Сконструированные компоненты cascade и комплексы cascade



Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
Сконструированные компоненты cascade и комплексы cascade
C12N15/113 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2774631:

КАРИБУ БАЙОСАЙЕНСИЗ, ИНК. (US)

Изобретение относится к области биотехнологии, в частности к композиции, содержащей первый сконструированный эффекторный комплекс CRISPR-Cas класса 1 типа I, первый руководящий полинуклеотид, содержащий первый спейсер, способный связываться с первой последовательностью нуклеиновой кислоты-мишени, второй сконструированный эффекторный комплекс CRISPR-Cas класса 1 типа I, и второй руководящий полинуклеотид, содержащий второй спейсер, способный связываться со второй последовательностью нуклеиновой кислоты-мишени. Изобретение эффективно разрезания полинуклеотида, содержащего первую последовательность нуклеиновой кислоты-мишени и вторую последовательность нуклеиновой кислоты-мишени в клетке-хозяине или в биохимической реакционной смеси. 2 н. и 10 з.п. ф-лы, 49 ил., 53 табл., 26 пр.

 

Перекрестная ссылка на родственные заявки

[0001] Настоящая заявка является частичным продолжением заявки на патент США с регистрационным номером 16/420061, поданной 22 мая 2019 г., которая в настоящее время находится на рассмотрении и является продолжением заявки на патент США под регистрационным номером 16/267773, поданной 30 января 2019 г., и которая была оценена экспертизой как патентоспособная заявка и является продолжением заявки на патент США под регистрационным номером 16/104875, поданной 17 августа 2018 г., и на которую в настоящее время выдан патент США № 10227576 12 марта 2019 г., и в которой испрашивается преимущество предварительной заявки на патент США под регистрационным номером 62/684735, поданной 13 июня 2018 г. и находящейся в настоящее время находится на рассмотрении, и предварительной заявки на патент США под регистрационным номером 62/807717, поданной 19 февраля 2019 г., и находящейся в настоящее время на рассмотрении, и содержание указанных заявок включено в настоящее описание в полном объеме посредством ссылки.

Заявление об исследованиях или разработках, спонсируемых на средства Федеральных органов

[0002] Не приводится.

Список последовательностей

[0003] Настоящая заявка содержит список последовательностей, который был представлен в электронном виде в формате ASCII и, таким образом, полностью включен в настоящее описание посредством ссылки. Копия ASCII, созданная 12 июня 2019 года, называется CBI032-30_ST25.txt и имеет размер 3,1 мб.

Область техники

[0004] Настоящее изобретение в общих чертах относится к сконструированным системам CRISPR-Cas (Cascade) класса 1 типа I, которые содержат эффекторные комплексы из множества белков, нуклеопротеиновые комплексы, содержащие белки субъединицы CRISPR-Cas типа I и руководящие нуклеиновые кислоты, полинуклеотиды, кодирующие белки субъединицы CRISPR-Cas типа I и руководящие полинуклеотиды. Настоящее изобретение также относится к композициям и способам получения и применения сконструированных систем CRISPR-Cas типа I согласно изобретению.

Предшествующий уровень техники

[0005] Кластеризованные регулярно перемежающиеся короткие палиндромные повторы (CRISPR) и CRISPR-ассоциированные белки (Cas) составляют системы CRISPR-Cas. Системы CRISPR-Cas обеспечивают адаптивный иммунитет против чужеродных полинуклеотидов у бактерий и архебактерий (см., например, Barrangou, R., et al., Science 315: 1709-1712 (2007); Makarova, KS, et al., Nature Reviews Microbiology 9: 467-477 (2011); Garneau, JE, et al., Nature 468: 67-71 (2010); Sapranauskas, R., et al., Nucleic Acids Res. 39: 9275-9282 (2011); Koonin , EV, et al., Curr. Opin. Microbiol. 37: 67-78 (2017)). Различные системы CRISPR-Cas у своих природных хозяев способны нацеливаться на ДНК (класса 1, типа I; класса 2, типа II и типа V), нацеливаться на РНК (класса 2, типа VI) и совместно нацеливаться на ДНК и РНК в области стыка (класса 1, типа III), (см., например, Makarova, KS, et al., Nat. Rev.Microbiol. 13:722-736 (2015); Shmakov, S., et al., Nat. Rev. Microbiol. 15:169-182 (2017); Abudayyeh, O.O., et al., Science 353:1-17 (2016)).

[0006] Классификация систем CRISPR-Cas претерпела множество изменений. Coonin, E.V. и др. (Curr. Opin. Microbiol. 37: 67-78 (2017)) предложили систему классификации, которая учитывает сигнатуру генов cas, специфичных для отдельных типов и подтипов систем CRISPR-Cas. Классификация также учитывает сходство последовательностей между несколькими общими белками Cas, филогению наиболее консервативного белка Cas, организацию гена и структуру массива CRISPR. В этом способе представлена схема классификации, которая делит системы CRISPR-Cas на два отдельных класса: класс 1, включающий мультипротеиновый эффекторный комплекс (эффекторный комплекс типа I (CRISPR-ассоциированный комплекс для противовирусной защиты («Cascade»)), типа III (эффекторный комплекс Cmr/Csm) и типа IV); и класс 2, включающий единственный эффекторный белок (типа II (Cas9), типа V (Cas 12a, ранее обозначаемый Cpf1) и типа VI (Cas13a, ранее обозначаемый C2c2)). В системах класса 1, тип I является наиболее распространенным и разнообразным, тип III чаще встречается у архебактерий, чем у бактерий, а тип IV встречается реже.

[0007] Системы типа I содержат сигнатурный белок Cas3. Белок Cas3 имеет домены геликазы и ДНКазы, ответственные за расщепление последовательности-мишени ДНК. В настоящее время было идентифицировано семь подтипов системы типа I (то есть типа I-A, I-B, I-C, I-D, I-E, I-F (и варианты для I-F (например, I-Fv1, I-Fv2)) и I-U), которые имеют различные количества генов cas. Гены cas типа I включают, но не ограничиваются ими, следующие гены: cas7, cas5, cas8, cse2, csa5, cas3, cas2, cas4, cas1 и cas6. Примерами микроорганизмов, имеющих системы типа I, являются: I-A, Archaeoglobus fulgidus; I-B, Clostridium kluyveri; I-C, Bacillus halodurans; I-U, Geobacter sulfurereducens; I-D, Cyanothece sp. 8802; I-E, Escherichia coli K12 (E. coli K12); I-F, Yersinia pseudo-tuberculosis; Вариант I-F, Shewanella putrefaciens CN-32 (Koonin, E.V., et al., Curr. Opin. Microbiol. 37: 67-78 (2017)). Были описаны характеристики расщепления и прогрессирующей деградации ДНК, опосредуемых белком Cas3 (см., например, Plagens, A., et al., Nucleic Acids Res. 42: 5125-5138 (2014); Maier, L., et al., RNA Biol.10: 865-874 (2013); Hochstrasser, M., et al., Proc. Natl. Acad. Sci. USA 111: 6618-6623 (2014); Sinkunas, Т. et al., EMBO J. 30: 1335-1342 (2011); Westra, E., et al., Mol. Cell 46: 595-605 (2012); Mulepati, S. et al., J. Biol. Chem. 288: 22184-22192 (2013); Sinkunas, Т. et al., EMBO J. 32: 385-394 (2013); Mulepati, S., et al., J. Biol. Chem. 288: 22184-22192 (2013); Redding, S. et al., Cell 163: 854-865 (2015); Sinkunas, Т. et al., EMBO J. 32: 385-394 (2013); Westra, E., et al., Mol. Cell 46: 595-605 (2012)).

[0008] Системы типа I обычно кодируют белки, которые объединены с РНК CRISPR (cr-РНК или «руководящей РНК») с образованием комплекса Cascade. Эти комплексы содержат множество белков и cr-РНК, которые оба транскрибируются из этого локуса CRISPR. В системах типа I, первичный процессинг пре-cr-РНК катализируется Cas6. Обычно это приводит к образованию cr-РНК с 5’-фланкирующей последовательностью из 8 нуклеотидов, со спейсерной областью и с 5’-фланкирующей последовательностью; а обе 5’- и 3’-фланкирующие последовательности происходят от повторяющейся последовательности. В некоторых системах, 3’-фланкирующая последовательность образует структуру «стебель-петля»; а в других системах, вторичный процессинг 3'-конца cr-РНК катализируется рибонуклеазой(ами) (см., например, van der Oost, T. et al., Nature Reviews Microbiology 12: 479-492 (2014)).

[0009] Эффекторные комплексы Cascade систем CRISPR-Cas типа I содержат остов, имеющий паралогичные ассоциированные с повторами неизвестные белки (RAMP; например, белки Cas7 и Cas5), содержащие укладку мотива распознавания РНК (RRM) и дополнительные «крупные» и «небольшие» белки субъединиц (см., например, Koonin, E.V., et al., Curr. Opin. Microbiol. 37: 67-78, (2017), фигура 2). Эти эффекторные комплексы Cascade обычно содержат белок субъединицы Cas5 и несколько белков субъединицы Cas7. Такие эффекторные комплексы Cascade также содержат руководящую РНК. Эффекторные комплексы Cascade содержат различные субъединичные белки, расположенные асимметрично по длине руководящей РНК. Белок субъединицы Cas5 и белок крупной субъединицы (белок Cas8) расположены на одном конце комплекса, охватывая 5'-конец руководящей РНК. Несколько копий белка малой субъединицы взаимодействуют с остовом руководящей РНК, который связан с несколькими копиями белка субъединицы Cas7. Белок субъединицы Cas6, другой белок RAMP, связан с эффекторным комплексом Cascade, прежде всего, за счет ассоциации с 3’-фланкирующей последовательностью (повторяющейся областью) cr-РНК. Белок субъединицы Cas6 обычно функционирует как повтор- специфическая РНКаза, участвующая в процессинге пре-cr-РНК; однако, в системах типа I-C, Cas5 функционирует как повтор- специфическая РНКаза, а Cas6 отсутствует.

[0010] Первичные последовательности белков субъединицы Cascade CRISPR-Cas типа I имеют небольшую идентичность последовательносей, однако, присутствие гомологичных модулей RAMP и общее структурное сходство мультипротеиновых эффекторных комплексов подтверждает общее происхождение этих эффекторных комплексов (см., например, Koonin, E.V., et al., Curr. Opin. Microbiol. 37: 67-78 (2017)).

[0011] Механизм действия адаптивного иммунитета в системах CRISPR-Cas типа I включает, по существу, три фазы: адаптацию, экспрессию и интерференцию. В фазе адаптации, чужеродная ДНК или РНК инфицирует хозяина, а белки, кодируемые различными генами cas, связываются с областями инфицирующей ДНК или РНК. Такие области называются протоспейсерами. Смежный мотив протоспейсера (PAM) представляет собой короткую нуклеотидную последовательность (например, последовательность ДНК из 2-6 пар оснований), которая примыкает к протоспейсеру. Последовательности PAM обычно распознаются комплексом белка субъединицы cas1/белка субъединицы Cas2, где активный сайт, чувствительный к PAM, ассоциируется с белками субъединицы Сas1 (см., например, Jackson, SA, et al., Science 356:356(6333) (2017)).

[0012] На фазе экспрессии, массив CRISPR, содержащий несколько элементов спейсеров-повторов, транскрибируется как один транскрипт. Отдельные повторяющиеся элементы спейсера процессируются эндонуклеазой (например, типа I, белком Cas6; и типа I-C, белком Cas5) в отдельные cr-РНК. Белки субъединицы Cas экспрессируются и связываются с cr-РНК с образованием эффекторного комплекса Cascade.

[0013] Эффекторный комплекс Cascade сканирует чужеродные полинуклеотиды, инфицирующие хозяина, что позволяет выявлять ДНК, комплементарную спейсеру. В системах типа I, интерференция возникает в том случае, когда эффекторный комплекс идентифицирует последовательность, комплементарную спейсеру, который находится рядом с PAM; а белок Cas3 подвергается рекрутингу в связанный с ДНК эффекторный комплекс Cascade с последующим расщеплением и постепенным гидролизом чужеродного полинуклеотида.

[0014] Makarova, К.S. et al. (Cell 168: 946 (2017)) представили краткий обзор генов, гомологов, комплексов Cascade и механизмов действия систем CRISPR-Cas типа I.

[0015] Системы CRISPR-Cas типа I до сих пор имели ограниченное использование при конструировании эукариотических генома, отчасти из-за сложности гетерологичной экспрессии комплекса Cascade и механизма, благодаря которому системы CRISPR-Cas типа I расщепляют ДНК-мишени.

Описание сущности изобретения

[0016] Настоящее изобретение в общих чертах относится к композициям, содержащим сконструированные эффекторные комплексы CRISPR-Cas типа I и их компоненты, включая белковые компоненты, модифицированные или явно измененные руководящие полинуклеотиды и их комбинации.

[0017] Один вариант осуществления изобретения представляет собой композицию, содержащую:

[0018] первый сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий:

[0019] первый белок субъединицы Cse2, первый белок субъединицы Cas5, первый белок субъединицы Cas6 и первый белок субъединицы Cas7;

[0020] первый гибридный белок, содержащий первый белок субъединицы Cas8 и первый FokI, где N-конец первого белка субъединицы Cas8 или C-конец первого белка субъединицы Cas8 ковалентно связан посредством первого линкерного полипептида с С-концом или N-концом, соответственно, первого FokI, и где первый линкерный полипептид имеет длину от 10 аминокислот до 40 аминокислот, и

[0021] первый руководящий полинуклеотид, содержащий первый спейсер, способный связываться с первой последовательностью нуклеиновой кислоты-мишени; и

[0022] второй сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий:

[0023] второй белок субъединицы Cse2, второй белок субъединицы Cas5, второй белок субъединицы Cas6 и второй белок субъединицы Cas7,

[0024] второй гибридный белок, содержащий второй белок субъединицы Cas8 и второй FokI, где N-конец второго белка субъединицы Cas8 или C-конец второго белка Cas8 ковалентно связан посредством второго линкерного полипептида с C-концом или N-концом, соответственно, второго FokI, и где второй линкерный полипептид имеет длину от 10 аминокислот до 40 аминокислот, и

[0025] второй руководящий полинуклеотид, содержащий второй спейсер, способный связываться со второй последовательностью нуклеиновой кислоты-мишени, где соседний мотив протоспейсера (PAM) второй последовательности нуклеиновой кислоты-мишени и PAM первой последовательности нуклеиновой кислоты-мишени имеет межспейсерное расстояние от 20 пар оснований до 42 пар оснований.

[0026] В некоторых вариантах осуществления изобретения, длина первого линкерного полипептида и/или второго линкерного полипептида составляет от 15 аминокислот до 30 аминокислот или от 17 аминокислот до 20 аминокислот. В одном варианте осуществления изобретения, длины первого линкерного полипептида и второго линкерного полипептида являются одинаковыми.

[0027] Межспейсерные расстояния между второй последовательностью нуклеиновой кислоты-мишени и первой последовательностью нуклеиновой кислоты-мишени включают, но не ограничиваются ими, от 22 пар оснований до 40 пар оснований, от 26 пар оснований до 36 пар оснований, от 29 пар оснований до 35 пар оснований, или от 30 пар оснований до 34 пар оснований.

[0028] Первый FokI и второй FokI могут представлять собой мономерные субъединицы, которые способны связываться с образованием гомодимера, или отдельные субъединицы, которые способны связываться с образованием гетеродимера.

[0029] В некоторых вариантах осуществления изобретения, N-конец первого белка субъединицы Cas8 ковалентно связан посредством первого линкерного полипептида с C-концом первого FokI, C-конец первого белка субъединицы Cas8 ковалентно связан посредством первого линкерного полипептида с N-концом первого FokI, N-конец второго белка субъединицы Cas8 ковалентно связан посредством второго линкерного полипептида с C-концом второго FokI, C-конец второго белка субъединицы Cas8 ковалентно связан посредством второго линкерного полипептида с C-концом второго FokI, и их комбинаций. Каждый первый белок субъединицы Cas8 и второй белок субъединицы Cas8 могут содержать белок субъединицы Cas8, имеющий другую последовательность, или первый и второй белки субъединицы Cas8 могут содержать идентичные аминокислотные последовательности.

[0030] Аналогичным образом, первый белок субъединицы Cse2 и второй белок субъединицы Cse2 могут содержать различные или идентичные аминокислотные последовательности белка субъединицы Cse2, первый белок субъединицы Cas5 и второй белок субъединицы Cas5 могут содержать различные или идентичные аминокислотные последовательности белка субъединицы Cas5, первый белок субъединицы Cas6 и второй белок субъединицы Cas6 могут содержать различные или идентичные аминокислотные последовательности белка субъединицы Cas6, первый белок субъединицы Cas7 и второй белок субъединицы Cas7 могут содержать различные или идентичные аминокислотные последовательности белка субъединицы Cas7 и их комбинации.

[0031] В предпочтительном варианте осуществления изобретения, руководящие полинуклеотиды содержат РНК.

[0032] В своем дополнительном варианте, настоящее изобретение включает сконструированный мутантный белок CRISPR Cas3 типа I («белок mCas3»), способный уменьшать перемещение вдоль ДНК по сравнению с белком CRISPR Cas3 типа I дикого типа («белком wtCas3»).

[0033] Настоящее изобретение также включает применение вышеуказанных композиций для редактирования генома в клетках, а также способы получения вышеуказанных композиций.

[0034] Дальнейшие варианты осуществления настоящего изобретения будут очевидны для специалистов в данной области исходя из приведенного здесь описания.

Краткое описание чертежей

[0035] Чертежи представлены без соблюдения пропорций и масштаба. Расположения индикаторов являются приблизительными.

[0036] На фиг. 1А представлена обобщенная иллюстрация эффекторного комплекса CRISPR-Cas типа I. На фиг. 1B представлена обобщенная иллюстрация cr-РНК CRISPR-Cas типа I.

[0037] На фиг. 2А, фиг. 2B и фиг. 2C представлены иллюстративные примеры двух сконструированных эффекторных комплексов CRISPR-Cas типа I с гибридными доменами, связанными с соседними спейсерными последовательностями.

[0038] На фиг. 3A и фиг. 3B представлены примеры белков с кольцевой пермутацией.

[0039] На фиг. 4A, фиг. 4B, фиг. 5A, фиг. 5B, фиг. 6A, фиг. 6B, фиг. 6C, фиг. 7А, фиг. 7B, фиг. 8, фиг. 9, фиг. 10A и фиг. 10В проиллюстрировано множество примеров сконструированных эффекторных комплексов CRISPR-Cas типа I согласно изобретению.

[0040] На фиг. 11A и фиг. 11B проиллюстрированы примеры каналов субстратов.

[0041] На фиг. 12A, фиг. 12B и фиг. 12C представлена обобщенная иллюстрация сайт-направленного рекрутинга функционального белкового домена, связанного с белком субъединицы Cascade комплексом dCas9:NATNA.

[0042] На фиг. 13A, фиг. 13B, фиг. 14A, фиг. 14B и фиг. 14С проиллюстрированы примеры сконструированных эффекторных комплексов CRISPR-Cas типа I согласно изобретению.

[0043] На фиг. 15A, фиг. 15B, фиг. 15C, фиг. 16A, фиг. 16B, фиг. 16C, фиг. 17А, фиг. 17B, фиг. 17C, фиг. 18A, фиг. 18B, фиг. 18C, фиг. 18D, фиг. 19A, фиг. 19B, фиг. 20A и фиг. 20В представлены примеры сконструированных эффекторных комплексов CRISPR-Cas типа I согласно изобретению и способы их применения.

[0044] На фиг. 21A, фиг. 21B, фиг. 21C, фиг. 21D, фиг. 22A, фиг. 22B, фиг. 22C и фиг. 22D проиллюстрированы варианты осуществления настоящего изобретения, в которых используется белок Cas3, обладающий активной эндонуклеазной активностью.

[0045] На фиг. 23A, фиг. 23B, фиг. 23C, фиг. 23D, фиг. 23E, фиг. 24, фиг. 25, фиг. 26 и фиг. 27 представлены схематические диаграммы различных систем экспрессии компонентов Cascade.

[0046] На фиг. 28, фиг. 29, фиг. 30, фиг. 31A, фиг. 31B, фиг. 32, фиг. 33A, фиг. 33B и фиг. 34 представлены данные, относящиеся к редактированию генома с использованием сконструированных систем Cascade согласно изобретению.

[0047] На фиг. 35 проиллюстрирован пример минимального массива CRISPR, содержащего спаренные руководящие РНК (рРНК).

[0048] На фиг. 36A, фиг. 36B, фиг. 36C и фиг. 36D представлены данные, относящиеся к редактированию генома в человеческих клетках посредством RNP и доставки сконструированных комплексов CRISPR-Cas на основе плазмиды.

[0049] На фиг. 37A, фиг. 37B, фиг. 37C, фиг. 37D, фиг. 37E, фиг. 37F и фиг. 37G представлены данные результатов репарации.

[0050] На фиг. 38A, фиг. 38B и фиг. 38C представлены данные, относящиеся к тому, как ошибочные спаривания между рРНК и ДНК-мишенью ингибируют редактирование генома посредством сконструированных комплексов CRISPR-Cas типа I.

[0051] На фиг. 39A, фиг. 39B, фиг. 39C и фиг. 39D представлены данные, относящиеся к расширенному скринингу селективности PAM для трех вариантов гомологов Cascade.

[0052] На фиг. 40A, фиг. 40B, фиг. 40C, фиг. 40D, фиг. 40E и фиг. 40F представлены данные, относящиеся к репрезентативным изменениям в эффективности редактирования сконструированными комплексами CRISPR-Cas типа I.

[0053] На фиг. 41A, фиг. 41B и ФИГ. 41C представлены данные, относящиеся к расширенному скринингу длины линкера FokI-Cas8 и расстояния между спейсерами для трех вариантов гомолога Cascade.

[0054] На фиг. 42A и фиг. 42B проиллюстрирован пример ПЦР-амплификации с использованием матричного олигонуклеотида.

[0055] На фиг. 43 представлены данные по процентам редактирования генома в зависимости от варианта гомолога FokI-Cascade и расстояния между спейсерами.

[0056] На фиг. 44 проиллюстрировано линейное представление функциональных доменов белка EcoCas3 и относительные положения мутантов, полученных в последовательности.

[0057] На фиг. 45A, фиг. 45B, фиг. 45C и ФИГ. 45D показаны данные, относящиеся к редактированию генома с использованием комплексов EcoCascade RNP, содержащих белки EcoCas3 дикого типа или мутантные белки EcoCas3.

[0058] На фиг. 46A, фиг. 46B, фиг. 46C, фиг. 47A и ФИГ. 47B представлены данные, относящиеся к блокированию комплекса dCas9-VP64/оцрРНК RNP и его влиянию на расщепление мишеней комплексами EcoCascade RNP.

[0059] На фиг. 48 представлены репрезентативные данные по редактированию под действием Cas3 [D452A]/-EcoCascade или mCas3[D452A]-EcoCascade.

[0060] На фиг. 49 представлены данные по редактированию генома на восьми сайтах-мишенях TRAC под действием комплексов PseCascade RNP.

Включение посредством ссылки

[0061] Все патенты, публикации и заявки на патенты, цитируемые в настоящей заявке, включены в настоящее описание посредством ссылки, как если бы каждый отдельный патент, публикация или патентная заявка были конкретно и отдельно включены посредством ссылки в полном объеме и во всех целях.

Подробное описание изобретения

[0062] Следует отметить, что используемая здесь терминология предназначена только для описания конкретных вариантов осуществления изобретения, и не рассматривается как ограничение объема изобретения. В настоящем описании и в формуле изобретения, артикли «a», «an» и «the», употребляемые с существительными в единственном числе, могут относиться и к существительным во множественном числе, если из контекста описания не следует обратное. Таким образом, например, термин «полинуклеотид» включает один или более полинуклеотидов, а термин «вектор» включает один или более векторов.

[0063] Если это не оговорено особо, то все технические и научные термины, используемые в настоящей заявке, имеют свои общепринятые значения, понятные специалистам в области, к которой относится изобретение. Хотя в настоящем изобретении могут быть применены и другие способы и материалы, аналогичные или эквивалентные описанным здесь способам и материалам, однако, предпочтительными являются материалы и способы, описанные в настоящей заявке.

[0064] Исходя из приведенного здесь описания и описания примеров, специалист в данной области может применять стандартные методы иммунологии, биохимии, химии, молекулярной биологии, микробиологии, биологии клетки, геномики и методы рекомбинантных полинуклеотидов, как описано, например, в следующих известных документах: Cellular and Molecular Immunology, Ninth Edition, A. K. Abbas., et al., Elsevier (2017), ISBN 978-0323479783; Cancer Immunotherapy Principles and Practice, First Edition, L.H. Butterfield, et al., Demos Medical (2017), ISBN 978-1620700976; Janeway’s Immunobiology, Ninth Edition, Kenneth Murphy, Garland Science (2016), ISBN 978-0815345053; Clinical Immunology and Serology: A Laboratory Perspective, Fourth Edition, C. Dorresteyn Stevens, et al., F.A. Davis Company (2016), ISBN 978-0803644663; Antibodies: A Laboratory Manual, Second edition, E.A. Greenfield, Cold Spring Harbor Laboratory Press (2014), ISBN 978-1-936113-81-1; Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, Seventh Edition, R.I. Freshney, Wiley-Blackwell (2016), ISBN 978-1118873656; Transgenic Animal Technology, Third Edition: A Laboratory Handbook, C.A. Pinkert, Elsevier (2014), ISBN 978-0124104907; The Laboratory Mouse, Second Edition, H. Hedrich, Academic Press (2012), ISBN 978-0123820082; Manipulating the Mouse Embryo: A Laboratory Manual, Fourth Edition, R. Behringer, et al., Cold Spring Harbor Laboratory Press (2013), ISBN 978-1936113019; PCR 2: A Practical Approach, M.J. McPherson, et al., IRL Press (1995), ISBN 978-0199634248; Methods in Molecular Biology (Series), J.M. Walker, ISSN 1064-3745, Humana Press; RNA: A Laboratory Manual, D.C. Rio, et al., Cold Spring Harbor Laboratory Press (2010), ISBN 978-0879698911; Methods in Enzymology (Series), Academic Press; Molecular Cloning: A Laboratory Manual (Fourth Edition), M.R. Green, et al., Cold Spring Harbor Laboratory Press (2012), ISBN 978-1605500560; Bioconjugate Techniques, Third Edition, G.T. Hermanson, Academic Press (2013), ISBN 978-0123822390; Methods in Plant Biochemistry and Molecular Biology, W.V. Dashek, CRC Press (1997), ISBN 978-0849394805; Plant Cell Culture Protocols (Methods in Molecular Biology), V.M. Loyola-Vargas, et al., Humana Press (2012), ISBN 978-1617798177; Plant Transformation Technologies, C.N. Stewart, et al., Wiley-Blackwell (2011), ISBN 978-0813821955; Recombinant Proteins from Plants (Methods in Biotechnology), C. Cunningham, et al., Humana Press (2010), ISBN 978-1617370212; Plant Genomics: Methods and Protocols (Methods in Molecular Biology), W. Busch, Humana Press (2017), ISBN 978-1493970018; Plant Biotechnology: Methods in Tissue Culture and Gene Transfer, R. Keshavachandran, et al., Orient Blackswan (2008), ISBN 978-8173716164.

[0065] Кластеризованные регулярно перемежающиеся короткие палиндромные повторы (CRISPR) и родственные CRISPR-ассоциированные белки (белки Cas) составляют системы CRISPR-Cas (см., например, Barrangou, R., et al., Science 315: 1709-1712 (2007)).

[0066] Используемые здесь термины «белок Cas», «белок CRISPR-Cas» и «белок субъединицы CRISPR-Cas» и «белок субъединицы Cas», если не указано иное, означают белки CRISPR-Cas класса 1 типа I. Обычно белки субъединицы Cas, используемые в аспектах настоящего изобретения, способны взаимодействовать с одним или более родственными полинуклеотидами (чаще всего, cr-РНК) с образованием эффекторного комплекса типа I (чаще всего, комплекса RNP).

[0067] Гены, кодирующие Cascade в системах CRISPR-Cas типа I-E, с течением времени меняли свои названия, что может вызывать путаницу при сравнении последней и более старой терминологии в литературе. Обычно в настоящем описании используется номенклатура, изложенная Koonin, E., et al. (Curr. Opin. Microbiol. 37: 67-78 (2017)), где гены в эталонном опероне K12 E. coli приводятся в следующем порядке: cas3, cas8, cas11, cas7, cas5, cas6, cas1 и cas2. Для простоты, буква «e» в cas8e иногда используется для идентификации гена cas8 между различными подтипами в системах типа I. Стехиометрия CRISPR-Cas типа I-E в E. coli дикого типа представлена следующим образом: Cas51-Cas61 -Cas76-Cas81-Cas112-рРНК1.

[0068] Однако для перекрестных ссылок: cas8 ранее назывался cse1 и casA, и также известен как «крупная субъединица»; cas11 ранее назывался cse2 и casB, и также известен как «малая субъединица»; cas7 ранее назывался cse4 и casC;, cas5 ранее назывался casD, а иногда ему присваивали название cas5e; а cas6 ранее назывался cse3 и casE, и ему часто давали название cas6e. Гены, кодирующие белки субъединицы Cas, перечислены в Таблице 1.

[0069]

Таблица 1
Белки CRISPR-Cas типа I
Функция Универсальное название семейства* Альтернативное название Сообщаемая стехиометрия (если она присутствует)
5’-кэп РНК, распознавание PAM, раскручивание дуплекса Cas5 CasD, Cas5e, Csc1, Csy2, Csf3, Cas1822 1
Распознавание PAM, раскручивание дуплекса, рекрутинг Cas3 Cas8 Крупная субъединица CasA, Cse1, Cas8a, Cas8b, Cas8c, Cas8e, Cas8f, Csy1 1
Стабилизация R-петли Cas11 Малая субъединица, CasB, Cse2 2
Остов Cas7 CasC, Cse4, Csc2, Csy3, Csf2, Cas1821, Cst2/DevR 3-6
3’-кэп РНК Cas6 CasE, Cse3, Cas6e, Cas6f, Csy4 1
Расщепление ДНК Cas3 Cas3’, Cas3’’ 1

* Как было определено Makarova, K.S., et al., Nat. Rev. Microbiol. 13:722-736 (2015); Koonin, E.V., et al., Curr Opin Microbiol. 37:67-78 (2017).

[0070] Последовательности PAM обычно распознаются комплексом белка субъединицы Сas1/белка субъединицы Cas2, где активный сайт чувствительности к PAM ассоциируется с белками субъединицы Сas1 (см., например, Jackson, SA, et al., Science 356: 356 (6333) (2017)). Белок Сas1 и белок Сas2 присутствуют в подавляющем большинстве известных систем CRISPR-Cas и являются достаточными для встраивания спейсеров в кластеры CRISPR (см., например, Yosef, I, et al., Nucleic Acids Res.40: 5569-5576 (2012)). Эти два белка образуют комплекс для процесса адаптации. Эндонуклеазная активность белка Сas1 необходима для интеграции спейсера, тогда как белок Cas2, по-видимому, выполняет неферментативную функцию (см., например, Nunez, J., et al., Nat Struct Mol Biol. 21:528-534 (2014); Richter, C., et al., PLoS One. 2012;7:e49549). Белковый комплекс Сas1-Cas2 представляет собой высококонсервативный модуль обработки информации систем CRISPR-Cas, который, по-видимому, является квазиавтономным от остальной системы (см., например, Makarova, K., et al., Methods Mol. Biol. 1311: 47-75 (2015)). Белок эндонуклеазы Сas1 является ценным белком Cas, который обеспечивает уникальную способность систем CRISPR сохранять память о предыдущих взаимодействиях с инфекционными агентами.

[0071] Используемые здесь термины «эффекторный комплекс CRISPR-Cas типа I», «комплекс нуклеопротеинов (NP) CRISPR-Cas типа I», «комплекс нуклеопротеинов Cascade (NP)» и «комплекс нуклеопротеинов (NP) типа I» являются синонимами и обычно означают белок Cascade, образующий комплекс с руководящим полинуклеотидом. Термины «комплекс Cascade» и «комплекс типа I» обычно относятся к белковым компонентам комплекса Cascade NP. Термины «комплекс Cascade RNP», «комплекс CRISPR-Cas RNP типа I» и «комплекс RNP типа I» означают комплекс Cascade, содержащий cr-РНК по сравнению с более общим руководящим полинуклеотидом (то есть, как в комплексе Cascade NP). Пример эффекторного комплекса CRISPR-Cas дикого типа типа I проиллюстрирован на фиг. 1А. На фиг. 1A представлен комплекс, взятый из публикации Makarova, KS, et al. (Cell 168: 946 (2017); Makarova, K., et al., Nature Reviews Microbiology 13: 722-736 (2015)). На фиг. 1A показаны шесть белков: белок Cas7, белок Cas5, белок Cas8, два белка Cse2, белок Cas6 и cr-РНК (фиг. 1A: Cas7, Cas5, Cas8, Cse2 и Cas6; пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилечной cr-РНК; cr-РНК показана черной линией, содержащей шпильку), представленные как комплекс Cascade. Этот комплекс способен связываться с последовательностью нуклеиновой кислоты-мишени. После ассоциации белка wtCas3 (фиг. 1A, Cas3 обведен пунктирной рамкой) с комплексом Cascade, этот комплекс способен расщеплять последовательность нуклеиновой кислоты-мишени. Как указано в Таблице 1, общее количество некоторых белков субъединицы Cas может варьироваться в комплексах Cascade.

[0072] Термины «Cas3» и «белок Cas3» »используются здесь как синонимы и означают белки CRISPR-Cas3 типа I, их модификации и варианты. Эффекторные комплексы CRISPR-Cas типа I связываются с чужеродной ДНК, комплементарной руководящей cr-РНК, и осуществляют рекрутинг Cas3, то есть транс-действующей нуклеазы-геликазы, необходимой для расщепления мишени. Белки Cas3 имеют мотивы, характерные для геликаз из суперсемейства 2, и содержат область DEAD/DEAH-бокса и консервативный С-концевой домен. Белки Cas3 и их варианты известны специалистам в данной области (см., например, Westra, E.R., et al., Mol. Cell. 46: 595-605 (2012); Sinkunas, T., et al., EMBO J. 30:1335-1342 (2011); Beloglazova, N., et al., EMBO J. 30:4616-4627 (2011); Mulepati, S., et al., J. Biol. Chem. 286:31896-31903 (2011)). Используемый здесь термин «белок mCas3» означает белок Cas3, содержащий одну или более мутаций по сравнению с его соответствующим белком wtCas3. Белки mCas3 включают, но не ограничиваются ими, белки mCas3 (например, белки Примера 23A, Примера 23B и Примера 23C), белки dblmCas3 (например, белки Примера 26A, Примера 26B и Примера 26C) и dCas3* (мутированный белок Cas3, который не обладает нуклеазной активностью и/или геликазной активностью).

[0073] Используемый здесь термин «нуклеаза» означает фермент, способный расщеплять фосфодиэфирные связи, такие как соединения двух нуклеотидов, как было обнаружено в двухцепочечных (дц) нуклеиновых кислотах (например, дцДНК, геномной ДНК (гДНК), дцРНК), одноцепочечных (оц) нуклеиновых кислотах (например, оцДНК, РНК) или гибридных дцРНК/ДНК. «Эндонуклеаза» обычно может влиять на оц-(ники) или дц-разрывы в своих молекулах-мишенях. Одним из примеров ДНК-эндонуклеазы является фермент FokI. «Эндонуклеаза FokI» и «FokI» используются здесь как синонимы и означают фермент FokI, гомологи FokI, ферментативно активный(е) домен(ы) ферментов FokI и варианты ферментов FokI. Димеризация FokI обычно необходима для расщепления ДНК. Димеры FokI могут содержать две мономерные субъединицы, которые ассоциируются друг с другом с образованием гомодимера, или две отдельные мономерные субъединицы, которые ассоциируются друг с другом с образованием гетеродимера (см., например, Bitinaite, J., et al., Proc. Natl. Acad. Sci. USA 95: 10570-10575 (1998); Ramalingam, S. et al., J. Mol. Biol. 405: 630-641 (2011)). Одним из примеров варианта FokI является вариант Шарки, описанный Guo, et al. (Guo, J., et al., J. Mol. Biol. 400: 96-107 (2010)). Дополнительные ДНК- и РНК-нуклеазы известны специалистам в данной области.

[0074] Используемые здесь термины «РНК CRISPR», «cr-РНК» и «руководящая РНК» означают одну или более РНК, с которыми белки субъединицы Cas способны взаимодействовать с образованием эффекторного комплекса типа I, который направляет этот комплекс предпочтительно на связывание с последовательностью нуклеиновой кислоты-мишени в полинуклеотиде (по сравнению с полинуклеотидом, который не включает последовательность нуклеиновой кислоты-мишени). Используемые здесь термины «руководящий» и «руководящий полинуклеотид» относятся к полинуклеотидному компоненту эффекторных комплексов типа I, содержащему рибонуклеотидные основания (например, РНК) и сахара рибозы, а также их отдельные компоненты и комбинации, включая, но не ограничиваясь ими, дезоксирибонуклеотидные основания, аналоги нуклеотидов, модифицированные нуклеотиды, различные азотистые основания, принципиально различные нуклеотидные основания, химически различающиеся молекулы, смеси оснований (например, основания РНК, основания ДНК, и/или модифицированные основания) и т.п., а также их комбинации, помимо синтетических остовов, природных остовов, неприродных остовов, фундаментально различающихся остатков остовов, химически различающиеся остатков или связей, модифицированных остовов, смесей (например, рибозных или дезоксирибозных компонентов остова) и т.п., а также их комбинаций. Некоторые примеры руководящих полинуклеотидов описаны в настоящей заявке. Пример cr-РНК CRISPR-Cas типа I, ассоциированной с последовательностью нуклеиновой кислоты-мишени посредством спейсера cr-РНК, показан на фиг. 1В. На фиг. 1B представлен пример, взятый из публикации Hochstrasser, ML, et al., Mol. Cell 63: 840-851 (2016). На фиг. 1B, PAM (фиг. 1B, 104) связан с последовательностью нуклеиновой кислоты-мишени, а также проиллюстрированы 5’- и 3’-цепи двухцепочечной нуклеиновой кислоты (фиг. 1B, вертикальные линии представляют водородные связи). Руководящий полинуклеотид (фиг. 1B, 106) обычно включает 5’-фланкирующую область (фиг. 1B, 101), спейсерную область (фиг. 1B, 103), содержащую затравочную область и 3’-шпильку, содержащую две повторяющиеся области, связанные водородными связями (фиг. 1В, 102); а горизонтальные линии представляют водородные связи. Последовательности PAM, связанные с рядом гомологов Cascade типа I, обсуждаются в настоящей заявке. Последовательности PAM представляют собой последовательности, смежные с протоспейсером (фиг. 1B, 105). На фиг. 1B показан спейсер комплекса Cascade, связанный с последовательностью нуклеиновой кислоты-мишени (фиг. 1B, вертикальные линии представляют водородные связи). На фиг. 1B также проиллюстрирована протоспейсерная область (фиг. 1В, протоспейсер). Спейсер может включать область cr-РНК длиной приблизительно от 6 до приблизительно 56 нуклеотидов, причем, этот спейсер комплементарен последовательностью нуклеиновой кислоты-мишени в полинуклеотиде. Длину спейсера можно изменять для точной настройки активности Cascade в системах CRISPR-Cas типа I-E. Комплексы Cascade могут включать дополнительную субъединицу Cas7 с каждым из 6 нуклеотидами, добавленных к спейсеру cr-РНК, и дополнительную субъединицу Cse2 с каждым из 12 нуклеотидов, добавленных к спейсеру (см., например, Luo, ML, et al., Nucleic Acids Res. 44 (15): 7385-7394 (2016)). Спейсер обычно включает область длиной приблизительно от 32 до приблизительно 36 нуклеотидов.

[0075] Термины «спейсер», «спейсерная последовательность» и «последовательность, связывающаяся с нуклеиновой кислотой-мишенью» используются здесь как синонимы.

[0076] Термины «мишень», «последовательность-мишень», «последовательностью нуклеиновой кислоты-мишени» и «целевая последовательность» используются здесь как синонимы и означают последовательности нуклеиновой кислоты, которая полностью или частично комплементарна руководящей последовательности, связывающейся с нуклеиновой кислотой-мишенью (например, спейсера cr-РНК) комплекса нуклеопротеинов Cascade (например, комплекса Cascade RNP). Обычно, последовательность, связывающуюся с нуклеиновой кислотой-мишенью, выбирают так, чтобы она была на 100% комплементарна последовательности нуклеиновой кислоты-мишени, с которой непосредственно связывается комплекс нуклеопротеинов Cascade, однако, для ослабления связывания с последовательностью нуклеиновой кислоты-мишени может быть использован более низкий процент комплементарности. Если последовательность, связывающаяся с мишенью, на 100% комплементарна последовательности-мишени, то связывание с «нецелевой» последовательностью означает связывание нуклеопротеинового комплекса Cascade с последовательностями нуклеиновой кислоты, которые менее чем на 100% комплементарны последовательности, связывающейся с нуклеиновой кислотой-мишенью (спейсером). Двухцепочечная последовательность ДНК обычно содержит последовательность нуклеиновой кислоты-мишени на одной цепи (фиг. 1B, область, связанная водородными связями с руководящей РНК). «Область-мишень» включает последовательность нуклеиновой кислоты-мишени.

[0077] Используемый здесь термин «стеблевой элемент» или «стеблевая структура» относится к двум цепям нуклеиновых кислот, которые, как известно или предположительно, образуют двухцепочечную область («стеблевой элемент»). «Элемент стебель-петля» или «структура стебель-петля» относится к структуре стебля, где 3'-концевые последовательности одной цепи ковалентно связаны с 5'-концевыми последовательностями второй цепи посредством нуклеотидной последовательности обычно одноцепочечных нуклеотидов («нуклеотидная последовательность элемента стебель-петля»). В некоторых вариантах осуществления изобретения, элемент петли содержит нуклеотидную последовательность элемента петли длиной приблизительно от 3 до приблизительно 20 нуклеотидов, а предпочтительно приблизительно от 4 до приблизительно 10 нуклеотидов. В предпочтительных вариантах осуществления изобретения, нуклеотидная последовательность элемента петли представляет собой одноцепочечную нуклеотидную последовательность неспаренных оснований нуклеиновых кислот, которые не взаимодействуют посредством образования водородной связи с образованием стеблевого элемента в нуклеотидной последовательности элемента петли. Термин «шпилечный элемент» также используется здесь для обозначения структур стебель-петля. Такие структуры хорошо известны специалистам в данной области. Спаривание оснований может быть точным, однако, как известно специалистам в данной области, стеблевой элемент не требует точного спаривания оснований. Таким образом, стеблевой элемент может включать одно или более ошибочно спаренных оснований или неспаренных оснований. Пример структуры стебель-петля в руководящем полинуклеотиде представлен на фиг. 1B.

[0078] Термины «нуклеотидная последовательность линкерного элемента», «линкерная нуклеотидная последовательность» и «линкерный полинуклеотид» используются здесь как синонимы и означают одноцепочечную последовательность нуклеиновой кислоты или двухцепочечную последовательностю нуклеиновой кислоты из одного или более нуклеотидов, ковалентно присоединенных к первой последовательности нуклеиновой кислоты (например, 5'-линкерная нуклеотидная последовательность - первая последовательность нуклеиновой кислоты-3'). В некоторых вариантах осуществления изобретения, линкерная нуклеотидная последовательность соединяет две отдельные последовательности нуклеиновой кислоты с образованием одного полинуклеотида (например, 5'-первая последовательность нуклеиновой кислоты - линкерная нуклеотидная последовательность - вторая последовательность нуклеиновой кислоты-3'). Другими примерами линкерных нуклеотидных последовательностей являются, но не ограничиваются ими, 5'-первая последовательность нуклеиновой кислоты - линкерная нуклеотидная последовательность -3' и 5'-линкерная нуклеотидная последовательность - первая первая последовательность нуклеиновой кислоты - линкерная нуклеотидная последовательность-3'. В некоторых вариантах осуществления изобретения, нуклеотидная последовательность линкерного элемента может представлять собой одноцепочечную нуклеотидную последовательность неспаренных оснований нуклеиновых кислот, которые не взаимодействуют друг с другом посредством образования водородной связи с образованием вторичной структуры (например, структуры стебель-петля) внутри нуклеотидной последовательности линкерного элемента. В некоторых вариантах осуществления изобретения, две нуклеотидные последовательности линкерного элемента могут взаимодействовать друг с другом посредством образования водородной связи между двумя нуклеотидными последовательностями линкерного элемента. В некоторых вариантах осуществления изобретения, линкерный полинуклеотид кодирует «линкерный полипептид». Такой линкерный полинуклеотид обычно соединяет 3’-конец первого полинуклеотида, кодирующего первый полипептид, с 5'-концом второго полинуклеотида, кодирующего второй полипептид с образованием одного полинуклеотида, который кодирует гибридный белок, содержащий N-первый полипептид - линкерный полипептид - второй полипептид-C. В некоторых вариантах осуществления изобретения, более, чем две полипептидных последовательности могут быть соединены тандемно линкерными полипептидами (например, N-первый полипептид - первый линкерный полипептид - второй полипептид - второй линкерный полипептид - третий полипептид-C). Используемые здесь термины «линкерный полипептид», «линкерная полипептидная последовательность», «аминокислотная линкерная последовательность» и «линкерная последовательность» также являются синонимами.

[0079] Используемый здесь термин «соединяющая нуклеотидная последовательность» означает линкерную последовательность одноцепочечной последовательности нуклеиновой кислоты, которая ковалентно связывает первую последовательность нуклеиновой кислоты и вторую последовательность нуклеиновой кислоты.

[0080] Используемые здесь термины «промежуточный спейсер», «межспейсерная область» и «межспейсерное расстояние» являются синонимами и относятся к расстоянию между PAM первой последовательностью нуклеиновой кислоты-мишени (например, первой последовательности ДНК-мишени) и PAM второй последовательностью нуклеиновой кислоты-мишени (например, второй последовательности ДНК-мишени) обычно в ориентации PAM-in, где первый эффекторный комплекс CRISPR-Cas типа I включает первый спейсер, способный связываться с первой последовательностью нуклеиновой кислоты-мишени, а второй эффекторный комплекс CRISPR-Cas типа I содержит второй спейсер, способный связываться со второй последовательностью нуклеиновой кислоты-мишени. На фиг. 2А, фиг. 2B и фиг. 2C представлены иллюстративные примеры двух эффекторных комплексов CRISPR-Cas типа I (фиг. 2A: «Cascade1», обведенный сплошной рамкой, содержащей «crRNA1»; и «Cascade2», пунктирная рамка, содержащая «crRNA2»), содержащих гибридные белки (фиг. 2A, «FP1» и «FP2», представленные в виде кольцевых секторов; например, FP1 и FP могут представлять собой FokI), связанные с каждым комплексом Cascade посредством линкерных полинуклеотидов (Фиг. 2A, «Линкер 1» и «Линкер 2»), где эффекторные комплексы CRISPR-Cas связаны с соседними последовательностями нуклеиновой кислоты-мишени на двухцепочечной ДНК (Фиг. 2A, «дцДНК», представленная парными горизонтальными пунктирными линиями). Указаны также последовательности PAM, связанные с каждой последовательностью нуклеиновой кислоты-мишени (фиг. 2A, «PAM1», открытая рамка и «PAM2», открытая рамка)). На фиг. 2A проиллюстрирован промежуточный спейсер (показанный как горизонтальная линия с двумя стрелками вверх на фиг. 2A) между двумя сайтами-мишенями в конфигурации PAM-in (PAM-in/PAM-in). На фиг. 2B проиллюстрирован промежуточный спейсер (показанный как горизонтальная линия с двумя стрелками вверх на фиг. 2В) между двумя сайтами-мишенями в конфигурации PAM-in/PAM-out. На фиг. 2C проиллюстрирован промежуточный спейсер (показанный как горизонтальная линия с двумя стрелками вверх на фиг. 2С) между двумя сайтами-мишенями в конфигурации PAM-out (PAM-out/PAM-out). На фиг. 2А, фиг. 2B и фиг. 2С также проиллюстрировано разделение двух цепей дцДНК. Комплекс Cascade распознает последовательность дцДНК-мишени, смежную с PAM. Последовательности PAM распознаются Cse1. Спаривание оснований между cr-РНК и комплементарной цепью ДНК-мишени приводит к образованию R-петли со смещенной некомплементарной цепью ДНК-мишени (см., например, Beloglazova, N., et al., Nucleic Acids Res. 43: 530-543 (2015)).

[0081] Используемый здесь термин «когнатный» относится к биомолекулам, которые взаимодействуют, например, с рецептором клеточной поверхности (например, с рецептором хемокина) и с его лигандом (например, с хемокином, экспрессируемым на опухолевой клетке или в микроокружении опухоли); к сайт-направленному полипептиду и руководящему полипептиду; к сайт-направленному комплексу «полипептид/руководящий полипептид» (то есть, к нуклеопротеиновому комплексу), способному осуществлять сайт-направленное связывание с последовательностью нуклеиновой кислоты-мишени, комплементарной руководящей связывающей последовательности; и т.п. Кроме того, термин «когнатный» относится к группе белков субъединицы Cas (например, Cse2, Cas5, Cas6, Cas7 и Cas8) и одному или более руководящим полинуклеотидам (например, к РНК CRISPR/Cas типа I), которые могут образовывать нуклеопротеиновый комплекс, способный осуществлять сайт-направленное связывание с последовательностью нуклеиновой кислоты-мишени, комплементарной спейсеру, присутствующему в одном или более руководящих полинуклеотидах.

[0082] Используемые здесь термины «дикого типа», «встречающийся в природе» и «немодифицированный» односятся к типичной (или наиболее распространенной) форме, внешнему виду, фенотипу или штамму, существующим в природе, например, к типичной формк клеток, организмов, полинуклеотидов, белков, макромолекулярных комплексов, генов, РНК, ДНК или геномов в том виде, в каком они встречаются в природном источнике и могут быть выделены из него. Форма, внешний вид, фенотип или штамм дикого типа служат исходным родителем перед нацеленной модификацией, изменением, мутацией и/или заметно отличающимися структурными изменениями. Таким образом, мутантные, вариантные, сконструированные, рекомбинантные и модифицированные формы не являются формами дикого типа.

[0083] Термины «сконструированный», «генетически сконструированный», «генетически модифицированный», «рекомбинантный», «модифицированный», «неприродный» и «ненативный» указывают на преднамеренную модификацию генома организма или клетки человеком или модификацию с помощью устройства. Эти термины охватывают методы модификации генома, которые включают редактирование генома, определенное в настоящей заявке, а также методы, которые изменяют экспрессию или осуществляют его инактивацию, ферментную инженерию, направленную эволюцию, конструирование на основе известной информации, методы случайного мутагенеза, перестановку генов, оптимизацию по кодонам и т.п. Методы генной инженерии известны специалистам в данной области.

[0084] Используемые здесь термины «ковалентная связь», «ковалентно присоединенный», «ковалентно связанный», «ковалентно сцепленный», «ковалентно соединенный» и «молекулярная связь» являются синонимами и относятся к химической связи, которая включает разделение электронных пар между атомами. Примеры ковалентных связей включают, но не ограничиваются ими, фосфодиэфирные связи, фосфортиоатные связи, дисульфидные связи и пептидные связи (-CO-NH-).

[0085] Используемые здесь термины «нековалентная связь», «нековалентно присоединенный», «нековалентно связанный», «нековалентно сцепленный», «нековалентно соединенный» и «нековалентное взаимодействие» являются синонимами и относятся к любой относительно слабой химической связи, которая не включает разделение пар электронов. Множество нековалентных связей часто стабилизируют конформацию макромолекул и опосредуют специфические взаимодействия между молекулами. Примеры нековалентных связей включают, но не ограничиваются ими, водородные связи, ионные взаимодействия (например, Na+Cl-), ван-дер-ваальсовы взаимодействия и гидрофобные связи.

[0086] Используемые здесь термины «водородная связь», «образование пары водород-основание» и «водородные связи» являются синонимами и относятся к канонической водородной связи и неканонической водородной связи, включая, но не ограничиваясь ими, «пары оснований Уотсона-Крика с водородными связями» (пары оснований с водородными связями W-C или водородные связи W-C); «пары оснований Хугстена с водородными связями» (водородная связь Хугстена); и «пары оснований с неоднозначным спариванием и с водородными связями» (водородные связи с неоднозначным спариванием). Водородная связь W-C, включая обратную водородную связь W-C, относится к спариванию оснований пурин-пиримидин, например, аденин:тимин, гуанин:цитозин и урацил:аденин. Водородная связь Хугстена, включая обратную водородную связь Хугстена, относится к разновидности спаривания оснований в нуклеиновых кислотах, где два нуклеооснования, по одному на каждой цепи, удерживаются вместе водородными связями в большой бороздке. Эта водородная связь, не являющаяся водородной связью W-C, позволяет третьей цепи наматываться вокруг дуплекса и образовывать трехцепочечные спирали. Водородные связи с неоднозначным спариванием, включая обратную водородную связь с неоднозначным спариванием, относится к спариванию двух нуклеотидов в молекулах РНК, которые не подчинаются правилам спаривания оснований Уотсона-Крика. Существует четыре основные пары оснований с неоднозначным спариванием: гуанин:урацил, инозин (гипоксантин):урацил, инозин:аденин и инозин:цитозин. Правила канонической водородной связи и неканонической водородной связи известны специалистам в данной области (см., например, The RNA World, Third Edition (Cold Spring Harbor Monograph Series), R.F. Gesteland, Cold Spring Harbor Laboratory Press (2005), ISBN 978-0879697396; The RNA World, Second Edition (Cold Spring Harbor Monograph Series), R.F. Gesteland, et al., Cold Spring Harbor Laboratory Press (1999), ISBN 978-0879695613; The RNA World (Cold Spring Harbor Monograph Series), R.F. Gesteland, et al., Cold Spring Harbor Laboratory Press (1993), ISBN 978-0879694562 (см., например, Appendix 1: Structures of Base Pairs Involving at Least Two Hydrogen Bonds, I. Tinoco); Principles of Nucleic Acid Structure, W. Saenger, Springer International Publishing AG (1988), ISBN 978-0-387-90761-1; Principles of Nucleic Acid Structure, First Edition, S. Neidle, Academic Press (2007), ISBN 978-01236950791).

[0087] Используемые здесь термины «соединять», «соединенный» и «соединяющий» являются синонимами и относятся к ковалентной связи или нековалентной связи между двумя макромолекулами (например, полинуклеотидами, белками и т.п.).

[0088] Используемые здесь термины «последовательность нуклеиновой кислоты», «нуклеотидная последовательность» и «олигонуклеотид» являются синонимами и относятся к полимерной форме нуклеотидов. Используемый здесь термин «полинуклеотид» означает полимерную форму нуклеотидов, которая имеет один 5’-конец и один 3'-конец и может содержать одну или более последовательностей нуклеиновых кислот. «Кольцевой полинуклеотид» означает полинуклеотид, имеющий ковалентную связь между его 5'-концом и его 3'-концом, и таким образом способствующую образованию кольцевого полинуклеотида. Нуклеотиды могут представлять собой дезоксирибонуклеотиды (ДНК), рибонуклеотиды (РНК), их аналоги или комбинациями (например, как описано выше для руководящих полинуклеотидов) и могут иметь любую длину. Полинуклеотиды могут выполнять любую функцию и могут иметь различные вторичные и третичные структуры. Эти термины охватывают известные аналоги природных нуклеотидов и нуклеотидов, которые модифицированы по своим основаниям, сахарам и/или фосфатным группам. Аналоги конкретного нуклеотида обладают одинаковой специфичностью при образовании пары оснований (например, аналог пары оснований A с T). Полинуклеотид может содержать один модифицированный нуклеотид или множество модифицированных нуклеотидов. Примерами модифицированных нуклеотидов являются, но не ограничиваются ими, фторированные нуклеотиды, метилированные нуклеотиды и аналоги нуклеотидов. Структура нуклеотида может быть модифицирована до или после сборки полимера. После полимеризации, полинуклеотиды могут быть дополнительно модифицированы, например, посредством конъюгирования с компонентом для мечения или с компонентом для связывания с мишенью. Нуклеотидная последовательность может включать ненуклеотидные компоненты. Этот термин также охватывает нуклеиновые кислоты, содержащие модифицированные остатки или связи остова, которые являются синтетическими, встречающимися в природе и/или не встречающимися в природе, и обладают такими же связывающими свойствами, как и эталонный полинуклеотид (например, ДНК или РНК). Примеры таких аналогов включают, но не ограничиваются ими, фосфортиоаты, фосфорамидаты, метилфосфонаты, хиральные метилфосфонаты, 2-O-метил-рибонуклеотиды, пептид-нуклеиновые кислоты (PNA), нуклеозиды блокированнлой нуклеиновой кислоты (LNA™) (Exiqon, Inc., Woburn, MA), гликоль-нуклеиновую кислоту, мостиковые нуклеиновые кислоты и морфолиноструктуры.

[0089] Пептид-нуклеиновые кислоты (PNA) представляют собой синтетические гомологи нуклеиновых кислот, в которых полинуклеотидный фосфатно-сахарный остов заменен гибким псевдопептидным полимером, а нуклеооснования связаны с полимером. PNA обладают способностью гибридизоваться с комплементарными последовательностями РНК и ДНК с высокой аффинностью и специфичностью.

[0090] В фосфортиоатных нуклеиновых кислотах, фосфортиоатная (PS) связь заменяет атом серы на немостиковый кислород в полинуклеотидфосфатном остове. Эта модификация делает межнуклеотидную связь устойчивой к расщеплению нуклеазой. В некоторых вариантах осуществления изобретения, фосфортиоатные связи вводятся между последними 3-5 нуклеотидами у 5'-конца или у 3'-конца полинуклеотидной последовательности для ингибирования разложения экзонуклеазой. Размещение фосфортиоатных связей по всему олигонуклеотиду также позволяет уменьшить степень разложения эндонуклеазами.

[0091] Треозо-нуклеиновая кислота (TNA) представляет собой искусственный генетический полимер. Структура остова TNA включает повторяющиеся треозные сахара, связанные фосфодиэфирными связями. Полимеры TNA устойчивы к расщеплению нуклеазами. TNA могут подвергаться самосборке за счет водородных связей пар оснований в дуплексные структуры.

[0092] Инверсии связи могут быть введены в полинуклеотиды с использованием «обратных фосфорамидитов» (см., например, www.ucalgary.ca/dnalab/synthesis/-modifications/linkages). 3’-3’-связь на конце полинуклеотида защищает полинуклеотид от расщепления экзонуклеазой за счет создания олигонуклеотида, имеющего два 5'-ОН-конца, но не имеющего 3'-ОН-конца. Обычно, такие полинуклеотиды имеют фосфорамидитные группы в положении 5'-OH и защитную диметокситритильную (DMT) группу в положении 3'-OH. Обычно, защитная группа DMT находится на 5'-OH, а фосфорамидит находится на 3'-OH.

[0093] Полинуклеотидные последовательности представлены здесь в обычной ориентации от 5’- до 3’-конца, если это не оговорено особо.

[0094] Используемый здесь термин «идентичность последовательностей» обычно относится к процентной идентичности нуклеотидных оснований или аминокислот при сравнении первого полинуклеотида или полипептида со вторым полинуклеотидом или полипептидом с использованием алгоритмов, имеющих различные весовые параметры. Идентичность последовательностей между двумя полинуклеотидами или двумя полипептидами может быть определена путем выравнивания последовательностей различными методами и с использованием компьютерных программ (например, BLAST, CS-BLAST, PSI-BLAST, FASTA, HMMER, L-ALIGN и т.п.), доступными на web-сайтах, включая, но не ограничиваясь ими, GENBANK (www.ncbi.nlm.nih.gov/genbank/) и EMBL-EBI (www.ebi.ac.uk). Идентичность последовательностей между двумя полинуклеотидами или двумя полипептидными последовательностями обычно вычисляют с использованием стандартных параметров по умолчанию с применением различных методов или компьютерных программ. Используемая здесь высокая степень идентичности последовательностей двух полинуклеотидов или двух полипептидов обычно составляет приблизительно от 90% до 100%, например, приблизительно 90% или более, предпочтительно приблизительно 95% или более, а еще более предпочтительно, приблизительно 98% или более. Используемая здесь умеренная степень идентичности последовательностей двух полинуклеотидов или двух полипептидов обычно составляет приблизительно от 80% до 85%, например, приблизительно 80% или более, а предпочтительно приблизительно 85%. Используемая здесь низкая степень идентичности последовательностей двух полинуклеотидов или двух полипептидов обычно составляет приблизительно от 50% до 75%, например, приблизительно 50%, предпочтительно приблизительно 60%, а еще более предпочтительно, приблизительно 75%. Так, например, белок Cas (например, Cse2, Cas5, Cas6, Cas7 и/или Cas8 типа I-E), содержащий аминокислотные замены, может иметь низкую степень идентичности последовательностей, умеренную степень идентичности последовательностей или высокую степень идентичности последовательностей по своей длине по сравнению с эталонным белком Cas (например, Cse2, Cas5, Cas6, Cas7 и/или Cas8 типа I-E дикого типа, соответственно). В качестве другого примера, руководящий полинуклеотид может иметь низкую степень идентичности последовательностей, умеренную степень идентичности последовательностей или высокую степень идентичности последовательностей по своей длине по сравнению с эталонным руководящим полинуклеотидом дикого типа, который образует комплексы с эталонными белками Cas (например, руководящий полинуклеотид, который образует комплекс с Cse2, Cas5, Cas6, Cas7 и/или Cas8 типа I-E).

[0095] Используемые здесь термины «гибридизация», «гибридизовать» или «гибридизующий» относятся к способу объединения двух комплементарных одноцепочечных молекул ДНК или РНК с образованием одной двухцепочечной молекулы (ДНК/ДНК, ДНК/РНК, РНК/РНК) за счет спаривания оснований посредством водородных связей. Жесткость гибридизации обычно определяется температурой гибридизации и концентрацией соли буфера для гибридизации; например, высокая температура и низкое содержание соли обеспечивают условия гибридизации высокой жесткости. Примерами интервалов концентраций соли и интервалов температур для различных условий гибридизации являются: высокая жесткость, приблизительно от 0,01М до приблизительно 0,05М соли, температура гибридизации на 5-10°C ниже Tm; умеренная жесткость, приблизительно от 0,16М до приблизительно 0,33М соли, температура гибридизации на 20-29°C ниже Tm; и низкая жесткость, приблизительно от 0,33М до приблизительно 0,82М соли, температура гибридизации на 40-48°C ниже Tm. Tm дуплексных последовательностей нуклеиновых кислот вычисляют стандартными методами, хорошо известными специалистам в данной области (см., например, Maniatis, T., et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: New York (1982); Casey, T. et al., Nucleic Acids Res.4: 1539-1552 (1977); Bodkin, DK, et al., J. Virological Methods 10: 45-52 (1985); Wallace, RB, et al., Nucleic Acids Res. 9: 879-894 (1981)). Алгоритмы предсказания для оценки Tm также широко известны. Условия высокой жесткости для гибридизации обычно означают условия, при которых полинуклеотид, комплементарный последовательности-мишени, преимущественно гибридизуется с последовательностью-мишенью и, по существу, не гибридизуется с нецелевыми последовательностями. Обычно, условия гибридизации имеют умеренную жесткость, а предпочтительно высокую жесткость.

[0096] Используемый здесь термин «комплементарность» относится к способности последовательности нуклеиновой кислоты образовывать водородную(ые) связь(и) с другой последовательностью нуклеиновой кислоты (например, посредством канонического спаривания оснований Уотсона-Крика). Процент комплементарности означает процент остатков в последовательности нуклеиновой кислоты, которые могут образовывать водородные связи со второй последовательностью нуклеиновой кислоты. Если две последовательности нуклеиновой кислоты имеют 100% комплементарность, то эти две последовательности считаются полностью комплементарными, то есть все смежные остатки первого полинуклеотида связаны водородными связями с одинаковым числом смежных остатков во втором полинуклеотиде.

