценивали экспрессию eGFP под управлением промоторов CAG, EFIα, PGK и UBC в клетках DRG крысы и первичных клетках DRG с использованием лентивирусных векторов и обнаруживали, что UBC демонстрировал более слабую экспрессию, чем другие 3 промотора, и имело место только 10-12% экспрессии в глии, которую наблюдали для всех промоторов. Soderblom et al. (E. Neuro 2015; содержание которого включено в настоящее описание посредством ссылки в полном объеме) экспрессия eGFP в AAV8 с промоторами CMV и UBC и AAV2 с промотором CMV после инъекции в двигательную кору. Интраназальное введение плазмиды, содержащей промотор UBC или EFIα, демонстрировало длительную экспрессию в дыхательных путях, большую, чем экспрессия с использованием промотора CMV (см., например, Gill et al., Gene Therapy 2001, том 8, 1539-1546; содержание которого включено в настоящее описание посредством ссылки в полном объеме). Husain et al. (Gene Therapy 2009; содержание которого включено в настоящее описание посредством ссылки в полном объеме) оценивали конструкцию HβH с промотором hGUSB, промотором HSV-1LAT и промотором NSE и обнаруживали, что конструкция HβH демонстрировала более слабую экспрессию, чем NSE в головном мозге мыши. Passini and Wolfe (J. Virol. 2001, 12382-12392, содержание которого включено в настоящее описание посредством ссылки в полном объеме) оценивали долгосрочные эффекты вектора HβH после внутрижелудочковой инъекции неонатальным мышам и обнаруживали, что имела место длительная экспрессия в течение по меньшей мере 1 года. Низкую экспрессию во всех областях головного мозга обнаруживали Xu et al. (Gene Therapy 2001, 8, 1323-1332; содержание которого включено в настоящее описание посредством ссылки в полном объеме), когда использовали промоторы NF-L и NF-H, по сравнению с CMV-lacZ, CMV-luc, EF, GFAP, hENK, nAChR, PPE, PPE+wpre, NSE (0,3 т. о.), NSE (1,8 т. о.) и NSE (1,8 т. о.+wpre). Xu et al. обнаруживали, что активность промотора в нисходящем порядке представляла собой NSE (1,8 т. о.), EF, NSE (0,3 т. о.), GFAP, CMV, hENK, PPE, NFL и NFH. NFL представляет собой промотор из 650 нуклеотидов и NFH представляет собой промотор из 920 нуклеотидов, оба они отсутствуют в печени, но NFH распространен в чувствительных проприоцептивных нейронах, головном мозге и спинном мозге, а также NFH присутствует в сердце. Scn8a представляет собой промотор из 470 нуклеотидов, который экспрессирован на всем протяжении DRG, спинного мозга и головного мозга, при особенно высокой экспрессии, наблюдаемой в гиппокампальных нейронах и клетках Пуркинье мозжечка, коре, таламусе и гипоталамусе (см., например, Drews et al. 2007 и Raymond et al. 2004; содержание каждого из которых включено в настоящее описание посредством ссылки во всей их полноте).

[00746] В одном из вариантов осуществления геном вектора содержит промотор UBC. Промотор UBC может иметь размер 300-350 нуклеотидов. В качестве неограничивающего примера, промотор UBC составляет 332 нуклеотида.

[00747] В одном из вариантов осуществления геном вектора содержит промотор GUSB. Промотор GUSB может иметь размер 350-400 нуклеотидов. В качестве неограничивающего примера, промотор GUSB составляет 378 нуклеотидов. В качестве неограничивающего примера, конструкция может представлять собой AAV-промотор-CMV/интрон глобина-модулирующий полинуклеотид-RBG, где AAV может быть самокомплементарным и AAV может представлять собой серотип DJ.

[00748] В одном из вариантов осуществления геном вектора содержит промотор NFL. Промотор NFL может иметь размер 600-700 нуклеотидов. В качестве неограничивающего примера, промотор NFL составляет 650 нуклеотидов. В качестве неограничивающего примера, конструкция может представлять собой AAV-промотор-CMV/интрон глобина-модулирующий полинуклеотид-RBG, где AAV может быть самокомплементарным и AAV может представлять собой серотип DJ.

[00749] В одном из вариантов осуществления геном вектора содержит промотор NFH. Промотор NFH может иметь размер 900-950 нуклеотидов. В качестве неограничивающего примера, промотор NFH составляет 920 нуклеотидов. В качестве неограничивающего примера, конструкция может представлять собой AAV-промотор-CMV/интрон глобина-модулирующий полинуклеотид-RBG, где AAV может быть самокомплементарным и AAV может представлять собой серотип DJ.

[00750] В одном из вариантов осуществления геном вектора содержит промотор scn8a. Промотор scn8a может иметь размер 450-500 нуклеотидов. В качестве неограничивающего примера, промотор scn8a составляет 470 нуклеотидов. В качестве неограничивающего примера, конструкция может представлять собой AAV-промотор-CMV/интрон глобина-модулирующий полинуклеотид-RBG, где AAV может быть самокомплементарным и AAV может представлять собой серотип DJ.

[00751] В одном из вариантов осуществления геном вектора содержит промотор FXN.

[00752] В одном из вариантов осуществления геном вектора содержит промотор PGK.

[00753] В одном из вариантов осуществления геном вектора содержит промотор CBA.

[00754] В одном из вариантов осуществления геном вектора содержит промотор CMV.

[00755] В одном из вариантов осуществления геном вектора содержит промотор H1.

[00756] В одном из вариантов осуществления геном вектора содержит промотор U6.

[00757] В одном из вариантов осуществления геном вектора содержит промотор печени или скелетной мышцы. Неограничивающие примеры промоторов печени включают hAAT и TBG. Неограничивающие примеры промоторов скелетной мышцы включают десмин, MCK и C5-12.

[00758] В одном из вариантов осуществления AAV вектор содержит энхансерный элемент, промотор и/или 5'UTR интрон. Энхансер может представлять собой, но не ограничиваясь этим, энхансер CMV, промотор может представлять собой, но не ограничиваясь этим, промотор CMV, CBA, UBC, GUSB, NSE, синапсина, MeCP2 и GFAP, а 5'UTR/интрон может представлять собой, но не ограничиваясь этим, SV40 и CBA-MVM. В качестве неограничивающего примера, энхансер, промотор и/или интрон, используемые в комбинации, могут представлять собой: (1) энхансер CMV, промотор CMV, 5'UTR интрон SV40; (2) энхансер CMV, промотор CBA, 5'UTR интрон SV40; (3) энхансер CMV, промотор CBA, 5'UTR интрон CBA-MVM; (4) промотор UBC; (5) промотор GUSB; (6) Промотор NSE; (7) промотор синапсина; (8) промотор MeCP2; (9) промотор GFAP, (10) промотор H1; и (11) промотор U6.

[00759] В одном из вариантов осуществления AAV вектор имеет сконструированный промотор.

Компонент вирусного генома: интроны

[00760] В одном из вариантов осуществления геном вектора содержит по меньшей мере один элемент для увеличения специфичности мишени трансгена и экспрессии (см., например, Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; содержание которого включено в настоящее описание посредством ссылки в полном объеме), такой как интрон. Неограничивающие примеры интронов включают MVM (67-97 п. о.), F.IX усеченный интрон 1 (300 п. о.), SD β-глобина/акцепторный сайт сплайсинга тяжелой цепи иммуноглобулина (250 п. о.), аденовирусный донор сплайсированного фрагмента/акцепторный сайт сплайсинга иммуноглобина (500 п. о.), поздний донор сплайсированного фрагмента/акцепторный сайт сплайсинга SV40 (19S/16S) (180 п. о.) и гибридный аденовирусный донор сплайсированного фрагмента/акцепторный сайт сплайсинга IgG (230 п. о.).

[00761] В одном из вариантов осуществления интрон может составлять 100-500 нуклеотидов в длину. Интрон может иметь длину 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 или 500. Промотор может иметь длину между 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, или 400-500.

[00762] В одном из вариантов осуществления AAV вектор может содержать интрон SV40 или его фрагмент или вариант. В качестве неограничивающего примера, промотор может представлять собой CMV. В качестве другого неограничивающего примера, промотор может представлять собой CBA. В качестве еще одного другого неограничивающего примера, промотор может представлять собой H1.

[00763] В одном из вариантов осуществления AAV вектор может содержать интрон β-глобина или его фрагмент или вариант. В качестве неограничивающего примера, промотор может представлять собой CMV. В качестве другого неограничивающего примера, промотор может представлять собой CBA. В качестве еще одного другого неограничивающего примера, промотор может представлять собой H1.

[00764] В одном из вариантов осуществления кодируемую молекулу миРНК можно располагать ниже интрона в экспрессирующем векторе, например, но не ограничиваясь этим, интрон SV40 или интрон β-глобинаа или другие известные в данной области. Кроме того, кодируемую молекулу миРНК также можно располагать выше последовательности полиаденилирования в экспрессирующем векторе. В качестве неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов ниже промотора с интроном и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве другого неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже интрона и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или больше чем 25% нуклеотидов ниже интрона и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве другого неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% последовательности ниже интрона и/или выше последовательности полиаденилирования в экспрессирующем векторе.

Компонент вирусного генома: последовательность полиаденилирования

[00765] В одном из вариантов осуществления вирусный геном AAV частицы по настоящему изобретению содержит по меньшей мере одну последовательность полиаденилирования. Вирусный геном AAV частицы может содержать последовательность полиаденилирования между 3'-концом кодирующей последовательности полезной нагрузки и 5'-концом 3'ITR.

[00766] В одном из вариантов осуществления последовательность полиаденилирования или «последовательность полиА» может находиться в диапазоне от 0 приблизительно до 500 нуклеотидов в длину. Последовательность полиаденилирования может составлять, но не ограничиваясь этим, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499 и 500 нуклеотидов в длину.

[00767] В одном из вариантов осуществления последовательность полиаденилирования составляет 50-100 нуклеотидов в длину.

[00768] В одном из вариантов осуществления последовательность полиаденилирования составляет 50-150 нуклеотидов в длину.

[00769] В одном из вариантов осуществления последовательность полиаденилирования составляет 50-160 нуклеотидов в длину.

[00770] В одном из вариантов осуществления последовательность полиаденилирования составляет 50-200 нуклеотидов в длину.

[00771] В одном из вариантов осуществления последовательность полиаденилирования составляет 60-100 нуклеотидов в длину.

[00772] В одном из вариантов осуществления последовательность полиаденилирования составляет 60-150 нуклеотидов в длину.

[00773] В одном из вариантов осуществления последовательность полиаденилирования составляет 60-160 нуклеотидов в длину.

[00774] В одном из вариантов осуществления последовательность полиаденилирования составляет 60-200 нуклеотидов в длину.

[00775] В одном из вариантов осуществления последовательность полиаденилирования составляет 70-100 нуклеотидов в длину.

[00776] В одном из вариантов осуществления последовательность полиаденилирования составляет 70-150 нуклеотидов в длину.

[00777] В одном из вариантов осуществления последовательность полиаденилирования составляет 70-160 нуклеотидов в длину.

[00778] В одном из вариантов осуществления последовательность полиаденилирования составляет 70-200 нуклеотидов в длину.

[00779] В одном из вариантов осуществления последовательность полиаденилирования составляет 80-100 нуклеотидов в длину.

[00780] В одном из вариантов осуществления последовательность полиаденилирования составляет 80-150 нуклеотидов в длину.

[00781] В одном из вариантов осуществления последовательность полиаденилирования составляет 80-160 нуклеотидов в длину.

[00782] В одном из вариантов осуществления последовательность полиаденилирования составляет 80-200 нуклеотидов в длину.

[00783] В одном из вариантов осуществления последовательность полиаденилирования составляет 90-100 нуклеотидов в длину.

[00784] В одном из вариантов осуществления последовательность полиаденилирования составляет 90-150 нуклеотидов в длину.

[00785] В одном из вариантов осуществления последовательность полиаденилирования составляет 90-160 нуклеотидов в длину.

[00786] В одном из вариантов осуществления последовательность полиаденилирования составляет 90-200 нуклеотидов в длину.

[00787] В одном из вариантов осуществления кодируемую молекулу миРНК можно располагать выше последовательности полиаденилирования в экспрессирующем векторе. Кроме того, кодируемую молекулу миРНК можно располагать ниже промотора, такого как, но не ограничиваясь этим, промотор CMV, U6, H1, CBA или CBA, с интроном SV40 или β-глобина человека в экспрессирующем векторе. В качестве неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или больше чем 30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве другого неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или больше чем 25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе. В качестве другого неограничивающего примера, кодируемую молекулу миРНК можно располагать в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% ниже промотора и/или выше последовательности полиаденилирования в экспрессирующем векторе.

Экспрессирующий вектор

[00788] В одном из вариантов осуществления экспрессирующий вектор (например, AAV вектор) может содержать по меньшей мере один из модулирующих полинуклеотидов, кодирующих по меньшей мере одну из последовательностей миРНК или дуплексов, описанных в настоящем описании.

[00789] В одном из вариантов осуществления экспрессирующий вектор может содержать, от ITR до ITR в направлении от 5' к 3', ITR, промотор, интрон, модулирующий полинуклеотид, последовательность полиА и ITR.

Размер генома

[00790] В одном из вариантов осуществления геном вектора, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в настоящем описании, может представлять собой одноцепочечный или двухцепочечный геном вектора. Размер генома вектора может представлять собой малый, средний, большой или максимальный размер. Дополнительно, геном вектора может содержать промотор и хвост полиА.

