Композиции химерного поксвируса и их применение



Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
Композиции химерного поксвируса и их применение
C07K2317/565 - Пептиды (пептиды в пищевых составах A23, например получение белковых композиций для пищевых составов A23J, препараты для медицинских целей A61K; пептиды, содержащие бета-лактамовые кольца, C07D; циклические дипептиды, не содержащие в молекуле любого другого пептидного звена, кроме образующего их кольцо, например пиперазин-2,5-дионы, C07D; алкалоиды спорыньи циклического пептидного типа C07D519/02; высокомолекулярные соединения, содержащие статистически распределенные аминокислотные единицы в молекулах, т.е. при получении предусматривается не специфическая, а случайная последовательность аминокислотных единиц, гомополиамиды и блоксополиамиды, полученные из аминокислот, C08G 69/00; высокомолекулярные продукты, полученные из протеинов, C08H 1/00; получение

Владельцы патента RU 2757002:

СИТИ ОФ ХОУП (US)

Изобретение относится к биотехнологии. Описан химерный поксвирус для лечения рака, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO:1 или SEQ ID NO:2, при этом указанная последовательность нуклеиновой кислоты включает: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; или (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент. Также описана нуклеиновая кислота, кодирующая химерный поксвирус и фармацевтическая композиция для лечения рака, содержащая терапевтически эффективное количество химерного поксвируса. Представлен способ лечения рака у пациента, включающий введение указанному пациенту терапевтически эффективного количество химерного поксвируса. Изобретение расширяет арсенал средств для борьбы с раком. 4 н. и 63 з.п. ф-лы, 57 ил., 5 табл., 9 пр.

 

Ссылки на родственные заявки

[0001] В настоящей заявке испрашивается приоритет по временной заявке США №62/372408, поданной 9 августа 2016 года, и временной заявке США №62/519010, поданной 13 июня 2017 года, которые полностью включены в настоящее описание в качестве ссылки для любых целей.

Ссылка на «список последовательностей», таблицу или приложение к списку компьютерных программ, представленных в файле ascii.

[0002] Список последовательностей, записанный в файле 48440-606001WO_ST25, создан 8 августа 2017 года, 696 239 байт, формат компьютера IBM-PC, операционная система MS-Windows, включен настоящим посредством ссылки.

Уровень техники

[0003] Рак является второй ведущей причиной смерти в США. В последние годы был достигнут значительный прогресс в иммунотерапии рака, включая ингибиторы иммунных контрольных точек, Т-клетки с химерными антигенными рецепторами и онколитические вирусы. Онколитические вирусы представляют собой встречающиеся в природе или генетически модифицированные вирусы, которые инфицируют, размножаются и, в конечном итоге, убивают раковые клетки, оставляя здоровые клетки неповрежденными. Однако клинические преимущества онколитических вирусов в качестве самостоятельных видов лечения остаются ограниченными. В данной области техники необходимы новые композиции, использующие преимущества полезных свойств онколитических вирусов, при этом максимально повышающие безопасность и клинические результаты. В данном документе, среди прочего, раскрыты решения этих и других проблем в данной области техники.

Сущность изобретения

[0004] В одном аспекте изобретение относится к химерному поксвирусу, содержащему последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1 или SEQ ID NO: 2, при этом последовательность нуклеиновой кислоты включает фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, включающей штамм Brighton вируса коровьей оспы, штамм Herman поксвируса енотов, штамм Utrecht поксвируса кроликов, штамм WR вируса осповакцины, штамм IHD вируса осповакцины, штамм Elstree вируса осповакцины, штамм CL вируса осповакцины, штамм Lederle-Chorioallantoic вируса осповакцины, штамм AS вируса осповакцины, штамм NZ2 орф-вируса и штамм TJS псевдопоксвируса коров.

[0005] В одном аспекте изобретение относится к выделенной нуклеиновой кислоте, кодирующей химерный поксвирус, который описан в настоящем описании.

[0006] В одном аспекте изобретение относится к фармацевтической композиции, содержащей терапевтически эффективное количество химерного поксвируса, который описан в настоящем описании.

[0007] В другом аспекте изобретение относится к способу лечения рака у пациента, включающему введение пациенту терапевтически эффективного количества химерного поксвируса, который описан в настоящем описании, с осуществлением, тем самым, лечения рака у пациента. В вариантах осуществления рак представляет собой рак молочной железы, рак толстой кишки, рак почек, лейкоз, рак легкого, меланому, рак яичников, рак предстательной железы, рак поджелудочной железы, рак мозга, рак печени, рак желудка или саркому.

[0008] В другом аспекте изобретение относится к способу получения химерного поксвируса, включающему: инфицирование клетки по меньшей мере двумя штаммами поксвируса, выбранными из группы, включающей штамм Brighton вируса коровьей оспы, штамм Herman поксвируса енотов, штамм Utrecht поксвируса кроликов, штамм WR вируса осповакцины, штамм IHD вируса осповакцины, штамм Elstree вируса осповакцины, штамм CL вируса осповакцины, штамм Lederle-Chorioallantoic вируса осповакцины, штамм AS вируса осповакцины, штамм NZ2 орф-вируса и штамм TJS псевдопоксвируса коров; и обеспечение возможности репликации по меньшей мере двух штаммов поксвируса, с получением тем самым химерного поксвируса.

[0009] В одном аспекте изобретение относится к способу ингибирования клеточной пролиферации клетки, включающему приведение в контакт клетки с химерным поксвирусом, как описано в настоящем описании.

[0010] В одном аспекте изобретение относится к химерному поксвирусу, содержащему последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1 или SEQ ID NO: 2, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; или (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0011] В другом аспекте изобретение относится к химерному поксвирусу, содержащему последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; или (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0012] В другом аспекте изобретение относится к химерному поксвирусу, содержащему последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 2, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; или (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0013] В другом аспекте изобретение относится к химерному поксвирусу, содержащему последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 3, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; или (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0014] В одном аспекте изобретение относится к химерному поксвирусу, содержащему последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1 или SEQ ID NO: 2, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; (iii) одну или более связывающих последовательностей нуклеиновой кислоты; или (iv) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0015] В другом аспекте изобретение относится к химерному поксвирусу, содержащему последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; (iii) одну или более связывающих последовательностей нуклеиновой кислоты; или (iv) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0016] В другом аспекте изобретение относится к химерному поксвирусу, содержащему последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 2, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; (iii) одну или более связывающих последовательностей нуклеиновой кислоты; или (iv) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0017] В другом аспекте изобретение относится к химерному поксвирусу, содержащему последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 3, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; (iii) одну или более связывающих последовательностей нуклеиновой кислоты; или (iv) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

Краткое описание чертежей

[0018] ФИГ. 1. Изоляты новых химерных ортопоксвирусов #33 (SEQ ID NO: 1) и #17 (SEQ ID NO: 3) демонстрируют превосходную способность уничтожать раковые клетки по сравнению с родительскими индивидуальными штаммами вируса дикого типа и контрольными вирусами GLV-1h68 и OncoVEX GFP.

[0019] ФИГ. 2. Изолят нового химерного парапоксвируса #189 (SEQ ID NO: 2) демонстрирует превосходную способность уничтожать раковые клетки по сравнению с родительскими индивидуальными штаммами вируса дикого типа и контрольными вирусами GLV-1h68 и OncoVEX GFP.

[0020] ФИГ. 3. Изоляты новых химерных ортопоксвирусов #17 (SEQ ID NO: 3) и #33 (SEQ ID NO: 1) демонстрируют мощную способность уничтожать раковые клетки в клеточных линиях рака поджелудочной железы по сравнению с их родительскими штаммами вируса и контрольными вирусами GLV-1h68 и OncoVEX GFP.

[0021] ФИГ. 4. Изолят нового химерного парапоксвируса #189 (SEQ ID NO: 2) демонстрирует мощную способность уничтожать раковые клетки в клеточных линиях рака поджелудочной железы по сравнению с их родительскими штаммами вируса и контрольными вирусами GLV-1h68 и OncoVEX GFP.

[0022] ФИГ. 5A-5C. Изоляты новых химерных вирусов #33 (SEQ ID NO: 1) и #189 (SEQ ID NO: 2) демонстрируют превосходную способность уничтожать клетки в клеточных линиях рака желудка. Раковые клетки инфицировали каждым вирусом при MOI 0,01, 0,1 и 1,0, Жизнеспособность клеток через 96 часов после инфицирования наносили на график в зависимости от MOI в клеточных линиях рака желудка MKN-45 (Фиг. 5A), OCUM-2M (Фиг. 5B) и KATO-3 (Фиг. 5C).

[0023] ФИГ. 6A-6D. Цитотоксический эффект HOV-189 (SEQ ID NO: 2) in vitro зависит как от времени, так и от дозы в клеточных линиях трижды негативного рака молочной железы. (Фиг. 6A) Hs578T. LD50, MOI 0,396 (SD 0,113), (Фиг. 6B) BT549. LD50, MOI 1,636 (SD 0,539), (Фиг. 6C) MDA-MB-468. LD50, MOI 0,185 (SD 0,071), (Фиг. 6D) MDA-MB-231. LD50, MOI 1,712 (SD 1,263). LD50 (через 96 ч), средняя летальная доза; MOI, множественность заражения; SD, стандартное отклонение.

[0024] ФИГ. 7. Репликация HOV-189 (SEQ ID NO: 2) в клеточных линиях трижды негативного рака молочной железы. Эффективная репликация вируса происходила in vitro в клеточных линиях BT549, Hs578T и MDA-MB-231 при низкой множественности заражения (MOI 0,01). Репликация HOV-189 в MDA-MB-468 была низкой при MOI 0,01. При MOI 10 репликация HOV-189 в MDA-MB-468 оставалась почти на два порядка ниже, чем трех других клеточных линий.

[0025] ФИГ. 8. Интратуморальная инъекция HOV-189 (SEQ ID NO: 2) в ксенотрансплантаты MDA-MB-468 эффективно уменьшает относительный размер опухоли в дозах, составляющих всего 103 БОЕ на опухоль, по сравнению с контролем. Опухоли инъецировали PBS (контроль), 103 БОЕ на опухоль, 104 БОЕ на опухоль или 105 БОЕ на опухоль при исходном объеме опухоли, составляющем приблизительно 100-150 мм3. Размер опухоли измеряли приблизительно каждые 3 дня, и эффект обработки был устойчивым через 6 недель после инъекции.

[0026] ФИГ. 9. Не наблюдали значительного снижения относительной массы тела у голых мышей, обработанных интратуморальной инъекцией HOV-189 (SEQ ID NO: 2), по сравнению с инъецированными PBS контролями. Массу тела измеряли приблизительно каждые 3 дня.

[0027] ФИГ. 10A-10C. HOV-189 (SEQ ID NO: 2) инфицирует опухоли MDA-MB-468 in vivo. Иммунофлуоресцентное обнаружение поликлонального антитела против орф-вируса демонстрирует вирусную инфекцию опухолевой ткани ксенотрансплантата MDA-MB-468, собранной через 1 неделю после интратуморальной инъекции HOV-189. (Фиг. 10A) Контрольная опухоль, 10X, (Фиг. 10B) Опухоль из группы обработки 105 БОЕ, 10X, (Фиг. 10C) Опухоль из группы обработки 105 БОЕ, 60X. (ORF и контрастный краситель DAPI).

[0028] ФИГ. 11. Интратуморальная инъекция HOV-189 (SEQ ID NO: 2) оказывает туморостатическое действие на отдаленную неинъецированную опухоль. Вторые опухоли молочной железы, полученные в ксенотрансплантатах MDA-MB-468, обрабатывали одной интратуморальной инъекцией HOV-189 при 105 БОЕ, тогда как четвертые опухоли молочной железы не инъецировали. Контрольные опухоли инъецировали PBS. Размер опухоли измеряли приблизительно каждые 3 дня.

[0029] ФИГ. 12A-12L. Анализ цитотоксичности проводили на клеточных линиях рака PANC-1, MiaPaCa-2, BxPC-3, SU.86.86, Capan-1 и AsPC-1 посредством культивирования 3×103 раковых клеток на лунку в 100 мкл RPMI, 5% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов. 20 мкл вируса, как указано, затем добавляли при множественности заражения (MOI) 1, 0,1 и 0,01. Ежедневный анализ жизнеспособности клеток проводили, добавляя 20 мкл CellTiter 96 Aqueous One Solution Cell Proliferation Assay во все лунки и считывая колориметрические показатели после 1 часа инкубации. Результаты эксперимента стандартизировали только для среды и контроля с MOI 0. Этот эксперимент повторяли в трех повторах. Представлены графики, показывающие процент выживания клеток с течением времени для PANC-1 (Фиг. 12A), MiaPaCa-2 (Фиг. 12C), BxPC-3 (Фиг. 12E), SU.86.86 (Фиг. 12G), Capan-1 (Фиг. 12I) и AsPC-1 (Фиг. 12K), обработанных #33 при MOI 1, 0,1 или 0,01. Также представлены столбиковые диаграммы, сравнивающие процент выживаемости клеток через 120 часов для раковых клеток PANC-1 (Фиг. 12B), MiaPaCa-2 (Фиг. 12D), BxPC-3 (Фиг. 12F), SU.86.86 (Фиг. 12H), Capan-1 (Фиг. 12J) и AsPC-1 (Фиг. 12L), обработанных вирусом, как указано. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, как указано, используя однофакторный дисперсионный анализ в каждый момент времени. Для SU.86.86 (Фиг. 12H) статистический анализ проводили, используя непарный t-тест для каждой MOI.

[0030] ФИГ. 13A-13L. Кривую репликации вируса строили на клеточных линиях рака PANC-1, MiaPaCa-2, BxPC-3, SU.86.86, Capan-1, и AsPC-1 посредством культивирования клеток при 5×105 клеток на лунку в 2 мл RPMI, 10% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов в трех повторах. Затем среды аспирировали, и добавляли #33, OncoVEX GFP, GLV-1h68 или #189 при множественности заражения (MOI) 0,01 в 500 мкл RPMI, 2,5% FBS, 1% раствора антибиотика-антимикотика в течение 1 часа, встряхивая каждые 20 минут. Через один час среды аспирировали, и добавляли 1,5 мл RPMI, 2,5% FBS, 1% раствора антибиотика-антимикотика. Через 24, 48 и 72 часа собирали клетки и супернатант, и после трех циклов заморозки и оттаивания выполняли серийные разведения в двух повторах. Этот эксперимент повторяли в двух повторах. Представленные графики демонстрируют БОЕ/миллион клеток с течением времени для раковых клеток PANC-1 (Фиг. 13A), MiaPaCa-2 (Фиг. 13C), BxPC-3 (Фиг. 13E), SU.86.86 (Фиг. 13G), Capan-1 (Фиг. 13I) и AsPC-1 (Фиг. 13K), обработанных вирусом, как указано. Также представлены столбиковые диаграммы, сравнивающие БОЕ/миллион клеток в каждый момент времени для каждого вируса в раковых клетках, обработанных PANC-1 (Фиг. 13B), MiaPaCa-2 (Фиг. 13D), BxPC-3 (Фиг. 13F), SU.86.86 (Фиг. 13H), Capan-1 (Фиг. 13J) и AsPC-1 (Фиг. 13L). Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени.

[0031] ФИГ. 14A-14C. Восемнадцати самкам бестимусных голых мышей Nude-Foxn1nu (Envigo, Indianapolis, IN) имплантировали 2×106 двусторонних боковых опухолей MiaPaCa-2. Как только размеры опухоли достигали 400 мм3, в левостороннюю опухоль инъецировали 50 мкл PBS (3 мыши), #33 (5 мышей), #33-(SE)hNIS или #33-(SE)hNIS-E9LmiR100t (5 мышей) при приблизительно 1×105 БОЕ/доза. Чистое процентное изменение массы (Фиг. 14A) и процентное изменение (Фиг. 14B) инъецированных опухолей и процентное изменение неинъецированных опухолей (FID. 14C) регистрировали два раза в неделю в течение 43 дней.

[0032] ФИГ. 15A-15C. Двадцати шести самкам бестимусных голых мышей Nude-Foxn1nu (Envigo, Indianapolis, IN) имплантировали 1,25×106 двусторонних боковых опухолей PANC-1. Как только размеры опухоли достигали приблизительно 250 мм3, в левостороннюю опухоль инъецировали 50 мкл PBS (4 мыши), #33 (6 мышей), #33-(SE)hNIS (6 мышей), #33-(SE)hNIS-E9LmiR100t (5 мышей) или #33-(H5)Fluc2 при приблизительно 1×103 БОЕ/доза. Чистое процентное изменение массы (Фиг. 15A) и процентное изменение (Фиг. 15B) инъецированных опухолей и процентное изменение неинъецированных опухолей (Фиг. 15C) регистрировали два раза в неделю в течение 43 дней.

[0033] ФИГ. 16. Два раза в неделю одной контрольной PBS-мыши и 3 инъецированным #33-(H5)Fluc2 мышам интраперитонеально инъецировали 4,28 мг люциферина в 150 мкл PBS. Через 7 минут получали люциферазную визуализацию при стандартной выдержке. Относительную единицу регистрировали в каждый момент времени и анализировали относительно контрольных мышей PBS в качестве исходного уровня.

[0034] ФИГ. 17A-17D. Анализ цитотоксичности проводили на клеточных линиях рака HT-29 и HCT-116 посредством культивирования клеток при 3×103 на лунку в 100 мкл среды МакКоя 5А, 5% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов. 20 мкл вируса, либо #33, #33-(SE)hNIS, #33-(H5)Emerald, OncoVEXGFP, GLV-1h68, либо #189, затем добавляли при множественности заражения (MOI) 1, 0,1 и 0,01. Ежедневный анализ жизнеспособности клеток проводили, добавляя 20 мкл CellTiter 96 Aqueous One Solution Cell Proliferation Assay во все лунки и считывая колориметрические показатели после 1 часа инкубации. Результаты эксперимента стандартизировали только для среды и контроля с MOI 0. Этот эксперимент повторяли в трех повторах. Представлены графики, показывающие процент выживания клеток с течением времени для HT-29 (Фиг. 17A) и HCT-116 (Фиг. 17C), обработанные #33 при MOI 1, 0,1 или 0,01. Также представлены столбиковые диаграммы, сравнивающие процент выживаемости клеток через 120 часов для раковых клеток HT-29 (Фиг. 17B) и HCT-116 (Фиг. 17D), обработанных вирусом, как указано. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени.

[0035] ФИГ. 18A-18F. Анализ цитотоксичности проводили на клеточных линиях рака SW620, SW480 и COLO 320DM посредством культивирования клеток при 3×103 на лунку в 100 мкл RPMI, 5% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов. 20 мкл вируса, либо #33, #33-(SE)hNIS, #33-(H5)Emerald, OncoVEXGFP, GLV-1h68, либо #189 затем добавляли при множественности заражения (MOI) 1, 0,1 и 0,01. Ежедневный анализ жизнеспособности клеток проводили, добавляя 20 мкл CellTiter 96 Aqueous One Solution Cell Proliferation Assay во все лунки и считывая колориметрические показатели после 1 часа инкубации. Результаты эксперимента стандартизировали только для среды и контроля с MOI 0. Этот эксперимент повторяли в трех повторах. Представлены графики, показывающие процент выживания клеток с течением времени для SW620 (Фиг. 18A), SW480 (Фиг. 18C) и COLO 320DM (Фиг. 18E), обработанных #33 при MOI 1, 0,1 или 0,01. Также представлены столбиковые диаграммы, сравнивающие процент выживаемости клеток через 120 часов для раковых клеток SW620 (Фиг. 18B), SW480 (Фиг. 18D) и COLO 320DM (Фиг. 18F), обработанных вирусом, как указано. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени. «NS» над сравниваемым столбиком означает «несущественно».

[0036] ФИГ. 19A-19B. Анализ цитотоксичности проводили на клеточной линии рака LoVo посредством культивирования клеток при 3×103 на лунку в 100 мкл среды F-12K, 5% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов. 20 мкл вируса, либо #33, #33-(SE)hNIS, #33-(H5)Emerald, OncoVEXGFP, GLV-1h68, либо #189 затем добавляли при множественности заражения (MOI) 1, 0,1 и 0,01. Ежедневный анализ жизнеспособности клеток проводили, добавляя 20 мкл CellTiter 96 Aqueous One Solution Cell Proliferation Assay во все лунки и считывая колориметрические показатели после 1 часа инкубации. Результаты эксперимента стандартизировали только для среды и контроля с MOI 0. Этот эксперимент повторяли в трех повторах. На ФИГ. 19A показан процент выживаемости клеток с течением времени для раковых клеток LoVo, обработанных #33 при MOI 1, 0,1 или 0,01. На ФИГ. 19B показана столбиковая диаграмма, сравнивающая процент выживаемости клеток через 120 часов для раковых клеток LoVo, обработанных вирусом, как указано. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени. «NS» над сравниваемым столбиком означает «несущественно».

[0037] ФИГ. 20A-20D. Кривую репликации вируса строили на клеточных линиях рака HT-29 и HCT-116 посредством культивирования клеток при 5×105 клеток на лунку в 2 мл среды МакКоя 5А, 10% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов в трех повторах. Затем среды аспирировали, и добавляли #33, #33-(SE)hNIS, #33-(H5)Emerald, OncoVEXGFP, GLV-1h68 или #189 при множественности заражения (MOI) 0,01 в 500 мкл среды МакКоя 5А, 2,5% FBS, 1% раствора антибиотика-антимикотика в течение 1 часа, встряхивая каждые 20 минут. Через один час среды аспирировали, и добавляли 1,5 мл среды МакКоя 5А, 2,5% FBS, 1% раствора антибиотика-антимикотика. Через 24, 48 и 72 часа собирали клетки и супернатант, и после трех циклов заморозки и оттаивания выполняли серийные разведения в двух повторах. Этот эксперимент повторяли в двух повторах. Представленные графики демонстрируют БОЕ/миллион клеток с течением времени для HT-29 (Фиг. 20A) и HCT-116 (Фиг. 20C). Также представлены столбиковые диаграммы, сравнивающие БОЕ/миллион клеток в каждый момент времени для каждого вируса в раковых клетках, обработанных HT-29 (Фиг. 20B) и HCT-116 (Фиг. 20D). Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени.

[0038] ФИГ. 21A-21D. Кривую репликации вируса строили на клеточных линиях рака SW620 и SW480 посредством культивирования клеток при 5×105 клеток на лунку в 2 мл RPMI, 10% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов в трех повторах. Затем среды аспирировали, и добавляли #33, #33-(SE)hNIS, #33-(H5)Emerald, OncoVEXGFP, GLV-1h68, или #189 при множественности заражения (MOI) 0,01 в 500 мкл RPMI 2,5% FBS, 1% раствора антибиотика-антимикотика в течение 1 часа, встряхивая каждые 20 минут. Через один час среды аспирировали, и добавляли 1,5 мл RPMI, 2,5% FBS, 1% раствора антибиотика-антимикотика. Через 24, 48 и 72 часа собирали клетки и супернатант, и после трех циклов заморозки и оттаивания выполняли серийные разведения в двух повторах. Этот эксперимент повторяли в двух повторах. Представленные графики демонстрируют БОЕ/миллион клеток с течением времени для SW620 (Фиг. 21A) и SW480 (Фиг. 21C). Также представлены столбиковые диаграммы, сравнивающие БОЕ/миллион клеток в каждый момент времени для каждого вируса в раковых клетках, обработанных SW620 (Фиг. 21B) и SW480 (Фиг. 21D). Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени.

[0039] ФИГ. 22. Иммуногистохимический анализ раковых клеток HCT-116, инфицированных вирусом #33 или #33-(SE)hNIS. Изображения получены через 24 ч после инъекции с MOI 0,01.

[0040] ФИГ. 23. Иммуногистохимический анализ HT-29 раковых клеток, инфицированных вирусом #33 или #33-(SE)hNIS. Изображения получены через 24 ч после инъекции с MOI 0,01.

[0041] ФИГ. 24. Четырнадцати самкам бестимусных голых мышей Nude-Foxn1nu (Envigo, Indianapolis, IN) имплантировали 5×106 клеток HT-29 на двусторонние боковые опухоли. Как только размеры опухоли достигали приблизительно 200 мм3, в обе опухоли инъецировали 50 мкл PBS (4 мыши), #33 (5 мышей) или #33-(H5)Fluc2 (5 мышей) при приблизительно 1×105 БОЕ/доза. Чистое процентное изменение массы и процентное изменение опухолей регистрировали два раза в неделю в течение 42 дней. На ФИГ. 24 показан процент изменения опухоли HT-29 с течением времени. Значимое различие в процентном изменении объема опухоли отметили при сравнении контроля PBS как с #33 (3 мыши), так и #33-(H5)Fluc2 (p=0,02 и p=0,03, соответственно).

[0042] ФИГ. 25. Два раза в неделю одной контрольной PBS-мыши и 3 инъецированным #33-(H5)Fluc2 мышам инъецировали 4,28 мг люциферина в 150 мкл PBS интраперитонеально. Через 7 минут люциферазную визуализацию получали при стандартной выдержке. Относительную единицу регистрировали в каждый момент времени и анализировали относительно контрольных мышей PBS в качестве исходного уровня.

[0043] ФИГ. 26. Девятнадцати самкам бестимусных голых мышей Nude-Foxn1nu (Envigo, Indianapolis, IN) имплантировали 5×106 двусторонних боковых опухолей HCT-116. Как только размеры опухоли достигали приблизительно 200 мм3, в обе опухоли инъецировали 50 мкл PBS (2 мыши), #33 (3 мыши), #33-(SE)hNIS или #33-(H5)Fluc2 при приблизительно 1×105 БОЕ/доза. Чистое процентное изменение массы и процентное изменение опухолей регистрировали два раза в неделю в течение 42 дней. На ФИГ. 25 показан процент изменения опухоли HCT-116 с течением времени. Значимое различие в процентном изменении объема опухоли отметили при сравнении контроля PBS с #33 (3 мыши), #33-(SE)hNIS и #33-(H5)Fluc2 (p=0,0002, p=0,0001 и p=0,0002, соответственно).

[0044] ФИГ. 27. Два раза в неделю одной контрольной PBS-мыши и 3 инъецированным #33-(H5)Fluc2 мышам интраперитонеально инъецировали 4,28 мг люциферина в 150 мкл PBS. Через 7 минут люциферазную визуализацию получали при стандартной выдержке. Относительную единицу регистрировали в каждый момент времени и анализировали относительно контрольных мышей PBS в качестве исходного уровня.

[0045] ФИГ. 28A-28C. Опосредованная онколитическим вирусом цитотоксичность в клетках рака легких и фибробластах легких через 72 ч после инъекции. 5000 клеток A549, H2199 или HF1 фибробластов культивировали в каждой лунке 96-луночного планшета. На следующий день клетки инфицировали различными вирусами (#33, #33-(H5)Emerald, #189, GLV-1h68, OncoVEXGFP) с указанной множественностью заражения (MOI; 0, 0,001, 0,01, 0,1, 1 MOI) или псевдоинфицировали. Жизнеспособность клеток определяли, используя CellTiter96AQueous One Solution (Promega; Cat#G3581) через 72 часа после инъекции. Выживаемость инфицированных клеток A549 (Фиг. 28A), клеток H2199 (Фиг. 28B) или фибробластов HF1 (Фиг. 28C) вычисляли по отношению к выживаемости псевдоинфицированных клеток.

[0046] ФИГ. 29. GFP-изображения по дням для ксенотранстплантантной модели А549 после однократной инъекции 1000 БОЕ вируса (#33-(H5)Emerald, GLV-1h68 или OncoVEXGFP интратуморально), как указано, в правую опухоль.

[0047] ФИГ. 30. Масса мышей по дням для ксенотранстплантантной модели А549. Через 3 недели после инъекции опухолевых клеток А549 мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3), и в правостороннюю опухоль каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VECTM, #189, контроль PBS) или интраперитонеально (i.p.) инъецировали #33-(H5)Emerald. Мышей взвешивали два раза в неделю, и показано процентное изменение их массы. Каждая линия представляет массу отдельной мыши.

[0048] ФИГ. 31A-31B. Регрессия опухоли для ксенотранстплантантной модели А549. Через 3 недели после инъекции опухолевых клеток А549 мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3), и в правостороннюю опухоль каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VECTM, #189, контроль PBS), или интраперитонеально (i.p.) инъецировали #33-(H5)Emerald. Объем инъецированной (Фиг. 31A) и неинъецированной (Фиг. 31B) опухоли измеряли два раза в неделю, используя цифровые штангенциркули. Каждая линия представляет объем опухоли отдельной мыши.

[0049] ФИГ. 32. Объем инфицированных вирусом опухолей в ксенотранстплантантной модели А549. Через 3 недели после инъекции опухолевых клеток А549 мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3), и в правостороннюю опухоль каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VECTM, #189, контроль PBS), или интраперитонеально (i.p.) инъецировали #33-(H5)Emerald. Объем опухолей измеряли два раза в неделю, используя цифровые штангенциркули. Каждая линия представляет средний объем инъецированных опухолей в отдельных группах обработки со стандартным отклонением. Статистический анализ: однофакторный дисперсионный анализ на 24 день (*=p<0,05).

[0050] ФИГ. 33. Объем неинъецированных опухолей в ксенотранстплантантной модели А549. Через 3 недели после инъекции опухолевых клеток А549 мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3), и в правостороннюю опухоль каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VECTM, #189, контроль PBS), или интраперитонеально (i.p.) инъецировали #33-(H5)Emerald. Объем опухолей для неинъецированной опухоли измеряли два раза в неделю, используя цифровые штангенциркули. Каждая линия представляет средний объем инъецированных опухолей в отдельных группах обработки со стандартным отклонением. Статистический анализ: однофакторный дисперсионный анализ на 24 день (*=p<0,05).

[0051] ФИГ. 34A-34B. Кратность изменения объема опухоли. Через 3 недели после инъекции опухолевых клеток А549 мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3), и в правостороннюю опухоль каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VECTM, #189, контроль PBS), или интраперитонеально (i.p.) инъецировали #33-(H5)Emerald. Объем опухолей измеряли два раза в неделю, используя цифровые штангенциркули. Кратность изменения объема опухоли для инъецированных (Фиг. 34A) и неинъецированных (Фиг. 34B) опухолей вычисляли путем нормализации объемов опухоли в различные моменты времени объемами опухоли в момент инъекции вируса (т.е. 0 день). На ФИГ. 34A-34B каждая линия представляет средний объем опухоли в отдельных группах обработки со стандартным отклонением. Статистический анализ: однофакторный дисперсионный анализ на 24 день (*=p<0,05).

[0052] ФИГ. 35A-35B. Биораспределение вирусов в инъецированных и неинъецированных опухолях (модель А549). Через 3 недели после инъекции опухолевых клеток А549 мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3), и только в правостороннюю опухоль правой сторон у каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP). Через шесть дней после инъекции вируса производили сбор опухолей и нормальных органов. Собранные ткани взвешивали, измельчали на мелкие кусочки и гомогенизировали в 1 мл PBS, используя гомогенизатор Bullet Blender Gold. Гомогенаты подвергали 3 циклам замораживания-оттаивания с последующей обработкой ультразвуком в течение 1 минуты. Гомогенаты центрифугировали при 1000 об/мин в течение 3 минут, а супернатанты собирали. Супернатанты серийно разводили и определяли титр вируса, используя стандартный анализ бляшкообразования. На ФИГ. 35A показаны БОЕ/г опухоли для каждого вируса в инъецированной опухоли. На ФИГ. 35B показаны БОЕ/г опухоли для каждого вируса в неинъецированной опухоли.

[0053] ФИГ. 36. Титр вирусов в яичниках мышей (модель А549). Через 3 недели после инъекции опухолевых клеток А549 мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3), и только в правостороннюю опухоль правой сторон у каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VEC™). Через шесть дней после инъекции вируса производили сбор опухолей и нормальных органов. Собранные ткани взвешивали, измельчали на мелкие кусочки и гомогенизировали в 1 мл PBS, используя гомогенизатор Bullet Blender Gold. Гомогенаты подвергали 3 циклам замораживания-оттаивания с последующей обработкой ультразвуком в течение 1 минуты. Гомогенаты центрифугировали при 1000 об/мин в течение 3 минут, а супернатанты собирали. Супернатанты серийно разводили и определяли титр вируса, используя стандартный анализ бляшкообразования. На ФИГ. 36 показаны БОЕ/г ткани (яичников) для каждого вируса. Не обнаружено (ND).

[0054] ФИГ. 37. Титр вирусов в крови через 20 дней после инъекции вируса. Через 3 недели после инъекции опухолевых клеток А549 мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3), и только в правостороннюю опухоль правой сторон у каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VEC™). Кровь брали у мышей (n=3) путем пункции лицевой вены. После 3 циклов замораживания и оттаивания кровь серийно разводили, и определяли титр вируса, используя стандартный анализ бляшкообразования. На ФИГ. 37 показаны БОЕ/мл крови для каждого инъецированного вируса. Не обнаружено (ND).

[0055] ФИГ. 38. Химерный вирус #33 более эффективен, чем родительские вирусы, в уничтожении клеток рака легких (A549). Анализ цитотоксичности: 5000 клеток культивировали в каждой лунке 96-луночного планшета. На следующий день клетки инфицировали химерным вирусом #33 или родительскими вирусами с указанной множественностью заражения (MOI), или псевдоинфицировали. Жизнеспособность клеток определяли, используя CellTiter96AQueous One Solution (Promega; Cat#G3581), через 72 часа после инъекции. Выживаемость инфицированных клеток вычисляли относительно выживаемости псевдоинфицированных клеток.

[0056] ФИГ. 39. Изменение массы тела после обработки. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 103 БОЕ указанных вирусов интратуморально инъецировали только в правостороннюю опухоль каждой мыши. Мышей взвешивали два раза в неделю, и процентное изменение их массы наносили на график. Каждая линия представляет массу отдельной мыши.

[0057] ФИГ. 40. Регрессия опухоли. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 103 БОЕ указанных вирусов интратуморально инъецировали только в правостороннюю опухоль каждой мыши. Объем опухолей (и инъецированных, и неинъецированных) измеряли два раза в неделю, используя цифровой штангенциркуль (объем={(длина)2× ширина/2}. Каждая линия представляет объем опухоли отдельной мыши.

[0058] ФИГ. 41. Титр вирусов в инъецированных и неинъецированных опухолях через 7 дней после инъекции. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 103 БОЕ указанных вирусов интратуморально инъецировали только в правостороннюю опухоль каждой мыши. Через шесть дней после инъекции вируса производили сбор опухолей и нормальных органов. Собранные ткани взвешивали, измельчали на мелкие кусочки и гомогенизировали в 1 мл PBS, используя гомогенизатор Bullet Blender Gold. Гомогенаты подвергали 3 циклам замораживания-оттаивания с последующей обработкой ультразвуком в течение 1 минуты. Гомогенаты центрифугировали при 1000 об/мин в течение 3 минут, а супернатанты собирали. Супернатанты серийно разводили, и определяли титр вируса, используя стандартный анализ бляшкообразования.

[0059] ФИГ. 42. Биораспределение вирусов. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 103 БОЕ указанных вирусов интратуморально инъецировали только в правостороннюю опухоль каждой мыши. Через шесть дней после инъекции вируса производили сбор опухолей и нормальных органов. Собранные ткани взвешивали, измельчали на мелкие кусочки и гомогенизировали в 1 мл PBS, используя гомогенизатор Bullet Blender Gold. Гомогенаты подвергали 3 циклам замораживания-оттаивания с последующей обработкой ультразвуком в течение 1 минуты. Гомогенаты центрифугировали при 1000 об/мин в течение 3 минут, а супернатанты собирали. Супернатанты серийно разводили и определяли титр вируса, используя стандартный анализ бляшкообразования.

[0060] ФИГ. 43. Титр вирусов в крови инъецированных мышей. Кровь брали из лицевой вены мышей с опухолью А549 в различные моменты времени после интратуморальной инъекции 1000 БОЕ указанных вирусов. Вирус в образцах крови титровали, используя стандартную методику анализа бляшкообразования. В моче до 10 дня после инъекции вирусов не обнаружили.

[0061] ФИГ. 44. Выживаемость мышей после инъекции вирусов. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 103 БОЕ указанных вирусов интратуморально инъецировали только в правостороннюю опухоль каждой мыши. Объем опухоли измеряли два раза в неделю, используя цифровые штангенциркули, и мышей подвергали эвтаназии, когда одна из двусторонних опухолей превышала опухолевую нагрузку (3000 мм3), или когда мыши слабели (потеря >20% массы тела) вследствие обработки вирусом.

[0062] ФИГ. 45A-45C. Сравнение цитотоксического потенциала химерного #33 и родительских поксвирусов в A549. ФИГ. 45A. MOI вирусов, необходимую для уничтожения 50% клеток A549 (LD50), рассчитывали для всех вирусов и сравнивали. ФИГ. 45B. Клетки инфицировали #33 или родительскими вирусами с MOI 0,03 БОЕ, и кратное увеличение титра вирусов относительно исходного вируса определяли через 24 часа после инъекции и сравнивали среди вирусов. ФИГ. 45C. Клетки A549 инфицировали вирусами, как на ФИГ. 45B, и супернатант из инфицированных лунок собирали через 12 и 18 ч после инъекции. Титр вирусов в супернатанте определяли посредством анализа бляшкообразования и сравнивали среди вирусов.

[0063] ФИГ. 46A-46B. Клетки A549 инфицировали #33 или #33-(H5)Emerald, который имеет ген J2R (TK), замещенный на (зеленую) кассету экспрессии Emerald, при различных MOI. ФИГ. 46A. 5000 клеток культивировали в каждой лунке 96-луночного планшета. На следующий день в клетки инфицировали химерный вирус #33 или #33-(H5)Emerald, который имеет ген J2R (TK), замещенный на (зеленую) кассету экспрессии Emerald, при различных MOI. Жизнеспособность клеток определяли, используя CellTiter96AQueous One Solution (Promega; Cat#G3581), через 72 часа после инъекции. Выживаемость инфицированных клеток вычисляли относительно выживаемости псевдоинфицированных клеток. ФИГ. 46B. Клетки A549 инфицировали #33 или #33-(H5) при MOI 0,03 БОЕ, и в указанные моменты времени определяли кратное увеличение титра вирусов относительно исходного вируса.

[0064] ФИГ. 47A-47B. ФИГ. 47A. Изображение: A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 103 бляшкообразующих единиц (БОЕ) #33-(H5)Emerald или PBS интратуморально инъецировали только в правостороннюю опухоль каждой мыши. У мышей визуализировали зеленую флуоресценцию (возбуждение: 465 & эмиссия: 530 нм) два раза в неделю, используя оборудование для создания изображений у мелких животных (система визуализации LagoX), и изображения обрабатывали, используя программное обеспечение для обработки изображений AMIview. ФИГ. 47B. Среднюю интенсивность флуоресценции (MFI) Emerald вычисляли для каждой опухоли в различные моменты времени, используя программное обеспечение для обработки изображений AMIview. Сравнивали среднюю MFI (n=5 мышей/группа) для инъецированных и неинъецированных опухолей.

[0065] ФИГ. 48A-48D. ФИГ. 48A. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=7), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 103 бляшкообразующих единиц (БОЕ) #33-(H5)Emerald PBS интратуморально инъецировали только в правостороннюю опухоль каждой мыши. Мышей взвешивали два раза в неделю, и процентное изменение их массы наносили на график. Каждая линия представляет массу отдельной мыши. ФИГ. 48B. Объем опухолей измеряли два раза в неделю, используя цифровые штангенциркули (объем={(длина)2 × ширина/2}. Каждая линия представляет средний объем инъецированных опухолей в отдельной группе обработки с SD. Статистика: непарный Т-критерий; ****=p<0,0001. **33-GFP относится к животным, обработанным #33-(H5)Emerald. ФИГ. 48C. Объем опухоли для отдельных мышей в каждой группе обработки наносили на график. ФИГ. 48D. Мышей подвергали эвтаназии, когда одна из двусторонних опухолей превышала опухолевую нагрузку (3000 мм3), и кривую выживаемости для группы, обработанной вирусом, сравнивали кривой выживаемости группы, обработанной PBS. Статистика: логранговый критерий (Кокса-Мантеля); ****=p<0,0001.

[0066] ФИГ. 49A-49C. ФИГ. 49A. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 103 БОЕ указанных вирусов интратуморально инъецировали только в правостороннюю опухоль каждой мыши. На 7 и 56 день после инъекции вирусов 3 мышей из группы, обработанной вирусом, подвергали эвтаназии и производили сбор их органов, а также опухолей. Титры вирусов в извлеченных органах определяли посредством анализа бляшкообразования и сравнивали среди опухолей и органов. Статистика: Однофакторный дисперсионный анализ; ***=p<0,0001. ND = не определяется. ФИГ. 49B. Срезы опухолей (через 7 дней после инъекции вирусов) окрашивали на вирус осповакцины. Темное окрашивание представляет инфицированные вирусом области срезов опухолей. Каждый срез принадлежит отдельной мыши. ФИГ. 49D. Срезы опухолей, полученные на 7 день после инъекции вирусов, окрашивали на апоптозные клетки, используя In Situ Cell death detection Fluorescein (Roche). Для «положительного контроля» срезы опухолей обрабатывали рекомбинантной ДНКазой I (300 ед/мл) в течение 10 минут при комнатной температуре. Серый сигнал представляет апоптозные клетки.

[0067] ФИГ. 50. цитотоксичность in vitro в клетках OVCAR8 (через 72 ч после инъекции). 5000 клеток OVCAR8 (рака яичников человека) культивировали в каждой лунке 96-луночного планшета. На следующий день в клетки инфицировали химерный вирус #33 или #33 с делецией TK (#33/TK-), или вирусы #33 с целевыми последовательностями miR100 и Let-7c вставляли в основные вирусные гены E9L или D4R. Инфицирование проводили при указанных множественностях заражениях (MOI). Жизнеспособность клеток определяли, используя CellTiter96AQueous One Solution (Promega; Cat#G3581), через 72 часа после инъекции. Выживаемость инфицированных клеток вычисляли относительно выживаемости псевдоинфицированных клеток.

[0068] ФИГ. 51. Кинетика роста вирусов в клетках OVCAR8. OVCAR8 клетки инфицировали указанными вирусами при MOI 0,03 БОЕ в 6-луночных планшетах. Клеточные лизаты из инфицированных лунок собирали через 24, 48 и 72 ч после инъекции. Титры вирусов в клеточных лизатах определяли посредством анализа бляшкообразования, и кратное повышение титра вирусов относительно исходного вируса наносили на график.

[0069] ФИГ. 52. Процентное изменение массы мышей. OVCAR8, клетки рака яичников человека культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=8 для PBS и n=5 для всех других групп), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 105 БОЕ указанных вирусов или PBS интратуморально инъецировали только в правостороннюю опухоль каждой мыши. Мышей взвешивали два раза в неделю, и процентное изменение их массы наносили на график. Каждая линия представляет массу отдельной мыши.

[0070] ФИГ. 53. Объем опухоли. OVCAR8, клетки рака яичников человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=8 для PBS и n=5 для всех других групп), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 105 БОЕ указанных вирусов или PBS интратуморально инъецировали только в правостороннюю опухоль каждой мыши. Объем опухолей измеряли два раза в неделю, используя цифровые штангенциркули (объем={(длина)2 × ширина/2}. Объем инъецированных вирусом и неинъецированных опухолей для каждой мыши в каждой группе обработки наносили на график.

[0071] ФИГ. 54A-54B. Средний объем опухоли для инъецированных и неинъецированных опухолей. OVCAR8, клетки рака яичников человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=8 для PBS и n=5 для всех других групп), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 105 БОЕ указанных вирусов или PBS интратуморально инъецировали только в правостороннюю опухоль каждой мыши. Объем опухолей измеряли два раза в неделю, используя цифровой штангенциркуль (объем={(длина)2 × ширина/2}. Средний объем опухоли с SD для каждой группы обработки наносили на график. На ФИГ. 54A и 54B показан средний объем опухоли для инъецированных и неинъецированных опухолей, соответственно.

[0072] ФИГ. 55. Титры вирусов в органах через 7 дней после инъекции. OVCAR8, клетки рака яичников человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в PBS и матригеле 1:1 для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 105 БОЕ указанных вирусов интратуморально инъецировали только в правостороннюю опухоль каждой мыши. На 7 день после инъекции вирусов мыши подвергали эвтаназии, и производили сбор их органов, а также опухолей. Титры вирусов в извлеченных органах определяли посредством анализа бляшкообразования и сравнивали среди опухолей и органов. Примечание: в нормальных органах (легких, печени, яичниках, почках, селезенке и мозге) и неинъецированных опухолях вирус не обнаружен.

[0073] ФИГ. 56. miR100 в опухолях OVCAR8 и органах мышей. Бестимусных голых мышей-носителей ксенотрансплантатов OVCAR8 (n=3) подвергали эвтаназии, и производили сбор их органов, а также опухолей. Собранные ткани гомогенизировали, и выделяли суммарную РНК, используя miRNeasy mini kit (Qiagen). ПЦР в реальном времени проводили для определения уровней miR-100 в лизатах.

[0074] ФИГ. 57. Let-7c в опухолях OVCAR8 и органах мышей. Бестимусных голых мышей-носителей ксенотрансплантатов OVCAR8 (n=3) подвергали эвтаназии, и производили сбор их органов, а также опухолей. Собранные ткани гомогенизировали, и выделяли суммарную РНК, используя miRNeasy mini kit (Qiagen). ПЦР в реальном времени проводили для определения уровней Let-7c в лизатах.

Подробное описание изобретения

[0075] В настоящем описании описаны композиции химерного поксвируса, которые сочетают в себе благоприятные свойства от различных видов вирусов для создания новых гибридных химерных поксвирусов, которые превосходят отдельные вирусы дикого типа. Заявители получили химерные поксвирусы из различных родов. Изоляты химерных ортопоксвирусов и парапоксвирусов демонстрируют превосходную способность уничтожения в панелях клеточных линий рака NCI-60 по сравнению с их отдельными родительскими вирусами дикого типа. Кроме того, пользуясь преимуществом в виде того факта, что представители разных родов семейства poxviridae являются антигенно различимыми, эффективный химерный ортопоксвирус и эффективный химерный парапоксвирус, полученные в этом исследовании, потенциально можно объединить в одну и ту же схему лечения для достижения максимальной терапевтической эффективности.

I. Определения

[0076] Хотя в настоящем описании показаны и описаны различные варианты осуществления и аспекты настоящего изобретения, специалистам в данной области техники будет очевидно, что такие варианты осуществления и аспекты представлены только в качестве примера. Специалистам в данной области техники будут встречаться многочисленные вариации, изменения и замены без отступления от изобретения. Следует понимать, что различные альтернативы вариантам осуществления настоящего изобретения, описанным в настоящем описании, можно использовать при практическом осуществлении настоящего изобретения.

[0077] Заголовки разделов, используемые в указанном документе, предназначены только для организационных целей и не должны рассматриваться как ограничивающие предмет описания. Все документы или части документов, цитируемых в заявке, включая, без ограничения, патенты, патентные заявки, статьи, книги, руководства и научные труды, тем самым напрямую включены в качестве ссылки в полном объеме для любых целей.

[0078] Если не указано иное, технические и научные термины, используемые в настоящем описании, имеют такое же значение, которое обычно понятно специалистам в данной области техники. См., например, Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed., J. Wiley & Sons (New York, NY 1994); Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold Springs Harbor, NY 1989). Любые способы, устройства и материалы, подобные или эквивалентные описанным в настоящем описании, можно использовать при практическом осуществлении этого изобретения. Следующие определения приведены для облегчения понимания определенных терминов, часто используемых в настоящем описании, и не предназначены для ограничения объема настоящего раскрытия.

[0079] Термины «выделять» или «выделенный» применительно к нуклеиновой кислоте, вирусу или белку означают, что нуклеиновая кислота, вирус или белок по существу не содержат других клеточных компонентов, с которыми он связан в естественном состоянии. Он может быть, например, в гомогенном состоянии и может быть либо в сухом, либо в водном растворе. Чистоту и гомогенность обычно определяют, используя методы аналитической химии, такие как электрофорез в полиакриламидном геле или жидкостная хроматография высокого разрешения. Белок, который является преобладающим видом, присутствующим в препарате, по существу очищен.

[0080] «Нуклеиновая кислота», или «олигонуклеотид», или «полинуклеотид», или грамматические эквиваленты, используемые в настоящем описании, означают по меньшей мере два нуклеотида, ковалентно связанных вместе. Термин «нуклеиновая кислота» относится к дезоксирибонуклеотидам или рибонуклеотидам и их полимерам в одно- или двухцепочечной форме или к их комплементам. Термин «полинуклеотид» относится к линейной последовательности нуклеотидов. Термин «нуклеотид» обычно относится к одной единице полинуклеотида, то есть мономеру. Нуклеотиды могут представлять собой рибонуклеотиды, дезоксирибонуклеотиды или их модифицированные варианты. Примеры рассматриваемых в настоящем описании, полинуклеотидов включают одноцепочечную и двухцепочечную ДНК, одноцепочечную и двухцепочечную РНК (включая миРНК) и гибридные молекулы, содержащие смеси одноцепочечной и двухцепочечной ДНК и РНК. Термины также охватывают нуклеиновые кислоты, содержащие известные аналоги нуклеотидов или модифицированные остатки или связи основной цепи, которые являются синтетическими, природного происхождения и неприродного происхождения, которые имеют свойства связывания, сходные с эталонной нуклеиновой кислотой, и которые метаболизируются аналогично эталонным нуклеотидам. Примеры таких аналогов включают, без ограничения, фосфоротиоаты, фосфорамидаты, метилфосфонаты, хиралметилфосфонаты и 2-O-метил рибонуклеотиды.

[0081] Нуклеиновые кислоты могут включать неспецифические последовательности. В рамках изобретения термин «неспецифическая последовательность» относится к последовательности нуклеиновой кислоты, которая содержит ряд остатков, которые не предназначены для того, чтобы быть комплементарными или только частично комплементарными любой другой последовательности нуклеиновой кислоты. В качестве примера, неспецифическая последовательность нуклеиновой кислоты представляет собой последовательность остатков нуклеиновой кислоты, которая не функционирует в качестве ингибирующей нуклеиновой кислоты при контакте с клеткой или организмом. «Ингибирующая нуклеиновая кислота» представляет собой нуклеиновую кислоту (например, ДНК, РНК, полимер нуклеотидных аналогов), которая способна связываться с нуклеиновой кислотой-мишенью (например, мРНК, переносимой в белок) и уменьшать транскрипцию нуклеиновой кислоты-мишени (например, мРНК из ДНК) или уменьшать трансляцию нуклеиновой кислоты-мишени (например, мРНК) или изменять сплайсинг транскрипта (например, одноцепочечного морфолино олиго).

[0082] «Меченая нуклеиновая кислота или олигонуклеотид» представляет собой нуклеиновую кислоту или олигонуклеотид, которая связана, либо ковалентно, посредством линкера или химической связи, либо нековалентно, посредством ионных, ван-дер-ваальсовых, электростатических или водородных связей с меткой, так что присутствие нуклеиновой кислоты можно обнаружить, обнаружив присутствие обнаруживаемой метки, связанной с нуклеиновой кислотой. В качестве альтернативы, способ, использующий взаимодействия с высокой аффинностью, может достигать тех же результатов, когда один из пары партнеров по связыванию связывается с другим, например, биотин, стрептавидин. В вариантах осуществления основная цепь фосфотиоатной нуклеиновой кислоты или фосфотиоатного полимера содержит детектируемую метку, как описано в настоящем документе и общеизвестно в данной области.

[0083] Слова «комплементарный» или «комплементарность» относятся к способности нуклеиновой кислоты в полинуклеотиде образовывать пару оснований с другой нуклеиновой кислотой во втором полинуклеотиде. Например, последовательность A-G-T является комплементарной к последовательности T-C-A. Комплементарность может быть частичной, при которой только некоторые из нуклеиновых кислот совпадают в соответствии со спариванием оснований, или полной, когда все нуклеиновые кислоты совпадают в соответствии со спариванием оснований.

[0084] Нуклеиновая кислота является «функционально связанной», когда она находится в функциональном отношении с другой последовательностью нуклеиновой кислоты. Например, ДНК для предпоследовательности или секреторного лидера функционально связана с ДНК для полипептида, если она экспрессируется в виде белка-предшественника, который участвует в секреции полипептида; промотор или энхансер функционально связан с кодирующей последовательностью, если он влияет на транскрипцию последовательности; или сайт связывания рибосомы функционально связан с кодирующей последовательностью, если он расположен так, чтобы облегчить трансляцию. Обычно «функционально связанный» означает, что последовательности ДНК, которые связаны, находятся рядом друг с другом и, в случае секреторного лидера, являются смежными и находятся в фазе считывания. Однако энхансеры не должны быть смежными. Связывание осуществляется путем лигирования на подходящих сайтах рестрикции. Если такие сайты не существуют, синтетические олигонуклеотидные адаптеры или линкеры используют в соответствии с общепринятой практикой.

[0085] Термин «ген» означает сегмент ДНК, участвующий в продуцировании белка; он включает области, предшествующие и следующие за областью кодирования (лидер и трейлер), а также промежуточные последовательности (интроны) между отдельными кодирующими сегментами (экзоны). Лидер, трейлер, а также интроны включают регуляторные элементы, которые необходимы во время транскрипции и трансляции гена. Кроме того, «белковый генный продукт» представляет собой белок, экспрессируемый конкретным геном.

[0086] Слово «экспрессия» или «экспрессируемый» в рамках изобретения по отношению к гену, означает продукт транскрипции и/или трансляции этого гена. Уровень экспрессии молекулы ДНК в клетке можно определить на основе либо количества соответствующей мРНК, которая присутствует в клетке, либо количества белка, кодируемого этой ДНК, продуцируемого клеткой. Уровень экспрессии некодирующих молекул нуклеиновой кислоты (например, миРНК) можно определить посредством стандартных методов ПЦР или нозерн-блоттинга, хорошо известных в данной области. См. Sambrook et al., 1989 Molecular Cloning: A Laboratory Manual, 18.1-18.88.

[0087] Термин «миРНК», «малая интерферирующая РНК», «малая РНК» или «РНКi» в рамках изобретения относится к нуклеиновой кислоте, которая образует двухцепочечную РНК, причем эта двухцепочечная РНК обладает способностью уменьшать или ингибировать экспрессию гена или целевого гена при экспрессии в той же клетке, что и ген или целевой ген. Комплементарные части нуклеиновой кислоты, которые гибридизуют с образованием двухцепочечной молекулы, обычно имеют значительную или полную идентичность. В одном варианте осуществления миРНК или РНКi относится к нуклеиновой кислоте, которая имеет значительную или полную идентичность с целевым геном и образует двухцепочечную миРНК. В вариантах осуществления миРНК ингибирует экспрессию генов, взаимодействуя с комплементарной клеточной мРНК, тем самым препятствуя экспрессии комплементарной мРНК. Как правило, длина нуклеиновой кислоты составляет по меньшей мере приблизительно 15-50 нуклеотидов (например, каждая комплементарная последовательность двухцепочечной миРНК имеет длину 15-50 нуклеотидов, а длина двухцепочечной миРНК составляет приблизительно 15-50 пар оснований). В других вариантах осуществления длина составляет 20-30 нуклеотидных оснований, предпочтительно приблизительно 20-25 или приблизительно 24-29 нуклеотидов в длину, например, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов в длину. Неограничивающие примеры миРНК включают в себя рибозимы, РНК-ловушки, короткие шпилечные РНК (shРНК), микроРНК (миРНК) и малые ядрышковые РНК (snoРНК).

[0088] Термин «рекомбинантный» при использовании со ссылкой, например, на клетку или нуклеиновую кислоту, белок или вектор, указывает, что клетка, нуклеиновая кислота, белок или вектор модифицированы посредством введения гетерологичной нуклеиновой кислоты или белка или изменения нативной нуклеиновой кислоты или белка, или что клетка получена из клетки, модифицированной таким образом. Таким образом, например, рекомбинантные клетки экспрессируют гены, которые не обнаружены в нативной (нерекомбинантной) форме клетки, или экспрессируют нативные гены, которые иначе аномально экспрессируются, недостаточно экспрессируются или не экспрессируются вообще. Трансгенные клетки и растения представляют собой клетки и растения, которые экспрессируют гетерологичный ген или кодирующую последовательность, обычно в результате рекомбинантных методов.

[0089] Термин «гетерологичный» при использовании со ссылкой на части нуклеиновой кислоты указывает, что нуклеиновая кислота содержит две или более подпоследовательности, которые не обнаруживаются в одинаковом отношении друг к другу в природе. Например, нуклеиновую кислоту обычно получают рекомбинантно, имея две или более последовательностей из неродственных генов, расположенных для получения новой функциональной нуклеиновой кислоты, например, промотора из одного источника и кодирующей области из другого источника. Аналогично, гетерологичный белок указывает на то, что белок содержит две или более подпоследовательности, которые не обнаруживают в одинаковых отношениях друг с другом в природе (например, слитый белок).

[0090] Термин «экзогенный» относится к молекуле или веществу (например, соединению, нуклеиновой кислоте или белку), которые образуются за пределами данной клетки или организма. Например, «экзогенный промотор», как упоминается в настоящем описании, представляет собой промотор, который не образуется в клетке или организме, которым он экспрессируется. И наоборот, термин «эндогенный» или «эндогенный промотор» относится к молекуле или веществу, которое является нативным или образуется в данной клетке или организме.

[0091] Термин «выделенный» применительно к нуклеиновой кислоте или белку означает, что нуклеиновая кислота или белок по существу не содержат других клеточных компонентов, с которыми они связаны в естественном состоянии. Они могут находиться, например, в гомогенном состоянии и могут быть либо сухими, либо в водном растворе. Чистоту и однородность обычно определяют с использованием методик аналитической химии, таких как электрофорез в полиакриламидном геле или жидкостная хроматография высокого разрешения. Белок, который является преобладающим видом, присутствующим в препарате, по существу очищен.

[0092] Термины «полипептид», «пептид» и «белок» используют в настоящем описании взаимозаменяемо для обозначения полимера из аминокислотных остатков, при этом в вариантах осуществления полимер может быть конъюгирован с фрагментом, который не состоит из аминокислот. Эти термины применяют к аминокислотным полимерам, в которых один или несколько аминокислотных остатков представляют собой искусственный химический миметик соответствующей встречающейся в природе аминокислоты, а также к встречающимся в природе аминокислотным полимерам и не встречающимся в природе аминокислотным полимерам. «Слитый белок» относится к химерному белку, кодирующему две или более отдельных последовательностей белка, которые рекомбинантно экспрессируются в виде одного фрагмента.

[0093] Термины «пептидил» и «пептидильный фрагмент» означают одновалентный пептид.

[0094] Термин «аминокислота» относится к аминокислотам природного происхождения и синтетическим аминокислотам, а также к аминокислотным аналогам и миметикам аминокислот, которые функционируют аналогично аминокислотам природного происхождения. Аминокислоты природного происхождения представляют собой аминокислоты, кодируемые генетическим кодом, а также те аминокислоты, которые модифицируются позднее, например, гидроксипролин, γ-карбоксиглутамат и O-фосфосерин. Аминокислотные аналоги относятся к соединениям, которые имеют ту же основную химическую структуру, что и аминокислота природного происхождения, то есть α-углерод, который связывается с водородом, карбоксильной группой, аминогруппой и R-группой, например, гомосерином, норлейцином, метионинсульфоксидом, метионин метилсульфонием. Такие аналоги имеют модифицированные R-группы (например, норлейцин) или модифицированные пептидные каркасы, но сохраняют ту же основную химическую структуру, что и аминокислота природного происхождения. Миметики аминокислот относятся к химическим соединениям, имеющим структуру, которая отличается от общей химической структуры аминокислоты, но которая действует аналогично аминокислоте природного происхождения. Термины «аминокислота неприродного происхождения» и «ненатуральная аминокислота» относятся к аминокислотным аналогам, синтетическим аминокислотам и миметикам аминокислот, которые не встречаются в природе.

[0095] В настоящем описании, аминокислоты могут называться либо их общеизвестными трехбуквенными символами, либо однобуквенными символами, рекомендованными Комиссией по биохимической номенклатуре IUPAC-IUB. Нуклеотиды так же могут называться их общепринятыми однобуквенными кодами.

[0096] «Консервативно модифицированные варианты» применяют как к последовательностям аминокислот, так и нуклеиновых кислот. Что касается специфических последовательностей нуклеиновой кислоты, то «консервативно модифицированные варианты» относятся к тем нуклеиновым кислотам, которые кодируют идентичные или по существу идентичные аминокислотные последовательности. Вследствие вырожденности генетического кода любой заданный белок кодируется значительным количеством функционально идентичных нуклеиновых кислот. Например, все кодоны GCA, GCC, GCG и GCU кодируют аминокислоту аланин. Таким образом, в каждом положении, в котором кодоном предусмотрен аланин, кодон можно заменить на любой из соответствующих кодонов без изменения кодируемого полипептида.

[0097] Такие варианты нуклеиновых кислот являются «молчащими вариантами», которые представляют собой один вид консервативно модифицированных вариантов. Каждая последовательность нуклеиновой кислоты в настоящем описании, которая кодирует полипептид, также включает любой возможный молчащий вариант нуклеиновой кислоты. Специалисты в данной области техники признают, что каждый кодон в нуклеиновой кислоте (за исключением AUG, который, как правило, является единственным кодоном для метионина, и TGG, который, как правило, является единственным кодоном для триптофана) можно модифицировать так, чтобы произвести функционально идентичную молекулу. Соответственно, в каждой описанной последовательности подразумевают каждый молчащий вариант нуклеиновой кислоты, которая кодирует полипептид.

[0098] Что касается аминокислотных последовательностей, то специалистам в этой области техники понятно, что отдельные замены, делеции или вставки в последовательность нуклеиновой кислоты, пептидов, полипептидов или белков, которые изменяют, добавляют или удаляют отдельную аминокислоту или небольшой процент аминокислот в кодируемой последовательности, представляют собой «консервативно модифицированный вариант», в котором изменение приводит к замене аминокислоты на химически похожую аминокислоту. Таблицы консервативных замен, обеспечивающих функционально схожие аминокислоты, хорошо известны в этой области техники. Такие консервативно модифицированные варианты представляют собой дополнения и не исключают полиморфные варианты, межвидовые гомологи и аллели согласно настоящему изобретению.

[0099] Каждая из приведенных ниже восьми групп содержит аминокислоты, которые являются консервативными заменами друг друга: 1) Аланин (A), Глицин (G); 2) Аспарагиновая кислота (D), Глутаминовая кислота (E); 3) Аспарагин (N), Глутамин (Q); 4) Аргинин (R), Лизин (K); 5) Изолейцин (I), Лейцин (L), Метионин (M), Валин (V); 6) Фенилаланин (F), Тирозин (Y), Триптофан (W); 7) Серин (S), Треонин (T) и 8) Цистеин (C), Метионин (M) (см., например, Creighton, Proteins (1984)).

[0100] Термины «идентичный» или процент «идентичности» в контексте двух или более последовательностей нуклеиновой кислоты или полипептидов относится к двум или более последовательностям или подпоследовательностям, которые являются одинаковыми или имеют указанный процент остатков аминокислот или нуклеотидов, которые являются одинаковыми (т.е. приблизительно 60% идентичности, предпочтительно 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или более высокой идентичности по указанной области, при сравнении и выравнивании для максимального соответствия в пределах окна сравнения, или предполагаемой области), что измеряют с использованием алгоритмов сравнения последовательностей BLAST или BLAST 2.0 с параметрами, используемыми по умолчанию, описанными ниже, или посредством выравнивания вручную и визуального контроля (см., например, NCBI web site http://www.ncbi.nlm.nih.gov/BLAST/ или т.п.). Такие последовательности затем называют «по существу идентичными». Это определение также относится и его можно применять к последовательностям, комплементарным тестируемой последовательности. Определение также включает последовательности, которые имеют делеции и/или добавления, а также последовательности, которые имеют замены. Как описано ниже, предпочтительные алгоритмы могут учитывать гэпы и тому подобное. Предпочтительно идентичность существует в области, длина которой составляет по меньшей мере приблизительно 25 аминокислот или нуклеотидов, или, более предпочтительно, в области длиной 50-100 аминокислот или нуклеотидов.

[0101] Термины «ген тимидинкиназы», «ген ТК», «ген ТК», «ген J2R» или «J2R» в рамках изобретения относятся к любой из рекомбинантных или встречающихся в природе форм гена или их вариантам или гомологам, которые кодируют полипептид тимидинкиназы, способный поддерживать активность полипептида тимидинкиназы (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с полипептидом тимидинкиназой). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательностей нуклеиновой кислоты по всей последовательности или части последовательности (например, 50 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с геном тимидинкиназы природного происхождения. В вариантах осуществления ген тимидинкиназы содержит последовательность нуклеиновой кислоты SEQ ID NO: 4. В вариантах осуществления ген тимидинкиназы представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 4. В вариантах осуществления ген тимидинкиназы мутирован. В вариантах осуществления ген тимидинкиназы частично удален. В вариантах осуществления ген тимидинкиназы содержит последовательность нуклеиновой кислоты SEQ ID NO: 5. В вариантах осуществления ген тимидинкиназы содержит последовательность нуклеиновой кислоты SEQ ID NO: 5.

[0102] Термин «ген F14.5L», «последовательность F14.5L», «F14.5L» и тому подобное в рамках изобретения относится к любой из рекомбинантных или встречающихся в природе форм гена F14.5L или его вариантам или их гомологам, которые кодируют полипептид F14.5L, способный поддерживать активность полипептида F14.5L (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с полипептидом F14.5L). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательности нуклеиновой кислоты по всей последовательности или части последовательности (например, 50 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с геном F14.5L природного происхождения. В вариантах осуществления ген F14.5L по существу идентичен последовательности нуклеиновой кислоты, соответствующей положению 44428-44279 последовательности нуклеиновой кислоты, идентифицированной номером доступа KX781953, или варианту или гомологу, имеющему существенную с ним идентичность. В вариантах осуществления ген F14.5L содержит последовательность нуклеиновой кислоты SEQ ID NO: 6. В вариантах осуществления ген F14.5L представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 6. В вариантах осуществления ген F14.5L является мутированным. В вариантах осуществления ген F14.5L частично удален. В вариантах осуществления ген F14.5L содержит последовательность нуклеиновой кислоты SEQ ID NO: 7. В вариантах осуществления ген F14.5L содержит последовательность нуклеиновой кислоты SEQ ID NO: 7.

[0103] Термины «ген D4R», «ген урацил-ДНК-гликозилазы» и тому подобное в рамках изобретения относятся к любой из рекомбинантных или встречающихся в природе форм гена урацил-ДНК-гликозилазы или их вариантам или гомологам, которые кодируют полипептид урацил-ДНК-гликозилазу, способный сохранять активность полипептида урацил-ДНК-гликозилазы (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с полипептидом урацил-ДНК-гликозилазой). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательностей нуклеиновой кислоты по всей последовательности или части последовательности (например, 50 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с геном урацил-ДНК-гликозилазы природного происхождения. В вариантах осуществления ген урацил-ДНК-гликозилазы по существу идентичен последовательности нуклеиновой кислоты, соответствующей позиции 102720-103376 последовательности нуклеиновой кислоты, идентифицированной номером доступа DQ439815, или варианту или гомологу, имеющему существенную с ним идентичность. В вариантах осуществления ген урацил-ДНК-гликозилазы содержит последовательность нуклеиновой кислоты SEQ ID NO: 8. В вариантах осуществления ген урацил-ДНК-гликозилазы представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 8.

[0104] Термины «ген E9L», «ген ДНК-полимеразы» и тому подобное в рамках изобретения относятся к любой из рекомбинантных или встречающихся в природе форм гена ДНК-полимеразы или его вариантам или гомологам, которые кодируют полипептид ДНК-полимеразу, способный сохранять активность полипептида ДНК-полимеразы (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с полипептидом ДНК-полимеразой). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательностей нуклеиновой кислоты по всей последовательности или части последовательности (например, 50, 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с геном ДНК-полимеразы природного происхождения. В вариантах осуществления ген ДНК-полимеразы по существу идентичен последовательности нуклеиновой кислоты, соответствующей позиции 56656-53636 последовательности нуклеиновой кислоты, идентифицированной номером доступа AY243312 или варианту или гомологу, имеющему существенную с ним идентичность. В вариантах осуществления ген ДНК-полимеразы содержит последовательность нуклеиновой кислоты SEQ ID NO: 12. В вариантах осуществления ген ДНК-полимеразы представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 12.

[0105] Термины «человеческий ген натрий-йодидного симпортера», «ген hNIS», «ген NIS» и тому подобное в рамках изобретения относятся к любой из рекомбинантных или встречающихся в природе форм человеческого гена натрий-йодидного симпортера или его вариантам или гомологам, которые кодируют человеческий полипептид натрий-йодидного симпортера, способный поддерживать активность полипептида человеческого натрий-йодидного симпортера (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с полипептидом человеческого натрий-йодидного симпортера). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательностей нуклеиновой кислоты по всей последовательности или части последовательности (например, 50, 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с человеческим геном натрий-йодидного симпортера природного происхождения. В вариантах осуществления человеческий ген натрий-йодидного симпортера по существу идентичен последовательности нуклеиновой кислоты, идентифицированной номером доступа NM_000453, или варианту или гомологу, имеющему существенную с ним идентичность. В вариантах осуществления человеческий ген натрий-йодидного симпортера содержит последовательность нуклеиновой кислоты SEQ ID NO: 13. В вариантах осуществления человеческий ген натрий-йодидного симпортера представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 13.

[0106] Термины «ген Emerald» или «последовательность Emerald» в рамках изобретения относится к полученному посредством генной инженерии гену или его вариантам, которые кодируют полипептид Emerald, способный сохранять активность полипептида Emerald (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с полипептидом Emerald). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательностей нуклеиновой кислоты по всей последовательности или части последовательности (например, 50, 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с последовательностью Emerald. В вариантах осуществления Emerald по существу идентичен последовательности нуклеиновой кислоты, соответствующей позиции 3215-3931 последовательности нуклеиновой кислоты, идентифицированной номером доступа KF293661, или варианту или гомологу, имеющему существенную с ним идентичность. В вариантах осуществления ген Emerald содержит последовательность нуклеиновой кислоты SEQ ID NO: 14. В вариантах осуществления ген Emerald представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 14.

[0107] Термины «ген люциферазы светлячков» или «последовательность люциферазы светлячков» в рамках изобретения относятся к любой из рекомбинантных или встречающихся в природе форм гена люциферазы светлячков или его вариантам или гомологам, которые кодируют полипептид люциферазу светлячков, способный сохранять активность полипептида люциферазы светлячков (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с полипептидом люциферазы светлячков). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательностей нуклеиновой кислоты по всей последовательности или части последовательности (например, 50, 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с геном люциферазы светлячков природного происхождения. В вариантах осуществления ген люциферазы светлячков по существу идентичен последовательности нуклеиновой кислоты, соответствующей позиции 3129-4781 последовательности нуклеиновой кислоты, идентифицированной номером доступа KF990214, или варианту или гомологу, имеющему существенную с ним идентичность. В вариантах осуществления ген люциферазы светлячков содержит последовательность нуклеиновой кислоты SEQ ID NO: 15. В вариантах осуществления ген люциферазы светлячков представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 15.

[0108] Термины «ген mCherry» или «последовательность mCherry» в рамках изобретения относятся к любой из рекомбинантных или встречающихся в природе форм гена или его вариантам или гомологам, которые кодируют полипептид mCherry, способный сохранять активность полипептида mCherry (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с полипептидом mCherry). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательностей нуклеиновой кислоты по всей последовательности или части последовательности (например, 50, 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с геном mCherry природного происхождения. В вариантах осуществления ген mCherry по существу идентичен последовательности нуклеиновой кислоты, соответствующей позиции 1073-1783 последовательности нуклеиновой кислоты, идентифицированной номером доступа KX446949, или варианту или гомологу, имеющему существенную с ним идентичность. В вариантах осуществления ген mCherry содержит последовательность нуклеиновой кислоты SEQ ID NO: 16. В вариантах осуществления ген mCherry представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 16.

[0109] Термины «Промотор Н5», «H5» и тому подобное в рамках изобретения относятся к любой из рекомбинантных или встречающихся в природе форм промотора Н5 или его вариантам или гомологам, которые сохраняют активность промотора Н5 (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с промотором Н5). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательностей нуклеиновой кислоты по всей последовательности или части последовательности (например, 50, 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с промотором Н5 природного происхождения. В вариантах осуществления промотор Н5 по существу идентичен последовательности нуклеиновой кислоты, соответствующей позиции 7-76 последовательности нуклеиновой кислоты, идентифицированной номером доступа FJ386852, или варианту или гомологу, имеющему существенную с ним идентичность. В вариантах осуществления промотор Н5 содержит последовательность нуклеиновой кислоты SEQ ID NO: 18. В вариантах осуществления промотор Н5 представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 18.

