Инсектицидные белки растительного происхождения и способы их применения



Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
Инсектицидные белки растительного происхождения и способы их применения
C12N15/8286 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2762832:

Е.И.ДЮПОН ДЕ НЕМУР ЭНД КОМПАНИ (US)
ПАЙОНИР ХАЙ-БРЕД ИНТЕРНЭШНЛ, ИНК. (US)

Изобретение относится к рекомбинантному инсектицидному полипептиду, а также к кодирующему его полинуклеотиду и содержащей его композиции. Также раскрыта ДНК-конструкция и растение, содержащие вышеуказанный полинуклеотид. Изобретение эффективно для борьбы с вредителем Diabrotica virgifera и вредителем Diabrotica barberi. 10 н. и 7 з.п. ф-лы, 6 ил., 11 табл., 17 пр.

 

ССЫЛКА НА ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ, ПРЕДСТАВЛЕННЫЙ В ЭЛЕКТРОННОМ ВИДЕ

Официальная копия данного перечня последовательностей предоставлена в электронном виде с помощью EFS-Web как перечень последовательностей в файле формата ASCII с названием "6472WOPCT_Sequence_Listing", созданном 03 июня 2016 года и имеющем размер 4831 килобайтов, и подана одновременно с описанием. Перечень последовательностей, содержащийся в данном документе в формате ASCII, является частью описания и включен в данный документ с помощью ссылки во всей своей полноте.

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к области молекулярной биологии. Предусмотрены новые гены, которые кодируют пестицидные белки. Эти пестицидные белки и последовательности нуклеиновой кислоты, которые их кодируют, применимы в получении пестицидных составов и в получении трансгенных растений, устойчивых к вредителям.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

Биологический контроль насекомых-вредителей, имеющих значение для сельского хозяйства, с применением микробного средства, такого как грибы, бактерии или другие виды насекомых, представляет не оказывающую отрицательного влияния на окружающую среду и коммерчески привлекательную альтернативу синтетическим химическим пестицидам. В целом можно сказать, что применение биопестицидов создает меньший риск загрязнения и неблагоприятных воздействий на окружающую среду, и биопестициды обеспечивают специфичность в отношении большего числа мишеней, чем та, которая характерна для традиционных химических инсектицидов широкого спектра действия. Кроме того, зачастую производство биопестицидов стоит дешевле, и вследствие этого улучшается экономически эффективный выход продукции для широкого спектра сельскохозяйственных культур.

Как известно, определенные виды микроорганизмов рода Bacillus обладают пестицидной активностью в отношении ряда насекомых-вредителей, в том числе Lepidoptera, Diptera, Coleoptera, Hemiptera и других. Bacillus thuringiensis (Bt) и Bacillus popilliae входят в число наиболее успешных средств биологического контроля, разработанных на данное время. Патогенность в отношении насекомых также приписывалась штаммам B. larvae, B. lentimorbus, B. sphaericus и B. cereus. Микробные инсектициды, в частности полученные из штаммов Bacillus, сыграли важную роль в сельском хозяйстве как альтернатива химическому контролю вредителей.

Были разработаны культурные растения с повышенной устойчивостью к насекомым с помощью генной инженерии культурных растений для выработки пестицидных белков Bacillus. Например, с помощью генной инженерии были разработаны растения кукурузы и хлопчатника для выработки пестицидных белков, выделенных из штаммов Bt. Данные сельскохозяйственные культуры, разработанные с помощью генной инженерии, в настоящее время широко применяются в сельском хозяйстве и предоставляют фермеру не оказывающую отрицательного влияния на окружающую среду альтернативу традиционным способам контроля насекомых. Хотя они и были признаны коммерчески весьма успешными, данные разработанные с помощью генной инженерии устойчивые к насекомым культурные растения обеспечивают устойчивость только к узкому спектру экономически важных насекомых-вредителей. В некоторых случаях насекомые могут развивать устойчивость к различным инсектицидным соединениям, что повышает необходимость в идентификации альтернативных биологических средств контроля для контроля вредителей.

Соответственно, остается необходимость в новых пестицидных белках с различными спектрами инсектицидной активности в отношении насекомых-вредителей, например, в инсектицидных белках, которые активны в отношении ряда насекомых из отряда Lepidoptera и отряда Coleoptera, в том числе без ограничения насекомых-вредителей, у которых развилась устойчивость к существующим инсектицидам.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

В одном аспекте предусмотрены композиции и способы обеспечения пестицидной активности у бактерий, растений, растительных клеток, тканей и семян. Композиции включают молекулы нуклеиновой кислоты, кодирующие последовательности пестицидных и инсектицидных полипептидов, векторы, содержащие такие молекулы нуклеиновой кислоты, и клетки-хозяева, содержащие векторы. Композиции также включают последовательности пестицидных полипептидов и антитела к таким полипептидам. Последовательности нуклеиновой кислоты можно применять в ДНК-конструкциях или кассетах экспрессии для трансформации и экспрессии в организмах, в том числе микроорганизмах и растениях. Нуклеотидные или аминокислотные последовательности могут представлять собой синтетические последовательности, которые были сконструированы для экспрессии в организме, в том числе без ограничения микроорганизме или растении. Композиции также содержат трансформированные бактерии, растения, растительные клетки, ткани и семена.

В другом аспекте предусмотрены выделенные или рекомбинантные молекулы нуклеиновой кислоты, кодирующие перфорины растительного происхождения, в том числе формы с аминокислотными заменами, делециями, вставками, фрагменты и их комбинации. В частности, предусмотрены выделенные или рекомбинантные молекулы нуклеиновой кислоты, кодирующие полипептиды IPD079, в том числе формы с аминокислотными заменами, делециями, вставками, фрагменты и их комбинации. Дополнительно охватываются аминокислотные последовательности, соответствующие полипептидам IPD079. Предусмотрены выделенные или рекомбинантные молекулы нуклеиновой кислоты, способные кодировать полипептиды IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, и SEQ ID NO: 140, а также варианты с аминокислотной заменой, варианты с делецией, варианты со вставкой, их фрагменты и их комбинации. Также охватываются последовательности нуклеиновой кислоты, которые комплементарны последовательности нуклеиновой кислоты согласно вариантам осуществления или которые гибридизуются с последовательностью согласно вариантам осуществления.

В другом аспекте предусмотрены выделенные или рекомбинантные полипептиды IPD079, в том числе без ограничения полипептиды под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, и SEQ ID NO: 140, а также варианты с аминокислотной заменой, варианты с делецией, варианты со вставкой, их фрагменты и их комбинации.

В другом аспекте предусмотрены способы получения полипептидов и применения этих полипептидов для контроля или уничтожения вредителей из группы чешуекрылых, жесткокрылых, нематод, грибов и/или двукрылых. Трансгенные растения согласно вариантам осуществления экспрессируют одну или несколько пестицидных последовательностей, раскрытых в данном документе. В различных вариантах осуществления трансгенное растение дополнительно содержит один или несколько дополнительных генов устойчивости к насекомым, например один или несколько дополнительных генов для контроля вредителей из группы жесткокрылых, чешуекрылых, полужесткокрылых или нематод. Специалисту в данной области будет понятно, что трансгенное растение может также содержать любой ген, обеспечивающий агрономический признак, представляющий интерес.

В другом аспекте также предусмотрены способы выявления нуклеиновых кислот и полипептидов согласно вариантам осуществления в образце. Предусмотрен набор для выявления наличия перфорина растительного происхождения, в том числе без ограничения полипептида IPD079 по настоящему изобретению, или выявления наличия полинуклеотида, кодирующего полипептид IPD079, в образце. Набор может предусматриваться вместе со всеми реагентами и контрольными образцами, необходимыми для осуществления способа выявления предполагаемого средства, а также с инструкциями по применению.

Композиции и способы согласно вариантам осуществления применимы для получения организмов с повышенной устойчивостью к вредителям или переносимостью их. Эти организмы и композиции, содержащие организмы, желательны для сельскохозяйственных целей. Композиции согласно вариантам осуществления также применимы для получения измененных или улучшенных белков, которые обладают пестицидной активностью, или для выявления наличия полипептидов IPD079.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

На фиг. 1A-1I показано выравнивание с помощью модуля ALIGNX® пакета программ Vector NTI® аминокислотных последовательностей IPD079Aa, (SEQ ID NO: 2), IPD079Ab (SEQ ID NO: 4), IPD079Ac (SEQ ID NO: 6), IPD079Ad (SEQ ID NO: 8), IPD079Ae (SEQ ID NO: 10), IPD079Af (SEQ ID NO: 12), IPD079Ag (SEQ ID NO: 14), IPD079Ah (SEQ ID NO: 16), IPD079Ai (SEQ ID NO: 18), IPD079Aj (SEQ ID NO: 20), IPD079Ak (SEQ ID NO: 22), IPD079Al (SEQ ID NO: 26), IPD079Am (SEQ ID NO: 28), IPD079An (SEQ ID NO: 30), IPD079Ao (SEQ ID NO: 32), IPD079Ap (SEQ ID NO: 36), IPD079Aq (SEQ ID NO: 38), IPD079Ar (SEQ ID NO: 40), IPD079As (SEQ ID NO: 44), IPD079At (SEQ ID NO: 46), IPD079Au (SEQ ID NO: 48), IPD079Av (SEQ ID NO:50), IPD079Aw (SEQ ID NO: 52), IPD079Ax (SEQ ID NO: 54), IPD079Az (SEQ ID NO: 74), IPD079Ba (SEQ ID NO: 24), IPD079Bb (SEQ ID NO:34), IPD079Bc (SEQ ID NO: 42), IPD079Bd (SEQ ID NO: 76), IPD079Be (SEQ ID NO: 78), IPD079Bf (SEQ ID NO: 80), IPD079Bg (SEQ ID NO: 82), IPD079Bh (SEQ ID NO: 84), IPD079Bi (SEQ ID NO: 86), IPD079Bj (SEQ ID NO: 88), IPD079Bk (SEQ ID NO: 90), IPD079Bl (SEQ ID NO: 92), и IPD079Bm (SEQ ID NO: 94). Различия в последовательностях выделены.

На фиг. 2A-2J представлено выравнивание аминокислотных последовательностей с помощью модуля ALIGNX® пакета программ Vector NTI® IPD079Eb (SEQ ID NO: 58), IPD079Ea (SEQ ID NO: 56), IPD079Eaa (SEQ ID NO: 132), IPD079Eab (SEQ ID NO: 134), IPD079Eac (SEQ ID NO: 136), IPD079Ead (SEQ ID NO: 138), IPD079Eae (SEQ ID NO: 140), IPD079Ec (SEQ ID NO: 60), IPD079Ed (SEQ ID NO: 62), IPD079Ee (SEQ ID NO: 64), IPD079Ef (SEQ ID NO: 66), IPD079Eg (SEQ ID NO: 68), IPD079Eh (SEQ ID NO: 70), IPD079Ei (SEQ ID NO: 96), IPD079Ej (SEQ ID NO: 98), IPD079Ek (SEQ ID NO: 100), IPD079El (SEQ ID NO: 102), IPD079Em (SEQ ID NO: 104), IPD079En (SEQ ID NO: 106), IPD079Eo (SEQ ID NO: 108), IPD079Ep (SEQ ID NO: 110), IPD079Eq (SEQ ID NO: 112), IPD079Er (SEQ ID NO: 114), IPD079Es (SEQ ID NO: 116), IPD079Et (SEQ ID NO: 118), IPD079Eu (SEQ ID NO: 120), IPD079Ev (SEQ ID NO: 122), IPD079Ew (SEQ ID NO: 124), IPD079Ex (SEQ ID NO: 126), IPD079Ey (SEQ ID NO: 128), IPD079Ez (SEQ ID NO: 130) и IPD079Fa (SEQ ID NO: 142). Различия в последовательностях выделены.

На фиг. 3 показан график конкурирования гомологов, выраженного в % общего связывания 1 нМ полипептида IPD079Aa, меченого Alexa (SEQ ID NO: 2), с мембранными везикулами щеточной каймы (BBMV) западного кукурузного жука (WCRW) относительно концентрации (нМ) немеченого полипептида IPD079Aa (SEQ ID NO: 2).

На фиг. 4 показан график конкурирования гомологов, выраженного в % общего связывания 1 нМ полипептида IPD079Ea, меченого Alexa (SEQ ID NO: 56), с мембранными везикулами щеточной каймы (BBMV) западного кукурузного жука (WCRW) относительно концентрации (нМ) немеченого полипептида IPD079Ea (SEQ ID NO: 56).

На фиг. 5 показан график, демонстрирующий показатели поражения узлов кукурузным жуком (CRWNIS) на отдельных объектах, трансформированных конструкциями PHP68039, PHP68040, PHP76130 и PHP76131, содержащими генные конструкции, кодирующие полипептид IPD079Aa (SEQ ID NO: 2) и полипептид IPD079Ea (SEQ ID NO: 56), по сравнению с объектами отрицательного контроля, содержащими конструкцию без полинуклеотида IPD079 ("пустые"). Каждый символ представляет собой отдельный объект.

На фиг. 6A-6B показано выравнивание с помощью модуля ALIGNX® пакета программ Vector NTI® аминокислотных последовательностей IPD079Aa (SEQ ID NO: 2), IPD079Ea (SEQ ID NO: 56) и химер IPD079: Chimera1 (SEQ ID NO: 1277), Chimera2 (SEQ ID NO: 1278) и Chimera3 (SEQ ID NO: 1276). Различия в последовательностях выделены. Положения точки кроссинговера в химерах отмечены "▼" в верхней части последовательности IPD079Aa.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Следует понимать, что настоящее изобретение не ограничивается конкретными описанными методиками, протоколами, клеточными линиями, родами и реагентами, в связи с этим они могут варьировать. Также следует понимать, что терминология, используемая в данном документе, предназначена лишь для описания конкретных вариантов осуществления и не подразумевается как ограничивающая объем настоящего изобретения.

Используемая в данном документе форма единственного числа включает ссылки на множественное число, если контекст явно не указывает иное. Так, например, ссылка на "клетку" включает множество таких клеток, и ссылка на "белок" включает ссылку на один или несколько белков или их эквивалентов, известных специалистам в данной области, и т. д. Все технические и научные термины, используемые в данном документе, имеют то же значение, которое обычно понимается специалистом в данной области, к которой принадлежит настоящее изобретение, если явно не указано иное.

Настоящее изобретение относится к композициям и способам для контроля вредителей. Способы предусматривают трансформацию организмов последовательностями нуклеиновой кислоты, кодирующими перфорины растительного происхождения. Способы предусматривают трансформацию организмов последовательностями нуклеиновой кислоты, кодирующими полипептиды IPD079. В частности, последовательности нуклеиновой кислоты согласно вариантам осуществления применимы для получения растений и микроорганизмов, которые обладают пестицидной активностью. Таким образом, предусмотрены трансформированные бактерии, растения, растительные клетки, растительные ткани и семена. Композиции представляют собой последовательности нуклеиновых кислот или перфоринов из видов растений. Последовательности нуклеиновых кислот находят применение в конструировании векторов экспрессии для последующей трансформации организмов, представляющих интерес, в качестве зондов для выделения других гомологичных (или частично гомологичных) генов и для получения измененного перфорина растительного происхождения, в частности полипептидов IPD079, с помощью способов, известных из уровня техники, таких как сайт-направленный мутагенез, замена доменов или ДНК-шаффлинг. Перфорины растительного происхождения находят применение в контроле или уничтожения популяций вредителей из группы чешуекрылых, жесткокрылых, двукрылых, грибов, полужесткокрылых или нематод и в получении композиций с пестицидной активностью. Насекомые-вредители, представляющие интерес, включают без ограничения виды Lepidoptera, в том числе без ограничения совку кукурузную, (CEW) (Helicoverpa zea), огневку кукурузную (ECB) (Ostrinia nubilalis), моль капустную, например Helicoverpa zea Boddie; совку соевую, например Pseudoplusia includens Walker; и совку бархатных бобов, например Anticarsia gemmatalis Hübner, а также виды Coleoptera, в том числе без ограничения западного кукурузного жука (Diabrotica virgifera) - WCRW, южного кукурузного жука (Diabrotica undecimpunctata howardi) -SCRW и северного кукурузного жука (Diabrotica barberi) - NCRW. Полипептиды IPD079 находят применение в контроле или уничтожении популяций вредителей из группы чешуекрылых, жесткокрылых, двукрылых, грибов, полужесткокрылых и нематод и в получении композиций с пестицидной активностью.

Под используемым в данном документе выражением "пестицидный токсин" или "пестицидный белок" подразумевают токсин, который обладает токсической активностью в отношении одного или нескольких вредителей, в том числе без ограничения представителей отрядов Lepidoptera, Diptera, Hemiptera и Coleoptera или типа Nematoda, или белок, который характеризуется гомологией с таким белком. Пестицидные белки были выделены из организмов, в том числе, например, Bacillus sp., Pseudomonas sp., Photorhabdus sp., Xenorhabdus sp., Clostridium bifermentans и Paenibacillus popilliae. Пестицидные белки включают без ограничения инсектицидные белки из Pseudomonas sp., такие как PSEEN3174 (Monalysin; (2011) PLoS Pathogens 7:1-13); из штамма CHA0 и Pf-5 Pseudomonas protegens (ранее fluorescens) (Pechy-Tarr, (2008) Environmental Microbiology 10:2368-2386; № доступа в GenBank EU400157); из Pseudomonas Taiwanensis (Liu, et al., (2010) J. Agric. Food Chem. 58:12343-12349) и из Pseudomonas pseudoalcligenes (Zhang, et al., (2009) Annals of Microbiology 59:45-50 и Li, et al., (2007) Plant Cell Tiss. Organ Cult. 89:159-168); инсектицидные белки из Photorhabdus sp. и Xenorhabdus sp. (Hinchliffe, et al., (2010) The Open Toxicology Journal 3:101-118 и Morgan, et al., (2001) Applied and Envir. Micro. 67:2062-2069); патент США № 6048838 и патент США № 6379946; полипептид PIP-1 из публикации заявки на патент США US20140007292; полипептид AfIP-1A и/или AfIP-1B из публикации заявки на патент США US20140033361; полипептид PHI-4 из публикаций заявки на патент США US20140274885 и US20160040184; полипептид PIP-47 из патентной публикации согласно РСТ № WO2015/023846, полипептид PIP-72 из патентной публикации согласно РСТ № WO2015/038734; полипептид PtIP-50 и полипептид PtIP-65 из патентной публикации согласно РСТ № WO2015/120270; полипептид PtIP-83 из патентной публикации согласно РСТ № WO2015/120276; полипептид PtIP-96 из патентной публикации согласно РСТ с регистрационным номером PCT/US15/55502; полипептид IPD073 из патентной публикации согласно РСТ с регистрационным номером PCT/US16/32273, полипептид IPD082 из патента США с регистрационным номером 62/269482, и δ-эндотоксины, в том числе без ограничения классы Cry1, Cry2, Cry3, Cry4, Cry5, Cry6, Cry7, Cry8, Cry9, Cry10, Cry11, Cry12, Cry13, Cry14, Cry15, Cry16, Cry17, Cry18, Cry19, Cry20, Cry21, Cry22, Cry23, Cry24, Cry25, Cry26, Cry27, Cry 28, Cry 29, Cry 30, Cry31, Cry32, Cry33, Cry34, Cry35,Cry36, Cry37, Cry38, Cry39, Cry40, Cry41, Cry42, Cry43, Cry44, Cry45, Cry 46, Cry47, Cry49, Cry50, Cry51, Cry52, Cry53, Cry 54, Cry55, Cry56, Cry57, Cry58, Cry59, Cry60, Cry61, Cry62, Cry63, Cry64, Cry65, Cry66, Cry67, Cry68, Cry69, Cry70, Cry71, Cry72, Cry73 и Cry 74 генов δ-эндотоксинов и генов цитолитических токсинов cyt1 и cyt2 B. thuringiensis. Представители этих классов инсектицидных белков из B. thuringiensis хорошо известны специалисту в данной области (см., Crickmore, et al., "Bacillus thuringiensis toxin nomenclature" (2011), на веб-сайте по адресу lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/, доступ к которому можно получить во всемирной сети Интернет с использованием приставки "www").

Примеры δ-эндотоксинов также включают без ограничения белки Cry1A из патентов США №№ 5880275 и 7858849; токсины DIG-3 или DIG-11 (варианты белков cry с N-концевой делецией α-спирали 1 и/или α-спирали 2, такие как Cry1A, Cry3A) из патентов США №№ 8304604, 8304605, 8476226 и 9006520; Cry1B из публикации заявки на патент США № 2006/0112447; Cry1C из патента США № 6033874; Cry1F из патентов США №№ 5188960 и 6218188; химеры Cry1A/F из патентов США №№ 7070982; 6962705 и 6713063); белок Cry2, такой как белок Cry2Ab из патента США № 7064249); белок Cry3A, в том числе без ограничения сконструированный гибридный инсектицидный белок (eHIP), созданный путем слияния уникальных комбинаций вариабельных областей и консервативных блоков по меньшей мере двух различных белков Cry (публикация заявки на патент США № 2010/0017914); белок Cry4; белок Cry5; белок Cry6; белки Cry8 из патентов США №№ 7329736, 7449552, 7803943, 7476781, 7105332, 7378499 и 7462760; белок Cry9, как, например, представители семейств Cry9A, Cry9B, Cry9C, Cry9D, Cry9E и Cry9F; белок Cry15 из Naimov, et al., (2008) Applied and Environmental Microbiology, 74:7145-7151; Cry22, белок Cry34Ab1 из патентов США №№ 6127180, 6624145 и 6340593; белки CryET33 и cryET34 из патентов США №№ 6248535, 6326351, 6399330, 6949626, 7385107 и 7504229; гомологи CryET33 и CryET34 из патента США № 8796026, публикации заявки на патент США № 2012/0278954 и публикации согласно РСТ № WO 2012/139004; белок Cry35Ab1 из патентов США №№ 6083499, 6548291 и 6340593; белок Cry46, белок Cry 51, бинарный токсин Cry; TIC901 или родственный токсин; TIC807 из патента США № 8609936; ET29, ET37, TIC809, TIC810, TIC812, TIC127, TIC128 из WO 2007/027776; AXMI-027, AXMI-036 и AXMI-038 из патента США № 8236757; AXMI-031, AXMI-039, AXMI-040, AXMI-049 из патента США № 7923602; AXMI-018, AXMI-020 и AXMI-021 из WO 2006/083891; AXMI-010 из WO 2005/038032; AXMI-003 из WO 2005/021585; AXMI-008 из патента США № 7351881; AXMI-006 из публикации заявки на патент США № 2004/0216186; AXMI-007 из публикации заявки на патент США № 2004/0210965; AXMI-009 из заявки на патент США № 2004/0210964; AXMI-014 из публикации заявки на патент США № 2004/0197917; AXMI-004 из патента США № 7355099; AXMI-028 и AXMI-029 из WO 2006/119457, патентов США №№ 7622572, 7803925, 7803391, 7811598, 8314292; AXMI-007, AXMI-008, AXMI-0080, AXMI-009, AXMI-014 и AXMI-004 из WO 2004/074462; AXMI-150 из патента США № 8084416; AXMI-205 из публикации заявки на патент США № 2011/0023184; AXMI-011, AXMI-012, AXMI-013, AXMI-015, AXMI-019, AXMI-044, AXMI-037, AXMI-043, AXMI-033, AXMI-034, AXMI-022, AXMI-023, AXMI-041, AXMI-063 и AXMI-064 из патента США № 8829279 или публикации заявки на патент США № US20140344999; AXMI-R1 и родственные белки из патента США № 8299217; AXMI221Z, AXMI222z, AXMI223z, AXMI224z и AXMI225z из патента США № 8686124; AXMI218, AXMI219, AXMI220, AXMI226, AXMI227, AXMI228, AXMI229, AXMI230 и AXMI231 из патента США № 8759619; AXMI-115, AXMI-113, AXMI-005, AXMI-163 и AXMI-184 из патента США № 8334431; AXMI-001, AXMI-002, AXMI-030, AXMI-035 и AXMI-045 из публикации заявки на патент США № 2013/0117884; AXMI-066 и AXMI-076 из публикации заявки на патент США № 2009/0144852; AXMI128, AXMI130, AXMI131, AXMI133, AXMI140, AXMI141, AXMI142, AXMI143, AXMI144, AXMI146, AXMI148, AXMI149, AXMI152, AXMI153, AXMI154, AXMI155, AXMI156, AXMI157, AXMI158, AXMI162, AXMI165, AXMI166, AXMI167, AXMI168, AXMI169, AXMI170, AXMI171, AXMI172, AXMI173, AXMI174, AXMI175, AXMI176, AXMI177, AXMI178, AXMI179, AXMI180, AXMI181, AXMI182, AXMI185, AXMI186, AXMI187, AXMI188, AXMI189 из патента США № 8318900 или публикации заявки на патент США № 2013/0055469; AXMI079, AXMI080, AXMI081, AXMI082, AXMI091, AXMI092, AXMI096, AXMI097, AXMI098, AXMI099, AXMI100, AXMI101, AXMI102, AXMI103, AXMI104, AXMI107, AXMI108, AXMI109, AXMI110, AXMI111, AXMI112, AXMI114, AXMI116, AXMI117, AXMI118, AXMI119, AXMI120, AXMI121, AXMI122, AXMI123, AXMI124, AXMI1257, AXMI1268, AXMI127, AXMI129, AXMI164, AXMI151, AXMI161, AXMI183, AXMI132, AXMI138, AXMI137 из патента США № 8461421 и публикации заявки на патент США № 2013/0305412, белки cry, такие как Cry1A и Cry3A, имеющие модифицированные протеолитические сайты, из патента США № 8319019; белки токсинов Cry1Ac, Cry2Aa и Cry1Ca из штамма VBTS 2528 Bacillus thuringiensis из патента США № 8551757. Инсектицидная активность белков Cry хорошо известна специалисту в данной области (для обзора см. van Frannkenhuyzen, (2009) J. Invert. Path. 101:1-16). Применение белков Cry в качестве признаков трансгенного растения хорошо известно специалисту в данной области, и трансгенные растения с Cry, в том числе без ограничения растения, экспрессирующие Cry1Ac, Cry1Ac+Cry2Ab, Cry1Ab, Cry1A.105, Cry1F, Cry1Fa2, Cry1F+Cry1Ac, Cry2Ab, Cry3A, mCry3A, Cry3Bb1, Cry34Ab1, Cry35Ab1, Vip3A, mCry3A, Cry9c и CBI-Bt, были разрешены контролирующими органами (см. Sanahuja, (2011) Plant Biotech Journal 9:283-300 и CERA. (2010) GM Crop Database Center for Environmental Risk Assessment (CERA), ILSI Research Foundation, г. Вашингтон на веб-сайте по адресу cera-gmc.org/index.php?action=gm_crop_database, доступ к которым можно получить во всемирной сети Интернет с использованием приставки "www"). В растениях также может экспрессироваться два или более пестицидных белков, хорошо известных специалисту в данной области, таких как Vip3Ab и Cry1Fa (US2012/0317682); Cry1BE и Cry1F (US2012/0311746); Cry1CA и Cry1AB (US2012/0311745); Cry1F и CryCa (US2012/0317681); Cry1DA и Cry1BE (US2012/0331590); Cry1DA и Cry1Fa (US2012/0331589); Cry1AB и Cry1BE (US2012/0324606); Cry1Fa и Cry2Aa, а также Cry1I и Cry1E (US2012/0324605); Cry34Ab/35Ab и Cry6Aa (US20130167269); Cry34Ab/VCry35Ab и Cry3Aa (US20130167268) и Cry3A, а также Cry1Ab или Vip3Aa (US20130116170). Пестицидные белки включают также инсектицидные липазы, в том числе ацилгидролазы омыляемых липидов из патента США № 7491869 и холестериноксидазы, как, например, из Streptomyces (Purcell et al. (1993) Biochem Biophys Res Commun 15:1406-1413). Пестицидные белки также включают токсины VIP (вегетативные инсектицидные белки) из патентов США №№ 5877012, 6107279, 6137033, 7244820, 7615686 и 8237020 и т. п. Другие белки VIP хорошо известны специалисту в данной области (см. веб-сайт по адресу lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/vip.html, доступ к которому можно получить через всемирную сеть Интернет с использованием приставки "www"). Пестицидные белки также включают белки токсинового комплекса (TC), которые можно получить из таких организмов, как Xenorhabdus, Photorhabdus и Paenibacillus (см. патенты США №№ 7491698 и 8084418). Некоторые TC-белки обладают "самостоятельной" инсектицидной активностью, а другие TC-белки повышают активность самостоятельных токсинов, вырабатываемых тем же указанным организмом. Токсичность "самостоятельного" TC-белка (например, из Photorhabdus, Xenorhabdus или Paenibacillus) может повышаться с помощью одного или нескольких TC-белков, "усилителей", полученных из организма-источника из другого рода. Существуют три основных типа TC-белков. Как изложено в данном документе, белки класса A ("белок A") представляют собой самостоятельные токсины. Белки класса B ("белок B") и белки класса C ("белок C") повышают токсичность белков класса A. Примерами белков класса A являются TcbA, TcdA, XptA1 и XptA2. Примерами белков класса B являются TcaC, TcdB, XptB1Xb и XptC1Wi. Примерами белков класса C являются TccC, XptC1Xb и XptB1Wi. Пестицидные белки также включают белки яда пауков, змей и скорпионов. Примеры пептидов яда пауков включают без ограничения пептиды ликотоксин-1 и его мутантные формы (патент США № 8334366).

В некоторых вариантах осуществления полипептид IPD079 включает аминокислотные последовательности, выведенные из последовательностей нуклеиновой кислоты полной длины, раскрытых в данном документе, и аминокислотные последовательности, которые короче, чем последовательности полной длины, получены либо в результате применения альтернативного сайта инициации, расположенного ниже, либо в результате процессинга, дающего более короткий белок с пестицидной активностью. Процессинг может происходить в организме, в котором экспрессируется белок, или во вредителе после поглощения белка.

Таким образом, в данном документе предусмотрены новые выделенные или рекомбинантные последовательности нуклеиновой кислоты, которые обеспечивают пестицидную активность. Также предусмотрены аминокислотные последовательности полипептидов IPD079. Белок, полученный в результате трансляции генов этих полипептидов IPD079, обеспечивает возможность клеткам контролировать или уничтожать вредителей, которые их поглощают.

Молекулы нуклеиновой кислоты, а также их варианты и фрагменты

В некоторых вариантах осуществления предусмотрены выделенные или рекомбинантные молекулы нуклеиновой кислоты, содержащие последовательности нуклеиновой кислоты, кодирующие перфорины растительного происхождения или их биологически активные части, а также молекулы нуклеиновой кислоты, подходящие для применения в качестве гибридизационных зондов для идентификации молекул нуклеиновой кислоты, кодирующих белки с участками гомологии последовательностей. Один вариант осуществления относится к выделенным или рекомбинантным молекулам нуклеиновой кислоты, содержащим последовательности нуклеиновой кислоты, кодирующие полипептиды IPD079 или их биологически активные части, а также к молекулам нуклеиновой кислоты, подходящим для применения в качестве гибридизационных зондов для идентификации молекул нуклеиновой кислоты, кодирующих белки с участками гомологии последовательностей. Используемый в данном документе термин "молекула нуклеиновой кислоты" относится к молекулам ДНК (например, рекомбинантной ДНК, кДНК, геномной ДНК, пластидной ДНК, митохондриальной ДНК) и молекулам РНК (например, мРНК), а также к аналогам ДНК или РНК, полученным с применением аналогов нуклеотидов. Молекула нуклеиновой кислоты может быть однонитевой или двухнитевой, но предпочтительно представляет собой двухнитевую ДНК.

"Выделенная" молекула нуклеиновой кислоты (или ДНК) используется в данном документе для обозначения последовательности нуклеиновой кислоты (или ДНК), которая больше не находится в своей естественной среде, например находится in vitro. "Рекомбинантная" молекула нуклеиновой кислоты (или ДНК) используется в данном документе для обозначения последовательности нуклеиновой кислоты (или ДНК), которая находится в рекомбинантной бактериальной или растительной клетке-хозяине. В некоторых вариантах осуществления "выделенная" или "рекомбинантная" нуклеиновая кислота не содержит последовательности (предпочтительно последовательности, кодирующие белок), которые в естественных условиях фланкируют нуклеиновую кислоту (т. е. последовательности, расположенные на 5′- и 3′-концах нуклеиновой кислоты) в геномной ДНК организма, из которого получена нуклеиновая кислота. Для целей настоящего изобретения выражения "выделенные" или "рекомбинантные", при использовании для обозначения молекул нуклеиновой кислоты, исключают выделенные хромосомы. Например, в различных вариантах осуществления рекомбинантная молекула нуклеиновой кислоты, кодирующая полипептиды IPD079, может содержать менее приблизительно 5 т. о., 4 т. о., 3 т. о., 2 т. о., 1 т. о., 0,5 т. о. или 0,1 т. о. из последовательностей нуклеиновой кислоты, которые в естественных условиях фланкируют молекулу нуклеиновой кислоты в геномной ДНК клетки, из которой получена нуклеиновая кислота.

В некоторых вариантах осуществления выделенная молекула нуклеиновой кислоты, кодирующая перфорин растительного происхождения или полипептид IPD079, характеризуется одним или несколькими изменениями в последовательности нуклеиновой кислоты по сравнению с нативной или геномной последовательностью нуклеиновой кислоты. В некоторых вариантах осуществления изменение в нативной или геномной последовательности нуклеиновой кислоты включает без ограничения изменения в последовательности нуклеиновой кислоты вследствие вырожденности генетического кода; изменения в последовательности нуклеиновой кислоты вследствие аминокислотной замены, вставки, делеции и/или добавления по сравнению с нативной или геномной последовательностью; удаление одного или нескольких интронов; делецию одного или нескольких регуляторных участков, расположенных выше или ниже; и делецию 5'- и/или 3'-нетранслируемого участка, ассоциированного с геномной последовательностью нуклеиновой кислоты. В некоторых вариантах осуществления молекула нуклеиновой кислоты, кодирующая перфорины растительного происхождения или полипептид IPD079 по настоящему изобретению, представляет собой последовательность, отличную от геномной.

Предусматривается множество полинуклеотидов, которые кодируют перфорины растительного происхождения и полипептиды IPD079 или родственные белки. Такие полинуклеотиды применимы для получения перфоринов растительного происхождения и полипептидов IPD079 по настоящему изобретению в клетках-хозяевах, если они функционально связаны с подходящим промотором, энхансером, последовательностями терминации транскрипции и/или полиаденилирования. Такие полинуклеотиды также применимы в качестве зондов для выделения гомологичных или фактически гомологичных полинуклеотидов, которые кодируют перфорины растительного происхождения и полипептиды IPD079 или родственные белки.

Полинуклеотиды, кодирующие полипептиды IPD079

Один источник полинуклеотидов, которые кодируют перфорины растительного происхождения и полипептиды IPD079 или родственный белок, представляет собой вид папоротников или других примитивных растений. Один источник полинуклеотидов, которые кодируют полипептиды IPD079 или родственные белки, представляет собой вид папоротников или других примитивных растений, которые содержат полинуклеотид IPD079 под SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 57, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 или SEQ ID NO: 139, кодирующий полипептид IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140. Полинуклеотиды под SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 57, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 или SEQ ID NO: 139 можно применять для экспрессии полипептидов IPD079 в бактериальных хозяевах, которые включают без ограничения бактериальные клетки-хозяева Agrobacterium, Bacillus, Escherichia, Salmonella, Pseudomonas и Rhizobium. Полинуклеотиды также применимы в качестве зондов для выделения гомологичных или фактически гомологичных полинуклеотидов, которые кодируют полипептиды IPD079 или родственные белки. Такие зонды можно применять для идентификации гомологичных или фактически гомологичных полинуклеотидов, полученных из видов Pteridophyta.

Полинуклеотиды, которые кодируют перфорины растительного происхождения и полипептиды IPD079 по настоящему изобретению, также можно синтезировать de novo из последовательности перфоринов растительного происхождения или полипептида IPD079. Полинуклеотидную последовательность гена можно вывести из последовательности полипептида IPD079 за счет применения генетического кода. Компьютерные программы, такие как "BackTranslate" (GCG™ Package, Acclerys, Inc., Сан-Диего, Калифорния), можно применять для превращения пептидной последовательности в соответствующую нуклеотидную последовательность, кодирующую пептид. Примеры последовательностей перфорина растительного происхождения, которые можно использовать для получения соответствующих нуклеотидных кодирующих последовательностей, включают без ограничения полипептиды под любым из SEQ ID NO: 158-1248. Примеры последовательностей полипептидов IPD079, которые можно использовать для получения соответствующих нуклеотидных кодирующих последовательностей, включают без ограничения полипептиды IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, и SEQ ID NO: 140. Кроме того, синтетические полинуклеотидные последовательности, кодирующие перфорины растительного происхождения и полипептиды IPD079 по настоящему изобретению, можно сконструировать таким образом, что они будут экспрессироваться в растениях. В патенте США № 5500365 описан способ синтеза генов растения для повышения уровня экспрессии белка, кодируемого синтезированным геном. Данный способ относится к модификации последовательностей структурных генов экзогенного трансгена, что приводит к их более эффективным транскрипции, процессингу, трансляции и экспрессии в растении. Характерные особенности генов, которые хорошо экспрессируются в растениях, предусматривают удаление последовательностей, которые могут вызывать нежелательный сплайсинг интронов или полиаденилирование в кодирующем участке генного транскрипта, при этом в значительной степени сохраняется аминокислотная последовательность токсичной части инсектицидного белка. Аналогичный способ для получения усиленной экспрессии трансгенов в однодольных растениях раскрыт в патенте США № 5689052.

В некоторых вариантах осуществления молекула нуклеиновой кислоты, кодирующая полипептид IPD079, представляет собой полинуклеотид с последовательностью, изложенной в SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 57, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 или SEQ ID NO: 139, и ее вариантами, фрагментами и комплементарными ей последовательностями. Выражение "комплементарная последовательность" используется в данном документе для обозначения последовательности нуклеиновой кислоты, которая в достаточной степени комплементарна данной последовательности нуклеиновой кислоты, так что она может гибридизироваться с данной последовательностью нуклеиновой кислоты, за счет чего образуется стабильный дуплекс. Выражение "варианты полинуклеотидной последовательности" используется в данном документе для обозначения последовательности нуклеиновой кислоты, которая без учета несходства, связанного с вырожденностью генетического кода, кодирует тот же полипептид.

В некоторых вариантах осуществления молекула нуклеиновой кислоты, кодирующая перфорин растительного происхождения или полипептид IPD079, представляет собой последовательность нуклеиновой кислоты, отличную от геномной. Используемые в данном документе выражения "последовательность нуклеиновой кислоты, отличная от геномной", или "молекула нуклеиновой кислоты, отличная от геномной", или "полинуклеотид, отличный от геномного" относятся к молекуле нуклеиновой кислоты, у которой имеется одно или несколько изменений в последовательности нуклеиновой кислоты по сравнению с нативной или геномной последовательностью нуклеиновой кислоты. В некоторых вариантах осуществления изменение в отношении нативной или геномной молекулы нуклеиновой кислоты включает без ограничения изменения в последовательности нуклеиновой кислоты, обусловленные вырожденностью генетического кода; оптимизацию кодонов в последовательности нуклеиновой кислоты для экспрессии в растениях; изменения в последовательности нуклеиновой кислоты для введения по меньшей мере одной аминокислотной замены, вставки, делеции и/или добавления по сравнению с нативной или геномной последовательностью; удаление одного или нескольких интронов, ассоциированных с геномной последовательностью нуклеиновой кислоты; вставку одного или нескольких гетерологичных интронов; делецию одного или нескольких регуляторных участков, расположенных выше или ниже, которые ассоциированы с геномной последовательностью нуклеиновой кислоты; вставку одного или нескольких гетерологичных регуляторных участков, расположенных выше или ниже; делецию 5'- и/или 3'-нетранслируемого участка, ассоциированного с геномной последовательностью нуклеиновой кислоты; вставку гетерологичного 5'- и/или 3'-нетранслируемого участка и модификацию сайта полиаденилирования. В некоторых вариантах осуществления молекула нуклеиновой кислоты, отличная от геномной, представляет собой кДНК. В некоторых вариантах осуществления молекула нуклеиновой кислоты, отличная от геномной, представляет собой синтетическую последовательность нуклеиновой кислоты.

В некоторых вариантах осуществления молекула нуклеиновой кислоты, кодирующая полипептид IPD079, представляет собой полинуклеотид, отличный от геномного, с нуклеотидной последовательностью, характеризующейся по меньшей мере 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с последовательностью нуклеиновой кислоты под SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 57, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 или SEQ ID NO: 139, где полипептид IPD079 обладает инсектицидной активностью.

В некоторых вариантах осуществления молекула нуклеиновой кислоты кодирует полипептид IPD079, содержащий аминокислотную последовательность под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140, имеющую 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 или более аминокислотных замен по сравнению с нативной аминокислотой в соответствующем положении SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140.

В некоторых вариантах осуществления молекула нуклеиновой кислоты кодирует полипептид перфорина растительного происхождения под любым из SEQ ID NO: 158-1248.

В некоторых вариантах осуществления молекула нуклеиновой кислоты, кодирующая перфорин растительного происхождения или полипептид IPD079, получена из вида папоротников отдела Pteridophyta. Филогения папоротников, используемая в данном документе, основана на классификации современных папоротников по A. R. Smith et al., TAXON, 55:705-731 (2006). Другие филогенетические классификации современных папоротников известны специалисту в данной области. Дополнительную информацию, касающуюся филогении папоротников, можно найти на веб-сайте по адресу mobot.org/MOBOT/research/APweb/ (доступ к которому можно получить с использованием приставки "www") и в работе Schuettpelz E. and Pryer K. M., TAXON 56: 1037-1050 (2007), и она основана на трех пластидных генах. Дополнительные виды папоротников и других примитивных растений можно найти на веб-сайте по адресу homepages.caverock.net.nz/~bj/fern/list.htm (доступ к которому можно получить с использованием приставки http://).

Также предусмотрены молекулы нуклеиновой кислоты, которые кодируют продукты транскрипции и/или трансляции, которые в дальнейшем подвергаются сплайсингу с образованием в итоге функциональных перфоринов растительного происхождения или полипептидов IPD079. Сплайсинг может осуществляться in vitro или in vivo, и он может включать цис- или транс-сплайсинг. Субстратом для сплайсинга могут быть полинуклеотиды (например, РНК-транскрипты) или полипептиды. Примером цис-сплайсинга полинуклеотида является ситуация, когда интрон, вставленный в кодирующую последовательность, удаляется и два фланкирующих экзонных участка соединяются с образованием последовательности, кодирующей полипептид IPD079. Примером транс-сплайсинга будет ситуация, когда полинуклеотид кодируется с разделением кодирующей последовательности на два или более фрагментов, которые могут транскрибироваться раздельно, а затем соединяться с образованием пестицидной кодирующей полноразмерной последовательности. Применение последовательности энхансера сплайсинга, которую можно вводить в конструкцию, может облегчать сплайсинг, как цис-, так и транс-сплайсинг полипептидов (патенты США №№ 6365377 и 6531316). Таким образом, в некоторых вариантах осуществления полинуклеотиды напрямую не кодируют полноразмерный полипептид IPD079, а кодируют фрагмент или фрагменты полипептида IPD079. Эти полинуклеотиды можно применять для экспрессии функционального полипептида IPD079 посредством механизма, включающего сплайсинг, при этом сплайсинг может происходить на уровне полинуклеотида (например, интрон/экзон) и/или полипептида (например, интеин/экстеин). Это может быть полезным, например, в контроле экспрессии пестицидной активности, поскольку функциональный пестицидный полипептид будет экспрессироваться только в том случае, если все требуемые фрагменты экспрессируются в среде, которая обеспечивает возможность процессов сплайсинга с образованием функционального продукта. В другом примере введение одной или нескольких последовательностей вставок в полинуклеотид может облегчать рекомбинацию с полинуклеотидом с низкой гомологией; при этом применение интрона или интеина в отношении последовательности вставки облегчает удаление вставочной последовательности, что восстанавливает тем самым функцию кодируемого варианта.

Молекулы нуклеиновой кислоты, которые являются фрагментами этих последовательностей нуклеиновой кислоты, кодирующих полипептиды IPD079, также охватываются вариантами осуществления. Используемое в данном документе выражение "фрагмент" относится к части последовательности нуклеиновой кислоты, кодирующей полипептид IPD079. Фрагмент последовательности нуклеиновой кислоты может кодировать биологически активную часть полипептида IPD079, или он может представлять собой фрагмент, который можно применять в качестве гибридизационного зонда или ПЦР-праймера с применением способов, раскрытых ниже. Молекулы нуклеиновой кислоты, которые являются фрагментами последовательности нуклеиновой кислоты, кодирующей полипептид IPD079, содержат по меньшей мере приблизительно 180, 210, 240, 270, 300, 330, 360, 390 или 420 смежных нуклеотидов или вплоть до количества нуклеотидов, присутствующих в последовательности нуклеиновой кислоты полной длины, кодирующей полипептид IPD079, раскрытый в данном документе, в зависимости от предполагаемого применения. Выражение "смежные нуклеотиды" используется в данном документе для обозначения нуклеотидных остатков, которые непосредственно прилегают друг к другу. Фрагменты последовательностей нуклеиновой кислоты согласно вариантам осуществления будут кодировать фрагменты белка, которые сохраняют биологическую активность полипептида IPD079 и, соответственно, сохраняют инсектицидную активность. Выражение "сохраняет инсектицидную активность" используют в данном документе для обозначения полипептида, характеризующегося по меньшей мере приблизительно 10%, по меньшей мере приблизительно 30%, по меньшей мере приблизительно 50%, по меньшей мере приблизительно 70%, 80%, 90%, 95% или большей инсектицидной активностью полноразмерного полипептида. В некоторых вариантах осуществления полипептид IPD079 характеризуется по меньшей мере приблизительно 10%, по меньшей мере приблизительно 30%, по меньшей мере приблизительно 50%, по меньшей мере приблизительно 70%, 80%, 90%, 95% или большей инсектицидной активностью полноразмерного полипептида IPD079Aa (SEQ ID NO: 2). В одном варианте осуществления инсектицидная активность представляет собой активность в отношении видов жесткокрылых. В одном варианте осуществления инсектицидная активность представляет собой активность в отношении вида Diabrotica. В некоторых вариантах осуществления инсектицидная активность представляет собой активность в отношении одного или нескольких насекомых-вредителей из группы кукурузного жука: западного кукурузного жука, Diabrotica virgifera; северного кукурузного жука, D. barberi: южного кукурузного жука или жука-блошки одиннадцатиточечной; Diabrotica undecimpunctata howardi, и мексиканского кукурузного жука, D. virgifera zeae.

В некоторых вариантах осуществления фрагмент последовательности нуклеиновой кислоты, кодирующей полипептид IPD079, который кодирует биологически активную часть белка, будет кодировать по меньшей мере приблизительно 15, 20, 30, 50, 75, 100, 125 смежных аминокислот или вплоть до общего числа аминокислот, присутствующих в полноразмерном полипептиде IPD079 по настоящему изобретению. В некоторых вариантах осуществления фрагмент представляет собой фрагмент с N-концевым и/или C-концевым усечением по меньшей мере приблизительно 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 или более аминокислот с N-конца и/или C-конца относительно SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140 или их вариантов, например, путем протеолиза, вставки стартового кодона, делеции кодонов, кодирующих удаляемые аминокислоты с одновременной вставкой стоп-кодона или вставкой стоп-кодона в кодирующую последовательность.

В некоторых вариантах осуществления полипептид IPD079 кодируется последовательностью нуклеиновой кислоты, достаточно гомологичной последовательности нуклеиновой кислоты под SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 57, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 или SEQ ID NO: 139. Выражение "достаточно гомологичная" используется в данном документе для обозначения аминокислотной последовательности или последовательности нуклеиновой кислоты, характеризующихся по меньшей мере приблизительно 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или большей гомологией последовательности при сравнении с эталонной последовательностью с помощью одной из программ выравнивания, описанных в данном документе, с использованием стандартных параметров. Специалисту в данной области будет понятно, что эти значения можно соответствующим образом скорректировать для определения соответствующей гомологии белков, кодируемых двумя последовательностями нуклеиновой кислоты, принимая во внимание вырожденность кодонов, аминокислотное сходство, расположение рамки считывания и т. п. В некоторых вариантах осуществления гомология последовательностей определяется в отношении последовательности полной длины полинуклеотида, кодирующего полипептид IPD079, или в отношении последовательности полной длины полипептида IPD079.

В некоторых вариантах осуществления нуклеиновая кислота, кодирующая полипептид IPD079, выбрана из SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 57, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 или SEQ ID NO: 139.

В некоторых вариантах осуществления нуклеиновая кислота кодирует полипептид IPD079, характеризующийся по меньшей мере приблизительно 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или большей идентичностью последовательности по сравнению с SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140. В некоторых вариантах осуществления идентичность последовательностей рассчитывают с применением алгоритма ClustalW в модуле ALIGNX® пакета программ Vector NTI® Program Suite (Invitrogen Corporation, Карлсбад, Калифорния) со всеми cтандартными параметрами. В некоторых вариантах осуществления идентичность последовательностей рассчитывают по всей длине полипептида с применением алгоритма ClustalW в модуле ALIGNX пакета программ Vector NTI Program Suite (Invitrogen Corporation, Карлсбад, Калифорния) со всеми стандартными параметрами.

В некоторых вариантах осуществления нуклеиновая кислота кодирует полипептид IPD079, характеризующийся по меньшей мере приблизительно 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или большей идентичностью последовательности по сравнению с SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92 или SEQ ID NO: 94.

В некоторых вариантах осуществления нуклеиновая кислота кодирует полипептид IPD079, характеризующийся по меньшей мере приблизительно 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или большей идентичностью последовательности по сравнению с SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140.

Для определения процентной идентичности двух аминокислотных последовательностей или двух последовательностей нуклеиновой кислоты осуществляют выравнивание последовательностей для целей оптимального сравнения. Процентная идентичность двух последовательностей является функцией количества идентичных положений, имеющихся в последовательностях (т. е. процентная идентичность=количество идентичных положений/общее количество положений (например, перекрывающихся положений)×100). В одном варианте осуществления две последовательности имеют одинаковую длину. В другом варианте осуществления сравнение проводят по всей протяженности эталонной последовательности (например, по всей протяженности SEQ ID NO: 1). Процент идентичности двух последовательностей можно определить с применением методик, аналогичных описанным ниже, которые допускают введение гэпов или не допускают введения гэпов. При расчете процентной идентичности, как правило, подсчитывают точные совпадения.

Другим неограничивающим примером математического алгоритма, используемого для сравнения последовательностей, является алгоритм по Needleman and Wunsch, (1970) J. Mol. Biol. 48(3):443-453, используемый в программном обеспечении GAP версии 10 для определения идентичности и сходства последовательностей с применением следующих параметров по умолчанию: % идентичности и % сходства для последовательности нуклеиновой кислоты с применением штрафа за открытие гэпа 50, и штрафа за продолжение гэпа 3, и матрицы замен nwsgapdna.cmpii; % идентичности или % сходства для аминокислотной последовательности с применением штрафа за открытие гэпа 8, и штрафа за продолжение гэпа 2, и матрицы замен BLOSUM62. Также можно применять эквивалентные программы. Выражение "эквивалентная программа" применяется в данном документе для обозначения любой программы для сравнения последовательностей, которая для любых двух исследуемых последовательностей генерирует выравнивание с совпадениями идентичных нуклеотидных остатков и идентичной процентной идентичностью последовательности при сравнении с соответствующим выравниванием, сгенерированным с помощью GAP версии 10.

Варианты осуществления также охватывают молекулы нуклеиновой кислоты, кодирующие варианты полипептида IPD079. Выражение "варианты" последовательностей нуклеиновой кислоты, кодирующих полипептид IPD079, включают последовательности, которые кодируют полипептиды IPD079, раскрытые в данном документе, но которые отличаются консервативными заменами, обусловленными вырожденностью генетического кода, а также последовательности, которые являются достаточно идентичными, как обсуждалось выше. Встречающиеся в природе аллельные варианты можно идентифицировать с применением хорошо известных методик молекулярной биологии, таких как полимеразная цепная реакция (ПЦР) и методики гибридизации, изложенные ниже. Вариантные последовательности нуклеиновой кислоты также включают синтетически полученные последовательности нуклеиновой кислоты, которые были получены, например, с применением сайт-направленного мутагенеза, но которые все еще кодируют раскрытые полипептиды IPD079, которые рассматриваются ниже.

Настоящее изобретение предусматривает выделенные или рекомбинантные полинуклеотиды, которые кодируют любые из полипептидов IPD079, раскрытых в данном документе. Специалисты обычной квалификации в данной области легко поймут, что вследствие вырожденности генетического кода существует множество нуклеотидных последовательностей, кодирующих полипептиды IPD079 по настоящему изобретению.

Также специалисту в данной области техники будет понятно, что изменения можно вводить путем мутирования последовательностей нуклеиновой кислоты, что ведет к изменениям в аминокислотной последовательности кодируемых полипептидов IPD079 без изменения биологической активности белка. Таким образом, вариантные молекулы нуклеиновой кислоты можно создавать путем введения одной или нескольких нуклеотидных замен, добавлений и/или делеций в соответствующую последовательность нуклеиновой кислоты, раскрытую в данном документе, так что одна или несколько аминокислотных замен, добавлений или делеций вводятся в кодируемый белок. Мутации можно вводить с помощью стандартных методик, таких как сайт-направленный мутагенез и ПЦР-опосредованный мутагенез. Такие вариантные последовательности нуклеиновой кислоты также охватываются настоящим изобретением.

В качестве альтернативы вариантные последовательности нуклеиновой кислоты можно получать путем введения мутаций случайным образом по всей или части кодирующей последовательности, как, например, путем сайт-насыщающего мутагенеза, и полученные мутанты можно подвергать скринингу в отношении способности обеспечивать пестицидную активность для идентификации мутантов, которые сохраняют активность. После мутагенеза кодируемый белок можно экспрессировать рекомбинантным способом, и активность белка можно определять с применением стандартных методик анализа.

Полинуклеотиды по настоящему изобретению и их фрагменты необязательно применяют в качестве субстратов для ряда реакций рекомбинации и рекуррентной рекомбинации, в дополнение к стандартным способам клонирования, изложенным, например, в Ausubel, Berger и Sambrook, т. е. для получения дополнительных гомологов пестицидных полипептидов и их фрагментов с требуемыми свойствами. Известен ряд таких реакций, в том числе разработанные авторами настоящего изобретения и их сотрудниками. Способы получения варианта любой нуклеиновой кислоты, приведенной в данном документе, предусматривают рекуррентную рекомбинацию такого полинуклеотида со вторым (или большим количеством) полинуклеотидом, таким образом, получение библиотеки вариантных полинуклеотидов также представляет собой варианты осуществления по настоящему изобретению, так же как и полученные библиотеки, клетки, содержащие библиотеки и любой рекомбинантный полинуклеотид, полученный такими способами. Дополнительно такие способы необязательно предусматривают отбор вариантного полинуклеотида из таких библиотек на основе пестицидной активности, как есть, где такую рекуррентную рекомбинацию осуществляют in vitro или in vivo.

Ряд протоколов создания разнообразия, в том числе протоколы рекуррентной рекомбинации нуклеиновых кислот, доступен и полностью описан в уровне техники. Для получения одного или нескольких вариантов нуклеиновой кислоты или набора нуклеиновых кислот, а также вариантов кодируемых белков, процедуры можно применять отдельно и/или в комбинации. По отдельности и вместе эти процедуры обеспечивают надежные, широко применяемые способы создания диверсифицированных нуклеиновых кислот и наборов нуклеиновых кислот (в том числе, например, библиотек нуклеиновых кислот), применимых, например, для конструирования или быстрой эволюции нуклеиновых кислот, белков, метаболических путей, клеток и/или организмов с новыми и/или улучшенными характеристиками.

Хотя в ходе следующего обсуждения для ясности делают разграничение и классификацию, будет принято во внимание, что методики часто не являются взаимоисключающими. Более того, различные способы можно применять по отдельности или в комбинации, одновременно или последовательно, для получения доступа к различным вариантам последовательностей.

Результатом любой из процедур создания разнообразия, описанных в данном документе, может быть создание одной или нескольких нуклеиновых кислот, которые можно подвергнуть отбору или скринингу в отношении нуклеиновых кислот, имеющих требуемые свойства или обеспечивающих их, или нуклеиновых кислот, которые кодируют белки, имеющие требуемые свойства или обеспечивающие их. После диверсификации с помощью одного или нескольких способов, описанных в данном документе или иным образом доступных специалисту в данной области, любые получаемые нуклеиновые кислоты можно подвергать отбору в отношении требуемой активности или свойства, например пестицидной активности или такой активности при требуемом значении pH и т. д. Это может включать идентификацию любой активности, которую можно выявить, например в автоматизированном или автоматизируемом формате, посредством любого из анализов, известных в данной области, см., например, ниже обсуждение проведения скрининга в отношении инсектицидной активности. Можно оценивать ряд связанных (или даже несвязанных) свойств последовательно или одновременно, на усмотрение специалиста-практика.

Описания ряда процедур создания разнообразия с целью создания модифицированных последовательностей нуклеиновой кислоты, например последовательностей, кодирующих полипептиды с пестицидной активностью или их фрагменты, находятся в следующих публикациях и литературных ссылках, приведенных в них: Soong, et al., (2000) Nat Genet 25(4):436-439; Stemmer, et al., (1999) Tumor Targeting 4:1-4; Ness, et al., (1999) Nat Biotechnol 17:893-896; Chang, et al., (1999) Nat Biotechnol 17:793-797; Minshull and Stemmer, (1999) Curr Opin Chem Biol 3:284-290; Christians, et al., (1999) Nat Biotechnol 17:259-264; Crameri, et al., (1998) Nature 391:288-291; Crameri, et al., (1997) Nat Biotechnol 15:436-438; Zhang, et al., (1997) PNAS USA 94:4504-4509; Patten, et al., (1997) Curr Opin Biotechnol 8:724-733; Crameri, et al., (1996) Nat Med 2:100-103; Crameri, et al., (1996) Nat Biotechnol 14:315-319; Gates, et al., (1996) J Mol Biol 255:373-386; Stemmer, (1996) "Sexual PCR and Assembly PCR" в The Encyclopedia of Molecular Biology. VCH Publishers, New York. pp. 447-457; Crameri and Stemmer, (1995) BioTechniques 18:194-195; Stemmer, et al., (1995) Gene, 164:49-53; Stemmer, (1995) Science 270: 1510; Stemmer, (1995) Bio/Technology 13:549-553; Stemmer, (1994) Nature 370:389-391 и Stemmer, (1994) PNAS USA 91:10747-10751.

Мутационные способы создания разнообразия включают, например, сайт-направленный мутагенез (Ling, et al., (1997) Anal Biochem 254(2):157-178; Dale, et al., (1996) Methods Mol Biol 57:369-374; Smith, (1985) Ann Rev Genet 19:423-462; Botstein and Shortle, (1985) Science 229:1193-1201; Carter, (1986) Biochem J 237:1-7 и Kunkel, (1987) "The efficiency of oligonucleotide directed mutagenesis" в Nucleic Acids & Molecular Biology (Eckstein and Lilley, eds., Springer Verlag, Berlin)); мутагенез с применением урацил-содержащих матриц (Kunkel, (1985) PNAS USA 82:488-492; Kunkel, et al., (1987) Methods Enzymol 154:367-382 и Bass, et al., (1988) Science 242:240-245); олигонуклеотид-направленный мутагенез (Zoller and Smith, (1983) Methods Enzymol 100:468-500; Zoller and Smith, (1987) Methods Enzymol 154:329-350 (1987); Zoller and Smith, (1982) Nucleic Acids Res 10:6487-6500), мутагенез фосфоротиоат-модифицированной ДНК (Taylor, et al., (1985) Nucl Acids Res 13:8749-8764; Taylor, et al., (1985) Nucl Acids Res 13:8765-8787 (1985); Nakamaye and Eckstein, (1986) Nucl Acids Res 14:9679-9698; Sayers, et al., (1988) Nucl Acids Res 16:791-802 и Sayers, et al., (1988) Nucl Acids Res 16:803-814); мутагенез с применением дуплексной ДНК с гэпом (Kramer, et al., (1984) Nucl Acids Res 12:9441-9456; Kramer and Fritz, (1987) Methods Enzymol 154:350-367; Kramer, et al., (1988) Nucl Acids Res 16:7207 и Fritz, et al., (1988) Nucl Acids Res 16:6987-6999).

Дополнительные подходящие способы включают точечную репарацию ошибочно спаренных оснований (Kramer, et al., (1984) Cell 38:879-887), мутагенез с применением штаммов-хозяев с недостаточностью репарации (Carter, et al., (1985) Nucl Acids Res 13:4431-4443 и Carter, (1987) Methods in Enzymol 154:382-403), делеционный мутагенез (Eghtedarzadeh and Henikoff, (1986) Nucl Acids Res 14:5115), рестрикцию-отбор и рестрикцию-очистку (Wells, et al., (1986) Phil Trans R Soc Lond A 317:415-423), мутагенез посредством полного синтеза гена (Nambiar, et al., (1984) Science 223:1299-1301; Sakamar and Khorana, (1988) Nucl Acids Res 14:6361-6372; Wells, et al., (1985) Gene 34:315-323 и Grundström, et al., (1985) Nucl Acids Res 13:3305-3316), репарацию двухнитевых разрывов (Mandecki, (1986) PNAS USA, 83:7177-7181 и Arnold, (1993) Curr Opin Biotech 4:450-455). Дополнительные сведения по многим из вышеуказанных способов можно найти в Methods Enzymol, том 154, в котором также описаны полезные руководства по поиску и устранению проблем в случае различных способов мутагенеза.