[00791] В одном из вариантов осуществления геном вектора, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в настоящем описании, могет представлять собой малый одноцепочечный геном вектора. Малый одноцепочечный геном вектора может составлять 2,7 до 3,5 т. о. в размере, например, приблизительно 2,7, 2,8, 2,9, 3,0, 3,1, 3,2, 3,3, 3,4 и 3,5 т. о. в размере. В качестве неограничивающего примера, малый одноцепочечный геном вектора может составлять 3,2 т. о. в размере. Дополнительно, геном вектора может содержать промотор и хвост полиА.

[00792] В одном из вариантов осуществления геном вектора, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в настоящем описании, может представлять собой малый двухцепочечный геном вектора. Малый двухцепочечный геном вектора может составлять от 1,3 до 1,7 т. о. в размере, например, приблизительно 1,3, 1,4, 1,5, 1,6 и 1,7 т. о. в размере. В качестве неограничивающего примера, малый двухцепочечный геном вектора может составлять 1,6 т. о. в размере. Дополнительно, геном вектора может содержать промотор и хвост полиА.

[00793] В одном из вариантов осуществления геном вектора, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в настоящем описании, например, миРНК или дцРНК, может представлять собой средний одноцепочечный геном вектора. Средний одноцепочечный геном вектора может составлять от 3,6 до 4,3 т. о. в размере, например, приблизительно 3,6, 3,7, 3,8, 3,9, 4,0, 4,1, 4,2 и 4,3 т. о. в размере. В качестве неограничивающего примера, средний одноцепочечный геном вектора может составлять 4,0 т. о. в размере. Дополнительно, геном вектора может содержать промотор и хвост полиА.

[00794] В одном из вариантов осуществления геном вектора, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в настоящем описании, может представлять собой средний двухцепочечный геном вектора. Средний двухцепочечный геном вектора может составлять от 1,8 до 2,1 т. о. в размере, например, приблизительно 1,8, 1,9, 2,0 и 2,1 т. о. в размере. В качестве неограничивающего примера, средний двухцепочечный геном вектора может составлять 2,0 т. о. в размере. Дополнительно, геном вектора может содержать промотор и хвост полиА.

[00795] В одном из вариантов осуществления геном вектора, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в настоящем описании, может представлять собой большой одноцепочечный геном вектора. Большой одноцепочечный геном вектора может составлять от 4,4 до 6,0 т. о. в размере, например, приблизительно 4,4, 4,5, 4,6, 4,7, 4,8, 4,9, 5,0, 5,1, 5,2, 5,3, 5,4, 5,5, 5,6, 5,7, 5,8, 5,9 и 6,0 т. о. в размере. В качестве неограничивающего примера, большой одноцепочечный геном вектора может составлять 4,7 т. о. в размере. В качестве другого неограничивающего примера, большой одноцепочечный геном вектора может составлять 4,8 т. о. в размере. В качестве еще одного другого неограничивающего примера, большой одноцепочечный геном вектора может составлять 6,0 т. о. в размере. Дополнительно, геном вектора может содержать промотор и хвост полиА.

[00796] В одном из вариантов осуществления геном вектора, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в настоящем описании, может представлять собой большой двухцепочечный геном вектора. Большой двухцепочечный геном вектора может составлять от 2,2 до 3,0 т. о. в размере, например, приблизительно 2,2, 2,3, 2,4, 2,5, 2,6, 2,7, 2,8, 2,9 и 3,0 т. о. в размере. В качестве неограничивающего примера, большой двухцепочечный геном вектора может составлять 2,4 т. о. в размере. Дополнительно, геном вектора может содержать промотор и хвост полиА.

Получение вируса

[00797] Настоящее раскрытие предусматривет способ создания парвовирусных частиц, например, AAV частиц, посредством репликации вирусного генома в реплицирующей вирус клетке, который включает приведение реплицирующей вирус клетки в контакт с полинуклеотидом AAV или геномом AAV.

[00798] Настоящее раскрытие предусматривает способ получения AAV частицы, обладающей увеличенной (повышенной, усовершенствованной) эффективностью трансдукции, включающий стадии: 1) совместной трансфекции компетентных бактериальных клеток бакмидным вектором и любым из вектора вирусной конструкции и/или AAV вектором с конструкцией полезной нагрузки, 2) выделения получаемых экспрессирующего вирусную конструкцию вектора и экспрессирующего конструкцию полезной нагрузки AAV вектора и отдельной трансфекции реплицирующих вирус клеток, 3) выделения и очистки получаемых частиц с полезной нагрузкой и вирусной конструкцией, содержащих экспрессирующий вирусную конструкцию вектор или экспрессирующий конструкцию полезной нагрузки AAV вектор, 4) совместного инфицирования реплицирующей вирус клетки AAV частицами как с полезной нагрузкой, так и с вирусной конструкцией, содержащих экспрессирующий вирусную конструкцию вектор или экспрессирующий конструкцию полезной нагрузки AAV вектор, 5) сбора и очистки вирусной частицы, содержащей парвовирусный геном.

[00799] В одном из вариантов осуществления настоящее изобретение предусматривает способ получения AAV частицы, включающий стадии 1) одновременной совместной трансфекции клеток млекопитающих, таких как, но не ограничиваясь этим, клетки HEK293, с использованием области полезной нагрузки, конструкции, экспрессирующей гены rep и cap, и конструкции помощника, 2) сбора и очистки AAV частицы, содержащей вирусный геном.

Клетки

[00800] Настоящее раскрытие предусматривает клетку, содержащую полинуклеотид AAV и/или геном AAV.

[00801] Получение вируса, раскрытое в настоящем описании, описывает процессы и способы получения AAV частиц, которые приводят в контакт с целевой клеткой для того, чтобы доставлять конструкцию полезной нагрузки, например, рекомбинантную вирусную конструкцию, которая содержит нуклеотид, кодирующий молекулу полезной нагрузки.

[00802] В одном из вариантов осуществления AAV частицы можно получать в реплицирующей вирус клетке, которая включает клетку насекомого.

[00803] Условия роста для клеток насекомого в культуре и получение гетерологичных продуктов в клетках насекомого в культуре хорошо известны в данной области, см. патент США № 6204059, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00804] Любую клетку насекомого, которая допускает репликацию парвовируса и которую можно поддерживать в культуре, можно использовать в соответствии с настоящим изобретением. Можно использовать клеточные линии из Spodoptera frugiperda, включая в качестве неограничивающих примеров клеточные линии Sf9 или Sf21, клеточные линии дрозофилы или клеточные линии комара, такие как клеточные линии, полученные из Aedes albopictus. Использование клеток насекомого для экспрессии гетерологичных белков хорошо документировано в качестве способов введения нуклеиновых кислот, таких как векторы, например, векторы, совместимые с клетками насекомых, в такие клетки, и способов поддержания таких клеток в культуре. См., например, Methods in Molecular Biology, ред. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir.63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir.219:37-44 (1996); Zhao et al., Vir.272:382-93 (2000); и Samulski et al., патент США № 6204059, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме.

[00805] Реплицирующую вирус клетку можно выбирать у любого биологического организма, в том числе прокариотические (например, бактериальные) клетки и эукариотические клетки, в том числе, клетки насекомого, клетки дрожжей и клетки млекопитающих. Реплицирующие вирус клетки могут включать клетки млекопитающих, такие как клетки A549, WEH1, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO. W138, HeLa, HEK293, Saos, C2C12, L, HT1080, HepG2 и первичные фибробласты, гепатоциты и миобластные клетки, полученные у млекопитающих. Реплицирующие вирус клетки включают клетки, получаемые у биологических видов млекопитающих, включая в качестве неограничивающих примеров человека, обезьяну, мышь, крысу, кролика и хомяка, или тип клеток, включая в качестве неограничивающих примеров фибробласты, гепатоциты, опухолевые клетки, трансформированные клетки клеточных линий и т. д.

Мелкомасштабное получение AAV частиц

[00806] Получение вируса, раскрытое в настоящем описании, описывает процессы и способы получения AAV частиц, которые приводят в контакт с целевой клеткой для того, чтобы доставлять полезную нагрузку, например, рекомбинантную вирусную конструкцию, которая содержит нуклеотид, кодирующий полезную нагрузку.

[00807] В одном из вариантов осуществления AAV частицы можно получать в реплицирующих вирус клетках, которые включают клетки млекопитающего.

[00808] Реплицирующие вирус клетки, широко используемые для получения рекомбинантных AAV частиц, включают, но не ограничиваясь этим, клетки 293, клетки COS, клетки HeLa, KB-клетки и другие клеточные линии млекопитающих, как описано в патентах США №№ 6156303, 5387484, 5741683, 5691176 и 5688676; патентной заявке США 2002/0081721, и международных патентных заявках WO 00/47757, WO 00/24916 и WO 96/17947, содержание каждого из которых включено в настоящее описание посредством ссылки во всей их полноте.

[00809] В одном из вариантов осуществления AAV частицы получают в клетках млекопитающего, которые экспрессируют все три белка VP при стехиометрии приблизительно 1:1:10 (VP1:VP2:VP3). Регуляторные механизмы, которые делают возможным этот контролируемый уровень экспрессии, включают получение двух мРНК, одной для VP1 и другой для VP2 и VP3, которые получают дифференциальным сплайсингом.

[00810] В другом варианте осуществления AAV частицы получают в клетках млекопитающих с использованием способа тройной трансфекции, в котором конструкция полезной нагрузки, парвовирусный Rep и парвовирусный Cap и конструкция помощника находятся в трех различных конструкциях. Способ тройной трансфекции тремя компонентами получения AAV частиц можно использовать для получения небольших партий вируса для анализов, включая эффективность трансдукции, оценку целевой ткани (тропизм) и стабильность.

Бакуловирус

[00811] Получение частиц, раскрытое в настоящем описании, описывает процессы и способы получения AAV частиц, которые приводят в контакт с целевой клеткой для того, чтобы доставлять конструкцию полезной нагрузки, которая содержит нуклеотид, кодирующий полезную нагрузку.

[00812] В кратком изложении, каждый из вектора вирусной конструкции и AAV вектора с конструкцией полезной нагрузки встраивают посредством транспозонной донорно-акцепторной системы в бакмиду, также известную как бакуловирусная плазмида, с помощью стандартных способов молекулярной биологии, которые знает и выполняет специалист в данной области. Трансфекция отдельных популяций реплицирующих вирус клеток дает два бакуловируса, один содержит экспрессирующий вирусную конструкцию вектор и другой содержит экспрессирующий конструкцию полезной нагрузки AAV вектор. Два бакуловируса можно использовать для того, чтобы инфицировать одну популяцию реплицирующих вирус клеток для получения AAV частиц.

[00813] Бакуловирусные экспрессирующие векторы для получения вирусных частиц в клетках насекомого, включая в качестве неограничивающих примеров клетки Spodoptera frugiperda (Sf9), обеспечивают высокие титры продукта вирусных частиц. Рекомбинантный бакуловирус, кодирующий экспрессирующий вирусную конструкцию вектор и экспрессирующий конструкцию полезной нагрузки AAV вектор, инициирует продуктивную инфекцию реплицирующих вирус клеток. Инфекционные бакуловирусные частицы, высвобождаемые после первичной инфекции, вторично инфицируют дополнительные клетки в культуре, экспоненциально инфицируя всю популяцию клеточной культуры за несколько циклов инфекции, что является функцией начальной множественности заражения, см. Urabe, M. et al., J Virol. 2006 Feb; 80 (4):1874-85, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00814] Получение AAV частиц с использованием бакуловируса в клеточной системе насекомого может быть направлено на известную генетическую и физическую нестабильность бакуловирусов. В одном из вариантов осуществления система получения направлена на нестабильность бакуловирусов в течение нескольких пассирований за счет использования системы сохранения инфицированных клеток и масштабирования без определения титра. Мелкомасштабные посевные культуры продуцирующих вирус клеток трансфицируют вирусными экспрессионными конструкциями, кодирующими структурные, неструктурные, компоненты вирусной частицы. Инфицированные бакуловирусами продуцирующие вирус клетки собирают в аликвоты, которые можно криосохранять в жидком азоте; аликвоты сохраняют жизнеспособность и инфекционность для инфицирования крупномасштабной продуцирующей вирус клеточной культуры Wasilko DJ et al., Protein Expr Purif. 2009 Jun; 65(2):122-32, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00815] Генетически стабильный бакуловирус можно использовать для получения источника одного или нескольких компонентов для получения AAV частиц в клетках беспозвоночных. В одном из вариантов осуществления дефектные бакуловирусные экспрессирующие векторы в клетках насекомого можно поддерживать эписомально. В таком варианте осуществления конструируют бакмидный вектор с управляющими репликацией элементами, включая в качестве неограничивающих примеров промоторы, энхансеры и/или регулируемые клеточным циклом репликационные элементы.

[00816] В одном из вариантов осуществления можно конструировать бакуловирусы с (не)селективным маркером для рекомбинации в локусе хитиназы/катепсина. Локус chia/v-cath не обязателен для размножения бакуловируса в тканевой культуре, а V-cath (EC 3.4.22.50) представляет собой цистеиновую эндопротеазу, которая наиболее активна на субстратах, содержащих дипептид Arg-Arg. Дипептид Arg-Arg присутствует в структурных белках капсида денсовирусов и парвовирусов, но нечасто встречается в VP1 депендовирусов.

[00817] В одном из вариантов осуществления конструируют стабильные реплицирующие вирус клетки, допускающие бакуловирусную инфекцию, с по меньшей мере одной стабильно встроенное копией любого из элементов, необходимых для репликации и образования вирусных частиц AAV, включая в качестве неограничивающих примеров, весь геном AAV, гены Rep и Cap, гены Rep, гены Cap, каждый белок Rep в виде отдельной транскрипционной кассеты, каждый белок VP в виде отдельной транскрипционной кассеты, AAP (белок активации сборки) или по меньшей мере один из бакуловирусных генов-помощников с нативными или ненативными промоторами.