[0110] Термины «промотор SE», «SE» и тому подобное в рамках изобретения относятся к любой из рекомбинантных или встречающихся в природе форм промотора SE или его вариантам или гомологам, которые сохраняют активность промотора SE (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с промотором SE). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательностей нуклеиновой кислоты по всей последовательности или части последовательности (например, 50, 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с промотором SE природного происхождения. В вариантах осуществления промотор SE содержит последовательность нуклеиновой кислоты SEQ ID NO: 19. В вариантах осуществления промотор SE представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 19.

[0111] Термины «промотор 11K», «11K» и тому подобное в рамках изобретения относятся к любой из рекомбинантных или встречающихся в природе форм промотора 11К или его вариантам или гомологам, которые сохраняют активность промотора 11К (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с промотором 11К). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность последовательностей нуклеиновой кислоты по всей последовательности или части последовательности (например, 50, 100, 150 или 200 непрерывной части нуклеиновой кислоты) по сравнению с промотором 11K природного происхождения. В вариантах осуществления промотор 11К по существу идентичен последовательности нуклеиновой кислоты, соответствующей позиции 40734-40771 последовательности нуклеиновой кислоты, идентифицированной номером доступа KF179385, или варианту или гомологу, имеющему существенную с ним идентичность. В вариантах осуществления промотор 11К содержит последовательность нуклеиновой кислоты SEQ ID NO: 20. В вариантах осуществления промотор 11К представляет собой последовательность нуклеиновой кислоты SEQ ID NO: 20.

[0112] Антитела представляют собой большие, сложные молекулы (молекулярная масса ~150000 или приблизительно 1320 аминокислот) со сложной внутренней структурой. Молекула природного антитела содержит две идентичные пары полипептидных цепей, каждая пара имеет одну легкую цепь и одну тяжелую цепь. Каждая легкая цепь и тяжелая цепь, в свою очередь, состоит из двух областей: вариабельной («V») области, участвующей в связывании целевого антигена, и константной («C») области, которая взаимодействует с другими компонентами иммунной системы. Вариабельные области легкой и тяжелой цепи объединяются в трехмерном пространстве, образуя вариабельную область, которая связывает антиген (например, рецептор на поверхности клетки). В каждой вариабельной области легкой или тяжелой цепи есть три коротких сегмента (в среднем 10 аминокислот в длину), называемых областями, определяющими комплементарность («CDR»). Шесть CDR в вариабельном домене антитела (три из легкой цепи и три из тяжелой цепи) складываются вместе в трехмерном пространстве, образуя фактический антителосвязывающий сайт, который прикрепляется к целевому антигену. Положение и длина CDR были точно определены E. Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, 1983, 1987. Часть вариабельной области, не включенная в CDR, называется каркасом («FR»), который формирует окружение для CDR.

[0113] Термин «антитело» используется в соответствии с его общеизвестным значением в данной области. Антитела существуют, например, в виде интактных иммуноглобулинов или в виде ряда хорошо охарактеризованных фрагментов, полученных путем расщепления различными пептидазами. Так, например, пепсин расщепляет антитело ниже дисульфидных связей в шарнирной области с образованием F(ab)'2, димера Fab, который сам по себе является легкой цепью, соединенной с VH-CH1 с помощью дисульфидной связи. F(ab)'2 можно восстановить в мягких условиях, чтобы разорвать дисульфидную связь в шарнирной области, превращая тем самым димер F(ab)'2 в Fab'-мономер. Fab'-мономер представляет собой по существу Fab с частью шарнирной области (см. Fundamental Immunology (Рамкл ed., 3d ed. 1993). Хотя различные фрагменты антител определены в аспекте расщепления интактного антитела, специалисту в данной области будет понятно, что такие фрагменты можно синтезировать de novo либо химически, либо с использованием методики рекомбинантной ДНК. Таким образом, термин антитело в рамках изобретения также включает фрагменты антител, полученные либо посредством модификации целых антител, либо синтезированных de novo с использованием методик рекомбинантной ДНК (например, одноцепочечных Fv) или идентифицированных с использованием библиотек фагового дисплея (см., например, McCafferty et al., Nature 348:552-554 (1990)).

[0114] Иллюстративная структурная единица иммуноглобулина (антитела) содержит тетрамер. Каждый тетрамер состоит из двух идентичных пар полипептидных цепей, каждая пара имеет одну «легкую» (приблизительно 25 кДа) и одну «тяжелую» цепь (приблизительно 50-70 кДа). N-конец каждой цепи определяет вариабельную область, составляющую приблизительно от 100 до 110 или более аминокислот, в первую очередь ответственную за распознавание антигена. Термины вариабельная легкая цепь (VL) и вариабельная тяжелая цепь (VH) относятся к этим легким и тяжелым цепям, соответственно. Fc (т.е. кристаллизуемый фрагмент иммуноглобулина) представляет собой «основание» или «хвост» иммуноглобулина и обычно состоит из двух тяжелых цепей, которые вносят два или три константных домена в зависимости от класса антитела. Связываясь со специфическими белками, Fc-фрагмент обеспечивает, чтобы каждое антитело вырабатывало соответствующий иммунный ответ для данного антигена. Fc-фрагмент также связывается с различными клеточными рецепторами, такими как Fc-рецепторы, и другими иммунными молекулами, такими как белки комплемента.

[0115] Термин «антиген» в рамках изобретения к молекулам, способным связываться с антителосвязывающим доменом, предоставленным в настоящем описании. «Антигенсвязывающий домен» в рамках изобретения представляет собой область антитела, которая связывается с антигеном (эпитопом). Как описано выше, антигенсвязывающий домен обычно состоит из одного константного и одного вариабельного домена каждой из тяжелой и легкой цепей (VL, VH, CL и CH1, соответственно). Паратоп или антигенсвязывающий сайт формируется на N-конце антигенсвязывающего домена. Два вариабельных домена антигенсвязывающего домена обычно связывают эпитоп на антигене.

[0116] Антитела существуют, например, в виде интактных иммуноглобулинов или в виде ряда хорошо охарактеризованных фрагментов, полученных путем расщепления различными пептидазами. Так, например, пепсин расщепляет антитело ниже дисульфидных связей в шарнирной области с образованием F(ab)'2, димера Fab, который сам по себе является легкой цепью, соединенной с VH-CH1 с помощью дисульфидной связи. F(ab)'2 можно восстановить в мягких условиях, чтобы разорвать дисульфидную связь в шарнирной области, превращая тем самым димер F(ab)'2 в Fab'-мономер. Fab'-мономер представляет собой по существу Fab с частью шарнирной области (см. Fundamental Immunology (Paul ed., 3rd ed. 1993). Хотя различные фрагменты антител определены в аспекте расщепления интактного антитела, специалисту в данной области будет понятно, что такие фрагменты можно синтезировать de novo либо химически, либо с использованием методики рекомбинантной ДНК. Таким образом, термин антитело в рамках изобретения также включает фрагменты антител, полученные либо посредством модификации целых антител, либо синтезированных de novo с использованием методик рекомбинантной ДНК (например, одноцепочечных Fv) или идентифицированных с использованием библиотек фагового дисплея (см., например, McCafferty et al., Nature 348:552-554 (1990)).

[0117] Одноцепочечный вариабельный фрагмент (scFv) обычно представляет собой белок слияния вариабельных областей тяжелых (VH) и легких цепей (VL) иммуноглобулинов, связанных с коротким линкерным пептидом, состоящим из от 10 до приблизительно 25 аминокислот. Линкер обычно может быть богат глицином для гибкости, а также серином или треонином для растворимости. Линкер может соединить N-конец VH с C-концом VL или наоборот.

[0118] Эпитоп антитела представляет собой область его антигена, с которой связывается антитело. Два антитела связываются с одним и тем же или перекрывающимся эпитопом, если каждое конкурентно ингибирует (блокирует) связывание другого с антигеном. То есть 1-, 5-, 10-, 20- или 100-кратный избыток одного антитела ингибирует связывание другого по меньшей мере на 30%, но предпочтительно на 50%, 75%, 90% или даже на 99%, как измерено в анализе конкурентного связывания (см., например, Junghans et al., Cancer Res. 50:1495, 1990). В качестве альтернативы, два антитела имеют один и тот же эпитоп, если по существу все аминокислотные мутации в антигене, которые уменьшают или устраняют связывание одного антитела, уменьшают или устраняют связывание другого. Два антитела имеют перекрывающиеся эпитопы, если некоторые аминокислотные мутации, которые уменьшают или устраняют связывание одного антитела, уменьшают или устраняют связывание другого.

[0119] Для получения подходящих антител согласно настоящему изобретению и для применения в соответствии с настоящим изобретением, например, рекомбинантных, моноклональных или поликлональных антител, можно использовать многие методики, известные в данной области (см., например, Kohler & Milstein, Nature 256:495-497 (1975); Kozbor et al., Immunology Today 4: 72 (1983); Cole et al., pp. 77-96 in Monoclonal Antibodies и Cancer Therapy, Alan R. Liss, Inc. (1985); Coligan, Current Protocols in Immunology (1991); Harlow & Lane, Antibodies, A Laboratory Manual (1988); и Goding, Monoclonal Antibodies: Principles and Practice (2rd ed. 1986)). Гены, кодирующие тяжелые и легкие цепи интересующего антитела, можно клонировать из клеток, например, гены, кодирующие моноклональное антитело, можно клонировать из гибридомы и использовать для получения рекомбинантного моноклонального антитела. Генные библиотеки, кодирующие тяжелые и легкие цепи моноклональных антител, также можно получить из гибридомных или плазматических клеток. Случайные комбинации продуктов генов тяжелой и легкой цепей генерируют большой пул антител с различной антигенной специфичностью (см., например, Kuby, Immunology (3rd ed. 1997)). Методики получения одноцепочечных антител или рекомбинантных антител (патент США №4946778, патент США №4816567) можно адаптировать для получения антител к полипептидам данному изобретения. Кроме того, для экспрессии гуманизированных или человеческих антител можно использовать трансгенных мышей или другие организмы, такие как другие млекопитающие (см., например, патенты США №№5545807; 5545806; 5569825; 5625126; 5633425; 5661016, Marks et al., Bio/Technology 10:779-783 (1992); Lonberg et al., Nature 368:856-859 (1994); Morrison, Nature 368:812-13 (1994); Fishwild et al., Nature Biotechnology 14:845-51 (1996); Neuberger, Nature Biotechnology 14:826 (1996); и Lonberg & Huszar, Intern. Rev. Immunol. 13:65-93 (1995)). В качестве альтернативы, технологию фагового дисплея можно использовать для идентификации антител и гетеромерных Fab-фрагментов, которые специфически связываются с выбранными антигенами (см., например, McCafferty et al., Nature 348:552-554 (1990); Marks et al., Biotechnology 10:779-783 (1992)). Антитела также можно получать биспецифичными, т.е. способными распознавать два разных антигена (см., например, WO 93/08829, Traunecker et al., EMBO J. 10:3655-3659 (1991); и Suresh et al., Methods in Enzymology 121:210 (1986)). Антитела также могут быть гетероконъюгатами, например, двумя ковалентно связанными антителами, или иммунотоксинами (см., например, патент США №4676980, WO 91/00360; WO 92/200373; и EP 03089).

[0120] Когда фраза «специфически (или избирательно) связывается с антителом» или «специфически (или избирательно) иммунореактивен с», относится к белку или пептиду, она относится к реакции связывания, которая определяет присутствие белка, часто в гетерогенной популяции белков и др. биопрепаратов. Таким образом, при заданных условиях иммуноанализа указанные антитела связываются с конкретным белком по меньшей мере в два раза больше по сравнению с исходными и, более типично, более чем в 10-100 раз больше по сравнению с исходными. Для специфического связывания с антителом в таких условиях обычно требуется антитело, которое выбирают из-за его специфичности к конкретному белку. Например, поликлональные антитела можно выбрать для получения только подмножества антител, которые специфически иммунореактивны с выбранным антигеном, а не с другими белками. Этот выбор можно достигнуть путем вычитания антител, которые перекрестно реагируют с другими молекулами. Для отбора антител, специфически иммунореактивных с конкретным белком, можно использовать различные форматы иммуноанализа. Например, для отбора антител, специфически иммунореактивных с белком, обычно используют твердофазный иммуноанализ ELISA (см., например, Harlow & Lane, Using Antibodies, A Laboratory Manual (1998) для описания форматов и условий иммуноанализа, которые можно использовать для определения специфической иммунореактивности).

[0121] «Приведение в контакт» используют в соответствии с его основным обычным значением, и оно относится к процессу, позволяющему по меньшей мере двум отдельным видам (например, химическим соединениям, включая биомолекулы или клетки) стать достаточно близкими для реакции, взаимодействия или физического прикосновения. Это следует понимать; однако полученный продукт реакции можно получить непосредственно из реакции между добавленными реагентами или из промежуточного продукта из одного или более из добавленных реагентов, которые можно получить в реакционной смеси.

[0122] Термин «приведение в контакт» может включать предоставление возможности реагирования, взаимодействия или физического соприкосновения двух видов, причем эти два вида могут представлять собой, например, домен антитела, как описано в настоящем описании, и антителосвязывающий домен. В вариантах осуществления приведение в контакт включает, например, предоставление возможности домену антитела, как описано в настоящем описании, взаимодействовать с антителосвязывающим доменом.

[0123] «Пациент» или «нуждающийся в этом пациент» относится к живому организму, страдающему или склонному к заболеванию или состоянию, которое можно лечить путем введения композиции или фармацевтической композиции, представленной в настоящем описании. Неограничивающие примеры включают людей, других млекопитающих, коров, крыс, мышей, собак, обезьян, коз, овец, коров, оленей и других животных, не являющихся млекопитающими. В некоторых вариантах осуществления пациентом является человек.

[0124] Термины «заболевание» или «состояние» относятся к состоянию или состоянию здоровья пациента или пациента, которое можно лечить посредством соединений или способов в рамках изобретения. Заболевание может представлять собой рак. В некоторых дополнительных случаях «рак» относится к человеческим видам рака и карциномам, саркомам, аденокарциномам, лимфомам, лейкозам, включая солидные и лимфоидные виды рака, рак почек, молочной железы, легких, мочевого пузыря, толстой кишки, яичников, предстательной железы, поджелудочной железы, желудка, головного мозга, головы и шеи, кожи, матки, яичка, глиому, пищевода и печени, включая гепатокарциному, лимфому, включая острую B-лимфобластную лимфому, неходжкинские лимфомы (например, Беркитта, мелкоклеточную, и крупноклеточную лимфомы), лимфому Ходжкина, лейкоз (включая AML, ALL и CML) или множественную миелому.

[0125] В рамках изобретения термин «рак» относится ко всем типам рака, новообразований или злокачественных опухолей, обнаруженных у млекопитающих (например, у людей), включая лейкоз, карциномы и саркомы. Иллюстративные виды рака, которые можно лечить соединением или способом в рамках изобретения, включают рак молочной железы, рак толстой кишки, рак почки, лейкоз, рак легкого, меланому, рак яичников, рак предстательной железы, рак поджелудочной железы, рак головного мозга, рак печени, рак желудка или саркому.

[0126] Термин «лейкоз» в широком смысле относится к прогрессирующим, злокачественным заболеваниям кроветворных органов и обычно характеризуется измененной пролиферацией и развитием лейкоцитов и их предшественников в крови и костном мозге. Лейкоз обычно классифицируют клинически на основании (1) длительности и характера заболевания - острый или хронический; 2) типа вовлеченной клетки; миелоидный (миелогенный), лимфоидный (лимфогенный) или моноцитарный; и (3) увеличения или не увеличения количества аномальных клеток в крови - лейкемический или нелейкемический (сублейкемический). Иллюстративные лейкозы, которые можно лечить соединением или способом в рамках изобретения, включают, например, острый нелимфоцитарный лейкоз, хронический лимфоцитарный лейкоз, острый гранулоцитарный лейкоз, хронический гранулоцитарный лейкоз, острый промиелоцитарный лейкоз, Т-клеточный лейкоз взрослых, алейкемический лейкоз, лейкемический лейкоз, базофильный лейкоз, бластный лейкоз, лейкоз крупного рогатого скота, хронический миелоцитарный лейкоз, гематодерматоз, эмбриональный лейкоз, эозинофильный лейкоз, лейкоз Гросса, волосатоклеточный лейкоз, гемобластный лейкоз, гемоцитобластный лейкоз, гистиоцитарный лейкоз, недифференцируемый лейкоз, острый моноцитарный лейкоз, лейкопенический лейкоз, лимфолейкоз, лимфобластный лейкоз, лимфоцитарный лейкоз, лимфогенный лейкоз, лимфоидный лейкоз, лейкоз с клетками лимфосаркомы, мастоцитарный лейкоз, мегакариоцитарный лейкоз, микромиелобластный лейкоз, моноцитарный лейкоз, миелобластный лейкоз, миелоцитарный лейкоз, миелоидный гранулоцитарный лейкоз, миеломоноцитарный лейкоз, лейкоз Негели, плазмоклеточный лейкоз, множественную миелому, плазмоцитарный лейкоз, промиелоцитарный лейкоз, лейкоз с клетками Ридера, лейкоз Шиллинга, недифференцируемый лейкоз, сублейкемический лейкоз или лейкоз из недифференцированных клеток.

[0127] Термин «саркома» в целом относится к опухоли, которая состоит из вещества, подобного эмбриональной соединительной ткани, и обычно состоит из плотно упакованных клеток, заключенных в волокнистое или гомогенное вещество. Саркомы, которые можно лечить соединением или способом в рамках изобретения, включают хондросаркому, фибросаркому, лимфосаркому, меланосаркому, миксосаркому, остеосаркому, саркому Абемети, жировую/адипо саркому, липоаркому, альвеолярную саркому мягких тканей, амелобоастосаркому, ботриоидную саркому, саркому хлорому, хориокарциному, эмбриональную саркому, саркому опухоль Вильмса, саркому эндометрия, стромальную саркому, саркому Юинга, фасциальную саркому, фибробластическую саркому, гигантоклеточную саркому, гранулоцитарную саркому, саркому Ходжкина, идиопатическую множественную геморрагическую пигментную саркому, иммунобластную саркому из В-клеток, лимфому, иммунобластную саркому из T-клеток, саркому Дженсена, саркому Капоши, саркому купферовых клеток, ангиосаркому, лейкосаркому, саркому злокачественную мезотелиому, периостальную саркому, ретикулоцитарную саркому, саркому Рауса, листовидную цистосаркому, синовиальную саркому или телеангиэктатическую саркому.

[0128] Термин «меланома» означает опухоль, возникающую из меланоцитарной системы кожи и других органов. Меланомы, которые можно лечить соединением или способом в рамках изобретения, включают, например, акральную лентигинозную меланому, беспигментную меланому, доброкачественную ювенильную меланому, меланому Клаудмана, меланому S91, меланому Хардинга-Пасси, ювенильную меланому, меланому типа злокачественного лентиго, злокачественную меланому, узловую меланому, подногтевую меланому или поверхностно распространяющуюся меланому.

[0129] Термин «карцинома» относится к злокачественному новообразованию, состоящему из эпителиальных клеток, стремящихся инфильтрировать окружающие ткани и вызывать метастазы. Иллюстративные карциномы, которые можно лечить соединением или способом в рамках изобретения, включают, например, медуллярную карциному щитовидной железы, семейную медуллярную карциному щитовидной железы, ацинарную карциному, ацинозную карциному, аденокистозную карциному, железисто-кистозную карциному, аденоматозную карциному, карциному коры надпочечников, альвеолярную карцинома, альвеолярноклеточную карциному, базальноклеточную карциному, базоцеллюлярную карциному, базалоидную карциному, базальноплоскоклеточную карциному, бронхоальвеолярную карциному, бронхиолярную карциному, бронхогенную карциному, медуллярную карциному, холангиоцеллюлярную карциному, хориокарциному, коллоидную карциному, комедокарциному, карциному тела матки, крибриформную карциному, инфильтрирующую карциному, карциному кожи, цилиндрическую карциному, цилиндроклеточную карциному, карциному протоков, карциному твердого неба, эмбриональную карциному, мозговидную карциному, эпидермоидную карциному, карциному эпителиальных аденоидов, экзофитную карциному, карциному из язвы, фиброзную карциному, желеобразную карциному, коллоидную карциному, гигантоклеточную карциному, гигантоцеллюлярную карциному, гландулярную карциному, гранулезотекаклеточную карциному, базальноклеточную карциному, гематоидную карциному, гепатоцеллюлярную карциному, карциному из клеток Гюртле, карциному с гиалиновой стромой, гипернефроидную карциному, эмбриональную карциному инфантильного типа, карциному in situ, интрадермальную карциному, интраэпитилиальную карциному, карциному Кромпечера, карциному из клеток Кульчицкого, крупноклеточную карциному, лентикулярную карциному, carcinoma lenticulare, липоматозную карциному, лимфоэпителиальную карциному, carcinoma medullare, медуллярную карциному, меланокарциному, карциному мягкого неба, муцинозную карциному, carcinoma muciparum, мукоцеллюлярную карциному, мукоэпидермоидную карциному, carcinoma mucosum, слизистую карциному, миксоматозную карциному, назофарингеальную карциному, овсяноклеточную карциному, оссифицирующую карциному, остеоидную карциному, папиллярную карциному, перипортальную карциному, преинвазивную карциному, шиловидноклеточную карциному, пульповидую карциному, почечноклеточную карциному почек, резервноклеточную карциному, саркомоподобную карциному, карциному Шнейдера, скиррозную карциному, карциному мошонки, перстневидноклеточную карциному, недифференцированную карциному, мелкоклеточную карциному, соланоидную карциному, карциному из сферических клеток, веретеноклеточную карциному, губчатую карциному, squamous carcinoma, плоскоклеточную карциному, string carcinoma, телеангиэктатическую карциному, carcinoma telangiectodes, переходно-клеточную карциному, carcinoma tuberosum, туберозную карциному, веррукозную карциному или виллезную карциному.

[0130] Термин «ассоциированный» или «ассоциированный с» в контексте вещества или активности или функции вещества, ассоциированного с заболеванием (например, раком, астмой, язвенным колитом, синдромом раздраженного кишечника, артритом, увеитом, гангренозной пиодермией или узловатой эритемой) вызван (полностью или частично) либо симптомом заболевания вызван (полностью или частично) посредством вещества или активности или функции вещества.

[0131] В рамках изобретения термины «иммунная контрольная точка», «белок иммунной контрольной точки» или «белок контрольной точки» можно использовать взаимозаменяемо, и они относятся к композициям (молекулам), способным модулировать длительность и амплитуду физиологических иммунных ответов (например, ослаблять и/или устранять длительную активацию иммунных клеток, таким образом регулируя нормальный иммунный гомеостаз). Белки иммунных контрольных точек могут стимулировать (усиливать) иммунный ответ. В вариантах осуществления белок контрольной точки представляет собой клеточный рецептор. Примеры стимулирующих молекул контрольных точек включают, без ограничения, члены суперсемейства рецепторов фактора некроза опухоли (TNF) (например, CD27, CD40, OX40, индуцированный глюкокортикоидами ген семейства TNFR (GITR) и CD137), члены суперсемейства B7-CD28 (например, сам CD28 и индуцируемый Т-клеточный костимулятор (ICOS)). В качестве альтернативы белки иммунных контрольных точек могут ингибировать (уменьшать) иммунный ответ. Примеры ингибирующих молекул контрольных точек включают, без ограничения, рецептор аденозина А2А (A2AR), B7-H3, B7-H4, BTLA, CTLA-4, индоламин 2,3-диоксигеназу (IDO), иммуноглобулиноподобные рецепторы киллеров (KIR), LAG3, PD-1, TIM-3, и иммуноглобулин-V домен супрессор T-клеточной активации (VISTA).

[0132] Подобным образом «ингибитор иммунной контрольной точки» или «ингибитор контрольной точки» в рамках изобретения относится к веществу (например, антителу или его фрагменту, небольшой молекуле), которое способно ингибировать, отрицательно влиять (например, уменьшать) активность или функцию белка контрольной точки (например, уменьшать экспрессию или уменьшать активность белка контрольной точки) относительно активности или функции белка контрольной точки при отсутствии ингибитора. Ингибитор контрольной точки может по меньшей мере в какой-то мере, частично или полностью блокировать стимуляцию, уменьшать, предотвращать или задерживать активацию, или инактивировать, десенсибилизировать, или понижающе регулировать передачу сигнала или ферментативную активность или количество белка контрольной точки. Ингибитор контрольной точки может ингибировать белок контрольной точки, например, связывая, частично или полностью блокируя, уменьшая, предотвращая, задерживая, инактивируя, десенсибилизируя или понижающе регулируя активность белка контрольной точки. В вариантах осуществления ингибитор контрольной точки представляет собой антитело. В вариантах осуществления ингибитор контрольной точки представляет собой фрагмент антитела. В вариантах осуществления ингибитор контрольной точки представляет собой вариант антитела. В вариантах осуществления ингибитор контрольной точки представляет собой scFv. В вариантах осуществления ингибитор контрольной точки представляет собой анти-CTLA-4 антитело. В вариантах осуществления ингибитор контрольной точки представляет собой анти-PD1 антитело. В вариантах осуществления ингибитор контрольной точки представляет собой анти-PD-L1 антитело. В вариантах осуществления ингибитор контрольной точки представляет собой анти-LAG-3 антитело. В вариантах осуществления ингибитор контрольной точки представляет собой анти-IgG1k антитело. В вариантах осуществления ингибитор контрольной точки представляет собой анти-CD25 антитело. В вариантах осуществления ингибитор контрольной точки представляет собой анти-IL2R антитело. В вариантах осуществления ингибитор контрольной точки образует часть онколитического вируса. Неограничивающие примеры ингибиторов контрольных точек включают ипилимумаб, пембролизумаб, ниволумаб, талимоген лагерпарепвек, дурвалумаб, даклизумаб, авелумаб и атезолизумаб.

[0133] Термин «аберрантный» в рамках изобретения относится к отличному от нормального. При использовании для описания ферментативной активности аберрантная относится к активности, большей или меньшей, чем нормальный контроль или среднее значение нормальных контрольных образцов без заболеваний. Аберрантная активность может относиться к величине активности, которая приводит к заболеванию, при этом возврат аберрантной активности к нормальному или не ассоциированному с заболеванием количеству (например, используя способ, как описано в настоящем описании), приводит к уменьшению заболевания или одного или более симптомов заболевания.

[0134] «Контроль» или «стандартный контроль» относится к образцу, измерению или значению, которое служит эталоном, обычно известным эталоном, для сравнения с тестовым образцом, измерением или значением. Например, тестируемый образец можно взять у пациента с подозрением на данное заболевание (например, рак), и сравнить с известным нормальным (не заболевшим) индивидуумом (например, стандартным контрольным пациентом). Стандартный контроль также может представлять собой среднее измерение или значение, полученное у популяции сходных индивидуумов (например, стандартных контрольных пациентов), у которых нет данного заболевания (т.е. стандартной контрольной популяции), например, здоровых индивидуумов с аналогичным анамнезом, того же возраста, массой и т.д. Стандартное контрольное значение также можно получить у одного и того же индивидуума, например, из ранее полученного образца у пациента до начала заболевания. Например, можно разработать контроль для сравнения терапевтической пользы на основе фармакологических данных (например, периода полувыведения) или терапевтических мер (например, сравнение побочных эффектов). Контроль также важен для определения значимости данных. Например, если значения для данного параметра в контролях широко варьируют, отклонения в тестируемых образцах не будут считаться значительными. Специалист поймет, что стандартные контроли можно разработать для оценки любого количества параметров (например, уровней РНК, уровней белка, определенных типов клеток, конкретных текучих сред организма, конкретных тканей, синовиоцитов, синовиальной текучей среды, синовиальной ткани, фибробластоподобных синовиоцитов, макрофагоподобных синовиоцитов и т.д.).

[0135] Специалист в данной области поймет, какие стандартные контроли являются наиболее подходящими в данной ситуации, и сможет анализировать данные на основе сравнения со стандартными контрольными значениями. Стандартные контроли также полезны для определения значимости (например, статистической значимости) данных. Например, если значения для данного параметра широко варьируют в стандартных контролях, отклонения в тестируемых образцах не будут считаться значительными.

[0136] Термин «диагноз» относится к относительной вероятности того, что заболевание (например, рак) присутствует у пациента. Точно так же термин «прогноз» относится к относительной вероятности того, что у пациента в будущем может возникнуть определенный результат в отношении болезненного состояния. Например, в контексте настоящего изобретения прогноз может относиться к вероятности того, что у индивидуума разовьется заболевание (например, рак), или к вероятности степени тяжести заболевания (например, длительности заболевания). Термины не предназначены быть абсолютными, как будет понятно любому специалисту в области медицинской диагностики.

[0137] «Биологический образец» или «образец» относится к материалам, полученным или взятым у пациента или пациента. Биологический образец включает срезы тканей, такие как образцы, полученные при биопсии и вскрытии, и замороженные срезы, взятые для гистологических целей. Такие образцы включают текучие среды организма, такие как кровь и фракции или продукты крови (например, сыворотка, плазма, тромбоциты, эритроциты и тому подобное), мокрота, ткани, культивируемые клетки (например, первичные культуры, экспланты и трансформированные клетки), кал, моча, синовиальная текучая среда, суставная ткань, синовиальная ткань, синовиоциты, фибробластоподобные синовиоциты, макрофагоподобные синовиоциты, иммунные клетки, гемопоэтические клетки, фибробласты, макрофаги, Т-клетки и т.д. Биологический образец обычно получают из эукариотического организма, такого как млекопитающее, такое как примат, например, шимпанзе или человек; корова; собака; кошка; грызун, например, морская свинка, крыса, мышь; кролик; или птица; рептилия; или рыба.

[0138] «Клетка» в рамках изобретения относится к клетке, выполняющей метаболические или другие функции, достаточные для сохранения или репликации своей геномной ДНК. Клетку можно идентифицировать посредством хорошо известных в данной области способов, включая, например, наличие интактной мембраны, окрашивание определенным красителем, способность продуцировать потомство или, в случае гамет, способность объединяться со второй гаметой, чтобы произвести жизнеспособное потомство. Клетки могут включать прокариотические и эукариотические клетки. Прокариотические клетки включают, без ограничения, бактерии. Эукариотические клетки включают, без ограничения, дрожжевые клетки и клетки, полученные из растений и животных, например, клеток млекопитающих, насекомых (например, spodoptera) и человека. Клетки могут быть полезны, когда они естественным образом не прилипают или были обработаны, чтобы не прилипать к поверхностям, например, путем трипсинизации.

[0139] Термин «реплицировать» используется в соответствии с его обычным значением и относится к способности клетки или вируса продуцировать потомство. Специалист в данной области техники сразу поймет, что термин «реплицировать» при использовании в связи с ДНК относится к биологическому процессу получения двух идентичных копий ДНК из одной исходной молекулы ДНК. Таким образом, термин «реплицировать» включает пассирование и реинфицирование клеток потомства. В вариантах осуществления химерный поксвирус в рамках изобретения обладает повышенной онколитической активностью по сравнению с его родительским вирусом. В вариантах осуществления онколитическая активность (способность вызывать гибель клетки у инфицированной клетки) увеличивается более чем в 1,5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 100, 10000, 10000 раз по сравнению с онколитической активностью родительского вируса (одного из вирусов, использованных для образования химерного вируса в рамках изобретения).

[0140] «Синергическое количество» в рамках изобретения относится к сумме первого количества (например, количества первого химерного поксвируса) и второго количества (например, количества второго химерного поксвируса), которая приводит к синергическому эффекту (т.е. эффекту больше, чем суммарный эффект). Следовательно, термины «синергия», «синергизм», «синергический», «комбинированный синергический объем» и «синергический терапевтический эффект», которые взаимозаменяемо используются в настоящем описании, относятся к измеренному эффекту химерных поксвирусов, вводимых в комбинации, когда измеряемый эффект больше, чем сумма отдельных эффектов каждого из химерных поксвирусов, вводимых отдельно в качестве единственного агента.

[0141] В вариантах осуществления синергическое количество может составлять приблизительно 0,1, 0,2, 0,3, 0,4, 0,5, 0,6, 0,7, 0,8, 0,9, 1,0, 1,1, 1,2, 1,3, 1,4, 1,5, 1,6, 1,7, 1,8, 1,9, 2,0, 2,1, 2,2, 2,3, 2,4, 2,5, 2,6, 2,7, 2,8, 2,9, 3,0, 3,1, 3,2, 3,3, 3,4, 3,5, 3,6, 3,7, 3,8, 3,9, 4,0, 4,1, 4,2, 4,3, 4,4, 4,5, 4,6, 4,7, 4,8, 4,9, 5,0, 5,1, 5,2, 5,3, 5,4, 5,5, 5,6, 5,7, 5,8, 5,9, 6,0, 6,1, 6,2, 6,3, 6,4, 6,5, 6,6, 6,7, 6,8, 6,9, 7,0, 7,1, 7,2, 7,3, 7,4, 7,5, 7,6, 7,7, 7,8, 7,9, 8,0, 8,1, 8,2, 8,3, 8,4, 8,5, 8,6, 8,7, 8,8, 8,9, 9,0, 9,1, 9,2, 9,3, 9,4, 9,5, 9,6, 9,7, 9,8, 9,9, 10,0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 или 99% количества первого химерного поксвируса при отдельном использовании от второго химерного поксвируса. В вариантах осуществления синергическое количество может составлять приблизительно 0,1, 0,2, 0,3, 0,4, 0,5, 0,6, 0,7, 0,8, 0,9, 1,0, 1,1, 1,2, 1,3, 1,4, 1,5, 1,6, 1,7, 1,8, 1,9, 2,0, 2,1, 2,2, 2,3, 2,4, 2,5, 2,6, 2,7, 2,8, 2,9, 3,0, 3,1, 3,2, 3,3, 3,4, 3,5, 3,6, 3,7, 3,8, 3,9, 4,0, 4,1, 4,2, 4,3, 4,4, 4,5, 4,6, 4,7, 4,8, 4,9, 5,0, 5,1, 5,2, 5,3, 5,4, 5,5, 5,6, 5,7, 5,8, 5,9, 6,0, 6,1, 6,2, 6,3, 6,4, 6,5, 6,6, 6,7, 6,8, 6,9, 7,0, 7,1, 7,2, 7,3, 7,4, 7,5, 7,6, 7,7, 7,8, 7,9, 8,0, 8,1, 8,2, 8,3, 8,4, 8,5, 8,6, 8,7, 8,8, 8,9, 9,0, 9,1, 9,2, 9,3, 9,4, 9,5, 9,6, 9,7, 9,8, 9,9, 10,0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 или 99% количества второго химерного поксвируса при использовании отдельно от первого химерного поксвируса.

[0142] Термины «вирус» или «вирусная частица» используются в соответствии с их обычным значением в вирусологии и относятся к вириону, включая вирусный геном (например, ДНК, РНК, одноцепочечный, двухцепочечный), вирусный капсид и ассоциированные белки, и в случае оболочечных вирусов (например, герпесвируса, поксвируса) оболочка включает липиды и необязательно компоненты мембран клетки-хозяина и/или вирусные белки.

[0143] Термин «поксвирус» используют в соответствии с его обычным значением в вирусологии, и он относится к члену семейства Poxviridae, способному инфицировать позвоночных и беспозвоночных, который размножается в цитоплазме их хозяина. В вариантах осуществления вирионы поксвируса имеют размер около 200 нм в диаметре и около 300 нм в длину и обладают геномом в одном линейном двухцепочечном сегменте ДНК, обычно 130-375 т.п.н. Термин поксвирус включает, без ограничений, все роды Poxviridae (например, бетаэнтомопоксвирус, ятапоксвирус, цервидпоксвирус, гаммаэнтомопоксвирус, лепорипоксвирус, вирус оспы свиней, моллюсципоксвирус, вирус оспы крокодилов, альфаэнтомопоксвирус, каприпоксвирус, ортопоксвирус, авипоксвирус и парапоксвирус). В вариантах осуществления поксвирус представляет собой ортопоксвирус (например, вирус оспы, вирус осповакцины, поксвирус коров, вирус оспы обезьян), парапоксвирус (например, орф-вирус, псевдопоксвирус коров, вирус папулезного стоматита крупного рогатого скота), ятапоксвирус (например, поксвирус Тана, вирус опухоли обезьян Яба) или моллюсципоксвирус (например, вирус контагиозного моллюска). В вариантах осуществления поксвирус представляет собой ортопоксвирус (например, штамм Brighton вируса коровьей оспы, штамм Herman поксвируса енотов, штамм Utrecht поксвируса кроликов, штамм WR вируса осповакцины, штамм IHD вируса осповакцины, штамм Elstree вируса осповакцины, штамм CL вируса осповакцины, штамм Lederle-Chorioallantoic вируса осповакцины или штамм AS вируса осповакцины). В вариантах осуществления поксвирус представляет собой парапоксвирус (например, штамм NZ2 орф-вируса или штамм TJS псевдопоксвируса коров).

[0144] Термин «химерный», используемый в контексте химерного поксвируса, используют в соответствии с его обычным значением в вирусологии, и он относится к гибридному микроорганизму (например, химерному поксвирусу), созданному посредством соединения фрагментов нуклеиновых кислот из двух или более различных микроорганизмов (например, два вируса из одного подсемейства, два вируса из разных подсемейств). В вариантах осуществления фрагменты нуклеиновой кислоты по меньшей мере из двух комбинированных штаммов поксвирусов содержат основные гены, необходимые для репликации. В вариантах осуществления фрагменты одного по меньшей мере из двух штаммов вируса поксвируса содержат основные гены, необходимые для репликации. Химерный поксвирус в рамках изобретения, включая его варианты осуществления, может включать один или несколько трансгенов (т.е. последовательности нуклеиновых кислот, не являющихся нативными для вирусного генома). Например, химерный поксвирус в рамках изобретения, включая его варианты осуществления, может включать противораковую последовательность нуклеиновой кислоты, связывающую последовательность нуклеиновой кислоты, последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент, или любую их комбинацию. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, включая противораковую последовательность нуклеиновой кислоты, связывающую последовательность нуклеиновой кислоты и последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, включая противораковую последовательность нуклеиновой кислоты и последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, включая связывающую последовательность нуклеиновой кислоты и последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, включая противораковую последовательность нуклеиновой кислоты и связывающую последовательность нуклеиновой кислоты.

[0145] Термин «бляшкообразующие единицы» используют в соответствии с его обычным значением в вирусологии, и он относится к количеству бляшек в монослое клеток, которые могут образовываться на объем вирусных частиц. В некоторых вариантах осуществления единицы основаны на количестве бляшек, которые могут образоваться при инфицировании монослоя восприимчивых клеток. Например, в вариантах осуществления 1000 БОЕ/мкл указывает на то, что 1 мкл раствора, содержащего вирусные частицы, содержит достаточное количество вирусных частиц для образования 1000 инфекционных бляшек в монослое клеток. В вариантах осуществления бляшкообразующие единицы сокращенно обозначают «БОЕ».

[0146] Термины «множественность заражения» или «MOI» используют в соответствии с их обычным значением в вирусологии и относятся к отношению инфекционного агента (например, поксвируса) к мишени (например, клетке) в данной площади или объеме. В вариантах осуществления площадь или объем предполагаются гомогенными.

[0147] Термин «штамм Brighton поксвируса коров» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и их функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма Brighton поксвируса коров или его варианты, которые сохраняют активность штамма Brighton поксвируса коров (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма Brighton поксвируса коров или его варианты, геном которых имеет идентичность последовательностей с геномом штамма Brighton поксвируса коров (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма Brighton поксвируса коров). Штамм Brighton поксвируса коров может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом Brighton поксвируса коров) активность, экспрессию, нацеливание клеток или инфекционность штамма Brighton поксвируса коров. Штамм Brighton поксвируса коров можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм Brighton поксвируса коров относится к штамму вируса, идентифицированному ATCC (Американская коллекция типовых культур), ссылочный номер ATCC VR-302™, его вариантам или гомологам. В вариантах осуществления штамм Brighton поксвируса коров относится к штамму вируса, идентифицированному таксономически, ссылочный номер 265872, его вариантам или гомологам.

[0148] Термин «штамм Herman поксвируса енотов» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и его функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма Herman поксвируса енотов или его варианты, которые сохраняют активность штамма Herman поксвируса енотов (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма Herman поксвируса енотов или его варианты, геном которых имеет идентичность последовательностей с геномом штамма Herman поксвируса енотов (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма Herman поксвируса енотов). Штамм Herman поксвируса енотов может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом Herman поксвируса енотов) активность, экспрессию, нацеливание клеток или инфекционность штамма Herman поксвируса енотов. Штамм Herman поксвируса енотов можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм Herman поксвируса енотов относится к штамму вируса, идентифицированному ATCC, ссылочный номер ATCC VR-838™, его вариантам или гомологам. В вариантах осуществления штамм Herman поксвируса енотов относится к штамму вируса, кодируемому последовательностью нуклеиновой кислоты со ссылочным номером NC_027213.

[0149] Термин «штамм Utrecht поксвируса кроликов» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и его функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма Utrecht поксвируса кроликов или его варианты, которые сохраняют активность штамма Utrecht поксвируса кроликов (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма Utrecht поксвируса кроликов или его варианты, геном которых имеет идентичность последовательностей с геномом штамма Utrecht поксвируса кроликов (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма Utrecht поксвируса кроликов). Штамм Utrecht поксвируса кроликов может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом Utrecht поксвируса кроликов) активность экспрессию, нацеливание клеток или инфекционность штамма Utrecht поксвируса кроликов. Штамм Utrecht поксвируса кроликов можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм Utrecht поксвируса кроликов относится к штамму вируса, идентифицированному ATCC, ссылочный номер ATCC VR-1591™, его вариантам или гомологам. В вариантах осуществления штамм Utrecht поксвируса кроликов относится к штамму вируса, идентифицированному таксономически, ссылочный номер 45417, его вариантам или гомологам.

[0150] Термин «штамм WR вируса осповакцины» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и его функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма WR вируса осповакцины или его варианты, которые сохраняют активность штамма WR вируса осповакцины (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма WR вируса осповакцины или его варианты, геном которых имеет идентичность последовательностей с геномом штамма WR вируса осповакцины (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма WR вируса осповакцины). Штамм WR вируса осповакцины может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом WR вируса осповакцины) активность, экспрессию, нацеливание клеток или инфекционность штамма WR вируса осповакцины. Штамм WR вируса осповакцины можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм WR вируса осповакцины относится к штамму вируса, идентифицированному ATCC, ссылочный номер ATCC VR-1354™, его вариантам или гомологам. В вариантах осуществления штамм WR вируса осповакцины относится к штамму вируса, идентифицированному таксономически, ссылочный номер 10254, его вариантам или гомологам.

[0151] Термин «штамм IHD вируса осповакцины» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и его функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма IHD вируса осповакцины или его варианты, которые сохраняют активность штамма IHD вируса осповакцины (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма IHD вируса осповакцины или его варианты, геном которых имеет идентичность последовательностей с геномом штамма IHD вируса осповакцины (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма IHD вируса осповакцины). Штамм IHD вируса осповакцины может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом IHD вируса осповакцины) активность, экспрессию, нацеливание клеток или инфекционность штамма IHD вируса осповакцины. Штамм IHD вируса осповакцины можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм IHD вируса осповакцины относится к штамму вируса, идентифицированному ATCC, ссылочный номер ATCC VR-156™, его вариантам или гомологам. В вариантах осуществления штамм IHD вируса осповакцины относится к штамму вируса, идентифицированному таксономически, ссылочный номер 10251, его вариантам или гомологам.

[0152] Термин «штамм Elstree вируса осповакцины» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и его функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма Elstree вируса осповакцины или его варианты, которые сохраняют активность штамма Elstree вируса осповакцины (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма Elstree вируса осповакцины или его варианты, геном которых имеет идентичность последовательностей с геномом штамма Elstree вируса осповакцины (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма Elstree вируса осповакцины). Штамм Elstree вируса осповакцины может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом Elstre вируса осповакцины) активность, экспрессию, нацеливание клеток или инфекционность штамма Elstree вируса осповакцины. Штамм Elstree вируса осповакцины можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм Elstree вируса осповакцины относится к штамму вируса, идентифицированному ATCC, ссылочный номер ATCC VR-1549™, его вариантам или гомологам.

[0153] Термин «штамм CL вируса осповакцины» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и его функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма CL вируса осповакцины или его варианты, которые сохраняют активность штамма CL вируса осповакцины (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма CL вируса осповакцины или его варианты, геном которых имеет идентичность последовательностей с геномом штамма CL вируса осповакцины (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма CL вируса осповакцины). Штамм CL вируса осповакцины может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом CL вируса осповакцины) активность, экспрессию, нацеливание клеток или инфекционность штамма CL вируса осповакцины. Штамм CL вируса осповакцины можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм CL вируса осповакцины относится к штамму вируса, идентифицированному ATCC, ссылочный номер ATCC VR-1774™, его вариантам или гомологам.

[0154] Термин «штамм Lederle-Chorioallantoic вируса осповакцины» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и его функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма Lederle-Chorioallantoic вируса осповакцины или его варианты, которые сохраняют активность штамма Lederle-Chorioallantoic вируса осповакцины (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма Lederle-Chorioallantoic вируса осповакцины или его варианты, геном которых имеет идентичность последовательностей с геномом штамма Lederle-Chorioallantoic вируса осповакцины (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма Lederle-Chorioallantoic вируса осповакцины). Штамм Lederle-Chorioallantoic вируса осповакцины может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом Lederle-Chorioallantoic вируса осповакцины) активность, экспрессию, нацеливание клеток или инфекционность штамма Lederle-Chorioallantoic вируса осповакцины. Штамм Lederle-Chorioallantoic вируса осповакцины можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм Lederle-Chorioallantoic вируса осповакцины относится к штамму вируса, идентифицированному ATCC, ссылочный номер ATCC VR-118™, его вариантам или гомологам.

[0155] Термин «штамм AS вируса осповакцины» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и его функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма AS вируса осповакцины или его варианты, которые сохраняют активность штамма AS вируса осповакцины (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма AS вируса осповакцины или его варианты, геном которых имеет идентичность последовательностей с геномом штамма AS вируса осповакцины (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма AS вируса осповакцины). Штамм AS вируса осповакцины может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом AS вируса осповакцины) активность, экспрессию, нацеливание клеток или инфекционность штамма AS вируса осповакцины. Штамм AS вируса осповакцины можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм AS вируса осповакцины относится к штамму вируса, идентифицированному ATCC, ссылочный номер ATCC VR-2010™, его вариантам или гомологам.

[0156] Термин «штамм NZ2 орф-вируса» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и его функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма NZ2 орф-вируса или его варианты, которые сохраняют активность штамма NZ2 орф-вируса (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма NZ2 орф-вируса или его варианты, геном которых имеет идентичность последовательностей с геномом штамма NZ2 орф-вируса (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма NZ2 орф-вируса). Штамм NZ2 орф-вируса может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом NZ2 орф-вируса) активность, экспрессию, нацеливание клеток или инфекционность штамма NZ2 орф-вируса. Штамм NZ2 орф-вируса можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм NZ2 орф-вируса относится к штамму вируса, идентифицированному ATCC, ссылочный номер ATCC VR-1548™, его вариантам или гомологам. В вариантах осуществления штамм NZ2 орф-вируса относится к штамму вируса, идентифицированному таксономически, ссылочный номер 10259, его вариантам или гомологам.

[0157] Термин «штамм TJS псевдопоксвируса коров» используют в соответствии с его общим, обычным значением в вирусологии, и он относится к вирусным штаммам с такими же или похожими названиями и его функциональным фрагментам и гомологам. Термин включает рекомбинантные или встречающиеся в природе формы штамма TJS псевдопоксвируса коров или его варианты, которые сохраняют активность штамма TJS псевдопоксвируса коров (например, в пределах по меньшей мере 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% или 100%). Термин включает рекомбинантные или встречающиеся в природе формы штамма TJS псевдопоксвируса коров или его варианты, геном которых имеет идентичность последовательностей с геномом штамма TJS псевдопоксвируса коров (например, приблизительно 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или 100% идентичности с геномом штамма TJS псевдопоксвируса коров). Штамм TJS псевдопоксвируса коров может относиться к вариантам, имеющим мутированные аминокислотные остатки, которые модулируют (например, повышают или понижают, при сравнении со штаммом TJS псевдопоксвируса коров) активность, экспрессию, нацеливание клеток или инфекционность штамма TJS псевдопоксвируса коров. Штамм TJS псевдопоксвируса коров можно модифицировать, как описано в настоящем описании. В вариантах осуществления штамм TJS псевдопоксвируса коров относится к штамму вируса, идентифицированному ATCC, ссылочный номер ATCC VR-634™, его вариантам или гомологам.

[0158] В вариантах осуществления штамм Brighton поксвируса коров представляет собой штамм Brighton поксвируса коров ATCC VR-302™. В вариантах осуществления штамм Herman поксвируса енотов представляет собой штамм Herman поксвируса енотов ATCC VR-838™. В вариантах осуществления штамм Utrecht поксвируса кроликов представляет собой штамм Utrecht поксвируса кроликов ATCC VR-1591™. В вариантах осуществления штамм WR вируса осповакцины представляет собой штамм WR вируса осповакцины ATCC VR-1354™. В вариантах осуществления штамм IH3 вируса осповакцины представляет собой штамм IHD вируса осповакцины ATCC VR-156™. В вариантах осуществления штамм Elstree вируса осповакцины представляет собой штамм Elstree вируса осповакцины ATCC VR-1549™. В вариантах осуществления штамм CL вируса осповакцины представляет собой штамм CL вируса осповакцины ATCC VR-1774™. В вариантах осуществления штамм Lederle-Chorioallantoic вируса осповакцины представляет собой штамм Lederle-Chorioallantoic вируса осповакцины ATCC VR-118™. В вариантах осуществления штамм AS вируса осповакцины представляет собой штамм AS вируса осповакцины ATCC VR-2010™. В вариантах осуществления штамм NZ2 орф-вируса представляет собой штамм NZ2 орф-вируса ATCC VR-1548™. В вариантах осуществления штамм TJS псевдопоксвируса коров представляет собой штамм TJS псевдопоксвируса коров ATCC VR-634™. В вариантах осуществления штамм Brighton поксвируса коров относится к штамму вируса, идентифицированному таксономически, ссылочный номер 265872, его вариантам или гомологам.

[0159] В этом раскрытии «содержит», «содержащий», «заключающий в себе» и «имеющий» и тому подобное могут иметь значение, приписываемое им в Патентном законе США, и могут означать «включает», «включающий» и тому подобное. Термин «по существу состоящий из» или «по существу состоит» также имеет значение, указанное в Патентном законе США, и этот термин является неограничивающим, что допускает наличие большего, чем изложено, если основные или новые характеристики того, что говорится, не изменяются при наличии более того, что изложено, но исключает варианты осуществления предшествующего уровня техники.

II. Вирусные композиции

[0160] В одном аспекте изобретение относится к химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1 или SEQ ID NO: 2, при этом последовательность нуклеиновой кислоты включает фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, включающей штамм Brighton вируса коровьей оспы, штамм Herman поксвируса енотов, штамм Utrecht поксвируса кроликов, штамм WR вируса осповакцины, штамм IHD вируса осповакцины, штамм Elstree вируса осповакцины, штамм CL вируса осповакцины, штамм Lederle-Chorioallantoic вируса осповакцины, штамм AS вируса осповакцины, штамм NZ2 орф-вируса и штамм TJS псевдопоксвируса коров.

[0161] Химерные поксвирусы, как описано в настоящем описании, могут включать трансгены. В рамках изобретения «трансген» относится к последовательности нуклеиновой кислоты, которая возникает вне данной клетки, организма или вируса. Следовательно, трансген в рамках изобретения не является нативным или не возникает в поксвирусе. Трансген в рамках настоящего изобретения может кодировать белок или может представлять собой некодирующую последовательность нуклеиновой кислоты. Трансгены в рамках настоящего изобретения могут включать противораковые последовательности нуклеиновых кислот (например, связывающую последовательность нуклеиновой кислоты и последовательности нуклеиновых кислот, которые кодируют полипептиды, полезные для лечения рака) или последовательности нуклеиновых кислот, кодирующие определяемый фрагмент. Таким образом, в вариантах осуществления химерный поксвирус, описанный в настоящем описании, содержит одну или более противораковых последовательностей нуклеиновой кислоты или последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент. В вариантах осуществления химерный поксвирус, описанный в настоящем описании, содержит одну или более противораковых последовательностей нуклеиновой кислоты и последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0162] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 71% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 72% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 73% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 74% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 75% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 76% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 77% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 78% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 79% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 80% с SEQ ID NO: 1.

[0163] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 81% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 82% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 83% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 84% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 85% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 86% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 87% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 88% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 89% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 90% с SEQ ID NO: 1.

[0164] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 91% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 92% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 93% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 94% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 95% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 96% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 97% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 98% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 99% с SEQ ID NO: 1.

[0165] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 71% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 72% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 73% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 74% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 75% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 76% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 77% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 78% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 79% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 80% с SEQ ID NO: 2.

[0166] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 81% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 82% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 83% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 84% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 85% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 86% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 87% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 88% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 89% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 90% с SEQ ID NO: 2.

[0167] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 91% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 92% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 93% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 94% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 95% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 96% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 97% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 98% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 99% с SEQ ID NO: 2.

[0168] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 71% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 72% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 73% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 74% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 75% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 76% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 77% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 78% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 79% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 80% с SEQ ID NO: 1.

[0169] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 81% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 82% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 83% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 84% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 85% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 86% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 87% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 88% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 89% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 90% с SEQ ID NO: 1.

[0170] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 91% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 92% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 93% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 94% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 95% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 96% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 97% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 98% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 99% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты представляет собой последовательность SEQ ID NO: 1.

[0171] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 71% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 72% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 73% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 74% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 75% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 76% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 77% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 78% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 79% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 80% с SEQ ID NO: 2.

[0172] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 81% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 82% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 83% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 84% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 85% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 86% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 87% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 88% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 89% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 90% с SEQ ID NO: 2.

[0173] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 91% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 92% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 93% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 94% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 95% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 96% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 97% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 98% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую 99% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты представляет собой последовательность SEQ ID NO: 1.

[0174] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 71% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 72% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 73% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 74% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 75% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 76% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 77% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 78% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 79% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 80% с SEQ ID NO: 1.

[0175] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 81% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 82% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 83% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 84% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 85% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 86% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 87% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 88% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 89% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 90% с SEQ ID NO: 1.

[0176] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 91% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 92% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 93% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 94% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 95% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 96% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 97% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 98% с SEQ ID NO: 1. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 99% с SEQ ID NO: 1.

[0177] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 71% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 72% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 73% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 74% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 75% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 76% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 77% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 78% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 79% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 80% с SEQ ID NO: 2.

[0178] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 81% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 82% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 83% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 84% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 85% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 86% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 87% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 88% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 89% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 90% с SEQ ID NO: 2.

[0179] В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 91% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 92% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 93% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 94% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 95% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 96% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 97% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 98% с SEQ ID NO: 2. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую приблизительно 99% с SEQ ID NO: 2.

[0180] Последовательность нуклеиновой кислоты может иметь идентичность последовательностей, составляющую по меньшей мере 70%, и последовательность нуклеиновой кислоты, имеющая по меньшей мере 70% идентичность последовательностей, может быть непрерывной. В вариантах осуществления последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 70%, и последовательность нуклеиновой кислоты, имеющую по меньшей мере 70% идентичность последовательностей, не является непрерывной последовательностью. «Последовательность, не являющаяся непрерывной» в рамках изобретения, относится к последовательности, включающей один или более фрагментов последовательностей, не имеющих идентичность последовательностей с SEQ ID NO: 1 или SEQ ID NO: 2. В вариантах осуществления не являющаяся непрерывной последовательность представляет собой последовательность, включающую первый фрагмент последовательности, имеющий по меньшей мере 70% идентичность последовательностей с SEQ ID NO: 1 или SEQ ID NO: 2, соединенный со вторым фрагментом последовательности, имеющим по меньшей мере 70% идентичность последовательностей с SEQ ID NO: 1 или SEQ ID NO: 2, через фрагмент последовательности, не имеющий идентичность последовательностей с SEQ ID NO: 1 или SEQ ID NO: 2. В вариантах осуществления не являющаяся непрерывной последовательность представляет собой последовательность, включающую множество фрагментов последовательностей, имеющих по меньшей мере 70% идентичность последовательностей с SEQ ID NO: 1 или SEQ ID NO: 2, соединенных через множество фрагментов последовательностей, не имеющих идентичность последовательностей с SEQ ID NO: 1 или SEQ ID NO: 2. В вариантах осуществления химерный поксвирус дополнительно содержит нуклеотидную вставку, делецию или мутацию.

[0181] В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0182] В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров и штамма Herman поксвируса енотов. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров и штамма Utrecht поксвируса кроликов. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров и штамма WR вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров и штамма IHD вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров и штамма Elstree вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров и штамма CL вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров и штамма Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров и штамма AS вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров и штамма NZ2 орф-вируса. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров и штамма TJS псевдопоксвируса коров.

[0183] В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов и штамма WR вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов и штамма IHD вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов и штамма Elstree вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов и штамма CL вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов и штамма Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов и штамма AS вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов и штамма NZ2 орф-вируса. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов и штамма TJS псевдопоксвируса коров.

[0184] В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины и штамма IHD вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины и штамма Elstree вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины и штамма CL вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины и штамма Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины и штамма AS вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины и штамма NZ2 орф-вируса. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины и штамма TJS псевдопоксвируса коров.

[0185] В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины и штамма Elstree вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины и штамма CL вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины и штамма Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины и штамма AS вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины и штамма NZ2 орф-вируса. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины и штамма TJS псевдопоксвируса коров.

[0186] В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Elstree вируса осповакцины и штамма CL вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Elstree вируса осповакцины и штамма Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Elstree вируса осповакцины и штамма AS вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Elstree вируса осповакцины и штамма NZ2 орф-вируса. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Elstree вируса осповакцины и штамма TJS псевдопоксвируса коров.

[0187] В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма CL вируса осповакцины и штамма Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма CL вируса осповакцины и штамма AS вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма CL вируса осповакцины и штамма NZ2 орф-вируса. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма CL вируса осповакцины и штамма TJS псевдопоксвируса коров.

[0188] В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Lederle-Chorioallantoic вируса осповакцины и штамма NZ2 орф-вируса. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Lederle-Chorioallantoic вируса осповакцины и штамма TJS псевдопоксвируса коров.

[0189] В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма AS вируса осповакцины и штамма NZ2 орф-вируса. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма AS вируса осповакцины и штамма TJS псевдопоксвируса коров. В вариантах осуществления последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0190] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины или штамма AS вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0191] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Herman поксвируса енотов. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Elstree вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма CL вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Lederle-Chorioallantoic вируса осповакцины или штамм AS вируса осповакцины.

[0192] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма TJS псевдопоксвируса коров.

[0193] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины или штамма AS вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0194] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Herman поксвируса енотов. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Elstree вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма CL вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Lederle-Chorioallantoic вируса осповакцины или штамм AS вируса осповакцины.

[0195] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 80% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма TJS псевдопоксвируса коров.

[0196] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины или штамма AS вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0197] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Herman поксвируса енотов. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Elstree вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма CL вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Lederle-Chorioallantoic вируса осповакцины или штамм AS вируса осповакцины.

[0198] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 90% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма TJS псевдопоксвируса коров.

[0199] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины или штамма AS вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0200] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Herman поксвируса енотов. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Elstree вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма CL вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Lederle-Chorioallantoic вируса осповакцины или штамм AS вируса осповакцины.

[0201] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 95% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма TJS псевдопоксвируса коров.

[0202] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины или штамма AS вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0203] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Brighton поксвируса коров. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Herman поксвируса енотов. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Utrecht поксвируса кроликов. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма WR вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма IHD вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Elstree вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма CL вируса осповакцины. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 1, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма Lederle-Chorioallantoic вируса осповакцины или штамм AS вируса осповакцины.

[0204] В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 98% с SEQ ID NO: 2, и при этом последовательность нуклеиновой кислоты содержит фрагменты нуклеиновой кислоты из штамма TJS псевдопоксвируса коров.

[0205] В вариантах осуществления химерный поксвирус представляет собой онколитический вирус. Онколитический вирус в рамках изобретения представляет собой вирус, способный выделять и уничтожать раковые клетки. В вариантах осуществления онколитический вирус выделяет клетки рака легкого. В вариантах осуществления онколитический вирус выделяет клетки рака яичников. В вариантах осуществления онколитический вирус выделяет клетки рака поджелудочной железы. В вариантах осуществления онколитический вирус предпочтительно выделяет раковые клетки относительно нераковых клеток.

[0206] В вариантах осуществления миРНК-связывающая последовательность образует часть гена ДНК-полимеразы химерного поксвируса. В вариантах осуществления поксвирус включает миРНК-связывающую последовательность. В вариантах осуществления поксвирус включает множество миРНК-связывающих последовательностей. В вариантах осуществления множество миРНК-связывающих последовательностей независимо отличаются. В вариантах осуществления множество миРНК-связывающих последовательностей являются одинаковыми. В вариантах осуществления миРНК-связывающая последовательность составляет приблизительно 22 нуклеотида в длину. В вариантах осуществления миРНК-связывающая последовательность составляет по меньшей мере 22 нуклеотида в длину. В вариантах осуществления миРНК-связывающая последовательность составляет 22 нуклеотида в длину. В вариантах осуществления миРНК-связывающая последовательность составляет приблизительно 22 нуклеотида в длину. В вариантах осуществления каждая из множества миРНК-связывающих последовательностей составляет по меньшей мере нуклеотида в длину. В вариантах осуществления каждая из множества миРНК-связывающих последовательностей составляет приблизительно 22 нуклеотида в длину. В вариантах осуществления каждая из множества миРНК-связывающих последовательностей составляет 22 нуклеотида в длину.

[0207] В одном аспекте изобретение относится ка выделенная нуклеиновая кислота, кодирующая химерный поксвирус, который описан в настоящем описании. В вариантах осуществления выделенная нуклеиновая кислота представляет собой SEQ ID NO: 1. В вариантах осуществления выделенная нуклеиновая кислота представляет собой SEQ ID NO: 2.

III. Вирусные композиции, содержащие трансгены

[0208] Химерные поксвирусы в рамках настоящего изобретения, включая его варианты осуществления, могут содержать трансгены. Трансгены, включенные в химерный поксвирус в рамках изобретения, могут повышать онколитическую активность химерного поксвируса по сравнению с химерным поксвирусом с отсутствующим указанным трансгеном. Трансгены могут, кроме того, увеличивать способность химерного поксвируса дифференцированно экспрессироваться/реплицироваться в раковых клетках по сравнению со здоровыми (нераковыми) клетками. Если химерный поксвирус включает трансгены, нуклеиновая кислота химерного поксвируса содержит противораковую последовательность нуклеиновой кислоты, связывающую последовательность нуклеиновой кислоты, последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент, или любую их комбинацию. Таким образом, в одном аспекте изобретение относится к химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1 или SEQ ID NO: 2, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; или (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0209] В одном аспекте изобретение относится к химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамм CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; или (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0210] В одном аспекте изобретение относится к химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 2, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; или (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0211] В одном аспекте изобретение относится к химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 3, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; или (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0212] В рамках изобретения термины «противораковая последовательность нуклеиновой кислоты» или «противораковые последовательности нуклеиновых кислот» относятся к последовательностям нуклеиновых кислот, обладающим антинеопластическими свойствами и/или способностью ингибировать рост или пролиферацию раковых клеток, и/или предусматривающих селективную экспрессию химерного поксвируса в рамках изобретения, включая его варианты осуществления, в раковой клетке по сравнению со здоровой клеткой. Противораковые последовательности нуклеиновых кислот могут ингибировать прогрессирование или замедлять прогрессирование рака временно или постоянно. Примеры противораковых последовательностей нуклеиновой кислоты включают последовательности, кодирующие белки, экспрессия которых прямо или опосредованно ингибирует рост раковых клеток. Например, противораковую последовательность нуклеиновой кислоты в рамках изобретения может кодировать белок, который экспрессируется на более высоком уровне в раковой клетке по сравнению со здоровой клеткой (например, натрий-йодидный транспортер)). В другом неограничивающем примере противораковая последовательность нуклеиновой кислоты может кодировать полипептид (антитело), способное дерепрессировать противоопухолевые иммунные ответы (например, анти-PD-L1 антитела или их фрагменты). В вариантах осуществления противораковая последовательность нуклеиновой кислоты содержит последовательность нуклеиновой кислоты, способную увеличивать экспрессию/репликацию химерного поксвируса в раковой клетке по сравнению со здоровой клеткой. Таким образом, в вариантах осуществления скорость экспрессии (например, транскрипции, трансляции) химерного поксвируса, включающего противораковую последовательность нуклеиновой кислоты, уменьшается в здоровой клетке по сравнению с раковой клеткой. В вариантах осуществления химерный поксвирус, включающий противораковую последовательность нуклеиновой кислоты, не экспрессируется в обнаруживаемом количестве в здоровой клетке. В вариантах осуществления противораковая последовательность нуклеиновой кислоты представляет собой связывающую последовательность нуклеиновой кислоты. В вариантах осуществления противораковая последовательность нуклеиновой кислоты содержит связывающую последовательность нуклеиновой кислоты.

[0213] В рамках изобретения «связывающая последовательность нуклеиновой кислоты» относится к последовательности нуклеиновой кислоты, способной к связыванию (гибридизации) с по меньшей мере частично комплементарной клеточной нуклеиновой кислотой (например, ДНК, РНК, миРНК), при этом клеточная нуклеиновая кислота присутствует в повышенном количестве в здоровой клетке по сравнению с раковой клеткой. Связывающая последовательность нуклеиновой кислоты в рамках изобретения может образовывать часть нуклеиновой кислоты, состоящую из химерного поксвируса, и может быть функционально связана с геном химерного поксвируса. При связывании клеточной нуклеиновой кислоты со связывающей последовательностью нуклеиновой кислоты ген химерного поксвируса можно нацелить на деградацию (гидролиз), тем самым уменьшая экспрессию/репликацию химерного поксвируса. В вариантах осуществления связывающая последовательность нуклеиновой кислоты представляет собой ДНК-связывающую последовательность. В вариантах осуществления связывающую последовательность нуклеиновой кислоты представляет собой РНК-связывающую последовательность. В вариантах осуществления связывающая последовательность нуклеиновой кислоты представляет собой миРНК-связывающую последовательность. Вследствие этого, в вариантах осуществления противораковая последовательность нуклеиновой кислоты представляет собой связывающую последовательность нуклеиновой кислоты. В вариантах осуществления противораковая последовательность нуклеиновой кислоты представляет собой ДНК-связывающую последовательность. В вариантах осуществления противораковая последовательность нуклеиновой кислоты представляет собой РНК-связывающую последовательность. В вариантах осуществления противораковая последовательность нуклеиновой кислоты представляет собой миРНК-связывающую последовательность.

[0214] «Последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент» в рамках изобретения относится к последовательности нуклеиновой кислоты, которая кодирует композицию, определяемую спектроскопическим, фотохимическим, биохимическим, иммунохимическим, химическим или другим физическим способом. Последовательности нуклеиновых кислот, кодирующие определяемый фрагмент, могут кодировать флуоресцентный фрагмент. Неограничивающими примерами флуоресцентных фрагментов являются mCherry, Emerald и люцифераза светлячков.

[0215] В одном аспекте изобретение относится к химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1 или SEQ ID NO: 2, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; (iii) одну или более связывающих последовательностей нуклеиновой кислоты; или (iv) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0216] В другом аспекте изобретение относится к химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; (iii) одну или более связывающих последовательностей нуклеиновой кислоты; или (iv) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0217] В другом аспекте изобретение относится к химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 2, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; (iii) одну или более связывающих последовательностей нуклеиновой кислоты; или (iv) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0218] В другом аспекте изобретение относится к химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 3, при этом последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; (iii) одну или более связывающих последовательностей нуклеиновой кислоты; или (iv) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0219] В вариантах осуществления последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; и (ii) одну или более противораковых последовательностей нуклеиновой кислоты. В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины. В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0220] В вариантах осуществления последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; и (ii) одну или более связывающих последовательностей нуклеиновой кислоты. В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины. В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0221] В вариантах осуществления последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; и (ii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент. В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины. В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0222] В вариантах осуществления последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; и (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент. В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины. В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0223] В вариантах осуществления последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; и (iii) одну или более связывающих последовательностей нуклеиновой кислоты. В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины. В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0224] Противораковые последовательности нуклеиновых кислот (трансгены) могут образовывать часть генома химерного поксвируса в рамках изобретения, включая его варианты осуществления. Геном химерного поксвируса содержит гены, необходимые для экспрессии и репликации поксвируса. Гены, необходимые для экспрессии и репликации химерного поксвируса, называются в настоящем описании «основными генами». Гены, которые не требуются для экспрессии и репликации химерного поксвируса, называются в настоящем описании «второстепенными генами». Противораковые последовательности нуклеиновых кислот можно заключить в геном химерного поксвируса посредством вставки в гены, или они могут быть функционально связаны с генами. После вставки противораковой последовательности нуклеиновой кислоты в ген химерного поксвируса ген (например, второстепенный ген) или его части можно удалить. В вариантах осуществления одна или более противораковых последовательностей нуклеиновой кислоты образуют часть второстепенного гена химерного поксвируса. В вариантах осуществления одну или более противораковых последовательностей нуклеиновой кислоты вставляют во второстепенный ген химерного поксвируса. В вариантах осуществления второстепенный ген представляет собой ген тимидинкиназы. В вариантах осуществления второстепенный ген представляет собой ген J2R. В вариантах осуществления второстепенный ген представляет собой ген F14.5L.

[0225] Как обсуждалось выше, противораковые последовательности нуклеиновых кислот могут кодировать полипептиды, пригодные для лечения рака. В вариантах осуществления одна или более противораковых последовательностей нуклеиновой кислоты независимо кодируют ингибитор PD-L1 или натрий-йодидный симпортер. В вариантах осуществления ингибитор PD-L1 представляет собой анти-PD-L1 scFv. В вариантах осуществления анти-PD-L1 scFv содержит последовательность SEQ ID NO: 17. В вариантах осуществления анти-PD-L1 scFv представляет собой последовательность SEQ ID NO: 17. В вариантах осуществления натрий-йодидный симпортер содержит последовательность SEQ ID NO: 13. В вариантах осуществления натрий-йодидный симпортер представляет собой последовательность SEQ ID NO: 13.

[0226] «PD-L1» или «белок PD-L1», который упомянут в настоящем описании, содержит любую из рекомбинантных или встречающихся в природе форм лиганда программируемой смерти 1 (PD-L1), также известного как кластер дифференциации 274 (CD 274), или его варианты или гомологи, которые сохраняют активность PD-L1 (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с PD-L1). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность аминокислотных последовательностей по всей последовательности или части последовательности (например, непрерывной части из 50, 100, 150 или 200 аминокислот) по сравнению с белком PD-L1 природного происхождения. В вариантах осуществления белок PD-L1 по существу идентичен белку, идентифицированному UniProt, ссылочный номер Q9NZQ7, или варианту или гомологу, имеющему существенную с ним идентичность.

[0227] Термин «ингибитор PD-L1» в рамках изобретения относится к веществу (например, антителу, фрагменту антитела, одноцепочечному вариабельному фрагменту [scFv]), способному определяемо уменьшать экспрессию или уровень активности PD-L1 по сравнению с контролем. Ингибированная экспрессия или активность PD-L1 может составлять 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или менее, чем в контроле. В некоторых случаях ингибирование составляет 1,5, 2, 3, 4, 5, 10 или более раз по сравнению с контролем. Ингибитор PD-L1 ингибирует PD-L1, например, по меньшей мере в какой-то мере, частично или полностью блокируя стимуляцию, уменьшая, предотвращая или задерживая активацию, или инактивируя, десенсибилизируя или понижающе регулируя трансдукцию сигнала, активность или количество PD-L1 по сравнению с отсутствием ингибитора PD-L1.