Дополнительные подробности, касающиеся различных способов создания разнообразия, можно найти в следующих патентах США, публикациях и заявках согласно PCT и публикациях EPO: в патенте США № 5723323, патенте США № 5763192, патенте США № 5814476, патенте США № 5817483, патенте США № 5824514, патенте США № 5976862, патенте США № 5605793, патенте США № 5811238, патенте США № 5830721, патенте США № 5834252, патенте США № 5837458, WO 1995/22625, WO 1996/33207, WO 1997/20078, WO 1997/35966, WO 1999/41402, WO 1999/41383, WO 1999/41369, WO 1999/41368, EP 752008, EP 0932670, WO 1999/23107, WO 1999/21979, WO 1998/31837, WO 1998/27230, WO 1998/27230, WO 2000/00632, WO 2000/09679, WO 1998/42832, WO 1999/29902, WO 1998/41653, WO 1998/41622, WO 1998/42727, WO 2000/18906, WO 2000/04190, WO 2000/42561, WO 2000/42559, WO 2000/42560, WO 2001/23401 и PCT/US01/06775.

Нуклеотидные последовательности согласно вариантам осуществления также можно применять для выделения соответствующих последовательностей из растений, в том числе без ограничения из папоротников и других примитивных растений. Таким образом, такие способы как ПЦР, гибридизация и т. п. можно применять для идентификации таких последовательностей на основе гомологии их последовательности с последовательностями, изложенными в данном документе. Вариантами осуществления охватываются последовательности, выбранные на основе идентичности их последовательности полным последовательностям, изложенным в данном документе, или их фрагментам. Такие последовательности включают в себя последовательности, которые являются ортологами раскрытых последовательностей. Термин "ортологи" относится к генам, происходящим от общего предкового гена и выявляемым у различных видов вследствие видообразования. Гены, обнаруживаемые у различных видов, считаются ортологами в том случае, если их нуклеотидные последовательности и/или кодируемые ими белковые последовательности имеют существенную степень идентичности, как определено в других разделах данного документа. Функции ортологов зачастую являются высококонсервативными среди видов.

В случае подхода, основанного на ПЦР, олигонуклеотидные праймеры можно сконструировать для применения в ПЦР-реакциях для амплификации соответствующих последовательностей ДНК, исходя из кДНК или геномной ДНК, извлеченных из какого-либо организма, представляющего интерес. Способы конструирования ПЦР-праймеров и ПЦР-клонирования, как правило, известны из уровня техники и раскрыты в Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York), в дальнейшем "Sambrook". См. также Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); и Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Известные способы ПЦР включают без ограничения способы с применением парных праймеров, гнездовых праймеров, одиночных специфичных праймеров, вырожденных праймеров, ген-специфичных праймеров, вектор-специфичных праймеров, частично ошибочно спаренных праймеров и т. п.

Для идентификации потенциальных полипептидов IPD079 из коллекций папоротников, мхов или других примитивных растений лизаты клеток папоротников, мхов или других примитивных растений можно подвергать скринингу с помощью антител, полученных против полипептидов IPD079 и/или полипептидов IPD079, с помощью способов вестерн-блоттинга и/или ELISA. Этот тип анализов можно выполнять высокопроизводительным способом. Положительные образцы можно дополнительно анализировать с помощью различных методик, таких как очистка и идентификация белков с помощью антител. Способы получения антител хорошо известны в данной области, как обсуждается ниже.

В качестве альтернативы для идентификации гомологов полипептидов IPD079 можно применять способ идентификации белков на основе масс-спектрометрии с применением протоколов из литературных источников (Scott Patterson, (1998), 10.22, 1-24, Current Protocol in Molecular Biology, опубликованный John Wiley & Son Inc.). Точнее говоря, способ идентификации белков на основе LC-MS/MS применяют для установления связи MS-данных указанных лизатов клеток или образцов, обогащенных молекулами с требуемой молекулярной массой (вырезанных из геля SDS-PAGE с полосками с молекулярной массой, соответствующей полипептидам IPD079), с информацией о последовательности полипептидов IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140 и их гомологов. Любое совпадение в пептидных последовательностях указывает на возможность наличия гомологичных белков в образцах. Дополнительные методики (очистки белка и методики молекулярной биологии) можно применять для выделения белка и идентификации последовательностей гомологов.

В способах гибридизации для скрининга кДНК или геномных библиотек можно применять всю или часть последовательности пестицидной нуклеиновой кислоты. Способы для конструирования таких кДНК и геномных библиотек, как правило, известны из уровня техники и раскрыты в Sambrook и Russell, (2001), выше. Так называемые гибридизационные зонды могут представлять собой фрагменты геномной ДНК, фрагменты кДНК, фрагменты РНК или другие олигонуклеотиды, и они могут быть помечены детектируемой группой, такой как 32P, или любым другим детектируемым маркером, таким как другие радиоактивные изотопы, флуоресцентное соединение, фермент или кофактор фермента. Зонды для гибридизации можно создавать путем мечения синтетических олигонуклеотидов, основанных на известной последовательности нуклеиновой кислоты, кодирующей полипептид IPD079, раскрытой в данном документе. Дополнительно можно применять вырожденные праймеры, сконструированные на основе консервативных нуклеотидных или аминокислотных остатков в последовательности нуклеиновой кислоты или кодируемой аминокислотной последовательности. Как правило, зонд содержит участок последовательности нуклеиновой кислоты, который гибридизируется при жестких условиях по меньшей мере с приблизительно 12, по меньшей мере с приблизительно 25, по меньшей мере с приблизительно 50, 75, 100, 125, 150, 175 или 200 последовательными нуклеотидами последовательности нуклеиновой кислоты, кодирующей полипептид IPD079 по настоящему изобретению или его фрагмент или вариант. Способы получения зондов для гибридизации, как правило, известны из уровня техники и раскрыты в Sambrook и Russell, (2001), выше, включенном в данный документ с помощью ссылки.

Например, полную последовательность нуклеиновой кислоты, кодирующей полипептид IPD079, раскрытую в данном документе, или одну или несколько ее частей можно применять в качестве зонда, способного специфично гибридизироваться с соответствующими последовательностями нуклеиновой кислоты, кодирующими последовательности, подобные полипептиду IPD079, и матричными РНК. Для достижения специфичной гибридизации при различных условиях такие зонды включают в себя последовательности, которые являются уникальными и предпочтительно состоят по меньшей мере из приблизительно 10 нуклеотидов в длину или по меньшей мере из приблизительно 20 нуклеотидов в длину. Такие зонды можно применять для амплификации соответствующих пестицидных последовательностей из выбранного организма с помощью ПЦР. Эту методику можно применять для выделения дополнительных кодирующих последовательностей из требуемого организма или в качестве диагностического анализа для определения присутствия кодирующих последовательностей в организме. Методики гибридизации включают гибридизационный скрининг высеянных ДНК-библиотек (либо бляшек, либо колоний; см., например, Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).

Гибридизацию таких последовательностей можно проводить в жестких условиях. Выражения "жесткие условия" или "жесткие условия гибридизации" применяются в данном документе для обозначения условий, при которых зонд будет гибридизироваться со своей целевой последовательностью в явно большей степени, чем с другими последовательностями (например, по меньшей мере в 2 раза больше по сравнению с фоновой последовательностью). Жесткие условия являются зависимыми от последовательности и будут отличаться при различных обстоятельствах. Путем контроля жесткости условий гибридизации и/или отмывки можно идентифицировать целевые последовательности, которые на 100% комплементарны зонду (гибридизация с гомологичным зондом). В качестве альтернативы условия жесткости можно скорректировать для обеспечения некоторого ошибочного спаривания в последовательностях с тем, чтобы выявлять более низкие степени сходства (гибридизация с гетерологичным зондом). В целом зонд составляет менее приблизительно 1000 нуклеотидов в длину, предпочтительно менее 500 нуклеотидов в длину

Белки, а также их варианты и фрагменты

Перфорины растительного происхождения и полипептиды IPD079 также охвачены настоящим изобретением. Выражение "перфорины растительного происхождения", используемое в данном документе, относится к полипептиду, выделенному из растения или идентифицированному с помощью методов протеомики в геноме растения или транскриптоме, который содержит домен MAC/перфорина (MACPF) согласно Pfam (PF01823) или его вариант. Выражения "полипептид IPD079" и "белок IPD079", используемые в данном документе взаимозаменяемо, относятся к полипептиду перфорина растительного происхождения с инсектицидной активностью, в том числе без ограничения инсектицидной активностью в отношении одного или нескольких насекомых-вредителей из отрядов Lepidoptera и/или Coleoptera, и достаточно гомологичному белку с SEQ ID NO: 2 или SEQ ID NO: 56. Предполагается ряд полипептидов IPD079. В некоторых вариантах осуществления полипептид IPD079 получают из видов папоротников отдела Pteridophyta. Источниками перфоринов растительного происхождения и полипептидов IPD079 или родственных белков являются виды растений, выбранные без ограничения из видов Adiantum, Adonis, Aglaomorpha, Asparagus, Asplenium, Bignonia, Blechnum, Bolbitis, Campyloneurum, Celosia, Cissus, Colysis, Davallia, Didymochlaena, Doellingeria, Dryopteris, Elaphoglossum, Equisetum, Hedera, Huperzia, Lycopodium, Lygodium, Marsilea, Matteuccia, Microsorum, Nephrolepis, Onoclea, Ophioglossum, Pandorea, Pellaea, Phormium, Platycerium, Polypodium, Polystichium, Prostanthera, Psilotum, Pteris, Rumohra, Schizophragma, Selaginella, Sphaeropteris, Stenochiaena, Symphoricarpos, Thelypteris, Tupidanthus, Verbascum, Vernonia и Waldsteinia. Источниками перфоринов растительного происхождения и полипептидов IPD079 или родственных белков являются папоротники и виды других примитивных растений, выбранные без ограничения из видов Huperzia, Ophioglossum, Lycopodium и Platycerium. Выражения "полипептид IPD094" и "белок IPD094", используемые в данном документе взаимозаменяемо, относятся к полипептиду перфорина растительного происхождения с инсектицидной активностью, в том числе без ограничения инсектицидной активностью в отношении одного или нескольких насекомых-вредителей из отрядов Lepidoptera и/или Coleoptera, и достаточно гомологичному белку с SEQ ID NO: 144.

Выражение "достаточно гомологичная" используется в данном документе для обозначения аминокислотной последовательности, которая характеризуется по меньшей мере приблизительно 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или большей гомологией последовательности при сравнении с эталонной последовательностью с помощью одной из программ выравнивания, описанных в данном документе, с использованием стандартных параметров. Термин "приблизительно" при использовании в данном документе в контексте процентной идентичности последовательности означает +/- 0,5%. В некоторых вариантах осуществления гомологию последовательности определяют относительно полноразмерной последовательности полипептида. Специалисту в данной области будет понятно, что эти значения можно соответствующим образом скорректировать для определения соответствующей гомологии белков, принимая во внимание аминокислотное сходство и т. п. В некоторых вариантах осуществления идентичность последовательностей рассчитывают с применением алгоритма ClustalW в модуле ALIGNX® пакета программ Vector NTI® Program Suite (Invitrogen Corporation, Карлсбад, Калифорния) со всеми cтандартными параметрами. В некоторых вариантах осуществления идентичность последовательностей рассчитывают по всей длине полипептида с применением алгоритма ClustalW в модуле ALIGNX® пакета программ Vector NTI® Program Suite (Invitrogen Corporation, Карлсбад, Калифорния) со всеми стандартными параметрами.

Используемые в данном документе термины "белок", "пептидная молекула" или "полипептид" включают любую молекулу, которая содержит пять или более аминокислот. Из уровня техники хорошо известно, что белковые, пептидные или полипептидные молекулы могут подвергаться модификации, в том числе посттрансляционным модификациям, таким как без ограничения образование дисульфидных связей, гликозилирование, фосфорилирование или олигомеризация. Таким образом, используемые в данном документе термины "белок", "пептидная молекула" или "полипептид" включают в себя любой белок, который модифицирован посредством какого-либо биологического или небиологического процесса. Термины "аминокислота" и "аминокислоты" относятся ко всем встречающимся в природе L-аминокислотам.

Выражение "рекомбинантный белок" применяется в данном документе для обозначения белка, который более не находится в своей естественной среде, например in vitro, или в рекомбинантной бактериальной или растительной клетке-хозяине. Полипептид, который фактически не содержит клеточный материал, включает препараты белка, имеющие менее приблизительно 30%, 20%, 10% или 5% (по сухому весу) белка, не являющегося пестицидным (также называемого в данном документе "загрязняющим белком").

Выражения "фрагменты" или "биологически активные части" включают фрагменты полипептида, содержащие аминокислотные последовательности, достаточно идентичные полипептиду, и которые проявляют инсектицидную активность. Такие биологически активные части можно получать с помощью рекомбинантных методик и оценивать в отношении инсектицидной активности.

Выражение "варианты", используемое в данном документе, относится к белкам или полипептидам с аминокислотной последовательностью, которая по меньшей мере на приблизительно 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентична исходной аминокислотной последовательности. Варианты могут быть в форме аминокислотных замен; делеций, в том числе без ограничения делеции аминокислот на N-конце и/или C-конце; и добавлений, в том числе без ограничения N-концевых и/или C-концевых, по сравнению с нативным полипептидом.

Перфорины растительного происхождения

В некоторых вариантах осуществления перфорин растительного происхождения содержит домен MAC/перфорина (MACPF) согласно Pfam (PF01823). В некоторых вариантах осуществления перфорины растительного происхождения идентифицируют с помощью способов протеомики, известных специалисту в данной области. В некоторых вариантах осуществления перфорины растительного происхождения идентифицируют с помощью BLAST и/или HMMSearch. В некоторых вариантах осуществления перфорины растительного происхождения соответствовали профильной HMM Pfam ID № IPR020864 при E-значении менее 0,01 и имели длину более 250 аминокислот. В некоторых вариантах осуществления перфорин растительного происхождения характеризуется по меньшей мере 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или большей идентичностью аминокислотной последовательности с любой из SEQ ID NO: 158-1248. В некоторых вариантах осуществления перфорин растительного происхождения содержит аминокислотную последовательность полипептида под любым из SEQ ID NO: 158-1248 их гомологов или их вариантов. В некоторых вариантах осуществления перфорин растительного происхождения характеризуется по меньшей мере 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или большей идентичностью аминокислотной последовательности с полипептидом IPD094 под SEQ ID NO: 144. В некоторых вариантах осуществления перфорин растительного происхождения представляет собой полипептид IPD094 по настоящему изобретению, его гомологи или его варианты. В некоторых вариантах осуществления перфорин растительного происхождения представляет собой полипептид IPD079 по настоящему изобретению.

Полипептиды IPD079

В некоторых вариантах осуществления полипептид IPD079 содержит аминокислотную последовательность, характеризующуюся по меньшей мере 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140, где полипептид IPD079 обладает инсектицидной активностью.

В некоторых вариантах осуществления полипептид IPD079 содержит аминокислотную последовательность, характеризующуюся по меньшей мере 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92 или SEQ ID NO: 94, где полипептид IPD079 обладает инсектицидной активностью.

В некоторых вариантах осуществления полипептид IPD079 содержит аминокислотную последовательность, характеризующуюся по меньшей мере 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью с аминокислотной последовательностью под SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140, где полипептид IPD079 обладает инсектицидной активностью.

В некоторых вариантах осуществления полипептид IPD079 содержит аминокислотную последовательность, характеризующуюся по меньшей мере приблизительно 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью по всей длине аминокислотной последовательности под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92 или SEQ ID NO: 94.

В некоторых вариантах осуществления полипептид IPD079 содержит аминокислотную последовательность, характеризующуюся по меньшей мере приблизительно 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичностью по всей длине аминокислотной последовательности под SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140.

В некоторых вариантах осуществления полипептид IPD079 содержит аминокислотную последовательность под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92 или SEQ ID NO: 94, имеющую 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 или более аминокислотных замен по сравнению с нативной аминокислотой в соответствующем положении SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92 или SEQ ID NO: 94.

В некоторых вариантах осуществления полипептид IPD079 содержит аминокислотную последовательность под SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140, имеющую 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 или более аминокислотных замен по сравнению с нативной аминокислотой в соответствующем положении SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140.

В некоторых вариантах осуществления идентичность последовательностей рассчитывают по всей длине полипептида с применением алгоритма ClustalW в модуле ALIGNX® пакета программ Vector NTI® Program Suite (Invitrogen Corporation, Карлсбад, Калифорния) со всеми стандартными параметрами.

В некоторых вариантах осуществления полипептид IPD079 содержит аминокислотную последовательность под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92 или SEQ ID NO: 94.

В некоторых вариантах осуществления полипептид IPD079 содержит аминокислотную последовательность под SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140.

Фрагмент или биологически активные части полипептидов IPD079 включают фрагменты, содержащие аминокислотные последовательности, достаточно идентичные аминокислотной последовательности, изложенной в SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140, где полипептид IPD079 обладает инсектицидной активностью. Такие биологически активные части можно получать с помощью рекомбинантных методик и оценивать в отношении инсектицидной активности.

В некоторых вариантах осуществления фрагмент полипептида IPD079 представляет собой фрагмент с N-концевым и/или C-концевым усечением по меньшей мере приблизительно 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 или более аминокислот с N-конца и/или C-конца относительно SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 или SEQ ID NO: 140, например, путем протеолиза, вставки стартового кодона, делеции кодонов, кодирующих удаляемые аминокислоты с одновременной вставкой стартового кодона и/или вставкой стоп-кодона.

Филогенетический анализ, анализ мотивов последовательности и структурный анализ семейств инсектицидных белков

Можно использовать способ анализа последовательности и структуры, который может состоять из четырех компонентов: построения филогенетического дерева, обнаружения мотивов белковой последовательности, прогнозирования вторичной структуры и выравнивания белковых последовательностей и вторичных структур. Подробные описания каждого компонента проиллюстрированы ниже.

1) Построение филогенетического дерева

Филогенетический анализ можно выполнять с применением программного обеспечения MEGA5. Белковые последовательности подвергали анализу с использованием ClustalW версии 2 (Larkin M.A et al (2007) Bioinformatics 23(21): 2947-2948) для множественного выравнивания последовательностей. Затем определяют эволюционную историю с помощью способа максимального правдоподобия, исходя из модели на основе JTT-матрицы. Получают дерево с наивысшим логарифмическим правдоподобием, экспортируют его в формат Newick, и дополнительно обрабатывают для извлечения ID последовательностей в том же порядке, в котором они представлены на дереве. Некоторые клады, представляющие подсемейства, можно идентифицировать вручную для каждого семейства инсектицидных белков.

2) Обнаружение мотивов белковой последовательности

Белковые последовательности перегруппировывают согласно ранее построенному филогенетическому дереву и вводят в средство для анализа МОТИВОВ MEME (Multiple EM for MOTIF Elicitation) (Bailey T.L., and Elkan C., Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994.) для идентификации ключевых мотивов последовательности. Начальные настройки MEME являются следующими: минимальное количество сайтов 2, минимальный размер мотива 5 и максимальное количество мотивов 30. Мотивы последовательности, уникальные для каждого подсемейства, идентифицировали с помощью визуального осмотра. Распределение МОТИВОВ по всему семейству генов можно было визуализировать на HTML-вебстранице. МОТИВЫ нумеруют согласно расположению E-значения для каждого МОТИВА.

3) Прогнозирование вторичной структуры

PSIPRED, ведущую технологию прогнозирования вторичной структуры (Jones DT. (1999) J. Mol. Biol. 292: 195-202), можно инсталлировать на локальном Linux-сервере, и использовать для прогнозирования вторичной структуры белка. Средство обеспечивает точное прогнозирование структуры с применением двух нейронных цепей прямой связи, исходя из результата PSI-BLAST. Базу данных для PSI-BLAST создают путем удаления участков низкой сложности, трансмембранного участка и участков суперспирали в Uniref100. Результаты PSIPRED содержат вторичные структуры (альфа-спираль: H, бета-тяж: E и клубок: C) и соответствующую степень уверенности для каждой аминокислоты в данной белковой последовательности.

4) Выравнивание белковых последовательностей и вторичных структур

Можно разработать скрипт для создания выравнивания вторичных структур с гэпами согласно множественному выравниванию белковых последовательностей из стадии 1 для всех белков. Все подвергнутые выравниванию белковые последовательности и структуры комбинируют в единый файл FASTA, а затем импортируют в MEGA для визуализации и идентификации консервативных структур.

В некоторых вариантах осуществления полипептид IPD079 имеет расчетную молекулярную массу от приблизительно 30 кДа до приблизительно 70 кДа, от приблизительно 40 кДа до приблизительно 60 кДа, от приблизительно 45 кДа до приблизительно 55 кДа и от приблизительно 47,5 кДа до приблизительно 52,5 кДа. Выражение "приблизительно" в отношении молекулярной массы означает ± 1 кДа.

В некоторых вариантах осуществления полипептид IPD079 характеризуется модифицированным физическим свойством. Используемый в данном документе термин "физическое свойство" относится к любому параметру, который подходит для описания физико-химических характеристик белка. Используемые в данном документе выражения "физическое свойство, представляющее интерес" и "свойство, представляющее интерес" используются взаимозаменяемо для обозначения физических свойств белков, подлежащих исследованию и/или модификации. Примеры физических свойств включают без ограничения суммарный поверхностный заряд и распределение зарядов на поверхности белка, суммарную гидрофобность и распределение гидрофобных остатков на поверхности белка, плотность поверхностного заряда, плотность гидрофобности поверхности, общее число поверхностных ионизируемых групп, поверхностное натяжение, размер белка и его распределение в растворе, температуру плавления, теплоемкость и второй вириальный коэффициент. Примеры физических свойств также включают без ограничения растворимость, фолдинг, стабильность и усвояемость. В некоторых вариантах осуществления полипептид IPD079 характеризуется повышенной усвояемостью протеолитических фрагментов в кишечнике насекомых. Модели для расщепления с помощью искусственного желудочного сока известны специалисту в данной области (Fuchs, R.L. and J.D. Astwood. Food Technology 50: 83-88, 1996; Astwood, J.D., et al Nature Biotechnology 14: 1269-1273, 1996; Fu TJ et al J. Agric Food Chem. 50: 7154-7160, 2002).

В некоторых вариантах осуществления варианты включают полипептиды, которые отличаются по аминокислотной последовательности вследствие мутагенеза. Вариантные белки, охваченные настоящим изобретением, являются биологически активными, то есть они все еще обладают требуемой биологической активностью (т. е. пестицидной активностью) нативного белка. В некоторых вариантах осуществления вариант будет обладать по меньшей мере приблизительно 10%, по меньшей мере приблизительно 30%, по меньшей мере приблизительно 50%, по меньшей мере приблизительно 70%, по меньшей мере приблизительно 80% или более инсектицидной активности нативного белка. В некоторых вариантах осуществления варианты могут обладать усиленной активностью по сравнению с нативным белком.

Бактериальные гены довольно часто имеют несколько метиониновых инициаторных кодонов поблизости от стартового сайта открытой рамки считывания. Зачастую, инициация трансляции по одному или нескольким из этих старт-кодонов будет приводить к образованию функционального белка. Эти старт-кодоны могут включать кодоны ATG. Однако бактерии, такие как Bacillus sp., также распознают кодон GTG в качестве старт-кодона, и белки, трансляция которых инициируется по кодонам GTG, в качестве первой аминокислоты содержат метионин. В редких случаях, трансляция в бактериальных системах может инициироваться по кодону TTG, хотя в таком случае TTG кодирует метионин. Кроме того, зачастую априори не определяют, какой из этих кодонов естественным образом используется в бактерии. Таким образом понятно, что применение одного из взаимных метиониновых кодонов может также приводить к образованию пестицидных белков. Эти пестицидные белки охватываются настоящим изобретением и могут применяться в способах по настоящему изобретению. Будет понятно, что при экспрессии в растениях будет необходимо изменить взаимный стартовый кодон на ATG для надлежащей трансляции.

Специалисту в данной области будет понятно, что кодирующую последовательность полинуклеотида можно модифицировать с добавлением кодона в предпоследнем положении после метионинового стартового кодона для создания сайта для рестрикционных ферментов для целей рекомбинантного клонирования и/или для целей экспрессии. В некоторых вариантах осуществления полипептид IPD079 дополнительно содержит остаток аланина в предпоследнем положении после метионина, являющегося инициатором трансляции.

В некоторых вариантах осуществления метионин, являющийся инициатором трансляции, в полипептиде IPD079 отщепляется посттрансляционно. Специалисту в данной области будет понятно, что N-концевой метионин, являющийся инициатором трансляции, может удаляться метионин-аминопептидазой во многих клеточных системах экспрессии.

В другом варианте осуществления перфорины растительного происхождения, в том числе без ограничения полипептид IPD079, могут экспрессироваться в виде белка-предшественника со вставочной последовательностью, которая катализирует многостадийный посттрансляционный сплайсинг белка. Сплайсинг белка предусматривает вырезание вставочных последовательностей из полипептида с одновременным присоединением фланкирующих последовательностей с получением нового полипептида (Chong, et al., (1996) J. Biol. Chem., 271:22159-22168). Эта вставочная последовательность или элемент сплайсинга белка, называемые интеинами, которые катализируют свое собственное вырезание посредством трех согласованных реакций на N-терминальной и C-терминальной границах сплайсинга: ацильной перестройки N-терминального цистеина или серина; реакции переэтерификации между двумя концами с образованием разветвленного сложноэфирного или тиоэфирного промежуточного соединения и расщепления пептидной связи, сопряженного с образованием кольца с участием C-терминального аспарагина интеина с высвобождением интеина (Evans, et al., (2000) J. Biol. Chem., 275:9091-9094). Выяснение механизма сплайсинга белка привело к возникновению ряда применений, связанных с интеинами (Comb et al., патент США № 5496714; Comb et al., патент США № 5834247; Camarero and Muir, (1999) J. Amer. Chem. Soc. 121:5597-5598; Chong, et al., (1997) Gene 192:271-281, Chong, et al., (1998) Nucleic Acids Res. 26:5109-5115; Chong, et al., (1998) J. Biol. Chem. 273:10567-10577; Cotton, et al., (1999) J. Am. Chem. Soc. 121:1100-1101; Evans, et al., (1999) J. Biol. Chem. 274:18359-18363; Evans, et al., (1999) J. Biol. Chem. 274:3923-3926; Evans, et al., (1998) Protein Sci. 7:2256-2264; Evans, et al., (2000) J. Biol. Chem. 275:9091-9094; Iwai and Pluckthun, (1999) FEBS Lett. 459:166-172; Mathys, et al., (1999) Gene 231:1-13; Mills, et al., (1998) Proc. Natl. Acad. Sci. USA 95:3543-3548; Muir, et al., (1998) Proc. Natl. Acad. Sci. USA 95:6705-6710; Otomo, et al., (1999) Biochemistry 38:16040-16044; Otomo, et al., (1999) J. Biolmol. NMR 14:105-114; Scott, et al., (1999) Proc. Natl. Acad. Sci. USA 96:13638-13643; Severinov and Muir, (1998) J. Biol. Chem. 273:16205-16209; Shingledecker, et al., (1998) Gene 207:187-195; Southworth, et al., (1998) EMBO J. 17:918-926; Southworth, et al., (1999) Biotechniques 27:110-120; Wood, et al., (1999) Nat. Biotechnol. 17:889-892; Wu, et al., (1998a) Proc. Natl. Acad. Sci. USA 95:9226-9231; Wu, et al., (1998b) Biochim Biophys Acta 1387:422-432; Xu, et al., (1999) Proc. Natl. Acad. Sci. USA 96:388-393; Yamazaki, et al., (1998) J. Am. Chem. Soc., 120:5591-5592). Относительно применения интеинов в растительных трансгенах см. Yang, et al., (Transgene Res 15:583-593 (2006)) и Evans, et al., (Annu. Rev. Plant Biol. 56:375-392 (2005)).

В другом варианте осуществления перфорин растительного происхождения, в том числе без ограничения полипептид IPD079, может кодироваться двумя отдельными генами, при этом интеин белка-предшественника берет начало от двух генов, он называется сплит-интеин, и две части предшественника соединяются за счет образования пептидной связи. Это образование пептидной связи осуществляется с помощью транс-сплайсинга, опосредованного интеином. Для этой цели первая и вторая кассеты экспрессии, содержащие два отдельных гена, дополнительно кодируют интеины, способные опосредовать транс-сплайсинг белков. С помощью транс-сплайсинга белки и полипептиды, кодируемые первым и вторым фрагментами, могут быть связаны путем образования пептидной связи. Интеины транс-сплайсинга можно выбирать из ядерного генома или генома органелл различных организмов, в том числе эукариот, архебактерий и эубактерий. Интеины, которые можно применять, перечислены на веб-сайте по адресу neb.com/neb/inteins.html, доступ к которому можно получить через всемирную сеть Интернет с использованием приставки "www"). Нуклеотидную последовательность, кодирующую интеин, можно разделять на 5′-часть и 3′-часть, которые кодируют соответственно 5′-часть и 3′-часть интеина. Части последовательности, которые не являются необходимыми для интеин-сплайсинга (например, домен хоминг-эндонуклеазы), могут быть удалены. Интеин-кодирующая последовательность расщепляется, так что 5′- и 3′-части способны к транс-сплайсингу. Для выбора подходящего сайта расщепления интеин-кодирующей последовательности можно следовать соображениям, опубликованным у Southworth, et al., (1998) EMBO J. 17:918-926. При конструировании первой и второй кассет экспрессии 5′ интеин-кодирующую последовательность соединяют с 3′-концом первого фрагмента, кодирующего N-концевую часть полипептида IPD079, а 3′ интеин-кодирующую последовательность соединяют с 5′-концом второго фрагмента, кодирующего C-концевую часть полипептида IPD079.

В целом партнеров для транс-сплайсинга можно конструировать с использованием любого сплит-интеина, в том числе любых встречающихся в природе или искусственно расщепленных сплит-интеинов. Известны несколько встречающихся в природе сплит-интеинов, например: сплит-интеин гена DnaE PCC6803 Synechocystis sp. (см. Wu, et al., (1998) Proc Natl Acad Sci USA. 95(16):9226-31 и Evans, et al., (2000) J Biol Chem. 275(13):9091-4 и гена DnaE из Nostoc punctiforme (см. Iwai, et al., (2006) FEBS Lett. 580(7):1853-8). Интеины, не относящиеся к сплит-интеинам, были искусственно расщеплены в лаборатории с созданием новых сплит-интеинов, например: искусственно расщепленный интеин Ssp DnaB (см. Wu, et al., (1998) Biochim Biophys Acta. 1387:422-32), и расщепленный интеин Sce VMA (см. Brenzel, et al., (2006) Biochemistry. 45(6):1571-8), и искусственно расщепленный грибной мини-интеин (см. Elleuche, et al., (2007) Biochem Biophys Res Commun. 355(3):830-4). Также доступны базы данных по интеинам, в которых перечислены известные интеины (см., например, базу данных, доступную онлайн веб-сайте по адресу bioinformatics.weizmann.ac.il/˜pietro/inteins/Inteinstable.html, доступ к которому можно получить через всемирную сеть Интернет с использованием приставки "www").

Встречающиеся в природе интеины, не относящиеся к сплит-интеинам, могут обладать эндонуклеазной или другими видами ферментативной активности, которые, как правило, можно устранять при конструировании искусственно расщепленного сплит-интеина. Такие мини-интеины или минимизированные сплит-интеины хорошо известны из уровня техники и, как правило, они состоят из менее чем 200 аминокислотных остатков в длину (см. Wu, et al., (1998) Biochim Biophys Acta. 1387:422-32). Подходящие сплит-интеины могут иметь другие обеспечивающие очистку полипептидные элементы, добавляемые к их структуре, при условии, что такие элементы не подавляют сплайсинг сплит-интеина, или их добавляют таким способом, который дает возможность удалить их перед сплайсингом. Сообщалось о сплайсинге белка с применением белков, которые содержат бактериальные интеин-подобные (BIL) домены (см. Amitai, et al., (2003) Mol Microbiol. 47:61-73) и самопроцессирующиеся домены hedgehog (Hog) (последние при объединении с интеинами называют суперсемейством Hog/интеин или семейством HINT (см. Dassa, et al., (2004) J Biol Chem. 279:32001-7), и домены, такие как эти, можно также применять для получения искусственно расщепленных интеинов. В частности, не подвергающихся сплайсингу представителей таких семейств можно модифицировать с помощью методик молекулярной биологии для введения или восстановления активности сплайсинга в таких родственных разновидностях. Последние исследования показывают, что сплайсинг можно наблюдать при обеспечении реакции N-терминального компонента сплит-интеина с C-терминальным компонентом сплит-интеина, при этом в естественных условиях он не является его "партнером"; например, сплайсинг наблюдали при использовании партнеров, которые всего на 30-50% гомологичны "природному" сплайсинг-партнеру (см. Dassa, et al., (2007) Biochemistry. 46(1):322-30). Было показано, что другие такие смеси несовместимых партнеров сплит-интеинов не реагируют друг с другом (см. Brenzel, et al., (2006) Biochemistry. 45(6):1571-8). Однако в пределах компетенции специалиста в соответствующей области определить, может ли конкретная пара полипептидов связываться друг с другом с обеспечением функционального интеина, используя стандартные способы и не используя изобретательские навыки.

В другом варианте осуществления перфорины растительного происхождения, в том числе без ограничения полипептид IPD079, представляют собой вариант с круговыми перестановками. В определенных вариантах осуществления полипептид IPD079 представляет собой вариант с круговыми перестановками полипептида под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140.

Разработка способов с применением рекомбинантной ДНК обеспечивала возможность исследовать эффекты транспозиции последовательностей в отношении фолдинга, структуры и функции белка. Подход, применяемый при создании новых последовательностей, подобен тому, что происходит со встречающимися в природе парами белков, которые связываются посредством линейной реорганизации их аминокислотных последовательностей (Cunningham, et al., (1979) Proc. Natl. Acad. Sci. U.S.A. 76:3218-3222; Teather and Erfle, (1990) J. Bacteriol. 172:3837-3841; Schimming, et al., (1992) Eur. J. Biochem. 204:13-19; Yamiuchi and Minamikawa, (1991) FEBS Lett. 260:127-130; MacGregor, et al., (1996) FEBS Lett. 378:263-266). Первое in vitro применение этого типа перестановки у белков описали Goldenberg и Creighton (J. Mol. Biol. 165:407-413, 1983). При создании варианта с круговыми перестановками новый N-конец выбирают во внутреннем сайте (точечный разрыв) оригинальной последовательности, при этом новая последовательность имеет такой же порядок аминокислот, как и оригинальная, от точечного разрыва до тех пор, пока она не достигает аминокислоты, которая находится в оригинальном C-конце или вблизи него. В данной точке новая последовательность присоединяется либо непосредственно, либо через дополнительную часть последовательности (линкер) к аминокислоте, которая находится на оригинальном N-конце или вблизи него, и новая последовательность продолжается такой же последовательностью, что и оригинальная до тех пор, пока она не достигнет точки, которая находится в аминокислоте, которая была N-терминальной по отношению к сайту точечного разрыва оригинальной последовательности, или вблизи него, причем этот остаток образует новый C-конец цепи. Длину аминокислотной последовательности линкера можно выбирать эмпирически, или исходя из информации о структуре, или путем применения комбинации двух этих подходов. Если информация о структуре является недоступной, то можно получить небольшие серии линкеров для тестирования с использованием конструирования, длина которых варьирует для охвата диапазона от 0 до 50 Å и последовательность которых выбрана таким образом, чтобы соответствовать доступности поверхностных групп (гидрофильность, Hopp and Woods, (1983) Mol. Immunol. 20:483-489; Kyte and Doolittle, (1982) J. Mol. Biol. 157:105-132; площади поверхности, доступной воздействию растворителя, Lee and Richards, (1971) J. Mol. Biol. 55:379-400) и способности принимать необходимую конформацию без нарушения конфигурации пестицидного полипептида (конформационно подвижный; Karplus and Schulz, (1985) Naturwissenschaften 72:212-213). При условии, что при трансляции средняя длина остатка составляет 2,0-3,8 Å, это будет означать, что длина, подлежащая тестированию, будет составлять от 0 до 30 остатков, при этом предпочтительным диапазоном является 0-15 остатков. Примером такой эмпирической серии будет конструирование линкеров с применением кассетной последовательности, такой как Gly-Gly-Gly-Ser, повторяемой n раз, где n составляет 1, 2, 3 или 4. Специалисты в данной области поймут, что существует множество таких последовательностей, варьирующихся по длине или составу, которые могут служить в качестве линкеров, прежде всего учитывая то, что они не являются ни чрезмерно длинными, ни чрезмерно короткими (см. Sandhu, (1992) Critical Rev. Biotech. 12:437-462); причем, если они являются слишком длинными, то энтропийные эффекты, вероятно, будут дестабилизировать трехмерную укладку и также могут сделать фолдинг кинетически невыполнимым, а если они являются слишком короткими, то они вероятно будут дестабилизировать молекулу вследствие скручивающей или стерической деформации. Специалисты в анализе информации о структуре белка, будут понимать, что при наличии расстояние между концами цепей, определяемое как расстояние между c-альфа атомами углерода, можно применять для определения длины используемой последовательности или по меньшей мере для ограничения числа возможностей, которые требуется протестировать при эмпирическом отборе линкеров. Они также будут понимать, что иногда имеет место, когда положения концов полипептидной цепи являются нечеткими в структурных моделях, полученных по данным рентгеноструктурного анализа или ядерной магнитно-резонансной спектроскопии, и в случае такой ситуации, следовательно, ее необходимо принимать во внимание для правильной оценки длины требуемого линкера. На основании остатков, положение которых четко определено, выбирают два остатка, которые близки по последовательности к концам цепи, и расстояние между их c-альфа атомами углерода используют для расчета приблизительной длины для линкера между ними. С использованием расчетной длины в качестве предварительных данных далее отбирают линкеры в пределах диапазона количества остатков (из расчета 2-3,8 Å на остаток). Эти линкеры можно составлять из оригинальной последовательности, укороченной или удлиненной при необходимости, и в случае удлинения можно выбирать дополнительные остатки, которые являются гибкими и гидрофильными, как описано выше; или необязательно оригинальная последовательность может замещаться с применением серии линкеров, причем одним примером является вышеупомянутый подход с использованием кассеты Gly-Gly-Gly-Ser; или необязательно можно применять комбинацию оригинальной последовательности и новой последовательности, имеющей подходящую общую длину. Последовательности пестицидных полипептидов, способных к фолдингу с образованием биологически активных состояний, можно получать путем соответствующего отбора начальных (амино-конец) и концевых (карбоксильный конец) положений из исходной полипептидной цепи, при этом с применением линкерной последовательности, которая описана выше. Амино-конец и карбоксильный конец выбирают из общего отрезка последовательности, называемого участком точечного разрыва, с использованием нижеописанных рекомендаций. Таким образом, новую аминокислотную последовательность получают путем отбора амино-конца и карбоксильного конца из одного участка точечного разрыва. Во многих случаях выбор новых концов будет таким, что оригинальное положение карбоксильного конца непосредственно предшествует положению амино-конца. Однако специалисты в данной области поймут, что выборы концов в каком-либо месте в пределах участка могут оказывать влияние, и что это фактически будет приводить либо к удалениям, либо к добавлениям к амино-части или карбоксильной части новой последовательности. Основным положением молекулярной биологии является то, что первичная аминокислотная последовательность белка обуславливает фолдинг в трехмерную структуру, необходимую для проявления его биологической функции. Специалистам в данной области известны способы получения и интерпретации информации о трехмерной структуре с применением рентгеноструктурного анализа одиночных кристаллов белка или ядерной магнитно-резонансной спектроскопии растворов белка. Примеры информации о структуре, которая подходит для идентификации участков точечного разрыва, включают расположение и тип вторичной структуры белка (альфа- и 3-10 спирали, параллельные и антипараллельные бета-слои, обращения или повороты цепи и петли; Kabsch and Sander, (1983) Biopolymers 22:2577-2637; степень доступности аминокислотных остатков для растворителя, масштаб и тип взаимодействий остатков друг с другом (Chothia, (1984) Ann. Rev. Biochem. 53:537-572), а также статическое и динамическое распределение конформаций на протяжении полипептидной цепи (Alber and Mathews, (1987) Methods Enzymol. 154:511-533). В некоторых случаях известна дополнительная информация о доступности остатков для растворителя; причем одним примером является сайт посттрансляционного прикрепления углеводов, который обязательно находится на поверхности белка. Если экспериментальная информация о структуре не доступна или ее невозможно получить, то также доступны способы для анализа первичной аминокислотной последовательности с тем, чтобы делать прогнозы о третичной и вторичной структуре белка, доступности для растворителя и наличии поворотов и петель. Для эмпирического определения доступности поверхностных групп также иногда применимы биохимические способы, если прямые способы определения структуры невозможны; например, применение идентификации сайтов деполимеризации после ограниченного протеолиза для того, чтобы делать заключение о доступности поверхностных групп (Gentile and Salvatore, (1993) Eur. J. Biochem. 218:603-621). Таким образом, путем применения либо информации о структуре, полученной экспериментальным путем, либо прогностических способов (например, Srinivisan and Rose, (1995) Proteins: Struct., Funct. & Genetics 22:81-99) проводят исследование исходной аминокислотной последовательности для классификации участков в отношении того, важны ли они для поддержания вторичной и третичной структур. Наличия последовательностей в участках, которые, как известно, участвуют в периодической вторичной структуре (альфа и 3-10 спирали, параллельные и антипараллельные бета-слои), следует избегать. Аналогично, участки аминокислотной последовательности, которые, как наблюдается или прогнозируется, обладают низкой степенью доступности для действия растворителя, наиболее вероятно являются частью так называемого гидрофобного ядра белка, и их следует также избегать при выборе амино-конца или карбоксильного конца. В отличие от этого, участки, которые, как известно или прогнозируется, находятся в поверхностных поворотах или петлях, и в частности те участки, о которых известно, что они не требуются для биологической активности, являются предпочтительными сайтами для расположения противоположных концов полипептидной цепи. Предпочтительные непрерывные отрезки аминокислотной последовательности, основанные на вышеприведенных критериях, называют участком точечного разрыва. Полинуклеотиды, кодирующие полипептиды IPD079 с круговыми перестановками с новым N-концом/C-концом, которые содержат линкерный участок, отделяющий оригинальный C-конец и N-конец, по сути, можно получать согласно способу, описанному в Mullins, et al., (1994) J. Am. Chem. Soc. 116:5529-5533. Несколько стадий амплификации посредством полимеразной цепной реакции (ПЦР) применяют для перестройки последовательности ДНК, кодирующей первичную аминокислотную последовательность белка. Полинуклеотиды, кодирующие полипептиды IPD079 с круговыми перестановками с новым N-концом/C-концом, которые содержат линкерный участок, отделяющий оригинальный C-конец и N-конец, можно получать на основе способа тандемных повторов, описанного в Horlick, et al., (1992) Protein Eng. 5:427-431. Амплификацию посредством полимеразной цепной реакции (ПЦР) генов с новыми N-концом/C-концом выполняют с применением ДНК-матрицы с тандемными повторами.

В другом варианте осуществления предусмотрены слитые белки, содержащие перфорины растительного происхождения, в том числе без ограничения полипептиды IPD079 по настоящему изобретению. В некоторых вариантах осуществления слитые белки содержат полипептид IPD079, в том числе без ограничения полипептид под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140 и его активные фрагменты.

Способы разработки и конструирования слитых белков (и кодирующих их полинуклеотидов) известны специалистам в данной области. Полинуклеотиды, кодирующие перфорины растительного происхождения или полипептид IPD079, могут быть слиты с сигнальными последовательностями, которые будут управлять локализацией белка в конкретных компартментах прокариотической или эукариотической клетки и/или управлять секрецией полипептида IPD079 согласно вариантам осуществления из прокариотической или эукариотической клетки. Например, в E. coli, может потребоваться направить экспрессию белка в периплазматическое пространство. Примеры сигнальных последовательностей или белков (или их фрагментов), с которыми можно сливать полипептид IPD079 с тем, чтобы направить экспрессию полипептида в периплазматическое пространство бактерий, включают без ограничения сигнальную последовательность pelB сигнальную последовательность белка, связывающего мальтозу (MBP), MBP, сигнальную последовательность ompA, сигнальную последовательность B-субъединицы периплазматического неустойчивого к нагреванию энтеротоксина E. coli и сигнальную последовательность щелочной фосфатазы. Для конструирования слитых белков коммерчески доступны несколько векторов, которые будут управлять локализацией белка, такие как серия векторов pMAL (в частности серия pMAL-p), доступная от New England Biolabs. В конкретном варианте осуществления полипептид IPD079 можно сливать с сигнальной последовательностью пектатлиазы pelB для увеличения эффективности экспрессии и очистки таких полипептидов в грамотрицательных бактериях (см. патенты США №№ 5576195 и 5846818). Слияния пластидный транзитный пептид растения/полипептид хорошо известны из уровня техники (см. патент США № 7193133). Апопластные транзитные пептиды, такие как сигнальная последовательность для секреции альфа-амилазы риса или ячменя, также хорошо известны из уровня техники. Пластидный транзитный пептид сливают, как правило, со стороны N-конца с полипептидом, подлежащим нацеливанию (например, партнером слияния). В одном варианте осуществления слитый белок состоит, по сути, из пластидного транзитного пептида и полипептида IPD079, подлежащего нацеливанию. В другом варианте осуществления слитый белок состоит из пластидного транзитного пептида и полипептида, подлежащего нацеливанию. В таких вариантах осуществления пластидный транзитный пептид предпочтительно находится на N-конце слитого белка. Однако дополнительные аминокислотные остатки могут находиться на N-конце относительно пластидного транзитного пептида при условии, что слитый белок по меньшей мере частично нацеливается на пластиду. В определенном варианте осуществления пластидный транзитный пептид находится на N-концевой половине, N-концевой трети или N-концевой четверти слитого белка. Как правило, большая часть или весь пластидный транзитный пептид вырезается из слитого белка после вставки в пластиду. Положение расщепления может слегка варьировать между видами растений, на различных стадиях развития растения, в результате специфических внутриклеточных условий или конкретной комбинации применяемого транзитного пептида/партнера слияния. В одном варианте осуществления сайт расщепления пластидного транзитного пептида является гомогенным, за счет чего сайт расщепления является идентичным в популяции слитого белка. В другом варианте осуществления сайт расщепления пластидного транзитного пептида не является гомогенным, за счет чего сайт расщепления варьирует по 1-10 аминокислотам в популяции слитого белка. Пластидный транзитный пептид можно рекомбинантно сливать со вторым белком одним из нескольких путей. Например, сайт распознавания рестрикционной эндонуклеазой можно вводить в нуклеотидную последовательность транзитного пептида в положении, соответствующем его C-концу, и такой же или совместимый сайт можно вводить посредством генной инженерии в нуклеотидную последовательность белка, подлежащего нацеливанию, по его N-концу. При конструировании этих сайтов необходимо следить за тем, чтобы кодирующие последовательности транзитного пептида и второго белка содержались "в рамке" для обеспечения синтеза требуемого слитого белка. В некоторых случаях предпочтительным может быть удаление инициаторного метионинового кодона второго белка при введении нового сайта рестрикции. Введение сайтов распознавания рестрикционной эндонуклеазы в обе исходные молекулы и их последующее соединение посредством методик с использованием рекомбинантной ДНК может приводить к добавлению одной или нескольких дополнительных аминокислот между транзитным пептидом и вторым белком. Как правило, это не влияет на нацеливающую активность, поскольку сайт расщепления транзитного пептида остается доступным и функционирование второго белка не изменится при добавлении этих дополнительных аминокислот по его N-концу. В качестве альтернативы специалист в данной области может создать точный сайт расщепления между транзитным пептидом и вторым пептидом (с его инициирующим метионином или без него) с применением синтеза генов (Stemmer, et al., (1995) Gene 164:49-53) или аналогичных способов. Кроме того, слияние транзитного пептида может намеренно включать аминокислоты ниже сайта расщепления. Аминокислоты на N-конце зрелого белка могут воздействовать на способность транзитного пептида нацеливать белки в пластиды и/или эффективность расщепления после импорта белков. Это может зависеть от белка, подлежащего нацеливанию. См., например, Comai, et al., (1988) J. Biol. Chem. 263(29):15104-9.

В некоторых вариантах осуществления предусмотрены слитые белки, содержащие перфорин растительного происхождения, в том числе без ограничения полипептид IPD079, и инсектицидный полипептид, соединенный посредством аминокислотного линкера. В некоторых вариантах осуществления предусмотрены слитые белки, представленные формулой, выбранной из группы, состоящей из

R1-L-R2, R2-L-R1, R1-R2 или R2-R1,

где R1 представляет собой перфорин растительного происхождения или полипептид IPD079, R2 представляет собой белок, представляющий интерес. Полипептид R1 слит либо непосредственно, либо через линкерный (L) сегмент с полипептидом R2. Термин "непосредственно" обозначает слияния, в которых полипептиды соединены без пептидного линкера. Таким образом, "L" представляет собой химическую связь или полипептидный сегмент, с которым оба R1 и R2 слиты в рамке, при этом наиболее часто L представляет собой линейный пептид, с которым R1 и R2 связаны посредством амидных связей, связывающих карбокси-конец R1 с амино-концом L и карбокси-конец L с амино-концом R2. Под "слиты в рамке" подразумевают, что между рамками считывания R1 и R2 отсутствует сайт терминации трансляции или разрыв. Линкерная группа (L) представляет собой обычно полипептид, составляющий от 1 до 500 аминокислот в длину. Линкеры, соединяющие две молекулы, предпочтительно конструируют так, (1) чтобы они давали возможность двум молекулам сворачиваться и действовать независимо друг от друга, (2) чтобы они не имели склонности к развитию упорядоченной вторичной структуры, которая может вступать в конфликт с функциональными доменами двух белков, (3) чтобы они имели минимальную гидрофобную или зарядную характеристику, которая может вступать в конфликт с функциональными доменами белка, и (4) чтобы они обеспечивали стерическое разделение R1 и R2, так что R1 и R2 могли одновременно взаимодействовать со своими соответствующими рецепторами на одной клетке. Как правило, поверхностные аминокислоты в гибких участках белка включают Gly, Asn и Ser. По сути, любая перестановка аминокислотных последовательностей, содержащих Gly, Asn и Ser, как ожидается, будет удовлетворять вышеуказанным критериям для линкерной последовательности. Другие нейтральные аминокислоты, такие как Thr и Ala, также можно применять в линкерной последовательности. Дополнительные аминокислоты также можно включать в линкеры, поскольку добавление уникальных сайтов рестрикции в линкерную последовательность облегчает конструирование слияний.

В некоторых вариантах осуществления линкеры содержат последовательности, выбранные из группы формул: (Gly3Ser)n, (Gly4Ser)n, (Gly5Ser)n, (GlynSer)n или (AlaGlySer)n, где n представляет собой целое число. Одним примером очень гибкого линкера является спейсерный участок, богатый (GlySer), присутствующий в белке pIII нитевидных бактериофагов, например бактериофагов M13 или fd (Schaller, et al., 1975). Этот участок обеспечивает длинный гибкий спейсерный участок между двумя доменами поверхностного белка pIII. Также включены линкеры, в состав которых входит последовательность распознавания эндопептидазы. Такой сайт расщепления может быть очень важным для отделения отдельных компонентов слияния с целью определения того, являются ли они правильным образом свернутыми и активными in vitro. Примеры различных эндопептидаз включают без ограничения плазмин, энтерокиназу, калликреин, урокиназу, тканевой активатор плазминогена, клострипаин, химозин, коллагеназу, протеазу яда гадюки Рассела, фермент расщепления постпролина, протеазу V8, тромбин и фактор Xa. В некоторых вариантах осуществления линкер содержит аминокислоты EEKKN (SEQ ID NO: 157) из мультигенного экспрессионного "проводника" (MGEV), который расщепляется протеазами вакуолей, как раскрыто в публикации заявки на выдачу патента США № 2007/0277263. В других вариантах осуществления пептидные линкерные сегменты из шарнирного участка тяжелой цепи иммуноглобулинов IgG, IgA, IgM, IgD или IgE обеспечивают угловое взаимодействие между прикрепленными полипептидами. Особенно применимыми являются такие шарнирные участки, в которых остатки цистеина замещены на остатки серина. Линкеры по настоящему изобретению включают последовательности, полученные из шарнирного участка IgG гамма 2b мыши, в котором остатки цистеина были заменены на остатки серина. Слитые белки не ограничиваются формой, размером или количеством используемых линкерных последовательностей, и единственное требование для линкера заключается в том, что функционально он отрицательно не влияет на фолдинг и функционирование отдельных молекул слияния.

В другом варианте осуществления предусмотрены химерные полипептиды IPD079, которые создают путем соединения двух или более частей генов IPD079, которые изначально кодируют отдельные белки IPD079, для создания химерного гена. Результатом трансляции химерного гена является единый химерный полипептид IPD079 с участками, мотивами или доменами, полученными из каждого из исходных полипептидов. В определенных вариантах осуществления химерный белок содержит части, мотивы или домены полипептидов IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140 в любой комбинации.

Понятно, что последовательности ДНК можно изменять различными способами, и что эти изменения могут приводить к последовательностям ДНК, кодирующим белки с аминокислотными последовательностями, отличными от тех, которые кодируют пестицидный белок дикого типа (или нативный). В некоторых вариантах осуществления полипептид IPD079 можно изменять различными способами, в том числе с помощью аминокислотных замен, делеций, усечений и вставок одной или нескольких аминокислот, в том числе до 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145 или более аминокислотных замен, делеций и/или вставок или их комбинаций по сравнению с любой из SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140.

Способы осуществления таких манипуляций, как правило, известны в данной области. Например, варианты аминокислотной последовательности полипептида IPD079 можно получать с помощью мутаций в ДНК. Это также можно осуществлять с помощью одной из нескольких форм мутагенеза и/или путем направленной эволюции. В некоторых аспектах изменения, закодированные в аминокислотной последовательности, не будут существенно влиять на функцию белка. Такие варианты будут обладать требуемой пестицидной активностью. Однако понятно, что способность полипептида IPD079 обеспечивать пестицидную активность можно повышать путем применения таких методик в композициях согласно настоящему изобретению.

Например, можно осуществить консервативные аминокислотные замены по одному или нескольким несущественным аминокислотным остаткам. "Несущественный" аминокислотный остаток представляет собой остаток, который можно изменять относительно последовательности полипептида IPD079 дикого типа без изменения биологической активности. "Консервативная аминокислотная замена" представляет собой замену, при которой аминокислотный остаток замещен на аминокислотный остаток, имеющий аналогичную боковую цепь. Семейства аминокислотных остатков, имеющие аналогичные боковые цепи, были определены в уровне техники. Такие семейства включают: аминокислоты с основными боковыми цепями (например, лизин, аргинин, гистидин); кислотными боковыми цепями (например, аспарагиновую кислоту, глутаминовую кислоту); полярными отрицательно заряженными остатками и их амидами (например, аспарагиновую кислоту, аспарагин, глутаминовую кислоту, глутамин); незаряженными полярными боковыми цепями (например, глицин, аспарагин, глутамин, серин, треонин, тирозин, цистеин); небольшими алифатическими неполярными или слабополярными остатками (например, аланин, серин, треонин, пролин, глицин); неполярными боковыми цепями (например, аланин, валин, лейцин, изолейцин, пролин, фенилаланин, метионин, триптофан); крупными алифатическими неполярными остатками (например, метионин, лейцин, изолейцин, валин, цистеин); бета-разветвленными боковыми цепями (например, треонин, валин, изолейцин); ароматическими боковыми цепями (например, тирозин, фенилаланин, триптофан, гистидин); крупными ароматическими боковыми цепями (например, тирозин, фенилаланин, триптофан).

Аминокислотные замены можно проводить в неконсервативных участках, которые сохраняют функцию. В целом, такие замены не следует проводить для консервативных аминокислотных остатков или для аминокислотных остатков, находящихся в консервативном мотиве, где такие остатки являются существенными для активности белка. Примеры остатков, которые являются консервативными и которые могут быть существенными для активности белка, включают, например, остатки, которые идентичны у всех белков, содержащихся в выравнивании аналогичных или родственных токсинов с последовательностями согласно вариантам осуществления (например, остатки, которые идентичны при выравнивании гомологичных белков). Примеры остатков, которые являются консервативными, но которые могут позволять консервативные аминокислотные замены и все еще сохранять активность, включают, например, остатки, которые характеризуются только консервативными заменами у всех белков, содержащихся в выравнивании аналогичных или родственных токсинов с последовательностями согласно вариантам осуществления (например, остатки, которые характеризуются только консервативными заменами у всех белков, содержащихся в выравнивании гомологичных белков). Однако специалисту в данной области будет понятно, что функциональные варианты могут иметь незначительные консервативные или неконсервативные изменения в консервативным остаткам. Указания в отношении подходящих аминокислотных замен, которые не влияют на биологическую активность белка, представляющего интерес, можно найти в модели Dayhoff, et al., (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), включенном в данный документ с помощью ссылки.

При осуществлении таких изменений можно учитывать индекс гидропатичности аминокислот. Важность индекса гидропатичности аминокислот для обеспечения согласованной биологической функции белка в целом понятна из уровня техники (Kyte and Doolittle, (1982) J Mol Biol. 157(1):105-32). Признают, что относительная гидропатичность аминокислоты вносит вклад во вторичную структуру полученного в результате белка, что в свою очередь определяет взаимодействие белка с другими молекулами, например, ферментами, субстратами, рецепторами, ДНК, антителами, антигенами и т. п.

Из уровня техники известно, что определенные аминокислоты можно замещать другими аминокислотами, имеющими аналогичный индекс или балл гидропатичности, и в результате по-прежнему получать белок с аналогичной биологической активностью, т. е. по-прежнему получают эквивалентный белок с биологической функцией. Каждой аминокислоте был присвоен индекс гидропатичности на основании ее гидрофобности и зарядных характеристик (Kyte and Doolittle, ibid). Они являются следующими: изолейцин (+4,5); валин (+4,2); лейцин (+3,8); фенилаланин (+2,8); цистеин/цистин (+2,5); метионин (+1,9); аланин (+1,8); глицин (-0,4); треонин (-0,7); серин (-0,8); триптофан (-0,9); тирозин (-1,3); пролин (-1,6); гистидин (-3,2); глутамат (-3,5); глутамин (-3,5); аспартат (-3,5); аспарагин (-3,5); лизин (-3,9) и аргинин (-4,5). При осуществлении таких изменений предпочтительной является замена аминокислот, индексы гидропатичности которых находятся в пределах до +2, особенно предпочтительной тех с индексами в пределах до +1 и даже более предпочтительной тех с индексами в пределах до +0,5.

Из уровня техники также понятно, что замену подобных аминокислот можно эффективно проводить на основании гидрофильности. В патенте США № 4554101 заявляется, что наибольшая локальная средняя гидрофильность белка, определяемая гидрофильностью смежных аминокислот, коррелирует с биологическим свойством белка.

Как подробно описано в патенте США № 4554101, аминокислотным остаткам были присвоены следующие значения гидрофильности: аргинин (+3,0); лизин (+3,0); аспартат (+3,0.+0,1); глутамат (+3,0.+0,1); серин (+0,3); аспарагин (+0,2); глутамин (+0,2); глицин (0); треонин (-0,4); пролин (-0,5.+0,1); аланин (-0,5); гистидин (-0,5); цистеин (-1,0); метионин (-1,3); валин (-1,5); лейцин (-1,8); изолейцин (-1,8); тирозин (-2,3); фенилаланин (-2,5); триптофан (-3,4).

В качестве альтернативы изменения можно совершать в белковой последовательности многих белков на амино- или карбокси-конце без существенного влияния на активность. Они могут включать вставки, делеции или изменения, введенные с помощью современных молекулярных способов, таких как ПЦР, в том числе амплификации посредством ПЦР, которые изменяют или расширяют последовательность, кодирующую белок, за счет включения последовательностей, кодирующих аминокислоты, в олигонуклеотиды, используемые при амплификации посредством ПЦР. В качестве альтернативы добавленные белковые последовательности могут включать последовательности, кодирующие весь белок, например такие, которые обычно применяют в области техники для получения слияний белков. Такие слитые белки часто применяют для (1) повышения экспрессии белка, представляющего интерес, (2) введения связывающего домена, ферментативной активности или эпитопа для облегчения либо очистки белка, выявления белка либо других экспериментальных применений, известных из уровня техники, (3) нацеливания секреции или трансляции белка во внутриклеточную органеллу, такую как периплазматическое пространство грамотрицательных бактерий, митохондрия или хлоропласты растений или эндоплазматический ретикулум эукариотических клеток, причем последнее зачастую приводит к гликозилированию белка.

Вариантные нуклеотидные и аминокислотные последовательности по настоящему изобретению также охватывают последовательности, полученные в результате процедур, связанных с мутациями и рекомбинациями, такими как ДНК-шаффлинг. С помощью такой процедуры, например, один или несколько различных участков, кодирующих полипептид IPD079 по настоящему изобретению, можно применять для создания нового полипептида IPD079, обладающего требуемыми свойствами. Таким образом, библиотеки рекомбинантных полинуклеотидов создают из популяции родственных по последовательностям полинуклеотидов, содержащих участки последовательностей, которые характеризуются значительной идентичностью последовательности и могут подвергаться гомологичной рекомбинации in vitro или in vivo. Например, с использованием данного подхода мотивы с кодирующими домен последовательностями, представляющий интерес, можно подвергать шаффлингу между пестицидным геном и другими известными пестицидными генами с получением нового гена, кодирующего белок с улучшенным свойством, представляющим интерес, таким как повышенная инсектицидная активность. Стратегии для такого ДНК-шаффлинга известны из уровня техники. См., например, Stemmer, (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751; Stemmer, (1994) Nature 370:389-391; Crameri, et al., (1997) Nature Biotech. 15:436-438; Moore, et al., (1997) J. Mol. Biol. 272:336-347; Zhang, et al., (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri, et al., (1998) Nature 391:288-291; и патенты США №№ 5605793 и 5837458.

Замена доменов или шаффлинг представляет собой другой механизм получения измененных полипептидов IPD079. Можно проводить замену доменов между полипептидами IPD079 по настоящему изобретению с получением в результате гибридных или химерных токсинов с повышенной инсектицидной активностью или расширенным спектром мишеней. Способы получения рекомбинантных белков и тестирования их в отношении пестицидной активности хорошо известны из уровня техники (см., например, Naimov, et al., (2001) Appl. Environ. Microbiol. 67:5328-5330; de Maagd, et al., (1996) Appl. Environ. Microbiol. 62:1537-1543; Ge, et al., (1991) J. Biol. Chem. 266:17954-17958; Schnepf, et al., (1990) J. Biol. Chem. 265:20923-20930; Rang, et al., 91999) Appl. Environ. Microbiol. 65:2918-2925).