Крупномасштабное получение

[00818] В некоторых вариантах осуществления получение AAV частиц можно модифицировать для увеличения масштаба получения. Способы крупромасштабного получения вируса в соответствии с настоящим раскрытием могут включать любые из тех, что изложены в патентах США №№ 5756283, 6258595, 6261551, 6270996, 6281010, 6365394, 6475769, 6482634, 6485966, 6943019, 6953690, 7022519, 7238526, 7291498 и 7491508 или международных публикациях №№ WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 и WO2001023597, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме. Способы увеличения маштаба получения вирусных частиц обычно включают увеличение числа реплицирующих вирус клеток. В некоторых вариантах осуществления реплицирующие вирус клетки включают прилипающие клетки. Для увеличения машстаба получения вирусных частиц с помощью прилипающих реплицирующих вирус клеток необходимы более крупные поверхности для клеточных культур. В некоторых случаях, способы крупномасштабного получения включают использование вращающихся флаконов для увеличения поверхностей для клеточных культур. Другие субстраты клеточных культур с увеличенной площадью поверхности известны в данной области. Примеры дополнительных прилипающих клеточных культуральных продуктов с увеличенной площадью поверхности включают, но не ограничиваясь этим, CELLSTACK®, CELLCUBE® (Corning Corp., Corning, NY) и NUNCTM CELL FACTORYTM (Thermo Scientific, Waltham, MA.) В некоторых случаях, крупномасштабные поверхности для прилипающих клеток могут содержать приблизительно от 1000 см2 приблизительно до 100000 см2. В некоторых случаях крупномасштабные прилипающие клеточные культуры могут содержать приблизительно от 107 приблизительно до 109 клеток, приблизительно от 108 приблизительно до 1010 клеток, приблизительно от 109 приблизительно до 1012 клеток или по меньшей мере 1012 клеток. В некоторых случаях, крупномасштабные прилипающие культуры могут продуцировать приблизительно от 109 приблизительно до 1012, приблизительно от 1010 приблизительно до 1013, приблизительно от 1011 приблизительно до 1014, приблизительно от 1012 приблизительно до 1015 или по меньшей мере 1015 вирусных частиц.

[00819] В некоторых вариантах осуществления способы крупномасштабного получения вируса по настоящему раскрытию могут включать использование суспензионных клеточных культур. Суспензионная клеточная культура допускает значительно увеличенное число клеток. Обычно число прилипающих клеток, которые можно выращивать приблизительно на 10-50 см2 площади поверхности, можно выращивать в суспензии в объеме приблизительно 1 см3.

[00820] Трансфекцию реплицирующих клеток в формате крупномасштабной культуры можно осуществлять в соответствии с любыми способами, известными в данной области. Для крупномасштабных прилипающих клеточных культур способы трансфекции могут включать, но не ограничиваясь этим, использование неорганических соединений (например, фосфата кальция), органических соединений [например, полиэтиленимина (PEI)] или использование нехимических способов (например, электропорации). Для клеток, растущих в суспензии, способы трансфекции могут включать, но не ограничиваясь этим, использование фосфата кальция и использование PEI. В некоторых случаях трансфекцию крупномасштабных суспензионных культур можно осуществлять в соответствии с разделом, озаглавленным «Transfection Procedure», который изложен в Feng, L. et al., 2008. Biotechnol Appl. Biochem. 50:121-32, содержание которого включено в настоящее описание посредством ссылки в полном объеме. В соответствии с такими вариантами осуществления, можно формировать комплексы PEI-ДНК для введения плазмид, подлежащих трансфекции. В некоторых случаях клетки, подлежащие трансфекции комплексами PEI-ДНК, можно «шокировать» перед трансфекцией. Это включает снижение температуры клеточной культуры до 4°C в течение периода приблизительно 1 час. В некоторых случаях клеточные культуры можно шокировать в течение периода приблизительно от 10 минут приблизительно до 5 часов. В некоторых случаях клеточные культуры можно шокировать при температуре приблизительно от 0°C приблизительно до 20°C.

[00821] В некоторых случаях трансфекция может включать один или несколько векторов для экспрессии эффекторной молекулы РНК для того, чтобы снижать экспрессию нуклеиновых кислот с одной или нескольких AAV конструкций полезной нагрузки. Такие способы позволяют увеличивать получение вирусных частиц посредством снижения клеточных ресурсов, затрачиваемых на экспрессию конструкций полезной нагрузки. В некоторых случаях такие способы можно осуществлять в соответствии с тем, что изложено в публикации США № US2014/0099666, содержание которой включено в настоящее описание посредством ссылки в полном объеме.

Биореакторы

[00822] В некоторых вариантах осуществления биореакторы для клеточной культуры можно использовать для крупромасштабного получения вируса. В некоторых случаях, биореакторы включаютт реакторы с перемешиваемым резервуаром. Такие реакторы в целом содержат сосуд, обычно цилиндрической формы, с перемешивателем (например, импеллером). В некоторых вариантах осуществления такие сосуды биореактора можно помещать в водяную рубашку для того, чтобы управлять температурой сосуда и/или минимизировать эффекты, оказываемые изменением температуры окружающей среды. Объем сосуда биореактора может находиться в диапазоне в размере приблизительно от 500 мл приблизительно до 2 л, приблизительно от 1 л приблизительно до 5 л, приблизительно от 2,5 л приблизительно до 20 л, приблизительно от 10 л приблизительно до 50 л, приблизительно от 25 л приблизительно до 100 л, приблизительно от 75 л приблизительно до 500 л, приблизительно от 250 л приблизительно до 2000 л, приблизительно от 1000 л приблизительно до 10000 л, приблизительно от 5000 л приблизительно до 50000 л или по меньшей мере 50000 л. Дно сосуда может быть скругленным или плоским. В некоторых случаях, животное клеточные культуры можно поддерживать в биореакторах с круглодонными сосудами.

[00823] В некоторых случаях, сосуд биореактора можно нагревать через использование термоциркулятора. Термоциркуляторы прокачивают нагретую воду по водяной рубашке. В некоторых случаях, нагретую воду можно прокачивать через трубы (например, змеевики), которые присутствуют в сосуде биореактора. В некоторых случаях теплый воздух может циркулировать вокруг биореактора, включая в качестве неограничивающих примеров паровоздушное пространство непосредственно над средой для культивирования. Дополнительно, уровни pH и CO2 можно поддерживать для того, чтобы оптимизировать жизнеспособность клеток.

[00824] В некоторых случаях, биореакторы могут включать половолоконные реакторы. Половолоконные биореакторы могут поддерживать культуру и субстратзависимых и независимых от заякоривания клеток. Кроме того, биореакторы могут включать, но не ограничиваясь этим, биореакторы с плотным слоем или неподвижным слоем. Такие биореакторы могут содержать сосуды со стеклянными гранулами для прикрепления прилипающих клеток. Кроме того, реакторы с плотным слоем могут содержать керамические гранулы.

[00825] В некоторых случаях, вирусные частицы получают с использованием одноразового биореактора. В некоторых вариантах осуществления такие биореакторы могут включать одноразовые биореакторы WAVETM.

[00826] В некоторых вариантах осуществления получение AAV частиц в культуре клеток животного в биореакторе можно осуществлять в соответствии со способами, изложенными в патентах США №№ 5,064764, 6194191, 6566118, 8137948 или патентной заявке США № US2011/0229971, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме.

Лизис клеток

[00827] Клетки по изобретению, включая в качестве неограничивающих примеров продуцирующие вирус клетки, можно подвергать лизису клеток в соответствии с любыми известными в данной области способами. Лизис клеток можно осуществлять для получения одного или нескольких средств (например, вирусных частиц), присутствующих в любых клетках по изобретению. В некоторых вариантах осуществления лизис клеток можно осуществлять в соответствии с любым из способов, перечисленных в патентах США №№ 7326555, 7579181, 7048920, 6410300, 6436394, 7732129, 7510875, 7445930, 6726907, 6194191, 7125706, 6995006, 6676935, 7968333, 5756283, 6258595, 6261551, 6270996, 6281010, 6365394, 6475769, 6482634, 6485966, 6943019, 6953690, 7022519, 7238526, 7291498 и 7491508 или международных публикациях №№ WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 и WO2001023597, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме. Способы лизиса клеток могут быть химическими или механическими. Химический лизис клеток обычно включает приведение одной или нескольких клеток в контакт с одним или несколькими лизирующими средствами. Механический лизис обычно включает воздействие на одну или несколько клеток одним или несколькими лизирующими условиями и/или одним или несколькими лизирующими усилиями.

[00828] В некоторых вариантах осуществления химический лизис можно использовать для того, чтобы лизировать клетки. Как используют в настоящем описании, термин «лизирующее средство» относится к любому средству, которое может способствовать разрушению клетки. В некоторых случаях, лизирующие средства вводят в растворы, называемые лизирующими растворами или лизирующими буферами. Как используют в настоящем описании, термин «лизирующий раствор» относится к раствору (обычно водному), содержащему одно или несколько лизирующих средств. В дополнение к лизирующим средствам, лизирующие растворы могут содержать одно или несколько из буферных средств, солюбилизирующих средств, поверхностно-активных средств, консервантов, криозащитных средств, ферментов, ингибиторов ферментов и/или хелаторов. Лизирующие буферы представляют собой лизирующие растворы, содержащие одно или несколько буферных средств. Дополнительные компоненты лизирующих растворов могут включать одно или несколько солюбилизирующих средств. Как используют в настоящем описании, термин «солюбилизирующее средство» относится к соединению, которое повышает растворимость одного или нескольких компонентов раствора и/или растворимость одной или нескольких частиц, к которым применяют растворы. В некоторых случаях солюбилизирующие средства увеличивают растворимость белков. В некоторых случаях, солюбилизирующие средства выбирают на основе их способности увеличивать растворимость белков, при этом сохраняя конформацию и/или активность белков.

[00829] Образцовые лизирующие средства могут включать любые из тех, которые описаны в патентах США №№ 8685734, 7901921, 7732129, 7223585, 7125706, 8236495, 8110351, 7419956, 7300797, 6699706 и 6143567, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме. В некоторых случаях, лизирующие средства можно выбирать из лизирующих солей, амфотерных средств, катионных средств, ионных детергентов и неионных детергентов. Лизирующие соли могут включать, но не ограничиваясь этим, хлорид натрия (NaCl) и хлорид калия (KCl). Кроме того, лизирующие соли могут включать любые из тех, что описаны в патентах США №№ 8614101, 7326555, 7579181, 7048920, 6410300, 6436394, 7732129, 7510875, 7445930, 6726907, 6194191, 7125706, 6995006, 6676935 и 7968333, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме. Концентрации солей можно увеличивать или уменьшать, чтобы достигать эффективной концентрации для разрыва клеточных мембран. Амфотерные средства, как обозначают в настоящем описании, представляют собой соединения, способные реагировать в качестве кислоты или основания. Амфотерные средства могут включать, но не ограничиваясь этим, лизофосфатидилхолин, 3-((3-холамидопропил) диметиламмоний)-1-пропансульфонат (CHAPS), ZWITTERGENT® и т. п. Катионные средства могут включать, но не ограничиваясь этим, цетилтриметиламмония бромид (C (16) TAB) и хлорид бензалкония. Лизирующие средства, содержащие детергенты, могут включать ионные детергенты или неионные детергенты. Детергенты могут выполнять функцию разрушения или растворения клеточных структур, включая в качестве неограничивающих примеров клеточные мембраны, клеточные стенки, липиды, углеводы, липопротеины и гликопротеины. Образцовые ионные детергенты включают любые из тех, что изложены в патентах США №№ 7625570 и 6593123 или публикации США № US2014/0087361, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме. Некоторые ионные детергенты могут включать, но не ограничиваясь этим, додецилсульфат (SDS), холат и дезоксихолат натрия. В некоторых случаях, ионные детергенты можно включать в лизирующие растворы в качестве солюбилизирующего средства. Неионные детергенты могут включать, но не ограничиваясь этим, октилглюкозид, дигитонин, люброл, C12E8, TWEEN®-20, TWEEN®-80, Triton X-100 и Noniodet P-40. Неионные детергенты обычно представляют собой более слабые лизирующие средства, но могут быть включены в качестве солюбилизирующих средств для солюбилизации клеточных и/или вирусных белков. Дополнительные лизирующие средства могут включать ферменты и мочевину. В некоторых случаях, одно или несколько лизирующих средств можно комбинировать в лизирующем растворе для того, чтобы усиливать одно или несколько из лизиса клеток и растворимости белков. В некоторых случаях, ингибиторы ферментов можно включать в лизирующие растворы для того, чтобы предотвращать протеолиз, который может быть запущен разрушением клеточных мембран.