[0097] Используемый здесь термин «связывание» означает нековалентное взаимодействие между макромолекулами (например, между белком и полинуклеотидом, между полинуклеотидом и полинуклеотидом, между белком и белком и т.п.). Такое нековалентное взаимодействие также называется «ассоциацией» или «взаимодействием» (например, если первая макромолекула взаимодействует со второй макромолекулой, то первая макромолекула связывается со второй макромолекулой нековалентным образом). Некоторые части связывающего взаимодействия могут быть последовательность-специфическими (термины «последовательность-специфическое связывание», «последовательность-специфически связывается», «сайт-специфическое связывание» и «сайт-специфически связывается» используются здесь как синонимы). Используемый здесь термин «последовательность-специфическое связывание» обычно означает, что один или более руководящих полинуклеотидов, способных образовывать комплекс с белками субъединицы CRISPR-Cas типа I (например, Cse2, Cas5, Cas6, Cas7 и Cas8), сообщает белку способность связываться предпочтительно с последовательностью нуклеиновой кислоты (например, последовательностью ДНК), содержащей последовательность нуклеиновой кислоты-мишени (например, последовательности ДНК-мишени), а не со второй последовательностью нуклеиновой кислоты (например, второй последовательностью ДНК) без последовательности, связывающейся с нуклеиновой кислотой-мишенью (например, без последовательности, связывающейся с ДНК-мишенью). Все компоненты связывающего взаимодействия не обязательно должны быть последовательность-специфическими, например, контакты белка с фосфатными остатками в остове ДНК. Связывающие взаимодействия можно охарактеризовать константой диссоциации (Kd). «Аффинность связывания» относится к силе связывающего взаимодействия. Повышенная аффинность связывания коррелирует с более низким Kd.

[0098] В контексте настоящего описания считается, что эффекторные комплексы «нацелены» на полинуклеотид, если такой комплекс связывается с полинуклеотидом или расщепляет полинуклеотид в последовательности-мишени нуклеиновой кислоты в полинуклеотиде.

[0099] Используемый здесь термин «двухцепочечный разрыв» (DSB) относится к разрывам обеих цепей двухцепочечного сегмента ДНК. В некоторых случаях, если происходит такой разрыв, то можно сказать, что одна цепь имеет «липкий конец», где нуклеотиды являются открытыми и не связаны водородными связями с нуклеотидами на другой цепи. В других случаях может образовываться «тупой конец», когда обе нити имеют пары оснований, полностью спаренные друг с другом.

[00100] Используемые здесь термины «донорный полинуклеотид», «донорный олигонуклеотид» и «донорная матрица» являются синонимами и могут представлять собой двухцепочечный полинуклеотид (например, ДНК), одноцепочечный полинуклеотид (например, ДНК или РНК) или их комбинацию. Донорные полинуклеотиды могут содержать гомологические ветви, фланкирующие последовательность вставки (например, DSB в ДНК). Плечи гомологии на каждой стороне могут различаться по их длине (например, 1-50 оснований, 50-100 оснований, 100-200 оснований, 200-300 оснований, 300-500 оснований, 500-1000 оснований). Плечи гомологии могут быть симметричными или асимметричными по длине. Параметры для конструирования и получения донорных полинуклеотидов хорошо известны специалистам в данной области (см., например, Ran, F., et al., Nature Protocols 8: 2281-2308 (2013); Smithies, O., et al., Nature 317: 230-234 (1985); Thomas, K. et al., Cell 44: 419-428 (1986); Wu, S. et al., Nature Protocols 3: 1056-1076 (2008); Singer, B., et al., Cell 31: 25-33 (1982); Shen, P., et al., Genetics 112: 441-457 (1986); Watt, V., et al., Proc. Natl. Acad. Sci. USA 82: 4768-4772 (1985); Sugawara, N., et al., J. Mol. Bio. 12: 563-575 (1992); Rubnitz, J., et al., J. Mol. Bio. 4: 2253-2258 (1984); Ayares, D., et al., Proc. Natl. Acad. Sci. USA 83: 5199-5203 (1986); Liskay, R., et al., Genetics 115: 161-167 (1987)). В некоторых вариантах осуществления изобретения, донорный полинуклеотид включает химерный антигенный рецептор (например, CAR).

[00101] Используемые здесь термины «рецептор химерного антигена» и «CAR» являются синонимами и относятся к молекуле полипептида, созданной в лаборатории и обычно содержащей по меньшей мере два компонента: внеклеточный антиген-распознающий домен (также называемый доменом связывания с мишенью или внеклеточным лиганд-связывающим доменом) и внутриклеточный домен активации (например, содержащий один или более внутриклеточных сигнальных доменов и обычно один или более костимулирующих сигнальных доменов). CAR может также содержать шарнирный домен и трансмембранный домен. Типичный полипептид CAR имеет следующую структуру: N-конец-внеклеточный-[антиген-распознающий домен-шарнирный домен]-трансмембранный-[трансмембранный домен]-внутриклеточный-[внутриклеточный домен активации]-C конец; или N-конец-внутриклеточный-[внутриклеточный домен активации]-трансмембранный-[трансмембранный домен]-внеклеточный-[антиген-распознающий домен- шарнирный домен]-C конец.

[00102] Примеры внеклеточных антиген-распознающих доменов включают молекулы, используемые для связывания с антигеном, и включают, но не ограничиваются ими, одноцепочечный вариабельный фрагмент иммуноглобулина (scFv), антигенсвязывающий фрагмент (Fab; обычно область антитела, которая связывается с антигеном и состоит из одного константного домена и одного вариабельного домена каждой из тяжелой и легкой цепей), наноантитела, одноцепочечные антитела семейства Верблюдовых или акул, сконструированные белок-связывающие каркасы (например, DARP-ины и центирины), или природный(е) лиганд(ы), который(е) связывается(ются) с их родственным(и) рецептором(ами).

[00103] Примеры шарнирных доменов включают, но не ограничиваются ими, полипептидные шарниры различной длины (например, в одну или более аминокислот), шарнирную область CD8-альфа, шарнирную область CD28, шарнирную область IgG4 и их комбинации.

[00104] Примеры трансмембранных доменов включают, но не ограничиваются ими, трансмембранную область, происходящую от трансмембранного белка, такого как CD8-альфа, CD28, DAP10, DAP12, NKG2D и их комбинации.

[00105] Примеры внутриклеточных доменов активации включают, но не ограничиваются ими, внутриклеточный сигнальный домен CD28, 4-1BB, CD3-дзета, OX40, 2B4, DAP10, DAP12, усеченные и мутированные сигнальные домены (например, с мутациями и усечениями в трех доменах ITAM CD3-дзета) или другие внутриклеточные сигнальные домены, и их комбинации.

[00106] Если внеклеточный лиганд-связывающий домен связывается с когнатным лигандом, то внутриклеточный сигнальный домен CAR активирует лимфоциты (описание CAR-T-клеток см., например, Brudno, J., et al., Nature Rev. Clin. Oncol.15: 31-46 (2018); Maude, S., et al., N. Engl. J. Med. 371: 1507-1517 (2014); Sadelain, M., et al., Cancer Disc. 3: 388-398 (2013); патент США № 7446190; патент США № 8399645) (описание CAR-NK-клеток см., например, Rezvani, K., et al., Mol. Ther., 25 : 1769-1781 (2017); Siegler, E., et al., Cell Stem Cell. 23: 160-161 (2018); Li Y. et al., Stem Cell. 23: 181-192 (2018); Lin, C. et al., Biochim. Biophys. Acta. Rev. Cancer. 1869: 200-215 (2018); Hu, Y. et al., Acta. Pharmacol. Sin. 39: 167-176 (2018); Fang, F. et al., Semin. Immunol. 31:37-54 (2017); Glienke, W. et al. Front Pharmacol. 6:21 (2015)).

[00107] В Таблице 2 представлены иллюстративные клеточные мишени и scFv-связывающие белки, которые связываются с клеточными мишенями. Такие scFv-связывающие белки или их части могут быть включены в конструкции CAR.

[00108]

Таблица 2
Репрезентативные клеточные мишени и белки, связывающиеся с scFv CAR
Клеточная мишень Белок, связывающийся с scFv CAR
CD19 анти-CD19 антитело
CD20 анти-CD20 антитело
CD22 анти-CD22 антитело
CD30 анти-CD30 антитело
CD33 анти-CD33 антитело
CD37 анти-CD37 антитело
CD43 анти-CD43 антитело
CD138 анти-CD138 антитело
CD171/L1CAM анти-CD171 антитело
CEA анти-CEA антитело
CD123 анти-CD123 антитело
Рецептор фактора активации B-клеток (BAFF-R) [также называемый членом суперсемейства рецепторов фактора некроза опухоли 13C (TNFRSF13C); рецептор BLyS 3 (BR3); и CD268 Анти-BAFF-R антитело
Рецептор IL13 альфа IL13
Рецептор эпидермального фактора роста Антитело против рецептора эпидермального фактора роста
EFGRvIII анти-EFGRvIII антитело
ErbB анти-ErbB антитело
FAP анти-FAP антитело
GD2 анти-GD2 антитело
Глипикан 3 Антитело против глипикана 3
Her2 анти-Her2 антитело
Мезотелин Анти против мезотелина
Белки ULBP и MICA/B NKG2D
PD1 анти-PD1 антитело
MUC1 анти-MUC1 антитело
VEGF2 анти-VEGF2 антитело
SLAMF7 анти-SLAMF7 антитело
BCMA анти-BCMA антитело
WT1 анти-WT1 антитело
MUC16 анти-MUC1 антитело 6
LewisY/LeY анти-LeY антитело
FLT3 Лиганд FLT3 или анти-FLT3 антитело
ROR1 анти-ROR1 антитело
Клаудин 18 Антитело против клаудина 18
Клаудин 6 Антитело против клаудина 6

[00109] Используемый здесь термин «гомологичная репарация» (HDR) относится к репарации ДНК, которая происходит в клетках, например, во время репарации DSB в гДНК. HDR требует гомологии нуклеотидных последовательностей и использует донорный или матричный полинуклеотид для репарации последовательности, в которой происходит DSB (например, в последовательности ДНК-мишени). Донорный полинуклеотид обычно имеет необходимую гомологию последовательности с последовательностью, фланкирующей DSB, а поэтому донорный полинуклеотид может служить подходящей матрицей для репарации. HDR приводит к передаче генетической информации, например, от донорного полинуклеотида к целевой последовательности ДНК. HDR приводит к переносу генетической информации, например, из донорного полинуклеотида в последовательность ДНК-мишени. HDR может приводить к изменению последовательности ДНК-мишени (например, к инсерции, делеции или мутации), если донорная полинуклеотидная последовательность отличается от последовательности ДНК-мишени и часть или весь донорный полинуклеотид включены в последовательность ДНК-мишени. В некоторых вариантах осуществления изобретения, весь донорный полинуклеотид, часть донорного полинуклеотида или копия донорного полинуклеотида интегрируется в сайт последовательности ДНК-мишени. Так, например, донорный полинуклеотид может быть использован для репарации разрыва в последовательности ДНК-мишени, где репарация приводит к передаче генетической информации от донорного полинуклеотида в сайте или в непосредственной близости от разрыва в ДНК. Соответственно, новая генетическая информация может быть встроена в последовательность ДНК-мишени или скопирована в эту последовательность.

[00110] «Геномная область» представляет собой сегмент хромосомы в геноме клетки-хозяина, который присутствует по обе стороны от сайта последовательности нуклеиновой кислоты-мишени или, альтернативно, также включает часть сайта последовательности нуклеиновой кислоты-мишени. Плечи гомологии донорного полинуклеотида обладают гомологией, достаточной для гомологичной рекомбинации с соответствующими геномными областями. В некоторых вариантах осуществления изобретения, плечи гомологии донорного полинуклеотида обладают значительной гомологией последовательности с геномной областью, непосредственно фланкирующей сайт последовательности нуклеиновой кислоты-мишени; при этом известно, что плечи гомологии могут быть сконструированы так, чтобы они имели достаточную гомологию с геномными областями, расположенными далеко от сайта последовательности нуклеиновой кислоты-мишени.

[00111] Используемый здесь термин «негомологичное присоединение по концам» (NHEJ) относится к репарации DSB в ДНК посредством прямого лигирования одного конца разрыва с другим концом разрыва без участия донорного полинуклеотида. NHEJ представляет собой путь репарации ДНК, доступный клеткам для репарации ДНК без использования репарационной матрицы. NHEJ, в отсутствии донорного полинуклеотида часто приводит к случайной инсерции или делеции нуклеотидов в сайте DSB.

[00112] «Присоединение по концам, опосредуемое микрогомологией» (MMEJ) представляет собой путь репарации DSB в гДНК. MMEJ включает делеции, фланкирующие DSB, и выравнивание микрогомологичных последовательностей внутри сайта разрыва перед присоединением. MMEJ определяется генетически и требует активности, например, CtIP, поли(АДФ-рибозо)полимеразы 1 (PARP1), ДНК-полимеразы-тета (Pol θ), ДНК-лигазы 1 (Lig 1) или ДНК-лигазы 3 (Lig 3). Дополнительные генетические компоненты известны специалистам в данной области (см., например, Sfeir, A., et al., Trends in Biochemical Sciences 40: 701-714 (2015)).

[00113] Используемый здесь термин «репарация ДНК» включает любой процесс, посредством которого клеточный аппарат восстанавливает повреждение молекулы ДНК, содержащейся в клетке. Репарированные повреждения могут включать одноцепочечные разрывы или DSB. Существует по меньшей мере три механизма репарации DSB: HDR, NHEJ и MMEJ. Используемый здесь термин «репарация ДНК» также означает репарацию ДНК в результате модификации человеком или с помощью устройства, где локус-мишень был модифицирован, например, путем инсерции, делеции или замены нуклеотидов, которые представляют собой формы редактирования генома.

[00114] Используемый здесь термин «рекомбинация» означает процесс обмена генетической информацией между двумя полинуклеотидами.

[00115] Используемые здесь термины «регуляторные последовательности», «регуляторные элементы» и «элементы регуляции» являются синонимами и относятся к полинуклеотидным последовательностям, расположенным выше (5'-некодирующим последовательностям), внутри или ниже (3'-нетранслируемым последовательностям) экспрессируемого полинуклеотида-мишени. Регуляторные последовательности влияют, например, на время транскрипции; на количество или уровень транскрипции; на процессинг или стабильность РНК; и/или на трансляцию родственной структурной нуклеотидной последовательности. Регуляторные последовательности могут включать последовательности, связывающиеся с активатором, энхансеры, интроны, последовательности распознавания полиаденилирования, промоторы, сайты инициации транскрипции, последовательности, связывающиеся с репрессором, структуры стебель-петля, последовательности инициации трансляции, внутренние сайты связывания с рибосомой (IRES), лидерные последовательности трансляции, последовательности терминации транскрипции (например, сигналы полиаденилирования и последовательности поли-U), последовательности терминации трансляции, сайты связывания с праймерами и т.п.

[00116] Регуляторные элементы включают элементы, которые регулируют конститутивную, индуцибельную и репрессируемую экспрессию нуклеотидной последовательности в клетках-хозяевах многих типов, и элементы, которые регулируют экспрессию нуклеотидной последовательности только в определенных клетках-хозяевах (например, тканеспецифические регуляторные последовательности). В некоторых вариантах осуществления изобретения, вектор содержит один или более промоторов pol III, один или более промоторов pol II, один или более промоторов pol I или их комбинации. Примеры промоторов pol III включают, но не ограничиваются ими, промоторы U6 и H1. Примеры промоторов pol II включают, но не ограничиваются ими, промотор LTR ретровируса саркомы Рауса (RSV) (необязательно с энхансером RSV), промотор цитомегаловируса (CMV) (необязательно с энхансером CMV; см., например, Boshart, M., et al., Cell 41: 521-530 (1985)), промотор SV40, промотор дигидрофолатредуктазы, промотор β-актина, промотор фосфоглицеринкиназы (PGK) и промотор EF1α, а также сконструированные искусственные промоторы (например, промотор MND и промотор CAG). Специалистам в данной области очевидно, что конструкция экспрессионного вектора может зависеть от таких факторов, как выбор клетки-хозяина, которая должна быть трансформирована; желаемый уровень экспрессии и т.п. Вектор может быть введен в клетки-хозяева для получения транскриптов РНК, белков или пептидов, включая гибридные белки или пептиды, кодируемые описанными здесь последовательностями нуклеиновой кислоты.

[00117] Используемый здесь термин «ген» означает полинуклеотидную последовательность, содержащую экзон(ы) и родственные регуляторные последовательности. Ген может дополнительно содержать интрон(ы) и/или нетранслируемую(ые) область(и) (UTR).

[00118] Используемый здесь термин «функционально присоединенный» относится к полинуклеотидным последовательностям или аминокислотным последовательностям, находящимся в функциональной взаимосвязи друг с другом. Так, например, регуляторные последовательности (например, промотор или энхансер) «функционально присоединены» к полинуклеотиду, кодирующему генный продукт, если регуляторные последовательности регулируют или вносят вклад в модуляцию транскрипции полинуклеотида. Функционально присоединенные регуляторные элементы обычно являются смежными с кодирующей последовательностью. Однако энхансеры могут функционировать даже в том случае, когда они отделены от промотора на несколько тысяч оснований или более. Кроме того, мультицистронные конструкции могут включать множество кодирующих последовательностей, которые используют только один промотор, включая саморасщепляющийся пептид 2A, элемент IRES и т.п. Соответственно, некоторые регуляторные элементы могут быть функционально присоединены к полинуклеотидным последовательностям, но не являются смежными с полинуклеотидной последовательностью. Аналогичным образом, элементы регуляции трансляции вносят свой вклад в модуляцию экспрессии белка из полинуклеотида.

[00119] Используемый здесь термин «экспрессия» означает транскрипцию полинуклеотида из матрицы ДНК, приводящей, например, к образованию матричной РНК (мРНК) или другого транскрипта РНК (например, некодирующего, такого как структурные или каркасные РНК). Этот термин также относится к процессу, посредством которого транскрибированная мРНК транслируется в пептиды, полипептиды или белки. Транскрипты и кодируемые полипептиды могут называться общим термином «генный(е) продукт(ы)». Экспрессия может включать сплайсинг мРНК в эукариотической клетке, если полинуклеотид происходит от гДНК.

[00120] «Кодирующая последовательность» или последовательность, которая «кодирует» выбранный полипептид, представляет собой молекулу нуклеиновой кислоты, которая транскрибируется (в случае ДНК) и транслируется (в случае мРНК) в полипептид in vitro или in vivo, если она находится под контролем соответствующих регуляторных последовательностей. Границы кодирующей последовательности определяются старт-кодоном на 5'-конце и стоп-кодоном трансляции на 3'-конце.

[00121] Используемый здесь термин «искусственный активатор транскрипции (ATA)» или «искусственный фактор транскрипции (ATF)», означает комплекс, способный осуществлять рекрутинг холофермента РНК-полимеразы II в гены, с которыми он связязивается, вызывая тем самым эктопическую экспрессию представляющего интерес гена. Такие активаторы включают по меньшей мере два компонента: (1) каталитически неактивный полинуклеотид-связывающий домен, который либо непосредственно распознает когнатные нуклеотидные последовательности и может связываться с этими последовательностями, либо полинуклеотид-связывающий домен, который направляется к таким последовательностям для связывания (например, нуклеопротеиновый комплекс, содержащий домен, связывающийся с нуклеиновой кислотой, и руководящий домен, как описано в настоящей заявке); и (2) домен активации (также называемый «эффекторным доменом»), который взаимодействует с множеством белков, участвующих в механизме транскрипции для усиления транскрипции.

[00122] «Каталитически неактивный полинуклеотид-связывающий домен» означает молекулу, которая связывается с сайтом нуклеиновой кислоты-мишени, связанной со связывающим доменом, но не расщепляет этот сайт. Репрезентативные примеры таких доменов подробно описаны в настоящей заявке.

[00123] Используемый здесь термин «модулировать» относится к изменению количества, степени или величины функции. Так, например, описанный здесь нуклеопротеиновый комплекс CRISPR типа I может модулировать активность промоторной последовательности посредством связывания с последовательностью нуклеиновой кислоты-мишени, расположенной в положении промотора или сайта инициации транскрипции или сайта-регулятора или рядом с ними. В зависимости от действия, происходящего после связывания, нуклеопротеиновый комплекс CRISPR типа I может индуцировать, усиливать, подавлять или ингибировать транскрипцию гена, функционально присоединенного к промоторной последовательности. Таким образом, «модуляция» экспрессии гена включает активацию гена и репрессию гена.

[00124] Модуляция может быть проанализирована путем определения любого свойства, на которое прямо или опосредовано влияет экспрессия гена-мишени. Такие свойства включают, например, изменения уровней РНК или белка, активности белка, уровней продукта, экспрессии гена или уровня активности репортерных генов. Соответственно, термины «модуляция экспрессии», «ингибирование экспрессии» и «активация экспрессии» гена могут относиться к способности нуклеопротеинового комплекса CRISPR типа I изменять, активировать или ингибировать транскрипцию гена.

[00125] Функция (например, ферментативная функция) может модулироваться с повышением (например, увеличиваться, усиливаться, амплифицироваться или ускоряться) или модулироваться с понижением (например, уменьшаться, ослабляться, снижаться или ингибироваться). В одном варианте осуществления изобретения, связывание белка mCas3 с одноцепочечной ДНК (оцДНК) или связывание/гидролиз АТФ под действием белка mCas3 могут быть модулированы с повышением или с понижением по сравнению с соответствующим белком wtCas3.

[00126] Используемые здесь термины «вектор» и «плазмида» означают полинуклеотидный носитель для введения генетического материала в клетку. Векторы могут быть линейными или кольцевыми. Векторы могут содержать последовательность репликации, способную влиять на репликацию вектора в подходящей клетке-хозяине (например, ориджин репликации). После трансформации подходящего хозяина, вектор может реплицироваться и функционировать независимо от генома хозяина или интегрироваться в геном хозяина. Конструкция вектора зависит, помимо прочего, от предполагаемого применения и типа клетки-хозяина для вектора, и конструирование вектора согласно изобретению для конкретного применения в клетке-хозяина находится в пределах компетенции специалиста в данной области. Существуют четыре основных типа векторов, а именно, плазмиды, вирусные векторы, космиды и искусственные хромосомы. Обычно векторы содержат ориджин репликации, сайт множественного клонирования и/или селективный маркер. Экспрессионный вектор обычно содержит экспрессионный кластер. Термин «рекомбинантный вирус» означает вирус, который был генетически изменен, например, путем добавления или встраивания конструкции гетерологичной нуклеиновой кислоты в вирусный геном или его часть.

[00127] Используемый здесь термин «экспрессионный кластер» означает полинуклеотидную конструкцию, созданную рекомбинантными методами или путем синтеза и содержащую регуляторные последовательности, функционально присоединенные к выбранному полинуклеотиду для облегчения экспрессии выбранного полинуклеотида в клетке-хозяине. Так, например, регуляторные последовательности могут облегчать транскрипцию выбранного полинуклеотида в клетке-хозяине или транскрипцию и трансляцию выбранного полинуклеотида в клетке-хозяине. Экспрессионный кластер может быть, например, интегрирован в геном клетки-хозяина или присутствовать в векторе с образованием экспрессионного вектора.

[00128] Используемый здесь термин «нацеливающий вектор» представляет собой конструкцию рекомбинантной ДНК, обычно содержащую адаптированные ветви ДНК, гомологичные гДНК, которые фланкируют элементы гена-мишени или последовательности нуклеиновой кислоты-мишени (например, DSB). Нацеливающий вектор включает донорный полинуклеотид. Элементы гена-мишени могут быть модифицированы различными способами, включая делеции и/или инсерции. Дефектный ген-мишень может быть заменен функциональным геном-мишенью или, в качестве альтернативы, функциональный ген может быть нокаутирован. Донорный полинуклеотид нацеливающего вектора содержит, но необязательно, селективный кластер, содержащий селективный маркер, который вводится в ген-мишень. Нацеливающие области (содержащие последовательности нуклеиновой кислоты-мишени), смежные с геном-мишенью или находящиеся внутри него, могут быть использованы для влияния на регуляцию экспрессии гена.

[00129] Используемый здесь термин «между» включает конечные значения в данном интервале (например, длина от 1 до 50 нуклеотидов включает 1-й нуклеотид и 50-й нуклеотид; длина от 5 до 50 аминокислот включает 5-ю аминокислоту и 50-ю аминокислоту).

[00130] Используемый здесь термин «аминокислота» (а.к.) относится к природным и синтетическим (неприродным) аминокислотам, включая аналоги аминокислот, модифицированные аминокислоты, пептидомиметики, глицин и оптические D- или L-изомеры.

[00131] Используемые здесь термины «пептид», «полипептид», «белок» и «белок субъедицы» являются синонимами и относятся к полимерам, состоящим из аминокислот. Полипептид может иметь любую длину. Он может быть разветвленным или линейным, может прерываться не аминокислотами и может содержать модифицированные аминокислоты. Эти термины также означают аминокислотный полимер, который был модифицирован, например, посредством ацетилирования, образования дисульфидной связи, гликозилирования, липидизации, фосфорилирования, ПЭГилирования, биотинилирования, перекрестного сшивания и/или конъюгирования (например, с компонентом или лигандом для мечения). Полипептидные последовательности представлены здесь в традиционной ориентации от N-конца до C-конца, если это не оговорено особо.

[00132] Полипептиды и полинуклеотиды могут быть получены с применением рутинных методов в области молекулярной биологии (см., папример, известные руководства, перечисленные выше). Кроме того, практически любой полипептид или полинуклеотид может быть получен из коммерчески доступных источников.

[00133] Используемые здесь термины «гибридный белок» и «химерный белок» относятся к одному белку, созданному путем присоединения двух или более белков, белковых доменов, белковых фрагментов или полипептидов с кольцевой пермутацией, которые в природе не встречаются вместе в одном белке. В некоторых вариантах осуществления изобретения, линкерный полинуклеотид может быть использован для связывания первого белка, белковых доменов или белковых фрагментов или полипептидов с кольцевой пермутацией со вторым белком, белковыми доменами, белковыми фрагментами или с полипептидами с кольцевой пермутацией. Так, например, гибридный белок может содержать белок CRISPR-Cas типа I (например, Cas8, Cas3) и функциональный домен из другого белка (например, FokI; см., например, патент США № 9885026). Модификация для включения таких доменов в гибридные белки может сообщать дополнительную активность сконструированным белкам CRISPR-Cas типа I. Такие активности могут включать нуклеазную активность, метилтрансферазную активность, деметилазную активность, ДНК-репарирующую активность, ДНК-повреждающую активность, дезаминирующую активность, дисмутазную активность, алкилирующую активность, депуринизирующую активность, окислительную активность, активность образования димера пиримидина, интегразную активность, транспозазную активность, рекомбиназную активность, полимеразную активность, лигазную активность, геликазную активность, фотолиазную активность, гликозилазную активность, ацетилтрансферазную активность, деацетилазную активность, киназную активность, фосфатазную активность, убихитинлигазную активность, деубихитинизирующую активность, аденилирующую активность, деаденилирующую активность, SUMOилирующую активность, деSUMOилирующую активность, рибозилирующую активность, дерибозилирующую активность и/или миристоилирующую активность или демиристоилирующую активность, которая модифицирует полипептид, ассоциированный с последовательностью нуклеиновой кислоты-мишени (например, с гистоном).

[00134] В некоторых вариантах осуществления изобретения, гибридный белок может содержать эпитопные метки (например, гистидиновые метки, метки НА, метки FLAG® (Sigma Aldrich, St. Louis, MO), метки Myc, метки сигнала ядерной локализации (NLS), SunTag), последовательности репортерного белка (например, глутатион-S-трансферазу, бета-галактозидазу, люциферазу, белок, флуоресцирующий в зеленом диапазоне спектра, белок, флуоресцирующий в голубом диапазоне спектра, белок, флуоресцирующий в желтом диапазоне спектра) и/или домены связывания последовательности нуклеиновой кислоты (например, ДНК-связывающий домен или РНК-связывающий домен).

[00135] Гибридный белок может также содержать домены-активаторы (например, факторы транскрипции теплового шока, активаторы NFKB) или репрессорные домены (например, домен KRAB). Как описано Lupo, A., et al., Current Genomics 14: 268-278 (2013), домен KRAB является сильным модулем репрессии транскрипции и расположен в аминоконцевой последовательности большинства белков «цинковых пальцев» C2H2 (см., например, Margolin, L, et al., Proc. Natl. Acad. Sci. USA 91: 4509-4513 (1994); Witzgall, R., et al., Proc. Natl. Acad. Sci. USA 91: 4514-4518 (1994)). Домен KRAB обычно связывается с ко-репрессорными белками и/или факторами транскрипции посредством белок-белковых взаимодействий, вызывая репрессию транскрипции генов, с которыми связываются белки цинковых пальцев KRAB (KRAB-ZFP) (см., например, Friedman, JR, et al., Genes & Development 10: 2067-2678 (1996)). В некоторых вариантах осуществления изобретения, линкерные последовательности нуклеиновой кислоты используют для связывания двух или более белков, белковых доменов или белковых фрагментов.

[00136] Используемый здесь термин «CASCADEa» (Cascade-активация) представляет собой способ или систему CRISPR, где этот способ или эта система активируют экспрессию гена, ассоциированного с локусом последовательности нуклеиновой кислоты-мишени комплекса Cascade RNP. В некоторых вариантах осуществления изобретения, один или более белков комплекса Cascade связаны с эффекторным доменом (например, VP16 или VP64), а комплекс Cascade RNP, содержащий гибридный и руководящий полинуклеотид, используется для рекрутинга эндогенных факторов транскрипции. В некоторых вариантах осуществления изобретения, руководящий полинуклеотид может быть присоединен у 5’- или 3’-конца к эффекторному домену нуклеотида, такому как MS2-связывающая РНК, которая также осуществляет рекрутинг факторов транскрипции.

[00137] Используемый здесь термин «CASCADEi» (Cascade-ингибирование) представляет собой способ или систему CRISPR, где этот способ или эта система CRISPR ингибирует экспрессию гена, ассоциированного с локусом последовательности нуклеиновой кислоты-мишени комплекса Cascade RNP (то есть комплекс Cascade RNP используется для подавления экспрессии гена). Для рекрутинга эндогенных факторов репрессии, один или более белков в комплексе Cascade обычно связаны с эффекторным доменом (например, KRAB). В некоторых вариантах осуществления изобретения, руководящий полинуклеотид может быть присоединен у 5’- или 3’-конца к эффекторному домену нуклеотида, который также осуществляет рекрутинг эндогенных эффекторных белков репрессии транскрипции.

[00138] Используемый здесь термин «фрагмент» означает часть молекулы. Фрагмент может представлять собой функциональную группу или часть молекулы со множеством функциональных групп (например, которые имеют общие структурные признаки). Термины «фрагмент» и «функциональная группа» обычно используются здесь как синонимы, однако, более конкретно, «функциональная группа» может относиться к части молекулы, которая обладает некоторым общим химическим свойством. Термин «часть» часто используется как структурное описание. В некоторых вариантах осуществления изобретения, 5'-конец, 3'-конец или 5'-конец и 3'-конец (например, ненативный 5'-конец и/или ненативный 3'-конец в первом стеблевом элементе) может включать один или более фрагментов.

[00139] Используемый здесь термин «адоптивная клетка» означает клетку, которая может быть генетически модифицирована для использования в клеточной терапии, например, для лечения рака и/или профилактики болезни «трансплантат против хозяина» (GvHD) и других нежелательных побочных эффектов клеточной терапии, таких как, но не ограничиваясь ими, цитокиновый шторм, онкогенные трансформации вводимого генетически модифицированного материала, неврологические расстройства и т.п. Адоптивные клетки включают, но не ограничиваются ими, стволовые клетки, индуцированные плюрипотентные стволовые клетки (iPSC), стволовые клетки пуповинной крови, лимфоциты, макрофаги, эритроциты, фибробласты, эндотелиальные клетки, эпителиальные клетки и клетки-предшественники поджелудочной железы.

[00140] Используемый здесь термин «клеточная терапия» относится к лечению заболевания или расстройства с использованием генетически модифицированных клеток. Генетические модификации могут быть введены описанными здесь способами, такими как способы, включающие использование вирусных векторов, нуклеофекцию, доставку путем «выстреливания» генов, сонопорацию, сжатие клеток, липофекцию или использование других химических веществ, пептидов, проникающих в клетки, и т.п.

[00141] Используемый здесь термин «адоптивная клеточная терапия (АКТ)» означает терапию, в которой используются генетически модифицированные адоптивные клетки, полученные от конкретного пациента, возвращаемые затем этому пациенту (терапия аутологическими клетками), или от неродственного донора (терапия аллогенными клетками) для лечения пациента. АКТ включает, но не ограничиваются ими, введение трансплантатов костного мозга, трансплантатов стволовых клеток, терапию Т-клетками, терапию CAR-Т-клетками и терапию природными клетками-киллерами (NK).

[00142] Используемый здесь термин «лимфоцит» означает лейкоцит (белую кровяную клетку), который является частью иммунной системы позвоночных. Термин «лимфоцит» также охватывает гемопоэтические стволовые клетки или индуцированные плюрипотентные стволовые клетки (iPSC), которые дают начало развитию лимфоидных клеток. Лимфоциты включают Т-клетки для развития клеточно-опосредованного цитотоксического адаптивного иммунитета, такие как цитотоксические CD4+- и/или CD8+-T-клетки; альфа/бета-Т-клетки и гамма/дельта-Т-клетки; регуляторные Т-клетки, такие как Treg-клетки; NK-клетки, которые вырабатывают клеточно-опосредованный цитотоксический врожденный иммунитет; В-клетки для вырабатывания гуморального адаптивного иммунитета, регулируемого антителами; NK/T-клетки; индуцированные цитокинами клетки-киллеры (клетки CIK); и антигенпрезентирующие клетки (АПК), такие как дендритные клетки. Лимфоцит может представлять собой клетку млекопитающего, такую как клетка человека (Homo sapiens; H. sapiens). Термин «лимфоцит» также охватывает генетически модифицированные Т-клетки и NK-клетки, модифицированные для продуцирования химерных антигенных рецепторов (CAR) на поверхности Т- или NK-клеток (CAR-T-клетки и CAR-NK-клетки). Эти CAR-T-клетки распознают специфически растворимые антигены или антигены на поверхности клетки-мишени, такой как поверхность опухолевой клетки, или на клетках в микроокружении опухоли.

[00143] Используемый здесь термин «лимфоцит» также охватывает Т-клетки, сконструированные на основе Т-клеточного рецептора (TCR), то есть генетически сконструированные для экспрессии одного или более специфических, природных или сконструированных Т-клеточных рецепторов, которые могут распознавать белок или (глико)липидные антигены клеток-мишеней, презентированных главным комплексом гистосовместимости (MHC). Небольшие фрагменты этих антигенов, такие как пептиды или жирные кислоты, перемещаются к поверхности клетки-мишени и презентируются Т-клеточным рецепторам как часть MHC. Связывание Т-клеточного рецептора с МНС, нагруженными антигеном, активирует лимфоцит.

[00144] Активация лимфоцитов происходит в том случае, когда лимфоциты запускаются посредством антиген-специфических рецепторов на клеточной поверхности. Это приводит к пролиферации и дифференцировке клеток в специализированные эффекторные лимфоциты. Такие «активированные» лимфоциты обычно характеризуются набором рецепторов на поверхности лимфоцита. Поверхностные маркеры активированных Т-клеток включают CD3, CD4, CD8, PD1, IL2R и другие. Активированные цитотоксические лимфоциты могут уничтожать клетки-мишени после связывания когнатных рецепторов на поверхности клеток-мишеней.

[00145] Используемый здесь термин «лимфоцит» также охватывает опухоль-инфильтрирующие лимфоциты (TIL). TIL представляют собой иммунные клетки, которые проникают в окружение опухоли и вокруг нее («микроокружение опухоли»). TIL обычно выделяют из опухолевых клеток и микроокружения опухоли и отбирают in vitro на высокую реактивность против опухолевых антигенов. TIL культивируют in vitro в условиях, которые устраняют влияние толерантности, существующее in vivo, а затем вводят индивидууму для лечения.

[00146] Т-клетки обычно имеют несколько подтипов, таких как «необученныее Т-клетки» (Tn), «стволовые клетки Т-клетки памяти» (Tscm), «центральные Т-клетки памяти» (Tcm), «эффекторные Т-клетки памяти» (Tern), «эффекторные Т-клетки» (Teff) и «регуляторные Т-клетки» (Treg). Каждая субпопуляция Т-клеток характеризуется набором маркеров клеточной поверхности.

[00147] Используемый здесь термин «аффинная метка» обычно означает одну или более групп, которые повышают аффинность связывания одной макромолекулы с другой, например, для облегчения образования сконструированного нуклеопротеинового комплекса CRISPR-Cas типа I. В некоторых вариантах осуществления изобретения, аффинная метка может быть использована для повышения аффинности связывания одного белка субъединицы Cas с другим белком субъединицы Cas (например, первого белка Cas7 со вторым белком Cas7). В некоторых вариантах осуществления изобретения, аффинная метка может быть использована для повышения аффинности связывания одного или более белков субъединицы Cas с когнатным руководящим полинуклеотидом. В некоторых вариантах осуществления изобретения, одну или более аффинных меток вводят у N-конца белковой последовательности субъединицы Cas, у C-конца последовательности белка субъединицы Cas в положение, расположенное между N-концом и C-концом последовательности белка субъединицы Cas, или их комбинации. В некоторых вариантах осуществления изобретения, один или более руководящих полинуклеотидов содержат аффинную метку, которая повышает аффинность связывания руководящего полинуклеотида с одним или более белками субъединицы Cas. Широкое разнообразие аффинных меток описано в заявке на патент США № 2014-0315985, опубликованной 23 октября 2014 г. Лиганды и лиганд-связывающие фрагменты представляют собой спаренные аффинные метки.

[00148] Используемый здесь термин «перекрестная связь» означает связь, которая связывает одну полимерную цепь (например, полинуклеотида или полипептида) с другой. Такие связи могут быть ковалентными или ионными связями. В некоторых вариантах осуществления изобретения, один полинуклеотид может быть связан с другим полинуклеотидом посредством перекрестного связывания полинуклеотидов. В других вариантах осуществления изобретения, полинуклеотид может быть перекрестно связан с полипептидом. В дополнительных вариантах осуществления изобретения, полипептид могут быть перекрестно связан с полипептидом.

[00149] Используемый здесь термин «перекрестно-связывающий фрагмент» обычно относится к фрагменту, подходящему для обеспечения перекрестного связывания двух макромолекул. Перекрестно-связывающий фрагмент является еще одним примером аффинной метки.

[00150] Используемый здесь термин «клетка-хозяин» обычно относится к биологической клетке. Клетка представляет собой основную структурную, функциональную и/или биологическую единицу организма. Клетка может происходить от любого организма, имеющего одну или более клеток. Примеры клеток-хозяев включают, но не ограничиваются ими, прокариотическую клетку, эукариотическую клетку, бактериальную клетку, клетку архебактерий, клетку одноклеточного эукариотического организма, клетку эукариотического организма, клетку простейших, клетку растения, клетки водорослей (например, Botryococcus braunii, Chlamydomonas reinhardtii, Nannochloropsis gaditana, Chlorella pyrenoidosa, Sargassum patens C. agardh и т.п.), клетки морских водорослей (например, бурых водорослей), клетки грибов (например, дрожжевые клетки или клетки съедибных грибов), клетку животного, клетку беспозвоночного животного (например, плодовой мушки, нематоциста, иглокожих, нематод и т.п.), клетку позвоночных животных, включая млекопитающих (например, свиней, коров, коз, овец, грызунов, крыс, мышей, приматов, не являющихся человеком, человека и т.п.). Кроме того, клетка-хозяин может представлять собой стволовую клетку или клетку-предшественника, и иммунологическую клетку, такую как любая из описанных здесь иммунологических клеток. Клетка-хозяин может представлять собой человеческую клетку. В некоторых вариантах осуществления изобретения, человеческая клетка находится вне человеческого тела. В некоторых вариантах осуществления изобретения, клетки тела живого организма (например, человеческого тела) модифицируют ex vivo (то есть вне живого организма). Ex vivo часто относится к медицинской процедуре, при которой орган, клетки или ткань берут из живого организма (например, человеческого тела) для проведения лечения или лечебной процедуры, а затем возвращают в живой организм.

[00151] Используемый здесь термин «стволовая клетка» означает клетку, которая обладает способностью к самообновлению, то есть, способностью проходить многочисленные циклы клеточного деления, сохраняя при этом недифференцированное состояние. Стволовые клетки могут быть тотипотентными, плюрипотентными, мультипотентными, олигопотентными или унипотентными. Стволовые клетки могут представлять собой эмбриональные клетки, клетки плода, клетки амниотической жидкости, клетки взрослых или индуцированные плюрипотентные стволовые клетки.

[00152] Используемый здесь термин «индуцированная плюрипотентная стволовая клетка» относится к типу плюрипотентных стволовых клеток, которые были искусственно получены из не-плюрипотентной клетки, а обычно из соматической клетки. В некоторых вариантах осуществления изобретения, соматическая клетка представляет собой человеческую соматическую клетку. Примеры соматических клеток включают, но не ограничиваются ими, дермальные фибробласты, мезенхимальные клетки костного мозга, клетки сердечной мышцы, кератиноциты, клетки печени, клетки желудка, нервные стволовые клетки, клетки легких, клетки почек, клетки селезенки и клетки поджелудочной железы. Дополнительные примеры соматических клеток включают клетки иммунной системы, включая, но не ограничиваясь ими, В-клетки, дендритные клетки, гранулоциты, врожденные лимфоидные клетки, мегакариоциты, моноциты/макрофаги, клетки-супрессоры миелоидного происхождения, природные клетки-киллеры (NK), T-клетки, тимоциты и гемопоэтические стволовые клетки.

[00153] Используемый здесь термин «гемопоэтическая стволовая клетка» относится к недифференцированной клетке, которая обладает способностью дифференцироваться в гемопоэтическую клетку, такую как лимфоцит.

[00154] Используемый здесь термин «растение» относится ко всем растениям, органам растений, тканям растений, зародышевой плазме, семенам, клеткам растений и их потомству. Клетки растений включают, но не ограничиваются ими, клетки семян, суспензионных культур, зародышей, меристемных областей, каллусной ткани, листьев, корней, побегов, гаметофитов, спорофитов, пыльцы и микроспор. Части растения включают дифференцированные и недифференцированные ткани, включая, но не ограничиваясь ими, корни, стебли, побеги, листья, пыльцу, семена, опухолевую ткань и различные формы клеток и культур (например, отдельные клетки, протопласты, зародыши и ткань каллуса). Ткань растения может находиться в растении или в растительном органе, ткани или в культуре клеток. «Орган растения» означает ткань растения или группу тканей, которые составляют морфологически и функционально отличающуюся часть растения.

[00155] Используемые здесь термины «субъект», «индивидуум» или «пациент» являются синонимами и относятся к любому члену семейства Хордовых, включая, но не ограничиваясь ими, людей и других приматов, включая приматов, не являющихся человеком, таких как макак-резус, шимпанзе и другие виды обезьян и человекообразных обезьян; сельскохозяйственных животных, таких как крупный рогатый скот, овцы, свиньи, козы и лошади; домашних животных, таких как собаки и кошки; лабораторных животных, включая кроликов, мышей, крыс и морских свинок; птиц, включая домашних птиц, диких птиц и дичь, таких как куры, индюки и другие птицы семейства куриных, утки и гуси; и т.п. Этот термин не указывает на конкретный возраст или пол. Таким образом, этот термин включает взрослых, молодых и новорожденных индивидуумов, а также мужчин и женщин. В некоторых вариантах осуществления изобретения, клетка-хозяин происходит от индивидуума (например, лимфоциты, стволовые клетки, клетки-предшественники или тканеспецифические клетки). В некоторых вариантах осуществления изобретения, индивидуум не является человеком. В некоторых вариантах осуществления изобретения, индивидуумом является человек (H. sapiens).

[00156] Используемые здесь термины «эффективное количество» или «терапевтически эффективное количество» композиции или агента, такого как генетически сконструированные адоптивные клетки, описанные в настоящей заявке, означают количество композиции или агента, достаточное для достижения желаемого ответа, например для предотвращения или устранения одного или более вредных побочных эффектов, ассоциированных с терапией аллогенными адоптивными клетками. Такие ответы будут зависеть от конкретно рассматриваемого заболевания. Так, например, у пациента, проходящего лечение рака с применением адоптивной клеточной терапии, желаемый ответ включает, но не ограничивается ими, лечение или предотвращение эффектов GvHD, отторжения трансплантата, то есть, «болезни трансплантат против хозяина», синдрома высвобождения цитокинов (CRS), цитокинового шторма, и снижения онкогенных трансформаций вводимых генетически модифицированных клеток. Точное необходимое количество может варьироваться от индивидуума к индивидууму, в зависимости от вида, возраста и общего состояния здоровья индивидуума, тяжести состояния, подлежащего лечению, и конкретно используемых модифицированных лимфоцитов, способа введения и т.п. Подходящее «эффективное» количество в любом отдельном случае может быть определено средним специалистом в данной области посредством рутинного экспериментирования.

[00157] Термины «лечение» или «терапия» конкретного заболевания, такого как злокачественное заболевание, или GvHD включает: (1) профилактику заболевания, например, предотвращение развития заболевания или индуцирование заболевания с меньшей интенсивностью у индивидуума, который может быть предрасположен к этому заболеванию, но у которого еще отсутствуют симптомы заболевания или эти симптомы не проявляются; (2) подавление заболевания, например, снижение скорости его развития, прекращение его развития или обратное развитие патологического состояния; и/или (3) ослабление симптомов заболевания, например, уменьшение количества симптомов, наблюдаемых у индивидуума.

[00158] Используемый здесь термин «редактирование гена» или «редактирование генома» означает тип генной инженерии, которая приводит к генетической модификации, такой как инсерция, делеция или замена нуклеотидной последовательности, или даже одного основания в определенном участке в геноме клетки. Эти термины включают, но не ограничиваются ими, экспрессию гетерологичного гена, встраивание или делецию гена или промотора, мутацию нуклеиновой кислоты и деструктивную генетическую модификацию, как определено в настоящей заявке.

[00159] Термин «эпитоп» означает сайт в молекуле, на который отвечают специфические В-клетки и Т-клетки. Эпитоп может содержать 3 или более аминокислот в пространственной конформации, уникальной для этого эпитопа. Обычно, эпитоп состоит по меньшей мере из пяти таких аминокислот а, чаще всего, по меньшей мере из 8-10 таких аминокислот. Способы определения пространственной конформации аминокислот известны специалистам в данной области и включают, например, рентгеновскую кристаллографию, электронную микроскопию и 2-мерный ядерный магнитный резонанс. Кроме того, идентификация эпитопов в данном белке может быть легко осуществлена хорошо известными методами, такими как проведение исследований по гидрофобности и сайт-ориентированной серологии.

[00160] «Мимотоп» представляет собой макромолекулу, такую как пептид, которая имитирует структуру эпитопа. Благодаря этому его свойству он вызывает реакцию антител, аналогичную той, которая вызывается эпитопом. Антитело к данному эпитопному антигену распознает мимотоп, который имитирует этот эпитоп. Мимотопы обычно получают из библиотек фагового представления посредством биопэннинга.

[00161] Под «антителом» подразумевается молекула, которая «распознает», то есть специфически связывается с представляющим интерес эпитопом, присутствующим в полипептиде, таким как лиганд-связывающий домен. Под «специфическим связыванием» подразумевается, что антитело взаимодействует с эпитопом по типу взаимодействия «замок и ключ» с образованием комплекса между антигеном и антителом. Используемый здесь термин «антитело» включает антитела, полученные из моноклональных препаратов, а также следующие антитела: молекулы гибридных (химерных) антител; фрагменты F(ab')2 и F(ab); молекулы Fv (нековалентные гетеродимеры; одноцепочечные молекулы Fv (scFv); конструкции димерных и тримерных фрагментов антител; миниантитела; гуманизованные молекулы антител; одноцепочечные антитела; антитела Nanobody® (Ablynx NV, Zwijnaarde, Belgium); и любые функциональные фрагменты, полученные из таких молекул, где такие фрагменты сохраняют иммунологические связывающие свойства исходной молекулы антитела. Антитела могут быть получены от животных различных видов, таких как человек, мышь, крыса, кролик, верблюд, курица и т.п. Антитела и части антител могут быть затем получены методами in vitro, такими как фаговое представление и дрожжевое представление. Полностью гуманизованные антитела могут быть получены из плазмы человека, клонирования В-клеток человека, мыши, крысы, кролика, курицы и т.п., которые имеют модифицированный репертуар гуманизованных В-клеток. Затем, антитела могут быть дополнительно модифицированы посредством созревания аффинности и другими методами, такими как афукозилирование или конструирование Fc IgG.

[00162] Используемый здесь термин «моноклональное антитело» означает композицию антител, содержащую гомогенную популяцию антител. Этот термин не ограничивается видом или источником антитела, и способом его получения. Этот термин охватывает целые иммуноглобулины, а также фрагменты, такие как Fab, F(ab')2, Fv и другие фрагменты, и популяции химерных и гуманизованных гомогенных антител, которые обладают иммунологическими свойствами связывания исходной молекулы моноклонального антитела.

[00163] «Антитело-зависимая клеточно-опосредованная цитотоксичность (ADCC)», также называемая «антителозависимой клеточной цитотоксичностью», относится к механизму, посредством которого эффекторная клетка иммунной системы активно лизирует клетку-мишень, такую как адоптивная клетка, если домен, связывающийся с лигандом на поверхности мембраны, был связан со специфическим антителом. Эффекторные клетки обычно являются природными клетками-киллерами (NK). Однако, макрофаги, нейтрофилы и эозинофилы также могут опосредовать ADCC. ADCC не зависит от комплемент-зависимой цитотоксичности (CDC), которая также лизирует мишени посредством повреждения мембраны без участия антител или клеток иммунной системы.

[00164] Используемый здесь термин «трансформация» означает встраивание экзогенного полинуклеотида в клетку-хозяина, независимо от метода, применяемого для такого встраивания. Так, например, трансформация может происходить посредством прямого поглощения, трансфекции, инфицирования и т.п. Экзогенный полинуклеотид может поддерживаться в виде неинтегрированного вектора, например, эписомы, или, альтернативно, он может быть интегрирован в геном хозяина. Используемый здесь термин «трансгенный организм» относится к организму, содержащему генетический материал, в который была искусственно введена ДНК неродственного организма. Этот термин включает потомство (любого поколения) трансгенного организма, при условии, что это потомство имеет генетическую модификацию. В некоторых вариантах осуществления изобретения, трансгенный организм представляет собой трансгенный организм, не являющийся человеком.

[00165] Используемый здесь термин «выделенный» может относиться к молекуле (например, к полинуклеотиду или полипептиду), которая в результате вмешательства человека существует отдельно от своего природного окружения и, следовательно, не является природным продуктом. Термин «выделенный», если он относится к полипептиду, означает, что указанная молекула присутствует отдельно и обособленно от всего организма, в которым эта молекула присутствует в природе, или присутствует, в основном, в отсутствии других биологических макромолекул того же типа. Термин «выделенный», если он относится к полинуклеотиду, означает, что молекула нуклеиновой кислоты лишена, полностью или частично, последовательностей, обычно связанных с ней в природе; или эта последовательность, хотя и существует в природе, но имеет связанные с ней гетерологичные последовательности; или молекула, отделенная от хромосомы.

[00166] Используемый здесь термин «очищенный» предпочтительно означает, что присутствие данной молекулы составляет по меньшей мере 75% по массе, более предпочтительно, по меньшей мере 85% по массе, еще более предпочтительно, по меньшей мере 95% по массе, а наиболее предпочтительно по меньшей мере 98% по массе этой молекулы.

[00167] Используемый здесь термин «канал субстрата» относится к прямому переносу реагента из одной ферментативной реакции в другую ферментативную реакцию без предварительной диффузии в основную среду (см., например, Wheeldon, I., et al., Nat. Chem. 8: 299-309 (2016)). Промежуточные продукты этих ферментативных стадий не находятся в равновесии с основной массой раствора, что позволяет повысить эффективность и выход ферментативных процессов. В большинстве случаев, ферменты в природных метаболических процессах приобретают способность к совместной локализации и к сборке в регулируемые агрегаты.

[00168] Используемый здесь термин «элемент канала субстрата» относится к компоненту метаболического пути. В некоторых вариантах осуществления изобретения, элемент канала субстрата представляет собой фермент, который катализирует химическую реакцию.

[00169] Используемый здесь термин «комплекс каналов субстрата» относится к множеству элементов канала субстрата, которые были совместно локализованы по определенным механизмам.

[00170] Используемый здесь термин «каркас РНК» относится к молекуле РНК, которую могут использовать пептиды в качестве субстрата для связывания.

[00171] Представленные здесь данные продемонстрировали, что эти гибриды между компонентами Cascade и нуклеазными доменами (например, зависимыми от димеризации неспецифическими FokI-нуклеазными доменами; см., например, Urnov, FD, et al., Nature Reviews Genetics 11: 636-646 (2010); Joung, JK, et al., Nat. Rev. Mol. Cell Biol.14: 49-55 (2013); Guilinger, JP, et al., Nat. Biotechnol. 32: 577-582 (2014); Tsai, SQ, et al., Nat. Biotechnol. 32: 569-576 (2014)) опосредуют эффективное программируемое редактирование генов в зависимости от РНК под действием систем типа I в клетках человека. Эти данные продемонстрировали, что сконструированные системы CRISPR-Cas типа I (например, включающие гибрид компонентов FokI-Cascade) могут быть непосредственно трансфицированы как интактные комплексы рибонуклеопротеинов (RNP) или собраны в клетках посредством доставки отдельных компонентов, кодируемых плазмидами. Как описано в настоящей заявке, все гены, связанные с CRISPR (Cas), были собраны в один полицистронный вектор, что позволяло получить упрощенную двухкомпонентную систему экспрессии руководящей РНК под контролем белка Cas. Кроме того, длина/состав конструкции линкерных последовательностей нуклеаз (например, FokI)/компонентов Cascade и геометрическая конфигурация соответствующей ДНК, а также выбор гомолога Cascade, позволяют сконструировать комплексы CRISPR-Cas Типа I с эффективностью редактирования приблизительно до 50%. Были определены ключевые характеристики сконструированных систем CRISPR-Cas типа I (например, включающих гибридные белки компонентов FokI-Cascade), в зависимости от требований к PAM и чувствительности к ошибочному спариванию во время нацеливания на ДНК.

[00172] В своем первом аспекте, настоящее изобретение относится к сконструированным полинуклеотидам, кодирующим компоненты Cascade, включая, но не ограничиваясь ими, белки субъединиц Cascade и руководящие полинуклеотиды Cascade.

[00173] В одном своем варианте, настоящее изобретение относится к сконструированным полинуклеотидам, кодирующим компоненты Cascade, происходящие от систем I-E Cascade. Типичные полинуклеотидные конструкции, содержащие белки Cascade и cr-РНК Cascade, представлены в Примере 1. В Примере 1, в Таблице 15 и в SEQ ID NO: 1 - SEQ ID NO: 20 представлены последовательности полинуклеотидной ДНК-генов, кодирующих пять субъединичных белков Cascade типа I-E, в частности, штамма E. coli K-12 MG1655, а также аминокислотные последовательности полученных белковых компонентов. Полинуклеотидные последовательности были получены из гДНК E. coli и были оптимизированы по кодонам специально для экспрессии в E. coli и/или специально для экспрессии в эукариотических клетках (например, в человеческих клетках). При транскрипции этого полинуклеотида в cr-РНК-предшественник и процессинга РНК-эндонуклеазой Cascade, образуется зрелая cr-РНК, которая функционирует как руководящая РНК для нацеливания на комплементарные последовательности ДНК в геноме. Минимальный массив CRISPR содержит две повторяющиеся последовательности (подчеркнутые в последовательностях массива CRISPR, представленных в Примере 1), фланкирующие репрезентативную спейсерную последовательность, которая представляет собой руководящую часть cr-РНК. Процессинг РНК эндонуклеазой Cascade генерирует cr-РНК с повторяющимися последовательностями на 5’- и 3’-концах, фланкирующих руководящую последовательность. Специалист в данной области, принимая во внимание описание, приведенное в настоящей заявке и в примерах, может самостоятельно выбрать соответствующие спейсерные последовательности для нацеленного связывания комплекса Cascade с выбранной последовательностью-мишенью (например, в гДНК).

[00174] Полинуклеотидные последовательности, кодирующие компоненты Cascade из других видов бактерий или архебактерий, могут быть идентифицированы и сконструированы в соответствии с указаниями, приведенными в разделе «Описание» и с использованием пакетов биоинформационных программ, таких как BLAST и PSI-BLAST, для обнаружения локализации, например, гомологов генов субъединиц Cascade в штамме E. coli K-12 MG1655, а затем для выявления фланкирующих геномных соседних областей гена Cascade для определения локализации и идентификации генов остальных белков субъединицы Cascade (см., например, Пример 14A, Пример 14B, Пример 15A и Пример 15B). Поскольку гены Cascade встречаются вместе как консервативные опероны, то они обычно располагаются в последовательном порядке в пределах одного и того же подтипа типа I, что облегчает их идентификацию и отбор для последующего анализа и экспериментов. Так, например, дополнительные системы типа I-E могут быть идентифицированы путем определения локализации гомологов Cas8, выявления видов бактерий, перспективных для тестирования гомологичных Cascade, а затем получения или конструирования полинуклеотидных последовательностей, кодирующих Cas8 и других белковых компонентов Cascade из этих гомологичных систем CRISPR-Cas.

[00175] Полинуклеотидные ДНК-последовательности генов, кодирующих субъединичные белки Cascade у различных видов (перечисленных в Таблице 3 и в Таблице 4), некоторые из которых, вместе с комплексами Cascade, являются гомологичными комплексам, полученным из штамма E. coli K-12 MG1655, и аминокислотные последовательности полученных белковых компонентов, а также репрезентативные минимальные массивы CRISPR представлены как SEQ ID NO: 22 - SEQ ID NO: 213 (Таблица 3).