[0228] Термины «натрий-йодидный симпортер», «NIS», или «hNIS», как упомянуто в настоящем описании, включают любую из рекомбинантных или встречающихся в природе форм натрий-йодидного симпортера или его варианты или гомологи, которые сохраняют активность натрий-йодидного симпортера (например, в пределах по меньшей мере 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% или 100% активности по сравнению с натрий-йодидным симпортером). В некоторых аспектах варианты или гомологи имеют по меньшей мере 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичность аминокислотных последовательностей по всей последовательности или части последовательности (например, непрерывной части из 50, 100, 150 или 200 аминокислот) по сравнению с натрий-йодидным симпортером природного происхождения. В вариантах осуществления натрий-йодидный симпортер по существу идентичен белку, идентифицированному UniProt, ссылочный номер Q92911, или варианту или гомологу, имеющему существенную с ним идентичность. В вариантах осуществления натрий-йодидный симпортер содержит последовательность SEQ ID NO: 13. В вариантах осуществления натрий-йодидный симпортер представляет собой последовательность SEQ ID NO: 13.

[0229] Экспрессия противораковой последовательности нуклеиновой кислоты в рамках изобретения может контролироваться промотором. Вследствие этого в вариантах осуществления одна или более противораковых последовательностей нуклеиновой кислоты каждая функционально связана с промотором. В вариантах осуществления промотор представляет собой ранний промотор вируса осповакцины. В вариантах осуществления промотор представляет собой синтетический ранний промотор. В вариантах осуществления синтетический ранний промотор содержит последовательность SEQ ID NO: 19. В вариантах осуществления синтетический ранний промотор представляет собой последовательность SEQ ID NO: 19. В вариантах осуществления промотор представляет собой поздний промотор вируса осповакцины. В вариантах осуществления промотор представляет собой промотор Н5 или промотор 11К. В вариантах осуществления промотор Н5 содержит последовательность SEQ ID NO: 18. В вариантах осуществления промотор Н5 представляет собой последовательность SEQ ID NO: 18. В вариантах осуществления промотор 11К содержит последовательность SEQ ID NO: 20. В вариантах осуществления промотор 11К представляет собой последовательность SEQ ID NO: 20.

[0230] Противораковую последовательность нуклеиновой кислоты (связывающую последовательность нуклеиновой кислоты), предоставленную в настоящем описании, можно заключить в геном химерного поксвируса так, чтобы она находилась в функциональных отношениях (функционально связана) с определенным геном поксвируса. Например, противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) может быть функционально связана с геном поксвируса, если она воздействует на транскрипцию или трансляцию гена поксвируса. В целом, противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) и ген поксвируса функционально связаны, когда они являются смежными и/или в фазе считывания. В вариантах осуществления одна или более противораковых последовательностей нуклеиновой кислоты (одна или более связывающих последовательностей нуклеиновой кислоты) функционально связаны с основным геном химерного поксвируса. В вариантах осуществления одна или более противораковых последовательностей нуклеиновой кислоты (одна или более связывающих последовательностей нуклеиновой кислоты) функционально связаны с геном ДНК-полимеразы химерного поксвируса. В вариантах осуществления одна или более противораковых последовательностей нуклеиновой кислоты (одна или более связывающих последовательностей нуклеиновой кислоты) функционально связаны с 3'-концом гена ДНК-полимеразы химерного поксвируса. В вариантах осуществления одна или более противораковых последовательностей нуклеиновой кислоты (одна или более связывающих последовательностей нуклеиновой кислоты) функционально связаны с геном урацил-ДНК-гликозилазы. В вариантах осуществления одна или более противораковых последовательностей нуклеиновой кислоты (одна или более связывающих последовательностей нуклеиновой кислоты) функционально связаны 3'-концом гена урацил-ДНК-гликозилазы.

[0231] В вариантах осуществления одна или более противораковых последовательностей нуклеиновой кислоты (одна или более связывающих последовательностей нуклеиновой кислоты) независимо кодирует миРНК-связывающую последовательность. В вариантах осуществления миРНК-связывающая последовательность представляет собой miR100-связывающую последовательность или let7c-связывающую последовательность. В вариантах осуществления миРНК-связывающая последовательность представляет собой miR100-связывающую последовательность. В вариантах осуществления miR100-связывающая последовательность содержит последовательность SEQ ID NO: 9. В вариантах осуществления miR100-связывающая последовательность представляет собой последовательность SEQ ID NO: 9. В вариантах осуществления miR100-связывающая последовательность содержит последовательность SEQ ID NO: 10. В вариантах осуществления miR100-связывающая последовательность представляет собой последовательность SEQ ID NO: 10. В вариантах осуществления миРНК-связывающая последовательность представляет собой let7c-связывающую последовательность. В вариантах осуществления let7c-связывающая последовательность содержит последовательность SEQ ID NO: 11. В вариантах осуществления let7c-связывающая последовательность представляет собой последовательность SEQ ID NO: 11.

[0232] В вариантах осуществления одна или более противораковых последовательностей нуклеиновой кислоты представляют собой первую противораковую последовательность нуклеиновой кислоты и вторую противораковую последовательность нуклеиновой кислоты. В рамках изобретения первая противораковая последовательность нуклеиновой кислоты может являться первой последовательностью, связывающей нуклеиновые кислоты, и вторая противораковая последовательность нуклеиновой кислоты может являться второй последовательностью, связывающей нуклеиновые кислоты.

[0233] В вариантах осуществления первая противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, и указанная вторая противораковая последовательность нуклеиновой кислоты (вторая связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность. В вариантах осуществления первая противораковая последовательность нуклеиновой кислоты образует часть гена тимидинкиназы, а вторая противораковая последовательность нуклеиновой кислоты (вторая связывающая последовательность нуклеиновой кислоты) функционально связана с геном урацил-ДНК-гликозилазы. В вариантах осуществления первая противораковая последовательность нуклеиновой кислоты образует часть гена тимидинкиназы, а вторая противораковая последовательность нуклеиновой кислоты (вторая связывающая последовательность нуклеиновой кислоты) функционально связана с геном ДНК-полимеразы.

[0234] В вариантах осуществления первая противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, а вторая противораковая последовательность нуклеиновой кислоты кодирует ингибитор PD-L1. В вариантах осуществления первая противораковая последовательность нуклеиновой кислоты образует часть гена тимидинкиназы, а вторая противораковая последовательность нуклеиновой кислоты образует часть гена F14.5L.

[0235] В вариантах осуществления последовательность нуклеиновой кислоты содержит: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; и (ii) указанную последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент. В вариантах осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует флуоресцентный фрагмент. В вариантах осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, образует часть второстепенного гена химерного поксвируса. В вариантах осуществления второстепенный ген представляет собой ген тимидинкиназы. В вариантах осуществления части второстепенного гена удалены.

[0236] В вариантах осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, функционально связанный с промотором. В вариантах осуществления промотор представляет собой ранний промотор вируса осповакцины. В вариантах осуществления промотор представляет собой синтетический ранний промотор. В вариантах осуществления синтетический ранний промотор содержит последовательность SEQ ID NO: 19. В вариантах осуществления синтетический ранний промотор представляет собой последовательность SEQ ID NO: 19. В вариантах осуществления промотор представляет собой поздний промотор вируса осповакцины. В вариантах осуществления промотор представляет собой промотор Н5 или промотор 11К. В вариантах осуществления промотор Н5 содержит последовательность SEQ ID NO: 18. В вариантах осуществления промотор Н5 представляет собой последовательность SEQ ID NO: 18. В вариантах осуществления промотор 11К содержит последовательность SEQ ID NO: 20. В вариантах осуществления промотор 11К представляет собой последовательность SEQ ID NO: 20.

[0237] В одном варианте осуществления противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность, имеющую последовательность SEQ ID NO: 10 и функционально связанную с 3'-концом гена урацил-ДНК-гликозилазы.

[0238] В одном варианте осуществления противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность, имеющую последовательность SEQ ID NO: 9 и функционально связанную с 3'-концом гена урацил-ДНК-гликозилазы.

[0239] В одном варианте осуществления противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность, имеющую последовательность SEQ ID NO: 11 и функционально связанную с 3'-концом гена урацил-ДНК-гликозилазы.

[0240] В одном варианте осуществления противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность, имеющую последовательность SEQ ID NO: 9 и функционально связанную с 3'-концом гена ДНК-полимеразы.

[0241] В одном варианте осуществления противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность, имеющую последовательность SEQ ID NO: 11 и функционально связанную с 3'-концом гена ДНК-полимеразы.

[0242] В одном варианте осуществления ген тимидинкиназы химерного поксвируса имеет последовательность SEQ ID NO: 5.

[0243] В одном варианте осуществления противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, функционально связанный с синтетическим ранним промотором, и образует часть гена тимидинкиназы, при этом натрий-йодидный симпортер имеет последовательность SEQ ID NO: 13, а синтетический ранний промотор имеет последовательность SEQ ID NO: 19.

[0244] В одном варианте осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует флуоресцентный фрагмент, имеющий последовательность SEQ ID NO: 14, функционально связанный с промотором Н5, и образует часть гена тимидинкиназы, при этом промотор Н5 имеет последовательность SEQ ID NO: 18.

[0245] В одном варианте осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует флуоресцентный фрагмент, имеющий последовательность SEQ ID NO: 15, функционально связанный с синтетическим ранним промотором, и образует часть гена тимидинкиназы, при этом синтетический ранний промотор имеет последовательность SEQ ID NO: 19.

[0246] В одном варианте осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует флуоресцентный фрагмент, имеющий последовательность SEQ ID NO: 15, функционально связанный с промотором Н5, и образует часть гена тимидинкиназы, при этом промотор Н5 имеет последовательность SEQ ID NO: 18.

[0247] В одном варианте осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует флуоресцентный фрагмент, имеющий последовательность SEQ ID NO: 15, функционально связанный с промотором 11К, и образует часть гена тимидинкиназы, при этом промотор 11К имеет последовательность SEQ ID NO: 20.

[0248] В одном варианте осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует флуоресцентный фрагмент, имеющий последовательность SEQ ID NO: 16, функционально связанный с промотором Н5, и образует часть гена тимидинкиназы, при этом промотор Н5 имеет последовательность SEQ ID NO: 18.

[0249] В одном варианте осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует флуоресцентный фрагмент, имеющий последовательность SEQ ID NO: 16, функционально связанный с промотором 11К, и образует часть гена тимидинкиназы, при этом промотор 11К имеет последовательность SEQ ID NO: 20.

[0250] В одном варианте осуществления первая противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, функционально связанный с синтетическим ранним промотором, и образует часть гена тимидинкиназы; и вторая противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность, имеющую последовательность SEQ ID NO: 10, и функционально связанную с 3'-концом гена урацил-ДНК-гликозилазы, при этом натрий-йодидный симпортер имеет последовательность SEQ ID NO: 13, а синтетический ранний промотор имеет последовательность SEQ ID NO: 19.

[0251] В одном варианте осуществления первая противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, функционально связанный с синтетическим ранним промотором, и образует часть гена тимидинкиназы; и вторая противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность, имеющую последовательность SEQ ID NO: 9, и функционально связанную с 3'-концом гена урацил-ДНК-гликозилазы, при этом натрий-йодидный симпортер имеет последовательность SEQ ID NO: 13, а синтетический ранний промотор имеет последовательность SEQ ID NO: 19.

[0252] В одном варианте осуществления первая противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, функционально связанный с синтетическим ранним промотором, и образует часть гена тимидинкиназы; и вторая противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность, имеющую последовательность SEQ ID NO: 11, и функционально связанную с 3'-концом гена урацил-ДНК-гликозилазы, при этом натрий-йодидный симпортер имеет последовательность SEQ ID NO: 13, а синтетический ранний промотор имеет последовательность SEQ ID NO: 19.

[0253] В одном варианте осуществления первая противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, функционально связанный с синтетическим ранним промотором, и образует часть гена тимидинкиназы; и вторая противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность, имеющую последовательность SEQ ID NO: 9, и функционально связанную с 3'-концом гена ДНК-полимеразы, при этом натрий-йодидный симпортер имеет последовательность SEQ ID NO: 13, а синтетический ранний промотор имеет последовательность SEQ ID NO: 19.

[0254] В одном варианте осуществления первая противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, функционально связанный с синтетическим ранним промотором, и образует часть гена тимидинкиназы; и вторая противораковая последовательность нуклеиновой кислоты (связывающая последовательность нуклеиновой кислоты) кодирует миРНК-связывающую последовательность, имеющую последовательность SEQ ID NO: 11, и функционально связанную с 3'-концом гена ДНК-полимеразы, при этом натрий-йодидный симпортер имеет последовательность SEQ ID NO: 13, а синтетический ранний промотор имеет последовательность SEQ ID NO: 19.

[0255] В одном варианте осуществления ген F14.5L химерного поксвируса имеет последовательность SEQ ID NO: 7.

[0256] В одном варианте осуществления противораковая последовательность нуклеиновой кислоты кодирует анти-PD-L1 scFv, функционально связанный с промотором Н5, и образует часть гена F14.5L, при этом анти-PD-L1 scFv имеет последовательность SEQ ID NO: 17, а промотор Н5 имеет последовательность SEQ ID NO: 18.

[0257] В одном варианте осуществления противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, функционально связанный с синтетическим ранним промотором, и образует часть гена тимидинкиназы, и ген F14.5L имеет последовательность SEQ ID NO: 7, при этом натрий-йодидный симпортер имеет последовательность SEQ ID NO: 13, а синтетический ранний промотор имеет последовательность SEQ ID NO: 19.

[0258] В одном варианте осуществления первая противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, функционально связанный с синтетическим ранним промотором, и образует часть гена тимидинкиназы; и вторая противораковая последовательность нуклеиновой кислоты кодирует анти-PD-L1 scFv, функционально связанный с промотором Н5, и образует часть гена F14.5L, при этом натрий-йодидный симпортер имеет последовательность SEQ ID NO: 13, синтетический ранний промотор имеет последовательность SEQ ID NO: 19, анти-PD-L1 scFv имеет последовательность SEQ ID NO: 17, а промотор Н5 имеет последовательность SEQ ID NO: 18.

IV. Способы получения химерного поксвируса

[0259] В другом аспекте изобретение относится к способ получения химерного поксвируса, при этом способ включает: инфицирование клетки по меньшей мере двумя штаммами поксвируса, выбранными из группы, содержащей штамм Brighton вируса коровьей оспы, штамм Herman поксвируса енотов, штамм Utrecht поксвируса кроликов, штамм WR вируса осповакцины, штамм IHD вируса осповакцины, штамм Elstree вируса осповакцины, штамм CL вируса осповакцины, штамм Lederle-Chorioallantoic вируса осповакцины, штамм AS вируса осповакцины, штамм NZ2 орф-вируса и штамм TJS псевдопоксвируса коров; и обеспечение возможности репликации по меньшей мере двух штаммов поксвируса, тем самым получая химерный поксвирус.

[0260] Способы получения химерного поксвируса в рамках настоящего изобретения можно использовать для образования химерных поксвирусов, содержащих трансгены (например, противораковую последовательность нуклеиновой кислоты, связывающую последовательность нуклеиновой кислоты, последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент), как описано в настоящем описании.

[0261] В вариантах осуществления по меньшей мере два штамма вируса поксвируса каждый присутствует при множественности заражения, составляющей менее чем приблизительно 1,0. В вариантах осуществления по меньшей мере два штамма вируса поксвируса каждый присутствует при множественности заражения, составляющей менее чем приблизительно 0,5. В вариантах осуществления по меньшей мере два штамма вируса поксвируса каждый присутствует при множественности заражения, составляющей менее чем приблизительно 0,1. В вариантах осуществления по меньшей мере два штамма вируса поксвируса каждый присутствует при множественности заражения, составляющей менее чем приблизительно 0,05. В вариантах осуществления по меньшей мере два штамма вируса поксвируса каждый присутствует при множественности заражения, составляющей менее чем приблизительно 0,01.

[0262] В вариантах осуществления химерный поксвирус получают посредством способа, включающего: инфицирование клетки по меньшей мере двумя штаммами поксвируса, выбранными из группы, содержащей штамм Brighton вируса коровьей оспы, штамм Herman поксвируса енотов, штамм Utrecht поксвируса кроликов, штамм WR вируса осповакцины, штамм IHD вируса осповакцины, штамм Elstree вируса осповакцины, штамм CL вируса осповакцины, штамм Lederle-Chorioallantoic вируса осповакцины, штамм AS вируса осповакцины, штамм NZ2 орф-вируса и штамм TJS псевдопоксвируса коров; и обеспечение возможности репликации по меньшей мере двух штаммов поксвируса, тем самым получая химерный поксвирус.

[0263] В вариантах осуществления клетку инфицируют штаммом Brighton вируса коровьей оспы, штаммом Herman поксвируса енотов, штаммом Utrecht поксвируса кроликов, штаммом WR вируса осповакцины, штаммом IHD вируса осповакцины, штаммом Elstree вируса осповакцины, штаммом CL вируса осповакцины, штаммом Lederle-Chorioallantoic вируса осповакцины и штаммом AS вируса осповакцины.

[0264] В вариантах осуществления фрагменты нуклеиновой кислоты происходят из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0265] В вариантах осуществления клетку инфицируют штаммом Brighton поксвируса коров и штаммом Herman поксвируса енотов. В вариантах осуществления клетку инфицируют штаммом Brighton поксвируса коров и штаммом Utrecht поксвируса кроликов. В вариантах осуществления клетку инфицируют штаммом Brighton поксвируса коров и штаммом WR вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Brighton поксвируса коров и штаммом IHD вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Brighton поксвируса коров и штаммом Elstree вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Brighton поксвируса коров и штаммом CL вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Brighton поксвируса коров и штаммом Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Brighton поксвируса коров и штаммом AS вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Brighton поксвируса коров и штаммом NZ2 орф-вируса. В вариантах осуществления клетку инфицируют штаммом Brighton поксвируса коров и штаммом TJS псевдопоксвируса коров.

[0266] В вариантах осуществления клетку инфицируют штаммом Utrecht поксвируса кроликов и штаммом WR вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Utrecht поксвируса кроликов и штаммом IHD вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Utrecht поксвируса кроликов и штаммом Elstree вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Utrecht поксвируса кроликов и штаммом CL вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Utrecht поксвируса кроликов и штаммом Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Utrecht поксвируса кроликов и штаммом AS вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Utrecht поксвируса кроликов и штаммом NZ2 орф-вируса. В вариантах осуществления клетку инфицируют штаммом Utrecht поксвируса кроликов и штаммом TJS псевдопоксвируса коров.

[0267] В вариантах осуществления клетку инфицируют штаммом WR вируса осповакцины и штаммом IHD вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом WR вируса осповакцины и штаммом Elstree вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом WR вируса осповакцины и штаммом CL вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом WR вируса осповакцины и штаммом Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом WR вируса осповакцины и штаммом AS вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом WR вируса осповакцины и штаммом NZ2 орф-вируса. В вариантах осуществления клетку инфицируют штаммом WR вируса осповакцины и штаммом TJS псевдопоксвируса коров.

[0268] В вариантах осуществления клетку инфицируют штаммом IHD вируса осповакцины и штаммом Elstree вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом IHD вируса осповакцины и штаммом CL вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом IHD вируса осповакцины и штаммом Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом IHD вируса осповакцины и штаммом AS вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом IHD вируса осповакцины и штаммом NZ2 орф-вируса. В вариантах осуществления клетку инфицируют штаммом IHD вируса осповакцины и штаммом TJS псевдопоксвируса коров.

[0269] В вариантах осуществления клетку инфицируют штаммом Elstree вируса осповакцины и штаммом CL вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Elstree вируса осповакцины и штаммом Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Elstree вируса осповакцины и штаммом AS вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Elstree вируса осповакцины и штаммом NZ2 орф-вируса. В вариантах осуществления клетку инфицируют штаммом Elstree вируса осповакцины и штаммом TJS псевдопоксвируса коров.

[0270] В вариантах осуществления клетку инфицируют штаммом CL вируса осповакцины и штаммом Lederle-Chorioallantoic вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом CL вируса осповакцины и штаммом AS вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом CL вируса осповакцины и штаммом NZ2 орф-вируса. В вариантах осуществления клетку инфицируют штаммом CL вируса осповакцины и штаммом TJS псевдопоксвируса коров.

[0271] В вариантах осуществления клетку инфицируют штаммом Lederle-Chorioallantoic вируса осповакцины и штаммом AS вируса осповакцины. В вариантах осуществления клетку инфицируют штаммом Lederle-Chorioallantoic вируса осповакцины и штаммом NZ2 орф-вируса. В вариантах осуществления клетку инфицируют штаммом Lederle-Chorioallantoic вируса осповакцины и штаммом TJS псевдопоксвируса коров.

[0272] В вариантах осуществления клетку инфицируют штаммом AS вируса осповакцины и штаммом NZ2 орф-вируса. В вариантах осуществления клетку инфицируют штаммом AS вируса осповакцины и штаммом TJS псевдопоксвируса коров. В вариантах осуществления клетку инфицируют штаммом NZ2 орф-вируса и штаммом TJS псевдопоксвируса коров.

[0273] В вариантах осуществления клеткой является клетка, представляющая собой почечный фибробласт. В вариантах осуществления клетка представляет собой эпителиальную клетку. В вариантах осуществления клеткой является клетка, представляющая собой клетку CV-1. В вариантах осуществления клетка представляет собой эпителиальную клетку почки коровы.

V. Фармацевтические композиции

[0274] В одном аспекте изобретение относится ка фармацевтическая композиция, содержащая терапевтически эффективное количество химерного поксвируса в рамках изобретения, включая его варианты осуществления. В вариантах осуществления химерный поксвирус включает трансгены (например, противораковую последовательность нуклеиновой кислоты, связывающую последовательность нуклеиновой кислоты, последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент, или любую их комбинацию).

[0275] «Фармацевтически приемлемый эксципиент» и «фармацевтически приемлемый носитель» относятся к веществу, которое способствует введению активного вещества, его абсорбции пациентом и которое можно включать в композиции согласно настоящему изобретению, не вызывая значительного неблагоприятного токсикологического воздействия на пациента. Неограничивающие примеры фармацевтически приемлемых эксципиентов включают воду, NaCl, физиологические солевые растворы, лактат Рингера, физиологический раствор сахарозы, физиологический раствор глюкозы, связующие вещества, наполнители, дезинтегранты, смазочные материалы, покрытия, подсластители, ароматизаторы, солевые растворы (такие как раствор Рингера), спирты, масла, желатины, углеводы, такие как лактоза, амилоза или крахмал, сложные эфиры жирных кислот, гидроксиметилцеллюлозу, поливинилпирролидин, красители и тому подобное. Такие препараты можно стерилизовать и, при необходимости, смешивать со вспомогательными агентами, такими как смазывающие вещества, консерванты, стабилизаторы, увлажняющие вещества, эмульгаторы, соли для воздействия на осмотическое давление, буферные агенты, красители и/или ароматические вещества и др., которые не вступают во вредную реакцию с соединениями согласно настоящему изобретению. Специалист в данной области поймет, что в настоящем изобретении пригодны и другие фармацевтические эксципиенты.

[0276] Композиции химерного поксвируса в рамках настоящего изобретения, включая его варианты осуществления, можно вводить перорально, через желудочно-кишечный тракт или ректально. Введение может быть в форме однократной болюсной дозы или может быть, например, с помощью помпы для непрерывной перфузии. В вариантах осуществления химерный поксвирус в рамках изобретения комбинируют с одним или более эксципиентов, например, дезинтегранта, наполнителя, вещества, способствующего скольжению, или консерванта. В вариантах осуществления химерный поксвирус в рамках изобретения образует часть капсулы. Подходящие капсулы включают капсулы с твердой оболочкой или капсулы с мягкой оболочкой. Для образования капсулы можно использовать любой коллоид на основе липидов или полимеров. Иллюстративные полимеры, пригодные для коллоидных препаратов, включают желатин, растительные полисахариды или их производные, такие как каррагинаны, и модифицированные формы крахмала и целлюлозы, например, гипромеллозу. Необязательно, к раствору гелеобразующего агента можно добавить другие ингредиенты, например пластификаторы, такие как глицерин и/или сорбит, для уменьшения твердости капсулы, красители, консерванты, дезинтегранты, смазывающие вещества и обработку поверхности.

[0277] Композиции химерного поксвируса можно составить в виде стандартной лекарственной формы, причем каждая дозировка содержит, например, от приблизительно 0,005 до приблизительно 2000 мг определенного химерного поксвируса, имеющего минимальную уреазную активность на дозу. Термин «стандартные лекарственные формы» относится к физически дискретным единицам, подходящим в качестве единичных доз для пациентов людей и других млекопитающих, причем каждая единица содержит предварительно определенное количество активного материала, рассчитанное для получения желаемого терапевтического эффекта, в сочетании с подходящим фармацевтическим эксципиентом. Для приготовления твердых композиций, таких как таблетки, основной активный ингредиент смешивают с фармацевтическим эксципиентом с образованием твердой композиции до придания ей лекарственной формы, содержащей гомогенную смесь соединения согласно настоящему изобретению. Когда эти композиции до придания ей лекарственной формы называют гомогенными, активный ингредиент обычно равномерно распределен по всей композиции, так что композицию можно легко подразделить на одинаково эффективные стандартные лекарственные формы, такие как таблетки, пилюли и капсулы.

[0278] В некоторых вариантах осуществления таблетки или пилюли согласно настоящему изобретению могут быть покрыты оболочкой или составлены иным образом для получения лекарственной формы, обеспечивающей преимущество пролонгированного действия. Например, таблетка или пилюля могут содержать внутренний лекарственный и наружный лекарственный компонент, причем последний находится в форме оболочки над первым. Два компонента могут быть разделены энтеросолюбильным слоем, который служит для противодействия распаду в желудке и позволяет внутреннему компоненту без изменений проходить в двенадцатиперстную кишку или задерживаться при высвобождении. Для таких энтеросолюбильных слоев или покрытий можно использовать ряд материалов; такие материалы включают ряд полимерных кислот и смеси полимерных кислот с такими материалами, как шеллак, цетиловый спирт и ацетат целлюлозы.

[0279] Жидкие формы, в которые можно включить композиции согласно настоящему изобретению, для перорального введения или посредством инъекции, включают водные растворы, подходящие ароматизированные сиропы, водные или масляные суспензии и ароматизированные эмульсии с пищевыми маслами, такими как хлопковое масло, кунжутное масло, кокосовое масло или арахисовое масло, а также эликсиры и аналогичные фармацевтические несущие среды.

VI. Способы лечения

[0280] В другом аспекте изобретение относится к способ лечения рака у пациента, при этом способ включает введение пациенту терапевтически эффективное количество химерного поксвируса в рамках изобретения, включая его варианты осуществления, тем самым осуществляя лечение рака у пациента. В вариантах осуществления рак представляет собой рак молочной железы, рак толстой кишки, рак почек, лейкоз, рак легкого, меланому, рак яичников, рак предстательной железы, рак поджелудочной железы, рак мозга, рак печени, рак желудка или саркому. В вариантах осуществления рак представляет собой рак молочной железы. В вариантах осуществления рак представляет собой рак толстой кишки. В вариантах осуществления рак представляет собой рак почки. В вариантах осуществления рак представляет собой лейкоз. В вариантах осуществления рак представляет собой рак легкого. В вариантах осуществления рак представляет собой меланому. В вариантах осуществления рак представляет собой рак яичников. В вариантах осуществления рак представляет собой рак предстательной железы. В вариантах осуществления рак представляет собой рак поджелудочной железы. В вариантах осуществления рак представляет собой рак головного мозга. В вариантах осуществления рак представляет собой рак печени. В вариантах осуществления рак представляет собой рак желудка. В вариантах осуществления рак представляет собой саркому. В вариантах осуществления рак представляет собой Трижды негативный рак молочной железы.

[0281] В вариантах осуществления введение включает введение первого химерного поксвируса и второго химерного поксвируса. В вариантах осуществления первый химерный поксвирус и второй химерный поксвирус вводят в комбинированном синергическом количестве. В вариантах осуществления первый химерный поксвирус и второй химерный поксвирус вводят одновременно. В вариантах осуществления первый химерный поксвирус и второй химерный поксвирус вводят последовательно.

[0282] В вариантах осуществления поксвирус вводят по меньшей мере при 103 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят по меньшей мере при 104 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят по меньшей мере при 105 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят по меньшей мере при 106 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят по меньшей мере при 107 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят по меньшей мере при 108 бляшкообразующих единиц (БОЕ)/кг.

[0283] В вариантах осуществления поксвирус вводят при 103 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят при 104 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят при 105 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят при 106 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят при 107 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят при 108 бляшкообразующих единиц (БОЕ)/кг.

[0284] В вариантах осуществления поксвирус вводят в количестве по меньшей мере 103 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят при 103 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят в количестве приблизительно 4×104 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят при 4×104 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят в количестве приблизительно 5×104 бляшкообразующих единиц (БОЕ)/кг. В вариантах осуществления поксвирус вводят при 5×104 бляшкообразующих единиц (БОЕ)/кг.

[0285] В одном аспекте изобретение относится к способу ингибирования клеточной пролиферации клетки, при этом способ включает приведение в контакт клетки с химерным поксвирусом, как описано в настоящем описании. В вариантах осуществления клетка представляет собой раковую клетку. В вариантах осуществления раковая клетка представляет собой клетку рака молочной железы, клетку рака толстой кишки, клетку рака почки, лейкозную клетку, клетку рака легкого, клетку меланомы, клетку рака яичников, клетку рака предстательной железы, клетку рака поджелудочной железы, клетку рака головного мозга, клетку рака печени, клетку рака желудка или клетку саркомы. В вариантах осуществления раковая клетка представляет собой клетку рака молочной железы. В вариантах осуществления раковая клетка представляет собой клетку рака толстой кишки. В вариантах осуществления раковая клетка представляет собой клетку рака почки. В вариантах осуществления раковая клетка представляет собой лейкозную клетку. В вариантах осуществления раковая клетка представляет собой клетку рака легкого. В вариантах осуществления раковая клетка представляет собой меланому. В вариантах осуществления раковая клетка представляет собой клетку рака яичников. В вариантах осуществления раковая клетка представляет собой клетку рака предстательной железы. В вариантах осуществления раковая клетка представляет собой клетку рака поджелудочной железы. В вариантах осуществления раковая клетка представляет собой клетку рака головного мозга. В вариантах осуществления раковая клетка представляет собой клетку рака печени. В вариантах осуществления раковая клетка представляет собой клетку рака желудка. В вариантах осуществления раковая клетка представляет собой клетку саркомы. В вариантах осуществления раковая клетка представляет собой клетку трижды негативного рака молочной железы.

[0286] В соответствии со способами в рамках изобретения, пациенту вводят эффективное количество одного или более агентов в рамках изобретения. Термины эффективное количество и эффективная доза используют взаимозаменяемо. Термин эффективное количество определяется как любое количество, необходимое для получения желаемого физиологического ответа (например, для лечения рака). Специалист в данной области может эмпирически определить эффективные количества и схемы введения агента. Диапазоны доз для введения являются диапазоны, достаточно большие для получения желаемого эффекта, при котором затрагиваются один или несколько симптомов заболевания или расстройства (например, уменьшаются или отсрочиваются). Дозировка не должна быть настолько большой, чтобы вызывать существенные побочные эффекты, такие как нежелательные перекрестные реакции, анафилактические реакции и тому подобное. Как правило, дозировка будет варьировать в зависимости от возраста, состояния, пола, типа заболевания, степени заболевания или расстройства, пути введения или от того, включены ли в схему другие лекарственные препараты, и может быть определена специалистом в данной области. Дозировку может скорректировать конкретный врач в случае каких-либо противопоказаний. Дозировки можно варьировать и можно вводить в виде одного или нескольких введений ежедневно, в течение одного или нескольких дней. Рекомендации по соответствующим дозировкам для данных классов фармацевтических продуктов можно найти в литературе. Например, для данного параметра эффективное количество будет показывать увеличение или уменьшение по меньшей мере на 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90% или по меньшей мере на 100%. Эффективность также может быть выражена как «кратное» увеличение или уменьшение. Например, терапевтически эффективное количество может иметь по меньшей мере 1,2-кратное, 1,5-кратное, 2-кратное, 5-кратное или более влияние по сравнению с контролем. Точная доза и состав будут зависеть от цели лечения и будут определены специалистом в данной области с использованием известных методик (см., например, Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Remington: The Science and Practice of Pharmacy, 20th Edition, Gennaro, Editor (2003), и Pickar, Dosage Calculations (1999)).

[0287] Для профилактического применения терапевтически эффективное количество композиции химерного поксвируса, описанной в настоящем описании, вводят пациенту до или во время раннего начала (например, при начальных признаках и симптомах рака). Терапевтическое лечение включает введение пациенту терапевтически эффективного количества агентов, описанных в настоящем описании, после постановки диагноза или развития заболевания. Таким образом, в другом аспекте предложен способ лечения заболевания (например, рака) у пациента.

[0288] Термины «пациент», «пациент», «индивидуум» и т.д. не предназначены быть ограничивающими и в целом могут быть взаимозаменяемыми. Таким образом, индивидуум, описанный как «пациент», не обязательно имеет данное заболевание, но может просто обратиться за медицинской помощью.

[0289] В рамках изобретения «лечить» или «лечение» состояния, заболевания или расстройства или симптомов, ассоциированных с состоянием, заболеванием или расстройством, относится к подходу для получения благотворных или желаемых результатов, включая клинические результаты. Благотворные или желаемые клинические результаты могут включать, без ограничения, облегчение или улучшение одного или более симптомов или состояний, уменьшение степени состояния, расстройства или заболевания, стабилизацию течения состояния, расстройства или заболевания, предотвращение развития состояния, расстройства или заболевания, предотвращение распространения состояния, расстройства или заболевания, задержку или замедление прогрессирования состояния, расстройства или заболевания, задержку или замедление состояния, расстройства или начала заболевания, улучшение или временное облегчение течения состояния, расстройства или заболевания, и ремиссию, частичную ли или полную. «Лечение» также может означать продление выживаемости пациента сверх ожидаемого при отсутствии лечения. «Лечение» также может означать ингибирование прогрессирования состояния, расстройства или заболевания, замедление прогрессирования состояния, расстройства или заболевания, хотя в некоторых случаях оно предполагает постоянное прекращение прогрессирования состояния, расстройства или заболевания. В рамках изобретения термины «лечение», «лечить» или «обработка» относятся к способу уменьшения воздействия одного или нескольких симптомов заболевания или состояния, характеризующегося экспрессией протеазы или симптома заболевания или состояния, характеризующегося экспрессией протеазы. Таким образом, в раскрытом способе лечение может означать уменьшение тяжести установленного заболевания, состояния или симптома заболевания или состояния (например, рака) на 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или 100%. Например, способ лечения заболевания считается лечением, если у пациента наблюдается уменьшение на 10% одного или нескольких симптомов заболевания по сравнению с контролем. Таким образом, уменьшение может быть на 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% или уменьшением на любой процент сокращением между 10% и 100% по сравнению с нативными или контрольными уровнями. Понятно, что лечение не обязательно относится к излечению или полного прекращения заболевания, состояния или симптомов заболевания или состояния. Кроме того в рамках изобретения ссылки на уменьшение, снижение или ингибирование включают изменение на 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% или более по сравнению с контрольным уровнем, и такие термины могут включать, но не обязательно включать полную элиминацию.

[0290] Независимо от того, как составлены композиции химерного поксвируса, требуемая дозировка будет зависеть от пути введения, природы состава, природы состояния пациента, например, незрелости иммунной системы или желудочно-кишечного расстройства, размеров, массы, площади поверхности, возраста и пола пациента, других вводимых лекарственных препаратов и суждений лечащих врачей-клиницистов. в качестве альтернативы или в дополнение, дозировку можно выразить в виде БОЕ/кг сухой массы.

[0291] Введение может быть однократным или множественным (например, 2- или 3-, 4-, 6-, 8-, 10-, 20-, 50-, 100-, 150-кратные или более). Продолжительность лечения любой композицией, предоставленной в настоящем описании, может быть любой длительности времени, начиная с одного дня и заканчивая продолжительностью жизни хозяина (например, много лет). Например, композицию можно вводить один раз в неделю (например, в течение от 4 недель до многих месяцев или лет); один раз в месяц (например, от трех до двенадцати месяцев или в течение многих лет) или один раз в год в течение периода 5 лет, десять лет или дольше Также отмечено, что частоту лечения можно изменять. Например, композиции согласно настоящему изобретению можно вводить один раз (или два раза, три раза и т.д.) ежедневно, еженедельно, ежемесячно или ежегодно.

[0292] Композиции также можно вводить в сочетании с другими терапевтическими агентами. В вариантах осуществления композиции также можно вводить в сочетании с противораковыми агентами. Другие терапевтические агенты будут варьировать в зависимости от конкретного расстройства, но могут включать, например, модификацию диеты, гемодиализ, терапевтические агенты, такие как бензоат натрия, фенилацетат, аргинин или хирургические средства. Одновременное введение двух или более терапевтических агентов не требует, чтобы агенты вводили в одно и то же время или одним и тем же путем, при условии, что имеется наложение периода времени, в течение которого агенты оказывают свое терапевтическое действие. Предполагается одновременное или последовательное введение, как и введение в разные дни или недели.

[0293] Соединения, описанные в настоящем описании, можно применять в комбинации друг с другом, с другими активными агентами (например, противораковыми агентами), о которых известно, что они полезны при лечении заболеваний, описанных в настоящем описании, (например, рака молочной железы, рака толстой кишки, рака почки, лейкоза, рака легкого, меланомы, рака яичников, рака предстательной железы, рака поджелудочной железы, рака головного мозга, рака печени, рака желудка или саркомы), или со вспомогательными агентами, могут быть неэффективными сами по себе, но могут способствовать эффективности активного агента.

[0294] В вариантах осуществления способ включает введение терапевтического агента. В вариантах осуществления терапевтический агент представляет собой ингибитор белка контрольной точки. В вариантах осуществления терапевтический агент представляет собой ипилимумаб. В вариантах осуществления терапевтический агент представляет собой пембролизумаб. В вариантах осуществления терапевтический агент представляет собой ниволумаб. В вариантах осуществления терапевтический агент представляет собой талимоген лагерпарепвек. В вариантах осуществления терапевтический агент представляет собой дурвалумаб. В вариантах осуществления терапевтический агент представляет собой даклизумаб. В вариантах осуществления терапевтический агент представляет собой авелумаб. В вариантах осуществления терапевтический агент представляет собой атезолизумаб. В вариантах осуществления химерный поксвирус и терапевтический агент вводят в комбинированном синергическом количестве. В вариантах осуществления химерный поксвирус и терапевтический агент вводят одновременно. В вариантах осуществления химерный поксвирус и терапевтический агент вводят последовательно.

[0295] В некоторых вариантах осуществления совместное введение включает введение одного активного агента в течение 0,5, 1, 2, 4, 6, 8, 10, 12, 16, 20 или 24 часов после второго активного агента (например, противоракового агента). Совместное введение включает введение двух активных агентов одновременно, приблизительно одновременно (например, в течение приблизительно 1, 5, 10, 15, 20, или 30 минут один после другого) или последовательно в любом порядке. В некоторых вариантах осуществления совместное введение можно осуществлять посредством приготовления совместного состава, то есть получения единой фармацевтической композиции, включающей оба активных агента. В других вариантах осуществления активные агенты можно составить отдельно. В другом варианте осуществления активные и/или вспомогательные агенты могут быть связаны или конъюгированы друг с другом.

[0296] «Противораковый агент» используют в соответствии с его общим, обычным значением, и он относится к композиции (например, соединению, лекарственному средству, антагонисту, ингибитору, модулятору), обладающей противоопухолевыми свойствами или способностью ингибировать рост или пролиферацию клеток. В некоторых вариантах осуществления противораковое средство представляет собой химиотерапевтическое средство. В некоторых вариантах осуществления противораковый агент представляет собой агент, идентифицированный в настоящем описании, который можно использовать в способах лечения рака. В некоторых вариантах осуществления противораковый агент представляет собой агент, одобренный FDA или аналогичным регулирующим органом страны, не являющейся США, для лечения рака. Примеры противораковых агентов включают, без ограничения, ингибиторы MEK (например, MEK1, MEK2, или MEK1 и MEK2) (например, XL518, CI-1040, PD035901, селуметиниб/AZD6244, GSK1120212/траметиниб, GDC-0973, ARRY-162, ARRY-300, AZD8330, PD0325901, U0126, PD98059, TAK-733, PD318088, AS703026, BAY 869766), алкилирующие агенты (например, циклофосфамид, ифосфамид, хлорамбуцил, бусульфан, мелфалан, мехлоретамин, урамустин, тиотепа, нитрозомочевину, азотистые иприты (например, мехлорэтамин, циклофосфамид, хлорамбуцил, мейфалан), этиленимин и метилмеламины (например, гексаметилмеламин, тиотепа), алкилсульфонаты (например, бусульфан), препараты нитрозомочевины (например, кармустин, ломустин, семустин, стрептозоцин), триазены (декарбазин)), антиметаболиты (например, 5-азатиоприн, лейковорин, капецитабин, флударабин, гемцитабин, пеметрексед, ралтитрексед, аналог фолиевой кислоты (например, метотрексат) или аналоги пиримидина (например, фторурацил, флоксуридин, цитарабин), аналоги пурина (например, меркаптопурин, тиогуанин, пентостатин) и т.д.), растительные алкалоиды (например, винкристин, винбластин, винорелбин, виндезин, подофиллотоксин, паклитаксел, доцетаксел и т.д.), ингибиторы топоизомеразы (например, иринотекан, топотекан, амсакрин, этопозид (VP16), этопозид фосфат, тенипозид и т.д.), противоопухолевые антибиотики (например, доксорубицин, адриамицин, даунорубицин, эпирубицин, актиномицин, блеомицин, митомицин, митоксантрон, пликамицин и т.д.), соединения на основе платины или платиносодержащие агенты (например, цисплатин, оксалоплатин, карбоплатин), антрацендион (например, митоксантрон), замещенная мочевина (например, гидроксимочевина), производное метилгидразина (например, прокарбазин), супрессоры синтеза коры надпочечников (например, митотан, аминоглутетимид), эпиподофиллотоксины (например, этопозид), антибиотики (например, даунорубицин, доксорубицин, блеомицин), ферменты (например, L-аспарагиназа), ингибиторы сигнального пути митоген-активируемой протеинкиназы (например, U0126, PD98059, PD184352, PD0325901, ARRY-142886, SB239063, SP600125, BAY 43-9006, вортманнин или LY294002, ингибиторы Syk, ингибиторы mTOR, антитела (например, ритуксан), госсифол, генасенс, полифенол Е, хлорофузин, полностью трансретиноевая кислота (ATRA), бриостатин, родственный фактору некроза опухоли лиганд, индуцирующий апоптоз (TRAIL), 5-аза-2'-дезоксицитидин, полностью трансретиноевая кислота, доксорубицин, винкристин, этопозид, гемцитабин, иматиниб (Гливек.RTM.), гелданамицин, 17-N-аллиламино-17-деметоксигелданамицин (17-AAG), флавопиридол, LY294002, бортезомиб, герцептин, BAY 11-7082, PKC412, PD184352, 20-эпи-1, 25 дигидроксивитамин D3; 5-этинилурацил; абиратерон; акларубицин; ацилфульвен; адеципенол, адозелесин, альдеслейкин, ALL-TK антагонисты, алтретамин, амбамустин, амидокс, амифостин, аминолевулиновую кислоту, амрубицин, амсакрин, анагрелид, анастрозол, андрографолид; ингибиторы ангиогенеза, антагонист D, антагонист G, антареликс; антидорсализующий морфогенетический белок-1; антиандроген, карциному предстательной железы, антиэстроген; антинеопластон; антисмысловые олигонуклеотиды, афидиколина глицинат, гены-модуляторы апоптоза, регуляторы апоптоза, аруриновую кислоту, apa-CDP-DL-РТВА, аргинин-деаминазу, асулакрин, атаместан, атримустин, аксинастатин 1, аксинастатин 2, аксинастатин 3, азасетрон, азатоксин, азатирозин, производные баккатина III; баланол, батимастат, антагонисты BCR/ABL, бензохлорины, бензоилстауроспорин, производные бета-лактама, бета-алетин, бетакламицин В, бетулиновую кислоту; ингибитор bFGF; бикалутамид, бисантрен, бисазиридинил спермин, биснафид, бистратен А, бизелесин, брефлат, бропиримин, будотитан, бутионина сульфоксимин, кальципотриол, калфостин С, производные камптотецина, канарипокс IL-2; капецитабин, карбоксамид -аминотриазол, карбоксиамидотриазол, CaRest M3, CARN 700; ингибитор на основе хрящей, карзелесин, ингибиторы казеин - киназы (ICOS), кастаноспермин, цекропин В, цетрореликс, хлорины, хлорхиноксалина сульфонамид, цикапрост, цис-порфирин, кладрибин, аналоги кломифена, клотримазол, коллистмицин А, коллисмицин В, комбретастатин А4, аналог комбретастатина, конагенин, крамбесцидин 816, криснатол, криптофицин 8; производные криптофицина А; курацин А, циклопентантрахиноны, циклоплатам, ципемицин, цитарабина окфосфат, цитолитический фактор, цитостатин, дакликсимаб, децитабин, дегидродидемин В, деслорелин, дексаметазон, дексифосфамид, дексразоксан, дексверапамил, диазиквон, дидемнин В, дидокс, диэтилнорспермин, дигидро-5-азацитин, 9-диоксамицин, дифенилспиромустин, докозанол; доласетрон, доксифлуридин, дролоксифен, дронабинол, дуокармицин SA, эбселен, экомустин, эделфосин, эдреколомаб, эфлорнитин, элемен, эмитефур, эпирубицин, эпристерид, аналог эстрамустина, агонисты эстрогенов, антагонисты эстрогенов, этанидазол, этопозида фосфат, эксеместан, фадрозол, фазарабин, фенретинид, филграстим, финастерид; флавопиритол; флезеластин, флуастерон, флударабин, флуородаунорубицина гидрохлорид, форфенимекс, форместан, фостриецин, фотемустин, гадолиния тексафирин, галлия нитрат, галоцитабин, ганиреликс, ингибиторы желатиназы, гемцитабин, ингибиторы глутатиона; гепсульфам, герегулин, гексаметиленбисацетамид, гиперицин, ибандроновую кислоту, идарубицин, идоксифен, идрамантон, илмофосин, иломастат, имидазоакридоны, имиквимод, иммуностимулирующие пептиды; ингибитор рецептора инсулиноподобного фактора-1 роста, агонисты интерферона, интерфероны, интерлейкины, йобенгуан, иододоксорубицин, ипомеанол, 4-, ироплакт, ирсогладин, изобенгазол, ламелларина-N триацетат; ланреотид, лейнамицин, ленограстим, летинана сульфат, лептолстатин, летрозол, фактор ингибирования лейкоза; альфа-интерферон лейкоцитов, лейпролид+эстроген+прогестерон, лейпрорелин, левамизол, лиарозол, аналог линейного полиамина, липофильный дисахарид - пептид, липофильные соединения платины, лиссоклинамид 7, лобаплатин, ломбрицин, лометрексол, лонидамин, лосоксантрон, ловастатин, локсоринбин, луртотекан; лютеция тексафирин, лизофиллин, литические пептиды, маитансин, манностатин А, маримастат, мазопрокол, маспин, ингибиторы матрилизина, ингибиторы матриксной металлопротеиназы, меногарил, мербарон, метерелин, мепиониназу, метоклопромид; ингибитор MIF; мифепристон, милтефосин, миримостим, «ошибочная» двухнитевая РНК, митогуазон, митолактол, аналоги митомицина, митонафид; митотоксиновый фактор роста фибробластов сапорин; митоксантрон, мофаротен, молграмостим, моноклональное антитело, хорионический гонадотропный гормон человека; монофосфорил-липид А+sk клеточной стенки микобактерии; мопидамол; ингибитор гена множественной устойчивости к лекарственным препаратам; терапия супрессором множественных опухолей-1; противораковый агент горчицы; микапероксид В, экстракт стенок микобактериальных клеток, мириапорон, N-ацетилдиналин, N-замещенные бензамиды, нафарелин, нагрестип, налоксон+пентазоцин, напавин, нафтерпин, нартограстим, недаплатин, неморубицин, неридроновую кислоту, нейтральную эндопептидазу, нилутамид, нисамицин, модуляторы закиси азота, нитроксидный антиоксидант, нитруллин, 06-бензилгуанин, октреотид, окиценон, олигонуклеотиды, онапристон, ондансетрон, орацин, индуктор орального цитокина, ормаплатин, осатерон, оксалиплатин; оксауномицин, палауамин, пальмитоилризоксин, памидроновую кислоту, панакситриол, паномифен, парабактин, пазеллиптин, пегаспаргазу, пелдесин; пентозанполисульфат натрия; пентостатин, пентрозол, перфлуброн, перфосфамид, периллиловый спирт, феназиномицин, фенилацетат, ингибиторы фосфатазы, пицибанил; пилокарпина гидрохлорид, пирарубицин, пиритрексим; плацетин А, плацетин В; ингибитор активатора плазминогена, комплекс платины, соединения платины, комплекс платина-триамин, порфимер натрия; порфиромицин, преднизон, пропил-бис-акридон, простагландин J2, ингибиторы протеасом; иммуномодулятор на основе белка А; ингибитор протеинкиназы С, ингибиторы протеинкиназы С, микроалгал, ингибиторы протеинтирозин фосфатазы, ингибиторы пуриннуклеозид-фосфорилазы, пурпурины, пиразолакридин; конъюгат пиридоксилированного гемоглобина с полиоксиэтиленом; антагонисты raf; ралтитрексед, рамосетрон, ингибиторы ras-фарнезилротеинтрансферазы, ингибиторы ras; ингибитор ras-GAP; деметилированный ретеллиптин, этидронат рения Re 186, ризоксин, рибозимы, ретинамид RII, роглетимид, рогитукин, ромуртид; рохинимекс; рубигинон B1; рубоксил, сафингол, сайнтопин, SarCNU, саркофитол А, сарграмостим, миметики Sdi 1, семустин; образующийся при старении ингибитор 1; смысловые олигонуклеотиды; ингибиторы трансдукции сигнала; модуляторы трансдукции сигнала; одноцепочечный антигенсвязывающий белок; сизофиран; собузоксан; натрия борокаптат; натрия фенилацетат; солверол; соматомединсвязывающий белок; сонермин; спарфозовая кислота; спикамицин D; спиромустин; спленопентин; спонгистатин 1; скваламин; ингибитор стволовых клеток; ингибиторы деления стволовых клеток; стипиамид; ингибиторы стромелизина; сульфинозин; антагонист суперактивного вазоактивного интестинального пептида; сурадиста; сурамин; свайнсонин; синтетические гликозаминогликаны; таллимустин; тамоксифена метиодид; тауромустин; тазаротен; натриевая соль текогалана; тегафур; теллурапирилиум; ингибиторы теломеразы; темопорфин; темозоломид; тенипозид; тетрахлородекаоксид; тетразомин; талибластин; тиокоралин; тромбопоэтин; миметик тромбопоэтина; тималфазин; агонист рецептора тимопоэтина; тимотринан; тиреотропный гормон; тинэтилэтиопурпурин; тирапазамин; титаноцена бихлорид; топсентин; торемифен; фактор тотипотентных стволовых клеток; ингибиторы трансляции; третиноин; триацетилуридин; трицирибин; триметрексат; трипторелин; трописетрон; туростерид; ингибиторы тирозинкиназы; тирфостины; ингибиторы UBC; убенимекс; выведенный из урогенитального синуса ингибирующий рост фактор; антагонисты рецептора урокиназы; вапреотид; вариолин В; векторная система, генная терапия эритроцитов; веларезол; верамин; вердинс; вертепорфин; винорелбин; винксалтин; витаксин; ворозол; занотерон; зениплатин; зиласкорб; зиностатина стималамер, адриамицин, дактиномицин, блеомицин, винбластин, цисплатин, ацивицин; акларубицин; акодазола гидрохлорид; акронин; адозелезин; алдеслейкин; алтретамин; амбомицин; аметантрона ацетат; аминоглютетимид; амсакрин; анастрозол; антрамицин; аспарагиназа; асперлин; азацитидин; азетепа; азотомицин; батимастат; бензодепа; бикалутамид; бисантрена гидрохлорид; биснафида димесулат; бизелезин; блеомицина сульфат; бреквинар натрия; бропиримин; бусульфан; кактиномицин; калустерон; карацемид; карбетимер; карбоплатин; кармустин; карубицина гидрохлорид; карзелесин; цедефингол; хлорамбуцил; циролемицин; кладрибин; криснатола мезилат; циклофосфамид; цитарабин; дакарбазин; даунорубицина гидрохлорид; децитабин; дексормаплатин; дезагуанин; дезагуанина мезилат; диазиквон; доцетаксел; доксорубицин; доксорубицина гидрохлорид; дролоксифен; дролоксифена цитрат; дромостанолона пропионат; дуазомицин; эдатрексат; эфлорнитина гидрохлорид; элсамитруцин; энлоплатин; энпромат; эпипропидин; эпирубицина гидрохлорид; эрбулозол; эзорубицина гидрохлорид; эстрамустин; эстрамустина фосфат натрия; этанидазол; этопосид; этопосида фосфат; этоприн; фадрозола гидрохлорид; фазарабин; фенретинид; флоксуридин; флударабина фосфат; фторурацил; фторцитабин; фосквидон; фостриэцин-натрий; гемцитабин; гемцитабина гидрохлорид; гидроксимочевина; идарубицина гидрохлорид; ифосфамид; илмофосин; интерлейкин II (включая рекомбинантный интерлейкин II или rIL.sub.2), интерферон альфа-2a; интерферон альфа-2b; интерферон альфа-n1; интерферон альфа-n3; интерферон бета-1a; интерферон гамма-1b; ипроплатин; иринотекана гидрохлорид; ланреотида ацетат; летрозол; леупролида ацетат; лиарозола гидрохлорид; лометрексол натрий; ломустин; лозоксантрона гидрохлорид; масопрокол; майтансин; мехлорэтамина гидрохлорид; мегестрола ацетат; меленгестрола ацетат; мелфалан; меногарил; меркаптопурин; метотрексат; метотрексат натрия; метоприн; метуредепа; митиндомид; митокарцин; митокромин; митогиллин; митомалцин; митомицин; митоспер; митотан; митоксантрона гидрохлорид; микофеноловая кислота; нокодазол; ногаламицин; ормаплатин; оксисуран; пегаспаргаза; пелиомицин; пентамустин; пепломицина сульфат; перфосфамид; пипоброман; пипосульфан; пироксантрона гидрохлорид; пликармицин; пломестан; порфимер натрия; порфиромицин; преднимустин; прокарбазина гидрохлорид; пуромицин; пуромицина гидрохлорид; пиразофурин; рибоприн; роглетимид; сафингол; сафингола гидрохлорид; семустин; симтразен; спарфосат натрия; спарсомицин; спирогермания гидрохлорид; спиромустин; спироплатин; стрептонигрин; стрептозоцин; сулофенур; тализомицин; текогалан натрия; тегафур; телоксантрона гидрохлорид; темопорфин; тенипозид; тероксирон; тестолактон; тиамиприн; тиогуанин; тиотепа; тиазофурин; тирапазамин; торемифена цитрат; трестолона ацетат; трицирибина фосфат; триметрексат; триметрексата глукуронат; трипторелин; тубулозола гидрохлорид; урациловый иприт; уредепа; вапреотид; вертепорфин; винбластина сульфат; винкристина сульфат; виндесин; виндесина сульфат; винепидина сульфат; винглицината сульфат; винлеурозина сульфат; винорелбина тартрат; винросидина сульфат; винзолидина сульфат; ворозол; зениплатин; зиностатин; зорубицина гидрохлорид, агенты, которые останавливают клетки в фазах G2-M и/или модулируют образование или стабильность микротрубочек, (например, Taxol.TM (т.е. паклитаксел), Taxotere.TM, соединения, содержащие таксановый скелет, эрбулозол (т.е. R-55104), доластатин 10 (т.е. DLS-10 и NSC-376128), мивобулин изетионат (т.е. в виде CI-980), винкристин, NSC-639829, дискодермолид (т.е. в виде NVP-XX-A-296), ABT-751 (Abbott, т.е. E-7010), алториртины (например, алториртин и алториртин C), Спонгистатины (например, спонгистатин 1, спонгистатин 2, спонгистатин 3, спонгистатин 4, спонгистатин 5, спонгистатин 6, спонгистатин 7, спонгистатин 8 и спонгистатин 9), цемадотина гидрохлорид (т.е. LU-103793 и NSC-D-669356), эпотилоны (например, эпотилон A, эпотилон B, эпотилон C (т.е. дезоксиэпотилон или dEpoA), эпотилон D (т.е. KOS-862, dEpoB и дезоксиэпотилон B), эпотилон E, эпотилон F, эпотилон B N-оксид, эпотилон A N-оксид, 16-аза-эпотилон B, 21-аминоэпотилон B (т.е. BMS-310705), 21-гидроксиэпотилон D (т.е. дезоксиэпотилон F и dEpoF), 26-фторэпотилон, ауристатин PE (т.е. NSC-654663), соблидотин (т.е. TZT-1027), винкристина сульфат, криптофицин 52 (т.е. LY-355703), витилевуамид, тубулизин А, канаденсол, центауреидин (т.е. NSC-106969), онкоцидин A1 (т.е. BTO-956 и DIME), фиджанолид В, лаулималид, наркозин (также известный как NSC-5366), наскапин, гемиастерлин, ванадоцен ацетилацетонат, монсатрол, инаноцин (т.е. NSC-698666), элеутеробины (такие как дезметилэлеутеробин, дезэтилэлеутеробин, изоэлеутеробин A и Z-элеутеробин), карибеозид, карибеолин, галихондрин В, диазонамид А, таккалонолид А, диозостатин, (-)-фенилагистин (т.е. NSCL-96F037), миосеверин B, ресверастатин фосфат натрий, стероиды (например, дексаметазон), финастерид, ингибиторы ароматазы, агонисты гонадотропин-рилизинг-гормона (GnRH), такие как гозерелин или лейпролид, адренокортикостероиды (например, преднизон), прогестины (например, гидроксипрогестерон капроат, мегестрол ацетат, медроксипрогестерон ацетат), эстрогены (например, диэтилстилбестрол, этинилэстрадиол), антиэстрогены (например, тамоксифен), андрогены (например, тестостерона пропионат, флуоксиместерон), антиандрогены (например, флутамид), иммуностимуляторы (например, Bacillus Calmette-Guérin (BCG), левамизол, интерлейкин-2, альфа-интерферон и т. д.), моноклональные антитела (например, моноклональные анти-CD20, анти-HER2, анти-CD52, анти-HLA-DR и анти-VEGF антитела), иммунотоксины (например, конъюгат моноклонального анти-CD33 антитела и калихеамицина, конъюгат моноклонального анти-CD22 антитела и экзотоксина синегнойной палочки и т.д.), радиоиммунтеапия (например, моноклональное анти-CD20 антитело, конъюгированное с 111In, 90Y или 131I и т.д.), триптолид, гомогаррингтонин, дактиномицин, доксорубицин, эпирубицин, топотекан, итраконазол, виндезин, церивастатин, винкристин, дезоксиаденозин, сертралин, питавастатин, иринотекан, клофазимин, 5-нонилокситриптамин, вемурафениб, дабрафениб, эрлотиниб, гефитиниб, ингибиторы EGFR, терапия или препарат, нацеленный на рецептор эпидермального фактора роста (EGFR) (например, гефитиниб (Iressa™), эрлотиниб (Tarceva™), цетуксимаб (Erbitux™), лапатиниб (Tykerb™), панитумумаб (Vectibix™), вандетаниб (Caprelsa™), афатиниб/BIBW2992, CI-1033/канертиниб, нератиниб/HKI-272, CP-724714, TAK-285, AST-1306, ARRY334543, ARRY-380, AG-1478, дакомитиниб/PF299804, OSI-420/ десметил эрлотиниб, AZD8931, AEE788, пелитиниб/EKB-569, CUDC-101, WZ8040, WZ4002, WZ3146, AG-490, XL647, PD153035, BMS-599626.

VII. Способы обнаружения

[0297] В другом аспекте изобретение относится к способ обнаружения рака у пациента, при этом способ включает в себя приведение в контакт раковой клетки с химерным поксвирусом в рамках изобретения, включая его варианты осуществления, и обеспечение возможности репликации химерного поксвируса, тем самым обнаруживая раковую клетку. В вариантах осуществления химерный поксвирус содержит последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент. В вариантах осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует флуоресцентный фрагмент. В вариантах осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует mCherry. В вариантах осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует Emerald. В вариантах осуществления последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует люциферазу светлячков. В вариантах осуществления раковая клетка находится в пациенте. В вариантах осуществления пациент представляет собой млекопитающее. В вариантах осуществления пациент представляет собой человека.

ПРИМЕРЫ

[0298] Следующие примеры предложены для иллюстрации, но не для ограничения заявленного изобретения.

Пример 1. Новые эффективные химерные поксвирусы для онколитической иммунотерапии рака

[0299] Рак является второй по значимости причиной смерти в Соединенных Штатах. В последние годы был достигнут значительный прогресс в иммунотерапии рака, включающий ингибиторы иммунных контрольных точек, Т-клетки с химерными антигенными рецепторами и онколитические вирусы.

[0300] Онколитические вирусы представляют собой встречающиеся в природе или генетически модифицированные вирусы, которые инфицируют, размножаются и в конечном итоге убивают раковые клетки, оставляя при этом здоровые клетки неповрежденными (1, 2). Недавно было завершено клиническое исследование III фазы онколитического вируса простого герпеса T-VEC на 436 пациентах с нерезектабельной меланомой IIIB, IIIC или IV стадии, которое, как сообщалось, достигло своей первичной конечной точки с устойчивой частотой ответа 16,3% у пациентов, получавших T-VEC по сравнению с 2,1% у пациентов, получавших GM-CSF (3). На основании результатов этого испытания FDA одобрило T-VEC 27 октября 2015 года. Одобрение FDA первого онколитического вируса проложило путь к перспективной области.

[0301] На различных фазах клинических испытаний протестировали конструкты онколитического вируса по меньшей мере восьми различных видов, включая аденовирус, вирус простого герпеса-1, вирус ньюкаслской болезни, реовирус, вирус кори, вирус Коксаки, вирус Сенека-Вэлли и вирус осповакцины. Стало ясно, что онколитические вирусы хорошо переносятся больными раком. Однако клинические преимущества онколитических вирусов в качестве самостоятельного лечения остаются ограниченными (5). Вследствие опасений по поводу безопасности онколитических вирусов как в доклинических, так и в клинических исследованиях использовали только высоко аттенуированные онколитические вирусы (либо авирулентные естественным образом, либо аттенуированные посредством генной инженерии). Поскольку безопасность онколитических вирусов в настоящее время четко установлена, пришло время разработать и протестировать онколитические вирусы с максимальной противоопухолевой активностью. Онколитические вирусы с сильным онколитическим эффектом высвобождают многочисленные опухолевые антигены, что приводит к сильному иммунотерапевтическому эффекту.

[0302] Вирус осповакцины, прототип члена семейства поксвирусов, использовали в качестве противооспенной вакцины для ликвидации оспы, которая, по оценкам, убила 500 миллионов человек только в 19 и 20 веках. Таким образом, это, вероятно, наиболее успешный живой биотерапевтический агент. Безопасность вируса осповакцины хорошо продемонстрирована миллионами людей во всем мире. Вирус осповакцины также является первым онколитическим вирусом, продемонстрировавшим вирусный онколиз в лаборатории. Вирус осповакцины в качестве онколитического вируса протестировали во многих клинических испытаниях, и было показано, что он хорошо переносится пациентами с поздней стадией рака (2). Несколько исследований показывают, что с точки зрения онколитической активности вирус осповакцины превосходит аденовирус (6), один из наиболее изученных видов онколитических вирусов и первый онколитический вирус, одобренный для лечения рака в Китае (7). Помимо вируса осповакцины другие члены семейства поксвирусов также протестировали в качестве онколитических вирусов, в том числе поксвирус енотов (8), орф-вирус (9) и вирус миксомы (10).

[0303] Химерные поксвирусы обладают потенциалом комбинировать благоприятные свойства от разных видов вирусов и, таким образом, превосходят отдельные вирусы дикого типа. Поскольку ортопоксвирусы и парапоксвирусы являются антигенно различимыми, эффективный химерный ортопоксвирус и эффективный химерный парапоксвирус, полученные в этом исследовании, потенциально можно объединить в одну и ту же схему лечения для достижения максимальной терапевтической эффективности. Заявители получили базы химерных ортопоксвирусов и химерных парапоксвирусов. Некоторые изоляты химерных ортопоксвирусов и парапоксвирусов демонстрируют превосходную способность уничтожать клетки в клеточных линиях рака панели NCI-60 по сравнению с их отдельными родительскими вирусами дикого типа.

[0304] Получение пулов химерных вирусов и выделение отдельных химерных вирусов. Пул химерных ортопоксвирусов был получен путем коинфицирования клеток CV-1 штаммом Brighton вируса коровьей оспы, штаммом Herman поксвируса енотов, штаммом Utrecht поксвируса кроликов и штаммами WR, IHD, Elstree, CL, Lederle-Chorioallantoic и AS вируса осповакцины при множественности заражения (MOI) 0,01 на вирус. Для получения пула химерных парапоксвирусов клетки MDBK коинфицировали штаммом NZ2 орф-вируса и штаммом TJS псевдопоксвируса коров при MOI 0,1. Пилотные эксперименты заявителей показывают, что клетки CV-1 восприимчивы ко всем ортопоксвирусам, использованным в этом исследовании, и что и орф-вирус, и псевдопоксвирус коров инфицируют и образуют бляшки в клетках MDBK.

[0305] 100 бляшек химерных ортопоксвирусов и 100 бляшек химерных парапоксвирусов были отобраны из клеток CV-1, инфицированных пулом химерного ортопоксвируса, и клеток MDBK, инфицированных пулом химерного парапоксвируса, соответственно. Эти двести бляшек дополнительно очищали методом бляшкообразования еще два раза в соответствующих клетках с получением 200 клонально очищенных индивидуальных изолятов химерного вируса. Вирусы # 14-113 являются изолятами химерных ортопоксвирусов, тогда как вирусы # 114-213 являются изолятами химерных парапоксвирусов.

[0306] Идентификация новых эффективных изолятов химерного поксвируса посредством скрининга высокой производительности в клеточных линиях NCI-60. Активность по уничтожению опухолевых клеток у 200 изолятов химерных ортопоксвирусов и химерных парапоксвирусов, а также 11 штаммов родительского вируса и 2 контрольных онколитических вирусов (GLV-1h68 и OncoVEX GFP) оценивали и сравнивали на панели клеточных линий NCI-60 (Таблица 1). GLV-1h68 является одним из наиболее изученных онколитических вирусов коровьей оспы и в настоящее время находится в клинической разработке. OncoVEX GFP имеет такую же основу, что и T-VEC, онколитический вирус простого герпеса-1 и первый онколитический вирус, одобренный FDA. Каждую клеточную линию инфицировали каждым вирусом при MOI 0,01. Жизнеспособность клеток измеряли через 96 ч после инфицирования, используя анализы MTS. Используемое количество вируса (MOI 0,01) в этом эксперименте со скринингом высокой производительности намеренно поддерживали на низком уровне и оптимизировали для сравнения уничтожения клеток в адгезивных клеточных линиях (большинство клеточных линий на панели NCI-60 являются адгезивными клетками), поэтому можно выделять новые эффективные изоляты вируса. Это количество вируса, однако, было слишком малым, чтобы увидеть значительное и последовательное уничтожение клеток в суспензионных клеточных линиях. Вот почему результаты для 6 клеточных линий лейкоза не включили в анализ с целью сравнения вирусов.

[0307] Таблица 1. Каталог клеточных линий NCI-60

Наименование Вид Орган происхождения Культура
BT549 Человек Молочная железа Адгезивная
HS 578T Человек Молочная железа Адгезивная
MCF7 Человек Молочная железа Адгезивная
MDA-MB-231 Человек Молочная железа Адгезивная
MDA-MB-468 Человек Молочная железа Адгезивная
T-47D Человек Молочная железа Адгезивная
SF268 Человек ЦНС Адгезивная
SF295 Человек ЦНС Адгезивная
SF539 Человек ЦНС Адгезивная
SNB-19 Человек ЦНС Адгезивная
SNB-75 Человек ЦНС Адгезивная
U251 Человек ЦНС Адгезивная
Colo205 Человек Толстая кишка Адгезивная & Суспензия
HCC 2998 Человек Толстая кишка Адгезивная
HCT-116 Человек Толстая кишка Адгезивная
HCT-15 Человек Толстая кишка Адгезивная
HT29 Человек Толстая кишка Адгезивная
KM12 Человек Толстая кишка Адгезивная
SW620 Человек Толстая кишка Адгезивная
786-O Человек Почка Адгезивная
A498 Человек Почка Адгезивная
ACHN Человек Почка Адгезивная
CAKI Человек Почка Адгезивная
RXF 393 Человек Почка Адгезивная
SN12C Человек Почка Адгезивная
TK-10 Человек Почка Адгезивная
UO-31 Человек Почка Адгезивная
CCRF-CEM Человек Лейкоз Суспензия
HL-60 Человек Лейкоз Суспензия
K562 Человек Лейкоз Суспензия
MOLT-4 Человек Лейкоз Суспензия
RPMI-8226 Человек Лейкоз Суспензия
SR Человек Лейкоз Суспензия
A549 Человек Легкое Адгезивная
EKVX Человек Легкое Адгезивная
HOP-62 Человек Легкое Адгезивная
HOP-92 Человек Легкое Адгезивная & Суспензия
NCI-H226 Человек Легкое Адгезивная
NCI-H23 Человек Легкое Адгезивная
NCI-H322M Человек Легкое Суспензия
NCI-H460 Человек Легкое Адгезивная
NCI-H522 Человек Легкое Адгезивная
LOX IMVI Человек Меланома Полуагезивная
M14 Человек Меланома Адгезивная
MALME-3M Человек Меланома Адгезивная & Суспензия
MDA-MB-435 Человек Меланома Адгезивная
SK-MEL-2 Человек Меланома Адгезивная
SK-MEL-28 Человек Меланома Адгезивная
SK-MEL-5 Человек Меланома Адгезивная
UACC-257 Человек Меланома Адгезивная
UACC-62 Человек Меланома Адгезивная
IGROV1 Человек Яичник Адгезивная
OVCAR-3 Человек Яичник Адгезивная
OVCAR-4 Человек Яичник Адгезивная
OVCAR-5 Человек Яичник Адгезивная
OVCAR-8 Человек Яичник Адгезивная
SK-OV-3 Человек Яичник Адгезивная
NCI-ADR-RES Человек Яичник Адгезивная
DU145 Человек Простата Адгезивная
PC-3 Человек Простата Адгезивная

[0308] Среди 100 новых изолятов химерных ортопоксвирусов изоляты #17 (SEQ ID NO: 3) и #33 (SEQ ID NO: 1) продемонстрировали значительно лучшее уничтожение клеток в клеточных линиях солидных опухолей NCI-60, чем 9 родительских штаммов ортопоксвируса и два контрольных вируса (Фиг. 1). Из 100 новых изолятов парапоксвируса выделили изолят #189 (SEQ ID NO: 2), продемонстрировавший значительно лучшее уничтожение клеток, чем два родительских штамма парапоксвируса и контрольные вирусы (Фиг. 2). Все три новых изолята химерных вирусов (#17, #33 и #189) вызывали значительную гибель клеток в большинстве клеточных линиях солидного рака NCI-60 даже при низкой MOI 0,01. В целом, штаммы ортопоксвируса и изоляты химерного ортопоксвируса были более эффективными, чем штаммы парапоксвируса и изоляты химерного парапоксвируса в уничтожении раковых клеток при низкой MOI 0,01.

[0309] Геномное секвенирование #33 и #189. Геномные ДНК новых изолятов поксвирусов #33 и #189 выделяли из очищенных вирионов и подвергали секвенированию следующего поколения с использованием Illumina Hiseq 2500 с покрытием более чем 1000х. Гэпы амплифицировали посредством ПЦР и секвенировали посредством секвенирования по Сэнгеру. 189 415 пар оснований (bps) генома #33 были полностью секвенированы, тогда как из 189 генома было получено 138 203 bps. Первоначальный BLAST против GenBank показал, что геномные последовательности как #33, так и #189 не идентичны никаким геномным последовательностям GenBank. #33 ближе к штаммам вируса осповакцины, чем к любым другим ортопоксвирусам. #189 очень близок к штамму NZ2 орф-вируса, одному из родительских парапоксвирусов. Нуклеотидные последовательности всех орф-вирусов, идентифицированных в штамме NZ2 орф-вируса, идентичны таковым в #189. В геноме #189 имеется одна вставка «G» в позиции 6755 по сравнению с NZ2 орф-вируса. В областях инвертированых концевых повторов одна копия повторяющегося элемента удалена, а одна копия другого повторяющегося элемента вставлена в геном #189. В целом, и #33, и #189 представляют новые уникальные изоляты поксвируса.