[00830] В некоторых вариантах осуществления осуществляют механический лизис клеток. Механические способы лизиса клеток могут включать использование одного или нескольких лизирующих условий и/или одного или нескольких лизирующих усилий. Как используют в настоящем описании, термин «лизирующее условие» относится к состоянию или обстоятельству, которое способствует разрушению клеток. Лизирующие условия могут включать определенную температуру, давление, осмотическую чистоту, солесодержание и т. п. В некоторых случаях, лизирующие условия включают повышенные или пониженные температуры. В соответствии с некоторыми вариантами осуществления, лизирующие условия включают изменения температуры, чтобы способствовать разрушению клеток. Лизис клеток, который осуществляют в соответствии с такими вариантами осуществления, может включать лизис замораживанием-оттаиванием. Как используют в настоящем описании, термин «лизис замораживанием-оттаиванием» относится к клеточному лизису, при котором клеточный раствор подвергают одному или нескольким циклам замораживания-оттаивания. В соответствии со способами лизиса замораживанием-оттаиванием, клетки в растворе замораживают для того, чтобы вызывать механическое разрушение клеточных мембран, обусловленное формированием и ростом кристаллов льда. Клеточные растворы, используемые в соответсвтии со способами лизиса замораживанием-оттаиванием, дополнительно могут содержать одно или несколько лизирующих средств, солюбилизирующих средств, буферных средств, криозащитных средств, поверхностно-активных средств, консервантов, ферментов, ингибиторов ферментов и/или хелаторов. Когда клеточные растворы, которые подвергали заморозке, оттаивают, такие компоненты могут увеличивать выход желаемых клеточных продуктов. В некоторых случаях, одно или несколько криозащитных средств включены в клеточные растворы, которые подвергают лизису замораживанием-оттаиванием. Как используют в настоящем описании, термин «криозащитное средство» относится к средству, используемому для того, чтобы защищать одно или несколько веществ от повреждения из-за заморозки. Криозащитные средства могут включать любое из тех, что изложены в публикации США № US2013/0323302 или патентах США №№ 6503888, 6180613, 7888096, 7091030, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме. В некоторых случаях, криозащитные средства могут включать, но не ограничиваясь этим, диметилсульфоксид, 1,2-пропандиол, 2,3-бутандиол, формамид, глицерин, этиленгликоль, 1,3-пропандиол и n-диметилформамид, поливинилпирролидон, гидроксиэтилкрахмал, агарозу, декстраны, инозит, глюкозу, гидроксиэтилкрахмал, лактозу, сорбит, метилглюкозу, сахарозу и мочевину. В некоторых вариантах осуществления лизис замораживанием-оттаиванием можно осуществлять в соответствии с любым из способов, описанных в патенте США № 7704721, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00831] Как используют в настоящем описании, термин «лизирующее усилие» относится к физической активности, используемой для того, чтобы разрушать клетку. Лизирующие усилия могут включать, но не ограничиваясь этим, механические усилия, звуковые усилия, гравитационные силы, оптические силы, электрические силы и т. п. Лизис клеток, который осуществляют посредством механического усилия, обозначают в настоящем описании как «механический лизис». Механические усилия, которые можно использовать в соответствии с механическим лизисом, могут включать большие сдвиговые усилия в текучих веществах. В соответствии с такими способами механического лизиса можно использовать микрофлюидизирующее средство. Микрофлюидизирующие средства обычно содержат впускной резервуар, куда можно вносить клеточные растворы. Затем клеточные растворы прокачивают в камеру взаимодействия через насос (например, насос высокого давления) с высокой скоростью и/или давлением для получения сдвиговых усилий в текучем веществе. Затем получаемые лизаты можно собирать в один или несколько выходных резервуаров. Скорость и/или давление насоса можно корректировать для того, чтобы модулировать лизис клеток и увеличивать выход продуктов (например, вирусных частиц). Другие способы механического лизиса могут включать физическое разрушение клеток посредством соскребания.

[00832] Способы лизиса клеток можно выбирать на основе формата клеточной культуры клеток, подлежащих лизису Например, для прилипающих клеточных культур можно использовать некоторые способы химического и механического лизиса. Такие способы механического лизиса могут включать лизис замораживанием-оттаиванием или соскребание. В другом примере, химический лизис прилипающих клеточных культур можно осуществлять через инкубацию с лизирующими растворами, содержащими поверхностно-активное средство, такое как Triton-X-100. В некоторых случаях, клеточные лизаты, создаваемые из прилипающих клеточных культур, можно обрабатывать одной или несколькими нуклеазами, чтобы снижать вязкость лизатов, обусловленную высвобожденной ДНК.

[00833] В одном из вариантов осуществления способ сбора AAV частиц без лизиса можно использовать для эффективного и масштабируемого получения AAV частиц. В неограничивающем примере, AAV частицы можно получать, культивируя AAV частицы, не имеющие сайта связывания гепарина, тем самым позволяя AAV частицам проходить в супернатант в клеточной культуре, собирая супернатант из культуры; и выделяя AAV частицы из супернатанта, как описано в патентной заявке США 20090275107, содержание которой включено в данное описание посредством ссылки в полном объеме.

Осветление

[00834] Клеточные лизаты, содержащие вирусные частицы, можно подвергать осветлению. Осветление относится к начальным стадиям, выполняемым при очистке вирусных частиц от клеточных лизатов. Осветление служит для того, чтобы получать лизаты для дальнейшей очистки посредством удаления более крупного нерастворимого дебриса. Стадии осветления могут включать, но не ограничиваясь этим, центрифугирование и фильтрование. Во время осветления центрифугирование можно осуществлять на более низких скоростях для того, чтобы удалять только более крупный дебрис. Аналогичным образом, фильтрование можно осуществлять с использованием фильтров с порами более крупных размеров, чтобы удалять только более крупный дебрис. В некоторых случаях тангенциальное поточное фильтрование можно использовать во время осветления. Оцели осветления вируса включают высокопропускной процессинг клеточных лизатов и оптимизацию конечного выхода вируса. Преимущества включения стадии осветления включают масштабируемость процессинга более крупных объемов лизата. В некоторых вариантах осуществления осветление можно осуществлять в соответствии с любым из способов, представленных в патентах США №№ 8524446, 5756283, 6258595, 6261551, 6270996, 6281010, 6365394, 6475769, 6482634, 6485966, 6943019, 6953690, 7022519, 7238526, 7291498, 7491508, публикациях США №№ US2013/0045186, US2011/0263027, US2011/0151434, US2003/0138772 и международных публикациях №№ WO2002012455, WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 и WO2001023597, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме.

[00835] Способы осветления клеточного лизата посредством фильтрования хорошо изучены в данной области, и их можно осуществлять в соответствии с различными доступными способами, включая в качестве неограничивающих примеров пассивное фильтрование и фильтрование потока. Используемые фильтры могут иметь различные материалы и размеры пор. Например, фильтры клеточного лизата могут иметь размеры пор приблизительно от 1 мкМ приблизительно до 5 мкМ, приблизительно от 0,5 мкМ приблизительно до 2 мкМ, приблизительно от 0,1 мкМ приблизительно до 1 мкМ, приблизительно от 0,05 мкМ приблизительно до 0,05 мкМ и приблизительно от 0,001 мкМ приблизительно до 0,1 мкМ. Образцовые размеры пор для фильтров клеточного лизата могут включать, но не ограничиваясь этим, 2,0, 1,9, 1,8, 1,7, 1,6, 1,5, 1,4, 1,3, 1,2, 1,1, 1, 0,9, 0,8, 0,7, 0,6, 0,5, 0,4, 0,3, 0,2, 0,1, 0,95, 0,9, 0,85, 0,8, 0,75, 0,7, 0,65, 0,6, 0,55, 0,5, 0,45, 0,4, 0,35, 0,3, 0,25, 0,2, 0,15, 0,1, 0,05, 0,22, 0,21, 0,20, 0,19, 0,18, 0,17, 0,16, 0,15, 0,14, 0,13, 0,12, 0,11, 0,1, 0,09, 0,08, 0,07, 0,06, 0,05, 0,04, 0,03, 0,02, 0,01, 0,02, 0,019, 0,018, 0,017, 0,016, 0,015, 0,014, 0,013, 0,012, 0,011, 0,01, 0,009, 0,008, 0,007, 0,006, 0,005, 0,004, 0,003, 0,002, 0,001 и 0,001 мкМ. В одном из вариантов осуществления осветление может включать фильтрование через фильтр с размером пор 2,0 мкМ для того, чтобы удалять крупный дебрис, после чего следует пропускание через фильтр с размером пор 0,45 мкМ для того, чтобы удалять интактные клетки.

[00836] Материалы фильтров могут включать различные материалы. Такие материалы могут включать, но не ограничиваясь этим, полимерные материалы и металлические материалы (например, спеченный металл и пористый алюминий.) Образцовые материалы могут включать, но не ограничиваясь этим, нейлон, целлюлозные материалы (например, ацетат целлюлозы), поливинилиденфторид (PVDF), полиэфирсульфон, полиамид, полисульфон, полипропилен и полиэтилентерефталат. В некоторых случаях, фильтры, которые можно использовать для осветления клеточных лизатов, могут включать, но не ограничиваясь этим, фильтры ULTIPLEAT PROFILE™ (Pall Corporation, Port Washington, NY), мембранные фильтры SUPOR™ (Pall Corporation, Port Washington, NY)

[00837] В некоторых случаях, фильтрование потока можно осуществлять для увеличения скорости и/или эффективности фильтрования. В некоторых случаях, фильтрование потока может включать вакуумное фильтрование. В соответствии с такими способами, вакуум создают на стороне фильтра, противоположной стороне клеточного лизата, подлежащего фильтрованию. В некоторых случаях, клеточные лизаты можно пропускать через фильтры с помощью центробежных сил. В некоторых случаях используют насос, чтобы проталкивать клеточный лизат через осветляющие фильтры. Скорость потока клеточного лизата через один или несколько фильтров можно модулировать посредством корректировки одного из размера канала и/или давления текучего вещества.

[00838] В соответствии с некоторыми вариантами осуществления, клеточные лизаты можно осветлять посредством центрифугирования. Центрифугирование можно использовать для осаждения нерастворимых частиц в лизате. Во время осветления, сила центрифугирования [выражаемая в единицах гравитации (g), которые представляют кратность стандартной гравитационной силы] может быть ниже, чем в последующих стадиях очистки. В некоторых случаях можно осуществлять центрифугирование клеточных лизатов на приблизительно от 200 g приблизительно до 800 g, приблизительно от 500 g приблизительно до 1500 g, приблизительно от 1000 g приблизительно до 5000 g, приблизительно от 1200 g приблизительно до 10000 g или приблизительно от 8000 g приблизительно до 15000 g. В некоторых вариантах осуществления центрифугирование клеточного лизата осуществляют на 8000 g в течение 15 минут. В некоторых случаях, центрифугирование в градиенте плотности можно осуществлять для того, чтобы разделять частицы в клеточном лизате по скорости седиментации. Градиенты, используемые в соответствии со способам по настоящему раскрытию, могут включать, но не ограничиваясь этим, градиенты хлорида цезия и ступенчатые градиенты йодиксанола.

Очистка: хроматография

[00839] В некоторых случаях, AAV частицы можно очищать от осветеленных клеточных лизатов с помощью одного или несколькию способов хроматографии. Хроматография относится к любому числу известных в данной области способов отделения одного или нескольких элементов от смеси. Такие способы могут включать, но не ограничиваясь этим, ионообменную хроматографию (например, катионообменную хроматографию и анионообменную хроматографию), иммуноаффинную хроматографию и эксклюзионную хроматографию. В некоторых вариантах осуществления способы вирусной хроматографии могут включать любые из тех, которые изложены в патентах США №№ 5756283, 6258595, 6261551, 6270996, 6281010, 6365394, 6475769, 6482634, 6485966, 6943019, 6953690, 7022519, 7238526, 7291498 и 7491508 или международных публикациях №№ WO1996039530, WO1998010088, WO1999014354, WO1999015685, WO1999047691, WO2000055342, WO2000075353 и WO2001023597, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме.

[00840] В некоторых вариантах осуществления ионообменную хроматографию можно использовать для выделения вирусных частиц. Ионообменную хроматографию используют для связывания вирусных частиц на основе взаимодействий заряд-заряд между капсидными белками и заряженными участками, присутствующими на стационарной фазе, обычно колонке, через которую пропускают препараты вируса (например, осветеленные лизаты). После внесения препаратов вируса, связанные вирусные частицы затем можно элюировать посредством внесения раствора для элюирования, чтобы нарушать взаимодействия заряд-заряд. Растворы для элюирования можно оптимизировать посредством корректировки концентрации соли и/или pH для увеличения выхода связанных вирусных частиц. В зависимости от заряда вирусных капсидов, которые выделяют, можно выбирать способы катионо- или анионообменной хроматографии. Способы ионообменной хроматографии могут включать, но не ограничиваясь этим, любые из тех, которые изложены в патентах США №№ 7419817, 6143548, 7094604, 6593123, 7015026 и 8137948, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме.

[00841] В некоторых вариантах осуществления можно использовать иммуноаффинную хроматографию. Иммуноаффинная хроматография представляет собой форму хроматографии, в которой используют одно или несколько иммунных соединений (например, антител или структур, родственных антителам) для удерживания вирусных частиц. Иммунные соединения могут специфически связываться с одной или несколькими структурами на поверхностях вирусных частиц, включая в качестве неограничивающих примеров один или несколько белков вирусной оболочки. В некоторых случаях, иммунные соединения могут обладать специфичностью к конкретному варианту вируса. В некоторых случаях, иммунные соединения могут связываться с несколькими вариантами вируса. В некоторых вариантах осуществления иммунные соединения могут включать рекомбинантные одноцепочечные антитела. Такие рекомбинантные одноцепочечные антитела могут включать те, которые описаны в Smith, R.H. et al., 2009. Mol. Ther. 17(11):1888-96, содержание которого включено в настоящее описание посредством ссылки в полном объеме. Такие иммунные соединения способны связываться с несколькими вариантами капсида AAV, включая в качестве неограничивающих примеров AAV1, AAV2, AAV6 и AAV8.