[00176]

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Protein Подтип и организм Тип последовательности
SEQ ID NO: 1 Cass 1-E Escherichia coli K-12 MG1655 Генная последовательность геномной ДНК
SEQ ID NO: 2 Cse2 1-E Escherichia coli K-12 MG1655 Генная последовательность геномной ДНК
SEQ ID NO: 3 Cas7 1-E Escherichia coli K-12 MG1655 Генная последовательность геномной ДНК
SEQ ID NO: 4 Cas5 1-E Escherichia coli K-12 MG1655 Генная последовательность геномной ДНК
SEQ ID NO: 5 Cas6 1-E Escherichia coli K-12 MG1655 Генная последовательность геномной ДНК
SEQ ID NO: 6 Cass 1-E Escherichia coli K-12 MG1655 Генная последовательность ДНК, оптимизированная по кодонам E. coli
SEQ ID NO: 7 Cse2 1-E-Escherichia coli K-12 MG1655 Генная последовательность ДНК, оптимизированная по кодонам E. coli
SEQ ID NO: S Cas7 1-E-Escherichia coli K-12 MG1655 Генная последовательность ДНК, оптмизированная по кодонам E. coli
SEQ ID NO: 9 Cas5 1-E-Escherichia coli K-12 MG1655 Генная последовательность ДНК, оптимизированная по кодонам E. coli
SEQ ID NO: 10 Cas6 1-E-Escherichia coli K-12 MG1655 Генная последовательность ДНК, оптмизированная по кодонам E. coli
SEQ ID NO: 11 Cass 1-E-Escherichia coli K-12 MG1655 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 12 Cse2 1-E-Escherichia coli K-12 MG1655 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 13 Cas7 1-E-Escherichia coli K-12 MG1655 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 14 Cas5 1-E-Escherichia coli K-12 MG1655 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 15 Cas6 1-E-Escherichia coli K-12 MG1655 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 16 Cass 1-E Escherichia coli K-12 MG1655 Аминокислотная последовательность белка
SEQ ID NO: 17 Cse2 1-E Escherichia coli K-12 MG1655 Аминокислотная последовательность белка
SEQ ID NO: 1S Cas7 1-E Escherichia coli K-12 MG1655 Аминокислотная последовательность белка
SEQ ID NO: 19 Cas5 1-E Escherichia coli K-12 MG1655 Аминокислотная последовательность белка
SEQ ID NO: 20 Cas6 1-E Escherichia coli K-12 MG1655 Аминокислотная последовательность белка
SEQ ID NO: 21 Cas3 1-E Escherichia coli K-12 MG1655 Аминокислотная последовательность белка
SEQ ID NO: 22 Cass 1-E Oceanicola sp. HL-35 Генная последовательность геномной ДНК
SEQ ID NO: 23 Cse2 1-E Oceanicola sp. HL-35 Генная последовательность геномной ДНК
SEQ ID NO: 24 Cas7 1-E Oceanicola sp. HL-35 Генная последовательность геномной ДНК

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/белок Protein Подтип и организм Тип последовательности
SEQ ID NO: 25 Cas5 1-E Oceanicola sp. HL-35 Генная последовательность геномной ДНК
SEQ ID NO: 26 Cas6 1-E Oceanicola sp. HL-35 Генная последовательность геномной ДНК
SEQ ID NO: 27 Cas8 1-E_Oceanicola sp. HL-35 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 28 Cse2 1-E_Oceanicola sp. HL-35 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 29 Cas7 1-E_Oceanicola sp. HL-35 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 30 Cas5 1-E_Oceanicola sp. HL-35 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 31 Cas6 1-E_Oceanicola sp. HL-35 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 32 Cas8 1-E Oceanicola sp. HL-35 Аминокислотная последовательность белка
SEQ ID NO: 33 Cse2 1-E Oceanicola sp. HL-35 Аминокислотная последовательность белка
SEQ ID NO: 34 Cas7 1-E Oceanicola sp. HL-35 Аминокислотная последовательность белка
SEQ ID NO: 35 Cas5 1-E_Oceanicola sp. HL-35 Аминокислотная последовательность белка
SEQ ID NO: 36 Cas6 1-E Oceanicola sp. HL-35 Аминокислотная последовательность белка
SEQ ID NO: 37 CRISPR 1-E Oceanicola sp. HL-35 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 38 Cas8 1-E Pseudomonas sp. S-6-2 Генная последовательность геномной ДНК
SEQ ID NO: 39 Cse2 1-E Pseudomonas sp. S-6-2 Генная последовательность геномной ДНК
SEQ ID NO: 40 Cas7 1-E Pseudomonas sp. S-6-2 Генная последовательность геномной ДНК
SEQ ID NO: 41 Cas5 1-E_Pseudomonas sp. S-6-2 Генная последовательность геномной ДНК
SEQ ID NO: 42 Cas6 1-E Pseudomonas sp. S-6-2 Генная последовательность геномной ДНК
SEQ ID NO: 43 Cas8 1-E_Pseudomonas sp. S-6-2 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 44 Cse2 1-E_Pseudomonas sp. S-6-2 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 45 Cas7 1-E_Pseudomonas sp. S-6-2 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 46 Cas5 1-E_Pseudomonas sp. S-6-2 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 47 Cas6 1-E_Pseudomonas sp. S-6-2 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 48 Cas8 1-E Pseudomonas sp. S-6-2 Аминокислотная последовательность белка

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 49 Cse2 1-E Pseudomonas sp. S-6-2 Аминокислотная последовательность белка
SEQ ID NO: 50 Cas7 1-E Pseudomonas sp. S-6-2 Аминокислотная последовательность белка
SEQ ID NO: 51 Cas5 1-E_Pseudomonas sp. S-6-2 Аминокислотная последовательность белка
SEQ ID NO: 52 Cas6 1-E Pseudomonas sp. S-6-2 Аминокислотная последовательность белка e
SEQ ID NO: 53 CRISPR 1-E Pseudomonas sp. S-6-2 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 54 Cas8 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Генная последовательность геномной ДНК
SEQ ID NO: 55 Cse2 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Генная последовательность геномной ДНК
SEQ ID NO: 56 Cas7 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Генная последовательность геномной ДНК
SEQ ID NO: 57 Cas5 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Генная последовательность геномной ДНК
SEQ ID NO: 58 Cas6 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Генная последовательность геномной ДНК
SEQ ID NO: 59 Cas8 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 60 Cse2 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 61 Cas7 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 62 Cas5 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 63 Cas6 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 64 Cas8 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Аминокислотная последовательность белка
SEQ ID NO: 65 Cse2 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Аминокислотная последовательность белка
SEQ ID NO: 66 Cas7 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Аминокислотная последовательность белка
SEQ ID NO: 67 Cas5 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Аминокислотная последовательность белка

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 68 Cas6 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Аминокислотная последовательность белка
SEQ ID NO: 69 CRISPR 1-E_Salmonella enterica подвид enterica штамм серотипа Muenster Репрезентативный минимальный массив CRISPR
SEQ ID NO: 70 Cas8 1-E Atlantibacter hermannii NBRC 105704 Генная последовательность геномной ДНК
SEQ ID NO: 71 Cse2 1-E Atlantibacter hermannii NBRC 105704 Генная последовательность геномной ДНК
SEQ ID NO: 72 Cas7 1-E Atlantibacter hermannii NBRC 105704 Генная последовательность геномной ДНК
SEQ ID NO: 73 Cas5 1-E Atlantibacter hermannii NBRC 105704 Генная последовательность геномной ДНК
SEQ ID NO: 74 Cas6 1-E Atlantibacter hermannii NBRC 105704 Генная последовательность геномной ДНК
SEQ ID NO: 75 Cas8 1-E-Atlantibacter hermannii NBRC 105704 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 76 Cse2 1-E-Atlantibacter hermannii NBRC 105704 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 77 Cas7 1-E-Atlantibacter hermannii NBRC 105704 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 78 Cas5 1-E-Atlantibacter hermannii NBRC 105704 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 79 Cas6 1-E Atlantibacter hermannii NBRC 105704 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 80 Cas8 1-E Atlantibacter hermannii NBRC 105704 Аминокислотная последовательность белка
SEQ ID NO: 81 Cse2 1-E Atlantibacter hermannii NBRC 105704 Аминокислотная последовательность белка
SEQ ID NO: 82 Cas7 1-E Atlantibacter hermannii NBRC 105704 Аминокислотная последовательность белка
SEQ ID NO: 83 Cas5 1-E Atlantibacter hermannii NBRC 105704 Аминокислотная последовательность белка
SEQ ID NO: 84 Cas6 1-E Atlantibacter hermannii NBRC 105704 Аминокислотная последовательность белка
SEQ ID NO: 85 CRISPR 1-E Atlantibacter hermannii NBRC 105704 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 86 Cas8 1-E Geothermobacter sp. EPR-M Генная последовательность геномной ДНК
SEQ ID NO: 87 Cse2 1-E Geothermobacter sp. EPR-M Генная последовательность геномной ДНК
SEQ ID NO: 88 Cas7 1-E Geothermobacter sp. EPR-M Генная последовательность геномной ДНК
SEQ ID NO: 89 Cas5 1-E Geothermobacter sp. EPR-M Генная последовательность геномной ДНК
SEQ ID NO: 90 Cas6 1-E Geothermobacter sp. EPR-M Генная последовательность геномной ДНК
SEQ ID NO: 91 Cas8 1-E_Geothermobacter sp. EPR-M Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 92 Cse2 1-E_Geothermobacter sp. EPR-M Генная последовательность ДНК, оптмизированная по кодонам H. sapiens

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 93 Cas7 1-E_Geothermobacter sp. EPR-M Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 94 Cass 1-E_Geothermobacter sp. EPR-M Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 95 Cas6 1-E_Geothermobacter sp. EPR-M Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 96 Cas8 1-E_Geothermobacter sp. EPR-M Аминокислотная последовательность белка
SEQ ID NO: 97 Cse2 1-E Geothermobacter sp. EPR-M Аминокислотная последовательность белка
SEQ ID NO: 98 Cas7 1-E Geothermobacter sp. EPR-M Аминокислотная последовательность белка
SEQ ID NO: 99 Cass 1-E Geothermobacter sp. EPR-M Аминокислотная последовательность белка
SEQ ID NO: 100 Cas6 1-E_Geothermobacter sp. EPR-M Аминокислотная последовательность белка
SEQ ID NO: 101 CRISPR 1-E Geothermobacter sp. EPR-M Репрезентативный минимальный массив CRISPR
SEQ ID NO: 102 Cas8 1-E_Methylocaldum sp. 148 Генная последовательность геномной ДНК
SEQ ID NO: 103 Cse2 1-E Methylocaldum sp. 148 Генная последовательность геномной ДНК
SEQ ID NO: 104 Cas7 1-E Methylocaldum sp. 148 Генная последовательность геномной ДНК
SEQ ID NO: 105 Cass 1-E Methylocaldum sp. 148 Генная последовательность геномной ДНК
SEQ ID NO: 106 Cas6 1-E Methylocaldum sp. 148 Генная последовательность геномной ДНК
SEQ ID NO: 107 Cas8 1-E_Methylocaldum sp. 148 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 108 Cse2 1-E_Methylocaldum sp. 148 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 109 Cas7 1-E_Methylocaldum sp. 148 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 110 Cass 1-E_Methylocaldum sp. 148 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 111 Cas6 1-E_Methylocaldum sp. 148 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 112 Cas8 1-E_Methylocaldum sp. 148 Аминокислотная последовательность белка
SEQ ID NO: 113 Cse2 1-E Methylocaldum sp. 148 Аминокислотная последовательность белка
SEQ ID NO: 114 Cas7 1-E_Methylocaldum sp. 148 Аминокислотная последовательность белка
SEQ ID NO: 115 Cass 1-E Methylocaldum sp. 148 Аминокислотная последовательность белка
SEQ ID NO: 116 Cas6 1-E Methylocaldum sp. 148 Аминокислотная последовательность белка
SEQ ID NO: 117 CRISPR 1-E Methylocaldum sp. 148 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 118 Cas8 1-E Methanocella arvoryzae MRE50 Генная последовательность геномной ДНК

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade для 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 119 Cse2 1-E Methanocella arvoryzae MRE50 Генная последовательность геномной ДНК
SEQ ID NO: 120 Cas7 1-E Methanocella arvoryzae MRE50 Генная последовательность геномной ДНК
SEQ ID NO: 121 Cas5 1-E Methanocella arvoryzae MRE50 Генная последовательность геномной ДНК
SEQ ID NO: 122 Cas6 1-E Methanocella arvorvzae MRE50 Генная последовательность геномной ДНК
SEQ ID NO: 123 Cass 1-E_Methanocella arvoryzae MRE50 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 124 Cse2 1-E_Methanocella arvoryzae MRE50 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 125 Cas7 1-E_Methanocella arvoryzae MRE50 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 126 Cas5 1-E_Methanocella arvoryzae MRE50 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 127 Cas6 1-E_Methanocella arvoryzae MRE50 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 128 Cass 1-E Methanocella arvoryzae MRE50 Аминокислотная последовательность белка
SEQ ID NO: 129 Cse2 1-E Methanocella arvoryzae MRE50 Аминокислотная последовательность белка
SEQ ID NO: 130 Cas7 1-E Methanocella arvoryzae MRE50 Аминокислотная последовательность белка
SEQ ID NO: 131 Cas5 1-E Methanocella arvoryzae MRE50 Аминокислотная последовательность белка
SEQ ID NO: 132 Cas6 1-E Methanocella arvoryzae MRE50 Аминокислотная последовательность белка
SEQ ID NO: 133 CRISPR 1-E Methanocella arvoryzae MRE50 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 134 Cass 1-E Lachnospiraceae bacterium KH1T2 Генная последовательность геномной ДНК
SEQ ID NO: 135 Cse2 1-E_Lachnospiraceae bacterium KH1T2 Генная последовательность геномной ДНК
SEQ ID NO: 136 Cas7 1-E Lachnospiraceae bacterium KH1T2 Генная последовательность геномной ДНК
SEQ ID NO: 137 Cas5 1-E_Lachnospiraceae bacterium KH1T2 Генная последовательность геномной ДНК
SEQ ID NO: 138 Cas6 1-E Lachnospiraceae bacterium KH1T2 Генная последовательность геномной ДНК
SEQ ID NO: 139 Cass 1-E_Lachnospiraceae bacterium KH1T2 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 140 Cse2 1-E_Lachnospiraceae bacterium KH1T2 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 141 Cas7 1-E_Lachnospiraceae bacterium KH1T2 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 142 Cas5 1-E_Lachnospiraceae bacterium KH1T2 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 143 Cas6 1-E_Lachnospiraceae bacterium KH1T2 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 144 Casa 1-E Lachnospiraceae bacterium KH1T2 Аминокислотная последовательность белка
SEQ ID NO: 145 Cse2 1-E Lachnospiraceae bacterium KH1T2 Аминокислотная последовательность белка
SEQ ID NO: 146 Cas7 1-E Lachnospiraceae bacterium KH1T2 Аминокислотная последовательность белка
SEQ ID NO: 147 Cas5 1-E Lachnospiraceae bacterium KH1T2 Аминокислотная последовательность белка
SEQ ID NO: 148 Cas6 1-E Lachnospiraceae bacterium KH1T2 Аминокислотная последовательность белка
SEQ ID NO: 149 CRISPR 1-E Lachnospiraceae bacterium KH1T2 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 150 Casa 1-E_Klebsiella pneumoniae штамм VRC00172 Генная последовательность геномной ДНК
SEQ ID NO: 151 Cse2 1-E Klebsiella pneumoniae штамм VRC00172 Генная последовательность геномной ДН
SEQ ID NO: 152 Cas7 1-E Klebsiella pneumoniae штамм VRC00172 Генная последовательность геномной ДНК
SEQ ID NO: 153 Cas5 1-E Klebsiella pneumoniae штамм VRC00172 Генная последовательность геномной ДНК
SEQ ID NO: 154 Cas6 1-E Klebsiella pneumoniae штамм VRC00172 Генная последовательность геномной ДНК
SEQ ID NO: 155 Casa 1-E_Klebsiella pneumoniae штамм VRC00172 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 156 Cse2 1-E_Klebsiella pneumoniae штамм VRC00172 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 157 Cas7 1-E_Klebsiella pneumoniae штамм VRC00172 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 158 Cas5 1-E_Klebsiella pneumoniae штамм VRC00172 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 159 Cas6 1-E_Klebsiella pneumoniae штамм VRC00172 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 160 Casa 1-E Klebsiella pneumoniae штамм VRC00172 Аминокислотная последовательность белка
SEQ ID NO: 161 Cse2 1-E Klebsiella pneumoniae штамм VRC00172 Аминокислотная последовательность белка
SEQ ID NO: 162 Cas7 1-E Klebsiella pneumoniae штамм VRC00172 Аминокислотная последовательность белка
SEQ ID NO: 163 Cas5 1-E Klebsiella pneumoniae штамм VRC00172 Аминокислотная последовательность белка
SEQ ID NO: 164 Cas6 1-E Klebsiella pneumoniae штамм VRC00172 Аминокислотная последовательность белка
SEQ ID NO: 165 CRISPR 1-E_Klebsiella pneumoniae штамм VRC00172 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 166 Casa 1-E Pseudomonas aeruginosa DHS01 Генная последовательность геномной ДНК
SEQ ID NO: 167 Cse2 1-E Pseudomonas aeruginosa DHS01 Генная последовательность геномной ДНК
SEQ ID NO: 16a Cas7 1-E Pseudomonas aeruqinosa DHS01 Генная последовательность геномной ДНК
SEQ ID NO: 169 Cas5 1-E Pseudomonas aeruginosa DHS01 Генная последовательность геномной ДНК
SEQ ID NO: 170 Cas6 1-E Pseudomonas aeruginosa DHS01 Генная последовательность геномной ДНК

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 171 Cas8 1-E_Pseudomonas aeruginosa DHS01 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 172 Cse2 1-E_Pseudomonas aeruginosa DHS01 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 173 Cas7 1-E_Pseudomonas aeruginosa DHS01 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 174 Cas5 1-E_Pseudomonas aeruginosa DHS01 Генная последовательность ДНК, оптмизированная по кодонам H. sapiense
SEQ ID NO: 175 Cas6 1-E_Pseudomonas aeruginosa DHS01 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 176 Cas8 1-E Pseudomonas aeruginosa DHS01 Аминокислотная последовательность белка
SEQ ID NO: 177 Cse2 1-E Pseudomonas aeruginosa DHS01 Аминокислотная последовательность белка
SEQ ID NO: 178 Cas7 1-E Pseudomonas aeruqinosa DHS01 Аминокислотная последовательность белка
SEQ ID NO: 179 Cas5 1-E Pseudomonas aeruginosa DHS01 Аминокислотная последовательность белка
SEQ ID NO: 180 Cas6 1-E_Pseudomonas aeruginosa DHS01 Аминокислотная последовательность белка
SEQ ID NO: 181 CRISPR 1-E Pseudomonas aeruginosa DHS01 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 182 Cas8 1-E Streptococcus thermophilus штамм ND07 Генная последовательность геномной ДНК
SEQ ID NO: 183 Cse2 1-E Streptococcus thermophilus штамм ND07 Генная последовательность геномной ДНК
SEQ ID NO: 184 Cas7 1-E_Streptococcus thermophilus штамм ND07 Генная последовательность геномной ДНК
SEQ ID NO: 185 Cas5 1-E Streptococcus thermophilus штамм ND07 Генная последовательность геномной ДНК
SEQ ID NO: 186 Cas6 1-E Streptococcus thermophilus штамм ND07 Генная последовательность геномной ДНК
SEQ ID NO: 187 Cas8 1-E_Streptococcus thermophilus штамм ND07 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 188 Cse2 1-E_Streptococcus thermophilus штамм ND07 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 189 Cas7 1-E_Streptococcus thermophilus штамм ND07 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 190 Cas5 1-E_Streptococcus thermophilus штамм ND07 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 191 Cas6 1-E_Streptococcus thermophilus штамм ND07 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 192 Cas8 1-E Streptococcus thermophilus штамм ND07 Аминокислотная последовательность белка
SEQ ID NO: 193 Cse2 1-E Streptococcus thermophilus штамм ND07 Аминокислотная последовательность белка
SEQ ID NO: 194 Cas7 1-E Streptococcus thermophilus штамм ND07 Аминокислотная последовательность белка

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 195 Cass 1-E Streptococcus thermophi lus штамм ND07 Аминокислотная последовательность белка
SEQ ID NO: 196 Cas6 1-E Streptococcus thermophi lus штамм ND07 Аминокислотная последовательность белка
SEQ ID NO: 197 CRISPR 1-E_Streptococcus thermophi lus штамм ND07 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 198 Cas8 1-E Streptomvces sp. S4 Генная последовательность геномной ДНК
SEQ ID NO: 199 Cse2 1-E Streptomyces sp.S4 Генная последовательность геномной ДНК
SEQ ID NO: 200 Cas? 1-E Streptomvces sp. S4 Генная последовательность геномной ДНК
SEQ ID NO: 201 Cass 1-E Streptomyces sp. S4 Генная последовательность геномной ДНК
SEQ ID NO: 202 Cas6 1-E Streptomyces sp. S4 Генная последовательность геномной ДНК
SEQ ID NO: 203 Cas8 1-E_Streptomyces sp. S4 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 204 Cse2 1-E_Streptomyces sp. S4 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 205 Cas7 1-E_Streptomyces sp. S4 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 206 Cass 1-E_Streptomyces sp. S4 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 207 Cas6 1-E_Streptomyces sp. S4 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 208 Cas8 1-E Streptomyces sp. S4 Аминокислотная последовательность белка
SEQ ID NO: 209 Cse2 1-E Streptomyces sp.S4 Аминокислотная последовательность белка
SEQ ID NO: 210 Cas7 1-E Streptomyces sp. S4 Аминокислотная последовательность белка
SEQ ID NO: 211 Cass 1-E Streptomyces sp.S4 Аминокислотная последовательность белка
SEQ ID NO: 212 Cas6 1-E Streptomvces sp. S4 Аминокислотная последовательность белка
SEQ ID NO: 213 CRISPR 1-E Streptomyces sp.S4 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 214 Cas6 1-B_Fusobacterium nucleatum подвид animalis 3 1 33 Генная последовательность геномной ДНК
SEQ ID NO: 215 Cas8 1-B_Fusobacterium nucleatum подвид animalis 3 1 33 Генная последовательность геномной ДНК
SEQ ID NO: 216 Cas7 1-B_Fusobacterium nucleatum подвид animalis 3 1 33 Генная последовательность геномной ДНК
SEQ ID NO: 217 Cass 1-B_Fusobacterium nucleatum подвид animalis 3 1 33 Генная последовательность геномной ДНК
SEQ ID NO: 218 Cas6 1-B_Fusobacterium nucleatum подвид animalis 3 1 33 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 219 Cas8 l-8_Fusobacteri um nucleatum подвид animalis 3 1 33 Генная последовательность ДНК, оптмизированная по кодонам H. sapiensH. sapiens
SEQ ID NO: 220 Cas7 l-8_Fusobacteri um nucleatum подвид animalis 3 1 33 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 221 Cas5 l-8_Fusobacteri um nucleatum подвид animalis 3 1 33 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 222 Cas6 l-8_Fusobacteri um nucleatum подвид animalis 3 1 33 Аминокислотная последовательность белка
SEQ ID NO: 223 Cas8 l-8_Fusobacteri um nucleatum подвид animalis
3 1 33
Аминокислотная последовательность белка
SEQ ID NO: 224 Cas7 l-8_Fusobacteri um nucleatum подвид animalis 3 1 33 Аминокислотная последовательность белка
SEQ ID NO: 225 Cas5 l-8_Fusobacteri um nucleatum подвид animalis 3 1 33 Аминокислотная последовательность белка
SEQ ID NO: 226 CRISPR l-8_Fusobacteri um nucleatum подвид animalis 3 1 33 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 227 Cas6 1-8 Campylobacter fetus подвид testudinum Sp3 Генная последовательность геномной ДНК
SEQ ID NO: 228 Cas8 1-8 Campylobacter fetus подвид testudinum Sp3 Генная последовательность геномной ДНК
SEQ ID NO: 229 Cas7 1-8 Campylobacter fetus подвид testudinum Sp3 Генная последовательность геномной ДНК
SEQ ID NO: 230 Cas5 1-8 Campylobacter fetus подвид testudinum Sp3 Генная последовательность геномной ДНК
SEQ ID NO: 231 Cas6 l-8_Campylobacter fetus подвид testudinum Sp3 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 232 Cas8 l-8_Campylobacter fetus подвид testudinum Sp3 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 233 Cas7 l-8_Campylobacter fetus подвид testudinum Sp3 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 234 Cas5 l-8_Campylobacter fetus подвид testudinum Sp3 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 235 Cas6 1-8 Campylobacter fetus подвид testudinum Sp3 Аминокислотная последовательность белка
SEQ ID NO: 236 Cas8 1-8 Campylobacter fetus подвид testudinum Sp3 Аминокислотная последовательность белка
SEQ ID NO: 237 Cas7 1-8 Campylobacter fetus подвид testudinum Sp3 Аминокислотная последовательность белка
SEQ ID NO: 238 Cas5 1-8 Campylobacter fetus подвид testudinum Sp3 Аминокислотная последовательность белка
SEQ ID NO: 239 CRISPR l-8_Campylobacter fetus подвид testudinum Sp3 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 240 Cas6 1-8 Odoribacter splanchnicus DSM 20712 Генная последовательность геномной ДНК

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 241 Cas8 1-B Odoribacter splanchnicus DSM 20712 Генная последовательность геномной ДНК
SEQ ID NO: 242 Cas7 1-B Odoribacter splanchnicus DSM 20712 Генная последовательность геномной ДНК
SEQ ID NO: 243 Cass 1-B Odoribacter splanchnicus DSM 20712 Генная последовательность геномной ДНК
SEQ ID NO: 244 Cas6 1-B_Odoribacter splanchnicus DSM 20712 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 245 Cas8 1-B_Odoribacter splanchnicus DSM 20712 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 246 Cas7 1-B_Odoribacter splanchnicus DSM 20712 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 247 Cass 1-B_Odoribacter splanchnicus DSM 20712 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 248 Cas6 1-B_Odoribacter splanchnicus DSM 20712 Аминокислотная последовательность белка
SEQ ID NO: 249 Cas8 1-B_Odoribacter splanchnicus DSM 20712 Аминокислотная последовательность белка
SEQ ID NO: 250 Cas7 1-B Odoribacter splanchnicus DSM 20712 Аминокислотная последовательность белка
SEQ ID NO: 251 Cass 1-B Odoribacter splanchnicus DSM 20712 Аминокислотная последовательность белка
SEQ ID NO: 252 CRISPR 1-B_Odoribacter splanchnicus DSM 20712 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 253 Cass 1-C Bacillus halodurans C-12S Генная последовательность геномной ДНК
SEQ ID NO: 254 Cas8 1-C Bacillus halodurans C-12S Генная последовательность геномной ДНК
SEQ ID NO: 255 Cas7 1-C Bacillus halodurans C-12S Генная последовательность геномной ДНК
SEQ ID NO: 256 Cass 1-C Bacillus halodurans C-12S Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 257 Cas8 1-C Bacillus halodurans C-12S Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 258 Cas7 1-C-Bacillus halodurans C-12S Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 259 Cass 1-C Bacillus halodurans C-12S Аминокислотная последовательность белка
SEQ ID NO: 260 Cas8 1-C Bacillus halodurans C-12S Аминокислотная последовательность белка
SEQ ID NO: 261 Cas7 1-C Bacillus halodurans C-12S Аминокислотная последовательность белка
SEQ ID NO: 262 CRISPR 1-C Bacillus halodurans C-12S Репрезентативный минимальный массив CRISPR
SEQ ID NO: 263 Cass 1-C_Desulfovibrio vulgaris RCH1 плазмида pDEVAL01 Генная последовательность геномной ДНК
SEQ ID NO: 264 Cas8 1-C_Desulfovibrio vulgaris RCH1 плазмида pDEVAL01 Генная последовательность геномной ДНК

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип после довательности
SEQ ID NO: 265 Cas7 1-C_Desulfovibrio vulgaris RCH1 плазмида pDEVAL01 Генная последовательность геномной ДНК
SEQ ID NO: 266 Cass 1-C_Desulfovibrio vulgaris RCH1 плазмида pDEVAL01 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 267 Cas8 1-C_Desulfovibrio vulgaris RCH1 плазмида pDEVAL01 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 268 Cas7 1-C_Desulfovibrio vulgaris RCH1 плазмида pDEVAL01 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 269 Cass 1-C_Desulfovibrio vulgaris RCH1 плазмида pDEVAL01 Аминокислотная последовательность белка
SEQ ID NO: 270 Cas8 1-C_Desulfovibrio vulgaris RCH1 плазмида pDEVAL01 Аминокислотная последовательность белка
SEQ ID NO: 271 Cas7 1-C_Desulfovibrio vulgaris RCH1 плазмида pDEVAL01 Аминокислотная последовательность белка
SEQ ID NO: 272 CRISPR 1-C_Desulfovibrio vulgaris RCH1 плазмида pDEVAL01 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 273 Cass 1-C Geobacillus thermocatenulatus штамм KCTC 3921 Генная последовательность геномной ДНК
SEQ ID NO: 274 Cas8 1-C Geobacillus thermocatenulatus штамм KCTC 3921 Генная последовательность геномной ДНК
SEQ ID NO: 275 Cas7 1-C Geobacillus thermocatenulatus штамм KCTC 3921 Генная последовательность геномной ДНК
SEQ ID NO: 276 Cass 1-C Geobacillus thermocatenulatus штамм KCTC 3921 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 277 Cas8 1-C Geobacillus thermocatenulatus штамм KCTC 3921 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 278 Cas7 1-C Geobacillus thermocatenulatus штамм KCTC 3921 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 279 Cass 1-C Geobacillus thermocatenulatus штамм KCTC 3921 Аминокислотная последовательность белка
SEQ ID NO: 280 Cas8 1-C Geobacillus thermocatenulatus штамм KCTC 3921 Аминокислотная последовательность белка
SEQ ID NO: 281 Cas7 1-C Geobacillus thermocatenulatus штамм KCTC 3921 Аминокислотная последовательность белка

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 282 CRISPR 1-C Geobacillus thermocatenulatus штамм KCTC 3921 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 283 Casa 1-F_Vibrio cholerae штамм L15 Генная последовательность геномной ДНК
SEQ ID NO: 284 Cas5 1-F_Vibrio cholerae штамм L15 Генная последовательность геномной ДНК
SEQ ID NO: 285 Cas7 1-F_Vibrio cholerae штамм L15 Генная последовательность геномной ДНК
SEQ ID NO: 286 Cas6 1-F_Vibrio cholerae штамм L15 Генная последовательность геномной ДНК
SEQ ID NO: 287 Cas8 1-F-Vibrio cholerae штамм L15 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 288 Cas5 1-F_Vibrio cholerae штамм L15 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 289 Cas7 1-F_Vibrio cholerae штамм L15 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 290 Cas6 1-F_ Vibrio cholerae штамм L15 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 291 Casa 1-F_Vibrio cholerae штамм L15 Аминокислотная последовательность белка
SEQ ID NO: 292 Cas5 1-F_Vibrio cholerae штамм L15 Аминокислотная последовательность белка
SEQ ID NO: 293 Cas7 1-F Vibrio cholerae штамм L15 Аминокислотная последовательность белка
SEQ ID NO: 294 Cas6 1-F Vibrio cholerae штамм L15 Аминокислотная последовательность белка
SEQ ID NO: 295 CRISPR 1-F Vibrio cholerae штамм L15 Exemplary minimal CRISPR array
SEQ ID NO: 296 Casa 1-F Klebsiella oxytoca штамм ICU1-2b Генная последовательность геномной ДНК
SEQ ID NO: 297 Cas5 1-F Klebsiella oxytoca штамм ICU1-2b Генная последовательность геномной ДНК
SEQ ID NO: 29a Cas7 1-F_Klebsiella oxytoca штамм ICU1-2b Генная последовательность геномной ДНК
SEQ ID NO: 299 Cas6 1-F Klebsiella oxvtoca штамм ICU1-2b Генная последовательность геномной ДНК
SEQ ID NO: 300 Casa 1-F_Klebsiella oxytoca штамм ICU1-2b Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 301 Cas5 1-F_Klebsiella oxytoca штамм ICU1-2b Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 302 Cas7 1-F_Klebsiella oxytoca штамм ICU1-2b Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 303 Cas6 1-F_Klebsiella oxytoca штамм ICU1-2b Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 304 Casa 1-F Klebsiella oxytoca штамм ICU1-2b Аминокислотная последовательность белка
SEQ ID NO: 305 Cas5 1-F_Klebsiella oxytoca штамм ICU1-2b Аминокислотная последовательность белка
SEQ ID NO: 306 Cas7 1-F_Klebsiella oxytoca штамм ICU1-2b Аминокислотная последовательность белка

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 307 Cas6 1-F Klebsiella oxytoca штамм ICU1-2b Аминокислотная последовательность белка
SEQ ID NO: 308 CRISPR 1-F Klebsiella oxytoca штамм ICU1-2b Репрезентативный минимальный массив CRISPR
SEQ ID NO: 309 Cas8 1-F Pseudomonas aeruginosa UCBPP-PA14 Генная последовательность геномной ДНК
SEQ ID NO: 310 Cas5 1-F Pseudomonas aeruginosa UCBPP-PA14 Генная последовательность геномной ДНК
SEQ ID NO: 311 Cas7 1-F Pseudomonas aeruginosa UCBPP-PA14 Генная последовательность геномной ДНК
SEQ ID NO: 312 Cas6 1-F Pseudomonas aeruQinosa UCBPP-PA14 Генная последовательность геномной ДНК
SEQ ID NO: 313 Cas8 1-F_Pseudomonas aeruginosa UCBPP-PA14 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 314 Cas5 1-F_Pseudomonas aeruginosa UCBPP-PA14 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 315 Cas7 1-F_Pseudomonas aeruginosa UCBPP-PA14 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 316 Cas6 1-F_Pseudomonas aeruginosa UCBPP-PA14 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 317 Cas8 1-F Pseudomonas aeruQinosa UCBPP-PA14 Аминокислотная последовательность белка
SEQ ID NO: 318 Cas5 1-F Pseudomonas aeruginosa UCBPP-PA14 Аминокислотная последовательность белка
SEQ ID NO: 319 Cas7 1-F Pseudomonas aeruginosa UCBPP-PA14 Аминокислотная последовательность белка
SEQ ID NO: 320 Cas6 1-F Pseudomonas aeruqinosa UCBPP-PA14 Аминокислотная последовательность белка
SEQ ID NO: 321 CRISPR 1-F Pseudomonas aeruQinosa UCBPP-PA14 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 322 Cas7 1 -Fv2 Shewanella putrefaciens CN-32 Генная последовательность геномной ДНК
SEQ ID NO: 323 Cas5 1 -Fv2_Shewanella putrefaciens CN-32 Генная последовательность геномной ДНК
SEQ ID NO: 324 Cas6 1 -Fv2 Shewanella putrefaciens CN-32 Генная последовательность геномной ДНК
SEQ ID NO: 325 Cas7 1 -Fv2_Shewanella putrefaciens CN-32 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 326 Cas5 1 -Fv2_Shewanella putrefaciens CN-32 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 327 Cas6 1 -Fv2_Shewanella putrefaciens CN-32 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 328 Cas7 1 -Fv2 Shewanella putrefaciens CN-32 Аминокислотная последовательность белка
SEQ ID NO: 329 Cas5 1 -Fv2 Shewanella putrefaciens CN-32 Аминокислотная последовательность белка
SEQ ID NO: 330 Cas6 1 -Fv2 Shewanella putrefaciens CN-32 Аминокислотная последовательность белка
SEQ ID NO: 331 CRISPR 1-Fv2 Shewanella putrefaciens CN-32 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 332 Cas7 1 -Fv2_Acinetobacter sp. 869535 Генная последовательность геномной ДНК
SEQ ID NO: 333 Cas5 1 -Fv2 Acinetobacter sp. 869535 Генная последовательность геномной ДНК

Таблица 3

Полинуклеотидные последовательности генов, кодирующих белки Cascade 12 видов

SEQ ID NO: Ген/Белок Подтип и организм Тип последовательности
SEQ ID NO: 334 Cas6 1 -Fv2 Acinetobacter sp. 869535 Генная последовательность геномной ДНК
SEQ ID NO: 335 Cas7 1 -Fv2_Acinetobacter sp. 869535 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 336 Cas5 1 -Fv2_Acinetobacter sp. 869535 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 337 Cas6 1 -Fv2_Acinetobacter sp. 869535 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 338 Cas7 1 -Fv2 Acinetobacter sp. 869535 Аминокислотная последовательность белка
SEQ ID NO: 339 Cas5 1 -Fv2 Acinetobacter sp. 869535 Аминокислотная последовательность белка
SEQ ID NO: 340 Cas6 1 -Fv2 Acinetobacter sp. 869535 Аминокислотная последовательность белка
SEQ ID NO: 341 CRISPR L1-Fv2_Acinetobacter sp. 869535 Репрезентативный минимальный массив CRISPR
SEQ ID NO: 342 Cas7 1 -Fv2 Vibrio cholerae HE48 Генная последовательность геномной ДНК
SEQ ID NO: 343 Cas5 1 -Fv2 Vibrio cholerae HE48 Генная последовательность геномной ДНК
SEQ ID NO: 344 Cas6 1 -Fv2 Vibrio cholerae HE48 Генная последовательность геномной ДНК
SEQ ID NO: 345 Cas7 1 -Fv2-Vibrio cholerae HE48 Генная последовательность ДНК, оптмизированная по кодонам H. sapiense
SEQ ID NO: 346 Cas5 1 -Fv2 Vibrio cholerae HE48 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 347 Cas6 1-Fv2 Vibrio cholerae HE48 Генная последовательность ДНК, оптмизированная по кодонам H. sapiens
SEQ ID NO: 348 Cas7 1 -Fv2 Vibrio cholerae HE48 Аминокислотная последовательность белка
SEQ ID NO: 349 Cas5 1-Fv2 Vibrio cholerae HE48 Аминокислотная последовательность белка
SEQ ID NO: 350 Cas6 1 -Fv2 Vibrio cholerae HE48 Аминокислотная последовательность белка
SEQ ID NO: 351 CRISPR 1 -Fv2 Vibrio cholerae HE48 Репрезентативный минимальный массив CRISPR

[00177] Полинуклеотидные последовательности для белков были получены из гДНК бактерии-хозяина и были оптимизированы по кодонам специально для экспрессии в E. coli и/или были оптимизированы по кодонам специально для экспрессии в эукариотических клетках (например, в клетках человека). Последовательности полинуклеотидной ДНК, кодирующие соответствующие минимальные массивы CRISPR, были основаны на повторяющихся последовательностях, происходящих от 12 видов, и могут быть использованы для создания зрелой cr-РНК, которая функционирует как руководящая РНК. В Таблице 4, минимальный массив CRISPR включает две повторяющиеся последовательности (показаны строчными буками, подчеркнуты), фланкирующие репрезентативную «спейсерную» последовательность, которая представляет собой руководящую часть cr-РНК. Процессинг РНК субъединицей эндонуклеазы Cascade генерирует cr-РНК с повторяющимися последовательностями на обоих 5'- и 3'-концах, фланкирующих руководящую последовательность.

[00178]

Таблица 4
Минимальные массивы CRISPR
SEQ ID NO: Виды Минимальные повторы CRISPR
SEQ ID NO:37 I-E_Oceanicola sp. HL-35 ctgttccccgcacacgcggggatgaaccgGGTTCTTCGATCTGCGCATCCATGATGCCGCCctgttccccgcacacgcggggatgaaccg
SEQ ID NO:53 I-E_Pseudomonas sp. S-6-2 gtgttccccgcacctgcggggatgaaccGGGCCGGGGCGTTTGCGCTGTCAGGGGCGTCCCgtgttccccgcacctgcggggatgaaccg
SEQ ID NO:69 Штамм серотипа Muenster I-E_Salmonella enterica подвида enterica gtgttccccgcgccagcggggataaaccgCAGCTTTAGCATCGGTCGACAGCCCATCTGGCgtgttccccgcgccagcggggataaaccg
SEQ ID NO:85 I-E_Atlantibacter hermannii NBRC 105704 gtgttccccgcgccagcggggataaaccgTTTTAAAACAGGATGTGGCCCGCCTGGTGCTGgtgttccccgcgccagcggggataaaccg
SEQ ID NO:101 I-E_Geothermobacter sp. EPR-M ctgttccccgcacccgcggggatgaaccgGTCATCTATTTTTAATGGACGATATTTTTCAActgttccccgcacccgcggggatgaaccg
SEQ ID NO:117 I-E_Methylocaldum sp. 14B ctgttccccacgtacgtggggatgaaccgACGGCGTAATGGTAATTGTTAGCCGACAAGTTctgttccccacgtacgtggggatgaaccg
SEQ ID NO:133 I-E_Methanocella arvoryzae MRE50 aaagtccccacaggcgtgggggtgaaccgTGATCAGTAACCCGGTCACCATTAAACAGATTaaagtccccacaggcgtgggggtgaaccg
SEQ ID NO:149 I-E_Lachnospiraceae bacterium KH1T2 gtattccccacgcacgtggrggtaaatcCGCTGAGTTTAATTACGCAGCGGAAGCCGGAGCGgtattccccacgcacgtgggggtaaatc
SEQ ID NO:165 Штамм I-E_Klebsiella pneumoniae VRCO0172 gtcttccccacacgcgtgggggtgtttcCGGCTCTTTTTTATCTCCTTCATCCTTCGCTATgtcttccccacacgcgtgggggtgtttc
SEQ ID NO:181 I-E_Pseudomonas aeruginosa DHS01 gtgttccccacatgcgtggggatgaaccgGGCACCATCGGCGCCATTGACCGCGCGCTGAAGgtgttccccacatgcgtggggatgaaccg
SEQ ID NO:197 Штамм I-E_Streptococcus thermophilus ND07 gtttttcccgcacacgcgggggtgatccTATACCTATATCAATGGCCTCCCACGCATAAGCgtttttcccgcacacgcgggggtgatcc
SEQ ID NO:213 I-E_Streptomyces sp. S4 gtcggccccgcacccgcggggatgctccAATGGCCGAGGACGACGGCGATCTGGCCACGGACgtcggccccgcacccgcggggatgctcc

[00179] В другом своем варианте, настоящее изобретение относится к сконструированным полинуклеотидным последовательностям, кодирующим компоненты Cascade из дополнительных видов бактерий или архебактерий в других подтипах типа I; включая, но не ограничиваясь ими, типы I-B, I-C, I-F и варианты I-F, которые могут быть идентифицированы и сконструированы в соответствии с указаниями, приведенными в разделе «Описание» и с использованием пакетов биоинформационных программ, таких как BLAST и PSI-BLAST, для определения локализации гомологов генов Cascade из систем идентификации, позволяющих определить каждый подтип (см., например, Makarova, K.S., et al., Nat. Rev. Microbiol. 13:722-736 (2015); Koonin, E.V., et al., Curr Opin Microbiol. 37:67-78 (2017). После идентификации нужных гомологов, фланкирующие геномные соседние области гена Cascade могут быть исследованы для определения локализации и идентификации генов остальных описанных здесь белков субъединиц Cascade. В качестве примера, дополнительные системы типа I-F могут быть идентифицированы путем определения локализации гомологов Cas8 (дополнительные системы варианта 2 типа I-F могут быть идентифицированы путем определения локализации гомологов Cas5) и идентификации перспективных видов бактерий для тестирования гомологичного Cascade, а затем получения или конструирования полинуклеотидных последовательностей, кодирующих Cas8, Cas5 и другие белковые компоненты Cascade из гомологичных систем CRISPR-Cas.

[00180] Полинуклеотидные последовательности ДНК генов, кодирующих три, четыре или пять белков субъединиц Cascade, происходящих от типов I-B, I-C, I-F и варианта 2 I-F от 12 дополнительных гомологичных комплексов Cascade, и аминокислотные последовательности полученных белковых компонентов, а также типичные минимальные массивы CRISPR представлены как SEQ ID NO: 214 - SEQ ID NO: 351 (Таблица 3). Полинуклеотидные последовательности для белков субъединиц были получены из гДНК бактерии-хозяина и были оптимизированы по кодонам специально для экспрессии в E. coli и/или были оптимизированы по кодонам специально для экспрессии в эукариотических клетках (например, в клетках человека). Последовательности полинуклеотидной ДНК, кодирующие соответствующие минимальные массивы CRISPR, были основаны на повторяющихся последовательностях, происходящих от 12 видов, и могут быть использованы для создания зрелой cr-РНК, которая функционирует как руководящая РНК. В Таблице 5, минимальный массив CRISPR включает две повторяющиеся последовательности (показаны строчными буками, подчеркнуты), фланкирующие репрезентативную «спейсерную» последовательность, которая представляет собой руководящую часть cr-РНК. Процессинг РНК субъединицей эндонуклеазы Cascade генерирует cr-РНК с повторяющимися последовательностями на обоих 5'- и 3'-концах, фланкирующих руководящую последовательность.

[00181]

Таблица 5
Минимальные массивы CRISPR
SEQ ID NO: Типы Минимальные повторы CRISPR
SEQ ID NO:226 I-B_Fusobacterium nucleatum subsp. animalis 3_1_33 atgaactgtaaacttgaaaagttttgaaatGTTGACAAATATTCAGATAATTTTTCAAAATCTTTTatgaactgtaaacttgaaaagttttgaaat
SEQ ID NO:239 I-B_Campylobacter fetus subsp. testudinum Sp3 gtttgctaatgacaatatttgtgttaaaacAAGCGTAGCACCAAAAGAAGCGTATGAAAGCATAGgtttgctaatgacaatatttgtgttaaaac
SEQ ID NO:252 I-B_Odoribacter splanchnicus DSM 20712 cttttaattgaactaaggtagaattgaaacTAGGAATAAACCGTACCCAACCACGTAGCCATATACGcttttaattgaactaaggtagaattgaaac
SEQ ID NO:262 I-C_Bacillus halodurans C-125 gtcgcactcttcatgggtgcgtggattgaaatCCTTTGACGGAGAGGGGAACAGGAAATTAGAGAAGgtcgcactcttcatgggtgcgtggattgaaat
SEQ ID NO:272 Плазмида I-C_Desulfovibrio vulgaris RCH1 pDEVAL01 gtcgccccccacgcgggggcgtggattgaaacCAGTCTCGTTACCCTGTCGCGGAGGGCGTCGATgtcgccccccacgcgggggcgtggattgaaac
SEQ ID NO:282 Штамм I-C_Geobacillus thermocatenulatus KCTC 3921 gttgcacccggctattaagccgggtgaggattgaaacTATATCACACAGCTTCTTAGTATCATCGACAACACGTgttgcacccggctattaagccgggtgaggattgaaac
SEQ ID NO:295 Штамм I-F_Vibrio cholerae L15 gttcactgccgtacaggcagcttagaaaAATATGCAGGGGTTTGAAACGCTCGATGTTATgttcactgccgtacaggcagcttagaaa
SEQ ID NO:308 Штамм I-F_Klebsiella oxytoca ICU1-2b gttcactgccgtacaggcagcttagaaaAAAAACTGAGCGGCCGCAGAATGAAGTTGTAAgttcactgccgtacaggcagcttagaaa
SEQ ID NO:321 I-F_Pseudomonas aeruginosa UCBPP-PA14 gttcactgccgtgtaggcagctaagaaaACCACCCGCTACCACCGGCAGCCGCACCGGCCgttcactgccgtgtaggcagctaagaaa
SEQ ID NO:331 I-Fv2_Shewanella putrefaciens CN-32 gttcaccgccgcacaggcggcttagaaaTCAACCAAATCATAAATTGCGCGACCACATTGgttcaccgccgcacaggcggcttagaaa
SEQ ID NO:341 I-Fv2_Acinetobacter sp. 869535 gttcactgccatataggcagcttagaaaATCGTTTTTTCATACGAGATTCGAAACGGACAgttcactgccatataggcagcttagaaa
SEQ ID NO:351 I-Fv2_Vibrio cholerae HE48 gttcactgccgcacaggcagcttagaaaTAACCGGAGGCGTACACTCGATAGAGGCAGCGgttcactgccgcacaggcagcttagaaa

[00182] В примерах 19A-19I и в примерах 22A-22C описано конструирование и тестирование множества гомологов комплекса Cascade, каждый из которых содержит гибридный белок субъединицы Cas-FokI, для оценки эффективности редактирования генома для каждого комплекса Cascade. Наилучшее редактирование наблюдалось у варианта от Pseudomonas sp. S-6-2, в то время как другие гомологи (то есть Salmonella enterica, Geothermobacter sp. EPR-M, Methanocella arvoryzae MRE50 и S. thermophilus (штамм ND07)) показали редактирование, приблизительно эквивалентное E. coli. Редактирование также наблюдалось в случае сконструированных комплексов FokI-Cascade штамма Vibrio cholera L15 (типа I-F) и комплексов FokI-Cascade штамма Vibrio cholera HE48 (типа I-Fv2). В одном из вариантов осуществления изобретения, различные требования к PAM этих различных гомологов могут увеличивать нужную плотность в полинуклеотиде-мишени (например, гДНК в клетке). Соответственно, эта коллекция гомологов комплекса Cascade обеспечивает еще большую гибкость при выборе последовательностей-мишеней нуклеиновых кислот в полинуклеотиде-мишени (например, гДНК в клетке).

[00183] Во втором своем аспекте, настоящее изобретение относится к модифицированным белкам субъединиц Cascade. Белки субъединиц Cascade, подходящие для модификации, включают, но не ограничиваются ими, белки субъединиц Cascade описанных здесь видов.

[00184] В одном своем варианте, настоящее изобретение относится к сконструированным белкам субъединицы Cascade с кольцевой пермутацией. Такие кольцевые пермутации белка субъединицы Cascade позволяют получить структуру белка, имеющую различную степень связывания исходной линейной аминокислотной белка субъединицы Cascade, но имеющую в целом аналогичную трехмерную форму (см., например, Bliven, S., et al. др., PLoS Comput. Biol. 8: e1002445 (2012)). Кольцевые пермутации белков субъединиц Cascade могут иметь ряд преимуществ. Так, например, кольцевая пермутация белка субъединицы Cas7 может создавать новый N-конец и новый C-конец, предназначенные для их связывания с дополнительной полипептидной последовательностью с образованием гибридного белка или линкерной области без нарушения укладки белка Cas7 или сборки комплекса Cascade. Три примера кольцевых пермутаций Cas7 (Cas7 с кольцевыми пермутациями, cpCas7) проиллюстрированы на фиг. 3A и фиг. 3B. На фиг. 3A и фиг. 3B показаны три части белка: N-концевая часть нативного белка (фиг. 3A, вертикальные полосы, например, белок Cas7), центральная часть нативного белка (фиг. 3A, заштрихованы серым), и C-концевая часть природного белка (фиг. 3A, не заштриховано). На фиг. 3A проиллюстрировано перемещение N-концевой части нативного белка в C-концевое положение нативного белка для получения белка с кольцевой пермутацией (фиг. 3A, cpCas7), где N-концевая часть нативного белка теперь находится в N-концевой части cpCas7 и связана с центральной частью нативного белка линкерным полипептидом (фиг. 3A, линкером). На фиг. 3B проиллюстрировано перемещение С-концевой части нативного белка (фиг. 3B, Cas7) в N-концевое положение нативного белка (фиг. 3B, cpCas7), где C-концевая часть нативного белка теперь находится на N-конце cpCas7 и связана с центральной частью нативного белка линкерным полипептидом (фиг. 3B, линкером).

[00185] Данные, представленные в Примере 10A, Примере 10B и Примере 10, показали, что очистка комплексов Cascade, содержащих варианты белка субъединицы Cas7 с кольцевой пермутацией, продемонстрировала, что белки субъединицы CRISPR-Cas с кольцевой пермутацией типа I-E могут быть с успехом использованы для образования комплексов Cascade, имеющих, по существу, такой же состав (на основе молекулярной массы), как и комплексы Cascade, содержащие белки дикого типа.

[00186] В другом своем варианте, настоящее изобретение относится к белкам субъединиц Cascade, присоединенным к дополнительным полипептидным последовательностям для получения гибридных белков, а также к полинуклеотидам, кодирующим такие гибридные белки. Дополнительные полипептидные последовательности могут включать, но не ограничиваются ими, белки, белковые домены, белковые фрагменты и функциональные домены. Примеры таких дополнительных полипептидных последовательностей включают, но не ограничиваются ими, последовательности, происходящие от доменов активации или репрессии транскрипции, и нуклеотид-дезаминазы (например, цитидин-дезаминазы или аденин-дезаминазы, такие как описано Komor, et. Al., Nature 553: 420-424 (2016); Koblan et al., Nat. Biotechnol. Doi: 10.1038/nbt.4172 (May 29, 2018)). В настоящей заявке представлены дополнительные функциональные домены для гибридных белков.

[00187] Дополнительная полипептидная последовательность может быть присоединена к любому из белков субъединицы Cascade, где дополнительная полипептидная последовательность кодируется дополнительной полинуклеотидной последовательностью, которая обычно присоединяется к 5'- или 3'-концу полинуклеотида, содержащего кодирующую последовательность белка субъединицы Cascade. В некоторых вариантах осуществления изобретения, дополнительные полинуклеотидные последовательности, которые кодируют аминокислотные линкеры, соединяют белок субъединицы Cascade с дополнительными представляющими интерес полипептидными последовательностями. В некоторых вариантах осуществления изобретения, полинуклеотидные последовательности для партнера гибридного белка и линкерная последовательность могут происходить от природных последовательностей гДНК или могут быть оптимизированы по кодонам для бактериальной экспрессии в E.coli или для эукариотической экспрессии в клетках млекопитающих (например, в клетках человека). Примеры гибридных белков, содержащих аффинные метки (например, His6, Strep-tag® II (IBA GMBH LLC, Göttingen, Germany)), сигнал или последовательность ядерной локализации (NLS), белок, связывающийся с мальтозой, и FokI представлены в Примере 1. Репрезентативные аминокислотные линкерные последовательности также представлены в Примере 1.

[00188] В примере 11A описаны гибриды «белок субъединицы Cascade - FokI», а также гибриды белка субъединицы Cascade с цитидин-дезаминазами, эндонуклеазами, рестриктирующими ферментами, нуклеазами/геликазами или их доменами. В примере 11B описаны гибриды белка субъединицы Cascade с другими белками субъединицы Cascade, а также гибриды белка субъединицы Cascade с с другими гибридными белками субъединицы Cascade, и доменом белка-фермента (Пример 11D). В некоторых вариантах осуществления изобретения, белок субъединицы CRISPR типа I может быть оценен in silico на возможность его использования для получения гибридных белков у N-конца, C-конца или положениях между N-концом и C-концом. В некоторых вариантах осуществления изобретения, белок субъединицы CRISPR типа I может быть связан с одним или более гибридными доменами у N-конца, C-конца или в положениях между N-концом и C-концом посредством одного или более полипептидных линкеров. В некоторых вариантах осуществления изобретения, белок субъединицы Cascade может быть присоединен к одноцепочечному FokI (например, одноцепочечному гибриду FokI с комплексом EcoCascade RNP; нуклеотидной последовательностью SEQ ID NO: 1926; последовательностью белка SEQ ID NO: 1927). Репрезентативные полипептидные линкеры представлены в Примерах 1, 11, 18 и 19.

[00188] Фиг. 4A и фиг. 4B проиллюстрированы комплексы Cascade, содержащие белок субъединицы Cas8 (фиг. 4A, фиг. 4B, Cas7, Cas5, Cas8, Cse2, Cas6, пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилькой cr-РНК; кРНК показана черной линией, и содержит шпильку; и Cas8, где «C» означает C-конец, а «N» означает N-конец), присоединенный к дополнительной последовательности белка (например, FokI). На фиг. 4A показан пример дополнительной белковой последовательности (фиг. 4A, FP), связанной с С-концом белка субъединицы Cas8 посредством линкерного полипептида (фиг. 4A, черная изогнутая линия). На фиг. 4B показан пример дополнительной последовательности белка (фиг. 4B, FP), соединенной с N-концом белка субъединицы Cas8 посредством линкерного полипептида (фиг. 4B, черная изогнутая линия). В Примере 11A описаны in silico конструирование, клонирование, экспрессия и очистка Cas8 типа I-E, присоединенного по N-концу к домену нуклеазы FokI.

[00190] На Фиг. 5A и фиг. 5B проиллюстрированы дополнительные примеры комплексов Cascade, содержащих белок субъединицы Cascade, присоединенный к дополнительной последовательности белка. На фиг. 5A и фиг. 5B, кРНК показана черной линией и содержит шпильку, а также показаны относительные положения белков Cas в комплексе Cascade (фиг. 5A, фиг. 5B: Cas7, Cas5, Cas8, Cse2, Cas6; пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилькой cr-РНК). На фиг. 5A показан пример детектируемого фрагмента (например, белка флуоресцирующего в зеленом диапазоне спектра; фиг. 5A, GFP), присоединенного к каждому из шести белков субъединицы Cas7 посредством линкерного полипептида (фиг. 5А, изогнутая черная линия). Такой комплекс Cascade может быть использован для обнаружения связывания комплекса с последовательностью нуклеиновой кислоты-мишени благодаря обеспечению значительной амплификации сигнала в результате присутствия множества детектируемых фрагментов, связанных с комплексом Cascade. На фиг. 5B показан пример дополнительной последовательности белка (фиг. 5B, FP), связанной с белком субъединицы Cas6 посредством линкерного полипептида (фиг. 5B, изогнутая черная линия).

[00191] Примеры гибридных белков, содержащих белки субъединицы Cascade E. coli типа I-E, включают, но не ограничиваются ими, ту же самую субъединицу (например, Cse2_линкер_Cse2), субъединицы с кольцевой пермутацией (например, cpCas7_линкер_cpCas7_линкер_ cpCas7_линкер_cpCas7_линкер_cpCas7_линкер_cpCas7), белок Cascade типа I-E, связанный с нуклеазой (например, FokI_линкер_Cas8, Cas3_линкер_Cas8,Cas6_линкер_FokI, S1-нуклеаза_линкер_Cse2_линкер_Cse2), белок Cascade типа I-E, связанный с цитидин-дезаминазой (например, Cas8_линкер_AID, Cse2_линкер_Cse2_линкер_APOBEC3G), и белок Cascade типа I-E, связанный с одним или более другими белками Cascade типа I-E (например, Cas6_линкер_cpCas7_линкер_cpCas7_линкер_cpCas7_линкер_cpCas7_

линкер_cpCas7_линкер_cpCas7,cpCas7_линкер_cpCas7_линкер_cpCas7_

линкер_cpCas7_линкер_cpCas7_линкер_cpCas7_линкер_Cas5,Cas6_

линкер_cpCas7_линкер_cpCas7_линкер_cpCas7_линкер_cpCas7_линкер_cpCas7_линкер_cpC as7_линкер_Cas5).

[00192] На фиг. 6A, фиг. 6B и фиг. 6C представлены иллюстрации сконструированных эффекторных комплексов CRISPR-Cas типа I, которые содержат cpCas7. На фиг. 6A, фиг. 6B и фиг. 6C, «cpCas7» представляет собой белок Cas7 с кольцевой пермутацией (фиг. 6A, фиг. 6B, фиг. 6C: cpCas7, Cas5, Cas8, Cse2 и Cas6; пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилькой cr-РНК; кРНК показан черной линией, содержащей шпильку; для cpCas7, штриховка соответствует белку с кольцевой пермутацией, показанному на фиг. 3А), а также показаны относительные положения белков Cas в комплексе Cascade. На фиг. 6A представлен комплекс Cascade, содержащий шесть отдельных белков субъединиц cpCas7 (фиг. 6A, cpCas7). На фиг. 6B представлен комплекс Cascade, содержащий шесть гибридных белков субъединицы cpCas7, где C-конец белка субъединицы cpCas7 (фиг. 6B, cpCas7) присоединен к N-концу соседнего белка субъединицы cpCas7 посредством линкерного полипептида (фиг. 6B, линкерный полипептид показан черной линией, соединяющей белки субъединицы cpCas7). На фиг. 6C представлен вариант, где комплекс Cascade включает шесть гибридных белков субъединицы cpCas7 («остов»), где C-конец первого белка субъединицы cpCas7 присоединен к N-концу второго белка субъединицы cpCas7 посредством линкерного полипептида (Фиг. 6С, линкерный полипептид показан в виде черной линии, соединяющей белки субъединицы cpCas7); С-конец второго белка субъединицы cpCas7 присоединен к N-концу другой последовательности белка (фиг. 6С, FP) (например, цитидиндезаминазы) посредством линкерных полипептидов (фиг. 6C, прямые черные линии, соединяющие cpCas7 и FP), а C-конец этой белок-кодирующей последовательности присоединен к N-концу третьего cpCas7 посредством линкерного полипептида. Одним из преимуществ такого гибридного остова цепи белков субъединицы cpCas7 является то, что дополнительная последовательность белка может быть введена в определенное положение вдоль всего остова, что будет обеспечивать доступ дополнительной белковой последовательности к различным участкам по всей длине последовательности нуклеиновой кислоты-мишени, с которой непосредственно связывается руководящая последовательность комплекса Cascade.

[00193] На фиг. 7A и фиг. 7В показаны другие варианты сконструированных эффекторных комплексов CRISPR-Cas типа I, содержащих гибридные белки. На фиг. 7A и фиг. 7B показаны относительные положения белков Cas в комплексе Cascade (фиг. 7A, фиг. 7B: Cas7, Cas5, Cas8, Cse2 и Cas6; пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилькой cr-РНК; cr-РНК изображена черной линией и содержит шпильку). На фиг. 7A показан комплекс Cascade, содержащий гибридный белок Cse2-Cse2 (фиг. 7A, два белка Cse2, соединенные изогнутой черной линией). In silico конструирование, клонирование, экспрессия, очистка и анализы на сдвиг электрофоретической подвижности описаны в примере 11B и в Примере 11C, относящихся к комплексам Cascade, содержащим гибридые белки Cse2-Cse2. На фиг. 7В показан комплекс Cascade, содержащий гибридный белок Cse2-Cse2, соединенный посредством линкерного полипептида (фиг. 7B, изогнутая черная линия, соединяющая белок Cse2 с FP) с дополнительной последовательностью белка (фиг. 7B, FP). В Примере 11D описаны in silico конструирование, клонирование, экспрессия и очистка белка Cse2-Cse2, присоединенного к цитидин-дезаминазе.

[00194] В некоторых вариантах осуществления изобретения, один или более сигналов ядерной локализации могут быть добавлены к сконструированному N-концу или C-концу субъединицы белка Cascade (например, гибридного белка Cas8-FokI, белка cpCas7 или гибридного белка Cse2-Cse2).

[00195] В некоторых вариантах гибридных полипептидов, линкерные полипептиды соединяют две или более белок-кодирующих последовательности. Длина типичных линкерных полипептидов описана в примерах. Обычно длина линкера включает, но не ограничивается ими, приблизительно от 10 аминокислот до приблизительно 40 аминокислот, приблизительно от 15 аминокислот до приблизительно 30 аминокислот и приблизительно от 17 аминокислот до приблизительно 20 аминокислот. Аминокислотный состав линкерных полипептидов обычно включает аминокислоты, которые являются полярными, небольшими и/или заряженными (например, Gly, Ala, Leu, Val, Gln, Ser, Thr, Pro, Glu, Asp, Lys, Arg, His, Asn, Cys, Tyr). В дополнительных вариантах осуществления изобретения, линкерные полипептиды сконструированы так, чтобы они не содержат метионина, а гибрид был сконструирован так, чтобы он не содержал скрытых сайтов инициации трансляции. В соответствии с руководством, представленным в разделе «Описание», линкерный полипептид был сконструирован так, чтобы это обеспечивало соответствующую пространственную конфигурацию и расположение функционального домена и белка Cascade внутри гибридного белка (см., например, Chichili, C., et al., Protein Science 22: 153-167 (2013); Chen, X. et al., 65: 1357-1369 (2013); George R. et al., Protein Engineering, Design and Selection 15: 871-879 (2002)). Дополнительными примерами линкерных полипептидов, используемых для осуществления настоящего изобретения, являются идентифицированные линкерные полипептиды, которые соединяют кодирующие последовательности белков Cascade друг с другом в организмах, содержащих системы Cascade (например, линкерный полипептид, который соединяет Cas8 с Cas3 в Streptomyces griseus, как описано Westra, ER, et al., Mol, Cell. 46: 595-605 (2012)).

[00196] Последовательности ДНК, кодирующие гибридный белок, могут быть оптимизированы по кодонам для экспрессии в выбранном организме, таком как клетки бактерий, архебактерий, растений, грибов или млекопитающих. Программы оптимизации по кодонам являются широкодоступными, например, на web-сайте Integrated DNA Technologies (www.idtdna.com/CodonOpt) или на серверах Genscript® (Genscript, Piscataway, NJ). Для облегчения клонирования в экспрессионный вектор реципиента, дополнительные последовательности, перекрывающиеся с вектором, совместимым для клонирования SLIC (см., например, Li, M., et al., Methods Mol. Biol. 852: 51-59 (2012)), могут быть присоединены у 5’- и 3’-концов последовательности ДНК.

[00197] В других вариантах осуществления изобретения, белки субъединиц Cascade могут быть присоединены к доменам активации и/или репрессии транскрипции. В некоторых вариантах осуществления изобретения, гибридный белок может содержать домены-активаторы (например, факторы транскрипции теплового шока, активаторы NFKB, VP16 и VP64 (см., например, Eguchi, A. et. Al., Proc. Natl. Acad. Sci. USA H3 : E8257-E8266 (2016); Perez-Pinera, P. et. Al., Nature Methods 10: 973-6 (2013); Gilbert, LA, et. Al. Cell 159: 647-61 (2014)) или домены-репрессоры (например, домен KRAB). В некоторых вариантах осуществления изобретения, линкерные последовательности нуклеиновых кислот используются для соединения двух или более кодирующих последовательностей для белков, доменов белка или фрагментов белка.

[00198] Комплексы Cascade, содержащие белки субъединиц CRISPR-Cas типа I, присоединенные к активаторам транскрипции, могут быть использованы для активации экспрессии гена. Локус-мишень может содержать сайт инициации транскрипции (TSS), который обычно содержит один или более сайтов связывания с факторами механизмов активации транскрипции в клетках. На фиг. 8 проиллюстрирован комплекс Cascade, содержащий шесть гибридных белков, содержащих cpCas7 (см. фиг. 3A), соединенный посредством линкерного полипептида (фиг. 8, изогнутая черная линия, соединяющая cpCas7 с VP64) с активатором транскрипции VP64. На фиг. 8, cr-РНК проиллюстрирована черной линией и содержит шпильку, и показаны относительные положения белков Cas в комплексе Cascade (фиг. 8: cpCas7, Cas5, Cas8, Cse2 и Cas6; пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилькой cr-РНК). Такой способ конструирования комплекса Cascade позволяет преобразовать этот комплекс в гибкий инструмент для активации транскрипции гена (CASCADEa), где нацеливание на выбранный ген достигается путем отбора руководящей последовательности, которая нацелена на связывание комплекса Cascade с одним или более регуляторными элементами (например, TSS) выбранного гена. В примере 12 описана конструкция белка cp-Cas7 E. coli типа I-E, присоединенного к домену активации VP64, для сообщения комплексу Cascade функции активации транскрипции. Активаторы транскрипции включают, но не ограничиваются ими, гомеодоменные белки, белки «цинковых пальцев», белки крыловидной спирали (вилки), белки «лейциновой молнии», белки «спираль-петля-спираль», гетеродимерные факторы транскрипции, домены активации и факторы транскрипции, которые связываются с энхансерами (см., например, Molecular Cell Biology, Harvey Lodish et al., WH Freeman & Co; (2002) ISBN 978-0849394805).

[00199] Кроме того, комплексы Cascade, содержащие белки субъединиц CRISPR-Cas типа I, присоединенные к репрессорам транскрипции, могут быть использованы для подавления экспрессии гена. Локус-мишень может содержать элементы регуляции транскрипции. В одном варианте осуществления изобретения, белок субъединицы Cascade может быть связан с доменом KRAB посредством линкерного полипептида. Комплекс Cascade, включающий гибрид белка субъединицы Cascade/домена KRAB, может преобразовывать комплекс в гибкий инструмент для репрессии транскрипции гена (CASCADEi), где нацеливание на выбранный ген достигается путем отбора руководящей последовательности, которая регулирует связывание комплекса Cascade с одним или более регуляторными элементами выбранного гена. Репрессоры транскрипции включают, но не ограничиваются ими, пассивные репрессоры транскрипции, семейство факторов транскрипции bzip, sp1-подобные репрессоры транскрипции, активные репрессоры транскрипции (например, репрессоры транскрипции, действующие посредством рекрутинга гистон-деацетилаз, гистон-деацетилирования и репрессоров двойного специфического действия (см., например, Thiel, G., et al., Eur. J. Biochem. 271:2855-2862 (2004); Nicola Reynolds, N., et al., Development 140:505-512 (2013); Gaston, K., et al., Cell Mol. Life Sci., 60:721-741 (2003)).

[00200] В дополнительных вариантах осуществления изобретения, белки субъединицы Cascade могут быть присоединены к аффинным меткам.

[00201] В других вариантах осуществления изобретения, руководящие полинуклеотиды CRISPR-Cas типа I могут быть модифицированы путем вставки выбранного полинуклеотидного элемента или модификаций нуклеотидов в выбранных положениях в руководящих полинуклеотидах (например, фундаментально отличающихся модификаций фрагментов ДНК для фрагментов РНК, а также других модификаций, описанных выше для руководящих полинуклеотидов). Такие варианты осуществления изобретения включают, но не ограничиваются ими, руководящие полинуклеотиды CRISPR-Cas типа I, присоединенные к 5’-концу, 3’-концу, или внутри к одному или более эффекторным доменами нуклеотидов (например, к MS2 или MS2-P65-HSF1, связывающихся с РНК или с аптамером, которые осуществляют рекрутинг факторов транскрипции). На фиг. 9 проиллюстрирован руководящий полинуклеотид CRISPR типа I, и показаны относительные положения белков Cas в комплексе Cascade (фиг. 9: Cas7, Cas5, Cas8, Cse2 и Cas6; пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилькой cr-РНК; кРНК показана черной линией и содержит шпильку в пунктирной рамке). На фиг. 9, cr-РНК дополнительно содержит шпильку РНК-аптамера (фиг. 9, положение указано стрелкой), введенную в 3’-шпильку руководящего полинуклеотида.

[00202] Длина руководящих CRISPR-Cas типа I может быть также изменена обычно путем удлинения или укорачивания белка субъединицы Cas7 и области связывания белка субъединицы Cse2. На фиг. 10A проиллюстрирован комплекс Cascade с тремя субъединицами Cas7, одной субъединицей Cse2 и укороченной cr-РНК (фиг. 10A: Cas7, Cas5, Cas8, Cse2 и Cas6; пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилькой cr-РНК; cr-РНК показана черной линией и содержит шпильку). На фиг. 10В проиллюстрирован комплекс Cascade с девятью субъединицами Cas7, тремя субъединицами Cse2 и укороченной cr-РНК (фиг. 10В: Cas7, Cas5, Cas8, Cse2 и Cas6; пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилькой cr-РНК; cr-РНК показана черной линией и содержит шпильку).