Выравнивание гомологов IPD079 (фигуры 1 и 2) обеспечивает возможность идентификации остатков, которые являются высококонсервативными среди гомологов в данном семействе.

Композиции

Также охвачены композиции, содержащие перфорин растительного происхождения по настоящему изобретению, в том числе без ограничения полипептид IPD079 по настоящему изобретению. В некоторых вариантах осуществления композиция содержит полипептид IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140. В некоторых вариантах осуществления композиция содержит слитый белок IPD079.

Антитела

Также охвачены антитела к перфорину растительного происхождения по настоящему изобретению, в том числе без ограничения к полипептиду IPD079 согласно вариантам осуществления или к его вариантам или фрагментам. Антитела по настоящему изобретению включают поликлональные и моноклональные антитела, а также их фрагменты, которые сохраняют свою способность связываться с полипептидом IPD079, обнаруженным в кишечнике насекомого. Полагают, что антитело, моноклональное антитело или его фрагмент способны связывать молекулу, если они способны специфично реагировать с молекулой, связывая, тем самым, молекулу с антителом, моноклональным антителом или его фрагментом. Как подразумевается, термин "антитело" (Ab) или "моноклональное антитело" (Mab) включает интактные молекулы, а также их фрагменты, или связывающие участки, или домены (такие как, например, фрагменты Fab и F(ab)2), которые способны связывать гаптен. Как правило, такие фрагменты получают с помощью протеолитического расщепления, например с помощью папаина или пепсина. В качестве альтернативы гаптен-связывающие фрагменты можно получать посредством применения технологии рекомбинантной ДНК или с помощью синтетической химии. Как правило, способы получения антител по настоящему раскрытию изобретению из уровня техники. Например, см. Antibodies, A Laboratory Manual, Ed Harlow and David Lane (eds.) Cold Spring Harbor Laboratory, N.Y. (1988), а также приводимые в нем литературные источники. Стандартные справочные работы, излагающие общие принципы иммунологии, включают Klein, J. Immunology: The Science of Cell-Noncell Discrimination, John Wiley & Sons, N.Y. (1982); Dennett, et al., Monoclonal Antibodies, Hybridoma: A New Dimension in Biological Analyses, Plenum Press, N.Y. (1980) и Campbell, "Monoclonal Antibody Technology," в Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 13, Burdon, et al., (eds.), Elsevier, Amsterdam (1984). См. также патенты США №№ 4196265; 4609893; 4713325; 4714681; 4716111; 4716117 и 4720459. Антитела к полипептиду IPD079 или их антиген-связывающие части можно получать с помощью ряда методик, в том числе традиционных методик получения моноклональных антител, например стандартной методики гибридизации соматических клеток согласно Kohler и Milstein, (1975) Nature 256:495. Также можно использовать другие методики получения моноклонального антитела, такие как вирусная или онкогенная трансформация B-лимфоцитов. Система на основе животного для получения гибридом представляет собой систему на основе мыши. В данной области известны протоколы иммунизации и методики выделения спленоцитов иммунизированных животных для слияния. Также известны партнеры слияния (например, клетки миеломы мыши) и процедуры слияния. Антитело и моноклональные антитела по настоящему изобретению можно получить путем использования полипептида IPD079 в качестве антигенов.

Предусмотрен набор для выявления присутствия полипептида IPD079 или выявления присутствия нуклеотидной последовательности, кодирующей полипептид IPD079, в образце. В одном варианте осуществления в наборе имеются реагенты на основе антитела для выявления присутствия полипептида IPD079 в образце ткани. В другом варианте осуществления в наборе имеются меченые зонды на основе нуклеиновой кислоты, применяемые для выявления присутствия одного или нескольких полинуклеотидов, кодирующих полипептид IPD079. В наборе также имеются соответствующие реагенты и контрольные образцы для проведения способа выявления, а также инструкции для применения набора.

Идентификация и выделение рецептора

Также охвачены рецепторы к полипептиду IPD079 согласно вариантам осуществления или к его вариантам или фрагментам. Способы идентификации рецепторов, хорошо известные из уровня техники (см. Hofmann, et. al., (1988) Eur. J. Biochem. 173:85-91; Gill, et al., (1995) J. Biol. Chem. 27277-27282), можно использовать для идентификации и выделения рецептора, который распознает полипептид IPD079, с применением мембранных везикул щеточной каемки от восприимчивых насекомых. В дополнение к способу радиоактивного мечения, приведенному в упомянутых источниках, полипептид IPD079 можно метить с помощью флуоресцентного красителя и других стандартных меток, таких как стрептавидин. Мембранные пузырьки из щеточной каемки (BBMV) восприимчивых насекомых, таких как соевая совка и щитники, можно получать в соответствии с протоколами, приведенными в ссылочных документах, и разделять на геле SDS-PAGE, а также переносить на подходящую мембрану. Меченый полипептид IPD079 можно инкубировать с мембраной, на которой находятся подвергнутые блоттингу BBMV, и при этом меченный полипептид IPD079 можно идентифицировать с помощью меченых репортеров. Идентификацию полосы(полос) белка(белков), которые взаимодействуют с полипептидом IPD079, можно проводить с помощью секвенирования N-концевых аминокислотных остатков в газовой фазе или способа идентификации белков на основе масс-спектрометрии (Patterson, (1998) 10.22, 1-24, Current Protocol in Molecular Biology, опубликованный John Wiley & Son Inc.). После идентификации белка соответствующий ген можно клонировать из библиотеки геномной ДНК или кДНК восприимчивых насекомых, и аффинность связывания можно оценивать непосредственно с помощью полипептида IPD079. Рецепторную функцию в осуществлении инсектицидной активности полипептида IPD079 можно подтвердить путем осуществления способа нокаута гена с помощью RNAi (Rajagopal, et al., (2002) J. Biol. Chem. 277:46849-46851).

Нуклеотидные конструкции, кассеты и векторы экспрессии

Использование термина "нуклеотидные конструкции" в данном документе не предназначено ограничивать варианты осуществления нуклеотидными конструкциями, содержащими ДНК. Специалистам в данной области будет понятно, что нуклеотидные конструкции, в частности полинуклеотиды и олигонуклеотиды, состоящие из рибонуклеотидов и комбинаций рибонуклеотидов и дезоксирибонуклеотидов, также можно использовать в способах, раскрытых в данном документе. Нуклеотидные конструкции, нуклеиновые кислоты и нуклеотидные последовательности согласно вариантам осуществления дополнительно охватывают все комплементарные формы таких конструкций, молекул и последовательностей. Кроме того, нуклеотидные конструкции, нуклеотидные молекулы и нуклеотидные последовательности согласно вариантам осуществления охватывают все нуклеотидные конструкции, молекулы и последовательности, которые можно использовать в способах согласно вариантам осуществления для трансформации растений, в том числе без ограничения состоящие из дезоксирибонуклеотидов, рибонуклеотидов и их комбинаций. Такие дезоксирибонуклеотиды и рибонуклеотиды имеют в составе как встречающиеся в природе молекулы, так и синтетические аналоги. Нуклеотидные конструкции, нуклеиновые кислоты и нуклеотидные последовательности согласно вариантам осуществления также охватывают все формы нуклеотидных конструкций, в том числе без ограничения однонитевые формы, двухнитевые формы, шпильки, структуры типа "стебель-и-петля" и им подобные.

Дополнительный вариант осуществления относится к трансформированному организму, такому как организм, выбранный из растительных клеток или клеток насекомых, бактерий, дрожжей, бакуловируса, простейших, нематод и водорослей. Трансформированный организм содержит молекулу ДНК согласно вариантам осуществления, кассету экспрессии, содержащую молекулу ДНК, или вектор, содержащий кассету экспрессии, которые могут быть стабильно встроенными в геном трансформированного организма.

Последовательности согласно вариантам осуществления предусматриваются в составе ДНК-конструкций для экспрессии в организме, представляющем интерес. Конструкции будут включать 5' и 3' регуляторные последовательности, функционально связанные с последовательностью согласно вариантам осуществления. Термин "функционально связанный", используемый в данном документе, относится к функциональной связи между промотором и второй последовательностью, где последовательность промотора инициирует и опосредует транскрипцию последовательности ДНК, соответствующей второй последовательности. Как правило, функционально связанный означает, что связанные последовательности нуклеиновой кислоты являются смежными, и при необходимости соединяют два кодирующих белок участка в одной рамке считывания. Конструкция может дополнительно содержать по меньшей мере один дополнительный ген, подлежащий введению в организм путем котрансформации. В качестве альтернативы дополнительный(дополнительные) ген(гены) могут предусматриваться в нескольких ДНК-конструкциях.

Такая ДНК-конструкция снабжена несколькими сайтами рестрикции для вставки последовательности гена, кодирующего полипептид IPD079, транскрипция которой будет регулироваться регуляторными участками ДНК-конструкция может дополнительно содержать селектируемые маркерные гены.

Как правило, в направлении транскрипции от 5' к 3' концу ДНК-конструкция будет включать: участок инициации транскрипции и трансляции (т. е. промотор), последовательность ДНК согласно вариантам осуществления и участок терминации транскрипции и трансляции (т. е. участок терминации), функционирующие в организме, служащем хозяином. Участок инициации транскрипции (т. е. промотор) может быть нативным, аналогичным, чужеродным или гетерологичным относительно организма-хозяина и/или последовательности согласно вариантам осуществления. Кроме того, промотор может представлять собой природную последовательность или в качестве альтернативы синтетическую последовательность. Термин "чужеродный", используемый в данном документе, указывает на то, что промотор не найден в нативном организме, в который введен промотор. Если промотор является "чужеродным" или "гетерологичным" относительно последовательности согласно вариантам осуществления, то предполагается, что промотор не является нативным или встречающимся в природе промотором для функционально связанной последовательности согласно вариантам осуществления. Химерный ген, как используется в данном документе, содержит кодирующую последовательность, функционально связанную с участком инициации транскрипции, который является гетерологичным для кодирующей последовательности. Если промотор представляет собой нативную или природную последовательностью, то экспрессия функционально связанной последовательности изменена по сравнению с экспрессией дикого типа, что приводит к изменению фенотипа.

В некоторых вариантах осуществления ДНК-конструкция может также включать последовательность транскрипционного энхансера. Используемый в данном документе термин "энхансер" относится к последовательности ДНК, которая может стимулировать активность промотора и которая может представлять собой характерный элемент промотора или гетерологичный элемент, вставленный для повышения уровня активности или тканевой специфичности промотора. Из уровня техники известны различные энхансеры, например, также могут применяться интроны со свойствами улучшения генной экспрессии в растениях (публикация заявки на патент США № 2009/0144863, интрон убиквитина (т. е. интрон 1 убиквитина маиса (см., например, последовательность NCBI S94464)), омега-энхансер или омега-штрих-энхансер (Gallie, et al., (1989) Molecular Biology of RNA ed. Cech (Liss, New York) 237-256 и Gallie, et al., (1987) Gene 60:217-25), энхансер CaMV 35S (см., например, Benfey, et al., (1990) EMBO J. 9:1685-96) и энхансеры из патента США № 7803992, каждый из которых включен с помощью ссылки. Вышеприведенный перечень транскрипционных энхансеров не предназначен для ограничения. В вариантах осуществления можно применять любой подходящий транскрипционный энхансер.

Участок терминации может быть нативным относительно участка инициации транскрипции, может быть нативным относительно функционально связанной последовательности ДНК, представляющей интерес, может быть нативным относительно растения-хозяина или может быть получен из другого источника (т. е. чужеродный или гетерологичный для промотора, последовательности, представляющей интерес, растения-хозяина или какой-либо их комбинации).

Подходящие участки терминации доступны из Ti-плазмиды A. tumefaciens, такие как участки терминации генов октопинсинтазы и нопалинсинтазы. См. также Guerineau, et al., (1991) Mol. Gen. Genet. 262:141-144; Proudfoot, (1991) Cell 64:671-674; Sanfacon, et al., (1991) Genes Dev. 5:141-149; Mogen, et al., (1990) Plant Cell 2:1261-1272; Munroe, et al., (1990) Gene 91:151-158; Ballas, et al., (1989) Nucleic Acids Res. 17:7891-7903 и Joshi, et al., (1987) Nucleic Acid Res. 15:9627-9639.

При необходимости, нуклеиновую кислоту можно оптимизировать для усиления экспрессии в организме-хозяине. Таким образом, если организм-хозяин является растением, то для усиления экспрессии можно синтезировать синтетические нуклеиновые кислоты с применением кодонов, предпочтительных для растений. См. например Campbell and Gowri, (1990) Plant Physiol. 92:1-11, где обсуждается применение кодонов, предпочтительных для хозяина. Например, хотя последовательности нуклеиновой кислоты согласно вариантам осуществления могут экспрессироваться как у видов однодольных, так и видов двудольных растений, последовательности можно модифицировать с учетом специфичных предпочтений кодонов и предпочтений по содержанию GC у однодольных или двудольных, если было показано, что предпочтения отличаются (Murray et al. (1989) Nucleic Acids Res. 17:477-498). Таким образом, кодон, предпочтительный для маиса, для конкретной аминокислоты можно получить из известных последовательностей генов маиса. Данные о частоте использования кодонов в маисе для 28 генов из растений маиса приведены в таблице 4 в Murray, et al., выше. Из уровня техники доступны способы синтеза генов, предпочтительных для растений. См., например, патенты США №№ 5380831 и 5436391, а также Murray, et al., (1989) Nucleic Acids Res. 17:477-498 и Liu H et al. Mol Bio Rep 37:677-684, 2010, включенные в данный документ с помощью ссылки. Таблицу использования кодонов Zea maize также можно найти на веб-сайте по адресу kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=4577, доступ к которому можно получить с использованием приставки www.

Таблицу использования кодонов Glycine max можно найти на веб-сайте по адресу kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=3847&aa=1&style=N, доступ к которому можно получить с использованием приставки www.

В некоторых вариантах осуществления в рекомбинантной молекуле нуклеиновой кислоты, кодирующая полипептид IPD079, имеются кодоны, оптимизированные для маиса.

Известны дополнительные модификации последовательности для усиления экспрессии гена у клеточного хозяина. Они включают устранение последовательностей, кодирующих ложные сигналы полиаденилирования, сигналы сайта сплайсинга экзонов и интронов, транспозон-подобные повторы и другие хорошо изученные последовательности, которые могут быть вредны для экспрессии гена. Содержание GC в последовательности можно скорректировать до уровней, средних для данного клеточного хозяина, рассчитываемых с учетом известных генов, экспрессируемых в клетке-хозяине. Термин "клетка-хозяин", используемый в данном документе, относится к клетке, которая содержит вектор и которая поддерживает репликацию и/или экспрессию предполагаемых векторов экспрессии. Клетки-хозяева могут быть прокариотическими клетками, такими как E. coli, или эукариотическими клетками, такими как клетки дрожжей, насекомых, амфибий или млекопитающих, или клетками однодольных или двудольных растений. Примером клетки-хозяина, относящейся к однодольному растению, является клетка-хозяин маиса. Если это возможно, то последовательность модифицируют для того, чтобы избежать образования прогнозируемых шпилечных вторичных структур мРНК.

Кассеты экспрессии могут дополнительно содержать 5'-лидерные последовательности. Такие лидерные последовательности могут способствовать усилению трансляции. Лидерные последовательности трансляции известны из уровня техники и предусматривают лидерные последовательности пикорнавирусов, например лидерную последовательность EMCV (5'-некодирующий участок вируса энцефаломиокардита) (Elroy-Stein, et al., (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); лидерные последовательности потивирусов, например лидерную последовательность TEV (вируса гравировки табака) (Gallie, et al., (1995) Gene 165(2):233-238), лидерную последовательность MDMV (вируса карликовой мозаики кукурузы), последовательность белка, связывающего тяжелую цепь иммуноглобулина человека (BiP) (Macejak, et al., (1991) Nature 353:90-94); нетранслируемую лидерную последовательность из мРНК белка оболочки вируса мозаики люцерны (AMV RNA 4) (Jobling, et al., (1987) Nature 325:622-625); лидерную последовательность вируса табачной мозаики (TMV) (Gallie, et al., (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256) и лидерную последовательность вируса хлорозной мозаики маиса (MCMV) (Lommel, et al., (1991) Virology 81:382-385). См. также Della Cioppa et al. (1987) Plant Physiology 84:965-968. Такие конструкции могут также содержать "сигнальную последовательность" или "лидерную последовательность" для облегчения сопряженного с трансляцией или посттрансляционного транспорта пептида в определенные внутриклеточные структуры, такие как хлоропласт (или другая пластида), эндоплазматический ретикулум или аппарат Гольджи.

Выражение "сигнальная последовательность", используемое в данном документе, относится к последовательности, которая, как известно или как ожидается, приводит к сопряженному с трансляцией или посттрансляционному транспорту пептида через клеточную мембрану. У эукариот это обычно подразумевает секрецию в пузырьках аппарата Гольджи, при этом происходит гликолизирование до некоторой степени. Инсектицидные токсины бактерий зачастую синтезируются в виде протоксинов, которые активируются под действием протеолиза в кишечнике целевого вредителя (Chang, (1987) Methods Enzymol. 153:507-516). В некоторых вариантах осуществления сигнальная последовательность расположена в нативной последовательности или может быть получена из последовательности согласно вариантам осуществления. Выражение "лидерная последовательность", используемое в данном документе, относится к любой последовательности, которая при трансляции приводит к аминокислотной последовательности, способной запускать сопряженный с трансляцией транспорт пептидной цепи во внутриклеточную органеллу. Таким образом, это предусматривает лидерные последовательности, целенаправленно воздействующие на транспорт и/или гликозилирование посредством перехода в эндоплазматический ретикулум, перехода в вакуоли, пластиды, в том числе хлоропласты, митохондрии и т. п. Кодируемые в ядре белки, нацеленные в компартмент полости тилакоида хлоропластов, имеют характерный двойной транзитный пептид, состоящий из сигнального пептида, нацеливающего на строму, и сигнального пептида, нацеливающего на полость. Информация для нацеливания на строму находится в ближайшей к амино-концу части транзитного пептида. Сигнальный пептид, нацеливающий на полость, находится в ближайшей к карбокси-концу части транзитного пептида и содержит всю информацию для нацеливания на полость. Последние исследования по протеомике хлоропластов высших растений добились успеха в идентификации многочисленных кодируемых в ядре белков полости (Kieselbach et al. FEBS LETT 480:271-276, 2000; Peltier et al. Plant Cell 12:319-341, 2000; Bricker et al. Biochim. Biophys Acta 1503:350-356, 2001), при этом их сигнальный пептид, нацеливающий на полость, можно потенциально применять в соответствии с настоящим изобретением. О приблизительно 80 белках из Arabidopsis, а также гомологичных белках из шпината и гороха огородного, сообщается в Kieselbach et al., Photosynthesis Research, 78:249-264, 2003. В частности, в таблице 2 данной публикации, которая включена в настоящее описание с помощью ссылки, раскрыто 85 белков из полости хлоропласта, идентифицированных по их номеру доступа (см. также публикацию заявки на выдачу патента США 2009/09044298). Кроме того, опубликованная недавно предварительная версия генома риса (Goff et al, Science 296:92-100, 2002) является подходящим источником для информации о сигнальном пептиде, нацеливающим на полость, который можно применять в соответствии с настоящим изобретением.

Подходящие транзитные пептиды хлоропластов (CTP), хорошо известные специалисту в данной области, также включают химерные CTP, содержащие без ограничения N-концевой домен, центральный домен или C-концевой домен CTP из 1-дезокси-D-ксилоза-5-фосфатсинтазы Oryza sativa, супероксиддисмутазы Oryza sativa, синтазы растворимого крахмала Oryza sativa, NADP-зависимого фермента, действующего на яблочную кислоту, Oryza sativa, фосфо-2-дегидро-3-дезоксигептонатальдолазы 2 Oryza sativa, L-аскорбатпероксидазы 5 Oryza sativa, фосфоглюкан-вода-дикиназы Oryza sativa, ssRUBISCO Zea Mays, бета-глюкозидазы Zea Mays, малатдегидрогеназы Zea Mays, тиоредоксина M-типа Zea Mays из публикации заявки на выдачу патента США 2012/0304336).

Ген полипептида IPD079, подлежащего нацеливанию в хлоропласт, можно оптимизировать для экспрессии в хлоропласте с учетом отличий по использованию кодонов между растительным ядром и этой органеллой. Таким образом, нуклеиновые кислоты, представляющие интерес, можно синтезировать с применением кодонов, предпочтительных для хлоропласта. См., например, патент США № 5380831, включенный в данный документ с помощью ссылки.

При получении кассеты экспрессии с различными фрагментами ДНК можно проводить манипуляции так, чтобы получить последовательности ДНК в надлежащей ориентации и, при необходимости, в надлежащей рамке считывания. С данной целью для соединения фрагментов ДНК можно использовать адаптеры или линкеры или можно задействовать другие манипуляции для обеспечения подходящих сайтов рестрикции, удаления избыточной ДНК, удаления сайтов рестрикции и т. п. С данной целью можно задействовать мутагенез in vitro, репарацию с помощью праймеров, рестрикцию, гибридизацию, повторные замены, например транзиции и трансверсии.

При практическом осуществлении вариантов осуществления можно применять ряд промоторов. Промоторы можно выбирать, исходя из необходимого результата. Нуклеиновые кислоты можно комбинировать с конститутивными, предпочтительными для ткани, индуцируемыми или другими промоторами для экспрессии в организме-хозяине. Подходящие конститутивные промоторы для применения в растительной клетке-хозяине включают, например, основной промотор промотора Rsyn7 и других конститутивных промоторов, раскрытых в WO 1999/43838 и патенте США № 6072050; основной промотор 35S CaMV (Odell, et al., (1985) Nature 313:810-812); промотор актина риса (McElroy, et al., (1990) Plant Cell 2:163-171); убиквитиновый промотор (Christensen, et al., (1989) Plant Mol. Biol. 12:619-632 и Christensen, et al., (1992) Plant Mol. Biol. 18:675-689); pEMU (Last, et al., (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten, et al., (1984) EMBO J. 3:2723-2730); промотор ALS (патент США № 5659026) и т. п. Другие конститутивные промоторы включают, например, раскрытые в патентах США №№ 5608149; 5608144; 5604121; 5569597; 5466785; 5399680; 5268463; 5608142 и 6177611.

В зависимости от требуемого результата, может быть полезно экспрессировать ген с помощью индуцируемого промотора. Особый интерес для регуляции экспрессии нуклеотидных последовательностей согласно вариантам осуществления у растений представляют собой индуцируемые ранением промоторы. Такие индуцируемые ранением промоторы могут реагировать на повреждение, вызванное питанием насекомого, и они включают промотор гена ингибитора протеиназы (pin II) картофеля (Ryan, (1990) Ann. Rev. Phytopath. 28:425-449; Duan, et al., (1996) Nature Biotechnology 14:494-498); wun1 и wun2, патент США № 5428148; win1 и win2 (Stanford, et al., (1989) Mol. Gen. Genet. 215:200-208); системин (McGurl, et al., (1992) Science 225:1570-1573); WIP1 (Rohmeier, et al., (1993) Plant Mol. Biol. 22:783-792; Eckelkamp, et al., (1993) FEBS Letters 323:73-76); ген MPI (Corderok, et al., (1994) Plant J. 6(2):141-150) и т. п., включенные в данный документ с помощью ссылки.

Кроме того, в способах и нуклеотидных конструкциях согласно вариантам осуществления можно использовать индуцируемые патогеном промоторы. Такие индуцируемые патогеном промоторы включают промоторы из белков, связанных с патогенезом (PR-белков), которые индуцируются после заражения патогеном; например PR-белков, SAR-белков, бета-1,3-глюканазы, хитиназы и т. д. См., например, Redolfi, et al., (1983) Neth. J. Plant Pathol. 89:245-254; Uknes, et al., (1992) Plant Cell 4: 645-656 и Van Loon, (1985) Plant Mol. Virol. 4:111-116. См. также WO 1999/43819, включенную в данный документ с помощью ссылки.

Представляют интерес промоторы, которые экспрессируются локально в месте заражения патогеном или вблизи него. См., например, Marineau, et al., (1987) Plant Mol. Biol. 9:335-342; Matton, et al., (1989) Molecular Plant-Microbe Interactions 2:325-331; Somsisch, et al., (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch, et al., (1988) Mol. Gen. Genet. 2:93-98 и Yang, (1996) Proc. Natl. Acad. Sci. USA 93:14972-14977. См. также Chen, et al., (1996) Plant J. 10:955-966; Zhang, et al., (1994) Proc. Natl. Acad. Sci. USA 91:2507-2511; Warner, et al., (1993) Plant J. 3:191-201; Siebertz, et al., (1989) Plant Cell 1:961-968; патент США № 5750386 (индуцируемый нематодами); а также источники, приведенные в данных документах. Особый интерес представляет индуцируемый промотор для гена PRms маиса, экспрессия которого индуцируется патогеном Fusarium moniliforme (см, например, Cordero, et al., (1992) Physiol. Mol. Plant Path. 41:189-200).

Регулируемые химическими веществами промоторы можно использовать для модулирования экспрессии гена в растении посредством применения экзогенного химического регулятора. В зависимости от цели, промотор может представлять собой индуцируемый химическим веществом промотор, при этом применение химического вещества индуцирует экспрессию гена, или репрессируемый химическим веществом промотор, при этом применение химического вещества подавляет экспрессию гена. Индуцируемые химическими веществами промоторы известны в уровне техники и включают без ограничения промотор In2-2 маиса, который активируется антидотами к бензолсульфонамидным гербицидам, промотор GST маиса, который активируется гидрофобными электрофильными соединениями, которые применяются в качестве предвсходовых гербицидов, и промотор PR-1a табака, который активируется салициловой кислотой. Другие регулируемые химическими веществами промоторы, представляющие интерес, включают чувствительные к стероидам промоторы (см., например, индуцируемый глюкокортикоидом промотор в Schena, et al., (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 и McNellis, et al., (1998) Plant J. 14(2):247-257), а также индуцируемые тетрациклинами и репрессируемые тетрациклинами промоторы (см., например, Gatz, et al., (1991) Mol. Gen. Genet. 227:229-237 и патенты США №№ 5814618 и 5789156), включенные в данный документ с помощью ссылки.

Для целенаправленного воздействия на усиленную экспрессию полипептида IPD079 в конкретной ткани растения можно использовать предпочтительные в отношении ткани промоторы. Предпочтительные для ткани промоторы включают промоторы, обсуждаемые в Yamamoto, et al., (1997) Plant J. 12(2)255-265; Kawamata, et al., (1997) Plant Cell Physiol. 38(7):792-803; Hansen, et al., (1997) Mol. Gen Genet. 254(3):337-343; Russell, et al., (1997) Transgenic Res. 6(2):157-168; Rinehart, et al., (1996) Plant Physiol. 112(3):1331-1341; Van Camp, et al., (1996) Plant Physiol. 112(2):525-535; Canevascini, et al., (1996) Plant Physiol. 112(2):513-524; Yamamoto, et al., (1994) Plant Cell Physiol. 35(5):773-778; Lam, (1994) Results Probl. Cell Differ. 20:181-196; Orozco, et al., (1993) Plant Mol Biol. 23(6):1129-1138; Matsuoka, et al., (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590 и Guevara-Garcia, et al., (1993) Plant J. 4(3):495-505. Такие промоторы можно модифицировать в случае необходимости для получения слабой экспрессии.

Промоторы, предпочтительные для листа, известны из уровня техники. См., например, Yamamoto, et al., (1997) Plant J. 12(2):255-265; Kwon, et al., (1994) Plant Physiol. 105:357-67; Yamamoto, et al., (1994) Plant Cell Physiol. 35(5):773-778; Gotor, et al., (1993) Plant J. 3:509-18; Orozco, et al., (1993) Plant Mol. Biol. 23(6):1129-1138 и Matsuoka, et al., (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590.

Известны промоторы, предпочтительные для корня, или промоторы, специфичные в отношении корня, и их можно выбирать из многих доступных из литературных источников или выделенных de novo из различных совместимых видов. См., например, Hire, et al., (1992) Plant Mol. Biol. 20(2):207-218 (специфичный в отношении корня сои ген глутаминсинтетазы); Keller and Baumgartner, (1991) Plant Cell 3(10):1051-1061 (специфичный в отношении корня регуляторный элемент в гене GRP 1.8 фасоли); Sanger, et al., (1990) Plant Mol. Biol. 14(3):433-443 (специфичный в отношении корня промотор гена маннопинсинтазы (MAS) из Agrobacterium tumefaciens) и Miao, et al., (1991) Plant Cell 3(1):11-22 (полноразмерный кДНК-клон, кодирующий цитозольную глутаминсинтетазу (GS), которая экспрессируется в корнях и корневых клубеньках сои). См. также Bogusz, et al., (1990) Plant Cell 2(7):633-641, где описаны два промотора, специфичные в отношении корня, выделенные из генов гемоглобина от азотфиксирующего растения Parasponia andersonii, не относящегося к бобовым, и родственного растения Trema tomentosa, не относящегося к бобовым и не являющегося азотфиксирующим. Промоторы этих генов были связаны с репортерным геном β-глюкуронидазы и введены как в растение Nicotiana tabacum, не относящееся к бобовым, так и в бобовое растение Lotus corniculatus, и при этом в обоих случаях специфичная в отношении корня активность промотора сохранялась. Leach и Aoyagi (1991) описывают свой анализ промоторов, обеспечивающих высокий уровень экспрессии генов roIC и roID Agrobacterium rhizogenes, индуцирующих разрастание корней (см. Plant Science (Limerick) 79(1):69-76). Они пришли к выводу, что в этих промоторах энхансер и предпочтительные для ткани ДНК-детерминанты разделены. Teeri et al. (1989) применяли слияние гена с lacZ для того, чтобы показать, что ген из T-DNA Agrobacterium, кодирующий октопинсинтазу, является особенно активным в эпидермисе кончика корня, и что ген TR2' является специфичным в отношении корня в интактном растении и стимулируется при ранении в ткани листа, что является особенно необходимой комбинацией характеристик для применения с инсектицидным или ларвицидным геном (см. EMBO J. 8(2):343-350). Ген TR1', слитый с nptII (неомицинфосфотрансферазой II), продемонстрировал аналогичные характеристики. Дополнительные промоторы, предпочтительные для корня, включают промотор гена VfENOD-GRP3 (Kuster, et al., (1995) Plant Mol. Biol. 29(4):759-772) и промотор rolB (Capana, et al., (1994) Plant Mol. Biol. 25(4):681-691. См. также, патенты США №№ 5837876; 5750386; 5633363; 5459252; 5401836; 5110732 и 5023179. Предпочтительные для корней регуляторные последовательности Arabidopsis thaliana раскрыты в US20130117883.

Промоторы, "предпочтительные для семени", включают как промоторы "специфичные в отношении семени" (промоторы, которые активны во время развития семени, такие как промоторы запасных белков семени), так и промоторы "прорастания семени" (промоторы, которые активны во время прорастания семени). См. Thompson, et al., (1989) BioEssays 10:108, включенную в данный документ с помощью ссылки. Такие промоторы, предпочтительные для семени, включают без ограничения Cim1 (индуцируемый цитокинином транскрипт); cZ19B1 (зеин маиса весом 19 кДа) и milps (мио-инозитол-1-фосфатсинтаза); (см. патент США № 6225529, включенный в данный документ с помощью ссылки). Гамма-зеин и Glb-1 являются специфичными в отношении эндосперма промоторами. В случае двудольных растений промоторы, специфичные в отношении семени, включают без ограничения промотор гена ингибитора трипсина-3 типа Кунитц (KTi3) (Jofuku and Goldberg, (1989) Plant Cell 1:1079-1093), β-фазеолина бобов, напина, β-конглицинина, глицинина 1, лектина сои, круциферина и т. п. В случае однодольных растений, промоторы, специфичные в отношении семени, включают без ограничения промоторы из генов зеина весом 15 кДа, зеина весом 22 кДа, зеина весом 27 кДа, g-зеина, waxy, shrunken 1, shrunken 2, глобулина 1 маиса и т. д. См. также WO 2000/12733, где раскрыты промоторы, предпочтительные для семени, из генов end1 и end2, включенную в данный документ с помощью ссылки. У двудольных растений промоторы, специфичные в отношении семени, включают без ограничения промотор гена белков семенной оболочки из Arabidopsis, pBAN; а также промоторы генов раннего развития семян из Arabidopsis, p26, p63 и p63tr (патенты США №№ 7294760 и 7847153). Промотор, который характеризуется "предпочтительной" экспрессией в конкретной ткани, экспрессируется в такой ткани в большей степени, чем по меньшей мере в одной другой растительной ткани. Для некоторых предпочтительных для ткани промоторов показана экспрессия почти исключительно в конкретной ткани.

Если требуется низкий уровень экспрессии, то будут применять слабые промоторы. В целом, используемый в данном документе термин "слабый промотор" относится к промотору, который управляет экспрессией кодирующей последовательности на низком уровне. Под низким уровнем экспрессии подразумевают уровни от приблизительно 1/1000 транскриптов до приблизительно 1/100000 транскриптов, до приблизительно 1/500000 транскриптов. В качестве альтернативы понятно, что термин "слабые промоторы" также охватывает промоторы, которые управляют экспрессией только в небольшом количестве клеток и не управляют в других, при этом обеспечивается общий низкий уровень экспрессии. Если промотор управляет экспрессией на неприемлемо высоких уровнях, то части промоторной последовательности можно удалить или модифицировать для снижения уровней экспрессии.

Такие слабые конститутивные промоторы включают, например, основной промотор промотора Rsyn7 (WO 1999/43838 и патент США № 6072050), основной промотор 35S CaMV и т. п. Другие конститутивные промоторы включают, например, раскрытые в патентах США №№ 5608149; 5608144; 5604121; 5569597; 5466785; 5399680; 5268463; 5608142 и 6177611, включенных в данный документ с помощью ссылки.

Приведенный выше перечень промоторов не предназначен для ограничения. В вариантах осуществления можно применять любой подходящий промотор.

Как правило, кассета экспрессии будет содержать селектируемый маркерный ген для отбора трансформированных клеток. Селектируемые маркерные гены используют для отбора трансформированных клеток или тканей. Маркерные гены включают гены, кодирующие устойчивость к антибиотику, такие как гены, кодирующие неомицинфосфотрансферазу II (NEO) и гигромицинфосфотрансферазу (HPT), а также гены, обеспечивающие устойчивость к гербицидным соединениям, таким как глуфосинат аммония, бромоксинил, имидазолиноны и 2,4-дихлорфеноксиацетат (2,4-D). Дополнительные примеры подходящих селектируемых маркерных генов включают без ограничения гены, кодирующие устойчивость к хлорамфениколу (Herrera Estrella, et al., (1983) EMBO J. 2:987-992); метотрексату (Herrera Estrella, et al., (1983) Nature 303:209-213 и Meijer, et al., (1991) Plant Mol. Biol. 16:807-820); стрептомицину (Jones, et al., (1987) Mol. Gen. Genet. 210:86-91); спектиномицину (Bretagne-Sagnard, et al., (1996) Transgenic Res. 5:131-137); блеомицину (Hille, et al., (1990) Plant Mol. Biol. 7:171-176); сульфонамиду (Guerineau, et al., (1990) Plant Mol. Biol. 15:127-136); бромоксинилу (Stalker, et al., (1988) Science 242:419-423); глифосату (Shaw, et al., (1986) Science 233:478-481 и заявки на выдачу патентов США с серийными №№ 10/004357 и 10/427692); фосфинотрицин (DeBlock, et al., (1987) EMBO J. 6:2513-2518). См., в целом, Yarranton, (1992) Curr. Opin. Biotech. 3:506-511; Christopherson, et al., (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao, et al., (1992) Cell 71:63-72; Reznikoff, (1992) Mol. Microbiol. 6:2419-2422; Barkley, et al., (1980) in The Operon, pp. 177-220; Hu, et al., (1987) Cell 48:555-566; Brown, et al., (1987) Cell 49:603-612; Figge, et al., (1988) Cell 52:713-722; Deuschle, et al., (1989) Proc. Natl. Acad. Sci. USA 86:5400-5404; Fuerst, et al., (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle, et al., (1990) Science 248:480-483; Gossen, (1993) диссертация на соискание научной степени доктора, Гейдельбергский университет; Reines, et al., (1993) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow, et al., (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti, et al., (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956; Baim, et al., (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski, et al., (1991) Nucleic Acids Res. 19:4647-4653; Hillenand-Wissman, (1989) Topics Mol. Struc. Biol. 10:143-162; Degenkolb, et al., (1991) Antimicrob. Agents Chemother. 35:1591-1595; Kleinschnidt, et al., (1988) Biochemistry 27:1094-1104; Bonin, (1993) диссертация на соискание научной степени доктора, Гейдельбергский университет; Gossen, et al., (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva, et al., (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka, et al., (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin) и Gill, et al., (1988) Nature 334:721-724. Такие раскрытия включены в данный документ с помощью ссылки.

Приведенный выше перечень селектируемых маркерных генов не предназначен для ограничения. В вариантах осуществления можно применять любой селектируемый маркерный ген.

Трансформация растений

Способы согласно вариантам осуществления включают введение полипептида или полинуклеотида в растение. "Введение", как используется в данном документе, означает включение в растение полинуклеотида или полипептида таким образом, что последовательность попадает внутрь клетки растения. Способы согласно вариантам осуществления не зависят от конкретного способа введения полинуклеотида или полипептида в растение, нужно лишь чтобы полинуклеотид или полипептиды проникали внутрь по меньшей мере одной клетки растения. Из уровня техники известны способы введения полинуклеотида и/или полипептидов в растения, в том числе без ограничений способы стабильной трансформации, способы транзиентной трансформации и способы трансформации, опосредованной вирусами.

"Стабильная трансформация", как используется в данном документе, означает, что нуклеотидная конструкция, введенная в растение, интегрируется в геном растения и может наследоваться его потомством. "Транзиентная трансформация", как используется в данном документе, означает, что полинуклеотид вводят в растение, и он не интегрируется в геном растения, или в растение вводят полипептид. Выражение "растение", используемое в данном документе, относится к целым растениям, органам растения (например, листьям, стеблям, корням и т. д.), семенам, растительным клеткам, частям растения для вегетативного размножения, зародышам и их потомству. Растительные клетки могут быть дифференцированными или недифференцированными (например, клетками каллюса, клетками суспензионных культур, протопластами, клетками листьев, клетками корней, клетками флоэмы и пыльцой).

Протоколы трансформации, а также протоколы для введения нуклеотидных последовательностей в растения, могут изменяться в зависимости от типа растения или растительной клетки, т. е. класса однодольных или двудольных, на которые нацелена трансформация. Подходящие способы введения нуклеотидных последовательностей в растительные клетки и последующая вставка в геном растения включают микроинъекцию (Crossway, et al., (1986) Biotechniques 4:320-334), электропорацию (Riggs, et al., (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606), трансформацию, опосредованную Agrobacterium (патенты США №№ 5563055 и 5981840), прямой перенос генов (Paszkowski, et al., (1984) EMBO J. 3:2717-2722) и баллистическое ускорение частиц (см., например, патенты США №№ 4945050; 5879918; 5886244 и 5932782; Tomes, et al., (1995) в Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips, (Springer-Verlag, Berlin) и McCabe, et al., (1988) Biotechnology 6:923-926) и трансформацию гена Lecl (WO 00/28058). Относительно трансформации картофеля см. Tu, et al., (1998) Plant Molecular Biology 37:829-838 и Chong, et al., (2000) Transgenic Research 9:71-78. Дополнительные процедуры трансформации можно найти в Weissinger, et al., (1988) Ann. Rev. Genet. 22:421-477; Sanford, et al., (1987) Particulate Science and Technology 5:27-37 (лук репчатый); Christou, et al., (1988) Plant Physiol. 87:671-674 (соя); McCabe, et al., (1988) Bio/Technology 6:923-926 (соя); Finer and McMullen, (1991) In Vitro Cell Dev. Biol. 27P:175-182 (соя); Singh, et al., (1998) Theor. Appl. Genet. 96:319-324 (соя); Datta, et al., (1990) Biotechnology 8:736-740 (рис); Klein, et al., (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (маис); Klein, et al., (1988) Biotechnology 6:559-563 (маис); патенты США №№ 5240855; 5322783 и 5324646; Klein, et al., (1988) Plant Physiol. 91:440-444 (маис); Fromm, et al., (1990) Biotechnology 8:833-839 (маис); Hooykaas-Van Slogteren, et al., (1984) Nature (London) 311:763-764; патент США № 5736369 (злаки); Bytebier, et al., (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet, et al., (1985) в The Experimental Manipulation of Ovule Tissues, ed. Chapman, et al., (Longman, New York), pp. 197-209 (пыльца); Kaeppler, et al., (1990) Plant Cell Reports 9:415-418 и Kaeppler, et al., (1992) Theor. Appl. Genet. 84:560-566 (трансформация, опосредованная прокалыванием клеток путем встряхивания их в суспензии микроигл); D'Halluin, et al., (1992) Plant Cell 4:1495-1505 (электропорация); Li, et al., (1993) Plant Cell Reports 12:250-255 и Christou and Ford, (1995) Annals of Botany 75:407-413 (рис); Osjoda, et al., (1996) Nature Biotechnology 14:745-750 (маис при участии Agrobacterium tumefaciens); все из которых включены в данный документ с помощью ссылки.

В конкретных вариантах осуществления последовательности согласно вариантам осуществления можно вводить в растение с применением ряда способов транзиентной трансформации. Такие способы временной трансформации включают без ограничения введение полинуклеотида IPD079 или его вариантов и фрагментов непосредственно в растение или введение транскрипта полипептида IPD079 в растение. Такие способы включают, например, микроинъекцию или бомбардировку частицами. См., например, Crossway, et al., (1986) Mol Gen. Genet. 202:179-185; Nomura, et al., (1986) Plant Sci. 44:53-58; Hepler, et al., (1994) Proc. Natl. Acad. Sci. 91:2176-2180 и Hush, et al., (1994) The Journal of Cell Science 107:775-784, все из которых включены в данный документ с помощью ссылки. В качестве альтернативы растение можно транзиентно трансформировать с помощью полинуклеотида IPD079 с применением методик, известных из уровня техники. Такие методики включают применение вирусной векторной системы и осаждение полинуклеотида таким способом, который исключает последующее высвобождение ДНК. Таким образом, может происходить транскрипция ДНК, связанной с частицами, однако частота, с которой она высвобождается для интеграции в геном, в значительной степени снижена. Такие способы включают применение частиц, покрытых полиэтиленимином (PEI; № по кат. Sigma P3143).

Из уровня техники известны способы нацеленной вставки полинуклеотида в конкретное местоположение в геноме растения. В одном варианте осуществления вставку полинуклеотида в требуемое местоположение в геноме выполняют с использованием системы сайт-специфичной рекомбинации. См., например, WO 1999/25821, WO 1999/25854, WO 1999/25840, WO 1999/25855 и WO 1999/25853, все из которых включены в данный документ с помощью ссылки. Вкратце, полинуклеотид согласно вариантам осуществления может содержаться в кассете для переноса, фланкированной двумя неидентичными сайтами рекомбинации. Кассету для переноса вводят в растение, имеющее в своем геноме стабильно встроенный целевой сайт, который фланкирован двумя неидентичными сайтами рекомбинации, которые соответствуют сайтам кассеты для переноса. Обеспечивают подходящую рекомбиназу, и кассета для переноса интегрируется в целевой сайт. Полинуклеотид, представляющий интерес, таким образом интегрируется в конкретное хромосомное положение в геноме растения.

Векторы для трансформации растений могут состоять из одного или нескольких ДНК-векторов, необходимых для достижения трансформации растения. Например, общепринятой практикой в области техники является использование векторов для трансформации растений, которые состоят из более одного смежного сегмента ДНК. В уровне техники эти векторы зачастую называют "бинарными векторами". Бинарные векторы, а также векторы с плазмидами-помощниками наиболее часто применяются при трансформации, опосредованной Agrobacterium, при этом размер и сложность сегментов ДНК, необходимых для достижения эффективной трансформации, являются очень большими, и предпочтительным является разделение функций на отдельных молекулах ДНК. Бинарные векторы обычно содержат плазмидный вектор, который содержит действующие в цис-положении последовательности, требуемые для переноса T-DNA (как, например, левой границы и правой границы), селектируемый маркер, который разрабатывают таким образом, что он способен экспрессироваться в растительной клетке, и "ген, представляющий интерес" (ген, разработанный таким образом, что он способен экспрессироваться в растительной клетке, из которой требуется получить трансгенные растения). Также в этом плазмидном векторе присутствуют последовательности, необходимые для репликации в бактериях. Действующие в цис-положении последовательности расположены так, чтобы обеспечить возможность эффективного переноса в растительные клетки и экспрессии в них. Например, селектируемый маркерный ген и пестицидный ген расположены между левой и правой границами. Часто второй плазмидный вектор содержит действующие в транс-положении факторы, которые опосредуют перенос T-DNA из Agrobacterium в растительные клетки. Эта плазмида часто содержит функции вирулентности (гены Vir), что обеспечивает возможность заражения растительных клеток Agrobacterium и перенос ДНК путем расщепления по граничным последовательностям и переноса ДНК, опосредованного vir, как понятно из уровня техники (Hellens and Mullineaux, (2000) Trends in Plant Science 5:446-451). Для трансформации растений можно применять несколько типов штаммов Agrobacterium (например, LBA4404, GV3101, EHA101, EHA105 и т. п.). Второй плазмидный вектор не является необходимым для трансформации растений другими способами, такими как бомбардировка микрочастицами, микроинъекция, электропорация, с помощью полиэтиленгликоля и т. д.

В целом, способы трансформации растений включают перенос гетерологичной ДНК в целевые растительные клетки (например, незрелые или зрелые зародыши, суспензионные культуры, недифференцированный каллюс, протопласты и т. д.), с последующим применением соответствующего отбора с максимальным пороговым значением (в зависимости от селектируемого маркерного гена) для выделения трансформированных растительных клеток из группы нетрансформированной клеточной массы. После интеграции гетерологичной чужеродной ДНК в растительные клетки затем применяют соответствующий отбор с максимальным пороговым значением в среде для уничтожения нетрансформированных клеток для отделения и размножения предположительно трансформированных клеток, которые переживают эту обработку с отбором, посредством регулярного переноса на свежую среду. С помощью продолжающегося пассирования и проверки с помощью соответствующего отбора идентифицируют и размножают клетки, которые трансформированы плазмидным вектором. Затем можно применять молекулярные и биохимические способы для подтверждения присутствия интегрированного гетерологичного гена, представляющего интерес, в геноме трансгенного растения.

Как правило, эксплантаты переносят на свежую порцию той же среды и культивируют обычным способом. Впоследствии трансформированные клетки дифференцируются в побеги после помещения в среду для регенерации, дополненную средством отбора с максимальным пороговым значением. Затем побеги переносят на селективную среду для выращивания растений с получением укоренившихся побегов или саженцев. Затем трансгенный саженец выращивают до зрелого растения и получают фертильные семена (например, Hiei, et al., (1994) The Plant Journal 6:271-282; Ishida, et al., (1996) Nature Biotechnology 14:745-750). Как правило, эксплантаты переносят на свежую порцию той же среды и культивируют обычным способом. Общее описание методик и способов для получения трансгенных растений приведены в Ayres and Park, (1994) Critical Reviews in Plant Science 13:219-239 и Bommineni and Jauhar, (1997) Maydica 42:107-120. Поскольку трансформированный материал содержит множество клеток, то как трансформированные, так и нетрансформированные клетки присутствуют в любой части подвергнутого воздействию целевого каллюса, или ткани, или группы клеток. Возможность уничтожать нетрансформированные клетки и обеспечивать размножение трансформированных клеток приводит в результате к трансформированным растительным культурам. Зачастую, возможность удаления нетрансформированных клеток является ограничивающим фактором для быстрого получения трансформированных растительных клеток и успешного выращивания трансгенных растений.

Из клеток, которые были трансформированы, можно вырастить растения в соответствии с традиционными способами. См., например, McCormick, et al., (1986) Plant Cell Reports 5:81-84. Эти растения затем можно выращивать и опылять либо с использованием такой же трансформированной линии, либо других линий, и получать гибрид с конститутивной или индуцируемой экспрессией требуемого идентифицированного фенотипического свойства. Можно вырастить два или более поколений для того, чтобы убедиться в том, что экспрессия требуемой фенотипической характеристики стабильно поддерживается и наследуется, а затем собрать семена, чтобы убедиться в том, что экспрессия требуемого фенотипического свойства была достигнута.

Нуклеотидные последовательности согласно вариантам осуществления можно обеспечить в растении путем приведения растения в контакт с вирусом или вирусными нуклеиновыми кислотами. Как правило, такие способы включают встраивание нуклеотидной конструкции, представляющей интерес, в вирусную молекулу ДНК или РНК. Понятно, что рекомбинантные белки согласно вариантам осуществления можно исходно синтезировать как часть вирусного полипротеина, который позже может быть процессирован путем протеолиза in vivo или in vitro с получением требуемого полипептида IPD079. Также понятно, что такой вирусный полипротеин, содержащий по меньшей мере часть аминокислотной последовательности IPD079 согласно вариантам осуществления, может обладать требуемой пестицидной активностью. Такие вирусные полипротеины и нуклеотидные последовательности, которые их кодируют, охвачены вариантами осуществления. Способы получения растений с нуклеотидными конструкциями и продуцирования кодируемых белков в растениях, которые включают молекулы вирусных ДНК или РНК, известны из уровня техники. См., например, патенты США №№ 5889191; 5889190; 5866785; 5589367 и 5316931; включенные в данный документ с помощью ссылки.

Способы трансформации хлоропластов известны из уровня техники. См., например, Svab, et al., (1990) Proc. Natl. Acad. Sci. USA 87:8526-8530; Svab and Maliga, (1993) Proc. Natl. Acad. Sci. USA 90:913-917; Svab and Maliga, (1993) EMBO J. 12:601-606. Способ основан на доставке генной пушкой ДНК, содержащей селектируемый маркер, и нацеливании ДНК в геном пластид с помощью гомологичной рекомбинации. Кроме того, трансформацию пластид можно осуществлять трансактивацией молчащего трансгена, находящегося в пластидах, путем экспрессии, предпочтительной для определенной ткани, РНК-полимеразы, кодируемой ядерным геномом и функционирующей в пластиде. О такой системе сообщали в McBride, et al., (1994) Proc. Natl. Acad. Sci. USA 91:7301-7305.

Варианты осуществления дополнительно относятся к материалу для размножения трансформированного растения согласно вариантам осуществления, в том числе без ограничения семенам, клубням, клубнелуковицам, луковицам, листьям и черенкам корней и побегов.

Варианты осуществления можно применять для трансформации любых видов растений, в том числе без ограничения однодольных и двудольных. Примеры растений, представляющих интерес, включают без ограничений кукурузу (Zea mays), Brassica sp. (например, B. napus, B. rapa, B. juncea), в частности виды Brassica, пригодные в качестве источников масла из семян растений, люцерну (Medicago sativa), рис (Oryza sativa), рожь (Secale cereale), сорго (Sorghum bicolor, Sorghum vulgare), просо (например, пеннисетум рогозовидный (Pennisetum glaucum), просо культурное (Panicum miliaceum), щетинник итальянский (Setaria italica), просо пальчатое (Eleusine coracana)), подсолнечник (Helianthus annuus), сафлор (Carthamus tinctorius), пшеницу (Triticum aestivum), сою (Glycine max), табак (Nicotiana tabacum), картофель (Solanum tuberosum), разновидности арахиса (Arachis hypogaea), хлопчатник (Gossypium barbadense, Gossypium hirsutum), сладкий картофель (Ipomoea batatus), маниок (Manihot esculenta), кофейное дерево (Coffea spp.), кокосовую пальму (Cocos nucifera), ананас (Ananas comosus), цитрусовые деревья (Citrus spp.), шоколадное дерево (Theobroma cacao), чайный куст (Camellia sinensis), банан (Musa spp.), авокадо (Persea americana), инжир (Ficus casica), гуаву (Psidium guajava), манго (Mangifera indica), маслину (Olea europaea), папайю (Carica papaya), кешью (Anacardium occidentale), макадамию (Macadamia integrifolia), миндаль (Prunus amygdalus), разновидности сахарной свеклы (Beta vulgaris), сахарный тростник (Saccharum spp.), разновидности овса, ячмень, овощи, декоративные растения и хвойные деревья.

Овощи включают разновидности томата (Lycopersicon esculentum), латук (например, Lactuca sativa), разновидности зеленой фасоли (Phaseolus vulgaris), разновидности лимской фасоли (Phaseolus limensis), разновидности гороха (Lathyrus spp.) и представителей рода Cucumis, таких как огурец (C. sativus), канталупа (C. cantalupensis) и дыня мускусная (C. melo). Декоративные растения включают азалию (Rhododendron spp.), гортензию (Macrophylla hydrangea), гибискус (Hibiscus rosasanensis), розы (Rosa spp.), тюльпаны (Tulipa spp.), нарциссы (Narcissus spp.), петунии (Petunia hybrida), гвоздику (Dianthus caryophyllus), пуансеттию (Euphorbia pulcherrima) и хризантему. Хвойные, которые можно использовать при практическом осуществлении вариантов осуществления, включают, например, разновидности сосны, такие как сосна ладанная (Pinus taeda), сосна Эллиота (Pinus elliotii), сосна желтая (Pinus ponderosa), сосна скрученная широкохвойная (Pinus contorta) и сосна лучистая (Pinus radiata); псевдотсугу Мензиса (Pseudotsuga menziesii); тсугу канадскую (Tsuga canadensis); ель сизую (Picea glauca); секвойю (Sequoia sempervirens); разновидности пихты, такие как пихта миловидная (Abies amabilis) и пихта бальзамическая (Abies balsamea), и разновидности туйи, такие как туя гигантская (Thuja plicata) и каллитропсис нутканский (Chamaecyparis nootkatensis). Растения согласно вариантам осуществления включают культурные растения (например, кукурузу, люцерну, подсолнечник, Brassica, сою, хлопчатник, сафлор, арахис, сорго, пшеницу, просо, табак и т. д.), такие как растения кукурузы и сои.

Разновидности газонной травы включают без ограничения: мятлик однолетний (Poa annua); райграс однолетний (Lolium multiflorum); мятлик сплюснутый (Poa compressa); овсяницу красную Чуинга (Festuca rubra); полевицу тонкую (Agrostis tenuis); полевицу болотную (Agrostis palustris); житняк пустынный (Agropyron desertorum); житняк гребенчатый (Agropyron cristatum); овсяницу длиннолистную (Festuca longifolia); мятлик луговой (Poa pratensis); ежу сборную (Dactylis glomerata); плевел многолетний (Lolium perenne); овсяницу красную (Festuca rubra); полевицу белую (Agrostis alba); мятлик обыкновенный (Poa trivialis); овсяницу овечью (Festuca ovina); костер безостый (Bromus inermis); овсяницу тростниковую (Festuca arundinacea); тимофеевку луговую (Phleum pratense); полевицу собачью (Agrostis canina); бескильницу расставленную (Puccinellia distans); пырей Смита (Agropyron smithii); свинорой пальчатый (Cynodon spp.); узкобороздник однобокий (Stenotaphrum secundatum); зойсию (Zoysia spp.); гречку заметную (Paspalum notatum); аксонопус афинский (Axonopus affinis); эремохлою змеехвостую (Eremochloa ophiuroides); кикуйю (Pennisetum clandesinum); паспалум влагалищный (Paspalum vaginatum); москитную траву (Bouteloua gracilis); бизонову траву (Buchloe dactyloids); боковой овес (Bouteloua curtipendula).

Растения, представляющие интерес, включают зерновые растения, которые дают семена, представляющие интерес, масличные растения и бобовые растения. Семена, представляющие интерес, включают семена зерновых культур, таких как кукуруза, пшеница, ячмень, рис, сорго, рожь, просо и т. д. Масличные растения включают хлопчатник, сою, сафлор, подсолнечник, Brassica, маис, люцерну, пальму, кокосовую пальму, лен, клещевину, маслину и т. д. Бобовые растения включают разновидности бобов и разновидности гороха. Бобы включают гуар, рожковое дерево, пажитник, сою, разновидности обыкновенной фасоли, вигну китайскую, золотистую фасоль, лимскую фасоль, стручковую фасоль, разновидности чечевицы, турецкий горох и т. д.

Оценка трансформации растений

После введения гетерологичной чужеродной ДНК в растительные клетки трансформацию или интеграцию гетерологичного гена в геном растения подтверждают с помощью различных способов, таких как анализ нуклеиновых кислот, белков и метаболитов, связанных с интегрированным геном.

ПЦР-анализ представляет собой быстрый способ скрининга трансформированных клеток, ткани или побегов в отношении присутствия встроенного гена на ранней стадии перед высаживанием в почву (Sambrook and Russell, (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). ПЦР проводят с применением олигонуклеотидных праймеров, специфичных в отношении гена, представляющего интерес, или исходных последовательностей вектора на основе Agrobacterium и т. д.

Трансформацию растений можно подтвердить с помощью Саузерн-блот анализа геномной ДНК (Sambrook and Russell, (2001) выше). В целом, общую ДНК экстрагируют из трансформанта, разрезают соответствующими ферментами рестрикции, фракционируют в агарозном геле и переносят на нитроцеллюлозную или найлоновую мембрану. Затем мембрану или "блот" анализируют с помощью зонда, например целевого фрагмента ДНК с радиоактивной меткой 32P, с целью подтверждения интеграции внедренного гена в геном растения в соответствии со стандартными методиками (Sambrook и Russell, (2001) выше).

При нозерн-блот анализе РНК выделяют из специфичных тканей трансформанта, фракционируют в агарозном геле, содержащем формальдегид, и переносят на найлоновый фильтр в соответствии со стандартными процедурами, которые обычно применяют в области техники (Sambrook and Russell, (2001) выше). Затем экспрессию РНК, кодируемой пестицидным геном, тестировали с помощью гибридизации фильтра с радиоактивным зондом, полученным из пестицидного гена, посредством способов, известных в уровне техники (Sambrook и Russell, (2001) выше).

Вестерн-блот, биохимические анализы и им подобные можно проводить в отношении трансгенных растений для подтверждения присутствия белка, кодируемого пестицидным геном, с помощью стандартных процедур (Sambrook и Russell, 2001, выше) с применением антител, которые связываются с одним или несколькими эпитопами, присутствующими на полипептиде IPD079.

Пакетирование признаков в трансгенном растении

Трансгенные растения могут содержать пакет из одного или нескольких инсектицидных полинуклеотидов, раскрываемых в данном документе, с одним или несколькими дополнительными полинуклеотидами, приводящими к продуцированию или обеспечению супрессии нескольких полипептидных последовательностей. Трансгенные растения, содержащие пакеты из последовательностей полинуклеотидов, можно получить либо с помощью традиционных способов скрещивания, либо посредством способов генной инженерии, либо применяя и то, и другое. Эти способы включают без ограничений размножение индивидуальных линий, при этом каждая содержит полинуклеотид, представляющий интерес, трансформацию трансгенного растения, содержащего ген, раскрытый в данном документе, добавочным геном и котрансформацию генов одной растительной клетки. Используемый в данном документе термин "пакетированный" предусматривает состояние, при котором в одном растении присутствуют несколько признаков (т. е. оба признака включены в ядерный геном, один признак включен в ядерный геном и один признак включен в геном пластиды, или оба признака включены в геном пластиды). В одном неограничивающем примере "пакетированные признаки" предусматривают молекулярный пакет, в котором последовательности физически граничат друг с другом. Выражение "признак", используемое в данном документе, относится к фенотипу, обусловленному конкретной последовательностью или группами последовательностей. Котрансформацию генов можно проводить с применением единых векторов для трансформации, содержащих несколько генов, или нескольких векторов, которые несут отдельные гены. Если последовательности пакетированы с помощью генетической трансформации растений, то представляющие интерес полинуклеотидные последовательности можно комбинировать в любое время и в любом порядке. Признаки можно вводить одновременно в протоколе котрансформации с представляющими интерес полинуклеотидами, представленными любой комбинацией кассет трансформации. Например, если будут вводиться две последовательности, то эти две последовательности могут содержаться в отдельных кассетах для трансформации (транс) или содержаться в одной кассете для трансформации (цис). Экспрессия этих последовательностей может управляться одним и тем же промотором или различными промоторами. В определенных случаях может потребоваться введение кассеты для трансформации, которая будет обеспечивать супрессию экспрессии представляющего интерес полинуклеотида. Ее можно комбинировать с любой комбинацией других кассет супрессии или кассет сверхэкспрессии для получения требуемой комбинации признаков в растении. Кроме того, считается, что полинуклеотидные последовательности можно пакетировать в требуемом местоположении в геноме с применением системы для сайт-специфичной рекомбинации. См., например, WO 1999/25821, WO 1999/25854, WO 1999/25840, WO 1999/25855 и WO 1999/25853, все из которых включены в данный документ с помощью ссылки.

В некоторых вариантах осуществления полинуклеотиды, кодирующие полипептид IPD079, раскрываемые в данном документе, отдельно или пакетированные с одним или несколькими дополнительными признаками устойчивости к насекомым, можно пакетировать с одним или несколькими дополнительными вводимыми признаками (например, с устойчивостью к гербициду, устойчивостью к грибам, устойчивостью к вирусам, переносимостью стрессов, устойчивостью к заболеваниям, мужской стерильностью, силой стебля и т. п.), или с признаками, влияющими на продукцию (например, повышенная урожайность, разновидности модифицированного крахмала, улучшенный профиль масел, сбалансированные аминокислоты, высокое содержание лизина или метионина, повышенная усвояемость, улучшенное качество волокон, устойчивость к засухе и т. п.). Таким образом, варианты осуществления полинуклеотида можно применять для обеспечения полного комплекса агрономических признаков, обеспечивающих улучшенное качество сельскохозяйственной культуры, с возможностью гибкого и экономически эффективного контроля любого количества сельскохозяйственных вредителей.

Трансгены, пригодные для пакетирования, включают без ограничения приведенные ниже.