[00842] В некоторых вариантах осуществления можно использовать эксклюзионную хроматографию (SEC). SEC может включать использование геля для того, чтобы разделять частицы в соответствии с размером. При очистке вирусных частиц SEC фильтрование иногда обозначают как «очистку». В некоторых случаях, SEC можно осуществлять для того, чтобы создавать конечный продукт, который является почти гомогенным. Такие конечные продукты в некоторых случаях можно использовать в доклинических исследованиях и/или клинических исследованиях (Kotin, R.M. 2011. Human Molecular Genetics. 20(1):R2-R6, содержание которого включено в настоящее описание посредством ссылки в полном объеме). В некоторых случаях SEC можно осуществлять в соответствии с любым из способов, изложенных в патентах США №№ 6143548, 7015026, 8476418, 6410300, 8476418, 7419817, 7094604, 6593123 и 8137948, содержание каждого из которых включено в настоящее описание посредством ссылки в полном объеме.

[00843] В одном из вариантов осуществления композиции, содержащие по меньшей мере одну AAV частицу, можно выделять или очищать с использованием способов, описанных в патенте США № US 6146874, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00844] В одном из вариантов осуществления композиции, содержащие по меньшей мере одну AAV частицу, можно выделять или очищать с использованием способов, описанных в патенте США № US 6660514, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00845] В одном из вариантов осуществления композиции, содержащие по меньшей мере одну AAV частицу, можно выделять или очищать с использованием способов, описанных в патенте США № US 8283151, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00846] В одном из вариантов осуществления композиции, содержащие по меньшей мере одну AAV частицу, можно выделять или очищать с использованием способов, описанных в патенте США № US 8524446, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

II. ФОРМУЛИРОВАНИЕ И ДОСТАВКА

Фармацевтические композиции и формулирование

[00847] Хотя описания фармацевтических композиций, например, тех модулирующих полинуклеотидов (включая кодирующие плазмиды или экспрессирующие векторы, такие как вирусы, например, AAV), содержащих полезную нагрузку, подлежащую доставке, которые предусмотрены в настоящем описании, в основном направлены на фармацевтические композиции, которые подходят для введения человеку, специалист в данной области поймет, что такие композиции в целом подходят для введения любому другому животному, например, не относящимся к человеку животным, например, не относящимся к человеку млекопитающим. Модификация фармацевтических композиций, подходящих для введения человеку, чтобы делать композиции подходящими для введения различным животным хорошо известны, и, как правило, опытный ветеринарный фармаколог может разрабатывать и/или выполнять такую модификацию с использованием только стандартных, если это вообще нужно, экспериментов. Субъекты, которым предусмотрено введение фармацевтических композиций, включают, но не ограничиваясь этим, человека и/или других приматов; млекопитающих, в том числе коммерчески значимых млекопитающих, таких как крупных рогатй скот, свиньи, лошади, овцы, кошки, собаки, мыши и/или крысы; и/или птиц, в том числе коммерчески значимых птиц, таких как домашняя птица, курицы, утки, гуси и/или индюшки.

[00848] В некоторых вариантах осуществления композиции вводят человеку, пациентам-людям или субъектам-людям. Для целей настоящего раскрытия, фраза «активный ингредиент» в целом относится или к вирусному вектору, несущему полезную нагрузку, или к молекуле полезной нагрузки модулирующего полинуклеотида, доставляемой с помощью вирусного вектора, как раскрыто в настоящем описании.

[00849] Составы фармацевтических композиций, описанных в настоящем описании, можно получать любым способом, который известен или будет разработан позже в области фармакологии. В целом, такие способы получения включают стадию приведения активного ингредиента в ассоциацию с эксципиентом и/или одним или несколькими другими вспомогательными ингредиентами и затем, в случае необходимости и/или желания, деление, придание геометрической формы и/или упаковывание продукта в виде желаемой единицы с одной или несколькими дозами.

[00850] Относительные количества активного ингредиента, фармацевтически приемлемого эксципиента и/или любых дополнительных ингредиентов в фармацевтической композиции в соответствии с изобретением варьируют, в зависимости от отличительных черт, размера и/или состояния субъекта, которого лечат, и, кроме того, в зависимости от пути, посредством которого композиция подлежит введению.

[00851] Модулирующие полинуклеотиды или вирусные векторы, кодирующие их, можно формулировать с использованием одного или нескольких эксципиентов для: (1) увеличения стабильности; (2) увеличения трансфекции или трансдукции клеток; (3) предоставления возможности длительного или отсроченного высвобождения; или (4) изменения биораспределения (например, чтобы направлять вирусный вектор в конкретные ткани или типы клеток).

[00852] Составы по настоящему изобретению могут включать, без ограничения, солевой раствор, липидоиды, липосомы, липидные наночастицы, полимеры, липоплексы, наночастицы ядро-оболочка, пептиды, белки, клетки, трансфицировнные вирусными векторами (например, для трансплантации субъекту), имитаторы наночастиц и их сочетания. Кроме того, вирусные векторы по настоящему изобретению можно формулировать с использованием самособирающихся наночастиц из нуклеиновых кислот.

[00853] Составы фармацевтических композиций, описанных в настоящем описании, можно получать любым способом, который известен или будет позже разработан в области фармакологии. В целом, такие способы получения включают стадию ассоциирования активного ингредиента с эксципиентом и/или одним или несколькими другими вспомогательными ингредиентами.

[00854] Фармацевтическую композицию в соответствии с настоящим раскрытием можно получать, упаковывать и/или продавать ангро, в виде отдельной стандартной дозы и/или в виде множества отдельных стандартных доз. Как используют в настоящем описании, «стандартная доза» относится к дискретному количеству фармацевтической композиции, которое содержит предварительно определяемое количество активного ингредиента. Количество активного ингредиента в целом равно дозе активного ингредиента, которую следует вводить субъекту, и/или удобной доле такой дозы, например, такой как одна вторая или одна третья такой дозы.

[00855] Относительные количества активного ингредиента, фармацевтически приемлемого эксципиента и/или любых дополнительных ингредиентов в фармацевтической композиции в соответствии с настоящим раскрытием, могут варьировать, в зависимости от отличительных черт, размера и/или состояния субъекта, подлежащего лечению, и, кроме того, в зависимости от пути, посредством которого композиция подлежит введению. Например, композиция может содержать между 0,1% и 99% (масс./масс.) активного ингредиента. В качестве примера, композиция может содержать между 0,1% и 100%, например, между 0,5 и 50%, 1-30%, 5-80%, по меньшей мере 80% (масс./масс.) активного ингредиента.

[00856] В некоторых вариантах осуществления составы, описанные в настоящем описании, могут содержать по меньшей мере одну молекулу полезной нагрузки. В качестве неограничивающего примера, составы могут содержать 1, 2, 3, 4 или 5 молекул полезной нагрузки модулирующего полинуклеотида. В одном из вариантов осуществления состав может содержать конструкцию полезной нагрузки модулирующего полинуклеотида, направленного на белки, выбранные из таких категорий, как, но не ограничиваясь этим, белки человека, ветеринарные белки, бактериальные белки, биологические белки, антитела, иммуногенные белки, терапевтические пептиды и белки, секретируемые белкы, белки плазматической мембранны, цитоплазматические и цитоскелетные белки, внутриклеточные связанные с мембраной белки, ядерные белки, белки, связанные с заболеванием человека, и/или белки, связанные с заболеваниями, не относящимися к человеку. В одном из вариантов осуществления состав содержит по меньшей мере три конструкции полезной нагрузки, направленных на белки.

[00857] В некоторых вариантах осуществления фармацевтически приемлемый эксципиент может быть чистым на по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, по меньшей мере 99% или 100%. В некоторых вариантах осуществления эксципиент одобрен для использования у человека и для ветеринарного использования. В некоторых вариантах осуществления эксципиент может быть одобрен в United States Food and Drug Administration. В некоторых вариантах осуществления эксципиент может иметь фармацевтическую степень чистоты. В некоторых вариантах осуществления эксципиент может отвечать стандартам фармакопеи США (USP), европейской фармакопеи (EP), бриатнской фармакопеи и/или международной фармакопеи.

[00858] Эксципиенты, которые, как используют в настоящем описании, включают, но не ограничиваясь этим, любые и все растворители, дисперсионные среды, разбавители или другие жидкие носители, способствующие диспергировнию или суспендированию средства, поверхностно-активные средства, изотонические средства, загустители или эмульгирующие средства, консерванты и т. п., как подходит для желаемой конкретной дозированной формы. Различные эксципиенты для формулирования фармацевтических композиций и способы получения композиций известны в данной области (см. Remington: The Science and Practice of Pharmacy, 21-е изд., A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, MD, 2006; включено в настоящее описание посредством ссылки в полном объеме). Использование стандартной эксципиентной среды может быть предусмотрено в объеме настоящего раскрытия, за исключением случаев, когда любая стандартная эксципиентная среда может быть несовместимой с веществом или его производными, например, посредством создания любого нежелательного биологического эффекта или иного взаимодействия вредоносным образом с любым другим компонентом(ами) фармацевтической композиции.

[00859] Образцовые разбавители включают, но не ограничиваясь этим, карбонат кальция, карбонат натрия, фосфат кальция, фосфат дикальция, сульфат кальция, гидрофосфат кальция, фосфат натрия лактозу, сахарозу, целлюлозу, микрокристаллическую целлюлозу, каолин, маннит, сорбит, инозит, хлорид натрия, сухой крахмал, кукурузный крахмал, сахарную пудру и т. д. и/или их сочетания.

Неактивные ингредиенты

[00860] В некоторых вариантах осуществления составы модулирующих полинуклеотидов могут содержать по меньшей мере один эксципиент, который представляет собой неактивный ингредиент. Как используют в настоящем описании, термин «неактивный ингредиент» относится к одному или нескольким неактивным средствам, включенным в составы. В некоторых вариантах осуществления все, ни один или некоторые из неактивных ингредиентов, которые можно использовать в составах по настоящему изобретению, могут быть одобрены в US Food and Drug Administration (FDA).

[00861] Составы вирусных векторов, несущих модулирующий полинуклеотид, раскрытые в настоящем описании, могут содержать катионы или анионы. В одном из вариантов осуществления составы содержат катионы металлов, такие как, но не ограничиваясь этим, Zn2+, Ca2+, Cu2+, Mg+ и их сочетания. В качестве неограничивающего примера, составы могут содержать полимеры и модулирующие полинуклеотиды в комплексе с катионом металла (см., например, патент США №№ 6265389 и 6555525, каждый из которых включен в настоящее описание посредством ссылки в полном объеме).

Доставка

[00862] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки вирионов AAV, описанных в европейской патентной заявке № EP1857552, содержание которой включено в настоящее описание посредством ссылки в полном объеме.

[00863] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки белков с использованием AAV векторов, описанных в европейской патентной заявке № EP2678433, содержание которой включено в настоящее описание посредством ссылки в полном объеме.

[00864] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки молекул ДНК с использованием AAV векторов, описанных в патенте США № US 5858351, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00865] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки ДНК в кровоток, описанных в патенте США № US 6211163, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00866] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки вирионов AAV, описанных в патенте США № US 6325998, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00867] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки ДНК в мышечные клетки, описанных в патенте США № US 6335011, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00868] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки ДНК в мышечные клетки и ткани, описанных в патенте США № US 6610290, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00869] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки ДНК в мышечные клетки, описанных в патенте США № US 7704492, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00870] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки полезной нагрузки в скелетные мышцы, описанных в патенте США № US 7112321, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00871] В одном из вариантов осуществления вирусный вектор можно вводить или доставлять с использованием способов доставки полезной нагрузки в центральную нервную систему, описанных в патенте США № US 7588757, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00872] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки полезной нагрузки, описанных в патенте США № US 8283151, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00873] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки полезной нагрузки для лечения болезни Альцгеймера, описанных в патенте США № US 8318687, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00874] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки полезной нагрузки, описанных в международной публикации патента № WO2012144446, содержание которой включено в настоящее описание посредством ссылки в полном объеме.

[00875] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки полезной нагрузки с использованием вектора доставки декарбоксилазы глутаминовой кислоты (GAD), описанных в международной публикации патента № WO2001089583, содержание которой включено в настоящее описание посредством ссылки в полном объеме.

[00876] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки полезной нагрузки, описанных в международной публикации патента № WO2001096587, содержание которой включено в настоящее описание посредством ссылки в полном объеме.

[00877] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки полезной нагрузки в мышечную ткань, описанных в международной публикации патента № WO2002014487, содержание которой включено в настоящее описание посредством ссылки в полном объеме.

[00878] В одном из вариантов осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с использованием способов доставки полезной нагрузки в нервные клетки, описанных в международной публикации патента № WO2012057363, содержание которой включено в настоящее описание посредством ссылки в полном объеме.

[00879] Фармацевтические композиции вирусных векторов, описанных в настоящем описании, могут отличаться одним или несколькими из биодоступности, терапевтического окна и/или объема распределения.

[00880] В одном из вариантов осуществления можно формулировать вирусные векторы, содержащие модулирующий полинуклеотид. В качестве неограничивающего примера, баричность и/или осмоляльность состава можно оптимизировать для обеспечения оптимального распределения лекарственного средства в центральной нервной системе или области или компоненте центральной нервной системы.

[00881] В одном из вариантов осуществления вирусные векторы, содержащие модулирующий полинуклеотид, можно доставлять субъекту через один путь введения.

[00882] В одном из вариантов осуществления вирусные векторы, содержащие модулирующий полинуклеотид, можно доставлять субъекту через путь введения в нескольких местах. Субъекту можно вводить вирусные векторы, содержащие модулирующий полинуклеотид в 2, 3, 4, 5 или больше чем 5 местах.

[00883] В одном из вариантов осуществления субъекту можно вводить вирусные векторы, содержащие модулирующий полинуклеотид, описанный в настоящем описании, с использованием болюсной инфузии.