[0310] Способы и материалы: Клеточные линии: Все линии раковых клеток выращивали в RPMI-1640 (Mediatech, Manassas, VA). Почечный фибробласт клеток (CV-1) африканской зеленой обезьяны и эпителиальные клетки почки коровы (MDBK) получили из Американской коллекции типовых культур (ATCC; Rockville, MD, USA) и выращивали на DMEM (Mediatech, Manassas, VA). Все среды были обогащены 10% FBS (Mediatech, Manassas, VA) и 1% раствором пенициллин-стрептомицина (Mediatech, Manassas, VA). Клетки культивировали при 37°C в 5% CO2.

[0311] Вирусы: штамм Brighton вируса коровьей оспы, штамм Herman поксвируса енотов, штамм Utrecht поксвируса кроликов, штаммы WR, IHD, Elstree, CL, Lederle-Chorioallantoic и AS вируса осповакцины, штамм NZ2 орф-вируса и штамм TJS псевдопоксвируса коров закупили у ATCC. Все штаммы ортопоксвируса выращивали и титровали в клетках CV-1, а штаммы парапоксвируса выращивали и титровали в клетках MDBK.

[0312] Создание пулов химерного ортопоксвируса и химерного парапоксвируса и выделение отдельных клональных изолятов химерных вирусов: Пул химерных ортопоксвирусов создали посредством коинфицирования клеток CV-1 штаммом Brighton вируса коровьей оспы, штаммом Herman поксвируса енотов, штаммом Utrecht поксвируса кроликов и штаммами WR, IHD, Elstree, CL, Lederle-Chorioallantoic и AS вируса осповакцины при множественности заражения (MOI) 0,01 на вирус. Для создания пула химерных парапоксвирусов клетки MDBK коинфицировали штаммом NZ2 орф-вируса и штаммом TJS псевдопоксвируса коров при MOI 0,1. Инфицированные клетки собирали через 3 дня после инфицирования. Исходный пул химерного ортопоксвируса дополнительно пассировали три раза в клетке CV-1 при MOI 0,1, где исходный пул химерного парапоксвируса дополнительно пассировали три раза в клетках MDBK при MOI 0,1. 100 бляшек химерного ортопоксвируса и 100 бляшек химерного парапоксвируса отобрали из клеток CV-1, инфицированных полученным в итоге пулом химерного ортопоксвируса, и клеток MDBK, инфицированных полученным в итоге пулом химерного парапоксвируса, соответственно. Эти двести бляшек дополнительно очищали методом бляшкообразования два раза в соответствующих клетках с получением 200 клонально очищенных индивидуальных изолятов химерного вируса.

[0313] Скрининг высокой производительности: клеточные линии рака NCI-60 и панель клеточной линии рака поджелудочной железы, включающую PANC-1, MIA-PaCa2, BxPC3, FG, Capan-2 и Su.86.86, распределяли в 96-луночные планшеты (3000 клеток/лунка для клеточных линий солидного рака и 5000/лунка для клеточных линий лейкоза), используя жидкостный манипулятор epMotion 5075 (Eppendorf) в стерильных условиях, инкубировали в течение ночи при 37°C в 5% (об./об.) CO2. Затем клетки инфицировали 200 изолятами химерного ортопоксвируса и химерного парапоксвируса наряду с 11 родительскими вирусными штаммами и 2 контрольными онколитическими вирусами GLV-1h68 и OncoVEX GFP при MOI 0,01. Жизнеспособность клеток определяли через 96 ч после инфицирования, используя анализы MTS (Promega). Поглощение при 490 нм измеряли с использованием автоматического планшет-ридера BMG PHERAstar (BMG Labtech). Каждый эксперимент проводился в двух повторах. Жизнеспособность клеток для ложно-инфицированных клеток была установлена на 100%.

[0314] Цитотоксичность вирусов в клеточных линиях рака желудка: клетки MKN-45, OCUM-2M и KATO-3 засеивали в 96-луночные планшеты при концентрации 3000 клеток на лунку и инкубировали в течение ночи при 37°C в 5% (об./об.) CO2. Клетки инфицировали #33, #189, GLV-1h68 и OncoVEX GFP при MOI 0,01, 0,1 и 1. Ежедневно в течение 4 дней проводили мониторинг жизнеспособности клеток, используя анализы MTS. 37°C в 5% (об./об.) CO2.

[0315] Геномное секвенирование: Геномные ДНК #33 и #189 экстрагировали из очищенных вирионов, используя Wizard Genomic DNA Purification kit (Promega), и фрагментировали посредством обработки ультразвуком. Библиотеки получали, используя KAPA LTP Library Preparation Kit. Секвенирование выполняли, используя Illumina Hiseq 2500

Пример 2. Скрининг высокой производительности в клеточных линиях рака поджелудочной железы

[0316] Клеточные линии рака NCI-60 содержат только солидный рак из 8 различных органов (см. Таблицу 1). Чтобы изучить, будут ли результаты клеточных линий рака NCI-60 воспроизведены при солидном раке из других органов, шесть клеточных линий рака поджелудочной железы (BxPC3, FG, MIA PaCa-2, Capan-2, PANC-1 и SU.86.86) инфицировали при MOI 0,1 теми же вирусами, которые применяли при скрининге высокой производительности в клеточных линиях рака NCI-60. Жизнеспособность клеток вновь измеряли через 96 ч после инфицирования, используя анализы MTS. Изоляты химерного ортопоксвируса #17 и #33 продемонстрировали наилучшее уничтожение клеток среди всех изолятов химерного ортопоксвируса, тогда как изолят химерного парапоксвируса #189 продемонстрировал наилучшее уничтожение клеток среди всех изолятов химерного парапоксвируса. Все они были лучше в уничтожении клеточных линий рака поджелудочной железы, как показано в таблице 2 и на Фиг. 3 и Фиг. 4, чем соответствующие им штаммы родительского вируса и контрольные вирусы GLV-1h68 и OncoVEX GFP. Таким образом, результаты линий раковых клеток NCI-60 были очень хорошо воспроизведены на панели клеточных линий рака поджелудочной железы.

[0317] Таблица 2. Выживаемость клеток рака поджелудочной железы (VACV = вируса осповакцины).

BxPC3 FG MIA PaCa 2 Capan 2 PANC-1 SU.86.86 Сред. Ст. откл. Название вируса
Сред. Сред. Сред. Сред. Сред. Сред.
20,38 18,22 24,06 109,76 20,31 52,27 40,83 36,09 #17
4,46 26,75 52,88 85,75 13,93 69,41 42,20 32,29 #33
31,01 60,98 102,04 113,08 57,20 30,54 65,81 34,93 VACV Elstree
20,78 40,62 104,90 104,86 68,57 60,23 66,66 33,91 VACV Lederle-Chorioallantoic
18,21 33,81 93,44 106,36 45,64 109,87 67,89 40,05 VACV IHD
16,40 66,23 90,91 93,81 43,05 100,69 68,51 33,31 Rabbitpox Utrecht
19,57 50,96 97,52 108,60 68,27 101,81 74,46 34,78 VACV CL
17,51 75,42 102,31 123,05 68,27 103,55 81,69 37,29 VACV WR
50,01 79,85 89,31 97,55 78,14 106,86 83,62 19,70 GLV-1h68
61,29 96,76 122,32 112,34 62,99 107,42 93,85 25,91 Raccoonpox Herman
63,81 99,06 114,44 80,60 108,15 104,16 95,04 19,14 OncoVEX GFP
106,79 95,12 101,38 102,37 95,09 103,55 100,71 4,71 Cowpox Brighton
101,00 106,93 118,90 111,92 107,05 108,34 109,02 5,99 VACV AS

Пример 3. Изолят нового химерного ортопоксвируса #33 и изолят химерного парапоксвируса #189 демонстрируют мощное уничтожение клеток в клеточных линиях рака желудка

[0318] На основе результатов скрининга высокой производительности клеточных линий рака NCI-60 и панели клеточных линий рака поджелудочной железы изолят нового химерного ортопоксвируса #33 и изолят химерного парапоксвируса #189 выбрали для описания дополнительных характеристик. Активность по уничтожению опухолевых клеток изолятов #33 и #189 дополнительно исследовали на трех клеточных линиях рака желудка. Клетки MKN-45, OCUM-2M и KATO-3 инфицировали #33, #189, GLV-1h68 и OncoVEX GFP при MOI 0,01, 0,1 и 1. Ежедневно в течение 4 дней проводили мониторинг жизнеспособности клеток, используя анализы MTS. Клеточные линии MKN-45 и OCUM-2M были наиболее чувствительны к #33, промежуточно чувствительны к GFP OncoVEX и наименее чувствительны к GLV-1h68. При том, что KATO-3 были наиболее чувствительными к GFP OncoVEX при низком MOI 0,01, #33, #189, и GFP OncoVEX одинаково хорошо уничтожали клетки KATO-3 при более высоком MOI (0,1 и 1). Клетки КАТО-3 были наименее чувствительны к GLV-1h68. В целом, #33 наиболее эффективно уничтожает клеточные линии рака желудка, тогда как GLV-1h68 наименее эффективно уничтожает клеточные линии рака желудка (Фиг. 5A-5C).

[0319] 90 генов, которые присутствуют во всех секвенированных ChPV, перечислены вместе с их функцией, если она известна, как указано в таблице 3. Гены названы в честь их аналога VACV-COP. Звездочка * указывает гены, также присутствующие в двух EnPV. Таблица 3 адаптирована из Gubser et al. (Gubser, C., Hue, S., Kellam, P., and Smith, G.L. (2004). Poxvirus genomes: a phylogenetic analysis. J Gen Virol 85, 105-117), который полностью включен в данный документ посредством ссылки и для всех целей.

[0320] Таблица 3. Минимальный генный комплемент хордопоксвирусов. Сокращения: IMV, внутриклеточный зрелый вирус; IEV, внутриклеточный оболочечный вирус; EEV, внеклеточный оболочечный вирус

ORF Предполагаемая функция ORF Предполагаемая функция
F9L* Неизвестна H6R* ДНК-топоизомераза I
F10L* Серин-треониновые протеинкиназы IMV H7R Неизвестна
F12L Белок IEV D1R* Кэпирующий мРНК фермент, большая субъединица
F13L Белок EEV/фосфолипаза D2L Белок кора IMV
F15L Неизвестна D3R* Белок кора IMV
F17R Фосфопротеин кора IMV, VP11/ДНК-связывающий белок D4R* Урацил-ДНК-гликозилаза
E1L* Поли (А) полимеразная каталитическая субъединица D5R* Нуклеозидтрифосфатаза
E2L Неизвестна D6R* Малая субъединица фактора ранней транскрипции, VETF-1
E4L Поли (А) полимеразная каталитическая субъединица, rpo30/VITF-1 D7R* Субъединица РНК-полимеразы rpo18
E6R* Неизвестна D9R 29 кДА mutT-подобный белок
E8R Неизвестна D10R* 29 кДА mutT-подобный белок, отрицательный регулятор экспрессии генов
E9L ДНК-полимераза D11L* Нуклеозидтрифосфатфосфогидролаза I
E10R мембраноассоциированный белок IMV D12L* Малая субъединица кэпирующего мРНК фермента, фактор промежуточной транскрипции, VITF
I1L коровый/ДНК-связывающий белок IMV D13L* Белок IMV, резистентность к рифампицину
I2L Неизвестна A1L* Фактор поздней транскрипции/VLTF-2
I3L Фосфопротеин, связывает ssDNA A2L* Фактор поздней транскрипции/VLTF-3
I5L структурный белок IMV, VP13K A2-5L Тиоредоксиноподобный белок
I6L Неизвестна A3L* Основной белок кора IMV, P4b
I7L* Белок кора IMV A4L Белок кора IMV
I8R* Нуклеозидтрифосфатфосфогидролаза II, РНК- геликаза, НТФаза A5R* Субъединица РНК-полимеразы rpo19
G1L* Металлоэндопротеиназа/ морфогенез вириона A6L Неизвестна
G2R Поздняя транскрипция/ IBT-зависимый белок A7L* Большая субъединица фактора ранней транскрипции, VETF
G3L Неизвестна A8R Фактор промежуточной транскрипции, VITF-3
G4L Глутаредоксин 2, мембранный белок, морфогенез вириона A9L* белок IMV, участвует в морфогенезе
G5R* Неизвестна A10L* основной белок кора P4a IMV
G5-5R Субъединица РНК-полимеразы rpo7 A11R* Неизвестна
G6R* Неизвестна A12L белок кора IMV
G7L белок кора IMV, VP16K A13L мембраноассоциированный белок IMV /p8
G8R Фактор поздней транскрипции, VLTF-1 A14L Белок IMV, p16
G9R* белок миристил A14-5L Белок IMV
L1R* Миристилированный белок IMV A15L Неизвестна
L2R Неизвестна A16L* белок миристил
L3L* Неизвестна A17L Белок мембраны IMV, фактор морфогенеза
L4R* Белок кора IMV VP8, ДНК- и РНК-связывающий белок A18R* ДНК-геликаза, ДНК-зависимая АТФаза, фактор высвобождения транскрипта
L5R* Неизвестна A19L Неизвестна
J1R Димерный вирионный белок A20R фактор процессивности ДНК-полимеразы
J3R* Поли (А) полимеразная стимулирующая субъединица, VP39 A21L* Неизвестна
J4R Субъединица РНК-полимеразы rpo22 A22R* Резольваза структуры Холлидея
J5L* Неизвестна A23R* Фактор промежуточной транскрипции, VITF-3
J6R* Субъединица РНК-полимеразы rpo147 A24R* Субъединица РНК-полимеразы rpo132
H1L Тирозин-сериновая фосфатаза, созревание вириона A28L* Неизвестна
H2R* Неизвестна A29L* Субъединица РНК-полимеразы rpo35
H3L* Иммунодоминантный белок оболочки IMV p35 A30L Неизвестна
H4L* Фактор специфичности транскрипции, связанный с РНК-полимеразой, RAP 94 A32L* АТФ- и ГТФ-связывающий мотив А, упаковка ДНК
H5R Фактор поздней транскрипции, VLTF-4 A34R Гликопротеин EEV

[0321] Понятно, что примеры и варианты осуществления, описанные в настоящем описании, предназначены только для иллюстративных целей и что различные модификации или изменения в их свете будут предложены специалистам в данной области техники и должны быть включены в сущность и сферу охвата этой заявки и в объем правовых притязаний приложенной формулы изобретения. Все публикации, патенты и патентные заявки, процитированные, в настоящем описании, тем самым включены в качестве ссылки во всей их полноте для всех целей.

Пример 4. Новый химерный парапоксвирус hov-189 в качестве онколитической иммунотерапии при трижды негативном раке молочной железы

[0322] Трижды негативный рак молочной железы (TNBC) является агрессивным подтипом рака молочной железы с высокой частотой рецидивов и неблагоприятным прогнозом. Здесь заявители описывают новый полученный методом генной инженерии парапоксвирус, который эффективно уничтожает TNBC.

[0323] Способы: Новый химерный парапоксвирус (HOV-189) получили посредством гомологической рекомбинации и идентифицировали посредством скрининга высокой производительности. Цитотоксичность оценивали in vitro на четырех клеточных линиях TNBC. Репликацию вируса исследовали посредством стандартного анализа бляшкообразования. Ортотопные ксенотрансплантаты TNBC получали посредством имплантации MDA-MB-468 в жировые слои второй и четвертой молочных желез бестимусных голых мышей и обрабатывали вирусом.

[0324] Результаты: HOV-189 продемонстрировал дозозависимую цитотоксичность при низкой множественности заражения (MOI) с гибелью >90% клеток через шесть дней после обработки. Значительное уменьшение размера опухоли наблюдали через две недели после интратуморальной инъекции при дозах всего 103 БОЕ по сравнению с контролем (P<0,01). Кроме того, был продемонстрирован абскопальный эффект (сокращение неинъецированных отдаленных опухолей).

[0325] Заключение: HOV-189 продемонстрировали эффективную цитотоксичность in vitro и мощный противоопухолевый эффект in vivo в дозах всего лишь 103 БОЕ. Эти данные подтверждают клинические исследования этого сильнодействующего агента против TNBC.

[0326] Введение

[0327] Приблизительно 12-20% одного миллиона вновь диагностированных случаев рака молочной железы во всем мире каждый год являются трижды негативным раком молочной железы11, что означает отсутствие у них экспрессии эстрогенового рецептора (ER), прогестеронового рецептора и рецептора эпидермального фактора роста человека 2 (HER2). Трижды негативный рак молочной железы (TNBC) демонстрирует худшие клинические результаты, как вследствие его агрессивного поведения, так и из-за отсутствия эффективных видов таргетной терапии. Пациенты с TNBC имеют более высокий риск рецидива и развития метастазирования в первые пять лет после постановки диагноза, чем пациенты без TNBC12.

[0328] В настоящее время основой адъювантной терапии TNBC является цитотоксическая химиотерапия, но были проведены интенсивные исследования и разработки таргетной терапии, включая исследования ингибиторов поли(АДФ-рибоза)полимеразы 1 (PARP1), ингибиторов PI3K, ингибиторов МЕК и ингибиторов лиганда программируемой смерти 1 (PD-L1)11,13.

[0329] Иммунотерапия долгое время была областью исследования для многих типов рака, включая рак молочной железы. TNBC демонстрирует повышенную генетическую нестабильность, более высокий уровень неоантигенов и имеет частоту инфильтрирующих опухоль лимфоцитов (TIL) в микроокружении, что делает TNBC более иммуногенным, чем заболевание, не являющееся трижды негативным14. Эти факторы делают TNBC подходящим кандидатом для иммунотерапии. Заявители ранее исследовали противоопухолевый эффект онколитического вируса осповакцины в модели TNBC15. Здесь заявители представляют данные о новом химерном парапоксвирусе, который эффективен в моделях TNBC как in vitro и in vivo.

[0330] Способы

[0331] Клеточная культура и клеточные линии. Клеточные линии трижды негативного рака молочной железы человека MDA-MB-231 (любезно предоставленные доктором Sangkil Nam, City of Hope), MDA-MB-468 (любезно предоставленные доктором John Yim, City of Hope), BT549 (Dr. Yim) и Hs578T (Dr. Yim) культивировали в RPMI 1640 (Corning, Corning NY) с добавлением 10% фетальной сыворотки крупного рогатого скота (FBS) и 100 МЕ/мл стрептомицина и пенициллина. Все линии TNBC протестировали и проверили на подлинность посредством Genetica Cell Line Testing (Burlington, NC). Фибробласты почек (CV-1) африканской зеленой обезьяны и клетки MDBK получили из Американской коллекции типовых культур (Mannassus, VA) и культивировали в модифицированной Дульбекко среде Игла (DMEM, Corning, Corning NY), обогащенной 0% FBS и 100 МЕ/мл стрептомицина и пенициллина. Все клетки выращивали при 37°C в 5% влажном CO2-инкубаторе.

[0332] Разработка и селекция химерного парапоксвируса. Для создания пула химерных парапоксвирусов клетки MDBK коинфицировали штаммом NZ2 орф-вируса (ATCC) и штаммом TJS псевдопоксвируса коров (ATCC). Инфицированные клетки собирали через 3 дня после инфицирования. Сто бляшек химерного парапоксвируса отобрали из клеток MDBK, инфицированных пулом химерного парапоксвируса. Эти 100 бляшек дополнительно очищали методом бляшкообразования два раза в клетках MDBK с получением 100 клонально очищенных индивидуальных изолятов химерного вируса, которые вместе с их родительскими вирусами подвергали скринингу высокой производительности в клеточных линиях NCI-60. Для этого исследования был выбран изолят HOV-189, который продемонстрировал наиболее сильные противоопухолевые свойства против клеточных линий NCI-60.

[0333] Анализы цитотоксичности. Клетки высевали при 1000 клеток/лунка для MDA-MB-231, BT549 и Hs578T и при 3000 клеток/лунка для MDA-MB-468 в 96-луночные планшеты и инкубировали в течение ночи. Клетки инфицировали 0,1, 1 и 10 MOI каждого вируса для MDA-MB-231 и 0,01, 0,1 и 1 для MDA-MB-468, BT549 и Hs578T. Жизнеспособность клеток измеряли в трех повторах каждые 24 часа в течение от одного до шести дней с использованием раствора CellTiter 96 Awater One (Promega, Madison, WI) на спектрофотометре (Tecan Spark 10M, Mannedorf, Switzerland) при 490 нм.

[0334] Анализы репликации вируса. Репликацию вируса в TNBC определяли количественно, используя стандартный анализ бляшкообразования. Клетки высевали до слияния в 6-луночные планшеты в 2 мл питательной среды, затем инфицировали 0,01 MOI каждого вируса. Клетки собирали в трех повторах в течение трех дней подряд. Клетки MDBK инфицировали серийными разведениями образцов, обработанных HOV-189, в 24-луночных планшетах.

[0335] Ортотопические ксенотрансплантатные модели. Двадцати шести Самкам Hsd:бестимусных голых мышей Nude-Foxn1nu (Envigo, Indianapolis, IN) инъецировали 107 клеток MDA-MB-468 с 6 мг/мл матригел (Corning) в жировые слои второй и четвертой молочных желез в возрасте 12 недель. Когда опухоли достигали размера приблизительно 100-150 мм3, мышей рандомизировали, и в опухоли интратуморально инъецировали либо только PBS (n= 4), 103 БОЕ (n=6), 104 БОЕ (n=6), либо 105 БОЕ (n=7) в 50 мкл PBS. Дисперсия размеров опухоли существенно не различалась между группами до обработки. Затем размер опухоли измеряли каждые три дня в течение шести недель. Объем опухоли рассчитывали по V (мм3)=(4/3 ×(π)×(a/2)2×(b/2), где а представляет собой наименьший диаметр, а b представляет собой наибольший диаметр. Через семь дней после интратуморальной инъекции от двух до четырех мышей на группу умерщвляли так, что опухоль и органы (легкие, сердце, печень, почку, селезенку, яичник, головной мозг) быстро замораживали в жидком азоте и использовали для дальнейшего гистопатологического окрашивания, иммуногистохимического окрашивания и анализов вирусного бляшкообразования. У оставшихся трех мышей опухоли только вторых молочных желез обрабатывали 105 БОЕ в 50 мкл PBS для того, чтобы наблюдать действие, если таковое имеется, на неинъецированную опухоль четвертой молочной железы. Через две недели после обработки обе опухоли собирали для определения вирусного титра в каждой.

[0336] РЕЗУЛЬТАТЫ

[0337] HOV-189 эффективно уничтожает TNBC in vitro зависимым от времени и дозы образом. Учитывая гетерогенную природу TNBC, две клеточные линии метастатического происхождения (MDA-MB-231 и MDA-MB-468) и две клеточные линии неметастатического происхождения (Hs578T и BT549) обрабатывали HOV-189 при MOI в диапазоне от 0,01 до 10 в течение шести дней. HOV-189 наиболее эффективно уничтожал Hs578T (LD50 через 96 ч: MOI 0,396) и MDA-MB-468 (LD50, MOI 0,185) с >80% гибелью клеток через шесть дней при обработке с MOI 1 (фиг. 6A и 6C). Хотя LD50 была выше для BT549 и MDA-MB-231 (LD50, MOI 1,636 и MOI 1,712, соответственно), данные MDA-MB-231 показывают, что увеличение концентрации HOV-189 приводит к >90% гибели клеток при MOI 10 после шесть дней (Фиг. 6D).

[0338] HOV-189 реплицируется в TNBC in vitro. Репликацию вируса оценивали во всех четырех клеточных линиях TNBC посредством стандартного анализа бляшкообразования инфицированных клеток, собранных в течение трех дней. Эффективная репликация вируса происходила в BT549, Hs578T и MDA-MB-231 при MOI 0,01, при этом максимальная репликация происходила в течение 24-48 часов (Фиг. 7). Однако репликация HOV-189 в MDA-MB-468 была слабой при MOI 0,01, несмотря на демонстрацию эффективной цитотоксичности при низкой MOI. Репликацию вируса улучшили посредством увеличения концентрации до MOI 10 в линии MDA-MB-468 (Фиг. 7).

[0339] Интратуморальная инъекция HOV-189 эффективно редуцирует размер опухоли в ортотопических ксенотрансплантатах TNBC без значительной вирусной токсичности. Ортотопические ксенотрансплантаты создали посредством имплантации клеток MDA-MB-468 в жировые слои второй и четвертой молочных желез бестимусных голых мышей. Обе опухоли получали одну интратуморальную инъекцию либо PBS, либо HOV-189 (103 БОЕ, 104 БОЕ или 105 БОЕ). Все группы, обработанные HOV-189, продемонстрировали значительную редукцию относительного размера опухоли к 13 дню после обработки по сравнению с контрольными животными, обработанными PBS, и этот эффект обработки сохранялся через шесть недель после инъекции (Фиг. 8). Интратуморальные инъекции хорошо переносились мышами без заметной вирусной токсичности, что они продемонстрировали отсутствием значительного снижения массы тела в группах обработки по сравнению с контрольной группой (Фиг. 9).

[0340] Биораспределение HOV-189 в течение одной недели и шести недель после обработки демонстрирует присущую опухолеспецифичность in vivo. Через одну и шесть недель после инъекции HOV-189 от двух до четырех мышей из каждой группы умерщвляли для исследования биораспределения вируса. Титры вируса инфицированной опухолевой ткани продемонстрировали титр HOV-189 на 2 порядка выше по сравнению с другими органами в оба момента времени, отражая естественную тропность HOV-189 к раковым клеткам по сравнению с нормальными клетками (таблица 4). Помимо инъецированной опухолевой ткани, HOV-189 был обнаружен только в ткани сердца и легкого через одну неделю после инъекции и в легочной ткани через шесть недель после инъекции, что коррелирует с отсутствием значительной наблюдаемой системной токсичности.

[0341] Инфицирование и репликация HOV-189 в орпотопической ксенотранстплантантной модели подтверждена иммунофлуоресцентной визуализацией. Через неделю после инъекции HOV-189 иммунофлуоресцентное обнаружение поликлонального антитела против орф-вируса демонстрирует инфицирование вирусом опухолевой ткани, обработанной HOV-189, при 105 БОЕ на опухоль по сравнению с контролем (Фиг. 10A и 10B). Кроме того, схема детектирования антител, слитых с контрастным красителем DAPI, согласуется с активной репликацией на вирусных фабриках, поскольку антитела против орф-вируса локализуются в областях только за пределами ядра (Фиг. 10C).

[0342] Интратуморальная инъекция HOV-189 инъекция оказывает опухолевое действие на отдаленные неинъецированные опухоли. Трех животных обработали HOV-189 при 105 БОЕ только во второй опухоли молочной железы, тогда как четвертую опухоль молочной железы оставляли необработанной. Размер опухоли измеряли каждые три дня по сравнению с обработанными PBS контролями, и титры вирусов количественно определяли посредством стандартного анализа бляшкообразования в конце двух недель. В то время как относительный размер опухоли первоначально увеличивался в группе инъецированных опухолей (вероятно, из-за травмы вследствие самой инъекции), размер опухоли уменьшался после шестого дня со значительной редукцией по сравнению с контролем на 13 день (р<0,05). Относительный размер опухоли в группе неинъецированных опухолей оставался стабильным, несмотря на то, что их никогда не подвергали непосредственной обработке HOV-189 (фиг. 11). Титры вируса в конце двух недель показали, что средний титр в инъецированных опухолях составил 3,37×103 БОЕ/г ткани по сравнению по сравнению со средним значением неинъецированных опухолей при 1,15×103 БОЕ/г ткани.

[0343] Обсуждение

[0344] Трижды негативный рак молочной железы (TNBC) составляет 15-20% всех диагнозов рака молочной железы. Он имеет тенденцию проявлять агрессивную биологию, часто поражая более молодых женщин и предвещая более высокую частоту рецидивов и худшую общую выживаемость16,17. В отличие от гормон-рецептор-положительного заболевания TNBC не имеет известных биологических маркеров для разработки и применения эффективных методов таргетной терапии. Поэтому основой неоадъювантной и адъювантной терапии остается цитотоксическая химиотерапия, которая может быть ассоциирована с многочисленными системными побочными эффектами11,13.

[0345] В октябре 2015 года Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) одобрило вирус простого герпеса (HSV-1) под названием T-VEC (талимоген лагерпарепвек) в качестве первого онколитического вируса (OV) для применения у людей18. Это одобрение стало знаковым событием в области вирусологии и иммунотерапии, вызвавшее большой интерес к дальнейшей разработке OV для лечения других видов рака, включая TNBC. OV демонстрируют естественную тропность к раковым клеткам по сравнению с нормальными клетками, используя патологические нарушения в раковых клетках, такие как измененные внутриклеточные пути передачи сигналов и сверхэкспрессия рецепторов клеточной поверхности, чтобы преимущественно инфицировать раковые клетки19-21. Кроме того, OV-опосредованное разрушение инфицированных клеток высвобождает цитокины, опухолеассоциированные антигены (TAA), молекулярные фрагменты, ассоциированные с повреждениями (DAMP), и молекулярные фрагменты, ассоциированные с патогеном (PAMP), которые запускают как врожденную, так и адаптивную иммунную систему против раковых клеток20,22-26. TNBC демонстрирует повышенную генетическую нестабильность, увеличение количества неоантигенов и увеличение количества инфильтрирующих опухоль лимфоцитов (TIL) в микроокружении14. Это делает TNBC более иммуногенным, чем заболевание, не являющееся трижды негативным, и подходящим кандидатом на OV-направленную терапию.

[0346] Это исследование демонстрирует, что новый химерный парапоксвирус, HOV-189, обладает цитотоксическим действием in vitro в четырех различных клеточных линиях TNBC, как метастатического, так и неметастатического происхождения. Однократная интратуморальная инъекция HOV-189 в ксенотрансплантаты TNBC бестимусных голых мышей значительно редуцировала размер опухоли без признаков значительной токсичности. Кроме того, вирус также был обнаружен в неинъецированных отдаленных участках опухоли со стабилизацией размера этих опухолей. Таким образом, HOV-189 демонстрирует способность системно перемещаться и нацеливаться на отдаленные участки заболевания, что может найти применение в неоадъювантной терапии, а также в условиях метастазирования.

[0347] Следует отметить, что редукция размеров опухоли in vivo наблюдалось при дозах HOV-189, составляющих всего 103 БОЕ на опухоль. Это говорит о том, что противоопухолевый эффект вряд ли является результатом прямого онколиза в результате вирусной репликации, поскольку HOV-189 продемонстрировал слабую репликацию in vitro. Генетическое секвенирование HOV-189 обнаруживает тесную связь с одним из его родительских вирусов, орф-вирусом (ORFV) парапоксвирусов. Предыдущие исследования ORFV показали, что обработка ORFV вызывает сильный иммуномодулирующий эффект, особенно в отношении активации натуральных клеток-киллеров (NK)27,28. Даже обработка инактивированным ультрафиолетом (УФ) ORFV вызвала сходную, хотя и более слабую реакцию, демонстрируя, что сам вирус, вероятно, содержит антигенный структурный компонент, который способен индуцировать иммунный ответ независимо от его фактической репликации. Учитывая, что генетическая последовательность HOV-189 очень тесно связана с NZ2 вируса ORFV, заявители выдвигают гипотезу о том, что противоопухолевый механизм действия HOV-189, вероятно, опосредован иммунными клетками, может быть, опосредован NK-клетками, объясняя эффект, наблюдаемый при низких дозах и его плохой репликация in vitro.

[0348] По сравнению с другими OV ORFV не был хорошо изучен в контексте разработки клинической терапии. Многое из того, что известно о естественном развитии вызванного им заболевания, было взято из ветеринарной медицины. Тем не менее, есть несколько свойств ORFV, которые могут быть полезны для разработки его в качестве OV для лечения видов рака у человека. Во-первых, инфекция ORVF не вызывает серьезных заболеваний у людей29. Во-вторых, инфекция ORFV вызывает сильную стимуляцию иммунной системы (с доминированием Th1), и способность вызывать иммунный ответ сохраняют даже инактивированные вирусные частицы30,31. В-третьих, нейтрализующие антитела встречаются редко, и реинфекция может возникать, несмотря на выработку антител против ORF. Это означает, что повторные дозы потенциально можно назначать одному и тому же пациенту28, что является логичным улучшением по сравнению с другими OV в клинической разработке, которые требуют переключения серотипа или повторных доз уникальных в антигенном отношении вирусов для продолжения ответа. Наконец, клинический ответ с использованием более низких вирусных титров ORFV является еще одним практическим улучшением разработки OV, поскольку получение OV является сложным, дорогостоящим и времязатратным и обычно требует титров в диапазоне 106-109 БОЕ на инъекцию.

[0349] Итак, HOV-189 является новым химерным парапоксвирусом дикого типа, эффективным против TNBC как in vitro, так и in vivo. С таргетной терапией, отсутствующей в лечении TNBC, HOV-189 представляет собой перспективный путь для иммунотерапии в этой области. Что касается будущих направлений, заявители планируют дальнейшие доклинические испытания в других ксенотрансплантатных моделях, а также генетические модификации вируса дикого типа для повышения селективности опухоли и общей активности

Таблица 4. Биораспределение вируса HOV-189 в различных органах через 1 и 6 недель после обработки.

Титр вируса через 1 неделю (БОЕ/г ткани) Титр вируса через 6 недель (БОЕ/г ткани)
Титр Животные с обнаружением/всего протестировано животных SD Предел обнаружения Титр Животные с обнаружением/всего протестировано животных SD Предел обнаружения
Опухоль 1,64×104 3/3 1,22×104 1,18×103 4/4 1,24×103
Головного мозга ND 0/3 2,52×102 ND 0/4 2,53×102
Сердца 1,07×102 1/3 1,85×102 ND 0/4 4,28×102
Легких 8,96×102 3/3 7,23×102 3,33×101 1/4 6,67×101
Печени ND 0/3 1,14×102 ND 0/4 1,12×102
Селезенки ND 0/3 1,87×102 ND 0/4 6,58×102
Почек ND 0/3 2,43×102 ND 0/4 2,57×102
Яичника ND 0/3 2,62×103 ND 0/4 4,39×102

Пример 5. Конструирование рекомбинантных химерных поксвирусов

[0350] Конструирование челночных векторов для вставки кассет экспрессии чужеродного гена в геном химерного поксвируса #33

[0351] Для конструирования челночного вектора тимидинкиназы (ТК) левые и правые фланкирующие последовательности гена ТК химерного поксвируса #33 амплифицировали посредством ПЦР из геномной ДНК #33, используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGCATATGATCTATGGATTACCATGGATGACAACTC-3' (SEQ ID NO: 21) и 5'-CGTTTAACTCGTCTAATTAATTCTGTAC-3' (SEQ ID NO: 22) (левая фланкирующая), 5'-CAGGTAAAAGTACAGAATTAATTAGACGAGTTAAACGAGCTCGTCGACGGATCCGCTAGC

GGCCGCGGAGGTAATGATATGTATCAATCGGTGTGTAG-3' (SEQ ID NO: 23) и 5'-GCGGAATTCGTAATTACTTAGTAAATCCGCCGTACTAGG-3' (SEQ ID NO: 24) (правая фланкирующая). Два фрагмента объединили, используя метод сплайсинга генов путем перекрывающегося удлинения32. Полученный фрагмент расщепляли с помощью NdeI и EcoRI и клонировали в таким же образом резанную плазмиду pGPT с получением p33NC-TK. Фланкирующие последовательности TK в челночном векторе подтверждали секвенированием. p33NC-TK содержит левую и правую фланкирующие последовательности TK, разделенные SacI, SalI, BamHI, NheI и NotI и геном гуанинфосфорибозилтрансферазы (gpt) Escherichia coli, управляемым ранним промотором вируса осповакцины (VACV) p7.5E в качестве транзиентно-доминантного селектируемого маркера.

[0352] Челночный вектор F14.5L сконструировали аналогично. Левую и правую фланкирующие последовательности гена F14.5L химерного поксвируса #33 амплифицировали посредством ПЦР из геномной ДНК #33, используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGCATATGTAGAAGAATTGATAAATATGAAACCTTTTAAG-3' (SEQ ID NO: 25) и 5'-CCTCTCTAGCTTTCACTTAAACTGTATCG-3' (SEQ ID NO: 26) (левая фланкирующая), 5'-GAATAATCGATACAGTTTAAGTGAAAGCTAGAGAGGAAGCTTGAGCTCGA GGATCCGCTAGCGGCCGCTGAAGAGGATGCTAGAATCAAGGAGGAGCAAG-3' (SEQ ID NO: 27) и 5'-GCGGAATTCTCCGGGCAGTGACTTTGTAGCTCTCCCAG-3' (SEQ ID NO: 28) (правая фланкирующая). Два фрагмента объединили, используя метод сплайсинга генов путем перекрывающегося удлинения. Полученный фрагмент расщепляли с помощью NdeI и EcoRI и клонировали в таким же образом разрезанную плазмиду pGPT с получением p33NC-F14.5L. Фланкирующие последовательности F14.5L в челночном векторе подтверждали секвенированием. p33NC-F14.5L содержит левую и правую фланкирующие последовательности F14.5L, разделенные HindIII, SacI, XhoI, BamHI, NheI и NotI и gpt Escherichia coli, управляемого ранним промотором p7.5E в качестве транзиентно-доминантного селектируемого маркера.

[0353] Конструирование челночных векторов для слияния целевых последовательностей микроРНК с основными генами химерного поксвируса #33

[0354] Для слияния целевой последовательности miR-100 с 3'-концом урацил-ДНК-гликозилазы (кодируемой геном D4R в вирусе осповакцины) химерного поксвируса #33, левую и правую фланкирующие последовательности гена D4R химерного поксвируса #33 амплифицировали посредством ПЦР из геномной ДНК #33, используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGCATATGCACGCGCCATATACTATTACTTATCACGATG-3' (SEQ ID NO: 29) и 5'-TTAATAAATAAACCCTTGAGCCCAATTTATAGG-3' (SEQ ID NO: 30) (левая фланкирующая), 5'-CCTATAAATTGGGCTCAAGGGTTTATTTATTAACACAAGTT CGGATCTACGGGTTcgatCACAAGTTCGGATCTACGGGTTaccggtCACAAGTTCGGATCTACG

GGTTtcacCACAAGTTCGGATCTACGGGTTTGCTTTAGTGAAATTTTAACTTGTGTTC-3' (SEQ ID NO: 31) и 5'-GCGGAATTCCTAGTACCTACAACCCGAAGAGTTG-3' (SEQ ID NO: 32) (правая фланкирующая). Два фрагмента объединили, используя метод сплайсинга генов путем перекрывающегося удлинения. Полученный фрагмент расщепляли с помощью NdeI и EcoRI и клонировали в таким же образом разрезанную плазмиду pGPT с получением p33NCD4R-miR100t и p33NCD4R-miR100t-2. Фланкирующие последовательности D4R в челночном векторе подтверждали секвенированием. p33NCD4R-miR100t содержит 4 копии целевой последовательности miR-100, слитой с 3'-концом D4R, как и предполагалось, тогда как p33NCD4R-miR100t-2 представляет собой спонтанный мутант с удаленными 2 копиями целевой последовательности miR-100. Оба вектора содержат Escherichia coli gpt, управляемого ранним промотором p7.5E VACV в качестве транзиентно-доминантного селектируемого маркера.

[0355] Для слияния целевой последовательности Let-7c с 3'-концом урацил-ДНК-гликозилазы (кодируемой геном D4R в вирусе осповакцины) химерного поксвируса #33, левую и правую фланкирующие последовательности гена D4R химерного поксвируса #33 амплифицировали посредством ПЦР из геномной ДНК #33, используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGCATATGCACGCGCCATATACTATTACTTATCACGATG-3' (SEQ ID NO: 33) и 5'-TTAATAAATAAACCCTTGAGCCCAATTTATAGG-3' (SEQ ID NO: 34) (левая фланкирующая), 5'-CCTATAAATTGGGCTCAAGGGTTTATTTATTAAAACCATACAACCT ACTACCTCAcgatAACCATACAACCTACTACCTCAaccggtAACCATACAACCTACTACCTCAtc acAACCATACAACCTACTACCTCATGCTTTAGTGAAATTTTAACTTGTGTTC-3' (SEQ ID NO: 35) и 5'-GCGGAATTCCTAGTACCTACAACCCGAAGAGTTG-3' (SEQ ID NO: 36) (правая фланкирующая). Два фрагмента объединили, используя метод сплайсинга генов путем перекрывающегося удлинения. Полученный фрагмент расщепляли с помощью NdeI и EcoRI и клонировали в таким же образом разрезанную плазмиду pGPT с получением p33NCD4R-Let7ct. Фланкирующие последовательности D4R в челночном векторе подтверждали секвенированием. p33NCD4R-Let7ct содержит 4 копии целевой последовательности Let-7c слитой с 3'-концом D4R, как и предполагалось. Она содержит gpt Escherichia coli, управляемого ранним промотором p7.5E VACV в качестве транзиентно-доминантного селектируемого маркера.

[0356] С целью слияния целевой последовательности miR-100 с 3'-концом ДНК-полимеразы (кодируемой геном E9L в вирусе осповакцины) химерного поксвируса #33, левую и правую фланкирующие последовательности гена E9L химерного поксвируса #33 амплифицировали посредством ПЦР из геномной ДНК #33, используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGGGCGCCGAGTTTGAGGCGGTATATAAGAAT CTGATTATGC-3' (SEQ ID NO: 37) и 5'-TTATGCTTCGTAAAATGTAGGTTTTGAACC-3' (SEQ ID NO: 38) (левая фланкирующая), 5'-GGTTCAAAACCTACATTTTACGAAGCATAA CACAAGTTCGGATCTACGGGTTcgatCACAAGTTCGGATCTACGGGTTaccggtCACAAGTTCG GATCTACGGGTTtcacCACAAGTTCGGATCTACGGGTTAATAATTTACAACAGTTGTACGTC GCTCTTTG-3' (SEQ ID NO: 39) и 5'-GCGCAATTGCATTGCTAATGGAT CGTTCTCTGGTAGATACG-3' (SEQ ID NO: 40) (правая фланкирующая). Два фрагмента объединили, используя метод сплайсинга генов путем перекрывающегося удлинения. Полученный фрагмент расщепляли с помощью NdeI и EcoRI и клонировали в нарезанную NarI и EcoRI плазмиду pGPT с получением p33NCE9L-miR100t. Фланкирующие последовательности ELL в челночном векторе подтверждали секвенированием. p33NCE9L-miR100t содержит 4 копии целевой последовательности miR-100 слитой с 3'-концом E9L, как и предполагалось. Она также содержит gpt Escherichia coli управляемого ранним промотором p7.5E VACV в качестве транзиентно-доминантного селектируемого маркера.

[0357] Для слияния целевой последовательность Let-7c с 3'-концом ДНК-полимеразы (кодируемой геном E9L в вирусе осповакцины) химерного поксвируса #33 левую и правую фланкирующие последовательности гена E9L химерного поксвируса #33 амплифицировали посредством ПЦР из геномной ДНК #33, используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGGGCGCCGAGTTTGAGGCGGTATATAAGAATCTGATTATGC-3' (SEQ ID NO: 41) и 5'-TTATGCTTCGTAAAATGTAGGTTTTGAACC-3' (SEQ ID NO: 42) (левая фланкирующая), 5'-GGTTCAAAACCTACATTTTACGAAGCATAAAACCATACAACCTACTACCTCAcgatAACCAT ACAACCTACTACCTCAaccggtAACCATACAACCTACTACCTCAtcacAACCATACAACCTACT ACCTCAAATAATTTACAACAGTTGTACGTCGCTCTTTG-3' (SEQ ID NO: 43) и 5'-GCGCAATTGCATTGCTAATGGATCGTTCTCTGGTAGATACG-3' (SEQ ID NO: 44) (правая фланкирующая). Два фрагмента объединили, используя метод сплайсинга генов путем перекрывающегося удлинения. Полученный фрагмент расщепляли с помощью NdeI и EcoRI и клонировали в плазмиду pGPT, разрезанную NarI и EcoRI, с получением p33NCE9L-Let7ct. Фланкирующие последовательности E9L в челночном векторе подтверждали секвенированием. p33NCE9L-Let7ct содержит 4 копии целевой последовательности Let-7c, слитой с 3'-концом E9L, как и предполагалось. Она также содержит gpt Escherichia coli, управляемый ранним промотором p7.5E VACV в качестве транзиентно-доминантного селектируемого маркера.

[0358] Вставка кассет экспрессии чужеродного гена в челночные векторы TK и F14.5L

[0359] Кассета экспрессии натрий-йодидного симпортера человека (hNIS). Кассету экспрессии hNIS с синтетическим ранним промотором (SE) VACV амплифицировали посредством ПЦР, используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGAAGCTTGAGCTCAAAAATTGAAAAACTAGCGTCTTTTTTTGCTCGAAGTCGACCACC ATGGAGGCCGTGGAG-3' (SEQ ID NO: 45) и 5'-GCGGATCCATAAAAATTAATT AATCAGAGGTTTGTCTCCTGCTGGTCTCG-3' (SEQ ID NO: 46). ПЦР-фрагмент расщепляли с помощью NdeI и EcoRI и клонировали в таким же образом разрезанную плазмиду p33NC-TK с получением p33NCTK-SE-hNIS. Последовательность кассеты экспрессии hNIS подтверждали секвенированием.

[0360] Кассета экспрессии Emerald (вариант GFP). Кассету экспрессии Emerald с ранним/поздним промотором H5 VACV амплифицировали посредством ПЦР из плазмиды Emerald-pBAD (Addgene, Cambridge, MA), используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGGGTTGTGTTAAAT TGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTG TTCACC-3' (SEQ ID NO: 47) и 5'-GCGGGATCCATAAAAATTAATTA ATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3' (SEQ ID NO: 48). ПЦР-фрагмент расщепляли с помощью NdeI и EcoRI и клонировали в таким же образом разрезанную плазмиду p33NC-TK с получением p33NCTK-H5-Emerald. Последовательность кассеты экспрессии Emerald подтверждали секвенированием.

[0361] Кассеты экспрессии люциферазы светлячков. Кассету экспрессии люциферазы светлячков с поздним промотором 11K VACV амплифицировали посредством ПЦР из плазмиды pCDNA3.1(+)/Luc2=tdT (Addgene, Cambridge, MA), используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGAAGCTTGAGCTCTAGTAGAATTTCATTTTGTTTTTTTCTATGCTATAAATAGTCGACC

ACCATGGAAGATGCCAAAAACATTAAGAAGGGCCCAGC-3' (SEQ ID NO: 49) и 5'-GCGGGATCCATAAAAATTAATTAATCACACGGCGATCTTGCCGCCCTTCTTGGCCTTAATG

AG-3' (SEQ ID NO: 50). ПЦР-фрагмент расщепляли с помощью NdeI и EcoRI и клонировали в таким же образом разрезанную плазмиду p33NC-TK с получением p33NCTK-11K-Fluc2. Последовательность кассеты экспрессии люциферазы светлячков подтверждали секвенированием. Для получения плазмид, содержащих кассеты экспрессии люциферазы светлячков с VACV SE и промотор H5s, cDNA люциферазы светлячков амплифицировали посредством ПЦР из плазмиды pCDNA3.1(+)/Luc2=tdT (Addgene, Cambridge, MA), используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGGTCGACCACCATGGAAGATGCCAAAAACATTAAGAAGGGCCCAGC-3' (SEQ ID NO: 51) и 5'-GCGGGATCCATAAAAATTAATTAATCACACGGCGATCTTGCC GCCCTTCTTGGCCTTAATGAG-3' (SEQ ID NO: 52). ПЦР-фрагмент расщепляли с помощью SalI и BamHI и клонировали в таким же образом разрезанные плазмиды p33NCTK-SE-hNIS и p33NCTK-H5-Emerald, заменяя hNIS и Emerald с получением p33NCTK-SE-Fluc2 и p33NCTK-H5-Fluc2, соответственно. Последовательность cDNA люциферазы светлячков в обоих векторах подтверждали секвенированием.

[0362] Кассеты экспрессии mCherry. cDNA mCherry амплифицировали посредством ПЦР из плазмиды pLV-mCherry (Addgene, Cambridge, MA), используя Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) и праймеры: 5'-GCGGTCGACCACCATGGTGAGCAAGGGCGAGGAGGATAACATGG-3' (SEQ ID NO: 53) и 5'-GCGGGATCCATAAAAATTAATTAATCACTTGTACAGCTCGTCCATGCCG CCGGTGGAGTGG-3' (SEQ ID NO: 54). ПЦР-фрагмент расщепляли с помощью SalI и BamHI и клонировали в таким же образом разрезанные плазмиды p33NCTK-H5-Emerald и p33NCTK-11K-Fluc2, заменяя Emerald и люциферазы светлячков с получением p33NCTK-H5-mCherry и p33NCTK-11K-mCherry, соответственно. Последовательность cDNA mCherry в обоих векторах подтверждали секвенированием.

[0363] Кассета экспрессии анти-PD-L1 одноцепочечного антитела. Кассету экспрессии анти-PD-L1 одноцепочечного антитела, содержащую промотор Н5 VACV, лидерная последовательность легкой цепи Igκ, последовательности цепей VH и VL атезолизумаба, разделенную (G4S)3 линкерной последовательностью, и С-концевую последовательность маркера FLAG, синтезировали посредством Integrated DNA Technologies (Coralville, Iowa). Фрагмент расщепляли с помощью HindIII и BamHI и клонировали в таким же образом разрезанные плазмиды p33NC-F14.5L с получением p33NCF14.5L-H5-anti-PD-L1. Последовательность кассеты экспрессии анти-PD-L1 одноцепочечного антитела подтверждали секвенированием.

[0364] Получение рекомбинантных химерных поксвирусов

[0365] Клетки CV-1 инфицировали родительскими вирусами при множественности заражения (MOI) 0,1 в течение 1 ч, затем трансфицировали векторами для переноса генов (Таблица 5), используя jetPRIME in vitro DNA & siРНК transfection reagent (Polyplus-transfection Inc. New York, NY). Через два дня после инфицирования собирали инфицированные/трансфицированные клетки, и рекомбинантные вирусы отбирали и очищали по методу бляшкообразования, как описано ранее33.

[0366] Таблица 5. Список рекомбинантных химерных поксвирусов

Рекомбинантные химерные поксвирусы Родительский вирус Вектор для переноса генов Генотип
33-D4RmiR100t-2 #33 p33NCD4R-miR100t-2 Целевая последовательность (2 копии) miR-100, слитой с 3'-концом D4R
33-D4RmiR100t #33 p33NCD4R-miR100t Целевая последовательность (4 копии) miR-100, слитой с 3'-концом D4R
33-D4Rlet7ct #33 p33NCD4R-let7ct Целевая последовательность (4 копии) Let-7c, слитой с 3'-концом D4R
33-E9LmiR100t #33 p33NCE9L-miR100t Целевая последовательность (4 копии) miR-100, слитой с 3'-концом E9L
33-E9Llet7ct #33 p33NCE9L-let7ct Целевая последовательность (4 копии) Let-7c, слитой с 3'-концом E9L
33ΔTK #33 p33NC-TK TK-инактивированный
33-(SE)hNIS #33 p33NCTK-SE-hNIS (SE)hNIS, вставленный в TK
33-(H5)Emerald #33 p33NCTK-H5-Emerald (H5)Emerald, вставленный в TK
33-(SE)Fluc2 #33 p33NCTK-SE-Fluc2 (SE)Fluc2, вставленный в TK
33-(H5)Fluc2 #33 p33NCTK-H5-Fluc2 (H5)Fluc2, вставленный в TK
33-(11K)Fluc2 #33 p33NCTK-11K-Fluc2 (11K)Fluc2, вставленный в TK
33-(H5)mCherry #33 p33NCTK-H5-mCherry (H5)mCherry, вставленный в TK
33-(11K)mCherry #33 p33NCTK-11K-mCherry (11K)mCherry, вставленный в TK
33-(SE)hNIS-D4RmiR100t-2 33-(SE)hNIS p33NCD4R-miR100t-2 (SE)hNIS, вставленный в TK; Целевая последовательность (2 копии) miR-100, слитой с 3'-концом D4R
33-(SE)hNIS-D4R-miR100t 33-(SE)hNIS p33NCD4R-miR100t (SE)hNIS, вставленный в TK; Целевая последовательность (4 копии) miR-100, слитой с 3'-концом D4R
33-(SE)hNIS-D4Rlet7ct 33-(SE)hNIS p33NCD4R-let7ct (SE)hNIS, вставленный в TK; Целевая последовательность (4 копии) Let-7c, слитой с 3'-концом D4R
33-(SE)hNIS-E9LmiR100t 33-(SE)hNIS p33NCE9L-miR100t (SE)hNIS, вставленный в TK; Целевая последовательность (4 копии) miR-100, слитой с 3'-концом E9L
33-(SE)hNIS-E9Llet7ct 33-(SE)hNIS p33NCE9L-let7ct (SE)hNIS, вставленный в TK; Целевая последовательность (4 копии) Let-7c, слитой с 3'-концом E9L
33ΔF14.5L #33 p33NC-F14.5L F14.5L-инактивированный
33-(H5)anti-PD-L1 #33 p33NCF14.5L-H5-anti-PD-L1 (H5)анти-PD-L1, вставленный в F14.5L
33-(SE)hNISΔF14.5L 33-(SE)hNIS p33NC-F14.5L SE)hNIS, вставленный в TK; F14.5L-инактивированный
33-(SE)hNIS-(H5)анти-PD-L1 33-(SE)hNIS p33NCF14.5L-H5-anti-PD-L1 SE)hNIS, вставленный в TK; (H5)анти-PD-L1, вставленный в F14.5L

Пример 6. Композиции химерного поксвируса и их применение

[0367] Заявители недавно разработали новые онколитические химерные поксвирусы, используя свою уникальную методологию для получения вирусных химер с последующим скринингом высокой производительности в клеточных линиях NCI-60 и панкреатических клеточных линиях. Эти новые химерные поксвирусы используют наилучший потенциал нацеливания нескольких родительских вирусов, демонстрируя превосходную противоопухолевую активность в более чем 70 клеточных линиях рака по сравнению с их родительскими вирусами и онколитическими вирусами, которые в настоящее время проходят клинические испытания на людях. В ксенотрансплантантных моделях человеческого трижды негативного рака молочной железы, рака поджелудочной железы и рака легкого новые химерные поксвирусы могут уменьшать опухоли при одной внутриопухолевой инъекции всего 1000 бляшкообразующих единиц вируса без явных побочных эффектов. Это на 2-5 порядков ниже, чем у большинства онколитических вирусов, проходящих клинические испытания. Кроме того, химерные поксвирусы эффективно распространяются из инъецированных опухолей к неинъецированным опухолям, что приводит к значительным абскопальным эффектам (сокращение неинъецированных отдаленных опухолей).

[0368] Чтобы помочь осуществлению мониторинга инфицирования и репликации вируса in vitro и in vivo, в химерные поксвирусы вставили кассеты экспрессии Emerald (варианта GFP), mCherry (красного флуоресцентного белка) и люциферазы светлячков. Экспрессия этих генов оптической визуализации легко обнаруживается, что значительно облегчает мониторинг репликации и распространения вируса in vivo без существенного влияния на репликацию и эффективность вируса.

[0369] Вооружение онколитических вирусов терапевтическими генами является широко распространенной стратегией для повышения противоопухолевой эффективности онколитических вирусов. Среди всех испытанных терапевтических генов, натрий-йодидный симпортер человека (hNIS) показал большие перспективы как в доклинических, так и в клинических исследованиях. hNIS представляет собой мембраносвязанный гликопротеин, присутствующий на базолатеральной поверхности фолликулярных клеток щитовидной железы. Он облегчает транспорт йода в цитоплазму, где в процессе синтеза гормонов щитовидной железы происходит его органификация. Эта молекула была успешно использована для накопления радиоактивного йода как при визуализации, так и при лечении дифференцированного рака щитовидной железы, что дает высокий ответ и скорость излечения (>90%). Кассету экспрессии hNIS вставили в химерные поксвирусы, чтобы превратить нетиреоидные виды рака в «тиреоидоподобный» рак, который, как ожидается, отвечает на терапию радиоактивным йодом или рением-188. Таким образом, нетиреоидные виды рака после превращения в «тиреоидоподобный» рак станет визуализируемым при использовании радиоактивного йода, и будет потенциально уничтожен по меньшей мере тремя механизмами: внутренней онколитической активностью онколитических вирусов, нацеленной лучевой терапией и противоопухолевыми иммунными ответами, опосредованными онколитическими вирусами и лучевой терапией. Заявители продемонстрировали, что hNIS должным образом экспрессируется на клеточной мембране опухолевых клеток после инфицирования hNIS-экспрессирующим химерным поксвирусом. Кроме того, первоначальные экспериментальные результаты показывают, что вставка кассеты экспрессии hNIS не влияет на внутреннюю онколитическую активность родительских вирусов как in vitro, так и на животных моделях. Кроме того, заявители показали, что химерные поксвирусы, экспрессирующие hNIS, безопасны для мышей, имеющих опухоли.

[0370] Иммунные ингибиторы контрольной точки представляют собой инновационные лекарственные препараты для лечения солидных опухолей и были одобрены для лечения меланомы, немелкоклеточного рака легкого и почечно-клеточного рака. Эти препараты требуют наличия уже существующего противоопухолевого иммунного ответа. Праймированием иммунной системы онколитическими вирусами можно повысить чувствительность иммунного репертуара пациента стать более благоприятным для терапии анти-PD-1/PD-L1 и анти-CTLA-4. Комбинируя онколитические вирусы с ингибиторами иммунных контрольных точек, можно преодолеть множество иммунных путей, индуцирующих иммунную толерантность. Кроме того, онколитические вирусы способствуют инфильтрации цитотоксических CD8 T-клеток в инфицированные опухоли и индуцируют повышающую регуляцию CTLA-4 или PD-L1 посредством активации продуцирующих IFN-γ цитотоксических CD8 T-клеток, тем самым позволяя анти-CTLA-4 и анти-CTLA-4-PD-1/PD-L1 терапии достигать максимального терапевтического потенциала. Данные нескольких доклинических исследований подтверждают сочетание терапии онколитическими вирусами с блокадой контрольных точек. Клинические испытания по оценке комбинации первого одобренного FDA онколитического вируса T-VEC с анти-CTLA-4 и анти-PD-1 антителами продолжаются. Первые результаты обнадеживают. Для усиления противоопухолевых иммунных ответов, инициируемых химерными поксвирусами, особенно химерными поксвирусами, экспрессирующими hNIS, экспрессионная кассета анти-PD-L1 вставляют в химерные поксвирусы или химерные поксвирусы, экспрессирующие hNIS. Заявители ожидают, что, хотя вставление hNIS в онколитические вирусы будет способствовать синергическому уничтожению опухолевых клеток с помощью радиоактивного йода и визуализации в ядерной медицине инфицированных опухолевых клеток, экспрессия иммуностимулирующих трансгенов, таких как анти-PD-L1, в этих же векторах значительно усилит противоопухолевые иммунные ответы при потенциальном снижении целевой аутоиммунной токсичности.

Пример 7. Таргетинг рака поджелудочной железы терапией онколитическими вирусами

[0371] Анализ Цитотоксичности

[0372] Анализ цитотоксичности проводили на клеточных линиях рака Panc-1 (Фиг. 12A-12B), MiaPaCa-2 (Фиг. 12C-12D), BxPC-3 (Фиг. 12E-12F), SU.86.86 (Фиг. 12G-12H), Capan-1 (Фиг. 12I-12J) и AsPC-1 (Фиг. 12K-12K) посредством культивирования 3×103 раковых клеток на лунку в 100 мкл RPMI 5% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов. Затем добавляли 20 мкл вируса, либо #33, OncoVEXGFP, GLV-1h68, либо #189, при множественности заражения (MOI) 1, 0,1 и 0,01. Ежедневный анализ жизнеспособности клеток проводили, добавляя 20 мкл CellTiter 96 Aqueous One Solution Cell Proliferation Assay во все лунки и считывая колориметрические показатели после 1 часа инкубации. Результаты эксперимента стандартизировали только для среды и контроля с MOI 0. Этот эксперимент повторяли в трех повторах. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени. Для SU.86.86 статистический анализ проводили, используя непарный t-тест для каждой MOI.

[0373] Кривая роста вирусов

[0374] Кривую репликации вируса строили на клеточных линиях рака Panc-1 (Фиг. 13A-13B), MiaPaCa-2 (Фиг. 13C-13D), BxPC-3 (Фиг. 13E-13F), SU.86.86 (Фиг. 13G-13H), Capan-1 (Фиг. 13I-13J) и AsPC-1 (Фиг. 13K-13L) посредством культивирования клеток при 5×105 клеток на лунку в 2 мл RPMI 10% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов в трех повторах. Затем среды аспирировали, и добавляли #33, OncoVEXGFP, GLV-1h68, или #189 при множественности заражения (MOI) 0,01 в 500 мкл RPMI 2,5% FBS, 1% раствора антибиотика-антимикотика в течение 1 часа, встряхивая каждые 20 минут. Через один час среды аспирировали, и добавляли 1,5 мл RPMI 2,5% FBS, 1% раствора антибиотика-антимикотика. Через 24, 48 и 72 часа собирали клетки и супернатант и после трех циклов заморозки и оттаивания выполняли серийные разведения в двух повторах. Этот эксперимент повторяли в двух повторах. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени.

[0375] Обработка опухолей при раке поджелудочной железы in vivo

[0376] Восемнадцати самкам бестимусных голых мышей Nude-Foxn1nu (Envigo, Indianapolis, IN) имплантировали 2×106 двусторонних боковых опухолей MiaPaCa-2. Как только размеры опухоли достигали 400 мм3, в левостороннюю опухоль инъецировали 50 мкл PBS (3 мыши), #33 (5 мышей), #33-(SE)hNIS или #33-(SE)hNIS-E9LmiR100t (5 мышей) при приблизительно 1×105 БОЕ/доза. Фактическая доза HOV-33 составила 7,8×104. Фактическая доза HOV-33-SE/hNIS составила 4,5×104. Фактическая доза HOV-33-SE/hNIS-E9L-miR100t составила 1,6×105. Чистое процентное изменение массы и процентное изменение инъецированной опухоли и неинъецированных опухолей регистрировали два раза в неделю в течение 43 дней (Фиг. 14A-14C). Всех мышей умерщвляли через 43 дня, и на органах мышей проводили титрование вируса. Значительные различия в инъецированных опухолях были отмечены при сравнении контроля PBS с #33, #33-(SE) hNIS и #33-(SE) hNIS-E9LmiR100t (фиг. 14B; p=0,01, p=0,01 и p=0,0001, соответственно). Значительные различия были отмечены только в группах неинъецированных опухолей между контролем PBS и # 33-(SE)hNIS (Фиг. 14C; p=0,03).

[0377] Двадцати шести самкам бестимусных голых мышей Nude-Foxn1nu (Envigo, Indianapolis, IN) имплантировали 1,25×106 двусторонних боковых опухолей Panc-1. Как только размеры опухоли достигали приблизительно 250 мм3, в левостороннюю опухоль инъецировали 50 мкл PBS (4 мыши), #33 (6 мыши), #33-(SE)hNIS (6 мыши), #33-(SE)hNIS-E9LmiR100t (5 мышей) или #33-(H5)Fluc2 при приблизительно 1×103 БОЕ/доза. Фактическая доза HOV-33 составила 8,6×102. Фактическая доза HOV-33-SE/hNIS составила 6,3×102. Фактическая доза HOV-33-H5Fluc составила 1×104. Фактическая доза HOV-33-SE/hNIS-E9L-miR100t составила 1,0×103. Чистое процентное изменение массы и процентное изменение инъецированной и неинъецированных опухолей регистрировали два раза в неделю в течение 43 дней (Фиг. 15A-15C). Всех мышей умерщвляли через 45 дней. Значительные различия в проценте изменения объема инъецированных опухолей были отмечены при сравнении контроля PBS во всехгруппах (Фиг. 15B; p=0,0001). Значительные различия были отмечены только в группах неинъецированных опухолей между контролем PBS и #33, #33-(H5)Fluc2 и #33-(SE)hNIS-E9LmiR100t (Фиг. 15C; p=0,003, p=0,008, p=0,002, соответственно).

[0378] Два раза в неделю одной контрольной PBS-мыши и 3 инъецированным #33-(H5)Fluc2 мышам интраперитонеально инъецировали 4,28 мг люциферина в 150 мкл PBS. Через 7 минут люциферазную визуализацию получали при стандартной выдержке. Относительную единицу регистрировали в каждый момент времени и анализировали относительно контрольных мышей PBS в качестве исходного уровня (Фиг. 16).

Пример 8. Таргетинг рак толстой кишки терапией онколитическими вирусами

[0379] Анализ цитотоксичности

[0380] Анализ цитотоксичности проводили на клеточных линиях рака HT-29 (Фиг. 17A-17B) и HCT-116 (Фиг. 17C-17D) посредством культивирования клеток при 3×103 на лунку в 100 мкл среды МакКоя 5А, 5% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов. Затем добавляли 20 мкл вируса, либо #33, OncoVEXGFP, GLV-1h68, либо #189, при множественности заражения (MOI) 1, 0,1 и 0,01. Ежедневный анализ жизнеспособности клеток проводили, добавляя 20 мкл CellTiter 96 Aqueous One Solution Cell Proliferation Assay во все лунки и считывая колориметрические показатели после 1 часа инкубации. Результаты эксперимента стандартизировали только для среды и контроля с MOI 0. Этот эксперимент повторяли в трех повторах. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени.

[0381] Анализ цитотоксичности проводили на клеточных линиях рака SW620 (Фиг. 18A-18B), SW480 (Фиг. 18C-18D) и COLO 320DM (Фиг. 18E-F) посредством культивирования клеток при 3×103 на лунку в 100 мкл RPMI, 5% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов. Затем добавляли 20 мкл вируса, либо #33, OncoVEXGFP, GLV-1h68, либо #189, при множественности заражения (MOI) 1, 0,1 и 0,01. Ежедневный анализ жизнеспособности клеток проводили, добавляя 20 мкл CellTiter 96 Aqueous One Solution Cell Proliferation Assay во все лунки и считывая колориметрические показатели после 1 часа инкубации. Результаты эксперимента стандартизировали только для среды и контроля с MOI 0. Этот эксперимент повторяли в трех повторах. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени.

[0382] Анализ цитотоксичности проводили на клеточной линии рака LoVo (Фиг. 19A-19B) посредством культивирования клеток при 3×103 на лунку в 100 мкл среды F-12K, 5% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов. Затем добавляли 20 мкл вируса, либо #33, OncoVEXGFP, GLV-1h68, либо #189, при множественности заражения (MOI) 1, 0,1 и 0,01. Ежедневный анализ жизнеспособности клеток проводили, добавляя 20 мкл CellTiter 96 Aqueous One Solution Cell Proliferation Assay во все лунки и считывая колориметрические показатели после 1 часа инкубации. Результаты эксперимента стандартизировали только для среды и контроля с MOI 0. Этот эксперимент повторяли в трех повторах. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени.

[0383] Кривая роста вирусов

[0384] Кривую репликации вируса строили на клеточных линиях рака HT-29 (Фиг. 20A-20B) и HCT-116 (Фиг. 20C-20D) посредством культивирования клеток при 5×105 клеток на лунку в 2 мл среды МакКоя 5А 10% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов в трех повторах. Затем среды аспирировали и #33, #33-(SE)hNIS, #33-(H5)Emerald, OncoVEXGFP, GLV-1h68 или #189 добавляли при множественности заражения (MOI) 0,01 в 500 мкл среды МакКоя 5А 2,5% FBS, 1% раствора антибиотика-антимикотика в течение 1 часа, встряхивая каждые 20 минут. Через один час среды аспирировали, и добавляли 1,5 мл среды МакКоя 5А 2,5% FBS, 1% раствора антибиотика-антимикотика. Через 24, 48 и 72 часа собирали клетки и супернатант и после трех циклов заморозки и оттаивания, выполняли серийные разведения в двух повторах. Этот эксперимент повторяли в двух повторах. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени.

[0385] Кривую репликации вируса строили на SW620 (Фиг. 21A-21B) и SW480 (Фиг. 21C-21D) клеточных линиях рака посредством культивирования клеток при 5×105 клеток на лунку в 2 мл RPMI 10% FBS, 1% раствора антибиотика-антимикотика в течение 24 часов в трех повторах. Затем среды аспирировали, и добавляли #33, #33-(SE)hNIS, #33-(H5)Emerald, OncoVEXGFP, GLV-1h68, или #189 при множественности заражения (MOI) 0,01 в 500 мкл RPMI 2,5% FBS, 1% раствора антибиотика-антимикотика в течение 1 часа, встряхивая каждые 20 минут. Через один час среды аспирировали добавляли и 1,5 мл RPMI 2,5% FBS, 1% раствора антибиотика-антимикотика. Через 24, 48 и 72 часа собирали клетки и супернатант, и после трех циклов заморозки и оттаивания выполняли серийные разведения в двух повторах. Этот эксперимент повторяли в двух повторах. Статистический анализ проводили, сравнивая #33 с другими экспериментальными группами, используя однофакторный дисперсионный анализ в каждый момент времени.

[0386] Иммуногистохимия HCT-116 #33-(SE)hNIS

[0387] Визуализацию in vitro #33-(SE)hNIS проводили в HCT-116 через 24, 48 и 72 часов при MOI 1, 0,1 и 0,01. В каждую лунку 8-луночного предметного стекла добавляли 2×105 клеток HCT 116 в 500 мкл 10% FBS среды МакКоя 5А. Среды аспирировали после инкубации в течение 24 часов, и в каждую лунку добавляли соответствующую MOI #33-(SE)hNIS в 200 мкл 2,5% FBS среды МакКоя 5А. Через 1 час среды аспирировали и клетки дважды промывали PBS. Среды заменяли на 1 мл 10% FBS среды МакКоя 5А. Через 24, 48 или 72 часа среды аспирировали. Фиксацию проводили 4% параформальдегидом в течение 15 минут при комнатной температуре. Затем дважды промывали PBS. Пермеабилизацию проводили 0,1% Triton X-100 в PBS в течение 5 минут на льду. Клетки вновь промывали PBS. Затем предметные стекла инкубировали в блокирующем буфере TNB в течение 30 минут при 37°C (Блокирующий буфер TNB: 0,1M Tris-HCl, рН 7,5, 0,15 NaCl и 0,5% Блокирующего реагента-Perkin Elmer, cat FP1020). В разведении 1:50 добавляли мышиные антитела против человеческого натрий-йодидного транспортера (hNIS) в блокирующем буфере TNB и инкубировали в течение ночи при 4°С (ab 17795). Затем предметные стекла дважды промывали PBS, а затем в разведении 1:100 добавляли козий антимышиный IgG H&L (Alexa Fluor 488) (ab150113) в блокирующем буфере TNB и инкубировали при комнатной температуре в течение 1 часа. Затем клетки дважды промывали PBS. В разведении 1:200 добавляли кроличьи антитела против вируса осповакцины (ab35219) в TNB и инкубировали в течение ночи при 4°C. Затем клетки дважды промывали PBS. Блокирование посредством TNB происходило за 30 минут. Затем в разведении 1:100 добавляли козьи антикроличьи вторичные антитела и помещали в комнатную температуру в течение 1 часа. После двух промываний PBS добавляли DAPI в разведении 1:1000 при комнатной температуре в течение 5 минут. Вновь проводили промывание PBS. Изображения получали, используя EVOS auto cell imaging system (Фиг. 22).