1. Трансгены, которые обеспечивают устойчивость к насекомым или заболеваниям и которые кодируют приведенные ниже

(A) гены устойчивости растения к заболеваниям. Защитные механизмы растений зачастую активируются посредством специфического взаимодействия между продуктом гена устойчивости к заболеваниям (R) в растении и продуктом соответствующего гена авирулентности (Avr) в патогене. Разновидность растения можно трансформировать с помощью клонированного гена устойчивости с целью разработки растений, которые устойчивы к специфичным штаммам патогена. См., например, Jones, et al., (1994) Science 266:789 (клонирование гена Cf-9 томата, обеспечивающего устойчивость к Cladosporium fulvum); Martin, et al., (1993) Science 262:1432 (ген Pto томата, обеспечивающий устойчивость к Pseudomonas syringae pv. томата, кодирует протеинкиназу); Mindrinos, et al., (1994) Cell 78:1089 (ген RSP2 Arabidopsis, обеспечивающий устойчивость к Pseudomonas syringae), McDowell and Woffenden, (2003) Trends Biotechnol. 21(4):178-83 и Toyoda, et al., (2002) Transgenic Res. 11(6):567-82. Растение, устойчивое к заболеванию, представляет собой растение, которое более устойчиво к патогену по сравнению с растением дикого типа.

(B) Гены, кодирующие белок Bacillus thuringiensis, его производное или синтетический полипептид, смоделированный на его основе. См., например, Geiser, et al., (1986) Gene 48:109, которые раскрывают клонирование и нуклеотидную последовательность гена дельта-эндотоксина Bt. Кроме того, молекулы ДНК, кодирующие гены дельта-эндотоксина, можно приобрести в Американской коллекции типовых культур (Роквилл, Мэриленд), например, под номерами доступа ATCC® 40098, 67136, 31995 и 31998. Другие неограничивающие примеры трансгенов Bacillus thuringiensis, разработанных с помощью методик генной инженерии, приведены в следующих патентах и заявках на выдачу патентов, и тем самым включены с помощью ссылки для данной цели: патенты США №№ 5188960; 5689052; 5880275; 5986177; 6023013, 6060594, 6063597, 6077824, 6620988, 6642030, 6713259, 6893826, 7105332; 7179965, 7208474; 7227056, 7288643, 7323556, 7329736, 7449552, 7468278, 7510878, 7521235, 7544862, 7605304, 7696412, 7629504, 7705216, 7772465, 7790846, 7858849 и WO 1991/14778; WO 1999/31248; WO 2001/12731; WO 1999/24581 и WO 1997/40162.

Гены, кодирующие пестицидные белки, также можно пакетировать без ограничения с инсектицидными белками из Pseudomonas sp., такими как PSEEN3174 (Monalysin; (2011) PLoS Pathogens 7:1-13); из Pseudomonas protegens штамма CHA0 и Pf-5 (ранее fluorescens) (Pechy-Tarr, (2008) Environmental Microbiology 10:2368-2386; № доступа в GenBank EU400157); из Pseudomonas Taiwanensis (Liu, et al., (2010) J. Agric. Food Chem., 58:12343-12349) и из Pseudomonas pseudoalcligenes (Zhang, et al., (2009) Annals of Microbiology 59:45-50 и Li, et al., (2007) Plant Cell Tiss. Organ Cult. 89:159-168); инсектицидными белками из Photorhabdus sp. и Xenorhabdus sp. (Hinchliffe, et al., (2010) The Open Toxicology Journal, 3:101-118 и Morgan, et al., (2001) Applied and Envir. Micro. 67:2062-2069); патент США № 6048838 и патент США № 6379946; полипептидом PIP-1 из публикации заявки на патент США US20140007292; полипептидом AfIP-1A и/или AfIP-1B из публикации заявки на патент США US20140033361; полипептидом PHI-4 из публикаций заявки на патент США US20140274885 и US20160040184; полипептидом PIP-47 из патентной публикации согласно РСТ № WO2015/023846, полипептидом PIP-72 из патентной публикации согласно РСТ № WO2015/038734; полипептидом PtIP-50 и полипептидом PtIP-65 из патентной публикации согласно РСТ № WO2015/120270; полипептидом PtIP-83 из патентной публикации согласно РСТ № WO2015/120276; полипептидом PtIP-96 из патента согласно РСТ с регистрационным номером PCT/US15/55502; полипептидом IPD073 из патента согласно РСТ с регистрационным номером PCT/US16/32273, полипептидом IPD082 из патента США с регистрационным номером 62/269482, и δ-эндотоксинами, в том числе без ограничения с классами Cry1, Cry2, Cry3, Cry4, Cry5, Cry6, Cry7, Cry8, Cry9, Cry10, Cry11, Cry12, Cry13, Cry14, Cry15, Cry16, Cry17, Cry18, Cry19, Cry20, Cry21, Cry22, Cry23, Cry24, Cry25, Cry26, Cry27, Cry 28, Cry 29, Cry 30, Cry31, Cry32, Cry33, Cry34, Cry35,Cry36, Cry37, Cry38, Cry39, Cry40, Cry41, Cry42, Cry43, Cry44, Cry45, Cry 46, Cry47, Cry49, Cry50, Cry51, Cry52, Cry53, Cry 54, Cry55, Cry56, Cry57, Cry58, Cry59, Cry60, Cry61, Cry62, Cry63, Cry64, Cry65, Cry66, Cry67, Cry68, Cry69, Cry70, Cry71, Cry72, Cry73 и Cry 74 генов δ-эндотоксинов, и генами цитолитических токсинов cyt1 и cyt2 B. thuringiensis. Представители этих классов инсектицидных белков из B. thuringiensis хорошо известны специалисту в данной области (см., Crickmore, et al., "Bacillus thuringiensis toxin nomenclature" (2011), на веб-сайте по адресу lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/, доступ к которому можно получить во всемирной сети Интернет с использованием приставки "www").

Примеры δ-эндотоксинов также включают без ограничения белки Cry1A из патентов США №№ 5880275 и 7858849; токсины DIG-3 или DIG-11 (варианты белков cry с N-концевой делецией α-спирали 1 и/или α-спирали 2, такие как Cry1A, Cry3A) из патентов США №№ 8304604, 8304605, 8476226 и 9006520; Cry1B из публикации заявки на патент США № 2006/0112447; Cry1C из патента США № 6033874; Cry1F из патентов США №№ 5188960 и 6218188; химеры Cry1A/F из патентов США №№ 7070982; 6962705 и 6713063); белок Cry2, такой как белок Cry2Ab из патента США № 7064249); белок Cry3A, в том числе без ограничения сконструированный гибридный инсектицидный белок (eHIP), созданный путем слияния уникальных комбинаций вариабельных областей и консервативных блоков по меньшей мере двух различных белков Cry (публикация заявки на патент США № 2010/0017914); белок Cry4; белок Cry5; белок Cry6; белки Cry8 из патентов США №№ 7329736, 7449552, 7803943, 7476781, 7105332, 7378499 и 7462760; белок Cry9, как, например, представители семейств Cry9A, Cry9B, Cry9C, Cry9D, Cry9E и Cry9F; белок Cry15 из Naimov, et al., (2008) Applied and Environmental Microbiology, 74:7145-7151; Cry22, белок Cry34Ab1 из патентов США №№ 6127180, 6624145 и 6340593; белки CryET33 и cryET34 из патентов США №№ 6248535, 6326351, 6399330, 6949626, 7385107 и 7504229; гомологи CryET33 и CryET34 из патента США № 8796026, публикации заявки на патент США № 2012/0278954 и публикации согласно РСТ № WO 2012/139004; белок Cry35Ab1 из патентов США №№ 6083499, 6548291 и 6340593; белок Cry46, белок Cry 51, бинарный токсин Cry; TIC901 или родственный токсин; TIC807 из патента США № 8609936; ET29, ET37, TIC809, TIC810, TIC812, TIC127, TIC128 из WO 2007/027776; AXMI-027, AXMI-036 и AXMI-038 из патента США № 8236757; AXMI-031, AXMI-039, AXMI-040, AXMI-049 из патента США № 7923602; AXMI-018, AXMI-020 и AXMI-021 из WO 2006/083891; AXMI-010 из WO 2005/038032; AXMI-003 из WO 2005/021585; AXMI-008 из патента США № 7351881; AXMI-006 из публикации заявки на патент США № 2004/0216186; AXMI-007 из публикации заявки на патент США № 2004/0210965; AXMI-009 из заявки на патент США № 2004/0210964; AXMI-014 из публикации заявки на патент США № 2004/0197917; AXMI-004 из патента США № 7355099; AXMI-028 и AXMI-029 из WO 2006/119457, патентов США №№ 7622572, 7803925, 7803391, 7811598, 8314292; AXMI-007, AXMI-008, AXMI-0080, AXMI-009, AXMI-014 и AXMI-004 из WO 2004/074462; AXMI-150 из патента США № 8084416; AXMI-205 из публикации заявки на патент США № 2011/0023184; AXMI-011, AXMI-012, AXMI-013, AXMI-015, AXMI-019, AXMI-044, AXMI-037, AXMI-043, AXMI-033, AXMI-034, AXMI-022, AXMI-023, AXMI-041, AXMI-063 и AXMI-064 из патента США № 8829279 или публикации заявки на патент США № US20140344999; AXMI-R1 и родственные белки из патента США № 8299217; AXMI221Z, AXMI222z, AXMI223z, AXMI224z и AXMI225z из патента США № 8686124; AXMI218, AXMI219, AXMI220, AXMI226, AXMI227, AXMI228, AXMI229, AXMI230 и AXMI231 из патента США № 8759619; AXMI-115, AXMI-113, AXMI-005, AXMI-163 и AXMI-184 из патента США № 8334431; AXMI-001, AXMI-002, AXMI-030, AXMI-035 и AXMI-045 из публикации заявки на патент США № 2013/0117884; AXMI-066 и AXMI-076 из публикации заявки на патент США № 2009/0144852; AXMI128, AXMI130, AXMI131, AXMI133, AXMI140, AXMI141, AXMI142, AXMI143, AXMI144, AXMI146, AXMI148, AXMI149, AXMI152, AXMI153, AXMI154, AXMI155, AXMI156, AXMI157, AXMI158, AXMI162, AXMI165, AXMI166, AXMI167, AXMI168, AXMI169, AXMI170, AXMI171, AXMI172, AXMI173, AXMI174, AXMI175, AXMI176, AXMI177, AXMI178, AXMI179, AXMI180, AXMI181, AXMI182, AXMI185, AXMI186, AXMI187, AXMI188, AXMI189 из патента США № 8318900 или публикации заявки на патент США № 2013/0055469; AXMI079, AXMI080, AXMI081, AXMI082, AXMI091, AXMI092, AXMI096, AXMI097, AXMI098, AXMI099, AXMI100, AXMI101, AXMI102, AXMI103, AXMI104, AXMI107, AXMI108, AXMI109, AXMI110, AXMI111, AXMI112, AXMI114, AXMI116, AXMI117, AXMI118, AXMI119, AXMI120, AXMI121, AXMI122, AXMI123, AXMI124, AXMI1257, AXMI1268, AXMI127, AXMI129, AXMI164, AXMI151, AXMI161, AXMI183, AXMI132, AXMI138, AXMI137 из патента США № 8461421 и публикации заявки на патент США № 2013/0305412, белки cry, такие как Cry1A и Cry3A, имеющие модифицированные протеолитические сайты, из патента США № 8319019; белки токсинов Cry1Ac, Cry2Aa и Cry1Ca из штамма VBTS 2528 Bacillus thuringiensis из патента США № 8551757. Инсектицидная активность белков Cry хорошо известна специалисту в данной области (для обзора см. van Frannkenhuyzen, (2009) J. Invert. Path. 101:1-16). Применение белков Cry в качестве признаков трансгенного растения хорошо известно специалисту в данной области, и трансгенные растения с Cry, в том числе без ограничения растения, экспрессирующие Cry1Ac, Cry1Ac+Cry2Ab, Cry1Ab, Cry1A.105, Cry1F, Cry1Fa2, Cry1F+Cry1Ac, Cry2Ab, Cry3A, mCry3A, Cry3Bb1, Cry34Ab1, Cry35Ab1, Vip3A, mCry3A, Cry9c и CBI-Bt, были разрешены контролирующими органами (см. Sanahuja, (2011) Plant Biotech Journal 9:283-300 и CERA. (2010) GM Crop Database Center for Environmental Risk Assessment (CERA), ILSI Research Foundation, г. Вашингтон на веб-сайте по адресу cera-gmc.org/index.php?action=gm_crop_database, доступ к которым можно получить во всемирной сети Интернет с использованием приставки "www"). В растениях также может экспрессироваться два или более пестицидных белков, хорошо известных специалисту в данной области, таких как Vip3Ab и Cry1Fa (US2012/0317682); Cry1BE и Cry1F (US2012/0311746); Cry1CA и Cry1AB (US2012/0311745); Cry1F и CryCa (US2012/0317681); Cry1DA и Cry1BE (US2012/0331590); Cry1DA и Cry1Fa (US2012/0331589); Cry1AB и Cry1BE (US2012/0324606); Cry1Fa и Cry2Aa, а также Cry1I и Cry1E (US2012/0324605); Cry34Ab/35Ab и Cry6Aa (US20130167269); Cry34Ab/VCry35Ab и Cry3Aa (US20130167268); и Cry3A, а также Cry1Ab или Vip3Aa (US20130116170). Пестицидные белки включают также инсектицидные липазы, в том числе ацилгидролазы омыляемых липидов из патента США № 7491869 и холестерин-оксидазы, как, например, из Streptomyces (Purcell et al. (1993) Biochem Biophys Res Commun 15:1406-1413). Пестицидные белки также включают токсины VIP (вегетативные инсектицидные белки) из патентов США №№ 5877012, 6107279, 6137033, 7244820, 7615686 и 8237020 и т. п. Другие белки VIP хорошо известны специалисту в данной области (см. веб-сайт по адресу lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/vip.html, доступ к которому можно получить через всемирную сеть Интернет с использованием приставки "www"). Пестицидные белки включают также белки токсинового комплекса (TC), которые можно получить из таких организмов, как Xenorhabdus, Photorhabdus и Paenibacillus (см. патенты США №№ 7491698 и 8084418). Некоторые TC-белки обладают "самостоятельной" инсектицидной активностью, а другие TC-белки повышают активность самостоятельных токсинов, вырабатываемых тем же указанным организмом. Токсичность "самостоятельного" TC-белка (например, из Photorhabdus, Xenorhabdus или Paenibacillus) может повышаться с помощью одного или нескольких TC-белков-"усилителей", полученных из организма-источника из другого рода. Существуют три основных типа TC-белков. Как изложено в данном документе, белки класса A ("белок A") представляют собой самостоятельные токсины. Белки класса B ("белок B") и белки класса C ("белок C") повышают токсичность белков класса A. Примерами белков класса A являются TcbA, TcdA, XptA1 и XptA2. Примерами белков класса B являются TcaC, TcdB, XptB1Xb и XptC1Wi. Примерами белков класса C являются TccC, XptC1Xb и XptB1Wi. Пестицидные белки также включают белки яда пауков, змей и скорпионов. Примеры пептидов яда пауков включают без ограничения пептиды ликотоксин-1 и его мутантные формы (патент США № 8334366).

(C) Полинуклеотид, кодирующий специфичный в отношении насекомых гормон или феромон, такой как экдистероид и ювенильный гормон, его вариант, миметик на его основе или его антагонист или агонист. См., например, раскрытие Hammock, et al., (1990) Nature 344:458 бакуловирусной экспрессии клонированной эстеразы ювенильного гормона, инактиватора ювенильного гормона.

(D) Полинуклеотид, кодирующий специфичный в отношении насекомых пептид, который при экспрессии нарушает физиологию насекомого, на которого оказывают воздействие. Например, см. раскрытия Regan, (1994) J. Biol. Chem. 269:9 (экспрессионное клонирование приводит к ДНК, кодирующей рецептор диуретического гормона насекомых); Pratt, et al., (1989) Biochem. Biophys. Res. Comm. 163:1243 (аллостатин, обнаруженный у Diploptera puntata); Chattopadhyay, et al., (2004) Critical Reviews in Microbiology 30(1):33-54; Zjawiony, (2004) J Nat Prod 67(2):300-310; Carlini and Grossi-de-Sa, (2002) Toxicon 40(11):1515-1539; Ussuf, et al., (2001) Curr Sci. 80(7):847-853 и Vasconcelos and Oliveira, (2004) Toxicon 44(4):385-403. См. также патент США № 5266317, Tomalski, et al., в котором раскрыты гены, кодирующие специфичные для насекомых токсины.

(E) Полинуклеотид, кодирующий фермент, ответственный за избыточное накопление монотерпена, сесквитерпена, стероида, гидроксамовой кислоты, производного фенилпропаноида или другой небелковой молекулы с инсектицидной активностью.

(F) Полинуклеотид, кодирующий фермент, вовлеченный в модификацию, в том числе посттрансляционную модификацию, биологически активной молекулы; например, гликолитический фермент, протеолитический фермент, липолитический фермент, нуклеаза, циклаза, трансаминаза, эстераза, гидролаза, фосфатаза, киназа, фосфорилаза, полимераза, эластаза, хитиназа и глюканаза, либо натуральные, либо синтетические. См. заявку согласно PCT WO 1993/02197 на имя Scott, et al., в которой раскрыта нуклеотидная последовательность гена каллазы. Молекулы ДНК, которые содержат последовательности, кодирующие хитиназу, можно получить, например, из ATCC® под номерами доступа 39637 и 67152. См. также Kramer, et al., (1993) Insect Biochem. Molec. Biol. 23:691, в которой содержатся сведения о нуклеотидной последовательности кДНК, кодирующей хитиназу табачного бражника, и Kawalleck, et al., (1993) Plant Molec. Biol. 21:673, в которой предложена нуклеотидная последовательность гена полиубиквитина ubi4-2 петрушки, и патенты США №№ 6563020; 7145060 и 7087810.

(G) Полинуклеотид, кодирующий молекулу, которая стимулирует сигнальную трансдукцию. Например, см. раскрытие в Botella, et al., (1994) Plant Molec. Biol. 24:757, каcающееся нуклеотидных последовательностей клонов кДНК кальмодулина из фасоли золотистой, и Griess, et al., (1994) Plant Physiol. 104:1467, в которой представлена нуклеотидная последовательность клона кДНК кальмодулина маиса.

(H) Полинуклеотид, кодирующий пептид с гидрофобным моментом. См. заявку согласно PCT WO 1995/16776 и патент США № 5580852, раскрывающие пептидные производные тахиплезина, которые подавляют грибковые патогены растений, и заявку согласно PCT WO 1995/18855, а также патент США № 5607914 (в котором раскрыты синтетические противомикробные пептиды, которые придают устойчивость к заболеваниям).

(I) Полинуклеотид, кодирующий мембранную пермеазу, каналообразователь или блокатор каналов. Например, см. раскрытие в Jaynes, et al., (1993) Plant Sci. 89:43 гетерологичной экспрессии аналога цекропин-бета литического пептида для придания трансгенным растениям табака устойчивости к Pseudomonas solanacearum.

(J) Ген, кодирующий вирусный инвазивный белок или сложный токсин, полученный из него. Например, накопление белков вирусной оболочки в трансформированных растительных клетках придает устойчивость к вирусной инфекции и/или развитию заболевания, вызванного вирусом, из которого получен ген белка оболочки, а также родственными вирусами. См. Beachy, et al., (1990) Ann. Rev. Phytopathol. 28:451. Устойчивость, опосредованную белком оболочки, придавали трансформированным растениям в отношении вируса мозаики люцерны, вируса мозаики огурца, вируса полосатости табака, вируса X картофеля, вируса Y картофеля, вируса гравировки табака, вируса погремковости табака и вируса табачной мозаики. Там же.

(K) Ген, кодирующий антитело, специфичное в отношении насекомого, или полученный из него иммунотоксин. Таким образом, антитело, нацеленное на критическую метаболическую функцию в кишке насекомого, будет инактивировать фермент, на который оказывается воздействие, с уничтожением насекомого. См. также Taylor, et al., Abstract #497, SEVENTH INT′L SYMPOSIUM ON MOLECULAR PLANT-MICROBE INTERACTIONS (Эдинбург, Шотландия, 1994) (ферментативная инактивация в трансгенном табаке посредством выработки одноцепочечных фрагментов антител).

(L) Ген, кодирующий антитело, специфичное в отношении вируса. См., например, Tavladoraki, et al., (1993) Nature 366:469, где показано, что трансгенные растения, экспрессирующие гены рекомбинантного антитела, защищены от поражения вирусом.

(M) Полинуклеотид, кодирующий белок, останавливающий развитие, вырабатываемый в природе патогеном или паразитом. Таким образом, грибные эндо-альфа-1,4-D-полигалактуроназы облегчают грибную колонизацию и высвобождение питательных веществ для растений путем солюбилизации гомо-альфа-1,4-D-галактуроназы клеточной стенки растения. См. Lamb, et al., (1992) Bio/Technology 10:1436. Клонирование и определение характеристик гена, который кодирует белок, подавляющий эндополигалактуроназу бобов, описан в Toubart, et al., (1992) Plant J. 2:367.

(N) Полинуклеотид, кодирующий белок, останавливающий развитие, вырабатываемый в природе растением. Например, Logemann, et al., (1992) Bio/Technology 10:305 показали, что трансгенные растения, экспрессирующие ген ячменя, инактивирующий рибосомы, обладали повышенной устойчивостью к грибковым заболеваниям.

(O) Гены, вовлеченные в реакцию системной приобретенной устойчивости (SAR) и/или гены, связанные с патогенезом. Briggs, (1995) Current Biology 5(2), Pieterse and Van Loon, (2004) Curr. Opin. Plant Bio. 7(4):456-64, и Somssich, (2003) Cell 113(7):815-6.

(P) Противогрибковые гены (Cornelissen and Melchers, (1993) Pl. Physiol. 101:709-712, и Parijs, et al., (1991) Planta 183:258-264, и Bushnell, et al., (1998) Can. J. of Plant Path. 20(2):137-149. Также см. публикации заявок на выдачу патентов США с серийными №№ 09/950933; 11/619645; 11/657710; 11/748994; 11/774121 и патенты США №№ 6891085 и 7306946. Киназы, подобные рецептору LysM, для распознавания фрагментов хитина, как первая стадия в защитной реакции растения в отношении грибков-патогенов (US 2012/0110696).

(Q) Гены системы детоксикации, такие как кодирующие фумонизин, беауверицин, монилиформин и зеараленон и их структурно родственные производные. Например, см. патенты США №№ 5716820; 5792931; 5798255; 5846812; 6083736; 6538177; 6388171 и 6812380.

(R) Полинуклеотид, кодирующий цистатин и ингибиторы цистеинпротеиназы. См. патент США № 7205453.

(S) Гены дефензинов. См. WO 2003/000863 и патенты США №№ 6911577; 6855865; 6777592 и 7238781.

(T) Гены, обеспечивающие устойчивость к нематодам. См., например, заявку согласно PCT WO 1996/30517; заявку согласно PCT WO 1993/19181, WO 2003/033651 и Urwin, et al., (1998) Planta 204:472-479, Williamson, (1999) Curr Opin Plant Bio. 2(4):327-31; патенты США №№ 6284948 и 7301069 и гены miR164 (WO 2012/058266).

(U) Гены, которые обеспечивают устойчивость к корневой гнили, вызываемой Phytophthora, такие как Rps 1, Rps 1-a, Rps 1-b, Rps 1-c, Rps 1-d, Rps 1-e, Rps 1-k, Rps 2, Rps 3-a, Rps 3-b, Rps 3-c, Rps 4, Rps 5, Rps 6, Rps 7 и другие гены Rps. См., например, Shoemaker, et al., Phytophthora Root Rot Resistance Gene Mapping in Soybean, Plant Genome IV Conference, San Diego, Calif. (1995).

(V) Гены, которые обеспечивают устойчивость к бурой стеблевой гнили, такие как описаны в патенте США № 5689035, включенном с помощью ссылки с этой целью.

(W) Гены, которые обеспечивают устойчивость к Colletotrichum, такие как описанные в публикации заявки на выдачу патента США US 2009/0035765, включенной с помощью ссылки с этой целью. Они включают локус Rcg, который можно использовать как конверсию одного локуса.

2. Трансгены, которые обеспечивают устойчивость к гербициду, например приведенные ниже

(A) Полинуклеотид, кодирующий устойчивость к гербициду, который подавляет образование конуса нарастания или меристемы, такому как имидазолинон или сульфонилмочевина. Иллюстративные гены в этой категории кодируют мутантный фермент ALS и AHAS, как описано, например, соответственно у Lee, et al., (1988) EMBO J. 7:1241 и Miki, et al., (1990) Theor. Appl. Genet. 80:449. См. также патенты США №№ 5605011; 5013659; 5141870; 5767361; 5731180; 5304732; 4761373; 5331107; 5928937 и 5378824; заявку на выдачу патента США с серийным № 11/683737 и публикацию международной заявки WO 1996/33270.

(B) Полинуклеотид, кодирующий белок для устойчивости к глифосату (устойчивость придают мутантные гены 5-енолприрувил-3-фосфошикиматсинтазы (EPSP) и aroA соответственно), и другим фосфоновым соединениям, таким как глуфосинат (гены фосфинотрицинацетилтрансферазы (PAT) и фосфинотрицинацетилтрансферазы (bar) Streptomyces hygroscopicus), и пиридинокси- или феноксипропионовым кислотам и циклогексонам (гены, кодирующие ингибитор ACCазы). См., например, патент США № 4940835, Shah, et al., в котором раскрыта нуклеотидная последовательность формы EPSPS, которая может придавать устойчивость к глифосату. В патенте США № 5627061, Barry, et al., также описаны гены, кодирующие ферменты EPSPS. См. также патенты США №№ 6566587; 6338961; 6248876; 6040497; 5804425; 5633435; 5145783; 4971908; 5312910; 5188642; 5094945, 4940835; 5866775; 6225114; 6130366; 5310667; 4535060; 4769061; 5633448; 5510471; Re. 36449; RE 37287 E и 5491288 и публикации международных заявок EP 1173580; WO 2001/66704; EP 1173581 и EP 1173582, которые включены в данный документ с помощью ссылки для данной цели. Устойчивость к глифосату также придается растениям, которые экспрессируют ген, кодирующий фермент глифосат-оксидоредуктазу, как более подробно описано в патентах США №№ 5776760 и 5463175, которые включены в данный документ для данной цели с помощью ссылки. Кроме того, устойчивость к глифосату может придаваться растениям посредством сверхэкспрессии генов, кодирующих глифосат-N-ацетилтрансферазу. См., например, патенты США №№ 7462481; 7405074 и публикацию заявки на выдачу патента США № US 2008/0234130. Молекулу ДНК, кодирующую мутантный ген aroA, можно получить под номером доступа ATCC® 39256, а нуклеотидная последовательность мутантного гена раскрыта в патенте США № 4769061, выданном Comai. В заявке EP № 0333033, выданном Kumada, et al. и патенте США № 4975374, выданном Goodman, et al., раскрыты нуклеотидные последовательности генов глутаминсинтетазы, придающие устойчивость к гербицидам, таким как L-фосфинотрицин. Нуклеотидная последовательность гена фосфинотрицин-ацетилтрансферазы представлена в заявках EP №№ 0242246 и 0242236, Leemans, et al.; De Greef, et al., (1989) Bio/Technology 7:61, где описано получение трансгенных растений, которые экспрессируют химерные гены bar, кодирующие фосфинотрицинацетилтрансферазную активность. См. также патенты США №№ 5969213; 5489520; 5550318; 5874265; 5919675; 5561236; 5648477; 5646024; 6177616 и 5879903, которые включены в данный документ для данной цели с помощью ссылки. Иллюстративные гены, придающие устойчивость к феноксипропионовым кислотам и циклогексонам, таким как сетоксидим и галоксифоп, представляют собой гены Acc1-S1, Acc1-S2 и Acc1-S3, описанные у Marshall, et al., (1992) Theor. Appl. Genet. 83:435.

(C) Полинуклеотид, кодирующий белок, обеспечивающий устойчивость к гербициду, который подавляет фотосинтез, такому как триазин (гены psbA и gs+) и бензонитрил (ген нитрилазы). Przibilla, et al., (1991) Plant Cell 3:169 описывают трансформацию Chlamydomonas с помощью плазмид, кодирующих мутантные гены psbA. Нуклеотидные последовательности генов нитрилазы раскрыты в патенте США № 4810648, выданном Stalker, и молекулы ДНК, содержащие эти гены, доступны под номерами доступа ATCC® 53435, 67441 и 67442. Клонирование и экспрессия ДНК, кодирующей глутатион-S-трансферазу, описаны у Hayes, et al., (1992) Biochem. J. 285:173.

(D) В ряд растений был введен полинуклеотид, кодирующий белок, обеспечивающий устойчивость к синтазе ацетогидроксикислот, которая, как было обнаружено, делает растения, которые экспрессируют данный фермент, устойчивыми к нескольким типам гербицидов (см., например, Hattori, et al., (1995) Mol Gen Genet. 246:419). Другие гены, которые придают устойчивость к гербицидам, включают в себя ген, кодирующий химерный белок цитохрома P4507A1 крысы и NADPH-цитохром-P450-оксидоредуктазы дрожжей (Shiota, et al., (1994) Plant Physiol 106:17), гены, кодирующие глутатионредуктазу и супероксиддисмутазу (Aono, et al., (1995) Plant Cell Physiol 36:1687), и гены, кодирующие различные фосфотрансферазы (Datta, et al., (1992) Plant Mol Biol 20:619).

(E) Полинуклеотид, кодирующий устойчивость к гербициду, целенаправленно воздействующему на протопорфириногеноксидазу (protox), которая необходима для выработки хлорофилла. Фермент protox служит в качестве мишени для ряда гербицидных соединений. Эти гербициды также подавляют рост всех присутствующих различных видов растений, вызывая их полное разрушение. Разработка растений, характеризующихся измененной protox-активностью, которые устойчивы к этим гербицидам, описана в патентах США №№ 6288306, 6282837 и 5767373 и публикации международной заявки WO 2001/12825.

(F) Ген aad-1 (изначально из Sphingobium herbicidovorans) кодирует белок арилоксиалканоатдиоксигеназу (AAD-1). Признак обеспечивает переносимость гербицидов на основе 2,4-дихлорфеноксиуксусной кислоты и арилоксифеноксипропионата (обычно называемых "фоп"-гербициды, таких как квизалофоп). Ген aad-1, как таковой, обеспечивающий переносимость гербицида у растений, впервые был раскрыт в WO 2005/107437 (см. также US 2009/0093366). Ген aad-12, полученный от Delftia acidovorans, который кодирует белок арилоксиалканоатдиоксигеназу (AAD-12), приводящий к переносимости гербицидов на основе 2,4-дихлорфеноксиуксусной кислоты и пиридилоксиацетата путем инактивации некоторых гербицидов с арилоксиалканоатным фрагментом, в том числе фенокси-ауксина (например, 2,4-D, MCPA), а также видов пиридилокси-ауксина (например, флуроксипира, триклопира).

(G) Полинуклеотид, кодирующий устойчивую к гербициду дикамба-монооксигеназу, раскрытый в публикации заявки на выдачу патента США 2003/0135879, для придания переносимости дикамбы.

(H) Полинуклеотидная молекула, кодирующая бромоксинилнитрилазу (Bxn), раскрытая в патенте США № 4810648, для придания переносимости бромоксинила.

(I) Полинуклеотидная молекула, кодирующая фитоен (crtl), описанный у Misawa, et al., (1993) Plant J. 4:833-840 и у Misawa, et al., (1994) Plant J. 6:481-489, для переносимости норфлуразона.

3. Трансгены, которые обеспечивают измененные характеристики зерна или вносят в них вклад

Например:

(A) измененное содержание жирных кислот, например с помощью приведенного ниже.

(1) Подавления стеароил-ACP для повышения содержания стеариновой кислоты в растении. См. Knultzon, et al., (1992) Proc. Natl. Acad. Sci. USA 89:2624 и WO 1999/64579 (Genes to Alter Lipid Profiles in Corn).

(2) Повышения содержания олеиновой кислоты посредством модификации гена FAD-2 и/или снижения содержания линоленовой кислоты посредством модификации гена FAD-3 (см. патенты США №№ 6063947; 6323392; 6372965 и WO 1993/11245).

(3) Изменения содержания конъюгированных линоленовой или линолевой кислоты, как, например, в WO 2001/12800.

(4) Изменения LEC1, AGP, Dek1, Superal1, mi1 ps, различных генов Ipa, таких как Ipa1, Ipa3, hpt или hggt. Например, см. WO 2002/42424, WO 1998/22604, WO 2003/011015, WO 2002/057439, WO 2003/011015, патенты США №№ 6423886, 6197561, 6825397 и публикации заявок на выдачу патентов США с номерами US 2003/0079247, US 2003/0204870 и Rivera-Madrid, et al., (1995) Proc. Natl. Acad. Sci. 92:5620-5624.

(5) Генов, кодирующих дельта-8-десатуразу для получения длинноцепочечных полиненасыщенных жирных кислот (патенты США №№ 8058571 и 8338152), дельта-9 десатуразу для снижения содержания насыщенных жиров (патент США № 8063269), Δ6-десатуразу примулы для улучшения профилей омега-3 жирных кислот.

(6) Выделенных нуклеиновых кислот и белков, ассоциированных с регуляцией метаболизма липидов и сахаров, в частности белка липидного метаболизма (LMP), применяемых в способах получения трансгенных растений и модуляции уровней запасных веществ семени, в том числе липидов, жирных кислот, видов крахмала или запасных белков семени, и их применения в способах модуляции размера семени, количества семян, веса семян, длины корней и размера листьев растений (EP 2404499).

(7) Изменения экспрессии белка с высоким уровнем экспрессии, индуцируемого сахарами 2 (HSI2), в растении для повышения или снижения экспрессии HSI2 в растении. Повышение экспрессии HSI2 повышает содержание масла, тогда как понижение экспрессии HSI2 снижает восприимчивость к абсцизовой кислоте и/или повышает устойчивость к засухе (публикация заявки на выдачу патента США № 2012/0066794).

(8) Экспрессии цитохрома b5 (Cb5) отдельно или вместе с FAD2 для модуляции содержания масла в семени растения, в частности для повышения уровней омега-3 жирных кислот и улучшения соотношения омега-6 и омега-3 жирных кислот (публикация заявки на выдачу патента США № 2011/0191904).

(9) Молекул нуклеиновой кислоты, кодирующих wrinkled1-подобные полипептиды для модуляции метаболизма сахаров (патент США № 8217223).

(B) Измененное содержание фосфора, например с помощью приведенного ниже.

(1) Введения гена, кодирующего фитазу, при этом будет улучшаться распад фитата, что приводит к большему количеству свободного фосфата в трансформированном растении. Например, см. Van Hartingsveldt, et al., (1993) Gene 127:87 относительно раскрытия нуклеотидной последовательности гена фитазы Aspergillus niger.

(2) Модуляции гена, который снижает содержание фитата. У маиса это можно осуществлять, например, с помощью клонирования, а затем повторного введения ДНК, ассоциированной с одним или несколькими аллелями, такими как аллели LPA, обнаруженные у мутантов маиса, характеризующихся низкими уровнями фитиновой кислоты, как например в WO 2005/113778, и/или посредством изменения активности инозитолкиназы, как в WO 2002/059324, публикации заявки на выдачу патента США № 2003/0009011, WO 2003/027243, публикации заявки на выдачу патента США № 2003/0079247, WO 1999/05298, патенте США № 6197561, патенте США № 6291224, патенте США № 6391348, WO 2002/059324, публикации заявки на выдачу патента США № 2003/0079247, WO 1998/45448, WO 1999/55882, WO 2001/04147.

(C) Измененные углеводы, на которые воздействовали, например, путем изменения гена, кодирующего фермент, который воздействует на паттерн ветвления крахмала, или гена, изменяющего тиоредоксин, такого как NTR и/или TRX (см. патент США № 6531648, который включен для данной цели с помощью ссылки), и/или нокаута гамма-зеина или использования мутанта, такого как cs27, или TUSC27, или en27 (см. патент США № 6858778 и публикацию заявки на выдачу патента США № 2005/0160488, публикацию заявки на выдачу патента США № 2005/0204418, которые включены для данной цели с помощью ссылки). См. Shiroza, et al., (1988) J. Bacteriol. 170:810 (нуклеотидная последовательность мутантного гена фруктозилтрансферазы Streptococcus), Steinmetz, et al., (1985) Mol. Gen. Genet. 200:220 (нуклеотидная последовательность гена левансахаразы Bacillus subtilis), Pen, et al., (1992) Bio/Technology 10:292 (получение трансгенных растений, которые экспрессируют альфа-амилазу Bacillus licheniformis), Elliot, et al., (1993) Plant Molec. Biol. 21:515 (нуклеотидные последовательности генов инвертазы томата), Søgaard, et al., (1993) J. Biol. Chem. 268:22480 (сайт-направленный мутагенез гена альфа-амилазы ячменя) и Fisher, et al., (1993) Plant Physiol. 102:1045 (фермент II ветвления крахмала эндосперма маиса), WO 1999/10498 (улучшенная усвояемость и/или извлечение крахмала путем модификации UDP-D-ксилоза 4-эпимеразы, Fragile 1 и 2, Ref1, HCHL, C4H), патент США № 6232529 (способ получения семян с высоким содержанием масла путем модификации уровней крахмала (AGP)). Гены модификации жирных кислот, упомянутые в данном документе, можно применять также для воздействия на содержание и/или состав крахмала благодаря взаимосвязи путей метаболизма крахмала и масла.

(D) Измененное содержание или состав антиоксидантов, как, например, изменение токоферола или токотриенолов. Например, см. патент США № 6787683, публикацию заявки на выдачу патента США № 2004/0034886 и WO 2000/68393, предусматривающие манипуляцию с уровнями антиоксидантов, и WO 2003/082899, благодаря изменению гомогентизатгеранилгеранилтрансферазы (hggt).

(E) Измененное содержание незаменимых аминокислот в семени. Например, см. патент США № 6127600 (способ повышения накопления незаменимых аминокислот в семенах), патент США № 6080913 (бинарные способы повышения накопления незаменимых аминокислот в семенах), патент США № 5990389 (высокое содержание лизина), WO 1999/40209 (изменение аминокислотного состава семян), WO 1999/29882 (способы изменения аминокислотного состава белков), патент США № 5850016 (изменение аминокислотного состава семян), WO 1998/20133 (белки с повышенными уровнями незаменимых аминокислот), патент США № 5885802 (высокое содержание метионина), патент США № 5885801 (высокое содержание треонина), патент США № 6664445 (растительные ферменты биосинтеза аминокислот), патент США № 6459019 (повышенное содержание лизина и треонина), патент США № 6441274 (бета-субъединица растительной триптофансинтазы), патент США № 6346403 (ферменты метаболизма метионина), патент США № 5939599 (высокое содержание серы), патент США № 5912414 (повышенное содержание метионина), WO 1998/56935 (растительные ферменты биосинтеза аминокислот), WO 1998/45458 (разработанный с помощью генной инженерии белок семени, имеющий более высокую процентную долю незаменимых аминокислот), WO 1998/42831 (повышенное содержание лизина), патент США № 5633436 (повышение содержания серосодержащих аминокислот), патент США № 5559223 (синтетические запасные белки с определенной структурой, содержащие программируемые уровни незаменимых аминокислот для улучшения питательной ценности растений), WO 1996/01905 (повышенное содержание треонина), WO 1995/15392 (повышенное содержание лизина), публикацию заявки на выдачу патента США № 2003/0163838, публикацию заявки на выдачу патента США № 2003/0150014, публикацию заявки на выдачу патента США № 2004/0068767, патент США № 6803498, WO 2001/79516.

4. Гены, контролирующие мужскую стерильность

Доступно несколько способов обеспечения генетической мужской стерильности, как, например, несколько мутантных генов в отдельных положениях в пределах генома, которые придают мужскую стерильность, как раскрыто в патентах США №№ 4654465 и 4727219, Brar, et al., и хромосомные транслокации, как описано Patterson в патенте США №№ 3861709 и 3710511. В дополнение к этим способам, Albertsen, et al. в патенте США № 5432068 описывают систему ядерной мужской стерильности, которая включает: идентификацию гена, который крайне важен для мужской фертильности; сайленсинг этого нативного гена, который крайне важен для мужской фертильности; удаление нативного промотора из гена, важного для мужской фертильности, и замещение его на индуцируемый промотор; вставку этого полученного с помощью генной инженерии гена обратно в растение, и таким образом создание растения, которое характеризуется мужской стерильностью, поскольку индуцируемый промотор не "включен", в результате чего ген мужской фертильности не транскрибируется. Фертильность восстанавливают посредством индуцирования или "включения" промотора, который, в свою очередь, осуществляет транскрипцию гена, обеспечивающего мужскую фертильность.

(A) Введение гена деацетилазы под управлением промотора, специфичного в отношении тапетума, и с применением химического N-Ac-PPT (WO 2001/29237).

(B) Введение различных промоторов, специфичных в отношении тычинок (WO 1992/13956, WO 1992/13957).

(C) Введение барназы и гена барстара (Paul, et al., (1992) Plant Mol. Biol. 19:611-622).

Дополнительные примеры систем и генов ядерной мужской и женской стерильности см. также в патентах США №№ 5859341; 6297426; 5478369; 5824524; 5850014 и 6265640, все из которых тем самым включены с помощью ссылки.

5. Гены, которые создают сайт для сайт-специфичной интеграции ДНК

Подразумевается введение сайтов FRT, которые можно применять в системе FLP/FRT, и/или сайтов Lox, которые можно применять в системе Cre/Loxp. Например, см. Lyznik, et al., (2003) Plant Cell Rep 21:925-932 и WO 1999/25821, которые тем самым включены в данный документ с помощью ссылки. Другие системы, которые можно применять, включают рекомбиназу Gin из фага Mu (Maeser, et al., (1991) Vicki Chandler, The Maize Handbook ch. 118 (Springer-Verlag 1994), рекомбиназу Pin из E. coli (Enomoto, et al., 1983) и систему R/RS из плазмиды pSRi (Araki, et al., 1992).

6. Гены, которые воздействуют на устойчивость к абиотическому стрессу

В том числе без ограничений на цветение, развитие початка и семени, улучшение эффективности использования азота, измененную реактивность в отношении азота, устойчивость к засухе или ее переносимость, устойчивость к холоду или его переносимость, а также устойчивость к засолению или ее переносимость и повышенную урожайность при стрессе.

(A) Например, см. WO 2000/73475, где эффективность использования воды изменена благодаря изменению содержания малата; патенты США №№ 5892009, 5965705, 5929305, 5891859, 6417428, 6664446, 6706866, 6717034, 6801104, WO 2000/060089, WO 2001/026459, WO 2001/035725, WO 2001/034726, WO 2001/035727, WO 2001/036444, WO 2001/036597, WO 2001/036598, WO 2002/015675, WO 2002/017430, WO 2002/077185, WO 2002/079403, WO 2003/013227, WO 2003/013228, WO 2003/014327, WO 2004/031349, WO 2004/076638, WO 199809521.

(B) WO 199938977, в которой описаны гены, в том числе гены CBF, и факторы транскрипции, эффективные в ослаблении отрицательных эффектов замораживания, высокого содержания солей и засухи на растения, а также обеспечивающие другие положительные эффекты в отношении фенотипа растения.

(C) Публикация заявки на выдачу патента США № 2004/0148654 и WO 2001/36596, где в растениях изменяют содержание абсцизовой кислоты, что приводит к улучшенному фенотипу растения, такому как повышенная урожайность и/или повышенная переносимость абиотического стресса.

(D) WO 2000/006341, WO 2004/090143, патенты США №№ 7531723 и 6992237, где экспрессия цитокинина модифицируется, что приводит к растениям с повышенной переносимостью стрессов, как, например, переносимостью засухи и/или повышенной урожайностью. Также см. WO 2002/02776, WO 2003/052063, JP 2002/281975, патент США № 6084153, WO 2001/64898, патент США № 6177275 и патент США № 6107547 (улучшение использования азота и измененная реактивность в отношении азота).

(E) Что касается изменения содержания этилена, см. публикацию заявки на выдачу патента США № 2004/0128719, публикацию заявки на выдачу патента США № 2003/0166197 и WO 2000/32761.

(F) Что касается растительных факторов транскрипции или транскрипционных регуляторов, связанных с реакцией на абиотический стресс, см., например, публикацию заявки на выдачу патента США № 2004/0098764 или публикацию заявки на выдачу патента США № 2004/0078852.

(G) Гены, которые повышают экспрессию вакуолярной пирофосфатазы, такие как AVP1 (патент США № 8058515), для повышенной урожайности; нуклеиновая кислота, кодирующая полипептиды HSFA4 или HSFA5 (фактор теплового шока класса A4 или A5), полипептид, подобный белку транспортера олигопептидов (OPT4-подобный); пластохрон-2-подобный (PLA2-подобный) полипептид или Wuschel-родственный гомеобокс 1-подобный (WOX1-подобный) полипептид (публикация заявки на выдачу патента США № US 2011/0283420).

(H) Подавление полинуклеотидов, кодирующих белки поли-(АДФ-рибоза)-полимеразы (PARP) для модуляции запрограммированной клеточной смерти (патент США № 8058510), для повышения мощности.

(I) Полинуклеотид, кодирующий полипептиды DTP21, для обеспечения устойчивости к засухе (публикация заявки на выдачу патента США № US 2011/0277181).

(J) Нуклеотидные последовательности, кодирующие белки ACC синтазы 3 (ACS3) для модуляции развития, модуляции реакции на стресс и модуляции переносимости стрессов (публикация заявки на выдачу патента США № US 2010/0287669).

(K) Полинуклеотиды, кодирующие белки, которые приводят к фенотипу переносимости засухи (DTP), для обеспечения устойчивости к засухе (WO 2012/058528).

(L) Гены токоферолциклазы (TC) для обеспечения переносимости засухи и засоления (публикация заявки на выдачу патента США № 2012/0272352).

(M) Белки семейства протеаз, нацеленные на CAAX-концевые аминокислоты, для придания переносимости стрессов (патент США № 8338661).

(N) Мутации в гене, кодирующем SAL1, характеризовались повышенной переносимостью стрессов, в том числе характеризовались повышенной устойчивостью к засухе (публикация заявки на выдачу патента США № 2010/0257633).

(O) Экспрессия последовательности нуклеиновой кислоты, которая кодирует полипептид, выбранный из группы, состоящей из: полипептида GRF, RAA1-подобного полипептида, полипептида SYR, полипептида ARKL и полипептида YTP, усиливающих признаки, связанные с урожайностью (публикация заявки на выдачу патента США № 2011/0061133).

(P) Модуляция экспрессии в растении нуклеиновой кислоты, кодирующей полипептид трегалоза-фосфатфосфатазу (TPP) класса III для улучшения у растений признаков, связанных с урожайностью, в частности повышения урожайности семян (публикация заявки на выдачу патента США № 2010/0024067).

Другие гены и факторы транскрипции, которые воздействуют на рост и агрономические признаки растений, такие как урожайность, цветение, рост растения и/или структура растения, можно вводить или интрогрессировать в растения, см., например, WO 1997/49811 (LHY), WO 1998/56918 (ESD4), WO 1997/10339 и патент США № 6573430 (TFL), патент США № 6713663 (FT), WO 1996/14414 (CON), WO 1996/38560, WO 2001/21822 (VRN1), WO 2000/44918 (VRN2), WO 1999/49064 (GI), WO 2000/46358 (FR1), WO 1997/29123, патент США № 6794560, патент США № 6307126 (GAI), WO 1999/09174 (D8 и Rht) и WO 2004/076638, а также WO 2004/031349 (факторы транскрипции).

7. Гены, которые обеспечивают повышенную урожайность

(A) Трансгенное культурное растение, трансформированное с помощью нуклеиновой кислоты, кодирующей 1-аминоциклопропан-1-карбоксилатдезаминаза-подобный полипептид (ACCDP), где экспрессия последовательности нуклеиновой кислоты в культурном растении приводит к повышенному росту корней, и/или повышенной урожайности, и/или повышенной переносимости стрессов под влиянием факторов среды у растения, по сравнению с разновидностью дикого типа растения (патент США № 8097769).

(B) Как было показано, сверхэкспрессия гена белков "цинковых пальцев" маиса (Zm-ZFP1) с применением промотора, активного преимущественно в семенах, усиливает рост растения, увеличивает количество зерен и общий вес зерен на растение (публикация заявки на выдачу патента США № 2012/0079623).

(C) Как было показано, конститутивная сверхэкспрессия белка с доменом границ латеральных органов (LOB) (Zm-LOBDP1) маиса увеличивает количество зерен и общий вес зерен на растение (публикация заявки на выдачу патента США № 2012/0079622).

(D) Улучшение у растений признаков, связанных с урожайностью, с помощью модуляции экспрессии у растения нуклеиновой кислоты, кодирующей VIM1 (вариант с метилированием 1)-подобный полипептид, или VTC2-подобный (GDP-L-галактоза-фосфорилаза) полипептид, или полипептид DUF1685, или ARF6-подобный (восприимчивый к ауксину фактор) полипептид (WO 2012/038893).

(E) Модуляция экспрессии в растении нуклеиновой кислоты, кодирующей Ste20-подобный полипептид или его гомолог, позволяет растениям обеспечивать повышенную урожайность относительно контрольных растений (EP 2431472).

(F) Гены, кодирующие полипептиды нуклеозиддифосфаткиназы (NDK) и их гомологи для модификации строения корня растения (публикация заявки на выдачу патента США № 2009/0064373).

8. Гены, которые обеспечивают усвояемость растения

(A) Изменение уровня ксилана, присутствующего в клеточной стенке растения, с помощью модуляции экспрессии ксилансинтазы (патент США № 8173866).

В некотором варианте осуществления пакетированный признак может представлять собой признак или трансгенный объект, который получил разрешение контролирующих органов, в том числе без ограничения трансгенные объекты, одобренные контролирующими органами, которые хорошо известны специалисту в данной области, и их можно найти на веб-сайте Центра оценки риска для окружающей среды (cera-gmc.org/?action=gm_crop_database, доступ к которому можно получить с применением префикса www) и на веб-сайте Международной службы по приобретению агробиотехнологических приложений (isaaa.org/gmapprovaldatabase/default.asp, доступ к которому можно получить с использованием приставки www).

Сайленсинг генов

В некоторых вариантах осуществления пакетированный признак может быть в форме, применимой для сайленсинга одного или нескольких полинуклеотидов, представляющих интерес, что приводит к супрессии одного или нескольких целевых полипептидов вредителя. В некоторых вариантах осуществления сайленсинг достигается благодаря применению супрессионной ДНК-конструкции.

В некоторых вариантах осуществления один или несколько полинуклеотидов, кодирующих полипептиды полипептида IPD079 или их фрагментов или вариантов, могут быть пакетированы с одним или несколькими полинуклеотидами, кодирующими один или несколько полипептидов, характеризующихся инсектицидной активностью или агрономическими признаками, изложенными выше, и необязательно могут дополнительно предусматривать один или несколько полинуклеотидов, предусмотренных для сайленсинга генов одного или нескольких целевых полинуклеотидов, которые обсуждаются ниже.

"Супрессионная ДНК-конструкция" представляет собой рекомбинантную ДНК-конструкцию, которая при трансформации или стабильной интеграции в геном растения приводит в результате к "сайленсингу" целевого гена в растении. Целевой ген может быть эндогенным или трансгенным по отношению к растению. Выражение "сайленсинг", используемое в данном документе в отношении целевого гена, обычно относится к обеспечению супрессии уровней мРНК или белка/фермента, экспрессируемых целевым геном, и/или уровня активности фермента или функционирования белка. Термин "супрессия" включает понижение, снижение, ухудшение, уменьшение, подавление, устранение и предотвращение. "Сайленсинг" или "сайленсинг генов" не определяет механизм и включают без ограничения супрессию, опосредованную антисмысловыми олигонуклеотидами, косупрессию, супрессию, опосредованную вирусами, супрессию, опосредованную шпильками, супрессию, опосредованную структурами типа "стебель-петля", подходы на основе RNAi и подходы на основе низкомолекулярных РНК.

Супрессионная ДНК-конструкция может содержать участок, происходящий от целевого гена, представляющего интерес, и может содержать всю или часть последовательности нуклеиновой кислоты смысловой нити (или антисмысловой нити) целевого гена, представляющего интерес. В зависимости от подхода, который будет использоваться, участок может быть на 100% идентичным или менее, чем на 100% идентичным (например, по меньшей мере на 50% или на любое целое число от 51% до 100% идентичным) всей смысловой нити (или антисмысловой нити) гена, представляющего интерес, или ее части.

Супрессионные ДНК-конструкции хорошо известны в данной области, легко конструируются сразу после выбора целевого гена, представляющего интерес, и включают без ограничения косупрессионные конструкции, антисмысловые конструкции, вирусные супрессионные конструкции, шпильковые супрессионные конструкции, супрессионные конструкции типа "стебель-петля", конструкции, вырабатывающие двухнитевые РНК, и в более общем смысле конструкции для RNAi (РНК-интерференции) и конструкции на основе небольших РНК, такие как конструкции на основе siRNA (коротких интерферирующих РНК) и miRNA (микроРНК).

Выражение "антисмысловое подавление" относится к продуцированию антисмысловых РНК-транскриптов, способных обеспечивать супрессию экспрессии целевого белка.

Выражение "антисмысловая РНК" относится к РНК-транскрипту, который комплементарен всему целевому первичному транскрипту или мРНК или их части, и который блокирует экспрессию фрагмента целевой выделенной нуклеиновой кислоты (патент США № 5107065). Комплементарность антисмысловой РНК может быть с любой частью конкретного генного транскрипта, т. е. с 5'-некодирующей последовательностью, 3'-некодирующей последовательностью, интронами или кодирующей последовательностью.

Выражение "косупрессия" относится к продуцированию смысловых РНК-транскриптов, способных обеспечивать супрессию экспрессии целевого белка. Выражение "смысловая" РНК относится к РНК-транскрипту, который включает мРНК и может быть транслирован с образованием белка в клетке или in vitro. Конструкции для косупрессии у растений ранее разрабатывались с основным вниманием к сверхэкспрессии последовательностей нуклеиновой кислоты, имеющих гомологию с нативной мРНК, в смысловой ориентации, что приводит к снижению уровней всех РНК, имеющих гомологию со сверхэкспрессированной последовательностью (см., Vaucheret, et al., (1998) Plant J. 16:651-659 и Gura, (2000) Nature 404:804-808).

В другом варианте описывается применение последовательностей растительных вирусов для управления супрессией проксимальных последовательностей, кодирующих мРНК (публикация согласно PCT WO 1998/36083).

В недавней работе было описано применение "шпильковых" структур, которые включают всю мРНК-кодирующей последовательности в комплементарной ориентации или ее часть, что приводит к потенциальной структуре "стебель-петля" у экспрессированной РНК (публикация согласно PCT WO 1999/53050). В данном случае стебель формируется полинуклеотидами, соответствующими гену, представляющему интерес, в смысловой или в антисмысловой ориентации по отношению к промотору, а петля формируется несколькими полинуклеотидами гена, представляющего интерес, которые не имеют комплементарной последовательности в конструкции. Это повышает частоту косупрессии или сайленсинга в регенерированных трансгенных растениях. Обзор шпильковой супрессии см. в Wesley, et al., (2003) Methods in Molecular Biology, Plant Functional Genomics: Methods and Protocols 236:273-286.

Конструкция, в которой стебель образован по меньшей мере 30 нуклеотидами из гена, который подлежит супрессии, и петля образована случайной нуклеотидной последовательностью, также эффективно применялась для супрессии (публикация согласно PCT WO 1999/61632).

Также было описано применение последовательностей поли-T и поли-A для получения стебля в структуре "стебель-петля" (публикация согласно PCT WO 2002/00894).

Еще один вариант включает применение синтетических повторов для содействия образованию стебля в структуре "стебель-петля". Было показано, что трансгенные организмы, полученные с такими фрагментами рекомбинантной ДНК, характеризуются сниженными уровнями белка, кодируемого нуклеотидным фрагментом, который образует петлю, как описано в публикации согласно РСТ WO 2002/00904.

РНК-интерференция относится к процессу, специфичному в отношении последовательности посттранскрипционного сайленсинга генов у животных, который опосредован короткими интерферирующими РНК (siRNA) (Fire, et al., (1998) Nature 391:806). Соответствующий процесс у растений обычно называют посттранскрипционным сайленсингом генов (PTGS) или РНК-опосредованным сайленсингом, и также называют подавлением у грибов. Процесс посттранскрипционного сайленсинга генов считается эволюционно-консервативным механизмом клеточной защиты, применяющимся для предотвращения экспрессии чужеродных генов, и он широко распространен у различных представителей растительного мира и типов животных (Fire, et al., (1999) Trends Genet. 15:358). Такая защита от экспрессии чужеродных генов могла развиться в ответ на выработку двухнитевых РНК (dsRNA), полученных в результате вирусной инфекции или в результате случайной интеграции транспозонных элементов в геном хозяина, путем клеточного ответа, который специфически разрушает гомологичную однонитевую РНК вирусной геномной РНК. Присутствие dsRNA в клетках вызывает RNAi-ответ через механизм, который полностью еще не охарактеризован.

Присутствие длинных dsRNA в клетках стимулирует активность фермента рибонуклеазы III, называемого "дайсер". Дайсер вовлекается в процессинг dsRNA с образованием коротких фрагментов dsRNA, называемых короткими интерферирующими РНК (siRNA) (Berstein et al., Nature 409:363, 2001). Как правило, короткие интерферирующие РНК, полученные в результате активности дайсер, имеют длину от приблизительно 21 до приблизительно 23 нуклеотидов, и включают дуплексы из приблизительно 19 пар оснований (Elbashir, et al., (2001) Genes Dev. 15:188). Кроме того, дайсер был вовлечен в вырезание 21- и 22-нуклеотидных небольших временных РНК (stRNA) из РНК-предшественника консервативной структуры, которые вовлечены в контроль на уровне трансляции (Hutvagner, et al., (2001) Science 293:834). Для RNAi-ответа также характерен эндонуклеазный комплекс, обычно называемый комплексом РНК-индуцированного сайленсинга (RISC), который опосредует расщепление однонитевой РНК, последовательность которой комплементарна антисмысловой нити дуплекса siRNA. Расщепление целевой РНК происходит в середине участка, комплементарного антисмысловой нити дуплекса siRNA (Elbashir, et al., (2001) Genes Dev. 15:188). Кроме того, РНК-интерференция также может подразумевать сайленсинг генов, опосредованный небольшими РНК (например, miRNA), предположительно посредством клеточных механизмов, которые регулируют структуру хроматина, и тем самым предотвращают транскрипцию последовательностей целевых генов (см., например, Allshire, (2002) Science 297:1818-1819; Volpe, et al., (2002) Science 297:1833-1837; Jenuwein, (2002) Science 297:2215-2218 и Hall, et al., (2002) Science 297:2232-2237). Таким образом, молекулы miRNA по настоящему изобретению можно применять для опосредования сайленсинга генов путем взаимодействия с РНК-транскриптами или в качестве альтернативы взаимодействия с конкретными генными последовательностями, где такое взаимодействие приводит к сайленсингу генов либо на транскрипционном, либо на посттранскрипционном уровне.

Дополнительно предусмотрены способы и композиции, которые обеспечивают возможность повышения уровня RNAi, получаемой с помощью элемента сайленсинга. В таких вариантах осуществления в способах и композициях используется первый полинуклеотид, содержащий элемент сайленсинга для целевой последовательности вредителя, функционально связанный с промотором, активным в растительной клетке; и второй полинуклеотид, содержащий усиливающий супрессию элемент, содержащий целевую последовательность вредителя или ее активный вариант или фрагмент, функционально связанные с промотором, активным в растительной клетке. Объединенная экспрессия элемента сайленсинга с усиливающим супрессию элементом ведет к увеличению амплификации ингибиторных РНК, вырабатываемых на основе элемента сайленсинга сверх того уровня, который достигается при экспрессии только элемента сайленсинга самого по себе. В дополнение к увеличенной амплификации специфических видов молекул для RNAi самих по себе, способы и композиции дополнительно обеспечивают возможность выработки отличающейся группы видов молекул для RNAi, которые могут улучшать эффективность нарушения экспрессии целевого гена. Таким образом, когда усиливающий супрессию элемент экспрессируется в растительной клетке в комбинации с элементом сайленсинга, способы и композиции могут обеспечивать возможность системной выработки молекул для RNAi по всему растению; выработку больших количеств молекул для RNAi, чем можно было бы наблюдать в случае только конструкции элемента сайленсинга отдельно; и улучшенную загрузку молекул для RNAi во флоэму растения, таким образом обеспечивается лучший контроль насекомых, питающихся флоэмой, с помощью подхода с RNAi. Таким образом, различные способы и композиции обеспечивают улучшенные способы доставки ингибиторных РНК целевому организму. См., например, публикацию заявки на выдачу патента США 2009/0188008.

Используемое в данном документе выражение "усиливающий супрессию элемент" предусматривает полинуклеотид, содержащий целевую последовательность, подлежащую супрессии, или ее активный фрагмент или вариант. Понятно, что усиливающий супрессию элемент не должен быть идентичным целевой последовательности, но усиливающий супрессию элемент скорее может содержать вариант целевой последовательности, при условии что последовательность усиливающего супрессию элемента в достаточной степени идентична целевой последовательности, чтобы обеспечить возможность повышенного уровня RNAi, получаемой с помощью элемента сайленсинга, сверх того уровня, который достигается при экспрессии только элемента сайленсинга. Аналогично, усиливающий супрессию элемент может содержать фрагмент целевой последовательности, где фрагмент имеет достаточную длину, чтобы обеспечить возможность повышенного уровня RNAi, получаемой с помощью элемента сайленсинга, сверх того уровня, который достигается при экспрессии только элемента сайленсинга.

Понятно, что можно использовать несколько усиливающих супрессию элементов из одной целевой последовательности, или из различных целевых последовательностей, или из различных участков одной целевой последовательности. Например, используемые усиливающие супрессию элементы могут содержать фрагменты целевой последовательности, полученные из другого участка целевой последовательности (т. е. из 3′UTR, кодирующей последовательности, интрона и/или 5′UTR). Кроме того, усиливающий супрессию элемент может содержаться в кассете экспрессии, как описано в другом месте данного документа, и в определенных вариантах осуществления усиливающий супрессию элемент находится на одном или на другом ДНК-векторе или -конструкции по отношению к элементу сайленсинга. Усиливающий супрессию элемент может быть функционально связан с промотором, раскрытым в данном документе. Признается тот факт, что усиливающий супрессию элемент может экспрессироваться конститутивно, или в качестве альтернативы он может вырабатываться способом, зависящим от стадии, с использованием различных индуцируемых, или предпочительных для ткани, или регулируемых в ходе развития промоторов, которые обсуждаются в другом месте данного документа.