[00884] В одном из вариантов осуществления субъекту можно вводить вирусные векторы, содержащие модулирующий полинуклеотид, описанный в настоящем описании, с использованием длительной доставки в течение периода в минуты, часы или сутки. Скорость инфузии можно изменять в зависимости от субъекта, распределения, состава или другого параметра доставки.

[00885] В одном из вариантов осуществления катетер можно располагать в больше чем одном месте в позвоночнике для доставки в несколько мест. Вирусные векторы, содержащие модулирующий полинуклеотид, можно доставлять непрерывной и/или болюсной инфузией. Каждое место доставки может представлять собой отличающуюся схему дозирования, или одну и ту же схему дозирования можно использовать для каждого места доставки. В качестве неограничивающего примера, места доставки могут находиться в шейной и поясничной области. В качестве другого неограничивающего примера, места доставки могут находиться в шейной области. В качестве другого неограничивающего примера, места доставки могут находиться в поясничной области.

[00886] В одном из вариантов осуществления у субъекта можно анализировать анатомию и патологию позвоночника пере доставкой вирусных векторов, содержащих модулирующий полинуклеотид, описанный в настоящем описании. В качестве неограничивающего примера, субъект со сколиозом может иметь отличающиеся схему дозирования и/или местоположение катетера по сравнению с субъектом без сколиоза.

[00887] В одном из вариантов осуществления ориентация позвоночника субъекта во время доставки вирусных векторов, содержащих модулирующий полинуклеотид, может быть вертикальной относительно земли.

[00888] В другом варианте осуществления ориентация позвоночника субъекта во время доставки вирусных векторов, содержащих модулирующий полинуклеотид, может быть горизонтальной относительно земли.

[00889] В одном из вариантов осуществления позвоночник субъекта может находитья под углом к земле во время доставки вирусных векторов, содержащих модулирующий полинуклеотид, субъекту. Угол позвоночника субъекта относительно земли может составлять по меньшей мере 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 или 180°.

[00890] В одном из вариантов осуществления способ доставки и длительность выбирают для обеспечения обширной трансдукции в спинном мозге. В качестве неограничивающего примера, интратекальную доставку используют для обеспечения обширной трансдукции вдоль рострально-каудального сегмента спинного мозга. В качестве другого неограничивающего примера, инфузии в несколько мест обеспечивают более однородную трансдукцию вдоль рострально-каудального сегмента спинного мозга. В качестве еще одного другого неограничивающего примера, пролонгированные инфузии обеспечивают более однородную трансдукцию вдоль рострально-каудального сегмента спинного мозга.

Введение в клетки

[00891] Модулирующие полинуклеотиды по изобретению можно вводить в клетки-хозяева с использованием любых из множества подходов. Можно использовать инфекцию вирусным вектором, содержащим модулирующий полинуклеотид. Примеры подходящих вирусных векторов включают репликационно-дефектные ретровирусные векторы, аденовирусные векторы, аденоассоциированные векторы и лентивирусные векторы.

[00892] В соответствии с настоящим изобретением, вирусные векторы для использования в терапевтических и/или диагностических средствах содержат вирус, который очищен или редуцирован до минимальных компонентов, необходимых для трансдукции полезной нагрузки или груза нуклеиновой кислоты, представляющей интерес.

[00893] Таким образом, вирусные векторы конструируют в качестве носителей для специфической доставки, у которых при этом отсутствуют вредоносные признаки репликации и/или встраивания, встречающиеся у вируса дикого типа.

[00894] Как используют в настоящем описании, «вектор» представляет собой любую молекулу или фрагмент, который транспортирует, трансдуцирует или иным образом выполняет функцию носителя гетерологичной молекулы, такой как модулирующие полинуклеотиды по изобретению. «Вирусный вектор» представляет собой вектор, который содержит одну или несколько полинуклеотидных областей, кодирующих или содержащих молекулы полезной нагрузки, представляющие интерес, например, трансген, полинуклеотид, кодирующий полипептид или мультиполипептид, или модулирующуй нуклеиновую кислоту. Вирусные векторы по настоящему изобретению можно получать рекомбинантно, и они могут быть основаны на родительских или эталонных последовательностях аденоассоциированного вируса (AAV). Серотипы, которые можно использовать в настоящем изобретении, включают любые из тех, что берут начало из AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, AAV-DJ8, AAV-PHP.A и/или AAV-PHP.B.

[00895] В одном из вариантов осуществления серотип, который можно использовать в настоящем изобретении, может представлять собой AAV-DJ8. Аминокислотная последовательность AAV-DJ8 может содержать две или больше мутации для того, чтобы удалять гепаринсвязывающий домен (HBD). В качестве неограничивающего примера, последовательность AAV-DJ, описанная как SEQ ID NO:1 в патенте США № 7588772, содержание которого включено в настоящее описание посредством ссылки в полном объеме, может содержать две мутации: (1) R587Q, где аргинин (R; Arg) в аминокислоте 587 изменяют на глутамин (Q; Gln) и (2) R590T, где аргинин (R; Arg) в аминокислоте 590 изменяют на треонин (T; Thr). В качестве другого неограничивающего примера, может содержать три мутации: (1) K406R, где лизин (K; Lys) в аминокислоте 406 изменяют на аргинин (R; Arg), (2) R587Q, где аргинин (R; Arg) в аминокислоте 587 изменяют на глутамин (Q; Gln) и (3) R590T, где аргинин (R; Arg) в аминокислоте 590 изменяют на треонин (T; Thr).

[00896] AAV векторы также могут содержать самокомплементарные AAV векторы (scAAV). scAAV векторы содержат обе цепи ДНК, которые гибридизуются вместе с образованием двухцепочечной ДНК. Пропуская синтез второй цепи, scAAV делают возможной быструю экспрессию в клетке.

[00897] В одном из вариантов осуществления AAV вектор, используемый в настоящем изобретении, представляет собой scAAV.

[00898] В одном из вариантов осуществления модулирующие полинуклеотиды можно вводить в клетки от любых релевантных биологических видов, таких как, но не ограничиваясь этим, человек, собака, мышь, крыса или обезьяна.

[00899] В одном из вариантов осуществления модулирующие полинуклеотиды можно вводить в клетки, которые релевантны для заболевания, подлежащего лечению. В качестве неограничивающего примера, заболеванием является ALS и целевыми клетками являются двигательные нейроны и астроциты.

[00900] В одном из вариантов осуществления модулирующие полинуклеотиды можно вводить в клетки, которые имеют высокий уровень эндогенной экспрессии целевой последовательности.

[00901] В другом варианте осуществления модулирующие полинуклеотиды можно вводить в клетки, которые имеют низкий уровень эндогенной экспрессии целевой последовательности.

[00902] В одном из вариантов осуществления клетки могут представлять собой те, которые имеют высокую эффективность AAV трансдукции.

[00903] В одном из вариантов осуществления клетки, которые можно использовать для анализа модулирующих полинуклеотидов in vitro, включают, но не ограничиваясь этим, HEK293, HeLa, первичные астроциты человека, клеточную линию астроцитов человека (U251MG), нейроны SH-SY5Y и человек клетки-предшественники двигательных нейронов, полученные из iPSC.

III. ВВЕДЕНИЕ И ДОЗИРОВАНИЕ

Введение

[00904] Вирусные векторы, содержащие модулирующие полинуклеотиды по настоящему изобретению, можно вводить с помощью любого пути, результатом чего является терапевтически эффективный исход. Они включают, но не ограничиваясь этим, энтеральное (в кишечник), гастроэнтеральное, эпидуральное (в dura matter), оральное (через рот), трансдермальное, перидуральное, интрацеребральное (в большой мозг), интрацеребровентрикулярное (в мозговые желудочки), накожное (нанесение на кожу), внутрикожное (в собственно кожу), подкожное (под кожу), назальное введение (через нос), внутривенную (в вену), внутривенную болюсную, внутривенную капельную, внутриартериальную (в артерию), внутримышечную (в мышцы), интракардиальную (в сердце), внутрикостную инфузию (в костный мозг), интратекальную (в позвоночный канал), под мягкую оболочку мозга (между мягкой оболочкой и подлежащей тканью), интраперитонеальную (инфузию или инъекцию в брюшную полость), интравезикальную инфузию, интравитреальную (через глаз), внутрикавернозную инъекцию (в патологическую полость) внутриполостное (в основание пениса), интравагинальное введение, внутриматочное, экстраамниотическое введение, трансдермальное (диффузия через интактную кожу для системного распределения), чресслизистое (диффузия через слизистую оболочку), трансвагинальное, инсуфляция (нюхать), сублингвальное, сублабиальное, клизму, глазные капли (на конъюнктиву), в ушных каплях, аурикулярное (в ухо или с его помощью), буккальное (направленное к щеке), коньюнктивальное, кожное, дентальное (в зуб или зубы), электроосмотическое, эндоцервикальное, внутрь синусов, эндотрахеальное, экстракорпоральное, гемодиализное, инфильтрационное, интерстициальное, интраабдоминальное, внутриамниотическое, внутрисуставное, интрабилиарное, внутрибронхиальное, интрабурсальное, внутрихрящевое (в хрящ), интракаудальное (в конский хвост), интрацистернальное (в cisterna magna cerebellomedularis), внутрироговичное (в роговицу), дентальное внутрикоронарное, внутрикоронарное (в коронарные артерии), в пещеристое тело (в растяжимые пространства пещеристого тела пениса), внутридисковое (в диск), внутрипротоковое (в проток железы), интрадуоденальное (в двенадцатиперстную кишку), интрадуральное (в или под твердую мозговую оболочку), внутриэпидермальное (в эпидермис), внутрипищеводное (в пищевод), внутрижелудочное (в желудок), внутридесневое (в десны), внутриподвздошное (в дистальную часть тонкой кишки), внутрь повреждения (в пределах или непосредственно внутрь локализованного повреждения), внутрипросветное (в просвет трубки), интралимфатическое (в лимфу), интрамедуллярное (в полость костного мозга в кости), внутрименингиальное (в мягкие мозговые оболочки), внутриглазное (в глаз), интраовариальное (в яичник), интраперикардиальное (в перикард), внутриплевральное (в плевру), внутрипростатное (в предстательную железу), внутрилегочное (в легкие или их бронхи), внутрисинусное (в носовые или окологлазничные синусы), интраспинальное (в позвоночный столб), интрасиновиальное (в синовиальную полость сустава), внутрисухожильное (в сухожилие), интратестикулярное (в яичко), интратекальное (в цереброспинальную жидкость на любом уровне цереброспинальной оси), интраторакальное (в грудную клетку), внутритрубчатое (в трубки органа), внутриопухолевое (в опухоль), интратимпанальныоей (в среднее ухо), внутрисосудистое (в сосуд или сосуды), внутрижелудочковое (в желудочек), ионтофорез (посредством электрического тока, где ионы растворимых солей мигрируют в ткани организма), орошение (чтобы обмывать или промывать открытые раны или полости тела), ларингеальное (непосредственно в гортань), назогастральное (через нос и в желудок), способ с окклюзионной повязкой (топический путь введения, который затем покрывают повязкой, которая закрывает область), офтальмическое (на внешнюю часть глаза), орофарингеальное (непосредственно в рот и глотку), парентеральное, чрескожное, околосуставное, перидуральное, периневральное, периодонтальное, ректальное, дыхательное (в дыхательные пути посредством вдыхания перорально или назально для локальных или системных эффектов), ретробульбарное (позади варолиева моста или позади глазного яблока), в мягкую ткань, субарахноидальное, субконъюктивальное, подслизистое, топическое, трансплацентарное (через или сквозь плаценту), транстрахеальное (через стенку трахеи), транстимпаническое (сквозь или через барабанную полость), мочеточниковое (в мочеточник), уретральное (в уретру), вагинальное, каудальная блокада, диагностическое, блокада нервов, билиарная перфузия, кардиальная перфузия, фотофорез или спинальное. В конкретных вариантах осуществления, композиции можно вводить таким образом, который позволяет им пересекать гематоэнцефалический барьер, сосудистый барьер или другой эпителиальный барьер. В одном из вариантов осуществления состав для определенного пути введения может включать по меньшей мере один неактивный ингредиент.

Дозирование

[00905] Настоящее изобретение предусматривает способы, включающие введение вирусных векторов и их полезной нагрузки модулирующего полинуклеотида или комплексов в соответствии с изобретением нуждающемуся в этом субъекту. Фармацевтические, визуализационные, диагностические или профилактические композиции вирусных векторов можно вводить субъекту с использованием любого количества и любого пути введения, эффективных для предотвращения, лечения, диагностирования или визуализации заболевания, нарушения и/или состояния (например, заболевания, нарушения и/или состояния, относящегося к дефициту рабочей памяти). Точное требуемое количество варьирует от субъекта к субъекту, в зависимости от биологического вида, возраста и общего состояния субъекта, тяжести заболевания, конкретной композиции, способа ее введения, вида активности и т. п. Композиции в соответствии с изобретением обычно формулируют в стандартной дозированной форме для упрощения введения и однородности дозы. Однако следует понимать, что решение о полном суточном использовании композиций по настоящему изобретению может принимать лечащий врач в объеме здравого медицинского суждения. Конкретный терапевтически эффективный, профилактически эффективный или подходящий визуализационный уровень дозы для любого конкретного пациента зависит от различных факторов, включая нарушение, которое лечат, и тяжесть нарушения; активность конкретного используемого соединения; конкретную используемую композицию; возраст, массу тела, общее состояние здоровья, пол и диету пациента; время введения, путь введения и скорость экскреции конкретной используемой полезной нагрузки модулирующего полинуклеотида; длительность лечения; лекарственные средства, используемые в комбинации или совместно с конкретным используемым соединением; и схожие факторы, хорошо известные в области медицины.