[00203] В Примере 16 описано получение и тестирование модификаций руководящих cr-РНК CRISPR-Cas типа I и возможность использования модифицированных руководящих последовательностей для конструирования эффекторных комплексов CRISPR-Cas типа I.

[00204] В своем третьем аспекте, настоящее изобретение относится к последовательностям нуклеиновой кислоты, кодирующим один или более сконструированных компонентов Cascade, а также к экспрессионным кластерам, векторам и рекомбинантным клеткам, содержащим последовательности нуклеиновых кислот, кодирующие один или более сконструированных компонентов Cascade. Некоторые варианты осуществления третьего аспекта изобретения включают один или более полипептидов, кодирующих все компоненты выбранной системы Cascade (например, белки Cse2, Cas5, Cas6, Cas7 и Cas8 и один или более когнатных руководящих белков), где указанные компоненты способны образовывать эффекторный комплекс. Обычно, если экспрессируются более, чем один когнатный руководящий белок, то такие руководящие белки имеют различные спейсерные последовательности для прямого связывания с различными последовательностями нуклеиновой кислоты-мишени. Такие варианты включают, но не ограничиваются ими, экспрессионные кластеры, векторы и рекомбинантные клетки.

[00205] В одном своем варианте, настоящее изобретение относится к одному или более экспрессионным кластерам, содержащим одну или более последовательностей нуклеиновых кислот, кодирующих один или более сконструированных компонентов Cascade. Экспрессионные кластеры обычно содержат регуляторную последовательность, участвующую в одном или более из следующих процессов: регуляции транскрипции, посттранскрипционной регуляции или регуляции трансляции. Экспрессионные кластеры могут быть введены в организмы широкого ряда, включая, но не ограничиваясь ими, бактериальные клетки, дрожжевые клетки, клетки растений и клетки млекопитающих (включая клетки человека). Экспрессионные кластеры обычно содержат функциональные регуляторные последовательности, соответствующие организму(ам), в который(е) они вводятся.

[00206] В другом своем варианте, настоящее изобретение относится к векторам, включая экспрессионные векторы, содержащие одну или более последовательностей нуклеиновых кислот, кодирующих один или более сконструированных компонентов Cascade. Векторы могут также включать последовательности, кодирующие селективные или скринируемые маркеры. Кроме того, последовательности нацеливания на ядро могут быть также присоединены, например, к белкам субъединиц Cascade. Векторы могут также включать полинуклеотиды, кодирующие белковые метки (например, поли-His-метки, гемагглютининовые метки, флуоресцентные белковые метки и биолюминесцентные метки). Кодирующие последовательности для таких белковых меток могут быть присоединены, например, к одной или более последовательностям нуклеиновой кислоты, кодирующим белок субъединицы Cascade.

[00207] Общие методы конструирования экспрессионных векторов известны специалистам в данной области. Экспрессионные векторы для клеток-хозяев являются коммерчески доступными. Существует несколько коммерчески доступных компьютерных программ, разработанных для облегчения выбора подходящих векторов и их конструирования, таких как векторы из клеток насекомых для трансформации клеток насекомых и экспрессии генов в клетках насекомых; бактериальные плазмиды для бактериальной трансформации и экспрессии генов в бактериальных клетках, дрожжевые плазмиды для трансформации клеток и экспрессия генов в дрожжах и в других грибах, векторы млекопитающих для трансформации клеток млекопитающих и экспрессии генов в клетках млекопитающих или у млекопитающих, и вирусные векторы (включая, но не ограничиваясь ими, лентивирус, ретровирус, аденовирус, вирус простого герпеса I или II, парвовирус, вирус ретикулоэндотелиоза и аденоассоциировнный вирус (AAV-векторы) для трансформации и экспрессии генов, и эти способы облегчают клонирование таких полинуклеотидов.

[00208] Векторы на основе AAV (rAAV) являются одним из примеров вирусных векторов, используемых для осуществления способов согласно изобретению. AAV представляет собой одноцепочечный член ДНК семейства Parvoviridae и представляет собой природный вирус, дефектный по репликации. Векторы AAV относятся к числу вирусных векторов, наиболее часто используемых в генотерапии. Известны двенадцать человеческих серотипов AAV (AAV серотип 1 [AAV-1] - AAV-12) и более 100 серотипов не-человеческого происхождения. В одном вариантах осуществления изобретения, AAV-6 используется в качестве вектора.

[00209] Лентивирусные векторы представляют собой другой пример вирусных векторов, используемых для осуществления способов согласно изобретению. Лентивирус является членом семейства Retroviridae и представляет собой вирус с одноцепочечной РНК, который может инфицировать как делящиеся, так и неделящиеся клетки, а также обеспечивать стабильную экспрессию за счет интеграции в геном. Для повышения безопасности лентивирусных векторов, компоненты, необходимые для получения вирусного вектора, разделяют на множество плазмид. Векторы для переноса обычно являются некомпетентными по репликации и могут дополнительно содержать делецию в 3'LTR, что приводит к аутоинактивации вируса после интеграции. Плазмиды для упаковки и оболочечные плазмиды обычно используются в сочетании с вектором для переноса. Так, например, упаковывающая плазмида может кодировать комбинации генов Gag, Pol, Rev и Tat. Плазмида для переноса может содержать вирусные LTR и сигнал упаковки psi. Оболочечная плазмида обычно содержит белок оболочки (обычно гликопротеин вируса везикулярного стоматита, VSV-GP, из-за его широкого диапазона инфекционности).

[00210] Репрезентативные векторы для трансформации растений включают векторы, полученные из Ti-плазмиды Agrobacterium tumefaciens (см., например, Lee, LY, et al., Plant Physiology 146: 325-332 (2008)). Также полезными и известными в данной области являются плазмиды Agrobacterium rhizogenes. Так, например, в программе SNAPGENE™ (GSL Biotech LLC, Chicago, IL; snapgene.com/resources/plasmid_files/your_time_is_valuable/) представлен обширный список векторов, отдельных векторных последовательностей и векторных карт, а также коммерчески доступных источников для многих векторов.

[00211] Для экспрессии и очистки рекомбинантного Cascade в бактериальной экспрессионной системе могут быть сконструированы векторы, кодирующие белки субъединиц Cascade, а также минимальные массивы CRISPR, содержащие представляющие интерес руководящие последовательности. Соответственно, один из аспектов изобретения включает такие системы экспрессии. В одном варианте осуществления изобретения, комплекс Cascade экспрессируется из трех отдельных плазмидных векторов, которые вместе кодируют следующие компоненты: белок Cas8; белки Cse2, Cas7, Cas5 и Cas6; и РНК CRISPR. В некоторых вариантах осуществления изобретения, экспрессионная плазмида, кодирующая Cas8, включает последовательность природного гена гДНК, а в других вариантах осуществления изобретения, экспрессионная плазмида может кодировать Cas8, который был оптимизирован по кодонам для экспрессии в клетках выбранного типа. Аналогичным образом, экспрессионная плазмида, кодирующая Cse2, Cas7, Cas5, и Cas6, может содержать последовательности генов природной гДНК или может содержать последовательности генов, которые были оптимизированы по кодонам для экспрессии в клетках выбранного типа. В некоторых вариантах осуществления изобретения, весь оперон, кодирующий белок субъединицы Cascade, может быть расположен ниже одного промотора транскрипции, так, чтобы все различные белки транслировались из одного полицистронного транскрипта. В дополнительных вариантах осуществления изобретения, гены, кодирующие белки субъединиц Cascade, могут быть отделены друг от друга посредством промежуточных терминаторов и промоторов транскрипции.

[00212] Экспрессионная плазмида, кодирующая cr-РНК, может содержать всего два повтора, фланкирующих одну спейсерную последовательность, расположенную ниже соответствующего транскрипционного промотора, или она может содержать множество повторов, фланкирующих несколько спейсерных последовательностей либо одной и той же руководящей последовательности, либо нескольких отдельных руководящих последовательностей. Скоординированная экспрессия CRISPR и субъединиц Cascade, в частности, субъединицы Cas6, приводит к процессингу длинных предшественников cr-РНК в зрелую форму cr-РНК, каждая из которых содержит фрагменты одного повтора на 5'- и 3'-концах cr-РНК, и одну спейсерную последовательность в середине.

[00213] Альтернативная стратегия экспрессии полного комплекса Cascade в E. coli использует две плазмиды: одну плазмиду, которая кодирует весь оперон Cas8-Cse2-Cas7-Cas5-Cas6 на одной экспрессионной плазмиде, и одну плазмиду, кодирующую РНК CRISPR. В этом случае, 5'-конец гена Cse2, который обычно перекрывается с 3'-концом гена Cas8, пространственно отделен от 3'-конца гена Cas8, что позволяет присоединять полинуклеотидную последовательность, кодирующую аффинную метку и/или последовательность распознавания протеазой.

[00214] В Примере 2 описаны два типа бактериальных экспрессионных плазмидных систем для белков Cascade: система первого типа включает две плазмиды, то есть, первую плазмиду, кодирующую белок Cas8, и вторую плазмиду, кодирующую 4-субъединичных белка комплекса CasBCDE (оперон cse2-cas7-cas5-cas6); а система второго типа включает экспрессионную плазмиду, кодирующую все пять субъединичных белков комплекса Cascade (оперон cas8-cse2-cas7-cas5-cas6). Также описаны когнатные массивы CRISPR.

[00215] Для облегчения очистки комплексов Cascade, к субъединице Cse2 может быть присоединена аффинная метка, такая как N-концевая метка Strep-II или гексагистидиновая (His6) метка. Кроме того, аминокислотная последовательность, распознаваемая протеазой, такой как протеаза TEV или протеаза HRV3C, может быть встроена между аффинной меткой и нативным N-концом субъединицы Cse2, так, чтобы биохимическое расщепление последовательности протеазой после начальной очистки высвобождало аффинную метку из конечного рекомбинантного комплекса Cascade. Аффинная метка может быть также помещена на другие субъединицы или оставлена на субъединице Cse2 и объединена с дополнительными аффинными метками на других субъединицах. Репрезентативные белки субъединицы Cascade, содержащие аффинные метки, представлены в Примере 1, в Примере 2, в Примере 3A, в Примере 3B и в Примере 3C.

[00216] Для систем Cascade типа I-E, штамм E. coli может быть трансформирован плазмидами, кодирующими РНК CRISPR, а также генами cse2-cas7-cas5-cas6, индуцированными экспрессией белка, и может быть получен комплекс Cascade, в котором отсутствует субъединица Cas8. Этот комплекс Cascade обычно называют комплексом Cascade минус Cas8 или, альтернативно, комплексом CasBCDE (см., например, Jore, M., et al., Nat. Struct. Mol. Biol. 18: 529-536 (2011)). Этот очищенный комплекс может быть биохимически объединен с отдельно очищенным Cas8 для восстановления полного Cascade (см., например, Sashital, DG, et al., Mol. Cell 46: 606-615 (2012)).

[00217] В Таблице 6 представлены репрезентативные последовательности бактериальных экспрессионных плазмид, кодирующих минимальный массив CRISPR, конструкции cas8, cse2-cas7-cas5-cas6 и конструкции cas8-cse2-cas7-cas5-cas6, содержащие различные метки и конструкции. Плазмиды, которые кодируют комплексы Cascade и комплексы Cascade из гомологичных систем типа I, могут быть сконструированы аналогично репрезентативным последовательностям экспрессионных плазмид для типа I-E, обнаруженного в E.coli K-12 MG1655, в соответствии с указаниями, приведенными здесь в разделе «Описание». Таблица 6 также содержит последовательности экспрессионных плазмид, экспрессирующих белки Cas8-Cse2-Cas7-Cas5-Cas6, а также гибриды FokI с геном cas8 или с геном cas6, для получения гибридов нуклеаза-Cascade в целях проведения экспериментов по редактированию генов.

[00218]

Таблица 6
Векторы для получения эффекторных комплексов Cascade
SEQ ID NO: Описание Виды, от которых происходит эффекторный комплекс Тип последовательности
SEQ ID NO:352 Минимальный массив CRISPR I-E_E. coli K-12 MG1655 Спейсерная последовательность, нацеленная на J3
SEQ ID NO:353 Минимальный массив CRISPR I-E_E. coli K-12 MG1655 Спейсерная последовательность, нацеленная на CCR5.1
SEQ ID NO:354 Минимальный массив CRISPR (J3/L3) I-E_E. coli K-12 MG1655 Спейсерная последовательность минимального массива CRIPSR, нацеленная на J3 и L3
SEQ ID NO:355 Минимальный массив CRISPR (Hsa07) I-E_E. coli K-12 MG1655 Спейсерная последовательность минимального массива CRIPSR, нацеленная на Hsa07
SEQ ID NO:356 His6-MBP-TEV-Cas8 I-E_E. coli K-12 MG1655 Происходящая от гДНК с присоединенными метками
SEQ ID NO:357 StrepII-HRV3C-Cse2_Cas7_Cas5_Cas6 I-E_E. coli K-12 MG1655 Происходящая от гДНК с присоединенными метками
SEQ ID NO:358 Cas8_His6-HRV3C-Cse2_Cas7_Cas5_Cas6 I-E_E. coli K-12 MG1655 Происходящая от гДНК с присоединенными метками
SEQ ID NO:359 FokI-30aa-Cas8_His6-HRV3C-Cse2_Cas7_Cas5_Cas6 I-E_E. coli K-12 MG1655 Происходящая от гДНК с присоединенными метками
SEQ ID NO:360 FokI-30aa-Cas8_His6-HRV3C-Cse2_Cas7_Cas5_NLS-Cas6 I-E_E. coli K-12 MG1655 Происходящая от гДНК с присоединенными метками
SEQ ID NO:361 FokI-30aa-Cas8_His6-HRV3C-Cse2_Cas7-NLS_Cas5_Cas6 I-E_E. coli K-12 MG1655 Происходящая от гДНК с присоединенными метками
SEQ ID NO:362 Cas8_His6-HRV3C-Cse2_Cas7_Cas5_Cas6-20aa-FokI I-E_E. coli K-12 MG1655 Происходящая от гДНК с присоединенными метками

[00219] Таблица 7 содержит последовательности отдельных полипромоторных бактериальных экспрессионных плазмид, кодирующих все пять субъединичных белков вместе с cr-РНК из одной бактериальной экспрессионной плазмиды. В этой конструкции, каждый ген отделен от других генов, которые он фланкирует выше и ниже вместе с промотором и терминатором транскрипции. Могут быть введены дополнительные последовательности, которые кодируют аффинную метку и/или метку распознавания протеазы, и которые также присоединены к белку нуклеазы для создания гибрида Cascade-нуклеаза в целях редактирования гена.

[00220]

Таблица 7
Векторы для получения эффекторных комплексов Cascade
SEQ ID NO: Описание Виды, от которых происходит эффекторный комплекс Тип последовательности
SEQ ID NO:363 Полипромотор, Cas5_Cas3_Cse2_ Cas7_Cas6_Cas8_CRISPR(J3) I-E_E. coli K-12 MG1655 Происходящая от гДНК с присоединенными метками
SEQ ID NO:364 Полипромотор, Cas5_Cas3_Cse2_ Cas7_CRISPR(J3)_Cas6_Cas8 I-E_E. coli K-12 MG1655 Происходящая от гДНК с присоединенными метками
SEQ ID NO:365 Полипромотор(EcoCO), CRISPR(J3/L3)_
Cse2_Cas7_Cas5_Cas8_Cas6
I-E_E. coli K-12 MG1655 Оптимизированные по кодонам генные последовательности ДНК E. coli
SEQ ID NO:366 Полипромотор(EcoCO), CRISPR(J3/L3)_Cse2_Cas7_Cas5_
Cas8_FokI-30aa-Cas6
I-E_E. coli K-12 MG1655 Оптимизированные по кодонам генные последовательности ДНК E. coli
SEQ ID NO:367 Полипромотор(EcoCO), CRISPR(J3/L3)_Cse2_Cas7_Cas5_
Cas6_FokI-30aa-Cas8
I-E_E. coli K-12 MG1655 Оптимизированные по кодонам генные последовательности ДНК E. coli

[00221] Могут быть сконструированы дополнительные бактериальные экспрессионные плазмиды, кодирующие гомологичные комплексы Cascade от других подтипов Типа I и других бактериальных или архебактериальных организмов, исходя из описанных здесь критериев конструирования. Такие экспрессионные плазмиды могут быть сконструированы с использованием последовательностей гДНК генов Cascade, либо они могут быть сконструированы с использованием генных последовательностей, которые были оптимизированы по кодонам для экспрессии в E. coli или в других бактериальных штаммах.

[00222] Для экспрессии Cascade или эффекторных гибридов с Cascade в клетках млекопитающих, таких как клетки человека, были сконструированы эукариотические плазмидные экспрессионные векторы, обеспечивающие экспрессию соответствующих белков и компонентов РНК по механизму транскрипции и трансляции у эукариотов. В одном варианте осуществления изобретения, Cascade может быть создан в клетках млекопитающих посредством кодирования каждого белкового компонента на отдельном экспрессионном векторе, находящимся под контролем эукариотического промотора (например, промотора цитомегаловируса (CMV)), и кодирования cr-РНК на отдельном экспрессионном векторе, находящимся под контролем промотора РНК-полимеразы III (например, человеческого промотора U6). РНК CRISPR может кодироваться минимальным массивом CRISPR, содержащим по меньшей мере два повтора, фланкирующих одну или более спейсерных последовательностей, которые функционируют как руководящая часть зрелой crРНК. Конструкция, генерирующая РНК CRISPR, может быть сконструирована с дополнительными последовательностями, фланкирующими крайние повторы в минимальном массиве. Процессинг предшественника РНК CRISPR обеспечивается субъединицей процессинга РНК комплекса Cascade (белком субъединицы Cas6), который может экспрессироваться из отдельной плазмиды.

[00223] В Таблице 8 представлены последовательности отдельных эукариотических экспрессионных плазмид для каждого белка комплекса Cascade E. coli типа I-E. Субъединица Cas8 может быть присоединена к дополнительным доменам эффекторной нуклеазы, такой как нуклеаза FokI (Пример 1, Пример 3A, Пример 3B и Пример 3C). Таблица 8 также содержит последовательности экспрессионных плазмид для компонента cr-РНК Cascade, кодирующих две отдельные cr-РНК, где три последовательности повторов фланкируют два спейсера. Каждый из генов, кодирующих белок, может быть присоединен к полинуклеотидным последовательностям, которые присоединяют сигналы ядерной локализации (NLS), аффинные метки и линкерные последовательности, соединяющие эти метки. Другие гибриды с любым белками субъединицы Cascade могут кодироваться дополнительными полинуклеотидными последовательностями, которые обычно присоединены к 5'- или 3'-кодирующей последовательности, включая дополнительные полинуклеотидные последовательности, которые кодируют аминокислотные линкеры, соединяющие белок субъединицы Cascade с дополнительными представляющими интерес полипептидными последовательностями. Примеры гибридных белков-кандидатов описаны в настоящей заявке.

[00224]

Таблица 8
Векторы для получения эффекторных комплексов Cascade
SEQ ID NO: Описание Виды, от которых происходит эффекторный комплекс Тип последовательности
SEQ ID NO:368 Cas8, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:369 NLS-Cas8, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:370 NLS-HA-FokI-30aa-Cas8, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:371 NLS-Cse2, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:372 NLS-Cas7, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:373 Cas5, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:374 NLS-Cas5, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:375 Cas6, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:376 NLS-Cas6, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:377 NLS-V5-FokI-30aa-Cas8, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:378 Cas3-NLS, HsCO I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:379 CRISPR(Hsa07) I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens

[00225] Для экспрессии компонентов комплекса Cascade на меньшем количестве экспрессионных векторов могут быть сконструированы полицистронные экспрессионные векторы, где один промотор (например, промотор CMV) одновременно запускает экспрессию множества кодирующих последовательностей, которые разделены последовательностью вируса Thosea asigna 2А. Последовательности вирусного пептида 2А индуцируют вырезание рибосомы, что позволяет генам, кодирующим множество белков, объединяться в одну полицистронную конструкцию для экспрессии в эукариотических клетках. Таким образом, можно создать полицистронные векторы, кодирующие четыре или пять субъединиц белков комплекса Cascade на одном транскрипте под контролем одного промотора. Таблица 9 содержит последовательности эукариотических полицистронных экспрессионных плазмид, которые могут быть объединены с экспрессионной РНК-плазмидой CRISPR для получения функционального Cascade в клетках млекопитающих.

[00226]

Таблица 9
Векторы для получения эффекторных комплексов Cascade
SEQ ID NO: Описание Виды, от которых происходит эффекторный комплекс Тип последовательности
SEQ ID NO:380 Полицистронный(HsCO), NLS-Cas7_NLS-Cse2_NLS-Cas5_NLS-Cas6 I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:381 Полицистронный(HsCO), NLS-Cas7_NLS-Cse2_NLS-Cas5_NLS-Cas6_NLS-Cas8 I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:382 Полицистронный(HsCO), NLS-Cas7_NLS-Cse2_NLS-Cas5_NLS-Cas6_NLS-FokI-30aa-Cas8 I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:383 Полицистронный(HsCO), NLS-Cas7_NLS-Cse2_NLS-Cas5_NLS-Cas6_NLS-FokI-30aa-Cas8, без эпитопных меток I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:384 Полицистронный(HsCO), NLS-Cas7_NLS-Cse2_NLS-Cas5_NLS-FokI-30aa-Cas6_NLS-Cas8, без эпитопных меток I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens

[00227] В некоторых вариантах осуществления изобретения, РНК CRISPR кодируется в 3'-нетранслируемой области (UTR), белок-кодирующего гена, экспрессия которого регулируется промотором РНК-полимеразы II (например, промотором CMV) с образованием транскрипта. В таких вариантах осуществления изобретения, минимальный массив CRISPR был сконструирован так, чтобы он находился ниже белок-кодирующего гена, такого как Cas6, Cas7, или репортерного гена (например, кодирующего активированный белок, флуоресцирующий в зеленом диапазоне спектра, eGFP), и отделен от белок-кодирующей кодирующей последовательности триплексной последовательностью MALAT1, которая, как было показано ранее, придает стабильность расположенному выше транскрипту. Минимальный массив CRISPR процессируется субъединицей процессинга РНК Cascade (обычно он экспрессируется другой плазмидой), эндонуклеазой, которая расщепляет минимальный массив CRISPR, после чего в транскрипт вводится разрыв, и триплексная последовательность защищает 3'-конец вышерасположенного белок-кодирующего гена от преждевременного экзонуклеолитического расщепления. Таблица 10 содержит три полинуклеотидных последовательности, где массив CRISPR клонируется ниже Cas6, Cas7 или eGFP, а экспрессия всей гибридной последовательности регулируется промотором CMV.

[00228]

Таблица 10
Векторы для получения минимальных массивов CRISPR
SEQ ID NO: Описание Виды, от которых происходит эффекторный комплекс Тип последовательности
SEQ ID NO:385 eGFP_MALAT1-триплекс_CRISPR (Hsa07) I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:386 NLS-Cas7_MALAT1- триплекс_CRISPR (Hsa07) I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:387 NLS-Cas6_MALAT1- триплекс_CRISPR (Hsa07) I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens

[00229] В некоторых вариантах осуществления изобретения, массив РНК CRISPR кодируется в таком же векторе, как и полицистронная конструкция, индуцирующая экспрессию пяти белков субъединицы Cascade; где комбинация этих двух элементов генерирует универсальный вектор, который продуцирует все функциональные субъединицы (как белок, так и РНК) комплекса Cascade, вместе с любыми нуклеазными или эффекторными доменами, присоединенными к одной из субъединиц Cascade. Таблица 11 содержит две репрезентативные последовательности этих универсальных полинуклеотидных последовательностей, которые кодируют все соответствующие компоненты для продуцирования функциональных FokI-Cascade RNP в клетках млекопитающих.

[00230]

Таблица 11
Векторы для получения эффекторных комплексов Cascade
SEQ ID NO: Описание Виды, от которых происходит эффекторный комплекс Тип последовательности
SEQ ID NO:388 hU6_CRISPR(Hsa07)_F, CMV_NLS-Cas7_NLS-Cse2_NLS-Cas5_NLS-Cas6_NLS-FokI-30aa-Cas8 I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens
SEQ ID NO:389 hU6_CRISPR(Hsa07)_R, CMV_NLS-Cas7_NLS-Cse2_NLS-Cas5_NLS-Cas6_NLS-FokI-30aa-Cas8 I-E_E. coli K-12 MG1655 Оптимизированная по кодонам генная последовательность ДНК H. sapiens

[00231] В Примере 3A, в Примере 3B и в Примере 3C описаны экспрессионные системы, полученные с использованием отдельных плазмид, экспрессирующих каждый белок субъединицы Cascade и минимального массива CRISPR; экспрессионные системы, где последовательности, кодирующие множество белков субъединицы Cascade, экспрессируются из одного промотора, и экспрессионная система, где одноплазмидная система экспрессии Cascade была сконструирована для экспрессии всего оперона cas8-cse2-cas7-cas5-cas6 и минимального массива CRISPR для использования в клетках млекопитающих.

[00232] Специалист в данной области, следующий руководству, представленному в разделе «Описание», может сконструировать дополнительные экспрессионные векторы млекопитающих, кодирующие другие комплексы Cascade, аналогично примерам, где представлен комплекс Cascade E. coli типа I-E.

[00233] В своем четвертом аспекте, настоящее изобретение относится к получению сконструированных эффекторных комплексов CRISPR-Cas типа I путем введения плазмид, кодирующих один или более компонентов сконструированных эффекторных комплексов CRISPR-Cas типа I, в клетки-хозяева. Трансформированные клетки-хозяева (или рекомбинантные клетки) или потомство клеток, которые были трансформированы или трансфицированы методами рекомбинантных ДНК, могут содержать одну или более последовательностей нуклеиновых кислот, кодирующих один или более компонентов сконструированного эффекторного комплекса CRISPR-Cas типа I. Способы введения полинуклеотидов (например, экспрессионного вектора) в клетки-хозяева известны специалистам в данной области и обычно выбираются в зависимости от типа клетки-хозяина. Такие методы включают, например, вирусную или бактериофаговую инфекцию; трансфекцию; конъюгирование; электропорацию; преципитацию фосфатом кальция; трансфекцию, опосредованную полиэтиленимином; трансфекцию, опосредованную DEAE-декстраном; слияние протопластов; липофекцию; трансфекцию, опосредованную липосомами; метод выстреливания частиц; бомбардировку микрочастицами; прямую микроинжекцию и доставку, опосредованную наночастицами. В одном варианте осуществления изобретения, полинуклеотиды, кодирующие компоненты сконструированных эффекторных комплексов CRISPR-Cas типа I, вводят в бактериальные клетки (например, E. coli).

[00234] В Примере 4A и в Примере 4B описан способ введения и экспрессии последовательностей, кодирующих белок Cas8, а также последовательностей, кодирующих компоненты сконструированных эффекторных комплексов CRISPR-Cas типа I для бактериального продуцирования таких комплексов с использованием экспрессионных систем E. coli.

[00235] Множество описанных здесь репрезентативных клеток-хозяев может быть использовано для продуцирования рекомбинантных клеток с использованием сконструированного эффекторного комплекса Cascade. Такие клетки-хозяева включают, но не ограничиваются ими, клетку растения, дрожжевую клетку, бактериальную клетку, клетку насекомого, клетку водорослей и клетку млекопитающего.

[00236] Для простоты обсуждения следует отметить, что используемый ниже термин «трансфекция» относится к любому методу введения полинуклеотидов в клетку-хозяина.

[00237] В некоторых вариантах осуществления изобретения, клетку-хозяина транзиентно или непрерывно трансфицируют последовательностями нуклеиновой кислоты, кодирующими один или более компонентов эффекторного комплекса CRISPR-Cas типа I. В некоторых вариантах осуществления изобретения, клетку трансфицируют, как это происходит в природе у индивидуума. В некоторых вариантах осуществления изобретения, трансфицируемую клетку сначала берут у индивидуума, например, первичную клетку или клетку-предшественника. В некоторых вариантах осуществления изобретения, первичную клетку или клетку-предшественника культивируют и/или возвращают после трансфекции ex vivo тому же самому или другому индивидууму.

[00238] Экспрессия и очистка сконструированных эффекторных комплексов CRISPR-Cas типа I являются трудоемким процессом, а поэтому, для облегчения скрининга большого количества вариантов руководящих полинуклеотидов или эффекторных комплексов была разработана высокопроизводительная система доставки на основе плазмид. Каждый из пяти генов Cas был оптимизирован по кодонам человека и клонирован в экспрессионную плазмиду под контролем CMV в виде N-концевого гибрида NLS, и минимальный массив CRISPR, содержащий спаренные рРНК, нацеленные на экзон TRAJ27 локуса Т-клеточного рецептора альфа (браузер для генома UCSC, hg38) клонировали в шестую плазмиду, расположенную ниже человеческого промотора U6 (пример 3A; фиг. 35). На фиг. 35, элементы расположены в следующем порядке слева направо: промотор hu6, серый прямоугольник с ромбовидным концом; повтор 1, незаштрихованный ромб (белый); спейсер 1, серый вафельный прямоугольник; повтор 2, серый ромб; спейсер 2, серый точечный прямоугольник; и повтор 3, черный ромб. На фиг. 35, в скобках проиллюстрирована область, кодирующая две рРНК. В некоторых вариантах осуществления изобретения, две руководящие РНК могут быть одинаковыми (например, нацеливаться на одну и ту же последовательность нуклеиновой кислоты-мишени), а в других вариантах осуществления изобретения, две руководящие РНК могут быть различными (например, они могут нацеливаться на две различные последовательности нуклеиновой кислоты-мишени).

[00239] Процессинг рРНК в большинстве систем типа I в природе катализируется рибонуклеазой Cas6, присутствующей в Cascade (см., например, Brouns, S.J, et al., Science 321: 960-964 (2008); Hochstrasser, M., et al., Trends Biochem. Sci. 40: 58-66 (2015), а поэтому нет необходимости в использовании множества промоторов с применением описанного здесь метода спаренных рРНК. В соответствии с этим, один вариант осуществления изобретения включает векторы, содержащие спаренные руководящие полинуклеотиды, функционально присоединенные к регуляторным элементам для обеспечения экспрессии руководящих полинуклеотидов (например, рРНК). Котрансфекция с шестью плазмидами давала до ~3% редактирования в локусе TRAJ27, и удаление любого одного компонента приводило к отмене редактирования генома, с единственным исключением для Cast11, который представляет собой эффекторный комплекс Cascade E. coli и не является абсолютно необходимым для связывания ДНК (см., например, Westra, E., et al., RNA Biol. 9:1134-1138 (2012)).

[00240] В другом варианте осуществления изобретения, минимальные массивы CRISPR, обычно содержащие две руководящие последовательности, вводят в клетки или в биохимические реакционные смеси в качестве ДНК-матриц. ДНК-матрицы получают с помощью ПЦР-амплификации (например, фиг. 42A; Пример 20А). Такие минимальные массивы CRISPR могут быть введены в клетки с одной или более плазмидами, кодирующими белковые компоненты комплекса Cascade. В некоторых вариантах осуществления изобретения, минимальные массивы CRISPR и векторы, содержащие спаренные руководящие полинуклеотиды, могут быть введены в клетку или в биохимическую реакционную смесь. В способах, проводимых с применением двух комплексов Cascade RNP (например, в способах связывания последовательности нуклеиновой кислоты-мишени или в способах разрезания последовательностью нуклеиновой кислоты-мишени; см., например, фиг. 15A, фиг. 15B, фиг. 15C), минимальные массивы CRISPR могут кодировать две различных руководящих последовательности. В соответствии с этим, в некоторых вариантах осуществления изобретения, две руководящие РНК могут быть различными (например, нацелены на две различные последовательностью нуклеиновой кислоты). В методах с применением одного комплекса Cascade RNP (например, с использованием одного эффекторного комплекса CRISPR-Cas типа I, ассоциированного с белком mCas3, или эффекторного комплекса CRISPR-Cas типа I, где гибридный белок Cas3 ассоциирован с комплексом; см., например, фиг. 16A, 17B, 17C, фиг. 21A, фиг. 21B, фиг. 21C, фиг. 21D), минимальные массивы CRISPR могут кодировать две копии одной и той же руководящей последовательности. В соответствии с этим, в некоторых вариантах осуществления изобретения, две руководящих РНК могут быть одинаковыми (например, нацелены на одну и ту же последовательность нуклеиновой кислоты-мишени).

[00241] В еще одном варианте осуществления изобретения, полинуклеотиды, кодирующие руководящие последовательности, которые дополнительно содержат последовательности и структуры, распознаваемые белком Cas6 для эндонуклеолитического процессинга предшественников crРНК в зрелые руководящие РНК, могут быть введены в клетки или биохимические реакционные смеси. В других вариантах осуществления изобретения, зрелые руководящие полинуклеотиды, не требующие процессинга, могут быть использованы при сборке комплексов Cascade. Такие зрелые руководящие РНК могут включать модификации последовательностей (например, фосфортиоатные связи на 5'- и/или 3'-концах для облегчения защиты руководящей РНК от расщепления нуклеазами, например, РНКазами). Дополнительные модификации руководящей последовательности включают модификации, описанные здесь для нуклеотидных последовательностей (например, нуклеотидных аналогов и т.п.).

[00242] В Примере 9A, Примере 9B, Примере 9C и Примере 9D проиллюстрированы создание и доставка комплексов Cascade E. coli типа I-E, содержащих гибридные белки FokI, для облегчения редактирования генома в клетках человека. В примере 9B описана доставка плазмидных векторов, экспрессирующих компоненты комплекса Cascade, в эукариотические клетки. В своем пятом аспекте, настоящее изобретение относится к очистке сконструированных эффекторных комплексов CRISPR-Cas типа I из клеток и к применению таких комплексов. Сконструированные эффекторные комплексы CRISPR-Cas типа I продуцируются в клетке-хозяине. Сконструированные эффекторные комплексы CRISPR-Cas типа I (в данном случае комплексы Cascade RNP) очищают из клеточных лизатов.

[00243] В Примере 5A и в Примере 5B описана очистка комплексов Cascade RNP E. coli типа I-E, продуцируемых посредством сверхэкспрессии в бактериях, как описано в Примере 4B. В этом способе используется аффинная хроматография на иммобилизованном металле с последующей эксклюзионной хроматографией (ЭХ). В Примере 5A и в Примере 5B описаны методы, которые могут быть применены для оценки качества очищенных продуктов Cascade RNP. В примерах проиллюстрирована очистка комплексов Cascade RNP Cas8, Cas7, Cas6, Cas5 и Cse2, комплексов Cascade, содержащих белки Cas7, Cas6, Cas5 и Cse2, и гибридных белков FokI-Cas8.

[00244] Очищенные сконструированные эффекторные комплексы CRISPR-Cas типа I могут быть также использованы непосредственно в биохимических анализах (например, в анализах на связывание и/или расщепление). В Примере 6А, в Примере 6В и в Примере 6С описано получение последовательностей дцДНК-мишеней для использования в анализах на связывание или расщепление ДНК in vitro. В примере 6 описаны три метода получения последовательностей-мишеней, включая отжиг синтетических олигонуклеотидов оцДНК, ПЦР-амплификацию выбранных последовательностей нуклеиновой кислоты-мишени из гДНК, а также клонирование последовательностей нуклеиновой кислоты-мишени в бактериальные плазмиды. Последовательности-мишени дцДНК были использованы в анализах на связывание или расщепление Cascade.

[00245] Сайт-специфическое связывание и/или разрезание одним или более сконструированными эффекторными комплексами CRISPR-Cas типа I может быть подтверждено, если это необходимо, с помощью анализа на сдвиг электрофоретической подвижности (см., например, Garner, M., et al., Nucleic Acids Res. 9: 3047-3060 (1981); Fried, M., et al., Nucleic Acids Res. 9: 6505-6525 (1981); Fried, M., Electrophoresis 10: 366-376 (1989) ); Fillebeen, C., et al., J. Vis. Exp. (94), e52230, doi: 10.3791/52230 (2014)), или анализа на биохимическое расщепление, описанного в Примере 7.

[00246] Данные, представленные в Примере 7, продемонстрировали, что сконструированные эффекторные комплексы CRISPR-Cas типа I могут демонстрировать почти количественное расщепление ДНК, о чем свидетельствует превращение суперспирализованного кольцевого плазмидного субстрата в расщепленную линейную форму. После демонстрации устойчивой биохимической активности под действием сконструированных эффекторных комплексов CRISPR-Cas типа I (например, содержащих гибридные белки компонента FokI-Cascade) было осуществлено редактирование генома в клетках.

[00247] В Примере 8A, Примере 8B, Примере 8C и Примере 8D проиллюстрированы создание и доставка комплексов Cascade E. coli типа I-E, содержащих гибридные белки субъединицы Cas-FokI, в клетки человека. Данные, представленные в Примере 8D, продемонстрировали доставку предварительно собранных Cascade RNP в клетки-мишени и эффективное редактирование генома в клетках человека.

[00248] Очищенные сконструированные эффекторные комплексы CRISPR-Cas типа I могут быть непосредственно введены в клетки. Способы введения компонентов в клетку включают электропорацию, липофекцию, технологию выстреливания частиц и бомбардировку микрочастицами.

[00249] На Фиг. 36A, фиг. 36B, фиг. 36C и фиг. 36D представлены сравнительные данные по редактированию генома в клетках человека посредством сконструированных комплексов Cascade-RNP и доставки сконструированных комплексов CRISPR-Cas на основе плазмид. На фиг. 36A-D, фиг. 36A, клетки HEK293 трансфицировали очищенными RNP с последующим анализом путем секвенирования следующего поколения (NGS) отредактированных сайтов. Как показано на фиг. 36A (трансфекция RNP), комплексы FokI-Cascade RNP (фиг. 36A, представленные в левой части рисунка над прямой линией), нацеленные на два соседних локуса, были подвергнуты нуклеофекции в клетки HEK293 (фиг. 36A, звездчатые, серые, слева от рисунка), для индуцирования расщепления ДНК и редактирование генома. Были определены эффективности редактирования на 16 уникальных сайтах-мишенях генома (см. Пример 6C, Таблицу 31, двойной человеческий Hsa1-16) (n=1). TRAC представляет собой константную область T-клеточного рецептора. При продуцировании T-клеточных рецепторов, они включают стыки сплайсинга (то есть, «вариабельную» область и «область присоединения»). Некоторые из описанных здесь руководящих TRAC нацелены на области присоединения (например, TRAJ27). Расстояния между спейсерами для каждой мишени показаны под графиком (фиг. 36A, слева направо, 25, 30, 35, 40, 45 пар оснований (п.о.)). На фиг. 36A, на вертикальной оси представлен процент эффективности редактирования (фиг. 36A, эффективность редактирования (%)), на горизонтальной оси представлены мишени 1-16, а под горизонтальной осью находятся скобки, указывающие на длину промежуточного спейсера в парах оснований (п.о.).

[00250] На Фиг. 36B представлены репрезентативные результаты репарации ДНК для мишени 7 на фиг. 36А. На фиг. 36B, относительные положения половинных сайтов, на которые нацелены спаренные рРНК, показаны в верхней части чертежа вместе с ассоциированными с ними сайтами PAM. Расстояние между спейсерами показано верхней линией. На графике, ожидаемый сайт расщепления (фиг. 36B, положение «0» показано вертикальной черной средней линией) и расстояния в п.о. (от -50 до 50) указаны вверху. Каждая горизонтальная серая линия представляет другой класс секвенированных ридов, которые наблюдались в локусе-мишени. Эти линии имеют следующие индикаторы: серая область=соответствие последовательности; горизонтальная черная линия=делеция; и незаштриховаванная рамка=вставка. Кружки, расположенные справа от графика у каждой линии: черный кружок - рид дикого типа; а незаштриховаванные белые кружки - мутантные риды. Ожидаемый рид дикого типа показан в первой серой полосе («Ref»;, то есть эталонная последовательность). Рид дикого типа показан во второй серой полосе (вторая серая полоса; фиг. 36B, черный кружок). Следующие 11 линий иллюстрируют мутантные риды (фиг. 36B, незаштриховаванные кружки). Длины вставок, выраженные в количестве пар оснований, показаны в столбце справа от кружков. Общий процент ридов показан в следующем столбце справа, а общее число ридов представлено в последнем столбце справа.

[00251] Как показано на фиг. 36C (система трансфекции из 6 плазмид), клетки HEK293 (фиг. 36C, звездообразные, серые, слева от чертежа) трансфицировали шестью плазмидами, пятью плазмидами, кодирующими белки Cas (фиг. 36C, плазмиды обозначены как FokI-Cas8, Cas11, Cas7, Cas5 и Cas6), и одной плазмидой, кодирующей спаренные рРНК, где эти плазмиды находилась под контролем CMV и промотора U6 (hU6) человека (фиг. 36C, рРНК), а затем проводили NGS-анализ отредактированных сайтов. Иллюстрации комплексов FokI-Cascade RNP расположены ниже пунктирной линии. Были определены эффективности редактирования в мишени 7 на фиг. 36A (n=2) (фиг. 36A, черные столбцы на графике), и смеси плазмид, не содержащие отдельных компонентов (фиг. 36C, ниже горизонтальной оси, серые прямоугольники, содержащие -/+), были включены в качестве контролей (фиг. 36C, незаштриховаванные столбцы на графике).

[00252] Как показано на фиг. 36D (система трансфекции из 2 плазмид), клетки HEK293 (фиг. 36D, звездообразные, серые, слева от чертежа) трансфицировали плазмидой, экспрессирующей спаренные рРНК (фиг. 36D, плазмидная рРНК) и полицистронной экспрессионной плазмидой, кодирующей все пять белков, разделенных пептидами последовательностей «вырезания рибосомы» Т2А (фиг. 36D, CMV-Cas7-2A-cas11-2A-Cas5-2A-Cas6-2A-FokI-Cas8), с последующим проведением NGS-анализа отредактированных сайтов. Иллюстрации комплексов FokI-Cascade RNP расположены ниже пунктирной линии. Были определены эффективности редактирования для 16 мишеней, показанных на фиг. 36A, как для трансфекций 2-плазмидной системой (фиг. 36D, незаштриховаванные столбцы), так и для трансфекций 6-плазмидной системой на фиг. 37C (n=3) (фиг. 36D, черные столбцы). На фиг. 36D, по вертикальной оси отложен процент эффективности редактирования («Эффективность редактирования (%)»), по горизонтальной оси представлены мишени 1-16, а под горизонтальной осью находятся скобки, указывающие длину промежуточного спейсера в парах оснований (п.о.) (фиг. 36D, слева вправо, 25, 30, 35, 40, 45 п.о.).

[00253] Эксперименты были проведены путем нуклеофекции клеток HEK293 очищенными Cascade-RNP, содержащими сигнальные последовательности ядерной локализации на FokI и Cas6. Наблюдалась эффективность редактирования до ~4%, о чем свидетельствует секвенирование ПЦР-ампликонов следующего поколения, полученных из гДНК, и среди 16 протестированных сайтов-мишеней, редактирование обычно происходило на сайтах, имеющих межспейсерную длину 30 п.о. (фиг. 36A). Более тщательное изучение спектра результатов репарации показало, что INDEL были кластеризованы в середине промежуточного спейсера (фиг. 36B), что соответствовало конструкции комплексов CRISPR-Cas типа I. Соответственно, в одном варианте осуществления изобретения, сконструированные комплексы CRISPR-Cas типа I были непосредственно введены в клетку. Для экспериментов по доставке 6 плазмид (фиг. 36C) проводили сборку смесей плазмид, содержащих 420 нг каждой плазмиды, кроме одной, а затем, воду, используемую в качестве негативного контроля, или 700 нг плазмиды с отсутствием вставки добавляли снова после нуклеофекции. Для начальных экспериментов по доставке 2 полицистронных плазмид FokI-EcoCascade (фиг. 36D), клетки подвергали электропорации с использованием 500 нг каждой плазмиды или 500 нг плазмиды, экспрессирующей спаренные рРНК, и 2,5 мкг полицистронной плазмиды (всего 3 мкг для каждого условия). В одном варианте осуществления изобретения, все пять генов cas были сконструированы в один полицистронный экспрессионный вектор (фиг. 36D), последовательно соединенный последовательностями «вырезания рибосомы» T2A (см., например, Kim, I, et al., PLoS ONE 6, e18556 (2011); Liu, Z., et al., Sci. Rep.7: 2193 (2017)). Поразительно то, что котрансфекция с полицистронной плазмидой и плазмидой, экспрессирующей спаренные рРНК, давала эффективность редактирования и результаты репарации ДНК, аналогичные результатам, наблюдаемым как в методе из 6 плазмид (Пример 9A), так и в методах прямой доставки RNP (Пример 8A, Пример 8B, Пример 8C, Пример 8D), что подтверждает вывод о том, что биохимически активные сконструированные эффекторные комплексы CRISPR-Cas типа I подвергаются сборке и доставляются в ядро в клетках человека. В целом, эти эксперименты подтвердили значительно упрощенную систему экспрессии для воссоздания сложной 11-субъединичной РНК-зависимой нуклеазы в эукариотических клетках всего с двумя молекулярными компонентами, которые по своему размеру аналогичны широко используемым плазмидам Cas9 и оцрРНК.

[00254] Данные для сконструированных комплексов CRISPR-Cas типа I (E. coli (EcoCascade, Pseudomonas sp. S-6-2 (PseCascade) и Streptococcus thermophilus (SthCascade)) позволяют предположить, что большинство сайтов-мишеней будут уникальными, поскольку они должны включать как половинные сайты, необходимое расстояние между спейсерами и пермиссивные PAM. Гомологи Cascade, сконструированные из EcoCascade, PseCascade и SthCascade, были отобраны для более подробной характеризации.

[00255] На фиг. 37A, фиг. 37B, фиг. 37C и фиг. 37D проиллюстрирована эффективность редактирования по отношению к линкеру FokI, длине межспейсерного промежутка и гомологу Cascade. На фиг. 37A, эффективность редактирования FokI-EcoCascade показана в зависимости от длины линкера FokI-Cas8 (фиг. 37A, незаштриховаванные кружки, нижняя линия, 10 а.к.; незаштриховаванный кружок выше линии графика, 20 а.к.; черные кружки, 17 а.к.; и серые кружки, длина линкера 30 а.к.) и расстояния между спейсерами. На фиг. 37A, по вертикальной оси отложена эффективность редактирования (%), а по горизонтальной оси отложено расстояние между спейсерами в п.о.. Данные в каждой исходной точке представляют собой в среднем 3-4 уникальных сайта-мишени.

[00256] На Фиг. 37B показаны нуклеазы FokI-Cascade с 30-аминокислотными линкерами. Линкеры FokI-Cas8 были созданы для 12 вариантов Cascade типа I-E и протестированы на редактирование генома в 4-7 сайтах-мишенях. Данные в каждой исходной точке представляют один геномный сайт, а столбцы представляет среднее значение и стандартное отклонение (sd) по всем сайтам. Мишени содержали последовательности PAM либо AAG (фиг. 37B, серые столбцы), либо GAA (фиг. 37B, белые столбцы) с расстояниями между спейсерами 30 п.о., где виды на горизонтальной оси расположены в следующем порядке: Eco, E. coli; Pse, Pseudomonas sp. S-6-2; Sen, Salmonella enterica; Geo, Geothermobacter sp. EPR-М; Mar, Methanocella arvoryzae; Ahe, Atlantibacter hermannii; Oce, Oceanicola sp. HL-35; Pae, Pseudomonas aeruginosa; Sth, Streptococcus thermophilus; Str, Streptomyces sp. S4; Kpn, Klebsiella pneumoniae; Lba, Lachnospiraceae bacterium.

[00257] На фиг. 37C представлены данные для FokI-PseCascade, где по вертикальной оси отложена эффективность редактирования в процентах (фиг. 37C, эффективность редактирования (%)), а по горизонтальной оси отложена длина между спейсерами в парах оснований (п.о.). Длина линкера FokI-Cas8 составляла 17 аминокислот. Данные в каждой исходной точке представляют один геномный сайт, а столбцы означают среднее и стандартное отклонение для 7-8 сайтов.

[00258] На фиг. 37D представлены данные по эффективности редактирования FokI-PseCascade как функции последовательности PAM, где вертикальная ось представляет процент эффективности редактирования (фиг. 37D, эффективность редактирования (%)), а горизонтальная ось соответствует последовательностям PAM (фиг. 37D, слева направо: CCG, CGC, AAG, AAA, ATG, AAC, AGG, ATA, GAG и AAT). Геномные сайты содержали один AAG PAM и вариабельный PAM во втором половинном сайте, как показано на горизонтальной оси. Данные в каждой исходной точке представляет один геномный сайт, а столбцы представляют среднее значение и стандартное отклонение для 6-15 сайтов.

[00259] На фиг. 37Е представлены данные по эффективности редактирования FokI-EcoCascade (фиг. 37E, вертикальная ось, эффективность редактирования (%)) как функции последовательности PAM. Сайты-мишени содержали фиксированный PAM AAG и вариабельный PAM во втором половинном сайте, как показано на горизонтальной оси (фиг. 37E, слева направо, CCG, CGC, AAG, AGG, ATG, GAG, AAA, AAC, ATA и AAT). Каждая точка представляет единственный сайт-мишень в клетках HEK293, и 6-15 сайтов были протестированы на PAM (n=1 на сайт). Гистограммы представляют среднее значение и стандартное отклонение.

[00260] На фиг. 37F представлены данные по эффективности редактирования FokI-SthCascade (фиг. 37F, вертикальная ось, эффективность редактирования (%)) как функции последовательности PAM. Сайты-мишени содержали фиксированный PAM GAA и вариабельный PAM во втором половинном сайте, как показано на горизонтальной оси (фиг. 37F, слева направо, CC, AA, GA, TA и CA). Каждая точка представляет единственный сайт-мишень в клетках HEK293, и 18-33 сайтов были протестированы на PAM (n=1 на сайт). Гистограммы представляют среднее значение и стандартное отклонение.

[00261] На фиг. 37G представлены тепловые карты, иллюстрирующие частоты классов INDEL для 40 геномных сайтов, демонстрирующих высокую эффективность редактирования (10-53%) как показано на фиг. 37C и фиг. 37D. Эффективность редактирования, составляющая 0-60 процентов, представлена на гистограмме на верхней панели. Длины вставок 1-8 п.о. представлены на тепловой карте на средней панели, а длины делеций 1-50 п.о. представлены на тепловой карте на нижней панели. 40 геномных сайтов-мишеней (фиг. 37G, мишени) указаны на горизонтальной оси (1-40). Вставки в одну пару оснований разделены идентичными нуклеотидами, а серая шкала интенсивности, представленная в нижней части чертежа, соответствуют проценту частоты инсерций (фиг. 37G, частота инсерций (%), шкала от значения 0 и выше или равного 20) и проценту частоты делеций (фиг. 37G, частота делеций (%), шкала от значения 0 и выше или равного 20). Гистограмма справа отображает среднюю частоту INDEL (фиг. 37G, шкала от 0 до 20) каждого класса. Круговая диаграмма справа представляет число вставок 2-4 п.о. в результате предполагаемой репарации матрицы (фиг. 37G, черная область круговой диаграммы), где вставки определены здесь как вставки, содержащие дубликаты последовательностей, смежных с сайтом расщепления. «Другие» представлены в серой области круговой диаграммы.

[00262] Было проведено исследование наиболее близкородственных сайтов в геноме человека для пяти наиболее эффективно отредактированных сайтов-мишеней FokI-PseCascade (редактирование ~20-48%), с ограничениями только требованием промежуточного спейсера 30-33 п.о. По всем пяти мишеням не было обнаружено сайтов с ошибочным спариванием менее 22 на обоих половинных сайтах. Для экспериментов с использованием FokI-EcoCascade FokI-Cas8 линкерного типа и межспейсового расстояния (фиг. 37A), клетки подвергали нуклеофекции с использованием 2,4 мкг полицистронной плазмиды FokI-EcoCascade и ~0,5-3,5 мкг плазмиды, экспрессирующей спаренные рРНК.

[00263] Для скрининга гомологов FokI-Cascade (фиг. 37B), клетки подвергали нуклеофекции с использованием 1,5 мкг полицистронной плазмиды FokI-Cascade и ~0,4-2,2 мкг плазмиды, экспрессирующей спаренные рРНК. Среди гомологов было выбрано 4-7 сайтов, и были отобраны сайты, показавшие высокую эффективность редактирования с использованием FokI-EcoCascade. Для экспериментов по редактированию варианта гомолога FokI-Cas8 линкерного типа и с определенным межспейсерным расстоянием (фиг. 37C и фиг. 41A-41C), клетки подвергали нуклеофекции с использованием 5 мкг полицистронной плазмиды и ~100-400 нг олигоматричного ампликона, экспрессирующего спаренные рРНК. В этом эксперименте, концентрации рРНК не были нормализованы по лункам или вариантам гомологов. Кроме того, как показано на фиг. 41A-41C, клетки подвергали нуклеофекции в среднем приблизительно в 1,5 раза большим количеством гРНК FokI-PseCascade, чем рРНК FokI-EcoCascade или FokI-SthCascade.

[00264] В настоящей заявке описана ПЦР-амплификация олигоматрицы (например, Пример 20A). Стратегия олигоматричной ПЦР для получения ампликонов для экспрессии спаренных рРНК из человеческого промотора U6 (hU6) (фиг. 42A, 420) в клетках млекопитающих проиллюстрирована на фиг. 42A и фиг. 42B. Вкратце, обратный внутренний олигонуклеотид (фиг. 42A, 424) кодирует обе последовательности рРНК и был модифицирован для получения новых сайтов-мишеней (он также называется уникальным праймером, кодирующим последовательность «повтор-спейсер-повтор-спейсер-повтор» (фиг. 42A, 421: повтор, незаштриховаванный прямоугольник; спейсер 1, серый прямоугольник; повтор, незаштриховаванный прямоугольник; спейсер 2, серый прямоугольник; повтор, незаштриховаванный прямоугольник), тогда как остальные праймеры являются инвариантными (фиг. 42A: прямой внешний праймер, 422; прямой внутренний праймер, 423; обратный внешний праймер, 425). Эффективности редактирования на мишени 7 (см. Фиг. 36B) после котрансфекции клеток HEK293 полицистронной плазмидой, кодирующей комплекс FokI EcoCascade RNP, и плазмидой, экспрессирующей спаренные рРНК, или ампликоном, экспрессирующим спаренные рРНК, представлены на фиг. 42B. На фиг. 42В, вертикальная ось представляет эффективность редактирования (%), а горизонтальная ось представляет кластер из спаренных рРНК (нг). Данные в исходной точке представлены в следующем порядке: комплекс FokI-EcoCascade RNP (нг), плазмида из спаренных рРНК, ампликон из спаренных рРНК; 375, незаштриховаванный треугольник, незаштриховаванный кружок 750, черный треугольник, черный кружок; 1500, серый треугольник, серый кружок; 3000, черный треугольник с белой линией, черный кружок с белой линией; соответственно. Данные на фиг. 42B продемонстрировали сравнимую, если не более высокую эффективность редактирования для ампликонов, экспрессирующих спаренные рРНК, по сравнению с плазмидой, экспрессирующей спаренные рРНК.

[00265] Для скрининга PAM (фиг. 37D, фиг. 37E, фиг. 37F, фиг. 39A - 39D, фиг. 40С и фиг. 40F), обычно, клетки подвергали нуклеофекции с использованием 3 мкг полицистронной плазмиды FokI-Cascade и либо 150 нг (FokI-PseCascade и FokI-EcoCascade), либо ~80-120 нг (FokI-SthCascade) олигоматричного ампликона, экспрессирующего спаренные рРНК (если это не оговорено особо).

[00266] Для анализа на специфичность (фиг. 38A-фиг. 38C), клетки подвергали нуклеофекции с использованием 3 мкг полицистронного Cascade и 150 нг олигоматричного ампликона, экспрессирующего спаренные рРНК, и собирали через 5 дней после нуклеофекции. В верхней части фиг. 38А, горизонтальная линия представляет расстояние между спейсерами, ножницы указывают на ожидаемый сайт разрезания, и показаны половинные сайты геномной мишени с соответствующими областями PAM (фиг. 38A, прямоугольные рамки с контрастирующими концами). Отношения проиллюстрированных половинных сайтов к мишени показаны пунктирными линиями. Для каждой мишени проиллюстрированы 32 пары оснований, а область PAM показана рядом с затравочной последовательностью. На Фиг. 38A представлены спаренные рРНК, сконструированные так, чтобы они содержали ошибочные спаривания с одним или обоими половинными сайтами в геномной мишени, как показано заштрихованными рамками (за исключением сайтов PAM) в сетках. Следует обратить внимание, что для простоты, оба половинных сайта представлены в одинаковом направлении. На фиг. 38B представлена относительная эффективность редактирования в геномной мишени 70 для каждой комбинации рРНК с ошибочным спариванием, представленная в виде процента от эффективности редактирования для рРНК с правильным спариванием. На фиг. 38B, верхняя линия указывает на мишень (фиг. 38B, мишень 70), следующая линия представляет руководящую последовательность (фиг. 38B, рРНК1 и рРНК2), следующая строка определяет набор ошибочных спариваний (фиг. 38B, набор ошибочных спариваний (mm) 1 и набор ошибочных спариваний (mm) 2), а последующая строка иллюстрирует комплексы FokI-Cascade RNP. В левом столбце представлены данные для относительного редактирования руководящих последовательностей: набор 1 с 1 ошибочным спариванием (mm)/набор 2 с 2 ошибочными спариваниями руководящих последовательностей, а в правом столбце - набор 2 с 1 ошибочным спариванием руководящих последовательностей/набор 2 с 2 ошибочными спариваниями руководящих последовательностей, где данные в обоих столбцах представляют относительный процент эффективности редактирования (на фиг. 38B показана относительная эффективность редактирования (%); шкала 0-100), то есть, в левом столбце показаны данные для рРНК1 и рРНК2 с набором ошибочных спариваний (mm) 1 и 2, а в правом столбце показаны данные для той же мишени, но с замененными наборами ошибочных спариваний (mm) между рРНК1 и рРНК2 (n=1). На фиг. 38C показана эффективность редактирования в мишени 73 (n=1), представленая, как на фиг. 38B.

[00267] После разработки масштабируемого метода создания экспрессионных кластеров из спаренных рРНК с помощью олигоматричной ПЦР-амплификации (как описано в настоящей заявке), который исключает необходимость проведения трудоемких стадий клонирования, линкер FokI и длины между спейсерами ДНК были повторно скринированы на панели из 96 геномных сайтов-мишеней для каждого варианта гомолога. В случае линкера из 17 аминокислот, FokI-PseCascade давал стабильную эффективность редактирования в среднем ~15-25% в пределах межспейсерного окна приблизительно 30-33 п.о., а некоторые мишени демонстрировали INDEL до ~40-50% (фиг. 37C). Аналогичные тенденции наблюдались и с другими гомологами. Требования к PAM были исследованы путем нацеливания на геномные сайты, которые содержат один когнатный PAM и второй мутировавший PAM. Было показано, что распознавание PAM in vitro происходит гораздо более беспорядочно, чем у жесткого PAM 5'-GG-3' Streptococcus pyogenes (S. pyogenes) (см., например, Szczelkun, M., et al., Proc. Natl. Acad. Sci. USA 111: 9798-9803 (2014); Hayes, R., et al., Nature 530: 499- 503 (2016); Westra, E., et al., Mol. Cell. 46: 595-605 (2012); Fineran, P., et al., Proc. Natl. Acad. Sci. USA 111: E1629-E1638 (2014); Leenay, R., et al., Mol. Cell 62: 137-147 (2016)). Данные in vitro убедительно продемонстрировали, что большое количество PAM действительно допускает наличие активности с тенденциями к четкому ранжированию (фиг. 37D; фиг. 39A - фиг. 39D). И напротив, редактирование было полностью отменено, когда мутированный PAM представлял «собственную» мишень из массива CRISPR.

[00268] На каждой из фиг. 39A - фиг. 39D, вертикальная ось соответствует эффективности редактирования (эффективность редактирования (%)), а горизонтальная ось соответствует последовательности PAM, связанной с мишенью. На фиг. 39A показана эффективность редактирования FokI-PseCascade как функция последовательности PAM. Геномные сайты содержали один фиксированный PAM ATG и вариабельный PAM на втором половинном сайте, как показано на горизонтальной оси. В столбцах указаны среднее значение и стандартное отклонение (6-14 сайтов на вариабельный PAM, n=1 на сайт-мишень). Следует отметить, что на фиг. 37D представлены данные для FokI-PseCascade, где один PAM фиксируется в AAG, а другой PAM является вариабельным по всему набору PAM, включая ATG. Таким образом, подмножеством этих PAM являются AAG-ATG. На фиг. 39A представлены данные для FokI-PseCascade, где один PAM фиксируется на ATG, а другой PAM является вариабельным (фиг. 39A, горизонтальная ось, слева направо, AAG, AAC, AAA, ATG, GAG, ATA, AAT и AGG) по всему набору PAM, включая AAG. Таким образом, подмножеством этих PAM также являются AAG-ATG и те же самые сайты AAG-ATG на фиг. 37D.

[00269] На Фиг. 39B показано редактирование FokI-EcoCascade как функция последовательности PAM (фиг. 39B, горизонтальная ось, слева направо, CCG, CGC, AAG, AGG, ATG, GAG, AAA, AAC, ATA и AAT). Фиксированным PAM является AAG, а столбцы представляют среднее значение и стандартное отклонение (6-15 сайтов на вариабельный PAM, n=1 на сайт-мишень). На фиг. 39C (фиг. 39C, горизонтальная ось, слева направо, AAG, ATG, AAC, AAA, AGG, GAG, AAT и ATA) проиллюстрирован анализ, аналогичный анализу, показанному на фиг. 39B, за исключением того, что первый PAM был присоединен к ATG (6-14 сайтов на вариабельный PAM, n=1 на сайт-мишень). Столбец ATG на фиг. 39B, соответствующий паре AAG-ATG (среднее значение ~3) идентичен столбцу AAG на фиг. 39C, соответствующему паре AAG-ATG (среднее значение также ~3). Следует отметить, что вертикальные оси имеют различные масштабы. На Фиг. 39D показано редактирование FokI-SthCascade как функция последовательности PAM (фиг. 39D, горизонтальная ось, слева направо, CC, AA, GA, TA и CA). Фиксированным PAM был GAA, а столбцы представляют среднее значение и стандартное отклонение (18-33 сайта на вариабельный PAM; n=1 на сайт-мишень).

[00270] На Фиг. 40A, фиг. 40B, фиг. 40C, фиг. 40D, фиг. 40E и фиг. 40F представлены данные, относящиеся к репрезентативным изменениям в эффективности редактирования сконструированных комплексов CRISPR-Cas типа I. Данные, представленные на фиг. 40A (FokI-PseCascade) и фиг. 40D (FokI-SthCascade) для процентов эффективности редактирования (вертикальная ось) по сравнению с расстоянием между спейсерами в п.о. (горизонтальная ось), были получены, по существу, как описано в Примере 20C для данных, представленных на Фиг. 41A и фиг. 41C. На фиг. 40A и Фиг. 40D, горизонтальная ось представляет расстояние между спейсерами 23-34 п.о., а столбцы графика слева направо представляют длину линкера полипептида FokI-Cas8, равную 17 аминокислотам (светло-серые столбцы), 20 аминокислотам (темно-серые столбцы) и 30 аминокислотам (белые столбцы). Данные, представленные на фиг. 40C и фиг. 40F, были получены, по существу, как описано на фиг. 39B. На фиг. 40C и фиг. 40F, показано редактирование FokI-PseCascade и FokI-SthCascade (фиг. 40C, фиг. 40F, вертикальная ось, эффективность редактирования (%)) как функция последовательностей PAM (фиг. 40C, слева направо, CCG, CGC, AAG, AAA, ATG, AAC, AGG, ATA, GAG и AAT; фиг. 40F, слева направо, CC, AA, GA, TA и CA). На фиг. 40B проиллюстрированы комплексы FokI-PseCascade RNP. Фиксированным PAM для FokI-PseCascade был AAG (фиг. 40B, AAG PAM), а другой PAM является вариабельным по всему набору PAM (фиг. 40B, вариабельный PAM). На фиг. 40E проиллюстрированы комплексы FokI-SthCascade RNP. Фиксированным PAM для FokI-SthCascade был GAA (фиг. 40B, GAA PAM), а другой PAM является вариабельным по всему набору PAM (фиг. 40E, вариабельный PAM). FokI-PseCascade был повторно скринирован на предпочтение линкера и промежуточного спейсера, и полученные данные продемонстрировали почти 50% редактирование. Также было исследовано предпочтение PAM. На основании этих данных определяли предпочтение PAM in vitro в порядке ранжирования. По существу, такой же анализ был проведен для варианта из Streptococcus thermophilus. Эффективность редактирования была ниже в системе S. thermophilus. Однако представленные здесь данные показали, что в клетках человека in vivo, предпочтения PAM для системы S. thermophilus очень сильно различались. Один A, расположенный выше протоспейсера (то есть, последовательности-мишени) был подходящим для редактирования, что обычно приводило к увеличению количества потенциальных последовательностей-мишеней в гене (например, по сравнению с количеством потенциальных сайтов-мишеней, ассоциированных с PAM CRISPR-Cas9 типа II, класса 2 в одном и том же гене). Кроме того, представленные здесь данные in vivo коррелируют с предпочтениями PAM in vitro, продемонстрированными Sinkunas, T., et al., EMBO J. 32: 385-394 (2013).