В определенных вариантах осуществления при использовании как элемента сайленсинга, так и усиливающего супрессию элемента системная выработка молекул для RNAi происходит по всему растению. В дополнительных вариантах осуществления растение или части растения по настоящему изобретению имеют повышенную нагрузку молекул для RNAi во флоэме растения, что можно было наблюдать при экспрессии конструкции элемента сайленсинга отдельно, и таким образом обеспечивается лучший контроль насекомых, питающихся флоэмой, с помощью подхода с использованием RNAi. В определенных вариантах осуществления растения, части растения и растительные клетки по настоящему изобретению можно дополнительно охарактеризовать как обеспечивающие возможность выработки разнообразных видов молекул для RNAi, которые могут улучшать эффективность нарушения экспрессии целевого гена.

В определенных вариантах осуществления объединенная экспрессия элемента сайленсинга и усиливающего супрессию элемента повышает концентрацию ингибиторных РНК в растительной клетке, растении, части растения, растительной ткани или флоэме сверх того уровня, который достигается при экспрессии элемента сайленсинга отдельно.

Используемое в данном документе выражение "повышенный уровень ингибиторных РНК" предусматривает какое-либо статистически значимое повышение уровня молекул для RNAi, вырабатываемых в растении, обладающем комбинированной экспрессией по сравнению с соответствующим контрольным растением. Например, повышение уровня RNAi в растении, части растения или растительной клетке может предусматривать по меньшей мере приблизительно 1%, приблизительно 1% - 5%, приблизительно 5% - 10%, приблизительно 10% - 20%, приблизительно 20% - 30%, приблизительно 30% - 40%, приблизительно 40% - 50%, приблизительно 50% - 60%, приблизительно 60-70%, приблизительно 70% - 80%, приблизительно 80% - 90%, приблизительно 90% - 100% или большее повышение уровня RNAi в растении, части растения, растительной клетке или флоэме по сравнению с соответствующим контролем. В других вариантах осуществления повышение уровня RNAi в растении, части растения, растительной клетке или флоэме может предусматривать по меньшей мере приблизительно 1-кратное, приблизительно 1-кратное - 5-кратное, приблизительно 5-кратное - 10-кратное, приблизительно 10-кратное - 20-кратное, приблизительно 20-кратное - 30-кратное, приблизительно 30-кратное - 40-кратное, приблизительно 40-кратное - 50-кратное, приблизительно 50-кратное - 60-кратное, приблизительно 60-кратное - 70-кратное, приблизительно 70-кратное - 80-кратное, приблизительно 80-кратное - 90-кратное, приблизительно 90-кратное - 100-кратное или большее повышение уровня RNAi в растении, части растения, растительной клетке или флоэме по сравнению с подходящим контролем. Примеры объединенной экспрессии элемента сайленсинга с усиливающим супрессию элементом для контроля щитников и Lygus можно найти в публикации заявки на выдачу патента США 2011/0301223 и публикации заявки на выдачу патента США 2009/0192117.

Некоторые варианты осуществления относятся к понижающей регуляции экспрессии целевых генов у видов насекомых-вредителей с помощью интерферирующих молекул рибонуклеиновой кислоты (РНК). В публикации согласно PCT WO 2007/074405 описаны способы подавления экспрессии целевых генов у беспозвоночных вредителей, в том числе колорадского жука. В публикации согласно PCT WO 2005/110068 описаны способы подавления экспрессии целевых генов у беспозвоночных вредителей, в том числе в частности у западного кукурузного жука, в качестве средства контроля заражения насекомыми. Кроме того, в публикации согласно PCT WO 2009/091864 описаны композиции и способы супрессии целевых генов из видов насекомых-вредителей, в том числе вредителей из рода Lygus. Молекулы нуклеиновой кислоты, в том числе молекулы для RNAi для нацеливания на H-субъединицу вакуолярной АТФазы, пригодны для контроля популяции и заражения жесткокрылыми вредителями, как описано в публикации заявки на выдачу патента США 2012/0198586. В публикации согласно PCT WO 2012/055982 описана рибонуклеиновая кислота (РНК или двухнитевая РНК), которая ингибирует или обеспечивает подавление экспрессии целевого гена, который кодирует: рибосомальный белок насекомого, такой как рибосомальный белок L19, рибосомальный белок L40 или рибосомальный белок S27A; субъединицу протеасомы насекомого, такую как белок Rpn6, Pros 25, белок Rpn2, белок бета 1 субъединицы протеасомы или белок бета 2 Pros; β-коатомер COPI-везикулы насекомого, γ-коатомер COPI-везикулы, β'-коатомерный белок или ζ-коатомер COPI-везикулы; белок тетраспанин 2 A насекомого, который представляет собой предполагаемый белок трансмембранного домена; белок насекомого, относящийся к семейству актина, такой как актин 5C; белок убиквитин-5E насекомого; белок Sec23 насекомого, который представляет собой активатор ГТФазы, вовлеченной во внутриклеточный транспорт белков; белок "crinkled" насекомого, который представляет собой атипичный миозин, который вовлечен в двигательную активность; белок "crooked neck" насекомого, который вовлечен в регуляцию ядерного альтернативного сплайсинга мРНК; белок G-субъединицы вакуолярной H+-АТФазы насекомого и Tbp-1 насекомого, такой как Tat-связывающий белок. В публикациях заявок на выдачу патентов США 2012/029750, US 20120297501 и 2012/0322660 описаны интерферирующие рибонуклеиновые кислоты (РНК или двухнитевая РНК), которые функционируют при поглощении видами насекомых-вредителей с понижающей регуляцией экспрессии целевого гена в указанном насекомом-вредителе, где РНК содержит по меньшей мере один элемент сайленсинга, где элемент сайленсинга представляет собой участок двухнитевой РНК, содержащий гибридизованные комплементарные нити, из которых одна нить содержит или состоит из последовательности нуклеотидов, которая по меньшей мере частично комплементарна целевой нуклеотидной последовательности в пределах целевого гена. В публикации заявки на выдачу патента США 2012/0164205 описаны потенциальные мишени для интерферирующих двухнитевых рибонуклеиновых кислот для подавления беспозвоночных вредителей, в том числе: гомологичная последовательность Chd3, гомологичная последовательность бета-тубулина, гомологичная последовательность весом 40 кДа V-АТФазы, гомологичная последовательность EF1α, гомологичная последовательность субъединицы p28 протеосомы 26S, гомологичная последовательность эпоксидгидролазы ювенильного гормона, гомологичная последовательность белка хлоридных каналов, зависимых от набухания, гомологичная последовательность белка глюкоза-6-фосфат-1-дегидрогеназы, гомологичная последовательность белка Act42A, гомологичная последовательность фактора 1 АДФ-рибозилирования, гомологичная последовательность белка фактора транскрипции IIB, гомологичные последовательности хитиназы, гомологичная последовательность фермента, конъюгирующего убиквитин, гомологичная последовательность глицеральдегид-3-фосфатдегидрогеназы, гомологичная последовательность убиквитина B, гомолог эстеразы ювенильного гормона и гомологичная последовательность альфа-тубулина.

Применение в пестицидном контроле

Из уровня техники известны общие способы использования штаммов, содержащих последовательность нуклеиновой кислоты согласно вариантам осуществления или ее вариант, в пестицидном контроле или в конструировании других организмов в качестве пестицидных средств. См., например, патент США № 5039523 и EP 0480762A2.

Могут быть выбраны микроорганизмы-хозяева, которые как известно заселяют "фитосферу" (филлоплан, филлосферу, ризосферу и/или ризоплан) одной или нескольких сельскохозяйственных культур, представляющих интерес. Эти микроорганизмы выбирают таким образом, чтобы они могли успешно конкурировать в конкретной окружающей среде с микроорганизмами дикого типа, обеспечивать стабильное поддержание и экспрессию гена, экспрессирующего полипептид IPD079, и желательно обеспечивать улучшенную защиту пестицида от разрушения и инактивации в окружающей среде.

В качестве альтернативы, полипептиды IPD079 получали путем введения гетерологичного гена в клетку-хозяина. Экспрессия гетерологичного гена приводит, непосредственно или опосредованно, к выработке и сохранению пестицида внутри клетки. Эти клетки затем обрабатывают в условиях, которые продлевают активность токсина, продуцируемого в клетке, когда осуществляют применение клетки в отношении среды, окружающей целевого(целевых) вредителя(вредителей). Полученный продукт сохраняет токсичность токсина. Эти естественным образом инкапсулированные полипептиды IPD079 можно затем составлять в соответствии с традиционными методиками для внесения в среду, окружающую целевого вредителя, например, в почву, воду и на листву растений. См., например, EPA 0192319 и ссылочные документы, приведенные в нем.

Пестицидные композиции

В некоторых вариантах осуществления перфорин растительного происхождения можно применять в форме композиций, и можно применять по отношению к возделываемой площади или растению, подлежащим обработке, одновременно или последовательно с другими соединениями. Эти соединения могут представлять собой удобрения, средства борьбы с сорняками, криопротекторы, поверхностно-активные вещества, детергенты, пестицидные мыла, масла, применяемые во время состояния покоя, полимеры и/или составы с носителем с замедленным высвобождением или биоразлагаемым носителем, который обеспечивает длительное дозированное внесение в целевой области после однократного нанесения состава. Они также могут представлять собой селективные гербициды, химические инсектициды, вируциды, микробициды, амебоциды, пестициды, фунгициды, бактерициды, нематоциды, моллюскоциды или смеси из нескольких этих препаратов, при необходимости вместе с дополнительными приемлемыми с точки зрения сельского хозяйства носителями, поверхностно-активными веществами или вспомогательными веществами, способствующими нанесению, традиционно используемыми в области техники, связанной с получением составов. Подходящие носители и вспомогательные вещества могут быть твердыми или жидкими и соответствуют веществам, обычно используемым в технологии составления, например природным или регенерированным минеральным веществам, растворителям, диспергирующим веществам, смачивающим веществам, веществам, придающим клейкость, связующим или удобрениям. Аналогично, составы можно готовить в виде съедобных "приманок" или формировать в "ловушки" для вредителей, что обеспечивает поедание или заглатывание пестицидного состава целевым вредителем.

Способы применения активного ингредиента или агрохимической композиции, которая содержит по меньшей мере один перфорин растительного происхождения по настоящему изобретению, в том числе без ограничения полипептид IPD079, продуцируемый штаммами бактерий, предусматривают применение по отношению к листьям, покрытие семян и внесение в почву. Количество применений и норма применения зависят от интенсивности поражения соответствующим вредителем.

Композицию можно составлять в виде порошка, дуста, пеллеты, гранулы, распыляемого раствора, эмульсии, коллоидного вещества, раствора и т. п., и ее можно получать с помощью таких традиционных способов как сушка, лиофилизация, гомогенизация, экстракция, фильтрация, центрифугирование, осаждение или концентрирование культуры клеток, содержащих полипептид. Во всех таких композициях, которые содержат по меньшей мере один такой пестицидный полипептид, полипептид может присутствовать в концентрации от приблизительно 1% до приблизительно 99% по весу. Выражение "приблизительно" в отношении % по весу означает ± 0,5%.

Вредителей из группы чешуекрылых, двукрылых, настоящих клопов, нематод, полужесткокрылых или жесткокрылых можно уничтожать или уменьшать их количество на указанной площади с помощью способов по настоящему изобретению, или средства можно профилактически вносить на площадь в окружающей среде с целью предотвращения заражения восприимчивым вредителем. Предпочтительно, вредитель заглатывает пестицидно эффективное количество полипептида или контактирует с ним. Выражение "пестицидно эффективное количество", используемое в данном документе, относится к количеству пестицида, которое может приводить к гибели по меньшей мере одного вредителя или к заметно сниженному росту, питанию или нормальному физиологическому развитию вредителя. Данное количество будет варьировать в зависимости от таких факторов, как, например, специфические целевые вредители, подлежащие контролю, специфическая среда, местоположение, растение, культура или сельскохозяйственный участок, подлежащий обработке, условия окружающей среды и способ, норма, концентрация, стабильность и количество применений пестицидно эффективной полипептидной композиции. Составы также могут варьировать в зависимости от климатических условий, экологических соображений, и/или частоты нанесения, и/или тяжести заражения вредителями.

Описанные пестицидные композиции можно создавать путем составления либо суспензии бактериальных клеток, кристаллов и/или спор, либо выделенного белкового компонента с требуемым носителем, приемлемым с точки зрения сельского хозяйства. Композиции можно составлять перед введением с помощью надлежащих способов, таких как лиофилизация, сублимационная сушка, высушивание, или в водном носителе, среде или подходящем растворителе, таком как солевой раствор или другой буфер. Составленные композиции могут находиться в форме дуста, или гранулированного материала, или суспензии в масле (растительном или минеральном), или водных эмульсий или эмульсий масло/вода, или в виде смачиваемого порошка, или в комбинации с любым другим материалом носителя, подходящим для сельскохозяйственного применения. Подходящие носители, приемлемые с точки зрения сельского хозяйства, могут быть твердыми или жидкими и хорошо известны из уровня техники. Термин "приемлемый с точки зрения сельского хозяйства носитель" охватывает все вспомогательные вещества, инертные компоненты, диспергирующие вещества, поверхностно-активные вещества, вещества, придающие клейкость, связующие и т. д., которые обычно применяют в технологии составления пестицидов; причем они хорошо известны специалистам по составлению пестицидов. Составы можно смешивать с одним или несколькими твердыми или жидкими вспомогательными веществами и получать с помощью различных способов, например, путем равномерного перемешивания, смешивания и/или размалывания пестицидной композиции с подходящими вспомогательными веществами с применением традиционных методик составления. Подходящие составы и способы нанесения описаны в патенте США № 6468523, включенном в данный документ с помощью ссылки. Семена или растения можно также обрабатывать одной или несколькими химическими композициями, в том числе одним или несколькими гербицидами, инсектицидами или фунгицидами. Иллюстративные химические композиции включают следующее. Гербициды для фруктов/овощей: атразин, бромацил, диурон, глифосат, линурон, метрибузин, симазин, трифлуралин, флуазифоп, глуфосинат, галосульфурон от Gowan, паракват, пропизамид, сетоксидим, бутафенацил, галосульфурон, индазифлам; инсектициды для фруктов/овощей: алдикарб, Bacillus thuriengiensis, карбарил, карбофуран, хлорпирифос, циперметрин, дельтаметрин, диазинон, малатион, абамектин, цифлутрин/бета-цифлутрин, эсфенвалерат, лямбда-цигалотрин, ацеквиноцил, бифеназат, метоксифенозид, новалурон, кромафенозид, тиаклоприд, динотефуран, флуакрипирим, толфенпирад, клотианидин, спиродиклофен, гамма-цигалотрин, спиромезифен, спиносад, ринаксипир, циазипир, спинотерам, трифлумурон, спиротетрамат, имидаклоприд, флубендиамид, тиодикарб, метафлумизон, сульфоксафлор, цифлуметофен, цианопирафен, имидаклоприд, клотианидин, тиаметоксам, спиноторам, тиодикарб, флоникамид, метиокарб, эмамектин-бензоат, индоксакарб, фортиазат, фенамифос, кадусафос, пирипроксифен, фенбутатин-оксид, гекстиазокс, метомил, 4-[[(6-хлорпиридин-3-ил)метил](2,2-дифторэтил)амино]фуран-2(5H)-он; фунгициды для фруктов/овощей: карбендазим, хлороталонил, EBDC, сера, тиофанат-метил, азоксистробин, цимоксанил, флуазинам, фосетил, ипродион, крезоксим-метил, металаксил/мефеноксам, трифлоксистробин, этабоксам, ипроваликарб, трифлоксистробин, фенгексамид, окспоконазола фумарат, циазофамид, фенамидон, зоксамид, пикоксистробин, пираклостробин, цифлуфенамид, боскалид; гербициды для злаков: изопротурон, бромоксинил, иоксинил, фенокси-соединения, хлорсульфурон, клодинафоп, диклофоп, дифлуфеникан, феноксапроп, флорасулам, флуроксипир, метсульфурон, триасульфурон, флукарбазон, йодосульфурон, пропоксикарбазон, пиколинафен, мезосульфурон, бефлубутамид, пиноксаден, амидосульфурон, тифенсульфурон-метил, трибенурон, флупирсульфурон, сульфосульфурон, пирасульфотол, пироксулам, флуфенацет, тралкоксидим, пироксасульфон; фунгициды для злаков: карбендазим, хлороталонил, азоксистробин, ципроконазол, ципродинил, фенпропиморф, эпоксиконазол, крезоксим-метил, квиноксифен, тебуконазол, трифлоксистробин, симеконазол, пикоксистробин, пираклостробин, димоксистробин, протиоконазол, флуоксастробин; инсектициды для злаков: диметоат, лямбда-цигалотрин, дельтаметрин, альфа-циперметрин, β-цифлутрин, бифентрин, имидаклоприд, клотианидин, тиаметоксам, тиаклоприд, ацетамиприд, динетофуран, хлорпирифос, метамидофос, оксидеметон-метил, пиримикарб, метиокарб; гербициды для маиса: атразин, алахлор, бромоксинил, ацетохлор, дикамба, клопиралид, (S-)диметенамид, глуфосинат, глифосат, изоксафлутол, (S-)метолахлор, мезотрион, никосульфурон, примисульфурон, римсульфурон, сулькотрион, форамсульфурон, топрамезон, темботрион, сафлуфенацил, тиенкарбазон, флуфенацет, пироксасульфон; инсектициды для маиса: карбофуран, хлорпирифос, бифентрин, фипронил, имидаклоприд, лямбда-цигалотрин, тефлутрин, тербуфос, тиаметоксам, клотианидин, спиромезифен, флубендиамид, трифлумурон, ринаксипир, дельтаметрин, тиодикарб, β-цифлутрин, циперметрин, бифентрин, люфенурон, трифлуморон, тефлутрин, тебупиримфос, этипрол, циазипир, тиаклоприд, ацетамиприд, динетофуран, авермектин, метиокарб, спиродиклофен, спиротетрамат; фунгициды для маиса: фенитропан, тирам, протиоконазол, тебуконазол, трифлоксистробин; гербициды для риса: бутахлор, пропанил, азимсульфурон, бенсульфурон, цигалофоп, даимурон, фентразамид, имазосульфурон, мефенацет, оксазикломефон, пиразосульфурон, пирибутикарб, квинклорак, тиобенкарб, инданофан, флуфенацет, фентразамид, галосульфурон, оксазикломефон, бензобициклон, пирифталид, пеноксулам, биспирибак, оксадиаргил, этоксисульфурон, претилахлор, мезотрион, тефурилтрион, оксадиазон, феноксапроп, пиримисульфан; инсектициды для риса: диазинон, фенитротион, фенобукарб, монокротофос, бенфуракарб, бупрофезин, динотефуран, фипронил, имидаклоприд, изопрокарб, тиаклоприд, кромафенозид, тиаклоприд, динотефуран, клотианидин, этипрол, флубендиамид, ринаксипир, дельтаметрин, ацетамиприд, тиаметоксам, циазипир, спиносад, спиноторам, эмамектин-бензоат, циперметрин, хлорпирифос, картап, метамидофос, этофенпрокс, триазофос, 4-[[(6-хлорпиридин-3-ил)метил](2,2-дифторэтил)амино]фуран-2(5H)-он, карбофуран, бенфуракарб; фунгициды для риса: тиофанат-метил, азоксистробин, карпропамид, эдифенфос, феримзон, ипробенфос, изопротиолан, пенцикурон, пробеназол, пироквилон, трициклазол, трифлоксистробин, диклоцимет, феноксанил, симеконазол, тиадинил; гербициды для хлопчатника: диурон, флуометурон, MSMA, оксифлуорфен, прометрин, трифлуралин, карфентразон, клетодим, флуазифоп-бутил, глифосат, норфлуразон, пендиметалин, пиритиобак-натрий, трифлоксисульфурон, тепралоксидим, глуфосинат, флумиоксазин, тидиазурон; инсектициды для хлопчатника: ацефат, алдикарб, хлорпирифос, циперметрин, дельтаметрин, малатион, монокротофос, абамектин, ацетамиприд, эмамектин бензоат, имидаклоприд, индоксакарб, лямбда-цигалотрин, спиносад, тиодикарб, гамма-цигалотрин, спиромезифен, пиридалил, флоникамид, флубендиамид, трифлумурон, ринаксипир, бета-цифлутрин, спиротетрамат, клотианидин, тиаметоксам, тиаклоприд, динетофуран, флубендиамид, циазипир, спиносад, спиноторам, гамма-цигалотрин, 4-[[(6-хлорпиридин-3-ил)метил](2,2-дифторэтил)амино]фуран-2(5H)-он, тиодикарб, авермектин, флоникамид, пиридалил, спиромезифен, сульфоксафлор, профенофос, триазофос, эндосульфан; фунгициды для хлопчатника: этридиазол, металаксил, квинтозен; гербициды для сои: алахлор, бентазон, трифлуралин, хлоримурон-этил, хлорансулам-метил, феноксапроп, фомесафен, флуазифоп, глифосат, имазамокс, имазаквин, имазетапир, (S-)метолахлор, метрибузин, пендиметалин, тепралоксидим, глуфосинат; инсектициды для сои: лямбда-цигалотрин, метомил, паратион, тиокарб, имидаклоприд, клотианидин, тиаметоксам, тиаклоприд, ацетамиприд, динетофуран, флубендиамид, ринаксипир, циазипир, спиносад, спиноторам, эмамектин-бензоат, фипронил, этипрол, дельтаметрин, β-цифлутрин, гамма- и лямбда-цигалотрин, 4-[[(6-хлорпиридин-3-ил)метил](2,2-дифторэтил)амино]фуран-2(5H)-он, спиротетрамат, спинодиклофен, трифлумурон, флоникамид, тиодикарб, бета-цифлутрин; фунгициды для сои: азоксистробин, ципроконазол, эпоксиконазол, флутриафол, пираклостробин, тебуконазол, трифлоксистробин, протиоконазол, тетраконазол; гербициды для сахарной свеклы: хлоридазон, десмедифам, этофумезат, фенмедифам, триаллат, клопиралид, флуазифоп, ленацил, метамитрон, квинмерак, циклоксидим, трифлусульфурон, тепралоксидим, квизалофоп; инсектициды для сахарной свеклы: имидаклоприд, клотианидин, тиаметоксам, тиаклоприд, ацетамиприд, динетофуран, дельтаметрин, β-цифлутрин, гамма/лямбда-цигалотрин, 4-[[(6-хлорпиридин-3-ил)метил](2,2-дифторэтил)амино]фуран-2(5H)-он, тефлутрин, ринаксипир, циаксипир, фипронил, карбофуран; гербициды для канолы: клопиралид, диклофоп, флуазифоп, глуфосинат, глифосат, метазахлор, трифлуралин, этаметсульфурон, квинмерак, квизалофоп, клетодим, тепралоксидим; фунгициды для канолы: азоксистробин, карбендазим, флудиоксонил, ипродион, прохлораз, винклозолин; инсектициды для канолы: карбофурановые фосфороорганические соединения, пиретроиды, тиаклоприд, дельтаметрин, имидаклоприд, клотианидин, тиаметоксам, ацетамиприд, динетофуран, β-цифлутрин, гамма и лямбда-цигалотрин, тау-флувалериат, этипрол, спиносад, спиноторам, флубендиамид, ринаксипир, циазипир, 4-[[(6-хлорпиридин-3-ил)метил](2,2-дифторэтил)амино]фуран-2(5H)-он.

В некоторых вариантах осуществления гербицид представляет собой атразин, бромацил, диурон, хлорсульфурон, метсульфурон, тифенсульфурон-метил, трибенурон, ацетохлор, дикамбу, изоксафлутол, никосульфурон, римсульфурон, пиритиобак-натрий, флумиоксазин, хлоримурон-этил, метрибузин, квизалофоп, S-метолахлор, гексазинон или их комбинацию.

В некоторых вариантах осуществления инсектицид представляет собой эсфенвалерат, хлорантранилипрол, метомил, индоксакарб, оксамил или их комбинацию.

Пестицидная и инсектицидная активность

"Вредитель" включает без ограничения насекомых, грибки, бактерии, нематод, клещей, иксодовых клещей и т. п. Насекомые-вредители включают насекомых, выбранных из отрядов Coleoptera, Diptera, Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera, Orthroptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonaptera, Trichoptera и т. д., в частности Lepidoptera и Coleoptera.

Специалистам в данной области будет понятно, что не все соединения в равной степени эффективны в отношении всех вредителей. Соединения согласно вариантам осуществления проявляют активность в отношении насекомых-вредителей, которые могут включать экономически важных вредителей агрономических, лесных, тепличных продуктов, продуктов питомников декоративных растений, продуктов пищи и волокнистых продуктов, продуктов, связанных со здоровьем людей и животных, продуктов, связанных с домашней и коммерческой структурой, товаров для дома и продуктов для хранения.

Личинки из отряда Lepidoptera включают без ограничения совок, подгрызающих совок, пядениц и гелиотин семейства Noctuidae Spodoptera frugiperda JE Smith (совка травяная); S. exigua Hübner (совка малая); S. litura Fabricius (табачная совка, гусеница, пожирающая соцветия); Mamestra configurata Walker (совка Берта); M. brassicae Linnaeus (совка капустная); Agrotis ipsilon Hufnagel (совка-ипсилон); A. orthogonia Morrison (совка прямоугольная); A. subterranea Fabricius (совка зернистая); Alabama argillacea Hübner (совка хлопковая американская); Trichoplusia ni Hübner (совка ни); Pseudoplusia includens Walker (соевая совка); Anticarsia gemmatalis Hübner (совка бархатных бобов); Hypena scabra Fabricius (совка клеверная); Heliothis virescens Fabricius (табачная листовертка); Pseudaletia unipuncta Haworth (совка луговая); Athetis mindara Barnes и Mcdunnough (совка шершавая); Euxoa messoria Harris (чернобокая гусеница совки); Earias insulana Boisduval (совка хлопковая египетская); E. vittella Fabricius (совка пятнистая); Helicoverpa armigera Hübner (совка щетинконогая резедовая); H. zea Boddie (совка кукурузная или хлопковая совка); Melanchra picta Harris (гусеница совки); Egira (Xylomyges) curialis Grote (цитрусовая совка); огневок, чехлоносок, бабочек, строящих паутинные гнезда, конусных бабочек и вредителей, скелетирующих листья, из семейства Pyralidae Ostrinia nubilalis Hübner (мотылек стеблевой кукурузный); Amyelois transitella Walker (гусеницы, повреждающие рубчики цитрусовых); Anagasta kuehniella Zeller (огневка мельничная); Cadra cautella Walker (огневка сухофруктовая); Chilo suppressalis Walker (желтая рисовая огневка); C. partellus, (сорговая огневка); Corcyra cephalonica Stainton (огневка рисовая); Crambus caliginosellus Clemens (огневка кукурузная); C. teterrellus Zincken (огневка мятликовая); Cnaphalocrocis medinalis Guenée (листовертка рисовая); Desmia funeralis Hübner (виноградная листовертка); Diaphania hyalinata Linnaeus (дынная огневка); D. nitidalis Stoll (огневка огурцов-пикули); Diatraea grandiosella Dyar (огневка кукурузная юго-западная), D. saccharalis Fabricius (огневка сахарного тростника); Eoreuma loftini Dyar (мексиканская рисовая огневка); Ephestia elutella Hübner (огневка зерновая (какао)); Galleria mellonella Linnaeus (большая восковая моль); Herpetogramma licarsisalis Walker (огневка-травянка); Homoeosoma electellum Hulst (огневка подсолнечниковая); Elasmopalpus lignosellus Zeller (малая кукурузная огневка); Achroia grisella Fabricius (малая восковая моль); Loxostege sticticalis Linnaeus (луговой мотылек); Orthaga thyrisalis Walker (чайная моль); Maruca testulalis Geyer (огневка акациевая); Plodia interpunctella Hübner (моль индийская мучная); Scirpophaga incertulas Walker (стеблевая рисовая огневка); Udea rubigalis Guenée (огневка ржаво-коричневая); а также листоверток, листоверток-почкоедов, плодожорок и гусениц-вредителей плодов из семейства Tortricidae Acleris gloverana Walsingham (западная черноголовая листовертка); A. variana Fernald (восточная черноголовая листовертка); Archips argyrospila Walker (листовертка плодовых деревьев); A. rosana Linnaeus (европейская листовертка) и другие виды Archips, Adoxophyes orana Fischer von Rösslerstamm (листовертка сетчатая); Cochylis hospes Walsingham (полосатая подсолнечниковая моль); Cydia latiferreana Walsingham (лещинная плодожорка); C. pomonella Linnaeus (яблонная плодожорка); Platynota flavedana Clemens (листовертка изменчивая); P. stultana Walsingham (листовертка всеядная); Lobesia botrana Denis & Schiffermüller (листовертка европейская виноградная); Spilonota ocellana Denis & Schiffermüller (листовертка почковая); Endopiza viteana Clemens (листовертка виноградная); Eupoecilia ambiguella Hübner (листовертка гроздевая); Bonagota salubricola Meyrick (листовертка бразильская яблочная); Grapholita molesta Busck (плодожорка восточная персиковая); Suleima helianthana Riley (листовертка подсолнечниковая); Argyrotaenia spp.; Choristoneura spp..

Другие выбранные сельскохозяйственные вредители из отряда Lepidoptera включают без ограничения Alsophila pometaria Harris (осенний плодовый червь); Anarsia lineatella Zeller (моль фруктовая полосатая); Anisota senatoria J.E. Smith (сатурния оранжевая дубовая); Antheraea pernyi Guérin-Méneville (китайский дубовый шелкопряд); Bombyx mori Linnaeus (тутовый шелкопряд); Bucculatrix thurberiella Busck (кривоусая хлопковая моль); Colias eurytheme Boisduval (люцерновая желтушка); Datana integerrima Grote & Robinson (хохлатка ореховая); Dendrolimus sibiricus Tschetwerikov (сибирский шелкопряд), Ennomos subsignaria Hübner (пяденица ильмовая); Erannis tiliaria Harris (пяденица липовая); Euproctis chrysorrhoea Linnaeus (шелкопряд золотистый); Harrisina americana Guérin-Méneville (пироморфида американская); Hemileuca oliviae Cockrell (гусеница бабочки-сатурнии); Hyphantria cunea Drury (американская белая бабочка); Keiferia lycopersicella Walsingham (томатная моль); Lambdina fiscellaria fiscellaria Hulst (пяденица гемлоковая восточная); L. fiscellaria lugubrosa Hulst (пяденица гемлоковая западная); Leucoma salicis Linnaeus (волнянка ивовая); Lymantria dispar Linnaeus (непарный шелкопряд); Manduca quinquemaculata Haworth (бражник пятиточечный, томатный бражник); M. sexta Haworth (томатный бражник, табачный бражник); Operophtera brumata Linnaeus (пяденица зимняя); Paleacrita vernata Peck (пяденица весенняя); Papilio cresphontes Cramer (парусник кресфонтес, "апельсиновая собака"); Phryganidia californica Packard (коконопряд кольчатый калифорнийский); Phyllocnistis citrella Stainton (цитрусовая мушка-минер); Phyllonorycter blancardella Fabricius (моль-пестрянка плодовая нижнесторонняя); Pieris brassicae Linnaeus (белянка капустная большая); P. rapae Linnaeus (белянка капустная малая); P. napi Linnaeus (белянка брюквенная); Platyptilia carduidactyla Riley (пальцекрылка артишоковая); Plutella xylostella Linnaeus (моль капустная); Pectinophora gossypiella Saunders (розовый коробочный червь); Pontia protodice Boisduval and Leconte (клетчатая белянка); Sabulodes aegrotata Guenée (всеядная пяденица); Schizura concinna J.E. Smith (хохлатка); Sitotroga cerealella Olivier (моль ячменная ангумуазская); Thaumetopoea pityocampa Schiffermuller (походный шелкопряд сосновый); Tineola bisselliella Hummel (моль комнатная); Tuta absoluta Meyrick (томатная моль); Yponomeuta padella Linnaeus (горностаевая моль плодовая); Heliothis subflexa Guenée; Malacosoma spp. и Orgyia spp.

Представляют интерес личинки и имаго из отряда Coleoptera, в том числе долгоносики из семейств Anthribidae, Bruchidae и Curculionidae (в том числе без ограничения Anthonomus grandis Boheman (долгоносик хлопковый); Lissorhoptrus oryzophilus Kuschel (долгоносик рисовый водяной); Sitophilus granarius Linnaeus (долгоносик амбарный); S. oryzae Linnaeus (долгоносик рисовый); Hypera punctata Fabricius (долгоносик точечный); Cylindrocopturus adspersus LeConte (долгоносик подсолнечниковый стеблевой); Smicronyx fulvus LeConte (красный подсолнечниковый долгоносик); S. sordidus LeConte (серый подсолнечниковый долгоносик); Sphenophorus maidis Chittenden (долгоносик маисовый)); земляные блошки, огуречные листоеды, корневые черви, листоеды, картофельные жуки и листовые минеры семейства Chrysomelidae (в том числе без ограничения Leptinotarsa decemlineata Say (колорадский жук); Diabrotica virgifera virgifera LeConte (западный кукурузный жук); D. barberi Smith and Lawrence (северный кукурузный жук); D. undecimpunctata howardi Barber (южный кукурузный жук); Chaetocnema pulicaria Melsheimer (земляная кукурузная блошка); Phyllotreta cruciferae Goeze (блошка крестоцветная); Phyllotreta striolata (полосатая блошка); Colaspis brunnea Fabricius (листоед виноградный); Oulema melanopus Linnaeus (пьявица красногрудая); Zygogramma exclamationis Fabricius (подсолнечниковый листоед)); жуки из семейства Coccinellidae (в том числе без ограничения Epilachna varivestis Mulsant (мексиканская фасолевая коровка)); хрущи и другие жуки из семейства Scarabaeidae (в том числе без ограничения: Popillia japonica Newman (хрущик японский); Cyclocephala borealis Arrow (дупляк северный, хрущ); C. immaculata Olivier (дупляк южный, хрущ); Rhizotrogus majalis Razoumowsky (хрущ европейский); Phyllophaga crinita Burmeister (личинка хруща); Ligyrus gibbosus De Geer (жук морковный)); кожееды семейства Dermestidae; проволочники из семейства Elateridae, Eleodes spp., Melanotus spp.; Conoderus spp.; Limonius spp.; Agriotes spp.; Ctenicera spp.; Aeolus spp.; короеды из семейства Scolytidae и жуки из семейства Tenebrionidae.

Представляют интерес имаго и незрелые особи отряда Diptera, в том числе минирующие мушки Agromyza parvicornis Loew (кукурузная минирующая мушка); галлицы (в том числе без ограничения Contarinia sorghicola Coquillett (галлица сорговая); Mayetiola destructor Say (гессенская муха); Sitodiplosis mosellana Géhin (злаковая оранжевая галлица); Neolasioptera murtfeldtiana Felt, (подсолнечниковая галлица)); плодовые мушки (Tephritidae), Oscinella frit Linnaeus (плодовые мушки); цветочные мухи (в том числе без ограничения: Delia platura Meigen (муха ростковая); D. coarctata Fallen (муха озимая) и другие Delia spp., Meromyza americana Fitch (американская меромиза); Musca domestica Linnaeus (комнатные мухи); Fannia canicularis Linnaeus, F. femoralis Stein (малые комнатные мухи); Stomoxys calcitrans Linnaeus (жигалки осенние)); мухи полевые, жигалки, мухи мясные, Chrysomya spp.; Phormia spp. и другие мухи-вредители надсемейства Muscoidea, слепни Tabanus spp.; носоглоточные оводы Gastrophilus spp.; Oestrus spp.; бычьи оводы Hypoderma spp.; пестряки Chrysops spp.; Melophagus ovinus Linnaeus (кровососки овечьи) и другие Brachycera, комары Aedes spp.; Anopheles spp.; Culex spp.; мошки Prosimulium spp.; Simulium spp.; мокрецы, москиты, сциариды и другие Nematocera.

В качестве представляющих интерес насекомых включены имаго и насекомые на стадии нимфы отрядов Hemiptera и Homoptera, такие как без ограничения хермесы из семейства Adelgidae, слепняки из семейства Miridae, цикады из семейства Cicadidae, цикадки, Empoasca spp.; из семейства Cicadellidae, насекомые надсемейства Fulgoroidea из семейств Cixiidae, Flatidae, Fulgoroidea, Issidae и Delphacidae, горбатки из семейства Membracidae, листоблошки из семейства Psyllidae, белокрылки из семейства Aleyrodidae, тли из семейства Aphididae, филлоксеры из семейства Phylloxeridae, мучнистые червецы из семейства Pseudococcidae, червецы из семейств Asterolecanidae, Coccidae, Dactylopiidae, Diaspididae, Eriococcidae Ortheziidae, Phoenicococcidae и Margarodidae, кружевницы из семейства Tingidae, щитники из семейства Pentatomidae, клопы-черепашки, Blissus spp.; и другие наземники из семейства Lygaeidae, пенницы из семейства Cercopidae, краевики из семейства Coreidae, а также красноклопы и красноклопы хлопковые из семейства Pyrrhocoridae.

Важные с точки зрения сельского хозяйства представители отряда Homoptera дополнительно включают без ограничения: Acyrthisiphon pisum Harris (тля гороховая); Aphis craccivora Koch (тля люцерновая); A. fabae Scopoli (тля свекловичная); A. gossypii Glover (тля хлопковая, тля бахчевая); A. maidiradicis Forbes (тля кукурузная корневая); A. pomi De Geer (тля яблоневая); A. spiraecola Patch (тля зеленая цитрусовая); Aulacorthum solani Kaltenbach (тля картофельная обыкновенная); Chaetosiphon fragaefolii Cockerell (тля земляничная американская); Diuraphis noxia Kurdjumov/Mordvilko (русская пшеничная тля); Dysaphis plantaginea Paaserini (тля яблоневая розовая); Eriosoma lanigerum Hausmann (тля яблоневая кровяная); Brevicoryne brassicae Linnaeus (капустная тля); Hyalopterus pruni Geoffroy (тля сливовая опыленная); Lipaphis erysimi Kaltenbach (тля ложнокапустная); Metopolophium dirrhodum Walker (розанно-злаковая тля); Macrosiphum euphorbiae Thomas (большая картофельная тля); Myzus persicae Sulzer (тля персиковая, тля оранжерейная); Nasonovia ribisnigri Mosley (тля салатная зеленая); Pemphigus spp. (тли корневые и тли галловые); Rhopalosiphum maidis Fitch (тля сорговая); R. padi Linnaeus (тля черемуховая обыкновенная); Schizaphis graminum Rondani (тля злаковая обыкновенная); Sipha flava Forbes (тля желтая сахарного тростника); Sitobion avenae Fabricius (тля листовая); Therioaphis maculata Buckton (пятнистая люцерновая тля); Toxoptera aurantii Boyer de Fonscolombe (тля померанцевая) и T. citricida Kirkaldy (тля цитрусовая); Adelges spp. (хермесы); Phylloxera devastatrix Pergande (филлоксера гикори); Bemisia tabaci Gennadius (белокрылка табачная, белокрылка хлопковая); B. argentifolii Bellows и Perring (белокрылка магнолиевая); Dialeurodes citri Ashmead (белокрылка цитрусовая); Trialeurodes abutiloneus (белокрылка полосатокрылая) и T. vaporariorum Westwood (белокрылка тепличная); Empoasca fabae Harris (цикадка картофельная); Laodelphax striatellus Fallen (темная цикадка); Macrolestes quadrilineatus Forbes (цикадка астровая); Nephotettix cinticeps Uhler (цикадка зеленая); N. nigropictus Stål (рисовая цикадка); Nilaparvata lugens Stål (бурая рисовая цикадка); Peregrinus maidis Ashmead (цикадка кукурузная); Sogatella furcifera Horvath (цикадка белоспинная); Sogatodes orizicola Muir (дельфацид рисовый); Typhlocyba pomaria McAtee (цикадка яблоневая); Erythroneoura spp. (цикадки виноградные); Magicicada septendecim Linnaeus (периодическая цикада); Icerya purchasi Maskell (червец австралийский желобчатый); Quadraspidiotus perniciosus Comstock (щитовка калифорнийская); Planococcus citri Risso (мучнистый червец виноградный); Pseudococcus spp. (другие мучнистые червецы); Cacopsylla pyricola Foerster (листоблошка грушевая); Trioza diospyri Ashmead (листоблошка хурмовая).

Виды, представляющие интерес с точки зрения сельского хозяйства, из отряда Hemiptera включают без ограничения: Acrosternum hilare Say (щитник зеленый); Anasa tristis De Geer (клоп-ромбовик печальный); Blissus leucopterus leucopterus Say (клоп-черепашка); Corythuca gossypii Fabricius (кружевница хлопковая); Cyrtopeltis modesta Distant (клоп томатный); Dysdercus suturellus Herrich-Schäffer (красноклоп хлопковый); Euschistus servus Say (клоп коричневый вонючий); E. variolarius Palisot de Beauvois (щитник однопятнистый); Graptostethus spp. (комплекс клопов-наземников); Leptoglossus corculus Say (клоп-краевик сосновый); Lygus lineolaris Palisot de Beauvois (клоп луговой); L. Hesperus Knight (слепняк западный матовый); L. pratensis Linnaeus (клопик полевой); L. rugulipennis Poppius (клоп травяной европейский); Lygocoris pabulinus Linnaeus (зеленый слепняк); Nezara viridula Linnaeus (зеленый овощной клоп); Oebalus pugnax Fabricius (клоп-щитник рисовый); Oncopeltus fasciatus Dallas (клоп молочайный большой); Pseudatomoscelis seriatus Reuter (клоп-слепняк хлопковый).

Кроме того, варианты осуществления могут быть эффективными в отношении Hemiptera, таких как Calocoris norvegicus Gmelin (клопик картофельный); Orthops campestris Linnaeus; Plesiocoris rugicollis Fallen (клоп яблоневый северный); Cyrtopeltis modestus Distant (томатный клоп); Cyrtopeltis notatus Distant (клоп-слепняк); Spanagonicus albofasciatus Reuter (слепняк белоточечный); Diaphnocoris chlorionis Say (клоп-слепняк гледичии); Labopidicola allii Knight (слепняк луковый); Pseudatomoscelis seriatus Reuter (слепняк хлопковый); Adelphocoris rapidus Say (клоп быстрый); Poecilocapsus lineatus Fabricius (слепняк четырехлинейный); Nysius ericae Schilling (низиус вересковый); Nysius raphanus Howard (ложная черепашка); Nezara viridula Linnaeus (зеленый овощной клоп); Eurygaster spp.; Coreidae spp.; Pyrrhocoridae spp.; Tinidae spp.; Blostomatidae spp.; Reduviidae spp. и Cimicidae spp.

Также включены имаго и личинки из отряда Acari (клещи), такие как Aceria tosichella Keifer (галловый клещ пшеничный); Petrobia latens Müller (петробия многоядная); клещики паутинные и клещики красные семейства Tetranychidae, Panonychus ulmi Koch (красный плодовый клещ); Tetranychus urticae Koch (обыкновенный паутинный клещ); (T. mcdanieli McGregor (клещик Макданиела); T. cinnabarinus Boisduval (красный паутинный клещик); T. turkestani Ugarov & Nikolski (туркестанский паутинный клещик); плоские клещи семейства Tenuipalpidae, Brevipalpus lewisi McGregor (оранжевый клещ); ржавчинные и почковые клещи семейства Eriophyidae и другие клещи, питающиеся листьями, а также клещи, важные для здоровья человека и животных, т. е. пылевые клещи семейства Epidermoptidae, железницы семейства Demodicidae, зерновые клещи семейства Glycyphagidae, иксодовые клещи отряда Ixodidae. Ixodes scapularis Say (черноногий клещ); I. holocyclus Neumann (австралийский паралитический клещ); Dermacentor variabilis Say (клещ иксодовый собачий); Amblyomma americanum Linnaeus (иксодовый клещ Amblyomma) и конские и чесоточные клещи семейств Psoroptidae, Pyemotidae и Sarcoptidae.

Представляющими интерес насекомыми-вредителями из отряда Thysanura являются, например, Lepisma saccharina Linnaeus (чешуйница); Thermobia domestica Packard (термобия).

Дополнительные охватываемые вредители-артроподы включают: пауков из отряда Araneae, таких как Loxosceles reclusa Gertsch and Mulaik (бурый паук-отшельник) и Latrodectus mactans Fabricius (черная вдова), а также многоножек из отряда Scutigeromorpha, таких как Scutigera coleoptrata Linnaeus (обыкновенная мухоловка).

Насекомое-вредитель, представляющее интерес, включает надсемейство щитников и других родственных насекомых, в том числе без исключения виды, принадлежащие к семейству Pentatomidae (Nezara viridula, Halyomorpha halys, Piezodorus guildini, Euschistus servus, Acrosternum hilare, Euschistus heros, Euschistus tristigmus, Acrosternum hilare, Dichelops furcatus, Dichelops melacanthus, и Bagrada hilaris (клоп из рода Bagrada)), семейству Plataspidae (Megacopta cribraria - полушаровидный щитник) и семейству Cydnidae (Scaptocoris castanea - коричневый клоп-землекоп), а также виды Lepidoptera, в том числе без ограничения: моль капустную, например Helicoverpa zea Boddie; соевую совку, например Pseudoplusia includens Walker, и совку бархатных бобов, например Anticarsia gemmatalis Hübner.

Способы измерения пестицидной активности хорошо известны в уровне техники. См., например, Czapla and Lang, (1990) J. Econ. Entomol. 83:2480-2485; Andrews, et al., (1988) Biochem. J. 252:199-206; Marrone, et al., (1985) J. of Economic Entomology 78:290-293 и патент США № 5743477, все из которых включены в данный документ с помощью ссылки во полном объеме. Как правило, белок смешивают и применяют в анализах питания. См., например, Marrone, et al., (1985) J. of Economic Entomology 78:290-293. Такие анализы могут включать приведение растений в контакт с одним или несколькими вредителями и определение способности растения выживать и/или вызывать гибель вредителей.

Нематоды включают паразитических нематод, таких как галловые, цистообразующие и ранящие нематоды, в том числе Heterodera spp., Meloidogyne spp. и Globodera spp.; в частности, представителей цистообразующих нематод, в том числе без ограничения Heterodera glycines (соевая цистообразующая нематода); Heterodera schachtii (цистообразующая нематода свеклы); Heterodera avenae (цистообразующая нематода злаков), а также Globodera rostochiensis и Globodera pailida (цистообразующые нематоды картофеля). Ранящие нематоды включают Pratylenchus spp.

Средство для обработки семян

Для защиты и для повышения урожайности и улучшения технологий усовершенствования признаков дополнительные средства для обработки семян могут обеспечивать дополнительную приспособляемость культурных растений и экономически эффективный контроль в отношении насекомых, сорняков и заболеваний. Семенной материал можно обрабатывать, обычно обрабатывать поверхность с помощью композиции, содержащей комбинации химических или биологических гербицидов, антидотов гербицидов, инсектицидов, фунгицидов, ингибиторов и усилителей прорастания, питательных веществ, регуляторов и активаторов роста растений, бактерицидов, нематоцидов, авицидов и/или моллюскоцидов. Эти соединения обычно составляют вместе с дополнительными носителями, поверхностно-активными веществами или вспомогательными веществами, способствующими нанесению, традиционно используемыми в области, связанной с получением составов. Покрытия можно наносить с помощью пропитки материала для размножения жидким составом или с помощью покрытия комбинированным влажным или сухим составом. Примеры различных типов соединений, которые можно применять в качестве средств для обработки семян, представлены в The Pesticide Manual: A World Compendium, C.D.S. Tomlin Ed., опубликованном British Crop Production Council, который тем самым включен в данный документ с помощью ссылки.

Некоторые средства для обработки семян, которые можно применять в отношении семян сельскохозяйственных культур, включают без ограничения одно или несколько из абсцизовой кислоты, ацибензолар-S-метила, авермектина, амитрола, азаконазола, азоспириллума, азадирахтина, азоксистробина, Bacillus spp. (в том числе один или несколько из видов cereus, firmus, megaterium, pumilis, sphaericus, subtilis и/или thuringiensis), Bradyrhizobium spp. (в том числе один или несколько из betae, canariense, elkanii, iriomotense, japonicum, liaonigense, pachyrhizi и/или yuanmingense), каптана, карбоксина, хитозана, клотианидина, меди, циазипира, дифеноконазола, этидиазола, фипронила, флудиоксонила, флуоксастробина, флуквинконазола, флуразола, флуксофенима, белка гарпина, имазалила, имидаклоприда, ипконазола, изофлавеноидов, липохитоолигосахарида, манкозеба, марганца, манеба, мефеноксама, металаксила, метконазола, миклобутанила, PCNB, пенфлуфена, пинециллума, пентиопирада, перметрина, пикоксистробина, протиоконазола, пираклостробина, ринаксипира, S-метолахлора, сапонина, седаксана, TCMTB, тебуконазола, тиабендазола, тиаметоксама, тиокарба, тирама, толклофос-метила, триадименола, триходермы, трифлоксистробина, тритиконазола и/или цинка. Покрытие семян PCNB, относящееся к номеру регистрации EPA 00293500419, содержит квинтозен и терразол. TCMTB обозначает 2-(тиоцианометилтио)бензотиазол.

Сорта семян и семена со специфическими трансгенными признаками можно тестировать для определения того, какие дополнительные варианты обработки семян и нормы внесения могут дополнять такие сорта и трансгенные признаки для повышения урожайности. Например, сорт с хорошей потенциальной урожайностью, но восприимчивостью к пыльной головне, может выиграть от применения средства для обработки семян, которое обеспечивает защиту от пыльной головни, сорт с хорошей потенциальной урожайностью, но восприимчивостью к цистообразующим нематодам, может выиграть от применения средства обработки семян, которое обеспечивает защиту от цистообразующей нематоды и т. д. Аналогично, сорт, включающий трансгенный признак, который обеспечивает устойчивость к насекомым, может выиграть от второго механизма действия, придаваемого средством для обработки семян, сорт, включающий трансгенный признак, который придает устойчивость к гербициду, может выиграть от средства обработки семян с антидотом, который повышает устойчивость растений к такому гербициду и т. д. Кроме того, хорошее укоренение и ранняя всхожесть, которые являются результатом правильного применения средства для обработки семян, могут приводить к более эффективному использованию азота, лучшей способности переносить засуху и общему повышению потенциальной урожайности сорта или сортов, содержащих определенный признак, в комбинации со средством для обработки семян.

Способы уничтожения насекомого-вредителя и контроля популяции насекомых

В некоторых вариантах осуществления предусмотрены способы уничтожения насекомого-вредителя, предусматривающие приведение в контакт насекомого-вредителя с инсектицидно эффективным количеством по меньшей мере одного рекомбинантного перфорина растительного происхождения, в том числе без ограничения полипептида IPD079. В некоторых вариантах осуществления предусмотрены способы уничтожения насекомого-вредителя, предусматривающие приведение в контакт насекомого-вредителя с инсектицидно эффективным количеством рекомбинантного пестицидного белка под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140 или его варианта.

В некоторых вариантах осуществления предусмотрены способы контроля популяции насекомого-вредителя, предусматривающие приведение в контакт популяции насекомого-вредителя с инсектицидно эффективным количеством рекомбинантного полипептида IPD079. В некоторых вариантах осуществления предусмотрены способы контроля популяции насекомого-вредителя, предусматривающие приведение в контакт популяции насекомого-вредителя с инсектицидно эффективным количеством рекомбинантного полипептида IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140 или его варианта. Выражения "осуществление контроля популяции вредителя" или "контроль вредителя", используемые в данном документе, относятся к любому эффекту в отношении вредителя, который приводит к ограничению вреда, причиняемого вредителем. Контроль вредителя включает без ограничений уничтожение вредителя, подавление развития вредителя, изменение плодовитости или роста вредителя таким образом, что вредитель оказывает меньше вреда в отношении растения, снижение количества производимого потомства, получение менее приспособленных вредителей, получение вредителей, более восприимчивых к нападению хищников или удержание вредителей от поедания растения.

В некоторых вариантах осуществления предусмотрены способы контроля популяции насекомого-вредителя, устойчивого к пестицидному белку, включающие приведение в контакт популяции насекомого-вредителя с инсектицидно эффективным количеством рекомбинантного полипептида IPD079. В некоторых вариантах осуществления предусмотрены способы контроля популяции насекомого-вредителя, устойчивого к пестицидному белку, предусматривающие приведение в контакт популяции насекомого-вредителя с инсектицидно эффективным количеством рекомбинантного полипептида IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140 или его варианта.

В некоторых вариантах осуществления предусмотрены способы защиты растения от насекомого-вредителя, предусматривающие обеспечение экспрессии в растении или его клетке по меньшей мере одного гетерологичного рекомбинантного полинуклеотида, кодирующего полипептид IPD079. В некоторых вариантах осуществления предусмотрены способы защиты растения от насекомого-вредителя, предусматривающие обеспечение экспрессии в растении или его клетке рекомбинантного полинуклеотида, кодирующего полипептид IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140 или его варианты.

В некоторых вариантах осуществления предусмотрены способы защиты растения от насекомого-вредителя, предусматривающие обеспечение экспрессии в растении или его клетке по меньшей мере одного рекомбинантного полинуклеотида, кодирующего гетерологичный перфорин растительного происхождения. В некоторых вариантах осуществления предусмотрены способы защиты растения от насекомого-вредителя, предусматривающие обеспечение экспрессии в растении или его клетке по меньшей мере одного рекомбинантного полинуклеотида, кодирующего полипептид IPD094.

В некоторых вариантах осуществления предусмотрены способы защиты растения от насекомого-вредителя, предусматривающие обеспечение экспрессии в растении или его клетке по меньшей мере одного рекомбинантного полинуклеотида, кодирующего полипептид IPD094Aa под SEQ ID NO: 144 или его гомолог или вариант. В некоторых вариантах осуществления предусмотрены способы защиты растения от насекомого-вредителя, предусматривающие обеспечение экспрессии в растении или его клетке по меньшей мере одного рекомбинантного полинуклеотида, кодирующего гетерологичный перфорин растительного происхождения. В некоторых вариантах осуществления предусмотрены способы защиты растения от насекомого-вредителя, предусматривающие обеспечение экспрессии в растении или его клетке по меньшей мере одного рекомбинантного полинуклеотида, кодирующего гетерологичный перфорин растительного происхождения под любым из SEQ ID NO: 158-1248 или его гомолог или вариант.

Стратегии управления устойчивостью насекомых (IRM)

Было доказано, что экспрессия δ-эндотоксинов B. thuringiensis в трансгенных растениях кукурузы является эффективным средством контроля важных с точки зрения сельского хозяйства насекомых-вредителей (Perlak, et al., 1990; 1993). Однако, возникли насекомые, которые устойчивы к δ-эндотоксинам B. thuringiensis, экспрессирующимся в трансгенных растениях. Такая устойчивость, если она станет широко распространенной, будет явно ограничивать коммерческое значение идиоплазмы, содержащей гены, кодирующие такие δ-эндотоксины B. thuringiensis.

Одним способом повышения эффективности трансгенных инсектицидов в отношении целевых вредителей и одновременного снижения развития устойчивых к инсектицидам вредителей является применение полученных нетрансгенных (т. е. с неинсектицидным белком) рефугиев (раздел неинсектицидных сельскохозяйственных культур/кукурузы) для применения трансгенных сельскохозяйственных культур, вырабатывающих один инсектицидный белок, активный в отношении целевых вредителей. Управление по охране окружающей среды Соединенных Штатов Америки (epa.gov/oppbppdl/biopesticides/pips/bt_corn_refuge_2006.htm, доступ к которому можно получить с использованием приставки www) публикует требования по применению трансгенных сельскохозяйственных культур, вырабатывающих один Bt-белок, активный в отношении целевых вредителей. Кроме того, Национальная ассоциация кукурузоводов на своем веб-сайте: (ncga.com/insect-resistance-management-fact-sheet-bt-corn, доступ к которому можно получить с использованием приставки www) также предлагает аналогичные руководства, касающиеся требований к рефугиям. Из-за потерь, обусловленных насекомыми в пределах зоны регуфиев, более крупные рефугии могут снижать общую урожайность.

Другим способом повышения эффективности трансгенных инсектицидов в отношении целевых вредителей и одновременного снижения развития устойчивых к инсектицидам вредителям будет хранилище инсектицидных генов, которые эффективны в отношении групп насекомых-вредителей и которые проявляют свои эффекты посредством отличающихся механизмов действия.

Экспрессия в растении двух или более инсектицидных композиций, токсичных для одного вида насекомых, при этом каждый инсектицид экспрессируется на эффективных уровнях, будет представлять собой другой способ для достижения контроля развития устойчивости. Это основано на принципе, что эволюция устойчивости к двум отдельным механизмам действия значительно менее вероятна, чем только к одному. Например, Roush описывает стратегию двух токсинов, также называемую "создание пирамиды" или "пакетирование," для управления инсектицидными трансгенными сельскохозяйственными культурами. (The Royal Society. Phil. Trans. R. Soc. Lond. B. (1998) 353:1777-1786). Пакетирование или создание пирамиды из двух различных белков, каждый из которых эффективен в отношении целевых вредителей, и при этом отсутствует перекрестная устойчивость или она невелика, может обеспечивать возможность применения меньшего рефугия. Управление по охране окружающей среды США требует существенно меньший (как правило 5%) структурированный рефугий для высаживания кукурузы, не являющейся Bt, чем для продуктов с одним признаком (как правило 20%). Существуют различные способы обеспечения эффектов IRM рефугия, в том числе различные геометрические паттерны высаживания в полях и смеси семян "в мешке", как дополнительно обсуждается у Roush.

В некоторых вариантах осуществления перфорин растительного происхождения по настоящему изобретению, в том числе без ограничения полипептид IPD079, применимы в качестве стратегии управления устойчивостью насекомых в комбинации (т. е. в составе пирамиды) с другими пестицидными белками, в том числе без ограничения с Bt-токсинами, инсектицидными белками из Xenorhabdus sp. или Photorhabdus sp. и т. п.

Предусмотрены способы контроля заражения(заражений) насекомыми из отряда Lepidoptera и/или Coleoptera трансгенного растения, которые обеспечивают управление устойчивостью насекомых, предусматривающие обеспечение экспрессии в растении по меньшей мере двух различных инсектицидных белков, характеризующихся отличающимися механизмами действия.

В некоторых вариантах осуществления способы контроля заражения насекомыми из отряда Lepidoptera и/или Coleoptera трансгенного растения и содействия в управлении устойчивостью насекомых по меньшей мере к одному из инсектицидных белков предусматривают полипептид IPD094, инсектицидный в отношении насекомых из отряда Lepidoptera и/или Coleoptera.

В некоторых вариантах осуществления способы контроля заражения насекомыми из отряда Lepidoptera и/или Coleoptera трансгенного растения и содействия в управлении устойчивостью насекомых по меньшей мере к одному из инсектицидных белков предусматривают перфорин растительного происхождения, инсектицидный в отношении насекомых из отряда Lepidoptera и/или Coleoptera.

В некоторых вариантах осуществления способы контроля заражения насекомыми из отряда Lepidoptera и/или Coleoptera трансгенного растения и содействия в управлении устойчивостью насекомых по меньшей мере к одному из инсектицидных белков предусматривают полипептид IPD079, инсектицидный в отношении насекомых из отряда Lepidoptera и/или Coleoptera.

В некоторых вариантах осуществления способы контроля заражения насекомыми из отряда Lepidoptera и/или Coleoptera трансгенного растения и содействия в управлении устойчивостью насекомых по меньшей мере к одному из инсектицидных белков предусматривают полипептид IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140 или его варианты, инсектицидные в отношении насекомых из отряда Lepidoptera и/или Coleoptera.

В некоторых вариантах осуществления способы контроля заражения насекомыми из отряда Lepidoptera и/или Coleoptera трансгенного растения и содействия в управлении устойчивостью насекомых предусматривают обеспечение экспрессии в трансгенном растении полипептида IPD079 и белка Cry, инсектицидных в отношении насекомых из отряда Lepidoptera и/или Coleoptera, при этом они характеризуются отличающимися механизмами действия.

В некоторых вариантах осуществления способы контроля заражения насекомыми из отряда Lepidoptera и/или Coleoptera трансгенного растения и содействия в управлении устойчивостью насекомых предусматривают обеспечение экспрессии в трансгенном растении полипептида IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140 или его вариантов и белка Cry, инсектицидных в отношении насекомых из отряда Lepidoptera и/или Coleoptera, при этом они характеризуются отличающимися механизмами действия.

Также предусмотрены способы снижения вероятности появления устойчивости у насекомых из отряда Lepidoptera и/или Coleoptera к трансгенным растениям, экспрессирующим в растениях инсектицидные белки для контроля видов насекомых, предусматривающие обеспечение экспрессии полипептида IPD079, инсектицидного в отношении вида насекомых, в комбинации со вторым белком, инсектицидным в отношении вида насекомых, при этом они характеризуются отличающимися механизмами действия.

Также предусмотрены средства для эффективного управления устойчивостью насекомых из отряда Lepidoptera и/или Coleoptera к трансгенным растениям, предусматривающие совместную экспрессию на высоких уровнях в растениях двух или более инсектицидных белков, токсичных для насекомых из отряда Lepidoptera и/или Coleoptera, но при этом каждый проявляет отличающийся механизм осуществления его активности применительно к уничтожению, где два или более инсектицидных белка предусматривают полипептид IPD079 и белок Cry. Также предусмотрены средства для эффективного управления устойчивостью насекомых из отряда Lepidoptera и/или Coleoptera к трансгенным растениям, предусматривающие совместную экспрессию на высоких уровнях в растениях двух или более инсектицидных белков, токсичных для насекомых из отряда Lepidoptera и/или Coleoptera, но при этом каждый проявляет отличающийся механизм осуществления его активности применительно к уничтожению, где два или более инсектицидных белка предусматривают полипептид IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140 или его варианты и белок Cry.