[00906] В определенных вариантах осуществления вирусный вектор фармацевтические композиции в соответствии с настоящим изобретением можно вводить при уровнях дозы модулирующего полинуклеотида, достаточных для того, чтобы доставлять приблизительно от 0,0001 мг/кг приблизительно до 100 мг/кг, приблизительно от 0,001 мг/кг приблизительно до 0,05 мг/кг, приблизительно от 0,005 мг/кг приблизительно до 0,05 мг/кг, приблизительно от 0,001 мг/кг приблизительно до 0,005 мг/кг, приблизительно от 0,05 мг/кг приблизительно до 0,5 мг/кг, приблизительно от 0,01 мг/кг приблизительно до 50 мг/кг, приблизительно от 0,1 мг/кг приблизительно до 40 мг/кг, приблизительно от 0,5 мг/кг приблизительно до 30 мг/кг, приблизительно от 0,01 мг/кг приблизительно до 10 мг/кг, приблизительно от 0,1 мг/кг приблизительно до 10 мг/кг или приблизительно от 1 мг/кг приблизительно до 25 мг/кг массы тела субъекта в сутки, один или несколько раз в сутки, чтобы достигать желаемого терапевтического, диагностического, профилактического или визуализационного эффекта (см., например, диапазон стандартных доз, описанный в международной публикации № WO2013078199, включенной в настоящее описание посредством ссылки в полном объеме). Желаемую дозу модулирующего полинуклеотида можно доставлять больше чем один раз (например, больше чем одно введение в сутки). В определенных вариантах осуществления желаемую дозу модулирующего полинуклеотида можно доставлять с использованием нескольких введений (например, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 или больше введений). Когда используют несколько введений, можно использовать дробные схемы дозирования, такие как те, что описаны в настоящем описании. Как используют в настоящем описании, «дробная доза» представляет собой разделение отдельной стандартной дозы или общей суточной дозы на две или больше доз, например, два или больше введений отдельной стандартной дозы. Как используют в настоящем описании, «отдельная стандартная доза» представляет собой дозу любого модулирующего полинуклеотидного терапевтического средства, вводимого в одной дозе/в одно время/через один путь/в одной точке контакта, т. е. в одном событии введения. Как используют в настоящем описании, «общая суточная доза» представляет собой количество, даваемое или предписываемое для 24-часового периода. Его можно вводить в виде отдельной стандартной дозы. В одном из вариантов осуществления вирусные векторы, содержащие модулирующие полинуклеотиды по настоящему изобретению, вводят субъекту дробными дозами. Их можно формулировать только в буфере или в составе, описанном в настоящем описании.

[00907] В одном из вариантов осуществления доставка композиций в соответствии с настоящим изобретением в клетки включает скорость доставки, определяемую с помощью [VG/час=мл/час * VG/мл], где VG представляет собой вирусные геномы, VG/мл представляет собой концентрацию композиции и мл/час представляет собой скорость пролонгированной доставки.

[00908] В одном из вариантов осуществления доставка композиций в соответствии с настоящим изобретением в клетки может включать общую концентрацию на субъект между приблизительно 1×106 VG и приблизительно 1×1016 VG. В некоторых вариантах осуществления доставка может включать концентрацию композиции приблизительно 1×106, 2×106, 3×106, 4×106, 5×106, 6×106, 7×106, 8×106, 9×106, 1×107, 2×107, 3×107, 4×107, 5×107, 6×107, 7×107, 8×107, 9×107, 1×108, 2×108, 3×108, 4×108, 5×108, 6×108, 7×108, 8×108, 9×108, 1×109, 2×109, 3×109, 4×109, 5×109, 6×109, 7×109, 8×109, 9×109, 1×1010, 2×1010, 3×1010, 4×1010, 5×1010, 6×1010, 7×1010, 8×1010, 9×1010, 1×1011, 1,1×1011, 1,2×1011, 1,3×1011, 1,4×1011, 1,5×1011, 1,6×1011, 1,7×1011, 1,8×1011, 1,9×1011, 2×1011, 2,1×1011, 2,2×1011, 2,3×1011, 2,4×1011, 2,5×1011, 2,6×1011, 2,7×1011, 2,8×1011, 2,9×1011, 3×1011, 4×1011, 5×1011, 6×1011, 7×1011, 7,1×1011, 7,2×1011, 7,3×1011, 7,4×1011, 7,5×1011, 7,6×1011, 7,7×1011, 7,8×1011, 7,9×1011, 8×1011, 9×1011, 1×1012, 1,1×1012, 1,2×1012, 1,3×1012, 1,4×1012, 1,5×1012, 1,6×1012, 1,7×1012, 1,8×1012, 1,9×1012, 2×1012, 2,1×1012, 2,2×1012, 2,3×1012, 2,4×1012, 2,5×1012, 2,6×1012, 2,7×1012, 2,8×1012, 2,9×1012, 3×1012, 3,1×1012, 3,2×1012, 3,3×1012, 3,4×1012, 3,5×1012, 3,6×1012, 3,7×1012, 3,8×1012, 3,9×1012, 4×1012, 4,1×1012, 4,2×1012, 4,3×1012, 4,4×1012, 4,5×1012,4,6×1012, 4,7×1012, 4,8×1012, 4,9×1012, 5×1012, 6×1012, 6,1×1012, 6,2×1012, 6,3×1012, 6,4×1012, 6,5×1012, 6,6×1012, 6,7×1012, 6,8×1012, 6,9×1012, 7×1012, 8×1012, 8,1×1012, 8,2×1012, 8,3×1012, 8,4×1012, 8,5×1012, 8,6×1012, 8,7×1012, 8,8×1012, 8,9×1012, 9×1012, 1×1013, 1,1×1013, 1,2×1013, 1,3×1013, 1,4×1013, 1,5×1013, 1,6×1013, 1,7×1013, 1,8×1013, 1,9×1013, 2×1013, 3×1013, 4×1013, 5×1013, 6×1013, 6,7×1013, 7×1013, 8×1013, 9×1013, 1×1014, 2×1014, 3×1014, 4×1014, 5×1014, 6×1014, 7×1014, 8×1014, 9×1014, 1×1015, 2×1015, 3×1015, 4×1015, 5×1015, 6×1015, 7×1015, 8×1015, 9×1015 или 1×1016 VG/субъект.

[00909] В одном из вариантов осуществления доставка композиций в соответствии с настоящим изобретением в клетки может включать общую концентрацию на субъект между приблизительно 1×106 VG/кг и приблизительно 1×1016 VG/кг. В некоторых вариантах осуществления доставка может включать концентрацию композиции приблизительно 1×106, 2×106, 3×106, 4×106, 5×106, 6×106, 7×106, 8×106, 9×106, 1×107, 2×107, 3×107, 4×107, 5×107, 6×107, 7×107, 8×107, 9×107, 1×108, 2×108, 3×108, 4×108, 5×108, 6×108, 7×108, 8×108, 9×108, 1×109, 2×109, 3×109, 4×109, 5×109, 6×109, 7×109, 8×109, 9×109, 1×1010, 2×1010, 3×1010, 4×1010, 5×1010, 6×1010, 7×1010, 8×1010, 9×1010, 1×1011, 1,1×1011, 1,2×1011, 1,3×1011, 1,4×1011, 1,5×1011, 1,6×1011, 1,7×1011, 1,8×1011, 1,9×1011, 2×1011, 2,1×1011, 2,2×1011, 2,3×1011, 2,4×1011, 2,5×1011, 2,6×1011, 2,7×1011, 2,8×1011, 2,9×1011, 3×1011, 4×1011, 5×1011, 6×1011, 7×1011, 7,1×1011, 7,2×1011, 7,3×1011, 7,4×1011, 7,5×1011, 7,6×1011, 7,7×1011, 7,8×1011, 7,9×1011, 8×1011, 9×1011, 1×1012, 1,1×1012, 1,2×1012, 1,3×1012, 1,4×1012, 1,5×1012, 1,6×1012, 1,7×1012, 1,8×1012, 1,9×1012, 2×1012, 2,1×1012, 2,2×1012, 2,3×1012, 2,4×1012, 2,5×1012, 2,6×1012, 2,7×1012, 2,8×1012, 2,9×1012, 3×1012, 3,1×1012, 3,2×1012, 3,3×1012, 3,4×1012, 3,5×1012, 3,6×1012, 3,7×1012, 3,8×1012, 3,9×1012, 4×1012, 4,1×1012, 4,2×1012, 4,3×1012, 4,4×1012, 4,5×1012,4,6×1012, 4,7×1012, 4,8×1012, 4,9×1012, 5×1012, 6×1012, 6,1×1012, 6,2×1012, 6,3×1012, 6,4×1012, 6,5×1012, 6,6×1012, 6,7×1012, 6,8×1012, 6,9×1012, 7×1012, 8×1012, 8,1×1012, 8,2×1012, 8,3×1012, 8,4×1012, 8,5×1012, 8,6×1012, 8,7×1012, 8,8×1012, 8,9×1012, 9×1012, 1×1013, 1,1×1013, 1,2×1013, 1,3×1013, 1,4×1013, 1,5×1013, 1,6×1013, 1,7×1013, 1,8×1013, 1,9×1013, 2×1013, 3×1013, 4×1013, 5×1013, 6×1013, 6,7×1013, 7×1013, 8×1013, 9×1013, 1×1014, 2×1014, 3×1014, 4×1014, 5×1014, 6×1014, 7×1014, 8×1014, 9×1014, 1×1015, 2×1015, 3×1015, 4×1015, 5×1015, 6×1015, 7×1015, 8×1015, 9×1015 или 1×1016 VG/кг.

[00910] В одном из вариантов осуществления на дозу можно вводить приблизительно от 105 до 106 вирусных геномов (единиц).

[00911] В одном из вариантов осуществления доставка композиций в соответствии с настоящим изобретением в клетки может включать общую концентрацию между приблизительно 1×106 VG/мл и приблизительно 1×1016 VG/мл. В некоторых вариантах осуществления доставка может включать концентрацию композиции приблизительно 1×106, 2×106, 3×106, 4×106, 5×106, 6×106, 7×106, 8×106, 9×106, 1×107, 2×107, 3×107, 4×107, 5×107, 6×107, 7×107, 8×107, 9×107, 1×108, 2×108, 3×108, 4×108, 5×108, 6×108, 7×108, 8×108, 9×108, 1×109, 2×109, 3×109, 4×109, 5×109, 6×109, 7×109, 8×109, 9×109, 1×1010, 2×1010, 3×1010, 4×1010, 5×1010, 6×1010, 7×1010, 8×1010, 9×1010, 1×1011, 1,1×1011, 1,2×1011, 1,3×1011, 1,4×1011, 1,5×1011, 1,6×1011, 1,7×1011, 1,8×1011, 1,9×1011, 2×1011, 3×1011, 4×1011, 5×1011, 6×1011, 7×1011, 8×1011, 9×1011, 1×1012, 1,1×1012, 1,2×1012, 1,3×1012, 1,4×1012, 1,5×1012, 1,6×1012, 1,7×1012, 1,8×1012, 1,9×1012, 2×1012, 2,1×1012, 2,2×1012, 2,3×1012, 2,4×1012, 2,5×1012, 2,6×1012, 2,7×1012, 2,8×1012, 2,9×1012, 3×1012, 3,1×1012, 3,2×1012, 3,3×1012, 3,4×1012, 3,5×1012, 3,6×1012, 3,7×1012, 3,8×1012, 3,9×1012, 4×1012, 4,1×1012, 4,2×1012, 4,3×1012, 4,4×1012, 4,5×1012, 4,6×1012, 4,7×1012, 4,8×1012, 4,9×1012, 5×1012, 6×1012, 6,1×1012, 6,2×1012, 6,3×1012, 6,4×1012, 6,5×1012, 6,6×1012, 6,7×1012, 6,8×1012, 6,9×1012, 7×1012, 8×1012, 9×1012, 1×1013, 1,1×1013, 1,2×1013, 1,3×1013, 1,4×1013, 1,5×1013, 1,6×1013, 1,7×1013, 1,8×1013, 1,9×1013, 2×1013, 3×1013, 4×1013, 5×1013, 6×1013, 6,7×1013, 7×1013, 8×1013, 9×1013, 1×1014, 2×1014, 3×1014, 4×1014, 5×1014, 6×1014, 7×1014, 8×1014, 9×1014, 1×1015, 2×1015, 3×1015, 4×1015, 5×1015, 6×1015, 7×1015, 8×1015, 9×1015 или 1×1016 VG/мл.

Биодоступность

[00912] Вирусные векторы, содержащие модулирующий полинуклеотид по настоящему изобретению, при формулировании в композиции с средствами доставки/формулирования или носителями, как раскрыто в настоящем описании, могут проявлять увеличенную биодоступность по сравнению с композициями, не содержащими средств доставки, как раскрыто в настоящем описании. Как используют в настоящем описании, термин «биодоступность» относится к системной доступности заданного количества конкретного средства, вводимого субъекту. Биодоступность можно оценивать посредством измерения площади под кривой (AUC) или максимальной концентрации в сыворотке или плазме (Cmax) не измененной формы соединения после введения соединения млекопитающему. AUC представляет собой определение площади под кривой графика концентрации соединения в сыворотке или плазме по ординате (ось y) в зависимости от времени по абсциссе (ось x). В целом, AUC для конкретного соединения можно вычислять с использованием способов, известных специалистам в данной области и как описано в G. S. Banker, Modern Pharmaceutics, Drugs and the Pharmaceutical Sciences, т. 72, Marcel Dekker, New York, Inc., 1996, содержание которого включено в настоящее описание посредством ссылки в полном объеме.