[00271] Получение данных NGS по сотням отредактированных геномных сайтов давало возможность охарактеризовать результаты репарации ДНК DSB, введенных посредством FokI-PseCascade. Для 40 уникальных сайтов с частотами INDEL >10%, частоты, делеции и инсерции были проанализированы в зависимости от общего числа мутантных ридов в пределах окна 50 п.о., окружающего предсказанный сайт расщепления. Вставки из 2-4 п.о. были значительно обогащены и присутствовали в подавляющем большинстве исследованных сайтов (фиг. 37E). Детальный анализ показал, что ~90% этих вставок содержали точные дупликации последовательностей, смежных с сайтом расщепления. Не ограничиваясь какой-либо конкретной теорией, авторы лишь отмечают, что такие дупликации могут быть следствием матричной репарации ступенчатых разрывов, введенных димерным FokI.

[00272] Специфичность FokI-PseCascade оценивали путем редактирования двух высокоэффективных сайтов-мишеней с помощью обширной панели ошибочных спаренных рРНК (фиг. 38A). Предыдущие исследования Cascade выявили ~8-нуклеотидную PAM-проксимальную затравочную последовательность, а также разнообразные ошибочные спаривания в каждом 6-м положении в 32-нуклеотидной руководящей РНК поскольку эти основания происходят от структуры гетеродуплекса РНК-ДНК, образованной после связывания с мишенью (см., например, Jung, C., et al., Cell 170: 35-47 (2017); Mulepati, S., et al., Science 345: 1479-1484 (2014); Fineran, P., et al., Proc. Natl. Acad. Sci. USA 111: E1629-E1638 (2014); Semenova, E., et al., Proc. Natl. Acad. Sci. USA 108: 10098-10103 (2011)). Ошибочные спаривания в PAM-проксимальной затравочной области оказывали весьма негативное влияние на редактирование генома, тогда как ошибочные спаривания, удаленные от PAM, были достаточно толерантными, что давало эффективность редактирования почти как у дикого типа (фиг. 38B; фиг. 38C). Однако, если блоки ошибочных спариваний присутствовали на обоих половинных сайтах, то эффективность редактирования резко снижалась по всей панели протестированных спаренных рРНК (фиг. 38B, фиг. 38C). Исходя из данных по PAM и межспейсерных данных редактирования генома, опосредованного FokI-PseCascade (фиг.38C; фиг.37D), было выявлено одно преимущество сконструированных комплексов CRISPR-Cas типа I согласно изобретению, которое состоит в том, что сайт-мишень может встречаться через каждые ~20-30 п.о. в геноме человека, тогда как редактирование в потенциально нецелевых сайтах маловероятно.

[00273] В соответствии с этим, в одном варианте осуществления изобретения, потенциальные сайты-мишени или «плотность мишеней» данной сконструированной системы FokI-Cascade зависят от эффективного межпространственного расстояния и предпочтения PAM, и будут иметь некоторую вариабельность по всем гомологам. В некоторых вариантах осуществления изобретения, для вычисления плотности мишеней в геноме человека для FokI-PseCascade, FokI-EcoCascade и FokI-SthCascade могут быть использованы нижеследующие критерии (данные были экстраполированы для расчета прогнозируемой плотности мишеней).

[00274] FokI-PseCascade, плотность мишени может быть вычеслена с использованием следующего мотива:

[00275] 5’-[половинный сайт1-PAM1] - [промежуточный спейсер] - [PAM2-половинный сайт2]-3'.

[00276] В данном случае, [половинный сайт1-PAM1] означает обратный комплемент последовательности-мишени цепи-мишени рРНК1 половинного сайта 1 и PAM, а [половинный сайт2-PAM2] означает PAM цепи, не являющейся мишенью для рРНК2 половинного сайта 2. Исходя из распределения длин между спейсерами, которые поддерживали редактирование с помощью FokI-PseCascade (см., например, фиг. 37D), эффективная длина между спейсерами составляля приблизительно 30-33 п.о. PAM были определены как PAM, принадлежащие либо к набору 1, который давал наивысшую эффективность редактирования (AAG, AAA, ATG, AAC), либо к набору 2, если он содержал какие-либо из протестированных PAM, которые показали активность (AAG, AGG, ATG, GAG, AAA, AAC, AAT, ATA) (см., папример, фиг. 39A; фиг. 40B). Исходя из этого, потенциальные сайты-мишени, удовлетворяющие критерию предпочтительной длины между спейсерами с двумя PAM, принадлежащим либо к набору 1, либо к набору 2, будут встречаться в среднем через каждые 33,4 п.о. или 9,2 п.о., соответственно.

[00277] Плотность мишеней для FokI-EcoCascade была определена аналогичным образом, за исключением того, что длина промежуточного спейсера была определена как 31-33, а PAM были определены как принадлежащие к набору 1, который давал наилучшее редактирование (AAG, AGG, ATG, GAG, AAA), или к набору 2, если они содержали какие-либо из протестированных PAM, обладающих активностью (AAG, AGG, ATG, GAG, AAA, AAC, AAT, ATA) (см., например, фиг. 39C; фиг. 39D). Исходя из этого, потенциальные сайты-мишени были определены с использованием набора 1 PAM или набора 2 PAM, встречающихся, в среднем, через каждые 30,4 или 12,2 п.о., соответственно.

[00278] Плотность мишеней для FokI-SthCascade в человеческоом геноме определяли аналогичным образом, за исключением того, что длина промежуточного спейсера была определена как 29-31 п.о., а PAM были определены как NNA (см., например, фиг. 39D). Исходя из этого было установлено, что потенциальные сайты-мишени встречаются в среднем через каждые 4 п.о.

[00279] В соответствии с этим, сконструированные комплексы CRISPR-Cas типа I, описанные в настоящей заявке, позволяют разработать способ получения ряда потенциальных сайтов-мишеней путем идентификации ряда последовательностей-мишеней, смежных с PAM и доступных для редактирования генома. Таким образом, в одном своем варианте, настоящее изобретение относится к способу применения последовательностей PAM, связанных со сконструированными комплексами CRISPR-Cas типа I, для обеспечения увеличенного количества доступных последовательностей-мишеней в гене (например, по сравнению с количеством доступных последовательностей-мишеней, ассоциированных с последовательностями PAM систем CRISPR-Cas типа II или типа V класса 2). Применения этого метода относятся к использованию сконструированных комплексов CRISPR-Cas типа I, которые могут включать, но не ограничиваются ими, связывание и/или расщепление последовательности-мишени, мутацию последовательности-мишени, регуляцию транскрипции последовательности-мишени и ее регуляторных элементов, а также нацеленную модификацию, изменения и/или заметно отличающиеся структурные изменения (например, в генном продукте), опосредованные описанными здесь сконструированными комплексами CRISPR-Cas типа I.

[00280] В некоторых вариантах осуществления изобретения, сконструированные эффекторные комплексы CRISPR-Cas типа I, описанные в настоящей заявке, могут быть использованы для создания не-человеческих трансгенных организмов посредством сайт-специфического введения выбранной полинуклеотидной последовательности (например, части донорного полинуклеотида) в локус ДНК-мишени в геноме для введения модификации, изменения или мутации гДНК. Трансгенным организмом может быть животное или растение.

[00281] Трансгенное животное обычно получают путем введения сконструированных эффекторных комплексов CRISPR-Cas типа I в зиготную клетку. Базовый метод, описанный со ссылкой на создание трансгенных мышей (см., например, Cho, A., et al., «Generation of Transgenic Mice», Current Protocols in Cell Biology, CHAPTER.Unit-19.11 (2009)), включает пять основных стадий: во-первых, получение описанной здесь системы, включающей подходящий донорный полинуклеотид; во-вторых, сбор донорских зигот; в-третьих, микроинжекцию системы в зиготу мыши; в-четвертых, имплантацию микроинъецированных зигот мышам-реципиентам с псевдобеременностью; и в-пятых, осуществление генотипирования и анализ модификации гДНК, установленной у мышей-основателей. Мыши-основатели передают генетическую модификацию любому потомству. Мыши-основатели обычно гетерозиготны по трансгену. В результате спаривания этих мышей, в 25% случаев будут получены мыши, гомозиготные по трансгену.

[00282] Способы получения трансгенных растений также хорошо известны и могут применяться с использованием сконструированных эффекторных комплексов CRISPR-Cas 1 типа. Созданное трансгенное растение, например с использованием трансформации, опосредованной Agrobacterium, обычно содержит один трансген, встроенный в одну хромосому. Можно получить трансгенное растение, гомозиготное по трансгену, путем полового скрещивания (то есть, самоопыления) независимого сегрегированного трансгенного растения, содержащего один трансген, посредством самоопыления. Типичные анализы на зиготность включают, но не ограничиваются ими, анализы на полиморфизм по одному нуклеотиду и анализы посредством термоамплификации, которые позволяют различать гомозиготы и гетерозиготы.

[00283] В своем шестом аспекте, настоящее изобретение относится к применению сконструированных эффекторных комплексов CRISPR-Cas типа I для создания субстратных каналов. В некоторых вариантах осуществления изобретения были конструированы гибридные белки, содержащие элементы субстратного канала и белки субъединицы Cas7. Эти гибридные белки Cas7 затем были подвергнуты сборке в сконструированный эффекторный комплекс CRISPR-Cas типа I (например, включающий гибриды Cse2, Cas5, Cas6, Cas7-элемент субстратного канала и Cas8). В некоторых вариантах осуществления изобретения, cr-РНК сконструированного эффекторного комплекса CRISPR-Cas типа I может быть расширена для размещения дополнительных субъединиц Cas7 (см., например, Luo, M., et al., Nucleic Acids Res. 44: 7385-7394 (2016)). Различные элементы субстрата могут быть присоединены к Cas7, а затем смешаны с желаемой стехиометрией. При сборке этих различных субъединиц Cas7 в полный эффекторный комплекс CRISPR-Cas типа I, совместная локализация субстратных элементов может повышать эффективность субстратного канала.

[00284] В некоторых вариантах осуществления изобретения, каркас РНК конструируют так, чтобы множество гибридов Cas7-элемента субстратного канала могли связываться с этим каркасом в отсутствие других компонентов эффекторного комплекса CRISPR-Cas типа I.

[00285] Элементы канала субстрата могут быть присоединены к N-концу Cas7 и/или к C-концу Cas7. Кроме того, Cas7 с кольцевыми пермутациями могут быть присоединены к элементам канала субстрата.

[00286] На Фиг. 11A и фиг. 11В представлены иллюстрации субстратных каналов, состоящих из трех последовательных ферментных путей. Субстратные каналы способствуют прохождению промежуточных продуктов метаболизма непосредственно к активному центру следущего фермента в цепи метаболического пути без высвобождения в пространство дополнительных каналов. На фиг. 11A проиллюстрировано типичное расположение сконструированных каналов субстрата. Ферменты E1, E2 и E3 ковалентно или нековалентно взаимодействуют с матрицей каркасного белка (S1, S2, S3). Двуглавыми стрелками показаны взаимодействия (например, аффинные взаимодействия) между ферментом и каркасным белком. Затем субстрат (X) процессируется с образованием продукта (Y) без высвобождения в дополнительное пространство каналов. На фиг. 11B проиллюстрирован один вариант осуществления изобретения, включающий сконструированный эффекторный комплекс CRISPR-Cas типа I, который несет ферменты E1, E2 и E3 в качестве гибридных белков с белками субъединицы Cas7 (то есть, посредством ковалентного взаимодействия), создавая таким образом субстратный канал. Белки cpCas7 и остовы, образованные белками cpCas7, также могут быть использованы для осуществления этого аспекта изобретения.

[00287] В других вариантах осуществления изобретения, элементы канала субстрата могут быть присоединены к Cas6. Субъединица Cas6 в комплексах Cascade распознает специфические шпильчатые структуры РНК. Может быть сконструирован каркас РНК, который состоит из нескольких шпилечных структур РНК Cas6, сцепленных вместе. Пептиды Cas6 из различных комплексов Cascade имеют различные последовательности распознавания. Соответственно, каркасы РНК могут быть сконструированы из множественных ортогональных шпилек РНК Cas6. Путем присоединения различных элементов канала субстрата к ортогональным пептидам Cas6, комплексы канала субстрата могут быть собраны в определенной стехиометрии.

[00288] Элементы канала субстрата могут быть присоединены к N-концу Cas6 и/или C-концу Cas6. Кроме того, Cas6 с кольцевой пермутацией может быть присоединен к элементам каналов субстрата.

[00289] В некоторых вариантах осуществления изобретения, представляющий интерес гетерологичный метаболический путь может быть экспрессирован в организме-модели, таком как E. coli. Если гены экспрессируются гетерологично, то эти гены могут быть оптимизированы по кодонам для более эффективной экспрессии генов.

[00290] В одном из вариантов осуществления изобретения, представляющий интерес путь метаболизма представляет собой мевалонатный путь в Saccharomyces cerevisiae. Элементы субстратных каналов этого пути включают, но не ограничиваются ими, ацетоацетил-CoA-тиоазу (AtoB), гидроксиметилглутарил-CoA-синтазу (HMGS) и гидроксиметилглутарил-CoA-редуктазу (HMGR).

[00291] В другом варианте осуществления изобретения, представляющий интерес путь метаболизма представляет собой путь синтеза глицерина в S. cerevisiae. Элементы субстратных каналов этого пути включают, но не ограничиваются ими, глицерин-3-фосфатдегидрогеназу (GPD1) и глицерин-3-фосфатфосфатазу (GPP2).

[00292] В еще одном варианте осуществления изобретения, представляющий интерес путь метаболизма представляет собой путь гидролиза крахмала в Clostridium stercorarium. Элементы субстратного канала этого пути включают, но не ограничиваются ими, CelY и CelZ.

[00293] В дополнительном варианте осуществления изобретения, представляющий интерес путь метаболизма представляет собой глюкозо-фосфотрансферазный путь в E. coli. Элементы субстратных каналов этого пути включают, но не ограничиваются ими, трегалозо-6-фосфатсинтетазу (TPS) и трегалозо-6-фосфатфосфатазу (TPP).

[00294] В своем седьмом аспекте, настоящее изобретение относится к сайт-направленному рекрутингу функциональных доменов, присоединенных к белкам субъединицы Cascade, под действием комплексов, содержащих белок Cas9 типа II класса 2 и нуклеиновую кислоту, нацеленную на нуклеиновую кислоту (NATNA). Функциональные домены описаны в настоящей заявке и включают, но не ограничиваются ими, белковые домены, обладающие ферментативной функцией, способные к активации транскрипции или способные к репрессии транскрипции. В Примере 13A и Примере 13B описан способ конструирования последовательностей оцрРНК, cr-РНК, tracr-РНК CRISPR класса 2 типа II или последовательностей cr-РНК и tracr-RNA с повторяющейся стеблевой последовательностью CRISPR класса 1 типа I, где указанный способ позволяет осуществлять рекрутинг одного или более белков субъединицы Cascade для сайта связывания комплекса «белок CRISPR Cas/руководящая РНК типа II».

[00295] На Фиг. 12A, фиг. 12B и фиг. 12C дана обобщенная иллюстрация сайт-направленного рекрутинга функционального белкового домена, присоединенного к белку субъединицы Cascade под действием комплекса dCas9:NATNA, в сайт-мишень. NATNA CRISPR класса 2 типа II (фиг. 12A, 102), содержащая спейсерную последовательность (фиг. 12A, 101), ковалентно связана посредством линкерной последовательности нуклеиновой кислоты (фиг. 12A, 103) с повторяющейся стеблевой последовательностью CRISPR класса 1 типа I (Фиг. 12А, 104). NATNA CRISRP типа II, ковалентно связанная с повторяющейся стебельной последовательностью CRISPR I типа (Фиг. 12A, 105), способна связываться с dCas9 типа II (фиг. 12A, 106) и белклм субъединицы Cascade типа I (например, Cas6; фиг. 12A, 107), который связан посредством линкерной последовательности (фиг. 12A, 108) с функциональным доменом белка (например, ферментным доменом, доменом активации или репрессии транскрипции; фиг. 12A , 109) с образованием комплекса RNP. Этот комплекс RNP (фиг. 12B, 110) способен нацеливаться на двухцепочечную ДНК (фиг. 12B, 111), содержащую последовательность-мишень (фиг. 12B, 112), комплементарную спейсерной последовательности NATNA CRISPR типа II (фиг. 12A, 101). Распознавание мишени комплексом RNP приводит к гибридизации (фиг. 12B, 113) между спейсерной последовательностью (фиг. 12A, 101) и последовательностью-мишенью (фиг. 12B, 112). Локализация гибридного белка «субъединицы Cascade - функциональный домен» в ДНК позволяет модифицировать ДНК функциональным белковым доменом или доменом регуляции транскрипции соседнего гена (фиг. 12C, 114).

[00296] В своем восьмом аспекте, настоящее изобретение относится к композициям, содержащим сконструированные эффекторные комплексы CRISPR-Cas типа I, сконструированные руководящие полинуклеотиды и их комбинации. В некоторых вариантах осуществления изобретения, сконструированный эффекторный комплекс CRISPR-Cas типа I включает связанный гибридный белок Cas3. Системы CRISPR-Cas дикого типа I требуют скоординированного действия эффекторного комплекса Cascade для нацеливания на ДНК и геликазы-нуклеазы Cas3 для процессивной деградации ДНК. В одном варианте осуществления изобретения, эффекторные комплексы CRISPR-Cas типа I были сконструированы так, чтобы можно было получить точные DSB путем присоединения комплекса к нуклеазному домену (например, к неспецифическому эндонуклеазному домену FokI). В этом подходе используются спаренные руководящие полинуклеотиды, нацеленные на две последовательности ДНК половинного сайта, разделенные промежуточной последовательностью (то есть, промежуточным спейсером).

[00297] Вариант этого аспекта осуществления изобретения относится к композиции, содержащей два сконструированных эффекторных комплекса CRISPR-Cas типа I, каждый из которых содержит спейсер и гибридный белок, содержащий субъединицу Cas и эндонуклеазу (например, FokI; см., например, комплексы Cascade на фиг. 2A, фиг. 2B и фиг. 2C), где по меньшей мере два параметра изменяют в целях модуляции эффективности редактирования генома. Такими параметрами являются:

[00298] длина линкерного полипептида, используемого для получения гибридного белка, содержащего белок субъединицы Cas и эндонуклеазу (например, FokI); и

[00299] длина межспейсерного расстояния между последовательностями-мишенями нуклеиновой кислоты, с которыми могут связываться спейсеры.

[00300] В настоящей заявке представлены рекомендации относительно аминокислотного состава и линкерных полипептидных последовательностей.

[00301] Один вариант этого аспекта изобретения представляет собой композицию, включающиую:

[00302] первый сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий:

[00303] первый белок субъединицы Cse2, первый белок субъединицы Cas5, первый белок субъединицы Cas6 и первый белок субъединицы Cas7,

[00304] первый гибридный белок, содержащий первый белок субъединицы Cas8 и первый FokI, где N-конец первого белка субъединицы Cas8 или C-конец первого белка субъединицы Cas8 ковалентно связан посредством первого линкерного полипептида с С-концом или N-концом, соответственно, первого FokI, и где первый линкерный полипептид имеет длину приблизительно от 10 аминокислот до приблизительно 40 аминокислот, и

[00305] первый руководящий полинуклеотид, содержащий первый спейсер, способный связываться с первой последовательностью нуклеиновой кислоты-мишени; и

[00306] второй сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий:

[00307] второй белок субъединицы Cse2, второй белок субъединицы Cas5, второй белок субъединицы Cas6 и второй белок субъединицы Cas7,

[00308] второй гибридный белок, содержащий второй белок субъединицы Cas8 и второй FokI, где N-конец второго белка субъединицы Cas8 или C-конец второго белка Cas8 ковалентно связан посредством второго линкерного полипептида с С-концом или N-концом, соответственно, второго FokI, и где второй линкерный полипептид имеет длину приблизительно от 10 аминокислот до приблизительно 40 аминокислот, и

[00309] второй руководящий полинуклеотид, содержащий второй спейсер, способный связываться со второй последовательностью нуклеиновой кислоты-мишени, где мотив, смежный с протоспейсером (PAM) второй последовательностью нуклеиновой кислоты-мишени и PAM первой последовательности нуклеиновой кислоты-мишени имеют расстояние между спейсерами, составляющее приблизительно от 20 пар оснований до приблизительно 42 пар оснований.

[00310] Примеры такого первого сконструированного эффекторного комплекса CRISPR-Cas типа I, связанного с первой последовательностью нуклеиновой кислоты-мишени, и второго сконструированного эффекторного комплекса CRISPR-Cas типа I, связанного со второй последовательностью нуклеиновой кислоты-мишени, представлены на фиг. 2А, фиг. 2B и фиг. 2С.

[00311] В некоторых вариантах осуществления изобретения, длина первого линкерного полипептида и/или второго линкерного полипептида составляет приблизительно от 15 аминокислот до приблизительно 30 аминокислот или приблизительно от 17 аминокислот до приблизительно 20 аминокислот. В одном варианте осуществления изобретения, длины первого линкерного полипептида и второго линкерного полипептида являются одинаковыми.

[00312] Каждый первый белок субъединицы Cas8 и второй белок субъединицы Cas8 могут содержать идентичные аминокислотные последовательности белка субъединицы Cas8.

[00313] Аналогичным образом, первый белок субъединицы Cse2 и второй белок субъединицы Cse2 могут содержать идентичные аминокислотные последовательности белка субъединицы Cse2; первый белок субъединицы Cas5 и второй белок субъединицы Cas5 могут содержать идентичные аминокислотные последовательности белка субъединицы Cas5; первый белок субъединицы Cas6 и второй белок субъединицы Cas6 могут содержать идентичные аминокислотные последовательности белка субъединицы Cas6; и первый белок субъединицы Cas7 и второй белок субъединицы Cas7 могут содержать идентичные аминокислотные последовательности белка субъединицы Cas7 и их комбинации.

[00314] Обычно N-конец первого белка субъединицы Cas8 ковалентно связан посредством первого линкерного полипептида с C-концом первого FokI; C-конец первого белка субъединицы Cas8 ковалентно связан посредством первого линкерного полипептида с N-концом первого FokI; N-конец второго белка субъединицы Cas8 ковалентно связан посредством второго линкерного полипептида с C-концом второго FokI, а C-конец второго белка субъединицы Cas8 ковалентно связан посредством второго линкерного полипептида с N-концом второго FokI и их комбинации.

[00315] Варианты осуществления этого аспекта изобретения включают варианты, где длина между второй последовательностью нуклеиновой кислоты-мишени и первой последовательностью нуклеиновой кислоты-мишени представляет собой межспейсерное расстояние, составляющее приблизительно от 22 пар оснований до приблизительно 40 пар оснований, приблизительно от 26 пар оснований до приблизительно 36 пар оснований, приблизительно от 29 пар оснований до приблизительно 35 пар оснований, или приблизительно от 30 пар оснований до приблизительно 34 пар оснований.

[00316] Первый FokI и второй FokI могут представлять собой мономерные субъединицы, которые способны связываться друг с другом с образованием гомодимера, или отдельные субъединицы, которые способны связываться друг с другом с образованием гетеродимера.

[00317] В предпочтительном варианте осуществления изобретения, руководящие полинуклеотиды содержат РНК.

[00318] В некоторых вариантах осуществления изобретения, гДНК содержит PAM второй последовательности нуклеиновой кислоты-мишени и PAM первой последовательности нуклеиновой кислоты-мишени.

[00319] В некоторых вариантах осуществления изобретения, сконструированные эффекторные комплексы CRISPR-Cas типа I основаны на эффекторных комплексах CRISPR-Cas типа I одного или более организмов, выбранных из группы, состоящей из Salmonella enterica, Geothermobacter sp. (штамм EPR-M), Methanocella arvoryzae MRE50, Streptococcus thermophilus (например, Streptococcus thermophilus (штамм ND07), Pseudomonas sp. S-6-2 и E.coli. В предпочтительных вариантах осуществления изобретения, сконструированные эффекторные комплексы CRISPR-Cas типа I основаны на эффекторных комплексах CRISPR-Cas типа I Streptococcus thermophilus (например, Streptococcus thermophilus (штамм ND07), Pseudomonas sp. S-6-2 и/или E. coli. Pseudomonas sp. S-6-2 индуцировал эффективность редактирования в ~10 раз выше, чем у гомолога E. coli, и приблизительно половина других протестированных гомологов показала активность на уровне E. coli, что указывает на то, что сконструированные эффекторные комплексы CRISPR-Cas типа I, происходящие от других систем типа I, могут быть функционально использованы для редактирования генома в клетках человека.

[00320] Данные, представленные в Примере 18 A, в Примере 18B, в Примере 18C, в Примере 18D, в Примере 20A, в Примере 20B и в Примере 20C, продемонстрировали, что изменение длины линкерного полипептида, используемого для получения гибридного белка, содержащего белок субъединицы Cas и FokI, и/или изменение длины межспейсерного расстояния между последовательностями нуклеиновой кислоты-мишени, с которыми спейсеры способны связываться, облегчает модуляцию эффективности редактирования генома в клетках.

[00321] В еще одном своем варианте, настоящее изобретение относится к сконструированному эффекторному комплексу CRISPR-Cas типа I, содержащему первый гибридный белок, который включает белок субъединицы Cascade (например, белок субъединицы Cas8) и первый функциональный домен (например, FokI), и второй гибридный белок, который содержит белок dCas3* и второй функциональный домен (например, FokI) (фиг. 13A: Cas7, Cas5, Cas8, Cse2 и Cas6, пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилькой cr-РНК; кРНК показана черной линией и содержит шпильку). Сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий первый функциональный домен (например, FokI) (фиг. 13A, гибрид Cas8-линкер 1-FP1), может связываться с ДНК, а затем осуществлять рекрутинг гибридного белка «dCas3*-второй функциональный домен (например, FokI)» (фиг. 13A, dCas3*-линкер 2-FP2). В случае, когда первый функциональный домен (фиг. 13A, гибрид Cas8-линкер 1-FP1), и второй функциональный домен (фиг. 13A, dCas3*-линкер 2-FP2) содержит субъединицы димерного белка, то гибридный белок «dCas3*-второй функциональный домен (например, FokI)» связывается со сконструированным эффекторным комплексом CRISPR-Cas типа I, содержащим первый функциональный домен (например, FokI), что облегчает димеризацию первого функционального домена и второго функционального домена (фиг. 13A). На фиг. 14A проиллюстрировано связывание с дцДНК сконструированного эффекторного комплекса CRISPR-Cas типа I (фиг. 14A, Cascade), содержащего первый функциональный домен (фиг. 14A, FD1), связанный с белком субъединицы Cas (фиг. 14A, рамка, заштрихованная полосами) посредством линкерного полипептида (фиг. 14A, линкер 1) и dCas3*, связанный со вторым функциональным доменом (фиг. 14A, FD2) посредством линкерного полипептида (фиг. 14A, линкер 2), связанного с комплексом Cascade; что тем самым приводит к тесному взаимодействию FD1 и FD2 и к облегчению связывания FD1 и FD2. В связывании комплекса Cascade участвует одна последовательность PAM (фиг. 14A, PAM, незаштриховаванная рамка). На фиг. 14А, дцДНК проиллюстрирована парными горизонтальными пунктирными линиями. В случае, если функциональный домен представляет собой димерную эндонуклеазу (например, FokI), то близость FD1 и FD2 облегчает образование функционального димера.

[00322] Одним из преимуществ этого варианта осуществления изобретения является то, что один комплекс Cascade (распознающий одну последовательность PAM) может быть использован для расщепления двухцепочечной последовательности нуклеиновой кислоты-мишени по сравнению с использованием двух комплексов FokI-Cascade (ср. фиг. 14A с фиг.2A, 2B и 2C). Для использования двух комплексов FokI-Cascade требуются две последовательности PAM в правильной ориентации (фиг. 2A, фиг. 2B и фиг. 2C), что может ограничивать выбор проксимальных последовательностей нуклеиновой кислоты-мишени.

[00323] Длина и/или состав линкерного полипептида, используемого для получения гибридного белка, включающего белок субъединицы Cas и эндонуклеазу (например, FokI), а также длина и/или состав линкерного полипептида, используемого для получения гибридного белка, содержащего белок dCas3* и эндонуклеазу, могут варьироваться для модуляции эффективности редактирования генома. В Примере 21A, в Примере 21B, в Примере 21C и в Примере 21D описано конструирование и тестирование множества композиций и длин линкеров Cas3-FokI, а также композиций и длин линкеров FokI-Cas8 для модуляции эффективности редактирования генома.

[00324] Другой вариант этого аспекта изобретения включает сконструированный эффекторный комплекс CRISPR-Cas типа I (фиг. 13B: Cas7, Cas5, Cas8, Cse2 и Cas6; пунктирная рамка вокруг Cas6 указывает на его взаимодействие со шпилькой cr-РНК; cr-РНК показана черной линией и содержит шпильку) и гибридный белок, содержащий белок dCas3* (фиг. 13B, dCas3*) и функциональный домен (фиг. 13B, FP) (например, цитидиндезаминазу), соединенные линкерным полипептидом (фиг. 13B, линкер). Сконструированный эффекторный комплекс CRISPR-Cas типа I может связываться с ДНК и осуществлять рекрутинг гибридного белка «dCas3*-функциональный домен» (например, цитидиндезаминазу). Этот вариант может облегчать сайт-специфическое нацеливание последовательности нуклеиновой кислоты-мишени для модификации или взаимодействия с функциональным доменом. В случае цитидиндезаминазы, сконструированный эффекторный комплекс CRISPR-Cas типа I и гибридный белок, который содержит белок dCas3* и цитидин-дезаминазу, могут быть использованы для сайт-специфического редактирования оснований в последовательности нуклеиновой кислоты-мишени. На фиг. 14B проиллюстрирован пример сконструированного эффекторного комплекса CRISPR-Cas типа I (фиг. 14B, Cascade), включающего гибридный белок, содержащий белок dCas3* (фиг. 14B, dCas3*), связанный с функциональным доменом (фиг. 14B, FD) посредством линкерного полипептида (фиг. 14B, линкер), где этот комплекс связан с дцДНК (фиг. 14B, парные горизонтальные пунктирные линии). На фиг. 14B, контакт функционального домена с дцДНК облегчается. В связывании комплекса Cascade участвует одна последовательность PAM (фиг. 14B, PAM, незаштриховаванная рамка). На фиг. 14C проиллюстрирован другой пример сконструированного эффекторного комплекса CRISPR-Cas типа I (фиг. 14С, Cascade), включающего гибридный белок, содержащий белок dCas3* (фиг. 14С, dCas3*), связанный с функциональным доменом (фиг. 14С, FD) посредством линкерного полипептида (фиг. 14B, линкер), где этот комплекс связан с дцДНК (фиг. 14С, парные горизонтальные пунктирные линии). В связывании комплекса Cascade участвует одна последовательность PAM (фиг. 14B, PAM, незаштриховаванная рамка). На фиг. 14С, контакт функционального домена с дцДНК облегчается.

[00325] Дополнительные функциональные домены и белки, которые могут быть использованы для конструирования гибридных белков с белками субъединиц CRISPR-Cas типа I, описаны в настоящей заявке в разделах «Описание» и «Примеры». Композиции линкерного полипептида и длины гибридных белков «Cas3-линкерный полипептид-функциональный домен» могут быть оценены в соответствии с указаниями, представленными в Примерах 21A - 21D и в разделе «Описание» для определения их влияния на свойства функционального домена.

[00326] В некоторых вариантах осуществления настоящего изобретения могут быть использованы сконструированный эффекторный комплекс CRISPR-Cas типа I и белок mCas3, где белок mCas3 имеет пониженную геликазную активность (например, белок mCas3, мутантный белок, участвующий в процессинге Cas3, имеет пониженную подвижность вдоль ДНК по сравнению с белком CRISPR Cas3 типа I дикого типа), или белок mCas3 не обладает геликазной активностью (например, белок mCas3 больше не осуществляет процессииг нуклеазы побоно белку wtCas3, но сохраняет активность в образовании одноцепочечного разрыва). Сконструированные эффекторные комплексы CRISPR-Cas типа I могут связываться с ДНК, а затем осуществлять рекрутинг белка mCas3. Этот вариант осуществления изобретения позволяет облегчать сайт-специфическое расщепление геномной ДНК.

[00327] В Таблице 48 описан ряд белков mCas3, в которых мутации, внесенные в белок Cas3, влияют на область связывания/гидролиза АТФ домена геликазы или консервативную область пути оцДНК в домене геликазы. На фиг. 44 показано линейное представление функциональных доменов белка EcoCas3 и относительное расположение мутантов, созданных в Cas3-кодирующей последовательности. На фиг. 44 указаны домен нуклеазы HD (аминокислоты 1-272), домен геликазы (область RecA1, аминокислоты 273-521; область RecA2, аминокислоты 522-737), линкер (аминокислоты 738-794) и C-концевой домен (CTD, аминокислоты 795-888). Сотрудниками Huo, Y., et. a1., Nat. Struct. Mol. Biol. 9:771-777 (2014) был проведен анализ на консервативность последовательностей путем их выравнивания с последовательностями белков Cas3 из семейства Thermobifida fusca (код доступа: Q47PJ0; SEQ ID NO: 1869), Saccharomonospora viridis (C7MTA6; SEQ ID NO: 1870), Thermomonospora curvata (D1A6Q2; SEQ ID NO: 1922), Streptomyces avermitdis (Q825B5; SEQ ID NO: 1925), Streptomyces botropensis (M3DI13mo 1923), SEQ ID NO: штамма HD8 Thermus thermophilus (Q53 VY2; SEQ ID NO: 1924) и E. coli (P38036; SEQ ID NO: 1844). Был проведен скрининг 24 различных варианта белка EcoCas3 с мутациями в АТФ-связывающей части домена геликазы или домена, связывающегося с петлей оцДНК (Пример 23A - Пример 23C). Несколько мутантов показали значительно больше классов и/или классов с делециями со сдвигом в определенном положении в пределах окна ампликона; и это открытие подтверждает, что эти белки mCas3 обладают пониженной способностью к процессингу по сравнению с wtCas3.

[00328] В Примерах 23A - 23C описаны такие белки mCas3, в которых средние делеции, индуцированные белком mCas3, были короче по сравнению со средними делециями, генерируемыми соответствующим белком wtCas3. Такие белки mCas3 являются подходящими для редактирования генома (например, в клетках человека). На фиг. 45A, фиг. 45B, фиг. 45C и ФИГ. 45D представлены данные, указывающие на то, что белки mCas3, которые, если они связаны с комплексами Cascade RNP, генерируют более короткие средние длины делеций по сравнению с белком wtCas3 в ассоциации с комплексом Cascade RNP при введении и экспрессии в клетках человека. Исходя из описания настоящего изобретения, специалист в данной области может ввести аналогичные мутации в соответствующие области белков Cas3, полученных от других видов бактерий помимо E. coli.

[00329] В примере 26A-26C представлен дополнительный пример белка mCas3, подходящего для введения геномных делеций, где средние делеции, индуцированные белком mCas3, короче по сравнению со средними делециями, генерируемыми соответствующим белком wtCas3. Данные, представленные в этом примере, подтверждают, что дефицитный по АТФазе/геликазе вариант Cas3 из Pseudomonas sp. S-6-2 (белок mPseCas3) может быть использован вместе с комплексами PseCascade RNP для создания делеций в ожидаемом сайте расщепления (то есть, делеции, локализованной в сайте расщепления).

[00330] Активность белка wtPseCas3/PseCascade была дополнительно охарактеризована. Дополнительные эксперименты были проведены с использованием зондов для обогащения мишеней, которые позволяют обнаруживать крупные геномные делеции. В частности, клетки HEK293 трансфицировали ДНК-матрицами, кодирующими комплекс PseCascade RNP, белок wtPseCas3 и минимальный массив CRISPR, нацеленный на локус TRAC, по существу, как описано в примере 26A-26C. Зонды для обогащения мишеней использовали для выделения и секвенирования геномных фрагментов; тогда как в Примере 26C, окно ампликона использовали для идентификации присутствия делеций. Метод обогащения/секвенирования мишеней дает беспристрастную оценку более крупных делеций, которая не могла быть проведена с использованием окна ампликона для идентификации делеций. В целом, было обнаружено, что делеции, оцененные с помощью обогащения мишеней и секвенирования геномных фрагментов, являются в значительной степени однонаправленными, начиная с расположенного выше сайта инициации белка wtPseCas3. Делеции варьировались от 1 и почти до 250 т.п.о. Этот способ, помимо способа разрезания геномной ДНК и введения делеций заданной длины, может быть применен для создания больших рандомизированных подмножеств делеций в определенных положениях для зондирования регуляторных/промоторных областей генов.

[00331] Белки mCas3 могут содержать одну или более мутаций (например, комбинации мутаций, как описано в таблице 48).

[00332] Регуляция длины делеции была продемонстрирована для нескольких белков mCas3. В некоторых вариантах осуществления изобретения, белки mCas3 согласно изобретению в комбинации с комплексом Cascade, содержащим руководящий полинуклеотид, могут обеспечивать среднюю длину делеции приблизительно от 1 до приблизительно 600 пар оснований, приблизительно от 1 до приблизительно 500 пар оснований, приблизительно от 1 до приблизительно 400 пар оснований, приблизительно от 1 до приблизительно 300 пар оснований, предпочтительно приблизительно от 1 до приблизительно 250 пар оснований, приблизительно от 1 до приблизительно 200 пар оснований, или приблизительно от 1 до приблизительно 100 пар оснований.

[00333] В некоторых вариантах осуществления изобретения, белки wtCas3 или балки mCas3 могут быть присоединены к различным субъединицам комплекса Cascade для дополнительной регуляции средней длины делеции Cas3. Связывание с комплексом Cascade может ограничивать или предотвращать перемещение белка Cas3 или белка mCas3 вдоль ДНК, поскольку он будет прикреплен к локусу, с которым связан комплекс Cascade. Белки wtCas3 или белки mCas3 могут быть присоединены, обычно посредством линкерного полипептида, либо с N-, либо с С-концевым доменом белковых компонентов комплекса Cascade (например, для комплекса EcoCascade, гибридами могут быть гибриды с EcoCas8, EcoCas6 или EcoCas5). Последовательности NLS также могут быть присоединены к N-концу гибридных белков. Примеры таких конструкций для компонентов белка Cascade E. coli представлены в Таблице 12. Эти гибридные белки EcoCas3 также имеют последовательности NLS, присоединенные к их N-концам.

[00334]

Таблица 12
Плазмиды, кодирующие EcoCascade, содержащий гибридные белки Cas3
Последовательности ДНК SEQ ID NO: Соответствующие белковые последовательности* SEQ ID NO: Гибрид Cas3, длина линкера и ген комплекса Cascade Связывание с N- или C-концом гена комплекса Cascade
1875 1881 Гибрид Cas3-17 а.к.-Cas8 N-конец
1876 1882 Гибрид Cas8-17 а.к.-Cas3 C-конец
1877 1883 Гибрид Cas3-17 а.к.-Cas5 N-конец
1878 1884 Гибрид Cas5-17 а.к.-Cas3 C-конец
1879 1885 Гибрид Cas3-17 а.к.-Cas6 N-конец
1880 1886 Гибрид Cas6-17 а.к.-Cas3 C-конец

* белковая последовательность представляет собой кодируемую полицистронную белковую последовательность.

[00335] Варианты осуществления изобретения включают сконструированный белок CRISPR mCas3 типа I, способный снижать перемещение вдоль ДНК по сравнению с белком CRISPR Cas3 типа I дикого типа (белком wtCas3). В некоторых вариантах осуществления изобретения, белок mCas3 имеет последовательность, которая приблизительно на 90% или более, предпочтительно, приблизительно на 95% или более, а еще более предпочтительно приблизительно на 98% или более идентична последовательности соответствующего белка wtCas3. Кодирующая последовательность для белка mCas3 может содержать сигнал ядерной локализации, ковалентно связанный у амино-конца, карбокси-конца или у амино- и карбокси-концов. Белок mCas3 может содержать одну или более мутаций, которые подавляют геликазную активность, где сконструированный белок mCas3 сохраняет нуклеазную активность (или по меньшей мере ее часть) по сравнению с соответствующим белком wtCas3. Обычно, ДНК представляет собой дцДНК, содержащую область-мишень, включающую последовательность нуклеиновой кислоты-мишени. Если белок wtCas3 связан с соответствующим нуклеопротеиновым комплексом Cascade («комплексом Cascade NP/белком wtCas3, например, комплексом Cascade RNP), а комплекс Cascade NP содержит руководящую последовательность, включающую спейсер, комплементарный последовательности нуклеиновой кислоты-мишени, то связывание комплекса Cascade NP/белок wtCas3 с последовательностью нуклеиновой кислоты-мишени облегчает расщепление в области-мишени ДНК, а обычно, приводит к делеции в области-мишени; а белок mCas3, если он связан с комплексом Cascade NP (с «комплексом Cascade NP/белок mCas3», например, с комплексом «Cascade RNP/белок mCas3») и связывается с последовательностью нуклеиновой кислоты-мишени, облегчает расщепление в области-мишени ДНК и дает более короткую среднюю длину делеции по сравнению со средней длиной делеции wtCas3.

[00336] В некоторых вариантах осуществления изобретения, одна или более мутаций в белке mCas3 представляют собой замены аминокислот по сравнению с белком wtCas3. В других вариантах осуществления изобретения, одна или более делеций включают делецию или вставку аминокислот в последовательность, кодирующую белок mCas3, по сравнению с последовательностью, кодирующей белок wtCas3. Одна или более мутаций могут находиться либо в области RecA1, либо в области RecA2 геликазного домена. В одном варианте осуществления изобретения, одна или более мутаций снижают уровень связывания белка mCas3 с оцДНК по сравнению с белком wtCas3 (например, мутация, влияющая на связывание петли оцДНК, и/или мутация в консервативной области оцДНК-пути геликазного домена). В дополнительных вариантах осуществления изобретения, одна или более мутаций снижают степень гидролиза АТФ белком mCas3 по сравнению с белком wtCas3 или снижают уровень связывания АТФ с белком mCas3 по сравнению с белком wtCas3. В дополнительном варианте осуществления изобретения, белок mCas3 содержит комбинации одной или более мутаций, которые снижают уровень связывания белка mCas3 с оцДНК по сравнению с белком wtCas3, снижают степень гидролиза АТФ белком mCas3 или снижают уровень связывания АТФ с белком mCas3 по сравнению с белком wtCas3.

[00337] Дополнительные варианты осуществления изобретения включают последовательности, кодирующие белок mCas3, ковалентно связанный с амино-концом или с карбокси-концом последовательностей, кодирующих белок Cas нуклеопротеинового комплекса Cascade (например, комплекса Cascade RNP). Такой белок Cas может быть выбран из группы, состоящей из белка Cse2, белка Cas8, белка Cas7, белка Cas6 и белка Cas5.

[00338] В некоторых вариантах осуществления изобретения, белок wtCas3 представляет собой белок CRISPR Cas3 E. coli типа 1. В других вариантах осуществления изобретения, белок wtCas3 представляет собой белок wtCas3, выбранный из группы, состоящей из Pseudomonas sp. S-6-2, Thermobifida fusca, Saccharomonospora viridis, Thermomonospora curvata, Streptomyces avermitilis, Streptomyces botropensis, Thermus thermophilus, Vibrio cholera, Salmonella enterica, Geothermobacter sp. EPR-M, Methanocella arvoryzae MRE50 и Streptococcus thermophilus (штамма ND07).

[00339] Для белка CRISPR wtCas3 E. coli типа 1, одна или более мутаций могут включать, но не ограничиваются ими, D452H, A602V или D452H и A602V.

[00340] В дополнительных вариантах осуществления изобретения, клетка содержит ДНК, при этом, клетка может быть эукариотической клеткой (например, человеческой клеткой).

[00341] В других своих вариантах, настоящее изобретение включает полинуклеотиды, содержащие кодирующие последовательности для белков mCas3, экспрессионные кластеры, содержащие последовательности, кодирующие белок mCas3, плазмиды, содержащие последовательности, кодирующие белок mCas3, и нуклеопротеиновые комплексы Cascade, содержащие белки mCas3.

[00342] В своем девятом аспекте, настоящее изобретение относится к способам применения сконструированных эффекторных комплексов CRISPR-Cas типа I.

[00343] В некоторых своих вариантах, настоящее изобретение включает способ связывания последовательности нуклеиновой кислоты-мишени в полинуклеотиде (например, дцДНК), включающий получение одного или более сконструированных эффекторных комплексов CRISPR-Cas типа I для введения в клетку или в биохимическую реакционную смесь и введение сконструированных эффекторных комплексов CRISPR-Cas типа I в клетку или в биохимическую реакционную смесь для облегчения контактирования сконструированных эффекторных комплексов CRISPR-Cas типа I с полинуклеотидом. Контактирование комплексов с полинуклеотидом приводит к связыванию сконструированных эффекторных комплексов CRISPR-Cas типа I с последовательностью(ями) нуклеиновой кислоты-мишени в полинуклеотиде.

[00344] В одном из вариантов осуществления изобретения, сконструированный эффекторный комплекс CRISPR-Cas типа I содержит руководящую последовательность, комплементарную последовательности нуклеиновой кислоты-мишени в полинуклеотиде. Сконструированный эффекторный комплекс CRISPR-Cas типа I связывается с последовательностью нуклеиновой кислоты-мишени в полинуклеотиде.

[00345] В дополнительном варианте осуществления изобретения, первый сконструированный эффекторный комплекс CRISPR-Cas типа I содержит руководящую последовательность, комплементарную первой последовательности нуклеиновой кислоты-мишени в полинуклеотиде, а второй сконструированный эффекторный комплекс CRISPR-Cas типа I содержит руководящую последовательность, комплементарную второй последовательности нуклеиновой кислоты-мишени в полинуклеотиде. Первый сконструированный эффекторный комплекс CRISPR-Cas 1 типа связывается с первой последовательностью нуклеиновой кислоты-мишени, а второй сконструированный эффекторный комплекс CRISPR-Cas типа I связывается со второй последовательностью нуклеиновой кислоты-мишени в полинуклеотиде.

[00346] В еще одном варианте осуществления изобретения, сконструированный эффекторный комплекс CRISPR-Cas типа I содержит руководящую последовательность, комплементарную последовательности нуклеиновой кислоты-мишени в полинуклеотиде, и дополнительно содержит гибридный белок dCas3*, способный связываться с комплексом. Сконструированный эффекторный комплекс CRISPR-Cas типа I связывается с последовательностью нуклеиновой кислоты-мишени в полинуклеотиде, а эффекторный комплекс включает гибридный белок dCas3*, связанный с комплексом.

[00347] Такие способы связывания последовательности нуклеиновой кислоты-мишени могут быть осуществлены in vitro (например, в биохимической реакции или в культивируемых клетках; а в некоторых вариантах осуществления изобретения, культивируемыми клетками являются человеческие культивируемые клетки, которые остаются в культуре и не вводятся человеку); in vivo (например, в клетках живого организма, при условии, что в некоторых вариантах осуществления изобретения, этот организм не является человеческим организмом); или ex vivo (например, где клетки берут у индивидуума, при условии, что в некоторых вариантах осуществления изобретения, индивидуумом является человек, а в других вариантах, индивидуум не является человеком).

[00348] Специалистам в данной области известны различные методы оценки и/или количественного определения взаимодействий между последовательностями нуклеиновых кислот и полипептидами, включая, но не ограничиваясь ими: анализы посредством иммунопреципитации (ChIP), анализы на сдвиг электрофоретической подвижности ДНК (EMSA), анализ на ингибирование ДНК, и анализы на захват и детектирование в микропланшетах. Для практического применения многих из этих методов существуют коммерчески доступные наборы, материалы и реагенты, которые, например, можно получить у следующих поставщиков: Thermo Scientific (Wilmington, DE), Signosis (Santa Clara, CA), Bio-Rad (Hercules, CA) и promega (Madison, WI). Обычным методом обнаружения взаимодействий между полипептидом и последовательностью нуклеиновой кислоты является EMSA (см., например, Hellman LM, et al., Nature Protocols 2:1849-1861 (2007)).

[00349] В другом своем варианте, настоящее изобретение включает способ разрезания последовательностей нуклеиновой кислоты-мишени в полинуклеотиде (например, одноцепочечного разрезания в дцДНК или двухцепочечного разрезания в дцДНК), включающий получение одного или более сконструированных CRISPR Cas типа I для введения в клетку или биохимическую реакционную смесь и введение сконструированных эффекторных комплексов CRISPR-Cas типа I в клетку или биохимическую реакционную смесь для облегчения контактирования сконструированных эффекторных комплексов CRISPR-Cas типа I с полинуклеотидом.

[00350] В одном варианте осуществления изобретения, первый сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий руководящую последовательность, комплементарную первой последовательности нуклеиновой кислоты-мишени в полинуклеотиде, и первый нуклеазный домен (например, FokI) (фиг. 15A, Cascade 1, сплошная контурная рамка, соединенный посредством линкерного полипептида, изогнутая черная линия, с первым нуклеазным доменом, представленным в виде кругового сектора), и второй сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий руководящую последовательность, комплементарную второй последовательности нуклеиновой кислоты-мишени в полинуклеотид и второй нуклеазный домен (например, FokI) (фиг. 15A, Cascade 2, пунктирная контурная рамка, соединенный посредством линкерного полипептида, изогнутая черная линия, с первым нуклеазным доменом, представленным в виде кругового сектора), вводят в клетку или в биохимическую реакционную смесь. Первый сконструированный эффекторный комплекс CRISPR-Cas типа I (фиг. 15B, Cascade1) связывается с первой последовательностью нуклеиновой кислоты-мишени в дцДНК (фиг. 15B, дцДНК представлена парными горизонтальными черными линиями), а первый нуклеазный домен расщепляет первую цепь дцДНК (фиг. 15C, Cascade 1); и второй сконструированный эффекторный комплекс CRISPR-Cas типа I (фиг. 15B, Cascade 2) связывается со второй последовательностью нуклеиновой кислоты-мишени в дцДНК, а второй нуклеазный домен расщепляет вторую цепь дцДНК. Связывание сконструированных эффекторных комплексов CRISPR-Cas типа I приводит к разрезанию последовательностей нуклеиновой кислоты-мишени в полинуклеотиде (например, дцДНК) сконструированными эффекторными комплексами CRISPR-Cas типа I.

[00351] В дополнительном варианте осуществления изобретения, первый сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий руководящую последовательность, комплементарную первой последовательности нуклеиновой кислоты-мишени в полинуклеотиде, второй сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий руководящую последовательность, комплементарную второй последовательности нуклеиновой кислоты-мишени в полинуклеотиде и никазу Cas3 (например, вариант Cas3, дефицитный по АТФазе, и обладающий только никазной активностью) вводят в клетку или в биохимическую реакционную смесь. Первый сконструированный эффекторный комплекс CRISPR-Cas типа I связывается с первой последовательностью нуклеиновой кислоты-мишени в дцДНК, белок никазы Cas3 связывается с первым комплексом и расщепляет первую цепь дцДНК, а второй сконструированный эффекторный комплекс CRISPR-Cas типа I связывается со второй последовательностью нуклеиновой кислоты-мишени в дцДНК, белок никазы Cas3 связывается со вторым комплексом и расщепляет вторую цепь дцДНК. Связывание сконструированных эффекторных комплексов CRISPR-Cas типа I со связанными белками никазы Cas3 приводит к разрезанию последовательностей нуклеиновой кислоты-мишени в полинуклеотиде (например, в дцДНК) сконструированными эффекторными комплексами CRISPR-Cas типа I. В Примере 25A, в Примере 25B и в Примере 25C представлены данные, которые продемонстрировали, что комплексы Cascade RNP, содержащие мутантные белки, дефицитные по АТФазе Cas3, могут индуцировать целевые геномные делеции посредством спаренных одноцепочечных разрывов. Эти спаренные одноцепочечные разрывы могут способствовать образованию целевых делеций в геномах клеток-хозяев (например, клеток человека).

[00352] В другом варианте осуществления изобретения, сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий руководящую последовательность, комплементарную последовательности нуклеиновой кислоты-мишени в полинуклеотиде, и первый нуклеазный домен (например, FokI) (фиг. 16A, Cascade, пунктирная контурная рамка, соединенный посредством линкерного полипептида, изогнутая черная линия, с первым нуклеазным доменом, представленным в виде кругового сектора), и гибридный белок dCas3*-второй нуклеазный домен (например, FokI) (фиг. 16A, dCas3, сплошная контурная рамка, соединенный посредством линкерного полипептида, изогнутая черная линия, со вторым нуклеазным доменом, представленным в виде кругового сектора), способные связываться с комплексом, вводят в клетку или в биохимическую реакционную смесь. Сконструированный эффекторный комплекс CRISPR-Cas типа I (Фиг. 16B, Cascade) связывается с последовательностью нуклеиновой кислоты-мишени в дцДНК (Фиг. 16B, парные горизонтальные черные линии) и расщепляет первую цепь дцДНК (фиг. 16C, Cascade), а гибридный белок dCas3* связывается с комплексом Cascade RNP (фиг. 16B, dCas3*) и расщепляет вторую цепь дцДНК (Фиг.16C, dCas3*).

[00353] В другом варианте осуществления изобретения, сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий руководящую последовательность, комплементарную области-мишени, включающей последовательность нуклеиновой кислоты-мишени в полинуклеотиде, и белок Cas3 (например, белок Cas3 или белок mCas3), способные связываться с комплексом, вводят в клетку или в биохимическую реакционную смесь. Сконструированный эффекторный комплекс CRISPR-Cas типа I связывается с последовательностью нуклеиновой кислоты-мишени в дцДНК, а белок Cas3 (например, белок Cas3 или белок mCas3) связывается с комплексом и расщепляет по меньшей мере одну цепь дцДНК в области-мишени. В некоторых вариантах осуществления изобретения, расщепление дцДНК белком mCas3 приводит к делеции в области-мишени дцДНК. Этот способ может быть применен для получения крупных делеций определенной длины и может оказаться подходящим для создания нокаутов или нокинов генов. В некоторых вариантах осуществления изобретения, белок Cas3 (например, белок Cas3 или белок mCas3) может быть присоединен к белку субъединицы комплекса Cascade (например, к белку Cas7, белку Cas8, белку Cas5 и белку Cse2). В примерах с 23A по 23C описаны варианты белков mCas3.

[00354] В другом своем варианте, настоящее изобретение относится к применению эффекторных комплексов CRISPR-Cas типа I, в которых нуклеазный домен присоединен к белку комплекса Cascade (см., например, пример 11A, Таблица 38) или к белком dCas3* (например, к белку dCas3*, связанному с ДНКазой) для удаления последовательностей нуклеиновой кислоты-мишени. Этот метод может быть применен для разрезания, а также для введения делеций в область-мишень дцДНК и может быть подходящим для создания нокаутов гена. В некоторых вариантах осуществления изобретения, нуклеазный домен может быть присоединен к белку субъединицы комплекса Cascade, такому как белок Cas7, белок Cas8, белок Cas5, белок Cse2.

[00355] Способы разрезания последовательности нуклеиновой кислоты-мишени в полинуклеотиде могут дополнительно включать введение донорного полинуклеотида в клетку для облегчения включения по меньшей мере части донорного полинуклеотида в гДНК клетки.

[00356] На Фиг. 17A проиллюстрирован пример обеих цепей дцДНК (фиг. 17A, парные темные горизонтальные линии), расщепляемых первым сконструированным эффекторным комплексом CRISPR-Cas типа I, содержащим руководящую последовательность, комплементарную первой последовательности нуклеиновой кислоты-мишени в полинуклеотиде (фиг. 17A, Cascade 1) и первый нуклеазный домен (например, FokI) (фиг. 17A, линкерный полипептид, показанный изогнутой линией, соединяющей Cascade 1, и серым круговым сектором), и вторым сконструированным эффекторным комплексом CRISPR-Cas типа I, содержащим руководящую последовательность, комплементарную второй последовательности нуклеиновой кислоты-мишени в полинуклеотиде (фиг. 17A, Cascade 2) и второй нуклеазный домен (например, FokI) (фиг. 17A, линкерный полипептид, показанный изогнутой линией, соединяющей Cascade 2, и серым круговым сектором). На фиг. 17B проиллюстрирован донорный полинуклеотид (фиг. 17B, парные пунктирные линии показаны выше Cascade 2), содержащий плечи гомологии, комплементарные последовательностям ДНК, смежным с двухцепочечным сайтом разрезания (фиг. 18B, донор, пунктирные линии). На фиг. 17C проиллюстрировано включение части донорного полинуклеотида (фиг. 17C, парные пунктирные линии, соединяющие парные темные горизонтальные линии, представляющие дцДНК) в область двухцепочечного сайта разрезания. Включение донорного полинуклеотида опосредуется механизмами репарации клеточной ДНК (например, HDR) (фиг. 17B - фиг. 17C, направленная вниз вертикальная стрелка представляет механизмы репарации клеточной ДНК).

[00357] В других вариантах осуществления изобретения, сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий руководящую последовательность, комплементарную первой последовательности нуклеиновой кислоты-мишени в полинуклеотиде, и первый нуклеазный домен, могут быть спарены со вторым компонентом, содержащим второй нуклеазный домен, где второй компонент способен связываться со второй последовательностью нуклеиновой кислоты-мишени в полинуклеотиде. Примеры таких вторых компонентов включают эффекторную нуклеазу, подобную активатору транскрипции (TALEN), содержащую второй нуклеазный домен, нуклеазу «цинковый палец» (ZFN), содержащую второй нуклеазный домен, или комплекс dCas9/NATNA, содержащий второй нуклеазный домен.

[00358] В одном варианте осуществления изобретения, область полинуклеотида-мишени (например, гДНК) может быть удалена с использованием комбинации комплекса Cascade, содержащего руководящую последовательность, комплементарную первой последовательности нуклеиновой кислоты-мишени в полинуклеотиде-мишени, и комплекс dCas9/NATNA, где NATNA содержит спейсерную последовательность, комплементарную второй последовательности нуклеиновой кислоты-мишени в полинуклеотиде-мишени. Первую и вторую последовательности нуклеиновой кислоты-мишени выбирают так, чтобы они фланкировали последовательность нуклеиновой кислоты-мишени для делеции. Белок Cas3, обладающий активной эндонуклеазной активностью, связывается с комплексом Cascade, а затем постепенно делетирует одну цепь дцДНК, содержащую последовательность нуклеиновой кислоты-мишени, необходимую для делеции. Если белок Cas3 взаимодействует с комплексом dCas9/NATNA (то есть, «осуществляет блокирование»), то нуклеазная активность Cas3 может быть прекращена во второй последовательности нуклеиновой кислоты-мишени под действием комплекса dCas9/NATNA. На фиг. 21A - фиг. 21D проиллюстрирован пример делеции Cas3 последовательностью нуклеиновой кислоты-мишени. На фиг. 21A показана дцДНК (фиг. 21A, парные горизонтальные черные линии), содержащая последовательность нуклеиновой кислоты-мишени 1 (фиг. 21A, NATS1) и последовательность нуклеиновой кислоты-мишени 2 (фиг. 21A, NATS2), которые фланкируют последовательность нуклеиновой кислоты-мишени последовательность, необходимую для делеции. На фиг. 21A показан комплекс Cascade, содержащий руководящую последовательность, комплементарную NATS1 (фиг. 21A, Cascade; прямоугольник, обрамленный черной линией), белок Cas3 (фиг. 21A, Cas3; серый круговой сектор) и комплекс dCas9/NATNA, содержащий спейсер, комплементарный NATS2 (фиг. 21А, dCas9; прямоугольник, обрамленный пунктирной линией). На фиг. 21B показано связывание комплекса Cascade с NATS1, связывание белка Cas3 с комплексом Cascade и связывание комплекса dCas9/NATNA с NATS2. На фиг. 21С проиллюстрирована прогрессирующая делеция под действием Cas3 одной цепи последовательности нуклеиновой кислоты-мишени, необходимой для делеции. На фиг. 21D показана диссоциация белка Cas3 из дцДНК в положении комплекса dCas9/NATNA, связанного с NATS2. В примерах 24A-24D представлены данные, подтверждающие использование белковых барьеров для регуляции длины делеций, опосредуемой белком Cas3, связанным с комплексами нуклеопротеинов Cascade; и таким образом, возможность применения белка Cas3, связанного с комплексами нуклеопротеинов Cascade, для облегчения образования делеций определенной длины в гДНК клеток (например, клеток человека).

[00359] В другом варианте осуществления изобретения, область полинуклеотида-мишени (например, гДНК) может быть делетирована с использованием комбинации первого комплекса Cascade, содержащего руководящую последовательность, комплементарную первой последовательности нуклеиновой кислоты-мишени в полинуклеотиде-мишени, и второго комплекса Cascade, содержащего руководящую последовательность, комплементарную второй последовательности нуклеиновой кислоты-мишени в полинуклеотиде-мишени. Первую и вторую последовательности нуклеиновой кислоты-мишени выбирают так, чтобы они фланкировали последовательность нуклеиновой кислоты-мишени, необходимую для делеции. Белки Cas3, обладающие эндонуклеазной активностью, связываются с каждым комплексом Cascade, а затем постепенно удаляют обе цепи последовательности нуклеиновой кислоты-мишени, необходимые для делеции. Если каждый белок Cas3 взаимодействует с одним из комплексов Cascade, то нуклеазная активность Cas3 может быть прекращена в первой и во второй последовательности нуклеиновой кислоты-мишени под действием комплексов Cascade. На фиг. 22A - фиг. 22D проиллюстрирован пример делеции Cas3 обеими цепями последовательности нуклеиновой кислоты-мишени. На фиг. 22A показана дцДНК (фиг. 22A, парные горизонтальные черные линии), содержащая последовательность нуклеиновой кислоты-мишени 1 (фиг. 22A, NATS1) и последовательность нуклеиновой кислоты-мишени 2 (фиг. 22A, NATS2), которые фланкируют последовательность нуклеиновой кислоты-мишени, необходимую для делеции. На фиг. 22A показан первый комплекс Cascade, содержащий руководящую последовательность, комплементарную NATS1 (фиг. 22A, Cascade 1; прямоугольник, обрамленный черной линией), белки Cas3 (фиг. 22A, Cas3; серый круговой сектор) и второй комплекс Cascade, содержащий руководящую последовательность, комплементарную NATS2 (фиг. 22A, Cascade 2; прямоугольник, обрамленный пунктирной линией). На фиг. 22B показано связывание комплексов Cascade с NATS1 и NATS2, а также связывание белков Cas3 с комплексами Cascade. На фиг. 22С проиллюстрирована прогрессирующая делеция в результате перемещения вдоль ДНК и расщепления нуклеазой Cas3 обеих цепей последовательности нуклеиновой кислоты-мишени, необходимой для делеции. На фиг. 22D показана диссоциация белков Cas3 из дцДНК в положениях комплексов Cascade, связанных с NATS1 и NATS2.