Кроме того, предусмотрены способы получения разрешения контролирующих органов для выращивания или коммерческой реализации растений, экспрессирующих белки, инсектицидные в отношении насекомых из отряда Lepidoptera и/или Coleoptera, включающие стадию обращения, предоставления или ссылки на данные анализов связывания белков насекомых, демонстрирующие, что полипептид IPD079 не конкурирует с сайтами связывания для белков Cry у таких насекомых. Кроме того, предусмотрены способы получения разрешения контролирующих органов для выращивания или коммерческой реализации растений, экспрессирующих белки, инсектицидные в отношении насекомых из отряда Lepidoptera и/или Coleoptera, предусматривающие стадию обращения, предоставления или ссылки на данные анализов связывания белков насекомых, демонстрирующие, что полипептид IPD079 под SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, или SEQ ID NO: 140 или его вариант не конкурирует с сайтами связывания белков Cry у таких насекомых.

Способы увеличения урожайности растения

Предусмотрены способы увеличения урожайности. Способы предусматривают получение растения или растительной клетки, экспрессирующих полинуклеотид, кодирующий пестицидную полипептидную последовательность, раскрытую в данном документе, и выращивание растения или его семени в поле, зараженном вредителем, в отношении которого полипептид характеризуется пестицидной активностью. В некоторых вариантах осуществления полипептид характеризуется пестицидной активностью в отношении вредителя из группы чешуекрылых, жесткокрылых, двукрылых, полужесткокрылых или нематод, и при этом поле заражено вредителем из группы чешуекрылых, полужесткокрылых, жесткокрылых, двукрылых или нематод.

Как определено в данном документе, "урожайностью" растения называют качество и/или количество биомассы, продуцируемой растением. Выражение "биомасса", используемое в данном документе, относится к любому измеренному продукту растения. Увеличением продукции биомассы является любое улучшение урожайности измеренного продукта растения. Увеличение урожайности растения имеет несколько коммерческих применений. Например, увеличение биомассы листьев растения может приводить к увеличению урожайности листовых овощей для потребления человеком или животными. Кроме того, увеличение биомассы листьев можно применять для увеличения производства фармацевтических или промышленных продуктов растительного происхождения. Увеличение урожайности может предусматривать любое статистически значимое увеличение, в том числе без ограничения по меньшей мере 1% повышение, по меньшей мере 3% повышение, по меньшей мере 5% повышение, по меньшей мере 10% повышение, по меньшей мере 20% повышение, по меньшей мере 30% повышение, по меньшей мере 50% повышение, по меньшей мере 70% повышение, по меньшей мере 100% или большее повышение урожайности по сравнению с растением, не экспрессирующим пестицидную последовательность.

В конкретных способах урожайность растения повышается в результате улучшенной устойчивости к вредителю растения, экспрессирующего полипептид IPD079, раскрытый в данном документе. Экспрессия полипептида IPD079 приводит к сниженной способности вредителя к заражению растения или питанию на растении, улучшая таким образом урожайность растения.

Способы переработки

Дополнительно предусмотрены способы переработки растения, части растения или семени с получением пищевого или кормового продукта из растения, части растения или семени, содержащих перфорин растительного происхождения или полипептид IPD079. Растения, части растения или семена, предусматриваемые в данном документе, можно перерабатывать с получением масла, белковых продуктов и/или побочных продуктов, которые являются производными, полученными путем переработки, которые имеют коммерческое значение. Неограничивающие примеры включают трансгенные семена, содержащие молекулу нуклеиновой кислоты, кодирующую полипептид IPD079, который можно перерабатывать с получением соевого масла, соевых продуктов и/или побочных продуктов сои.

"Переработка" относится к любым физическим и химическим способам, применяемым для получения какого-либо соевого продукта, и включает без ограничения кондиционирование нагреванием, вальцевание и измельчение, экструзию, экстракцию растворителем или вымачивание в воде и экстракцию цельных или дробленых семян.

Следующие примеры представлены для иллюстрации, а не для ограничения.

ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ

Пример 1. Идентификация инсектицидного белка IPD079Aa, активного в отношении вида Diabrotica , из Huperzia phlegmaria

Инсектицидный белок IPD079Aa (SEQ ID NO: 2) идентифицировали посредством очистки белка, масс-спектрометрии (MS) и ПЦР-клонирования из Huperzia phlegmaria (L.) Rothm., (Id. № PS-8582) следующим образом. Образец Huperzia phlegmaria (L.) Rothm. (Id. № PS-8582) собирали, подвергали быстрому замораживанию в жидком N2 и хранили при -80°C. После хранения его измельчали в мелкий порошок при температуре жидкого N2 с помощью шаровой мельницы Geno/Grinder® (SPEX Sample Prep LLC, Метачен, Нью-Джерси). Для экстракции белка к каждым 5 граммам сырого веса ткани добавляли 20 мл 50 мМ буфера Tris, pH 8,0, 150 мМ KCl, 2,5 мМ EDTA, 1,5% поливинилполипирролидона (PVPP) и смесь ингибиторов протеаз (Roche Diagnostics, Германия). Гомогенат центрифугировали для удаления клеточного дебриса, фильтровали через фильтры с размером пор 0,22 мкм и подвергали обессоливанию с применением центрифужных колонок для обессоливания Zeba™ на 10 мл (Thermo Scientific, Иллинойс).

Биологические анализы in vitro в отношении западного кукурузного жука (WCRW) (Diabrotica virgifera virgifera) проводили с применением обессоленного экстракта белков, помещенного на питательную среду для Coleoptera на основе агара (Southland Products Inc., Лейк-Виллидж, Арканзас) в формате 96-луночного планшета. Применяли по три повторности на каждый образец. Образцы оставляли высыхать на поверхности питательной среды, и от пяти до восьми новорожденных насекомых помещали в каждую лунку обработанного планшета. После 48 часов инкубации при 27°C личинок оценивали в отношении смертности или степени остановки роста. Баллы регистрировали количественно как погибшие (3), со значительной остановкой роста (2) (незначительный рост или отсутствие роста, но живые и эквивалентные личинкам 1-ого возраста), с остановкой роста (1) (рост до второго возраста, но не эквивалентны контролям) или нормальные (0). Воздействие на образец протеиназы K и тепловых обработок приводило к потере активности, указывая на то, что образец был белковым по природе. Результаты биологических анализов показаны в таблице 1.

Таблица 1

Активность экстракта белков из H. phlegmaria в отношении личинок западного кукурузного жука
Средний балл обессоленного материала Средний балл после обработки протеиназой K/тепловой обработки
2 0

Пример 2. Очистка гомологов IPD079Aa

Применяемая схема очистки белков представляла собой следующую: измельчали 50 г растительного материала PS-8582, экстрагировали белковую фракцию и подвергали обессоливанию, как описано в примере 1. Обессоленный материал наносили на колонку HiTrap™ с SP на 5 мл от GE (GE, Пискатауэй, Нью-Джерси) и элюировали с помощью линейного градиента от 0 до 0,35 M NaCl в 50 мМ MES, pH 6,0, в 30 объемах колонки с получением фракций по 1,5 мл. Элюат SP идентифицировали в качестве активного в отношении WCRW посредством биологического анализа in vitro (как описано выше). Элюированную фракцию концентрировали с применением фильтра Amicon® с отсечением по молекулярной массе 3 кДа (Millipore, Биллерика, Массачусетс). Сконцентрированный в ~3,2x ретентат переносили в 30% (NH4)2SO4. Раствор 30% (NH4)2SO4 центрифугировали для удаления любого осадка и наносили на колонку HiTrap™ для HIC с бутилом на 1 мл от GE (GE, Пискатауэй, Нью-Джерси) и элюировали с помощью линейного градиента от 1 до 0 M (NH4)2SO4 в 50 мM MES, pH 6,0, в 50 объемах колонки с получением фракций по 1,0 мл. Фракции обессоливали на колонках для обессоливания Zeba™ на 0,5 мл (Thermo Scientific, Иллинойс) для удаления (NH4)2SO4. Активные в отношении WCRW фракции идентифицировали в качестве активных посредством биологического анализа in vitro (как описано выше). SDS-PAGE активных фракций содержал полосу, окрашенную Coomassie®, соответствующую ~55 кДа, которую вырезали и расщепляли трипсином.

Секвенирование и идентификацию белка выполняли посредством анализа с помощью масс-спектрометрии (MS) после расщепления белка трипсином. Белки для идентификации с помощью MS получали после прогона образца на геле LDS-PAGE, окрашенном бриллиантовым синим G-250 Coomassie®. Две полосы, представляющие интерес, вырезали из геля, удаляли краситель, восстанавливали с помощью дитиотреитола и затем алкилировали с помощью йодоацетамида. После расщепления трипсином в течение ночи образцы подвергали анализу с помощью жидкостной хроматографии-масс-спектрометрии (LC-MS). Анализ с помощью жидкостной хроматографии-тандемной масс-спектрометрии (LC-MS/MS) расщепленных трипсином пептидов проводили с применением электрораспыления на масс-спектрометре QToF Premiere™ (Waters®, Милфорд, Массачусетс), объединенном с системой LC для наноразмерного масштаба NanoAcquity™ (Waters®, Милфорд, Массачусетс), с градиентом от 2% ацетонитрила, 0,1% муравьиной кислоты до 60% ацетонитрила, 0,1% муравьиной кислоты. Полученные данные LC-MS анализировали с помощью Protein Lynx Global Server (Waters®, Милфорд, Массачусетс) с получением данных о последовательности DeNovo. Результаты масс-спектрометрии в отношении последовательности показали, что полипептид IPD079Aa (SEQ ID NO: 2) был сходен с перфорином при проведении поиска по базе данных со сравнением с последовательностями транскриптома Huperzia phlegmaria (Id. № PS-8582), описанного в примере 3.

Пример 3. Секвенирование транскриптома Huperzia phlegmaria

Транскриптом Huperzia phlegmaria (Id. № PS-8582) получали следующим образом. Общую РНК выделяли из замороженных тканей с применением набора RNeasy® (Qiagen®) для выделения общей РНК. Библиотеки для секвенирования из полученной общей РНК получали с применением набора для секвенирования мРНК TruSeq™ и протокола от Illumina®, Inc. (Сан-Диего, Калифорния). Вкратце, мРНК выделяли путем присоединения к гранулам с олиго(dT), фрагментировали до среднего размера 180 нуклеотидов, подвергали обратной транскрипции в кДНК с помощью случайных гексамерных праймеров, подвергали репарации концов, добавляли 3' A-хвост и лигировали с помощью пронумерованных адаптеров TruSeq™ от Illumina®. Лигированные фрагменты кДНК подвергали ПЦР-амплификации с применением праймеров TruSeq™ от Illumina® и очищенные продукты ПЦР проверяли в отношении качества и количества на чипе Agilent Bioanalyzer® DNA 7500. После оценки качества и количества по 100 нг библиотек транскриптов нормализовали путем обработки с помощью дуплекс-специфичной нуклеазы (DSN) (Evrogen®, Москва, Россия). Нормализацию завершали путем добавления 200 мМ буфера Hepes, за которым следовала тепловая денатурация и пять часов гибридизации при 68°C. Гибридизированную библиотеку обрабатывали с помощью 2 мкл фермента DSN в течение 25 минут, очищали с помощью колонок Qiagen® MinElute® в соответствии с протоколами производителя, и амплифицировали двенадцать циклов с применением специфичных в отношении адаптера праймеров от Illumina®. Конечные продукты очищали с помощью гранул Ampure® XP (Beckman Genomics, Данверс, Массачуссетс) и проверяли в отношении качества и количества на чипе Agilent Bioanalyzer® DNA 7500.

Нормализованные библиотеки транскриптов секвенировали в соответствии с протоколами производителя на Illumina® Genome Analyzer IIx. Каждую библиотеку гибридизировали в проточных ячейках с двумя дорожками и амплифицировали, блокировали, линеализировали и гибридизировали с праймером с помощью процесса получения клональных кластеров на cBot® от Illumina. Секвенирование завершали на Genome Analyzer IIx, который давал шестьдесят миллионов ридов со спаренными концами из 75 п.о. на нормализованную библиотеку.

В отношении пептидных последовательностей, идентифицированных для IPD079Aa (SEQ ID NO: 2) с помощью LC-MS-секвенирования (описанного в примере 3), проводили поиск со сравнением с белковыми последовательностями, прогнозируемыми с помощью открытых рамок считывания (ORF) из внутренних транскриптомных сборок для PS-8582. Пептиды давали точное совпадение с транскриптом, соответствующим IPD079Aa (SEQ ID NO: 1). Кодирующие последовательности применяли для конструирования следующих праймеров: GATTACCATATGGCCCAAATAGAGC (SEQ ID NO: 1249) и GCTAACTCGAGCTAGTCTAAATGACG (SEQ ID NO: 1250) для клонирования кодирующей последовательности IPD079Aa. Этот клон получали с помощью полимеразной цепной реакции с применением набора для ПЦР HF Advantage® (Clontech™, 1290 Terra Bella Ave., Маунтин-Вью, Калифорния, 94043) и кДНК, полученной из общей РНК из Huperzia phlegmaria с применением набора SuperScript® II (Thermo Fischer Scientific, Уолтем, Массачусетс), в качестве матрицы. Клонированную последовательность подтверждали секвенированием. На основе результатов секвенирования ДНК и белка полинуклеотидная последовательность IPD079Aa показана как SEQ ID NO: 1, а полипептидная последовательность IPD079Aa как SEQ ID NO: 2.

Пример 4. Идентификация инсектицидного белка IPD079Ea, активного в отношении вида Diabrotica , из Ophioglossum pendulum

Инсектицидный белок IPD079Ea (SEQ ID NO: 56) идентифицировали посредством очистки белка, масс-спектрометрии (MS) и ПЦР-клонирования из Ophioglossum pendulum (L.), (Id. № PS-9145) следующим образом. Образец Ophioglossum pendulum (L.). (Id. № PS-9145) собирали, подвергали быстрому замораживанию в жидком N2 и хранили при -80°C. После хранения его измельчали в мелкий порошок при температуре жидкого N2 с помощью шаровой мельницы Geno/Grinder® (SPEX Sample Prep LLC, Метачен, Нью-Джерси). Для экстракции белка к каждым 5 граммам сырого веса ткани добавляли 20 мл 50 мМ буфера Tris, pH 8,0, 150 мМ KCl, 2,5 мМ EDTA, 1,5% поливинилполипирролидона (PVPP) и смесь ингибиторов протеаз (Roche Diagnostics, Германия). Гомогенат центрифугировали для удаления клеточного дебриса, фильтровали через фильтры с размером пор 0,22 мкм и подвергали обессоливанию с применением центрифужных колонок для обессоливания Zeba™ на 10 мл (Thermo Scientific, Иллинойс).

Биологические анализы in vitro в отношении западного кукурузного жука (WCRW) (Diabrotica virgifera virgifera) проводили с применением обессоленного экстракта белков, помещенного на питательную среду для Coleoptera на основе агара (Southland Products Inc., Лейк-Виллидж, Арканзас) в формате 96-луночного планшета. Применяли по три повторности на каждый образец. Образцы оставляли высыхать на поверхности питательной среды, и от пяти до восьми новорожденных насекомых помещали в каждую лунку обработанного планшета. После 72 часов инкубации при 27°C личинок оценивали в отношении смертности или степени остановки роста. Баллы регистрировали количественно как погибшие (3), со значительной остановкой роста (2) (незначительный рост или отсутствие роста, но живые и эквивалентные личинкам 1-ого возраста), с остановкой роста (1) (рост до второго возраста, но не эквивалентны контролям) или нормальные (0). Воздействие на образец протеиназы K и тепловых обработок приводило к потере активности, указывая на то, что образец был белковым по природе. Результаты биологических анализов показаны в таблице 2.

Таблица 2

Активность экстракта белков из O. pendulum (L.) в отношении личинок западного кукурузного жука
Средний балл обессоленного материала Средний балл после обработки протеиназой K/тепловой обработки
3 0

Пример 5. Очистка гомологов IPD079Ea

Схема очистки белков состояла в следующем: измельчали 10 г растительного материала PS-9145, и белок экстрагировали и подвергали обессоливанию, как описано в примере 1. Обессоленный материал наносили на колонку Q HiTrap™ на 1 мл от GE (GE, Пискатауэй, Нью-Джерси). Белок элюировали из колонки с помощью линейного градиента от 0 до 0,7 M NaCl в 50 мM Tris, pH 8,0, в 100 объемах колонки и собирали фракции по 1,0 мл. Элюированные фракции, которые демонстрировали активность в отношении WCRW в биологическом анализе in vitro (как описано выше), объединяли и концентрировали в 3-6 раз с применением фильтра Amicon® с отсечением по молекулярной массе 3 кДа (Millipore, Биллерика, Массачусетс). Концентрированные фракции разделяли на SDS-PAGE, окрашивали с помощью Coomassie®, и окрашенную полосу, соответствующую ~55 кДа, вырезали и расщепляли трипсином для анализа MS.

Секвенирование и идентификацию белка выполняли посредством анализа с помощью масс-спектрометрии (MS) после расщепления белка трипсином. Белки для идентификации с помощью MS получали после прогона образца на геле LDS-PAGE, окрашенном бриллиантовым синим G-250 Coomassie®. Полосы, представляющие интерес, вырезали из геля, удаляли краситель, восстанавливали с помощью дитиотреитола и затем алкилировали с помощью йодоацетамида. После расщепления трипсином в течение ночи образцы подвергали анализу с помощью жидкостной хромотографии-масс-спектрометрии (LC-MS). Анализ с помощью LC-MS расщепленных трипсином пептидов выполняли с применением электрораспыления на масс-спектрометре QToF Premiere™ (Waters®, Милфорд, Массачусетс), объединенном с системой LC для наноразмерного масштаба NanoAcquity™ (Waters®, Милфорд, Массачусетс), с градиентом от 2% ацетонитрила, 0,1% муравьиной кислоты до 60% ацетонитрила, 0,1% муравьиной кислоты. Полученные данные LC-MS анализировали с помощью Protein Lynx Global Server (Waters®, Милфорд, Массачусетс) с получением данных о последовательности DeNovo.

Пример 6. Анализы в отношении Coleoptera с использованием очищенных полипептидов IPD079 и IPD094, экспрессированных в E. coli

Полинуклеотид IPD079Aa (SEQ ID NO: 1), кодирующий полипептид IPD079Aa (SEQ ID NO: 2), субклонировали в вектор pET14b (Novagen) с помощью сайтов рестрикции NdeI/XhoI в рамке с N-концевой меткой 6xHis, за которой следовал сайт расщепления тромбина. Ген (SEQ ID NO: 1), кодирующий IPD079Aa (SEQ ID NO: 2), также амплифицировали с помощью прямого праймера под SEQ ID NO: 154 и обратного праймера под SEQ ID NO: 155 для лигирования в векторе pET28 с N-концевой меткой 6x His, за которой следовал белок E.coli, связывающий мальтозу (Duplay et al. (1984) J. Biol. Chem. 259:10606-10613). Полинуклеотид IPD079Ea (SEQ ID NO: 55), кодирующий полипептид IPD079Ea (SEQ ID NO: 56), амплифицировали из кДНК, полученной из общей РНК из Ophioglossum pendulum, с применением прямого праймера под SEQ ID NO: 1251 и обратного праймера под SEQ ID NO: 1252. Полученный ПЦР-продукт субклонировали с применением набора для клонирования Gibson Assembly (NEB) в вектор pET28 с N-концевой меткой 6x His, за которой следовал белок E. coli, связывающий мальтозу. Полинуклеотид IPD094Aa (SEQ ID NO: 143), кодирующий полипептид IPD094Aa (SEQ ID NO: 144), амплифицировали из кДНК, полученной из общей РНК из Selaginella victoriae, с применением прямого праймера под SEQ ID NO: 1253 и обратного праймера под SEQ ID NO: 1254. Полученный ПЦР-продукт субклонировали в вектор pET28 с N-концевой меткой 6x His, за которой следовал белок E. coli, связывающий мальтозу. Химически компетентные клетки E. coli OverExpress™ C41(DE3) (Lucigen Corp., Миддлтон, Висконсин, 53562) (Miroux B. et al. Journal of Molecular Biology 260:289-298, 1996) трансформировали с помощью ДНК-плазмиды pET, содержащей соответствующую генную вставку IPD079 для рекомбинантной экспрессии белка. Трансформированные клетки E. coli выращивали в течение ночи при 37°C с отбором с помощью канамицина, а затем высевали в свежую среду 2xYT (1:25) и далее выращивали до обеспечения оптической плотности приблизительно 0,8. Экспрессию белка индуцировали путем добавления 0,3 мM IPTG, и клетки дополнительно выращивали при 16°C в течение 16 часов. Экспрессированные E. coli белки очищали c помощью хроматографии с использованием иммоблизированных ионов металла с применением агарозы Ni-NTA (Qiagen®, Германия) или амилозной смолы (NEB) в соответствии с протоколами производителя. Очищенные фракции загружали в колонки для обессоливания PD-10 (GE Life Sciences, Питтсбург, США), предварительно уравновешенные с помощью буфера 1xPBS. 3 мл буфера для элюирования загружали в каждую колонку, и из каждой колонки собирали по 2,5 мл элюата.

Серии концентраций очищенных образцов белка анализировали в отношении насекомых из отряда Coleoptera и рассчитывали концентрации для 50% смертности (LC50) или подавления роста 50% особей (IC50). Для определения инсектицидной активности белков IPD079 в отношении WCRW (Diabrotica virgifera) проводили биологические анализы со включением их в питательную среду, используя 20 мкл очищенных образцов белка, смешанных с 75 мкл искусственной питательной среды для WCRW (на основе Bio-Serv F9800B), в каждой из 96 лунок планшета для биологического анализа, затем высушивали на воздухе. После обеспечения питания на питательной среде при одинаковой дозе в течение одного дня по одной личинке помещали в каждую лунку 96-луночного планшета. Анализ проводили в течение шести (1+5) дней при 25°C без света, и затем оценивали смертность и остановку роста. Для определения инсектицидной активности белков IPD079 в отношении NCRW (Diabrotica barberi) проводили биологические анализы со включением их в питательную среду, используя 10 мкл очищенных образцов белка, смешанных с 50 мкл искусственной питательной среды для WCRW (на основе Bio-Serv F9800B), в каждой из 96 лунок планшета для биологического анализа, затем высушивали на воздухе. После обеспечения питания на питательной среде при одинаковой дозе в течение одного дня по две новорожденные личинки помещали в каждую лунку 96-луночного планшета. Анализ проводили в течение четырех (1+3) дней при 25°C без света, и затем оценивали смертность и остановку роста. Результаты в отношении WCRW и NCRW для IPD079Aa (SEQ ID NO: 2), IPD079Ea (SEQ ID NO: 56) и IPD094Aa (SEQ ID NO: 144), экспрессированных и очищенных из системы экспрессии на основе E. coli с использованием слитой на аминоконце полигистидиновой метки (NT His) или слияния с белком, связывающим мальтозу (MBP), показаны в таблице 3.

Таблица 3

Белок Активность в отношении WCRW Активность в отношении NCRW
NT His IPD079Aa (SEQ ID NO: 2) LC50=90-124 ppm
IC50=24-61 ppm
LC50 ~ 99 ppm
ILC50 ~ 11 ppm
MBP IPD079Aa (SEQ ID NO: 2) LC50=48 ppm
IC50=20 ppm
Не тестировали
MBP IPD079Ea
(SEQ ID NO: 56)
LC50=6,9 ppm
IC50=4,1 ppm
LC50=7,3 ppm
ILC50=3,0 ppm
NT His IPD094Aa
(SEQ ID NO: 144)
LC50=28 ppm
IC50=13 ppm
LC50 > 200 ppm
ILC50=93 ppm

Полипептид IPD079Aa (SEQ ID NO: 2), полипептид IPD079Ea (SEQ ID NO: 54) и полипептид IPD094Aa (SEQ ID NO: 144) также тестировали в отношении SCRW (Diabrotica undecimpunctata howardi). Биологические анализы проводили с использованием 10 мкл очищенных образцов белка, смешанных с 50 мкл искусственной питательной среды для SCRW (на основе Bio-Serv F9800B), в каждой из 96 лунок планшета для биологического анализа (BD Falcon 353910). Различное количество новорожденных Diabrotica undecimpunctata howardi (от 3 до 5) помещали в каждую лунку 96-луночного планшета. Анализ проводили в течение четырех дней при 25°C без света, и затем оценивали смертность и остановку роста. IPD094Aa (SEQ ID NO: 144) не проявлял активность в отношении новорожденных Diabrotica undecimpunctata howardi в концентрациях до 1250 ppm. IPD079Aa анализировали в виде чистого лизата, при этом наиболее высокая доза IPD079Aa составляла 50 ppm. Данные для полипептидов IPD079 показаны в таблице 4.

Таблица 4

WCRW IC50 SCRW Наиболее высокая тестируемая концентрация, ppm IC50
IPD079Aa
(SEQ ID NO: 2)
Гибель 25 ppm Не обнаружено 50
IPD079Ea
(SEQ ID NO: 56)
Гибель 6 ppm Гибель 1400 40
IPD079Ee
(SEQ ID NO: 64)
Гибель 15 ppm Не тестировали Не тестировали
IPD079Ef
(SEQ ID NO: 66)
Гибель 4 ppm Не тестировали Не тестировали
IPD094Aa
(SEQ ID NO: 144)
Гибель 25-80 ppm Не обнаружено 1250

Пример 7. Анализы в отношении Lepidoptera с использованием очищенных полипептидов IPD079, экспрессированных в E. coli

Анализы с обеспечением питания Lepidoptera проводили на искусственной питательной среде в 96-луночном планшете. Очищенный белок включали в специфичную для чешуекрылых искусственную питательную среду в соотношении 10 мкл белка на 40 мкл питательной смеси. Две из пяти новорожденных личинок помещали в каждую лунку с обеспечением питания ad libitum в течение 5 дней. Результаты выражали как положительные в отношении реакций личинок, таких как остановка развития и/или смертность. Результаты выражали как отрицательные, если личинки были подобны отрицательному контролю, который питался питательной средой, в которую вносили только вышеуказанный буфер.

Полипептид IPD079Ea (SEQ ID NO: 56) анализировали на огневке кукурузной (Ostrinia nubilalis), совке кукурузной (Helicoverpa zea), совке-ипсилон (Agrotis ipsilon) и совке травяной (Spodoptera frugiperda). Не наблюдали активности в отношении видов Lepidoptera, тестируемых с использованием полипептида IPD079Ea (SEQ ID NO: 56) при концентрации вплоть до 2000 ppm. Чистый лизат полипептида IPD079Aa (SEQ ID NO: 2) анализировали в отношении вышеуказанных насекомых и дополнительно на совке бархатных бобов (Anticarsia gemmatalis) и соевой совке (Pseudoplusia includens). Активности в отношении видов Lepidoptera не наблюдалось ни для каких гомологов IPD079Aa при концентрациях белков вплоть до 50 ppm.

Пример 8. Идентификация гомологов IPD079Aa

Аминокислотную последовательность полипептида IPD079Aa (SEQ ID NO: 2) подвергали поиску BLAST (средство поиска основного локального выравнивания; Altschul, et al., (1993) J. Mol. Biol. 215:403-410; см. также ncbi.nlm.nih.gov/BLAST/, доступ к которому можно получить с использованием приставки www) со сравнением с открытой и внутренней базой данных DUPONT-PIONEER, которая включала последовательности растительных белков. Аминокислотные последовательности выравнивали с белками в проприетарной базе данных белков от DUPONT-PIONEER. Гомологи полипептида IPD079Aa (SEQ ID NO: 2) идентифицировали в Huperzia salvinioides (Id. № PS-9141) и Huperzia nummulariifolium (Id. № PS-9151) и клонировали с помощью обратной транскрипции с использованием системы синтеза первой нити SuperScript® (Invitrogen) согласно инструкциям производителя с последующим проведением полимеразной цепной реакции с применением набора для ПЦР HF Advantage® (Clontech™, 1290 Terra Bella Ave., Маунтин-Вью, Калифорния, 94043) с праймерами под SEQ ID NO: 1255 и SEQ ID NO: 1256 для Huperzia salvinioides (Id. № PS-9141) и из Huperzia nummulariifolium (Id. № PS-9151) с использованием праймеров под SEQ ID NO: 1257 и SEQ ID NO: 1258. Полученные в результате ПЦР-продукты клонировали непосредственно в плазмидный вектор pCR®-Blunt® II-TOPO® с помощью набора для клонирования Zero Blunt® TOPO® (Life Technology). Выполняли секвенирование ДНК у случайных клонов. Два уникальных гомолога полипептида IPD079, IPD079Ab (SEQ ID NO: 4) и IPD079Ac (SEQ ID NO: 6), идентифицировали в Huperzia salvinioides (Id. № PS-9141), и 24 уникальных гомолога IPD079, IPD079Ad (SEQ ID NO: 8), IPD079Ae (SEQ ID NO: 10), IPD079Af (SEQ ID NO: 12), IPD079Ag (SEQ ID NO: 14), IPD079Ah (SEQ ID NO: 16), IPD079Ai (SEQ ID NO: 18), IPD079Aj (SEQ ID NO: 20), IPD079Ak (SEQ ID NO: 22), IPD079Al (SEQ ID NO: 26), IPD079Am (SEQ ID NO: 28), IPD079An (SEQ ID NO: 30), IPD079Ao (SEQ ID NO: 32), IPD079Ap (SEQ ID NO: 36), IPD079Aq (SEQ ID NO: 38), IPD079Ar (SEQ ID NO: 40), IPD079As (SEQ ID NO: 44), IPD079At (SEQ ID NO: 46), IPD079Au (SEQ ID NO: 48), IPD079Av (SEQ ID NO: 50), IPD079Aw (SEQ ID NO: 52), IPD079Ax (SEQ ID NO: 54), IPD079Ba (SEQ ID NO: 24), IPD079Bb (SEQ ID NO: 34), IPD079Bc (SEQ ID NO: 42), идентифицировали в Huperzia nummulariifolium (Id. № PS-9151). Гомологи IPD079Aa, исходный материал, идентификатор кодирующей последовательности полинуклеотида и идентификатор последовательности полипептида IPD079 показаны в таблице 5. Таблицы 8a-8c представляют собой матричные таблицы попарных взаимоотношений идентичности для глобальных выравниваний (пустые части матричной таблицы не показаны) на основе алгоритма Нидлмана-Вунша, реализованного в программе Needle (комплекс инструментов EMBOSS), гомологов IPD079Aa из примеров 1, 8 и 10.

Таблица 5

Название Вид Идентификационный № Полинуклеотид Полипептид
IPD079Aa Lycopodium phlegmaria PS-8582AF SEQ ID NO: 1 SEQ ID NO: 2
IPD079Ab Huperzia salvinioides PS-9141AF SEQ ID NO: 3 SEQ ID NO: 4
IPD079Ac Huperzia salvinioides PS-9141AF SEQ ID NO: 5 SEQ ID NO: 6
IPD079Ad Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 7 SEQ ID NO: 8
IPD079Ae Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 9 SEQ ID NO: 10
IPD079Af Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 11 SEQ ID NO: 12
IPD079Ag Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 13 SEQ ID NO: 14
IPD079Ah Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 15 SEQ ID NO: 16
IPD079Ai Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 17 SEQ ID NO: 18
IPD079Aj Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 19 SEQ ID NO: 20
IPD079Ak Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 21 SEQ ID NO: 22
IPD079Ba Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 23 SEQ ID NO: 24
IPD079Al Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 25 SEQ ID NO: 26
IPD079Am Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 27 SEQ ID NO: 28
IPD079An Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 29 SEQ ID NO: 30
IPD079Ao Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 31 SEQ ID NO: 32
IPD079Bb Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 33 SEQ ID NO: 34
IPD079Ap Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 35 SEQ ID NO: 36
IPD079Aq Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 37 SEQ ID NO: 38
IPD079Ar Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 39 SEQ ID NO: 40
IPD079Bc Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 41 SEQ ID NO: 42
IPD079As Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 43 SEQ ID NO: 44
IPD079At Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 45 SEQ ID NO: 46
IPD079Au Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 47 SEQ ID NO: 48
IPD079Av Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 49 SEQ ID NO: 50
IPD079Aw Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 51 SEQ ID NO: 52
IPD079Ax Lycopodium nummulariifolium PS-9151AF SEQ ID NO: 53 SEQ ID NO: 54
IPD079Eb Platycerium bifurcatum PS-9135AF SEQ ID NO: 57 SEQ ID NO: 58
IPD079Ea Ophioglossum pendulum PS-9145AF SEQ ID NO: 55 SEQ ID NO: 56
IPD079Ec Ophioglossum pendulum PS-9145AF SEQ ID NO: 59 SEQ ID NO: 60
IPD079Ed Ophioglossum pendulum PS-9145AF SEQ ID NO: 61 SEQ ID NO: 62
IPD079Ee Ophioglossum pendulum PS-9145AF SEQ ID NO: 63 SEQ ID NO: 64
IPD079Ef Ophioglossum pendulum PS-9145AF SEQ ID NO: 65 SEQ ID NO: 66
IPD079Eg Ophioglossum pendulum PS-9145AF SEQ ID NO: 67 SEQ ID NO: 68
IPD079Eh Ophioglossum pendulum PS-9145AF SEQ ID NO: 69 SEQ ID NO: 70

Полинуклеотиды IPD079Aa (SEQ ID NO: 1), IPD079Ab (SEQ ID NO: 3), IPD079Ac (SEQ ID NO: 5), IPD079Ad (SEQ ID NO: 7), IPD079Ae (SEQ ID NO: 9), IPD079Af (SEQ ID NO: 11) и IPD079Ba (SEQ ID NO: 23) клонировали в вектор pET14b (Novagen) с меткой 6x His или вектор pCOLD™ 3 (Clontech, 1290 Terra Bella Ave., Маунтин-Вью, Калифорния, 94043) для экспрессии в E. coli. В тестируемых конструкциях IPD079Aa (SEQ ID NO: 2) являлся растворимым и активным в отношении WCRW; полипептиды IPD079Ab (SEQ ID NO: 4) и IPD079Ac (SEQ ID NO: 6) являлись растворимыми, но не проявляли активности в отношении WCRW при тестируемых концентрациях; полипептиды IPD079Ad (SEQ ID NO: 8), IPD079Ae (SEQ ID NO: 10), IPD079Af (SEQ ID NO: 12) и IPD079Ba (SEQ ID NO: 24) не являлись растворимыми.

С помощью поиска BLAST в Selaginella victoriae также идентифицировали полипептид под SEQ ID NO: 144, называемый в данном документе IPD094Aa, который характеризуется 21% идентичностью последовательности с IPD079Aa (SEQ ID NO: 2), но его идентифицировали на основе гомологии сходства с перфорином. Полипептид IPD094Aa (SEQ ID NO: 144) кодируется полинуклеотидом под SEQ ID NO: 143.

Пример 9. Идентификация гомологов IPD079Ea

Гомологи IPD079Ea (SEQ ID NO: 56) идентифицировали в Ophioglossum pendulum (Id. № PS-9145) и Platycerium bifurcatum (Id. № PS-9135), клонировали с помощью обратной транскрипции согласно инструкциям производителя (система синтеза первой нити SuperScript®, Invitrogen) с последующим проведением полимеразной цепной реакции (набор для ПЦР HF Advantage® (Clontech™, 1290 Terra Bella Ave., Маунтин-Вью, Калифорния, 94043) с использованием праймеров под SEQ ID NO: 1251 и SEQ ID NO: 1252 для Ophioglossum pendulum, а для Platycerium bifurcatum с использованием праймеров под SEQ ID: 156 и SEQ ID NO: 1252. Полученные в результате ПЦР-продукты субклонировали с помощью набора для клонирования Gibson Assembly® (New England Biolabs, 240 County Road, Ипсвич, Массачусетс, 01938-2723) в вектор pET28 с N-концевой меткой 6x His, за которой следовал белок E. coli, связывающий мальтозу (Duplay et al. (1984) J. Biol. Chem. 259:10606-10613). Шесть уникальных гомологов IPD079Ea, IPD079Ec (SEQ ID NO: 60), IPD079Ed (SEQ ID NO: 62), IPD079Ee (SEQ ID NO: 64), IPD079Ef (SEQ ID NO: 66), IPD079Eg (SEQ ID NO: 68), IPD079Eh (SEQ ID NO: 70), идентифицировали в Ophioglossum pendulum (Id. № PS-9145), и один уникальный гомолог IPD079Ea, IPD079Eb (SEQ ID NO: 58), идентифицировали в Platycerium bifurcatum (Id. № PS-9135).

Гомологи IPD079Ea, исходный материал, идентификатор кодирующей последовательности полинуклеотида и идентификатор последовательности полипептида IPD079 показаны в таблице 6. Таблицы 9a-9c представляют собой матричные таблицы попарных взаимоотношений идентичности для глобальных выравниваний (пустые части матричной таблицы не показаны) на основе алгоритма Нидлмана-Вунша, реализованного в программе Needle (комплекс инструментов EMBOSS), гомологов IPD079Ea из примеров 4, 9 и 10.

Таблица 6

Название Вид Идентификационный № Полинуклеотид Полипептид
IPD079Eb Platycerium bifurcatum PS-9135AF SEQ ID NO: 57 SEQ ID NO: 58
IPD079Ea Ophioglossum pendulum PS-9145AF SEQ ID NO: 55 SEQ ID NO: 56
IPD079Ec Ophioglossum pendulum PS-9145AF SEQ ID NO: 59 SEQ ID NO: 60
IPD079Ed Ophioglossum pendulum PS-9145AF SEQ ID NO: 61 SEQ ID NO: 62
IPD079Ee Ophioglossum pendulum PS-9145AF SEQ ID NO: 63 SEQ ID NO: 64
IPD079Ef Ophioglossum pendulum PS-9145AF SEQ ID NO: 65 SEQ ID NO: 66
IPD079Eg Ophioglossum pendulum PS-9145AF SEQ ID NO: 67 SEQ ID NO: 68
IPD079Eh Ophioglossum pendulum PS-9145AF SEQ ID NO: 69 SEQ ID NO: 70

Электрокомпетентные клетки E. coli OverExpress™ C41 (DE3) (Lucigen Corp., Миддлтон, Висконсин, 53562) (Miroux B. et al. Journal of Molecular Biology 260:289-298, 1996) трансформировали с помощью каждого из векторов pET, содержащих генную вставку IPD079Eb (SEQ ID NO: 58), или IPD079Ec (SEQ ID NO: 59), или IPD079Ee (SEQ ID NO: 63), или IPD079Ef (SEQ ID NO: 65) для рекомбинантной экспрессии белка. Трансформированные клетки E. coli выращивали в течение ночи при 37°C с отбором с помощью канамицина в 3 миллилитрах среды 2xYT. Один миллилитр этой культуры использовали для инокуляции 1 литра среды 2xYT. Когда культуры достигали оптической плотности приблизительно 0,8, индуцировали экспрессию белка путем добавления 1 мM IPTG. Клетки дополнительно выращивали при 16°C в течение 16 часов. Клетки собирали с помощью центрифугирования и лизировали в 30 микролитрах 20 мM Tris, pH 8, содержащего реагент для экстракции бактериального белка 1/4X B-PER® II (Life Technologies), дополненного раствором лизоцима Ready-Lyse™ (Epicentre), эндонуклеазой OmniCleave™ (Epicentre, 5602 Research Park Blvd., Suite 200, Мэдисон, Висконсин, 53719) и набором со смесью ингибиторов протеаз V (EMD Millipore). Лизат осветляли путем центрифугирования. Ген IPD079Ec (SEQ ID NO: 59) не экспрессировался до достаточно высоких уровней для определения активности. Полипептиды IPD079Eb (SEQ ID NO: 58), IPD079Ee (SEQ ID NO: 64) и IPD079Ef (SEQ ID NO: 66) являлись активными в биологическом анализе в отношении WCRW.

Пример 10. Идентификация гомологов IPD079 по идентичности 5'- и 3'-концов

Для идентификации дополнительных гомологов IPD079 выравнивания гомологов генов IPD079Aa и IPD079Ea, идентифицированных в примерах 1, 4, 8 и 9, использовали для идентификации консервативных последовательностей вблизи 5'- и 3'-концов кодирующих последовательностей. Конструировали множество ПЦР-праймеров в пределах этих консервативных последовательностей. Обратную транскрипцию выполняли с помощью системы синтеза первой нити SuperScript® (Invitrogen) согласно инструкциям производителя с последующим проведением полимеразной цепной реакции с использованием высокоточной ДНК-полимеразы Phusion® (New England BioLabs) из Ophioglossum pendulum (Id. № PS-9145) с использованием праймеров 79E_GS_F (SEQ ID NO: 1264), 79_GS_R (SEQ ID NO: 1265), 79E_F1 (SEQ ID NO: 1266), 79E_R1 (SEQ ID NO: 1267), и из Huperzia goebelii (Id. № PS-9149) и Huperzia carinata (Id. № PS-11847) с использованием праймеров F1 (SEQ ID NO: 1259), F2 (SEQ ID NO: 1260), F3 (SEQ ID NO: 1261), R1 (SEQ ID NO: 1262), R2 (SEQ ID NO: 1263). Полученные в результате ПЦР-продукты клонировали непосредственно в плазмидный вектор pCR®-Blunt II-TOPO® с применением набора для клонирования Zero Blunt® TOPO® (Life Technology) и секвенировали ДНК. Двенадцать уникальных гомологов IPD079Aa, IPD079Ay (SEQ ID NO: 72), IPD079Az (SEQ ID NO: 74), IPD079Bd (SEQ ID NO: 76), IPD079Be (SEQ ID NO: 78), IPD079Bf (SEQ ID NO: 80), IPD079Bg (SEQ ID NO: 82), IPD079Bh (SEQ ID NO: 84), IPD079Bi (SEQ ID NO: 86), IPD079Bj (SEQ ID NO: 88), IPD079Bk (SEQ ID NO: 90), IPD079Bl (SEQ ID NO: 92), IPD079Bm (SEQ ID NO: 94), идентифицировали в Huperzia goebelii (Id. № PS-9149) и Huperzia carinata (Id. № PS-11847). Двадцать четыре уникальных гомолога IPD079Ea, IPD079Ei (SEQ ID NO: 96), IPD079Ej (SEQ ID NO: 98), IPD079Ek (SEQ ID NO: 100), IPD079El (SEQ ID NO: 102), IPD079Em (SEQ ID NO: 104), IPD079En (SEQ ID NO: 106), IPD079Eo (SEQ ID NO: 108), IPD079Ep (SEQ ID NO: 110), IPD079Eq (SEQ ID NO: 112), IPD079Er (SEQ ID NO: 114), IPD079Es (SEQ ID NO: 116), IPD079Et(SEQ ID NO: 118), IPD079Eu (SEQ ID NO: 120), IPD079Ev (SEQ ID NO: 122), IPD079Ew (SEQ ID NO: 124), IPD079Ex (SEQ ID NO: 126), IPD079Ey (SEQ ID NO: 128), IPD079Ez (SEQ ID NO: 130), IPD079Eaa (SEQ ID NO: 132), IPD079Eab (SEQ ID NO: 134), IPD079Eac (SEQ ID NO: 136), IPD079Ead (SEQ ID NO: 138), IPD079Eae (SEQ ID NO: 140), IPD079Eaf (SEQ ID NO: 142), идентифицировали в Ophioglossum pendulum. Гомологи IPD079, исходный материал, идентификатор кодирующей последовательности полинуклеотида и идентификатор последовательности полипептида IPD079 показаны в таблице 7.

Кодирующие последовательности гомологов IPD079Ea амплифицировали с праймерами 79AA_F-2 (SEQ ID NO: 1268), 79AA:5K_F-2 (SEQ ID NO: 1269), 79AA:2V:3N_F-2 (SEQ ID NO: 1270), 79AA_R (SEQ ID NO: 1271), 79EA_F-2 (SEQ ID NO: 1272), 79EA:4K:5T_F-2 (SEQ ID NO: 1273), 79EA_R (SEQ ID NO: 1274) и субклонировали с помощью Gibson Assembly® (New England BioLabs) в вектор pET28a с N-концевой меткой 6x His, за которой следовал белок E. coli, связывающий мальтозу (Duplay et al. (1984) J. Biol. Chem. 259:10606-10613), для экспрессии в E. coli. Гомологи IPD079Aa и гомологи IPD079Ea, показанные в таблице 7, экспрессировались в растворимом виде и являлись активными в отношении WCRW при тестируемых концентрациях, за исключением IPD079Bf (SEQ ID NO: 80), IPD079Bk (SEQ ID NO: 90), IPD079Bl (SEQ ID NO: 92), IPD079Bm (SEQ ID NO: 92), и IPD079Ep (SEQ ID NO: 110).

Таблица 7

Вид Идентификационный № Последовательность ДНК Белковая последовательность
IPD079Ay Huperzia goebelii PS-9149 SEQ ID NO: 71 SEQ ID NO: 72
IPD079Az Huperzia goebelii PS-9149 SEQ ID NO: 73 SEQ ID NO: 74
IPD079Bd Huperzia carinata PS-11487 SEQ ID NO: 75 SEQ ID NO: 76
IPD079Be Huperzia carinata PS-11487 SEQ ID NO: 77 SEQ ID NO: 78
IPD079Bf Huperzia carinata PS-11487 SEQ ID NO: 79 SEQ ID NO: 80
IPD079Bg Huperzia carinata PS-11487 SEQ ID NO: 81 SEQ ID NO: 82
IPD079Bh Huperzia carinata PS-11487 SEQ ID NO: 83 SEQ ID NO: 84
IPD079Bi Huperzia carinata PS-11487 SEQ ID NO: 85 SEQ ID NO: 86
IPD079Bj Huperzia carinata PS-11487 SEQ ID NO: 87 SEQ ID NO: 88
IPD079Bk Huperzia carinata PS-11487 SEQ ID NO: 89 SEQ ID NO: 90
IPD079Bl Huperzia carinata PS-11487 SEQ ID NO: 91 SEQ ID NO: 92
IPD079Bm Huperzia carinata PS-11487 SEQ ID NO: 93 SEQ ID NO: 94
IPD079Ei Ophioglossum pendulum PS-9145 SEQ ID NO: 95 SEQ ID NO: 96
IPD079Ej Ophioglossum pendulum PS-9145 SEQ ID NO: 97 SEQ ID NO: 98
IPD079Ek Ophioglossum pendulum PS-9145 SEQ ID NO: 99 SEQ ID NO: 100
IPD079El Ophioglossum pendulum PS-9145 SEQ ID NO: 101 SEQ ID NO: 102
IPD079Em Ophioglossum pendulum PS-9145 SEQ ID NO: 103 SEQ ID NO: 104
IPD079En Ophioglossum pendulum PS-9145 SEQ ID NO: 105 SEQ ID NO: 106
IPD079Eo Ophioglossum pendulum PS-9145 SEQ ID NO: 107 SEQ ID NO: 108
IPD079Ep Ophioglossum pendulum PS-9145 SEQ ID NO: 109 SEQ ID NO: 110
IPD079Eq Ophioglossum pendulum PS-9145 SEQ ID NO: 111 SEQ ID NO: 112
IPD079Er Ophioglossum pendulum PS-9145 SEQ ID NO: 113 SEQ ID NO: 114
IPD079Es Ophioglossum pendulum PS-9145 SEQ ID NO: 115 SEQ ID NO: 116
IPD079Et Ophioglossum pendulum PS-9145 SEQ ID NO: 117 SEQ ID NO: 118
IPD079Eu Ophioglossum pendulum PS-9145 SEQ ID NO: 119 SEQ ID NO: 120
IPD079Ev Ophioglossum pendulum PS-9145 SEQ ID NO: 121 SEQ ID NO: 122
IPD079Ew Ophioglossum pendulum PS-9145 SEQ ID NO: 123 SEQ ID NO: 124
IPD079Ex Ophioglossum pendulum PS-9145 SEQ ID NO: 125 SEQ ID NO: 126
IPD079Ey Ophioglossum pendulum PS-9145 SEQ ID NO: 127 SEQ ID NO: 128
IPD079Ez Ophioglossum pendulum PS-9145 SEQ ID NO: 129 SEQ ID NO: 130
IPD079Eaa Ophioglossum pendulum PS-9145 SEQ ID NO: 131 SEQ ID NO: 132
IPD079Eab Ophioglossum pendulum PS-9145 SEQ ID NO: 133 SEQ ID NO: 134
IPD079Eac Ophioglossum pendulum PS-9145 SEQ ID NO: 135 SEQ ID NO: 136
IPD079Ead Ophioglossum pendulum PS-9145 SEQ ID NO: 137 SEQ ID NO: 138
IPD079Eae Ophioglossum pendulum PS-9145 SEQ ID NO: 139 SEQ ID NO: 140
IPD079Fa Ophioglossum pendulum PS-9145 SEQ ID NO: 141 SEQ ID NO: 142

Электрокомпетентные клетки E. coli OverExpress™ C41 (DE3) (№ по кат. 60341, Lucigen Corp., 2905 Parmenter Street, Миддлтон, Висконсин) трансформировали каждым из векторов pET, содержащих соответствующую генную вставку IPD079, для рекомбинантной экспрессии белка. Трансформированные клетки E. coli выращивали в течение ночи при 37°C с отбором с помощью канамицина в 3 миллилитрах среды 2xYT. Один миллилитр этой культуры использовали для инокуляции 1 литра среды 2xYT. Когда культуры достигали оптической плотности приблизительно 0,8, индуцировали экспрессию белка путем добавления 1 мM IPTG. Клетки дополнительно выращивали при 16°C в течение 16 часов. Клетки собирали с помощью центрифугирования и лизировали в 30 микролитрах 20 мM Tris, pH 8, содержащего реагент для экстракции бактериального белка 1/4X B-PER® II (Life Technologies), дополненный раствором лизоцима Ready-Lyse™ (Epicentre), эндонуклеазой OmniCleave™ (Epicentre) и набором со смесью ингибиторов протеаз V (EMD Millipore). Лизаты осветляли путем центрифугирования.

Осветленные лизаты использовали в анализе с питательной средой для оценки влияния полипептидов IPD079 на личинок западного кукурузного жука (WCRW) (Diabrotica virgifera). Биологические анализы в отношении WCRW проводили с использованием процедуры включения в питательную среду и/или процедуры с нанесением образцов на питательную среду в рамках биологического анализа. Для биологических анализов с нанесением образцов на питательную среду 15 мкл осветленного лизата наносили поверхностно на 65 мкл модифицированной искусственной питательной среды для личинок WCRW (Bio-Serv F9800B) в каждой из 96 лунок планшета для биологического анализа (белый планшет Proxi-Plate, Perkin Elmer, № по кат. 6006299), затем высушивали на воздухе. Для биологических анализов со включением в питательную среду 15 мкл осветленного лизата смешивали с 65 мкл модифицированной искусственной питательной среды для личинок WCRW (Bio-Serv F9800B) в каждой из 96 лунок планшета для биологического анализа (белый планшет Proxi-Plate, Perkin Elmer, № по кат. 6006299), затем высушивали на воздухе в течение короткого периода времени. Для обоих способов биологического анализа как с нанесением образцов на питательную среду, так и с включением в питательную среду различное количество новорожденных WCRW (Diabrotica virgifera) (от 3 до 10) помещали в каждую лунку 96-луночного планшета. Анализы проводили в течение трех дней при 27°C с непрерывным освещением, и затем оценивали смертность и остановку роста. Проводили от четырех до восьми повторностей на каждый образец белка в зависимости от имеющегося объема образца. Каждую из четырех или восьми повторностей оценивали в баллах по шкале 0-3 (0 отсутствие эффекта, 1 небольшая задержка роста, 2 сильная задержка роста, 3 смертность) таким образом, что максимальное количество баллов для каждого образца составляло 12 (для анализа с четырьмя повторностями) и 24 (для анализа с восемью повторностями). Как среднее количество баллов, так и суммарное количество баллов использовали для дифференциации активности. Если средний балл для образца составлял ≥ 1, его считали активным при тестируемой концентрации белка в очищенном лизате.

Пример 11. Идентификация растительных перфоринов с помощью профильных HMM

IPD079Aa (SEQ ID NO: 2) и другие представители семейства полипептидов IPD079, приводимые в качестве примера, проявляют гомологию с белками с доменом мембраноатакующего комплекса/перфорина (MACPF), который имеет Pfam ID № IPR020864 (ссылка на базу данных Pfam: en.wikipedia.org/wiki/Pfam, доступ к которому можно получить с использованием приставки www).

Растительные перфорины идентифицировали путем осуществления запроса в отношении белковых последовательностей гомологов IPD079 и Pfam ID № IPR020864 с использованием BLAST и HMMSearch с сопоставлением с собственной базой данных транскриптомных сборок из целевых видов растений. Трансляции совпадений по HMM транскриптома перфорина получали во всех шести рамках считывания, при этом трансляции проводили от метионинового до стоп-кодона с размером белка >= 50 аминокислот. HMMSearch повторяли с использованием полученных в результате транслированных последовательность для исключения последовательностей, которые транслируются в неправильных рамках считывания. Идентифицированные таким образом гомологи выравнивали с помощью программного обеспечения MUSCLE (Edgar, Robert C. (2004), Nucleic Acids Research 19; 32(5):1792-7) с использованием программы MEGA 6 (Molecular Evolutionary Genetic Analysis -Tamura K., et al (2013) Mol. Biol. Evol. 30 (12): 2725-2729). Филогенетический анализ проводили с использованием программы MEGA 6 и способа максимального правдоподобия (Jones D.T., et al (1992). Comp Appl Biosci 8: 275-282; Tamura K., et al (2013) Mol. Biol. Evol. 30 (12): 2725-2729). Ответвления полученного в результате дерева аннотировали, сгруппировав в пять основных клад, и для каждой группы проводили субвыравнивания.

Основанный на HMM модуль пакета программного обеспечения HMMER® 3.0 (Finn, R., Nucleic Acid Research 39: Web Server issue W20-W37, 2011) использовали для создания профиля HMM для семейства полипептидов IPD079 на основе множественного выравнивания последовательностей (MSA) гомологов IPD079 по настоящему изобретению, IPD094Aa (SEQ ID NO: 144) по настоящему изобретению и активного бактериального перфорина AXMI-205 (публикация заявки на патент США 20110023184). Представителей каждой основной ветви выравнивали и использовали для построения HMM. Профильные HMM являются статистическими моделями множественных выравниваний последовательностей или даже отдельных последовательностей. С их помощью собирают специфичную в отношении положения информацию о том, насколько консервативным является каждый столбец выравнивания и какие остатки являются вероятными. HMMER® (анализ биологических последовательностей с применением профильных скрытых моделей Маркова) применяют для поиска гомологов белковых последовательностей в базах данных последовательностей и для осуществления выравниваний белковых последовательностей. HMMER® можно применять для поиска в базах данных последовательностей в отношении отдельных запрашиваемых последовательностей, но он становится в особенности эффективным, когда запросом является множественное выравнивание последовательностей семейства последовательностей. HMMER® создает профиль запроса, который задает специфичную в отношении положения систему оценки применительно к заменам, вставкам и делециям. Профили HMMER® представляют собой вероятностные модели, называемые "профильными скрытыми моделями Маркова" (профильные HMM) (Krogh et al., 1994, J. Mol. Biol., 235:1501-1531; Eddy, 1998, Curr. Opin. Struct. Biol., 6:361-365; Durbin et al., Probabilistic Models of Proteins and Nucleic Acids. Cambridge University Press, Cambridge UK. 1998, Eddy, Sean R., март 2010, руководство пользователя HMMER версии 3.0, Исследовательский кампус Джанелиа-фарм Медицинского института Говарда Хьюза, Ашберн, Вирджиния, США; публикация заявки на патент США № US20100293118). По сравнению с BLAST, FASTA и другими средствами выравнивания последовательностей и поиска в базах данных на основании более ранних методик оценки, с помощью HMMER® добиваются значительно большей точности и большей возможности обнаружения отдаленных гомологов благодаря эффективности лежащих в ее основе вероятностных моделей.

Все белковые последовательности, которые соответствовали профильной HMM Pfam ID № IPR020864 при E-значении менее 0,01 и имели длину более 250 аминокислот, рассматривали в качестве статистически значимых и соответствующих семейству генов. Поскольку все полученные статистически значимые совпадения белковых последовательностей являются представителями семейства генов растительного перфорина, предполагается, что профильная HMM применительно к известным активным бактериальным перфоринам является специфичной для расположения иерархии растительных перфоринов и идентификации других представителей семейства растительного перфорина. Были идентифицированы представители семейства растительного перфорина под SEQ ID NO: 158-1248.

Пример 12. Отсутствие перекрестной устойчивости IPD079Aa у устойчивого к mCry3A штамма WCRW

Штамм WCRW, устойчивый к mCry3A (RR>92-кратного), получали путем отбора WCRW на трансгенных по mCry3A растениях маиса с T0-уровнем экспрессии mCry3A при >10000 ppm общего белка в корнях шести отборов на личинках F3, F6, F7, F8, F10 и F12. Дополнительные отборы WCRW проводили на трансгенных по mCry3A растениях маиса с T0-уровнем экспрессии mCry3A при >30000 ppm белков в корнях до использования личинок для тестирования перекрестной устойчивости IPD079Aa (SEQ ID NO: 2). Биологические анализы со включением в питательную среду в отношении WCRW использовали для оценки влияний IPD079Aa (SEQ ID NO: 2) на личинки WCRW с помощью того же способа, что использовали в примере 5. Оценивали смертность и сильное отставание в росте насекомых, что использовали для расчета ингибиторных концентраций (IC50 и LC50) на основе пробит-анализа. Показатель устойчивости (RR) рассчитывали следующим образом: RR=(LC/IC50 устойчивого WCRW)/(LC/IC50 чувствительного WCRW). Как показано в таблице 10, устойчивые к Cry3A насекомые WCRW были чувствительны к IPD079Aa (SEQ ID NO: 2).

Таблица 10

Колония WCRW LC/IC IPD079Aa, ppm 95%CL Показатель устойчивости
Чувствительные к Cry3A LC50 90,01 66-132 1
IC50 24,45 19-31 1
Устойчивые к Cry3A LC50 99,04 79-122 1,1
IC50 34,6 27-43 1,4

Пример 13. Механизм действия

Для понимания механизма токсичности полипептида IPD079 оценивали специфичное связывание очищенных IPD079Aa (SEQ ID NO: 2) и IPD079Ea (SEQ ID NO: 56) с тканями средней кишки WCRW с помощью анализов конкуренции in vitro. Среднюю кишку извлекали из личинок WCRW третьего возраста для получения мембранных везикул щеточной каймы (BBMV), следуя способу, модифицированному по Wolfersberger et al. (Comp Bioch Physiol 86A: 301-308 (1987)), используя аминопептидазную активность для отслеживания обогащения. BBMV представляют собой компонент апикальной мембраны эпителиальных клеток, выстилающих ткань средней кишки насекомых, и, таким образом, служат в качестве модельной системы того, каким образом инсектицидные белки взаимодействуют внутри кишки после поглощения.

Обеспечивали экспрессию рекомбинантных IPD079Aa (SEQ ID NO: 2) и IPD079Ea (SEQ ID NO: 56) и очищали из системы экспрессии на основе E. coli с использованием слитой на аминоконце полигистидиновой метки (6x His). Полноразмерный очищенный белок метили с помощью Alexa-Fluor® 488 (Life Technologies) и невключенный флуорофор отделяли от меченого белка с помощью смолы для замены буфера (Life Technologies, A30006) в соответствии с рекомендациями производителя. До проведения экспериментов по связыванию количество белков оценивали с помощью денситометрии в геле с последующим окрашиванием с помощью Simply Blue® (Thermo Scientific) разделенных на SDS-PAGE образцов, которые включали BSA в качестве стандарта.

Буфер для связывания состоял из 50 мМ хлорида натрия, 2,7 мM хлорида калия, 8,1 мM моногидрофосфата натрия и 1,47 мM дигидрофосфата калия, pH 7,5. Для демонстрации специфического связывания и оценки аффинности BBMV (5 мкг) инкубировали с 1 нМ меченых Alexa IPD079Aa (SEQ ID NO: 2) или IPD079Ea (SEQ ID NO: 56) в 100 мкл буфера для связывания в течение 1 часа при RT в отсутствии и присутствии повышающихся концентраций немеченых IPD079Aa (SEQ ID NO: 2) или IPD079Ea (SEQ ID NO: 56). Центрифугирование при 20000g применяли для осаждения BBMV для отделения несвязанного токсина, оставшегося в растворе. Затем осадок BBMV дважды промывали буфером для связывания для удаления оставшегося несвязанного токсина. Конечный осадок BBMV (со связанным флуоресцентным токсином) солюбилизировали в восстанавливающем буфере Лэммли для образцов, нагревали до 100°C в течение 5 минут и подвергали SDS-PAGE с использованием 4-12% Bis-Tris полиакриламидных гелей (Life Technologies). Количество меченых Alexa IPD079Aa (SEQ ID NO: 2) или IPD079Ea (SEQ ID NO: 56) в геле из каждого образца измеряли посредством цифровой системы визуализации флуоресценции (Image Quant LAS4000 от GE Healthcare). Оцифрованные изображения анализировали с помощью денситометрического программного обеспечения (Phoretix 1D, TotalLab, Ltd.)

Кажущуюся аффинность IPD079Aa (SEQ ID NO: 2) в отношении BBMV WCRW устанавливали на основании концентрации немеченого белка, необходимой для снижения связывания меченого Alexa IPD079Aa (SEQ ID NO: 2) на 50% (значение EC50). Это значение составляло приблизительно 1 мкМ для связывания IPD079Aa (SEQ ID NO: 2) с BBMV WCRW (фигура 3).

Аналогично, кажущуюся аффинность IPD079Ea (SEQ ID NO: 56) в отношении BBMV WCRW устанавливали на основании концентрации немеченого белка, необходимой для снижения связывания меченого Alexa IPD079Ea (SEQ ID NO: 56) на 50%. Значение EC50 для связывания IPD079Ea (SEQ ID NO: 56) составляло приблизительно 1,1 мкM (фигура 4).