[00913] Значения Cmax представляют собой максимальные концентрации соединений, достигаемые в сыворотке или плазме субъекта после введения соединений субъекту. Значения Cmax конкретных соединений можно измерять с использованием способов, известных специалистам в данной области. Как используют в настоящем описании, фразы «увеличение биодоступности» или «усовершенствование фармакокинетики» относятся к действиям, которые могут увеличивать системную доступность вирусного вектора по настоящему изобретению (как измеряют по AUC, Cmax или Cmin) у субъекта. В некоторых вариантах осуществления такие действия могут включать совместное введение одного или нескольких средств доставки, как раскрыто в настоящем описании. В некоторых вариантах осуществления биодоступность вирусных векторов можно увеличивать по меньшей мере приблизительно на 2%, по меньшей мере приблизительно на 5%, по меньшей мере приблизительно на 10%, по меньшей мере приблизительно на 15%, по меньшей мере приблизительно на 20%, по меньшей мере приблизительно на 25%, по меньшей мере приблизительно на 30%, по меньшей мере приблизительно на 35%, по меньшей мере приблизительно на 40%, по меньшей мере приблизительно на 45%, по меньшей мере приблизительно на 50%, по меньшей мере приблизительно на 55%, по меньшей мере приблизительно на 60%, по меньшей мере приблизительно на 65%, по меньшей мере приблизительно на 70%, по меньшей мере приблизительно на 75%, по меньшей мере приблизительно на 80%, по меньшей мере приблизительно на 85%, по меньшей мере приблизительно на 90%, по меньшей мере приблизительно на 95% или приблизительно на 100%.

Терапевтическое окно

[00914] Вирусные векторы, содержащые модулирующий полинуклеотид по настоящему изобретению, при формулировании с одним или несколькими средствами доставки, как раскрыто в настоящем описании, могут проявлять увеличение терапевтического окна при введении соединения и/или композиции по сравнению с терапевтическим окном вирусных векторов, вводимых без одного или нескольких средств доставки, как раскрыто в настоящем описании. Как используют в настоящем описании, термин «терапевтическое окно» относится к диапазону концентраций в плазме или диапазону уровней терапевтически активного вещества в месте приложения действия, с высокой вероятностью вызвать терапевтический эффект. В некоторых вариантах осуществления терапевтические окна вирусных векторов, при введении в составе, можно увеличивать по меньшей мере приблизительно на 2%, по меньшей мере приблизительно на 5%, по меньшей мере приблизительно на 10%, по меньшей мере приблизительно на 15%, по меньшей мере приблизительно на 20%, по меньшей мере приблизительно на 25%, по меньшей мере приблизительно на 30%, по меньшей мере приблизительно на 35%, по меньшей мере приблизительно на 40%, по меньшей мере приблизительно на 45%, по меньшей мере приблизительно на 50%, по меньшей мере приблизительно на 55%, по меньшей мере приблизительно на 60%, по меньшей мере приблизительно на 65%, по меньшей мере приблизительно на 70%, по меньшей мере приблизительно на 75%, по меньшей мере приблизительно на 80%, по меньшей мере приблизительно на 85%, по меньшей мере приблизительно на 90%, по меньшей мере приблизительно на 95% или приблизительно на 100%.

Объем распределения

[00915] Вирусные векторы, содержащие модулирующий полинуклеотид по настоящему изобретению, при формулировании с одним или несколькими средствами доставки, как раскрыто в настоящем описании, могут проявлять усовершенствованный объем распределения (Vdist), например, уменьшенный или направленный, относительно составов, не содержащих одно или несколько средств доставки, как раскрыто в настоящем описании. Vdist связывает количество средства в организме с концентрацией этого же средства в крови или плазме. Как используют в настоящем описании, термин «объем распределения» относится к объему текучего вещества, который необходим, чтобы содержать общее количество средства в организме в той же концентрации, что и в крови или плазме: Vdist равно количеству средства в организме/концентрация средства в крови или плазме. Например, для дозы 10 мг заданного средства и концентрации в плазме 10 мг/л, объем распределения будет составлять 1 л. Объем распределения отражает степень, в которой средство присутствует во внесосудистой ткани. Большие объемы распределения отражают склонность средств связываться с компонентами ткани по сравнению с белками плазмы. В клинической ситуации Vdist можно использовать для того, чтобы определять загрузочные дозы для достижения равновесных концентраций. В некоторых вариантах осуществления объемы распределения композиций вирусных векторов по настоящему изобретению при совместном введении с одним или несколькими средствами доставки, как раскрыто в настоящем описании, можно снижать по меньшей мере приблизительно на 2%, по меньшей мере приблизительно на 5%, по меньшей мере приблизительно на 10%, по меньшей мере приблизительно на 15%, по меньшей мере приблизительно на 20%, по меньшей мере приблизительно на 25%, по меньшей мере приблизительно на 30%, по меньшей мере приблизительно на 35%, по меньшей мере приблизительно на 40%, по меньшей мере приблизительно на 45%, по меньшей мере приблизительно на 50%, по меньшей мере приблизительно на 55%, по меньшей мере приблизительно на 60%, по меньшей мере приблизительно на 65%, по меньшей мере приблизительно на 70%.

Комбинации

[00916] Вирусные векторы, содержащие модулирующий полинуклеотид, можно использовать в комбинации с одним или несколькими другими терапевтическими, профилактическими, диагностическими или визуализационными средствами. Не предусмотрено, что под «в комбинации с» подразумевают, что средства следует вводить одновременно и/или формулировать для доставки вместе, несмотря на то, что эти способы доставки входят в объем настоящего раскрытия. Композиции можно вводить одновременно с, до или после одной или нескольких других желаемых терапевтических или медицинских процедур. В целом, каждое средство вводят в дозе и/или по временной схеме, которые определяют для этого средства. В некоторых вариантах осуществления настоящее раскрытие охватывает доставку фармацевтических, профилактических, диагностическмх или визуализационных композиций в комбинации со средствами, которые могут усовершенствовать их биодоступность, снижать и/или модифицировать их метаболизм, ингибировать их экскрецию и/или модифицировать их распределение в организме.

IV. СПОСОБЫ ИСПОЛЬЗОВАНИЯ

Снижение экспрессии целевого гена

[00917] В некоторых вариантах осуществления настоящее изобретение предусматривает способы ингибирования/сайленсинга экспрессии гена в клетке. Соответственно, модулирующие полинуклеотиды, кодирующие дуплексы миРНК, или кодируемую дцРНК можно использовать для того, чтобы по существу ингибировать экспрессию гена в клетке, в частности, в нейроне. В некоторых аспектах, ингибирование экспрессии гена относится к ингибированию по меньшей мере приблизительно на 15%, например, по меньшей мере приблизительно на 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%. Соответственно, белковый продукт целевого гена можно ингибировать по меньшей мере приблизительно на 15%, предпочтительно по меньшей мере приблизительно на 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%.

[00918] В некоторых вариантах осуществления настоящее изобретение предусматривает способы ингибирования/сайленсинга экспрессии гена в клетке, в частности, в среднем шипиковом нейроне. В некоторых аспектах, ингибирование экспрессии гена относится к ингибированию по меньшей мере приблизительно на 15%, например, по меньшей мере приблизительно на 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%. Соответственно, белковый продукт целевого гена можно ингибировать по меньшей мере приблизительно на 15%, предпочтительно по меньшей мере приблизительно на 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%.

[00919] В некоторых вариантах осуществления настоящее изобретение предусматривает способы ингибирования/сайленсинга экспрессии гена в клетке, в частности в двигательном нейроне. В некоторых аспектах, ингибирование экспрессии гена относится к ингибированию по меньшей мере приблизительно на 15%, например, по меньшей мере приблизительно на 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%. Соответственно, белковый продукт целевого гена можно ингибировать по меньшей мере приблизительно на 15%, предпочтительно по меньшей мере приблизительно на 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%.

[00920] В некоторых вариантах осуществления настоящее изобретение предусматривает способы ингибирования/сайленсинга экспрессии гена в клетке, в частности, в астроците. В некоторых аспектах, ингибирование экспрессии гена относится к ингибированию по меньшей мере приблизительно на 15%, например, по меньшей мере приблизительно на 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%. Соответственно, белковый продукт целевого гена можно ингибировать по меньшей мере приблизительно на 15%, предпочтительно по меньшей мере приблизительно на 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%.

[00921] В одном из вариантов осуществления дуплексы миРНК или кодируемую дцРНК можно использовать для того, чтобы снижать экспрессию белка по меньшей мере приблизительно на 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%. В качестве неограничивающего примера, экспрессию белка можно снижать на 50-90%. В качестве неограничивающего примера, экспрессию белка можно снижать на 30-70%. В качестве неограничивающего примера, экспрессию белка можно снижать на 20-70%. В качестве неограничивающего примера, экспрессию белка можно снижать на 15-30%.

[00922] В одном из вариантов осуществления модулирующие полинуклеотиды, кодирующие дуплексы миРНК, или кодируемую дцРНК можно использовать для того, чтобы снижать экспрессию мРНК по меньшей мере приблизительно на 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%. В качестве неограничивающего примера, экспрессию мРНК можно снижать на 50-90%. В качестве неограничивающего примера, экспрессию мРНК можно снижать на 30-70%. В качестве неограничивающего примера, экспрессию мРНК можно снижать на 20-70%. В качестве неограничивающего примера, экспрессию мРНК можно снижать на 15-30%.

[00923] В одном из вариантов осуществления дуплексы миРНК или кодируемую дцРНК можно использовать для того, чтобы снижать экспрессию белка и/или мРНК по меньшей мере в одной области CNS, такой как, но не ограничиваясь этим, средний мозг. Экспрессию белка и/или мРНК снижают по меньшей мере приблизительно на 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100% по меньшей мере в одной области CNS. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 50-90%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле снижают на 20-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле снижают на 15-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 30-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 20-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 15-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 20-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 20-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 15-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 40-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 50-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 50-60%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 50%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 51%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 52%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 53%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 54%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 55%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 56%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 57%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 58%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 59%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 60%.

[00924] В одном из вариантов осуществления модулирующие полинуклеотиды, кодирующие дуплексы миРНК, или кодируемую дцРНК можно использовать для того, чтобы снижать экспрессию белка и/или мРНК по меньшей мере в одной области CNS, такой как, но не ограничиваясь этим, передний мозг. Экспрессию белка и/или мРНК снижают по меньшей мере приблизительно на 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100% по меньшей мере в одной области CNS. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 50-90%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 30-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 20-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 15-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 20-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 15-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 40-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 50-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 50-60%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 50%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 51%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 52%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 53%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 54%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 55%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 56%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 57%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 58%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 59%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 60%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 61%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 62%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 63%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 64%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 65%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 66%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 67%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 68%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 69%. В качестве неограничивающего примера, экспрессию белка и мРНК в полосатом теле и/или коре снижают на 70%.

[00925] В одном из вариантов осуществления модулирующие полинуклеотиды, кодирующие дуплексы миРНК, или кодируемую дцРНК можно использовать для того, чтобы снижать экспрессию белка и/или мРНК в скорлупе. Экспрессию белка и/или мРНК снижают по меньшей мере приблизительно на 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 55-60%, 55-70%, 55-80%, 55-90%, 55-95%, 55-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100% по меньшей мере в одной области CNS. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 40-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 50-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 50-60%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 50%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 51%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 52%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 53%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 54%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 55%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 56%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 57%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 58%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 59%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 60%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 61%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 62%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 63%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 64%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 65%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 66%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 67%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 68%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 69%. В качестве неограничивающего примера, экспрессию белка и мРНК в скорлупе снижают на 70%.

[00926] В одном из вариантов осуществления модулирующиие полинуклеотиды, кодирующие дуплексы миРНК, или кодируемую дцРНК можно использовать для того, чтобы снижать экспрессию белка и/или мРНК в коре. Экспрессию белка и/или мРНК снижают по меньшей мере приблизительно на 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 30-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают по меньшей мере на 30%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 40-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 50-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 50-60%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 50%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 51%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 52%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 53%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 54%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 55%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 56%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 57%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 58%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 59%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 60%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 61%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 62%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 63%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 64%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 65%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 66%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 67%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 68%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 69%. В качестве неограничивающего примера, экспрессию белка и мРНК в коре снижают на 70%.

[00927] В одном из вариантов осуществления модулирующие полинуклеотиды, кодирующие дуплексы миРНК, или кодируемую дцРНК можно использовать для того, чтобы снижать экспрессию белка и/или мРНК в двигательной коре. Экспрессию белка и/или мРНК снижают по меньшей мере приблизительно на 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 30-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 20-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 15-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают по меньшей мере на 30%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 40-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 50-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 50-60%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 50%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 51%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 52%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 53%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 54%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 55%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 56%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 57%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 58%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 59%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 60%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 61%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 62%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 63%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 64%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 65%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 66%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 67%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 68%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 69%. В качестве неограничивающего примера, экспрессию белка и мРНК в двигательной коре снижают на 70%.

[00928] В одном из вариантов осуществления модулирующие полинуклеотиды, кодирующие дуплексы миРНК, или кодируемую дцРНК можно использовать для того, чтобы снижать экспрессию белка и/или мРНК в соматосенсорной коре. Экспрессию белка и/или мРНК снижают по меньшей мере приблизительно на 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% и 100% или по меньшей мере на 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90%, 15-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% или 95-100%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 40-50%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 30-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 20-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 15-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают по меньшей мере на 30%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 40-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 50-70%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 50-60%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 50%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 51%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 52%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 53%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 54%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 55%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 56%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 57%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 58%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 59%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 60%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 61%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 62%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 63%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 64%. В качестве неограничивающего примера, экспрессию белка и мРНК в соматосенсорной коре снижают на 65%. В качестве неог