[0388] Иммуногистохимия HT-29 #33-(SE)hNIS

[0389] Визуализацию in vitro #33-(SE)hNIS проводили в HT-29 через 24, 48 и 72 часов при MOI 1, 0,1 и 0,01. В каждую лунку 8-луночного предметного стекла добавляли 2×105 клеток HCT 116 в 500 мкл 10% FBS среды МакКоя 5А. Среды аспирировали после инкубации в течение 24 часов, и в каждую лунку добавляли соответствующую MOI #33-(SE)hNIS в 200 мкл 2,5% FBS среды МакКоя 5А. Через 1 час среды аспирировали и клетки дважды промывали PBS. Среды заменяли на 1 мл 10% FBS среды МакКоя 5А. Через 24, 48 или 72 часа среды аспирировали. Фиксацию проводили 4% параформальдегидом в течение 15 минут при комнатной температуре. Затем дважды промывали PBS. Пермеабилизацию проводили 0,1% Triton X-100 в PBS в течение 5 минут на льду. Клетки вновь промывали PBS. Затем предметные стекла инкубировали в блокирующем буфере TNB в течение 30 минут при 37°C (Блокирующий буфер TNB: 0,1M Tris-HCl, рН 7,5, 0,15 NaCl и 0,5% Блокирующего реагента-Perkin Elmer, cat FP1020). В разведении 1:50 добавляли мышиные антитела против человеческого натрий-йодидного транспортера (hNIS) в блокирующем буфере TNB и инкубировали в течение ночи при 4°С (ab 17795). Затем предметные стекла дважды промывали PBS, а затем в разведении 1:100 добавляли козий антимышиный IgG H&L (Alexa Fluor 488) (ab150113) в блокирующем буфере TNB и инкубировали при комнатной температуре в течение 1 часа. Затем клетки дважды промывали PBS. В разведении 1:200 добавляли кроличьи антитела против вируса осповакцины (ab35219) в TNB и инкубировали в течение ночи при 4°C. Затем клетки дважды промывали PBS. Блокирование посредством TNB происходило за 30 минут. Затем в разведении 1:100 добавляли козьи антикроличьи вторичные антитела и помещали в комнатную температуру в течение 1 часа. После двух промываний PBS добавляли DAPI в разведении 1:1000 при комнатной температуре в течение 5 минут. Вновь проводили промывание PBS. Изображения получали, используя EVOS auto cell imaging system (Фиг. 23).

[0390] Обработка опухолей при раке толстой кишки in vivo

[0391] Четырнадцати самкам бестимусных голых мышей Nude-Foxn1nu (Envigo, Indianapolis, IN) имплантировали 5×106 клеток на двусторонние боковые опухоли HT-29. Как только размеры опухоли достигали приблизительно 200 мм3, в обе опухоли инъецировали 50 мкл PBS (4 мыши), #33 (5 мышей), или #33-(H5)Fluc2 (5 мышей) при приблизительно 1×105 БОЕ/доза. Чистое процентное изменение массы и процентное изменение опухолей регистрировали два раза в неделю в течение 42 дней. По две мыши из каждой группы умерщвляли через 10 дней и проводили титрование вируса и IHC органов. Всех оставшихся мышей умерщвляли через 42 дня, и на органах мышей проводили титрование вируса. Значительное различие в процентном изменении объема опухоли (фиг. 24) было отмечено при сравнении контроля PBS как с #33 (3 мыши), так и с #33-(H5)Fluc2 (p=0,02 и p=0,03, соответственно).

[0392] Два раза в неделю одной контрольной PBS-мыши и 3 инъецированным #33-(H5)Fluc2 мышам интраперитонеально инъецировали 4,28 мг люциферина в 150 мкл PBS. Через 7 минут получали люциферазную визуализацию при стандартной выдержке. Относительную единицу регистрировали в каждый момент времени и анализировали относительно контрольных мышей PBS в качестве исходного уровня (Фиг. 25).

[0393] Девятнадцати самкам бестимусных голых мышей Nude-Foxn1nu (Envigo, Indianapolis, IN) имплантировали 5×106 двусторонних боковых опухолей HCT-116. Как только размеры опухоли достигали приблизительно 200 мм3, в обе опухоли инъецировали 50 мкл PBS (2 мыши), #33 (3 мыши), #33-(SE)hNIS или #33-(H5)Fluc2 при приблизительно 1×105 БОЕ/доза. Чистое процентное изменение массы и процентное изменение опухолей регистрировали два раза в неделю в течение 42 дней. По 2 мыши на группу умерщвляли через 10 дней и проводили титрование вируса и IHC органов. Всех оставшихся мышей умерщвляли через 42 дня, и на органах мышей проводили титрование вируса. Значимое различие в ении контроля PBS с #33 (3 мыши), #33-(SE)hNIS и #33-(H5)Fluc2 (Фиг. 26; p=0,0002, p=0,0001 и p=0,0002, соответственно).

[0394] Два раза в неделю одной контрольной PBS-мыши и 3 инъецированным #33-(H5)Fluc2 мышам интраперитонеально инъецировали 4,28 мг люциферина в 150 мкл PBS. Через 7 минут люциферазную визуализацию получали при стандартной выдержке. Относительную единицу регистрировали в каждый момент времени и анализировали относительно контрольных мышей PBS в качестве исходного уровня (Фиг. 27).

Пример 9. Таргетинг рака легкого терапией онколитическими вирусами

[0395] Цитотоксический анализ

[0396] Цитотоксичность, опосредованная онколитичесим вирусом, при раке легкого и легочных клетках-фибробластах через 72 ч после инъекции. 5000 клеток A549, H2199 или фибробластов HF1 культивировали в каждой лунке 96-луночного планшета. На следующий день клетки инфицировали различными вирусами с указанной множественностью заражения (MOI; 0, 0,001, 0,01, 0,1, 1 MOI) или псевдоинфицировали. Применяли вирусы #33, #33-(H5)Emerald, #189, GLV-1h68 и OncoVEXGFP. Жизнеспособность клеток определяли, используя CellTiter96AQueous One Solution (Promega; Cat#G3581), через 72 часа после инъекции. Выживаемость инфицированных клеток A549 (Фиг. 28A), H2199 (Фиг. 28B) и фибробластов HF1 (Фиг. 28C) вычисляли по отношению к псевдоинфицированным клеткам.

[0397] Обработка опухолей при раке легкого in vivo

[0398] A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в 1:1 PBS и матригеле для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки 103 бляшкообразующих единиц (БОЕ) #33-(H5)Emerald, GLV1h68 или OncoVEXGFP интратуморально инъецировали только в правостороннюю опухоль каждой мыши. Все 3 вируса кодируют ген зеленого флуоресцентного белка (GFP). У мышей визуализировали зеленую флуоресценцию (возбуждение: 465 & эмиссия: 530 нм) два раза в неделю, используя оборудование для создания изображений у мелких животных (система визуализации LagoX) и изображения обрабатывали на программном обеспечении для обработки изображений AMIview (Фиг. 29).

[0399] Масса тела мышей. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в 1:1 PBS и матригеле для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки только в правостороннюю опухоль правой сторон у каждой мыши инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VECTM, #189, контроль PBS) интратуморально или #33-(H5)Emerald инъецировали интраперитонеально (i.p.). Мышей взвешивали два раза в неделю и определяли процентное изменение их массы (Фиг. 30). На фиг. 30 каждая линия представляет массу отдельной мыши.

[0400] Регрессия опухоли. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в 1:1 PBS и матригеле для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки только в правостороннюю опухоль правой сторон у каждой мыши инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VECTM, #189, контроль PBS) интратуморально или #33-(H5)Emerald инъецировали интраперитонеально (i.p.). Объем опухоли, как для инъецированных (Фиг. 31A), так и для неинъецированных опухолей (Фиг. 31B) измеряли два раза в неделю, используя цифровые штангенциркули (объем={(длина)2 × ширина/2}. На фиг. 31A и 31B каждая линия представляет объем опухоли для отдельных мышей.

[0401] Объем инфицированных вирусом опухолей в ксенотранстплантантной модели А549. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в 1:1 PBS и матригеле для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки только в правостороннюю опухоль правой сторон у каждой мыши инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VECTM, #189, контроль PBS) интратуморально, или #33-(H5)Emerald инъецировали интраперитонеально (i.p). Объем опухоли измеряли два раза в неделю, используя цифровые штангенциркули (объем={(длина)2 × ширина/2}. На фиг. 32 каждая линия представляет средний объем инъецированных опухолей с течением времени в отдельных группах обработки со стандартным отклонением. Статистический анализ: однофакторный дисперсионный анализ на 24 день (*=p<0,05).

[0402] Объем неинъецированных опухолей в ксенотранстплантантной модели А549. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в 1:1 PBS и матригеле для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки только в правостороннюю опухоль правой сторон у каждой мыши инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VEC™, #189, контроль PBS) интратуморально, или #33-(H5)Emerald инъецировали интраперитонеально (i.p.). Объем опухолей измеряли два раза в неделю, используя цифровые штангенциркули (объем={(длина)2 × ширина/2}. На фиг. 33 каждая линия представляет средний объем неинъецированных опухолей с течением времени в отдельных группах обработки со стандартным отклонением. Статистический анализ: однофакторный дисперсионный анализ на 24 день (*=p<0,05).

[0403] Кратность изменения объема опухоли инъецированных и неинъецированных опухолей. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в 1:1 PBS и матригеле для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=4 или 5), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки только в правостороннюю опухоль правой сторон у каждой мыши инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VEC™, #189, контроль PBS) интратуморально, или #33-(H5)Emerald инъецировали интраперитонеально (i.p.). Объем опухолей измеряли два раза в неделю, используя цифровые штангенциркули (объем={(длина)2 × ширина/2}. Кратность изменения объема опухоли рассчитывали путем нормализации объемов опухоли в разные моменты времени с объемами опухоли во время инъекции вируса (т.е. 0 день). Каждая линия представляет среднюю кратность изменения объема опухоли инъецированных (Фиг. 34A) и неинъецированных (Фиг. 34B) опухолей для отдельных групп обработки со стандартным отклонением. Статистический анализ: однофакторный дисперсионный анализ на 24 день (*=p<0,05).

[0404] Биораспределение вирусов в инъецированных и неинъецированных опухолях (модель А549). A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в 1:1 PBS и матригеле для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки только в правостороннюю опухоль правой сторон у каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VEC™). Через шесть дней после инъекции вируса производили сбор опухолей и нормальных органов. Собранные ткани взвешивали, измельчали на мелкие кусочки и гомогенизировали в 1 мл PBS, используя гомогенизатор Bullet Blender Gold. Гомогенаты подвергали 3 циклам замораживания-оттаивания с последующей обработкой ультразвуком в течение 1 минуты. Гомогенаты центрифугировали при 1000 об/мин в течение 3 минут, а супернатанты собирали. Супернатанты серийно разводили и титр вирусов определяли, используя стандартный анализ бляшкообразования. На фиг. 35A показан титр вирусов в БОЕ/г опухоли для инъецированных опухолей для каждого вируса, а на фиг. 35B показан титр вирусов в БОЕ/г опухоли для неинъецированных опухолей для каждого вируса.

[0405] Титр вирусов в яичниках мышей (модель А549). A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в 1:1 PBS и матригеле для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки только в правостороннюю опухоль правой сторон у каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VEC™). Через шесть дней после инъекции вируса производили сбор опухолей и нормальных органов. Собранные ткани взвешивали, измельчали на мелкие кусочки и гомогенизировали в 1 мл PBS, используя гомогенизатор Bullet Blender Gold. Гомогенаты подвергали 3 циклам замораживания-оттаивания с последующей обработкой ультразвуком в течение 1 минуты. Гомогенаты центрифугировали при 1000 об/мин в течение 3 минут, а супернатанты собирали. Супернатанты серийно разводили и определяли титр вируса, используя стандартный анализ бляшкообразования. На фиг. 36 показан титр вируса в БОЕ/г ткани (яичников) для каждого вируса. **ND означает, что вирус не был обнаружен.

[0406] Титр вирусов в крови через 20 дней после инъекции вируса. A549, клетки рака легких человека, культивировали, трипсинизировали, промывали PBS и ресуспендировали в 1:1 PBS и матригеле для получения 5×106 клеток на 100 мкл. 100 мкл суспензии клеток подкожно инъецировали с каждой стороны верхнего бока бестимусной голой мыши для получения 2 опухолей на мышь. Через 3 недели после инъекции опухолевых клеток мышей рассортировали по различным группам обработки (n=3), чтобы получить одинаковый средний объем опухоли в каждой группе (~200 мм3). После сортировки только в правостороннюю опухоль правой сторон у каждой мыши интратуморально инъецировали 103 БОЕ указанных вирусов (#33, #33-(H5)Emerald, GLV-1h68, OncoVEXGFP, T-VEC™). Кровь брали у мышей (n=3) путем пункции лицевой вены. После 3 циклов замораживания и оттаивания кровь серийно разводили и определяли титр вирусов, используя стандартный анализ бляшкообразования (Фиг. 37). **ND означает, что вирус не был обнаружен.

ССЫЛКИ

[0407] 1. Chen NG & Szalay AA (2011) Oncolytic virotherapy of cancer. Cancer Managment in Man: Chemotherapy, Biological Therapy, Hyperthermia and Supporting Measures, Cancer Growth and Progression, ed Minev BR (Springer, New York), Vol 13, pp 295-316.

[0408] 2. Chen NG & Szalay AA (2010) Oncolytic vaccinia virus: a theranostic agent for cancer. Future Virol. 5(6):763-784.

[0409] 3. Andtbacka RH, et al. (2015) Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. J Clin Oncol 33(25):2780-2788.

[0410] 4. Anonymous (2015) First Oncolytic Viral Therapy for Melanoma. Cancer discovery.

[0411] 5. Russell SJ, Peng KW, & Bell JC (2012) Oncolytic virotherapy. Nat Biotechnol 30(7):658-670.

[0412] 6. Thorne SH, et al. (2007) Rational strain selection and engineering creates a broad-spectrum, systemically effective oncolytic poxvirus, JX-963. J Clin Invest 117(11):3350-3358.

[0413] 7. Yu W & Fang H (2007) Clinical trials with oncolytic adenovirus in China. Curr Cancer Drug Targets 7(2):141-148.

[0414] 8. Evgin L, et al. (2010) Potent Oncolytic Activity of Raccoonpox Virus in the Absence of Natural Pathogenicity. Mol Ther.

[0415] 9. Rintoul JL, et al. (2012) ORFV: a novel oncolytic and immune stimulating parapoxvirus therapeutic. Mol Ther 20(6):1148-1157.

[0416] 10. Chan WM & McFadden G (2014) Oncolytic Poxviruses. Annu Rev Virol 1(1):119-141.

[0417] 11. Wahba, H.A. and H.A. El-Hadaad, Current approaches in treatment of triple-negative breast cancer. Cancer Biol Med, 2015. 12(2): p. 106-16.

[0418] 12. Curigliano, G. and A. Goldhirsch, The triple-negative subtype: new ideas for the poorest prognosis breast cancer. J Natl Cancer Inst Monogr, 2011. 2011(43): p. 108-10.

[0419] 13. Bianchini, G., et al., Triple-negative breast cancer: challenges and opportunities of a heterogeneous disease. Nat Rev Clin Oncol, 2016. 13(11): p. 674-690.

[0420] 14. Migali, C., et al., Strategies to modulate the immune system in breast cancer: checkpoint inhibitors and beyond. Ther Adv Med Oncol, 2016. 8(5): p. 360-74.

[0421] 15. Gholami, S., et al., A novel vaccinia virus with dual oncolytic and anti-angiogenic therapeutic effects against triple-negative breast cancer. Breast Cancer Res Treat, 2014. 148(3): p. 489-99.

[0422] 16. Dent, R., et al., Pattern of metastatic spread in triple-negative breast cancer. Breast Cancer Res Treat, 2009. 115(2): p. 423-8.

[0423] 17. Liedtke, C., et al., Response to neoadjuvant therapy and long-term survival in patients with triple-negative breast cancer. J Clin Oncol, 2008. 26(8): p. 1275-81.

[0424] 18. Andtbacka, R.C., M; Li, A; Shilkrut, M; Ross, MI, Phase 2, multicenter, randomized, open-label trial assessing efficacy and safety of talimogene laherparepvec (T-VEC) neoadjuvant treatment plus surgery vs surgery for resectable stage IIIB/C and IVM1a melanoma. J Clin Oncol, 2015. 33: TPS9094.

[0425] 19. Anderson, B.D., et al., High CD46 receptor density determines preferential killing of tumor cells by oncolytic measles virus. Cancer Res, 2004. 64(14): p. 4919-26.

[0426] 20. Kaufman, H.L., F.J. Kohlhapp, and A. Zloza, Oncolytic viruses: a new class of immunotherapy drugs. Nat Rev Drug Discov, 2015. 14(9): p. 642-62.

[0427] 21. Wang, G., et al., Infection of human cancer cells with myxoma virus requires Akt activation via interaction with a viral ankyrin-repeat host range factor. Proc Natl Acad Sci U S A, 2006. 103(12): p. 4640-5.

[0428] 22. Benencia, F., et al., HSV oncolytic therapy upregulates interferon-inducible chemokines and recruits immune effector cells in ovarian cancer. Mol Ther, 2005. 12(5): p. 789-802.

[0429] 23. Gauvrit, A., et al., Measles virus induces oncolysis of mesothelioma cells and allows dendritic cells to cross-prime tumor-specific CD8 response. Cancer Res, 2008. 68(12): p. 4882-92.

[0430] 24. Guillerme, J.B., et al., Measles virus vaccine-infected tumor cells induce tumor antigen cross-presentation by human plasmacytoid dendritic cells. Clin Cancer Res, 2013. 19(5): p. 1147-58.

[0431] 25. Haen, S.P. and H.G. Rammensee, The repertoire of human tumor-associated epitopes--identification and selection of antigens and their application in clinical trials. Curr Opin Immunol, 2013. 25(2): p. 277-83.

[0432] 26. Tang, D., et al., PAMPs and DAMPs: signal 0s that spur autophagy and immunity. Immunol Rev, 2012. 249(1): p. 158-75.

[0433] 27. Fiebig, H.H., et al., Inactivated orf virus (Parapoxvirus ovis) induces antitumoral activity in transplantable tumor models. Anticancer Res, 2011. 31(12): p. 4185-90.

[0434] 28. Rintoul, J.L., et al., ORFV: a novel oncolytic and immune stimulating parapoxvirus therapeutic. Mol Ther, 2012. 20(6): p. 1148-57.

[0435] 29. Robinson, A.J. and G.V. Petersen, Orf virus infection of workers in the meat industry. N Z Med J, 1983. 96(725): p. 81-5.

[0436] 30. Fachinger, V., et al., Poxvirus-induced immunostimulating effects on porcine leukocytes. J Virol, 2000. 74(17): p. 7943-51.

[0437] 31. Friebe, A., et al., Characterization of immunostimulatory components of orf virus (parapoxvirus ovis). J Gen Virol, 2011. 92(Pt 7): p. 1571-84.

[0438] 32. Horton RM, Ho SN, Pullen JK, Hunt HD, Cai Z, Pease LR. Gene splicing by overlap extension. Methods in enzymology. 1993;217:270-9. Epub 1993/01/01. PubMed PMID: 8474334.

[0439] 33. Falkner FG, Moss B. Transient dominant selection of recombinant vaccinia viruses. J Virol. 1990;64(6):3108-11. Epub 1990/06/01. PubMed PMID: 2159565.

Варианты осуществления P

[0440] Вариант осуществления P1. Химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1 или SEQ ID NO: 2, при этом указанная последовательность нуклеиновой кислоты включает фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0441] Вариант осуществления P2. Химерный поксвирус по варианту осуществления P1, при этом указанная последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 80%.

[0442] Вариант осуществления P3. Химерный поксвирус по варианту осуществления P1 или P2, при этом указанная последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 85%.

[0443] Вариант осуществления P4. Химерный поксвирус по одному из вариантов осуществления P1-P3, при этом указанная последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 90%.

[0444] Вариант осуществления P5. Химерный поксвирус по одному из вариантов осуществления P1-P4, при этом указанная последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 95%.

[0445] Вариант осуществления P6. Химерный поксвирус по одному из вариантов осуществления P1-P5, при этом указанная последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 98%.

[0446] Вариант осуществления P7. Химерный поксвирус по одному из вариантов осуществления P1-P6, при этом указанные фрагменты нуклеиновой кислоты происходят из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0447] Вариант осуществления P8. Химерный поксвирус по одному из вариантов осуществления P1-P6, при этом указанные фрагменты нуклеиновой кислоты происходят из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0448] Вариант осуществления P9. Химерный поксвирус по варианту осуществления P1, при этом указанный химерный поксвирус получают согласно способу, включающему: (i) инфицирование клетки по меньшей мере двумя штаммами поксвируса, выбранными из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; и (ii) обеспечение возможности репликации указанных по меньшей мере двух штаммов поксвируса, получая таким образом химерный поксвирус.

[0449] Вариант осуществления P10. Химерный поксвирус по варианту осуществления P9, при этом указанную клетку инфицируют штаммом Brighton вируса коровьей оспы, штаммом Herman поксвируса енотов, штаммом Utrecht поксвируса кроликов, штаммом WR вируса осповакцины, штаммом IHD вируса осповакцины, штаммом Elstree вируса осповакцины, штаммом CL вируса осповакцины, штаммом Lederle-Chorioallantoic вируса осповакцины и штаммом AS вируса осповакцины.

[0450] Вариант осуществления P11. Химерный поксвирус по варианту осуществления P9, при этом указанную клетку инфицируют штаммом NZ2 орф-вируса и штаммом TJS псевдопоксвируса коров.

[0451] Вариант осуществления P12. Химерный поксвирус по одному из вариантов осуществления P1-P11, при этом указанный химерный поксвирус представляет собой онколитический вирус.

[0452] Вариант осуществления P13. Химерный поксвирус по одному из вариантов осуществления P1-P12, при этом указанный поксвирус включает миРНК-связывающую последовательность.

[0453] Вариант осуществления P14. Химерный поксвирус по варианту осуществления P13, при этом указанная миРНК-связывающая последовательность образует часть гена ДНК-полимеразы указанного химерного поксвируса.

[0454] Вариант осуществления P15. Выделенная нуклеиновая кислота, кодирующая химерный поксвирус по одному из вариантов осуществления P1-P14.

[0455] Вариант осуществления P16. Фармацевтическая композиция, содержащая терапевтически эффективное количество химерного поксвируса по одному из вариантов осуществления P1-P14.

[0456] Вариант осуществления P17. Способ лечения рака у пациента, при этом указанный способ включает введение указанному пациенту терапевтически эффективного количества химерного поксвируса по одному из вариантов осуществления P1-P14, таким образом выполняя лечение рака у указанного пациента.

[0457] Вариант осуществления P18. Способ по варианту осуществления P17, при этом указанный рак представляет собой рак молочной железы, рак толстой кишки, рак почки, лейкоз, рак легкого, меланому, рак яичников, рак предстательной железы, рак поджелудочной железы, рак головного мозга, рак печени, рак желудка или саркому.

[0458] Вариант осуществления P19. Способ по варианту осуществления P17 или P18, при этом указанное введение включает введение первого химерного поксвируса и второго химерного поксвируса.

[0459] Вариант осуществления P20. Способ по варианту осуществления P19, при этом указанный первый химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом указанная последовательность нуклеиновой кислоты включает фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0460] Вариант осуществления P21. Способ по варианту осуществления P19 или P20, при этом указанный второй химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 2, и при этом указанная последовательность нуклеиновой кислоты включает фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0461] Вариант осуществления P22. Способ по одному из вариантов осуществления P19-P21, при этом указанный первый химерный поксвирус и указанный второй химерный поксвирус вводят в комбинированном синергическом количестве.

[0462] Вариант осуществления P23. Способ по одному из вариантов осуществления P19-P22, при этом указанный первый химерный поксвирус и указанный второй химерный поксвирус вводят одновременно.

[0463] Вариант осуществления P24. Способ по одному из вариантов осуществления P19-P22, при этом указанный первый химерный поксвирус и указанный второй химерный поксвирус вводят последовательно.

[0464] Вариант осуществления P25. Способ под одному из вариантов осуществления P19-P24, при этом указанный поксвирус вводят в количестве по меньшей мере 104 бляшкообразующих единиц (БОЕ)/кг.

[0465] Вариант осуществления P26. Способ по одному из вариантов осуществления P19-P25, при этом указанный поксвирус вводят в количестве по меньшей мере 106 бляшкообразующих единиц (БОЕ)/кг.

[0466] Вариант осуществления P27. Способ по одному из вариантов осуществления P19-P26, при этом указанный поксвирус вводят в количестве приблизительно 108 бляшкообразующих единиц (БОЕ)/кг.

[0467] Вариант осуществления P28. Способ получения химерного поксвируса, при этом указанный способ включает: (i) инфицирование клетки по меньшей мере двумя штаммами поксвируса, выбранными из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; и (ii) обеспечение возможности указанным по меньшей мере двух штаммам поксвируса реплицироваться, тем самым получая указанный химерный поксвирус.

[0468] Вариант осуществления P29. Способ по варианту осуществления P28, при этом каждый из указанных по меньшей мере двух вирусных штаммов поксвируса присутствует при множественности заражения, составляющей менее чем приблизительно 1.

[0469] Вариант осуществления P30. Способ по варианту осуществления P28 или P29, при этом каждый из указанных по меньшей мере двух вирусных штаммов поксвируса присутствует при множественности заражения, составляющей менее чем приблизительно 0,1.

[0470] Вариант осуществления P31. Способ по одному из вариантов осуществления P28-P30, при этом при этом каждый из указанных по меньшей мере двух штаммов поксвируса присутствует при множественности заражения, составляющей приблизительно 0,01.

[0471] Вариант осуществления P32. Способ по варианту осуществления P28, при этом указанную клетку инфицируют штаммом Brighton вируса коровьей оспы, штаммом Herman поксвируса енотов, штаммом Utrecht поксвируса кроликов, штаммом WR вируса осповакцины, штаммом IHD вируса осповакцины, штаммом Elstree вируса осповакцины, штаммом CL вируса осповакцины, штаммом Lederle-Chorioallantoic вируса осповакцины и штаммом AS вируса осповакцины.

[0472] Вариант осуществления P33. Способ по варианту осуществления P28, при этом указанную клетку инфицируют штаммом NZ2 орф-вируса и штаммом TJS псевдопоксвируса коров.

[0473] Вариант осуществления P34. Способ по одному из вариантов осуществления P28-P33, при этом указанный химерный поксвирус представляет собой онколитический вирус.

[0474] Вариант осуществления P35. Способ по одному из вариантов осуществления P28-P34, при этом указанный поксвирус включает миРНК-связывающую последовательность.

[0475] Вариант осуществления P36. Способ ингибирования клеточной пролиферации клетки, при этом указанный способ включает приведение в контакт клетки с химерным поксвирусом по одному из вариантов осуществления P1-P14.

[0476] Вариант осуществления P37. Способ по варианту осуществления P36, при этом указанная клетка представляет собой раковую клетку.

[0477] Вариант осуществления P38. Способ по варианту осуществления P37, при этом указанная раковая клетка представляет собой клетку рака молочной железы, клетку рака толстой кишки, клетку рака почки, лейкозную клетку, клетку рака легкого, клетку меланомы, клетку рака яичников, клетку рака предстательной железы, клетку рака поджелудочной железы, клетку рака головного мозга, клетку рака печени, клетку рака желудка или клетку саркомы.

Варианты осуществления

[0478] Вариант осуществления 1. Химерный поксвирус, содержащий последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1 или SEQ ID NO: 2, при этом указанная последовательность нуклеиновой кислоты включает: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; (ii) одну или более противораковых последовательностей нуклеиновой кислоты; или (iii) последовательность нуклеиновой кислоты, кодирующую определяемый фрагмент.

[0479] Вариант осуществления 2. Химерный поксвирус по варианту осуществления 1, при этом указанная последовательность нуклеиновой кислоты включает: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; и (ii) одну или более противораковых последовательностей нуклеиновой кислоты.

[0480] Вариант осуществления 3. Химерный поксвирус по варианту осуществления 1 или 2, при этом указанная одна или более противораковых последовательностей нуклеиновой кислоты образуют часть второстепенного гена указанного химерного поксвируса.

[0481] Вариант осуществления 4. Химерный поксвирус по варианту осуществления 3, при этом указанный второстепенный ген представляет собой ген тимидинкиназы.

[0482] Вариант осуществления 5. Химерный поксвирус по варианту осуществления 3, при этом указанный второстепенный ген представляет собой ген F14.5L.

[0483] Вариант осуществления 6. Химерный поксвирус по одному из вариантов осуществления 1-5, при этом указанная одна или более противораковых последовательностей нуклеиновой кислоты независимо кодируют ингибитор PD-L1 или натрий-йодидный симпортер.

[0484] Вариант осуществления 7. Химерный поксвирус по варианту осуществления 6, при этом указанный ингибитор PD-L1 представляет собой анти-PD-L1 scFv.

[0485] Вариант осуществления 8. Химерный поксвирус по одному из вариантов осуществления 1-7, при этом части указанного второстепенного гена удалены.

[0486] Вариант осуществления 9. Химерный поксвирус по одному из вариантов осуществления 1-8, при этом каждая из указанных одной или более противораковых последовательностей нуклеиновой кислоты функционально связана с промотором.

[0487] Вариант осуществления 10. Химерный поксвирус по варианту осуществления 9, при этом указанный промотор представляет собой ранний промотор вируса осповакцины.

[0488] Вариант осуществления 11. Химерный поксвирус по варианту осуществления 9 или 10, при этом указанный промотор представляет собой синтетический ранний промотор.

[0489] Вариант осуществления 12. Химерный поксвирус по варианту осуществления 9, при этом указанный промотор представляет собой поздний промотор вируса осповакцины.

[0490] Вариант осуществления 13. Химерный поксвирус по варианту осуществления 9 или 12, при этом указанный промотор представляет собой промотор Н5 или промотор 11К.

[0491] Вариант осуществления 14. Химерный поксвирус по одному из вариантов осуществления 1-8, при этом указанная одна или более противораковых последовательностей нуклеиновой кислоты функционально связаны с основным геном указанного химерного поксвируса.

[0492] Вариант осуществления 15. Химерный поксвирус по одному из вариантов осуществления 1-14, при этом указанная одна или более противораковых последовательностей нуклеиновой кислоты функционально связаны с геном ДНК-полимеразы указанного химерного поксвируса.

[0493] Вариант осуществления 16. Химерный поксвирус по одному из вариантов осуществления 1-15, при этом указанная одна или более противораковых последовательностей нуклеиновой кислоты функционально связаны с 3'-концом гена ДНК-полимеразы указанного химерного поксвируса.

[0494] Вариант осуществления 17. Химерный поксвирус по одному из вариантов осуществления 1-16, при этом указанная одна или более противораковых последовательностей нуклеиновой кислоты функционально связаны с геном урацил-ДНК-гликозилазы.

[0495] Вариант осуществления 18. Химерный поксвирус по одному из вариантов осуществления 1-17, при этом указанная одна или более противораковых последовательностей нуклеиновой кислоты функционально связаны с 3'-концом гена урацил-ДНК-гликозилазы.

[0496] Вариант осуществления 19. Химерный поксвирус по одному из вариантов осуществления 1-18, при этом указанная одна или более противораковых последовательностей нуклеиновой кислоты независимо кодируют миРНК-связывающую последовательность.

[0497] Вариант осуществления 20. Химерный поксвирус по варианту осуществления 19, при этом указанная миРНК-связывающая последовательность представляет собой miR100-связывающую последовательность или let7c-связывающую последовательность.

[0498] Вариант осуществления 21. Химерный поксвирус по одному из вариантов осуществления 1-20, при этом указанная одну или более противораковых последовательностей нуклеиновой кислоты представляют собой первую противораковую последовательность нуклеиновой кислоты и вторую противораковую последовательность нуклеиновой кислоты.

[0499] Вариант осуществления 22. Химерный поксвирус по варианту осуществления 21, при этом указанная первая противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, а указанная вторая противораковая последовательность нуклеиновой кислоты кодирует миРНК-связывающая последовательность.

[0500] Вариант осуществления 23. Химерный поксвирус по варианту осуществления 22, при этом указанная первая противораковую последовательность нуклеиновой кислоты образует часть гена тимидинкиназы и указанная вторая противораковую последовательность нуклеиновой кислоты функционально связана с геном урацил-ДНК-гликозилазы.

[0501] Вариант осуществления 24. Химерный поксвирус по варианту осуществления 22, при этом указанная первая противораковая последовательность нуклеиновой кислоты образует часть гена тимидинкиназы, а указанная вторая противораковая последовательность нуклеиновой кислоты функционально связана с геном ДНК-полимеразы.

[0502] Вариант осуществления 25. Химерный поксвирус по варианту осуществления 21, при этом указанная первая противораковая последовательность нуклеиновой кислоты кодирует натрий-йодидный симпортер, а указанная вторая противораковая последовательность нуклеиновой кислоты кодирует ингибитор PD-L1.

[0503] Вариант осуществления 26. Химерный поксвирус по варианту осуществления 25, при этом указанная первая противораковая последовательность нуклеиновой кислоты образует часть гена тимидинкиназы, а указанная вторая противораковая последовательность нуклеиновой кислоты образует часть гена F14.5L.

[0504] Вариант осуществления 27. Химерный поксвирус по варианту осуществления 1, при этом указанная последовательность нуклеиновой кислоты включает: (i) фрагменты нуклеиновой кислоты по меньшей мере из двух штаммов поксвируса, выбранных из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; и (ii) указанную последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент.

[0505] Вариант осуществления 28. Химерный поксвирус по варианту осуществления 27, при этом указанная последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, кодирует флуоресцентный фрагмент.

[0506] Вариант осуществления 29. Химерный поксвирус по варианту осуществления 27 или 28, при этом указанная последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, образует часть второстепенного гена указанного химерного поксвируса.

[0507] Вариант осуществления 30. Химерный поксвирус по варианту осуществления 29, при этом указанный второстепенный ген представляет собой ген тимидинкиназы.

[0508] Вариант осуществления 31. Химерный поксвирус по варианту осуществления 29 или 30, при этом части указанного второстепенного гена удалены.

[0509] Вариант осуществления 32. Химерный поксвирус по одному из вариантов осуществления 27-31, при этом указанная последовательность нуклеиновой кислоты, кодирующая определяемый фрагмент, функционально связана с промотором.

[0510] Вариант осуществления 33. Химерный поксвирус по варианту осуществления 32, при этом указанный промотор представляет собой ранний промотор вируса осповакцины.

[0511] Вариант осуществления 34. Химерный поксвирус по варианту осуществления 33, при этом указанный промотор представляет собой синтетический ранний промотор.

[0512] Вариант осуществления 35. Химерный поксвирус по варианту осуществления 32, при этом указанный промотор представляет собой поздний промотор вируса осповакцины.

[0513] Вариант осуществления 36. Химерный поксвирус по варианту осуществления 35, при этом указанный промотор представляет собой промотор Н5 или промотор 11К.

[0514] Вариант осуществления 37. Химерный поксвирус по одному из вариантов осуществления 1-36, при этом указанная последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 80%.

[0515] Вариант осуществления 38. Химерный поксвирус по одному из вариантов осуществления 1-37, при этом указанная последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 85%.

[0516] Вариант осуществления 39. Химерный поксвирус по одному из вариантов осуществления 1-38, при этом указанная последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 90%.

[0517] Вариант осуществления 40, Химерный поксвирус по одному из вариантов осуществления 1-39, при этом указанная последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 95%.

[0518] Вариант осуществления 41. Химерный поксвирус по одному из вариантов осуществления 1-40, при этом указанная последовательность нуклеиновой кислоты имеет идентичность последовательностей, составляющую по меньшей мере 98%.

[0519] Вариант осуществления 42. Химерный поксвирус по одному из вариантов осуществления 1-41, при этом указанные фрагменты нуклеиновой кислоты происходят из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0520] Вариант осуществления 43. Химерный поксвирус по одному из вариантов осуществления 1-41, при этом указанные фрагменты нуклеиновой кислоты происходят из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0521] Вариант осуществления 44. Химерный поксвирус по одному из вариантов осуществления 1-43, при этом указанный химерный поксвирус получают согласно способу, включающему: (i) инфицирование клетки по меньшей мере двумя штаммами поксвируса, выбранными из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; и (ii) обеспечение возможности указанным по меньшей мере двух штаммам поксвируса реплицироваться, тем самым получая указанный химерный поксвирус.

[0522] Вариант осуществления 45. Химерный поксвирус по варианту осуществления 44, при этом указанную клетку инфицируют штаммом Brighton вируса коровьей оспы, штаммом Herman поксвируса енотов, штаммом Utrecht поксвируса кроликов, штаммом WR вируса осповакцины, штаммом IHD вируса осповакцины, штаммом Elstree вируса осповакцины, штаммом CL вируса осповакцины, штаммом Lederle-Chorioallantoic вируса осповакцины и штаммом AS вируса осповакцины.

[0523] Вариант осуществления 46. Химерный поксвирус по варианту осуществления 44, при этом указанную клетку инфицируют штаммом NZ2 орф-вируса и штаммом TJS псевдопоксвируса коров.

[0524] Вариант осуществления 47. Химерный поксвирус по одному из вариантов осуществления 1-46, при этом указанный химерный поксвирус представляет собой онколитический вирус.

[0525] Вариант осуществления 48. Химерный поксвирус по одному из вариантов осуществления 1-47, при этом указанный поксвирус включает миРНК-связывающую последовательность.

[0526] Вариант осуществления 49. Химерный поксвирус по варианту осуществления 48, при этом указанная миРНК-связывающая последовательность образует часть гена ДНК-полимеразы указанного химерного поксвируса.

[0527] Вариант осуществления 50. Выделенная нуклеиновая кислота, кодирующая химерный поксвирус по одному из вариантов осуществления 1-49.

[0528] Вариант осуществления 51. Фармацевтическая композиция, содержащая терапевтически эффективное количество химерного поксвируса по одному из вариантов осуществления 1-49.

[0529] Вариант осуществления 52. Способ лечения рака у пациента, при этом указанный способ включает введение указанному пациенту терапевтически эффективного количества химерного поксвируса по одному из вариантов осуществления 1-49, таким образом выполняя лечение рака у указанного пациента.

[0530] Вариант осуществления 53. Способ по варианту осуществления 52, при этом указанный рак представляет собой рак молочной железы, рак толстой кишки, рак почки, лейкоз, рак легкого, меланому, рак яичников, рак предстательной железы, рак поджелудочной железы, рак головного мозга, рак печени, рак желудка или саркому.

[0531] Вариант осуществления 54. Способ по варианту осуществления 52 или 53, при этом указанный рак представляет собой трижды негативный рак молочной железы.

[0532] Вариант осуществления 55. Способ по одному из вариантов осуществления 52-54, при этом указанное введение включает введение первого химерного поксвируса и второго химерного поксвируса.

[0533] Вариант осуществления 56. Способ по варианту осуществления 55, при этом указанный первый химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 1, и при этом указанная последовательность нуклеиновой кислоты включает фрагменты нуклеиновой кислоты из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины и штамма AS вируса осповакцины.

[0534] Вариант осуществления 57. Способ по варианту осуществления 55 или 56, при этом указанный второй химерный поксвирус содержит последовательность нуклеиновой кислоты, имеющую идентичность последовательности, составляющую по меньшей мере 70% с SEQ ID NO: 2, и при этом указанная последовательность нуклеиновой кислоты включает фрагменты нуклеиновой кислоты из штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров.

[0535] Вариант осуществления 58. Способ по одному из вариантов осуществления 55-57, при этом указанный первый химерный поксвирус и указанный второй химерный поксвирус вводят в комбинированном синергическом количестве.

[0536] Вариант осуществления 59. Способ по одному из вариантов осуществления 55-58, при этом указанный первый химерный поксвирус и указанный второй химерный поксвирус вводят одновременно.

[0537] Вариант осуществления 60, Способ по одному из вариантов осуществления 55-58, при этом указанный первый химерный поксвирус и указанный второй химерный поксвирус вводят последовательно.

[0538] Вариант осуществления 61. Способ по одному из вариантов осуществления 52-60, при этом указанный поксвирус вводят в количестве по меньшей мере 103 бляшкообразующих единиц (БОЕ)/кг.

[0539] Вариант осуществления 62. Способ по одному из вариантов осуществления 52-61, при этом указанный поксвирус вводят в количестве по меньшей мере 103 бляшкообразующих единиц (БОЕ)/кг.

[0540] Вариант осуществления 63. Способ по одному из вариантов осуществления 52-61, при этом указанный поксвирус вводят в количестве по меньшей мере 104 бляшкообразующих единиц (БОЕ)/кг.

[0541] Вариант осуществления 64. Способ по одному из вариантов осуществления 52-61, при этом указанный поксвирус вводят в количестве приблизительно 4×104 бляшкообразующих единиц (БОЕ)/кг.

[0542] Вариант осуществления 65. Способ по одному из вариантов осуществления 52-61, при этом указанный поксвирус вводят в количестве приблизительно 5×104 бляшкообразующих единиц (БОЕ)/кг.

[0543] Вариант осуществления 66. Способ по одному из вариантов осуществления 52-61, при этом указанный поксвирус вводят в количестве по меньшей мере 106 бляшкообразующих единиц (БОЕ)/кг.

[0544] Вариант осуществления 67. Способ по одному из вариантов осуществления 52-61, при этом указанный поксвирус вводят при приблизительно 108 бляшкообразующих единиц (БОЕ)/кг.

[0545] Вариант осуществления 68. Способ получения химерного поксвируса, при этом указанный способ включает: (i) инфицирование клетки по меньшей мере двумя штаммами поксвируса, выбранными из группы, состоящей из штамма Brighton вируса коровьей оспы, штамма Herman поксвируса енотов, штамма Utrecht поксвируса кроликов, штамма WR вируса осповакцины, штамма IHD вируса осповакцины, штамма Elstree вируса осповакцины, штамма CL вируса осповакцины, штамма Lederle-Chorioallantoic вируса осповакцины, штамма AS вируса осповакцины, штамма NZ2 орф-вируса и штамма TJS псевдопоксвируса коров; и (ii) обеспечение возможности указанным по меньшей мере двух штаммам поксвируса реплицироваться, тем самым получая указанный химерный поксвирус.

[0546] Вариант осуществления 69. Способ по варианту осуществления 68, при этом каждый из указанных по меньшей мере двух вирусных штаммов поксвируса присутствует при множественности заражения, составляющей менее чем приблизительно 1.

[0547] Вариант осуществления 70. Способ по варианту осуществления 68 или 69, при этом каждый из указанных по меньшей мере двух вирусных штаммов поксвируса присутствует при множественности заражения, составляющей менее чем приблизительно 0,1.

[0548] Вариант осуществления 71. Способ по одному из вариантов осуществления 68-70, при этом при этом каждый из указанных по меньшей мере двух штаммов поксвируса присутствует при множественности заражения, составляющей приблизительно 0,01.

[0549] Вариант осуществления 72. Способ по варианту осуществления 68, при этом указанную клетку инфицируют штаммом Brighton вируса коровьей оспы, штаммом Herman поксвируса енотов, штаммом Utrecht поксвируса кроликов, штаммом WR вируса осповакцины, штаммом IHD вируса осповакцины, штаммом Elstree вируса осповакцины, штаммом CL вируса осповакцины, штаммом Lederle-Chorioallantoic вируса осповакцины и штаммом AS вируса осповакцины.

[0550] Вариант осуществления 73. Способ по варианту осуществления 68, при этом указанную клетку инфицируют штаммом NZ2 орф-вируса и штаммом TJS псевдопоксвируса коров.

[0551] Вариант осуществления 74. Способ по одному из вариантов осуществления 68-73, при этом указанный химерный поксвирус представляет собой онколитический вирус.

[0552] Вариант осуществления 75. Способ по одному из вариантов осуществления 68-74, при этом указанный поксвирус включает миРНК-связывающую последовательность.

[0553] Вариант осуществления 76. Способ ингибирования клеточной пролиферации клетки, при этом указанный способ включает приведение в контакт клетки с химерным поксвирусом по одному из вариантов осуществления 1-49.

[0554] Вариант осуществления 77. Способ по варианту осуществления 76, при этом указанная клетка представляет собой раковую клетку.

[0555] Вариант осуществления 78. Способ по варианту осуществления 77, при этом указанная раковая клетка представляет собой клетку рака молочной железы, клетку рака толстой кишки, клетку рака почки, лейкозную клетку, клетку рака легкого, клетку меланомы, клетку рака яичников, клетку рака предстательной железы, клетку рака поджелудочной железы, клетку рака головного мозга, клетку рака печени, клетку рака желудка или клетку саркомы.

[0556] Вариант осуществления 79. Способ по варианту осуществления 77 или 78, при этом указанная раковая клетка представляет собой клетку трижды негативного рака молочной железы.