[00360] В другом варианте осуществления изобретения, комплекс Cascade может быть модифицирован так, чтобы он не обладал способностью связываться с белком Cas3, и такой модифицированный комплекс Cascade может действовать как ингибитор, в основном, по механизму, проиллюстрированному на фиг. 21A - фиг. 21D, осуществляющему прекращение прогрессирующего разложения ДНК каталитически активным Cas3 в комбинации с комплексом Cascade RNP. Дополнительные сайт-специфические связывающие белки (например, эффекторы, подобные активаторам транскрипции (TAL), или ДНК-связывающие белки «цинковые пальцы» (ZnF)) могут быть использованы в качестве блокаторов по аналогичному механизму.

[00361] В некоторых вариантах осуществления изобретения, последовательность нуклеиновой кислоты-мишени представляет собой дцДНК (например, геномную ДНК). В некоторых вариантах осуществления изобретения, последовательность нуклеиновой кислоты-мишени является двухцепочечной, и одна или обе ее цепи были разрезаны. Такие способы разрезания последовательности нуклеиновой кислоты-мишени могут быть осуществлены in vitro, in vivo или ex vivo.

[00362] Как описано выше, в некоторых своих вариантах, настоящее изобретение относится к введению одного или более сконструированных эффекторных комплексов CRISPR-Cas типа I в клетку-хозяина для облегчения расщепления последовательности нуклеиновой кислоты-мишени в дцДНК в присутствии донорного полинуклеотида, где один или более сконструированных эффекторных комплексов CRISPR-Cas типа I образуют сайт разрезания (или сайт разрезания и ассоциированную делецию) в области-мишени, содержащей последовательность нуклеиновой кислоты-мишени в ДНК клетки-хозяина, что, тем самым, облегчает вставку по меньшей мере части донорного полинуклеотида в область-мишень. В некоторых вариантах осуществления изобретения, сайт разрезания представляет собой двухцепочечный разрыв в области-мишени (например, при использовании двух сконструированных эффекторных комплексов CRISPR-Cas типа I, каждый из которых содержит спейсер и гибридный белок, включающий белок Cas и эндонуклеазу (например, a FokI) или двух сконструированных эффекторных комплекса CRISPR-Cas типа I, каждый из которых содержит спейсер, связывающийся с белком Cas3 или mCas3). В некоторых вариантах осуществления изобретения, сайт разрезания представляет собой одноцепочечный разрыв в области-мишени (например, при использовании эффекторного комплекса CRISPR-Cas типа I, связанного с белком mCas3). В других вариантах осуществления изобретения, сайт разрезания представляет собой делецию в области-мишени (например, при использовании эффекторного комплекса CRISPR-Cas типа I, связанного с белком Cas3 или mCas3).

[00363] Для того, чтобы продемонстрировать гомологичную репарацию (HDR), был сконструирован минимальный массив CRISPR для нацеливания комплекса FokI-PseCascade RNP на четыре локуса (WDR92, B2M, CCR5 и TRAC) в геноме человека. Минимальные массивы CRISPR были созданы путем сборки на основе ПЦР с использованием трех олигонуклеотидов (SEQ ID NO: 1513 - SEQ ID NO: 1515; пример 20A) и уникального праймера, кодирующего последовательность «повтор-спейсер-повтор-спейсер-повтор», где первый и второй спейсеры направляли комплексы FokI-PseCascade RNP на соседние последовательности нуклеиновой кислоты-мишени для обеспечения димеризации FokI и расщепления генома (то есть, создания сайта разрезания).

[00364] Для каждого сайта инсерции HDR в области-мишени, содержащей сайт разрезания, а в данном случае, перекрывающейся с сайтом разрезания, клетки трансфицировали 3 мкг вектора, кодирующего компоненты белкового комплекса FokI-PseCascade, включающие FokI, присоединенный к N-концу Cas8 с NLS, соединенным с N-концом FokI; 150 нг минимальных массивов CRISPR и 0-60 пмоль донорного полинуклеотида на основе матричного одноцепочечного олигодезоксинуклеотида (ssODN) для HDR. ssODN содержит плечи гомологии, где каждое плечо гомологии составляло 75 нуклеотидов, а два плеча были симметрично расположены вокруг сайта разрезания. Донорный полинуклеотид дополнительно содержал фосфортиоатные связи в 3'-концевых нуклеотидах плечей гомологии для снижения или предотвращения разложения донорного полинуклеотида в клетке. 5’-конец фосфортиоатных связей донорного полинуклеотида дополнительно содержал последовательность вставки «TAATAAT» для инсерции двух стоп-кодонов и увеличения расстояния между спейсерами в репарированной хромосоме, что тем самым препятствовало повторному расщеплению комплекса FokI-PseCascade RNP.

[00365] Трансфекцию проводили в клетках HEK293, по существу, как описано в Примере 20B, за исключением того, что в смесь был включен ssODN для HDR. Через несколько дней после трансфекции, гДНК очищали от клеток, обрабатывали экзонуклеазой для удаления любых остаточных ssODN, которые могли загрязнять последующие ПЦР-продукты, а затем использовали в качестве матрицы для амплификации в целях определения вставки донора. Анализ методом глубокого секвенирования проводили, по существу, как описано в Примере 20C. Процент мутантных ридов от общего количества ридов в этом эксперименте представлен в Таблице 13 (первый столбец - пмоль ssODN):

[00366]

Таблица 13
Процент мутантных ридов
WDR92 B2M CCR5 TRAC
Rep1 Rep2 Rep3 Rep1 Rep2 Rep3 Rep1 Rep2 Rep3 Rep1 Rep2 Rep3
0 11,6 9,54 9,93 3,46 3,22 5,88 7,02 4,94 8,75 3,76 2,94 3,38
20 11 8,82 12,6 0,99 4,99 2,94 5,56 6,69 12,9 2,92 3,72 3,8
40 10,1 9,54 11,3 1,97 2,79 0 5,44 0,24 5,13 3,69 3,99 4,97
60 12,6 10,4 11,5 0,94 1,01 1,08 n/a 5,95 8,5 4 3,48 n/a

[00367] Процент мутантных ридов указывает на то, что мутантные риды содержат INDEL, являющиеся результатом негомологичного присоединения по концам, а также вставок последовательности HDR «TAATAAT».

[00368] Процент ридов HDR, содержащих только последовательность вставки «TAATAAT», от общего количества мутантных ридов в этом эксперименте, представлен в Таблице 14 (первый столбец - пмоль ssODN):

[00369]

Таблица 14
Процент ридов HDR
WDR92 B2M CCR5 TRAC
Rep1 Rep2 Rep3 Rep1 Rep2 Rep3 Rep1 Rep2 Rep3 Rep1 Rep2 Rep3
0 0 0 0 0 0 0 0 0 0 0 0 0
20 23,03 10,72 9,68 14,26 0,11 14,38 7,07 3,94 0,22 21,37 0 9,14
40 16,38 13,7 4,83 0 16,5 0 2,42 0 10,54 2,1 0 13,23
60 5,5 11,98 7,31 0 12,28 5 n/a 1,9 13,87 0,79 7,53 9,38

[00370] Как видно из данных, расщепление дцДНК комплексами каскадных RNP обеспечивает HDR и включение донорного полинуклеотида во множество локусов по всему геному человека.

[00371] В еще одном своем варианте, настоящее изобретение включает способ модификации одной или более последовательностей нуклеиновой кислоты-мишени в полинуклеотиде (например, ДНК) в клетке или в биохимической реакционной смеси, где указанный способ включает получение одного или более сконструированных эффекторных комплексов CRISPR-Cas типа I (например, содержащих гибридный белок «белок субъединицы Cas - цитидин-дезаминаза») для введения в клетку или в биохимическую реакционную смесь, и введение сконструированного(ых) эффекторного(ых) комплекса(ов) CRISPR-Cas типа I в клетку или биохимическую реакционную смесь, для облегченая контактирования сконструированного(ых) эффекторного(ых) комплекс(ов) CRISPR-Cas типа I с полинуклеотидом, приводящего к связыванию сконструированного(ых) эффекторного(ых) комплекс(ов) CRISPR-Cas типа I с последовательностью(ями) нуклеиновой кислоты-мишени в полинуклеотиде, которое облегчает замену последовательности(ей) нуклеиновой кислоты-мишени (например, C на T, G на A, A на G и T на C). На фиг. 18А-18D показан пример использования комплекса Cascade, включающего гибридный белок «белок субъединицы Cas - линкерный полипептид - цитидиндезаминаза» (комплекс Cascade/CD) для мутации нуклеотида-мишени в гДНК клетки (фиг. 18A, парные темные горизонтальные линии, где «C» - цитозин, а «G» - гуанин). Комплекс Cascade/CD (фиг. 18A; «Cascade» с линкерным полипептидом, изображенным изогнутой линией и соединяющим Cascade и цитидиндезаминазу «CD», представленную серым круговым сектором), вводят в клетку. Комплекс Cascade/CD содержит руководящщую последовательность, комплементарную последовательности ДНК-мишени, смежной с цитозином-мишенью (фиг. 18B, «C»). На фиг. 18B, комплекс Cascade/CD связывается с последовательностью-мишенью ДНК, а цитидиндезаминаза превращает цитозин (фиг. 18B, «C») в урацил (фиг. 18C, «U»). Затем механизмы репарации клеток могут осуществлять репарацию с заменой урацила на тимидин и заменять ошибочно спаренный гуанидин на аденин (фиг. 18C - фиг. 18D, направленная вниз вертикальная стрелка представляет механизмы репарации клеточной ДНК).

[00372] В еще одном своем варианте, настоящее изобретение включает способы модуляции транскрипции in vitro или in vivo, например, транскрипции гена, содержащего последовательности регуляторных элементов. Такие способы включают получение одного или более сконструированных эффекторных комплексов CRISPR-Cas типа I (например, включающих гибридный белок «белок субъединицы Cas - фактор транскрипции») для введения в клетку или в биохимическую реакционную смесь, и введение сконструированного(ых) эффекторного(ых) комплекса(ов) CRISPR-Cas типа I в клетку или в биохимическую реакционную смесь, что облегчает контактирование сконструированного(ых) эффекторного(ых) комплекса(ов) CRISPR-Cas типа I с последовательностями регуляторных элементов, приводящее к связыванию сконструированного(ых) эффекторного(ых) комплекс(ов) CRISPR-Cas типа I с последовательностями регуляторных элементов, и тем самым к облегчению модуляции транскрипции in vitro или in vivo гена, содержащего последовательности регуляторных элементов.

[00373] На Фиг. 19A и фиг. 19B представлены обобщенные иллюстрации примеров активации транскрипции родового гена («GENE1»). На фиг. 19А представлено краткое описание регуляции транскрипции эндогенного гена в эукариотической клетке. На фиг. 19A, две темные параллельные линии представляют двухцепочечную ДНК с указанием локализации гена 1 (фиг. 19A, GENE 1), а также сайта инициации транскрипции (фиг. 19A, TSS), связанного с геном 1. На первой панели фиг. 19A, фактор транскрипции (фиг. 19A, TF), который необходим для активации транскрипции гена 1 и полимеразы II (фиг. 19A, Pol II), показан как еще не связанный с Gene1-TSS. На второй панели проиллюстрировано связывание TF с когнатным TSS. Затем TF осуществляет рекрутинг белка активации транскрипции (фиг. 19A, TP), который затем осуществляет рекрутинг РНК-полимеразы II (фиг. 19A, Pol II). Обычно, в эукариотах, факторы TF и TP образуют комплекс, содержащий множество белков и, возможно, других молекул. На третьей панели проиллюстрирована результирующая транскрипция гена 1 с помощью Pol II (фиг. 19A, изогнутая стрелка на конце GENE 1 указывает направление транскрипции). Этот тип активации транскрипции обычно зависит от TF, специфичных к экспрессии гена(ов). На фиг. 19B проиллюстрирован один вариант осуществления изобретения, где комплекс Cascade сконструирован для включения белка или фактора (фиг. 19B, CASCADEa), который притягивает один или более компонентов в клетки, ответственных за активацию транскрипции (фактор активации транскрипции; фиг. 19Б, ТА). Примером одного такого белка или фактора является белок VP64. CASCADEa содержит руководящую последовательность, способную связываться с TSS или рядом с ним (фиг. 19B, TSS). На фиг. 19B, две темные параллельные линии представляют двухцепочечную ДНК, с указанием гена 1 (фиг. 19B, GENE 1), а также сайта инициации транскрипции (TSS), связанного с геном 1. На первой панели фиг. 19B, CASCADEa и полимераза II (фиг. 19B, Pol II) проиллюстрированы как еще не связанные с Gene1-TSS. На второй панели проиллюстрирована связь CASCADEa с мишенью TSS. Затем CASCADEa осуществляет рекрутинг белка активации транскрипции (фиг. 19B, TA), который затем осуществляет рекрутинг РНК-полимеразы II (фиг. 19B, Pol II). На третьей панели проиллюстрирована результирующая транскрипция гена 1 с помощью Pol II (фиг. 19B, изогнутая стрелка на конце GENE 1 указывает направление транскрипции). Одним из преимуществ этого варианта осуществления изобретения является то, что активация транскрипции гена не зависит от эндогенных факторов транскрипции, которые связываются с TSS гена, а скорее всего, TSS гена может быть нацелен путем выбора соответствующей руководящей последовательности Cascade.

[00374] На Фиг. 20A и фиг. 20B представлена обобщенная иллюстрация примера репрессии транскрипции родового гена (фиг. 20A, GENE 1) с использованием комплекса Cascade, включающего гибрид «белок субъединицы Cas - домен KRAB», и руководящей последовательности (фиг. 20A, CASCADEi с линкерным полипептидом, показанным в виде изогнутой линии, и соединяющим Cascade, и кольцевой элемент, представляющий домен KRAB), комплементарной регуляторным последовательностям (фиг. 20A, промотор), связанным с GENE1. Связывание CASCADEi с регуляторными последовательностями (фиг. 20B) приводит к репрессии транскрипции GENE 1 (Фиг. 20B, темная линия, оканчивающаяся X, представляет репрессию транскрипции).

[00375] Описанные здесь сконструированные эффекторные комплексы CRISPR-Cas типа I могут быть включены в набор. В некоторых вариантах осуществления изобретения, набор включает упаковку с одним или более контейнерами, содержащими элементы набора в виде одной или более отдельных композиций или, но необязательно, если это позволяет совместимость компонентов, в виде смеси. В некоторых вариантах осуществления изобретения, набор также включает один или более из следующих наполнителей: буфер, забуферивающий агент, соль, стерильный водный раствор, консервант и их комбинации. Репрезентативные наборы могут включать один или более сконструированных эффекторных комплексов CRISPR-Cas типа I и один или более наполнителей или одну или более последовательностей нуклеиновых кислот, кодирующих один или более компонентов сконструированных эффекторных комплексов CRISPR-Cas типа I.

[00376] Кроме того, наборы могут дополнительно содержать инструкции по применению композиций сконструированных эффекторных комплексов CRISPR-Cas типа I.

[00377] В другом своем аспекте, настоящее изобретение относится к способам получения или продуцирования одного или более сконструированных эффекторных комплексов CRISPR-Cas типа I или их компонентов. В одном варианте осуществления изобретения, способ получения или продуцирования включает получение сконструированных эффекторных комплексов CRISPR-Cas типа I в клетке и очистку сконструированных эффекторных комплексов CRISPR-Cas типа I из клеточных лизатов.

[00378] Сконструированные композиции эффекторных комплексов CRISPR-Cas типа I могут дополнительно содержать детектируемую метку, такую как фрагмент, который может давать детектируемый сигнал. Примеры детектируемых меток включают, но не ограничиваются ими, фермент, радиоизотоп, член пары специфического связывания, флуорофор (FAM), флуоресцентный белок (белок, флуоресцирующий в зеленом диапазоне спектра (GFP), белок, флуоресцирующий в красном диапазоне спектра, mCherry, tdTomato), аптамер ДНК или РНК вместе с подходящим флуорофором (активированный GFP (eGFP), «Spinach»), квантовую точку, антитело и т.п. Большое количество и разнообразие подходящих детектируемых меток хорошо известны среднему специалисту в данной области.

[00379] В некоторых вариантах осуществления изобретения, сконструированные эффекторные комплексы CRISPR-Cas типа I (то есть, нуклеопротеиновые частицы) могут быть введены в клетки способами, включающими, но не ограничивающимися ими, нуклеофекцию, доставку путем выстреливания генов, сонопорацию, сжатие клеток, липофекцию или использование других химических веществв, пептидов, проникающих в клетки, и т.п. В других вариантах осуществления изобретения, последовательности, кодирующие один или более компонентов сконструированных эффекторных комплексов CRISPR-Cas типа I и связанных с ними белков могут быть введены в клетки с использованием векторных систем, экспрессионных кластеров, содержащих последовательности ДНК, кодирующие один или более компонентов, а также одну или более молекул РНК (например, мРНК), содержащих экспрессионные кластеры, включающие последовательности РНК, кодирующие один или более компонентов.

[00380] Один из вариантов осуществления изобретения относится к применению сконструированных эффекторных комплексов CRISPR-Cas типа I для получения рекомбинантных клеток (например, модифицированных лимфоцитов). Этот способ обычно включает облегчение контакта дцДНК, содержащей область-мишень, включающую последовательность нуклеиновой кислоты-мишени в клетке-хозяине, с одним или более сконструированными эффекторными комплексами CRISPR-Cas класса 1 типа I согласно изобретению. Контактирование сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I с последовательностью нуклеиновой кислоты-мишени приводит к связыванию сконструированного эффекторного комплекса CRISPR-Cas 1 типа I класса с областью-мишенью, содержащей последовательность нуклеиновой кислоты-мишени, к расщеплению области-мишени, содержащей последовательность нуклеиновой кислоты-мишени, и к модификации дцДНК в области-мишени, и таким образом, к получению рекомбинантной клетки. В некоторых вариантах осуществления изобретения, дцДНК содержит более чем одну последовательность нуклеиновой кислоты-мишени, и сконструированные эффекторные комплексы CRISPR-Cas класса 1 типа I, содержащие спейсерные последовательности, комплементарные каждой последовательности нуклеиновой кислоты-мишени последовательности-мишени, используют для связывания, разрезания и модификации каждой последовательности нуклеиновой кислоты-мишени. В некоторых вариантах осуществления изобретения, модификация области-мишени представляет собой инсерцию, делецию или инсерцию и делецию. Выше описаны способы разрезания последовательностей нуклеиновой кислоты-мишени в полинуклеотиде (например, разрезание одной цепи в дцДНК или разрезание двух цепей в дцДНК), включающие получение одного или более сконструированных эффекторных комплексов CRISPR-Cas типа I для введения в клетку.

[00381] Варианты осуществления настоящего изобретения включают получение рекомбинантных клеток с использованием одного или более сконструированных эффекторных комплексов CRISPR-Cas класса 1 типа I, где гДНК рекомбинантных клеток содержит мутации с нокаутом (например, гена B2M и/или гена PDCD1), мутации с нокином (например, редактирование в локусе TRAC и интеграцию CAR из донорного полинуклеотида) или их комбинации. В некоторых вариантах осуществления изобретения, после расщепления в последовательности нуклеиновой кислоты-мишени в гене TRAC гДНК происходит включение по меньшей мере части донорного полинуклеотида в последовательность нуклеиновой кислоты-мишени. Донорный полинуклеотид может содержать конструкцию CAR, где CAR встроен в последовательность нуклеиновой кислоты-мишени.

[00382] Рекомбинантные клетки, полученные способами согласно изобретению, могут быть использованы для адоптивного переноса клеток (ACT). ACT представляет собой быстро развивающийся иммунотерапевтический метод, в котором используют трансплантированные иммунные клетки для лечения рака. ACT представляет собой перенос клеток пациенту. Чаще всего, иммунные клетки получают от иммунной системы с целью улучшения иммунной функции. При аутологичной иммунотерапии рака, иммунные клетки или стволовые клетки берут у пациента и размножают путем культивирования ex vivo до больших количеств, а затем возвращают пациенту. Иммунные клетки или стволовые клетки могут быть модифицированы различными способами в культуре (например, с использованием редактирования генома для включения CAR в геном Т-клетки). В некоторых вариантах осуществления изобретения, лимфоциты для модификации выделяют у индивидуума, модифицируют, а затем повторно вводят тому же индивидууму. Этот метод известен как терапия аутологичными лимфоцитами. При аллогенной иммунотерапии рака, культивирование иммунных клеток или стволовых клеток, происходящих от одного донора, позволяет проводить лечение большого числа пациентов. Такие иммунные клетки или стволовые клетки также могут быть модифицированы в культуре различными способами. В некоторых вариантах осуществления изобретения, лимфоциты могут быть выделены, модифицированы и введены другому индивидууму. Этот метод известен как терапия аллогенными лимфоцитами.

[00383] В некоторых вариантах осуществления изобретения, в таких способах иммунотерапии могут быть использованы лимфоциты, включая, но не ограничиваясь ими, Т-клетки, природные клетки-киллеры (NK-клетки), В-клетки, опухоль-инфильтрирующие лимфоциты (TIL), T-клетки, содержащие химерный антигенный рецептор (CAR -T-клетки), T-клетки, сконструированные на основе Т-клеточного рецептора (TCR), TCR-CAR-T-клетки, CAR-TIL-клетки, CAR-NK-клетки, сконструированные NK-клетки или гемопоэтические стволовые клетки, которые стимулируют образование лимфоцитов. В других вариантах осуществления изобретения, клетка представляет собой стволовую клетку, дендритную клетку и т.п. Геномы таких клеток могут быть модифицированы (например, посредством введения инсерций и/или делеций в геном лимфоцитов) с использованием одного или более сконструированных эффекторных комплексов Cascade класса I типа I согласно изобретению.

[00384] Лимфоциты для модификации могут быть выделены у индивидуума, такого как человек, например, из крови или из солидных опухолей, например, в случае TIL, или из лимфоидных органов, таких как тимус, костный мозг, лимфатические узлы и лимфоидные ткани, связанные со слизистой оболочкой. Способы выделения лимфоцитов хорошо известны специалистам в данной области. Так, например, лимфоциты могут быть выделены из мононуклеарных клеток периферической крови (МКПК), которые выделяют из цельной крови с использованием, например, фиколла, гидрофильного полисахарида, разделяющего слои крови, и путем центрифугирования в градиенте плотности. Обычно образцы крови с антикоагулянтом или дефибринированным слоем наносят слоями на раствор фиколла и центрифугируют до образования различных слоев клеток. Нижний слой включает красные кровяные тельца (эритроциты), которые собираются или агрегируются в среде фиколла и полностью опускаются на дно. Следующий слой содержит, в основном, гранулоциты, которые также мигрируют вниз через раствор фиколла-пака. Следующий слой включает лимфоциты, которые обычно находятся на границе раздела плазмы и раствора фиколла, наряду с моноцитами и тромбоцитами. Для выделения лимфоцитов этот слой восстанавливают, промывают солевым раствором для удаления тромбоцитов, фиколла и плазмы, а затем снова центрифугируют. Альтернативно, клетки могут быть выделены из донорской крови методами центрифугирования (например, с использованием аппарата CellSaver® (Haemonetrics, Braintree, MA) или автоматизированной системы обработки клеток Lovo (Fresenius Kabi USA, LLC, Lake Zurich, IL)).

[00385] Другие методы выделения лимфоцитов включают биопэннинг, который позволяет выделять популяции клеток из раствора путем связывания представляющих интерес клеток с пластиковыми поверхностями, покрытыми антителами. Затем, нежелательные клетки удаляют путем обработки специфическим антителом и комплементом. Кроме того, для обнаружения и подсчета лимфоцитов может быть проведен анализ методом сортинга клеток с активацией флуоресценции (FACS). В анализе FACS используется проточный цитометр, который разделяет меченые клетки на основе их различий при рассеянии света и флуоресценции.

[00386] В случае TIL, лимфоциты выделяют из опухоли и культивируют, например, в высоких дозах IL-2, и отбирают с помощью анализов по совместному культивированию для высвобождения цитокинов против аутологичных опухолевых или HLA-совместимых опухолевых клеточных линий. Культуры с признаками повышенной специфической реактивности, по сравнению с аллогенными контролями, не совместимыми с МНС, отбирают для быстрого размножения, а затем вводят индивидууму для лечения рака (см., например, Rosenberg, S., et al., Clin. Cancer Res. 17: 4550-4557 (2011); Dudly М. et al., Science 298: 850-854 (2002); Dudly М. et al., J. Clin. Oncol. 26: 5233-5239 (2008); Dudly М. et al., J. Immnother. 26: 332-342 (2003)).

[00387] После выделения, лимфоциты могут быть охарактеризованы с точки зрения их специфичности, частоты и функции. Часто используемые анализы включают анализ ELISPOT, который позволяет измерять частоту Т-клеточного ответа.

[00388] В некоторых вариантах осуществления изобретения, CD4+- и CD8+-T-клетки выделяют из донорских мононуклеарных клеток периферической крови (МКПК). Специалист в данной области может выделить Т-клетки или другие лимфоидные клетки различными описанными выше методами. Такие клетки могут быть также выделены путем дифференцировки из iPSC-клеток.

[00389] После выделения, лимфоциты могут быть активированы известными методоми для стимуляции пролиферации и дифференцировки в специализированные эффекторные лимфоциты. Поверхностными маркерами для активированных Т-клеток являются, например, CD3, CD4, CD8, PD1, IL2R и другие. Активированные цитотоксические лимфоциты могут уничтожать клетки-мишени после связывания когнатных рецепторов на поверхности клеток-мишеней. Маркеры поверхности для NK-клеток включают, например, CD16, CD56 и другие.

[00390] После выделения и, необязательно, активации, лимфоциты могут быть модифицированы для обеспечения желаемых свойств. Один или более сконструированных эффекторных комплексов Cascade типа I согласно изобретению могут быть использованы для введения геномных модификаций, включая, но не ограничиваясь ими, введение экспрессируемых кодирующих последовательностей и/или инактивацию экспрессии эндогенного гена. В некоторых вариантах осуществления изобретения, один или более сконструированных эффекторных комплексов Cascade типа I согласно изобретению могут быть использованы для редактирования гена TRAC (кодирующего константу Т-клеточного рецептора α), гена B2M (кодирующего микроглобулин β2) и/или гена PDCD1 (кодирующего белок запрограммированной гибели клеток 1; также известный как PD-1).

[00391] Т-клетки и NK-клетки являются примерами лимфоцитов, которые могут быть модифицированы способами согласно изобретению. В некоторых вариантах осуществления изобретения, один или более сконструированных эффекторных комплексов Cascade типа I согласно изобретению могут быть использованы для введения сайта разрезания в область-мишень гена в присутствии донорного полинуклеотида, содержащего CAR, где CAR включен в область-мишень генома лимфоцита. В дополнительных вариантах осуществления изобретения, один или более сконструированных эффекторных комплексов Cascade типа I согласно изобретению могут быть использованы для введения сайта разрезания в область-мишень гена для облегчения введения мутации с нокаутом для предотвращения экспрессии гена.

[00392] В другом варианте осуществления изобретения, сконструированные эффекторные комплексы Cascade типа I согласно изобретению могут быть использованы для введения геномных модификаций в человеческие iPSC. В некоторых вариантах осуществления изобретения, один или более сконструированных эффекторных комплексов Cascade типа I согласно изобретению могут быть использованы для редактирования гена TRAC, гена B2M и/или гена PDCD1. В других вариантах осуществления изобретения, сконструированные эффекторные комплексы Cascade типа I вместе с донорным полинуклеотидом могут быть использованы для введения геномных модификаций и кодирующих последовательностей, таких как CAR или цитокин (например, IL2, IL15 и т.п.). Затем модифицированные iPSC-клетки могут быть дополнительно дифференцированы в клетки зрелого типа, включающие Т-клетки и NK-клетки или дендритные клетки. В некоторых вариантах осуществления изобретения, модифицированные iPSC могут быть дифференцированы в CAR-T-клетки и CAR-NK-клетки.

[00393] В некоторых вариантах способов согласно изобретению, донорный полинуклеотид включает полинуклеотид, кодирующий CAR. CAR может быть нацелен на инсерцию в области-мишени гена (например, гена TRAC), содержащего сайт разрезания, посредством гомологичной рекомбинации («нокина»). Преимущество этого подхода заключается в том, что он также может обеспечить нокаут гена-мишени TRAC; то есть, ген TRAC должен быть сделан нефункциональным. Примеры внеклеточных антиген-распознающих доменов, которые могут быть включены в конструкции CAR, описаны выше (см. Таблицу 2). В одном из вариантов осуществления изобретения, внеклеточный антиген-распознающий домен содержит CD19-связывающий фрагмент (например, scFv против CD19). В другом варианте осуществления изобретения, внеклеточный антиген-распознающий домен содержит фрагмент, связывающийся с антигеном созревания В-клеток (BCMA) (например, scFv против BCMA).

[00394] В вариантах способов согласно изобретению, включающих создание сайта разрезания области-мишени ДНК, способ может дополнительно включать введение донорного полинуклеотида в модифицированную клетку для облегчения встраивания по меньшей мере части донорного полинуклеотида в область-мишень, содержащую сайт разрезания модифицированной клетки. Донорный полинуклеотид может быть непосредственно введен в модифицированную клетку. В некоторых вариантах осуществления изобретения, донорный полинуклеотид вводят с использованием вектора. Общие методы конструирования векторов известны специалистам в данной области. Примеры вирусных векторов включают, но не ограничиваются ими, лентивирус, ретровирус, аденовирус, вирус простого герпеса I или II, парвовирус, вирус ретикулоэндотелиоза и AAV-векторы.

[00395] Еще один вариант осуществления способов согласно изобретению включает введение мутации в гене B2M. В предпочтительных вариантах осуществления изобретения, мутация представляет собой нокаут-мутацию в гене B2M.

[00396] Еще один вариант осуществления способов согласно изобретению включает введение мутации в ген PDCD1. В предпочтительных вариантах осуществления изобретения, мутация представляет собой нокаут-мутацию в гене PDCD1.

[00397] Геномные модификации, вводимые посредством одного или более сконструированных эффекторных комплексов Cascade типа I согласно изобретению, могут быть осуществлены путем одновременного или последовательного введения сконструированных комплексов Cascade, полинуклеотидов (например, плазмид или экспрессионных кластеров) или их смесей в клетку-хозяина (например, в лимфоцит).

[00398] После получения модифицированных лимфоцитов, лимфоциты могут быть подвергнуты скринингу для отбора экспрессирующих клеток (например, клеток, экспрессирующих нужный рецептор клеточной поверхности), или неэкспрессирующих клеток (например, клеток, у которых экспрессия белка клеточной поверхности была инактивирована посредством редактирования генома с использованием одного или более сконструированных эффекторных комплексов Cascade типа I) с применением таких методов, как высокопроизводительные методы скрининга, включая, но не ограничиваясь ими, FACS, платформы скрининга на основе микрофлюидизации и т.п. Эти методы известны специалистам в данной области (см., например, Wojcik, M, et al., Int. J. Mol. Sci. 16: 24918-24945 (2015)).

[00399] Модифицированные лимфоциты, после их получения, могут быть включены в фармацевтические композиции для доставки индивидууму, подвергаемому лечению. Композиции согласно изобретению включают модифицированный лимфоцит и один или более фармацевтически приемлемых наполнителей. Примерами наполнителей являются, но не ограничиваются ими, углеводы, неорганические соли, противомикробные агенты, антиоксиданты, поверхностно-активные вещества, буферы, кислоты, основания и их комбинации. Наполнителями, подходящими для приготовления композиций для инъекций, являются вода, спирты, полиолы, глицерин, растительные масла, фосфолипиды и поверхностно-активные вещества. В качестве наполнителяя может присутствовать углевод, такой как сахар, дериватизированный сахар, такой как альдит, альдоновая кислота, этерифицированный сахар и/или сахарный полимер. Конкретными углеводными наполнителями являются, например, моносахариды, такие как фруктоза, мальтоза, галактоза, глюкоза, D-манноза, сорбоза и т.п.; дисахариды, такие как лактоза, сахароза, трегалоза, целлобиоза и т.п.; полисахариды, такие как рафиноза, мелецитоза, мальтодекстрины, декстраны, крахмалы и т.п.; и альдиты, такие как маннит, ксилит, мальтит, лактит, ксилит, сорбит (глюцит), пиранозилсорбит, миоинозит и т.п. Наполнитель может также включать неорганическую соль или буфер, такой как лимонная кислота, хлорид натрия, хлорид калия, сульфат натрия, нитрат калия, одноосновный фосфат натрия, двухосновный фосфат натрия и их комбинации. Для замораживания клеток в целях их хранения и транспортировки могут быть использованы замораживающие агенты (например, CryoStor® (BioLife Solutions Inc, Bothell, WA), замораживающая среда CS2, CS5 или CS10).

[00400] Фармацевтическая композиция согласно изобретению может также включать противомикробное средство для предотвращения или сдерживания роста микробов. Неограничивающими примерами противомикробных агентов, подходящих для использования в настоящем изобретении, являются хлорид бензалкония, хлорид бензетония, бензиловый спирт, хлорид цетилпиридиния, хлорбутанол, фенол, фенилэтиловый спирт, нитрат фенилртути, тимерозал и их комбинации.

[00401] В фармацевтической композиции также может присутствовать антиоксидант. Антиоксиданты используются для предотвращения окисления, и тем самым для предотвращения разрушения лимфоцитов или других компонентов препарата. Антиоксидантами, подходящими для их использования в настоящем изобретении, являются, например, аскорбилпальмитат, бутилированный гидроксианизол, бутилированный гидрокситолуол, гипофосфористая кислота, монотиоглицерин, пропилгаллат, бисульфит натрия, формальдегидсульфоксилат натрия, метабисульфит натрия и их комбинации.

[00402] В качестве наполнителя может присутствовать поверхностно-активное вещество. Примерами поверхностно-активных веществ являются: полисорбаты, такие как Твин 20 и Твин 80, и плюроники, такие как F68 и F88 (BASF, Mount Olive, New Jersey); сложные эфиры сорбитана; липиды, такие как фосфолипиды, такие как лецитин и другие фосфатидилхолины, фосфатидилэтаноламины (хотя, предпочтительно, не в липосомной форме), жирные кислоты и сложные эфиры жирных кислот; стероиды, такие как холестерин; хелатообразующие агенты, такие как EDTA; и цинк и другие подходящие катионы.

[00403] Кислоты или основания могут присутствовать в фармацевтической композиции в качестве наполнителя. Неограничивающими примерами кислот, которые могут быть использованы, являются кислоты, выбранные из группы, состоящей из соляной кислоты, уксусной кислоты, фосфорной кислоты, лимонной кислоты, яблочной кислоты, молочной кислоты, муравьиной кислоты, трихлоруксусной кислоты, азотной кислоты, перхлорной кислоты, фосфорной кислоты, серной кислоты, фумаровой кислоты и их комбинаций. Примерами подходящих оснований являются, но не ограничиваются ими, основания, выбранные из группы, состоящей из гидроксида натрия, ацетата натрия, гидроксида аммония, гидроксида калия, ацетата аммония, ацетата калия, фосфата натрия, фосфата калия, цитрата натрия, формиата натрия, сульфата натрия, сульфата калия, фумарата калия и их комбинаций.

[00404] Количество лимфоцитов (или других рекомбинантных клеток) в композиции будет варьироваться в зависимости от ряда факторов, но оптимальное количество будет представлять собой терапевтически эффективную дозу, если композиция находится в унифицированной лекарственной форме или в контейнере (например, в пакете). Терапевтически эффективная доза может быть определена экспериментально путем повторного введения увеличивающегося количества композиции для того, чтобы определить, какое количество дает клинически желаемый конечный результат.

[00405] Количество любого отдельного наполнителя в композиции будет варьироваться в зависимости от природы и функции наполнителя и конкретных потребностей композиции. Обычно, оптимальное количество любого отдельного наполнителя определяют с помощью рутинных экспериментов, то есть, путем приготовления композиций, содержащих различные количества наполнителей (от низкого до высокого), оценки стабильности и других параметров с последующим определением интервалов, при которых достигаются оптимальные свойства без значительных побочных эффектов. Однако, обычно, наполнитель(и) будет (будут) присутствовать в композиции в количестве приблизительно от 1% до приблизительно 99% по массе, предпочтительно приблизительно от 5% до приблизительно 98% по массе, более предпочтительно приблизительно от 15% до приблизительно 95% по массе наполнителя, при этом, наиболее предпочтительной концентрацией является концентрация менее чем 30% по массе. Эти вышеупомянутые фармацевтически приемлемые наполнители вместе с другими наполнителями описаны в руководстве “Remington: The Science & Practice of Pharmacy,” current edition, Williams & Williams; the “Physician’s Desk Reference,” current edition, Medical Economics, Montvale, NJ; and Kibbe, A.H., Handbook of Pharmaceutical Excipients, current edition, American Pharmaceutical Association, Washington, D.C.

[00406] Фармацевтические композиции могут быть помещены в шприц, устройство для имплантации или т.п. в зависимости от предполагаемого способа доставки и применения. Предпочтительно, количество присутствующей композиции соответствует разовой дозе в заранее определенной или предварительно упакованной форме.

[00407] Фармацевтические композиции согласно изобретению могут, но необязательно, включать один или более дополнительных агентов, таких как другие лекарственные средства, используемые для лечения индивидуума от рака или для устранения известных побочных эффектов такого лечения. Так, например, T-клетки высвобождают цитокины в кровоток, что может приводить к опасному повышению температуры и к резкому падению кровяного давления. Это состояние известно как синдром высвобождения цитокинов (СВЦ). У многих пациентов, СВЦ можно регулировать с помощью стандартной поддерживающей терапии, включая стероидную терапию и иммунотерапию, такую как введение тоцилизумаба (Actemra™, Genentech, South San Francisco, CA), который блокирует активность IL-6.

[00408] Индивидууму проводят по меньшей мере один терапевтически эффективный цикл лечения модифицированной композицией лимфоцитов. Под «терапевтически эффективным циклом лечения» подразумевается цикл лечения, который, при его проведении, дает положительный терапевтический ответ на лечение индивидуума от рассматриваемого заболевания. Под «положительным терапевтическим ответом» подразумевается, что у индивидуума, проходящего лечение в соответствии с настоящим изобретением, наблюдается ослабление одного или более симптомов заболевания, включая такие улучшения, как уменьшение опухоли и/или снижение потребности в терапии лимфоцитами.

[00409] В некоторых вариантах осуществления изобретения может быть введено множество терапевтически эффективных доз композиций, содержащих лимфоциты или другие лекарственные средства. Композиции согласно изобретению обычно, хотя и необязательно, вводят путем инъекции, например подкожно, интрадермально, внутривенно, внутриартериально, внутримышечно, внутрибрюшинно, интрамедуллярно, вовнутрь опухоли, интранодально, путем вливания или местно. Фармацевтический препарат может быть приготовлен в форме жидкого раствора или суспензии непосредственно перед введением. Все вышеизложенное также рассматривается как репрезентативный пример, поскольку могут быть также применены и дополнительные способы введения. Фармацевтические композиции могут быть введены одними и тем же или различными способами введения в соответствии с любым приемлемым с медицинской точки зрения способом, известным специалистам в данной области.

[00410] Фактически вводимая доза будет варьироваться в зависимости от возраста, массы тела и общего состояния здоровья индивидуума, а также от тяжести состояния, подвергаемого лечению, заключения врача и конкретно вводимых лимфоцитов. Терапевтически эффективные количества могут быть определены специалистом в данной области и могут быть скорректированы с учетом конкретных требований в каждом конкретном случае.

[00411] Обычно, терапевтически эффективное количество лимфоцитов будет составлять в пределах приблизительно от 1 × 105 до приблизительно 1 × 1010 лимфоцитов или более на пациента, например, от 1 × 106 до приблизительно 1 × 1010, например, от 1 × 107 до 1 × 1010, от 1 × 107 до 1 × 109, например, от 5 × 107 до 5 × 108 или любое количество в этих пределах. Другие интервалы доз могут составлять от 1 × 104 до 1 × 1010 клеток на кг массы тела. Общее количество лимфоцитов может быть введено в виде одной ударной дозы, либо оно может быть введено в виде двух или более доз, например, с интервалом в один или более дней. Общее количество лимфоцитов может быть введено в виде одной ударной дозы, либо оно может быть введено в виде двух или более доз, например, с интервалом в один или более дней. Количество вводимого соединения будет зависеть от активности конкретной композиции лимфоцитов, заболевания, подвергаемого лечению, и способа введения.

[00412] Кроме того, дозы могут содержать смесь лимфоцитов, например, смесь CD8+-клеток и CD4+-клеток. Если присутствует смесь CD8+- и CD4+-клеток, то отношение CD8+-клеток к CD4+-клеткам может составлять, например, 1:1, 1:2 или 2:1, 1:3 или 3:1, 1:4 или 4:1, 1:5 или 5:1 и т.п.

[00413] Модифицированные лимфоциты могут быть введены до, во время или после введения других агентов. Если модифицированные лимфоциты вводятся одновременно с другими агентами, то они могут быть представлены в одной и той же композиции или в различных композициях. Таким образом, лимфоциты и другие агенты могут быть введены пациенту посредством «параллельной терапии». Под «параллельной терапией» подразумевается проведение терапии индивидууму так, чтобы у него достигался терапевтический эффект от введения комбинации терапевтических средств. Так, например, такая параллельная терапия может быть достигнута путем введения дозы фармацевтической композиции, содержащей модифицированные лимфоциты, и дозы фармацевтической композиции, содержащей по меньшей мере один другой агент, такой как другой химиотерапевтический агент, который в комбинации с другими агентами содержит терапевтически эффективную дозу в соответствии с конкретной схемой введения доз. Аналогичным образом, модифицированные лимфоциты и терапевтические агенты могут быть введены по меньшей мере в одной терапевтической дозе. Введение отдельных фармацевтических композиций может быть осуществлено одновременно или в разное время (например, последовательно, в любом порядке, в один и тот же день или в разные дни), при условии, что у индивидуума, подвергаемого такой терапии будет наблюдаться терапевтический эффект от введения комбинации этих веществ.

[00414] Как описано в настоящей заявке, сконструированные эффекторные комплексы Cascade типа I согласно изобретению представляют собой средства для редактирования генома. Эксперименты, демонстрирующие функциональную реконструкцию системы CRISPR-Cas класса 1 в клетках млекопитающих для редактирования генома, показали, что такие оптимизированные конструкции плазмид позволяют использовать и другие системы CRISPR-Cas класса 1, включая системы, которые имеют меньшее число белковых компонентов и предъявляют меньше уникальных требований к PAM, и возможно даже эффекторные комплексы, нацеленные на РНК и ДНК и происходящие от систем CRISPR-Cas типа III (см., например, Hille, F., et al., Cell 172: 1239-1259 (2018); Tamulaitis, G., et al., Trends Microbiol.25: 49-61 (2017)). Мультисубъединичная природа комплексов Cascade дает возможность для осуществления поливалентного и/или стерически точного рекрутинга эффекторных гибридов, таких как синтетические факторы транскрипции, эпигеномные модификаторы и редакторы оснований. Кроме того, гетерологичная экспрессия полного пути интерференции ДНК из систем типа I, а именно, Cascade-опосредованного рекрутинга геликазы-нуклеазы Cas3 в геномные сайты-мишени, может быть использована для создания крупных делеций ДНК для выявления длинные участков оцДНК в целях гомологичной репарации и/или для механического устранения стерических затруднений белок-ДНК в определенных геномных локусах. В соответствии с этим, в одном варианте осуществления изобретения, сконструированные системы CRISPR-Cas класса 1 могут быть использованы для создания крупных делеционных областей, и донорный полинуклеотид (например, содержащий подходящие ветви гомологии) может быть введен в клетку, что будет облегчать встраивание по меньшей мере части донорного полинуклеотида в нужную область.

[00415] Вариантами осуществления изобретения являются, но не ограничиваются ими:

[00416] Вариант 1. Композиция, содержащая:

[00417] первый сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий:

[00418] первый белок субъединицы Cse2, первый белок субъединицы Cas5, первый белок субъединицы Cas6 и первый белок субъединицы Cas7;

[00419] первый гибридный белок, содержащий первый белок субъединицы Cas8 и первый FokI, где N-конец первого белка субъединицы Cas8 или C-конец первого белка субъединицы Cas8 ковалентно связан посредством первого линкерного полипептида с С-концом или N-концом, соответственно, первого FokI, и где первый линкерный полипептид имеет длину приблизительно от 10 аминокислот до приблизительно 40 аминокислот, и

[00420] первый руководящий полинуклеотид, содержащий первый спейсер, способный связываться с первой последовательностью нуклеиновой кислоты-мишени; и

[00421] второй сконструированный эффекторный комплекс CRISPR-Cas типа I, содержащий:

[00422] второй белок субъединицы Cse2, второй белок субъединицы Cas5, второй белок субъединицы Cas6 и второй белок субъединицы Cas7,

[00423] второй гибридный белок, содержащий второй белок субъединицы Cas8 и второй FokI, где N-конец второго белка субъединицы Cas8 или C-конец второго белка Cas8 ковалентно связан посредством второго линкерного полипептида с C-концом или N-концом, соответственно, второго FokI, и где второй линкерный полипептид имеет длину приблизительно от 10 аминокислот до приблизительно 40 аминокислот, и

[00424] второй руководящий полинуклеотид, содержащий второй спейсер, способный связываться со второй последовательностью нуклеиновой кислоты-мишени, где соседний мотив протоспейсера (PAM) второй последовательности нуклеиновой кислоты-мишени и PAM первой последовательности нуклеиновой кислоты-мишени имеет межспейсерное расстояние приблизительно от 20 п.о. до приблизительно 42 п.о.

[00425] Вариант 2. Композиция согласно варианту 1, где первый линкерный полипептид имеет длину приблизительно от 15 до приблизительно 30 аминокислот.

[00426] Вариант 3. Композиция согласно варианту 2, где первый линкерный полипептид имеет длину приблизительно от 17 аминокислот до приблизительно 20 аминокислот.

[00427] Вариант 4. Композиция согласно любому из вариантов 1-3, где второй линкерный полипептид имеет длину приблизительно от 15 аминокислот до приблизительно 30 аминокислот.

[00428] Вариант 5. Композиция согласно варианту 4, где второй линкерный полипептид имеет длину приблизительно приблизительно от 17 аминокислот до приблизительно 20 аминокислот.

[00429] Вариант 6. Композиция согласно любому из предшествующих вариантов, где длины первого линкерного полипептида и второго линкерного полипептида являются одинаковыми.

[00430] Вариант 7. Композиция согласно любому из предшествующих вариантов, где вторая последовательность нуклеиновой кислоты-мишени и первая последовательности нуклеиновой кислоты-мишени имеют расстояние между спейсерами приблизительно от 22 п.о. до приблизительно 40 п.о.

[00431] Вариант 8. Композиция согласно варианту 7, где вторая последовательность нуклеиновой кислоты-мишени и первая последовательности нуклеиновой кислоты-мишени имеют расстояние между спейсерами приблизительно от 26 п.о. до приблизительно до приблизительно 36 п.о.

[00432] Вариант 9. Композиция согласно варианту 8, где вторая последовательность нуклеиновой кислоты-мишени и первая последовательности нуклеиновой кислоты-мишени имеют расстояние между спейсерами приблизительно от 29 п.о. до приблизительно до приблизительно 35 п.о.

[00433] Вариант 10. Композиция согласно варианту 9, где вторая последовательность нуклеиновой кислоты-мишени и первая последовательности нуклеиновой кислоты-мишени имеют расстояние между спейсерами приблизительно от 30 п.о. до приблизительно до приблизительно 34 п.о..

[00434] Вариант 11. Композиция согласно любому из предшествующих вариантов, где первый FokI и второй FokI представляют собой мономерные субъединицы, способные связываться с образованием гомодимера.

[00435] Вариант 12. Композиция согласно любому из вариантов 1-10, где первый FokI и второй FokI представляют собой отдельные мономерные субъединицы, способные связываться с образованием гетеродимера.

[00436] Вариант 13. Композиция согласно любому из предшествующих вариантов, где N-конец первого белка субъединицы Cas8 ковалентно связан посредством первого линкерного полипептида с C-концом первого FokI.

[00437] Вариант 14. Композиция согласно любому из вариантов 1-12, где C-конец первого белка субъединицы Cas8 ковалентно связан посредством первого линкерного полипептида с N-концом первого FokI.

[00438] Вариант 15. Композиция согласно любому из предшествующих вариантов, где N-конец второго белка субъединицы Cas8 ковалентно связан посредством второго линкерного полипептида с С-концом второго FokI.

[00439] Вариант 16. Композиция согласно любому из вариантов 1-14, где C-конец второго белка субъединицы Cas8 ковалентно связан посредством второго линкерного полипептида с N-концом второго FokI.

[00440] Вариант 17. Композиция согласно любому из предшествующих вариантов, где первый белок субъединицы Cas8 и второй белок субъединицы Cas8 содержат идентичные аминокислотные последовательности.

[00441] Вариант 18. Композиция согласно любому из предшествующих вариантов, где первый белок субъединицы Cse2 и второй белок субъединицы Cse2 содержат идентичные аминокислотные последовательности; первый белок субъединицы Cas5 и второй белок субъединицы Cas5 содержат идентичные аминокислотные последовательности; первый белок первой субъединицы Cas6 и второй белок субъединицы Cas6 содержит идентичные аминокислотные последовательности; и первый белок первой субъединицы Cas7 и второй белок субъединицы Cas7 содержат идентичные аминокислотные последовательности.

[00442] Вариант 19. Композиция согласно любому из предшествующих вариантов, где первый руководящий полинуклеотид содержит РНК.

[00443] Вариант 20. Композиция согласно любому из предшествующих вариантов, где второй руководящий полинуклеотид содержит РНК.

[00444] Вариант 21. Композиция согласно любому из предшествующих вариантов, где геномная ДНК содержит PAM второй последовательности нуклеиновой кислоты-мишени и PAM первой последовательности нуклеиновой кислоты-мишени.

[00445] Вариант 22. Клетка, содержащая композицию согласно любому из предшествующих вариантов.

[00446] Вариант 23. Клетка согласно варианту 22, где геномная ДНК клетки содержит PAM второй последовательности нуклеиновой кислоты-мишени и PAM первой последовательности нуклеиновой кислоты-мишени.

[00447] Вариант 24. Клетка согласно варианту 22 или 23, где клетка является прокариотической клеткой.

[00448] Вариант 25. Клетка согласно варианту 22 или 23, где клетка является эукариотической клеткой.

[00449] Вариант 26. Одна или более последовательностей нуклеиновых кислот, кодирующих первый белок субъединицы Cse2, первый белок субъединицы Cas5, первый белок субъединицы Cas6, первый белок субъединицы Cas7, первый гибридный белок и первый руководящий полинуклеотид согласно любому из вариантов 1-21.

[00450] Вариант 27. Одна или более последовательностей нуклеиновых кислот, кодирующих второй белок субъединицы Cse2; второй белок субъединицы Cas5; второй белок субъединицы Cas6; второй белок субъединицы Cas7; второй гибридный белок и второй руководящий полинуклеотид согласно любому из вариантов 1-21.

[00451] Вариант 28. Один или более экспрессионных кластеров, содержащих одну или более последовательностей нуклеиновых кислот согласно варианту 26, варианту 27 или варианту 26 и варианту 27.

[00452] Вариант 29. Один или более векторов, содержащих один или более экспрессионных кластеров согласно варианту 28.

[00453] Вариант 30. Способ связывания полинуклеотида, содержащего первую последовательность нуклеиновой кислоты-мишени и вторую последовательность нуклеиновой кислоты-мишени, где указанный способ включает:

[00454] получение композиции согласно любому из вариантов 1-21 для введения в клетку или в биохимическую реакционную смесь; и

[00455] введение композиции в клетку или в биохимическую реакционную смесь для облегчения контактирования первого сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I с первой последовательностью нуклеиновой кислоты-мишени и контактирования второго сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I со второй последовательностью нуклеиновой кислоты-мишени, приводящих к связыванию первого сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I с первой последовательностью нуклеиновой кислоты-мишени и к связыванию второго сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I со второй последовательностью нуклеиновой кислоты-мишени в полинуклеотиде.

[00456] Вариант 31. Способ согласно варианту 30, где геномная ДНК содержит полинуклеотид.

[00457] Вариант 32. Способ разрезания полинуклеотида, содержащего первую последовательность нуклеиновой кислоты-мишени и вторую последовательность нуклеиновой кислоты-мишени, где указанный способ включает:

[00458] получение композиции согласно любому из вариантов 1-21 для введения в клетку или в биохимическую реакционную смесь; и

[00459] введение композиции в клетку или в биохимическую реакционную смесь для облегчения контактирования первого сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I с первой последовательностью нуклеиновой кислоты-мишени и контактирования второго сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I со второй последовательностью нуклеиновой кислоты-мишени, приводящих к разрезанию первой последовательности нуклеиновой кислоты-мишени первым сконструированным эффекторным комплексом CRISPR-Cas класса 1 типа I и к разрезанию второй последовательности нуклеиновой кислоты-мишени вторым сконструированным эффекторным комплексом CRISPR-Cas класса 1 типа I.

[00460] Вариант 33. Способ согласно варианту 32, где геномная ДНК содержит полинуклеотид.

[00461] Вариант 34. Набор, содержащий композицию согласно любому из вариантов 1-21 и буфер.

[00462] Вариант 35. Набор, содержащий одну или более последовательностей нуклеиновой кислоты согласно варианту 26, варианту 27 или варианту 26 и варианту 27; и буфер.

[00463] Вариант 36. Композиция, содержащая:

[00464] сконструированный эффекторный комплекс CRISPR-Cas класса 1 типа I, содержащий:

[00465] белок субъединицы Cse2, белок субъединицы Cas5, белок субъединицы Cas6 и белок субъединицы Cas7,

[00466] первый гибридный белок, содержащий белок субъединицы Cas8 и первый FokI, где N-конец первого белка субъединицы Cas8 или C-конец первого белка субъединицы Cas8 ковалентно связан посредством первого линкерного полипептида с C -концом или N-концом, соответственно, первого FokI, и

[00467] руководящий полинуклеотид, содержащий спейсер, способный связываться с последовательностью нуклеиновой кислоты-мишени; и

[00468] второй гибридный белок, содержащий сконструированный гибридный белок CRISPR-Cas3 класса 1 типа I, содержащий белок dCas3* и второй FokI, где N-конец белка dCas3* или C-конец белка dCas3* ковалентно связан посредством второго линкерного полипептида с С-концом или N-концом, соответственно, второго FokI, и где первый линкерный полипептид имеет длину приблизительно от 10 аминокислот до приблизительно 40 аминокислот.

[00469] Вариант 37. Композиция согласно варианту 36, где первый линкерный полипептид имеет длину приблизительно от 5 аминокислот до приблизительно 40 аминокислот.

[00470] Вариант 38. Композиция согласно варианту 36, где второй линкерный полипептид имеет длину приблизительно от 5 аминокислот до приблизительно 40 аминокислот.

[00471] Вариант 39. Клетка, содержащая композицию согласно любому из вариантов 36-38.

[00472] Вариант 40. Клетка согласно варианту 39, где клетка является прокариотической клеткой.

[00473] Вариант 41. Клетка согласно варианту 39, где клетка является эукариотической клеткой.

[00474] Вариант 42. Одна или более последовательностей нуклеиновой кислоты, кодирующие белок субъединицы Cse2, белок субъединицы Cas5, белок субъединицы Cas6, белок субъединицы Cas7, первый гибридный белок и руководящий полинуклеотид согласно любому из вариантов 36-38.

[00475] Вариант 43. Одна или более последовательностей нуклеиновой кислоты, кодирующие второй гибридный белок согласно любому из вариантов 36-38.

[00476] Вариант 44. Один или более экспрессионных кластеров, содержащих одну или более последовательностей нуклеиновых кислот согласно варианту 42, варианту 43 или варианту 42 и варианту 43.

[00477] Вариант 45. Один или более векторов, содержащих один или более экспрессионных кластеров согласно варианту 44.

[00478] Вариант 46. Способ связывания полинуклеотида, содержащего последовательность нуклеиновой кислоты-мишени, где указанный способ включает:

[00479] получение композиции согласно любому из вариантов 36-38 для введения в клетку или в биохимическую реакционную смесь; и

[00480] введение композиции в клетку или в биохимическую реакционную смесь для облегчения контактирования сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I с первой последовательностью нуклеиновой кислоты-мишени и контактирования второго гибридного белка со сконструированным эффекторным комплексом CRISPR-Cas класса 1 типа I, приводящих к связыванию сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I и второго гибридного белка с последовательностью нуклеиновой кислоты-мишени в полинуклеотиде.

[00481] Вариант 47. Способ согласно варианту 46, где геномная ДНК содержит полинуклеотид.

[00482] Вариант 48. Способ разрезания полинуклеотида, содержащего последовательность нуклеиновой кислоты-мишени, где указанный способ включает:

[00483] получение композиции согласно любому из вариантов 36-38 для введения в клетку или в биохимическую реакционную смесь; и

[00484] введение композиции в клетку или в биохимическую реакционную смесь для облегчения контактирования первого сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I с первой последовательностью нуклеиновой кислоты-мишени и контактирования второго сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I со второй последовательностью нуклеиновой кислоты-мишени,

[00485] введение композиции в клетку или в биохимическую реакционную смесь для облегчения контактирования сконструированного эффекторного комплекса CRISPR-Cas класса 1 типа I с последовательностью нуклеиновой кислоты-мишени и контактирования второго гибридного белка со сконструированным эффекторным комплексом CRISPR-Cas класса 1 типа I, приводящих к разрезанию последовательности нуклеиновой кислоты-мишени сконструированным эффекторным комплексом CRISPR-Cas класса 1 типа I и второго гибридного белка.

[00486] Вариант 49. Способ согласно варианту 48, где геномная ДНК содержит полинуклеотид.

[00487] Вариант 50. Набор, содержащий: композицию согласно любому из вариантов 36-38; и буфер.

[00488] Вариант 51. Набор, содержащий одну или более последовательностей нуклеиновых кислот согласно варианту 42, варианту 43 или варианту 42 и варианту 43; и буфер.

[00489] Вариант 52. Сконструированный мутантный белок CRISPR Cas3 типа I («белок mCas3»), способный уменьшать перемещение вдоль ДНК по сравнению с белком CRISPR Cas3 типа I дикого типа («белом wtCas3»), где белок mCas3 содержит:

[00490] последовательность, которая приблизительно на 95% или более идентична последовательности соответствующего белка wtCas3,

[00491] сигнал ядерной локализации, ковалентно связанный у амино-конца, карбокси-конца или у на амино- и карбокси-концов, и

[00492] одна или более мутаций, которые подавляют геликазную активность, где сконструированный мутантный белок CRISPR Cas3 типа I сохраняет нуклеазную активность,

[00493] где ДНК представляет собой двухцепочечную ДНК (дцДНК), содержащую область-мишень, включающую последовательность нуклеиновой кислоты-мишени;

[00494] где, если белок wtCas3 связан с соответствующим комплексом нуклеопротеинов Cascade («комплекс Cascade NP/белок wtCas3»), а комплекс Cascade NP содержит руководящую последовательность, включающую спейсер, комплементарный последовательности нуклеиновой кислоты-мишени, то связывание комплекса Cascade NP/белка wtCas3 с последовательностью нуклеиновой кислоты-мишени облегчает расщепление в области-мишени ДНК, и тем самым приводит к делеции («wtCas3-делеции»); и

[00495] где белок mCas3, если он связан с комплексом Cascade NP («комплексом Cascade NP/белком mCas3»), и если он связан с последовательностью нуклеиновой кислоты-мишени, способствует расщеплению в области-мишени ДНК, что тем самым приводит к более короткой делеции по сравнению с wtCas3-делецией.

[00496] Вариант 53. Белок mCas3 согласно варианту 53, где одна или более мутаций представляют собой замены аминокислот.

[00497] Вариант 54. Белок mCas3 согласно любому из предшествующих вариантов, где одна или более мутаций находятся либо в области RecA1, либо в области RecA2 геликазного домена.

[00498] Вариант 55. Белок mCas3 согласно любому из предшествующих вариантов, где одна или более мутаций подавляют связывание белка mCas3 с одноцепочечной ДНК (оцДНК) по сравнению с белком wtCas3.

[00499] Вариант 56. Белок mCas3 согласно любому из предшествующих вариантов, где одна или более мутаций подавляют гидролиз аденозинтрифосфата (АТФ) белком mCas3 или подавляют связывание АТФ с белком mCas3 по сравнению с белком wtCas3.

[00500] Вариант 57. Белок mCas3 согласно любому из предшествующих вариантов, где кодирующие последовательности для белка mCas3 ковалентно связаны с амино-концом или карбокси-концом кодирующих последовательностей для белка Cas комплекса Cascade NP.

[00501] Вариант 58. Белок mCas3 согласно любому из предшествующих вариантов, где одна или более мутаций подавляют связывание белка mCas3 с одноцепочечной ДНК (оцДНК) по сравнению с белком wtCas3.

[00502] Вариант 59. Белок mCas3 согласно любому из предшествующих вариантов, где кодирующие последовательности для белка mCas3 ковалентно связаны с амино-концом или карбокси-концом кодирующих последовательностей для белка Cas комплекса Cascade RNP.

[00503] Вариант 60. Белок mCas3 согласно любому из предшествующих вариантов, где белок Cas выбран из группы, состоящей из белка Cse2, белка Cas8, белка Cas7, белка Cas6 и белка Cas5.

[00504] Вариант 61. Белок mCas3 согласно любому из предшествующих вариантов, где белок wtCas3 представляет собой белок CRISPR Cas3 E. coli типа 1.

[00505] Вариант 62. Белок mCas3 согласно варианту 61, где одна или более мутаций выбраны из группы, состоящей из D452H, A602V, D452H и A602V.

[00506] Вариант 63. Белок mCas3 согласно любому из предшествующих вариантов, где ДНК находится внутри клетки.

[00507] Вариант 64. Белок mCas3 согласно варианту 63, где клетка является эукариотической клеткой.

[00508] Вариант 65. Белок mCas3 согласно варианту 64, где эукариотическая клетка представляет собой клетку млекопитающего (например, человеческую клетку).

[00509] Вариант 66. Один или более полинуклеотидов, кодирующих белок mCas3 согласно любому из вариантов 52-65.

[00510] Вариант 67. Плазмида, содержащая полинуклеотидную последовательность, кодирующую белок mCas3 согласно любому из вариантов 52-65 и функционально присоединенную к регуляторным последовательностям для экспрессии в клетке млекопитающего.

[00511] Вариант 68. Одна или более плазмид, содержащих полинуклеотидную последовательность, кодирующую белок mCas3 согласно любому из вариантов 52-65, и один или более полинуклеотидов, кодирующих компоненты белка соответствующего Cascade CRISPR типа I и функционально присоединенных к регуляторным последовательностями для экспрессии в клетке млекопитающего.

[00512] Вариант 69. Одна или более плазмид согласно варианту 68, дополнительно содержащие плазмиду, кодирующую один или более руководящих полинуклеотидов, функционально присоединенных к регуляторным последовательностями для экспрессии в клетке млекопитающего.

00513] Вариант 70. Нуклеопротеиновый комплекс CRISPR Cascade типа I, содержащий белок mCas3 согласно любому из вариантов 52-65.

[00514] Вариант 71. Нуклеопротеиновый комплекс CRISPR Cascade типа I согласно варианту 70, где нуклеопротеиновый комплекс представляет собой RNP.

[00515] Хотя в настоящей заявке представлены и описаны предпочтительные варианты осуществления настоящего изобретения, однако, для специалистов в данной области будет очевидно, что такие варианты приводятся здесь лишь в качестве примера. Исходя из описания настоящего изобретения и примеров, специалист в данной области может самостоятельно определить основные принципы изобретения, и не выходя за рамки существа и объема изобретения, может внести изменения, замены, вариации и модификации для адаптации настоящего изобретения к различным применениям и условиям. При этом предполагается, что такие изменения, замены, вариации и модификации также входят в объем настоящего изобретения.

Эксперименты

[00516] Аспекты настоящего изобретения проиллюстрированы в нижеследующих примерах. Были предприняты попытки обеспечить точность используемых чисел (например, количеств, концентраций, процентных изменений и т.п.), однако, следует также учитывать некоторые экспериментальные погрешности и отклонения. Если это не оговорено особо, то температура указывается в градусах Цельсия, а давление является атмосферным или близким к нему. Следует отметить, что эти примеры приводятся лишь в целях иллюстрации и не должны рассматриваться как ограничение объема настоящего изобретения.

[00517]

Пример 1

Конструирование in silico полинуклеотидов, кодирующих компоненты Cascade

[00518] В этом примере представлено описание конструирования полинуклеотидных компонентов, кодирующих Cascade, с использованием последовательностей гена, белка и CRISPR, полученных из системы CRISPR-Cas типа I-E.