Пример 14. Конструкции вектора экспрессии для экспрессии полипептидов IPD079 в растениях

Векторы экспрессии у растений конструировали со включением трансгенной кассеты, содержащей одну из двух различных генных конструкций, кодирующих IPD079Aa (SEQ ID NO: 2), и одну из двух различных генных конструкций, кодирующих IPD079Ea (SEQ ID NO: 56) под контролем промотора гена убиквитина маиса в комбинации с энхансерным элементом. Полученные в результате конструкции, PHP68039, PHP68040, PHP76130 и PHP76131 соответственно, использовали для получения трансгенных объектов маиса для тестирования эффективности в отношении кукурузного жука, обусловленной экспрессией полипептидов IPD079Aa (SEQ ID NO: 2) и IPD079Ea (SEQ ID NO: 56).

Пример 15. Опосредованная Agrobacterium трансформация маиса и регенерация трансгенных растений

Для опосредованной Agrobacterium трансформации маиса нуклеотидными последовательностями IPD079 использовали способ Zhao (патент США № 5981840 и публикация заявки на патент согласно PCT № WO 1998/32326; содержание которых включено тем самым в данный документ с помощью ссылки). Вкратце, из маиса выделяли незрелые зародыши, и зародыши приводили в контакт с суспензией Agrobacterium в условиях, при которых бактерии были способными переносить векторы PHP68039, PHP68040, PHP76130 и PHP76131 по меньшей мере в одну клетку по меньшей мере одного из незрелых зародышей (стадия 1: стадия инфицирования). На этой стадии незрелых зародышей погружали в суспензию Agrobacterium для инициации инокуляции. Зародыши в течение некоторого времени культивировали совместно с Agrobacterium (стадия 2: стадия совместного культивирования). Незрелые зародыши культивировали на твердой среде после стадии инфицирования. После периода совместного культивирования предполагалась необязательная стадия "покоя". На этой стадии покоя зародыши инкубировали в присутствии по меньшей мере одного антибиотика, который, как известно, подавляет рост Agrobacterium, без добавления селективного средства для трансформации растений (стадия 3: стадия покоя). Незрелые зародыши культивировали на твердой среде с антибиотиком, но без селективного средства, для элиминации Agrobacterium и в течение фазы покоя для инфицированных клеток. Затем, инокулированные зародыши культивировали на среде, содержащей селективное средство, и выделяли растущий трансформированный каллюс (стадия 4: стадия отбора). Незрелые зародыши культивировали на твердой среде с селективным средством, что приводило к селективному росту трансформированных клеток. Затем каллюс регенерировали с получением растений (стадия 5: стадия регенерации), и каллюсы, выросшие на селективной среде, культивировали на твердой среде для регенерации растений.

Для выявления белков IPD079 в ткани листьев 4 лиофилизированных высеченных с помощью штамповочного пресса кругов из листьев/образец растирали в порошок и ресуспендировали в 100 мкл PBS, содержащем 0,1% Tween 20 (PBST), 1% бета-меркаптоэтанола, содержащего 1 таблетку/7 мл ингибитора протеиназ Complete Mini (Roche 1183615301). Суспензию обрабатывали ультразвуком в течение 2 мин, а затем центрифугировали при 4°C, 20000 g в течение 15 мин. К надостадочной жидкости добавляли аликвоту из 1/3 объема 3X NuPAGE® LDS буфера для образца (Invitrogen™ (Калифорния, США), 1% B-ME, содержащего 1 таблетку/7 мл ингибитора протеиназы Complete Mini. Реакционную смесь нагревали при 80°C в течение 10 мин, а затем центрифугировали. Образец надосадочной жидкости загружали на гели 4-12% Bis-Tris Midi с подвижным буфером MES в соответствии с инструкциями производителя (Invitrogen™) и переносили на нитроцеллюлозную мембрану с применением устройства iBlot® (Invitrogen™). Нитроцеллюлозную мембрану инкубировали в PBST, содержащем 5% сухого обезжиренного молока, в течение 2 часов перед инкубацией в течение ночи с очищенным с помощью аффинной хроматографии антителом кролика к IPD079Aa в PBST в течение ночи. Мембрану трижды промывали PBST, а затем инкубировали в PBST в течение 15 мин, а затем двукратно по 5 мин перед инкубацией в течение 2 часов в PBST с антителом козы к Ig кролика, конъюгированным с HRP, в течение 3 часов. Выявленные белки визуализировали с использованием реагентов для вестерн-блоттинга ECL (GE Healthcare, № по кат. RPN2106) и пленки Kodak® Biomax® MR. Для выявления белка IPD079Aa в корнях корни лиофилизировали и 2 мг порошка на образец ресуспендировали в LDS, добавляли 1% бета-меркаптоэтанола, содержащего 1 таблетку/7 мл ингибитора протеиназ Complete Mini. Реакционную смесь нагревали при 80°C в течение 10 мин, а затем центрифугировали при 4°C, 20000 g в течение 15 мин. Образец надосадочной жидкости загружали на гели 4-12% Bis-Tris Midi с подвижным буфером MES в соответствии с инструкциями производителя (Invitrogen™) и переносили на нитроцеллюлозную мембрану с применением устройства iBlot® (Invitrogen™). Нитроцеллюлозную мембрану инкубировали в PBST, содержащем 5% порошка обезжиренного молока, в течение 2 часов перед инкубацией в течение ночи с очищенным с помощью аффинной хроматографии поликлональным антителом кролика к IPD079 в PBST в течение ночи. Мембрану трижды промывали PBST, а затем инкубировали в PBST в течение 15 мин, а затем двукратно по 5 мин перед инкубацией в течение 2 часов в PBST с антителом козы к Ig кролика, конъюгированным с HRP, в течение 3 часов. Связанные с антителом инсектицидные белки выявляли с применением реагентов для вестерн-блоттинга ECL™ (GE Healthcare, № по кат. RPN2106) и пленки Kodak® Biomax® MR.

Трансгенные растения маиса, положительные в отношении экспрессии инсектицидных белков, тестировали в отношении пестицидной активности с использованием стандартных биологических анализов, известных в данной области. Такие способы включали, например, биологические анализы с иссечением корня и биологические анализы целого растения. См., например, публикацию заявки на выдачу патента США № US 2003/0120054 и международную публикацию № WO 2003/018810.

Пример 16. Эффективность объектов с полипептидом IPD079 в теплице

Результаты эффективности T0 в теплице для объектов, полученных из конструкций PHP68039, PHP68040, PHP76130 и PHP76131, показаны на фигуре 5. Эффективность для объектов, полученных из всех 4 конструкций, наблюдали относительно объектов отрицательного контроля ("пустых"), которую оценивали по защите корня от западного кукурузного жука. Защиту корня оценивали на основе количества узлов пораженных корней (CRWNIS=показатель поражения узлов кукурузным жуком), используя способ, разработанный Oleson, et al. (2005) [J. Econ Entomol. 98(1):1-8]. Показатель поражения корня оценивали в баллах от "0" до "3", при этом "0" указывал на отсутствие видимого поражения корня, "1" означал 1 узел корневого повреждения, "2" означало 2 узла корневого повреждения, и "3" означало максимальный показатель в 3 узла корневого повреждения. Средние показатели (например, 1,5) указывают на дополнительную долю узлов повреждения (например, один и половина пораженного узла). На фигуре 5 показано, что большая часть объектов от PHP68039, PHP68040, PHP76130 и PHP76131 демонстрировала лучшие результаты, чем отрицательный контроль, и характеризовалась показателями поражения кукурузным жуком < 1,0.

Пример 17. Химерные полипептиды IPD079

Для получения активных вариантов IPD079 с диверсифицированными последовательностями получали химеры между IPD079Aa (SEQ ID NO: 2) и IPD079Ea (SEQ ID NO: 56) с помощью сборки множественных перекрывающихся ПЦР-фрагментов (набор для клонирования Gibson Assembly, New England Biolabs Inc.). Всего сконструировали 3 химеры: В таблице 11 показаны точки кроссинговера и % идентичности последовательности с IPD079Aa (SEQ ID NO: 2), а также результаты активности в отношении западного кукурузного жука. Химеры, обозначенные как 79Chimera1 (SEQ ID NO: 1277), начинаются с последовательности IPD079Aa на своем N-конце, тогда как химеры, обозначенные как 79Chimera2 (SEQ ID NO: 1278) и 79Chimera3 (SEQ ID NO: 1275), начинаются с последовательности IPD079Ea на своем N-конце. Выравнивание аминокислотных последовательностей IPD079Aa (SEQ ID NO: 2), IPD079Ea (SEQ ID NO: 56), 79Chimera1 (SEQ ID NO: 1277), 79Chimera2 (SEQ ID NO: 1278) и 79Chimera3 (SEQ ID NO: 1276) показано на фигуре 6.

Таблица 11

Обозначение химеры Положение точки кроссинговера % идентичности последовательности с IPD079Aa (SEQ ID NO: 2) Активность в отношении WCRW
Химера 1
SEQ ID NO: 1277
T147 72 Нет
Химера 2
SEQ ID NO: 1278
P286 83 Нет
Химера 3
SEQ ID NO: 1276
I352 76 Да

Номера положений кроссинговера основаны на выравнивании, показанном на фигуре 6

Приведенное выше описание различных проиллюстрированных вариантов осуществления согласно настоящему изобретению не подразумевается как исчерпывающее или служащее для ограничения объема точной раскрытой формой. Хотя конкретные варианты осуществления и примеры описаны в данном документе для иллюстративных целей, в пределах объема настоящего изобретения возможны различные эквивалентные модификации, что будет понятно специалистам в данной области. Представленные в данном документе идеи можно применять для других целей, отличающихся от примеров, описанных выше. В свете вышеизложенных идей возможны многочисленные модификации и вариации, и, следовательно, они находятся в пределах объема прилагаемой формулы изобретения.

Эти и другие изменения можно выполнять в свете вышеизложенного подробного описания. В целом, в следующей формуле изобретения используемые выражения не должны рассматриваться как ограничивающие объем настоящего изобретения конкретными вариантами осуществления, раскрытыми в описании и формуле изобретения.

Полное раскрытие каждого цитируемого документа (в том числе патентов, заявок на патенты, публикаций из журналов, рефератов, руководств, книг или других раскрытий) в разделах "Предпосылки изобретения", "Подробное описание" и "Примеры" включено в данный документ с помощью ссылки в полном объеме.

Были сделаны попытки обеспечения точности в отношении применяемых чисел (например количеств, температуры, концентраций и т. д.), но должны предусматриваться некоторые экспериментальные ошибки и отклонения. Если не указано иное, части представляют собой части по весу, молекулярная масса представляет собой среднюю молекулярную массу; температура приведена в градусах Цельсия, а давление является атмосферным или практически атмосферным.

--->

ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

<110> PIONEER HI BRED INTERNATIONAL INC

E.I. DU PONT DE NEMOURS & COMPANY

Allen, Stephen

Barry, Jennifer

Crane, Virginia

English, James

Fengler, Kevin

Schepers, Eric

Udranszky, Ingrid

<120> ИНСЕКТИЦИДНЫЕ БЕЛКИ РАСТИТЕЛЬНОГО ПРОИСХОЖДЕНИЯ И СПОСОБЫ ИХ ПРИМЕНЕНИЯ

<130> 6472-WO-PCT

<150> US62/201,977

<151> 2015-08-06

<160> 1278

<170> PatentIn версия 3.5

<210> 1

<211> 1353

<212> ДНК

<213> Lycopodium phlehmaria

<400> 1

atggcccaaa tagagccatt acctggatcg gatgcaatcg gactcagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat agacagctct tcgactttgc ccctcagcaa 120

gaaattactt tagaggacca cacatggctc ctctccactg atattgtata tattgctgta 180

cgcgatacgg atataaacac cgtctctctt cgcacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtatc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttcagttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatgaac tcggaggagc tgtttacgac gtacggaaca 480

cattatctga atgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatac taaaatcagc gtagttgcgg agagttcatt caagtcagtg 600

gctggcatgg aggtatccgc cgagtacaag gagcttatca agaaattcca agagaacagc 660

tccactagtc tgtacgccct cggtgggacc gcactctcca gcatcacaga cacggccagt 720

tacaacgcat ggttcagttc gattgataca cttcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatctggga actcgctgaa tcccctcagc gccaggagat cctccagaag 840

gctacgaaga cctttattcc gcccgaaatc agacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactattg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatatatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgacgccc atcactgcct tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tctaggttat accaggatca acagcgatct gaacgagggt 1140

gcggggggca aatatatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta atgaaaaagt cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc aggaggagac 1320

tatatcttcg tttgtttctc acgtcattta gac 1353

<210> 2

<211> 451

<212> БЕЛОК

<213> Lycopodium phlehmaria

<400> 2

Met Ala Gln Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly Leu Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Arg Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Thr Leu Glu Asp His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Val Tyr Ile Ala Val Arg Asp Thr Asp

50 55 60

Ile Asn Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asn Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Asn Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Thr Lys Ile Ser Val Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Glu Val Ser Ala Glu

195 200 205

Tyr Lys Glu Leu Ile Lys Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Leu Gly Gly Thr Ala Leu Ser Ser Ile Thr Asp Thr Ala Ser

225 230 235 240

Tyr Asn Ala Trp Phe Ser Ser Ile Asp Thr Leu Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Arg Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Trp Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Tyr Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Thr Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Leu

355 360 365

Gly Tyr Thr Arg Ile Asn Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Tyr Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Lys

405 410 415

Val Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Tyr Ile Phe Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 3

<211> 1353

<212> ДНК

<213> Huperzia salvinioides

<400> 3

atggcccaaa tagagccatt acctggatcg gatgcaatcg gacacagtta tgacgtattc 60

ggattttacg ccaaccccaa gagcgttaat agccagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgtata tgttgctgtc 180

cgggatacgg atataaaaac cgtctctctt tgcacaaaag atgaatactc cacggagctg 240

gctgcaagcg taaaattgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgacacggat tccacttaca cttcagttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatgaac tcggaggagc tgtttacgac gtacggaaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agagttcatt caagtccgtg 600

gctggcatgg acgtatcatc caagtacaag gaacttatcc agatattcca agagaacagc 660

ttcactagtc tgtacgccat cggtgggacc gcactctcca gcatcacaga cacggacact 720

tacaatgcat ggctcagttc gattgataca cttcccgtct tctgtggatt cacttgcgaa 780

agtcttcagc ccatctggga actcgctgaa tcccctcagc gccaggagat cctccagaag 840

gctacgatga cctttattcc gcccgaaatc agacgaaatg cgatcgtcga cgtagatatt 900

atcgtgtccg acaactattc ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccgaggg caaatatatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcaccgcct tggacgtggc ttctggcgat 1080

gacgatgatc cagacgttcc tcctggttat accaggatca acagcgatct gaacgagggt 1140

gcggggggca aatatatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaaact cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tatgtcttcg tttgtttctc acgtcattta gac 1353

<210> 4

<211> 451

<212> БЕЛОК

<213> Huperzia salvinioides

<400> 4

Met Ala Gln Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Ser Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Val Tyr Val Ala Val Arg Asp Thr Asp

50 55 60

Ile Lys Thr Val Ser Leu Cys Thr Lys Asp Glu Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Leu Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Asp Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asn Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ser Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Ile Phe Gln Glu Asn Ser Phe Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Leu Ser Ser Ile Thr Asp Thr Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Leu Pro Val Phe Cys Gly

245 250 255

Phe Thr Cys Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Met Thr Phe Ile Pro Pro

275 280 285

Glu Ile Arg Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Ser Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Glu Gly Lys Tyr Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Asp Val Ala Ser Gly Asp Asp Asp Asp Pro Asp Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Asn Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Tyr Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Lys

405 410 415

Leu Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Tyr Val Phe Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 5

<211> 1353

<212> ДНК

<213> Huperzia salvinioides

<400> 5

atggcccaaa tagagccatt acctggatcg gatgcaatcg gacacagtta tgacgtattc 60

ggattttacg ccaaccccaa gagcgttaat agccagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgtata tgttgctgtc 180

cgggatacgg atataaaaac cgtctctctt tgcacaaaag atgaatactc cacggagctg 240

gctgcaagcg taaaattgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgacacggat tccacttaca cttcagttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatgaac tcggaggagc tgtttacgac gtacggaaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agagttcatt caagtccgtg 600

gctggcatgg acgtatcatc caagtacaag gaacttatcc agatattcca agagaacagc 660

ttcactagtc tgtacgccat cggtgggacc gcactctcca gcatcacaga cacggacact 720

tacaatgcat ggctcagttc gattgataca cttcccgtct tctgtggatt cacttgcgaa 780

agtcttcagc ccatctggga actcgctgaa tcccctcagc gccaggagat cctccagaag 840

gctacgatga cctttattcc gcccgaaatc agacgaaatg cgatcgtcga cgtagatatt 900

atcgtgtccg acaactattc ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccgaggg caaatatatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcaccgcct tggacgtggc ttctggcgat 1080

gacaatgatc cagacgttcc tcctggttat accaggatca acagcgatct gaacgagggt 1140

gcggggggca aatatatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaaact cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agagggagac 1320

tatgtcttcg tttgtttctc acgtcattta gac 1353

<210> 6

<211> 451

<212> БЕЛОК

<213> Huperzia salvinioides

<400> 6

Met Ala Gln Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Ser Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Val Tyr Val Ala Val Arg Asp Thr Asp

50 55 60

Ile Lys Thr Val Ser Leu Cys Thr Lys Asp Glu Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Leu Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Asp Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asn Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ser Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Ile Phe Gln Glu Asn Ser Phe Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Leu Ser Ser Ile Thr Asp Thr Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Leu Pro Val Phe Cys Gly

245 250 255

Phe Thr Cys Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Met Thr Phe Ile Pro Pro

275 280 285

Glu Ile Arg Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Ser Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Glu Gly Lys Tyr Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Asp Val Ala Ser Gly Asp Asp Asn Asp Pro Asp Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Asn Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Tyr Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Lys

405 410 415

Leu Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Glu Gly Asp Tyr Val Phe Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 7

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 7

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtatc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagactgat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga acttgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccaca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgctt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgacaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 8

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 8

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn His Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Asp Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 9

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 9

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccag gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagaaaccg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttata cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac ttggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgagat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttattcc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacagct atacgaagat cgattatgat 960

ctgaaccaca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgacaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatctacg ttcgtttctc acctcattta gac 1353

<210> 10

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 10

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Arg Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Glu Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Leu Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Glu Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Ser Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn His Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Asp Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Tyr Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 11

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 11

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagactgat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtaggtgcgg agtgttcatt caagtccgtg 600

gttggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc gaaatctcca gcatcacaga cacggacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctccaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgcaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgctt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 12

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 12

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Gly

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Val Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Glu Ile Ser Ser Ile Thr Asp Thr Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 13

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 13

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtatc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagactgat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga acttgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccaca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgttt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgacaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 14

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 14

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn His Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Val Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Asp Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 15

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 15

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccag gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagaaaccg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatctggga actcgctgaa tcccctcagc gccaggagat cctccaaaag 840

gctacgaaga cctttattcc gcccgaagtc agacgaaatg cgatcgtgga cgtagagatt 900

accgtgtccg acagctattg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatatatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacaataatc catacattcc tccaggttat accaggatca acagcgatct gaacgagggt 1140

gcggggggca aatttattta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatgg ccagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tatatcttcg ttcgtttctc acctcattta gac 1353

<210> 16

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 16

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Arg Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Glu Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Val Arg Arg Asn Ala Ile Val Asp Val Glu Ile Thr Val Ser Asp

290 295 300

Ser Tyr Trp Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Tyr Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asn Asn Pro Tyr Ile Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Asn Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Gly Gln Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Tyr Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 17

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 17

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat agacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtt 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagc aagctttggc gagtatgaac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtttt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtaggtgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc gcaatctcca gcatcacaga cacggacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcaac gccaggagat cctccaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgcaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgctt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgacaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatctacg ttcgtttctc acctcattta gac 1353

<210> 18

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 18

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Arg Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Gln

130 135 140

Ala Leu Ala Ser Met Asn Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Gly

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Ile Ser Ser Ile Thr Asp Thr Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Asp Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Tyr Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 19

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 19

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat agacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtt 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagc aagctttggc gagtatgaac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtttt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtaggtgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc gcaatctcca gcatcacaga cacggacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcaac gccaggagat cctccaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgttt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggttac accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccatcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgagaatgtg 1260

gttacacctt acggattcac aacgattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 20

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 20

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Arg Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Gln

130 135 140

Ala Leu Ala Ser Met Asn Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Gly

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Ile Ser Ser Ile Thr Asp Thr Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Val Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ile Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Thr Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 21

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 21

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat agacagctct tcgactttgc ccctcagcaa 120

gaaattgttt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtt 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagc aagctttggc gagtatgaac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtttt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtaggtgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc gcaatctcca gcatcacaga cacggacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcaac gccaggagat cctccaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgctt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgacaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatctacg ttcgtttctc acctcattta gac 1353

<210> 22

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 22

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Arg Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Val Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Gln

130 135 140

Ala Leu Ala Ser Met Asn Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Gly

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Ile Ser Ser Ile Thr Asp Thr Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Asp Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Tyr Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 23

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 23

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccag gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagaaaccg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tctactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctccaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgcg gtgccaaggg caaatttatc tatttatgct acaagcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaaaccc atcactgcct tgaacgtggt ttctagcgat 1080

taccatgatc catccggtcc ttcaggttat accatgatct acacagatct gaaccagggt 1140

gtggggggca agtttatcta tctctgctac acaaaagatc cagctgcaat acccagcgac 1200

gaagatggac tgcccatacg tggcatccgc gttattggta acccacagtt cgggaatgtg 1260

gttacacctt acggattcac gaggattgat aaagatctga atgagggtgc aaagggagag 1320

tttatctacg ttcgtttctc acctcattta gac 1353

<210> 24

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 24

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Arg Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Glu Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Gly Ala Lys Gly Lys Phe Ile Tyr Leu Cys Tyr Lys Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Asn Val Val Ser Ser Asp Tyr His Asp Pro Ser Gly Pro Ser

355 360 365

Gly Tyr Thr Met Ile Tyr Thr Asp Leu Asn Gln Gly Val Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Pro Gln

405 410 415

Phe Gly Asn Val Val Thr Pro Tyr Gly Phe Thr Arg Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Lys Gly Glu Phe Ile Tyr Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 25

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 25

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgaccttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagaaaccg aaataaaaac cgtctctctt cgtacaaagg atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcgat agagtctgat 300

ttctcccaaa gcatcagcga tgagactgat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatagac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga acttgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgttt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggttac accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccatcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgagaatgtg 1260

gttacacctt acggattcac aacgattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 26

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 26

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Leu Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Glu Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Ile Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Ile Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Val Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ile Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Thr Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 27

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 27

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtt 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcgagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttctat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttattcc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgctt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggttac accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatctgc gttattggta acgaaaatat cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 28

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 28

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Cys Val Ile Gly Asn Glu Asn

405 410 415

Ile Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 29

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 29

atggtccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcaggaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagactgat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctgcaaaac 840

gctacgaaga cctttattcc acccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccaca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgacaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggggac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 30

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 30

Met Val Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Glu Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Asn Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn His Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Asp Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 31

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 31

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtt 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcgagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttttcccaaa gcatcagcga tgagacggat tccacttaca cttctattcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagc aagctttggc gagtatgaac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtttt ggtgggtggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtaggtgcgg agtgttcatt caagtccgtg 600

gttggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc gcaatctcca gcatcacaga cacggacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctccaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgcaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgctt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 32

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 32

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Ile Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Gln

130 135 140

Ala Leu Ala Ser Met Asn Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Gly

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Val Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Ile Ser Ser Ile Thr Asp Thr Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 33

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 33

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtgttc 60

ggattttatg ccaatccaaa gagcgtgaag aaagagctct tcgactttgc cctccagaaa 120

gaaatcactt tagagggcca cacttggctc ctttccactg atattgaata tattgcagtt 180

cgagatacgg aaataaaaac cgtctctctt cgcacaaaag atgcatactc aagcgagctg 240

gctgcaagcg taaaactgtc cggcagctat ggcggattct cagcgtcggt agaatctgac 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttcagttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagcacact gtggaagagc tacgctccaa gttgaagcct 420

gcgttgaagg aggcgttggc gaatatgaaa gaagtggagc tgttgagtac gtacgggaca 480

cattatatgg gcgaggtgtt ggtgggaggt cgtgcagatt atttggccac caccaaaacc 540

agtgcattca gctcggacac taaaatcagc acagtagcgg agagttcttt caagtccgta 600

gctggcatga aagtatccgc ggagcaaaag cagcttatcg aaaaattcca agaaaacagc 660

tccaccagtc tgtacgccat cggtgggagc gcactctcca gcatcacaga cacggccact 720

tacaacgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cactcgcgac 780

agtcttaggc ccatctggga gctcgctgaa tcccctcagc gccgggagat tctccgaaaa 840

gctacccaaa cgtttatccc accagaaatc acacgaaatg cagtcgttgg cgtagatatt 900

atcatgtctg aaaactattg ggtgaatcct ccgtacggct atacgaagat cgattacgat 960

ctgaatcgca atgccaaggg caaatatatc ttcttgtgtt acaaacaaca gaagatatca 1020

gtagctggat ccccagcgga tcccaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gatgataatc catatgttcc tccaggttac accaagatcg accaagatct gaacaaggat 1140

gctgggggca agtttatcta tctctcttac acaaaagatc cagctgcaat acccaacgac 1200

gaggatggac tgcccatacg tggcatccgc gttatcggca atgaaaagct tgagaatgtg 1260

gttacaccgt acggattcac gaggattgat gaagatctga ataaggatgc aaagggagac 1320

tatatcttcg ttcgtttctc acctcattta gac 1353

<210> 34

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 34

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Lys Lys Glu

20 25 30

Leu Phe Asp Phe Ala Leu Gln Lys Glu Ile Thr Leu Glu Gly His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Ser Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Leu Ser Gly Ser Tyr Gly Gly Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

His Thr Val Glu Glu Leu Arg Ser Lys Leu Lys Pro Ala Leu Lys Glu

130 135 140

Ala Leu Ala Asn Met Lys Glu Val Glu Leu Leu Ser Thr Tyr Gly Thr

145 150 155 160

His Tyr Met Gly Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Leu Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Thr Lys Ile Ser Thr Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Lys Val Ser Ala Glu

195 200 205

Gln Lys Gln Leu Ile Glu Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Ser Ala Leu Ser Ser Ile Thr Asp Thr Ala Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Arg Asp Ser Leu Arg Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Arg Glu Ile Leu Arg Lys Ala Thr Gln Thr Phe Ile Pro Pro

275 280 285

Glu Ile Thr Arg Asn Ala Val Val Gly Val Asp Ile Ile Met Ser Glu

290 295 300

Asn Tyr Trp Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Tyr Ile Phe Leu Cys Tyr Lys Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp Asn Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Lys Ile Asp Gln Asp Leu Asn Lys Asp Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Ser Tyr Thr Lys Asp Pro Ala Ala Ile Pro Asn Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Lys

405 410 415

Leu Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Arg Ile Asp Glu Asp

420 425 430

Leu Asn Lys Asp Ala Lys Gly Asp Tyr Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 35

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 35

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaagg atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagactgat tccacttata cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttctat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttattcc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacagct atacgaagat cgattatgat 960

ctgaaccaca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgacaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatctacg ttcgtttctc acctcattta gac 1353

<210> 36

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 36

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Ser Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn His Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Asp Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Tyr Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 37

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 37

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccag gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagaaaccg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttata cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac ttggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgagat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttattcc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacagct atacgaagat cgattatgat 960

ctgaaccaca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgacaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 38

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 38

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Arg Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Glu Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Leu Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Glu Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Ser Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn His Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Asp Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 39

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 39

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagaaaccg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tctttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtggggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgatata cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttattcc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgctt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggttac accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccga gttattggta acgaaaatat cgagaatgtg 1260

gttacacctt acggattcac aacgattgat aaagatctga acgagggtgc agggggagac 1320

tttatctacg ttcgtttctc acctcattta gac 1353

<210> 40

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 40

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Glu Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Gly Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Ile Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Thr Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Tyr Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 41

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 41

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtgttc 60

ggattttatg ccaatccaaa gagcgtgaag aaagagctct tcgactttgc cctccagaaa 120

gaaatcactt tagagggcca cacttggctc ctttccactg atattgaata tattgcagtt 180

cgagatacgg aaataaaaac cgtctctctt cgcacaaaag atgcatactc aagcgagctg 240

gctgcaagcg taaaactgtc cggcagctat ggcggattct cagcgtcggt agaatctgac 300

ttctcccaaa gcatcatcga tgagacggat tccacttaca cttcagttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagcacact gtggaagagc tacgctccaa gttgaagcct 420

gcgttgaagg aggcgttggc gaatatgaaa gaagtggagc tgttgagtac gtacgggaca 480

cattatatgg gcgaggtgtt ggtgggaggt cgtgcagatt atttggccac caccaaaacc 540

agtgcattca gctcggacac taaaatcagc acagtagcgg agagttcttt caagtccgta 600

gctggcatga aagtatccgc ggagcaaaag cagcttatcg aaaaattcca agaaaacagc 660

tccaccagtc tgtacgccat cggtgggagc gcactctcca gcatcacaga cacggccact 720

tacaacgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cactcgcgac 780

agtcttaggc ccatctggga gctcgctgaa tcccctcagc gccaggagat cctccaaaag 840

gctacgaagg cctttatttc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacaataatc catacattcc tccaggttat accaggatca acagcgatct gaacgagggt 1140

gcggggggca aatttattta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatgg cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagat 1320

tatatcttcg ttcgtttctc acctcattta gac 1353

<210> 42

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 42

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Lys Lys Glu

20 25 30

Leu Phe Asp Phe Ala Leu Gln Lys Glu Ile Thr Leu Glu Gly His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Ser Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Leu Ser Gly Ser Tyr Gly Gly Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ile Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

His Thr Val Glu Glu Leu Arg Ser Lys Leu Lys Pro Ala Leu Lys Glu

130 135 140

Ala Leu Ala Asn Met Lys Glu Val Glu Leu Leu Ser Thr Tyr Gly Thr

145 150 155 160

His Tyr Met Gly Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Leu Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Thr Lys Ile Ser Thr Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Lys Val Ser Ala Glu

195 200 205

Gln Lys Gln Leu Ile Glu Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Ser Ala Leu Ser Ser Ile Thr Asp Thr Ala Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Arg Asp Ser Leu Arg Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Ala Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asn Asn Pro Tyr Ile Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Asn Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Gly Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Tyr Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 43

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 43

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccag gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtt 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcgagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttttcccaaa gcatcagcga tgagacggat tccacttaca cttctattcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagc aagctttggc gagtatgaac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtttt ggtgggtggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtaggtgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctccaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgacaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 44

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 44

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Arg Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Ile Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Gln

130 135 140

Ala Leu Ala Ser Met Asn Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Gly

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Asp Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 45

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 45

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtt 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttata cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac ttggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgagat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgcaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgctt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatgg cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagat 1320

tatatcttcg ttcgtttctc acctcattta gac 1353

<210> 46

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 46

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Leu Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Glu Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Gly Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Tyr Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 47

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 47

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagaaaccg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttata cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac tcggatgagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tctactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcaac gccaggagat cctgcaaaag 840

gctacgaaga cctttatttc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgttt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggttac accaggatca gcagcgatct gaacgagggt 1140

gcggggggga aatttatcta tctatgctac acaaaagatc cggctgcaat acccatcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatat cgagaatgtg 1260

gttacacctt acggattcac aacgattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 48

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 48

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Glu Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Asp Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Ser Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Val Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ile Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Thr Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 49

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 49

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagaaaccg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttata cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac ttggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgagat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttattcc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacagct atacgaagat cgattatgat 960

ctgaaccaca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggctat accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatagac tgcccatacg tggcatccgc gttattggta acgaaaatat cgacaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatctacg ttcgtttctc acctcattta gac 1353

<210> 50

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 50

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Glu Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Leu Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Glu Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Ser Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn His Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Arg Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Ile Asp Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Tyr Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 51

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 51

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtt 180

cgagatacgg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcgagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttttcccaaa gcatcagcga tgagacggat tccacttaca cttctattcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttattcc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatttatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgctt tgtacgtggc ttctggcgat 1080

gacgatcatc catacgttcc tccaggttac accaggatca gcagcgatct gaacgagggt 1140

gcggggggca aatttatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatctgc gttattggta acgaaaatat cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tttatcttcg ttcgtttctc acctcattta gac 1353

<210> 52

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 52

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Ile Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Phe Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Val Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Ser Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Cys Val Ile Gly Asn Glu Asn

405 410 415

Ile Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Phe Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 53

<211> 1353

<212> ДНК

<213> Lycopodium nummulariifolium

<400> 53

atggcccgta tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat acacagctct tcgactttgc ccctcagcaa 120

gaaattattt tagaggacca caaatggctc ctctccactg atattgaata tattgctgtc 180

cgagaaaccg aaataaaaac cgtctctctt cgtacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttctgttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tctttcaagg aagctttggc gagtatggac tcggaggagc tgtttacgac gtacgggaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgagat tcaaatcagc gtagttgcgg agtgttcatt caagtccgtg 600

gctggcatgg acgtatcagc caagtacaag gagcttatcc agaaattcca agagaacagc 660

tccactagtc tgtacgccat cggtgggacc acaatctcca gcatcacaga caaagacact 720

tacaatgcat ggctcagttc gattgataca cgtcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatttggga actcgctgaa tcccctcagc gccaggagat cctgcaaaag 840

gctacgaaga cctttattcc gcccgaaatc aaacgaaatg caatcgtcga cgtagatatt 900

atcgtgtccg acaactatgg ggtgaatcct ccctacagct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatatatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacaataatc catacattcc tccaggttat accaggatca acagcgatct gaacgagggt 1140

gcggggggca aatttattta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaatgg cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagat 1320

tatatcttcg ttcgtttctc acctcattta gac 1353

<210> 54

<211> 451

<212> БЕЛОК

<213> Lycopodium nummulariifolium

<400> 54

Met Ala Arg Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Thr Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Ile Leu Glu Asp His Lys

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Ile Ala Val Arg Glu Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Glu Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Cys Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ala Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Lys Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Thr Ile Ser Ser Ile Thr Asp Lys Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Lys Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Gly Val Asn Pro Pro Tyr Ser Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Tyr Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asn Asn Pro Tyr Ile Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Asn Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Asn

405 410 415

Gly Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Tyr Ile Phe Val Arg Phe Ser Pro

435 440 445

His Leu Asp

450

<210> 55

<211> 1434

<212> ДНК

<213> Ophioglossum pendulum

<400> 55

atggaaccca acaaaggtgg tgctccagcc atgaaaaatg tagccaaacc ttccacaaag 60

agactcatac cgtcatccat tgctgcatca tcgcaaacat ctgcaaatgc attaaccgag 120

ccattgcctg gctctgatgc catcggccag agctacgatg cattcgggtt cttcgccaat 180

cccagaagca tcatgaagga gttgttcgag ttcagtcctc aagaggagat agtcgtggaa 240

ggaaatacct ggcttctctc ttcggacttc gtttacaccg caattagaga cactgagacc 300

tccacggtct cacgtcgcac caaggacgac tactccaagg aattggctgt gaaggtgaag 360

ctgtctggaa gctatggcta tttttctgcc tccgttgagt ctgatttctc tcagagcatt 420

tccgatgcga cggacaccac atacacttca gttcgcaccc acgtcaacaa gtggaggctg 480

agcctgaagg acgatgttgg ggcccttcgc tcgaagctgc tgcctggcgt caagcaggcg 540

ctggctacca tggatgctac gcagctcttt gacacgttcg ggactcacta tgtgagcgag 600

gtgcttgtgg gtgggcgtgc agactacgtt gccaccacca agaccagcgc gttcagctca 660

tccaccagca tcagcgtagc ggcagaagca tcattccagt ccatcgcggg tggggaggtg 720

tctccggagt ccaaggtgct tgcggagatg ctgagagaga acagcagcac acgcctgtac 780

gctcttggcg ggagtgccct ccccaacatc acagatccag ccacgtacaa cgcctggctg 840

gagtccattg acaccatccc tgtcttctgc ggattcactc aaaacagcct caagtccatc 900

tcggagcttg ctgactccgc tcaacgccgg gacgctctgg ccaaagcctc ccaaagctat 960

atcccatcat acgtgactcg tcctgcagtg gttggcttgg aggtcataat atcggacagc 1020

aactcggaga gccctcccta tggctacacc agaatagact acgacctcaa ccgcaacgca 1080

ggaggcaaat acgtgttcct ctgctacaag cagaagaaca tttcagtggg aggggatgcc 1140

gatgccatca ccgacgtcct tgtcgtctac ggaaatgacc gaaatccatc tgtgccgtct 1200

ggctacacca agatcgacaa ggacctcaac tccggggcag gcggtaagta tatctacttc 1260

tgctactcca aggacaagcg gaagcaagag gagggactgc ccattcgtgg gcttcgtgtt 1320

gttgggcctc acccaacctc agtggcacct tacggattct ctaagatcga catagatctg 1380

aatatgggtg caggaggaga ttttatatac ctttgcaaat cacgccattt ggag 1434

<210> 56

<211> 478

<212> БЕЛОК

<213> Ophioglossum pendulum

<400> 56

Met Glu Pro Asn Lys Gly Gly Ala Pro Ala Met Lys Asn Val Ala Lys

1 5 10 15

Pro Ser Thr Lys Arg Leu Ile Pro Ser Ser Ile Ala Ala Ser Ser Gln

20 25 30

Thr Ser Ala Asn Ala Leu Thr Glu Pro Leu Pro Gly Ser Asp Ala Ile

35 40 45

Gly Gln Ser Tyr Asp Ala Phe Gly Phe Phe Ala Asn Pro Arg Ser Ile

50 55 60

Met Lys Glu Leu Phe Glu Phe Ser Pro Gln Glu Glu Ile Val Val Glu

65 70 75 80

Gly Asn Thr Trp Leu Leu Ser Ser Asp Phe Val Tyr Thr Ala Ile Arg

85 90 95

Asp Thr Glu Thr Ser Thr Val Ser Arg Arg Thr Lys Asp Asp Tyr Ser

100 105 110

Lys Glu Leu Ala Val Lys Val Lys Leu Ser Gly Ser Tyr Gly Tyr Phe

115 120 125

Ser Ala Ser Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Ala Thr

130 135 140

Asp Thr Thr Tyr Thr Ser Val Arg Thr His Val Asn Lys Trp Arg Leu

145 150 155 160

Ser Leu Lys Asp Asp Val Gly Ala Leu Arg Ser Lys Leu Leu Pro Gly

165 170 175

Val Lys Gln Ala Leu Ala Thr Met Asp Ala Thr Gln Leu Phe Asp Thr

180 185 190

Phe Gly Thr His Tyr Val Ser Glu Val Leu Val Gly Gly Arg Ala Asp

195 200 205

Tyr Val Ala Thr Thr Lys Thr Ser Ala Phe Ser Ser Ser Thr Ser Ile

210 215 220

Ser Val Ala Ala Glu Ala Ser Phe Gln Ser Ile Ala Gly Gly Glu Val

225 230 235 240

Ser Pro Glu Ser Lys Val Leu Ala Glu Met Leu Arg Glu Asn Ser Ser

245 250 255

Thr Arg Leu Tyr Ala Leu Gly Gly Ser Ala Leu Pro Asn Ile Thr Asp

260 265 270

Pro Ala Thr Tyr Asn Ala Trp Leu Glu Ser Ile Asp Thr Ile Pro Val

275 280 285

Phe Cys Gly Phe Thr Gln Asn Ser Leu Lys Ser Ile Ser Glu Leu Ala

290 295 300

Asp Ser Ala Gln Arg Arg Asp Ala Leu Ala Lys Ala Ser Gln Ser Tyr

305 310 315 320

Ile Pro Ser Tyr Val Thr Arg Pro Ala Val Val Gly Leu Glu Val Ile

325 330 335

Ile Ser Asp Ser Asn Ser Glu Ser Pro Pro Tyr Gly Tyr Thr Arg Ile

340 345 350

Asp Tyr Asp Leu Asn Arg Asn Ala Gly Gly Lys Tyr Val Phe Leu Cys

355 360 365

Tyr Lys Gln Lys Asn Ile Ser Val Gly Gly Asp Ala Asp Ala Ile Thr

370 375 380

Asp Val Leu Val Val Tyr Gly Asn Asp Arg Asn Pro Ser Val Pro Ser

385 390 395 400

Gly Tyr Thr Lys Ile Asp Lys Asp Leu Asn Ser Gly Ala Gly Gly Lys

405 410 415

Tyr Ile Tyr Phe Cys Tyr Ser Lys Asp Lys Arg Lys Gln Glu Glu Gly

420 425 430

Leu Pro Ile Arg Gly Leu Arg Val Val Gly Pro His Pro Thr Ser Val

435 440 445

Ala Pro Tyr Gly Phe Ser Lys Ile Asp Ile Asp Leu Asn Met Gly Ala

450 455 460

Gly Gly Asp Phe Ile Tyr Leu Cys Lys Ser Arg His Leu Glu

465 470 475

<210> 57

<211> 1434

<212> ДНК

<213> Platycerium bifurcatum

<400> 57

atggaaccca acaaaggtgg tgctccagcc atgaaaaatg tagccaaacc ttccacaaag 60

agactcatac cgtcatccat tgctgcatca tcgcaaacat ctgcaaatgc attaaccgag 120

ccattgcctg gctctgatgc catcggccag agctacgatg cattcgggtt cttcgccaat 180

cccagaagca tcatgaagga gttgttcgag ttcagtcctc aagaggagat agtcgtggaa 240

ggaaatacct ggcttctctc ttcggacttc gtttacaccg caattagaga cactgagacc 300

tccacggtct cacgtcgcac caaggacgac tactccaagg aattggctgt gaaggtgaag 360

ctgtctggaa gctatggcta tttttctgcc tccgttgagt ctgatttctc tcagagcatt 420

tccgatgcga cggacaccac atacacttca gttcgcaccc acgtcaacaa gtggaggctg 480

agcctgaagg acgatgttgg ggcccttcgc tcgaagctgc tgcctggcgt caagcaggcg 540

ctggctacca tggatgctac gcagctcttt gacacgttcg ggactcacta tgtgagcgag 600

gtgcttgtgg gtgggcgtgc agactacgtt gccaccacca agaccagcgc gttcagctca 660

tccaccagca tcagcgtagc ggcagaagca tcattccagt ccatcgcggg tggggaggtg 720

tctccggagt ccaaggtgct tgcggagatg ctgagagaga acagcagcac acgcctgtac 780

gctcttggcg ggagtgccct ccccaacatc acagatccag ccacgtacaa cgcctggctg 840

gagtccattg acaccatccc tgtcttctgc ggattcactc aaaacagcct caagcccatc 900

tcggagcttg ctgactccgc tcaacgccgg gacgctctgg ccaaagcctc ccaaagctat 960

atcccatcat acgtgactcg tcctgcagtg gttggcttgg aggtcataat atcggacagc 1020

aactcggaga gccctcccta tggctacacc agaatagact acgacctcaa ccgcaacgca 1080

ggaggcaaat acgtgttcct ctgctacaag cagaagaaca tttcagtggg aggggatgcc 1140

gatgccatca ccgacgtcct tgtcgtctac ggaaatgacc gaaatccatc tgtgccgtct 1200

ggctacacca agatcgacaa ggacctcaac tccggggcag gcggtaagta tatctacttc 1260

tgctactcca aggacaagcg gaagcaagag gagggactgc ccattcgtgg gcttcgtgtt 1320

gttgggcctc acccaacctc agtggcacct tacggattct ctaagatcga catagatctg 1380

aatatgggtg caggaggaga ttttatatac ctttgcaaat cacgccattt ggag 1434

<210> 58

<211> 478

<212> БЕЛОК

<213> Platycerium bifurcatum

<400> 58

Met Glu Pro Asn Lys Gly Gly Ala Pro Ala Met Lys Asn Val Ala Lys

1 5 10 15

Pro Ser Thr Lys Arg Leu Ile Pro Ser Ser Ile Ala Ala Ser Ser Gln

20 25 30

Thr Ser Ala Asn Ala Leu Thr Glu Pro Leu Pro Gly Ser Asp Ala Ile

35 40 45

Gly Gln Ser Tyr Asp Ala Phe Gly Phe Phe Ala Asn Pro Arg Ser Ile

50 55 60

Met Lys Glu Leu Phe Glu Phe Ser Pro Gln Glu Glu Ile Val Val Glu

65 70 75 80

Gly Asn Thr Trp Leu Leu Ser Ser Asp Phe Val Tyr Thr Ala Ile Arg

85 90 95

Asp Thr Glu Thr Ser Thr Val Ser Arg Arg Thr Lys Asp Asp Tyr Ser

100 105 110

Lys Glu Leu Ala Val Lys Val Lys Leu Ser Gly Ser Tyr Gly Tyr Phe

115 120 125

Ser Ala Ser Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Ala Thr

130 135 140

Asp Thr Thr Tyr Thr Ser Val Arg Thr His Val Asn Lys Trp Arg Leu

145 150 155 160

Ser Leu Lys Asp Asp Val Gly Ala Leu Arg Ser Lys Leu Leu Pro Gly

165 170 175

Val Lys Gln Ala Leu Ala Thr Met Asp Ala Thr Gln Leu Phe Asp Thr

180 185 190

Phe Gly Thr His Tyr Val Ser Glu Val Leu Val Gly Gly Arg Ala Asp

195 200 205

Tyr Val Ala Thr Thr Lys Thr Ser Ala Phe Ser Ser Ser Thr Ser Ile

210 215 220

Ser Val Ala Ala Glu Ala Ser Phe Gln Ser Ile Ala Gly Gly Glu Val

225 230 235 240

Ser Pro Glu Ser Lys Val Leu Ala Glu Met Leu Arg Glu Asn Ser Ser

245 250 255

Thr Arg Leu Tyr Ala Leu Gly Gly Ser Ala Leu Pro Asn Ile Thr Asp

260 265 270

Pro Ala Thr Tyr Asn Ala Trp Leu Glu Ser Ile Asp Thr Ile Pro Val

275 280 285

Phe Cys Gly Phe Thr Gln Asn Ser Leu Lys Pro Ile Ser Glu Leu Ala

290 295 300

Asp Ser Ala Gln Arg Arg Asp Ala Leu Ala Lys Ala Ser Gln Ser Tyr

305 310 315 320

Ile Pro Ser Tyr Val Thr Arg Pro Ala Val Val Gly Leu Glu Val Ile

325 330 335

Ile Ser Asp Ser Asn Ser Glu Ser Pro Pro Tyr Gly Tyr Thr Arg Ile

340 345 350

Asp Tyr Asp Leu Asn Arg Asn Ala Gly Gly Lys Tyr Val Phe Leu Cys

355 360 365

Tyr Lys Gln Lys Asn Ile Ser Val Gly Gly Asp Ala Asp Ala Ile Thr

370 375 380

Asp Val Leu Val Val Tyr Gly Asn Asp Arg Asn Pro Ser Val Pro Ser

385 390 395 400

Gly Tyr Thr Lys Ile Asp Lys Asp Leu Asn Ser Gly Ala Gly Gly Lys

405 410 415

Tyr Ile Tyr Phe Cys Tyr Ser Lys Asp Lys Arg Lys Gln Glu Glu Gly

420 425 430

Leu Pro Ile Arg Gly Leu Arg Val Val Gly Pro His Pro Thr Ser Val

435 440 445

Ala Pro Tyr Gly Phe Ser Lys Ile Asp Ile Asp Leu Asn Met Gly Ala

450 455 460

Gly Gly Asp Phe Ile Tyr Leu Cys Lys Ser Arg His Leu Glu

465 470 475

<210> 59

<211> 1410

<212> ДНК

<213> Ophioglossum pendulum

<220>

<221> другой_признак

<222> (924)..(924)

<223> n представляет собой a, c, g или t

<400> 59

atgctcccgg ccgccatggc ggccgcggga attcgatttg aattaggcat gcgaggatcc 60

gaacccaaca aaggtggtgc tccagccatg aaaaatgtag ccaaaccttc cacaaagaga 120

ctcataccgt catccattgc tgcatcatcg caaacatctg caaatgcatt aaccgagcca 180

ttgcctggct ctgatgccat cggccagagc tacgatgcat tcgggttctt cgccaatccc 240

agaagcatca tgaaggagtt gttcgagttc agtcctcaag aggagatagt cgtggaagga 300

aatacctggc ttctctcttc ggaattcgtt tacaccgcaa ttagagacac tgagacctcc 360

acggtctcac gtcgcaccaa ggacgactac tccaaggaat tggctgtgaa ggtgaagctg 420

tctggaagct atggctattt ttctgcctcc gttgagtctg atttctctca gagcatttcc 480

gatgtgacgg acaccacata cacttcagtt cgcacccacg tcaacaagtg gaggctgagc 540

ctgaaggacg atgttggggc ccttcgctcg aagctgctgc ctggcgtcaa gcaggcgctg 600

gctaccatgg atgctacgca gctctttgac acgttcggga ctcactatgt gagcgaggtg 660

cttgtgggtg ggcgtgcaga ctacgttgcc accaccaaga ccagcgcgtt cagctcatcc 720

accagcatca gcgtagcggc agaagcatca ttccagtcca tcgcgggtgg ggaggtgtct 780

ccggagtcca aggtgcttgc ggagacgctg agagagaaca gcagcacacg cctgtacgct 840

cttggcggga gtgccctccc caacatcaca gatccagcca cgtacaacgc ctggctggag 900

tccattgaca ccatccctgt cttntgcgga ttcactcaaa acagcctcaa gcccatctcg 960

gagcttgctg actccgctca acgccgggac gctctggcca aagcctccca aagctatatc 1020

ccatcatacg tgactcgtcc tgcagtggtt ggcttggagg tcataatatc ggacagcaac 1080

tcggagagcc ctccctatgg ctacaccaga atagactacg acctcaaccg caacgcagga 1140

ggcaaatacg tgttcctctg ctacaagcag aagaacattt cagtgggagg ggatgccgat 1200

gccatcaccg acgtccttgt cgtctacgga aatgaccgaa atccatctgt gccgtctggc 1260

tacaccaaga tcgacaagga cctcaactcc ggggcaggcg gtaagtatat ctacttctgc 1320

tactccaagg acaagcggaa gcaagaggag ggactgccca ttcgtgggct tcgtgttgtt 1380

gggcctcacc caacctcagt ggcaccttac 1410

<210> 60

<211> 451

<212> БЕЛОК

<213> Ophioglossum pendulum

<220>

<221> другой_признак

<222> (289)..(289)

<223> Xaa может представлять собой любую втречающуюся в природе аминокислоту

<400> 60

Met Glu Pro Asn Lys Gly Gly Ala Pro Ala Met Lys Asn Val Ala Lys

1 5 10 15

Pro Ser Thr Lys Arg Leu Ile Pro Ser Ser Ile Ala Ala Ser Ser Gln

20 25 30

Thr Ser Ala Asn Ala Leu Thr Glu Pro Leu Pro Gly Ser Asp Ala Ile

35 40 45

Gly Gln Ser Tyr Asp Ala Phe Gly Phe Phe Ala Asn Pro Arg Ser Ile

50 55 60

Met Lys Glu Leu Phe Glu Phe Ser Pro Gln Glu Glu Ile Val Val Glu

65 70 75 80

Gly Asn Thr Trp Leu Leu Ser Ser Glu Phe Val Tyr Thr Ala Ile Arg

85 90 95

Asp Thr Glu Thr Ser Thr Val Ser Arg Arg Thr Lys Asp Asp Tyr Ser

100 105 110

Lys Glu Leu Ala Val Lys Val Lys Leu Ser Gly Ser Tyr Gly Tyr Phe

115 120 125

Ser Ala Ser Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Val Thr

130 135 140

Asp Thr Thr Tyr Thr Ser Val Arg Thr His Val Asn Lys Trp Arg Leu

145 150 155 160

Ser Leu Lys Asp Asp Val Gly Ala Leu Arg Ser Lys Leu Leu Pro Gly

165 170 175

Val Lys Gln Ala Leu Ala Thr Met Asp Ala Thr Gln Leu Phe Asp Thr

180 185 190

Phe Gly Thr His Tyr Val Ser Glu Val Leu Val Gly Gly Arg Ala Asp

195 200 205

Tyr Val Ala Thr Thr Lys Thr Ser Ala Phe Ser Ser Ser Thr Ser Ile

210 215 220

Ser Val Ala Ala Glu Ala Ser Phe Gln Ser Ile Ala Gly Gly Glu Val

225 230 235 240

Ser Pro Glu Ser Lys Val Leu Ala Glu Thr Leu Arg Glu Asn Ser Ser

245 250 255

Thr Arg Leu Tyr Ala Leu Gly Gly Ser Ala Leu Pro Asn Ile Thr Asp

260 265 270

Pro Ala Thr Tyr Asn Ala Trp Leu Glu Ser Ile Asp Thr Ile Pro Val

275 280 285

Xaa Cys Gly Phe Thr Gln Asn Ser Leu Lys Pro Ile Ser Glu Leu Ala

290 295 300

Asp Ser Ala Gln Arg Arg Asp Ala Leu Ala Lys Ala Ser Gln Ser Tyr

305 310 315 320

Ile Pro Ser Tyr Val Thr Arg Pro Ala Val Val Gly Leu Glu Val Ile

325 330 335

Ile Ser Asp Ser Asn Ser Glu Ser Pro Pro Tyr Gly Tyr Thr Arg Ile

340 345 350

Asp Tyr Asp Leu Asn Arg Asn Ala Gly Gly Lys Tyr Val Phe Leu Cys

355 360 365

Tyr Lys Gln Lys Asn Ile Ser Val Gly Gly Asp Ala Asp Ala Ile Thr

370 375 380

Asp Val Leu Val Val Tyr Gly Asn Asp Arg Asn Pro Ser Val Pro Ser

385 390 395 400

Gly Tyr Thr Lys Ile Asp Lys Asp Leu Asn Ser Gly Ala Gly Gly Lys

405 410 415

Tyr Ile Tyr Phe Cys Tyr Ser Lys Asp Lys Arg Lys Gln Glu Glu Gly

420 425 430

Leu Pro Ile Arg Gly Leu Arg Val Val Gly Pro His Pro Thr Ser Val

435 440 445

Ala Pro Tyr

450

<210> 61

<211> 1491

<212> ДНК

<213> Ophioglossum pendulum

<400> 61

atggtcgacc tgcaggcggc cgcgaattca ctagtgattg aattaggcat gagaggatcc 60

gaacccaaca aaggtggtgc tccagccatg aaaaatgtag ccaaaccttc cacaaagaga 120

ctcataccgt catccattgc tgcatcatcg caaacatctg caaatgcatt aaccgagcca 180

ttgcctggct ctgatgccat cggccagagc tacgatgcat tcgggttctt cgccaatccc 240

agaagcatca tgaaggagtt gttcgagttc agtcctcaag aggagatagt catggaagga 300

aatacctggc ttctctcttc ggacttcgtt tacaccgcaa ttagagacac tgagacctcc 360

acggtctcac gtcgcaccaa ggacgactac tccaaggaat tggctgtgaa ggtgaagctg 420

tctggaagct atggctattt ttctgcctcc gttgagtctg atttctctca gagcatttcc 480

gatgcgacgg acaccacata cacttcagtt cgcacccacg tcaacaagtg gaggctgagc 540

ctgaaggacg atgttggggc ccttcgctcg aagctgctgc ctggcgtcaa gcaggcgctg 600

gctaccatgg atgctacgca gctctttgac acgttcggga ctcactatgt gagcgaggtg 660

cttgtgggtg ggcgtgcaga ctacgttgcc accaccaaga ccagcgcgtt cagctcatcc 720

accagcatca gcgtagcggc agaagcatca ttccagtcca tcgcgggtgg ggaggtgtct 780

ccggagtcca aggtgcttgc ggagatgctg agagagaaca gcagcacacg cctgtacgct 840

cttggcggga gtgccctccc caacatcaca gatccagcca cgtacaacgc ctggctggag 900

tccattgaca ccatccctgt cttctgcgga ttcactcaaa acagcctcaa gcccatctcg 960

gagcttgctg actccgctca acgccgggac gctctggcca aagcctccca aagctatatc 1020

ccatcatacg tgactcgtcc tgcagtggtt ggcttggagg tcataatatc ggacagcaac 1080

tcggagagcc ctccctatgg ctacaccaga atagactacg acctcaaccg caacgcagga 1140

ggcaaatacg tgttcctctg ctacaagcag aagaacattt cagtgggagg ggatgccgat 1200

gccatcaccg acgtccttgt cgtctacgga aatgaccgaa atccatctgt gccgtctggc 1260

tacaccaaga tcgacaagga cctcaactcc ggggcaggcg gtaagtatat ctacttctgc 1320

tactccaagg acaagcggaa gcaagaggag ggactgccca ttcgtgggct tcgtgttgtt 1380

gggcctcacc caacctcagt ggcaccttac ggattctcta agatcgacat agatctgaat 1440

atgggtgcag gaggagattt tatatacctt tgcaaatcac gccatttgga g 1491

<210> 62

<211> 478

<212> БЕЛОК

<213> Ophioglossum pendulum

<400> 62

Met Glu Pro Asn Lys Gly Gly Ala Pro Ala Met Lys Asn Val Ala Lys

1 5 10 15

Pro Ser Thr Lys Arg Leu Ile Pro Ser Ser Ile Ala Ala Ser Ser Gln

20 25 30

Thr Ser Ala Asn Ala Leu Thr Glu Pro Leu Pro Gly Ser Asp Ala Ile

35 40 45

Gly Gln Ser Tyr Asp Ala Phe Gly Phe Phe Ala Asn Pro Arg Ser Ile

50 55 60

Met Lys Glu Leu Phe Glu Phe Ser Pro Gln Glu Glu Ile Val Met Glu

65 70 75 80

Gly Asn Thr Trp Leu Leu Ser Ser Asp Phe Val Tyr Thr Ala Ile Arg

85 90 95

Asp Thr Glu Thr Ser Thr Val Ser Arg Arg Thr Lys Asp Asp Tyr Ser

100 105 110

Lys Glu Leu Ala Val Lys Val Lys Leu Ser Gly Ser Tyr Gly Tyr Phe

115 120 125

Ser Ala Ser Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Ala Thr

130 135 140

Asp Thr Thr Tyr Thr Ser Val Arg Thr His Val Asn Lys Trp Arg Leu

145 150 155 160

Ser Leu Lys Asp Asp Val Gly Ala Leu Arg Ser Lys Leu Leu Pro Gly

165 170 175

Val Lys Gln Ala Leu Ala Thr Met Asp Ala Thr Gln Leu Phe Asp Thr

180 185 190

Phe Gly Thr His Tyr Val Ser Glu Val Leu Val Gly Gly Arg Ala Asp

195 200 205

Tyr Val Ala Thr Thr Lys Thr Ser Ala Phe Ser Ser Ser Thr Ser Ile

210 215 220

Ser Val Ala Ala Glu Ala Ser Phe Gln Ser Ile Ala Gly Gly Glu Val

225 230 235 240

Ser Pro Glu Ser Lys Val Leu Ala Glu Met Leu Arg Glu Asn Ser Ser

245 250 255

Thr Arg Leu Tyr Ala Leu Gly Gly Ser Ala Leu Pro Asn Ile Thr Asp

260 265 270

Pro Ala Thr Tyr Asn Ala Trp Leu Glu Ser Ile Asp Thr Ile Pro Val

275 280 285

Phe Cys Gly Phe Thr Gln Asn Ser Leu Lys Pro Ile Ser Glu Leu Ala

290 295 300

Asp Ser Ala Gln Arg Arg Asp Ala Leu Ala Lys Ala Ser Gln Ser Tyr

305 310 315 320

Ile Pro Ser Tyr Val Thr Arg Pro Ala Val Val Gly Leu Glu Val Ile

325 330 335

Ile Ser Asp Ser Asn Ser Glu Ser Pro Pro Tyr Gly Tyr Thr Arg Ile

340 345 350

Asp Tyr Asp Leu Asn Arg Asn Ala Gly Gly Lys Tyr Val Phe Leu Cys

355 360 365

Tyr Lys Gln Lys Asn Ile Ser Val Gly Gly Asp Ala Asp Ala Ile Thr

370 375 380

Asp Val Leu Val Val Tyr Gly Asn Asp Arg Asn Pro Ser Val Pro Ser

385 390 395 400

Gly Tyr Thr Lys Ile Asp Lys Asp Leu Asn Ser Gly Ala Gly Gly Lys

405 410 415

Tyr Ile Tyr Phe Cys Tyr Ser Lys Asp Lys Arg Lys Gln Glu Glu Gly

420 425 430

Leu Pro Ile Arg Gly Leu Arg Val Val Gly Pro His Pro Thr Ser Val

435 440 445

Ala Pro Tyr Gly Phe Ser Lys Ile Asp Ile Asp Leu Asn Met Gly Ala

450 455 460

Gly Gly Asp Phe Ile Tyr Leu Cys Lys Ser Arg His Leu Glu

465 470 475

<210> 63

<211> 1443

<212> ДНК

<213> Ophioglossum pendulum

<220>

<221> другой_признак

<222> (833)..(833)

<223> n представляет собой a, c, g или t

<220>

<221> другой_признак

<222> (873)..(873)

<223> n представляет собой a, c, g или t

<220>

<221> другой_признак

<222> (876)..(876)

<223> n представляет собой a, c, g или t

<400> 63

atgcgaggat ccgaacccaa caaaggtggt gctccagcca tgaaaaatgt agccaaacct 60

tccacaaaga cactcatacc gtcatccatt gctgcatcat cgcaaacagc tgcaaatgca 120

ttaaccgagc cattgcctgg ctctgatgcc atcggccaga gctacaatgc attcgggttc 180

tttgccaatc ccagaagcat catgaaggag ttgtttgagt tcagtcctca agaggagata 240

gtcgtggaag gaaatacctg gcttctctct tcggacttcg tttacaccgc aattagagac 300

agtgaggcct tcacgctctc acatcgcacc aaggacgact actccaagga attggctctg 360

aaggtgaagc tgtctggaag ctatggcttt ttttctgcct ccgttgagtc tgatttctct 420

cagagcattt ccgatgtgac ggacaccaca tacacttcag ttcgcaccca cgtcaacaag 480

tggaggctga gcctgaagga cgatgttggg gcccttcgct cgaagctgct gcctggcttc 540

aagcaggcgc tggctaccat ggatgctacg cagctctttg acacgttcgg gactcactat 600

gtgagcgagg tgcttgtggg tgggcgtgca gactacgttg ccaccaccaa gaccagcgcg 660

ttcagctcgt ccaccagcat cagcgtagcg gcagaagcat cattcaagtc catcgcgggt 720

ggggaggtgt ctccggagtc caaggagctt gcggagacgc tgagagagaa cagcagcaca 780

cgactgtacg ctcttggcgg gagtgccctc accaacatca cagatccagc cangtacaac 840

gcctggctgc agtccattga caccatccct gtnttntgcg gattcactca aaacagcctc 900

aagcccatct cggagcttgc tgactccgct caacgccggg acgctctggc caaagcctcc 960

caaagctata tcccatcata cgtgactcgt cctgcagtgg ttggcttgga ggtcataata 1020

tcggacagca actcagagag ccctccctat ggctacacca gaatagacta cgacctcaac 1080

cgcaacgcag gaggcaaata cgtgttcctc tgctacaagc agaagtacat ttcagtggga 1140

ggggatgccg atgccatcac cgacgtcctt gtcgtctacg gaaatgaccg aaatccatct 1200

gtgccgtctg gctacaccaa gatcgacaag gacctcaact ccggggcagg aggtaagtat 1260

atctacttct gctactccaa ggacaagcac aagcaagagg agggactgcc cattcgtggg 1320

cttcgtgttg ttgggcctca cccaacctca gtggcacctt acggattctc taagatcgac 1380

atagatctga atatgggtgc aggaggagat tttatatacc tttgcaaatc acgccatttg 1440

gag 1443

<210> 64

<211> 478

<212> БЕЛОК

<213> Ophioglossum pendulum

<220>

<221> другой_признак

<222> (275)..(275)