--->

СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

<110> City of Hope

Fong, Yuman

Chen, Nanhai

<120> Композиции химерных поксвирусов и их применение<130> 48440-606001WO

<150> US 62/372,408

<151> 2016-08-09

<150> US 62/519,010

<151> 2017-06-13

<160> 54

<170> PatentIn version 3.5

<210> 1

<211> 189415

<212> ДНК

<213> Искуственная последовательность

<220>

<223> Синтетический полинуклеотид

<400> 1

gagaaagaga taaaactttt ttacgactcc atcagaaaga ggtttaatat ttttgtgaga 60

ccatcgaaga gagaaagaga aagagatagt tagtctagat atttttctta gtacaaaagt 120

caatgtttta aaatatatgg acaagaattt gtctgtataa aaacttgtgt gaaattttgt 180

accaaagaaa aaatgtgagc agtatcccct acatggattt tactagatca tttatatacc 240

aaaaaatatt atacgatcta cgttttatta tatgatttta acgtgtaaat tataaacatt 300

attttatgat atacaattgt ctggtaacct agatgggcat aggggatgtt gataagctcg 360

acgagtatat gttgttggac gttattgttt aagaaatagt tgatgcatca gaaagagaat 420

aaaaaatatt ttagtgagac catcgaagag agaaagagat aaaacttttt tacgactcca 480

tcagaaagag gtttaatatt tttgtgagac catcgaagag agaaagagaa taaaaatatt 540

ttatgactcc attgaagaga gaaagagaaa atgagaatga gaataaaaat attttagtga 600

caccatcaga aagaggttta atatttttgt gagaccatcg aagagagaaa gagaataaaa 660

atattttatg actccattga agagagaaag agaaaatgag aatgagaata aaaatatttt 720

agtgacacca tcagaaagag gtttaatatt ttttatgaga ccatcaaaga gagaaagaga 780

ataaaaatat ttttgtaaaa ctttttttat gagaccatca aagagagaaa gagaataaaa 840

atatttttgt aaaacttttt ttatgagacc atcaaagaga gaaagagaat aaaaatattt 900

ttgtaaaact ttttttatga gaccatcaaa gagagaaaga gaataaaaat atttttgtaa 960

aacttttttt atgagaccat caaagagaga aagagaataa aaatattttt gtaaaacttt 1020

ttttatgaga ccatcaaaga gagaaagaga ataaaaaaat atttttgtaa aacttttttt 1080

atgagaccat cagaaagagg tttaatattt ttgtgatacc ctgaaaggaa ataggaatag 1140

gaatagtgtc ataatcgtat cacactattg agacagaaaa agaagaagtc gcgagaggta 1200

actttttgtt ttgcaaaccg gaatatagtg tccggtacac ttttttaatt cgtggtgtgc 1260

ctgaatcgtt cgattaaccc tactcatcca atttcagatg aatagagtta tcgattcaga 1320

cacacgcttt gagttttgtt gaatcgatga gtgaagtatc atcggttgca ccttcagatg 1380

ccgatccgtc gacatacttg acctcaagtt cagatgattc cttgcacatg tctccgatac 1440

gaacgctaaa ctctagattc ttgacacatt ttgtatcgac gatcgttgaa ccgatgatat 1500

cttcgtaact cactttctta tgagagatgt tagacccgag tactggatgg gtcttgatgt 1560

cgctgtcttt ctcttcttcg ctacatctga tgtcgataga cacctcacag tctttccatc 1620

agcggattct gagatggatt taatctgagg acatttggtg aatccaaagt tcattctcag 1680

acctccaccg atgatggagt aataagtggt aggaggatct acatcctcga ctgattccac 1740

ctcgggatct ggatctgact cggactctgt aatttccgtt acggattggc aaatcttatc 1800

atcggtcggt gtttggtctt gctttgtgac tttgataata acatcgattc ccatatgatg 1860

tttgttttct tcttccgtac acgatgagga tgattgctga agactggcag gcacatgcat 1920

gccagtacga tatattgttt catgattgct attgattgag tactgttctt tatgattcta 1980

cttccttacc gtgcaataaa ttagaatata ttttctactt ttacgagaaa ttaattattg 2040

tatttatggg tgaaaaactt actataaaaa gcgggtgggt ttggaattag tgatcagttt 2100

atgtatatcg caactaccgg gcatatggct acattaccca catgataaga gattgtatca 2160

gtttcgtagt cttgagtatt ggtattacta tatagtatat agatgtcgac gctagagtta 2220

ctgtctccga atgcggcatg atagtatcat tctttgcttt cgttaactgt ttggaggaag 2280

aatctttgtt attgcattta atctcgaaat tcagagtgca cacctttctc ctgtaaagaa 2340

tcctgaagtt gctaccttat taagaacgga gaagtatcca tcacgaaaga cgggattaca 2400

gtctttatga ttcatagtaa tagttagttc cgacgttgag atggattcgc tgagaccggt 2460

agtggtcgtc cgagtacacg atgtgtcgtt gacgggatac agattaattt ccacatcgat 2520

atagttaaag gtatttctgg gtacgggttt gagatcgtcg tacatgggaa atgaaatgtg 2580

actgtctgaa tgtatggctt taagatagct gtgataccgt atacaggtcg gtgtcggaga 2640

ttcgaatctc tttaaggcga cttatgtcac gatgatggaa tctatcttat cgaatgatat 2700

atttttcata aatacacttt tatagtcctc gtttaaacag aatttactat gtagttccgc 2760

gaatgactcg tcccttaata ggcagtaggc tagtatcttt tttacgtagt aatcgtcgta 2820

gggagagaca tcttgtagaa caacgattta atcataggta gagatacttt cagtctgtgg 2880

tggatgatgt cattcacaac atccgccttg tatatgatgt ttctgttttc aaacaccaag 2940

tcgaataccg tctttagtcg gaaggttgat gtcgtatccg atgtatgagg caacattgtt 3000

gttacaattt tgaaaggcgg tattatagta ttcgtctttc tgaatgtcga acctatctag 3060

tagataccgt agtatattga gagtgtatcc ttgattatgt tttatgaata gataaagtag 3120

atgttgtcct tcttcctttt gttcgtgcca attgagtaac attatgagaa tatgacctgt 3180

tgcacaatcg ttccatgatg ggtgtacaat caagattatt acgtatcctc gtatcggctc 3240

ctcgagataa aagagcatac accacacgag gactatgttt ggtatactgt tgaaggtaag 3300

tgtgtaaccg cgttaatgtt tgctccataa tctattatcg cgtagatgaa tcgcttctcg 3360

gctcgcatct tagtgtgact taacttgtaa taattgcttt tgtagaacgt ggatatgtgt 3420

ttacagtagt aatgaagaga agtgagtcca tcctcgtcga cgcaattagg gtcggatcct 3480

ttgtacagaa cgtaatagtt taagctccca ttgaatttat atctaagata acacagcaat 3540

agatcggatg atttactaaa gtcatcaatg gtgtccgtta gtatatcaaa gatcttgtta 3600

tcgattgata gtgaatgaat cagatagtgg tgtagaggaa tatgtccttt ttcatccttg 3660

ctatcaaagt tacgcatgcc gtggtgtaac aatatcttta atacagatgg attaaatcgt 3720

gtattcatcg tatagcaatg taatggagag ttacctcgtt tattcagatc gcagtgttta 3780

ataactagct taaacagatg agacgatgta tccacatcaa agaacgtaaa atacatatga 3840

caaacattgt tgacagaaac gtgaccttca ttcttaccgt cgtccataaa tacgttaggt 3900

atgtaccaca tactgtcgcg aacgatgcgt acaatctcgt ccatctcata atgatttact 3960

ttttcataat taaagatgtg aaagaaaaac agaacaatat atttttttag taatgtttat 4020

gcgagacata taaaataaac tccgtgttta tgatcatttt taacagcaac acattcaata 4080

ttgtattgtt atttttatat tatttacaca attaacaata tattattagt ttatattact 4140

gaattaataa tataaaattc ccaatcttgt cataaacaca cactgagaaa cagcataaac 4200

acaaaatcca tcaaaaatgt cgatgaaata tctgatgttg ttgttcgctg ctatgataat 4260

cagatcattc gccgatagtg gtaacgctat cgaaacgaca tcgccagaaa ttacaaacgc 4320

tacaacagat attccagcta tcagattatg cggtccagag ggagatggat attgtttaca 4380

cggtgactgt atccacgcta gagatattga cggtatgtat tgtagatgct ctcatggtta 4440

tacaggcatt agatgtcagc atgtagtatt agtagactat caacgttcag aaaacccaaa 4500

cactacaacg tcatatatcc catctcccgg tattatgctt gtattagtag gcattattat 4560

tattacgtgt tgtctattat ctgtttatag gttcactcga cgaactaaac tacctataca 4620

agatatggtt gtgccataat ttttataaat ttttttatga gtatttttac aaaaaaaatg 4680

tataaagtgt atgtcttatg tatatttata aaaatgctaa gtatgcgatg tatctatgtt 4740

atttgtattt atctaaacaa tacctctacc tctagatatt atacaaaaat tttttatttc 4800

ggcatattaa agtaaaatct agttaccttg aaaatgaata cagtgggtgg ttccgtatca 4860

ccagtaagaa cataatagtc gaatacagta tccgattgag attttgcata caatactagt 4920

ctagaaagaa atttgtaatc atcttctgtg acgggagtcc atatatctgt atcatcgtct 4980

agtttatcag tgtcccatgc tatattcctg ttatcatcat tagttaatga aaataactct 5040

cgtgcttcag aaaagtcaaa tattgtatcc atacatacat ctccaaaact atcgcttata 5100

cgtttatctt taacgatacc tatacctaga tggttattta ctaacagaca ttttccagat 5160

ctattgacta taactcctat agtttccaca tcaaccaagt aatgatcatc tattgttata 5220

taacaataac ataactcttt tccattttta tcagtatgta tatctatatc aacgtcgtcg 5280

ttgtagtgaa tagtagtcat tgatctatta tatgaaacgg atatgtctag aacggcaatt 5340

gttttacgtc cagttaacac tttctttgat ttaaagtcta gagtctttgc aaacataata 5400

tccttatccg actttatatt tcctgtaggg tggtataatt ttattttgcc tccacatatc 5460

ggtgtttcca aatatattac tagacaatat tccatatagt tattagttaa gggtacccaa 5520

ttagaacacg tacgcttatt atcatcattt ggatcgtatt tcataaaagt tattgtacta 5580

tcgatgtcaa cacattctac attttttaat cgtctatata gtatttttct gatattttct 5640

ataatatcag aattgtcttc catcggaagt tgtatactat cggaatcagt tacatgttta 5700

aataattctc tgatgtcatt ccttatacaa tcaaattcat tattaaacag tttaatagtc 5760

tgtagacctt tatcgtcgta aatatccatt gtcttattag ttacgcttat ttttatgtgt 5820

tttacgttgc tttattatat tttataagaa tgattgtttg acgaatcacg agaactatta 5880

agacacatta ttaggtatat attataaaaa agtttttgat tacgatgtta taagaggaaa 5940

gaggacacat taacatcata catcaattaa ctacattctt ataacatcgt aatcaaaaga 6000

attgcaattt tgatgtataa caactgtcaa tgggttatgg aattgtatat tacatattat 6060

acggtatgtt ggtaacgaca aataccgatc ggtaattgtc tgccggtgta atagaattat 6120

atatatctat ctattacacc ggctgagtat gcataataat aagttgtggt agtatgatct 6180

ccatatttat aatttaggac tttgtattca gtatttttgg aatcataaaa aataaaaaaa 6240

agttttacta atttaaaatt taaaaagtat ttacattttt ttcactgttt agtcgcggat 6300

atggaattcg atcctgccaa aatcaataca tcatctatag atcatgtaac aatattacaa 6360

tacatagatg aaccaaatga tataagacta acagtatgca ttatccgaaa tattaataac 6420

attacatatt atatcaatat cacaaaaata aatacacatt tggctaatca atttcgggct 6480

tggaaaaaac gtatcgccgg aagggactat atgactaact tatctagaga tacaggaata 6540

caacaatcaa aacttactga aactatacgt aactgtcaaa aaaatagaaa catatatggt 6600

ctatatatac actacaattt agttattaat gtggttattg attggataac cgatgtgatt 6660

gttcaatcaa tattaagagg gttggtaaat tggtacatag ctaataatac ctatactcca 6720

aatacaccca ataatacaac aaccatttct gagttggata tcatcaaaat actggataaa 6780

tacgaggacg tgtatagagt aagtaaagaa aaagaatgtg gaatttgcta tgaagttgtt 6840

tactcaaaac gatagatact ttggtttatt ggattcgtgt actcatatat tttgcataac 6900

atgcatcaat atatggcata aaacacgaag agaaaccggt gcgtcggata attgtcctat 6960

atgtcgtacc cgttttagaa acataacaat gagcaagttc tataagctag ttaactaata 7020

aataaaaagt ttaatttgtt gacgacgtat gtcgttattt ttctcgtatg aaagattaaa 7080

ttcaattcaa ttcgttgttt ctaatataat ctgccgtatt ggatggattc tcaagacaat 7140

tgcatttaga ttatattatc atgaataaaa atagtagcac gcactacttc agccaaatat 7200

tcttttttga aacgccatct atcgtagtga ggacacaagt gaacctataa ttatcaaatt 7260

tattagtatc agtcacatga aggactttct gtagagtgac gattctacca tctatggtac 7320

taacggtttc atcctccttg ataccctcac ccaaatgttc tataaattta gcatcctcgt 7380

ccgatctcat atcctttgcc aaccaataca tgtagctaaa attaggcata aatttcacac 7440

atccagtgca acgaaattct ccagaagatg ttacgatgtt taggttagga catttgattt 7500

cgtcggcatt aacatatggg tgaacacacc catacatgaa agcgatgaga aataggattc 7560

tcatcttgcc aaaatatcac tagaaaaaat ttatttatca attttaaagg tataaaaaat 7620

acttattgtt gctcgaatat tttgtatttg atggtatacg gaagattaga aatgtaggta 7680

ttatcatcaa ctgattctat ggttttatgt attctatcat gtttcactat tgcgtcggaa 7740

ataatatcat atgcttccac atatatttta ttttgtttta actcataata ctcacgtaat 7800

tctggattat tggcatatct atgaataatt ttagctccat gatcagtaaa tattaatgag 7860

aacatagtat taccacctac cattattttt ttcatttcgt tcaattcttg attgcaaaga 7920

tctatataat cattatagcg ttgacttatg gactctggaa tcttagacga tgtacagtca 7980

tctataatca tggcatattt aatacattgt tttatagcat agtagttatc tacgatgtta 8040

gatatttctc tcaatgaatc aatcacacaa tctaatgtag gtttatgaca taatagcatt 8100

ttcagcagtt caatgtttct agattcgttg atggcaatgg ctatacatgt atatccgtta 8160

tttgatctaa tgttgacatc tgaaccggat tctagcagta aagatactag agattgttta 8220

ttatatctaa cagccttgtg aagaagtgtt tctcctcgtt tgtcaatcat gttaatgtct 8280

ttaagataag gtaggcaaat gtttatagta ctaagaattg ggcaagcata agacatgtca 8340

caaagaccct ttttgtatgt ataagtgtaa aaattataac attcatagtt ggatttacat 8400

aggtgtccaa tcgggatctc tccatcatcg agataattga tggcatctcc cttccttttt 8460

tagtagatat ttcatcgtgt aagaatcaat attaatattt ctaaagtatt cgtgtatagc 8520

ctctttattt accacagttc catattccac tagagggata tcgccgaatg tcatatactc 8580

aattagtata tgttggagga catccgagtt cattgttttc aatatcaaaa agatggtttc 8640

cttatcattt ctccatagtg gtacaatact acacattatt ccgtgcggct ttccattttc 8700

caaaaacaat ttgaccaaat ctaaatctac atctttattg tatctataat cactatttag 8760

ataatcagcc ataattactc gagtgcaaca tgttagatcg tctatatatg aataagcagt 8820

gttatctatt cctttcatta acaatttaac gatgtctata tctatatgag atgacttaat 8880

ataatattga agagctgtac aatagttttt atctatagaa gacggcttga ttccgtgatt 8940

aattagacat ttaacaactt ccggacgcac atatgctctc gtatccgact ttgaatacag 9000

atgagagatg atatacagat gcaatacggt accgcaattt cgtagttgat aatcatcata 9060

cgcgtatcag tactcgtcct cataaagaac actgcagcca ttttctatga acaaatcaat 9120

aattttagga acaggatcat tgtcattaca taattttcta taactgaacg atggttttca 9180

catttaacac tcaagtcaaa tccatgttct accaacacct ttatcaagtc aacgtctaca 9240

tttttggatt tcatatagct gaatatatta aagtcattta tgttgctaaa tccagtggct 9300

tctagtagag ccatcgctat atcctttaac tttaacatgt ctactatttg tgtattcttc 9360

taatggggta gctgtctcca atttttgcgt aatggattag tgccactgtc tagtagtagt 9420

ttgacgacct cgacattatt acaatgctca ttaaaaaggt atgcgtgtaa agcattattc 9480

ttgaattggt tcctggtatc attaggatct ctgtctctca acatctgttt aagttcatcg 9540

agagccacct cctcattttc cagatagtca aacattttga ctgaatgagc tactgtgaac 9600

tctatacacc cacacaacta atgtcattaa atattatttt tttgaatgta tttataccat 9660

gtcaaaaact tgtacaatta ttaataaaaa taatttagtg tttaaatttt accagttcca 9720

gattttacac ctccgttaac cccacttttt acaccactgg acgatcctcc tccccacatt 9780

ccaccgccac cagatgtata agttttagat cctttattac taccatcatg tccatggata 9840

aagacactcc acatgccgcc actactaccc cctttagaag acatattaat aagacttaag 9900

gacaagttta acaataaaat taatcacgag taccctacta ccaacctaca ctattatatg 9960

attatagttt ctatttttac agtaccttaa ctaaagtctc tagtcacaag agcaatacta 10020

ccaacctaca ctattatatg attatagttt ctatttttat aggaacgcgt acgagaaaat 10080

caaatgtcta atttctaacg gtagtgttga taaacgatta tcgtcaatgg atacctcctc 10140

tatcatgtcg tctattttct tactttgttc tattaactta ttagcattat atattatttg 10200

attataaaac ttatattgct tattagccca atctgtaaat atcggattat taacatatcg 10260

tttctttgta ggtttattta acatgtacat cactgtaagc atgtccgtac catttatttt 10320

aatttgacgc atatccgcaa tttctttttc gcagtcggtt ataaattcta tatatgatgg 10380

atacatgcta catgtgtact tataatcgac taatatgaag tacttgatac atattttcag 10440

taacgattta ttattaccac ctatgaataa gtacctgtga tcgtctaggt aatcaactgt 10500

tttcttaata cattcgatgg ttggtaattt actcagaata atttccaata tcttaatata 10560

taattctgct atttctggga tatatttatc tgccagtata acacaaatag taatacatgt 10620

aaacccatat tttgttatta tattaatgtc tgcgccatta tctattaacc attctactag 10680

gctgacacta tgcgacttaa tacaatgata aagtatacta catccatgtt tatctatttt 10740

gtttatatca tcaatatacg gcttacaaag ttttagtatc gataacacat ccaactcacg 10800

catagagaag gtagggaata atggcataat atttattagg ttatcatcat tgtcattatc 10860

tacaactaag tttccatttt ttaaaatata ctcgacaact ttaggatctc tattgccaaa 10920

tttttgaaaa tatttattta tatgcttaaa tctatataat gtagctcctt catcaatcat 10980

acatttaata acattgatgt atactgtatg ataagataca tattctaaca atagatcttg 11040

tatagaatct gtatatcttt taagaattgt ggatattagg atattattac gtaaactatt 11100

acacaattct aaaatataaa acgtatcacg gtcgaataat agttgatcaa ctatataatt 11160

atcgattttg tgatttttct tcctaaactg tttacgtaaa tagttagata gaatattcat 11220

tagttcatga ccactatagt tactatcgaa taacgcgtca aatatttccc gtttaatatc 11280

gcatttgtca agataataat agagtgtggt atgttcacga taagtataat aacgcatctc 11340

ttttttgtgt gaaattaaat agtttatcac gtccaaagat gtagcataac catcttgtga 11400

cctagtaata atataataat agagaactgt tttacccatt ctatcatcat aatcagtggt 11460

gtagtcgtaa tcgtaatcgt ctaattcatc atcccaatta taatattcac cagcacgtct 11520

aatctgttct attttgatct tgtatccata ctgtatgttg ctacatgtag gtattccttt 11580

atccaataat agtttaaaca catctacatt gggatttgat gttgtagcgt atttctctac 11640

aatattaata ccatttttga tactatttat ttctatacct ttcgaaatta gtaatttcaa 11700

taagtctata tcgatgttat cagaacatag atattcgaat atatcaaaat cattgatatt 11760

tttatagtcg actgacgaca ataacaaaat cacaacatcg tttttgatat tattattttt 11820

cttggtaacg tatgccttta atggagtttc accatcatac tcatataatg gatttgcacc 11880

actttctatc aatgattgtg cactgctggc atcgatgtta aatgttttac aactatcata 11940

gagtatctta tcgttaacca tgattggttg ttgatgctat cgcatttttt ggtttctttc 12000

atttcagtta tgtatggatt tagcacgttt gggaagcatg agctcatatg atttcagtac 12060

tgtagtgtca gtactattag tttcgatcag atcaatgtct agatctatag aatcaaaaca 12120

cgataggtca gaagataatg aatatctgta cgcttctttt tgtactgtaa cttctggttt 12180

tgttagatgg ttgcatcgtg ctttaacatc aatggtacaa attttatcct cgctttgtgt 12240

atcatattcg tctctagtat aaaattctat attcagatta tcatgcgatg tgtatacgct 12300

aacggtatca ataaacggag cacaccattt agtcataaca gtaatccaaa attttttaaa 12360

gtatatctta acgaaagaag ttgtgtcatt gtctacggtg tatggtacta gatcctcata 12420

agtgtatata tctagagtaa tgtttaattt attaaatggt tgataatatg gatcctcatg 12480

acaatttccg aagatggaaa tgagatatag acatgcaata aatctaatcg aagacatggt 12540

tactccttaa aaaaatacga ataatcacct tggctattta gtaagtgtca tttaacacta 12600

tactcatatt aatccatgga ctcataatct ctatacggga ttaacggatg ttctatatac 12660

ggggatgagt agttttcttc tttaacttta tactttttac taatcatatt tagactgatg 12720

tatgggtaat agtgtttaaa gagttcgttc tcatcatcag aataaatcaa tatctctgtt 12780

tttttgttat acagatgtat tacagcctca tatattacgt aatagaacgt gtcatctacc 12840

ttattaactt tcaccgcata gttgtttgca aatacggtta atcctttgac ctcgtcgatt 12900

tccgaccaat ctgggcgtat aatgaatcta aactttaatt tcttgtaatc attcgaaata 12960

atttttagtt tgcatccgta gttatcccct ttatgtaact gtaaatttct caacgcgata 13020

tctccattaa taatgatgtc gaattcgtgc tgtataccca tactgaatgg atgaactaac 13080

gaatatcaac ggcgttaata gtaatttact ttttcatctt tacatattgg gtactagttt 13140

tactatcata agtttataaa ttccacaagc tactatggaa taagccaacc atcttagtat 13200

accacacatg tcttaaagtt tattaattaa ttacatgttg ttttatatat atcgctacga 13260

atttaaagag aaatcagttt aggaagaaaa aaattatcta tctacatcat cacgtctctg 13320

tattctacga tagagtgcta ctttaagatg agacatatcc gtgtcatcaa aaatatactc 13380

cattaaaatg attattccgg cagcgaactt gatattggat atatcacaac ctttgttaat 13440

atctacgaca atagacagca gtcccatggt tccataaaca gtgagtttat ctttctttga 13500

agcgatagtt tgtagagatc ttataaaacc gtcaaacgac atcgcattta tatctttagc 13560

taattcatat atgttaccat cgtaatatct aaccgcgtct atcttaaacg tttccatcgc 13620

tttaaagacg tttccgatag atggtctcat ttcatcagtc atactgagcc aacaaatata 13680

atcgtgtata acatctttga tagaatcaga ctctaaagaa aacgaatcgg ctttattata 13740

cgcattcatg ataaacttaa tgaaaaatgt ttttcgttgt ttaagttgga tgaatagtat 13800

gtcttaataa ttgttattat ttcattaatt aatatttagt aacgagtaca ctctataaaa 13860

acgagaatga cataactagt tatcaaagtg tctaggacgc gtaattttca tatggtatag 13920

atcctgtaag cattgtctgt attctggagc tattttcttt atcgcattag taagttcaga 13980

atatgttata aatttaaatc gaataacgaa catgacttta gtaaagtcgt ctatattaac 14040

tcttttattt tctagccatc gtaataccat gtttaagata gtatattctc tagttactac 14100

gatctcatcg ttgtctagaa tatcacatac tgaatctaca tccaatttta gaaattggtc 14160

tgtgttacat atctcttcta tattattgtt gatgtattgt cgtagaaaac tattacgtag 14220

accattttct ttataaaacg aatatatagt actccaatta tctttaccga tatatttgca 14280

cacataatcc attctctcaa tcactacatc tttaagattt tcgttgttaa gatatttggc 14340

taaactatat aattctatta gatcatcaac agaatcagta tatatttttc tagatccaaa 14400

gacgaactct ttggcgtcct ctataatatt cccagaaaag atattttcgt gttttagttt 14460

atcgagatct gatctgttca tatacgccat gattgtacgg tacgttatga taaccgcata 14520

aaataaaaat ccattttcat ttttaaccaa tactattcat aattgagatt gatgtaatac 14580

tttgttactt tgaacgtaaa gacagtacac ggatccgtat ctccaacaag cacgtagtaa 14640

tcaaatttgg tgttgttaaa cttcgcaata ttcatcaatt tagatagaaa cttatactca 14700

tcatctgttt taggaatcca tgtattatta ccactttcca acttatcatt atcccaggct 14760

atgtttcgtc catcatcgtt gcgcagagtg aataattctt ttgtattcgg tagttcaaat 14820

atatgatcca tgcatagatc ggcaaagcta ttgtagatgt gatttttcct aaatctaata 14880

taaaactcgt ttactagcaa acactttcct gatttatcga ccaagacaca tatggtttct 14940

aaatctatca agtggtgggg atccatagtt atgacgcagt aacatagatt attacattct 15000

tgactgtcgc taatatctaa atatttattg ttatcgtatt ggattctgca tatagatggc 15060

ttgtatgtca aagatataga acacataacc aatttatagt cgcgctttac attctcgaat 15120

ctaaagttaa gagatttaga aaacattata tcctcggatg atgttatcac tgtttctgga 15180

gtaggatata ttaaagtctt tacagatttc gtccgattca aataaatcac taaataatat 15240

cccacattat catctgttag agtagtatca ttaaatctat tatattttat gaaagatata 15300

tcactgctca cctctatatt tcgtacattt ttaaactgtt tgtataatat ctctctgata 15360

caatcagata tatctattgt gtcggtagac gataccgtta catttgaatt aatggtgttc 15420

cattttacaa cttttaacaa gttgaccaat tcatttctaa tagtatcaaa ctctccatga 15480

ttaaatattt taatagtatc cattttatat cactacggac acaaagtagc tgacataaac 15540

cattgtataa tttttatgtt ttatgtttat tagcgtacac attttggaag ttccggcttc 15600

catgtatttc ctggagagca agtagatgat gaggaaccag atagtttata tccgtacttg 15660

cacttaaagt ctacattgtc gttgtatgag tatgatcttt taaacccgct agacaagtat 15720

ccgtttgata ttgtaggatg tggacattta acaatctgac acgtgggtgg atcggaccat 15780

tctcctcctg aacacaggac accagagtta ccaatcaacg aatatccact attgcaacta 15840

taagttacaa cgctcccatc ggtataaaaa tcctcgtatc cgttatgtct tccgttggat 15900

atagatggag gggattggca tttaacagat tcacaaatag gtgcctcggg attccatacc 15960

atagatccag tagatcctaa ttcacaatac gatttagatt caccgatcaa ctgatatccg 16020

ctattacaag agtacgttat actagagcca aagtctactc cgccaatatc aagttggcca 16080

ttatcgatat ctcgaggcga tgggcatctc cgtttaatac attgattaaa gagtgtccat 16140

ccagtacctg tacatttagc atatataggt cccatttttt gctttctgta tccaggtaga 16200

catagatatt ctatagtgtc tcctatgttg taattagcat tagtttccac actattctta 16260

aattttatat taatgggacg tgaaggaata ggacagtatg atagaacgca tcctattccc 16320

aacaatgtca ggaacgtcac gctctccacc ttcatattta tttatccgta aaaatgttat 16380

cctggacatc gtacaaataa taaaaaagcc catatatgtt tgctattgta gaaattgttt 16440

ttcacagttg ctcaaaaacg atggcagtga cttatgagtt tcatctttag taaacatatc 16500

ataatattcg atattacgag ttgacatatc gaacaaattc caagtatttg attttggata 16560

atattcgtat tttgcatctg ctataattaa gatataatca ccgcaagaac acacgaacat 16620

ctttcctaca tggttaaagt acatgtataa ttctatccat ttgtcttcct taactatata 16680

tttgtataga taattacgag tctcataagt aattccagta attgcataga tgtcaccatc 16740

gtactctaca gcataaacta tactatgatg tctaggcatg ggagactttt ttatccaacg 16800

atttttagtg aaacattcta catcgtttaa tactacatat ttctcatacg tggtataaac 16860

tccacccatt acatatatat catcgtttac gaataccgac gcgcctgaat atctaggagt 16920

aattaagttt ggaagtctta tccatttcga agtgccgtgt ttcaaatatt ctgccacacc 16980

cgttgaaata gaaaattcta atcctcctat tacatataac tttccatcgt taacacaagt 17040

actaacttct gattttaacg acgacatatt agtaaccgtt ttccattttt tcgttttaag 17100

atctacccgc gatacggaat aaacatgtct attgttaatc atgccgccaa taatgtatag 17160

acaattatgt aaaacatttg cattatagaa ttgtctatct gtattaccga ctatcgtcca 17220

atattctgtt ctaggagagt aatgggttat tgtggatata taatcagagt ttttaatgac 17280

tactatatta tgttttatac catttcgtgt cactggcttt gtagatttgg atatagttaa 17340

tcccaacaat gatatagcat tgcgcatagt attagtcata aacttgggat gtaaaatgtt 17400

gatgatatct acatcgtttg gatttttatg tatccacttt aataatatca tagctgtaac 17460

atcctcatga tttacgttaa cgtcttcgtg ggataagata gttgtcagtt catcctttga 17520

taattttcca aattctggat cggatgtcac cgcagtaata ttgttgatta tttctaacat 17580

cgacgcatta tatagttttt taattccata ttgtttagaa aagttaaaca tccttataca 17640

atttgtggaa ttaatattat gaatcatagt ttttacacat agatctacta caggcgtaac 17700

atcaattatt acggcagcaa ctagtatcat ttctacattg tttatggtga tgtttatctt 17760

cttccagcgc atatagtcta atagcgattc aaacgcgtga tagtttatac cattcaatat 17820

aatcacttca tcatttatat ggtgctcctg aatgcgttta aaaaaattat acggagacgc 17880

cgtaataatt tccttattca cttgtataat ttccccattg atagaaaata tcacgctttc 17940

cattcttgaa gtactataag taattatagt ataatgtaaa cgtttatata ttcaatattt 18000

ttataaaaat cattttgaca ttaattcctt tttaaatttc cgtctatcat ctatagaaac 18060

gtattctatg aatttataaa atgcttttac gtgtcctatc gtaggcgata gaaccgctaa 18120

aaagcctatc gaatttctac aaaagaatct attatatggt atagggagag tataaaacat 18180

taaatgcccg tacttattaa agtattcagt agccaatcct aactctttcg aatacttatt 18240

aatggctctt gttctgtacg aatctatttt tttgaacaac ggacctagtg gtatatcttg 18300

ttctatgtat ctaaaataat gtctgactag atccgttagt ttaatatcct cagtcatctt 18360

gtctagaatg gcaaatctaa ctgcgggttt aggctttagt ttagttttta tatctacatc 18420

tatgtcttta tctaacacca aaaatataat agctaatatt ttattacaat catccggata 18480

ttcttctacg atctcactaa ctaatgtttc tttggttata ctagtatagt cacgatcaga 18540

caaataaaga aaatcagatg atcgatgaat aatacattta aattcatcat ctgtaagatt 18600

tttgagatgt ctcattaaaa tattattagg gttagtactc attatcattc ggcagctatt 18660

acttatttta ttatttttca ccatatagat caatcattag atcatcaaaa tatgtttcaa 18720

tcatcctaaa gagtatggtg aatgactctt cccatctaat ttctgaacgt tcaccaatgt 18780

ctctagccac tttggcacta atagcgatca ttcgcttagc gtcttctata ttattaactg 18840

gttgattcaa tctatctagc aatggaccgt cggacagcgt cattctcatg ttcttaatca 18900

atgtacatac atcgccgtca tctaccaatt catccaacaa cataagcttt ttaaaatcat 18960

cattataata ggtttgatcg ttgtcatttc tccaaagaat atatctaata agtagagtcc 19020

tcatgattag ttaacaacta ttttttatgt taaatcaatt agtacaccgc tatgtttaat 19080

acttattcat attttagttt ttaggattga gaatcaatac aaaaaattaa tgcatcatta 19140

attttagaaa tacttagttt ccacgtagtc aatgaaacat ttgaactcat cgtacaggac 19200

gttctcgtac aggacgtaac tataaaccgg tttatatttg ttcaagatag atacaaatcc 19260

gataactttt tttacgaatt ctacgggatc cactttaaaa gtgtcatacc gggttctttt 19320

tattctttta aacagatcaa tggtgtgatg ttgattaggt cttttacgaa tttgatatag 19380

aatagcgttc acatatcctc cataatggtc aatcgccatt tgttcgtatg tcataaattc 19440

tttaattata tgacactgtg tattatttag ttcatccttg ttcatcatta ggaatctatc 19500

caaaatggca attatactag aactataggt gcgttgtata cacatattga tgtgtctgtt 19560

tatacaatcc atgatatttg gatccatgct actaccttcg ggtaaaattg tagcatcata 19620

taccatttct agtactttag gttcattatt atccattgca gaggacgtca tgatcgaatc 19680

ataaaaaaat atattatttt tatgttattt tgttaaaaat aatcatcgaa tacttcgtaa 19740

gatactcctt catgaacata atcagttaca aaacgtttat atgaagtaaa gtatctacga 19800

tttttacaaa agtccggatg cataagtaca aagtacgcga taaacggaat aataatagat 19860

ttatctagtc tatctttttc tatagctttc atagttagat acatggtctc agaagtagga 19920

ttatgtaaca tcagcttcga taaaatgact gggttattta gtcttacaca ttcgctcata 19980

catgtatgac cgttaactac agagtctaca ctaaaatgat tgaacaatag atagtctacc 20040

attgtttcgt attcagatag tacagcgtag tacatggcat cttcacaaat tatatcattg 20100

tctaatagat atttgacgca tcttatggat cccacttcaa cagccatctt aaaatcggta 20160

aaatcatatt gctttccttt atcattaata atttctaaaa catcatctct atcataaaag 20220

atacaaatat taactgtttg atccgtaata acattgctag tcgatagcaa tttgttaata 20280

agatgcgctg ggctcaatgt cttaataaga agtgtaagag gactatctcc gaatttgttt 20340

tgtttattaa catccgttga tggaagtaaa agatctataa tgtctacatt cttgactgtt 20400

ttagagcata caatatggag aggtgtattt ccatcatgat ctggttttga gggactaatt 20460

cctagtttca tcatccatga gattgtagaa gcttttggat tgtctgacat aagatgtcta 20520

tgaatatgat ttttgccaaa tttatccact atcctggctt cgaatccgat ggacattatt 20580

tttttaaaca ctctttctga aggatctgta cacgccaaca acggaccaca tccttcttca 20640

tcaaccgagt tgttaatctt ggctccatac tgtaccaata aatttattct ctctatgact 20700

tcatcatctg ttcccgagag ataatataga ggtgttttat tatgtttatc acacgcgttt 20760

ggatctgcgc cgtgcgtcag cagcatcgcg actattctat tattattaat tttagaagct 20820

atatgcaatg gataatttcc atcatcatcc gtctcatttg gagagtatcc tctatgaaga 20880

agttcttcga caaatcgttc atctagtcct ttaattccac aatacgcatg tagaatgtga 20940

taattatttc cagaaggttc gatagcttgt agcatattcc taaatacatc taaattttta 21000

ctattatatt tggcataaag agatagataa tactcggccg acataatgtt gtccattgta 21060

gtataaaaat taatatttct atttctattt ctgtatattt gcaacaattt actctctata 21120

acaaatatca taacttagtt cttttatgtc aagaaggcac tggtttagtt catctataaa 21180

tgtcacgcca taactaccac gcatgccata ctcagaatta tgataaagat atttatcctt 21240

ggggtgtagg taatggggat taatctttgt tggatcagtc tctaagttaa cacatgtcac 21300

acatgatcca tttatagtta tatcacacga tgatgattta tgaattgatt ccggaagatc 21360

gctatcgtat tttgtggttc cacaattcat ttccatacat gttattgtca cactaatatt 21420

atgatgaact ttatctagcc gctgagtggt aaacaacaga acagatagtt tattatcttt 21480

accaacaccc tcagccgctg ccacaaatct ctgatccgta tccatgatgg tcatgtttat 21540

ttctagtccg tatccagtca acactatgtt agcatttctg tcgatatagc tttcactcat 21600

atgacactca ccaataatag tagaattaat gtcgtaattt acaccaatag tgagttcggc 21660

ggcaaagtac caataccggt aatcttgtcg aggaggacat atagtattct tgtattctac 21720

tgaatacccg agagatgcga tacaaaagag taagactaat ttgtaaacca tcttactcaa 21780

aatatgtaac aatagtacga tgcaatgagt aagacaatag gaaatctatc ttatatacac 21840

ataattattc tatcaatttt accaattagt tagtgtaatg ttaacaaaaa tgtgggagaa 21900

tctaattagt ttttctttac acaattgacg tacatgagtc tgagttcctt gtttttgcta 21960

attatttcat ccaatttatt attcttgact atatcgagat cttttgtata ggagtcagac 22020

ttgtattcaa catgcttttc tataatcatt ttagctattt cggcatcatc caatagtaca 22080

ttttccagat tagcagaata gatattaatg tcgtatttga acagagcctg taacatctca 22140

atgtctttat tatctatagc caatttaatg tccggaatga agagaaggga attattggtg 22200

tttgtcgacg tcatatagtc gagcaagaga atcatcatat ccacgtgtcc attttttata 22260

gtggtgtgaa tacaactaag gagaatagcc agatcaaaag tagatggtat ctctgaaaga 22320

aagtaggaaa caatacttac atcattaagc atgacggcat gataaaatga agttttccat 22380

ccagttttcc catagaacat cagtctccaa tttttcttaa caaacagttt taccgtttgc 22440

atgttaccac tatcaaccgc ataatacaat gcggtgtttc ccttgtcatc aaattgtgaa 22500

tcatccagtc cactgaatag caaaatcttt actattttgg tatcttccaa tgtggctgcc 22560

tgatgtaatg gaaattcatt ctctagaaga tttttcaatg ctccagcgtt caacaacgta 22620

catactagac gcacgttatt atcagctatt gcataataca aggcactatg tccatggaca 22680

tccgccttaa atgcatcttt gctagagaga aagcttttca gctgcttaga cttccaagta 22740

ttaattcgtg acagatccat gtctgaaacg agacgctaat tagtgtatat tttttcattt 22800

tttataattt tgtcatattg caccagaatt aataatatct ctaatagatc tgattagtag 22860

atacatggct atcgcaaaac aacatataca catttaataa aaataatatt tattaagaaa 22920

attcagattt cacgtaccca tcaatataaa taaaataatg attccttaca ccgtacccat 22980

attaaggaga ttccacctta cccataaaca atataaatcc agtaatatca tgtctgatga 23040

tgaacacaaa tggtgtatta aattccagtt tttcaggaga tgatctcgcc gtagctacca 23100

tgatagtaga tgcctctgct acagttcctt gttcgtcgac atctatcttt gcattctgaa 23160

acattttata aatatataat gggtccctag tcatatgttt aaacaacgca ttatctggat 23220

taaacatact aggagccatc atttcggcta tcgacttaat atccctctta ttttcgatag 23280

aaaatttagg gagtttaaga ttgtacactt tattccctaa ttgaaacgac caatagtcta 23340

attttgcagc cgtaatagaa tctgtgaaat gggtcatatt atcacctatt gccaggtaca 23400

tactaatatt agcatcctta tacggaaggc gtaccatatc atattcttcg tcatcgattg 23460

tgattgtatt tccttgcaat ttagtaacta cgttcatcat gggaaccgtt ttcgtaccgt 23520

acttattagt aaaactagca ttgcgtgttt tagtgatatc aaacggatat tgccatatac 23580

ctttaaaata tatagtatta atgattgccc atagagtatt attgtcgagc atattagaat 23640

ctactacatt agacataccg gatctacgtt ctactataga attaatttta ttaaccgcat 23700

ctcgtctaaa gtttaatcta tataggccga atctatgata ttgttgataa tacgacggtt 23760

taatgcacac agtattatct acgaaacttt gataagttag atcagtgtac gtatatttag 23820

atgttttcag cttagctaat cctgatatta attctgtaaa tgctggaccc agatctcttt 23880

ttctcaaatc catagtcttc aataattcta ttctagtatt acctgatgca ggcaatagcg 23940

acataaacat agaaaacgaa taaccaaacg gtgagaagac aatattatca tcttgaatat 24000

ttttatacgc tactataccg gcattggtaa atccttgcag acgataggta gacactgaac 24060

acgttaacga tagtatcaat aacgcaatca tgattttatg gtattaataa ttaaccttat 24120

ttttatgttc ggtataaaaa ttattgatgt ctacacatcc ttttgtaatt gacatctata 24180

tatccttttg tataatcaac tctaatcact ttaactttta cagttttccc taccagttta 24240

tccctatatt caacatatct atccatatgc atcttaacac tctctgccaa gatagcttca 24300

aagtgaggat agtcaaaaag ataaatatat agagcataat cattctcgta tactctgccc 24360

tttattacat cacccgcatt gggcaacgaa taacaaaatg caagcatctt gttaacgggc 24420

tcgtaaattg ggataaaaat tatgttttta tatctatttt attcaagaga atattcagga 24480

atttcttttt ccggttgtat ctcatcgcag tatatatcat ttgtacattg tttcatattt 24540

tttaatagtc tacacctttt agtaggacta gtatcgtaca attcatagct gtattttgaa 24600

ttccaatcac gcataaaaat atcttccaat tgttgacgaa gacctaatcc atcatccggt 24660

gtaatattaa tagatgctcc acatgtatcc gtaaagtaat ttcctgtcca atttgaggta 24720

cctatatacg ccgttttatc ggttaccata tatttggcat ggtttaccct agaatacgga 24780

atgggaggat cagcatctgg tacaataaat agctttactt ctatatttat gtttttagat 24840

tttagcatag cgatagatct taaaaagttt ctcatgataa acgaagatcg ttgccagcaa 24900

ctaatcaata gcttaacgga tacttgtctg tctatagcgg ctcttcttaa ttcatcttct 24960

atataaggcc aaaacaaaat attgcctgcc ttcgaataaa taatagggat aaagttcata 25020

acagatacat aaacgaattt actcgcattt ctaatacatg acaataaagc ggttaaatca 25080

ttggttcttt ccatagtaca tagttgttgc ggtgcagaag caataaatac agagtgtgga 25140

acaccactta cgttaatact aagaggatga tctgtattat aatacgacgg ataaaagttt 25200

ttccaattat atggtagatt gttaactcca agataccagt atacctcaaa aatttgagtg 25260

agatccgctg ccaagttcct attattgaag atcgcaatac ccaattcttt gacctgagtt 25320

agtgatctcc aatccatgtt agcgcttcct aaataaatat gtgtattatc agatatccaa 25380

aattttgtat gaagaactcc tcctaggata tttgtaatat ctatgtatcg tacttcaact 25440

ccggccattt gtagtctttc aacatccttt aatggtttgt tagatttatt gacggctact 25500

ctaactctta ctcctctttt gggtaattgt acaatctcgt ttaatattat cgtgccgaaa 25560

ttcgtaccca cttcatccga taaactccaa taaaaagatg atatatctag tgtttttgtg 25620

gtattggata gaatttccct ccacatgtta aatgtagaca aatatacttt atcaaattgc 25680

atacctatag gaatagtctc tgtaatcact gcgattgtat tatccggatt cattttattt 25740

gttaaaaaat aatcctatat cacttcactc tattaaaaat ccaagtttct atttctttca 25800

tgactgattt tttaacttca tccgtttcct tatgaagatg atgtttggca ccttcataaa 25860

tttttatttc tctattacaa tttgcatgtt gcatgaaata atatgcacct aaaacatcgc 25920

taatctcatt gtttgttccc tggagtatga gagtcggggg gtgttaatct tgggaattat 25980

ttttctaacc ttgttggtag ccttcaagac ctgactagca aatccagcct taattttttc 26040

atgattgatt aatgggtcgt attggtattt ataaacttta tccatatctc tagatactga 26100

ttctggacat agctttccga ctggcgcatt tggtgtgatg gttcccataa gtttggcagc 26160

tagcagattc agttttgaaa cagcatctgc attaactaga ggagacatta gaatcattgc 26220

tgtaaacaag tttggattat cgtaagaggc tagtatagaa attgttgctc ccatggaatg 26280

cccaataaga agactggaac tcctaaataa gtagatttaa tagttaccac gtgctgtacc 26340

acatctctaa catacgtacc aaagtcatca atcatcattt tttcaccatt acttcttcca 26400

tgtccaatat gatcatgtga gaatactaaa attcctaacg atgatatgtt ttcagctagt 26460

tcgtcataac gtccagaatg tttaccagct ccatgactta tgaatactaa tgccttagga 26520

tatgtaatag gtttccaata tatgtaatca ttgtccagat tgaacataca gtttgcactc 26580

atgattcacg ttatataact atcaatatta acagttcgtt tgatgatcat attattttta 26640

tgttttattg ataattgtaa aaacatacaa ttaaatcaat atagaggaag gagacggcta 26700

ctgtcttttg tgagatagtc atggcgacta aattagatta tgaggatgct gttttttact 26760

ttgtggatga tgataaaata tgtagtcgcg actccatcat cgatctaata gatgaatata 26820

ttacgtggag aaatcatgtt atagtgttta acaaagatat taccagttgt ggaagactgt 26880

acaaggaatt gatgaagttc gatgatgtcg ctatacggta ctatggtatt gataaaatta 26940

atgagattgt cgaagctatg agcgaaggag accactacat caattttaca aaagtccatg 27000

atcaggaaag tctattcgct accataggaa tatgtgctaa aatcactgaa cattggggat 27060

acaaaaagat ttcagaatct agattccaat cattgggaaa cattacagat ctgatgaccg 27120

acgataatat aaacatcttg atactttttc tagaaaaaaa attgaattga tgatataggg 27180

gtcttcataa cgcataatta ttacgttagc attctatatc cgtgttaaaa aaaattatcc 27240

tatcatgtat ttgagagttt tatatgtagc aaacatgata gctgtgatgc caataagctt 27300

tagatattca cgcgtgctag tgttagggat ggtattatct ggtggtgaaa tgtccgttat 27360

ataatctaca aaacaatcat cgcatatagt atgcgatagt agagtaaaca tttttatagt 27420

ttttactgga ttcatacatc gtctacccaa tttggttata aatgaaattg tcgccaatct 27480

tacacccaac cccttgttat ccattagtat agtattaact tcgttattta tgtcataaac 27540

tgtaaatgat tttgtagatg ccatatcata catgatattc atgtccctat tataatcatt 27600

actaacttta tcacaatata tgttgataat atctatatat gatctagtct ttgtgggcaa 27660

ctgtctatac aagtcgtcta aacgttgttt actcatatag tatcgaacag ccatcattac 27720

atggtcccgt tccgttgata gataatcgag tatgttagtg gacttgtcaa atctatatac 27780

catattttct ggaagtggat atacatagtc gtgatcaaca ttattgctag cctcatcttc 27840

tatatcatgt actataccat tatctatatc atctacataa tctacgatat tattacacat 27900

aaacatcgac aacatactat tgtttattat ctaagtcctg ttgatccaaa cccttgatct 27960

cctctatttg tactatctag agattgtact tcttccagtt ctggataata tatacgttga 28020

tagattagct gagctattct atctccagta tttacattaa acgtacattt tccattatta 28080

ataagaatga ctcctatgtt tcccctataa tcttcgtcta ttacaccacc tcctatatca 28140

atgcctttta gtgacagacc agacctagga gctattctac catagcaaat cttaggcatg 28200

gacatactaa tatctgtctt aattaactgt ctttctcctg gagggatagt ataatcgtaa 28260

gcgctataca aatcatatcc ggcagcaccc ggcgattgcc tagtaggaga tttagctctg 28320

ttagtttcct taacaaatct aactggtgag ttaatattca tgttgaacat aaaactaata 28380

ttttatttca aaattattta ccatcccata tattccatga ataagtgtga tgattgtaca 28440

cttctatagt atctatatac gattcacgat aaaatcctcc tatcaatagc agtttattat 28500

ccactatgat caattctgga ttatccctcg gataaatagg atcatctatc agagtccatg 28560

tattgctgga ttcacaataa aattccgcat ttctaccaac caagaataac cttctaccga 28620

acactaacgc gcatgattta taatgaggat aataagtgga tggtccaaac tgccactgat 28680

catgattggg tagcaaatat tctgtagttg tatcagtttc agaatgtcct cccattacgt 28740

atataacatt gtttatagat gccactgctg gattacatct aggtttcaga agactcggca 28800

tattaaccca agcagcatcc ccgtggaacc aacgctcaac agatgtggga tttggtagac 28860

ctcctactac gtataattta ttgttagcgg gtatcccgct agcatacagt ctggggctat 28920

tcatcggagg aattggaatc caattgtttg atatataatt tacagctata gcattgttat 28980

gtatttcatt gttcatccat ccaccgatga gatatactac ttctccaaca tgagtacttg 29040

tacacatatg gaatatatct ataatttgat ccatgttcat aggatactct atgaatggat 29100

acttgtatga tttgcgtggt tgtttatcac aatgaaatat tttggtacag tctagtatcc 29160

attttacatt atttatacct ctgggagaaa gataatttga cctgattaca tttttgataa 29220

ggagtagcag atttcctaat ttatttcttc gctttatata ccacttaatg acaaaatcaa 29280

ctacataatc ctcatctgga acatttagtt catcgctttc tagaataagt ttcatagata 29340

gataatcaaa attgtctatg atgtcatctt ccagttccaa aaagtgtttg gcaataaagt 29400

ttttagtatg acataagaga ttggatagtc cgtattctat acccatcatg taacactcga 29460

cacaatattc ctttctaaaa tctcgtaaga taaagtttat acaagtgtag atgataaatt 29520

ctacagaggt taatatagaa gcacgtaata aattgacgac gttatgacta tctatatata 29580

cctttccagt atacgagtaa ataactatag aagttaaact gtgaatgtca aggtctagac 29640

aaaccctcgt aactggatct ttatttttcg tgtatttttg acgtaaatgt gtgcgaaagt 29700

aaggagataa ctttttcaat atcgtagaat tgactattat attgccacct atagcatcaa 29760

taattgtttt gaatttctta gtcatagaca atgctaatat attcttacag tacacagtat 29820

taacaaatat cggcatttat gtttctttaa aagtcaacat ctagagaaaa atgattatct 29880

ttttgagaca taactcccat tttttggtat tcacccacac gtttttcgaa aaaattagtt 29940

tttccttcca atgatatatt ttccatgaaa tcaaacggat tggtaacatt ataaattttt 30000

ttaaatccca attcagaaat caatctatcc gcgacgaatt ctatatatgt tttcatcatt 30060

tcacaattca ttcctataag tttaactgga agagccgcag taagaaattc ttgttcaatg 30120

gatactgcat ctgttataat agatctaacg gtttcttcac tcggtggata caataaatgt 30180

ttaaacatca aacatgcgaa gtcgcagtgt agaccctcgt ctctactaat tagttcgttg 30240

gaaaacgtga gtccgggcat taggccacgc tttttaagcc aaaatatgga agcgaatgat 30300

ccggaaaaga agattccttc tactgcagca aaggcaataa gtctctctcc ataaccggcg 30360

ctgtcatgta tccacttttg agcccaatcg gccttctttt ttacacaagg catcgtttct 30420

atggcattaa agagatagtt tttttcatta ctatctttaa cataagtatc gatcaaaaga 30480

ctatacattt ccgaatgaat gttttcaatg gccatctgaa atccgtagaa acatctagcc 30540

tcggtaatct gtacttctgt acaaaatcgt tccgccaaat tttcattcac tattccgtca 30600

ctggctgcaa aaaacgccaa tacatgtttt ataaaatatt tttcgtctgg tgttagttta 30660

ttccaatcat tgatatcttt agatatatct acttcttcca ctgtccaaaa tgatgcctct 30720

gcctttttat acatgttcca gatgtcataa tattggattg ggaaaataac aaatctattt 30780

ggatttggtg caaggatggg ttccataact aaattaacaa tatcaataaa ttttttttca 30840

gttatctata tgcctgtact tggatttttt gtacatcgat atcgccgcaa tcactacaat 30900

aattacaagt attattgata gcattgttat tagtactatc ataattaaat tatcgacatt 30960

catgggtgct gaataatcgt tattatcatc attatcattt tgtaattgtg acatcatact 31020

aaataaatcg tttgcgagat tgttgtggga agcgggcatg gaggatgcat tatcattatt 31080

atttaacgcc ttccatttgg attcacaaat gttacgcaca ttcaacattt tatggaaact 31140

ataattttgt gaaaacagat aacaagaaaa ctcgttatcg ttcaaatttt taacgatagt 31200

aaaccgatta aacgtcgagc taatttctaa cgctagcgac tctgttggat atgggtttcc 31260

agatatatat cttttcagtt cccctacgta tctataatca tctgtaggaa atggaagata 31320

tttccattta tctactgttc ctaatatcat atgtggtggt gtagtagaac cattaagcgc 31380

gaaagatgtt atttcgcatc gtattttaac ttcgcaataa tttctggtta gataacgcac 31440

tctaccagtc aagtcaatga tattagcctt tacagatata ttcatagtag tcgtaacgat 31500

gactccatct tttagatgcg atactccttt gtatgtacca gaatcttcgt acctcaaact 31560

cgatatattt aaacaagtta atgagatatt aacgcgtttt atgaatgatg atatataacc 31620

agaagtttta tcctcggtgg ctagcgctat aaccttatca ttataatacc aactagtgtg 31680

attaatatgt gacacgttag tgtgggtaca aatatgtaca ttatcgtcta cgtcgtattc 31740

gatacatccg catacagcca acaaatataa aatgacaaat actctaacgc cgttcgtacc 31800

catcttgatg cggtttaata aatgttttga tttcaattta ttgtaaaaaa agattcggtt 31860

ttatactgtt cgatattctc attgcttata ttttcatcta tcatctccac acagtcaaat 31920

ccgtggttag catgcacctc atcaaccggt aaaagactat cggactcttc tatcattata 31980

actctagaat atttaatttg gtcattatta atcaagtcaa ttatcttatt tttaacaaac 32040

gtgagtattt tactcatttt ttataaaaac ttttagaaat atacagactc tatcgtgtgt 32100

ctatatcttc tttttatatc caatgtattt atgtctgatt tttcttcatt tatcatatat 32160

aatggtccaa attctacacg tgcttcggat tcatccagat cattaaggtt cttataattg 32220

taacatcctt ctcttccctc ttctacatct tccttcttat tcttattctt agcgtcacag 32280

aatctaccac agcaggatcc catgacgagc gtcatattaa actaattcat tttcaattat 32340

aatatactgg taatgaccat taaaataaaa atattcttca taaccggtaa gaaagtgaaa 32400

agttcacatt gaaactatgt cagtagtata catcatgaaa tgagatgaaa tgatgatata 32460

tatactctat tttggtggag gattatatga tataattcgt ggataatcat ttttaagaca 32520

catttcttta ttcgtaaatc ttttcacgtt aaatgagtgt ccatattttg caatttcttc 32580

atatgatggc ggtgtacgtg gacgaggctg ctcctgttct tgttgtagtc gccgactgtc 32640

gtgtttgcgt ttagatccct ccattatcgc gattgcgtag atggagtact attatatacc 32700

ttgtaattaa atttttttat taattaaacg tataaaaacg ttccgtatct gtatttaaga 32760

gccagatttc gtctaataga acaaatagct acagtaaaaa taactagaat aattgctaca 32820

cccactagaa accacggatc gtaatacggc aatcggtttt cgataatagg tggaacgtat 32880

attttattta aggacttaac aattgtctgt aaaccacaat ttgcttccgc ggatcctgta 32940

ttaactatct gtaaaagcat atgttgaccg ggcggagccg aacattctcc gatatctaat 33000

ttctgtatat ctataatatt attaacctcc gcatacgcat tacagttctt ttctagcttg 33060

gataccgcac taggtacatc gtctagatct attcctattt cttcagcgat agctcttcta 33120

tccttttccg gaagcaatga aatcacttca ataaatgatt caaccatgag tgtgaaacta 33180

agtcgagaat tactcatgca tttgttagtt attcggagcg cgcaattttt aaactgtcct 33240

ataacctctc ctatatgaat agcacaagtg acattagtag ggatagaatg ttgagctaat 33300

ttttgtaaat aactatctat aaaaagatta tacaaagttt taaactcttt agtttccgcc 33360

atttatccag tctgagaaaa tgtctctcat aataaatttt tccaagaaac taattgggtg 33420

aagaatggaa acctttaatc tatatttatc acagtctgtc ttggtacaca tgatgaattc 33480

ttctaatgct gtactaaatt cgatatcttt ttcgatttct ggatatgttt ttaataaagt 33540

atgaacaaag aaatggaaat cgtaatacca gttatgttta actttgaaat tgttttttat 33600

tttcttgtta atgattccag ccacttggga aaagtcaaag tcgtttaatg ccgatttaat 33660

acgttcatta aaaacaaact ttttatcctt tagatgaatt attattggtt cattggaatc 33720

aaaaagtaag atattatcgg gtttaagatc tgcgtgtaaa aagttgtcgc agcatggtag 33780

ttcgtaaatt ttaatgtata acagagccat ctgtaaaaag ataaacttta tgtattgtac 33840

caaagattta aatcctaatt tgatagctaa ctcggtatct actttatctg cagaatacag 33900

tgctagggga aaaattataa tatttcctct ttcgtattcg tagttagttc tcttttcatg 33960

ttcgaaaaag tgaaacatgc ggttaaaata gtttataaca ttaatattac tgttaataac 34020

tgccgggtaa aagtgggata gtaatttcac gaatttgata ctgtcctttc tctcgttaaa 34080

cgcctttaaa aaaactttag aagaatatct caatgagagt tcctgaccat ccatagtttg 34140

tatcaataat agcaacatat gaagaacccg tttatacaga gtatgtaaaa atgttaattt 34200

atagtttaat cccatggccc acgcacacac gattaatttt ttttcatctc cctttagatt 34260

gttgtataga aatttgggta ctgtgaactc cgccgtagtt tccatgggac tatataattt 34320

tgtggcctcg aatacaaatt ttactacata gttatctatc ttaaagacta taccatatcc 34380

tcctgtagat atgtgataaa aatcgtcgtt tataggataa aatcgtttat ccttttgttg 34440

gaaaaaggat gaattaatgt aatcattctc ttctatcttt agtagtgttt ccctattaaa 34500

attcttaaaa taatttaaca atctaactga cggagcccaa ttttggtgta aatctaattg 34560

ggacattata ttgttaaaat acaaacagtc tcctaatata acagtatctg ataatctatg 34620

gggagacatc cattgatatt caggggatga atcattggca acacccattt attgtacaaa 34680

aagccccaat ttacaaacga aagtccaggt ttgatagaga caaactatta actattttgt 34740

ctctgttttt aatttcttta gtaatgaaat tattcacaat atcagtatct tctttatcta 34800

ccagagattt tactaacttg ataaccttgg ctgtctcatt caatagggta gtaatatttg 34860

tatgtgtgat attgatatct ttttgaattg tttcttttag aagtgattct ttgatggtgc 34920

cagcatacga attacaataa tgcagaaact cggttaacat gcaggaatta tagtaagcca 34980

attccaattg ttgcctgtat tgtattagag tattaatatg cgcaatggtg tccttgcgtt 35040

tctctgatag aatgcgagca gcgattttgg cgttatcatt tgacgatatt tctggaatga 35100

cgaatcctgt ttctactaac tttttggtag gacaaagtga aacaatcaag aagatagctt 35160

ctcctcctat ttgtggaaga aattgaactc ctctagatga tctactgacg atagtatctc 35220

cttgacagat attggaccga attacagaag tacctggaat gtaaagccct gaaaccccct 35280

cattttttaa gcagattgtt gccgtaaatc ctgcactgtg accaagatag agagctcctt 35340

tggtgaatcc atctctatgt ttcagtttaa ccaagaaaca gtcagctggt ctaaaatttc 35400

catctctatc taatacagca tctaacttga tgtcaggaac tatgaccggt ttaatgttat 35460

atgtaacatt gagtaaatcc ttaagttcat aatcatcact gtcatcagtt atgtacgatc 35520

caaacaatgt ttctaccggc atagtggata cgaagatgct atccatcaga atgtttccct 35580

gattagtatt ttctatatag ctattcttct ttaaacgatt ttccaaatca gtaactatgt 35640

tcattttttt aggagtagga cgcctagcca gtatggaaga ggattttcta gatcctctct 35700

tcaacatctt tgatctcaat ggaatgcaaa accccatagt gaaacaacca acgataaaaa 35760

taatattgtt tttcactttt tataatttta ccatctgact catggattca ttaatatctt 35820

tataagagct actaacgtat aattctttat aactgaactg agatatatac accggatcta 35880

tggtttccat aattgagtaa atgaatgctc ggcaataact aatggcaaat gtatagaaca 35940

acgaaattat actagagttg ttaaagttaa tattttctat gagctgttcc aataaattat 36000

ttgttgtgac tgcgttcaag tcataaatca tcttgatact atccagtaaa cagtctttaa 36060

gttctggaat attatcatcc cattgtaaag cccctaattc gactatcgaa tatcctgctc 36120

tgatagcagt ttcaatatcg acggacgtca atactgtaat aaaggtggta gtattgtcat 36180

catcgtgata aactactgga atatggtcgt tagtaggtac ggtaacttta cacaacgcga 36240

tatataactt tccttttgta ccatttttaa cgtagttggg acgtcctgca gggtattgtt 36300

ttgaagaaat gatatcgaga acagatttga tacgatattt gttggattcc tgattattta 36360

ctataatata atctagacag atagatgatt cgataaatag aaaaggtata tcgttggtag 36420

gataatacat ccccattcca gtattctcgg atactctatt aatgacacta gttaagaaca 36480

tgtcttctat tctagaaaac gaaaacatcc tacatggact cattaaaact tctaacgctc 36540

ctgattgtgt ctcgaatgcc tcgtacaagg atttcaagga tgccatagat tctttgacca 36600

acgatttaga attgcgttta gcatctgatt tttttattaa atcgaatggt cggctctctg 36660

gtttgctacc ccaatgataa caatagtctt gtaaagataa accgcaagaa aatttatacg 36720

catccatcca aataacccta gcaccatcgg atgatattaa tgtattatta tagattttcc 36780

atccacagtt attgggccag tatactgtta gcaacggtat atcgaataga ttactcatgt 36840

aacctactag aatgatagtt cgtgtactag tcataatatc tttaatccaa tctaagaaat 36900

ataaaattag atcttttaca ctgttaaagt taacaaaggt attacccgga tacgtggata 36960

tcatatatgg cattggtcca ttatcagtaa tagctccata aactgatacg gcgatggttt 37020

ttatatgtgt ttgatctaac gaggaagaaa ttcgcgccca caattcatct ctagatatgt 37080

atttaatatc aaacggtaac acatcaattt cgggacgcgt atatgtttct aaatttttaa 37140

tccaaatata atgatgacct atatgcccta ttatcatact gtcaactata gtacacctag 37200

agaacttacg atacatctgt ttcctgtaat cgttaaattt tacaaatcta taacatgcta 37260

aaccttttga cgacaaccat tcattaattt ctgatatgga atctgtattc tcgataccgt 37320

attgttctaa agccagtgct atatctccct gttcgtggga acgctttcgt ataatatcga 37380

tcaacggata atctgaagtt tttggagaat aatatgactc atgatctatt tcgtccataa 37440

acaatctaga cataggaatt ggaggcgatg atcttaattt tgtgcaatga gtcgtcaatc 37500

ctataacttc taatcttgta atattcatca tcgacataat actatctatg ttatcatcgt 37560

atattagtat accatgacct tcttcatttc gtgccaaaat gatatacagt cttaaatagt 37620

tacgcaatat ctcaatagtt tcataattgt tagctgtttt catcaagatt tgtaccctgt 37680

ttaacatgat ggcgttctat acgtttctat tttctatttt ttaaattttt aacgatttac 37740

tgtggctaga tacccaatct ctctcaaata tttttttagc ctcgcttaca agctgtttat 37800

ctatactatt aaaactgacg aatccgtgat tttggtaatg ggttccgtcg aaatttgccg 37860

aagtgatatg aacatattcg tcgtcgacta tcaacaattt tgtattattc tgaatagtga 37920

aaaccttcac agatagatca ttttgaacac acaacgcgtc tagacttctg gcggttgcca 37980

tagaatatac gtcgttctta tcccaattac caactagaag tctgatctta actcctctat 38040

taatggctgc ttctataatg gagttgtaaa tgtcgggcca atagtagcta ttaccgtcga 38100

cacgtgtagt gggaactatg gccaaatgtt caatatctat actagtctta gctgacctga 38160

gtttatcaat aactacatcg gtatctagat ctctagaata tcccaatagg tgttccggag 38220

aatcagtaaa gaacactcca cctataggat tcttaatatg atacgcagtg ctaactggca 38280

gacaacaagc cgcagagcat aaattcaacc atgaattttt tgcgctatta aaggctttaa 38340

aagtatcaaa tcttctacga agatctgtgg ccagcggggg ataatcagaa tatacaccta 38400

acgttttaat cgtatgtata gatcctccag taaatgacgc gtttcctaca taacatcttt 38460

catcatctga cacccaaaaa caaccgagta gtagtcccac attatttttt ttatctatat 38520

taacggttat aaaatttata tccgggcagt gactttgtag ctctcccaga tttcttttcc 38580

ctcgttcatc tagcaaaact attattttaa tccctttttc agatgcctct tttagtttat 38640

caaaaataag cgctccccta gtcgtactca gaggattaca acaaaaagat gctatgtata 38700

tatatttctt agctagagtg ataatttcgt taaaacattc aaatgttgtt aaatgatcgg 38760

atctaaaatc catattttct ggtagtgttt ctaccagcct acattttgct cccgcaggta 38820

ccgatgcaaa tggccacatt tagttaacat aaaaacttat acatcctgtt ctatcaacga 38880

ttctagaata tcatcggcta tatcgctaaa attttcatca aagtcgacat cacaacctaa 38940

ctcagtcaat atattaagaa gttccatgat gtcatcttcg tttatttcta tatccgtatc 39000

cattgtagat tgttgaccga ttatcgagtt taaatcatta ctaatactca atccttcaga 39060

atacaatctg tgtttcattg taaatttata ggcggtgtat ttaagttggt agattttcaa 39120

ttatgtatca atatagcaac agtagttctt gctcctcctt gattctagca tcctcttcat 39180

tattttcttc tacgtacata aacatgtcca atacgttaga caacacaccg acgatggcgg 39240

ccgccacaga cacgaatatg actaaaccga tgaccattta aaaacccctc tctagctttc 39300

acttaaactg tatcgattat tcttttagaa catgtataat ataaaaacat tattctattt 39360

cgaatttagg cttccaaaaa tttttcatcc gtaaaccgat aataatatat atagacttgt 39420

taatagtcgg aataaataga ttaatgctta aactatcatc atctccacga ttagagatac 39480

aatatttaca ttctttttgc tgtttcgaaa ctttatcaat acacgttaat acaaacccag 39540

gaaggagata ttgaaactga ggctgttgaa aatgaaacgg tgaatacaat aattcagata 39600

atgtaaaatc atgattccgt attctgatga tattagaact gctaatggat gtcgatggta 39660

tgtatctagg agtatctatt ttaacaaagc atcgatttgc taatatacaa ttatcctttt 39720

gattaattgt tattttattc atattcttaa aaggtttcat atttatcaat tcttctacat 39780

taaaaatttc catttttaat ttatgtagcc ccgcaatact cctcattacg tttcattttt 39840

tgtctataat atccattttg ttcatctcgg tacatagatt atccaattga gaagcgcatt 39900

tagtagtttt gtacatttta agtttattga caaatcgtcg aaaactagtt atagttaaca 39960

ttttattatt tgataccctg atattaatac ccctgccgtt actattattt ataactgatg 40020

taatccacgt aacattagaa ttaattatcg atagtaatgc atcgacgctt ccaaaattgt 40080

ctattataaa ctcaccgata atttttttat tgcatgtttt catattcatt aggattatca 40140

aatctttaat cttattacga ttgtatgcgt tgatattgca agacgtcatt ctaaaagacg 40200

gaggatctcc atcaaatgcc aaacaatcac gtacaaagta catggaaata ggttttgttc 40260

tattgcgcat catagattta tatagaacac ccgtagaaat actaatttgt tttactctat 40320

aaaatactaa tgcatctatt tcatcgtttt gtataacgtc tttccaagtg tcaaattcca 40380

aatttttttc attgatagta ccaaattctt ctatctcttt aactacttgc atagataggt 40440

aattacagtg atgcctacat gccgtttttt gaaactgaat agatgcgtct agaagcgatg 40500

ctacgctagt cacaatcacc actttcatat ttagaatata tgtatgtaaa aatatagtag 40560

aatttcattt tgtttttttc tatgctataa atgaattctc attttgcatc tgctcatact 40620

ccgttttata tcaataccaa agaaggaaga tatttggttc taaaagccgt taaagtatgc 40680

gatgttagaa ctgtagaatg tgaaggaagt aaagcttcct gcgtactcaa agtagataaa 40740

ccctcatcac ccgcgtgtga gagaagacct tcgtcccctt ccagatgcga gagaatgaat 40800

aacccaggaa aacaagttcc gtttatgagg acggacatgc tacaaaatat gttcgcggct 40860

aatcgcgata atgtagcttc tagacttttg tcctaaaata ctattatatc cttttcgata 40920

ttaataaatc cgtgtcgtcc aggtttttta tctctttcag tatgtgaata gataggtatt 40980

ttatctctat tcatcatcga atttaagaga tccgataaac attgtttgta ttctccagat 41040

gtcagcatct gatacaacaa tatatgtgca cataaacctc tggcacttat ttcatgtacc 41100

ttccccttat cactaaggag aatagtattt gagaaatatg tatacatgat attatcatga 41160

attagatata cagaatttgt aacactctcg aaatcacacg atgtgtcggc gttaagatct 41220

aatatatcac tcgataacac attttcatct agatacacta gacatttttt aaagctaaaa 41280

tagtctttag tagtgacagt aactatgcga ttattttcat cgatgataca tttcatcggc 41340

atattattac gcttaccatc aaagactata ccatgtgtat atctaacgta ttctagcatg 41400

gttgccatac gcgcattaaa cttttcagga tctttggata gatcttccaa tctatctatt 41460

tgagaaaaca tttttatcat gttcaatagt tgaaacgtcg gatccactat atagatatta 41520

tctataaaga ttttaggaac tacgttcatg gtatcctggc gaatattaaa actatcaatg 41580

atatgattat cgttttcatc ttttatcacc atatagtttc taagatatgg gattttactt 41640

aatataatat tatttcccgt gataaatttt attagaaagg ccaaatctat aagaaaagtc 41700

ctagaattag tctgaagaat atctatatcg ccgtatagta tatttggatt aattagatat 41760

agagaatatg atccgtaaca tatacaactt ttattatggc gtctaagata ttcttccatc 41820

aacttattaa catttttgac tagggaagat acattatgac gtcccattac ttttgccttg 41880

tctattactg cgacgttcat agaatttagc atatctcttg ccaattcttc cattgatgtt 41940

acattataag aaattttaga tgaaattaca tttggagctt taatagtaag aactcctaat 42000

atgtccgtgt atgtggtcac taatacagat tgtagttcta taatcgtaaa taatttacct 42060

atattatatg tttgagtctg tttagaaaag tagctaagta tacgatcttt tatttctgat 42120

gcagatgtat taacatcgga aaaaaatctt tttttattct tttttactaa agatacaaat 42180

atgtctttgt taaaaacagt tattttttga atatttctag cttgtaattt taacatatga 42240

tattcgttca cactaggtac tctgcctaaa taggtttcta taatctttaa tgtaatatta 42300

ggaaaagtat tctgatcagg attcctattc attttgagga tttaaaactc tgattattgt 42360

ctaatatggt ctctacgcaa actttttcac agagcgatag agtttttgat aactcgtttt 42420

tcttaagaaa tataaaacta ctgtctccag agctcgctct atcttttatt ttatctaatt 42480

cgatacaaac tcctgatact ggttcagaaa gtaattcatt aattttcagt cctttataga 42540

agatatttaa tatagataat acaaaatctt cagtttttga tatcgatctg attgatccta 42600

gaactagata tattaataac gtgctcatta ggcagtttat ggcagcttga taattagata 42660

tagtatattc cagttcatat ttattagata ccgcattgcc cagattttga tattctatga 42720

attcctctga aaataaatcc aaaataacta gacattctat tttttgtgga ttagtgtact 42780

ctcttccctc tatcatgttc actactggtg tccacgatga taaatatcta gagggaatat 42840

aatatagtcc ataggatgcc aatctagcaa tgtcgaataa ctgtaatttt attcttcgct 42900

cttcattatg aattgattct tgaggtataa acctaacaca aattatatta ttagactttt 42960

cgtatgtaat gtctttcatg ttataagttt ttaatcctgg aatagaatct attttaatga 43020

ggcttttaaa cgcagagttc tccaacgagt caaagcataa tactctgttg tttttcttat 43080

atacgatgtt acgattttct tctttgaatg gaataggttt ttgaattagt ttataattac 43140

aacataatag ataaggaagt gtgcaaatag tacgcggaaa aaacataata gctcccctgt 43200

tttcatccat ggttttaagt aaatgatcac tggcttcttt agtcaatgga tattcgaaca 43260

ttaaccgttt catcatcatt ggacagaatc catatttttt aatgtaaaga gtgatcaaat 43320

cattgtgttt attgtaccat cttgttgtaa atgtgtattc ggttatcgga tctgctcctt 43380

tttctattaa agtatcgatg tcgatctcgt ctaagaattc aactatatcg acatatttca 43440

tttgtataca cataaccatt actaacgtag aatgtatagg aagagatgta acgggaacag 43500

ggtttgttga ttcgcaaact attctaatac ataattcttc tgttaatacg tcttgcacgt 43560

aatctattat agatgccaag atatctatat aattattttg taagatgatg ttaactatgt 43620

gatctatata agtagtgtaa taattcatgt attttgatat atgttccaac tctgtctttg 43680

tgatgtctag tttcgtaata tctatagcat cctcaaaaaa tatattcgca tatattccca 43740

agtcttcagt tctatcttct aaaaaatctt caacgtatgg aatataataa tctattttac 43800

ctcttctgat atcattaatg atatagtttt tgacactatc ttctgtcaat tgattcttat 43860

tcactatatc taagaaacgg atagcgtccc taggacgaac tactgccatt aatatctcta 43920

ttatagcttc tggacataat tcatctatta taccagaatt aatgggaact attccgtatc 43980

tatctaacat agttttaaga aagtcagaat ctaagacttg atgttcatat attggttcat 44040

acatgaaatg atctctattg atgatagtga ctatttcatt ctctgaaaat tggtaactca 44100

ttctatatat gctttccttg ttgatgaagg atagaatata ctcaatagaa tttgtaccaa 44160

caaactgttc tcttatgaat cgtatatcat catctgaaat aatcatgtaa ggcatacatt 44220

taacaattag agacttgtct cctgttatca atatactatt cttgtgataa tttatgtgtg 44280

aggcaaattt gtccacgttc tttaattttg ttatagtaga tatcaaatcc aatggagcta 44340

cagttcttgg cttaaacaga tatagttttt ctggaacgaa ttctacaaca ttattataaa 44400

ggactttggg tagataagtg ggatgaaatc ctattttaat taatgcgata gccttgtcct 44460

cgtgcagata tccaaacgct tttgtgatag tatggcattc attgtctaga aacgctctac 44520

gaatatctgt gacagatatc atctttagag aatatactag tcgcgttaat agtactacaa 44580

tttgtatttt ttaatctatc tcaataaaaa aattaatatg tatgattcaa tgtataacta 44640

aactactaac tgttattgat aactagaatc agaatctaat gatgacgtaa ccaagaagtt 44700

tatctactgc caatttagct gcattatttt tagcatctcg tttagatttt ccatctgcct 44760

tatcgaatac tcttccgtcg atatctacac aggcataaaa tgtaggagag ttactaggcc 44820

ccactgattc aatacgaaaa gaccaatctc tcttagttat ttggcagtac tcattaataa 44880

tggtgacagg gttagcatct ttccaatcaa taattttttt agccggaata acatcatcaa 44940

aagacttatg atcctctctc attgattttt cgcgggatac atcatctatt atggcgtcag 45000

ccataacatc agcatccggc ttatccgcct ccgttgtcat aaaccaacga ggaggaatat 45060

cgtcggagct gtacaccata gcactacgtt gaagatcgta cagagcttta ttaacttctc 45120

gcttctccat attaagttgt ctagttagtt gtgcagcagt agctccttcg attccaatgt 45180

ttttaatagc cgcacacaca atctctgcgt cagaacgctc gtcaatatag atcttagaca 45240

tttttagaga gaactaacac aaccagcaat aaaactaatt tattttatca tttttttatt 45300

catcatcctc tggtggttcg tcgtttctat cgaatgtgga tctgattaac ccgtcatcta 45360

taggtgatgc tggttctgga gattctggag gagatggatt attatctgga agaatctctg 45420

ttatttcctt gttttcatgt atcgattgcg ttgtaacatt aagattgcga aatgctctaa 45480

atttgggagg cttaaagtgt tgtttgcaat ctctacacgc atgtctaact agtggaggtt 45540

cgtcagcggc tctagtttga atcatcatcg gcgtagtatt cctactttta cagttaggac 45600

acggtgtatt gtatttctcg tcgagaacgt taaaataatc gttgtaactc acatccttta 45660

ttttatctat attgtattct actcctttct taatgcattt tataccgaat aagagatagc 45720

gaaggaattc tttttcggtg ccgctagtac ccttaatcat atcacatagt gttttatatt 45780

ccaaatttgt ggcaatagac ggtttatttc tatacgatag tttgtttctg gaatcctttg 45840

agtattctat accaatatta ttctttgatt cgaatttagt ttcttcgata ttagattttg 45900

tattacctat attcttgatg tagtactttg atgatttttc catggcccat tctattaagt 45960

cttccaagtt ggcatcatcc acatattgtg atagtaattc tcggatatca gtagcggcta 46020

ccgccattga tgtttgttca ttggatgagt aactactaat gtatacattt tccatttata 46080

acacttatgt attaactttg ttcatttata ttttttcatt attatgttga tattaacaaa 46140

agtgaatata tatatatgtt aataattgta ttgtggttat acggctacaa ttttataatg 46200

agtgaaagtc agtgtccgat gatcaatgac gatagcttta ctctgaaaag aaagtatcaa 46260

atcgatagtg cggagtcaac aataaaaatg gataagaaga ggataaagtt tcagaataga 46320

gccaaaatgg taaaagaaat aaatcagaca ataagagcag cacaaactca ttacgagaca 46380

ttgaaactag gatacataaa atttaagaga atgattagga ctactactct agaagatata 46440

gcaccatcta ttccaaataa tcagaaaact tataaactat tctcggacat ttcagccatc 46500

ggcaaagcat cacagaatcc gagtaagatg gtatatgctc tgctgcttta catgtttccc 46560

aatttgtttg gagatgatca tagattcatt cgttatagaa tgcatccaat gagtaaaatc 46620

aaacacaaga tcttctctcc tttcaaactt aatcttatta gaatattagt ggaagaaaga 46680

ttctataata atgaatgcag atctaataaa tggaaaataa ttggaacaca agttgataaa 46740

atgttgatag ctgaatctga taaatataca atagatgcaa ggtataacct aaaacccatg 46800

tatagaatca agggagaatc tgaagaagat accctcttta tcaaacagat ggtagaacaa 46860

tgtgtgacat cccaggaatt ggtggaaaaa gtgttgaaga tactgtttag agatttgttc 46920

aagagtggag aatacaaagc gtacagatac gatgatgatg tagaaaatgg atttattgga 46980

ttggatacac taaaattaaa cattgttcat gatatagttg aaccatgtat gcctgttcgt 47040

aggccagtgg ctaagatact gtgtaaagaa atggtaaata aatactttga gaatccgcta 47100

catattattg gtaaaaatct tcaagagtgc attgactttg ttagtgaata ggcatttcat 47160

ctttctccaa tactaattca aattgttaaa ttaataatgg atagtataaa tagttattag 47220

tgataaaata gtaaaaataa ttattagaat aagagtgtag tatcatagat aactctcttc 47280

tataaaaatg gattttattc gtagaaagta tcttatatac acagtagaaa ataatataga 47340

ttttttaaag gatgatacat taagtaaagt aaacaatttt accctcaatc atgtactagc 47400

tctcaagtat ctagttagca attttcctca acacgttatt actaaggatg tattagctaa 47460

taccaatttt tttgttttca tacatatggt acgatgttgt aaagtgtacg aagcggtttt 47520