[00519] В таблице 15 представлены полинуклеотидные последовательности ДНК-генов, кодирующих пять белков Cascade типа I-E, а в частности штамма K-12 MG1655E. coli, а также аминокислотные последовательности полученных белковых компонентов. Геномные последовательности были получены из эталонной последовательности NCBI NZ_CP014225.1. Как показано в Таблице 15, полинуклеотидные последовательности были либо амплифицированы из гДНК E. coli, либо полинуклеотиды, полученные от производителя и кодирующие компоненты белка Cascade, были оптимизированы по кодонам специально для экспрессии в E. coli, а также для экспрессии в клетках человека.

[00520]

Таблица 15
ДНК и аминокислотные последовательности белка Cas
Белок Тип последовательности Кодирующая последовательность ДНК Аминокислотная последовательность
Cas8 геномная SEQ ID NO:1 SEQ ID NO:16
Cse2 геномная SEQ ID NO:2 SEQ ID NO:17
Cas7 геномная SEQ ID NO:3 SEQ ID NO:18
Cas5 геномная SEQ ID NO:4 SEQ ID NO:19
Cas6 геномная SEQ ID NO:5 SEQ ID NO:20
Cas8 Оптимизированная по кодонам E. coli SEQ ID NO:6 SEQ ID NO:16
Cse2 Оптимизированная по кодонам E. coli SEQ ID NO:7 SEQ ID NO:17
Cas7 Оптимизированная по кодонам E. coli SEQ ID NO:8 SEQ ID NO:18
Cas5 Оптимизированная по кодонам E. coli SEQ ID NO:9 SEQ ID NO:19
Cas6 Оптимизированная по кодонам E. coli SEQ ID NO:10 SEQ ID NO:20
Cas8 Оптимизированная по кодонам H. sapiens SEQ ID NO:11 SEQ ID NO:16
Cse2 Оптимизированная по кодонам H. sapiens SEQ ID NO:12 SEQ ID NO:17
Cas7 Оптимизированная по кодонам H. sapiens SEQ ID NO:13 SEQ ID NO:18
Cas5 Оптимизированная по кодонам H. sapiens SEQ ID NO:14 SEQ ID NO:19
Cas6 Оптимизированная по кодонам H. sapiens SEQ ID NO:15 SEQ ID NO:20

[00521] Кроме того, было сконструировано несколько гибридных белков, содержащих белки Cascade. В Таблице 16 представлены полинуклеотидные последовательности ДНК-генов, кодирующих гибридные белки Cascade, а также аминокислотные последовательности полученных белковых компонентов. В большинстве случаев, гибридные белки, описанные в Таблице 16, включают короткие линкеры из трех аминокислот, соединяющие две полипептидные последовательности в гибридной конструкции; и эти линкеры обычно включают глицин-глицин-серин (GGS) или глицин-серин-глицин (GSG). Линкерные последовательности точно из трех аминокислот, используемые в каждом конкретном гибридном белке, можно найти в полноразмерной аминокислотной последовательности в Таблице 16.

[00522]

Таблица 16
Последовательности гибридного белка Cascade
Белок Cascade Гетерологичный полипептид Гетерологичный полипептид, связанный с N- или C-концом белка Cascade Кодирующая последовательность ДНК Экспрессиионная система для кодирующей последовательности ДНК Аминокислотная последовательность
Cse2 Strep-tag® II-HRV3C N SEQ ID NO:390 E. coli SEQ ID NO:391
Cse2 His6-HRV3C N SEQ ID NO:392 E. coli SEQ ID NO:393
Cse2 NLS N SEQ ID NO:394 Млекопитающее SEQ ID NO:395
Cas5 NLS N SEQ ID NO:396 Млекопитающее SEQ ID NO:397
Cas6 NLS N SEQ ID NO:398 E. coli SEQ ID NO:399
Cas6 NLS-HA N SEQ ID NO:400 E. coli SEQ ID NO:401
Cas6 NLS N SEQ ID NO:402 Млекопитающее SEQ ID NO:403
Cas7 NLS C SEQ ID NO:404 E. coli SEQ ID NO:405
Cas7 HA-NLS C SEQ ID NO:406 E. coli SEQ ID NO:407
Cas7 NLS N SEQ ID NO:408 Млекопитающее SEQ ID NO:409
Cas8 His6-MBP-TEV N SEQ ID NO:410 E. coli SEQ ID NO:411
Cas8 His6-MBP-TEV-NLS-FokI-линкер N SEQ ID NO:412 E. coli SEQ ID NO:413
Cas8 NLS N SEQ ID NO:414 Млекопитающее SEQ ID NO:415
Cas8 NLS-HA-FokI- линкер N SEQ ID NO:416 Млекопитающее SEQ ID NO:417

[00523] Пептидные метки His6 (гексагистидин; SEQ ID NO: 418) и Strep-tag™ II (GE Healthcare Bio-Sciences, Pittsburgh, PA) (SEQ ID NO: 419) на белке Cse2, при их совместной экспрессии с другими белками Cascade, позволяют проводить очистку комплекса посредством смолы, содержащей никель-нитрилоуксусную кислоту (Ni-NTA), или смолы Strep-Tactin™ (IBA GMBH LLC, Göttingen, Germany), соответственно. Последовательность распознавания протеазой HRV3C (человеческого риновируса 3C) (SEQ ID NO: 420) расщепляется протеазой HRV3C и может быть использована для удаления N-концевых гибридов из представляющего интерес белка. Пептидная метка NLS (сигнал ядерной локализации; SEQ ID NO: 421) на белках Cas6, Cas7 и/или Cas8 обеспечивает перенос в ядро в эукариотических системах. Пептидная метка HA (гемагглютинина; SEQ ID NO: 422) на белках Cas6 или Cas7 позволяет детектировать экспрессию гетерологичного белка с помощью Вестерн-блоттинга с антителом против НА. Гибридный пептид MBP (белка, связывающегося с мальтозой; SEQ ID NO: 423) представляет собой солюбилизирующую метку, которая облегчает очистку белка Cas8. Последовательность распознавания протеазой TEV (вируса гравировки табака) (SEQ ID NO: 424) расщепляется протеазой TEV и может быть использована для удаления N-концевых гибридов из представляющего интерес белка. Домен нуклеазы FokI включает вариант Шарки, описанный Guo et al. (Guo, T, et al., J. Mol. Biol. 400: 96-107 (2010)), две мономерные субъединицы FokI, связанные друг с другом с образованием гомодимера и катализирующие расщепление двухцепочечной ДНК после гомодимеризации. Линкерная последовательность (SEQ ID NO: 425) используется для присоединения нуклеазного домена FokI к белку Cas8.

[00524] Были сконструированы дополнительные линкерные последовательности различной длины и аминокислотного состава, которые соединяют домен нуклеазы FokI с белком Cas8. Эти аминокислотные последовательности можно найти в Таблице 17.

[00525]

Таблица 17
Аминокислотные линкерные последовательности
SEQ ID NO: Длина линкера (аминокислоты) Аминокислотная последовательность
SEQ ID NO:426 5 GGGGS
SEQ ID NO:427 8 TGPGAAAR
SEQ ID NO:428 10 GGSGSSGGSG
SEQ ID NO:429 12 TGPGAAARAASG
SEQ ID NO:430 15 GGSGSSGGSGSSGGS
SEQ ID NO:431 16 SGSETPGTSESATPES
SEQ ID NO:432 20 SGSETPGTSESATPESGGSG
SEQ ID NO:433 30 SGSETPGTSESATPESGGSGSSGGSGSSGG

[00526] Таблица 18 содержит последовательность полинуклеотидной ДНК четырех минимальных массивов CRISPR, которая при транскрибировании в предшественник cr-РНК и процессинге РНК-эндонуклеазным белком Cascade, генерирует зрелые cr-РНК, которые функционируют как руководящая РНК для нацеливания на комплементарные последовательности ДНК в биохимических анализах и в экспериментах по редактированию генов клеточных культур.

[00527] Минимальный массив CRISPR включает две повторяющиеся последовательности (подчеркнутые и показанные строчными буквами), фланкирующие спейсерную последовательность, которая представляет собой руководящую часть cr-РНК. Процессинг РНК под действием эндонуклеазного белка Cascade генерирует cr-РНК с повторяющимися последовательностями на обоих 5'- и 3'-концах, фланкирующих руководящую последовательность. Массив CRISPR также может быть расширен за счет включения трех повторяющихся последовательностей (подчеркнутых), фланкирующих две спейсерные последовательности, которые представляют собой руководящие части двух различных cr-РНК в результате процессинга РНК эндонуклеазным белком Cascade. При желании, массивы могут быть дополнительно расширены за счет включения дополнительных последовательностей спейсеров.

[00528]

Таблица 18
Последовательности массива CRISPR
SEQ ID NO: Тип клетки Мишень Минимальная последовательность массива CRISPR
SEQ ID NO:434 E. coli Мишень бактериофага λ J3 gagttccccgcgccagcggggataaaccgCCAGTGATAAGTGGAATGCCATGTGGGCTGTCgagttccccgcgccagcggggataaaccg
SEQ ID NO:435 E. coli Мишень бактериофага λ L3 gagttccccgcgccagcggggataaaccgAGTGGCAGATATAGCCTGGTGGTTCAGGCGGCgagttccccgcgccagcggggataaaccg
SEQ ID NO:436 E. coli Мишени бактериофага λ L3/J3 gagttccccgcgccagcggggataaaccgCCAGTGATAAGTGGAATGCCATGTGGGCTGTCgagttccccgcgccagcggggataaaccgAGTGGCAGATATAGCCTGGTGGTTCAGGCGGCgagttccccgcgccagcggggataaaccg
SEQ ID NO:437 Клетка H. sapiens Ген TRAC gagttccccgcgccagcggggataaaccgGTTGATTTGCCTGCATTGGTGTTACACAGTCTgagttccccgcgccagcggggataaaccgTAAGTTGTGTTCTTCTTTGCCTAGGCCTTCAGgagttccccgcgccagcggggataaaccg

[00529]

Пример 2

Конструирование бактериальных экспрессионных векторов для получения эффекторных комплексов Cascade

[00530] В этом примере описано конструирование бактериальных экспрессионных векторов, которые кодируют Cascade-ассоциированные белки, а также минимальный массив CRISPR, содержащий руководящую последовательность, как описано в Примере 1. Описано конструирование экспрессионных систем белка субъединицы Cascade для использования с плазмидами, кодирующими минимальные массивы CRISPR.

[00531] Одноплазмидная система экспрессии белков Cascade была сконструирована для экспрессии белков комплекса Cascade в E. coli, известного как комплекс CasBCDE (который содержит белки Cse2, Cas7, Cas5 и Cas6, но не белок Cas8) или весь функциональный комплекс Cascade в E. coli. Одноплазмидная система включает либо оперон cse2-cas7-cas5-cas6, либо весь оперон cas8-cse2-cas7-cas5-cas6 на одной экспрессионной плазмиде. Белок Cas8 может быть экспрессирован из собственной экспрессионной плазмиды для использования в биохимических экспериментах, в которых его смешивают с комплексом CasBCDE для восстановления Cascade.

[00532] Была использована исходная плазмида для конструирования экспрессионного вектора (см. Brouns, S., et al., Science 321: 960-964 (2008)). Одноплазмидная система экспрессии белка Cascade, содержащая оперон Cas, была собрана следующим образом. Кодирующие последовательности для генов cas были расположены в следующем порядке cse2-cas7-cas5-cas6 (комплекс CasBCDE или cas8-cse2-cas7-cas5-cas6 (полный комплекс Cascade)) и были разделены последовательностями, соответствующими аранжировке бактериальных генов дикого типа (см. эталонную последовательность NCBI NZ_CP014225.1).

[00533] Для присоединения полинуклеотидной последовательности, кодирующей аффинную метку (His6 или Strep-tag® II, IBA GMBH LLC, Göttingen, Germany), соответствующая кодирующая последовательность была встроена в область стыка 3'-конца гена cas8 и 5'-конца гена cse2; и эти две открытые рамки считывания перекрываются в последовательности гДНК дикого типа.

[00534] Для присоединения полинуклеотидных последовательностей, кодирующих N-концевые метки NLS и/или NLS-HA, к 5'-концу гена cas6, между геном cas6 и расположенным выше геном cas5 были введены дополнительные спейсерные группы, поскольку эти открытые рамки считывания перекрываются в последовательности гДНК дикого типа, так, что последовательность Шайна-Дальгарно для гена cas6 находится в 3'-части гена cas5. Новую последовательность Шайна-Дальгарно встраивали перед новыми открытыми рамками считывания NLS-Cas6 или NLS-HA-Cas6 для повышения эффективности трансляции.

[00535] Для присоединения полинуклеотидных последовательностей, кодирующих С-концевые метки NLS и/или HA-NLS, к 3'-концу гена cas7, между геном cas7 и расположенным ниже геном cas5 были введены дополнительные спейсерные группы, поскольку эти открытые рамки считывания находятся в непосредственной близости друг от друга в 3'-части гена cas7. Новую последовательность Шайна-Дальгарно встраивали ниже новых открытых рамок считывания Cas7-NLS или Cas7-HA-NLS для повышения эффективности трансляции гена cas5.

[00536] Для присоединения полинуклеотидных последовательностей, кодирующих N-концевые гибриды NLS-FokI-линкер к белку Cas8, соответствующие кодирующие последовательности были встроены у 5'-конца гена cas8.

[00537] Опероны cse2-cas7-cas5-cas6 и cas8-cse2-cas7-cas5-cas6 были клонированы в остов вектора pCDF (Millipore Sigma, Hayward, CA), который сообщает резистентность к спектиномицину из-за присутствия гена aadA. Транскрипция оперона регулируется промотором Т7 и находится под контролем оператора Lac; вектор также кодирует репрессор LacI. Терминатор T7 был клонирован ниже оперона cse2-cas7-cas5-cas6 или cas8-cse2-cas7-cas5-cas6. Вектор содержит ориджин репликации CDF.

[00538] Для экспрессии гибридных белков Cas8 или FokI-Cas8, ген cas8 клонировали в остов вектора семейства pET (MilliporeSigma, Hayward, CA), который сообщает резистентность к канамицину из-за присутствия гена kanR. Транскрипция оперона регулируется промотором Т7 (PT7) и находится под контролем оператора Lac (lacO); вектор также кодирует репрессор LacI (ген lacI). Терминатор Т7 был клонирован ниже гена cas8. Вектор содержит ориджин репликации ColE1.

[00539] На Фиг. 23A, фиг. 23B, фиг. 23C, фиг. 23D и фиг. 23E представлены схематические диаграммы сверхэкспрессионных векторов для оперона cas8, fokI-cas8, оперона cse2-cas7-cas5-cas6, оперона cas8-cse2-cas7-cas5-cas6 и оперона fokI-cas8-cse2-cas7-cas5-cas6. Обозначения на фиг. 23A, фиг. 23B, фиг. 23C, фиг. 23D и фиг. 23E описаны в этом Примере (а также в Примере 1) и представляют собой: PT7 (промотор T7), lacO (оператор Lac), His6 (гексагистидин), MBP (белок, связывающийся с мальтозой), Strep-tag® II (IBA GMBH LLC, Göttingen, Germany), последовательность распознавания протеазой HRV3C (человеческого риновируса 3C), последовательность распознавания протеазой TEV (вируса гравировки табака), NLS (сигнал ядерной локализации), kanR (ген резистентности к канамицину), lacI (репрессорный ген LacI), colE1 ori (ориджин репликации), CDF ori (ориджин репликации CloDF13), домен нуклеазы FokI (вариант Шарки) и aadA (ген, кодирующий белок резистентности к аминогликозиду).

[00540] В Таблице 19 представлены последовательности бактериальных экспрессионных плазмид, кодирующих белок Cas8, четыре белка комплекса CasBCDE (оперон cse2-cas7-cas5-cas6) и все пять белков комплекса Cascade (оперон cas8-cse2-cas7-cas5-cas6). Полинуклеотидные последовательности представлены с N-концевым гибридом FokI на белке Cas8 и без него.

[00541]

Таблица 19
Последовательности бактериальной плазмиды
SEQ ID NO: Название вектора Расположение белок-кодирующих последовательностей (от N до C) Основные свойства
SEQ ID NO:438 Экспрессионный вектор Cas8 His6-MBP-TEV-Cas8 Могут быть сообщены комплексу CasBCDE для восстановления Cascade
SEQ ID NO:439 Экспрессионный вектор FokI-Cas8 His6-MBP-TEV-NLS-Fok1-линкер-Cas8 FokI сообщает способность к расщеплению двухцепочечной ДНК
SEQ ID NO:440 Экспрессионный вектор комплекса CasBCDE Strep-tag® II-HRV3C-Cse2_Cas7_Cas5_Cas6 При коэкспрессии с массивом CRISPR, образует комплекс CasBCDE
SEQ ID NO:441 Экспрессионный вектор комплекса Cascade Cas8_His6-HRV3C-Cse2_Cas7_Cas5_Cas6 При коэкспрессии с массивом CRISPR, образует комплекс Cascade
SEQ ID NO:442 Экспрессионный вектор FokI-Cascade NLS-FokI-линкер-Cas8_His6-HRV3C-Cse2_Cas7_Cas5_Cas6 FokI сообщает способность к расщеплению двухцепочечной ДНК, которая является мишенью для cr-РНК
SEQ ID NO:443 Экспрессионный вектор FokI-Cascade, после метки NLS NLS-FokI-линкер-Cas8_His6-HRV3C-Cse2_Cas7-NLS_Cas5_Cas6 FokI сообщает способность к расщеплению двухцепочечной ДНК, которая является мишенью для cr-РНК; дополнительныая метка NLS на белке Cas7 улучшает транспорт в ядро

[00542] Для очистки комплекса CasBCDE и комплекса Cascade, содержащих cr-РНК, векторы, экспрессирующие белок и кодирующие оперон cse2-cas7-cas5-cas6 или оперон cas8-cse2-cas7-cas5-cas6, объединяли с вектором, содержащим минимальный массив CRISPR.

[00543] Массивы CRISPR клонировали в остов вектора pACYC-Duet1, который сообщает резистентность к хлорамфениколу за счет гена camR. Транскрипция массива регулируется промотором Т7 и находится под контролем оператора Lac (lacO); вектор также кодирует репрессор LacI. Терминатор Т7 был клонирован ниже массива CRISPR. Вектор содержит ориджин репликации p15A.

[00544] На Фиг. 24 представлена схематическая диаграмма экспрессионного вектора, содержащего массив CRISPR с 2 повторами (фиг. 24, «повторы») и 1 спейсером (фиг. 24, «спейсер»). Этот массив может быть расширен, как описано в настоящей заявке. Обозначения на фиг. 24 описаны в этом Примере (а также в Примере 1) и представляют собой: PT7 (промотор T7), lacO (оператор Lac), lacI (ген репрессора LacI), p15A ori (ориджин репликации) и camR (ген резистентности к хлорамфениколу).

[00545] В Таблице 20 представлены последовательности бактериальных экспрессионных плазмид, кодирующих репрезентативные минимальные массивы CRISPR.

[00546]

Таблица 20
Последовательности бактериальной плазмиды
SEQ ID NO: Название вектора ДНК, являющаяся мишенью для спейсера Основные свойства
SEQ ID NO:444 Экспрессионный вектор CRISPR(J3) Мишень бактериофага λ J3 Два повтора, один спейсер
SEQ ID NO:445 Экспрессионный вектор CRISPR(L3) Мишень бактериофага λ L3 Два повтора, один спейсер
SEQ ID NO:446 Экспрессионный вектор CRISPR(J3/L3) Мишени бактериофага λ L3/J3 Три повтора, два спейсера
SEQ ID NO:447 Экспрессионный вектор CRISPR(TRAC) Ген TRAC Три повтора, два спейсера

[00547]

Пример 3

Конструирование эукариотических экспрессионных векторов для продуцирования эффекторных комплексов Cascade в клетках млекопитающих

[00548] В этом примере описано конструирование эукариотических экспрессионных плазмидных векторов, которые кодируют Cascade-ассоциированные белки, а также минимальные массивы CRISPR, содержащие последовательности компонентов, описанных в Примере 1.

[00549] A. Отдельные плазмиды, экспрессирующие каждый белок Cascade и минимальный массив CRISPR.

[00550] Белки Cascade могут быть экспрессированы в клетках млекопитающих путем кодирования каждого из белковых компонентов в отдельном экспрессионном векторе под контролем предраннего промотора/энхансера человеческого цитомегаловируса (CMV) и кодирования cr-РНК в отдельном экспрессионном векторе под контролем человеческого промотора U6.

[00551] Исходная плазмида для каждой экспрессионной плазмиды представляет собой производное pcDNA3.1 (Thermo Scientific, Wilmington, DE). Кодирующие последовательности для белков Cascade, оптимизированные по кодонам для экспрессии в клетках человека (см. Пример 1), были встроены в вектор ниже промотора CMV и выше сигнала полиаденилирования бычьего гормона роста (bGH). Ген cse2 был присоединен к полинуклеотидным последовательностями у 5'-конца, кодирующим N-концевую метку эпитопа NLS и 3x-FLAG. Ген cas5 был присоединен к полинуклеотидным последовательностям у 5'-конца, кодирующим N-концевой NLS. Ген cas6 был присоединен к полинуклеотидным последовательностям у 5'-конца, кодирующим N-концевую эпитопную метку NLS и HA. Ген cas7 был присоединен к полинуклеотидным последовательностям у 5'-конца, кодирующим N-концевую эпитопную метку NLS и Myc. Ген cas8 был присоединен к полинуклеотидным последовательностям у 5'-конца, кодирующим N-концевой NLS; а В другом варианте осуществления изобретения, ген cas8 был присоединен к полинуклеотидным последовательностям у 5'-конца, кодирующим N-концевой NLS, эпитопную метку НА и домен нуклеазы FokI.

[00552] Каждый ген или гибрид генов клонировали в остов производного вектора pcDNA3.1, которая сообщает резистентность к к ампициллину из-за присутствия гена ampR. Вектор также кодирует ген резистентности к неомицину из-за присутствия гена neoR, который расположен ниже раннего промотора SV40 (PSV40) и ориджина (SV40 ori) и выше раннего сигнала полиаденилирования SV40 (SV40 pA). Этот вектор, помимо предраннего промотора/энхансера человеческого CMV (PCMV) и сигнала полиаденилирования bGH (бычьего гормона роста), содержит промотор Т7, расположенный выше представляющего интерес гена, что позволяет осуществлять транскрипцию мРНК in vitro. Вектор содержит ориджин репликации f1, а также ориджин репликации ColE1.

[00553] На Фиг. 25 представлена схематическая диаграмма экспрессионного вектора млекопитающих, кодирующего гибридный белок FokI-Cas8. Обозначения на фиг. 25 описаны в этом Примере (а также в Примере 1) и представляют собой: предранний промотор/энхансер человеческого CMV (PCMV), NLS (сигнал ядерной локализации), FokI (домен нуклеазы FokI (вариант Шарки)), последовательность, кодирующую белок Cas8, bGH pA (сигнал полиаденилирования бычьего гормона роста), f1 ori (ориджин репликации фага f1), PSV40 (ранний промотор SV40), SV40 ori (ориджин SV40), neoR (ген резистентности к неомицину), SV40 pA (ранний сигнал полиаденилирования SV40), colE1 ori (ориджин репликации) и ampR (ген резистентности к ампициллину). Аналогичным образом были сконструированы векторы, кодирующие другие белки Cascade.

[00554] В таблице 21 представлены последовательности отдельных экспрессионных векторов млекопитающих, кодирующих каждый из Cse2, Cas5, Cas6, Cas7, Cas8 и FokI-Cas8.

[00555]

Таблица 21
Экспрессионные векторы млекопитающих
SEQ ID NO: Название вектора Основные свойства
SEQ ID NO:448 Экспрессионный вектор Cse2 млекопитающих Cse2 содержит N-концевую метку NLS-3xFLAG
SEQ ID NO:449 Экспрессионный вектор Cas5 млекопитающих Cas5 содержит N-концевой NLS
SEQ ID NO:450 Экспрессионный вектор Cas6 млекопитающих Cas6 содержит N-концевую метку NLS-Ha
SEQ ID NO:451 Экспрессионный вектор Cas7 млекопитающих Cas7 содержит N-концевую метку NLS-Myc
SEQ ID NO:452 Экспрессионный вектор Cas8 млекопитающих Cas8 содержит N-концевой NLS
SEQ ID NO:453 Экспрессионный вектор FokI-Cas8 млекопитающих Cas8 содержит N-концевой NLS-HA-FokI; FokI сообщает способность к расщеплению двухцепочечной ДНК

[00556] РНК CRISPR кодируется минимальным массивом CRISPR, содержащим три повтора, фланкирующих две спейсерные последовательности. Конструкция, генерирующая РНК CRISPR, может быть сконструирована с дополнительными последовательностями, фланкирующими самые дальние повторы в минимальном массиве. Процессинг предшественника РНК CRISPR обеспечивается белком процессинга РНК комплекса Cascade (белком Cas6), который может быть экспрессирован на отдельной плазмиде.

[00557] Массив CRISPR был клонирован в тот же самый описанный выше остов производного вектора pcDNA3.1, за исключением того, что промотор человеческого CMV был заменен человеческим промотором U6 (PU6), а сигнал полиаденилирования bGH был заменен сигналом терминации поли-T. Пример такого массива CRISPR показан на фиг. 35. На этой фигуре, промотор hU6 (фиг. 35, показан пунктирной областью) находится рядом с первой повторяющейся последовательностью (чистый квадрат), которая находится рядом с первой последовательностью спейсера (фиг. 35, спейсер 1, скошенные линии), которая находится рядом со второй повторяющейся последовательностью (фиг. 35, серый квадрат), которая находится рядом со второй спейсерной последовательностью (фиг. 35, спейсер 2), которая находится рядом с третьей повторяющейся последовательностью (фиг. 35, черный квадрат). На фиг. 35 показана область, содержащая спаренные руководящие рРНК (фиг. 35, спаренные рРНК).

[00558] На Фиг. 26 представлена схематическая диаграмма эукариотического экспрессионного вектора, кодирующего репрезентативный массив CRISPR, нацеленный на ген TRAC. Обозначения на фиг. 26 описаны в этом Примере (а также в Примере 1) и представляют собой: PU6 (человеческий промотор U6), повторы (повторы РНК CRISPR), спейсер-1 TRAC (первый спейсер, нацеленный на ген TRAC), спейсер-2 TRAC (второй спейсер, нацеленный на ген TRAC), polyT (сигнал терминации поли-T), f1 ori (ориджин репликации фага f1), PSV40 (ранний промотор SV40), SV40 ori (ориджин репликации SV40), neoR (ген резистентности к неомицину), SV40 pA (ранний сигнал полиаденилирования SV40), colE1 ori (ориджин репликации) и ampR (ген резистентности к ампициллину).

[00559] В таблице 22 представлена последовательность репрезентативного экспрессионного вектора млекопитающих, кодирующего массив CRISPR, нацеленный на ген TRAC; последовательность спейсера, которая нацелена на совпадающие последовательности ДНК в гене TRAC, можно найти в Таблице 18.

[00560]

Таблица 22
Экспрессионный вектор млекопитающих
SEQ ID NO: Название вектора Спейсер, комплементарный мишени Основные свойства
SEQ ID NO:454 Экспрессионный вектор РНК CRISPR млекопитающих Ген TRAC Три повтора, два спейсера

[00561] B. Экспрессионная система белка Cascade, в которой несколько последовательностей, кодирующих белок Cascade, экспрессируются с одного промотора

[00562] Для экспрессии компонентов комплекса Cascade из меньшего количества экспрессионных векторов были сконструированы полицистронные экспрессионные векторы. На каждом из них, один промотор CMV одновременно регулирует экспрессию множества кодирующих последовательностей, которые разделены последовательностью вирусного пептида 2А. Пептидная последовательность вируса Thosea asigna 2A индуцирует вырезание рибосомы (см., например, Liu, Z., et al., Sci. Rep. 7: 2193 (2017)), что позволяет объединить несколько белок-кодирующих генов в одной полицистронной конструкции.

[00563] Исходная плазмида для полицистронной экспрессионной плазмиды представляла собой то же самое производное pcDNA3.1, описанное выше и содержащее промотор CMV и сигнал полиаденилирования bGH. Кодирующие последовательности для белков Cascade, оптимизированные по кодонам для экспрессии в человеческих клетках (см. Пример 1), были объединены в следующем порядке: cas7-cse2-cas5-cas6-cas8 с полинуклеотидной последовательностью, кодирующей пептид вируса Thosea asigna 2A (T2A), встроенный между каждой парой генов. Кроме того, полинуклеотидные последовательности, кодирующие метки NLS, были присоединены к 5'-концу каждого гена белка Cascade, а полинуклеотидная последовательность, кодирующая домен нуклеазы FokI, была присоединена к 5'-концу гена cas8 посредством линкерной последовательности из 30 аминокислот. Конечная конструкция имеет следующий порядок элементов: NLS-cas7-T2A-NLS-cse2-T2A-NLS-cas5-T2A-NLS-cas6-T2A-NLS-fokI-линкер-cas8.

[00564] На Фиг. 27 представлена схематическая диаграмма репрезентативного полицистронного экспрессионного вектора млекопитающих, кодирующего все белки Cascade. Обозначения на фиг. 27 описаны в этом Примере (а также в Примере 1) и представляют собой: предранний промотор/энхансер человеческого CMV (PCMV), NLS (сигнал ядерной локализации), T2A (полинуклеотидная последовательность, кодирующая пептид вируса Thosea asigna 2A), последовательности, кодирующие белки Cas7, Cse2, Cas5 и Cas6, fokI (нуклеазный домен FokI (вариант Шарки)), линкерную последовательность, кодирующую последовательность для белка Cas8, bGH pA (сигнал полиаденилирования бычьего гормона роста), f1 ori (ориджин репликации фага f1), PSV40 (ранний промотор SV40), SV40 ori (ориджин SV40), neoR (ген резистентности к неомицину), SV40 pA (ранний сигнал полиаденилирования SV40), colE1 ori (ориджин репликации), ampR (ген резистентности к ампициллину) и рестрикционный сайт MluI.

[00565] В Таблице 23 представлена последовательность репрезентативного полицистронного экспрессионного вектора млекопитающих, кодирующего все белки Cascade. Этот вектор может быть объединен с экспрессионным вектором млекопитающих, кодирующим РНК CRISPR, описанную выше, для получения функциональных комплексов Cascade в клетках млекопитающих.

[00566]

Таблица 23
Экспрессионные векторы млекопитающих
SEQ ID NO: Название вектора Расположение белок-кодирующих последовательностей (от N до C) Основные свойства
SEQ ID NO:455 Полицистронный экспрессионный вектор млекопитающих, кодирующий все пять белков Cascade NLS-Cas7-T2A_NLS-Cse2-T2A_NLS-Cas5-T2A_NLS-Cas6-T2A_NLS-FokI-Cas8 Один экспрессионный вектор для белка, кодирующий все белки Cascade, каждый с N-концевой меткой NLS. Cas8 содержит N-концевую NLS-HA-FokI; FokI сообщает способность к расщеплению двухцепочечной ДНК

[00567] C. Одноплазмидная экспрессионная система

[00568] Одноплазмидная экспрессионная система Cascade была сконструирована для экспрессии полного комплекса Cascade в клетках человека. Плазмида кодирует весь оперон cas8-cse2-cas7-cas5-cas6 и минимальный массив CRISPR на одной плазмиде. Эта плазмида была сконструирована из полицистронного вектора, экспрессирующего белок (описанного в Таблице 23 и на фиг. 27) путем встраивания минимального массива CRISPR вместе с вышерасположенным человеческим промотором U6 и нижерасположенным сигналом терминации поли-Т в рестрикционный сайт MluI.

[00569] В Таблице 24 представлена последовательность одной плазмиды для экспрессии всех пяти белков Cascade вместе с cr-РНК для облегчения образования комплексов Cascade в клетках человека.

[00570]

Таблица 24
Экспрессионный вектор млекопитающих
SEQ ID NO: Название вектора Расположение белок-кодирующих последовательностей (от N до C) Основные свойства
SEQ ID NO:456 Полицистронный экспрессионный вектор млекопитающих, кодирующий все пять белков Cascade и cr-РНК hU6_CRISPR(TRAC), CMV_NLS-Cas7-T2A_NLS-Cse2-T2A_NLS-Cas5-T2A_NLS-Cas6_NLS-FokI-Cas8 Один экспрессионный вектор для белка, кодирующий cr-РНК и все белки Cascade, каждый с N-концевой меткой NLS. Cas8 содержит N-концевую NLS-HA-FokI; FokI сообщает способность к расщеплению двухцепочечной ДНК

[00571] Плазмиды были также сконструированы для экспрессии белка Cas3 (SEQ ID NO: 21; мономерная нуклеаза Cas3/геликаза K-12 E.coli, субстрат MG1655) в E. coli и в клетках млекопитающих. В Таблице 25 представлены конструкции и последовательности этих плазмид.

[00572]

Таблица 25
Гибридные белки Cas3
SEQ ID NO: Белок Основные свойства
SEQ ID NO:457 Cas3 Генная последовательность гДНК
SEQ ID NO:458 Cas3 Аминокислотная последовательность белка
SEQ ID NO:459 His6-MBP-TEV-Cas3 Последовательность, происходящая от генной последовательности гДНК
SEQ ID NO:460 His6-MBP-TEV-Cas3 Аминокислотная последовательность белка
SEQ ID NO:461 His6-MBP-TEV-Cas3 Экспрессионный вектор Cas3 E. coli
SEQ ID NO:462 Cas3, оптимизированный по кодонам человека Генная последовательность ДНК, оптимизированная по кодонам H. sapiens
SEQ ID NO:463 Cas3-NLS Генная последовательность ДНК, оптимизированная по кодонам H. sapiens
SEQ ID NO:464 Cas3-NLS Аминокислотная последовательность белка
SEQ ID NO:465 Cas3-NLS Экспрессионный вектор Cas3 млекопитающих

[00573]

Пример 4

Введение полинуклеотидов, кодирующих компоненты Cascade, в бактериальный штамм-продуцент

[00574] В этом примере описаны введение и экспрессия последовательностей, кодирующих белок субъединицы Cas8, а также последовательностей, кодирующих компоненты сконструированных эффекторных комплексов CRISPR-Cas типа I в бактериальных клетках с использованием экспрессионных систем E.coli.

[00575] A. Экспрессия белка Cas8

[00576] Белок Cas8 типа I-E экспрессировали из плазмиды (Пример 2, SEQ ID NO: 438, Таблица 19, фиг. 23A), содержащий оперон для IPTG-индуцируемой экспрессии His6-MBP-TEV-Cas8 с промотора Т7. Экспрессионная плазмида сообщает резистентность к канамицину.

[00577] Для экспрессии белка Cas8, клетки E. coli трансформировали экспрессионной плазмидой. Вкратце, аликвоту 100 мкл химически компетентных клеток E. coli (клеток E. coli BL21 Star™ (Thermo Fisher Scientific, Waltham, MA)) в микроцентрифужной пробирке оттаивали на льду в течение 10 минут. К оттаявшим клеткам добавляли 35 нг плазмидной ДНК, и клетки инкубировали с ДНК на льду в течение 8 минут. Тепловой шок осуществляли путем помещения микроцентрифужной пробирки на водяную баню при температурей 42°С на 30 секунд, с последующим немедленным помещением пробирки на лед на 2 минуты. 900 мкл среды 2xYT добавляли в микроцентрифужную пробирку, и микроцентрифужную пробирку помещали во вращающееся устройство для пробирок при 37°C на 1 час. И наконец, 100 мкл восстановленных клеток помещали на твердую среду LB с канамицином (50 мкг/мл) и инкубировали в течение ночи при 37°C.

[00578] Отдельную колонию отбирали из колоний, которые росли на планшетах для отбора на резистентность к антибиотикам, и инокулировали в 10 мл среды 2xYT с добавлением канамицина (50 мкг/мл). Культуру выращивали в течение ночи при 37°C при встряхивании в орбитальном шейкере при 200 об/мин. 6 мл ночной культуры переносили в 2-литровую колбу с перегородками, содержащую 1 л 2xYT-среды с добавлением канамицина (50 мкг/мл). 1 л культуры выращивали при 37°C при встряхивании в орбитальном шейкере при 200 об/мин до тех пор, пока оптическая плотность на 600 нм не достигала 0,56.

[00579] Затем экспрессию индуцировали добавлением IPTG до конечной концентрации 1 мМ. Индуцированные культуры выращивали в течение ночи при 16°C при встряхивании в орбитальном шейкере при 200 об/мин. Клетки собирали центрифугированием при 4000 оборотов центрифуги (RCF) в течение 15 минут при 4°C. Клеточный осадок ресуспендировали в 15 мл буфера для лизиса, состоящего из 50 мМ Трис pH 7,5, 100 мМ NaCl, 5% глицерина и 1 мМ TCEP с добавлением 1 таблетки ингибитора протеазы Complete™ (Roche, Basel, Switzerland) на 50 мл буфера для лизиса. Ресуспендированные клетки переносили в коническую 50 мл-пробирку для немедленной последующей обработки. Белок Cas8 очищали, и очищенный белок охарактеризовывали, по существу, как описано ниже для гибридного белка FokI-Cas8 (Пример 5C).

[00580] B. Экспрессия компонентов комплексов Cascade RNP

[00581] Полный набор из пяти белков Cascade E. coli и руководящих РНК коэкспрессировали в клетках E. coli с использованием двухплазмидной системы для получения комплексов Cascade RNP. Одна плазмида (Пример 2, SEQ ID NO: 441, Таблица 19, фиг. 23D) содержала оперон для IPTG-индуцируемой экспрессии белков Cse2, Cas5, Cas6, Cas7 и Cas8 из промотора Т7. Аффинная метка His6 была включена в качестве трансляционного гибрида с N-концом Cse2 (Пример 1, SEQ ID NO: 392, Таблица 16). Вторая плазмида кодировала IPTG-индуцируемую экспрессию руководящей J3 (Пример 2, SEQ ID NO: 444, Таблица 20, фиг. 24). Плазмида для экспрессии белка Cascade сообщала резистентность к спектиномицину, а плазмида для экспрессии руководящей РНК Cascade сообщала резистентность к хлорамфениколу.

[00582] Для совместной экспрессии белков Cascade и компонентов РНК в одной и той же клетке, клетки E. coli одновременно трансформировали двумя плазмидами. Аликвоту 100 мкл химически компетентных клеток E. coli (E.coli, BL21 Star™ (DE3) (Thermo Fisher Scientific, Waltham, МA)) в микроцентрифужной пробирке оттаивали на льду в течение 10 минут. К оттаявшим клеткам добавляли 35 нг каждой плазмиды, и клетки инкубировали с ДНК на льду в течение 8 минут. Тепловой шок осуществляли путем помещения микроцентрифужной пробирки на водяную баню при температуре 42°С на 30 секунд, с последующим немедленным помещением этой пробирки на лед на 2 минуты. 900 мкл среды 2xYT добавляли в микроцентрифужную пробирку, и эту микроцентрифужную пробирку помещали во вращающееся устройство для пробирок при 37°C на 1 час. И наконец, 100 мкл восстановленных клеток помещали на твердую среду LB с хлорамфениколом (34 мкг/мл) и спектиномицином (50 мкг/мл) и инкубировали в течение ночи при 37°C.

[00583] Отдельную колонию отбирали из колоний, которые росли на планшетах для отбора на резистентность к антибиотику, и инокулировали в 10 мл среды 2xYT с добавлением хлорамфеникола (34 мкг/мл) и спектиномицина (100 мкг/мл). Культуру выращивали в течение ночи при 37°C при встряхивании в орбитальном шейкере при 200 об/мин. 6 мл ночной культуры переносили в 2-литровую колбу с перегородками, содержащую 1 л среды 2xYT с добавлением хлорамфеникола (34 мкг/мл) и спектиномицина (100 мкг/мл). 1 л культуры выращивали при 37°C при встряхивании в орбитальном шейкере при 200 об/мин до тех пор, пока оптическая плотность на 600 нм не достигала 0,56.

[00584] Экспрессию обеих плазмид индуцировали добавлением IPTG до конечной концентрации 1 мМ. Индуцированные культуры выращивали в течение ночи при 16°C при встряхивании в орбитальном шейкере при 200 об/мин. Клетки собирали центрифугированием при 4000 RCF в течение 15 минут при 4°C. Клеточный осадок ресуспендировали в 15 мл буфера для лизиса, состоящего из 50 мМ Трис pH 7,5, 100 мМ NaCl, 5% глицерина и 1 мМ TCEP с добавлением 1 таблетки ингибитора протеазы Complete™ (Roche, Basel, Switzerland) на 50 мл буфера для лизиса. Ресуспендированные клетки переносили в коническую 50 мл-пробирку для немедленной последующей обработки. Комплексы Cascade RNP были очищены и охарактеризованы, как описано ниже.

[00585]

Пример 5

Очистка компонентов Cascade и комплексов Cascade RNP

[00586] В этом примере описан способ очистки комплексов Cascade RNP E. coli типа I-E, продуцируемых сверхэкспрессией в бактериях, как описано в Примере 4B. В этом способе использовали аффинную хроматографию на иммобилизованным металле с последующей эксклюзионной хроматографией (ЭХ). В этом примере также описаны способы оценки качества очищенного продукта Cascade RNP. Кроме того, в этом примере описаны очистка и характеризация компонентов Cascade.

[00587] A. Очистка комплексов Cascade RNP Cas8, Cas7, Cas6, Cas5 и Cse2

[00588] Комплексы Cascade RNP типа I-E E. coli получали как описано в Примере 4B. Комплексы Cascade были захвачены с помощью аффинной хроматографии на иммобилизованным металле. Вкратце, ресуспендированные клеточные осадки, полученные как описано в Примере 4B, оттаивали на льду, и объем доводили до 35 мл путем добавления еще 15 мл буфера для лизиса, состоящего из 50 мМ Триса pH 7,5, 100 мМ NaCl, 5% глицерина и 1 мМ TCEP с добавлением 1 таблетки ингибитора протеазы Complete™ (Roche, Basel, Switzerland) на 50 мл буфера для лизиса.

[00589] Коническую 50 мл-пробирку помещали на баню с ледяной водой, и клетки лизировали путем проведения двух раундов обработки ультразвуком с использованием ультразвукового устройства Q500 с наконечником в 1/2 дюйма (Qsonica, Newtown, CT). Каждый раунд обработки ультразвуком состоял из цикла обработки продолжительностью 2,5 минуты с повторяющимися циклами обработки ультразвуком в течение 10 секунд с амплитудой 50% с последующими 20 секундами перерыва. Пробирку оставляли для охлаждения на бане с ледяной водой в течение одной минуты между циклами обработки ультразвуком. Лизаты осветляли центрифугированием при 48384 RCF в течение 30 минут при 4°C. Затем осветленный супернатант добавляли к смоле Hispur™ Ni-NTA (Thermo Fisher Scientific, Waltham, MA), предварительно уравновешенной промывочным Ni-буфером, состоящим из 50 мМ Триса pH 7,5, 100 мМ NaCl, 10 мМ имидазола, 5% глицерина и 1 мМ TCEP. Объем слоя смолы с аффинностью к никелю 1,5 мл использовали на каждый 1 л культуры для экспрессии в E. coli. После инкубирования в течение одного часа при 4°C при осторожном перемешивании, смолу осаждали центрифугированием при 500 RCF в течение 2 минут при 4°C. Супернатант отсасывали, и смолу 5 раз промывали 5 объемами слоя промывочного Ni-буфера. После каждой промывки, смолу осаждали при 500 RCF в течение 2 минут при 4°C, и супернатант удаляли путем аспирации. И наконец, связанные белки (включая комплексы Cascade RNP) элюировали добавлением пяти объемов слоя элюирующего Ni-буфера, состоящего из 50 мМ Трис pH 7,5, 100 мМ NaCl, 300 мМ имидазола, 5% глицерина и 1 мМ Трис (2-карбоксиэтил)фосфина (TCEP). После центрифугирования при 500 RCF в течение 2 минут при 4°C, аффинный элюат на никеле подвергали аспирации в чистую коническую 50 мл-пробирку.

[00590] Аффинный элюат на никеле дополнительно очищали с помощью эксклюзионной хроматографии (ЭХ). Аффинный элюат на никеле концентрировали до конечного объема 0,5 мл путем ультрафильтрации при 12°C с использованием центрифужного концентратора для ультрафильтрации Amicon® (MilliporeSigma, Billerica, MA) с мембраной Ultracel®-50 (MilliporeSigma, Hayward, CA). Концентрированный образец фильтровали с использованием центрифужного 0,22 мкМ-фильтра Ultrafree-MC GV (MilliporeSigma, Hayward, CA) с последующей дополнительной очисткой путем разделения при 4°C со скоростью потока 0,5 мл/минуту на колонке HiPrep™16/60 Sephacryl® S-300 (GE Healthcare, Uppsala, Sweden), уравновешенной буфером для ЭХ, состоящим из 50 мМ Триса pH 7,5, 500 мМ NaCl, 5% глицерина, 0,1 мМ EDTA и 1 мМ TCEP. Белки элюировали буфером для ЭХ и собирали 1 мл-фракции. Самый ранний пик элюирования, на что указывала УФ-280, показал, как и предполагалось, наличие высокомолекулярного агрегированного продукта, и соответствующие фракции отбрасывали. Последующие фракции элюирования анализировали с помощью электрофореза в ДСН-ПААГ с окрашиванием кумасси. Каждый правильно сформированный комплекс содержал одну молекулу Cas8, шесть молекул Cas7, по одной молекуле Cas6 и Cas5 и две молекулы Cse2. Фракции элюирования, которые имели приблизительно ожидаемую стехиометрию белков Cascade, при визуализации на ДСН-ПААГ, объединяли. Объединенные фракции анализировали спектрофотометрически для того, чтобы подтвердить, что они содержат значительное количество компонента нуклеиновой кислоты, о чем свидетельствует поглощение на 260 нм, которое превышает поглощение на 280 нм.

[00591] Объединенные образцы переносили в буфер для хранения, состоящий из 50 мМ Триса pH 7,5, 100 мМ NaCl, 5% глицерина, 0,1 мМ EDTA и 1 мМ TCEP, путем концентрирования объединенных образцов до 100 мкл с помощью центрифужного концентратора Amicon® (MilliporeSigma, Hayward, CA) с мембраной Ultracel®-50 (MilliporeSigma, Hayward, CA), а затем 50-кратно разводили буфером для хранения. И наконец, образец концентрировали до 10 мг/мл с использованием того же устройства для ультрафильтрации и хранили при -80°C.

[00592] Конечный очищенный продукт анализировали спектрофотометрически для определения конечной концентрации комплексов Cascade RNP и подтверждения присутствия компонента нуклеиновой кислоты, о чем свидетельствовало поглощение на 260 нм, которое превышало поглощение на 280 нм. Концентрацию комплексов Cascade RNP определяли путем деления оптической плотности на 280 нм на рассчитанную оптическую плотность 0,1% раствора интактного комплекса при длине пути 1 см. Прогнозируемая оптическая плотность 0,1% раствора очищенного комплекса составляла 2,03 см-1 и была рассчитана путем деления суммы рассчитанных коэффициентов экстинкции на 280 нм для каждой из молекул в комплексе (916940 М-1см-1) на сумму молекулярных масс каждой из молекул в комплексе (450832 г/моль).

[00593] Кроме того, конечный продукт анализировали с помощью электрофореза в ДСН-ПААГ с окрашиванием кумасси синим, для того, чтобы подтвердить, что каждый белковый компонент присутствовал приблизительно в правильной стехиометрии, и оценить присутствие загрязняющих белков. Гели для электрофореза в ДСН-ПААГ окрашивали красителем кумасси InstantBlue™ (Expedeon, San Diego, CA). Гели визуализировали с помощью визуализатора Gel doc™ EZ (Bio-Rad, Hercules, CA) и идентифицировали с помощью компьютерной программы ImageLab (Bio-Rad, Hercules, CA).

[00594] B. Очистка комплексов Cascade, содержащих белки Cas7, Cas6, Cas5 и Cse2.

[00595] Комплекс Cascade, состоящий из белковых компонентов Cas7, Cas6, Cas5 и Cse2, очищали. Руководящая РНК L3 (Пример 2, SEQ ID NO: 445, Таблица 20) была экспрессирована из первой плазмиды (Пример 2, фиг. 24), по существу, как описано в Примере 4B. Белки Cascade экспрессировали из второй плазмиды (Пример 2, SEQ ID NO: 440, Таблица 19, фиг. 23C), по существу, как описано в Примере 4B.

[00596] Комплекс захватывали с помощью аффинной хроматографии. Осадки ресуспендированных клеток оттаивали на льду. В конической 50 мл-пробирке, объем доводили до 35 мл путем добавления еще 15 мл буфера для лизиса, состоящего из 50 мМ Триса pH 7,5, 100 мМ NaCl, 5% глицерина, 1 мМ TCEP и с добавлением 1 таблетки ингибитора протеазы Complete™ (Roche, Basel, Switzerland) на 50 мл буфера для лизиса. Коническую 50 мл-пробирку помещали на баню с ледяной водой, и клетки лизировали путем проведения шести раундов обработки ультразвуком с использованием ультразвукового устройства Q500 с наконечником 1/2 дюйма (Qsonica, Newtown, CT). Каждый раунд обработки ультразвуком состоял из 1-минутного цикла обработки с повторяющимися циклами по 3 секунды обработки ультразвуком с амплитудой 90% с последующими перерывами в 9 секунд. Пробирку оставляли для охлаждения на бане с ледяной водой на одну минуту между раундами обработки ультразвуком. Лизат осветляли центрифугированием при 48384 RCF в течение 30 минут при 4°C. Осветленный супернатант подвергали аффинной очистке путем добавления смолы Strep-Tactin® Sepharose® (IBA GMBH LLC, Gottingen, Germany), которая была предварительно уравновешена промывочным буфером со Strep, состоящим из 50 мМ Триса pH 7,5, 100 мМ NaCl, 1 мМ. EDTA, 5% глицерина и 1 мМ TCEP. Объем слоя аффинной смолы 0,55 мл использовали на каждый 1 л культуры для экспрессии в E. coli. После инкубирования в течение одного часа при 4°C при осторожном перемешивании, образец выливали в одноразовую 30 мл-колонку с гравитационным потоком (Bio-Rad, Hercules, CA), что позволяло несвязанному продукту проходить через колонку. Смолу промывали пять раз пятью объемами слоя промывочного буфера со Strep. И наконец, связанные белки элюировали двумя последовательными добавлениями пяти объемов слоя элюирующего буфера со Strep, состоящего из 50 мМ Триса pH 7,5, 100 мМ NaCl, 2,5 мМ дезтиобиотина, 5% глицерина, 1 мМ EDTA и 1 мМ TCEP.

[00597] Аффинный элюат дополнительно очищали с помощью ЭХ. Аффинный элюат концентрировали до конечного объема 550 мкл путем ультрафильтрации при 12°C с использованием центрифужного концентратора Amicon® (MilliporeSigma, Hayward, CA) с мембраной Ultracel®-50 (Millipore Sigma, Hayward, CA). Концентрированный образец фильтровали с использованием шприцевого 13 мм-фильтра из ПВДФ с размером пор 0,22 мкм UltraCruz® (Santa Cruz Biotechnology, Dallas, TX), а затем очищали путем разделения при 4°C со скоростью потока 0,4 мл/мин на колонке HiPrep™ 16/60 с Sephacryl® S-300 (GE Healthcare, Uppsala, Sweden), уравновешенной буфером для ЭХ, состоящим из 50 мМ Триса pH 7,5, 500 мМ NaCl, 5% глицерина, 0,1 мМ EDTA и 1 мМ TCEP. Белок элюировали буфером для ЭХ и собирали 0,75 мл-фракции. Самый ранний пик элюирования, на что указывала УФ-280, показал, как и предполагалось, наличие высокомолекулярного агрегированного продукта, и соответствующие фракции отбрасывали. Фракции, соответствующие второму пику (плечо на обратной стороне первого пика УФ-280), объединяли.

[00598] Объединенные образцы переносили в буфер для хранения, состоящий из 50 мМ Триса pH 7,5, 100 мМ NaCl, 5% глицерина, 0,1 мМ EDTA и 1 мМ TCEP, путем концентрирования до 200 мкл с помощью центрифужного концентратора Amicon® (MilliporeSigma, Hayward, CA) с мембраной Ultracel®-50 (MilliporeSigma, Hayward, CA), а затем 50-кратно разводили буфером для хранения. Образец концентрировали второй раз до 700 мкл и снова 20-кратно разводили буфером для хранения. И наконец, образец концентрировали до 4,7 мг/мл с использованием того же устройства для ультрафильтрации и хранили при -80°C.

[00599] Конечный очищенный продукт анализировали спектрофотометрически для определения конечной концентрации комплексов Cascade RNP и подтверждения присутствия компонента нуклеиновой кислоты, о чем свидетельствовало поглощение на 260 нм, которое превышало поглощение на 280 нм. Концентрацию комплексов Cascade RNP определяли путем деления оптической плотности на 280 нм на рассчитанную оптическую плотность 0,1% раствора интактного комплекса при длине пути 1 см. Прогнозируемая оптическая плотность 0,1% раствора очищенного комплекса составляла 2,18 см-1 и была вычислена путем деления суммы рассчитанных коэффициентов экстинкции на 280 нм для каждой из молекул в комплексе (762240 М-1см-1) на сумму молекулярных масс каждой из молекул в комплексе (348952,07 г/моль).

[00600] Кроме того, конечный продукт анализировали с помощью электрофореза в ДСН-ПААГ с окрашиванием кумасси синим, для того, чтобы подтвердить, что каждый белок Cascade присутствовал приблизительно в правильной стехиометрии, и оценить присутствие загрязняющих белков. Гели для электрофореза в ДСН-ПААГ окрашивали красителем кумасси InstantBlue™ (Expedeon, San Diego, CA). Гели визуализировали с помощью визуализатора Gel doc™ EZ (Bio-Rad, Hercules, CA) и идентифицировали с помощью компьютерной программы ImageLab (Bio-Rad, Hercules, CA). Каждый правильно образованный комплекс содержал шесть молекул Cas7, по одной молекуле Cas6 и Cas5 и две молекулы Cse2.

[00601] C. Очистка гибридного белка FokI-Cas8

[00602] В настоящей заявке описан способ, применяемый для очистки гибридного белка, включающего связывание нуклеазы FokI с белком Cas8 E.coli типа I-E, из осадка бактериальной смеси для сверхэкспрессии с помощью аффинной хроматографии на иммобилизованном металле, катионообменной хроматографии (КОХ) и, наконец, эксклюзионной хроматографии (ЭХ).

[00603] Гибридный белок FokI-Cas8 E. coli типа I-E, включающий линкерную последовательность, описан в Примере 1 (SEQ ID NO: 413, Таблица 16). Экспрессионная плазмида описана в Примере 2 (SEQ ID NO: 439, Таблица 19, фиг. 23B). Клетки, содержащие гибридный белок, получали по существу, как описано в Примере 4А. Гибридный белок Cas8 содержал N-концевую метку His6, домен белка, связывающегося с мальтозой, сайт расщепления TEV, домен нуклеазы FokI и линкер из 30 аминокислот. Белок захватывали с помощью аффинной хроматографии на иммобилизованном металле. Коническую 50 мл-пробирку, содержащую ресуспендированные клеточные осадки, оттаивали на льду. Затем пробирку помещали на баню с ледяной водой, и клетки лизировали ультразвуком с использованием ультразвукового устройства Q500 с наконечником 1/4 дюйма (Qsonica, Newtown, CT) для трехминутного цикла обработки с повторением 10-секундных циклов обработки ультразвуком с амплитудой 40%, за которыми следует перерыв в 20 секунд. Лизаты осветляли центрифугированием при 30970 RCF в течение 30 минут при 4°C. Затем осветленный супернатант добавляли к смоле Hispur ™ Ni-NTA (Thermo Fisher Scientific, Waltham, MA), которая была предварительно уравновешена промывочным Ni-буфером, состоящим из 50 мМ Триса pH 7,5, 100 мМ NaCl, 10 мМ имидазола, 5% глицерина и 1 мМ TCEP. Объем слоя смолы с аффинностью к никелю 2 мл использовали для 1 л культуры для экспрессии в E. coli. После инкубирования в течение одного часа при 4°C при осторожном перемешивании, образец выливали на одноразовую 30 мл-колонку с гравитационным потоком (Bio-Rad, Hercules, CA), что позволяло несвязанному материалу проходить через колонку. Смолу промывали пять раз пятью объемами слоя промывочного Ni-буфера. И наконец, связанные белки элюировали пятью объемами слоя элюирующего Ni-буфера, состоящего из 50 мМ Триса pH 7,5, 100 мМ NaCl, 300 мМ имидазола, 5% глицерина и 1 мМ TCEP.

[00604] Элюат с аффинностью к никелю обрабатывали протеазой TEV для удаления аффинной метки. К элюату добавляли протеазу TEV в отношении 1:25 (масс./масс.). Образец, включающий TEV, диализовали в течение ночи против промывочного Ni-буфера с использованием 12 мл кассеты для диализа Slid-A-Lyzer™, с отсечкой молекулярной массы 10K (Thermo Fisher Scientific, Waltham, MA).

[00605] Протеазу TEV и расщепленный фрагмент His6-MBP удаляли из диализованного образца с помощью аффинной хроматографии на Ni. Диализованный образец выливали в чистую колонку со смолой Hispur™ Ni-NTA (Thermo Fisher Scientific, Waltham, MA), уравновешенную промывочным Ni-буфером. Затем смолу промывали 1 колоночным объемом промывочного буфера Ni-NTA. Проточную фракцию и промывку объединяли, концентрировали и переносили в буфер для хранения (50 мМ Триса pH 7,5, 500 мМ NaCl, 5% глицерина и 1 мМ TCEP) с использованием центрифужного концентратора Amicon® (Millipore Sigma, Hayward, CA) с мембраной Ultracel®-10 (Millipore Sigma, Hayward, CA). Затем этот образец замораживали при -80°C для хранения.

[00606] Образец оттаивали и дополнительно очищали катионообменной хроматографией (КОХ). Образец оттаивали на льду и 10-кратно разводили 0,475 мл - 4,75 мл холодного буфера для CIEX_A, состоящего из 50 мМ Триса pH 7,5, 5% глицерина и 1 мМ TCEP, в результате чего конечная концентрация NaCl составляла 50 мМ. Капиллярную 10 мл-петлю использовали для загрузки образца в 1 мл-колонку Hitrap™ SP HP (GE Healthcare, Uppsala, Sweden), уравновешенную буфером, содержащим буфер для CIEX_A и 5% буфер для CIEX_B (50 мМ Триса pH 7,5, 1 M NaCl, 5% глицерина и 1 мМ TCEP). Скорость потока во время разделения составляла 0,75 мл/мин. Петлю опорожняли на колонку с 15 мл 5% буфера для CIEX_B. Несвязанный образец промывали еще 2 мл 5% буфера для CIEX_B. Фракции по 500 мкл собирали по мере того, как связанные белки элюировались линейным градиентом 8 мл 5% - 65% буфера для CIEX_B. Наблюдалось два основных пика элюирования на УФ 280. Четыре фракции, соответствующие первому из этих двух пиков, были объединены. Общий объединенный объем составлял 2 мл.

[00607] Объединенные фракции КОХ дополнительно очищали с помощью ЭХ. Объединенные фракции КОХ концентрировали до конечного объема 0,3 мл путем ультрафильтрации при 12°С с использованием центрифужного концентратора Amicon® (MilliporeSigma, Hayward, CA) с мембраной Ultracel®-10 (MilliporeSigma, Hayward, CA). Концентрированный образец фильтровали через центрифужный 0,22 мкм-фильтр Ultrafree-MC GV (MilliporeSigma, Hayward, CA) (а затем очищали путем разделения при 4°C со скоростью потока 0,6 мл/минуту на колонке 10/300 Superdex™ 200 GL Increase (GE Healthcare, Uppsala, Sweden), уравновешенной буфером для ЭХ Cas8 (50 мМ Триса pH 7,5, 200 мМ NaCl, 5% глицерина и 1 мМ TCEP). Белок элюировали буфером для ЭХ Cas8 и собирали фракции по 0,5 мл. Самый ранний пик элюирования, на что указывала УФ-280, показал, как и предполагалось, наличие высокомолекулярного агрегированного продукта, и соответствующие фракции отбрасывали. Второй главный пик на УФ 280 элюировался приблизительно после пика в 14 мл. Фракции, соответствующие второму пику, объединяли. Объединенные образцы концентрировали до 40 мкл на центрифужном концентраторе Amicon® (MilliporeSigma, Hayward, CA) с мембраной Ultracel®-3 (MilliporeSigma, Hayward, CA). Концентрированный образец хранили при -80°C.

[00608] Конечный очищенный продукт анализировали спектрофотометрически для определения конечной концентрации гибридного белка и подтверждения присутствия значительного количества компонентов нуклеиновой кислоты, о чем свидетельствовало поглощение на 280 нм, которое превышало поглощение на 260 нм. Концентрацию гибрида FokI-Cas8 определяли путем деления оптической плотности на 280 нм на вычисленную оптическую плотность 0,1% раствора интактного комплекса. Прогнозируемая оптическая плотность 0,1% раствора очищенного комплекса составляла 1,05 см-1 и была вычислена путем деления коэффициента экстинкции на 280 нм для гибрида FokI-Cas8 (86290 М-1см-1) на его молекулярную массу (82171,32 г/моль). Кроме того, конечный продукт анализировали с помощью электрофореза в ДСН-ПААГ с окрашиванием красителем InstantBlue™ (Expedeon, San Diego, CA). Гели визуализировали с помощью визуализатора Gel doc™ EZ (Bio-Rad, Hercules, CA) и идентифицировали с помощью компьютерной программы ImageLab (Bio-Rad, Hercules, CA). Этот анализ показал, что очищенный гибридный белок имел ожидаемый размер, и что присутствовал лишь низкий уровень загрязняющих белков.

[00609]

Пример 6

Получение последовательностей дцДНК-мишени для их применения в анализах на биохимическое расщепление

[00610] Последовательности-мишени дцДНК для использования в анализах на связывание ДНК или расщепление ДНК in vitro под действием эффекторных комплексов Cascade или гибридов Cascade могут быть получены некоторыми различными способами. В этом примере описаны три метода получения последовательностей-мишеней, включая отжиг синтетических олигонуклеотидов оцДНК, ПЦР-амплификацию выбранных последовательностей нуклеиновой кислоты-мишени из гДНК и/или клонирование последовательностей нуклеиновой кислоты-мишени в бактериальные плазмиды. Последовательности-мишени дцДНК использовали в анализах на связывание или расщепление Cascade.

[00611] A. Получение последовательностей дцДНК-мишеней путем отжига синтетических олигонуклеотидов оцДНК

[00612] ДНК-олигонуклеотиды, кодирующие представляющую интерес область-мишень, содержащую последовательность-мишень, которая распознается руководящей частью РНК CRISPR, соседний мотив, смежный с протоспейсером (PAM) и дополнительные 5’- и 3’-фланкирующие последовательности, были закуплены у коммерческого производителя (Integrated DNA Technologies, Coralville, IA). Было заказано по два олигонуклеотида на конструкцию, один из которых содержал смысловую цепь, а другой - антисмысловую цепь. В Таблице 26 перечислены олигонуклеотидные последовательности, которые должны содержать последовательность-мишень, обозначенную J3 и происходящую от гДНК бактериофага лямбда. Последовательности-мишени и PAM фланкированы 20 п.о. дополнительной последовательности на 5’- и на 3'-концах.

[00613]

Таблица 26
Олигонуклеотиды оцДНК
Seq ID NO: Описание Последовательность
SEQ ID NO:466 Прямой олигонуклеотид, последовательность-мишень J3 ATCATCCTCCTGACAATTTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCTTTAAAAGCCAGGACGGTC
SEQ ID NO:467 Обратный олигонуклеотид, последовательность-мишень J3 GACCGTCCTGGCTTTTAAAGATGCCAGTGATAAGTGGAATGCCATGTGGGCTGTCAAAATTGTCAGGAGGATGAT

[00614] Олигонуклеотиды подвергали отжигу путем смешивания обоих олигонуклеотидов в эквимолярной концентрации (10 мкМ) в 1× буфере для отжига (6 мМ HEPES, pH 7,0 и 60 мМ KCl), при нагревании при 95°С в течение 2 минут с последующим медленным охлаждением. Гибридизованные олигонуклеотиды затем использовали непосредственно в анализах на связывание и/или расщепление ДНК с использованием эффекторного домена Cascade и/или гибрида эффекторного домена Cascade и RNP.