<223> Xaa может представлять собой любую втречающуюся в природе аминокислоту

<220>

<221> другой_признак

<222> (289)..(289)

<223> Xaa может представлять собой любую втречающуюся в природе аминокислоту

<400> 64

Met Glu Pro Asn Lys Gly Gly Ala Pro Ala Met Lys Asn Val Ala Lys

1 5 10 15

Pro Ser Thr Lys Thr Leu Ile Pro Ser Ser Ile Ala Ala Ser Ser Gln

20 25 30

Thr Ala Ala Asn Ala Leu Thr Glu Pro Leu Pro Gly Ser Asp Ala Ile

35 40 45

Gly Gln Ser Tyr Asn Ala Phe Gly Phe Phe Ala Asn Pro Arg Ser Ile

50 55 60

Met Lys Glu Leu Phe Glu Phe Ser Pro Gln Glu Glu Ile Val Val Glu

65 70 75 80

Gly Asn Thr Trp Leu Leu Ser Ser Asp Phe Val Tyr Thr Ala Ile Arg

85 90 95

Asp Ser Glu Ala Phe Thr Leu Ser His Arg Thr Lys Asp Asp Tyr Ser

100 105 110

Lys Glu Leu Ala Leu Lys Val Lys Leu Ser Gly Ser Tyr Gly Phe Phe

115 120 125

Ser Ala Ser Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Val Thr

130 135 140

Asp Thr Thr Tyr Thr Ser Val Arg Thr His Val Asn Lys Trp Arg Leu

145 150 155 160

Ser Leu Lys Asp Asp Val Gly Ala Leu Arg Ser Lys Leu Leu Pro Gly

165 170 175

Phe Lys Gln Ala Leu Ala Thr Met Asp Ala Thr Gln Leu Phe Asp Thr

180 185 190

Phe Gly Thr His Tyr Val Ser Glu Val Leu Val Gly Gly Arg Ala Asp

195 200 205

Tyr Val Ala Thr Thr Lys Thr Ser Ala Phe Ser Ser Ser Thr Ser Ile

210 215 220

Ser Val Ala Ala Glu Ala Ser Phe Lys Ser Ile Ala Gly Gly Glu Val

225 230 235 240

Ser Pro Glu Ser Lys Glu Leu Ala Glu Thr Leu Arg Glu Asn Ser Ser

245 250 255

Thr Arg Leu Tyr Ala Leu Gly Gly Ser Ala Leu Thr Asn Ile Thr Asp

260 265 270

Pro Ala Xaa Tyr Asn Ala Trp Leu Gln Ser Ile Asp Thr Ile Pro Val

275 280 285

Xaa Cys Gly Phe Thr Gln Asn Ser Leu Lys Pro Ile Ser Glu Leu Ala

290 295 300

Asp Ser Ala Gln Arg Arg Asp Ala Leu Ala Lys Ala Ser Gln Ser Tyr

305 310 315 320

Ile Pro Ser Tyr Val Thr Arg Pro Ala Val Val Gly Leu Glu Val Ile

325 330 335

Ile Ser Asp Ser Asn Ser Glu Ser Pro Pro Tyr Gly Tyr Thr Arg Ile

340 345 350

Asp Tyr Asp Leu Asn Arg Asn Ala Gly Gly Lys Tyr Val Phe Leu Cys

355 360 365

Tyr Lys Gln Lys Tyr Ile Ser Val Gly Gly Asp Ala Asp Ala Ile Thr

370 375 380

Asp Val Leu Val Val Tyr Gly Asn Asp Arg Asn Pro Ser Val Pro Ser

385 390 395 400

Gly Tyr Thr Lys Ile Asp Lys Asp Leu Asn Ser Gly Ala Gly Gly Lys

405 410 415

Tyr Ile Tyr Phe Cys Tyr Ser Lys Asp Lys His Lys Gln Glu Glu Gly

420 425 430

Leu Pro Ile Arg Gly Leu Arg Val Val Gly Pro His Pro Thr Ser Val

435 440 445

Ala Pro Tyr Gly Phe Ser Lys Ile Asp Ile Asp Leu Asn Met Gly Ala

450 455 460

Gly Gly Asp Phe Ile Tyr Leu Cys Lys Ser Arg His Leu Glu

465 470 475

<210> 65

<211> 1443

<212> ДНК

<213> Ophioglossum pendulum

<400> 65

atgcgaggat ccgaacccaa caaaggtggt gctccagcca tgaaaaatgt agccaaacct 60

tccacaaaga gactcatacc gtcatccatt gctgcatcat cgcaaacatc tgcaaatgca 120

ttaaccgagc cattgcctgg ctctgatgcc atcggccaga gctacgatgc attcgggttc 180

ttcgccaatc ccagaagcat catgaaggag ttgttcgagt tcagtcctca agaggagata 240

atcgtggaag gaaatacctg gcttctctct tcggacttcg tttacaccgc aattagagac 300

actgagacct ccacggtctc acgtcgcacc aaggacgact actccaagga attggctgtg 360

aaggtgaagc tgtctggaag ctatggctat ttttctgcct ccgttgagtc tgatttctct 420

cagagcattt ccgatgcgac ggacaccaca tacacttcag ttcgcaccca cgtcaacaag 480

tggaggctga gcctgaagga cgatgttggg gcccttcgct cgaagctgct gcctggcgtc 540

aagcaggcgc tggctaccat ggatgctacg cagctctttg acacgttcgg gactcactgt 600

gtgagcgagg tgcttgtggg tgggcgtgca gactacgttg ccaccaccaa gaccagcgcg 660

ttcagctcat ccaccagcat cagcgtagcg gcagaagcat cattccagtc catcgcgggt 720

ggggaggtgt ctccggagtc caaggtgctt gcggagatgc tgagagagaa cagcagcaca 780

cgcctgtacg ctcttggcgg gagtgccctc cccaacatca cagatccagc cacgtacaac 840

gcctggctgg agtccattga caccatccct gtcttctgcg gattcactca aaacagcctc 900

aagcccatct cggagcttgc tgactccgct caacgccggg acgctctggc caaagcctcc 960

caaagctata tcccatcata cgtgactcgt cctgcagtgg ttggcttgga ggtcataata 1020

tcggacagca actcggagag ccctccctat ggctacacca gaatagacta cgacctcaac 1080

cgcaacgcag gaggcaaata cgtgttcctc tgctacaagc agaagaacat ttcagtggga 1140

ggggatgccg atgccatcac cgacgtcctt gtcgtctacg gaaatgaccg aaatccatct 1200

gtgccgtctg gctacaccaa gatcgacaag gacctcaact ccggggcagg cggtaagtat 1260

atctacttct gctactccaa ggacaagcgg aagcaagagg agggactgcc cattcgtggg 1320

cttcgtgttg ttgggcctca cccaacctca gtggcacctt acggattctc taagatcgac 1380

atagatctga atatgggtgc aggaggagat tttatatacc tttgcaaatc acgccatttg 1440

gag 1443

<210> 66

<211> 478

<212> БЕЛОК

<213> Ophioglossum pendulum

<400> 66

Met Glu Pro Asn Lys Gly Gly Ala Pro Ala Met Lys Asn Val Ala Lys

1 5 10 15

Pro Ser Thr Lys Arg Leu Ile Pro Ser Ser Ile Ala Ala Ser Ser Gln

20 25 30

Thr Ser Ala Asn Ala Leu Thr Glu Pro Leu Pro Gly Ser Asp Ala Ile

35 40 45

Gly Gln Ser Tyr Asp Ala Phe Gly Phe Phe Ala Asn Pro Arg Ser Ile

50 55 60

Met Lys Glu Leu Phe Glu Phe Ser Pro Gln Glu Glu Ile Ile Val Glu

65 70 75 80

Gly Asn Thr Trp Leu Leu Ser Ser Asp Phe Val Tyr Thr Ala Ile Arg

85 90 95

Asp Thr Glu Thr Ser Thr Val Ser Arg Arg Thr Lys Asp Asp Tyr Ser

100 105 110

Lys Glu Leu Ala Val Lys Val Lys Leu Ser Gly Ser Tyr Gly Tyr Phe

115 120 125

Ser Ala Ser Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Ala Thr

130 135 140

Asp Thr Thr Tyr Thr Ser Val Arg Thr His Val Asn Lys Trp Arg Leu

145 150 155 160

Ser Leu Lys Asp Asp Val Gly Ala Leu Arg Ser Lys Leu Leu Pro Gly

165 170 175

Val Lys Gln Ala Leu Ala Thr Met Asp Ala Thr Gln Leu Phe Asp Thr

180 185 190

Phe Gly Thr His Cys Val Ser Glu Val Leu Val Gly Gly Arg Ala Asp

195 200 205

Tyr Val Ala Thr Thr Lys Thr Ser Ala Phe Ser Ser Ser Thr Ser Ile

210 215 220

Ser Val Ala Ala Glu Ala Ser Phe Gln Ser Ile Ala Gly Gly Glu Val

225 230 235 240

Ser Pro Glu Ser Lys Val Leu Ala Glu Met Leu Arg Glu Asn Ser Ser

245 250 255

Thr Arg Leu Tyr Ala Leu Gly Gly Ser Ala Leu Pro Asn Ile Thr Asp

260 265 270

Pro Ala Thr Tyr Asn Ala Trp Leu Glu Ser Ile Asp Thr Ile Pro Val

275 280 285

Phe Cys Gly Phe Thr Gln Asn Ser Leu Lys Pro Ile Ser Glu Leu Ala

290 295 300

Asp Ser Ala Gln Arg Arg Asp Ala Leu Ala Lys Ala Ser Gln Ser Tyr

305 310 315 320

Ile Pro Ser Tyr Val Thr Arg Pro Ala Val Val Gly Leu Glu Val Ile

325 330 335

Ile Ser Asp Ser Asn Ser Glu Ser Pro Pro Tyr Gly Tyr Thr Arg Ile

340 345 350

Asp Tyr Asp Leu Asn Arg Asn Ala Gly Gly Lys Tyr Val Phe Leu Cys

355 360 365

Tyr Lys Gln Lys Asn Ile Ser Val Gly Gly Asp Ala Asp Ala Ile Thr

370 375 380

Asp Val Leu Val Val Tyr Gly Asn Asp Arg Asn Pro Ser Val Pro Ser

385 390 395 400

Gly Tyr Thr Lys Ile Asp Lys Asp Leu Asn Ser Gly Ala Gly Gly Lys

405 410 415

Tyr Ile Tyr Phe Cys Tyr Ser Lys Asp Lys Arg Lys Gln Glu Glu Gly

420 425 430

Leu Pro Ile Arg Gly Leu Arg Val Val Gly Pro His Pro Thr Ser Val

435 440 445

Ala Pro Tyr Gly Phe Ser Lys Ile Asp Ile Asp Leu Asn Met Gly Ala

450 455 460

Gly Gly Asp Phe Ile Tyr Leu Cys Lys Ser Arg His Leu Glu

465 470 475

<210> 67

<211> 1491

<212> ДНК

<213> Ophioglossum pendulum

<400> 67

atggtcgacc tgcaggcggc cgcgaattca ctagtgattg aattaggcat gcgaggatcc 60

gaacccaaca aaggtggtgc tccagccatg aaaaatgtag ccaaaccttc cacaaagaga 120

ctcataccgt catccattgc tgcatcatcg caaacatctg caaatgcatt aaccgagcca 180

ttgcctggct ctgatgccat cggccagagc tacgatgcgt tcgggttctt cgccaatccc 240

agaagcatca tgaaggagtt gtttgagttc agtcctcaag aggagatagt cgtggaagga 300

aatacctggc ttctctcttc ggacttcgtt tacaccgcaa ttagagacag tgaggccttc 360

acgctctcac atcgcaccaa ggacgactac tccaaggaat tggctctgaa ggtgaagctg 420

tctggaagct atggcttttt ttctgcctcc gttgagtctg atttctctca gagcatttcc 480

gatgtgacgg acaccacata cacttcagtt cgcacccacg tcaacaagtg gaggctgagc 540

ctgaaggacg atgttggggc ccttcgctcg aagctgctgc ctggcttcaa gcaggcgctg 600

gctaccatgg atgctacgca gctctttgac acgttcggga ctcactatgt gagcgaggtg 660

cttgtgggtg ggcgtgcaga ctacgttgcc accaccaaga ccagcgcgtt cagctcgtcc 720

accagcatca gcgtagcggc agaagcatca ttcaagtcca tcgcgggtgg ggaggtgtct 780

ccggagtcca aggagcttgc ggagacgctg agagagaaca gcagcacacg actgtacgct 840

cttggcggga gtgccctcac caacatcaca gatccagcca cgtacaacgc ctggctgcag 900

tccattgaca ccatccctgt cttctgcgga ttcactcaaa acagcctcaa gcccatctcg 960

gagcttgctg actccgctca acgccgggac gctctggcca aagcctccca aagctatatc 1020

ccatcatacg tgactcgtcc tgcagtggtt ggcttggagg tcataatatc ggacagcaac 1080

tcggagagcc ctccctatgg ctacaccaga atagactacg acctcaaccg caacgcagga 1140

ggcaaatacg tgttcctctg ctacaagcag aagaacattt cagtgggagg ggatgcggat 1200

gccatcaccg acgtccttgt cgtctacgga aatgaccgaa atccatctgt gccgtctggc 1260

tacaccaaga tcgacaagga cctcaactcc ggggcaggcg gtaagtatat ctacttctgc 1320

tactccaagg acaagcggaa gcaagaggag ggactgccta ttcgtgggct tcgtgttgtt 1380

gggcctcacc caacctcagt ggcaccttac ggattctcta agatcgacat agatctgaat 1440

atgggtgcag gaggagattt tatatacctt tgcaaatcac gccatttgga g 1491

<210> 68

<211> 478

<212> БЕЛОК

<213> Ophioglossum pendulum

<400> 68

Met Glu Pro Asn Lys Gly Gly Ala Pro Ala Met Lys Asn Val Ala Lys

1 5 10 15

Pro Ser Thr Lys Arg Leu Ile Pro Ser Ser Ile Ala Ala Ser Ser Gln

20 25 30

Thr Ser Ala Asn Ala Leu Thr Glu Pro Leu Pro Gly Ser Asp Ala Ile

35 40 45

Gly Gln Ser Tyr Asp Ala Phe Gly Phe Phe Ala Asn Pro Arg Ser Ile

50 55 60

Met Lys Glu Leu Phe Glu Phe Ser Pro Gln Glu Glu Ile Val Val Glu

65 70 75 80

Gly Asn Thr Trp Leu Leu Ser Ser Asp Phe Val Tyr Thr Ala Ile Arg

85 90 95

Asp Ser Glu Ala Phe Thr Leu Ser His Arg Thr Lys Asp Asp Tyr Ser

100 105 110

Lys Glu Leu Ala Leu Lys Val Lys Leu Ser Gly Ser Tyr Gly Phe Phe

115 120 125

Ser Ala Ser Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Val Thr

130 135 140

Asp Thr Thr Tyr Thr Ser Val Arg Thr His Val Asn Lys Trp Arg Leu

145 150 155 160

Ser Leu Lys Asp Asp Val Gly Ala Leu Arg Ser Lys Leu Leu Pro Gly

165 170 175

Phe Lys Gln Ala Leu Ala Thr Met Asp Ala Thr Gln Leu Phe Asp Thr

180 185 190

Phe Gly Thr His Tyr Val Ser Glu Val Leu Val Gly Gly Arg Ala Asp

195 200 205

Tyr Val Ala Thr Thr Lys Thr Ser Ala Phe Ser Ser Ser Thr Ser Ile

210 215 220

Ser Val Ala Ala Glu Ala Ser Phe Lys Ser Ile Ala Gly Gly Glu Val

225 230 235 240

Ser Pro Glu Ser Lys Glu Leu Ala Glu Thr Leu Arg Glu Asn Ser Ser

245 250 255

Thr Arg Leu Tyr Ala Leu Gly Gly Ser Ala Leu Thr Asn Ile Thr Asp

260 265 270

Pro Ala Thr Tyr Asn Ala Trp Leu Gln Ser Ile Asp Thr Ile Pro Val

275 280 285

Phe Cys Gly Phe Thr Gln Asn Ser Leu Lys Pro Ile Ser Glu Leu Ala

290 295 300

Asp Ser Ala Gln Arg Arg Asp Ala Leu Ala Lys Ala Ser Gln Ser Tyr

305 310 315 320

Ile Pro Ser Tyr Val Thr Arg Pro Ala Val Val Gly Leu Glu Val Ile

325 330 335

Ile Ser Asp Ser Asn Ser Glu Ser Pro Pro Tyr Gly Tyr Thr Arg Ile

340 345 350

Asp Tyr Asp Leu Asn Arg Asn Ala Gly Gly Lys Tyr Val Phe Leu Cys

355 360 365

Tyr Lys Gln Lys Asn Ile Ser Val Gly Gly Asp Ala Asp Ala Ile Thr

370 375 380

Asp Val Leu Val Val Tyr Gly Asn Asp Arg Asn Pro Ser Val Pro Ser

385 390 395 400

Gly Tyr Thr Lys Ile Asp Lys Asp Leu Asn Ser Gly Ala Gly Gly Lys

405 410 415

Tyr Ile Tyr Phe Cys Tyr Ser Lys Asp Lys Arg Lys Gln Glu Glu Gly

420 425 430

Leu Pro Ile Arg Gly Leu Arg Val Val Gly Pro His Pro Thr Ser Val

435 440 445

Ala Pro Tyr Gly Phe Ser Lys Ile Asp Ile Asp Leu Asn Met Gly Ala

450 455 460

Gly Gly Asp Phe Ile Tyr Leu Cys Lys Ser Arg His Leu Glu

465 470 475

<210> 69

<211> 1443

<212> ДНК

<213> Ophioglossum pendulum

<400> 69

atgcgaggat ccgaacccaa caaaggtggt gctccagcca tgaaaaatgt agccaaacct 60

tccacaaaga gactcatacc gtcatccatt gctgcatcat cgcaaacatc tgcaaatgca 120

ttaaccgagc cattgcctgg ctctgatgcc atcggccaga gctacgatgc attcgggttc 180

ttcgccaatc ccagaagcat catgaaggag ttgttcgagt tcagtcctca aaaggagata 240

gtcgtggaag gaaatacctg gcttctctct tcggacttcg tttacaccgc aattagagac 300

actgagacct ccacggtctc acgtcgcacc aaggacgact actccaagga attggctgtg 360

aaggtgaagc tgtctggaag ctatggctat ttttctgcct ccgttgagtc tgatttctct 420

cagagcattt ccgatgcgac ggacaccaca tacacttcag ttcgcaccca cgtcaacaag 480

tggaggctga gcctgaagga cgatgttggg gcccttcgct cgaagctgct gcctggcgtc 540

aagcaggcgc tggctaccat ggatgctacg cagctctttg acacgttcgg gactcactat 600

gtgagcgagg tgcttgtggg tgggcgtgca gactacgttg ccaccaccaa gaccagcgcg 660

ttcagctcat ccaccagcat cagcgtagcg gcagaagcat cattccagtc catcgcgggt 720

ggggaggtgt ctccggagtc caaggtgctt gcggagatgc tgagagagaa cagcagcaca 780

cgcctgtacg ctcttggcgg gagtgccctc cccaacatca cagatccagt cacgtacaac 840

gcctggctgg agtccattga caccatccct gtcttctgcg gattcactca aaacagcctc 900

aagcccatct cggagcttgc tgactccgct caacgccggg acgctctggc caaagcctcc 960

caaagctata tcccatcata cgtgactcgt cctgcagtgg ttggcttgga ggtcataata 1020

tcggacagca actcggagag ccctccctat ggctacacca gaatagacta cgacctcaac 1080

cgcaacgcag gaggcaaata cgtgttcctc tgctacaagc agaagaacat ttcagtggga 1140

ggggatgccg atgccatcac cgacgtcctt gtcgtctacg gaaatgaccg aaatccatct 1200

gtgccgtctg gctacaccaa gatcgacaag gacctcaact ccggggcagg cggtaagtat 1260

atctacttct gctactccaa ggacaagcgg aagcaagagg agggactgcc cattcgtggg 1320

cttcgtgttg ttgggcctca cccaacctca gtggcacctt acggattctc taagatcgac 1380

atagatctga atatgggtgc aggaggagat tttatatacc tttgcaaatc acgccatttg 1440

gag 1443

<210> 70

<211> 478

<212> БЕЛОК

<213> Ophioglossum pendulum

<400> 70

Met Glu Pro Asn Lys Gly Gly Ala Pro Ala Met Lys Asn Val Ala Lys

1 5 10 15

Pro Ser Thr Lys Arg Leu Ile Pro Ser Ser Ile Ala Ala Ser Ser Gln

20 25 30

Thr Ser Ala Asn Ala Leu Thr Glu Pro Leu Pro Gly Ser Asp Ala Ile

35 40 45

Gly Gln Ser Tyr Asp Ala Phe Gly Phe Phe Ala Asn Pro Arg Ser Ile

50 55 60

Met Lys Glu Leu Phe Glu Phe Ser Pro Gln Lys Glu Ile Val Val Glu

65 70 75 80

Gly Asn Thr Trp Leu Leu Ser Ser Asp Phe Val Tyr Thr Ala Ile Arg

85 90 95

Asp Thr Glu Thr Ser Thr Val Ser Arg Arg Thr Lys Asp Asp Tyr Ser

100 105 110

Lys Glu Leu Ala Val Lys Val Lys Leu Ser Gly Ser Tyr Gly Tyr Phe

115 120 125

Ser Ala Ser Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Ala Thr

130 135 140

Asp Thr Thr Tyr Thr Ser Val Arg Thr His Val Asn Lys Trp Arg Leu

145 150 155 160

Ser Leu Lys Asp Asp Val Gly Ala Leu Arg Ser Lys Leu Leu Pro Gly

165 170 175

Val Lys Gln Ala Leu Ala Thr Met Asp Ala Thr Gln Leu Phe Asp Thr

180 185 190

Phe Gly Thr His Tyr Val Ser Glu Val Leu Val Gly Gly Arg Ala Asp

195 200 205

Tyr Val Ala Thr Thr Lys Thr Ser Ala Phe Ser Ser Ser Thr Ser Ile

210 215 220

Ser Val Ala Ala Glu Ala Ser Phe Gln Ser Ile Ala Gly Gly Glu Val

225 230 235 240

Ser Pro Glu Ser Lys Val Leu Ala Glu Met Leu Arg Glu Asn Ser Ser

245 250 255

Thr Arg Leu Tyr Ala Leu Gly Gly Ser Ala Leu Pro Asn Ile Thr Asp

260 265 270

Pro Val Thr Tyr Asn Ala Trp Leu Glu Ser Ile Asp Thr Ile Pro Val

275 280 285

Phe Cys Gly Phe Thr Gln Asn Ser Leu Lys Pro Ile Ser Glu Leu Ala

290 295 300

Asp Ser Ala Gln Arg Arg Asp Ala Leu Ala Lys Ala Ser Gln Ser Tyr

305 310 315 320

Ile Pro Ser Tyr Val Thr Arg Pro Ala Val Val Gly Leu Glu Val Ile

325 330 335

Ile Ser Asp Ser Asn Ser Glu Ser Pro Pro Tyr Gly Tyr Thr Arg Ile

340 345 350

Asp Tyr Asp Leu Asn Arg Asn Ala Gly Gly Lys Tyr Val Phe Leu Cys

355 360 365

Tyr Lys Gln Lys Asn Ile Ser Val Gly Gly Asp Ala Asp Ala Ile Thr

370 375 380

Asp Val Leu Val Val Tyr Gly Asn Asp Arg Asn Pro Ser Val Pro Ser

385 390 395 400

Gly Tyr Thr Lys Ile Asp Lys Asp Leu Asn Ser Gly Ala Gly Gly Lys

405 410 415

Tyr Ile Tyr Phe Cys Tyr Ser Lys Asp Lys Arg Lys Gln Glu Glu Gly

420 425 430

Leu Pro Ile Arg Gly Leu Arg Val Val Gly Pro His Pro Thr Ser Val

435 440 445

Ala Pro Tyr Gly Phe Ser Lys Ile Asp Ile Asp Leu Asn Met Gly Ala

450 455 460

Gly Gly Asp Phe Ile Tyr Leu Cys Lys Ser Arg His Leu Glu

465 470 475

<210> 71

<211> 1353

<212> ДНК

<213> Huperzia goebelii

<400> 71

atggcccaaa tagagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat agacagctct tcgactttgc ccctcagcaa 120

gaaattactt tagaggacca cacatggctc ctctccactg atattgtata tattgctgtc 180

cgggatacgg atataaaaac cgtctctctt cgcacaaaag attcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttcagttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatgaac tcggaggagc tgtttacgac gtacggaaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agagttcatt caagtccgtg 600

gctggcatgg acgtatcatc caagtacaag gaacttatcc agatattcca agagaacagc 660

tccactagtc tgtacgccat tggtgggacc gcactctcca gcatcacaga cacggacact 720

tacaatgcat ggctcagttc gattgataca cttcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatctggga actcgctgaa tcccctcagc gccaggagat cctccagaag 840

gctacgaaga cctttattcc gcccgaaatc agacgaaatg cgatcgtcga cgtagatatt 900

atcgtgtccg acaactattg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatatatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacgatcatc catacattcc tccaggttat accaggatca acagcgatct gaacgagggt 1140

gcggggggca aatatatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaaagt cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tatatcttcg tttgtttctc acgtcattta gac 1353

<210> 72

<211> 451

<212> БЕЛОК

<213> Huperzia goebelii

<400> 72

Met Ala Gln Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Arg Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Thr Leu Glu Asp His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Val Tyr Ile Ala Val Arg Asp Thr Asp

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Ser Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asn Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ser Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Ile Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Leu Ser Ser Ile Thr Asp Thr Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Leu Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Arg Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Trp Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Tyr Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Ile Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Asn Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Tyr Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Lys

405 410 415

Val Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Tyr Ile Phe Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 73

<211> 1353

<212> ДНК

<213> Huperzia goebelii

<400> 73

atggcccaaa tagagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattttacg ccaaccccaa gagcgttaat agacagctct tcgactttgc ccctcagcaa 120

gaaattactt tagaggacca cacatggctc ctctccactg atattgtata tattgctgtc 180

cgggatacgg atataacaac cgtctctctt cgcacaaaag attcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcagcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcga tgagacggat tccacttaca cttcagttcg tacaaatgtg 360

aacaagtgga agctcagtct gaagccaact gtggaagaac tgcgttccat gttgacacct 420

tcgttcaagg aagctttggc gagtatgaac tcggaggagc tgtttacgac gtacggaaca 480

cattatctga gtgaggtgtt ggtgggaggt cgcgcagatt atgtcgccac caccaaaacc 540

agtgcattca gctctgatat tcaaatcagc gtagttgcgg agagttcatt caagtccgtg 600

gctggcatgg acgtatcatc caagtacaag gaacttatcc agatattcca agagaacagc 660

tccactagtc tgtacgccat tggtgggacc gcactctcca gcatcacaga cacggacact 720

tacaatgcat ggctcagttc gattgataca cttcccgtct tctgtggatt cacttacgaa 780

agtcttcagc ccatctggga actcgctgaa tcccctcagc gccaggagat cctccagaag 840

gctacgaaga cctttattcc gcccgaaatc agacgaaatg cgatcgtcga cgtagatatt 900

atcgtgtccg acaactattg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatatatc tttttgtgct acaatcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gacgatcatc catacattcc tccaggttat accaggatca acagcgatct gaacgagggt 1140

gcggggggca aatatatcta tctatgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcatccgc gttattggta acgaaaaagt cgagaatgtg 1260

gttacacctt acggattcac gaagattgat aaagatctga acgagggtgc agggggagac 1320

tatatcttcg tttgtttctc acgtcattta gac 1353

<210> 74

<211> 451

<212> БЕЛОК

<213> Huperzia goebelii

<400> 74

Met Ala Gln Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Asn Arg Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Thr Leu Glu Asp His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Val Tyr Ile Ala Val Arg Asp Thr Asp

50 55 60

Ile Thr Thr Val Ser Leu Arg Thr Lys Asp Ser Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Ser Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Leu Ser Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asn Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Ile Gln Ile Ser Val Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Asp Val Ser Ser Lys

195 200 205

Tyr Lys Glu Leu Ile Gln Ile Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Leu Ser Ser Ile Thr Asp Thr Asp Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Leu Pro Val Phe Cys Gly

245 250 255

Phe Thr Tyr Glu Ser Leu Gln Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Thr Lys Thr Phe Ile Pro Pro

275 280 285

Glu Ile Arg Arg Asn Ala Ile Val Asp Val Asp Ile Ile Val Ser Asp

290 295 300

Asn Tyr Trp Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Tyr Ile Phe Leu Cys Tyr Asn Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp His Pro Tyr Ile Pro Pro

355 360 365

Gly Tyr Thr Arg Ile Asn Ser Asp Leu Asn Glu Gly Ala Gly Gly Lys

370 375 380

Tyr Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Lys

405 410 415

Val Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Lys Ile Asp Lys Asp

420 425 430

Leu Asn Glu Gly Ala Gly Gly Asp Tyr Ile Phe Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 75

<211> 1353

<212> ДНК

<213> Huperzia carinata

<400> 75

atggcccaaa tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattctatg ccaaccccaa gagcgtgaaa agagagctct tcgactttgc ccctcagcaa 120

gaaattactg aagagggcca cacttggctc ctttccactg atattgtaaa tactgctgtc 180

cgagatacgg aaataaaaac cgtctctctt cgcacaaaag atgaatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcggcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcca ggagacggac tccacttaca cttcagttcg tacaaatgtg 360

accaaatgga agctcggtct caagccaact gtcgaagaac tgcgttccat gttgacgcct 420

tcgttcaagg aggcattggc gagtatggag tcggaggagc tgtttacgac gtacgggaca 480

tattatctga gtgaggtgtt ggtgggaggt cgcgcagatt acgtggccac caccaaaacc 540

agtgcattca gctctgatac tcaaatcagc gtagttgcgg agagttcatt caagtccgtg 600

gctggcatgg aggtatcctc ccagtacaag gagcttatca agaaatttca agagaacagc 660

tccactcgtc tgtacgccat cggtgggacc gcactctcca gcatcacaga cacggccact 720

tacaacgcat ggctcagttc cattgataca cgtcccgtct tctgtggatt cactcgcgac 780

agtcttaggc ccatctggga gctcgctgaa tcccctcagc gccgggagat tctccgaaaa 840

gctacccaaa cgtttatccc accagaaatc acacgaaatg caatcgttgg cgtagatatt 900

atcatgtctg acaactattg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatatatc ttcttgtgtt acaaacaaca gaagatatca 1020

gtagctggat ccccagcgga tcccaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gatgataatc catatgttcc cgcaggttac accatgatca acacagatct gaaccagggt 1140

gcgaagggca agtttatcta tctctgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcctccgc gttattggta acccacaagt cgagaatgtg 1260

gttacacctt acggattcac gaggattaat aaagatctga atgagggtgc aaagggagag 1320

tatatctacg tttgtttctc acgtcattta gac 1353

<210> 76

<211> 451

<212> БЕЛОК

<213> Huperzia carinata

<400> 76

Met Ala Gln Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Lys Arg Glu

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Thr Glu Glu Gly His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Val Asn Thr Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Glu Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Gly Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Gln Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Thr Lys Trp Lys Leu Gly Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Glu Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

Tyr Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Thr Gln Ile Ser Val Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Glu Val Ser Ser Gln

195 200 205

Tyr Lys Glu Leu Ile Lys Lys Phe Gln Glu Asn Ser Ser Thr Arg Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Leu Ser Ser Ile Thr Asp Thr Ala Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Arg Asp Ser Leu Arg Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Arg Glu Ile Leu Arg Lys Ala Thr Gln Thr Phe Ile Pro Pro

275 280 285

Glu Ile Thr Arg Asn Ala Ile Val Gly Val Asp Ile Ile Met Ser Asp

290 295 300

Asn Tyr Trp Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Tyr Ile Phe Leu Cys Tyr Lys Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp Asn Pro Tyr Val Pro Ala

355 360 365

Gly Tyr Thr Met Ile Asn Thr Asp Leu Asn Gln Gly Ala Lys Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Leu Arg Val Ile Gly Asn Pro Gln

405 410 415

Val Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Arg Ile Asn Lys Asp

420 425 430

Leu Asn Glu Gly Ala Lys Gly Glu Tyr Ile Tyr Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 77

<211> 1353

<212> ДНК

<213> Huperzia carinata

<400> 77

atggcccaaa tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattctatg ccaaccccaa gagcgtgaaa agagagctct tcgactttgc ccctcagcaa 120

gaaattactg aagagggcca cacttggctc ctttccactg atattgtaaa tactgctgtc 180

cgagatacgg aaataaaaac cgtctctctt cgcacaaaag atgaatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcggcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcca ggagacggac tccacttaca cttcagttcg tacaaatgtg 360

accaaatgga agctcggtct caagccaact gtcgaagaac tgcgttccat gttgacgcct 420

tcgttcaagg aggcattggc gagtatggag tcggaggagc tgtttacgac gtacgggaca 480

tattatctga gtgaggtgtt ggtgggaggt cgcgcagatt acgtggccac caccaaaacc 540

agtgcattca gctctgatac tcaaatcagc gtagttgcgg agagttcatt caagtccgtg 600

gctggcatgg aggtatcctc ccagtacaat gagcttatca agaaatttca agagaacagc 660

tccactcgtc tgtacgccat cggtgggacc gcactctcca gcatcacaga cacggccact 720

tacaacgcat ggctcagttc gattgataca cttcccgtct tctgtggatt cactagcgca 780

agtcttaagc ccatctggga actcgctgaa tcctctcagc gccaggagat cctgcaaaag 840

gctgcgcaga cctttatccc gctcgaaatc agacgaaatg cgatcgttga cgtagctatt 900

atcgtgtccg acaaccatct ggtgaatcct ccctacggct ttacgaagat cgattttgat 960

ctgaaccgcg gtgccaaggg caaatttatc tatttgtgct acaagcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaaaccc atcactgcct tgaacgtggt ttctagcgat 1080

taccatgatc catccgctcc ttcaggttat accatgatca acacagatct gaaccagggt 1140

gcgaagggca agtttatcta tctctgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcctccgc gttattggta acccacaagt cgagaatgtg 1260

gttacacctt acggattcac gaggatcaat aaagatctga atgagggtgc aaagggagag 1320

tttatctacg tttgtttctc acgtcattta gac 1353

<210> 78

<211> 451

<212> БЕЛОК

<213> Huperzia carinata

<400> 78

Met Ala Gln Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Lys Arg Glu

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Thr Glu Glu Gly His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Val Asn Thr Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Glu Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Gly Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Gln Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Thr Lys Trp Lys Leu Gly Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Glu Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

Tyr Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Thr Gln Ile Ser Val Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Glu Val Ser Ser Gln

195 200 205

Tyr Asn Glu Leu Ile Lys Lys Phe Gln Glu Asn Ser Ser Thr Arg Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Leu Ser Ser Ile Thr Asp Thr Ala Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Leu Pro Val Phe Cys Gly

245 250 255

Phe Thr Ser Ala Ser Leu Lys Pro Ile Trp Glu Leu Ala Glu Ser Ser

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Ala Gln Thr Phe Ile Pro Leu

275 280 285

Glu Ile Arg Arg Asn Ala Ile Val Asp Val Ala Ile Ile Val Ser Asp

290 295 300

Asn His Leu Val Asn Pro Pro Tyr Gly Phe Thr Lys Ile Asp Phe Asp

305 310 315 320

Leu Asn Arg Gly Ala Lys Gly Lys Phe Ile Tyr Leu Cys Tyr Lys Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Asn Val Val Ser Ser Asp Tyr His Asp Pro Ser Ala Pro Ser

355 360 365

Gly Tyr Thr Met Ile Asn Thr Asp Leu Asn Gln Gly Ala Lys Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Leu Arg Val Ile Gly Asn Pro Gln

405 410 415

Val Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Arg Ile Asn Lys Asp

420 425 430

Leu Asn Glu Gly Ala Lys Gly Glu Phe Ile Tyr Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 79

<211> 1353

<212> ДНК

<213> Huperzia carinata

<400> 79

atggcccaaa tcaagccact acctggatct gattcagtcg gacacaatta tgatgtattc 60

ggattctttg ccaaccccaa gagcgtgaaa agacagctct ttgactttgc ccctcaggaa 120

gaaattactt tagagggcca cacttggctc ctttccactg atattgaata tactattgtc 180

cgagatatgg agataaaaac tctctcttat cgcacaaaag atgcatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcggcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcca ggagacggac tccacttaca cttcagttcg tacaaatgtg 360

accaaatgga agctcggtct caagccaact gtcgaagaac tgcgttccat gttgacgcct 420

tcgttcaagg aggcattggc gagtatggag tcggaggagc tgtttacgac gtacgggaca 480

tattatctga gtgaggtgtt ggtgggaggt cgcgcagatt acgtggccac caccaaaacc 540

agtgcattca gctctgatac tcaaatcagc gtagttgcgg agagttcatt caagtccgtg 600

gctggcatgg aggtatcctc ccagtacaag gagcttatca agaaatttca agagaacagc 660

tccactcgtc tgtacgccat cggtgggacc gcactctcca gcatcacaga cacggccact 720

tacaacgcat ggctcagttc gattgataca cttcccgtct tctgtggatt cactagcgca 780

agtcttaagc ccatctggga actcgctgaa tcctctcagc gccaggagat cctgcaaaag 840

gctgcgcaga cctttatccc gctcgaaatc agacgaaatg cgatcgttga cgtagctatt 900

atcgtgtccg acaaccatct ggtgaatcct ccctacggct ttacgaagat cgattttgat 960

ctgaaccgcg gtgccaaggg caaatttatc tatttgtgct acaagcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaaaccc atcactgcct tgaacgtggt ttctagcgat 1080

taccatgatc catccgctcc ttcaggttat accatgatca acacagatct gaaccagggt 1140

gcgaagggca agtttatcta tctctgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcctccgc gttattggta acccacaagt cgagaatgtg 1260

gttacacctt acggattcac gaggatcaat aaagatctga atgagggtgc aaagggagag 1320

tttatctacg tttgtttctc acgtcattta gac 1353

<210> 80

<211> 451

<212> БЕЛОК

<213> Huperzia carinata

<400> 80

Met Ala Gln Ile Lys Pro Leu Pro Gly Ser Asp Ser Val Gly His Asn

1 5 10 15

Tyr Asp Val Phe Gly Phe Phe Ala Asn Pro Lys Ser Val Lys Arg Gln

20 25 30

Leu Phe Asp Phe Ala Pro Gln Glu Glu Ile Thr Leu Glu Gly His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Thr Ile Val Arg Asp Met Glu

50 55 60

Ile Lys Thr Leu Ser Tyr Arg Thr Lys Asp Ala Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Gly Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Gln Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Thr Lys Trp Lys Leu Gly Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Glu Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

Tyr Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Thr Gln Ile Ser Val Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Glu Val Ser Ser Gln

195 200 205

Tyr Lys Glu Leu Ile Lys Lys Phe Gln Glu Asn Ser Ser Thr Arg Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Leu Ser Ser Ile Thr Asp Thr Ala Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Leu Pro Val Phe Cys Gly

245 250 255

Phe Thr Ser Ala Ser Leu Lys Pro Ile Trp Glu Leu Ala Glu Ser Ser

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Ala Gln Thr Phe Ile Pro Leu

275 280 285

Glu Ile Arg Arg Asn Ala Ile Val Asp Val Ala Ile Ile Val Ser Asp

290 295 300

Asn His Leu Val Asn Pro Pro Tyr Gly Phe Thr Lys Ile Asp Phe Asp

305 310 315 320

Leu Asn Arg Gly Ala Lys Gly Lys Phe Ile Tyr Leu Cys Tyr Lys Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Asn Val Val Ser Ser Asp Tyr His Asp Pro Ser Ala Pro Ser

355 360 365

Gly Tyr Thr Met Ile Asn Thr Asp Leu Asn Gln Gly Ala Lys Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Leu Arg Val Ile Gly Asn Pro Gln

405 410 415

Val Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Arg Ile Asn Lys Asp

420 425 430

Leu Asn Glu Gly Ala Lys Gly Glu Phe Ile Tyr Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 81

<211> 1353

<212> ДНК

<213> Huperzia carinata

<400> 81

atggcccaaa tcgagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattctatg ccaaccccaa gagcgtgaaa agagagctct tcgactttgc ccctcagcaa 120

gaaattactg aagagggcca cacttggctc ctttccactg atattgtaaa tactgctgtc 180

cgagatacgg aaataaaaac cgtctctctt cgcacaaaag atgaatactc cacggagctg 240

gctgcaagcg taaaagtgtc cggcagctat ggcggcttct cggcttcggt agagtctgat 300

ttctcccaaa gcatcagcca ggagacggac tccacttaca cttcagttcg tacaaatgtg 360

accaaatgga agctcggtct caagccaact gtcgaagaac tgcgttccat gttgacgcct 420

tcgttcaagg aggcattggc gagtatggag tcggaggagc tgtttacgac gtacgggaca 480

tattatctga gtgaggtgtt ggtgggaggt cgcgcagatt acgtggccac caccaaaacc 540

agtgcattca gctctgatac tcaaatcagc gtagttgcgg agagttcatt caagtccgtg 600

gctggcatgg aggtatcctc ccagtacaag gagcttatca agaaatttca agagaacagc 660

tccactcgtc tgtacgccat cggtgggacc gcactctcca gcatcacaga cacggccact 720

tacaacgcat ggctcagttc gattgataca cttcccgtct tctgtggatt cactagcgca 780

agtcttaagc ccatctggga actcgctgaa tcctctcagc gccaggagat cctgcaaaag 840

gctgcgcaga cctttatccc gctcgaaatc agacgaaatg cgatcgttga cgtagctatt 900

atcgtgtccg acaaccatct ggtgaatcct ccctacggct ttacgaagat cgattttgat 960

ctgaaccgcg gtgccaaggg caaatttatc tatttgtgct acaagcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaaaccc atcactgcct tgaacgtggt ttctagcgat 1080

taccatgatc catccgctcc ttcaggttat accatgatca acacagatct gaaccagggt 1140

gcgaagggca agtttatcta tctctgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcctccgc gttattggta acccacaagt cgagaatgtg 1260

gttacacctt acggattcac gaggatcaat aaagatctga atgagggtgc aaagggagag 1320

tttatctacg tttgtttctc acgtcattta gac 1353

<210> 82

<211> 451

<212> БЕЛОК

<213> Huperzia carinata

<400> 82

Met Ala Gln Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Lys Arg Glu

20 25 30

Leu Phe Asp Phe Ala Pro Gln Gln Glu Ile Thr Glu Glu Gly His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Val Asn Thr Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Val Ser Leu Arg Thr Lys Asp Glu Tyr Ser Thr Glu Leu

65 70 75 80

Ala Ala Ser Val Lys Val Ser Gly Ser Tyr Gly Gly Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Gln Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Thr Lys Trp Lys Leu Gly Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Glu Ser Glu Glu Leu Phe Thr Thr Tyr Gly Thr

145 150 155 160

Tyr Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Thr Gln Ile Ser Val Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Glu Val Ser Ser Gln

195 200 205

Tyr Lys Glu Leu Ile Lys Lys Phe Gln Glu Asn Ser Ser Thr Arg Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Leu Ser Ser Ile Thr Asp Thr Ala Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Leu Pro Val Phe Cys Gly

245 250 255

Phe Thr Ser Ala Ser Leu Lys Pro Ile Trp Glu Leu Ala Glu Ser Ser

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Ala Gln Thr Phe Ile Pro Leu

275 280 285

Glu Ile Arg Arg Asn Ala Ile Val Asp Val Ala Ile Ile Val Ser Asp

290 295 300

Asn His Leu Val Asn Pro Pro Tyr Gly Phe Thr Lys Ile Asp Phe Asp

305 310 315 320

Leu Asn Arg Gly Ala Lys Gly Lys Phe Ile Tyr Leu Cys Tyr Lys Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Asn Val Val Ser Ser Asp Tyr His Asp Pro Ser Ala Pro Ser

355 360 365

Gly Tyr Thr Met Ile Asn Thr Asp Leu Asn Gln Gly Ala Lys Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Leu Arg Val Ile Gly Asn Pro Gln

405 410 415

Val Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Arg Ile Asn Lys Asp

420 425 430

Leu Asn Glu Gly Ala Lys Gly Glu Phe Ile Tyr Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 83

<211> 1353

<212> ДНК

<213> Huperzia carinata

<400> 83

atggcccaaa tagagccatt acctggatcg gatgcaatcg gacacagtta tgatgtattc 60

ggattctttg ccagccccaa gagcgtgaaa agacatctct tcgactttgc ccctcaggaa 120

gaaattactt tagaggacca cgattggctc ctttccactg atattgaata tactgctgtc 180

cgagatacgg atatcaaaac catctcttat cgcacaaaag atgcatactc cagggatctg 240

gctgcaagcg taaaaatgtc cggcggctat ggcggctttt cggcttcggt ggagtccgat 300

ttctcccaaa gcatcagcca ggagacggac tccacttaca cttcagttcg tacaaatgtg 360

acgaaatgga agctcagact caagccaact gtggaagaac tgcgttccat gttgacgcct 420

tcgttcaagg aggcattggc aagtatggac tcggaggagc tgttttcgac gtacgggaca 480

tattatctga gtgaggtgtt ggtgggaggt cgcgcagatt acgtggccac caccaaaacc 540

agtgcattca gctctgatac tcaaatcagc gtagttgcgg agagttcatt caagtccgtg 600

gctggcatgg aggtatcctc ccagtacaag gagcttatca agaaatttca agagaacagc 660

tccactcgtc tgtacgccat cggtgggacc gcactctcca gcatcacaga cacggccact 720

tacaacgcat ggctcagttc gattgataca cttcccgtct tctgtggatt cactagcgca 780

agtcttaagc ccatctggga actcgctgaa tcctctcagc gccaggagat cctgcaaaag 840

gctgcgcaga cctttatccc gctcgaaatc agacgaaatg cgatcgttga cgtagctatt 900

atcgtgtccg acaaccatct ggtgaatcct ccctacggct ttacgaagat cgattttgat 960

ctgaaccgcg gtgccaaggg caaatttatc tatttgtgct acaagcaaca gaagatatca 1020

gtagcaggat cccctgcgga tccgaaaccc atcactgcct tgaacgtggt ttctagcgat 1080

taccatgatc catccgctcc ttcaggttat accatgatca acacagatct gaaccagggt 1140

gcgaagggca agtttatcta tctctgctac acaaaagatc cggctgcaat acccagcgac 1200

gaggatggac tgcccatacg tggcctccgc gttattggta acccacaagt cgagaatgtg 1260

gttacacctt acggattcac gaggattaat aaagatctga atgagggtgc aaagggagag 1320

tatatctacg tttgtttctc acgtcattta gac 1353

<210> 84

<211> 451

<212> БЕЛОК

<213> Huperzia carinata

<400> 84

Met Ala Gln Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Phe Ala Ser Pro Lys Ser Val Lys Arg His

20 25 30

Leu Phe Asp Phe Ala Pro Gln Glu Glu Ile Thr Leu Glu Asp His Asp

35 40 45

Trp Leu Leu Ser Thr Asp Ile Glu Tyr Thr Ala Val Arg Asp Thr Asp

50 55 60

Ile Lys Thr Ile Ser Tyr Arg Thr Lys Asp Ala Tyr Ser Arg Asp Leu

65 70 75 80

Ala Ala Ser Val Lys Met Ser Gly Gly Tyr Gly Gly Phe Ser Ala Ser

85 90 95

Val Glu Ser Asp Phe Ser Gln Ser Ile Ser Gln Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Thr Lys Trp Lys Leu Arg Leu Lys

115 120 125

Pro Thr Val Glu Glu Leu Arg Ser Met Leu Thr Pro Ser Phe Lys Glu

130 135 140

Ala Leu Ala Ser Met Asp Ser Glu Glu Leu Phe Ser Thr Tyr Gly Thr

145 150 155 160

Tyr Tyr Leu Ser Glu Val Leu Val Gly Gly Arg Ala Asp Tyr Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Thr Gln Ile Ser Val Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Glu Val Ser Ser Gln

195 200 205

Tyr Lys Glu Leu Ile Lys Lys Phe Gln Glu Asn Ser Ser Thr Arg Leu

210 215 220

Tyr Ala Ile Gly Gly Thr Ala Leu Ser Ser Ile Thr Asp Thr Ala Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Leu Pro Val Phe Cys Gly

245 250 255

Phe Thr Ser Ala Ser Leu Lys Pro Ile Trp Glu Leu Ala Glu Ser Ser

260 265 270

Gln Arg Gln Glu Ile Leu Gln Lys Ala Ala Gln Thr Phe Ile Pro Leu

275 280 285

Glu Ile Arg Arg Asn Ala Ile Val Asp Val Ala Ile Ile Val Ser Asp

290 295 300

Asn His Leu Val Asn Pro Pro Tyr Gly Phe Thr Lys Ile Asp Phe Asp

305 310 315 320

Leu Asn Arg Gly Ala Lys Gly Lys Phe Ile Tyr Leu Cys Tyr Lys Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Asn Val Val Ser Ser Asp Tyr His Asp Pro Ser Ala Pro Ser

355 360 365

Gly Tyr Thr Met Ile Asn Thr Asp Leu Asn Gln Gly Ala Lys Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Ser Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Leu Arg Val Ile Gly Asn Pro Gln

405 410 415

Val Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Arg Ile Asn Lys Asp

420 425 430

Leu Asn Glu Gly Ala Lys Gly Glu Tyr Ile Tyr Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 85

<211> 1353

<212> ДНК

<213> Huperzia carinata

<400> 85

atggtgaata tcgagccatt accaggatcg gatgcaatcg gacacagtta tgatgtgttc 60

ggattttatg ccaatcccaa gagcgtaaag aaagagcttt tcgactttgc cgtccagaaa 120

gaaatcactt cagagggcca cacttggctc ctttccactg atattaaata tattgcagtc 180

agagatacgg aaataaaaac cttctccctt cgcacaaaag atgcatactc aagcgagctg 240

gctaaaagcg taaaactgtc cggcagctac ggcggcttct cggaatcggt agagtcagac 300

ttctccgaaa gcatcagcga tgagacggat tccacataca cttcagttcg tacaaatgtg 360

aacaagtgga agatcagtct gaagcacagt gtggaaaagc tgcgctccct gttgaagcct 420

gcgttgaagg agccattggc gagtatgaac gcggtggagc tgttgagtac gtatgggaca 480

cattatctgg gcgaggtgtt ggtgggaggt cgtgcagatt ttgtggccac caccaaaacc 540

agtgcattca gctcggacac taaaatcagc atagtagcgg agagttcttt caagtccgtg 600

gctggcatga aagtatccgc ggagcaaaag cagcttatcg aaaacttcca agaaaacagc 660

tccactagtc tgtacgccat cggtgggagc gcactctcca gcatcacaga cacggccact 720

tacaacgcat ggctcagttc cattgataca cgtcccgtct tctgtggatt cactcgcgac 780

agtcttaggc ccatctggga gctcgctgaa tcccctcagc gccgggagat tctccgaaaa 840

gctacccaaa cgtttatccc accagaaatc acacgaaatg caatcgttgg cgtagatatt 900

atcatgtctg acaactattg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatatatc ttcttgtgtt acaaacaaca gaagatatca 1020

gtagctggat ccccagcgga tcccaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gatgataatc catatgttcc cgcaggttac accaagatcg acaaagattt gaacaaagat 1140

gctgggggca agtttatcta tctctgttac acaaaagatc cggctgcaat acccaacgac 1200

gaggatggac tgcccatacg tggcatccgc gttatcggca atgaaaaact tgagaatgtg 1260

gttaccccgt atggattcac gaggattgat gaagatctga ataagggtgc aaagggagac 1320

tatatcttcg tttgtttctc acgtcattta gac 1353

<210> 86

<211> 451

<212> БЕЛОК

<213> Huperzia carinata

<400> 86

Met Val Asn Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Lys Lys Glu

20 25 30

Leu Phe Asp Phe Ala Val Gln Lys Glu Ile Thr Ser Glu Gly His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Lys Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Phe Ser Leu Arg Thr Lys Asp Ala Tyr Ser Ser Glu Leu

65 70 75 80

Ala Lys Ser Val Lys Leu Ser Gly Ser Tyr Gly Gly Phe Ser Glu Ser

85 90 95

Val Glu Ser Asp Phe Ser Glu Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Ile Ser Leu Lys

115 120 125

His Ser Val Glu Lys Leu Arg Ser Leu Leu Lys Pro Ala Leu Lys Glu

130 135 140

Pro Leu Ala Ser Met Asn Ala Val Glu Leu Leu Ser Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Gly Glu Val Leu Val Gly Gly Arg Ala Asp Phe Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Thr Lys Ile Ser Ile Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Lys Val Ser Ala Glu

195 200 205

Gln Lys Gln Leu Ile Glu Asn Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Gly Ser Ala Leu Ser Ser Ile Thr Asp Thr Ala Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Arg Asp Ser Leu Arg Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Arg Glu Ile Leu Arg Lys Ala Thr Gln Thr Phe Ile Pro Pro

275 280 285

Glu Ile Thr Arg Asn Ala Ile Val Gly Val Asp Ile Ile Met Ser Asp

290 295 300

Asn Tyr Trp Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Tyr Ile Phe Leu Cys Tyr Lys Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp Asn Pro Tyr Val Pro Ala

355 360 365

Gly Tyr Thr Lys Ile Asp Lys Asp Leu Asn Lys Asp Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Asn Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Lys

405 410 415

Leu Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Arg Ile Asp Glu Asp

420 425 430

Leu Asn Lys Gly Ala Lys Gly Asp Tyr Ile Phe Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 87

<211> 1353

<212> ДНК

<213> Huperzia carinata

<400> 87

atggtgaata tcgagccatt accaggatcg gatgcaatcg gacacagtta tgatgtgttc 60

ggattttatg ccaatcccaa gagcgtaaag aaagagcttt tcgactttgc cgtccagaaa 120

gaaatcactt cagagggcca cacttggctc ctttccactg atattaaata tattgcagtc 180

agagatacgg aaataaaaac cttctccctt cgcacaaaag atgcatactc aagcgagctg 240

gctaaaagcg taaaactgtc cggcagctac ggcggcttct cggaatcggt agagtcagac 300

ttctccgaaa gcatcagcga tgagacggat tccacataca cttcagttcg tacaaatgtg 360

aacaagtgga agatcagtct gaagcacagt gtggaaaagc tgcgctccct gttgaagcct 420

gcgttgaagg agccattggc gagtatgaac gcggtggagc tgttgagtac gtatgggaca 480

cattatctgg gcgaggtgtt ggtgggaggt cgtgcagatt ttgtggccac caccaaaacc 540

agtgcattca gctcggacac taaaatcagc atagtagcgg agagttcttt caagtccgtg 600

gctggcatga aagtatccgc ggagcaaaag cagcttatcg aaaacttcca agaaaacagc 660

tccactagtc tgtacgccat cggtgagagc gcactctcca gcatcacaga cacggccact 720

tacaacgcat ggctcagttc cattgataca cgtcccgtct tctgtggatt cactcgcgac 780

agtcttaggc ccatctggga gctcgctgaa tcccctcagc gccgggagat tctccgaaaa 840

gctacccaaa cgtttatccc accagaaatc acacgaaatg caatcgttgg cgtagatatt 900

atcatgtctg acaactattg ggtgaatcct ccctacggct atacgaagat cgattatgat 960

ctgaaccgca atgccaaggg caaatatatc ttcttgtgtt acaaacaaca gaagatatca 1020

gtagctggat ccccagcgga tcccaagccc atcactgcct tgtacgtggc ttctggcgat 1080

gatgataatc catatgttcc cgcaggttac accaagatcg acaaagattt gaacaaagat 1140

gctgggggca agtttatcta tctctgttac acaaaagatc cggctgcaat acccaacgac 1200

gaggatggac tgcccatacg tggcatccgc gttatcggca atgaaaaact tgagaatgtg 1260

gttaccccgt atggattcac gaggattgat gaagatctga ataagggtgc aaagggagac 1320

tatatcttcg tttgtttctc acgtcattta gac 1353

<210> 88

<211> 451

<212> БЕЛОК

<213> Huperzia carinata

<400> 88

Met Val Asn Ile Glu Pro Leu Pro Gly Ser Asp Ala Ile Gly His Ser

1 5 10 15

Tyr Asp Val Phe Gly Phe Tyr Ala Asn Pro Lys Ser Val Lys Lys Glu

20 25 30

Leu Phe Asp Phe Ala Val Gln Lys Glu Ile Thr Ser Glu Gly His Thr

35 40 45

Trp Leu Leu Ser Thr Asp Ile Lys Tyr Ile Ala Val Arg Asp Thr Glu

50 55 60

Ile Lys Thr Phe Ser Leu Arg Thr Lys Asp Ala Tyr Ser Ser Glu Leu

65 70 75 80

Ala Lys Ser Val Lys Leu Ser Gly Ser Tyr Gly Gly Phe Ser Glu Ser

85 90 95

Val Glu Ser Asp Phe Ser Glu Ser Ile Ser Asp Glu Thr Asp Ser Thr

100 105 110

Tyr Thr Ser Val Arg Thr Asn Val Asn Lys Trp Lys Ile Ser Leu Lys

115 120 125

His Ser Val Glu Lys Leu Arg Ser Leu Leu Lys Pro Ala Leu Lys Glu

130 135 140

Pro Leu Ala Ser Met Asn Ala Val Glu Leu Leu Ser Thr Tyr Gly Thr

145 150 155 160

His Tyr Leu Gly Glu Val Leu Val Gly Gly Arg Ala Asp Phe Val Ala

165 170 175

Thr Thr Lys Thr Ser Ala Phe Ser Ser Asp Thr Lys Ile Ser Ile Val

180 185 190

Ala Glu Ser Ser Phe Lys Ser Val Ala Gly Met Lys Val Ser Ala Glu

195 200 205

Gln Lys Gln Leu Ile Glu Asn Phe Gln Glu Asn Ser Ser Thr Ser Leu

210 215 220

Tyr Ala Ile Gly Glu Ser Ala Leu Ser Ser Ile Thr Asp Thr Ala Thr

225 230 235 240

Tyr Asn Ala Trp Leu Ser Ser Ile Asp Thr Arg Pro Val Phe Cys Gly

245 250 255

Phe Thr Arg Asp Ser Leu Arg Pro Ile Trp Glu Leu Ala Glu Ser Pro

260 265 270

Gln Arg Arg Glu Ile Leu Arg Lys Ala Thr Gln Thr Phe Ile Pro Pro

275 280 285

Glu Ile Thr Arg Asn Ala Ile Val Gly Val Asp Ile Ile Met Ser Asp

290 295 300

Asn Tyr Trp Val Asn Pro Pro Tyr Gly Tyr Thr Lys Ile Asp Tyr Asp

305 310 315 320

Leu Asn Arg Asn Ala Lys Gly Lys Tyr Ile Phe Leu Cys Tyr Lys Gln

325 330 335

Gln Lys Ile Ser Val Ala Gly Ser Pro Ala Asp Pro Lys Pro Ile Thr

340 345 350

Ala Leu Tyr Val Ala Ser Gly Asp Asp Asp Asn Pro Tyr Val Pro Ala

355 360 365

Gly Tyr Thr Lys Ile Asp Lys Asp Leu Asn Lys Asp Ala Gly Gly Lys

370 375 380

Phe Ile Tyr Leu Cys Tyr Thr Lys Asp Pro Ala Ala Ile Pro Asn Asp

385 390 395 400

Glu Asp Gly Leu Pro Ile Arg Gly Ile Arg Val Ile Gly Asn Glu Lys

405 410 415

Leu Glu Asn Val Val Thr Pro Tyr Gly Phe Thr Arg Ile Asp Glu Asp

420 425 430

Leu Asn Lys Gly Ala Lys Gly Asp Tyr Ile Phe Val Cys Phe Ser Arg

435 440 445

His Leu Asp

450

<210> 89

<211> 1353

<212> ДНК

<213> Huperzia carinata

<400> 89

atggtgaata tcgagccatt accaggatcg gatgcaatcg gacacagtta tgatgtgttc 60

ggattttatg ccaatcccaa gagcgtaaag aaagagcttt tcgactttgc cgtccagaaa 120

gaaatcactt cagagggcca cacttggctc ctttccactg atattaaata tattgcagtc 180

agagatacgg aaataaaaac cttctccctt cgcacaaaag atgcatactc aagcgagctg 240

gctaaaagcg taaaactgtc cggcagctac ggcggcttct cggaatcggt agagtcagac 300

ttctccgaaa gcatcagcga tgagacggat tccacataca cttcagttcg tacaaatgtg 360

aacaagtgga agatcagtct gaagcacagt gtggaaaagc tgcgctccct gttgaagcct 420

gcgttgaagg agccattggc gagtatgaac gcggtggagc tgttgagtac gtatgggaca 480

cattatctgg gcgaggtgtt ggtgggaggt cgtgcagatt atgtggccac caccaaaacc 540

agtgcattca gctccagcac taaaatcagc acagtagcgg agagttcttt caaatccatg 600

gctggcatga aggtatctgc cgcgcacatg cagcttatcc agaaattcca agagaacagc