acgacacgca tttgatgcac ccacgttgta cgttaaagca ttgactaaga attatttatc 47580

gtttagtaac gcaatacaat cgtacaagga aaccgtgcat aaactaacac aagatgaaaa 47640

atttttagag gttgccgaat acatggacga attaggagaa cttataggcg taaattatga 47700

cttagttctt aatccattat ttcacggagg ggaacccatc aaagatatgg aaatcatttt 47760

tttaaaactg tttaagaaaa cagacttcaa agttgttaaa aaattaagtg ttataagatt 47820

acttatttgg gcatacctaa gcaagaaaga tacaggcata gagtttgcgg ataatgatag 47880

acaagatata tatactctat ttcaacaaac tggtagaatc gtccatagca atctaacaga 47940

aacgtttaga gattatatct ttcccggaga taagactagc tattgggtgt ggttaaacga 48000

aagtatagct aatgatgcgg atatcgttct taatagacac gccattacca tgtatgataa 48060

aattcttagt tatatatact ctgagataaa acagggacgc gttaataaaa acatgcttaa 48120

gttagtttat atctttgagc ctgaaaaaga tatcagagaa cttctgctag aaatcatata 48180

tgatattcct ggagatatcc tatctattat tgatgcaaaa aacgacgatt ggaaaaaata 48240

ttttattagt ttttataaag ctaattttat taacggtaat acatttatta gtgatagaac 48300

gtttaacgag gacttattca gagttgttgt tcaaatagat cccgaatatt tcgataatga 48360

acgaattatg tctttattct ctacgagtgc tgcggacatt aaacgatttg atgagttaga 48420

tattaataac agttatatat ctaatataat ttatgaggtg aacgatatca cattagatac 48480

aatggatgat atgaagaagt gtcaaatctt taacgaggat acgtcgtatt atgttaagga 48540

atacaataca tacctgtttt tgcacgagtc ggatcccatg gtcatagaga acggaatact 48600

aaagaaactg tcatctataa aatccaagag tagacggctg aacttgttta gcaaaaacat 48660

tttaaaatat tatttagacg gacaattggc tcgtctaggt cttgtgttag atgattataa 48720

aggagacttg ttagttaaaa tgataaacca tcttaagtct gtggaggatg tatccgcatt 48780

cgttcgattt tctacagata aaaaccctag tattcttcca tcgctaatca aaactatttt 48840

agctagttat aatatttcca tcatcgtctt atttcaaagg tttttaagag ataatctata 48900

tcatgtagaa gaattcttgg ataaaagcat ccatctaacc aagacggata agaaatatat 48960

acttcaattg ataagacacg gtagatcata gaacagacca aatatattat taataatttg 49020

tatatacata gatataatta tcacatatta aaaattcaca catttttgat aaatgggaac 49080

tgctgcaaca attcagactc ccaccaaatt aatgaataaa gaaaatgcag aaatgatttt 49140

ggaaaaaatt gttgatcata tagttatgta tattagtgac gaatcaagtg attcagaaaa 49200

taatcctgaa tatattgatt ttcgtaacag atacgaagac tatagatctc tcattataaa 49260

aagtgatcac gagtttgtaa agctatgtaa aaatcatgca gagaaaagtt ctccagaaac 49320

gcaacaaatg attatcaaac acatatacga acaatatctt attccagtat ctgaagtact 49380

attaaaacct ataatgtcca tgggtgacat aattacatat aacggatgta aagacaatga 49440

atggatgcta gaacaactct ctaccctaaa ctttaacaat ctccgcacat ggaactcatg 49500

tagcataggc aatgtaacgc gtctgtttta tacatttttt agttatctga tgaaagataa 49560

actaaatata taagtataat cccattctaa tactttaacc tgatgtatta gcatcttatt 49620

agaatattaa cctaactaaa agacataaca taaaaactca ttacatagtt gataaaaagc 49680

ggtaggatat aaatattatg gctgccaccg ttccgcgttt tgacgacgtg tacaaaaatg 49740

cacaaagaag aattctagat caagaaacat tttttagtag aggtctaagt agaccgttaa 49800

tgaaaaacac atatctattt gataattacg cgtatggatg gataccagaa actgcaattt 49860

ggagtagtag atacgcaaac ttagatgcaa gtgactatta tcccatttcg ttgggattac 49920

ttaaaaagtt cgagtttctc atgtctctat ataaaggtcc tattccagta tacgaagaaa 49980

aagtaaatac tgaattcatt gctaatggat cgttctctgg tagatacgta tcatatcttc 50040

gaaagttttc tgctcttcca acaaacgagt ttattagttt tttgttactg acttccattc 50100

caatctataa tatcttgttc tggtttaaaa atactcagtt tgatattact aaacacacat 50160

tattcagata cgtctataca gataatgcca aacacctggc gttggctagg tatatgcatc 50220

aaacaggaga ctataagcct ttgtttagtc gtctcaaaga gaattatata tttaccggtc 50280

ccgttccaat aggtatcaaa gatataaatc accctaatct tagtagagca agaagtccat 50340

ccgattatga gacattagct aatattagta ctatattgta ctttaccaag tatgatccgg 50400

tattaatgtt tttattgttt tacgtacctg ggtattcaat tactacaaaa attactccag 50460

ccgtagaata tctaatggat aaactgaatc taacaaagag cgacgtacaa ctgttgtaaa 50520

ttattttatg cttcgtaaaa tgtaggtttt gaaccaaaca ttctttcaaa gaatgagatg 50580

cataaaactt tattatccaa tagattgact atttcggacg tcaatcgttt aaagtaaact 50640

tcgtaaaata ttctttgatc actgccgagt ttaaaacttc tatcgataat tgtttcatat 50700

gttttaatat ttacaagttt tttggtccat ggtacattag ccggacaaat atatgcaaaa 50760

taatatcgtt ctccaagttc tatagtttct ggattatttt tattatattc agtaaccaaa 50820

tacatattag ggttatctgc ggatttataa tttgagtgat gcattcgact caacataaat 50880

aattctagag gagacgatct actatcaaat tcggatcgta aatctgtttc taaagaacgg 50940

agaatatcta tacatacctg attagaattc atccgtcctt cagacaacat ctcagacagt 51000

ctggtcttgt atgtcttaat catattctta tgaaacttgg aaacatctct tctagtttca 51060

ctagtacctt tattaattct ctcaggtaca gattttgaat tcgacgatgc cgagtatttc 51120

atcgttgtat atttcttctt cgattgcata atcagattct tatataccgc ctcaaactct 51180

attttaaaat tattaaacaa tactctatta ttaatcagtc gttctaactc ctttgctatt 51240

tctatggact tatctacatc ttgactgtct atctctgtaa acacggagtc ggtatctcca 51300

tacacgctac gaaaacgaaa tctgtaatct ataggcaacg atgttttcac aatcggatta 51360

atatctctat cgtccatata aaatggatta cttaatggat tggcaaaccg taacataccg 51420

ttagataact ctgctccatt tagtaccgat tctagataca agatcattct acgtcctatg 51480

gatgtgcaac tcttagccga agcgtatgag tatagagcac tatttctaaa tcccatcaga 51540

ccatatactg agttggctac tatcttgtac gtatattgca tggaatcata gatggccttt 51600

tcagttgaac tggtagcctg ttttaacatc tttttatatc tggctctctc tgccaaaaat 51660

gttcttaata gtctaggaat ggttccttct atcgatctat cgaaaattgc tatttcagag 51720

atgaggttcg gtagtctagg ttcacaatga accgtaatat atctaggagg tggatatttc 51780

tgaagcaaga gctgattatt tatttcttct tccaatctat tggtactaac aacgacaccg 51840

actaatgttt ccggagatag atttccaaag atacacacat taggatacag actgttataa 51900

tcaaagatta atacattatt actaaacatt ttttgttttg gagcaaatac cttaccgcct 51960

tcataaggaa acttttgttt tgtttctgat ctaactaaga tagttttagt ttccaacaat 52020

agctttaaca gtggaccctt gatgactgta ctcgctctat attcgaatac catggattga 52080

ggaagcacat atgttgacgc acccgcgtct gtttttgttt ctactccata atactcccac 52140

aaatactgac acaaacaagc atcatgaata cagtatctag ccatatctaa agctatgttt 52200

agattataat ccttatacat ctgagctaaa tcaacgtcat cctttccgaa agataattta 52260

tatgtatcat taggtaaagt aggacataat agtacgactt taaatccatt ttcccaaata 52320

tctttacgaa ttactttaca tataatatcc tcatcaacag tcacataatt acctgtggtt 52380

aaaacctttg caaatgcagc ggctttgcct ttcgcgtccg tagtatcgtc accgatgaac 52440

gtcatttctc taactcctct atttaatact ttacccatgc aactgaacgc gttcttggat 52500

atagaatcca atttgtacga atccaatttt tcagattttt gaatgaatga atatagatcg 52560

aaaaatatag ttccattatt gttattaacg tgaaacgtag tattggccat gccgcctact 52620

cccttatgac tagactgatt tctctcataa atacagagat gtacagcttc ctttttgtcc 52680

ggagatctaa agataatctt ctctcctgtt aataactcta gacgattagt aatatatctc 52740

agatcaaagt tatgtccgtt aaaggtaacg acatagtcga acgttagttc caacaattgt 52800

ttagctattc gtaacaaaac tatttcagaa cataaaacta gttctcgttc gtaatccatt 52860

tccattagtg actgtatcct caaacatcct ctatcgacgg cttcttgtat ttcctgttcc 52920

gttaacatct cttcattaat gagcgtaaac aataatcgtt taccacttaa atcgatataa 52980

cagtaacttg tatgcgagat tgggttaata aatacagaag gaaacttctt atcgaagtga 53040

cactctatat ctagaaataa gtacgatctt gggatatcga atctaggtat ttttttagcg 53100

aaacagttac gtggatcgtc acaatgataa catccattgt taatctttgt caaatattgc 53160

tcgtccaacg agtaacatcc gtctggagat atcccgttag aaatataaaa ccaactaata 53220

ttgagaaatt catccatggt ggcattttgt atgctgcgtt tctttggctc ttctatcaac 53280

cacatatctg cgacggagca ttttctatct ttaatatcta gattataact tattgtctcg 53340

tcaatgtcta tagttctcat ctttcccaac ggcctcgcat taaatggagg aggagacaat 53400

gactgatata tttcgtccgt cactacgtaa taaaagtaat gaggaaatcg tataaatacg 53460

gtctcaccat ttcgacatct ggatttcaga tataaaaatc tgttttcacc gtgactttca 53520

aaccaattaa tgcaccgaac atccatttat agaatttaga aatatatttt catttaaatg 53580

aatcccaaac attggggaag agccgtatgg accattattt ttatagtact ttcgcaagcg 53640

ggtttagacg gcaacataga agcgtgtaaa cgaaaactat atactatagt tagcactctt 53700

ccatgtcctg catgtagacg gcacgcgact atcgctatag aggacaataa tgtcatgtct 53760

agcgatgatc tgaattatat ttattatttt ttcatcagat tatttaacaa tttggcatct 53820

gatcccaaat acgcgatcga tgtgacaaag gttaaccctt tataaactta acccattata 53880

aaacttatga ttagtcacga ctgaaataac cgcgtgatta ttttttggta taattctaca 53940

cggcatggtt tctgtgacta tgaattcaac ccccgttaca ttagtgaaat ctttaacaaa 54000

cagcaagggt tcgtcaaaga cataaaactc attgtttaca atcgaaatag accccctatc 54060

acacttaaaa taaaaaatat ccttatcctt taccaccaaa taaaattctg attggtcaat 54120

gtgaatgtat tcacttaaca gttccacaaa tttatttatt aactccgagg cacatacatc 54180

gtcggtattt tttatggcaa actttactct tccagcatcc gtttctaaaa aaatattaac 54240

gagttccatt tatatcatcc aatattattg aaatgacgtt gatggacaaa tgatacaaat 54300

aagaaggtac ggtacctttg tccaccatct cctccaattc atgctctatt ttgtcattaa 54360

ctttaatgta tgaaaacagt acgccacatg cttccatgac agtgtgtaac actttggata 54420

caaaatgttt gacattagta taattgttca agactgtcaa tctataatag atagtagcta 54480

taatatattc tatgatggta ttgaagaaga tgacaacctt ggcatattga tcatttaaca 54540

cagacatggt atcaacagat agcttgaatg aaagagaatc agtaattgga ataagcgtct 54600

tctcgatgga gtgtccgtat accaacatgt ctgatatttt gatgtattcc attaaattat 54660

ttagtttttt ctttttattc tcgttaaaca gcatttctgt caacggaccc caacatcgtt 54720

gaccgattaa gttttgattg atttttccgt gtaaggcgta tctagtcaga tcgtatagcc 54780

tatccaataa tccatcgtct gtgcgtagat cacatcgtac actttttaat tctctataga 54840

agagcgacag acatctggag caattacaga cagcaatttc tttattctct acagatgtaa 54900

gatacttgaa gacattccta tgatgatgca gaattttgga taacacggta ttgatggtat 54960

ctgttaccat aattcctttg atggctgata gtgtcagagc acaagatttc caatctttga 55020

caatttttag caccattatc tttgttttga tatctatatc agacagcatg gtgcgtctga 55080

caacacaagg attaagacgg aaagatgaaa tgattctctc aacatcttca atggatacct 55140

tgctattttt tctggcatta tctatatgtg cgagaatatc ctctagagaa tcagtatcct 55200

ttttgatgat agtggatctc aatgacatgg gacgtctaaa ccttcttatt ctatcaccag 55260

attgcatggt gatttgtctt ctttctttta tcataatgta atctctaaat tcatcggcaa 55320

attgtctata tctaaaatca taatatgaga tgtttacctc tacaaatatc tgttcgtcca 55380

atgttagagt atttacatca gttttgtatt ccaaattaaa catggcaacg gatttaattt 55440

tatattcctc tattaagtcc tcgtcgataa taacagaatg tagataatca tttaatccat 55500

cgtacatggt tggaagatgc tcgttgacaa aatctttaat tgtcttgatg aaggtgggac 55560

tatatctaac atcttgatta ataaaattta taacattgtc cataggatac tttgtaacta 55620

gttttataca catctcttca tcggtaagtt tagacagaat atcgtgaaca ggtggtatat 55680

tatattcatc agatatacga agaacaatgt ccaaatctat attgtttaat atattatata 55740

gatgtagtgt agctcctaca ggaatatctt taactaagtc aatgatttca tcaaccgtta 55800

gatctatttt aaagttaatc atataggcat tgatttttaa aaggtatgta gccttgacta 55860

cattctcatt aattaaccat tccaagtcac tgtgtgtaag aagattatat tctatcataa 55920

gcttgactac atttggtccc gataccatta aagaattctt atgatataag gaaacagatt 55980

ttaggtactc atctactcta caagaatttt ggagagcctt aacgatatca gtgacgttta 56040

ttatttcagg aggaaaaaac ctaacattga gaatatcgga attaatagct tccagataca 56100

gtgattttgg caatagtccg tgtaatccat aatccagtaa cacgagctgg tgcttgctag 56160

acaccttttc aatgtttaat ttttttgaaa taagctttga taaagccttc ctcgcaaatt 56220

ccggatacat gaacatgtcg gcgacatgat taagtattgt tttttcatta tttttatatt 56280

ttctcaacaa gttctcaata ccccaataga tgatagaata tcacccaatg cgtccatgtt 56340

gtctatttcc aacaggtcgc tatatccacc aatagaagtt ttcccaaaaa agattctagg 56400

aacagttcta ccaccagtaa tttgttcaaa atagtcacgc aattcatttt cgggtttaaa 56460

ttctttaata tcgacaattt catacgctcc tcttttgaaa ctaaacttat ttagaatatc 56520

cagtgcattt ctacaaaaag gacatgtata cttgacaaaa attgtcactt tgttattggc 56580

caacctttgt tgtacaaatt cctcggccat tttaatattt aagtgatata aaactatctc 56640

gacttattta actctttagt cgagatatat ggacgcagat agctatatga tagccaacta 56700

cagaaggcaa acgctataaa aaacataatt acgacgagca tatttataaa tatttttatt 56760

cagcattact tgatatagta atattaggca cagtcaaaca ttcaaccact ctcgatacat 56820

taactctctc attttcttta acaaattctg caatatcttc gtaaaaagat tcttgaaact 56880

ttttagaata tctatcgact ctagatgaaa tagcgttcgt caacatacta tgttttgtat 56940

acataaaggc gcccatttta acagtttcta gtgacaaaat gctagcgatc ctaggatcct 57000

ttagaatcac atagattgac gattcgtctc tcttagtaac tctagtaaaa taatcataca 57060

atctagtacg cgaaataata ttatccttga cttgaggaga tctaaacaat ctagttttga 57120

gaacatcgat aagttcatcg ggaatgacat acatactatc tttaatagaa ctcttttcat 57180

ccagttgaat ggattcgtcc ttaaccaact gattaatgag atcttctatt ttatcatttt 57240

ccagatgata tgtatgtcca ttaaagttaa attgtgtagc gcttcttttt agtctagcag 57300

ccaatacttt aacatcacta atatcgatat acaaaggaga tgatttatct atggtattaa 57360

gaattcgttt ttcgacatct gtcaaaacca attccttttt gcctgtatca tccagttttc 57420

catcctttgt aaagaaatta ttttctacta gactattaat aagactgata aggattcctc 57480

cataattgca caatccaaac tttttcacaa aactagactt tacaagatct acaggaatgc 57540

gtacttcagg tttcttagct tgtgattttt tcttttgtgg acattttctt gtgaccaact 57600

catctaccat ttcattgatt ttagcagtga aataagcttt caatgcacgg gcactgatac 57660

tattgaaaac gagttgatct tcaaattccg ccatttaagt tcaccaaaca acttttaaat 57720

acaaatatat caatagtagt agaataagaa ctataaaaaa aataataatt aaccaatacc 57780

aaccccaaca accggtatta ttagttgatg tgactgtttt ctcatcactt agaacagatt 57840

taacaatttc tataaagtct gtcaaatcat cttccggaga ccccataaat acaccaaata 57900

tagcggcgta caacttatcc atttatacat tgaatattgg cttttcttta tcgctatctt 57960

catcatattc atcatcaata tcaacaagtc ccagattacg agccagatct tcttctacat 58020

tttcagtcat tgatacacgt tcactatctc cagagagtcc gataacgtta gccaccactt 58080

ctctatcaat gattagtttc ttgagtgcga atgtaatttt tgtttccgtt ccggatctat 58140

agaaaactac aggtgtgata attgccttgg ccaattgtct ttctctttta ctgagtgatt 58200

ctagttcacc ttctatagat ctgagaatgg atgattctcc agtcgaaaca tattctacca 58260

tggctccgtt taatttgttg atgaagatgg attcatcctt aaatgttttc tctgtaatag 58320

tttccaccga aagactatgc aaagaatttg gaatgcgttc cttgtgctta atgtttccat 58380

agacggcttc tagaagttga tacaacatag gactagccgc ggtaactttt atttttagaa 58440

agtatccatc gcttctatct tgtttagatt tatttttata aagtttagtc tctccttcca 58500

acataataaa agtggaagtc atttgactag ataaactatc agtaagtttt atagagatag 58560

acgaacaatt agcgtattga gaagcattta gtgtaacgta ttcgatacat tttgcattag 58620

atttactaat cgattttgca tactctataa cacccgcaca agtctgtaga gaatcgctag 58680

atgcagtagg tcttggtgaa gtttcaactc tcttcttgat taccttactc atgattaaac 58740

ctaaataatt gtactttgta atataatgat atatattttc actttatctc atttgagaat 58800

aaaaatgttt ttgtttaacc actgcatgat gtacagattt cggaatcaca aaccaccggt 58860

ggttttattt tatccttgtc caatgtgaat tgaatgggag cggatgcggg tttcgtacgt 58920

agatagtaca ttcccgtttt tagaccgaga ctccatccgt aaaaatgcat actcgttagt 58980

ttggaataac tcggatctgc tatatggata ttcatagatt gactttgatc gatgaaggct 59040

cccctgtctg cagccatttt tatgatcgtc ttttgtggaa tttcccaaat agttttataa 59100

actcgcttaa tatcttctgg aaggtttgta ttctgaatgg atccaccatc tgccataatc 59160

ctattcttga tctcatcatt ccataatttt ctctcggtta aaactctaag gagatgcgga 59220

ttaactactt gaaattctcc agacaatact ctccgagtgt aaatattact ggtatacggt 59280

tccaccgact cattatttcc caaaatttga gcagttgatg cagtcggcat aggtgccacc 59340

aataaactat ttctaagacc gtatgttctg attttatctt ttagaggttc ccaattccaa 59400

agatccgacg gtacaacatt ccaaagatca tattgtagaa taccgttact ggcgtacgat 59460

cctacatatg tatcgtatgg tccttccttc tcagctagtt cacaactcgc ctctaatgca 59520

ccgtaataaa tggtttcgaa gatcttctta tttagatctt gtgcttccag gctatcaaat 59580

ggataattta agagaataaa cgcgtccgct aatccttgaa caccaatacc gataggtcta 59640

tgtctcttat tagagatttc agcttctgga ataggataat aattaatatc tataatttta 59700

ttgagatttc tgacaattac tttgaccaca tccttcagtt tgagaaaatc aaatcgccca 59760

tctattacaa acatgttcaa ggcaacagat gccagattac aaacggctac ctcattagca 59820

tccgcatatt gtattatctc agtgcaaaga ttactacact tgatagttcc taaattttgt 59880

tgattactct ttttgttaca cgcatcctta taaagaatga atggagtacc agtttcaatc 59940

tgagattcta taatcgcttt ccagacgact cgagccttta ttatagattt gtatctcctt 60000

tctctttcgt atagtgtata caatcgttcg aactcgtctc cccaaacatt gtccaatcca 60060

ggacattcat ccggacacat caacgaccac tctccgtcat ccttcactcg tttcataaag 60120

agatcaggaa tccaaagagc tataaataga tctctggttc tatgttcctc gtttcctgta 60180

ttctttttaa gatcgaggaa cgccataata tcagaatgcc acggttccaa gtatatggcc 60240

ataactccag gccgtttgtt tcctccctga tctatgtatc tagcggtgtt attataaact 60300

ctcaacattg gaataatacc gtttgatata ccattggtac cggagatata gcttccactg 60360

gcacgaatat tactaattga tagacctatt ccccctgcca ttttagagat taatgcgcat 60420

cgttttaacg tgtcatagat accctctatg ctatcatcga tcatgttaag tagaaaacag 60480

ctagacattt ggtgacgact agttcccgca ttaaataagg taggagaagc gtgcgtaaac 60540

catttttcag aaagtagatt gtacgtctca atagctgagt ctatatccca ttgatgaatt 60600

cctactgcga cacgcattaa catgtgctga ggtctttcaa cgatcttgtt gtttattttc 60660

aacaagtagg atttttccaa agttttaaaa ccaaaatagt tgtatgaaaa gtctcgttcg 60720

taaataataa ccgagttgag tttatcctta tatttgttaa ctatatccat ggtgatactt 60780

gaaataatcg gagaatgttt cccattttta ggattaacat agttgaataa atcctccatc 60840

acttcactaa atagtttttt tgtttccttg tgtagatttg atacggctat tctggcggct 60900

agaatggcat aatccggatg ttgtgtagta caagtggctg ctatttcggc tgccagagtg 60960

tccaattcta ccgttgttac tccattatat attccttgaa taaccttcat agctatttta 61020

ataggatcta tatgatccgt gtttaagcca taacataatt ttctaatacg agacgtgatt 61080

ttatcaaaca tgacattttc cttgtatcca tttcgtttaa tgacaaacat ttttgttggt 61140

gtaataaaaa aattatttaa cttttcatta atagggattt gacgtacgta gcgtacaaaa 61200

tgattgttcc tggtatatag ataaagagtc ctatatattt gaaaatcgtt acggctcgat 61260

taaactttaa tgattgcata gtgaatatat cattaggatt taactccttg actatcaggg 61320

cggcaccaga aattaccatc aaaagcatta atacagttat gcctatcgca gttagaacgg 61380

ttatagcatc caccatttat atctaaaaat tagatcaaag aatatgtgac aaagtcctag 61440

ttgtatattg agaattgaca aaacaatgtt tcttacatat ttttttttta ttagtaaccg 61500

acttaatagt aggaactgga aaactagact tgattattct ataagtatag atacccttcc 61560

aaataatatt ctctttgata aaagttccag aaaatgtaga attttttaaa aagttatctt 61620

ttgctattac caagattgtg tttagacgct tattattaat atgagtgatg aaatccacac 61680

cgcctctaga tatcgccttt atttccacat tagatggtaa atccaatagt gaaactatct 61740

ttttaggaat gtatggactc gcgtttagag gagtgaacgt cttgggcgtc ggaaaggatg 61800

attcgtcaaa cgaataaaca atttcacaaa tggatgttaa tgtattagta ggaaattttt 61860

tgacgctagt ggaattgaag attctaatgg atgatgttct acctatttca tccgataaca 61920

tgttaatttc cgacaccaac ggttttaata tttcgatgat atacggtagt ctctctttcg 61980

gacttatata gcttattcca caatacgagt cattatatac tccaaaaaac aaaataacta 62040

gtataaaatc tgtatcgaat gggaaaaacg aaattatcga cataggtata gaatccggaa 62100

cattgaacgt attaatactt aattcttttt ctgtggtaag taccgatagg ttattgacat 62160

tgtatggttt taaatattct ataacttgag acttgataga tattagtgat gaattgaaaa 62220

ttatttttat caccacgtgt gtttcaggat catcgtcgac gcccgtcaac caaccgaatg 62280

gagtaaaata aatatcatta atatatgctc taaatattag tatttttatt aatcctttga 62340

ttatcatctt ctcgtacgcg aatgattcca tgatcaagag tgatttgaga acatcctccg 62400

gagtattaat gggcttagta aacagtacat cgttgcaata ataaaagtta tccaagttaa 62460

aggatattat gcattcgttt aaagatatca cctcatctga cggagacaat tttttggtag 62520

gttttagaga ctttgaagct acttgtttaa caaagttatt catcgtcgtt tactattcta 62580

tttaattttg tagttaattt atcacatatc acattaattg actttttggt ccacttttcc 62640

atacgtttat attcttttaa tcctgcgtta tccgtttccg ttatatccag tgatagatcg 62700

tgcaggttaa atagaatgct cttaaataat gtcattttct tatccgctaa aaatttaaag 62760

aatgtataaa cctttttcag agatttgaaa ctcttaggtg gtgtcctagt acacaatatc 62820

ataaacaaac taataaacat tccacattca gattccaaca gctgattaac ttctacatta 62880

atacagccta ttttcgctcc aaatgtacat tcgaaaaatc tgaataaaac atcgatgtca 62940

caatttgtat tatccaatac agaatgtctg tgattcgtgt taaaaccatc ggagaaggaa 63000

tagaaataaa aattattata gtggtggaat tcagttggaa tattgcctcc ggagtcataa 63060

aaggatacta aacattgttt tttatcataa attacacatt tccaatgaga caaataacaa 63120

aatccaaaca ttacaaatct agaggtagaa cttttaattt tgtctttaag tatatacgat 63180

aagatatgtt tattcataaa cgcgtcaaat ttttcatgaa tcgctaagga gtttaagaat 63240

ctcatgtcaa attgtcctat ataatccact tcggatccat aagcaaactg agagactaag 63300

ttcttaatac ttcgattgct catccaggct cctctctcag gctctatttt catcttgacg 63360

acctttggat tttcaccagt atgtattcct ttacgtgata aatcatcgat tttcaaatcc 63420

atttgtgaga agtctatcgc cttagatact ttttcccgta gtcgaggttt aaagaaatac 63480

gctaacggta tactagtagg taactcaaag acatcatata tagaatggta acgcgtcttt 63540

aactcgtcgg ttaactcttt cttttgatcg agttcgtcgc tactattggg tctgctcagg 63600

tgccccaact ctactagttc caacatcata ccgataggaa tacaagacac tttgccagcg 63660

gttgtagatt tatcatattt ctccactaca tatccgttac aatttgttaa aaatttagat 63720

acatctatat tgctacataa tccagctagt gaatatatat gacataataa attggtaaat 63780

cctagttctg gtattttact aattactaaa tctgtatatc tttccattta tcatggaaaa 63840

gaatttacca gatatcttct tttttccaaa ctgcgttaat gtattctctt acaaatattc 63900

acaagatgaa ttcagtaata tgagtaaaac ggaacgtgat agtttctcat tggccgtgtt 63960

tccagttata aaacatagat ggcataacgc acacgttgta aaacataaag gaatatacaa 64020

agttagtaca gaagcacgtg gaaaaaaagt atctcctcca tcactaggaa aacccgcaca 64080

cataaaccta accgcgaagc aatatatata cagtgaacac acaataagct ttgaatgtta 64140

tagttttcta aaatgtataa caaatacaga aatcaattcg ttcgatgagt atatattaag 64200

aggactatta gaagctggta atagtttaca gatattttcc aattccgtag gtaaacgaac 64260

agatactata ggtgtactag ggaataagta tccatttagc aaaattccat tggcctcatt 64320

aactcctaaa gcacaacgag agatattttc agcgtggatt tctcatagac ctgtagtttt 64380

aactggagga actggagtgg gtaagacgtc acaggtaccc aagttattgc tttggtttaa 64440

ttatttattt ggtggattct ctactctaga taaaatcact aactttcacg aaagaccagt 64500

cattctatct cttcctagga tagctttagt tagattgcat agcaatacca ttttaaaatc 64560

attgggattt aaggtactag atggatctcc tatttcttta cggtacggat ctataccgga 64620

agaattaata aacaaacaac caaaaaaata tggaattgta ttttctaccc ataagttatc 64680

tctaacaaaa ctatttagtt atggcactct tattatagac gaagttcatg agcatgatca 64740

aataggagat attattatag cagtagcgag aaagcatcat acgaaaatag attctatgtt 64800

tttaatgact gccacgttag aggatgaccg agaacggcta aaagtatttt tacctaatcc 64860

cgcatttata catattcctg gagatacact gtttaaaatt agcgaggtat ttattcataa 64920

taagataaat ccatcttcca gaatggcata catagaagaa gaaaagagaa atttagttac 64980

tgctatacag atgtatactc ctcctgatgg atcatccggt atagtctttg tggcatccgt 65040

tgcacagtgt cacgaatata aatcatattt agaaaaaaga ttaccgtatg atatgtatat 65100

tattcatggt aaggtcttag atatagacga aatattagaa aaagtgtatt catcacctaa 65160

tgtatcgata attatttcta ctccttattt ggaatccagc gttactatac gcaatgttac 65220

acacatttat gatatgggta aagtttttgt ccccgctcct tttggaggat cgcaagaatt 65280

tatttctaaa tctatgagag atcaacgaaa aggaagagta ggaagagtta atcctggtac 65340

atacgtctat ttctatgatc tgtcttatat gaagtctata cagcgaatag attcagaatt 65400

tctacataat tatatattgt acgctaataa gtttaatcta acactccccg aagatttgtt 65460

tataatccct acaaatttgg atattctatg gcgtacaaag gaatatatag actcgttcga 65520

tattagtaca gaaacatgga ataaattatt atccaattat tatatgaaga tgatagagta 65580

tgctaaactt tatgtactaa gtcctattct cgctgaggag ttggataact ttgagaggac 65640

gggagaatta actagtattg tacgagaagc cattttatct ctaaatttac gaattaagat 65700

tttaaatttt aaacataaag atgatgatac gtatatacac ttttgtaaaa tattattcgg 65760

tgtctataac ggaacaaacg ctactatata ttatcataga cctctaacgg gatatatgaa 65820

tatgatttca gatactatat ttgttcctgt agataataac taaaaatcaa actctaatga 65880

ccacatcttt ttttagagat gaaaaatttt ccacatctcc ttttgtagac acgactaaac 65940

attttgcaga aaaaagttta ttagtgttta gataatcgta tacttcatca gtgtagatag 66000

taaatgtgaa cagataaaag gtattcttgc tcaatagatt ggtaaattcc atagaatata 66060

ttaatccttt cttcttgaga tcccacatca tttcaaccag agacgtttta tccaatgatt 66120

tacctcgtac tataccacat acaaaactag attttgcagt gacgtcgtac ctggtattcc 66180

taccaaacaa aattttactt ttagttcttt tagaaaattc taaggtagaa tctctatttg 66240

ccaatatgtc atctatggaa ttaccactag caaaaaatga tagaaatata tattgataca 66300

tcgcagctgg ttttgatcta ctatacttta aaaacgaatc agattccata attgcctgta 66360

tatcatcagc tgaaaaacta tgttttacac gtattccttc ggcatttctt tttaatgata 66420

tatcttgttt agacaatgat aaagttatca tgtccatgag agacgcgtct ccgtatcgta 66480

taaatatttc attagatgtt agacgcttca ttaggggtat acttctataa ggtttcttaa 66540

ttagtccatc atttgttgcg tcaagaacta ctatcggatg ttgttgggta tctctagtgt 66600

tacacatggc cttactaaag tttgggtaaa taactatgat atctctatta attatagatg 66660

catatatttc atttgtcaag gatattagta tcgacttgct atcgtcatta atacgtgtaa 66720

tgtaatcata taaatcatgc gatagccaag gaaaattcaa atagatgttc atcatataat 66780

cgtcgctata attcatatta atactttgac attgactaat ttgtaatata gcctcgccac 66840

gaagaaagct ctcgtattca gtttcatcga taaaggatac cgttaaatat aactggttgc 66900

cgatagtctc atagtctatt aagtggtaag tttcgtacaa atacagaatc cctaaaatat 66960

tatctaatgt tggattaatc tttaccataa ctgtataaaa tggagacgga gtcataacta 67020

ttttaccgtt tgtacttact ggaatagacg aaggaataat ctccggacat gctggtaaag 67080

acccaaatgt ctgtttgaag aaatccaatg ttccaggtcc taatctctta acaaaaatta 67140

cgatattcga tcccgatatc ctttgcattc tatttaccag catatcacga actatattaa 67200

gattatctat catgtctatt ctcccaccgt tatataaatc gcctccgcta agaaacgtta 67260

gtatatccat acaatggaat acttcatttc taaaatagta ttcgttttct aattctttaa 67320

tgtgaaatcg tatactagaa agggaaaaat tatctttgag ttttccgtta gaaaagaacc 67380

acgaaactaa tgttctgatt gcgtccgatt ccgttgctga attaatggat ttacaccaaa 67440

aactcatata acttctagat gtagaagcat tcgctaaaaa attagtagaa tcaaaggata 67500

taagtagatg ttccaacaag tgagcaattc ccaagatttc atctatatca ttctcgaatc 67560

cgaaattaga aattcccaag tagatatcct ttttcatccg atcgttgatg aaaatacgaa 67620

ctttattcgg taagacaatc atttactaag gagtaaaata ggaagtaatg ttcgtatgtc 67680

gttatcatcg tataaattaa aggtgtgttt tttaccatta agtgacatta taattttacc 67740

aatattggaa ttataatata ggtgtatttg cgcactcgcg acggttgatg catcggtaaa 67800

tatagctgta tctaatgttc tagtcggtat ttcatcattt cgctgtctaa taatagcgtt 67860

ttctctatct gtttccatta cagctgcctg aagtttattg gtcggataat atgtaaaata 67920

ataagaaata catacgaata acaaaaataa aataagatat aataaagatg ccatttagag 67980

atctaatttt gtttaacttg tccaaattcc tacttacaga agatgaggaa tcgttggaga 68040

tagtgtcttc cttatgtaga ggatttgaaa tatcttatga tgacttgata acttactttc 68100

cagataggaa ataccataaa tatatttcta aagtatttga acatgtagat ttatcggagg 68160

aattaagtat ggaattccat gatacaactc tgagagattt agtctatctt agattgtaca 68220

agtattccaa gtgtatacgg ccgtgttata aattaggaga taatctaaaa ggcatagttg 68280

ttataaagga caggaatatt tatattagag aagcaaatga tgacttgata gaatatctcc 68340

tcaaggaata cactcctcag atttatacat attctaatga gcgcgtcccc ataactggtt 68400

caaaattaat tctttgtgga ttttctcaag ttacatttat ggcgtataca acgtcgcata 68460

taacaacaaa taaaaaggta gatgttctcg tttccaaaaa atgtatagat gaactagtcg 68520

atccaataaa ttatcaaata cttcaaaatt tatttgataa aggaagcgga acaataaaca 68580

aaatactcag gaagatattt tattcggtaa ccggtggcca aactccataa tttgcttttt 68640

ctatttcgga ttttagaatt tccaaattca ccagcgattt atcggttttg gtgaaatcca 68700

aggatttatt aatgtccaca aatgccattt gttttgtctg tggattgtat ttgaaaatgg 68760

aaacgatgta gttagataga tgcgctgcaa agtttcctat tagggttccg cgctttacgt 68820

cacccagcat acttgaatca ccatccttta aaaaaaatga taagatatca acatggagta 68880

tatcatactc ggattttaat tcttctactg catcactgac attttcacaa atactacaat 68940

acggtttacc gaaaataatc agtacgttct tcatttatgg gtatcaaaaa cttaaaatcg 69000

ttactgctgg aaaataaatc actgacgata ttagatgata atttatacaa agtatacaat 69060

ggaatatttg tggatacaat gagtatttat atagccgtcg ccaattgtgt cagaaactta 69120

gaagagttaa ctacggtatt cataaaatac gtaaacggat gggtaaaaaa gggagggcat 69180

gtaacccttt ttatcgatag aggaagtata aaaattaaac aagacgttag agacaagaga 69240

cgtaaatatt ctaaattaac caaggacaga aaaatgctag aattagaaaa gtgtacatcc 69300

gaaatacaaa atgttaccgg atttatggaa gaagaaataa aggcagaaat gcaattaaaa 69360

atcgataaac tcacatttca aatatattta tctgattctg ataacataaa aatatcattg 69420

aatgagatac taacacattt caacaataat gagaatgtta cattatttta ttgtgatgaa 69480

cgagacgcag aattcgttat gtgtctcgag gctaaaacac atttctctac cacaggagaa 69540

tggccgttga taataagtac cgatcaggat actatgctat ttgcatctac tgataatcat 69600

cctaagatga taaaaaactt aactcaactg tttaaatttg ttccctcggc agaggataac 69660

tatttagcaa aattaacggc gttagtgaat ggatgtgatt tctttcctgg actctatggg 69720

gcatctataa cacccaccaa cttaaacaaa atacaattgt ttagtgattt tacaatcgat 69780

aatatagtca ctagtttggc aattaaaaat tattatagaa agactaactc taccgtagac 69840

gtgcgtaata ttgttacgtt tataaacgat tacgctaatt tagacgatgt ctactcgtat 69900

gttcctcctt gtcaatgcac tgttcaagaa tttatatttt ccgcattaga tgaaaaatgg 69960

aacaatttta aatcatctta tttagagacc gttccgttac cctgccaatt aatgtatgca 70020

ttagaaccac gcaaggagat tgatgtttca gaagttaaaa ctttatcatc ttatatagat 70080

ttcgaaaata ctaaatcaga tatcgatgtt ataaaatcta tatcttcgat cttcggatat 70140

tctaacgaaa actgtaacac tatagtgttc ggcatctata aggataattt actactgagt 70200

ataaatagtt cattttactt taacgatagt ctgttaataa ccaatactaa aagtgataat 70260

ataataaata taggttacta gattaaaaat ggtgttccaa ctcgtgtgct ctacatgcgg 70320

caaagatatt tctcacgaac gatataaatt gattatacga aaaaaatcat taaaggatgt 70380

actcgtcagt gtaaagaacg aatgttgtag gttaaaatta tctacacaaa tagaacctca 70440

acgtaactta acagtgcaac ctctattgga tataaactaa tatggatccg gttaatttta 70500

tcaagacata tgcgcctaga ggttctatta tttttattaa ttataccatg tcattaacaa 70560

gtcatttgaa tccatcgata gaaaaacatg tgggtattta ttatggtacg ttattatcgg 70620

aacacttggt agttgaatct acctatagaa aaggagttcg aatagtccca ttggatagtt 70680

tttttgaagg atatcttagt gcaaaagtat acatgttaga gaatattcaa gttatgaaaa 70740

tagcagctga tacgtcatta actttattgg gtattccgta tggatttggt catgatagaa 70800

tgtattgttt taaattggta gctgaatgtt ataaaaatgc cggtattgat acatcgtcta 70860

aacgaatatt aggtaaagat atttttctga gccaaaactt cacagatgat aatagatgga 70920

taaagatata tgattctaat aatttaacat tttggcaaat tgattacctt aaagggtgag 70980

ttaatatgca taactactcc tccgttgttt tttccctcgt tctttttctt aacgttgttt 71040

gccatcactc tcataatgta aagatattct aaaatggtaa acttttgcat atcggacgca 71100

gaaattggta taaatgttgt aattgtatta tttcccgtca atggactagt cacagctcca 71160

tcagttttat atcctttaga gtatttctca ctcgtgtcta acattctaga gcattccatg 71220

atctgtttat cgttgatatt ggccggaaag atagattttt tattttttat tatattacta 71280

ttggcaattg tagatataac ttctggtaaa tatttttcta ccttttcaat ctcttctatt 71340

ttcaagccgg ctatatattc tgctatattg ttgctagtat caataccttt tctggctaag 71400

aagtcatatg tggtattcac tatatcagtt ttaactggta gttccattag cctttccact 71460

tctgcagaat aatcagaaat tggttcttta ccagaaaatc cagctactat aataggctca 71520

ccgatgatca ttggcaaaat cctatattgt accagattaa tgagagcata tttcatttcc 71580

aataattctg ctagttcttg agacattgat ttatttgatg aatctagttg gttctctaga 71640

tactctacca tttctgccgc atacaataac ttgttagata aaatcagggt tatcaaagtg 71700

tttagcgtgg ctagaatagt gggcttgcat gtattaaaga atgcggtagt atgagtaaac 71760

cgttttaacg aattatatag tctccagaaa tctgtggcgt tacatacatg agccgaatga 71820

catcgaagat tgtccaatat ttttaatagc tgctctttgt ccattatttc tatatttgac 71880

tcgcaacaat tgtagatacc attaatcacc gattcctttt tcgatgccgg acaatagcac 71940

aattgtttag ctttggactc tatgtattca gaattaatag atatatctct taatacagat 72000

tgcactatac attttgaaac tatgtcaaaa attgtagaac gacgctgttc tgcagccatt 72060

taactttaaa taatttacaa aaatttaaaa tgagcatccg tataaaaatc gataaactgc 72120

gccaaattgt ggcatatttt tcagagttca gtgaagaagt atctataaat gtagactcga 72180

cggatgagtt aatgtatatt tttgccgcct tgggcggatc tgtaaacatt tgggccatta 72240

tacctctcag tgcatcagtg ttctaccgcg gagccgaaaa cattgtgttt aatcttcctg 72300

tgtccaaggt aaaatcgtgt ttgtgtagtt ttcacaatga tgccatcata gatatagaac 72360

ctgatctgga aaataatcta gtaaaacttt ctagttatca tgtagtaagt gtcgattgta 72420

acaaggaact gatgcctatt aggacagata ctactatttg tctaagtata gatcaaaaga 72480

aatcttacgt gtttaatttt cacaagtatg aagaaaaatg ttgtggtaga accgtcattc 72540

atttagaatg gttgttgggc tttatcaagt gtattagtca gcatcagcat ttggctatta 72600

tgtttaaaga tgacaatatt attatgaaga ctcctggtaa tactgatgcg ttttccaggg 72660

aatattctat gactgaatgt tctcaagaac tacaaaagtt ttctttcaaa atagctatct 72720

cgtctctcaa caaactacga ggattcaaaa agagagtcaa tgtttttgaa actagaatcg 72780

taatggataa tgacgataac attctaggaa tgttgttttc ggatagagtt caatccttta 72840

agatcaacat ctttatgacg tttttagatt aatactttca atgagataaa tatgggtggc 72900

ggagtaagtg ttgagctccc taaacgggat ccgcctccgg gagtacccac tgatgagatg 72960

ttattaaacg tggataaaat gcatgacgtg atagctcccg ctaagctttt agaatatgtg 73020

catataggac cactagcaaa agataaagag gataaagtaa agaaaagata tccagagttt 73080

agattagtca acacaggacc cggtggtctt tcggcattgt taagacaatc gtataatgga 73140

accgcaccca attgctgtcg cacttttaat cgtactcatt attggaagaa ggatggaaag 73200

atatcagata agtatgaaga gggtgcagta ttagaatcgt gttggccaga cgttcacgac 73260

accggaaaat gcgatgttga tttattcgac tggtgtcagg gggatacgtt cgatagaaac 73320

atatgccatc agtggatcgg ttcagccttt aataggagta atagaactgt agagggtcaa 73380

caatcgttaa taaatctgta taataagatg caaacattat gtagtaaaga tgctagtgta 73440

ccaatatgtg aatcattttt gcatcattta cgcgcacaca atacagaaga tagcaaagag 73500

atgatcgatt atattctaag acaacagtct gcggacttta aacagaaata tatgagatgt 73560

agttatccca ctagagataa gttagaagag tcattaaaat atgcggaacc tcgagaatgt 73620

tgggatccag agtgttcgaa tgccaatgtt aatttcttgc taacacgtaa ttataataat 73680

ttaggacttt gcaatattgt acgatgtaat actagcgtga acaacttaca gatggataaa 73740

acttcctcat taagattgtc atgtggatta agcaatagtg atagattttc tactgttccc 73800

gtcaatagag caaaagtagt tcaacataat attaaacact cgttcgacct aaaattgcat 73860

ttgatcagtt tattatctct cttggtaata tggatactaa ttgtagctat ttaaatgggt 73920

gccgcggcaa gcatacagac gacggtgaat acactcagcg aacgtatctc gtctaaatta 73980

gaacaagaag cgaatgctag tgctcaaaca aaatgtgata tagaaatcgg aaatttttat 74040

atccgacaaa accatggatg taacctcact gttaaaaata tgtgctctgc ggacgcggat 74100

gctcagttgg atgctgtgtt atcagccgct acagaaacat atagtggatt aacaccggaa 74160

caaaaagcat acgtgccagc tatgtttact gctgcgttaa acattcagac gagtgtaaac 74220

actgttgtta gagattttga aaattatgtg aaacagactt gtaattctag cgcggtcgtc 74280

gataacaaat taaagataca aaacgtaatc atagatgaat gttacggagc cccaggatct 74340

ccaacaaatt tggaatttat taatacagga tctagcaaag gaaattgtgc cattaaggcg 74400

ttgatgcaat tgacgactaa ggccactact caaatagcac ctaaacaagt tgctggtaca 74460

ggagttcagt tttatatgat tgttatcggt gttataatat tggcagcgtt gtttatgtac 74520

tatgccaagc gtatgttgtt cacatccacc aatgataaaa tcaaacttat tttagccaat 74580

aaggaaaacg tccattggac tacttacatg gacacattct ttagaacttc tccgatggtt 74640

attgctacca cggatatgca aaactgaaaa tatattgata atattttaat agattaacat 74700

ggaagttatc actgatcgtc tagacgatat agtgaaacaa aatatagcgg atgaaaaatt 74760

tgtagatttt gttatacacg gtctagagca tcaatgtcct gctatacttc gaccattaat 74820

taggttgttt attgatatac tattatttgt tatagtaatt tatattttta cggtacgtct 74880

agtaagtaga aattatcaaa tgttgttggc gttggtggcg ctagtcatca cattaactat 74940

tttttattac tttatactat aatagtacta gactgacttc taacaaacat ctcacctgcc 75000

ataaataaat gcttgatatt aaagtcttct atttctaaca ctattccatc tgtggaaaat 75060

aatactctga cattatcgct aattgacaca tcggtgagtg atatgcctat aaagtaataa 75120

tcttctttgg gcacatatac cagtgtacca ggttctaaca acctatttac tggtgctcct 75180

atagcatact ttttctttac cttgagaata tccatcgttt gcttggtcaa tagcgatatg 75240

tgatttttta tcaaccactc gaaaaagtaa ttggagtgtt catatcctct acgggctatt 75300

gtctcatggc cgtgtatgaa atttaagtaa cacgactgtg gtagatttgt tctatagagc 75360

cggttgccgc aaatagatag aactaccaat atgtctgtac aaatgttaaa cattaattga 75420

ttaacagaaa aaacaatgtt cgttctggga atagaaacca gatcaaaaca aaattcgtta 75480

gaatatatgc cacgtttata cattgaatat aaaataacta cagtttgaaa aataacagta 75540

tcatttaaac atttaacttg cggggttaat ctcacaactt tactgttttt gaactgttca 75600

aaatatagca tagatccgtg agaaatacgt ttagccgcct ttaatagagg aaatcccacc 75660

gcctttctgg atctcaccaa cgacgatagt tctgaccagc aactcatttc ttcatcatcc 75720

acctgtttta acatataata ggcaggagat agatatccgt cattgcaata ttccttctcg 75780

taggcacaca atctaatatt gataaaatct ccattctctt ctctgcattt attatcttgt 75840

ttcggtggct gattaggctg tagtcttggt ttaggctttg gtatatcgtt gttgaatcta 75900

ttttggtcat taaatctttc atttcttcct ggtatatttt tatcacctcg tttggttgga 75960

tttttgtcta tattatcgtt tgtaacatcg gtacgggtat tcatttatca caaaaaaaac 76020

ttctctaaat gagtctactg ctagaaaacc tcatcgaaga agataccata ttttttgcag 76080

gaagtatatc tgagtatgat gatttacaaa tggttattgc cggcgcaaaa tccaaatttc 76140

caagatctat gctttctatt tttaatatag tacctagaac gatgtcaaaa tatgagttgg 76200

agttgattca taacgaaaat atcacaggag caatgtttac cacaatgtat aatataagaa 76260

acaatttggg tctaggagat gataaactaa ctattgaagc cattgaaaac tatttcttgg 76320

atcctaacaa tgaagttatg cctcttatta ttaataatac ggatatgact gccgtcattc 76380

ctaaaaaaag tggtaggaga aagaataaga acatggttat cttccgtcaa ggatcatcac 76440

ctatcttgtg tattttcgaa actcgtaaaa agattaatat ttataaagaa aatatggaat 76500

ccgcgtcgac tgagtataca cctatcggag acaacaaggc tttgatatct aaatatgcgg 76560

gaattaatgt cctgaatgtg tattctcctt ccacatccat gagattgaat gccatttacg 76620

gattcaccaa taaaaataaa ctagagaaac ttagtactaa taaggaacta gaatcgtata 76680

gttctagccc tcttcaagaa cccattaggt taaatgattt tctgggacta ttggaatgtg 76740

ttaaaaagaa tattcctcta acagatattc cgacaaagga ttgattacta taaatggaga 76800

atgttcctaa tgtatacttt aatcctgtgt ttatagagcc cacgtttaaa cattctttat 76860

taagtgttta taaacacaga ttaatagttt tatttgaagt attcgttgta ttcattctaa 76920

tatatgtatt ttttagatct gaattaaata tgttctttat gcctaaacga aaaatacccg 76980

atcctattga tagattacga cgtgctaatc tagcgtgtga agacgataaa ttaatgatct 77040

atggattacc atggatgaca actcaaacat ctgcgttatc aataaatagt aaaccgatag 77100

tgtataaaga ttgtgcaaag cttttgcgat caataaatgg atcacaacca gtatctctta 77160

acgatgttct tcgcagatga tgattcattt tttaagtatt tggctagtca agatgatgaa 77220

tcttcattat ctgatatatt gcaaatcact caatatctag actttctgtt attattattg 77280

atccaatcaa aaaataaatt agaagccgtg ggtcattgtt atgaatctct ttcagaggaa 77340

tacagacaat tgacaaaatt cacagacttt caagatttta aaaaactgtt taacaaggtc 77400

cctattgtta cagatggaag ggtcaaactt aataaaggat atttgttcga ctttgtgatt 77460

agtttgatgc gattcaaaaa agaatcctct ctagctacca ccgcaataga tcctattaga 77520

tacatagatc ctcgtcgtga tatcgcattt tctaacgtga tggatatatt aaagtcgaat 77580

aaagtgaaca ataattaatt ctttattgtc atcatgaacg gcggacatat tcagttgata 77640

atcggcccca tgttttcagg taaaagtaca gaattaatta gacgagttaa acgttatcaa 77700

atagctcaat ataaatgcgt gactataaaa tattctaacg ataatagata cggaacggga 77760

ctatggacgc atgataagaa taattttgaa gcattggaag caactaaact atgcgatgtt 77820

ttggaattaa ttacagattt ctccgtgata ggtatcgatg aaggacagtt ctttccagac 77880

attgttgaat tctgtgagcg tatggcaaac gaaggaaaaa tagttatagt agccgcactc 77940

gatgggacat ttcaacgtaa accgtttaat aatattttga atcttattcc attatctgaa 78000

atggtggtaa aactaactgc tgtgtgtatg aaatgcttta aggaggcttc cttttctaaa 78060

cgattgggtg aggaaaccga gataaaaata ataggaggta atgatatgta tcaatcggtg 78120

tgtagaaagt gttacatcga ctcataatat tatatttttt atctaaaaaa ctaaaaataa 78180

acattgatta aattttaata taatacttaa aaatggatgt tgtgtcgtta gataaaccgt 78240

ttatgtattt tgaggaaatt gataatgagt tagattacga accagaaagt gcaaatgagg 78300

tcgcaaaaaa actgccgtat caaggacagt taaaactatt actaggagaa ttattttttc 78360

ttagtaagtt acagcgacac ggtatattag atggtgccac cgtagtgtat ataggatctg 78420

ctcccggtac acatatacgt tatttgagag atcatttcta taatttagga gtgatcatca 78480

aatggatgct aattgacggc cgccatcatg atcctatttt aaatggattg cgtgatgtga 78540

ctctagtgac tcggttcgtt gatgaggaat atctacgatc catcaaaaaa caactgcatc 78600

cttctaagat tattttaatt tctgatgtga gatccaaacg aggaggaaat gaacctagta 78660

cggcggattt actaagtaat tacgctctac aaaatgtcat gattagtatt ttaaaccccg 78720

tggcgtctag tcttaaatgg agatgcccgt ttccagatca atggatcaag gacttttata 78780

tcccacacgg taataaaatg ttacaacctt ttgctccttc atattcagct gaaatgagat 78840

tattaagtat ttataccggt gagaacatga gactgactcg agttaccaaa ttagacgctg 78900

taaattatga aaaaaagatg tactacctta ataagatcgt ccgtaacaaa gtagttgtta 78960

actttgatta tcctaatcag gaatatgact attttcacat gtactttatg ctgaggaccg 79020

tgtactgcaa taaaacattt cctactacta aagcaaaggt actatttcta caacaatcta 79080

tatttcgttt cttaaatatt ccaacaacat caactgaaaa agttagtcat gaaccaatac 79140

aacgtaaaat atctagcaaa aattctatgt ctaaaaacag aaatagcaag agatccgtac 79200

gcggtaataa atagaaacgt gctactgaga tatactaccg atatagagta taatgattta 79260

gttactttaa taaccgttag acataaaatt gattctatga aaactgtgtt tcaggtattt 79320

aacgaatcat ccataaatta tactccggtt gatgatgatt atggagaacc aatcattata 79380

acatcgtatc ttcaaaaagg tcataacaag tttcctgtaa attttctata catagatgtg 79440

gtaatatctg acttatttcc tagctttgtt agactagata ctacagaaac taatatagtt 79500

aatagtgtac tacaaacagg tgatggtaaa aagactcttc gtcttcccaa aatgttagag 79560

acggaaatag ttgtcaagat tctctatcgc cctaatatac cattaaaaat tgttagattt 79620

ttccgcaata acatggtaac tggagtagag atagccgata gatctgttat ttcagtcgct 79680

gattaatcaa ttagtagaga tgagataaga acattataat aatcaataat atatcttata 79740

tcttatatct tatatcttat atcttgttta gaaaaatgct aatattaaaa tagctaacgc 79800

tagtaatcca atcggaagcc atttgatatc tataataggg tatctaattt cctgatttaa 79860

atagcggaca gctatattct cggtagctac tcgtttggaa tcacaaacat tatttacatc 79920

taatttacta tctgtaatgg aaacgtttcc caatgaaatg gtacaatccg atacattgca 79980

ttttgttata ttttttttta aagaggctgg taacaacgca tcgcttcgtt tacatggctc 80040

gtaccaacaa taatagggta atcttgtatc tattcctatc cgtactatgc ttttatcagg 80100

ataaatacat ttacatcgta tatcgtcttt gttagcatca cagaatgcat aaatttgttc 80160

gtccgtcatg ataaaaattt aaagtgtaaa tataactatt atttttatag ttgtaataaa 80220

aagggaaatt tgattgtata ctttcggttc tttaaaagaa actgacttga taaaaatggc 80280

tgtaatctct aaggttacgt atagtctata tgatcaaaaa gagattaatg ctacagatat 80340

tatcattagt catgttaaaa atgacgacga tatcggtacc gttaaagatg gtagactagg 80400

tgctatggat ggggcattat gtaaaacttg tgggaaaacg gaattggaat gtttcggtca 80460

ctggggtaaa gtaagtattt ataaaactca tatagttaag cctgaattta tttcagaaat 80520

tattcgttta ctgaatcata tatgtattca ctgcggatta ttgcgttcac gagaaccgta 80580

ttccgacgat attaacctaa aagagttatc gggacacgct cttaggagat taaaggataa 80640

aatattatcc aagaaaaagt catgttggaa cagcgaatgt atgcaaccgt atcaaaaaat 80700

tactttttca aagaaaaagg tttgtttcgt caacaagttg gatgatatta acgttcctaa 80760

ttctctcatc tatcaaaagt taatttctat tcatgaaaag ttttggccat tattagaaat 80820

tcatcaatat ccagctaact tattttatac agactacttt cccatccctc cgctgattat 80880

tagaccggct attagttttt ggatagatag tatacccaaa gaaaccaatg aattaactta 80940

cttattaggt atgatcgtta agaattgtaa cttgaatgct gatgaacagg ttatccagaa 81000

ggcggtaata gaatacgatg atattaaaat tatttctaat aacactacca gtatcaattt 81060

atcatatatc acatccggca aaaataatat gattagaagt tatatcgtcg cccggcgaaa 81120

agatcagacc gctagatctg taattggtcc cagtacatct atcaccgtta atgaggtagg 81180

aatgcccgca tatattagaa atacacttac agaaaagata tttgttaatg cctttacagt 81240

ggataaagtt aaacaactat tagcgtcaaa ccaagttaaa ttttacttta ataaacgatt 81300

aaaccaatta acaagaatac gccaaggaaa gtttatcaaa aataaaatac atttattgcc 81360

tggtgattgg gtagaagtag ctgttcaaga atatacaagt attatttttg gaagacagcc 81420

gtctctacat agatacaacg tcatcgcttc atctatcaga gctaccgaag gagatactat 81480

caaaatatct cccggaattg ccaactctca aaatgctgat ttcgacgggg atgaggaatg 81540

gatgatatta gaacaaaatc ctaaagctgt aattgaacaa agtattctta tgtatccgac 81600

gacgttactc aaacacgata ttcatggagc ccccgtttat ggatctattc aagatgaaat 81660

cgtagcagcg tattcattgt ttaggataca agatctttgt ttagatgaag tattgaacat 81720

cttggggaaa tatggaagag agttcgatcc taaaggtaaa tgtaaattca gcggtaaaga 81780

tatctatact tacttgatag gtgaaaagat taattatccg ggtctcttaa aggatggtga 81840

aattattgca aacgacgtag atagtaattt tgttgtggct atgaggcatc tgtcattggc 81900

tggactctta tccgatcata agtcgaacgt ggaaggtatc aactttatta tcaagtcatc 81960

ttatgttttt aagagatatc tatctattta cggttttggg gtgacattca aagatctgag 82020

accaaattcg acgttcacta ataaattgga ggccatcaac gtagaaaaaa tagaacttat 82080

caaagaagca tacgccaaat atctcaacga tgtaagagac gggaaaatag ttccattatc 82140

taaagcttta gaggcggact atgtggaatc catgttatcc aacttgacaa atcttaatat 82200

ccgagagata gaagaacata tgagacaaac gctgatagat gatccagata ataacctcct 82260

gaaaatggcc aaagcgggtt ataaagtaaa tcctacagaa ctaatgtata ttctaggtac 82320

gtatggacaa caaaggattg atggtgaacc agcagagact cgagtattgg gtagagtctt 82380

accttactat cttccagact ctaaggatcc agaaggaaga ggttacattc ttaattcttt 82440

aacaaaagga ttaacgggtt ctcaatatta cttttcgatg ctggttgcaa gatctcaatc 82500

tactgatatc gtctgtgaaa catcacgtac cggaacactg gctagaaaaa tcattaaaaa 82560

gatggaggat atggtggtcg acggatacgg acaagtagtt ataggtaata cgctcatcaa 82620

gtacgccgcc aattatacca aaattctagg ctcagtatgt aaacctgtag atcttatcta 82680

tccagatgag tccatgactt ggtatttgga aattagtgct ctgtggaata aaataaaaca 82740

gggattcgtt tactctcaga aacagaaact tgcaaagaag acattggcgc cgtttaattt 82800

cctagtattc gtcaaaccca ccactgagga taatgctatt aaggttaagg atctgtacga 82860

tatgattcat aacgtcattg atgatgtgag agagaaatac ttctttacgg tatctaatat 82920

agattttatg gagtatatat tcttgacgca tcttaatcct tctagaatta gaattacaaa 82980

agaaacggct atcactatct ttgaaaagtt ctatgaaaaa ctcaattata ctctaggtgg 83040

tggaactcct attggaatta tttctgcaca ggtattgtct gagaagttta cacaacaagc 83100

cctgtccagt tttcacacta ctgaaaaaag tggtgccgtc aaacaaaaac ttggtttcaa 83160

cgagtttaat aacttgacta atttgagtaa gaataagacc gaaattatca ctctggtatc 83220

cgatgatatc tctaaacttc aatctgttaa gattaatttc gaatttgtat gtttgggaga 83280

attaaatcca gacatcactc ttcgaaaaga aacagatagg tatgtagtag atataatagt 83340

caatagatta tacatcaaga gagcagaaat taccgaatta gtcgtcgaat atatgattga 83400

acgatttatc tcctttagcg tcattgtaaa ggaatggggt atggaaacat tcattgagga 83460

tgaggataat attagattta ctgtctacct aaatttcgtt gaaccggaag aattgaatct 83520

tagtaagttt atgatggttc ttccgggtgc cgccaacaag ggcaagatta gtaaattcaa 83580

gattcctatc tctgactata cgggatatga cgacttcaat caaacaaaaa agctcaataa 83640

gatgactgta gaactcatga atctaaaaga attgggttct ttcgatttgg aaaacgtcaa 83700

cgtgtatcct ggagtatgga atacatacga tatcttcggt atcgaggccg ctcgtgaata 83760

cttgtgcgaa gccatgttaa acacctatgg agaagggttc gattatctgt atcagccttg 83820

tgatcttctc gctagtttac tatgtgctag ttacgaacca gaatcagtga ataaattcaa 83880

gttcggcgca gctagtactc ttaagagagc tacgttcgga gacaataaag cattgttaaa 83940

cgcggctctt cataaaaagt cagaacctat taacgataat agtagctgcc acttttttag 84000

caaggtccct aatataggaa ctggatatta caaatacttt atcgacttgg gtcttctcat 84060

gagaatggaa aggaaactat ctgataagat atcttctcaa aagatcaagg aaatggaaga 84120

aacagaagac ttttaattct tatcaataac atatttttct atgatctgtc ttttaaacga 84180

tggattttcc acaaatgcgc ctctcaagtc cctcatagaa tgatacacgt ataaaaaata 84240

tagcataggc aatgactcct tatttttaga cattagatat gccaaaatca tagccccgct 84300

tctatttact cccgcagcac aatgaaccaa cacgggctcg tttcgttgat cacatttaga 84360

taaaaaggcg gttacgtcgt caaaatattt actaatatcg gtagttgtat catctaccaa 84420

cggtatatga ataatattaa tattagagtt aggtaatgta tatttatcca tcgtcaaatt 84480

taaaacatat ttgaacttaa cttcagatga tggtgcatcc atagcatttt tataatttcc 84540

caaatacaca ttattggtta cccttgtcat tatagtggga gatttggctc tgtgcatatc 84600

tccagttgaa cgtagtagta agtatttata caaacttttc ttatccattt ataacgtaca 84660

aatggataaa actactttat cggtaaacgc gtgtaattta gaatacgtta gagaaaaggc 84720

tatagtaggc gtacaagcag ccaaaacatc aacacttata ttctttgtta ttatattggc 84780

aattagtgcg ctattactct ggtttcagac gtctgataat ccagtcttta atgaattaac 84840

gagatatatg cgaattaaaa atacggttaa cgattggaaa tcattaacgg atagcaaaac 84900

aaaattagaa agtgatagag gtagacttct agccgctggt aaggatgata tattcgaatt 84960

caaatgtgtg gatttcggcg cctattttat agctatgcga ttggataaga aaacatatct 85020

gccgcaagct attaggcgag gtactggaga cgcgtggatg gttaaaaagg cggcaaaggt 85080

cgatccatct gctcaacaat tttgtcagta tttgataaaa cacaagtcta ataatgttat 85140

tacttgtggt aatgagatgt taaatgaatt aggttatagc ggttatttta tgtcaccgca 85200

ttggtgttcc gattttagta atatggaata gtgttagata aatgcggtaa cgaatgttcc 85260

tgtaaggaac cataacagtt tagatttaac gttaaagatg agcataaaca taataaacaa 85320

aattacaatc aaacctataa cattaatatc aaacaatcca aaaaatgaaa tcagtggagt 85380

agtaaacgcg tacataactc ctggataacg tttagtagct gccgttccta ttctagacca 85440

aaaattcggt ttcatgtttt cgaaacggtg ttctgcaaca agtcggggat cgtgttctac 85500

atatttggcg gcattatcca gtatctgcct attgatcttc atttcgtttt caattctggc 85560

tatttcaaaa taaaatcccg atgatagacc tccagacttt ataatttcat ctacgatgtt 85620

cagcgccgta gtaactctaa taatataggc tgataagcta acatcatacc ctcctgtata 85680

tgtgaatatg gcatgatttt tgtccattac aagctcggtt ttaactttat tgcctgtaat 85740

aatttctctc atctgtagga tatctatttt tttgtcatgc attgccttca agacgggacg 85800

aagaaacgta atatcctcaa taacgttatc gttttctaca ataactacat attctacctt 85860

tttattttct aactcggtaa aaaaattaga atcccatagg gctaaatgtc tagcgatatt 85920

tcttttcgtt tcctctgtac acatagtgtt acaaaaccct gaaaagaagt gagtatactt 85980

gtcatcattt ctaatgtttc ctccagtcca ctgtataaac gcataatcct tgtaatgatc 86040

tggatcatcc ttgactacca caacatttct tttttctggc ataacttcgt tgtcctttac 86100

atcatcgaac ttctgatcat taatatgctc atgaacatta ggaaatgttt ctgatggaag 86160

tctatcaata actggcacaa caataacagg agttttcgcc gccgccattt agttattgaa 86220

attaatcata tacaactctt taatacgagt tatattttcg tctatccatt gtttcacatt 86280

tacatatttc gacaaaaaga tataaaatgc gtattccaat gcttctctgt ttaatgaatt 86340

actaaaatat acaaacacgt cactgtctgg caataaatga tatcttagaa tattgtaaca 86400

atttattttg tattgcacat gttcgtgatc tatgagttct tcttcgaatg gcataggatc 86460

tccgaatctg aaaacgtata aataggagtt agaataataa tatttgagag tattggtaat 86520

atataaactc tttagcggta taattagttt ttttctctca atttctattt ttagatgtga 86580

tggaaaaatg actaattttg tagcattagt atcatgaact ctaatcaaaa tcttaatatc 86640

ttcgtcacac gttagctctt tgaagttttt aagagatgca tcagttggtt cgaccgatgg 86700

agtaggtgca acaatttttt gttcgatgta tgtatgtact ggagccattg ttttaactat 86760

aatggtgctt gtatcgaaaa actttaatgc agatagcgga agctcttcgc cgcgactttc 86820

tacatcgtaa ttgggttcta acgccgatct ctgaatggat actagttttc taagttctaa 86880

tgtgattctc tgaaaatgta aatccaattc ctccggcatt atagatgtgt atacatcggt 86940

aaataaaact atagtatcca acgatccctt ctcgcaaatt ctagtcttaa ccaaaaaatc 87000

gtatataacc acggagatgg cgtatttaag agtggattct tctaccgttt tgttcttgga 87060

tgtcatatag gaaactataa agtccgcact actgttaaga atgattacta acgcaactat 87120

atagttcaaa ttaagcattt tggaaacata aaataactct gtagacgata cttgactttc 87180

gaataagttt gcagacaaac gaagaaagaa cagacctctc ttaatttcag aagaaaactt 87240

tttttcgtat tcctgacgtc tagagtttat atcaataaga aagttaagaa ttagtcggtt 87300

aatgttgtat ttcattaccc aagtttgaga tttcataata ttatcaaaag acatgataat 87360

attaaagata aagcgctgac tatgaacgaa atagctatat ggttcgctca aaaatatagt 87420

cttgttaaac gtggaaacga taactgtatt tttaatcacg tcagcggcat ctaaattaaa 87480

tataggtata tttattccac acactctaca atatgccaca ccatcttcat aataaataaa 87540

ttcgttagca aaattattaa ttttagtgaa atagttagcg tcaactttca tagcttcctt 87600

caatctaatt tgatgctcac acggtgcgaa ttccactcta acatcccttt tccatgcctc 87660

aggttcatcg atctctataa tatctagttt tttgcgtttc acaaacacag gctcgtctct 87720

cgcgatgaga tctgtatagt aactatgtaa atgataacta gatagaaaga tgtagctata 87780

tagatgacga tcctttaaga gaggtataat aactttaccc caatcagata gactgttgtt 87840

atggtcttcg gaaaaagaat ttttataaat ttttccagta ttttccaaat atacgtactt 87900

aacatctaaa aaatccttaa tgataatagg aatggataat ccgtctattt tataaagaaa 87960

tacatatcgc acattatact tttttttgga aatgggaata ccgatgtgtc tacataaata 88020

tgcaaagtct aaatattttt tagagaatct taattggtcc aaattctttt ccaagtacgg 88080

taatagattt ttcatattga acggtatctt cttaatctct ggttctagtt ccgcattaaa 88140

tgatgaaact aagtcactat ttttataact aacgattaca tcacctctaa catcatcatt 88200

taccagaata ctgatcttct tttgtcgtaa atacatgtct aatgtgttaa aaaaaagatc 88260

atacaagtta tacgtcattt catctgtggt attcttgtca ttgaaggata aactcgtact 88320

aatctcttct ttaacagcct gttcaaattt atatcctata tacgaaaaaa tagcaaccag 88380

tgtttgatca tccgcgtcaa tattctgttc tatcgtagtg tataacaatc gtatatcttc 88440

ttctgtgata gtcgatacgt tataaaggtt gataacgaaa atatttttat ttcgtgaaat 88500

aaagtcatcg taggattttg gacttatatt cgcgtctagt agatatgctt ttatttttgg 88560

aatgatctca attagaatag tctctttaga gtccatttaa agttacaaac aactaggaaa 88620

ttggtttatg atgtataatt tttttagttt ttatagattc tttattctat acttaaaaaa 88680

tgaaaataaa tacaaaggtt cttgagggtt gtgttaaatt gaaagcgaga aataatcata 88740

aattatttca ttatcgcgat atccgttaag tttgtatcgt aatggcgtgg tcaattacga 88800

ataaagcgga tactagtagc ttcacaaaga tggctgaaat cagagctcat ctaaaaaata 88860

gcgctgaaaa taaagataaa aacgaggata ttttcccgga agatgtaata attccatcta 88920

ctaagcccaa aaccaaacga gccactactc ctcgtaaacc agcggctact aaaagatcaa 88980

ccaaaaagga ggaagtggaa gaagaagtag ttatagagga atatcatcaa acaactgaaa 89040

aaaattctcc atctcctgga gtcagcgaca ttgtagaaag cgtggccgct gtagagctcg 89100

atgatagcga cggggatgat gaacctatgg tacaagttga agctggtaaa gtaaatcata 89160

gtgctagaag cgatctttct gacctaaagg tggctaccga caatatcgtt aaagatctta 89220

agaaaattat tactagaatc tctgcagtat cgacggttct agaggatgtt caagcagctg 89280

gtatctctag acaatttact tctatgacta aagctattac aacactatct gatctagtca 89340

ccgagggaaa atctaaagtt gttcgtaaaa aagttaaaac ttgtaagaag taaatgcgtg 89400

cactttttta taaagatggt aaactcttta ccgataataa ttttttaaat cctgtatcag 89460

acgataatcc agcgtatgag gttttgcaac atgttaaaat tcctactcat ttaacagatg 89520

tagtagtata tgaacaaacg tgggaggagg cgttaactag attaattttt gtgggaagcg 89580

attcaaaagg acgtagacaa tacttttacg gaaaaatgca tgtacagaat cgcaacgcta 89640

aaagagatcg tatttttgtt agagtatata acgttatgaa acgaattaat tgttttataa 89700

acaaaaatat aaagaaatcg tccacagatt ccaattatca gttggcggtt tttatgttaa 89760

tggaaactat gttttttatt agatttggta aaatgaaata tcttaaggag aatgaaacag 89820

tagggttatt aacactaaaa aataaacaca tagaaataag tcccgatgaa atagttatca 89880

agtttgtagg aaaggacaaa gtttcacatg aatttgttgt tcataagtct aatagactat 89940

ataaaccgct attgaaactg acggatgatt ctagtcccga agaatttctg ttcaacaaac 90000

taagtgaacg aaaggtatac gaatgtatca aacagtttgg tattagaatc aaggatctcc 90060

gaacgtatgg agtcaattat acgtttttat ataatttttg gacaaatgta aagtccatat 90120

ctcctcttcc atcaccaaaa aagttaatag cgttaactat caaacaaact gctgaagtgg 90180

taggtcatac tccatcaatt tcaaaaagag cttacatggc aacgactatt ttagaaatgg 90240

taaaggataa aaatttttta gatgtagtat ctaaaactac gttcgatgaa ttcctatcta 90300

tagtcgtaga tcacgttaaa tcatctacgg atggatgata tagatcttta cacaaataat 90360

tacaagaccg ataaatggaa atggataagc gtatgaaatc tctcgcaatg accgctttct 90420

ttggggagct aagcacatta gatattatgg cattgataat gtctatattt aaacgccatc 90480

caaacaatac cattttttca gtggataagg atggtcagtt tatgattgat ttcgaatacg 90540

ataattataa ggcttctcaa tatttggatc tgaccctcac tccgatattt ggagatgaat 90600

gcaagactca cgcatcgagt atagccgaac aattggcgtg tgcggatatt attaaagagg 90660

atattagcga atacatcaaa actactcccc gtcttaaacg atttataaaa aaataccgca 90720

atagatcaga tactcgcatc agtcgagata cagaaaagct taaaatagct ctagctaaag 90780

gcatagatta cgaatatata aaagacgctt gttaataagt aaatgaaaaa aaactagtcg 90840

tttataataa aacacaatat ggatgccaac atagtatcat cttctactat tgcaacgtat 90900

atagacgctt tagcgaagaa tgcttcagaa ttagaacaga ggtctaccgc atacgaaata 90960

aataatgaat tggaactagt atttattaag ccgccattaa ttactttgac aaatgtagtg 91020

aatatctcta cgattcagga atcgtttatt cgatttaccg ttactaataa ggaaggtgtt 91080

aaaattagaa ctaagattcc attatctaag gtacatggtc tagatgtaaa aaatgtacag 91140

ttagtagatg ctatagataa catagtttgg gaaaagaaat cattagtgac ggaaaatcgt 91200

cttcacaaag aatgcttgtt gagactatcg acagaggaac gtcatatatt tttggattac 91260

aagaaatatg gatcctctat ccgactagaa ttagtcaatc ttattcaagc aaaaacaaaa 91320

aactttacga tagactttaa gctaaaatat tttctaggat ccggtgccca atctaaaagt 91380

tctttgttgc acgctattaa tcatccaaag tcaaggccta atacatctct ggaaatagaa 91440

ttcacaccta gagacaatga aaaagttcca tatgatgaac taataaagga attgacgact 91500

ctatcacgtc atatatttat ggcttctcca gagaatgtaa ttctttctcc gcctattaac 91560

gcacctataa agacttttat gttgcctaaa caagatatag taggtctgga tctggaaaat 91620

ctatatgccg taactaagac tgacggcatt cctataacta tcagagttac atcaaacggg 91680

ttgtattgtt attttacaca tcttggttat attattagat atcctgttaa gagaataata 91740

gattccgaag tagtagtctt tggtgaggca gttaaggata agaactggac cgtatatctc 91800

attaagctaa tagagcctgt gaatgcaatc aatgatagac tagaagaaag taagtatgtt 91860

gaatctaaac tagtggatat ttgtgatcgg atagtattca agtcaaagaa atatgaaggt 91920

ccgtttacta caactagtga agtcgtcgat atgttatcta catatttacc aaagcaacca 91980

gaaggtgtta ttctgttcta ttcaaaggga cctaaatcta acattgattt taaaattaaa 92040

aaggaaaata ctatagacca aactgcaaat gtagtattta ggtacatgtc cagtgaacca 92100

attatctttg gagaatcgtc tatctttgta gagtataaga aatttagcaa cgataaaggc 92160

tttcctaaag aatatggttc tggtaagatt gtgttatata acggcgttaa ttatctaaat 92220

aatatctatt gtttggaata tattaataca cataatgaag tgggtattaa gtccgtggtt 92280

gtacctatta agtttatagc agaattctta gttaatggag aaatacttaa acctagaatt 92340

gataaaacca tgaaatatat taactcagaa gattattatg gaaatcaaca taatatcata 92400

gttgaacatt taagagatca aagcatcaaa ataggagata tctttaacga ggataaacta 92460

tcggatgtgg gacatcaata cgccaataat gataaattta gattaaatcc agaagttagt 92520

tattttacga ataaacgaac tagaggaccg ttgggaattt tatcaaacta cgtcaagact 92580

cttcttattt ctatgtattg ttccaaaaca tttttagacg attccaacaa acgaaaggta 92640

ttggcgattg attttggaaa cggtgctgac ctggaaaaat acttttatgg agagattgcg 92700

ttattggtag cgacggatcc ggatgctgat gctatagcta gaggaaatga aagatacaac 92760

aaattaaact ctggaattaa aaccaagtac tacaaatttg actacattca ggaaactatt 92820

cgatccgata catttgtctc tagtgtcaga gaagtattct attttggaaa gtttaatatc 92880

atcgactggc agtttgctat ccattattct tttcatccga gacattatgc taccgtcatg 92940

aataacttat ccgaactaac tgcttctgga ggcaaggtat taatcactac catggacgga 93000

gacaaattat caaaattaac agataaaaag acttttataa ttcataagaa tttacctagt 93060

agcgaaaact atatgtctgt agaaaaaata gctgatgata gaatagtggt atataatcca 93120

tcaacaatgt ctactccaat gactgaatac attatcaaaa agaacgatat agtcagagtg 93180

tttaacgaat acggatttgt tcttgtagat aacgttgatt tcgctacaat tatagaacga 93240

agtaaaaagt ttattaatgg cgcatctaca atggaagata gaccgtctac aaaaaacttt 93300

ttcgaactaa atagaggagc cattaaatgt gaaggtttag atgtcgaaga cttacttagt 93360

tactatgttg tttatgtctt ttctaagcgg taaataataa tatggtatgg gttctgatat 93420

ccccgttcta aatgcattaa ataattccaa tagagcgatt tttgttccta taggaccttc 93480

caactgtgga tactctgtat tgttaataga tatattaata cttttgtcgg gtaacagagg 93540

ttctacgtct tctaaaaata aaagtttgat aacatctggc ctgttcataa ataaaaactt 93600

ggcgattcta tatatactct tattatcaaa tctagccatt gtcttataga tgtgagctac 93660

tgtaggtgta ccatttgatt ttctttctaa tactatatat ttctctcgaa gaagttcttg 93720

cacatcatct gggaataaaa tactactgtt gagtaaatca gttatttttt ttatatcgat 93780

attgatggac atttttatag ttaaggataa taagtatccc aaagtagata acgacgataa 93840

cgaagtattt atacttttag gaaatcacaa tgactttatc agatcaaaat taacaaaatt 93900

aaaggagcat gtattttttt ctgaatatat tgtgactcca gataaatatg gatctttatg 93960

cgtcgaatta aatgggtcta gttttcagca cggcggtaga tatatagagg tggaggaatt 94020

tatagatgct ggaagacaag ttagatggtg ttctacatcc aatcatatat ctgaagatat 94080

acccgaagat atacacactg ataaatttgt catttatgat atatacactt ttgacgcttt 94140

caagaataaa cgattggtat tcgtacaggt acctccgtcg ttaggagatg atagctattt 94200

gactaatccg ttattgtctc cgtattatcg taattcagta gccagacaaa tggtcaatga 94260

tatgattttt aatcaagatt catttttaaa atatttatta gaacatctga ttagaagcca 94320

ctatagagtt tctaaacata taacaatagt tagatacaag gataccgaag aattaaatct 94380

aacgagaata tgttataata gagataagtt taaggcgttt gtattcgctt ggtttaacgg 94440

cgtttcggaa aatgaaaagg tactagatac gtataaaaag gtatctaatt tgatataatg 94500

aattcagtga ctgtatcaca cgcgccatat actattactt atcacgatga ttgggaacca 94560

gtaatgagtc aattggtaga gttttataac gaagtagcca gttggctgct acgagacgag 94620

acgtcgccta ttcctgataa gttctttata cagttgaaac aaccgcttag aaataaacga 94680

gtatgtgtgt gcggtataga tccgtatccg aaagatggaa ctggtgtacc gttcgaatca 94740

ccaaatttta caaaaaaatc aattaaggag atagcttcat ctatatctag attaaccgga 94800

gtaattgatt ataaaggtta taaccttaat ataatagacg gggttatacc ctggaattat 94860

tacttaagtt gtaaattagg agaaacaaaa agtcacgcga tctactggga taagatttcc 94920

aagttactgc tgcagcatat aactaaacac gttagtgttc tttattgttt gggtaaaaca 94980

gatttctcga atatacgggc caagttagaa tccccggtaa ctaccatagt cggatatcat 95040

ccagcggcta gagaccgcca attcgagaaa gatagatcat ttgaaattat caacgtttta 95100

ctggaattag acaacaaggc acctataaat tgggctcaag ggtttattta ttaatgcttt 95160

agtgaaattt taacttgtgt tctaaatgga tgcggctatt agaggtaatg atgttatctt 95220

tgttcttaag actataggtg tcccgtcagc gtgcagacaa aatgaagatc caagatttgt 95280