[00615] ДНК-олигонуклеотиды, флуоресцентно меченные 5'-Cy5 и кодирующие представляющую интерес область-мишень, содержащую последовательность-мишень, распознаваемую руководящей частью РНК CRISPR, а также фланкирующий соседний мотив, смежный с протоспейсером (PAM), и дополнительные 5'- и 3'-фланкирующие последовательности, были закуплены у коммерческого производителя (Integrated DNA Technologies, Coralville, IA). Было заказано по четыре олигонуклеотида на конструкцию, один из которых содержал 5'-флуоресцентно меченную смысловую цепь, один содержал 5'-немеченную смысловую цепь, один содержал 5'-флуоресцентно-меченную антисмысловую цепь и один - 5'-немеченную антисмысловую цепь. Последовательности-мишени и PAM фланкированы дополнительной последовательностью в 20 п.о. у 5’- и 3’-концов.

[00616] В Таблице 27 перечислены олигонуклеотидные последовательности, которые должны содержать последовательность-мишень, обозначенную J3, которая была получена из гДНК бактериофага лямбда, и контрольную последовательность-мишень, обозначенную CCR5, которая была получена из человеческого локуса CCR5.

[00617]

Таблица 27
Олигонуклеотиды оцДНК для образования флуоресцентно меченной последовательности-мишени дцДНК
SEQ ID NO: Описание Последовательность
SEQ ID NO:468 Цепь-мишень J3 5’CGCCGAGCTCGAATTCTTTTGACAGCCCACATGGCATTCCACTTATCACTGGCATGGATCCTGGCTGTGGTGATG
SEQ ID NO:469 Цепь J3, не являющаяся мишенью 5’CATCACCACAGCCAGGATCCATGCCAGTGATAAGTGGAATGCCATGTGGGCTGTCAAAAGAATTCGAGCTCGGCG
SEQ ID NO:470 Сайт CCR5 цепи-мишени 5’CGCCGAGCTCGAATTCTTTTTAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCATGGATCCTGGCTGTGGTGATG
SEQ ID NO:471 Цепь CCR5, не являющаяся мишенью 5’CATCACCACAGCCAGGATCCATGCAAACACAGCATGGACGACAGCCAGGTACCTAAAAAGAATTCGAGCTCGGCG
SEQ ID NO:472 Цепь-мишень J3 5’Cy5-CGCCGAGCTCGAATTCTTTTGACAGCCC ACATGGCATTCCACTTATCACTGGCATG GATCCTGGCTGTGGTGATG
SEQ ID NO:473 Цепь J3, не являющаяся мишенью 5’Cy5-CATCACCACAGCCAGGATCCATGCCAGT GATAAGTGGAATGCCATGTGGGCTGTCA AAAGAATTCGAGCTCGGCG
SEQ ID NO:474 Сайт CCR5 цепи-мишени 5’Cy5-CGCCGAGCTCGAATTCTTTTTAGGTACCT GGCTGTCGTCCATGCTGTGTTTGCATGG ATCCTGGCTGTGGTGATG

[00618] Олигонуклеотиды подвергали отжигу путем смешивания меченных и немеченных или двух меченных или двух немеченных олигонуклеотидов в эквимолярной концентрации (1 мкМ) в 1× буфере для отжига (6 мМ HEPES, pH 7,0 и 60 мМ KCl) при нагревании при 95°С в течение 2 минут с последующим медленным охлаждением. Гибридизованные олигонуклеотиды затем использовали непосредственно в анализах на связывание с ДНК с использованием эффекторного домена Cascade и/или гибрида эффекторного домена Cascade и RNP. ДНК-олигонуклеотиды, флуоресцентно меченные Cy5, визуализировали с помощью биовизуализатора AZURE c600 (Azure BioSystems, Dublin, CA).

[00619] Этот способ может быть применен для получения дополнительных меченных или немеченных последовательностей-мишеней или последовательностей с двумя мишенями, причем, двойная мишень определяется как мишень, которая содержит две последовательности протоспейсера, на которые нацелены отдельные молекулы Cascade, разделенные последовательностью промежуточного спейсера.

[00620] B. Получение последовательностей дцДНК-мишеней посредством ПЦР-амплификации из гДНК

[00621] Последовательности дцДНК-мишени для двойных мишеней, происходящие от человеческой гДНК, получали посредством ПЦР-амплификации непосредственно из матричной гДНК. В частности, реакционные ПЦР-смеси содержали человеческую гДНК, очищенную из клеток K562, и смесь Q5 «горячего старта» High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA), а также праймеры, перечисленные в Таблице 28, где подчеркнутые части соответствуют сайтам связывания с праймерами внутри гДНК.

[00622]

Таблица 28
Праймеры для ПЦР-амплификации
Seq ID NO: Описание Последовательность
SEQ ID NO:475 Прямой праймер для амплификации двойной мишени Hsa07 из человеческой гДНК CACTCTTTCCCTACACGACGCTCTTCCGATCTTTCCTCCCTAACCTCCACCT
SEQ ID NO:476 Обратный праймер для амплификации двойной мишени Hsa07 из человеческой гДНК GGAGTTCAGACGTGTGCTCTTCCGATCTTAAAGAGCCCAACCAGATGC

[00623] ПЦР осуществляли в соответствии с инструкциями производителя (New England Biolabs, Ipswich, MA), и нужный продукт ДНК длиной 288 п.о. очищали с использованием набора Nucleospin Gel и PCR Cleanup (Macherey-Nagel, Bethlehem, PA). Затем эту дцДНК использовали непосредственно в анализах на связывание ДНК и/или расщепление ДНК с использованием эффекторного домена Cascade и/или гибрида эффекторного домена Cascade и RNP.

[00624] C. Получение последовательностей дцДНК-мишеней путем клонирования последовательностей-мишеней в бактериальные плазмиды

[00625] ДНК-олигонуклеотиды, кодирующие представляющую интерес область-мишень, содержащую последовательность-мишень, также известную как протоспейсер, который распознается руководящей частью РНК CRISPR, соседний мотив, смежный с протоспейсером (PAM), и дополнительные 5'- и 3'-фланкирующие последовательности, были закуплены у коммерческого производителя (Integrated DNA Technologies, Coralville, IA). Олигонуклеотиды были сконструированы так, чтобы при их отжиге, концы были регенерированы в «липкие» концы после расщепления их соответствующих сайтов распознавания рестриктирующими ферментами EcoRI и BlpI или BamHI и EcoRI. Олигонуклеотиды были сконструированы так, чтобы они содержали единственную последовательность-мишень, происходящую от генома бактериофага лямбда, обозначенного J3. Кроме того, олигонуклеотиды были сконструированы так, чтобы они содержали две тандемных последовательности-мишени, происходящие от генома бактериофага лямбда и обозначенные J3 и L3, которые были отделены друг от друга межспейсерной последовательностью из 15 п.о. Последовательности этих олигонуклеотидов перечислены в Таблице 29.

[00626]

Таблица 29
Олигонуклеотиды, содержащие последовательности-мишени
SEQ ID NO: Описание Сайты распознавания рестриктирующими ферментами Последовательность
SEQ ID NO:477 Прямой олигонуклеотид, последовательность-мишень J3 для клонирования в pACYC-Duet1 BamHI и EcoRI GATCCATGCCAGTGATAAGTGGAATGCCATGTGGGCTGTCAAAAG
SEQ ID NO:478 Обратный олигонуклеотид, последовательность-мишень J3 для клонирования в pACYC-Duet1 BamHI и EcoRI AATTCTTTTGACAGCCCACATGGCATTCCACTTATCACTGGCATG
SEQ ID NO:479 Прямой олигонуклеотид, последовательности-мишени J3-15п.о.-L3 для клонирования в pACYC-Duet1 EcoRI и BlpI AATTCTTTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTAGGCCTCTCGAGATGAGTGGCAGATATAGCCTGGTGGTTCAGGCGGCGCATGC
SEQ ID NO:480 Обратный олигонуклеотид, последовательности-мишени J3-15п.о.-L3 для клонирования в pACYC-Duet1 EcoRI и BlpI TCAGCATGCGCCGCCTGAACCACCAGGCTATATCTGCCACTCATCTCGAGAGGCCTAGGATGCCAGTGATAAGTGGAATGCCATGTGGGCTGTCAAAAG

[00627] Олигонуклеотиды содержат 5'-фосфорилированные концы, которые были введены коммерческим производителем или фосфорилированы в лаборатории с использованием полинуклеотид-киназы Т4 (New England Biolabs, Ipswich, MA). Затем олигонуклеотиды отжигали до конечной концентрации 1 мкМ путем смешивая эквимолярных количеств в буфере для отжига (6 мМ HEPES, pH 7,0, 60 мМ KCl) при нагревании до 95°С в течение 2 минут с последующим медленным охлаждением на рабочем столе.

[00628] Отдельно, плазмиду pACYC-Duet1 (MilliporeSigma, Hayward, CA) дважды расщепляли соответствующей парой рестриктирующих ферментов, либо BamHI и EcoRI, либо EcoRI и BlpI, липкие концы которых соответствуют липким концам, образованным концами гибридизованных олигонуклеотидов. Дважды расщепленный вектор отделяли от удаленной вставки с помощью электрофореза в агарозном геле.

[00629] Для клонирования гибридизованных олигонуклеотиды в дважды расщепленный вектор, гибридизованные олигонуклеотиды разводили до исходной концентрации 50 нМ, а затем 10 мкл реакционной смеси для лигирования получали с использованием гибридизованных олигонуклеотидов, вектора двойного расщепления и лигазы Quick (New England Biolabs, Ipswich, MA). Затем реакционную смесь для лигирования использовали для трансформации химически компетентных штаммов E.coli, и после культивирования в течение ночи на планшетах с агарозой, отдельные клоны выделяли и культивировали в жидкой культуре для получения достаточного количества бактериальных культур, из которых можно было выделить плазмиды. Затем проводили секвенирование по Сэнгеру для подтверждения нужной плазмидной последовательности. В Таблице 30 представлены полные векторные последовательности для плазмид, содержащих последовательность-мишень J3 (SEQ ID NO: 481), и плазмид, содержащих последовательности-мишени J3 и L3, разделенные межспейсерной последовательностью из 15 п.о. (SEQ ID NO: 482).

[00630]

Таблица 30
Полноразмерные плазмидные последовательности
SEQ ID NO: Описание плазмиды
SEQ ID NO:481 Последовательность-мишень J3 в pACYC-Duet1
SEQ ID NO:482 Последовательности-мишени J3-15 п.о.-L3 в pACYC-Duet1
SEQ ID NO:483 Последовательности-мишени J3-30 п.о.-L3 в pACYC-Duet1
SEQ ID NO:484 Плазмида со множеством мишеней

[00631] Были проведены дополнительные манипуляции по клонированию для создания дополнительных плазмидных конструкций с двумя мишенями. Межспейсерная последовательность из 15 п.о. SEQ ID NO: 482 содержит уникальные рестрикционные сайты AvrII и XhoI. Таким образом, введение дополнительных гибридизованных олигонуклеотидов в эти рестрикционные сайты позволяет расширить промежуточный спейсер до еще большей длины для биохимического тестирования с использованием Cascade и гибрида Cascade-нуклеаза и RNP. Поскольку гибридный комплекс cr-РНК - руководящий FokI-Cascade нацелен на два смежных сайта ДНК, то димеризация доменов FokI из смежных связанных с ДНК комплексов приводит к расщеплению ДНК в промежуточном спейсере, разделяющем два сайта-мишени. Были сконструированы и протестированы различные межспейсерные области для оценки заданной межспейсерной длины с заданной геометрией связывания между доменом нуклеазы FokI и его гибридным белком субъединицы Cascade. Полноразмерная векторная последовательность для субстрата ДНК-мишени, содержащего расширенную межспейсерную последовательность размером 30 п.о., представлена в Таблице 30 как SEQ ID NO: 483.

[00632] Кроме того, последующая стратегия клонирования позволила получить плазмидный субстрат, который содержит несколько последовательностей-мишеней, последовательно соединенных друг с другом вдоль одной большой вставки. Блок генов был заказан у коммерческого производителя (Integrated DNA Technologies, Coralville, IA) и содержал 17 последовательных двойных мишеней. Генный блок содержал 4 п.о., отделяющих каждую двойную мишень от соседних двойных мишеней, и содержал 16 двойных мишеней, полученных из гДНК H. sapiens, а также одну контрольную двойную мишень, содержащую мишени J3/L3, происходящие от генома бактериофага лямбда. Геномные координаты 16 последовательных двойных мишеней у человека показаны в Таблице 31. Блок генов был снабжен фланкирующими рестрикционными сайтами SacI и SbfI так, чтобы он мог быть клонирован в сайты SacI и Sbfl в векторе pACYC-Duet1. Полноразмерная векторная последовательность субстрата плазмиды с несколькими мишенями, полученная путем клонирования блока генов в pACYC-Duet1, представлена как SEQ ID NO: 484 в Таблице 30. Эта плазмида с множеством последовательностей-мишеней позволяет проводить биохимическое тестирование множества различных препаратов FokI-Cascade, несущих cr-РНК, нацеленных на один из последовательно соединенных сайтов-мишеней в плазмиде.

[00633]

Таблица 31
Двойные человеческие мишени
SEQ ID NO: Название мишени Ген Геномные координаты 5’-спейсера-мишени Геномные координаты 3’-спейсера-мишени
SEQ ID NO:485 Hsa01 PDCD1 chr2:241850348-241850382 chr2:241850408-241850442
SEQ ID NO:486 Hsa02 CTLA4 chr2:203870664-203870698 chr2:203870724-203870758
SEQ ID NO:487 Hsa03 TRAC chr14:22509340-22509374 chr14:22509405-22509439
SEQ ID NO:488 Hsa04 TRAC chr14:22509785-22509819 chr14:22509850-22509884
SEQ ID NO:489 Hsa05 TRAC chr14:22513932-22513966 chr14:22513997-22514031
SEQ ID NO:490 Hsa06 TRAC chr14:22515993-22516027 chr14:22516058-22516092
SEQ ID NO:491 Hsa07 TRAC chr14:22516265-22516299 chr14:22516330-22516364
SEQ ID NO:492 Hsa08 CD52 chr1:26320402-26320436 chr1:26320467-26320501
SEQ ID NO:493 Hsa09 CTLA4 chr2:203873012-203873046 chr2:203873077-203873111
SEQ ID NO:494 Hsa10 CTLA4 chr2:203873195-203873229 chr2:203873260-203873294
SEQ ID NO:495 Hsa11 TRAC chr14:22551630-22551664 chr14:22551700-22551734
SEQ ID NO:496 Hsa12 CTLA4 chr2:203872758-203872792 chr2:203872828-203872862
SEQ ID NO:497 Hsa13 TRAC chr14:22551862-22551896 chr14:22551937-22551971
SEQ ID NO:498 Hsa14 TRBC2 chr7:142801112-142801146 chr7:142801187-142801221
SEQ ID NO:499 Hsa15 TRAC chr14:22551630-22551664 chr14:22551710-22551744
SEQ ID NO:500 Hsa16 CTLA4 chr2:203867814-203867848 chr2:203867894-203867928

[00634]

Пример 7

Применение очищенных комплексов Cascade в анализах на биохимическое расщепление

[00634] В этом примере проиллюстрировано применение комплексов гибридных белков FokI-Cascade в биохимических анализах на расщепление дцДНК. Белковые реагенты сравнивали по своей активности в расщеплении дцДНК.

[00636] FokI-Cascade RNP, полученные из системы Cascade E. coli типа I-E, были сконструированы, рекомбинантно экспрессированы в E. coli и очищены для применения, как описано в примерах 1, 2 и 5. Эти RNP были сконструированы так, чтобы они содержали РНК CRISPR, которые нацелены на последовательности-мишени J3 и L3, происходящие от гДНК бактериофага лямбда, или которые нацелены на интрон в гене TRAC внутри человеческой гДНК. Каждый препарат RNP представляет собой гетерогенную смесь, содержащую два комплекса FokI-Cascade, которые, в основном, идентичны, за исключением руководящей части cr-РНК.

[00637] FokI-Cas8 был очищен отдельно от комплекса Cascade без Cas8, запрограммирован руководящими полинуклеотидами, нацеленными на последовательности-мишени J3 и L3 лямбда, и использован в биохимических анализах на расщепление плазмидными субстратами J3/L3, несущими сайты-мишени в конфигурации PAM-in.

[00638] Комплекс FokI-Cascade восстанавливали путем смешивания комплекса CasBCDE (полученного с использованием SEQ ID NO: 440 и SEQ ID NO: 446, как описано в Примере 2) с очищенным FokI-Cas8, содержащим линкер из 16 аминокислот (общая последовательность экспрессионного вектора FokI-Cas8 описана в Примере 2, SEQ ID NO: 439 в Таблице 19; конкретный линкер из 16 аминокислот представлен в Примере 1, SEQ ID NO: 431 в Таблице 17). Восстановление осуществляли в 1× буфере для расщепления Cascade (20 мМ Трис-Cl, pH 7,5, 200 мМ NaCl, 5 мМ MgCl2, 1 мМ TCEP, 5% глицерин) с CasBCDE и FokI-Cas8 в конечных концентрациях 1 мкМ.

[00639] Для проведения анализов на расщепление ДНК, реакционные смеси получали следующим образом. Плазмидный субстрат, содержащий последовательность с двойной мишенью J3/L3 с промежуточным спейсером из 30 пар оснований (SEQ ID NO: 483 в Таблице 30), инкубировали с различными концентрациями комплекса FokI-Cascade (3-100 нМ) в 15 мкл реакционной смеси в 1× буфере для расщепления Cascade с плазмидной ДНК в конечной концентрации 13,3 нг/мкл. Реакционные смеси инкубировали в течение 30 минут при 37°C, после чего добавляли 3 мкл загрузочного красителя 6× ДСН. Загрузочный краситель добавляли для денатурации связанных комплексов FokI-Cascade. Компоненты реакционной смеси разделяли с помощью электрофореза в 0,8% агарозном геле. Гели окрашивали после электрофореза красителем SYBR ™ Safe DNA Gel Stain (Thermo Scientific, Wilmington, DE).

[00640] В качестве позитивного контроля, белок Cas9 S. pyogenes был запрограммирован с помощью одноцепочечной руководящей РНК (оцрРНК), нацеленной на 20 п.о.-часть последовательности-мишени Cascade J3 (оцрРНК-J3; спейсерная последовательность представлена как SEQ ID NO: 501). Комплексы Cas9/оцрРНК-J3 восстанавливали путем смешивания Cas9 вместе с 2-кратным молярным избытком оцрРНК в 1× буфере CCE (20 мМ HEPES pH 7,4, 10 мМ MgCl2, 150 мМ KCl, 5% глицерин). Расщепление этим комплексом Cas9/оцрРНК-J3 оценивали в том же интервале концентраций (3-100 нМ) путем инкубирования реакционных смесей в течение 30 минут при 37°C. В этот эксперимент были также включены контрольные дорожки, содержащие неразрезанную плазмидную ДНК, а также плазмидную ДНК, линеаризованную рестриктирующим ферментом NheI (New England Biolabs, Ipswich, MA). О расщеплении ДНК-мишени свидетельствует сдвиг подвижности плазмиды, поскольку неразрезанная плазмидная ДНК является суперспирализованной и имеет более высокую подвижность, чем расщепленная линеаризованная плазмидная ДНК. Плазмидная ДНК с одноцепочечным разрывом и с незамкнутым кольцом имеет меньшую подвижность, чем суперспирализованная и линеаризованная плазмидная ДНК.

[00641] Данные, полученные в результате этих экспериментов, продемонстрировали, что в интервале тестирумых концентраций, комплекс FokI-Cascade обладал такой же активностью расщепления ДНК-мишени, как и Cas9-оцрРНК. При наивысшей тестирумой концентрации (100 нМ), плазмидная мишень была количественно линеаризована комплексом FokI-Cascade и Cas9-оцрРНК.

[00642] Реагенты комплекса FokI-Cascade также тестировали на их кинетику расщепления ДНК-мишени. Плазмидный субстрат, содержащий последовательность с двойной мишенью J3/L3 с промежуточным спейсером в 30 п.о. (SEQ ID NO: 483), инкубировали с 200 нМ комплекса FokI-Cascade или с 200 нМ Cas9-оцрРНК в 15 мкл реакционной смеси с плазмидной ДНК в конечной концентрации 13,3 нг/мкл. Реакции гасили через 0, 7, 10, 15, 20, 25 или 30 минут, и компоненты реакционной смеси разделяли с помощью электрофореза в агарозном геле, как описано выше. Комплекс FokI-Cascade продемонстрировал аналогичные, но немного более низкие скорости расщепления ДНК-мишени, чем комплекс Cas9/оцрРНК-J3, при этом, плазмидная мишень количественно линеаризовалась через 25 минут для комплекса FokI-Cascade и 20 минут для комплекса Cas9/оцрРНК-J3.

[00643] Реагенты комплекса FokI-Cascade также тестировали на их неспецифическое расщепление ДНК и/или активность образования одноцепочечного разрыва на субстрате плазмиды, не являющейся мишенью pACYC-Duet1 по сравнению со специфическим расщеплением ДНК плазмидного субстрата с двойной мишенью J3/L3. В Таблице 32 представлена последовательность плазмидного субстрата pACYC-Duet1, не являющегося мишенью и используемого для контроля (SEQ ID NO: 502). В частности, была исследована зависимость неспецифического и специфического расщепления ДНК-мишени от концентрации одновалентной соли в реакционном буфере. Были приготовлены варианты 1× буфера для расщепления Cascade (20 мМ Трис-Cl, pH 7,5, 200 мМ NaCl, 5 мМ MgCl2, 1 мМ TCEP и 5% глицерин), в которых концентрация NaCl снижалась с 200 мМ до 150 мМ, 100 мМ или 50 мМ, и те же самые реакции расщепления, описанные выше, проводили путем инкубирования 200 нМ комплекса FokI-Cascade с 13,3 нг/мкл плазмиды-мишени J3/L3, или с 13,3 нг/мкл плазмиды pACYC-Duet1, не являющейся мишенью. Были проведены дополнительные контрольные реакции, в которых концентрация NaCl поддерживалась на уровне 100 мМ, но 5 мМ MgCl2 заменяли на 10 мМ EDTA, что, как и ожидалось, предотвращало расщепление из-за потребности FokI в ионах двухвалентных металлов для расщепления ДНК. В соответствии с этим, нецелевую плазмиду, не являющуюся мишенью и плазмиду-мишень J3/L3 обрабатывали в следующих реакционных условиях: комплексом -FokI-Cascade; комплексом +FokI-Cascade, 100 мМ буфера NaCl+10 мМ EDTA; комплексом +FokI-Cascade, 50 мМ буфера NaCl; комплексом +FokI-Cascade, 100 мМ буфера NaCl; комплексом +FokI-Cascade, 150 мМ буфера NaCl, комплексом +FokI-Cascade, 200 мМ буфера NaCl. Данные продемонстрировали, что комплекс FokI-Cascade показал неспецифический одноцепочечный разрыв в плазмиде, не являющейся мишенью, и в плазмиде-мишени J3/L3 при низких концентрациях соли <200 мМ NaCl, но при концентрации одновалентной соли 200 мМ NaCl, плазмида, не являющася мишенью, оставалась интактной, тогда как плазмида-мишень J3/L3 была количественно линеаризована. Кроме того, буфер, содержащий EDTA, как и ожидалось, приводил к полному прекращению расщепления мишени.

[00644] Для того, чтобы подтвердить, что комплекс FokI-Cascade расщепляет плазмиду-мишень в ожидаемом положении, то есть, в середине межспейсерной последовательности, разделяющей мишени J3 и L3, был проведен эксперимент, в котором плазмида-мишень была сначала инкубирована с комплексом FokI-Cascade, а затем с рестриктирующим ферментом AfeI (New England Biolabs, Ipswich, MA), который расщепляет плазмидный субстрат в другом месте. Таким образом, расщепление комплексом FokI-Cascade 1 и AfeI превращает суперспирализованную кольцевую плазмиду в два линейных фрагмента, мигрирующих как отдельные молекулы на агарозном геле. В частности, ожидалось, что при расщеплении будут образовываться фрагменты длиной 2427 п.о. и 1357 п.о.

[00645] 13,3 нг/мкл плазмиды-мишени J3/L3 инкубировали с 200 нМ комплекса FokI-Cascade 1 в течение 30 минут, после чего к реакционной смеси добавляли 1 мкл AfeI (10 единиц/мкл; New England Biolabs, Ipswich, MA), с последующим дополнительным 30-минутным инкубированием при 37°C. Продукты реакции разделяли с помощью электрофореза в агарозном геле, как описано выше. Кроме того, для контрольных экспериментов, плазмиду-мишень инкубировали только с комплексом FokI-Cascade 1 или только с AfeI, и те же реакции проводили с плазмидой, которая не является мишенью, и которая может быть расщеплена AfeI, но не комплексом FokI-Cascade 1 (поскольку эта плазмида лишена двойной мишени J3/L3). В Таблице 32 представлена последовательность субстрата плазмиды pACYC-Duet1, не являющейся мишенью и используемой для контроля (SEQ ID NO: 502). В соответствии с этим, плазмиду, не являющуюся мишенью, и плазмиду-мишень J3/L3 обрабатывали в следующих реакционных условиях: комплексом -AfeI/-FokI-Cascade; комплексом -AfeI/+FokI-Cascade; комплексом +AfeI/+FokI-Cascade; и +AfeI/-FokI-Cascade. Данные продемонстрировали, что комплекс FokI-Cascade расщепляет плазмиду-мишень в ожидаемом положении, поскольку совместное инкубирование с комплексом FokI-Cascade 1 и AfeI приводит к образованию двух линейных продуктов ожидаемой длины.

[00646] Для дополнительного подтверждения специфичности последовательности расщепления ДНК комплексом FokI-Cascade, были созданы дополнительные субстраты контрольной плазмиды, которые содержат: мутацию в PAM, фланкирующем мишень J3; мутацию в PAM, фланкирующем мишень L3; мутации в обоих PAM, фланкирующих мишени J3/L3; мутации в спейсерной последовательности в мишени J3; мутации в спейсерной последовательности в мишени L3; мутации в обеих спейсерных последовательностях в мишенях J3/L3; и в мишени J3, но не в мишени L3, в мишени L3, но не в мишени J3, и ни в мишени J3, ни в мишени L3. В соответствии с этим, плазмидные субстраты представляют собой: мутант J3 PAM, мутант L3 PAM, мутант J3/L3 PAM, мутант спейсера J3, мутант спейсера L3, мутант спейсера J3/L3, плазмиду, не являющуюся мишенью; только мишень J3, только мишень L3 и плазмиду-мишень J3/L3. Каждую мишень обрабатывали в следующих реакционных условиях: комплексом -NdeI/-FokI-Cascade; комплексом +NdeI/-FokI-Cascade; и комплексом -NdeI/+FokI-Cascade 1. В Таблице 32 представлены последовательности всех мутантных плазмидных субстратов, описанных выше (с SEQ ID NO: 502 по SEQ ID NO: 510).

[00647]

Таблица 32
Мутированные последовательности плазмидного субстрата
SEQ ID NO: Описание плазмиды
SEQ ID NO:502 Плазмида pACYC-Duet1, не являющаяся мишенью
SEQ ID NO:503 Плазмида-мишень J3-30п.о.-L3, мутант J3 PAM
SEQ ID NO:504 Плазмида-мишень J3-30п.о.-L3, мутант L3 PAM
SEQ ID NO:505 Плазмида-мишень J3-30п.о.-L3, мутанты J3/L3 PAM
SEQ ID NO:506 Плазмида-мишень J3-30п.о.-L3, мутанты спейсера J3
SEQ ID NO:507 Плазмида-мишень J3-30п.о.-L3, мутанты спейсера L3
SEQ ID NO:508 Плазмида-мишень J3-30п.о.-L3, мутанты спейсера J3/L3
SEQ ID NO:509 Только плазмида-мишень J3
SEQ ID NO:510 Только плазмида-мишень L3

[00648] Реакции расщепления ДНК проводили, как описано выше, с использованием 200 нМ комплекса FokI-Cascade и 13,3 нг/мкл плазмидных субстратов; а контрольные реакции для линеаризации каждого плазмидного субстрата проводили с использованием NdeI (New England Biolabs, Ipswich, MA). Электрофорез в агарозном геле проводили, как описано выше. Данные продемонстрировали, что эффективное введение двухцепочечного разрыва и линеаризация плазмиды-мишени наблюдается только для плазмид-мишеней J3/L3, но не для контрольных плазмид, содержащих мутации PAM или затравочные мутации, или только для одного из двух сайтов-мишеней.

[00649] Компоненты для различных комплексов FokI-Cascade были клонированы и сверхэкспрессированы. RNP, продуцируемые этими компонентами, очищали и тестировали на биохимическое расщепление ДНК для сравнения активности различных комплексов FokI-Cascade. В частности, активности расщепления ДНК сравнивали для восстановленных комплексов FokI-Cascade, содержащих: отдельно очищенный комплекс CasBCDE (полученный с использованием SEQ ID NO: 440 и SEQ ID NO: 446) и FokI-Cas8 (полученный с использованием SEQ ID NO: 439); FokI-Cascade, несущий руководящие cr-РНК J3/L3 (полученные с использованием SEQ ID NO: 442 и SEQ ID NO: 446); FokI-Cascade, несущий дополнительный сигнал ядерной локализации на субъединице Cas7 (полученной с использованием SEQ ID NO: 443 и SEQ ID NO: 446), или на субъединице Cas6; FokI-Cascade, несущий дополнительный сигнал ядерной локализации и метку НА на субъединице Cas7 или на субъединице Cas6; FokI-Cascade, прошедший более жесткую очистку посредством эксклюзионной хроматографии (ЭХ) и ионообменной хроматографии (ИОХ); и FokI-Cascade, который был очищен только с помощью аффинной хромотографии на иммобилизованном металле (IMAC) без дополнительной очистки.

[00650] В соответствии с этим, плазмиду, не являющуюся мишенью, и плазмиду-мишень J3/L3 обрабатывали в следующих реакционных условиях: негативным контролем; AfeI; комплексом CasBCDE+FokI-Cas8; комплексом FokI-Cascade; комплексом FokI-Cascade (NLS-Cas6); комплексом FokI-Cascade (Cas7-NLS); комплексом FokI-Cascade (NLS-HA-Cas6); комплексом FokI-Cascade (Cas7-HA-NLS); комплексом FokI-Cascade (ИОХ, ЭХ-очистка); и комплексом FokI-Cascade (без очистки). Реакции расщепления ДНК проводили с использованием этих реагентов RNP, как описано выше, и с использованием плазмиды, не являющейся мишенью, или консенсусных плазмид-мишеней J3/L3, и продукты реакции разделяли с помощью электрофореза в агарозном геле. Данные продемонстрировали, что все реагенты RNP, за одним исключением, продемонстрировали почти идентичное и количественное расщепление плазмидной ДНК без фонового расщепления плазмиды, не являющейся мишенью. Единственным исключением был комплекс FokI-Cascade, который очищали без дополнительной очистки, и который обнаружывал более неспецифическую активность образования одноцепочечного разрыва, как видно на дорожке, соответствующей его инкубированию с плазмидой, не являющейся мишенью.

[00651] И наконец, с использованием NLS-меченного варианта Cas7 комплекса FokI-Cascade в качестве исходной точки, 16 различных спаренных руководящих cr-РНК были протестированы на биохимическое расщепление ДНК плазмидного субстрата для геномных сайтов H. sapiens Hsa01 - Hsa16, последовательно соединенных вдоль одной большой вставки (SEQ ID NO: 484). Каждая пара cr-РНК содержит две уникальные спейсерные последовательности, которые соответствуют двум смежным сайтам-мишеням в человеческой гДНК, разделенным промежуточным спейсером, где последовательности-мишени описаны в SEQ ID NO: 485 - SEQ ID NO: 500. В Таблице 33 представлены последовательности обеих cr-РНК в каждой паре, нацеленной на последовательности гДНК Hsa01 - Hsa16, где спейсер cr-РНК подчеркнут и показан строчными буквами, а последовательности 5’- и 3’-руководящей области соответствуют повторяющимся последовательностям из массива CRISPR.

[00652]

Таблица 33
Последовательности cr-РНК
SEQ ID NO: ДНК-мишень Последовательность cr-РНК
SEQ ID NO:511 Hsa01-1 AUAAACCGcgggcaggcagagcuggaggccuuucaggcccGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:512 Hsa01-2 AUAAACCGggccugaggugcugccugggcauguguaaaggGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:513 Hsa02-1 AUAAACCGcacugucacccggaccucaguggcuuugccugGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:514 Hsa02-2 AUAAACCGucugugcggcaaccuacaugauggggaaugagGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:515 Hsa03-1 AUAAACCGaugagcuuguuuguagcaccaccauaauucacGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:516 Hsa03-2 AUAAACCGuacguaaguaguggcaugugucagguggauucGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:517 Hsa04-1 AUAAACCGaaggcauuuggaccggcagacacauaauuguaGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:518 Hsa04-2 AUAAACCGagacuccagagccauccuugggaagagugcugGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:519 Hsa05-1 AUAAACCGacaagagguguguuuccugaauucccacagugGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:520 Hsa05-2 AUAAACCGuaaguguuucuagccauccuugauuuugaucaGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:521 Hsa06-1 AUAAACCGuggcuacugcucugucuccugggauccugccuGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:522 Hsa06-2 AUAAACCGgcccauaccuucaaggaaaauuaaggcaaauaGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:523 Hsa07-1 AUAAACCGguugauuugccugcauugguguuacacagucuGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:524 Hsa07-2 AUAAACCGuaaguuguguucuucuuugccuaggccuucagGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:525 Hsa08-1 AUAAACCGgcacugccugucaacuucuacaaccuggugauGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:526 Hsa08-2 AUAAACCGuaggggccaagcagugcccagcugggggucaaGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:527 Hsa09-1 AUAAACCGcuuucacugaaaguggagcugaugugacagaaGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:528 Hsa09-2 AUAAACCGaugugggucaaggaauuaaguuagggaauggcGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:529 Hsa10-1 AUAAACCGgcauaaaauuuaacuugaaaagaucauuucggGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:530 Hsa10-2 AUAAACCGgcuucaaaaauacucacauggcuauguuuuagGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:531 Hsa11-1 AUAAACCGaggggcaaugcagaggaaggagcgagggagcaGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:532 Hsa11-2 AUAAACCGgaggugaaagcugcuaccaccucugugcccccGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:533 Hsa12-1 AUAAACCGgcugaaauugcuuuucacauucuggcucuguuGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:534 Hsa12-2 AUAAACCGagaguccauauuucaauuuccaagagcugaggGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:535 Hsa13-1 AUAAACCGugcacagccaggggaggcugcagcagccuugcGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:536 Hsa13-2 AUAAACCGauggaucuucaguggguucucuugggcucuagGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:537 Hsa14-1 AUAAACCGccuguggccaggcacaccagugUGGCCUUUUGGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:538 Hsa14-2 AUAAACCGgaggugcacaguggggucagcacagacccgcaGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:539 Hsa15-1 AUAAACCGaggggcaaugcagaggaaggagcgagggagcaGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:540 Hsa15-2 AUAAACCGcugcuaccaccucugugcccccccggcaaugcGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:541 Hsa16-1 AUAAACCGgacuuuauauagauagcuuugaucccagauauGAGUUCCCCGCGCCAGCGGGG
SEQ ID NO:542 Hsa16-2 AUAAACCGguuuugcucuacuuccugaagaccugaacaccGAGUUCCCCGCGCCAGCGGGG

[00653] После очистки 16 комплексов FokI-Cascade проводили реакции расщепления, как описано выше, при этом комплексы FokI-Cascade инкубировали с плазмидным субстратом, содержащим геномные сайты H. sapiens Hsa01 - Hsa16, и продукты реакции разделяли с помощью электрофореза в агарозном геле. Данные продемонстрировали, что из 16 реагентов RNP, 14/16 (Hsa03-Hsa16) продемонстрировали почти количественное расщепление ДНК, о чем свидетельствует превращение суперспирального кольцевого плазмидного субстрата в расщепленную линейную форму. И только конструкции Hsa01 и Hsa02 показали частичную активность в отношении образования одноцепочечного разрыва. Кроме того, данные продемонстрировали, что комплексы FokI-Cascade были эффективно запрограммированы с использованием сконструированных 16 спаренных рРНК для нацеливания на терапевтически релевантные гены H. sapiens.

[00654]

Пример 8

Введение комплексов FokI-Cascade RNP в клетки-мишени

[00655] В этом примере проиллюстрированы конструирование и доставка комплексов Cascade типа I-E E. coli, содержащих гибридные белки FokI, для облегчения редактирования генома в клетках человека, и описана их доставка в клетки-мишени в виде предварительно собранных комплексов Cascade RNP.

[00656] A. Получение комплексов Cascade RNP, содержащих FokI, для переноса в клетки.

[00657] Минимальные массивы CRISPR были сконструированы для нацеливания на восемь различных локусов в геноме человека. Каждый минимальный массив CRISPR содержал две спейсерные последовательности, каждая из которых фланкировалась последовательностями повторов CRISPR. Две спейсерные последовательности локусов-мишеней в геноме разделены 30 п.о. (то есть, межспейсерной областью 30 п.о.), и каждый спейсер был сконструирован для связывания с последовательностью-мишенью, смежной с последовательностью мотива, смежного с протоспейсером AAG или ATG (PAM) в геноме клетки-мишени. Плазмидные векторы, содержащие каждый минимальный массив CRISPR, получали путем лигирования гибридизованных олигонуклеотидов (Integrated DNA Technologies, Coralville, IA) в остов вектора pACYC-Duet1 (MilliporeSigma, Hayward, CA) для бактериальной экспрессии.

[00658] Перекрывающиеся праймеры для получения выбранных спейсеров в минимальных массивах CRISPR представлены в Таблице 34, а последовательности праймеров описаны в Таблице 35.

[00659]

Таблица 34
Перекрывающиеся праймеры для получения минимальных массивов CRISPR
Компонент Ген-мишень Праймеры
Минимальный массив CRISPR Hsa03 Интрон TRAC A, B
Минимальный массив CRISPR Hsa04 Интрон TRAC C, D
Минимальный массив CRISPR Hsa05 Интрон TRAC E, F
Минимальный массив CRISPR Hsa06 Интрон TRAC G, H
Минимальный массив CRISPR Hsa07 Интрон TRAC I, J
Минимальный массив CRISPR Hsa08 Экзон CD52 K, L
Минимальный массив CRISPR Hsa09 Экзон CTLA4 M, N
Минимальный массив CRISPR Hsa10 Экзон CTLA4 O, P

[00660]

Таблица 35
Последовательности ДНК-праймеров
SEQ ID NO: Олигонуклеотид Последовательность
SEQ ID NO:543 A /5Phos/ACCGATGAGCTTGTTTGTAGCACCACCAT AATTCACGAGTTCCCCGCGCCAGCGGGGATAA ACCGTACGTAAGTAGTGGCATGTGTCAGGTGGA TTC
SEQ ID NO:544 B /5Phos/ACTCGAATCCACCTGACACATGCCACTA CTTACGTACGGTTTATCCCCGCTGGCGCGGGGA ACTCGTGAATTATGGTGGTGCTACAAACAAGCT CAT
SEQ ID NO:545 C /5Phos/ACCGAAGGCATTTGGACCGGCAGACACA TAATTGTAGAGTTCCCCGCGCCAGCGGGGATAA ACCGAGACTCCAGAGCCATCCTTGGGAAGAGT GCTG
SEQ ID NO:546 D /5Phos/ACTCCAGCACTCTTCCCAAGGATGGCTCT GGAGTCTCGGTTTATCCCCGCTGGCGCGGGGAA CTCTACAATTATGTGTCTGCCGGTCCAAATGCC TT
SEQ ID NO:547 E /5Phos/ACCGACAAGAGGTGTGTTTCCTGAATTCC CACAGTGGAGTTCCCCGCGCCAGCGGGGATAA ACCGTAAGTGTTTCTAGCCATCCTTGATTTTGAT CA
SEQ ID NO:548 F /5Phos/ACTCTGATCAAAATCAAGGATGGCTAGA AACACTTACGGTTTATCCCCGCTGGCGCGGGGA ACTCCACTGTGGGAATTCAGGAAACACACCTCT TGT
SEQ ID NO:549 G /5Phos/ACCGTGGCTACTGCTCTGTCTCCTGGGAT CCTGCCTGAGTTCCCCGCGCCAGCGGGGATAAA CCGGCCCATACCTTCAAGGAAAATTAAGGCAA ATA
SEQ ID NO:550 H /5Phos/ACTCTATTTGCCTTAATTTTCCTTGAAGG TATGGGCCGGTTTATCCCCGCTGGCGCGGGGAA CTCAGGCAGGATCCCAGGAGACAGAGCAGTAG CCA
SEQ ID NO:551 I /5Phos/ACCGGTTGATTTGCCTGCATTGGTGTTAC ACAGTCTGAGTTCCCCGCGCCAGCGGGGATAA ACCGTAAGTTGTGTTCTTCTTTGCCTAGGCCTTC AG
SEQ ID NO:552 J /5Phos/ACTCCTGAAGGCCTAGGCAAAGAAGAAC ACAACTTACGGTTTATCCCCGCTGGCGCGGGGA ACTCAGACTGTGTAACACCAATGCAGGCAAATC AAC
SEQ ID NO:553 K /5Phos/ACCGGCACTGCCTGTCAACTTCTACAACC TGGTGATGAGTTCCCCGCGCCAGCGGGGATAA ACCGTAGGGGCCAAGCAGTGCCCAGCTGGGGG TCAA
SEQ ID NO:554 L /5Phos/ACTCTTGACCCCCAGCTGGGCACTGCTTG GCCCCTACGGTTTATCCCCGCTGGCGCGGGGAA CTCATCACCAGGTTGTAGAAGTTGACAGGCAGT GC
SEQ ID NO:555 M /5Phos/ACCGCTTTCACTGAAAGTGGAGCTGATG TGACAGAAGAGTTCCCCGCGCCAGCGGGGATA AACCGATGTGGGTCAAGGAATTAAGTTAGGGA ATGGC
SEQ ID NO:556 N /5Phos/ACTCGCCATTCCCTAACTTAATTCCTTGA CCCACATCGGTTTATCCCCGCTGGCGCGGGGAA CTCTTCTGTCACATCAGCTCCACTTTCAGTGAA AG
SEQ ID NO:557 O /5Phos/ACCGGCATAAAATTTAACTTGAAAAGAT CATTTCGGGAGTTCCCCGCGCCAGCGGGGATAA ACCGGCTTCAAAAATACTCACATGGCTATGTTT TAG
SEQ ID NO:558 P /5Phos/ACTCCTAAAACATAGCCATGTGAGTATTT TTGAAGCCGGTTTATCCCCGCTGGCGCGGGGAA CTCCCGAAATGATCTTTTCAAGTTAAATTTTATG C
SEQ ID NO:559 Q CACTCTTTCCCTACACGACGCTCTTCCGATCTAGCCTGGAAAGACACAAAGC
SEQ ID NO:560 R GGAGTTCAGACGTGTGCTCTTCCGATCTCAGCCATCCTTTCCACCTAA
SEQ ID NO:561 S CACTCTTTCCCTACACGACGCTCTTCCGATCTATGCTGCAGGCTTTATGCTT
SEQ ID NO:562 T GGAGTTCAGACGTGTGCTCTTCCGATCTTTAGGCCTGCCTGACTTCTC
SEQ ID NO:563 U CACTCTTTCCCTACACGACGCTCTTCCGATCTGGGAAGAAGACCAACAAGAGG
SEQ ID NO:564 V GGAGTTCAGACGTGTGCTCTTCCGATCTTTCAAGGGAAGAAGCCATTG
SEQ ID NO:565 W CACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGCAGGAATTGGATGAAA
SEQ ID NO:566 X GGAGTTCAGACGTGTGCTCTTCCGATCTAACCTGAGATGACTGCCCAT
SEQ ID NO:567 Y CACTCTTTCCCTACACGACGCTCTTCCGATCTTTCCTCCCTAACCTCCACCT
SEQ ID NO:568 Z GGAGTTCAGACGTGTGCTCTTCCGATCTTAAAGAGCCCAACCAGATGC
SEQ ID NO:569 A2 CACTCTTTCCCTACACGACGCTCTTCCGATCTGTCTCAGCCTTAGCCCTGTG
SEQ ID NO:570 B2 GGAGTTCAGACGTGTGCTCTTCCGATCTCCCACTGCAAGTACAAGGGT
SEQ ID NO:571 C2 CACTCTTTCCCTACACGACGCTCTTCCGATCTGGATGCGGAACCCAAATTA
SEQ ID NO:572 D2 GGAGTTCAGACGTGTGCTCTTCCGATCTTAGTCTTCTCCCTCGCTCCC
SEQ ID NO:573 E2 CACTCTTTCCCTACACGACGCTCTTCCGATCTTGCAGCATTATGATGTGGGT
SEQ ID NO:574 F2 GGAGTTCAGACGTGTGCTCTTCCGATCTCAACCTTTAGCATCACTGGCT
SEQ ID NO:575 G2 CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTC
SEQ ID NO:576 H2 AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACG

[00661] Конструирование бактериальных экспрессионных векторов для получения комплексов Cascade RNP подробно описан в Примере 2. Вкратце, каждый ген cas экспрессировался из одного оперона, и кодирующие последовательности для генов cas были расположены в следующем порядке cas8-cse2-cas7-cas5-cas6. Фрагмент FokI был присоединен к Cas8 посредством линкера из 30 аминокислот, а сигнал ядерной локализации (NLS) был присоединен к N-концу FokI-Cas8 (комплекс FokI-Cascade) и к N-концу Cas6 (далее называемому комплексом FokI-Cascade-NLS-Cas6, SEQ ID NO: 577).

[00662] Комплексы FokI-Cascade-NLS-Cas6 очищали в виде собранных комплексов из E. coli, в основном, как описано в Примере 5A.

[00663] B. Перенос комплексов Cascade RNP, содержащих FokI, в эукариотические клетки

[00664] Клетки HEK293 (ATCC, Manassas, VA) культивировали в суспензии в среде DMEM с добавлением 10% FBS и 1× раствора антибиотика-противогрибкового средства (Mediatech, Inc., Manassas, VA) при 37°C, 5% CO2 и 100% влажности. Клетки HEK293 были трансфицированы с использованием 96-луночного планшета Shuttle Nucleofector® (Lonza, Allendale, NJ). Перед нуклеофекцией, 5 мкл FokI-Cascade RNP переносили в отдельные лунки 96-луночного планшета. Каждая лунка содержала ~225-500 пмоль комплексов FokI-Cascade-NLS-Cas6, в зависимости от RNP. Клетки HEK293 переносили в коническую центрифужную 50 мл-пробирку и центрифугировали при 200×g в течение 3 минут. Среду отсасывали, и клеточный осадок промывали PBS, не содержащим кальция и магния. Клетки центрифугировали еще один раз и ресуспендировали в буфере Nucleofector SF (Lonza, Allendale, NJ) в концентрации 1×107 клеток/мл. 20 мкл этой клеточной суспензии добавляли к комплексам FokI-Cascade-NLS-Cas6 в 96-луночном планшете, перемешивали, а затем весь объем переносили в 96-луночный планшет Nucleocuvette™ (Lonza, Allendale, NJ). Затем планшет загружали в 96-луночную систему Shuttle™ Nucleofector™ (Lonza, Allendale, NJ), и клетки подвергали нуклеофекции с использованием программы 96-CM-130 Nucleofector™ (Lonza, Allendale, NJ). Сразу после нуклеофекции, в каждую лунку 96-луночного планшета Nucleocuvette™ (Lonza, Allendale, NJ) добавляли 80 мкл полной среды DMEM. Затем все содержимое лунки переносили в 96-луночный планшет для культивирования ткани, содержащий 100 мкл полной среды DMEM. Клетки культивировали при 37°C, 5% CO2 и 100% влажности в течение ~72 часов.

[00665] Через ~72 часа, клетки HEK293 центрифугировали при 500 g в течение 5 минут, и среду удаляли. Клетки промывали PBS без кальция и магния. Затем клеточный осадок ресуспендировали в 50 мкл растворов для экстракции ДНК QuickExtract (Epicenter, Madison, WI). Затем полученные образцы гДНК инкубировали при 37°C в течение 10 минут, при 65°С в течение 6 минут и при 95°С в течение 3 минут для прекращения реакции. Затем образцы гДНК разводили 50 мкл воды и хранили при ~20°C для последующего анализа путем глубокого секвенирования.

[00666] C. Глубокое секвенирование гДНК из трансфицированных клеток

[00667] С использованием выделенной гДНК, первую ПЦР проводили с использованием смеси Q5 «горячего старта» High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA) в концентрации 1×, праймеров по 0,5 мкМ каждый, 3,75 мкл гДНК в конечном объеме 10 мкл и амплифицировали при 98°С в течение 1 минуты путем проведения 35 циклов по 10 секунд при 98°С, 20 секунд при 60°С, 30 секунд при 72°C и конечного удлинения при 72°C в течение 2 минут. Реакционную ПЦР-смесь разводили водой 1:100. Мишень-специфические праймеры показаны в Таблице 36. Мишень-специфические праймеры содержали последовательности, совместимые с Illumina, а поэтому продукты амплификации можно было проанализировать с использованием секвенатора MiSeq (Illumina, San Diego, CA).

[00668]

Таблица 36
Мишень-специфические праймеры, используемые для секвенирования
Мишень Олигонуклеотид*
Мишень Hsa03 Q, R
Мишень Hsa04 S, T
Мишень Hsa05 U, V
Мишень Hsa06 W, X
Мишень Hsa07 Y, Z
Мишень Hsa08 A2,B2
Мишень Hsa09 C2,D2
Мишень Hsa10 E2,F2

* Последовательности ДНК-праймера показаны в Таблице 35.

[00669] Вторую ПЦР «со штриховым кодированием» проводили так, чтобы каждая мишень была амплифицирована посредством праймеров (G2 и H2 в Таблице 35), каждый из которых содержал уникальные индексы длиной в 8 п.о. (обозначенные «NNNNNNNN» в последовательности праймеров (см. SEQ ID NO: 575 и SEQ ID NO: 576), что позволяет проводить демультиплексную реакцию каждого ампликона во время анализа последовательности.

[00670] Вторую ПЦР проводили с использованием смеси Q5 «горячего старта» High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA) в концентрации 1×, праймеров по 0,5 мкМ каждый, 1 мкл первого ПЦР-продукта, разведенного 1:100, в конечном объеме 10 мкл и амплифицировали при 98°С в течение 1 минуты, путем проведения 12 циклов по 10 секунд при 98°С, 20 секунд при 60°С, 30 секунд при 72°C и конечного удлинения при 72°C в течение 2 минут. Продукты ПЦР объединяли в одну микроцентрифужную пробирку для очистки ампликонов на основе сфер SPRIselect (Beckman Coulter, Pasadena, CA) для секвенирования.

[00671] К объединенным ампликонам добавляли 0,9-кратные объемы сфер SPRIselect, перемешивали и инкубировали при комнатной температуре в течение 10 минут. Микроцентрифужную пробирку помещали на магнитную подставку для пробирок (Beckman Coulter, Pasadena, CA) до тех пор, пока раствор не был осветлен. Супернатант удаляли и отбрасывали, а оставшиеся сферы промывали 1 объемом 85% этанола и инкубировали при комнатной температуре (КТ) в течение 30 секунд. После инкубирования этанол отсасывали и сферы сушили на воздухе при комнатной температуре в течение 10 минут. Затем микроцентрифужную пробирку снимали с магнитной подставки, и к сферам добавляли 0,25-кратный объем воды, интенсивно перемешивали и инкубировали в течение 2 минут при КТ. Микроцентрифужную пробирку центрифугировали в микроцентрифуге для сбора содержимого пробирки, а затем возвращали на магнитную подставку и инкубировали до тех пор, пока раствор не был осветлен, после чего, супернатант, содержащий очищенные ампликоны, распределяли по очищенным микроцентрифужным пробиркам. Библиотеку очищенных ампликонов количественно оценивали с использованием системы Nanodrop™ 2000 (Thermo Scientific, Wilmington, DE).

[00672] Библиотеку ампликонов нормализовали до концентрации 4 нМ, вычисленной исходя из оптической плотности на 260 нм (система Nanodrop ™ 2000 (Thermo Scientific, Wilmington, DE)) и размера ампликонов. Библиотека была проанализирована на секвенаторе MiSeq Sequencer (Illumina, San Diego, CA) с использованием набора реагентов MiSeq v2 путем проведения 300 циклов (Illumina, San Diego, CA), с двумя раундами по 151 циклу с парными концами плюс двух ридов для определения индекса по восемь циклов.

[00673] D. Анализ данных глубокого секвенирования

[00674] Идентичность продуктов в данных секвенирования анализировали на основании последовательностей индексного штрихкода, адаптированных к ампликонам во втором раунде ПЦР. Компьютерную команду на выполнение нижеследующих задач использовали для обработки данных MiSeq (Illumina, San Diego, CA):

[00675] Риды выравнивали с геномом человека (конструкции GRCh38/38) с использованием компьютерной программы Bowtie (bowtie-bio.sourceforge.net/index.shtml).

[00676] Выровненные риды сравнивали с локусами дикого типа; риды, не совпадающие ни с одной из частей локусов, были отброшены.

[00677] Были подсчитаны риды, совпадающие с последовательностью дикого типа. Риды с INDEL (приблизительно 10 п.о. от ожидаемого сайта разрезания FokI-Cascade RNP) были классифицированы по типу INDEL и подсчитаны.

[00678] Общее количество ридов с INDEL делили на сумму ридов дикого типа и ридов с INDEL с получением процента мутированных ридов.

[00679] На Фиг. 28 показано редактирование генома (фиг. 28, вертикальная ось, «% редактирования») в зависимости от нуклеофекции комплекса FokI-Cascade-NLS-Cas6 (n=1) (фиг. 27, горизонтальная ось, Hsa3, Hsa4, Hsa5, Hsa6, Hsa7, Hsa8, Hsa9 и Hsa10). На фиг. 28, белые столбцы представляют негативные контроли, а черные столбцы представляют добавление комплексов FokI-Cascade-NLS-Cas6. Комплексы FokI-Cascade-NLS-Cas6 индуцировали редактирование во всех восьми локусах. Редактирование варьировалось от ~0,2-5% INDEL, и эти INDEL были сосредоточены вокруг предполагаемого сайта разрезания в середине межспейсерной области.

[00680]

Пример 9

Введение плазмид, кодирующих компоненты комплексов FokI-Cascade RNP, в клетки-мишени

[00681] В этом примере проиллюстрированы конструирование и доставка комплексов Cascade E. coli типа I-E, содержащих гибридные белки FokI, для облегчения редактирования генома в клетках человека. В этом примере также описана доставка плазмидных векторов, экспрессирующих компоненты комплекса Cascade, в эукариотические клетки.

[00682] A. Получение вектора, кодирующего компоненты FokI-Cascade RNP, для переноса в клетки-мишени

[00683] Минимальный массив CRISPR был сконструирован так, чтобы он нацеливанлся на локус TRAC в геноме человека. Минимальный массив CRISPR содержал две спейсерные последовательности, каждая из которых была фланкирована последовательностями повторов CRISPR, как описано в Примерах 1 и 3. Две спейсерные последовательности локусов-мишеней в геноме были разделены 30 парами оснований, и каждый спейсер был комплементарен геномной последовательности, смежной с последовательностью AAG PAM. Плазмидный вектор, содержащий минимальный массив CRISPR, был получен путем лигирования гибридизованных олигонуклеотидов (Integrated DNA Technologies, Coralville, IA), кодирующих повтор CRISPR, фланкированный двумя спейсерными последовательностями, в экспрессионный вектор млекопитающих с двумя последовательностями повторов CRISPR. Полученная плазмида содержала мотив «повтор-спейсер-повтор-спейсер-повтор», который экспрессировал две руководящих последовательности от человеческого промотора U6 (hU6) (SEQ ID No: 454).

[00684] Гены, кодирующие белковые компоненты FokI-Cascade RNP, клонировали в плазмидные векторы, содержащие промоторы CMV, для обеспечения доставки и экспрессии в клетках млекопитающих. Гены Cas были клонированы в отдельные плазмиды (от SEQ ID NO: 448 до SEQ ID NO: 451 и SEQ ID NO: 453) или в одну плазмиду в виде полицистронной конструкции с каждым геном, связанным посредством последовательностей «вырезания рибосомы» вирусного пептида 2A (в SEQ ID NO: 455). Комплексы FokI-Cascade RNP были доставлены в эукариотические клетки двумя различными способами: гены cas и минимальный массив CRISPR были доставлены в отдельные плазмиды (систему доставки из шести плазмид, SEQ ID NO: 448 - SEQ ID NO: 451, SEQ ID NO: 453 и SEQ ID NO: 454), или в одну плазмиду, кодирующую все гены cas в виде полицистронной конструкции, и вторую плазмиду, кодирующую минимальный массив CRISPR (двухплазмидную систему доставки, SEQ ID NO: 454 и SEQ ID NО: 455).

[00685] B. Трансфекция плазмиды(плазмид), кодирующей(их) комплексы FokI-Cascade RNP.

[00686] Условия трансфекции для системы доставки из шести плазмид и системы доставки из двух плазмид были осуществлены, как подробно описано в Примере 8B, но со следующими модификациями. Перед нуклеофекцией, 5 мкл раствора плазмидного вектора переносили в отдельные лунки 96-луночного планшета. Система доставки из шести плазмид была первоначально протестирована путем оценки необходимости каждого компонента для редактирования генома. Более конкретно, «коктейли» плазмид добавляли в каждую лунку так, чтобы соблюдалось постоянное количество (420 нг) пяти плазмид и переменное количество шестой плазмиды (0 нг, 70 нг, 700 нг или 1400 нг). Затем сравнивали систему доставки из шести плазмид и систему доставки из двух плазмид путем нуклеофекции в фиксированном количестве (3,5 мкг) общей плазмидной ДНК, при этом, соотношение плазмиды минимального массива CRISPR к плазмиде (плазмидам), кодирующей(им) cas, варьировалось. И наконец, лизат собирали через ~72 часа после нуклеофекции для последующего анализа глубокого секвенирования.

[00687] C. Глубокое секвенирование гДНК из трансфицированных клеток и анализ данных.

Глубокое секвенирование осуществляли, как подробно описано в Примере 8C, но только с использованием мишень-специфических праймеров Y и Z Таблицы 36.

[00688] D. Анализ данных глубокого секвенирования

[00689] Анализ данных глубокого секвенирования был осуществлен как подробно описано в Примере 8D. На фиг. 29 показано редактирование генома (фиг. 29, вертикальная ось, «% редактирования») в локусе TRAC в зависимости от каждого компонента FokI-Cascade в стратегии доставки из шести плазмид (n=1) (фиг. 29, горизонтальная ось, руководящая последовательность FokI-Cas8, Cse2, Cas7, Cas5, Cas6 и контрольный образец). На фиг. 29, незаштриховаванные столбцы представляют 0 нг компонента FokI-Cascade, пунктирные столбцы представляют 70 нг компонента FokI-Cascade, столбцы с квадратным узором представляют 700 нг компонента FokI-Cascade, а полосатые столбцы представляют 1400 нг компонента FokI-Cascade (порядок полос на горизонтальной оси показан слева направо, соответственно, для каждого компонента FokI-Cascade). Как было показано, редактирование отменялось или резко сокращалось (в случае Cse2), если данный компонент отсутствовал. Это подтверждает, что каждый компонент Cascade необходим для редактирования посредством доставки плазмиды.

[00690] Ни Фиг. 30 показаны данные сравнения редактирования генома с помощью системы доставки из шести плазмид или системы доставки из двух плазмид. На фиг. 30 показано редактирование генома (фиг. 30, вертикальная ось, «% редактирования») в локусе-мишени в зависимости от различных концентраций каждого компонента систем из шести плазмид (фиг. 30, незаштриховаванные столбцы) и двух плазмид (фиг. 30, черные столбцы) (фиг. 30, порядок столбцов на горизонтальной оси показан слева направо, соответственно, для шестиплазмидной системы и двухплазмидной системы). Группы чисел по горизонтальной оси относятся к количеству компонентов: верхняя строка=общая плазмида в нг, вторая строка=плазмида минимального массива CRISPR в нг, и третья строка=плазмиды, кодирующие Cas, в нг (например, первая группа чисел: верхняя строка=общая плазмида, 3500 нг; вторая строка=плазмида минимального массива CRISPR, 0 нг; и третья строка=плазмиды, кодирующие Cas, 3500 нг).

[00691] В обоих этих способах наивысшие уровни редактирования были достигнуты при самым высоком отношении «плазмиды cas : плазмиды минимального массива CRISPR». Кроме того, полицистронная плазмида обеспечивала более высокие уровни редактирования, возможно, из-за увеличения уровня транскрипции на мкг плазмиды.

[00692]

Пример 10

Кольцевые пермутациии белков субъединицы Cascade

[00693] В этом примере проиллюстрированы in silico конструирование, клонирование, экспрессия и очистка белка Cas7 E. coli типа I-E с кольцевой пермутацией (cp) с применением метода моделирования в зависимости от структуры.

[00694] A. Конструирование in silico

[00695] Белок Cas7 типа I-E E. coli (SEQ ID NO: 18) подвергали циклической пермутации с применением метода на основе кристаллической структуры Cascade E. coli 5H9E.pdb (www.rcsb.org/pdb/; Hayes, R.P. et al., Nature 530 (7591): 499-503 (2016)). N-конец и С-конец нативного Cas7 были соединены посредством пептидного линкера из двух аминокислот, имеющих последовательность глицин-серин (G-S). Полипептидная последовательность этого кольцевого Cas7 была разомкнута в положении, соответствующем пептидной связи между остатками 301 и 302 в последовательности полипептида Cas7 дикого типа с образованием нового N-конца (остаток 302) и нового C-конца (остаток 301) и с получением варианта белка Cas7 с кольцевой пермутацией (белка cp-Cas7 V1). Новый N-конец и новый C-конец были сконструированы так, чтобы они были соединены с гибридным белком или линкерной областью без нарушения укладки белка Cas7 или сборки комплекса Cascade. Метиониновый остаток был присоединен к новому N-концу (то есть, аминокислотный остаток, соответствующий остатку 302 белка Cas7 дикого типа) белка V1 cp-Cas7 (SEQ ID NO: 578).

[00696] Второй белок cp-Cas7, белок cp-Cas7 V2, был сконструирован аналогичным образом с использованием линкера G-S. N-конец и C-конец белка V2 cp-Cas7 соответствуют остаткам 338 и 339, соответственно, в последовательности Cas7 дикого типа. Новый N-конец и новый C-конец были сконструированы так, чтобы они были соединены с гибридным белком или линкерной областью без нарушения укладки белка Cas7 или сборки комплекса Cascade. Метиониновый остаток был присоединен к N-концу (то есть аминокислотный остаток, соответствующий остатку 339 белка Cas7 дикого типа) белка V2 cp-Cas7 (SEQ ID NO: 579).

[00697] B. Клонирование, экспрессия и очистка комплексов Cascade, содержащих cp-Cas7

[00698] Кодирующие последовательности ДНК для сконструированных in silico полипептидных последовательностей белка cp-Cas7 V1 и белка cp-Cas7 V2 были оптимизированы по кодонам для экспрессии в E. coli.

[00699] Эти кодирующие последовательности ДНК были отправлены коммерческому производителю (GenScript, Piscataway, NJ) для синтеза. Последовательности ДНК отдельно вводили в экспрессионный вектор Cascade-оперонов (Таблица 19; SEQ ID NO: 441) для замены белка Cas7 дикого типа в экспрессионном векторе, как описано в Примере 2.

[00700] Каждый экспрессионный вектор переносили в клетки E. coli BL21 Star™ (Thermo Fisher Scientific, Waltham, МA) вместе со вторым вектором, кодирующим руководящую РНК для мишени J3 (SEQ ID NO: 444), представленную в Таблице 20, как описано в Примере 2. Клетки культивировали, как описано в Примере 4B. Комплексы Cascade E. coli типа I-E, содержащие белки Cas5