agaagcattt aaatgcgacg agttagaaag atatattgag aataatccag aatgtacact 95340

attcgaaagt cttagggatg aggaagcata ctctatagtc agaattttca tggatgtaga 95400

tttagacgcg tgtctagacg aaatagatta tttaacggct attcaagatt ttattatcga 95460

ggtgtcaaac tgtgtagcta gattcgcgtt tacagaatgc ggcgccattc atgaaaatgt 95520

aataaaatcc atgagatcta atttttcatt gactaagtct acaaatagag ataaaacaag 95580

ttttcatatt atctttttag acacgtatac cactatggat acattgatag ctatgaaacg 95640

aacactatta gaattaagta gatcatctga aaatccacta acaagatcga tagacactgc 95700

cgtatatagg agaaaaacaa ctcttcgggt tgtaggtact aggaaaaatc caaattgcga 95760

cactattcat gtaatgcaac caccgcatga taatatagaa gattacctat tcacttacgt 95820

ggatatgaac aacaatagtt attacttttc tctacaacaa cgattggagg atttagttcc 95880

tgataagtta tgggaaccag ggtttatttc attcgaagac gctataaaaa gagtttcaaa 95940

aatattcatt aattctataa taaactttaa tgatctcgat gaaaataatt ttacaacggt 96000

accactggtc atagattacg taacaccttg tgcattatgt aaaaaacgat cgcataaaca 96060

tccgcatcaa ctatcgttgg aaaatggtgc tattagaatt tacaaaactg gtaatccaca 96120

tagttgtaaa gttaaaattg ttccgttaga tggtaataaa ctgtttaata ttgcacaaag 96180

aattttagac actaactctg ttttattaac cgaacgagga gaccatatag tttggattaa 96240

taattcatgg aaatttaaca gcgaagaacc cttgataaca aaactaattt tgtcaataag 96300

acatcaacta cctaaggaat attcaagcga attactctgt ccaagaaaac gaaagactgt 96360

agaagctaac atacgagaca tgttagtaga ttcagtagag accgatacct atccggataa 96420

acttccgttt aaaaatggtg tattggacct ggtagacgga atgttttact ctggagatga 96480

tgctaaaaaa tatacgtgta ctgtatcaac cggatttaaa tttgacgata caaagttcgt 96540

cgaagacagt ccagaaatgg aagagttaat gaatatcatt aacgatatcc aaccattaac 96600

ggatgaaaat aagaaaaata gagagctata tgaaaaaaca ttatctagtt gtttatgtgg 96660

tgctaccaaa ggatgtttaa cattcttttt tggagaaact gcaactggaa agtcgacaac 96720

caaacgtttg ttaaagtctg ctatcggtga cctgtttgtt gagacgggtc aaacaatttt 96780

aacagatgta ttggataaag gacctaatcc atttatcgct aacatgcatt tgaaaagatc 96840

tgtattctgt agcgaactac ctgattttgc ctgtagtgga tcaaagaaaa ttagatctga 96900

caatattaaa aagttgacag aaccttgtgt cattggaaga ccgtgtttct ccaataaaat 96960

taataataga aaccatgcga caatcattat cgatactaat tacaaacctg tttttgatag 97020

gatagataac gcattaatga gaagaattgc cgtcgtgcga ttcagaacac acttttctca 97080

accttctggt agagaggctg ctgaaaataa tgacgcgtac gataaagtca aactattaga 97140

cgaggggtta gatggtaaaa tacaaaataa tagatataga ttcgcatttc tatacttgtt 97200

ggtgaaatgg tacagaaaat atcatgttcc tattatgaaa ctatatccta caccggaaga 97260

gattccggac tttgcattct atctcaaaat aggtactctg ttagtatcta gctctgtaaa 97320

gcatattcca ttaatgacgg acctctccaa aaagggatat atattgtacg ataatgtggt 97380

cactcttccg ttgactactt tccaacagaa aatatccaag tattttaatt ctagactatt 97440

tggacacgat atagagagct tcatcaatag acataagaaa tttgccaatg ttagtgatga 97500

atatctgcaa tatatattca tagaggatat ttcatctccg taaatatatg ctcatatatt 97560

tatagaagat atcacatatc taaatgaata ccggaatcat agatttattt gataatcatg 97620

ttgatagtat accaactata ttacctcatc agttagctac tctagattat ctagttagaa 97680

ctatcataga tgagaacaga agcgtgttat tgttccatat tatgggatca ggtaaaacaa 97740

taatcgcttt gttgttcgcc ttggtagctt ccagatttaa aaaggtttac attctagtgc 97800

ctaatatcaa cattttgaaa atttttaatt ataatatggg tgtagctatg aacttgttta 97860

atgacgaatt catagctgag aatatcttta ttcattccac aacaagtttt tattctctta 97920

attataacga taacgtcatt aattataacg gattatctcg ctacaataac tctattttta 97980

tcgttgatga ggcacataat atctttggga ataatactgg agaacttatg accgtgataa 98040

aaaataaaaa caagattcct tttctactat tgtctggatc tcccattact aacacaccta 98100

atactctggg tcatattata gatttaatgt ccgaagagac gatagatttt ggtgagatta 98160

ttagtcgtgg taagaaagta attcagacac ttcttaacga acgcggtgtg aatgtactta 98220

aggatttgct taaaggaaga atatcatatt acgaaatgcc tgataaagat ctaccaacga 98280

taagatatca cggacgtaag tttctagata ctagagtagt atattgtcac atgtctaaac 98340

ttcaagagag agattatatg attactagac gacagctatg ttatcatgaa atgtttgata 98400

aaaatatgta taacgtgtca atggcagtat tgggacaact taatctgatg aataatttag 98460

atactttatt tcaggaacag gataaggaat tgtacccaaa tctgaaaata aataatggcg 98520

tgttatacgg agaagaattg gtaacgttaa acattagttc caaatttaaa tactttatta 98580

atcggataca gacactcaac ggaaaacatt ttatatactt ttctaattct acatatggtg 98640

gattggtaat taaatatatc atgctcagta atggatattc tgaatataat ggttctcagg 98700

gaactaatcc acatatgata aacggcaaac caaaaacatt tgctatcgtt actagtaaaa 98760

tgaaatcgtc tttagaggat ctattagatg tgtataattc tcctgaaaac gatgatggca 98820

gtcaattgat gtttttgttt tcatcaaaca ttatgtccga atcctatact ctaaaagagg 98880

taaggcatat ttggtttatg actatcccag atactttttc tcaatacaac caaattcttg 98940

gacgatctat tagaaaattc tcttacgccg atatttctga accagttaat gtatatcttt 99000

tagccgccgt atattccgat ttcaatgacg aagtaacgtc attaaacgat tacacacagg 99060

atgaattgat taatgtttta ccatttgaca tcaaaaagct gttgtatcta aaatttaaga 99120

cgaaagaaac gaatagaata tactctattc ttcaagagat gtctgaaacg tattctcttc 99180

caccacatcc atcaattgta aaagttttat tgggagaatt ggtcagacaa tttttttata 99240

ataattctcg tattaagtat aacgactcca agttacttaa aatggttaca tcagttataa 99300

aaaataaaga agacgctagg aattacatag atgatattgt aaacggtcac ttctttgtat 99360

cgaataaagt atttgataaa tctcttttat acaaatacga aaacgatatt attacagtac 99420

cgtttagact ttcctacgaa ccatttgttt ggggagttaa ctttcgtaaa gaatataacg 99480

tggtatcttc tccataaaac tgatgaaata tataaagaaa taaatgtcga gctttgttac 99540

caatggatac cttccagtta cattggaacc acacgagctg acgttagaca taaaaactaa 99600

tattaggaat gccgtatata agacgtatct ccatagagaa attagtggta aaatggccaa 99660

gaaaatagaa attcgtgaag acgtggaatt acctctcggc gaaatagtta ataattctgt 99720

agttataaac gttccgtgtg taataaccta cgcgtattat cacgttgggg atatagtcag 99780

aggaacatta aacatcgaag atgaatcaaa tgtaactatt caatgtggag atttaatctg 99840

taaactaagt agagattcgg gtactgtatc atttagcgat tcaaagtact gcttttttcg 99900

aaatggtaat gcgtatgaca atggcagcga agtcactgcc gttctaatgg aggctcaaca 99960

aggtatcgaa tctagttttg tttttctcgc gaatatcgtc gactcataaa aaagagaata 100020

gcggtaagta taaacacgaa tactatggca ataattgcga atgttttatt ctcttcgata 100080

tatttttgat aatatgaaaa acatgtctct ctcaaatcgg acaaccatct cataaaatag 100140

ttctcgcgcg ctggagaggt agttgctgct cgtataatct ccccagaata atatacttgc 100200

gtgtcgtcgt tcaatttata cggatttcta tagttctctg ttatataatg cggttttcca 100260

tcatgattag acgacgacaa tagtgttctg aatttagata gttgatcaga atgaatgttt 100320

attggcgttg gaaaaattat ccatacagcg tctgcagagt ggttgatagt tgttcctaga 100380

tatgtaaaat aatccaactt actaggcagc aaattgtcta gataaaatac tgaatcaaac 100440

ggtgcagacg tattggcgga tctaatggaa tccaattgat taactatctt ttgaaaatat 100500

acatttttat gatccaatac ttgtaagaat atagaaataa tgataagtcc atcatcgtgt 100560

ttttttgcct cttcataaga actatatttt tttttattcc aatgaacaag attaatctct 100620

ccagagtatt tgtacacatc tatcaagtga ttggatccat aatcgtcttc ctttccccaa 100680

tatatatgta gtgatgataa cacatattca ttggggagaa accctccact tatatatcct 100740

cctttaaaat taatccttac tagttttcca gtgttctgga tagtggttgg tttcgactca 100800

ttataatgta tgtctaacgg cttcaatcgc gcgttagaaa ttgctttttt agtttctata 100860

ttaataggag atagttgttg cggcatagta aaaatgaaat gataactgtt taaaaatagc 100920

tcttagtatg ggaattacaa tggatgagga agtgatattt gaaactccta gagaattaat 100980

atctattaaa cgaataaaag atattccaag atcaaaagac acgcatgtgt ttgctgcgtg 101040

tataacaagt gacggatatc cgttaatagg agctagaaga acttcattcg cgttccaggc 101100

gatattatct caacaaaatt cagattctat ctttagagta tccactaaac tattacggtt 101160

tatgtactac aatgaactaa gagaaatctt tagacggttg agaaaaggtt ctatcaacaa 101220

tatcgatcct cactttgaag agttaatatt attgggtggt aaactagata aaaaggaatc 101280

tattaaagat tgtttaagaa gagaattaaa agaggaaagt gatgaacgta taacagtaaa 101340

agaatttgga aatgtaattc taaaacttac aacacgggat aaattattta ataaagtata 101400

tataagttat tgcatggcgt gttttattaa tcaatcgttg gaggatttat cgcatactag 101460

tatttacaat gtagaaatta gaaagattaa atcattaaat gattgtatta acgacgataa 101520

atacgaatat ctgtcttata tttataatat gctagttaat agtaaatgaa cttttacaga 101580

tctagtataa ttagtcagat tattaagtat aatagacgac tagctaagtc tattatttgc 101640

gaggatgact ctcaaattat tacactcacg gcattcgtta accaatgcct atggtgtcat 101700

aaacgagtat ccgtgtccgc tattttatta actactgata acaaaatatt agtatgtaac 101760

agacgagata gttttctcta ttctgaaata attagaacta gaaacatgtc tagaaagaaa 101820

cgattatttc tgaattattc caattatttg tccaaacagg aaagaagtat actatcgtca 101880

tttttttctc tagatccagc tactactgat aatgatagaa tagatgctat ttatccgggt 101940

ggcataccca aaaggggtga gaatgttcca gagtgtttat ccagggaaat taaagaagaa 102000

gttaatatag acaattcttt tgtattcata gacactcggt tttttattca tggcatcata 102060

gaagatacca ttattaataa attttttgag gtaatcttct ttgtcggaag aatatcttta 102120

acgagtgatc aaatcattga tacatttaaa agtaatcatg aaatcaagga tctaatattt 102180

ttagatccga attcaggtaa tggactccaa tacgaaattg caaaatatgc tctagatact 102240

gcaaaactca aatgttatgg ccatagagga tgttattacg aatcattaaa aaaattaact 102300

gaggatgatt gattagaaaa tataaattaa tttaccatcg tgtattttta taacgggatt 102360

gtccggcata tcatgtagat agttaccgtc tacatcgtat actcgaccat ctacgccttt 102420

aaatcctcta tttattgaca ttaatctatt agaattggaa taccaaatat tagtaccctc 102480

aattagttta ttggtaatat tttttttaga cgatagatcg atggctcttg aaaccaaggt 102540

tttccaaccg gactcattgt cgatcggtga gaagtctttt tcattagcat gaatccattc 102600

taatgatgta tgtttaaaca ctctaaacaa ttggacaaat tcttttgatt tgctttgaat 102660

gatttcaaat aggtcttcgt ctacagtagg cataccatta gataatctag ccattataaa 102720

gtgcacgttt acatatctac gttctggagg agtaagaacg tgactattga gacgaatggc 102780

tcttcctact atctgacgaa gagacgcctc gttccatgtc atatctaaaa tgaagatatc 102840

attaattgag aaaaaactaa taccctcgcc tccactagaa gagaatacgc atgttttaat 102900

gcattctccg ttagtgtttg attcttggtt aaactcagcc accgccttga ttctagtatc 102960

ttttgttcta gatgagaact ctatattaga gataccaaag actttgaaat atagtaataa 103020

gatttctatt cctgactgat taacaaatgg ttcaaagact agacatttac catgggatgc 103080

taatattccc aaacatacat ctataaattt gacgcttttc tcttttaatt cagtaaatag 103140

agagatatca gccgcactag catccccttt caatagttct ccctttttaa aggtatctaa 103200

tgcggattta gaaaactctc tatctcttaa tgaattttta aaatcattat atagtgttgc 103260

tatctcttgc gcgtattcgc ccggatcacg attttgtctt tcaggaaagc tatcgaacgt 103320

aaacgtagta gccatacgtc tcagaattct aaatgatgat atacctgttt ttatttcagc 103380

gagtttagcc ttttgataaa tttcttcttg ctttttcgac atattaacgt atcgcattaa 103440

tactgttttc ttagcgaatg atgcagaccc ttctacgtca tcaaaaatag aaaactcgtt 103500

attaactatg tacgaacata ggcctcctag tttggagact aattctttct catcaactag 103560

acgtttattc tcaaatagcg attggtgttg taaggatcct ggtcgtagta agttaaccaa 103620

catggtgaat tcttgcacac tattaacgat aggtgtagcc gataaacaaa tcatcttatg 103680

gttttttaat gcgatggtct tagataaaaa attatatact gaacgagtag gacggatctt 103740

accatcttct ttgattaatg atttagaaat gaagttatga cattcatcaa taatgacgca 103800

tattctactc ttggaattaa tagttttgat attagtaaaa aatttatttc taaaattttg 103860

atcatcgtaa ttaataaaaa tacaatcctt cgttatctct ggagcgtatc tgagtatagt 103920

gttcatccaa ggatcttcta tcaaagcctt tttcaccaat aagataatag cccaattcgt 103980

ataaatatcc ttaagatgtt tgagaatata tacagtagtc attgttttac cgacacccgt 104040

ttcatggaac aataaaagag aatgcatact gtctaatcct aagaaaactc ttgctacaaa 104100

atgttgataa tccttgaggc gtactacgtc cgaccccatc atttcaacgg gcatattagt 104160

agttctgcgc aatgcataat cgatataggc cgcgtgtgat ttactcattt atgagtgata 104220

agtaataact atgttttaaa aatcacagca gtagtttaac tagtcttctc tgatgtttgt 104280

tttcgatact ttttgaatca gaagtcatac tagaataaag caacgagtga acgtaataga 104340

gagcttcgta tactctattc gaaaactcta agaacttatt aatgaattcc gtatccactg 104400

gattgtttaa aatactaaat tgaacactgt tcacatcctt ccaagaagaa gacttagtga 104460

cggacttaac atgagacata aataaatcca aatttttttt acaaacatca ctagccacca 104520

taatggcgct atctttcaac cagctatcgc ttacgcattt tagcagtcta acatttttaa 104580

agagactaca atatattctc atagtatcga ttacacctct accgaataaa gttggaagtt 104640

taataataca atatttttcg tttacaaaat caaataatgg tcgaaacacg tcgaaggtta 104700

acatcttata atcgctaatg tatagattgt tttcagtgag atgattatta gatttaatag 104760

catctcgttc acgtttgaac agtttattgc gtgcgctgag gtcggcaact acggcgtccg 104820

ctttagtact cctcccataa tactttacgc tattaatctt taaaatttca tagactttat 104880

ctagatcgct ttctggtaac atgatatcat gtgtaaaaag ttttaacatg tcggtcggca 104940

ttctatttag atcattaact ctagaaatct gaagaaagta attagctccg tattccagac 105000

taggtaatgg gcttttacct agagacagat taagttctgg caatgtttca taaaatggaa 105060

gaaggacatg cgttccctcc cggatatttt ttacaatttc atccatttac aactctatag 105120

tttgttttca ttattattag ttattatctc ccataatctt ggtaatactt accccttgat 105180

cgtaagatac cttatacagg tcattacata caactaccaa ttgtttttgt acataataga 105240

ttggatggtt gacatccatg gtggaataaa ctactcgaac agatagttta tctttccccc 105300

tagatacatt agccgtaata gttgtcggcc taaagaatat ctttggtgta aagttaaaag 105360

ttagggttct tgttccatta ttgctttttg tcagtagttc attataaatt ctcgagatgg 105420

gtccgttctc tgaatataga acatcatttc caaatctaac ttctagtcta gaaataatat 105480

cggtcttatt cttaaaatct attcccttga tgaagggatc gttaatgaac aaatccttgg 105540

cctttgattc ggctgatcta ttatctccgt tatagacgtt acgttgacta gtccaaagac 105600

ttacaggaat agatgtatcg atgatgttga tactatgtga tatgtgagca aagattgttc 105660

tcttagtggc atcactatat gttccagtaa tggcggaaaa ctttttagaa atgttatata 105720

taaaagaatt ttttcgtgtt ccaaacatta gcagattagt atgaagataa acactcatat 105780

tatcaggaac attatcaatt tttacataca catcagcatc ttgaatagaa acgataccat 105840

cttctggaac ctcaacaatc tcggcagact ccggataacc agtcggtggg ccatcactaa 105900

caataactag atcatccaac aatctactca catatgcatc tatataatct ttttcatctt 105960

gtgagtaccc tggatacgaa ataaatttat tatccgtatt tccataataa ggtttagtat 106020

aaacagagag cgatgttgcc gcatgaactt cagttacagt cgccgttggt tggtttattt 106080

gacctattac tctcctaggt ttctctataa acgatggttt aatttgtaca ttcttaacca 106140

tatatccaat aaagctcaat tcaggaacat aaacaaattc tttgttgaac gtttcaaagt 106200

cgaacgaaga gtcacgaata acgatatcgg atactggatt gaaggttacc gttacggtaa 106260

tttttgaatc ggatagttta agactgctga atgtatcttc cacatcaaac ggagttttaa 106320

tataaacgta tactgtagat ggttctttaa tagtgtcatt aggagttagg ccaatagaaa 106380

tatcattaag ttcactagaa tatccagagt gtttcaaagc aattgtatta ttgatacaat 106440

tattatataa ttcttcgccc tcaatttccc aaataacacc gttacacgaa gagatagata 106500

cgtgattaat acatttatat ccaacatatg gtacgtaacc gaatcttccc atacctttaa 106560

cttctggaag ttccaaactc agaaccaaat gattaagcgc agtaatatac tgatccctaa 106620

tttcgaagct agcgatagcc tgattgtctg gaccatcgtt tgtcataact ccggatagag 106680

aaatatattg cggcatatat aaagttggaa tttgactatc gactgcgaag acattagacc 106740

gtttaataga gtcatcccca ccgatcaaag aattaatgat agtattattc attttctatt 106800

taaaatggaa aaagcttaca ataaactccg tagagaaata tctataattt gtgagttttc 106860

cttaaagtaa cagcttccgt aaacgccgtc tttatctctt agtaagttta ttgtatttat 106920

aaccttttcc ttatcttcat agaatactaa aggcaacaaa gaaatttttg gttcttctct 106980

aagagctacg tgagacttaa ccatagacgc caacgaatcc ctacatattt tagaacagaa 107040

atacccaact tcaccaccct tgaatgtctc aatactaata ggtttaaaaa ccaaatcttg 107100

attacaaaac caacacttat caattacact atttgtctta atagacacat ctgccataga 107160

tttataatac tttggtagta tacaagcgag tgcttcttct ttagcgggct taaagactgc 107220

tttaggtgct gaaataacca catctggaag gcttactcgc ttagccattt aattacggaa 107280

ctattttttt atacttctaa tgagcaagta gaaaacctct catctacaaa aacatactcg 107340

tgtccataat cctctaccat agttacacgt tttttagatc tcatatgtgc taaaaagttt 107400

tcccatacta attggttact attatttttc gtataatttt taacagtttg aggttttaga 107460

tttttagtta cagaagtgat atcgaatatt ttatccaaaa agaatgaata attaattgtc 107520

ttagaaggag tgttttcttg gcaaaagaat accaagtgct taaatatttc tactacttca 107580

ttaatctttt ctgtactcag attcagtttc tcatctttta cttgattgat tatttcaaag 107640

actaacttat aatccttttt atttattctc tcgttagcct taagaaaact agatacaaaa 107700

tttgcatcta catcatccgt ggatatttga tttttttcca tgatatccaa gagttccgag 107760

ataatttctc cagaacattg atgagacaat aatctccgca atacatttct caaatgaata 107820

agtttattag acacatggaa gtttgacttt ttttgtacct ttgtacattt ttgaaatacc 107880

gactcgcaaa aaatacaata ttcatatcct tgttcagata ctataccgtt gtgtctacaa 107940

ccgctacata atcgtagatt catgttaaca ctctacgtat ctcgtcgtcc aatattttat 108000

ataaaaacat tttatttcta gacgttgcca gaaaatcctg taatattttt agttttttgg 108060

gctgtgaata aagtatcgcc ctaatattgt taccgtcttc cgccaatata gtagttaaat 108120

tatccgcaca tgcaaaagaa caccgcttag gcggattcag tacaatgtta tatttttcgt 108180

accaactcat ttaaatatca taatctaaaa tagttctgta atatgtctag cgctaatata 108240

ttgatcataa tcctgtgcat aaattaagat acaacaatgt ctcgaaatca tcgacatggc 108300

ttcttccata gttagaagat cgtcgtcaaa gttagcaacg tgattcatca acatttgctg 108360

ttttgaggca gcaaatactg aaccgtcgcc attcaaccat tcataaaaac catcgtctga 108420

atccattgat aatttcttgt actggttttt gagagctcgc atcaatctag catttctagc 108480

tcccggattg aaaacagaaa gaggatcgta catccagggt ccattttctg taaatagaat 108540

cgtataatgt cccttcaaga agatatcaga cgatccacaa tcaaagaatt ggtctccgag 108600

tttgtaacaa actgcggact ttaacctata catgataccg tttagcatga tttctggtga 108660

tacgtcaatc ggagtatcat ctattagaga tctaaagccg gtgtaacatt ctccaccaaa 108720

catattctta ttctgacgtc gttctacata aaacatcatt gctccattaa cgataacagg 108780

ggaatgaaca gcactaccca tcacattagt tcccaatgga tcaatgtgtg taactccaga 108840

acatcttcca tatcctatgt taggaggagc gaacaccact cttccactat tgccatcgaa 108900

tgccatagaa taaatatcct tggaattgat agaaatcgga ctgtcggatg ttgtgatcat 108960

cttcatagga ttaacaacta tgtatggtgc cgcctgaagt ttcatatcgt aactgatgcc 109020

gtttataggt ctagccacag aaaccaacgt aggtctaaat ccaactatag acaaaataga 109080

agccaatatc tgttcctcat ctgtcataac ttgagagcat ccagtatgaa taatcttcat 109140

tagatgggga tctaccgcat catcatcgtt acaataaaaa attcccattc taatgttcat 109200

aattgctttt ctaatcatgg tatgcatgtt tgctctctga atctctgtgg aaattagatc 109260

tgatacacct gtaatcacta tcggattatc ctccgtaaga cgattaacca acaacatata 109320

attataagac tttacttttc taaattcata aagttgctgg attaggctat aggtgtctcc 109380

atgtacatac gcgttctcga gcgcaggaag tttaataccg aatagtgcca tcagaatagg 109440

atgaatatag taattagttt ctggttttct ataaataaaa gacaaatctt gtgaactaga 109500

catatcggta aaatgcatgg attggaatcg tgtagtcgac agaagaatat gatgattaga 109560

tggagagtat attttatcta actctttgag ttggtcaccg attctaggac tagctcgaga 109620

atgaataagt actaaaggat gagtacattt cacagaaaca ctagcattgt tcaatgtgct 109680

ctttacatgg gtaaggagtt gaaatagctc gtttctattt gttctgacaa tatttagttt 109740

attcataatg ttaagcatat cctgaatagt aaagttagat gtgtcatact tgttagtagt 109800

tagatattta gcaattgcat tcccatcatt tctcaatctc gtactccaat catgtgtaga 109860

tgctacttcg tcgatggaaa ccatacaatc ctttttgata ggctgttgag attgattatt 109920

tcctgcacgt ttaggtttgg tacgttgatt tctagcccct gcagatataa agtcatcgtc 109980

tacaattttg gataatgaat tgcatacact acaagacaaa gatttatcag aagtgtgaat 110040

atgatcttca tctaccaaag aaagagtttg attagtataa ctagatttta gtcctgcgtt 110100

agatgttaaa aaaacatcgc tattgaccac ggcttccatt atttatattc gtagttttta 110160

ctcgaaagcg tgattttaat atccaatctt attacttttg gaatcgttca aaacctttga 110220

ctagttgtag aatttgatct attgccctac gcgtatactc ccttgcatca tatacgttcg 110280

tcaccagatc gtttgtttcg gcctgaagtt ggtgcatatc tttttcaaca ctcgacatga 110340

gatccttaag ggccatatcg tctagatttt gttgagatgc tgctcctgga tttggatttt 110400

gttgtgctgt tgtacatact gtaccaccag taggtgtagg agtacataca gtggccacaa 110460

taggaggttg aggaggtgta accgttggag tagtacaaga aatacttcca tccgattgtt 110520

gtgtacatgt agttgttggt aacgtctgag aaggttgggt agatggcggt gtcgtcgtct 110580

tttgatcttt attaaattta gagataatat cctgaacagc attgctcggc gtcaacgctg 110640

gaaggagtga actcgccggc gcatcagtat ctgcagacag ccaatcaaaa agattagaca 110700

tatcagatga tgtattagtt tgttgtcgtg gttttggtgt aggagcagta ctactaggta 110760

gaagaatagg agccgatgta ggtgtcggaa ccggaaccgg ctgtggagtt atatgaatag 110820

ttggttgtag cggttggata ggctgtctgc tggcggccat catattatct ctagctagtt 110880

gttctcgcaa ctgtctttga taatacgact cttgagactt tagtcctatt tcaatcgctt 110940

catccttttt cgtatccgga tccttttttt cagaataata gattgacgac tttggtgtag 111000

aggattctgc cagcccctgt gagaacttgt taaagaagtc catttaaggc tttaaaattg 111060

aattgcgatt ataagattaa atggcagaca cagacgatat tatcgactat gaatccgatg 111120

atctcactga atacgaggat gatgaagaag aggaagaaga tggagagtca ctagaaacta 111180

gtgatataga tcccaaatct tcttataaga ttgtagaatc agcatccact catatagaag 111240

atgcgcattc caatcttaaa catataggga atcatatatc tgctcttaaa cgacgctata 111300

ctagacgtat aagtctattt gaaatagcgg gtataatagc agaaagctat aacttgcttc 111360

aacgaggaag attacctcta gtttcagaat tttctgacga aacgatgaag caaaatatgc 111420

tacatgtaat tatacaagag atagaggagg gttcttgtcc tatagtcatc gaaaagaacg 111480

gagaattgtt gtcggtaaac gattttgaca aagatggtct aaaattccat ctagactata 111540

ttatcaaaat ttggaaactt caaaaacgat attagaattt atacgaatat cgttctctaa 111600

atgtcacaat caagtctcgc atgttcagca atttattgtc gtactttata tcgtgttcat 111660

taacgatatc ttgcaaaata gtaatgattc tatcttcctt cgatagatat tcttcagaga 111720

ttattgtctt atattctttc ttgttatccg atatgaattt gataagactt tgaacattat 111780

taatacccgt ctgtttaatt ttttctacag atattttagt tttggcagat tctatcgtat 111840

ctgtcaatag acatccaaca tcgacattcg acgtcaattg tctataaatc aacgtataaa 111900

ttttagaaat aacattagcg aattgttgtg cattgatgtc gttattctga aacagtatga 111960

ttttaggtag cattttctta acaaagagaa cgtatttatt gttactcagt tgaacagatg 112020

atatatccag attactaacg catctgattc cgtataccaa actttcagaa gaaatggtgt 112080

acaattgttt gtattcattc aatgtctcct tttcagaaat tagtttagag tcgaatactg 112140

caataatttt caagagatag ttttcatcag ataagatttt atttagtgta gatatgataa 112200

aactattgtt ttgttggaga acttgatacg ccgcgttctc tgtagtcgac gctctcaaat 112260

gggaaacgat ctccattatt tttttggaat cggatactat atcttcggta tcttgacgca 112320

gtctagtata catagagtta agagagatta gagtttgtac attaagcaac atgtctctaa 112380

atgtggctac aaacttttcc tttttcacat catctagttt attatatacc gatttcacaa 112440

cggcaccaga tttaaggaac cagaatgaaa aactctgata actacaatat ttcatcatag 112500

ttacgatttt atcatcttct atagttggtg taatagcgca tacctttttc tccaagactg 112560

gaaccaacgt cataaaaatg tttaaatcaa aatccatatc aacatctgat gcgctaagac 112620

cagtctcgcg ttcaagatta tctttactaa tggtgacgaa ctcatcgtat agaactctaa 112680

gtttgtccat tatttattta cagatttagt tgtttaattt atttgtgctc ttccagagtt 112740

gggatagtat ttttctaacg tcggtattat attattagga tctacgttca tatgtatcat 112800

aatattaatc atccacgttt tgataaatct atctttagct tctgaaataa cgtatttaaa 112860

caaaggagaa aaatatttag ctacggcatc agacgcaata acattttttg taaatgtaac 112920

gtatttagac gacagatctt cgttaaaaag ttttccatct atgtagaatc catcggttgt 112980

taacaccatt cccgcgtcag attgaatagg agtttgaata gtttgttttg gaaatagatc 113040

cttcaataac ttatagttgg gtgggaaaaa atcgatttta tcactagact ctttcttttt 113100

tactatcatt acctcatgaa ctatttcttg aatgagtata tgtattttct ttcctatatc 113160

ggacgcgttc attggaaaat ataccatgtc gttaactata agaatatttt tatcctcgtt 113220

tacaaactga ataatatcag atgtagttcg taaacgaact atatcatcac cagcacaaca 113280

tctaactata tgatatccac tagtttcctt tagccgttta ttatcttgtt ccatattagc 113340

agtcattcca tcatttaaga aggcgtcaaa aataataggg agaaatgaca ttttggattc 113400

tgttacgact ttaccaaaat taaggatata cggacttact atctttttct caacgtcaat 113460

ttgatgaaca cacgatgaaa atgtgcttct atgagattga tcatgtagaa aacaacaagg 113520

gatacaatat ttccgcatat catgaaatat attaagaaat cccaccttat tatatttccc 113580

caaaggatcc atgcacgtaa acattatgcc gttatcatta ataaagactt ctttctcatc 113640

ggatctgtaa aagttgttac tgattttttt cattccagga tctagataat taataatgat 113700

gggttttcta ttcttattct ttgtattttg gcatatccta gaccagtaaa cagtttccac 113760

tttggtaaaa tcagcagact tttgaacgct attaaacatg gcattaatgg caataactaa 113820

aaatgtaaaa tatttttcta tgttaggaat atggtttttc actttaatag atatatggtt 113880

tttggccaaa atgatagata tttttttatc cgaggatagt aaaatattat tagtcgccgt 113940

ctctataaaa atgaagctag tctcgatatc caattttatt ctagaattga taggagtcgc 114000

caaatgtacc ttatacgtta tatctccctt gatgcgttcc atttgtgtat ctatatcgga 114060

cacaagatct gtaaatagtt ttacgttatt aatcatcacg gtatcgccgt cgctagataa 114120

cgctaatgta ccatccaagt cccaaatgga gagatttaac tgttcatcgt ttagaataaa 114180

atgattaccg gtcatattaa taaagtgttc atcgtatcta gataacaacg acttataatt 114240

aatgtccaag tcttgaactc gctgaatgat cttttttaac ccagttagtt ttagattggt 114300

acgaaatata ttgttaaact ttgattctat agtaatgtcc aaatctagtt gtggaaatac 114360

ttccatcaac attgtttcaa acttgataat attattatct acatcttcgt acgatccaaa 114420

ttccggaata gatgtatcgc acgctctggc cacccagata accaaaaagt cacacgctcc 114480

aggatataca ttgtataaaa agctatcgtt ttttagtagg gtttttttct gcgtgtatac 114540

gaagggatta aaaatagtat tatcaacgta actatattcc aaattattct tatgagaata 114600

gataataata tcgtccttaa tatctaacaa atttcctaaa tatcccttta attgagtcat 114660

tcgaagcgtc aatagaatat gtctcttaac tatttccggc tgttgtatat ttaaatgact 114720

tcgtaaaaaa taatatatgg gcgacttctc atctatgtaa tcatatggag tgagatatag 114780

ggctcgttct acctcctgcc ccttacccac ctgtaatacc aattgcggac ttactatata 114840

tcgcatattt atatcgtggg gtaaagtgaa aatctactac cgatgatgta agtcttacaa 114900

tgttcgaacc agtaccagat cttaatttgg aggcctccgt agaactaggg gaggtaaata 114960

tagatcaaac aacacctatg ataaaggaga atagcggttt tatatcccgc agtagacgtc 115020

tattcgccca tagatctaag gatgatgaga gaaaactagc actacgattc tttttacaaa 115080

gactttattt tttagatcat agagagattc attatttgtt cagatgcgtt gacgctgtaa 115140

aagacgtcac tattaccaaa aaaaataaca ttatcgtggc gccttatata gcacttttaa 115200

ctatcgcatc aaaaggatgc aaacttacag aaacaatgat tgaagcattc tttccagaac 115260

tatataatga acatagtaag aaatttaaat tcaactctca agtatccatc atccaagaaa 115320

aactcggata ccagtttgga aactatcacg tttatgattt tgaaccgtat tactctacag 115380

tagctctggc tattcgagat gaacattcat ctggcatttt taatatccgt caagagagtt 115440

atctggtaag ttcattatct gaaataacat atagatttta tctaattaat ctaaaatctg 115500

atcttgttca atggagtgct agtacgggcg ctgtaattaa tcaaatggta aatactgtat 115560

tgattacagt gtatgaaaag ttacaactgg tcatagaaaa tgattcacaa tttacatgtt 115620

cattggctgt ggaatcaaaa cttccaataa aattacttaa agatagaaat gaattattta 115680

caaaattcat taacgagtta aaaaagacca gttcattcaa gataagcaaa cgcgataagg 115740

atacgctact aaaatatttt acttaggact ggagttagaa tttatagacg actcatttcg 115800

tttatcatta ttactaccat cattattagt attcttcttg ttatcttgtt cagaaatata 115860

cagcaatgct atgcctaata ctaaatacat tatcatgctt gcaatggctc taacaacgac 115920

gaaccaaaat gaatttggtc gtagcttttg ttcacaaaaa tacataaaga aatgtctaca 115980

taaatctatg gcgccattgg ctacttgaaa tagcgccagt cctcctacag attttaatat 116040

agctgtataa catgacattt attcatcatc aaaagagaca gagtcaccat ctgtcatatt 116100

tagatttttt ttcatgtgtt caaagtatcc tctactcatt tcattataat agtttatcat 116160

acttagaatt ttaggacgga tcaatgagta agacttgact agatcgtcag tagtaatttg 116220

tgcatcgtct attctgcatc cgcttcgtcg aataatgtat agcatcgctt tgagattctc 116280

catagctatc aagtctttat acaatgacat ggaaatatct gtgaatactt tatacttctc 116340

caacatcgat gccttaacat catcgcctac tttagcattg aaaatacgtt ctattgtgta 116400

gatggatgta acaagatttt taaacaacaa tgccatctta cacgatgatt gcctcaagtc 116460

tccaatcgtt tgtttagaac gattagctac agagtccaat gcttggctga ctagcatatt 116520

attatcttta gaaattgtat tcttcaatga ggcgtttatc atatctgtga tttcgttagt 116580

catattacag tctgactggg ttgtaatgtt atccaacata tcacctatgg atacggtaca 116640

cgtaccagca tttgtaataa tcctatctaa gatgttgtat ggcattgcgc agaaaatatc 116700

ttctcctgta atatctccac tctcgataaa tctactcaga ttattcttaa atgccttatt 116760

ctctggagaa aagatatcag tgtccatcat ttcattaata gtatacgcag aaaagatacc 116820

acgagtatca attctatcca agatacttat cggttccgag tcacagataa tggtttcctc 116880

tccttcggga gatcctgcat agaaatatct aggacaatag tttctatact gtctgtaact 116940

ctgataatct ctaaagtcac taactgatac catgaaattg agaagatcaa acgctgaagt 117000

aattaatttt tctgcctcgt ttttactaca actagttttc atcaatgtag tgacgatgta 117060

ttgtttagtt acttttggtc taatactgat gatagagata ttattgcttc ccataatgga 117120

tcttctagta gtcaccttaa agcccattga tgcgaatagc agatagataa agtcttggta 117180

tgactccttt ctaatatagt acggactacc tttgtcaccc aactttatac ccacataagc 117240

cataacaacc tctttaatag ccgtttcatg aggtttatca gccatgagcc tgagtagttg 117300

gaagaatctc atgaatcccg tctcagaaag tcctatatgc atgatagatt tatctttcct 117360

gggaaactct cgtatagtca tagatgaaat actcttcaaa gtttctgaaa taagattagt 117420

aacagtctta cctccgacta ctctgggtaa caaacaaact ctaataggtg ttttctctgc 117480

ggagataata tcagaaagga tagagcaata agtagtatta ttgtgattat aaagaccgaa 117540

tacataacag gtagaattta taaacatcat gtcctgaagg tttttagact tgtattcctc 117600

gtaatccata ccgtcccaaa acatggattt ggtaactttg atagccgtag atctttgttc 117660

cttcgccaac aggttaaaga aattaataaa gaatttgttg tttctattta tgtccacaaa 117720

ttgcacgttt ggaagcgcca cggttacatt cactgcagca ttttgaggat cgcgagtatg 117780

aagtacgatg ttattgttta ctggtatatc tggaaagaaa tctaccagtc taggaataag 117840

agattgatat cgcatagaaa tagtaaagtt tataatctca tcatcgaaga gcattttgtt 117900

accattgtaa taaatatcca ctctgtcata tgtataaatg aagtactgtt caaacatgat 117960

gagatgttta tatgttggca tagtagtgag atcgacgttt ggtaatggca atgtattaag 118020

attaactcca taatgtctag cagcatctgc gatgttataa gcgtcgtcaa agcggggtcg 118080

atcttgtatt gttatatatt gtctaacacc tataagatta tcaaaatctt gtctgcttaa 118140

tacaccgtta acaatttttg ccttgaattc ttttattggt gcattaataa catccttata 118200

gaggatgtta aacaaataag tgttatcaaa gttaagatct ggatatttct tttctgctag 118260

aacatccatt gagtcggagc catctggttt aatataacca ccgataaatc tagctctgta 118320

ttctgtatcc gtcaatctaa tattaagaag gtgttgagtg aaaggtggaa gatcgtaaaa 118380

gctgtgagta ttaatgatag gattagtttc cgaactaatg ttaattgggg tattaataat 118440

atctatattt ccagcgttaa gtgtaacatt aaacagtttt aattcacgtg aagtagtatc 118500

aattaaataa ttaatgccca atttggatat agcagcctga agctcatctt gtttagttac 118560

ggatcctaat gagttattaa gcaatatatc gaacggatga acgaaggttg ttttgagttt 118620

gtcgcatact ttgtaatcta gacatagatg cggaagaacg gtagaaacta tacgaaataa 118680

atattcagag tcctctaatt gatcaagagt aactattgac ttaataggca tcatttattt 118740

agtattaaat gacgaccgta ccagtgacgg atatacaaaa cgatttaatt acagagtttt 118800

cagaagataa ttatccatct aacaaaaatt atgaaataac tcttcgtcaa atgtctattc 118860

taactcacgt taacaacgtg gtagatagag aacataatgc cgccgtagtg tcatctccag 118920

aggaaatatc ctcacaactt aatgaagatc tatttccaga tgatgattca ccggccacta 118980

ttatcgaacg agtacaacct catactacta ttattgacga tactccacct cctacgtttc 119040

gtagagagtt attaatatcg gaacaacgtc aacaacgaga aaaaagattt aatattacag 119100

tatcgaaaaa tgctgaagca ataatggaat ctagatctat gataacttct atgccaacac 119160

aaacaccatc cttgggagta gtttatgata aagataaaag aattcagatg ttagaggatg 119220

aagtggttaa tcttagaaat caacgatcta atacaaaatc atctgataat ttagataatt 119280

ttaccaaaat actatttggt aagactccgt ataaatcaac agaagttaat aagcgtatag 119340

ccatcgttaa ttatgcaaat ttgaacgggt ctcccttatc agtcgaggac ttggatgttt 119400

gttcagagga tgaaatagat agaatctata aaacgattaa acaatatcac gaaagtagaa 119460

aacgaaaaat tatcgtcact aacgtgatta ttattgtcat aaatattatc gagcaagcat 119520

tgctaaaact cggatttgaa gaaatcaaag gactgagtac cgatatcact tcagaaatta 119580

tcgatgtgga gatcggagat gactgcgatg ctgtagcatc aaaactagga atcggtaaca 119640

gtccggttct taatattgta ttgtttatac tcaagatatt cgttaaacga attaaaatta 119700

tttaatttaa tacattccca tatccagaca acaatcgtct ggattaatct gttcctgtcg 119760

tctcataccg gacgacatat taatcttttt attagtgggc atctttttag atggtttctt 119820

tttcccagca ttaactgagt cgatacctag aagatcgtga ttgatctctc cgaccattcc 119880

acgaacttct aattggccgt ctctgacggt accataaact attttaccag cattagtaac 119940

agcttggaca atctgaccat ccatcgcatt gtacgatgta gtagtaactg ttgttctacg 120000

tttaggagca ccagaagtat ttttggagcc cttggaggct gatgtagaag aagacgagga 120060

ttttgatttt ggtttacatg taatacattt tgaactcttt gattttgtat cacatgcgcc 120120

ggcagtcaca tctgtttgag aattaagatt attgttgcct cctttgacgg ctgcatctcc 120180

accgatttgc gctagtagat ttttaagctg tggtgtaatc ttattaactg tttcgatata 120240

atcatcgtaa ctgcttctaa cggctaaatt ttttttatcc gccatttaga agctaaaaat 120300

atttttattt atgcagaaga tttaactaga ttatacaatg aactaatatg atccttttcc 120360

agattattta caaacttggt attttttggt tctggaggag gcgaatttaa attcggactt 120420

ggattcagat tttgtaagtt cttgatctta ttatacatcg agtataggat ggcgacagta 120480

actgctacac aaataccgat caaaagaaga ataccaatca tttattgaca ataacttcac 120540

tattgatcaa gtatgcaata tatcatcttt tcactaaata agtagtaata atgattcaac 120600

aatgtcgaga tatatggacg ataataattt agttcatgga aatatcgcta tgattggtgt 120660

gaatgactcc gctaactctg tggggtgcgc agtgctttcc ccacatagaa taaattagca 120720

ttccgactgt gataataata ccaagtataa acgccataat actcaatact ttccatgtac 120780

gagtgggact ggtagactta ctaaagtcaa taaaggcgaa gatacacgaa agaatcaaaa 120840

gaatgattcc agcgattagc acgccggaaa aataatttcc aatcataagc atcatgtcca 120900

tttaactaat aaaaatttta aatcgccgaa tgaacaaagt ggaatataaa ccatataaaa 120960

acaatagttt gtactgcaaa aataatatct atttttgttt tcgaagatat ggtaaaatta 121020

aatagtagta cacagcatgt tataactaac agcagcaacg gctcgtaatt acttatcatt 121080

tactagacga aaaggtggtg ggatattttc ttgctcaaat aatacgaata tatcacccat 121140

ccattttatg cgatgtttat atactctaat ctttaataga tctatagacg acgggtttac 121200

caacaatata gattttatcg attcatctaa tttaaaccct tccttaaacg tgaatgatct 121260

attatctggc ataacgatga ctctacctga tgaatcggac aatgtactgg gccatgtaga 121320

ataaattatc aacgaattat cgtctacgaa catttatatc atttgtttta attttaggac 121380

gcgaataaat ggatataaaa tagaaaataa cagatattac aaccagtgtt atggccgcgc 121440

ccaaccaggt aggcagtttt attttatctt ttactacagg ttctcctgga tgtacgtcac 121500

caacggcgga cgtagttcta gtacaattag acgtaagttc cgcttgggaa ttttttaacg 121560

ctaaagagtt aacgttaatc gtgcacccaa cgtatttaca tctagttctt tgaacatctt 121620

gattataata taaccatttt ctatctctag attcgtcggt gcactcatgt aaccaacata 121680

ccctaggtcc taaatattta tctccggaat tagattttgg ataattcgcg caccaacaat 121740

ttctatttcc tttatgatcg ttacaaaaga cgtataatgc cgtatcccca aaagtaaaat 121800

aatcaggacg aataattcta ataaactcag aacaatatct cgcatccata tgtttggagc 121860

aaatatcgga ataagtagac atagccggtt tccgttttgc acgtaaccat tctaaacaat 121920

tggggtttcc aggatcgttt ctacaaaatc cagtcatgaa atcgtcacaa tgttctgtct 121980

tgtaattatt attaaatatt tttggacagt gtttggtatt tgtcttagaa caacattttg 122040

ctacgctatc actatcgccc aggagataat ccttttttat aaaatgacat cgttgcccgg 122100

atgctatata atcagtagcg tgttttaaat ccttaatata ttcaggagtt acctcgttct 122160

gataatagat taatgatcca ggacgaaatt tgaaagaact acatggttct ccatgaatta 122220

atacatattg tttagcaaat tcaggaacta taaaactact acaatgatct atcgacatac 122280

catctatcaa acaaaacttg ggtttaattt ctcccggaga tgtttcataa tagtacgtat 122340

aactttcttc tgcaaactta acagctctat tatattcagg ataattaaaa cctaattcca 122400

tatatttgtc tcgtatatct gctattcctg gtgctatttt gattctatta agagtaacag 122460

ctgcccccat tcttaataat cgtcagtatt taaactgtta aatgttggta tatcaacatc 122520

taccttattt cccgcagtat aaggtttgtt gcaggtatac tgttcaggaa tggttacatt 122580

tatacttctt ctatagtcct gtctttcgat gttcatcaca tatgcaaaga acagaataaa 122640

caaaataatg taagaaataa tattaaatat ctgtgaattc gtaaatacat tgattgccat 122700

aataattaca gcagctacaa tacacacaat agacattccc acagtgttgc cattacctcc 122760

acgatacatt tgagttacta agcaataggt aataactaag ctagtaagag gcaatagaaa 122820

agatgagata aatatcatca atatagagat tagaggaggg ctatatagag ccaagacgaa 122880

caaaatcaaa ccgagtaacg ttctaacatc attatttttg aagattccca aataatcatt 122940

cattcctcca taatcgtttt gcatcatacc tccatcttta ggcataaacg attgctgctg 123000

ttcctctgta aataaatctt tatcaagcac tccagcaccc gcagagaagt cgtcaagcat 123060

attgtaatat cttaaataac tcatttatat attaaaaaat gtcactatta aagatggagt 123120

ataatcttta tgccgaacta aaaaaaatga cttgtggtca acccctaagt ctttttaacg 123180

aagacgggga tttcgtagaa gttgaaccgg gatcatcctt taagtttctg atacctaagg 123240

gattttacgc ctctccttcc gtaaagacga gtctagtatt cgagacatta acaacgaccg 123300

ataataaaat cactagtatc aatccaacaa atgcgccaaa gttatatcct cttcaacgca 123360

aagtcgtatc tgaagtagtt tctaatatga ggaaaatgat cgaatcaaaa cgtcctctat 123420

acattactct tcacttggcg tgtggatttg gtaagactat taccacgtgt tatcttatgg 123480

ctacacacgg tagaaaaacc gtcatttgcg tacccaataa aatgttaata catcaatgga 123540

agacacaggt agaggcagtc ggattggaac ataagatatc catagatgga gtaagtagtc 123600

tattaaagga actaaagact caaagtccgg atgtattaat agtagtcagt agacatctga 123660

caaacgatgc cttttgtaaa tatatcaata agcattatga tttgttcatc ttggatgaat 123720

cacatacgta taatctgatg aacaatacag cagttacaag atttttagcg tattatcctc 123780

cgatgatgtg ttatttttta actgctacac ctagaccatc taacagaatt tattgtaaca 123840

gtattattaa tattgccaag ttatccgatc taaaaaaaac tatctatgcg gtagatagtt 123900

tttttgagcc atattccaca gacaatatta gacatatgat aaaacgatta gatggaccat 123960

ctaataaata tcatatatat actgagaagt tattatctgt agacgagcct agaaatcaac 124020

ttattcttga taccctggta gaagaattca agtcaggaac tattaatcgc attttagtta 124080

ttactaaact acgtgaacat atggtattct tctacaaacg attattagat cttttcggac 124140

cagaggttgt atttatagga gacgcccaaa atagacgtac tccagatatg gtcaaatcaa 124200

tcaaggaact aaatagattt atattcgtat ccaccttatt ttattccggt actggtttag 124260

atattcctag tttggattcg ttgttcattt gctcggcagt aatcaacaat atgcaaatag 124320

agcaattact agggagggta tgtcgagaaa cagaactatt agataggacg gtatatgtat 124380

ttcctaacac atccatcaaa gaaataaagt acatgatagg aaatttcatg caacgaatta 124440

ttagtctgtc tgtagataaa ctaggattta aacaaaaaag ttatcggaaa catcaagaat 124500

ccgatcccac ttctgtatgt acaacatcct ccagagaaga acgtgtatta aatagaatat 124560

ttaactcgca aaatcgttaa gaagtttaag cgacgatccg catgctgcgc aggccagtgt 124620

attacccctc atagtattaa tataatccaa tgatactttt gtgatgtcgg aaatcttaac 124680

caatttagac tgacaggcag aacacgtcat gcaatcatca tcgtcatcga taactgtagt 124740

cttgggcttc tttttgcggc tcttcattcc ggaacgcaca ttggtgctat ccatttaggt 124800

agtaaaaaat aagtcagaat atgccctata gcacgatcgt gcaaaacctg gtatatcgtc 124860

tctatcttta tcacaatata gtgtatcgac atctttatta ttattgacct cgtttatctt 124920

ggaacatgga atgggaacat ttttgttatc aacggccatc tttgccttaa ttccagatgt 124980

tgtaaaatta taactaaaca gtctatcatc gacacaaatg aaattcttgt ttagacgttt 125040

gtagtttacg tatgcggctc gttcgcgtct cattttttca gatattgcag gtactataat 125100

attaaaaata agaatgaaat aacataggat taaaaataaa gttatcatga cttctagcgc 125160

tgatttaact aacttaaaag aattacttag tctgtacaaa agtttgagat tttcagattc 125220

tgcggctata gaaaagtata attctttggt agaatgggga acatctactt actggaaaat 125280

aggcgtgcaa aaggtagcta atgtcgagac gtcaatatct gattattatg atgaggtaaa 125340

aaataaaccg tttaatattg atccgggcta ttacattttc ttaccggtat attttgggag 125400

cgtctttatt tattcgaagg gtaaaaatat ggtagaactt ggatctggaa actcttttca 125460

aataccagat gatatgcgaa gtgcgtgtaa caaagtatta gacagcgata acggaataga 125520

ctttctgaga tttgttttgt taaacaatag atggataatg gaagatgcta tatcaaaata 125580

tcagtctcca gttaatatat ttaaactagc tagtgagtac ggattaaaca tacccaaata 125640

tttagaaatt gaaatagagg aagacacatt atttgacgac gagttatact ctattataga 125700

acgctctttc gatgataaat ttccaaaaat atccatatcg tatattaagt tgggagaact 125760

taggcggcaa gttgtagact ttttcaaatt ctcgttcatg tatattgagt ccatcaaggt 125820

agatcgtata ggagataata tttttattcc tagcgttata acaaaatcag gaaaaaagat 125880

attagtaaaa gatgtagacc atttaatacg atccaaggtt agagaacata catttgtaaa 125940

agtaaaaaag aaaaacacat tttccatttt atacgactat gatggaaacg gaacagaaac 126000

tagaggagaa gtaataaaac gaattataga cactatagga cgagactatt atgttaacgg 126060

aaagtatttc tctaaggttg gtagtgcagg cttaaagcaa ttgactaata aattagatat 126120

taatgagtgc gcaactgtcg atgagttagt tgatgagatt aataaatccg gaactgtaaa 126180

acgaaaaata aaaaaccaat cagcatttga tttaagcaga gaatgtttgg gatatccaga 126240

agcggatttt ataacgttag ttaataacat gcggttcaaa atagaaaatt gtaaggttgt 126300

aaatttcaat attgaaaata ctaattgttt aaataacccg agtattgaaa ctatatatgg 126360

aaactttaac cagttcgtct caatctttaa tatcgtcacc gatgtcaaaa aaagattatt 126420

cgagtgaaat aatatgcgcc tttgatatag gtgcaaaaaa tcctgccaga actgttttag 126480

aagtcaagga taactccgtt agggtattgg atatatcaaa attagactgg agttctgatt 126540

gggaaaggcg catagctaaa gatttgtcac aatatgaata cactacagtt cttctagaac 126600

gtcagcctag aaggtcgccg tatgttaaat ttatctattt tattaaaggc tttttatatc 126660

atacatcggc tgccaaagtt atttgcgtct cgcctgtcat gtctggtaat tcatatagag 126720

atcgaaaaaa gagatcggtc gaagcatttc ttgattggat ggacacattc ggattgcgag 126780

actccgttcc ggatagacgc aaattagacg atgtagcgga tagtttcaat ttggctatga 126840

gatacgtatt agataaatgg aatactaatt atacacctta taataggtgt aaatctagaa 126900

attacataaa aaaaatgtaa taacgttagt aacgccatta tggataatct atttaccttt 126960

ctacatgaaa tagaagatag atatgccaga actattttta actttcatct aataagttgc 127020

gatgaaatag gagatatata tggtcttatg aaagaacgca tttcctcaga ggatatgttt 127080

gataatatag tgtataataa agatatacat cctgccatta agaaactagt gtattgcgac 127140

atccaactta ctaaacacat tattaatcag aatacgtatc cggtatttaa cgattcttca 127200

caagtgaaat gttgtcatta tttcgacata aactcagata atagcaatat tagctctcgt 127260

acagtagaga tatttgagag ggaaaagtca tctcttgtat catatattaa aactaccaat 127320

aagaagagaa aggtcaatta cggcgaaata aagaaaactg ttcatggagg cactaatgca 127380

aattactttt ccggtaaaaa gtctgacgag tatctgagta ctacagttag atccaacatt 127440

aatcaacctt ggatcaaaac catctctaag aggatgagag ttgatatcat taatcactct 127500

atagtaacgc gtggaaaaag ctctatatta caaactatag aaattatttt tactaataga 127560

acatgtgtga aaatattcaa ggattctact atgcacatta ttctatccaa ggacaaggat 127620

gaaaaggggt gtatacacat gattgacaaa ttattctatg tctattataa tttatttctg 127680

ttgttcgagg atatcatcca aaacgagtac tttaaagaag tagctaatgt tgtaaaccac 127740

gtactcacgg ctacggcatt agatgagaaa ttattcctaa ttaagaaaat ggctgaacac 127800

gatgtttatg gagttagcaa tttcaaaata gggatgttta acctgacatt tattaagtcg 127860

ttggatcata ccgttttccc ctctctgtta gatgaggata gcaaaataaa gttttttaag 127920

gggaaaaagc tcaatattgt agcattacga tctctggagg attgtataaa ttacgtgact 127980

aaatccgaga atatgataga aatgatgaag gaaagatcga ctattttaaa tagcatagat 128040

atagaaacgg aatcggtaga tcgtctaaaa gaattgcttc taaaatgaaa aaaaacactg 128100

attcagaaat ggatcaacga ctcggatata agtttttggt gcctgatcct aaagccggag 128160

ttttttatag accgttacat ttccaatatg tatcgtattc taattttata ttgcatcgat 128220

tgcatgaaat cttgaccgtc aagcggccac tcttatcgtt taagaataat acagaacgaa 128280

ttatgataga aattagcaat gttaaagtga ctcctccaga ttactcacct ataatcgcga 128340

gtattaaagg taagagttat gacgcattag ccacgttcac tgtaaatatc tttaaagagg 128400

taatgaccaa agagggtata tccatcacta aaataagtag ttatgaggga aaagattctc 128460

atttgataaa aattccgcta ctaataggat acgggaataa aaatccactt gatacagcca 128520

agtatcttgt tcctaatgtc ataggtggag tctttatcaa taaacaatct gtcgaaaaag 128580

taggaattaa tctagtagaa aagattacaa catggccaaa atttagggtt gttaagccaa 128640

actcattcac tttctcgttt tcctccgtat cccctcctaa tgtattaccg acaagatatc 128700

gccattacaa gatatctctg gatatatcac aattggaagc gttgaatata tcatcgacaa 128760

agacatttat aacggtcaat attgttttgc tgtctcaata tttatctaga gtgagtctag 128820

aattcattag acgtagttta tcatacgata tgcctccaga agttgtctat ctagtaaacg 128880

cgataataga tagtgctaaa cgaattactg aatctattac tgactttaat attgatacat 128940

acattaatga cctggtggaa gctgaacaca ttaaacaaaa atctcagtta acgattaacg 129000

agttcaaata tgaaatgctg cataactttt tacctcatat gaactataca cccgatcaac 129060

taaagggatt ttatatgata tctttactaa gaaagtttct ctactgtatc ttccacactt 129120

ctagatatcc agatagagat tcgatggttt gtcatcgcat cctaacgtac ggcaaatatt 129180

ttgagacgtt ggcacatgat gaattagaga attacatagg caacatccga aacgatatca 129240

tgaacaatca caagaacaga ggcacttacg cggtaaacat tcatgtacta acaactcccg 129300

gacttaatca cgcgttttct agcttattga gtggaaagtt caaaaagtca gacggtagtt 129360

atcgaacaca tcctcactat tcatggatgc agaatatttc tattcctagg agtgttggat 129420

tttatccgga tcaagtaaag atttcaaaga tgttttctgt cagaaaatac catccaagtc 129480

aatatcttta cttttgttca tcagacgttc cggaaagagg tcctcaggta ggtttagtat 129540

ctcaattgtc tgtcttgagt tccattacaa atatactaac gtctgagtat ttggatttgg 129600

aaaagaaaat ttgtgagtat atcagatcat attataaaga tgatataagt tactttgaaa 129660

caggatttcc aatcactata gaaaatgctc tagtcgcatc tcttaatcca aatatgatat 129720

gtgattttgt aactgacttt agacgtagaa aacggatggg attcttcggt aacttggagg 129780

taggtattac tttagttagg gatcacatga atgaaattcg cattaatatt ggagcgggaa 129840

gattagtcag accattcttg gttgtggata acggagagct catgatggat gtgtgtccgg 129900

agttagaaag cagattagac gacatgacat tctctgacat tcagaaagag tttccgcatg 129960

tcatcgaaat ggtagatata gaacaattta cttttagtaa cgtatgtgaa tcggttcaaa 130020

aatttagaat gatgtcaaag gatgaaagaa agcaatacga tttatgtgac tttcctgccg 130080

aatttagaga tggatatgtg gcatcttcat tagtgggaat caatcacaat tctggaccca 130140

gagctattct tggatgtgct caagctaaac aagctatctc ttgtctgagt tcggatatac 130200

gaaataaaat agacaatgga attcatttga tgtatccaga gaggccaatc gtgattagta 130260

aggctttaga aacttcaaag attgcggcta attgcttcgg ccaacatgtt actatagcat 130320

taatgtcgta caaaggtatc aatcaagagg atggaattat catcaaaaaa caatttattc 130380

agagaggcgg tctcgatata gttaccgcaa agaaacatca agtagaaatt ccattggaaa 130440

actttaataa caaagaaaga gataggtcta acgcctattc aaaattagaa agtaatggat 130500

tagttagact gaatgctttc ttggaatccg gagacgctat ggcacgaaat atctcatcaa 130560

gaactcttga agatgatttt gctagagata atcagattag cttcgatgtt tccgagaaat 130620

ataccgatat gtacaaatct cgcgttgaac gagtacaagt agaacttact gacaaagtta 130680

aggtacgagt attaaccatg aaagaaagaa gacccattct aggagacaaa tttaccacta 130740

gaacgagtca aaagggaaca gtcgcgtatg tcgcggatga aacggaactt ccatacgacg 130800

aaaatggtat cacgccagat gtcattatta attctacatc catcttctct agaaaaacta 130860

tatctatgtt gatagaagtt attttaacag ccgcatattc tgctaagccg tacaacaata 130920

agggagaaaa ccgacctgtc tgttttccta gtagtaacga aacatccatc gatacatata 130980

tgcaattcgc taaacaatgt tatgagcatt caaatccgaa attgtctgat gaagaattat 131040

cggataaaat cttttgtgaa aagattctct atgatcctga aacggataag ccttatgcat 131100

ccaaagtatt ttttggacca atttattact tgcgtctgag acatttaact caggacaagg 131160

caaccgttag atgtagaggt aaaaagacga agctcattag acaggcgaat gagggacgaa 131220

aacgtggagg aggtatcaag ttcggagaaa tggagagaga ctgtttaata gcgcatggcg 131280

cagccaatac tattacagaa gttttgaaag attcggaaga agattatcaa gatgtgtatg 131340

tttgtgaaaa ttgtggagac atagcagcac aaatcaaggg tattaataca tgtcttagat 131400

gttcaaaact taatctctct cctctcttaa caaaaattga taccacgcac gtatctaaag 131460

tatttcttac tcaaatgaac gccagaggcg taaaagtcaa attagatttc gaacgaagac 131520

ctccttcgtt ttataaacca ttagataaag ttgatctcaa gccgtctttt ctggtgtaat 131580

attctagttt ggtagtagat acatatcaat atcatcaaat tcgagatccg aattataaaa 131640

tgggcgtgga ttgttaacta tagaatcgga cgtctgatat tcgaaaatct gtggagtttc 131700

aggttttggt ggaggtgtaa ctgctacttg ggatactgaa gtctgatatt cagaaagctg 131760

tggatgttct ggttcggcat ccaccgatgg tgtcacatca ctaatcggtt cggtaacgtc 131820

tgtggatgga ggtgctactt ctacagaacc tgtagcctca gttgtcaacg gagatacatt 131880

tttaatgcga gaaaatgtat aatttggtaa tggtttctca tgtggatctg aagaagaggt 131940

aagatatcta ctagaaagat accgatcacg ttctagttct cttttgtaga acttaacttt 132000

ttctttctcc gcatctagtt gatattccaa cctcttcacg ttactacgtt cagattccaa 132060

ttcacgttcg catgggttac ctccgcagtt tttacgagcg atttcacgtt cagccttcat 132120

gcgtctctcc ctctctctat cgagtttatc agagcagtct ttctgaaggc gatcgaactc 132180

cataaatttc tccaacgctt tgattgtttc catagatttc cgaacttcag cttctaggac 132240

ggcgattctt tttctttcga attcacagct ggatgtacaa ccgtttccat taccgccatc 132300

tctaagtttc ttttctagat cggcaacatt tcatccccat gccttttaca ttcctcgagt 132360

ctactgtcgt cgaaatatcg ttccagctcc ttttcgacat caataacttt agcacgttgt 132420

ctctcaagct ctcttttgta gttatctgat tccctggcac gtttaagatc ttcatgcaat 132480

tgagtcagct cttaacttcc tctcttgctt cttcgtcata gtacgcgcaa tcactgtgag 132540

atccattgtt accacgtcta cactcggcga gctcgcgttt aagagattca atttcccgtt 132600

tgtattggtc catgtttcca ttgctaccac cattagattt acaggctgct agttgtcgtt 132660

cgagatcaga aatacgggtt ttcttggaat tgatttcgtc gatgtacttg gcatcgaaac 132720

acttattaag ttctttttcc aattctacga ttttatttct ttcgcgagtc aattccctcc 132780

tgtagtaact atctgttttg tcagattcac gctctctacg tagactttct tgcaagttac 132840

taatttgttc cctagcacgt ccgagtttag ttttatatgc tgaatagagt tctgattcat 132900

cctttgagca gatctctagc gatcgtttaa gattcctgat tctagtcttt agcctattta 132960

cctcctcaga agatgttccg ttaccgttgc gtttacactc gttaagctgt ctatcaagat 133020

ccatgattct atctctaaga cgttgcatct ctctttccat atcagcattg ctttcattat 133080

tacgtctgca gtcactcaac tgtctttcaa tatctgagat tctatctcta agacgtcgca 133140

tctctctctg tttcagcatt ggtttcatta ttacgtctac agtcgttcaa ctgtctttca 133200

agatctgata ttctagattg gagtctgcta atctctgtag cattttcacg gcattcactc 133260

agttgtcttt caagatctga aattttagat tggagtctgc taatctctgt aagatttcct 133320

cctccgctct cgatgcagtt ggtcaactta ttctctagtt ctctaatacg cgaacgcagt 133380

gcatcaactt cttgcgtgtc ttcctggttg cgtgtacatt catcgagtct agattcgaga 133440

tctctaacgc gtcgtcgttc ttcctcaagt tctctgcgta ctacagaaag cgtgtcccta 133500

tcttgttgat atttagcaat ttctgattct agagtactga ttttgcttac gtagttacta 133560

atagttgtct tggccttatc aagatcctcc ttgtatttgt cgcattcctt gatatcccta 133620

cgaagtctgg acagttccca ttcgacatta cgacgtttat cgatttcagc tcggagatcg 133680

tcatcgcgtt gttttagcca catacgactg agttcaagtt ctcgttgaca agatccatct 133740

acttttccat tcctaatagt atccagttcc ttttctagtt ctgaacgcat ttctcgttcc 133800

ctatcaagcg attctctcaa ttctcggata gtcttcttat caatttctaa taaatctgaa 133860

ccatcatctg tcccattttg aatatccctg tgttctttga tctcttttgt aagtcggtcg 133920

attctttcgg ttttataaac agaatccctt tccaaagtcc taatcttact gagtttatca 133980

ctaagttctg cattcaattc ggtgagtttt ctcttggctt cttccaactc tgttttaaac 134040

tctccactat ttccgcattc ttcctcgcat ttatctaacc attcaattag tttattaata 134100

actagttggt aatcagcgat tcctatagcc gttcttgtaa ttgtgggaac ataattagga 134160

tcttctaatg gattgtatgg cttgatagca tcatctttat cattattagg gggatggaca 134220

accttaattg gttggtcctc atctcctcca gtagcgtgtg gttcttcaat accagtgtta 134280

gtaataggct taggcaaatg cttgtcgtac gcgggcactt cctcatccat caagtattta 134340

taatcgggtt ctacttcaga atattctttt ctaagagacg cgacttcggg agttagtaga 134400

agaactctgt ttctgtatct atcaacgctg gaatcaatac tcaagttaag gatagcgaat 134460

acctcatcgt catcatccgt atcttctgaa acaccatcat atgacatttc atgaagtcta 134520

acgtattgat aaatagaatc agatttagta ttaaacagat ccttaacctt tttagtaaac 134580

gcatatgtat attttagatc tccagatttc ataatatgat cacatgcctt aaatgtcagt 134640

gcttccatga tataatctgg aacactaatg ggtgacgaaa aagatacagc accatatgct 134700

acgttgataa ataaatctga accactaagt agataatgat taatgttaag gaaaagaaaa 134760

tattcagtgt ataggtatgt cttggcgtca tatcttgtac taaacacgct aaacagtttg 134820

ttaatgtgat caatttccaa tagattaatt agagcagcgg gaataccaac aaacatatta 134880

ccacatccgt attttctatg aatatcacat atcatgttaa aaaatcttaa tagaagagcg 134940

aatatctcgt ctgacttaat gagacgtagt tcagcagcaa cataagtcat aactgtaaat 135000

agaacatact ttcctgtagt gttgattcta gactccacat caacaccatt attaaaaata 135060

gttttatata catctttaat ctgctctccg ttaatcgtcg aacgttctag tatacggaaa 135120

cactttgatt tcttatctgt agttaatgac ttagtgatat cacgaagaat attacgaatt 135180

acatttcttg tttttcttga gagacctgat tcagaactca actcatcgtt ccatagtttt 135240

tctacctcag tggcgaaatc tttggagtgc ttggtacatt tttcaataag gttcgtgacc 135300

tccatttatt ataaaaaatt tattcaaaac ttaactacaa tcgggtaatt ataagatcgt 135360

aaatctccca tgtggcggaa tactaccatc tatcgcatgt ggatggacag taggtaatgg 135420

ccatgggaac agtaatgatt gcatatttat ctttcttgct agtattactg catattgtcc 135480

caatgtttcg atgtgatgtt ctaacctatc aactgccgct gtatcacaac aatagtgtcc 135540

gatgaaatta agattatgat ccaatgtgtt taatatatga ttatcaagtc ttatacgatc 135600

cgcgtctttt ttgacaggat caggttcttc tacaggaaga agtttcggcc tcttatgata 135660

ttcatgtctg ggaaacggtg gtctagggtg aggctccggt atcggagtgg gttttggatt 135720

ataatcatca tcgtctatga catcatcatc atcttcgact tcgatattta ttttgctatc 135780

ttgatgatgt cctgtatcag ttgcattttc agcactcgac tgaatattag cgcattcatt 135840

gtctattatt accatatttc taaacccaaa atgtatgtgt tgaacatcag tactatcgtt 135900

gatgagtctt atagcatgaa ttcgcttatc gttatcgggt ttatcttctg tcaccttagc 135960

aattcctttt ttattaaact ctacataatc atatccattt ctattgtttg ttctaatata 136020

aacgagtata gcatcattgc taaatttttc aatagtatcg aaaacagaat atcctaaacc 136080

atataatata tattcaggga cactcaaact aaatgtccag gattctccta aatacgtaaa 136140

ctttaatagt gcgaaatcat tcaaaaatct accacttata gatagatagt acataaatgc 136200

gtatagtagt ctacctatct ctttattatg aaaaccggca ttacgatcat atatgtcgtg 136260

atatacctgt gatccgttta cgttaaacca taaatacatg ggtgatccta taaacatgaa 136320

tttatttcta attctcagag ctatagttaa ttgaccgtgt aatatttgct tacatgcata 136380

cttgatacgc tcattaataa aatttttatc attgctcgtt atctcagaat cgtatatata 136440

aggagtacca tcgtgattct taccagatat tatacaaaat actatatata aaatatattg 136500

accaacgtta gtaatcatat aaatgtttaa cgttttaaat tttgtattca atgatccatt 136560

atcatacgct agcatggtct tatgatattc attctttaaa atataatatt gtgttagcca 136620

ttgcattggg gctcctaatg gagatttttt attctcatcc attttaggat aggctttcat 136680

aaagtcccta ataacttcgt gaataatgtt tctatgtttt ctactgatgc atgtatttgc 136740

ttcgattttt ttatcccatg tttcatctat catagattta aacgcagtaa tgctcgcaac 136800

attaacatct tgaaccgttg gtacaattcc gttccataaa tttataatgt tcgccattta 136860

tataactcat tttttgaata tacttttaat taacaaaaga gttaagttac tcatatgggc 136920

gccgtccagt ctgaacatca atctttttag ccagagatat catagccgct cttagagttt 136980

cagcgtgatt ttccaaccta aatagaactt catcgttgcg tttacaacac ttttctattt 137040

gttcaaactt tgttgttaca ttagtaatct ttttttccaa attagttagc cgttgtttga 137100

gagtttcctc attgtcgtct tcatcggctt taacaattgc ttcgcgttta gcctctggct 137160

ttttagcagc ctttgtagaa aaaaattcag ttgctggaat tgcaagatcg tcatctccgg 137220

ggaaaagagt tccgtccatt taaagtacag attttagaaa ctgacactct gcgttattta 137280

tatttggtac aacacatgga ttataaatat cgatgttaat aacatcagaa aatgtaaagt 137340

ctatacattg ttgcatcgtg ttaaattttc taatggatct agtattattg ggtccaactt 137400

ctgcctgaaa tccaaatatg gaagcggata caaaaccgtt tcctggataa accacacatc 137460

tccacttttg ctttacatca gaaattgtgt cgttgacatc ttgaactctc ctatctaatg 137520

ccggtgttcc acctatagat tttgaatatt cgaatgctgc atgagtagca ttaaattcct 137580

taatattgcc ataattttca tatattgagt aaccctggat aaaaagtaaa cacaccgcag 137640

ccgtcgctac cacaataaaa aaaattgata gagagttcat ttataatcta ttagaagctg 137700

acaaaatttt tttacacgca tcagacaatg ctttaataaa tagttcaaca tctacttttg 137760

tcatatcgaa ccgatggtat gattctaacc tagaattaca tccgaaaaag ttgactatgt 137820

tcatagtcat taagtcatta acaaacaaca ttccagactc tggattataa gacgatactg 137880

tttcgtcaca attacctacc ttaatcatgt gattatgaat attggctatt agagcacctt 137940

ctaagaaatc tataatatct ttgaaacacg atttaaaatc aaaccacgaa tatacttcta 138000

cgaagaaagt tagtttaccc ataggagaaa taactataaa tggagatcta aatacaaaat 138060

ccggatctat gatagtttta acattattat attctctatt aaatacctcc acatctaaaa 138120

atgttaattt tgaaactatg tcttcgttta ttaccgtacc tgaactaaac gctataagct 138180

ctattgtttg agaactcttt aaacgatatt cttgaaatac atgtaacaaa gtttccttta 138240

actcggtcgg tttatctacc atagttacag aatttgtatc cttatctata atataataat 138300

caaaatcgta taaagttata taattatcgc gttcagattg ggatcttttc aaatagacta 138360

aaaaccccat ttctctagta agtatcttat gtatatgttt gtaaaatatc ttcatggtgg 138420

gaatatgctc taccgcagtt agccattcct cattgacagc ggtagatgta ttagacaaaa 138480

ctattccaat gtttaacaag ggccatttta cgagattatt aaatccttgt ttgataaatg 138540

tagccaatga gggttcgagt tcaacgacga ttgaattctc ttcccgcgga tgctgcatga 138600

tgaacgacgg gatgttgttc gattgatttg gaattctttt tcgacttttt gtttatatta 138660

aatattttaa aatttatagc ggatagcaat tcatgtacca cggataatgt agacgcgtat 138720

tgcgcatcga tatctttatt attagataaa tttatcaata aatgtgagaa gtttgcctcg 138780

ttaaggtctt ccatttaaat attatataaa catttgtgtt tgtatcttat tcgtctttta 138840

tggaatagtt ttttactagt aaagctgcaa ttacacactt tgtccgtaaa acataaatat 138900

aaacaccagc ttttatcaat cgttccaaaa agtcgacggc ggacattttt aacatggcat 138960

ctattttaaa tacacttagg tttttggaaa aaacatcatt ttataattgt aacgattcaa 139020

taactaaaga aaagattaag attaaacata agggaatgtc atttgtattt tataagccaa 139080

agcattctac cgttgttaaa tacttgtctg gaggaggtat atatcatgat gatttggttg 139140

tattggggaa ggtaacaatt aatgatctaa agatgatgct attttacatg gatttatcat 139200

atcatggagt gacaagtagt ggagcaattt acaaattggg atcgtctatc gatagacttt 139260

ctctaaatag gactattgtt acaaaagtta ataattatga tgatacattt tttgacgacg 139320

atgattgatc gctattgcac aattttgttt ttttactttc taatatagcg tttagattct 139380

ttttcatgtg cgaatattga tttactaaaa tatcgatgtt taacttttgt tctatgacgt 139440

ccttatcagc ggtatcggta catatacgta attcaccttc acaaaatacg gagtcttcga 139500

taataatagc caatcgatta ttggatctag cggtctgtat catattcaac atgtttaata 139560

tatcctttcg tttccccttt acaggcatcg atcgtagcat attttccgcg tctgagatgg 139620

aaatgttaaa actacaaaaa tgcgtaatgt tagcccgtcc taatattggt acgtgtctat 139680

aagtttggca tagtagaata atagacgtgt ttaaatgcct tccaaagttt aagaattcta 139740

ttagagtatt gcattttgat agtttatcgc ctacatcatc aaaaataagt aaaaagtgtg 139800

ctgatttttt atgattttgt gcgacagcaa tacatttttc tatgttactt ttagttcgta 139860

tcagattata ttctagagat tcctgactac taacgaaatt aatatgattt ggccaaatgt 139920

atccatcata atctggatta taaacgggtg taaacaagaa tatatgttta tattttttaa 139980

ctagtgtaga aaacagagat agtaaataga tagtttttcc agatccagat cctcccgtta 140040

aaaccattct aaacggcatt tttaataaat tttctcttga aaattgtttt tcttggaaac 140100

aattcataat tatatttaca gttactaaat taatttgata ataaatcaaa atatggaaaa 140160

ctaaggtcgt tagtagggag gagaacaaag aaggcacatc gtgacataaa taacatttat 140220

tatcatgatg acaccagaaa acgacgaaga gcagacatct gtgttctccg ctactgttta 140280

cagagacaaa attcagggaa agaataaacg caaacgcgtg attggtctat gtattagaat 140340

atctatggtt atttcactac tatctatgat taccatgtcc gcgtttctca tagtgcgcct 140400

aaatcaatgc atgtctgcta acgaggctgc tattactgac gccgctgttg ccgttgctgc 140460

tgcatcatct actcatagaa aggttgcgtc tagcactacg caatatgatc acaaagaaag 140520

ctgtaatggt ttatattacc agggttcttg ttatatatta cattcagact accagttatt 140580

ctcggatgct aaagcaaatt gcactgcgga atcatcaaca ctacccaata aatccgatgt 140640

cttgactacc tggctcattg attatgttaa ggatacatgg ggatctgatg gtaatccaat 140700

tacaaaaact acatccgatt atcaagattc tgatgtatca caagaagtta gaaagtattt 140760

ttgtgttaaa acaatgaact aatatttatt tttgtacatt aataaatgaa atcgcttaat 140820

agacaaactg taagtaggtt taagaagttg tcggtgccgg ccgctataat gatgatactc 140880

tcaaccatta ttagtggcat aggaacattt ctgcattaca aagaagaact gatgcctagt 140940

gcttgcgcca atggatggat acaatacgat aaacattgtt atttagatac taacattaaa 141000

atgtctacag ataatgcggt ttatcagtgt cgtaaattac gagccagatt gcctagaccg 141060

gatactagac atctgagagt attgtttagt attttttata aagattattg ggtaagttta 141120

aaaaagacca atgataaatg gttagatatt aataatgata aagatataga tattagtaaa 141180

ttaacaaatt ttaaacaact aaacagtacg acggatgctg aagcgtgtta tatatacaag 141240

tctggaaaac tggttaaaac agtatgtaaa agtactcaat ctgtactatg tgttaaaaaa 141300

ttctacaagt gacaacaaaa aatgaattaa taataagtcg ttaacgtacg ccgccatgga 141360

cgccgcgttt gttattactc caatgggtgt gttgactata acagatacat tgtatgatga 141420

tctcgatatc tcaatcatgg actttatagg accatacatt ataggtaaca taaaaactgt 141480

ccaaatagat gtacgggata taaaatattc cgacatgcaa aaatgctact ttagctataa 141540

gggtaaaata gttcctcagg attctaatga tttggctaga ttcaacattt atagcatttg 141600

tgccgcatac agatcaaaaa ataccatcat catagcatgc gactatgata tcatgttaga 141660

tatagaagat aaacatcagc cattttatct attcccatct attgatgttt ttaacgctac 141720

aatcatagaa gcgtataacc tgtatacagc tggagattat catctaatca tcaatccttc 141780

agataatctg aaaatgaaat tgtcgtttaa ttcttcattc tgcatatcag acggcaatgg 141840

atggatcata attgatggga aatgcaatag taatttttta tcataaaagt tgtaaagtaa 141900

ataataaaac aataaatatt gaactagtag tacgtatatt gagcaatcag aaatgatgct 141960

ggtacctctt atcacggtga ccgtagttgc gggaacaata ttagtatgtt atatattata 142020

tatttgtagg aaaaagatac gtactgtcta taatgacaat aaaattatca tgacaaaatt 142080

aaaaaagata aagagttcta attccagcaa atctagtaaa tcaactgata gcgaatcaga 142140

ctgggaggat cactgtagtg ctatggaaca aaacaatgac gtagataata tttctaggaa 142200

tgagatattg gacgatgata gcttcgctgg tagtttaata tgggataacg aatccaatgt 142260

tatggcgcct agcacagaac acatttacga tagtgttgct ggaagcacgc tgctaataaa 142320

taatgatcgt aatgaacaga ctatttatca gaacactaca gtagtactta atgaagatac 142380

caaacagaat cctaactatt catccaatcc tttcgtaaat tataataaaa ccagtatt